Methylenetetrahydrofolate reductase C677T polymorphism and Factor V Leiden variant in Mexican women with preeclampsia/eclampsia.

PubMed

Dávalos, I P; Moran, M C; Martínez-Abundis, E; González-Ortiz, M; Flores-Martínez, S E; Machorro, V; Sandoval, L; Figuera, L E; Mena, J P; Oliva, J M; Tlacuilo-Parra, J A; Sánchez-Corona, J; Salazar-Páramo, M

2005-01-01

The etiology of preeclampsia is still a matter of controversy. An association between hyperhomocysteinemia and preeclamptic patients has been described. A common missense mutation in the methylenetetrahydrofolate reductase (MTHFR) gene is associated with increased plasma homocysteine concentrations. In addition, the polymorphism of gene encoding for Factor V Leiden G1691A is associated with a prothrombotic state in heterozygous subjects. Both mutations in these thrombophilic proteins appear to have different prevalence in the general population and in patients with preeclampsia/eclampsia (PE/E). We studied single nucleotide polymorphisms for MTHFR C677T and coagulation Factor V Leiden in 33 Mexican patients with PE/E as a genetic risk factor for these diseases, comparing with a normotensive pregnant control group. The genotype and allele frequencies of MTHFR C677T and Factor V Leiden mutations between Mexican women with PE/E and healthy controls were not different. We conclude that these polymorphisms do not contribute in the etiology of PE/E as it has been reported in other populations.

Association between maternal, fetal and paternal MTHFR gene C677T and A1298C polymorphisms and risk of recurrent pregnancy loss: a comprehensive evaluation.

PubMed

Yang, Yi; Luo, Yunyao; Yuan, Jing; Tang, Yidan; Xiong, Lang; Xu, MangMang; Rao, XuDong; Liu, Hao

2016-06-01

Numerous studies have investigated the associations between methylenetetrahydrofolate reductase (MTHFR) gene C677T and A1298C polymorphisms and risk of recurrent pregnancy loss (RPL); however, the results remain controversial. The aim of this study is to drive a more precise estimation of association between MTHFR gene polymorphisms and risk of RPL. We searched PubMed, EMBASE, Cochrane library, Web of Science and China Knowledge Resource Integrated Database for papers on MTHFR gene C677T and A1298C polymorphisms and RPL risk. The pooled odds ratios (ORs) with 95 % confidence intervals (CIs) were used to assess the strength of association in the homozygous model, heterozygous model, dominant model, recessive model and an additive model. The software STATA (Version 13.0) was used for statistical analysis. Overall, 57 articles were included in the final meta-analysis. In maternal group the MTHFR C677T polymorphism showed pooled odds ratios for the homozygous comparison [OR = 2.285, 95 % CI (1.702, 3.067)] and the MTHFR A1298C polymorphism showed pooled odds ratios for recessive model [OR = 1.594, 95 % CI (1.136, 2.238)]. In fetal group the MTHFR C677T polymorphism showed pooled odds ratios for dominant model [OR = 1.037, 95 % CI (0.567, 1.894)] and the MTHFR A1298C polymorphism showed pooled odds ratios for dominant model [OR = 1.495, 95 % CI (1.102, 2.026)]. In summary, the results of our meta-analysis indicate that maternal and paternal MTHFR gene C677T and A1298C polymorphisms are associated with RPL. We also observed a significant association between fetal MTHFR A1298C polymorphism and RPL but not C677T.

Prevalence of factor V leiden, MTHFR C677T and MTHFR A1298C polymorphisms in patients with deep vein thrombosis in Central Iran.

PubMed

Ehsani, Majid; Imani, Aida; Moravveji, Alireza

2018-05-31

Deep vein thrombosis (DVT) is a common disease, especially among elderly patients, which is associated with high costs of treatment and high rates of recurrence. The risk factors for venous thrombosis are primarily related to hypercoagulability, which can be genetic or acquired, or because of immobilization and venous stasis. Among relevant genetic markers are a number of common polymorphisms and mutations in the genes coding for Factor V leiden and methylenetetrahydrofolate reductase. Differential associations of these polymorphisms have been reported in different populations with DVT due to ethnic variations. However, no study has been reported with respect to these polymorphisms in DVT in Iran. Thus, the aim of the present study is to determine the prevalence of FVL, MTHFR C677T and MTHFR A1298C gene polymorphisms in patients with DVT in central Iran. In the present cross-sectional study, a total of 100 patients with first and recurrent episodes of DVT and age less than 70 years were recruited during 2016-2017. Blood sample was collected from the recruited patients and FVL mutation was screened using ARMS-PCR method, MTHFR C677T and MTHFR A1298C mutations were screened using PCR-RFLP method. The results revealed that MTHFR A1298C gene polymorphism in both homozygote and heterozygote form was found to be most frequent i.e. 77% among cases, followed by MTHFR C677T (67%) and FVL (17%). The study highlights the importance of screening of these genetic markers among patients with DVT in this region.

Association between C677T and A1298C polymorphisms of the MTHFR gene and risk of male infertility: a meta-analysis.

PubMed

Yang, Y; Luo, Y Y; Wu, S; Tang, Y D; Rao, X D; Xiong, L; Tan, M; Deng, M Z; Liu, H

2016-04-26

Published studies on the association between the C677T and A1298C polymorphisms of the methylenetetrahydrofolate reductase (MTHFR) gene and male infertility risk are controversial. To obtain a more precise evaluation, we performed a meta-analysis based on published case-control studies. We conducted an electronic search of PubMed, EMBASE, the Cochrane Library, the Web of Science, and the China Knowledge Resource Integrated Database for papers on MTHFR gene C677T and A1298C polymorphisms and male infertility risk. Pooled odds ratios (ORs) with 95% confidence intervals (95%CIs) were used to assess the strength of association in homozygote, heterozygote, dominant, recessive, and additive models. Statistical heterogeneity, test of publication bias, and sensitivity analysis were carried out using the STATA software (Version 13.0). Overall, 21 studies of C677T (4505 cases and 4024 controls) and 13 studies of A1298C (2785 cases and 3094 controls) were included in this meta-analysis. For C677T, the homozygote comparison results were OR = 1.629, 95%CI (1.215- 2.184), and the recessive model results were OR = 1.462 (1.155- 1.850). For A1298C, the homozygote comparison results were OR = 1.289 (1.029-1.616), and the recessive model results were OR = 1.288 (1.034-1.604). In conclusion, the current meta-analysis showed that the MTHFR C677T polymorphism was associated with a significantly increased male infertility risk in the Asian and overall populations, but not in the Caucasian population, and there was a significant association between the A1298C polymorphism and male infertility risk in the Asian, Caucasian, and overall groups.

Methylenetetrahydrofolate reductase C677T and A1298C gene polymorphisms and therapy-related toxicity in children treated for acute lymphoblastic leukemia and non-Hodgkin lymphoma.

PubMed

Kantar, Mehmet; Kosova, Buket; Cetingul, Nazan; Gumus, Sevinc; Toroslu, Ertug; Zafer, Nur; Topcuoglu, Nejat; Aksoylar, Serap; Cinar, Mehtap; Tetik, Asli; Eroglu, Zuhal

2009-06-01

This study aimed to investigate the association of the methylenetetrahydrofolate reductase (MTHFR) gene C677T and A1298C polymorphisms with serum drug levels and toxicities after high-dose methotrexate (MTX) infusion. The study included 37 children with acute lymphoblastic leukemia or non-Hodgkin lymphoma. Serum MTX levels and toxicities of bone marrow, liver and kidney were analysed. Genotype analysis of the C677T and A1298C gene polymorphisms from genomic DNA of the subjects was performed by real-time PCR. Subjects with MTHFR polymorphism for C677T (CT, TT) had significantly higher MTX levels at 24 h (p = 0.009), and these genotypes did not seem to cause toxicity. Subjects with MTHFR polymorphism for A1298C (AC, CC) had significantly higher MTX levels at 48 h (p = 0.02), and had more grade III/IV anemia (p = 0.02), thrombocytopenia (p = 0.0001), elevated AST levels (p = 0.04) and frequent febrile neutropenic episodes (p = 0.004). The present study suggests that A1298C gene, but not C677T polymorphism is associated with MTX-related toxicity.

C677T methylenetetrahydrofolate reductase and plasma homocysteine levels among Thai vegans and omnivores.

PubMed

Kajanachumpol, Saowanee; Atamasirikul, Kalayanee; Tantibhedhyangkul, Phieuvit

2013-01-01

Hyperhomocysteinemia among vegetarians and vegans is caused mostly by vitamin B12 deficiency. A C-to-T mutation in the methylenetetrahydrofolate reductase (MTHFR) gene results in a thermolabile MTHFR, which may affect homocysteine (Hcy) levels. The importance of this gene mutation among populations depends on the T allele frequency. Blood Hcy, vitamin B12, folate, vitamin B6, and MTHFR C677T mutation status were determined in 109 vegans and 86 omnivores aged 30 - 50 years. The vegans had significantly higher Hcy levels than the omnivores, geometric means (95 % CI) 19.2 (17.0 - 21.7) µmol/L vs. 8.53 (8.12 - 8.95) µmol/L, p < 0.001. A C-to-T mutation in the vegans increased plasma Hcy, albeit insignificantly; geometric means 18.2 µmol/L, 20.4 µmol/L, and 30.0 µmol/L respectively in CC, CT, and TT MTHFR genotypes. There was also a significant decrease in serum folate; geometric means 12.1 ng/mL, 9.33 ng/mL, and 7.20 ng/mL respectively, in the CC, CT, and TT mutants, p = 0.006, and particularly, in the TT mutant compared with the CC wild type, 7.20 ng/mL vs. 12.1 ng/mL, p = 0.023. These findings were not seen in the omnivores. It was concluded that hyperhomocysteinemia is prevalent among Thai vegans due to vitamin B12 deficiency. C-to-T MTHFR mutation contributes only modestly to the hyperhomocysteinemia.

MTHFR C677T mutation increased the risk of Ischemic Stroke, especially in large-artery atherosclerosis in adults: an updated meta-analysis from 38 researches.

PubMed

Cui, Tao

2016-01-01

To date, many publications have evaluated the correlation between the Ethylenetetrahydrofolate reductase gene (MTHFR) C677T and Ischemic Stroke susceptibility in adults. However, the results remain inconclusive. The meta-analysis was performed to resolve the problem. Based on 38 studies, dichotomous data were presented as the odds ratio (OR) with a 95% confidence interval (CI). This study found, the carriers of the MTHFR 677C→T variation were more likely to increase the risk of Ischemic Stroke susceptibility in all over pooled population, including Asian and European, but not in African population (Europe: TT vs. CC+TC: OR = 1.364 95% CI = 1.010-1.841 p = 0.043; Asia subgroup: T vs. C: OR = 1.245, 95% CI = 1.141-1.358, p < 0.001; Africa: T vs. C: OR = 1.202, 95% CI = 0.990-1.459, p = 0.062). Among etiology stratified analysis, only large-artery atherosclerosis subgroups had a significant different, and the p value was less than 0.01 in all genetic models (T vs. C: OR = 1.29, 95% CI = 1.09-1.52, p = 0.002; TT+TC vs. CC: OR = 1.27, 95% CI = 1.06-1.51, p = 0.009; TT vs. CC+TC: OR = 1.62, 95% CI = 1.19-2.19, p = 0.002). This meta-analysis suggests that MTHFR C677T mutation increased the risk of Ischemic Stroke in adults, especially in large-artery atherosclerosis.

MTHFR GENE C677T POLYMORPHISM AND LEVELS OF DNA METHYLTRASFERASES IN SUBCLINICAL HYPOTHYROIDISM.

PubMed

Kvaratskhelia, T; Kvaratskhelia, E; Kankava, K; Abzianidze, E

2017-04-01

The aim of our study was to investigate the link between MTHFR gene C677T polymorphism and DNMTs levels in patients with Subclinical Hypothyroidism (SCH). In this study 19 adult patients with subclinical hypothyroidism and 19 healthy controls (mean age 31±5.5 and 33±5.1 years respectively) were recruited. All patients were diagnosed based on serum levels of TSH, FT4, anti-TG and anti-TPO antibodies. Written informed consents were obtained from all study subjects. Genomic DNA was extracted using Quick-DNA Universal Kit (Zymo Research, USA). The MTHFR C677T polymorphism was genotyped by PCR-RFLP method. Levels of DNMT1 and 3a were measured in nuclear extracts of PBMC using DNMTs assay kits (Abcam). Our data indicates that the frequency of genotypes and alleles were different among the patient and the control group. There is a significant increase in CC genotype distribution in the control group when compared to the SCH patient group, while the CT as well as TT genotype distribution were not increased significantly in SCH group versus control group. However the C allele is significantly prevalent in the control group compared to the SCH group, while T allele is prevalent in patients compared to the control group with a statically significant difference. In addition, individuals with TT and CT genotypes and hypothyroidism showed elevated amount of DNMT3a in nuclear extracts of PBMC compared with controls, while no significant difference in DNMT1 levels was observed. This study indicates the MTHFR C677T variant may contribute in alteration of epigenetic regulation such as DNA methylation mediated by DNA methyltransferases in patients with subclinical hypothyroidism and also, carriers of the T allele might have an increasing risk of developing SCH.

Association between Hcy levels and the CBS844ins68 and MTHFR C677T polymorphisms with essential hypertension.

PubMed

Cai, Weijuan; Yin, Liang; Yang, Fang; Zhang, Lei; Cheng, Jiang

2014-11-01

-D haplotype and EH (OR, 1.376). MTHFR C677T and CBS844ins68 polymorphisms were present in the populations studied and the CBS844ins68 homozygous mutation was not present. Therefore, there is a correlation between the polymorphisms of the MTHFR C677T gene and EH, and allele T may be one of the predisposing factors. MTHFR C677T and CBS844ins68 may exist with a certain linkage and the T-D haplotype may be a risk factor for EH.

Association between Hcy levels and the CBS844ins68 and MTHFR C677T polymorphisms with essential hypertension

PubMed Central

CAI, WEIJUAN; YIN, LIANG; YANG, FANG; ZHANG, LEI; CHENG, JIANG

2014-01-01

and EH (OR, 1.376). MTHFR C677T and CBS844ins68 polymorphisms were present in the populations studied and the CBS844ins68 homozygous mutation was not present. Therefore, there is a correlation between the polymorphisms of the MTHFR C677T gene and EH, and allele T may be one of the predisposing factors. MTHFR C677T and CBS844ins68 may exist with a certain linkage and the T-D haplotype may be a risk factor for EH. PMID:25279160

C677T (RS1801133 ) MTHFR gene polymorphism frequency in a colombian population.

PubMed

Romero-Sánchez, Consuelo; Gómez-Gutierrez, Alberto; Gómez, Piedad Elena; Casas-Gomez, Maria Consuelo; Briceño, Ignacio

2015-01-01

Abnormal levels of the enzyme methylenetetrahydrofolate reductase (MTHFR) are associated with an increased risk of both cardiovascular and cerebrovascular disease and higher concentrations of homocysteine. Abnormal levels are also related to birth defects, pregnancy complications, cancer and toxicity to methotrexate (MTX). Polymorphisms of MTHFR affect the activity of the enzyme. Genetic associations have been related to treatment efficacy. To establish the frequency of the C> T polymorphism at nucleotide 677 of the MTHFR gene in a group of Colombian individuals. Data from pharmacogenetic microarrays that include MTX sensibility-associated polymorphisms were retrospectively collected (Pathway Genomics(®)). The frequency of the C> T MTHFR rs1801133 marker polymorphism was analyzed. Microarray data from 68 men and 84 women were analyzed. Comparisons of genotype C/C vs. C/T and T/T were statistically significantly different (p= 0.00, p= 0.026, respectively), as were C/T and T / T (p= 0.0001). Results for the C/C and C/T genotypes in a Colombian population are similar to other previously studied groups of healthy subjects. Subjects from our population might be at risk of developing diseases associated with MTHFR polymorphisms and might present toxicity and adverse effects if treated with MTX, which suggests the need to evaluate therapeutic alternatives based on individual pharmacogenetic studies.

The association between MTHFR gene C677T polymorphism and ALL risk based on a meta-analysis involving 17,469 subjects.

PubMed

Zhang, Beibei; Zhang, Weiming; Yan, Liang; Wang, Daogang

2017-03-01

The methylenetetrahydrofolate reductase (MTHFR) gene C677T polymorphism is closely related to the acute lymphoblastic leukaemia (ALL) indicated by many previous epidemiologic studies. However, their conclusions were still conflicting. Our aim is to evaluate their associations using a more comprehensive updated meta-analysis. Electronic searches were conducted to select published studies prior to February, 2016. Totally, 39 case-control studies including 6551 ALL cases and 10,918 controls were selected in current meta-analysis. The association was detected significantly between MTHFR C677T polymorphism and ALL reducing susceptibility. Our results indicate that the MTHFR C677T polymorphism may be a promising ALL biomarker and studies to explore the protein levels of the variants and their functional role are required for the definitive conclusions. Copyright © 2017 Elsevier B.V. All rights reserved.

Methylenetetrahydrofolate Reductase Gene Polymorphisms (C677T and A1298C) and Hemorrhagic Stroke in Moroccan Patients.

PubMed

Abidi, Omar; Haissam, Mohammed; Nahili, Halima; El Azhari, Abdessamad; Hilmani, Said; Barakat, Abdelhamid

2018-07-01

The number of deaths from hemorrhagic strokes is about twice as high than the number of deaths from ischemic strokes. Genetic risk assessment could play important roles in preventive and therapeutic strategies. The present study was aimed to evaluate whether the MTHFR gene polymorphisms could increase the risk of cerebral hemorrhage in Moroccan patients. A total of 113 patients with hemorrhagic stroke and 323 healthy controls were included in this case-control study. The C677T (rs1801133) and A1298C (rs1801131) MTHFR gene polymorphisms were genotyped by Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) method in all patients and controls. The genotype and allele frequencies were compared between groups using appropriate statistical analyses. Both groups, patients and controls, were in accordance with the Hardy-Weinberg Equilibrium. For the C677T polymorphism, the frequencies of the CC, CT, and TT genotypes were 50.44% versus 46.13%, 39.82% versus 43.03, and 9.73% versus 10.84% in controls versus patients, respectively, whereas for the A1298C polymorphism, the frequencies of the AA, AC, and CC genotypes were 56.64% versus 57.59%, 40.71% versus 37.15, and 2.65% versus 5.26% in controls versus patients, respectively. No statistically significant difference has been proved between patients and controls frequencies (P >.05) for all additive, recessive, and dominant models. Additional analyses including genotypes combination, allelic frequencies, and hemorrhagic stroke patient subtypes did not show any statistically significant difference between controls and patients/subgroup patients. Our findings suggested no association between MTHFR gene polymorphisms and susceptibility to hemorrhagic strokes in Moroccan patients. Further investigations should be conducted to elucidate the roles of other gene variants in the pathogenesis of this condition. Copyright © 2018 National Stroke Association. Published by Elsevier Inc. All rights reserved.

C677T polymorphism in the methylenetetrahydrofolate reductase gene is associated with primary closed angle glaucoma

PubMed Central

Michael, Shazia; Qamar, Raheel; Akhtar, Farah; Khan, Wajid Ali

2008-01-01

Purpose To determine whether or not there is an association of the methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism with disease in cohorts of primary open-angle glaucoma (POAG) and primary closed-angle glaucoma (PCAG) from Pakistan. Methods This was a prospective study consisting of 150 patients (90 POAG and 60 PCAG) and 70 control subjects. Genomic DNA was extracted from leukocytes of the peripheral blood. MTHFR C677T polymorphism analysis was performed by the polymerase chain reaction-restriction fragment length polymorphism (RFLP) technique. Results The prevalence of the MTHFR C/T genotype was 22.2% in POAG, 13.3% in PACG, and 18.6% in controls whereas the MTHFR T/T genotype was present solely in the PACG group (6.9%). The difference regarding the T/T genotype between PACG and controls was statistically significant (p<0.01). Conclusions The MTHFR C677T polymorphism was found to be associated with PCAG but not POAG in patients of Pakistani origin. PMID:18385801

C677T (RS1801133 ) MTHFR gene polymorphism frequency in a colombian population

PubMed Central

Gómez-Gutierrez, Alberto; Gómez, Piedad Elena; Casas-Gomez, Maria Consuelo; Briceño, Ignacio

2015-01-01

Introduction: Abnormal levels of the enzyme methylenetetrahydrofolate reductase (MTHFR) are associated with an increased risk of both cardiovascular and cerebrovascular disease and higher concentrations of homocysteine. Abnormal levels are also related to birth defects, pregnancy complications, cancer and toxicity to methotrexate (MTX). Polymorphisms of MTHFR affect the activity of the enzyme. Genetic associations have been related to treatment efficacy. Objective: To establish the frequency of the C> T polymorphism at nucleotide 677 of the MTHFR gene in a group of Colombian individuals. Methods: Data from pharmacogenetic microarrays that include MTX sensibility-associated polymorphisms were retrospectively collected (Pathway Genomics®). The frequency of the C> T MTHFR rs1801133 marker polymorphism was analyzed. Results: Microarray data from 68 men and 84 women were analyzed. Comparisons of genotype C/C vs. C/T and T/T were statistically significantly different (p= 0.00, p= 0.026, respectively), as were C/T and T / T (p= 0.0001). Conclusions: Results for the C/C and C/T genotypes in a Colombian population are similar to other previously studied groups of healthy subjects. Subjects from our population might be at risk of developing diseases associated with MTHFR polymorphisms and might present toxicity and adverse effects if treated with MTX, which suggests the need to evaluate therapeutic alternatives based on individual pharmacogenetic studies. PMID:26309343

MTHFR A1298C and C677T gene polymorphisms and susceptibility to chronic myeloid leukemia in Egypt.

PubMed

Aly, Rabab M; Taalab, Mona M; Ghazy, Hayam F

2014-01-01

Methylenetetrahydrofolate reductase (MTHFR) is a key enzyme regulating the intracellular folate metabolism which plays an important role in carcinogenesis through DNA methylation. We aimed to evaluate the association between MTHFR A1298C and C677T polymorphisms and the risks of chronic myeloid leukemia (CML). Eighty-five patients with CML and a control group containing 100 healthy, age and sex matched individuals were examined for MTHFR C677T and A1298C polymorphisms using polymerase chain reaction-restriction fragment-length (PCR-RFLP) method. The frequency of 677TT genotype in patients with CML was significantly higher compared to controls (OR=2.513, 95% CI: 0.722-4.086, P=0.025). No such association was shown for heterozygous 677CT (OR=1.010, 95% CI: 0.460-2.218, P=0.981). Moreover, for A1298C genotype, a statistically significant higher frequency of 1298CC was also detected in CML patients compared to control group (OR=1.1816, 95% CI: 0.952-3.573, P=0.036), 0.036). No such statistical significance was demonstrable for heterozygote 1298AC (OR=1.046, 95% CI: 0.740-1.759, P=0.092). In addition, patients with joint 677CT/1298AC or 677TT/1298CC genotypes showed an association with increased risk of CML (OR=1.849, 95% CI: 0.935-2.540, P=0.024; OR=1.915, 95% CI: 1.202-3.845, P=0.020 respectively). .A statistically significant increased risk of resistant to therapy was observed with 677CT and 1298AC genotypes (P=0.001, P=0.002 respectively). We conclude that both MTHFR 677TT and 1298CC polymorphisms have been associated with risk of CML and both 677CT and 1298AC genotypes are associated with higher risk of resistant to therapy.

MTHFR A1298C and C677T gene polymorphisms and susceptibility to chronic myeloid leukemia in Egypt

PubMed Central

Aly, Rabab M; Taalab, Mona M; Ghazy, Hayam F

2014-01-01

Methylenetetrahydrofolate reductase (MTHFR) is a key enzyme regulating the intracellular folate metabolism which plays an important role in carcinogenesis through DNA methylation. We aimed to evaluate the association between MTHFR A1298C and C677T polymorphisms and the risks of chronic myeloid leukemia (CML). Eighty-five patients with CML and a control group containing 100 healthy, age and sex matched individuals were examined for MTHFR C677T and A1298C polymorphisms using polymerase chain reaction-restriction fragment-length (PCR-RFLP) method. The frequency of 677TT genotype in patients with CML was significantly higher compared to controls (OR = 2.513, 95% CI: 0.722-4.086, P = 0.025). No such association was shown for heterozygous 677CT (OR = 1.010, 95% CI: 0.460-2.218, P = 0.981). Moreover, for A1298C genotype, a statistically significant higher frequency of 1298CC was also detected in CML patients compared to control group (OR = 1.1816, 95% CI: 0.952-3.573, P = 0.036), 0.036). No such statistical significance was demonstrable for heterozygote 1298AC (OR = 1.046, 95% CI: 0.740-1.759, P = 0.092). In addition, patients with joint 677CT/1298AC or 677TT/1298CC genotypes showed an association with increased risk of CML (OR = 1.849, 95% CI: 0.935-2.540, P = 0.024; OR = 1.915, 95% CI: 1.202-3.845, P = 0.020 respectively). .A statistically significant increased risk of resistant to therapy was observed with 677CT and 1298AC genotypes (P = 0.001, P = 0.002 respectively). We conclude that both MTHFR 677TT and 1298CC polymorphisms have been associated with risk of CML and both 677CT and 1298AC genotypes are associated with higher risk of resistant to therapy. PMID:24966971

Interaction between MTHFR 677C>T and periconceptional folic acid supplementation in the risk of Hypospadias.

PubMed

Dokter, Elisabeth M J; van Rooij, Iris A L M; Wijers, Charlotte H W; Groothuismink, Johanne M; van der Biezen, Jan Jaap; Feitz, Wout F J; Roeleveld, Nel; van der Zanden, Loes F M

2016-04-01

Hypospadias is a congenital malformation with both environmental factors and genetic predisposition involved in the pathogenesis. The role of maternal periconceptional folic acid supplement use in the development of hypospadias is unclear. As folate levels may also be influenced by the C677T polymorphism in the methylenetetrahydrofolate reductase (MTHFR) gene, we hypothesize that a gene-environment interaction between this polymorphism and folic acid use is involved in the etiology of hypospadias. We conducted a case-control study among 855 hypospadias cases and 713 population-based controls from the AGORA data- and biobank. Folic acid supplement use was derived from maternal questionnaires and infant and maternal DNA was used to determine the MTHFR C677T polymorphism using Taqman assays. We performed separate analyses for different hypospadias phenotypes (anterior/middle/posterior). Hypospadias was neither associated with folic acid use or the MTHFR C677T polymorphism, nor with their interaction. However, we did find an association with middle hypospadias when no supplements were used (odds ratio = 1.6; 95% confidence interval, 1.1-2.4), especially in infants carrying the CT/TT genotype (odds ratio = 2.5; 95% confidence interval, 1.4-4.7). In addition, more infants with these genotypes seemed to have posterior hypospadias, regardless of folic acid use. Our study does not suggest a major role for folic acid supplements or the MTHFR C677T polymorphism in the etiology of hypospadias in general, but not using folic acid and/or carrying the MTHFR C677T polymorphism may be associated with middle and posterior hypospadias. Therefore, we stress the importance of studying gene-environment interactions preferably in stratified analyses for different hypospadias phenotypes. © 2016 Wiley Periodicals, Inc.

MTHFR polymorphisms C677T and A1298C and associations with IVF outcomes in Brazilian women.

PubMed

D'Elia, Priscila Queiroz; dos Santos, Aline Amaro; Bianco, Bianca; Barbosa, Caio Parente; Christofolini, Denise Maria; Aoki, Tsutomu

2014-06-01

The aim of this study was to investigate the association between MTHFR gene polymorphisms and IVF outcomes in Brazilian women undergoing assisted reproduction treatment. A prospective study was conducted in the Human Reproduction Department at the ABC University School of Medicine and the Ideia Fertility Institute between December 2010 and April 2012. The patient population was 82 women undergoing assisted reproduction cycles. The MTHFR polymorphisms C677T and A1298C were evaluated and compared with laboratory results and pregnancy rates. The C677T variant was associated with proportions of mature (P=0.006) and immature (P=0.003) oocytes whereas the A1298C variant was associated with number of oocytes retrieved (P=0.044). The polymorphisms, whether alone or in combination, were not associated with normal fertilization, good-quality embryo or clinical pregnancy rates. This study suggests that the number and maturity of oocytes retrieved may be related to the MTHFR polymorphisms C677T and A1298C. It is believed that folate has a crucial function in human reproduction and that folate deficiency can compromise the function of the metabolic pathways it is involved in, leading to an accumulation of homocysteine. The gene MTHFR encodes the 5-MTHFR enzyme, which is involved in folate metabolism, and C677T/A1298C polymorphisms of this gene are related to decreased enzyme activity and consequent changes in homocysteine concentration. Folate deficiency and hyperhomocysteinaemia can also compromise fertility and lead to pregnancy complications by affecting the development of oocytes, preparation of endometrial receptivity, implantation of the embryo and pregnancy. In folliculogenesis, hyperhomocysteinaemia can activate apoptosis, leading to follicular atresia and affecting the maturity of oocytes and the quality of embryos cultured in vitro. This study was performed to investigate the association between MTHFR polymorphisms and IVF outcomes in women undergoing assisted

C677T and A1298C polymorphisms of the methylenetetrahydrofolate reductase gene: effect on methotrexate-related toxicity in adult acute lymphoblastic leukaemia.

PubMed

Eissa, Deena Samir; Ahmed, Tamer Mohamed

2013-03-01

Methylenetetrahydrofolate reductase (MTHFR) is a key enzyme involved in folate metabolism. Two polymorphisms, C677T and A1298C, were described leading to reduced enzyme activity. Methotrexate (MTX) is an antifolate agent of consolidation and maintenance therapy of acute lymphoblastic leukaemia (ALL). Despite its clinical success, MTX can be associated with serious toxicities resulting in treatment interruption or discontinuation, impacting disease outcome. There is evidence that MTX toxicity can be affected by polymorphisms in genes encoding for drug-metabolizing enzymes such as MTHFR. Therefore, we aimed to investigate the influence of MTHFR C677T and A1298C polymorphisms on the frequency of MTX-related toxicity, disease outcome and patients' survival. MTHFR polymorphisms were assessed in 50 adult patients with de novo ALL using real-time PCR. Patients were followed-up for the development of haematologic and/or nonhaematologic toxicity and assessment of clinical outcome. Frequency of C677T polymorphisms was 42% for TT, 24% for CT and 34% for CC; A1298C polymorphisms were 28, 6 and 66% for CC, AC and AA, respectively. MTX therapy was significantly associated with neutropaenia, hepatic and gastrointestinal toxicities, unfavourable response at day 14 of induction therapy, increased relapse and mortality rates and shorter survival in patients with 677 TT genotype than in those with CC and CT, whereas 1298 CC genotype patients had lower frequency of neutropaenia, hepatic toxicity and relapse than in those with AA and AC. Our study suggests MTHFR polymorphism as an attractive predictor of MTX-related toxicity in adult ALL, considering it a potential prognostic factor influencing disease outcome.

Association of methylenetetrahydrofolate reductase gene C677T polymorphism with polycystic ovary syndrome risk: a systematic review and meta-analysis update.

PubMed

Fu, Li-yuan; Dai, Li-meng; Li, Xiao-gang; Zhang, Kun; Bai, Yun

2014-01-01

To re-estimate the association between methylenetetrahydrofolate reductase gene (MTHFR) C677T polymorphism and polycystic ovary syndrome (PCOS) risk by critically reviewing, analyzing and updating the current evidence. MTHFR C677T polymorphism has been studied as a possible risk factor for a variety of common conditions including heart disease, stroke and hypertension. Its association with PCOS was negative in a previous meta-analysis which had possible shortcomings. More studies have now been done but their results remain inconclusive. Available case-control studies containing genotype frequencies of MTHFR C677T were chosen, and odds ratio (OR) with 95% confidence interval (CI) was used to assess the strength of the association. Statistical analyses were performed using software Review Manager (Version 5. 2) and Stata (Version 11.0). Nine case-control studies including 638 PCOS and 759 healthy controls were identified. Meta-analysis showed a significant effect in the dominant model (TT+CT vs. CC: OR=1.65, 95%CI=1.28-2.12, P<0.0001) and heterozygote comparison (CT vs. CC: OR=1.83, 95%CI=1.17-2.87, P=0.008). In subgroup analysis stratified by ethnicity, MTHFR C677T variant was statistically significantly relevant to PCOS risk in European populations (TT+CT vs. CC: OR=2.16, 95%CI=1.50-3.12, P<0.0001; CT vs. CC: OR=2.11, 95%CI=1.15-3.87, P=0.02) but not in Asian populations (TT+CT vs. CC: OR=1.29, 95%CI=0.91-1.82, P=0.15; CT vs. CC: OR=1.31, 95%CI=0.91-1.90, P=0.15). This meta-analysis indicates that the 677T allele increases PCOS susceptibility, and this relevance seems to be more intense in Europeans than in Asians. Copyright © 2013. Published by Elsevier Ireland Ltd.

Association of Methylenetetrahydrofolate Reductase (MTHFR 677C>T and 1298A>C) Polymorphisms and Haplotypes with Silent Brain Infarction and Homocysteine Levels in a Korean Population

PubMed Central

Han, In Bo; Kim, Ok Joon; Ahn, Jung Yong; Oh, Doyeun; Hong, Sun Pyo; Huh, Ryoong; Chung, Sang Sup

2010-01-01

Purpose Methylenetetrahydrofolate reductase (MTHFR) is the main regulatory enzyme for homocysteine metabolism. In the present study, we evaluated whether the MTHFR 677C>T and 1298A>C gene polymorphisms are associated with SBI and plasma homocysteine concentration in a Korean population. Materials and Methods We enrolled 264 patients with SBI and 234 healthy controls in South Korea. Fasting plasma total homocysteine (tHcy) concentrations were measured, and genotype analysis of the MTHFR gene was carried out. Results The plasma tHcy levels were significantly higher in patients with SBI than in healthy controls. Despite a significant association between the MTHFR 677TT genotype and hyperhomocysteinemia, the MTHFR 677C>T genotypes did not appear to influence susceptibility to SBI. However, odds ratios of the 1298AC and 1298AC + CC genotypes for the 1298AA genotype were significantly different between SBI patients and normal controls. The frequencies of 677C-1298A and 677C-1298C haplotypes were significantly higher in the SBI group than in the control group. Conclusion This study demonstrates that the MTHFR 1298A>C polymorphism is a risk factor for SBI in a Korean population. The genotypes of 677C>T and 1298A>C polymorphisms interact additively, and increase the risk of SBI in Korean subjects. PMID:20191019

Associations of methylenetetrahydrofolate reductase C677T genotype with blood pressure levels in Chinese population with essential hypertension.

PubMed

Cheng, Jun; Tao, Fang; Liu, Yanhong; Venners, Scott A; Hsu, Yi-Hsiang; Jiang, Shanqun; Weinstock, Justin; Wang, Binyan; Tang, Genfu; Xu, Xiping

2018-01-01

To confirm the association between baseline blood pressure (BP) levels and the methylenetetrahydrofolate reductase (MTHFR) C677T gene polymorphism in patients with essential hypertension. A total of 347 patients were enrolled from the Dongzhi community in Anhui Province, China. The C677T polymorphism of the MTHFR gene was detected using high-throughput TaqMan allelic discrimination assay. Baseline BP was measured using a standardized mercury-gravity monometer. In the whole sample, the frequency of the MTHFR C677T genotypes CC, CT, and TT were 38.6%, 48.1%, and 13.3%, respectively. In a recessive model (CC+CT versus TT genotypes), baseline diastolic blood pressure (DBP) was significantly higher in patients with the TT genotype compared to those with the CT or CC genotypes (P= 0.013). We also divided all patients into three groups based on the tertiles of the baseline BP distribution. Compared to subjects in the lowest tertile of DBP, the adjusted odds of having the TT genotype among subjects in the highest tertile was 2.6 (95% CI: 1.1 to 6.2). However, no significant associations were observed between baseline systolic blood pressure (SBP) and the MTHFR C677T polymorphism. The MTHFR gene polymorphism could be an important genetic determinant of baseline DBP levels in Chinese essential hypertensive patients.

Individual and Joint Associations of Methylenetetrahydrofolate Reductase C677T Genotype and Plasma Homocysteine With Dyslipidemia in a Chinese Population With Hypertension.

PubMed

Liu, Yanhong; Li, Kang; Venners, Scott A; Hsu, Yi-Hsiang; Jiang, Shanqun; Weinstock, Justin; Wang, Binyan; Tang, Genfu; Xu, Xiping

2017-04-01

We aimed to examine the cross-sectional associations of plasma total homocysteine (tHcy) concentrations and methylenetetrahydrofolate reductase ( MTHFR) C677T genotype with dyslipidemia. A total of 231 patients with mild-to-moderate essential hypertension were enrolled from the Huoqiu and Yuexi communities in Anhui Province, China. Plasma tHcy levels were measured by high-performance liquid chromatography. Genotyping was performed by TaqMan allelic discrimination technique. Compared with MTHFR 677 CC + CT genotype carriers, TT genotype carriers had higher odds of hypercholesterolemia (adjusted odds ratio [OR] [95% confidence interval (CI)]: 2.7 [1.4-5.2]; P = .004) and higher odds of abnormal low-density lipoprotein cholesterol (adjusted OR [95% CI]: 2.3 [1.1-4.8]; P = .030). The individuals with the TT genotype had higher concentrations of log(tHcy) than those with the 677 CC + CT genotype (adjusted β [standard error]: .2 [0.03]; P < .001). Patients with tHcy ≥ 10 μmol/L had significantly higher odds of hypercholesterolemia (adjusted OR [95% CI]: 2.4 [1.2-4.7]; P = .010). Furthermore, patients with both the TT genotype and the tHcy ≥ 10 μmol/L had the highest odds of hypercholesterolemia (adjusted OR [95% CI]: 4.1 [1.8-9.4]; P = .001) and low-density lipoprotein cholesterol (adjusted OR [95% CI]: 2.4 [1.0-6.0]; P = .064). This study suggests that both tHcy and the MTHFR C677T gene polymorphism may be important determinants of the incidence of dyslipidemia in Chinese patients with essential hypertension. Further studies are needed to confirm the role of tHcy and the MTHFR C677T mutation in the development of dyslipidemia in a larger sample.

Homocysteine and the C677T Gene Polymorphism of Its Key Metabolic Enzyme MTHFR Are Risk Factors of Early Renal Damage in Hypertension in a Chinese Han Population

PubMed Central

Yun, Lin; Xu, Rui; Li, Guohua; Yao, Yucai; Li, Jiamin; Cong, Dehong; Xu, Xingshun; Zhang, Lihua

2015-01-01

Abstract The combined hyperhomocysteinemia condition is a feature of the Chinese hypertensive population. This study used the case-control method to investigate the association between plasma homocysteine and the C677T gene polymorphism of its key metabolic enzyme, 5, 10-methylenetetrahydrofolate reductase (MTHFR), and early renal damage in a hypertensive Chinese Han population. A total of 379 adult essential hypertensive patients were selected as the study subjects. The personal information, clinical indicators, and the C677T gene polymorphism of MTHFR were texted. This study used the urine microalbumin/urine creatinine ratio (UACR) as a grouping basis: the hypertension without renal damage group (NRD group) and the hypertension combined with early renal damage group (ERD group). Early renal damage in the Chinese hypertensive population was associated with body weight, systolic pressure, diastolic pressure, urea nitrogen, serum creatinine, cystatin C, uric acid, aldosterone, and glomerular filtration rate. The homocysteine level and the UACR in the TT genotype group were higher than those in the CC genotype group. The binary logistic regression analysis results showed that after sex and age were adjusted, the MTHFR C677T gene polymorphism was correlated with early renal damage in hypertension in both the recessive model and in the additive model. Plasma homocysteine and the C677T gene polymorphism of its key metabolic enzyme MTHFR might be independent risk factors of early renal damage in the hypertensive Chinese Han population. PMID:26717388

Homocysteine and the C677T Gene Polymorphism of Its Key Metabolic Enzyme MTHFR Are Risk Factors of Early Renal Damage in Hypertension in a Chinese Han Population.

PubMed

Yun, Lin; Xu, Rui; Li, Guohua; Yao, Yucai; Li, Jiamin; Cong, Dehong; Xu, Xingshun; Zhang, Lihua

2015-12-01

The combined hyperhomocysteinemia condition is a feature of the Chinese hypertensive population. This study used the case-control method to investigate the association between plasma homocysteine and the C677T gene polymorphism of its key metabolic enzyme, 5, 10-methylenetetrahydrofolate reductase (MTHFR), and early renal damage in a hypertensive Chinese Han population.A total of 379 adult essential hypertensive patients were selected as the study subjects. The personal information, clinical indicators, and the C677T gene polymorphism of MTHFR were texted. This study used the urine microalbumin/urine creatinine ratio (UACR) as a grouping basis: the hypertension without renal damage group (NRD group) and the hypertension combined with early renal damage group (ERD group).Early renal damage in the Chinese hypertensive population was associated with body weight, systolic pressure, diastolic pressure, urea nitrogen, serum creatinine, cystatin C, uric acid, aldosterone, and glomerular filtration rate. The homocysteine level and the UACR in the TT genotype group were higher than those in the CC genotype group. The binary logistic regression analysis results showed that after sex and age were adjusted, the MTHFR C677T gene polymorphism was correlated with early renal damage in hypertension in both the recessive model and in the additive model.Plasma homocysteine and the C677T gene polymorphism of its key metabolic enzyme MTHFR might be independent risk factors of early renal damage in the hypertensive Chinese Han population.

The methylenetetrahydrofolate reductase (MTHFR) 677 C>T polymorphism increases the risk of developing chronic myeloid leukemia-a case-control study.

PubMed

Bănescu, Claudia; Iancu, Mihaela; Trifa, Adrian P; Macarie, Ioan; Dima, Delia; Dobreanu, Minodora

2015-04-01

The methylenetetrahydrofolate reductase (MTHFR) 677 C>T and 1298 A>C polymorphisms are associated with variations in folate levels, a phenomenon linked to the development of various malignancies. The aim of this study was to investigate the influence of the 677 C>T and 1298 A>C polymorphisms in the MTHFR gene on the risk of developing chronic myeloid leukemia (CML). Our study included 151 patients with CML and 305 controls. The MTHFR 677 C>T and 1298 A>C polymorphisms were investigated by polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) and allele-specific PCR techniques. The CT and TT genotypes of the MTHFR 677 C>T polymorphism were associated with an increased risk of developing CML (odds ratio (OR) = 1.556, 95% confidence interval (CI) = 1.017-2.381, p value = 0.041, and OR = 1.897, 95% CI = 1.046-3.44, p value = 0.035, respectively). No association was observed between the prognostic factors (blasts, basophils, additional chromosomal abnormalities, EUTOS score, Sokal and Hasford risk groups) and the MTHFR 677 C>T and 1298 A>C variant genotypes in CML patients. Our study shows that the MTHFR 677 C>T polymorphism is significantly associated with the risk of CML in Romanian patients.

Combined genotype and haplotype distributions of MTHFR C677T and A1298C polymorphisms

PubMed Central

Fan, Shujun; Yang, Boyi; Zhi, Xueyuan; Wang, Yanxun; Zheng, Quanmei; Sun, Guifan

2016-01-01

Abstract Methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C polymorphisms are, independently and/or in combination, associated with many disorders. However, data on the combined genotype and haplotype distributions of the 2 polymorphisms in Chinese population were limited. We recruited 13,473 adult women from 9 Chinese provinces, collected buccal cell samples, and determined genotypes, to estimate the combined genotype and haplotype distributions of the MTHFR C677T and A1298C polymorphisms. In the total sample, the 6 common combined genotypes were CT/AA (29.5%), TT/AA (21.9%), CC/AA (15.4%), CC/AC (14.9%), CT/AC (13.7%), and CC/CC (3.4%); the 3 frequent haplotypes were 677T-1298A (43.6%), 677C-1298A (37.9%), and 677C-1298C (17.6%). Importantly, we observed that there were 51 (0.4%) individuals with the CT/CC genotype, 92 (0.7%) with the TT/AC genotype, 17 (0.1%) with the TT/CC genotype, and that the frequency of the 677T-1298C haplotype was 0.9%. In addition, the prevalence of some combined genotypes and haplotypes varied among populations residing in different areas and even showed apparent geographical gradients. Further linkage disequilibrium analysis showed that the D’ and r2 values were 0.883 and 0.143, respectively. In summary, the findings of our study provide further strong evidence that the MTHFR C677T and A1298C polymorphisms are usually in trans and occasionally in cis configurations. The frequencies of mutant genotype combinations were relatively higher in Chinese population than other populations, and showed geographical variations. These baseline data would be useful for future related studies and for developing health management programs. PMID:27902594

Association between methylenetetrahydrofolate reductase C677T polymorphism and epilepsy susceptibility: a meta-analysis.

PubMed

Wu, Yi-Le; Yang, Hui-Yun; Ding, Xiu-Xiu; Zhao, Xue; Chen, Jian; Bi, Peng; Sun, Ye-Huan

2014-06-01

Methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism has been implicated as a potential risk factor for epilepsy. To date, many case-control studies have investigated the association between MTHFR C677T polymorphism and epilepsy susceptibility. However, those findings were inconsistent. The objective of this study is to evaluate the precise association between MTHFR C677T polymorphism and epilepsy. An electronic search of PubMed, EMBASE for papers on the MTHFR C677T polymorphism and epilepsy susceptibility was performed. Odds ratios (ORs) with 95% confidence intervals (CIs) were calculated to assess the association. Ten case-control studies containing 1713 cases and 1867 controls regarding MTHFR C677T polymorphism were selected. A significant association between the MTHFR C677T polymorphism and epilepsy susceptibility was revealed in this meta-analysis (for T vs. C: OR=1.19, 95% CI=1.08-1.32; for TT+CT vs. CC: OR=1.20, 95% CI=1.05-1.38; for TT vs. CC: OR=1.48, 95% CI=1.20-1.83; for TT vs. CT+CC: OR=1.35, 95% CI=1.12-1.64). In subgroup analysis by ethnicity, the results also indicated the association between the MTHFR C677T polymorphism and epilepsy susceptibility within the Asian populations (for T vs. C: OR=1.55, 95% CI=1.15-2.07; for TT+CT vs. CC: OR=1.67, 95% CI=1.08-2.59; for TT vs. CC: OR=2.33, 95% CI=1.30-4.20; for TT vs. CT+CC: OR=1.89, 95% CI=1.12-3.18). The results indicated that MTHFR C677T polymorphism was associated with an increased risk of epilepsy. However, further studies in various regions are needed to confirm the findings from this meta-analysis. Copyright © 2014 British Epilepsy Association. Published by Elsevier Ltd. All rights reserved.

The association between MTHFR 677C>T genotype and folate status and genomic and gene-specific DNA methylation in the colon of individuals without colorectal neoplasia.

PubMed

Hanks, Joanna; Ayed, Iyeman; Kukreja, Neil; Rogers, Chris; Harris, Jessica; Gheorghiu, Alina; Liu, Chee Ling; Emery, Peter; Pufulete, Maria

2013-12-01

Decreased genomic and increased gene-specific DNA methylation predispose to colorectal cancer. Dietary folate intake and the methylenetetrahydrofolate reductase polymorphism (MTHFR 677C>T) may influence risk by modifying DNA methylation. We investigated the associations between MTHFR 677C>T genotype, folate status, and DNA methylation in the colon. We conducted a cross-sectional study of 336 men and women (age 19-92 y) in the United Kingdom without colorectal neoplasia. We obtained blood samples for measurement of serum and red blood cell folate, plasma homocysteine, and MTHFR 677C>T genotype and colonic tissue biopsies for measurement of colonic tissue folate and DNA methylation (genomic- and gene-specific, estrogen receptor 1, ESR1; myoblast determination protein 1, MYOD1; insulin-like growth factor II, IGF2; tumor suppressor candidate 33, N33; adenomatous polyposis coli, APC; mut-L homolog 1, MLH1; and O(6)-methylguanine-DNA methyltransferase, MGMT) by liquid chromatography/electrospray ionization mass spectrometry and pyrosequencing, respectively. Of the 336 subjects recruited, 185 (55%) carried the CC, 119 (35%) the CT, and 32 (10%) the TT alleles. No significant differences in systemic markers of folate status and colonic tissue folate between genotypes were found. The MTHFR TT genotype was not associated with genomic or gene-specific DNA methylation. Biomarkers of folate status were not associated with genomic DNA methylation. Relations between biomarkers of folate status and gene-specific methylation were inconsistent. However, low serum folate was associated with high MGMT methylation (P = 0.001). MTHFR 677C>T genotype and folate status were generally not associated with DNA methylation in the colon of a folate-replete population without neoplasia.

MTHFR C677T gene polymorphism and head and neck cancer risk: a meta-analysis based on 23 publications.

PubMed

Niu, Yu-Ming; Deng, Mo-Hong; Chen, Wen; Zeng, Xian-Tao; Luo, Jie

2015-01-01

Conflicting results on the association between MTHFR polymorphism and head and neck cancer (HNC) risk were reported. We therefore performed a meta-analysis to derive a more precise relationship between MTHFR C677T polymorphism and HNC risk. Three online databases of PubMed, Embase, and CNKI were researched on the associations between MTHFR C677T polymorphism and HNC risk. Twenty-three published case-control studies involving 4,955 cases and 8,805 controls were collected. Odds ratios (ORs) with 95% confidence interval (CI) were used to evaluate the relationship between MTHFR C677T polymorphism and HNC risk. Sensitivity analysis, cumulative analyses, and publication bias were conducted to validate the strength of the results. Overall, no significant association between MTHFR C677T polymorphism and HNC risk was found in this meta-analysis (T versus C: OR = 1.04, 95% CI = 0.92-1.18; TT versus CC: OR = 1.15, 95% CI = 0.90-1.46; CT versus CC: OR = 1.00, 95% CI = 0.85-1.17; CT + TT versus CC: OR = 1.01, 95% CI = 0.87-1.18; TT versus CC + CT: OR = 1.11, 95% CI = 0.98-1.26). In the subgroup analysis by HWE, ethnicity, study design, cancer location, and negative significant associations were detected in almost all genetic models, except for few significant risks that were found in thyroid cancer. This meta-analysis demonstrates that MTHFR C677T polymorphism may not be a risk factor for the developing of HNC.

The methylenetetrahydrofolate reductase 677T-1298C haplotype is a risk factor for acute lymphoblastic leukemia in children

PubMed Central

Kałużna, Ewelina Maria; Strauss, Ewa; Świątek-Kościelna, Bogna; Zając-Spychała, Olga; Gowin, Ewelina; Nowak, Jerzy S.; Rembowska, Jolanta; Januszkiewicz-Lewandowska, Danuta

2017-01-01

Abstract The etiology of acute lymphoblastic leukemia (ALL) is complex, linked with both environmental exposures and genetic factors. Functional variants of the methylenetetrahydrofolate reductase (MTHFR) gene result in disturbance in folate metabolism and may affect susceptibility to cancer. The study was performed to evaluate whether MTHFR C677T and A1298C polymorphisms, analyzed separately and together, are associated with the development of ALL in a population under 18 years of age of Caucasian ancestry. The study included 117 pediatric patients (59% males, mean age at diagnosis 7.4 ± 5.2 years) with ALL, confirmed by conventional immunophenotyping surface-marker analysis and 404 healthy control subjects (48.5% men, mean age 37.7 ± 11.3 years). The MTHFR C677T and A1298C genotypes were analyzed using allele discrimination tests with Taq-Man fluorescent probes. The MTHFR 677TT genotype was related to a 2-fold increase in risk of ALL (P = .014). The 677T-1298C haplotype was found in ALL patients but not in controls (frequency 0.598%; P <.0001). The observed frequency of carriers of this rare haplotype was 12%, including 677CT/1298CC (1.7%), 677TT/1298AC (6.0%), and 677CT/1298AC (4.3%) genotypes. The MTHFR 677T allele alone or in combination with the MTHFR 1298C allele significantly increases the risk of development of ALL in Polish population under 18 years of age. Further studies of haplotype composition in subjects with the 677CT/1298AC genotype are necessary to assess the risk of childhood ALL. PMID:29390492

Creatine kinase MM TaqI and methylenetetrahydrofolate reductase C677T and A1298C gene polymorphisms influence exercise-induced C-reactive protein levels.

PubMed

Miranda-Vilela, Ana Luisa; Akimoto, Arthur K; Lordelo, Graciana S; Pereira, Luiz C S; Grisolia, Cesar K; Klautau-Guimarães, Maria de Nazaré

2012-01-01

Physical training induces beneficial adaptations, but exhausting exercise increases reactive oxygen species, which can cause muscular injuries with consequent inflammatory processes, implying jeopardized performance and possibly overtraining. Acute strenuous exercise almost certainly exceeds the benefits of physical activity; it can compromise performance and may contribute to increased future risk of cardiovascular disease (CVD) in athletes. Polymorphisms in the muscle-type creatine kinase (CK-MM) gene may influence performance and adaptation to training, while many potentially significant genetic variants are reported as risk factors for CVD. Therefore, we investigated the influence of polymorphisms in CK-MM TaqI and NcoI, methylenetetrahydrofolate reductase (MTHFR C677T and A1298C) and C-reactive protein (CRP G1059C) genes on exercise-induced damage and inflammation markers. Blood samples were taken immediately after a race (of at least 4 km) that took place outdoors on flat tracks, and were submitted to genotyping and biochemical evaluation of aspartate aminotransferase (AST), CK, CRP and high-sensitivity CRP (hs-CRP). CK-MM TaqI polymorphism significantly influenced results of AST, CK and hs-CRP, and an association between MTHFR C677T and A1298C with CRP level was found, although these levels did not exceed reference values. Results indicate that these polymorphisms can indirectly influence performance, contribute to higher susceptibility to exercise-induced inflammation or protection against it, and perhaps affect future risks of CVD in athletes.

Creatine kinase MM TaqI and methylenetetrahydrofolate reductase C677T and A1298C gene polymorphisms influence exercise-induced C-reactive protein levels.

PubMed

Miranda-Vilela, Ana Luisa; Akimoto, Arthur K; Lordelo, Graciana S; Pereira, Luiz C S; Grisolia, Cesar K; Klautau-Guimarães, Maria de Nazaré

2012-03-01

Physical training induces beneficial adaptations, but exhausting exercise increases reactive oxygen species, which can cause muscular injuries with consequent inflammatory processes, implying jeopardized performance and possibly overtraining. Acute strenuous exercise almost certainly exceeds the benefits of physical activity; it can compromise performance and may contribute to increased future risk of cardiovascular disease (CVD) in athletes. Polymorphisms in the muscle-type creatine kinase (CK-MM) gene may influence performance and adaptation to training, while many potentially significant genetic variants are reported as risk factors for CVD. Therefore, we investigated the influence of polymorphisms in CK-MM TaqI and NcoI, methylenetetrahydrofolate reductase (MTHFR C677T and A1298C) and C-reactive protein (CRP G1059C) genes on exercise-induced damage and inflammation markers. Blood samples were taken immediately after a race (of at least 4 km) that took place outdoors on flat tracks, and were submitted to genotyping and biochemical evaluation of aspartate aminotransferase (AST), CK, CRP and high-sensitivity CRP (hs-CRP). CK-MM TaqI polymorphism significantly influenced results of AST, CK and hs-CRP, and an association between MTHFR C677T and A1298C with CRP level was found, although these levels did not exceed reference values. The results indicate that these polymorphisms can indirectly influence performance, contribute to higher susceptibility to exercise-induced inflammation or protection against it, and perhaps affect future risks of CVD in athletes.

Lack of association between MTHFR C677T and A1298C polymorphisms and risk of childhood acute lymphoblastic leukemia in the Kurdish population from Western Iran.

PubMed

Azhar, Mohammad-Reza; Rahimi, Zohreh; Vaisi-Raygani, Asad; Akramipour, Reza; Madani, Hamid; Rahimi, Ziba; Parsian, Abbas

2012-03-01

Polymorphism in genes involved in folate metabolism may influence the susceptibility to acute lymphoblastic leukemia (ALL). The aim of the present study was to determine the role of the two most common polymorphisms of the 5, 10-methylenetetrahydrofolate reductase (MTHFR) gene, MTHFR C677T and A1298C, and their interaction on the susceptibility to ALL. Seventy-two children with ALL and 109 age- and sex-matched healthy children from Western Iran were screened for MTHFR C677T and A1298C variants by using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). The frequencies of MTHFR 677T and 1298C alleles in patients were 29.9% and 43.1%, respectively, that were higher than those in controls (24.8% and 38.1%, respectively). Logistic regression analysis was performed and its result in the odds ratios (ORs) for possession of either MTHFR 677T or 1298C allele was found to be 1.98 [95% confidence interval (CI) 0.72-5.4, p = 0.18] and 1.48 (95% CI 0.59-3.69, p = 0.4), respectively. Also the concomitant presence of both MTHFR 677T and 1298C alleles was not associated with the risk of ALL [OR = 2.12 (95% CI 0.8-5.7, p = 0.13)]. Our results in a homogenous population with Kurdish ethnic background indicated that neither the MTHFR 677T allele nor the MTHFR 1298C allele is associated with increased risk of ALL.

Association between methylenetetrahydrofolate reductase polymorphism C677T and risk of chronic myeloid leukemia in Serbian population.

PubMed

Jakovljevic, Ksenija; Malisic, Emina; Cavic, Milena; Radulovic, Sinisa; Jankovic, Radmila

2012-07-01

Methylenetetrahydrofolate reductase (MTHFR) is a key enzyme regulating the intracellular folate metabolism which plays an important role in carcinogenesis through DNA methylation and nucleotide synthesis. The common MTHFR single nucleotide polymorphism C677T has been reported to be associated with reduced enzymatic activity. In order to investigate the influence of this polymorphism on the risk of chronic myeloid leukemia (CML), we performed a case-control study in a Serbian population of 52 patients with CML and 53 healthy control subjects. MTHFR C677T polymorphism genotyping was assessed using the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. The results demonstrated no statistical difference in MTHFR 677 frequency distribution between patient and control groups. Our findings suggest that MTHFR 677 gene variants have no significant influence on the susceptibility to CML in a Serbian population.

Methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C polymorphisms and the risk of primary Hepatocellular Carcinoma (HCC) in a Chinese population

PubMed Central

Cao, Wei; Zhang, Zuo-Feng; Cai, Lin; Jiang, Qing-Wu; You, Nai-Chieh; Goldstein, Binh Yang; Wei, Guo-Rong; Chen, Chuan-Wei; Lu, Qing-Yi; Zhou, Xue-Fu; Ding, Bao-Guo; Chang, Jun; Yu, Shun-Zhang

2014-01-01

Objectives Methylenetetrahydrofolate reductase (MTHFR), which is expressed in the liver, may be involved in both DNA methylation and DNA synthesis. It is also indicated as a potential risk factor of liver cancer in patients with chronic liver disease. To date, no study has been conducted on MTHFR and hepatocellular carcinoma (HCC) using a population-based design. The objective of this study was to evaluate the effects of polymorphisms of the MTHFR gene on the risk of primary liver cancer and their possible effect modifications on various environmental risk factors. Methods A population-based case–control study was conducted in Taixing, China. MTHFR C677T and A1298C were assayed by PCR-RFLP techniques. Results The frequency of MTHFR 677 C/C wild homo-zygotes genotype was 25.8% in cases, which was lower than that in controls (34.5%). The adjusted odds ratios (ORs) for the MTHFR 677 C/T and T/T genotype were 1.66(95% CI: 1.06–2.61), 1.21(95% CI: 0.65–2.28) respectively when compared with the MTHFR 677 C/C genotype. Subjects carrying any T genotype have the increased risk of 1.55(95% CI: 1.01–2.40) for development of primary hepatocellular carcinoma. A high degree of linkage disequilibrium was observed between the C677T and A1298C polymorphisms, with the D′ of 0.887 and p < 0.01. The MTHFR 677 any T genotype was suggested to have potentially more than multiplicative interactions with raw water drinking with p-value for adjusted interaction of 0.03. Conclusion We observed that the MTHFR 677 C/T genotype was associated with an increased risk of primary liver cancer in a Chinese population. The polymorphism of MTHFR 677 might modify the effects of raw water drinking on the risk of primary hepatocellular carcinoma. PMID:17503006

Association between MTHFR C677T polymorphism and depression: a meta-analysis in the Chinese population.

PubMed

Jiang, Wei; Xu, Jun; Lu, Xiao-Jie; Sun, Yang

2016-09-01

Depression is a worldwide public health issue, and its prevalence increases each year. Although a number of studies have been conducted on the association between MTHFR C677T polymorphism and depression in China, this association remains elusive and controversial. To clarify the impact of MTHFR C677T polymorphism on the risk of depression, a meta-analysis was performed in the Chinese population. Relevant studies were identified using PubMed, Springer Link, Ovid, Chinese Wanfang Data Knowledge Service Platform, Chinese National Knowledge Infrastructure and Chinese Biology Medicine through May 5, 2015. Pooled odds ratios (ORs) and 95% confidence intervals (CIs) were used to assess the strength of the associations. A total of 13 case-control studies including 1895 patients and 1913 controls were involved in this meta-analysis. Overall, T variant of MTHFR C677T gene polymorphism was significantly associated with an increased risk of depression in the Chinese population (T vs. C: OR = 1.52, 95% CI = 1.24-1.85; TT + CT vs. CC: OR = 1.64, 95% CI = 1.16-2.30; TT vs. CC: OR = 2.19, 95% CI = 1.49-3.24; TT vs. CC + CT: OR = 1.80, 95% CI = 1.31-2.46). In subgroup analyses stratified by geographic area and source of controls, the significant results were found in population-based studies, in hospital-based studies, in North and South China. The risk conferred by MTHFR C677T polymorphism is higher in North China than in South China. In conclusion, this meta-analysis suggests that MTHFR C677T polymorphism is associated with depression in the Chinese population, but these associations vary in different geographic locations.

The methylenetetrahydrofolate reductase 677T-1298C haplotype is a risk factor for acute lymphoblastic leukemia in children.

PubMed

Kałużna, Ewelina Maria; Strauss, Ewa; Świątek-Kościelna, Bogna; Zając-Spychała, Olga; Gowin, Ewelina; Nowak, Jerzy S; Rembowska, Jolanta; Januszkiewicz-Lewandowska, Danuta

2017-12-01

The etiology of acute lymphoblastic leukemia (ALL) is complex, linked with both environmental exposures and genetic factors. Functional variants of the methylenetetrahydrofolate reductase (MTHFR) gene result in disturbance in folate metabolism and may affect susceptibility to cancer. The study was performed to evaluate whether MTHFR C677T and A1298C polymorphisms, analyzed separately and together, are associated with the development of ALL in a population under 18 years of age of Caucasian ancestry.The study included 117 pediatric patients (59% males, mean age at diagnosis 7.4 ± 5.2 years) with ALL, confirmed by conventional immunophenotyping surface-marker analysis and 404 healthy control subjects (48.5% men, mean age 37.7 ± 11.3 years). The MTHFR C677T and A1298C genotypes were analyzed using allele discrimination tests with Taq-Man fluorescent probes.The MTHFR 677TT genotype was related to a 2-fold increase in risk of ALL (P = .014). The 677T-1298C haplotype was found in ALL patients but not in controls (frequency 0.598%; P <.0001). The observed frequency of carriers of this rare haplotype was 12%, including 677CT/1298CC (1.7%), 677TT/1298AC (6.0%), and 677CT/1298AC (4.3%) genotypes.The MTHFR 677T allele alone or in combination with the MTHFR 1298C allele significantly increases the risk of development of ALL in Polish population under 18 years of age. Further studies of haplotype composition in subjects with the 677CT/1298AC genotype are necessary to assess the risk of childhood ALL. Copyright © 2017 The Authors. Published by Wolters Kluwer Health, Inc. All rights reserved.

Folate restriction and methylenetetrahydrofolate reductase 677T polymorphism decreases adoMet synthesis via folate-dependent remethylation in human-transformed lymphoblasts.

PubMed

Chiang, E-P; Wang, Y-C; Tang, F-Y

2007-04-01

The homozygous mutation (677TT) in the methylenetetrahydrofolate reductase (MTHFR) gene reduces enzyme activity and alters cellular folate composition. Previous epidemiological studies reported a potential protective effect of MTHFR677C --> T against acute lymphocytic leukemia and malignant lymphoma, but the mechanism remains to be determined. We investigated the biochemical impacts of MTHFR677C --> T on cellular S-adenosyl methionine (adoMet) synthesis, global DNA methylation, and de novo purine synthesis, all of which are potential regulatory pathways involved in tumorigenesis. Metabolic fluxes of homocysteine remethylation and de novo purine synthesis were compared between Epstein-Barr virus-transformed lymphoblasts expressing MTHFR 677C and MTHFR 677T using stable isotopic tracers and GCMS. MTHFR TT genotype significantly reduced folate-dependent remethylation under folate restriction, reflecting limited methylated folates under folate restriction. Data also suggested increased formylated folate pool and increased purine synthesis when folate is adequate. The impacts of MTHFR 677T polymorphism appeared closely related to folate status, and such alterations may modulate metabolic pathways involved in cancer onset/progression. The advantage of de novo purine synthesis found in the MTHFR TT genotype may account for the protective effect of MTHFR in hematological malignancies. These transformed cells are potential models for studying the consequences of human genetic variation and cancer pathogenesis.

The association between methylenetetrahydrofolate reductase C677 > T polymorphisms and risk of pediatric acute lymphoblastic leukemia in Asia.

PubMed

Lin, Shiguang; Liu, Qin; Zeng, Xiaoming

2014-11-01

The association between methylenetetrahydrofolate reductase (MTHFR) C677 > T polymorphisms and pediatric acute lymphoblastic leukemia (ALL) risk in Asia is controversial. The aim of this meta-analysis was to further assess the relationship between MTHFR C677 > T polymorphisms and pediatric ALL for Chinese children. Studies about the MTHFR C677 > T polymorphisms and pediatric ALL risk were searched in the Medline, PubMed, EMBASE, Wanfang and CNIK databases. The genotype of the case and control group were extracted and pooled by meta-analysis. The association between ALL risk and C677 > T polymorphisms was demonstrated by odds ratio (OR) and its 95% confidence interval (CI). Twelve articles were included in this study with 1803 ALL cases and 4146 controls. In recessive genetic model (TT vs. CC + CT), the OR was 0.37 (95%CI: 0.31-0.43); in dominant genetic model (TT + CT vs. CC) the OR was 0.94 (95%CI: 0.82-1.06); and in the homozygous model the OR was 0.84 (95%CI: 0.69-1.03). The results indicated that Asian children with TT genotype of MTHFR gene may have less risk of developing ALL.

Role of Hyperhomocysteinemia and Methylene Tetrahydrofolate Reductase C677T Polymorphism in Idiopathic Portal Vein Thrombosis

PubMed Central

Ghaznavi, Habib; Soheili, Zahra; Samiei, Shahram; Soltanpour, Mohammad Soleiman

2016-01-01

Purpose: Portal vein thrombosis (PVT) is a rare and life-threatening vascular disorder characterized by obstruction or narrowing of the portal vein. Hyperhomocysteinemia and methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism has been studied in PVT patients with conflicting results. In the present study the association of hyperhomocysteinemia and MTHFR C677T polymorphism with PVT risk was investigated in Iranians. Materials and Methods: Our study population consisted of 10 idiopathic PVT patients and 80 healthy control subjects matched for age and sex. MTHFR C677T polymorphism was genotyped by the polymerase chain reaction technique combined with restriction enzyme fragment length polymorphism (PCR-RFLP) technique and plasma total homocysteine (tHcy) levels were determined by enzyme immunoassay method. Results: Mean plasma tHcy levels were significantly higher in PVT patients (20.2±6.8) than control subjects (10.9±4.7) (P=0.001). Moreover, plasma tHcy levels were significantly higher in 677T allele carriers relative to 677C allele carriers in both PVT patients (P=0.01) and control subjects (P=0.03). Neither homozygote nor heterozygote genotypes of MTHFR C677T polymorphism correlated significantly with PVT risk (P>0.05). Moreover, MTHFR C677T polymorphism didn’t increase the risk of PVT under dominant (CT+TT vs. CC) or recessive (TT vs. CC+CT) genetic models analyzed (P>0.05). The difference in frequency of minor 677T allele between PVT patients and control subjects was not statistically significant (P>0.05). Conclusion: Based on the current study, we suggest that hyperhomocysteinemia constitutes a significant and common risk factor for PVT. Also, MTHFR C677T polymorphism is not a risk factor for PVT but is a contributing factor for elevated plasma tHcy levels. PMID:27051654

Role of Hyperhomocysteinemia and Methylene Tetrahydrofolate Reductase C677T Polymorphism in Idiopathic Portal Vein Thrombosis.

PubMed

Ghaznavi, Habib; Soheili, Zahra; Samiei, Shahram; Soltanpour, Mohammad Soleiman

2016-03-01

Portal vein thrombosis (PVT) is a rare and life-threatening vascular disorder characterized by obstruction or narrowing of the portal vein. Hyperhomocysteinemia and methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism has been studied in PVT patients with conflicting results. In the present study the association of hyperhomocysteinemia and MTHFR C677T polymorphism with PVT risk was investigated in Iranians. Our study population consisted of 10 idiopathic PVT patients and 80 healthy control subjects matched for age and sex. MTHFR C677T polymorphism was genotyped by the polymerase chain reaction technique combined with restriction enzyme fragment length polymorphism (PCR-RFLP) technique and plasma total homocysteine (tHcy) levels were determined by enzyme immunoassay method. Mean plasma tHcy levels were significantly higher in PVT patients (20.2±6.8) than control subjects (10.9±4.7) (P=0.001). Moreover, plasma tHcy levels were significantly higher in 677T allele carriers relative to 677C allele carriers in both PVT patients (P=0.01) and control subjects (P=0.03). Neither homozygote nor heterozygote genotypes of MTHFR C677T polymorphism correlated significantly with PVT risk (P>0.05). Moreover, MTHFR C677T polymorphism didn't increase the risk of PVT under dominant (CT+TT vs. CC) or recessive (TT vs. CC+CT) genetic models analyzed (P>0.05). The difference in frequency of minor 677T allele between PVT patients and control subjects was not statistically significant (P>0.05). Based on the current study, we suggest that hyperhomocysteinemia constitutes a significant and common risk factor for PVT. Also, MTHFR C677T polymorphism is not a risk factor for PVT but is a contributing factor for elevated plasma tHcy levels.

Methylenetetrahydrofolate reductase C677T polymorphism in patients with lung cancer in a Korean population

PubMed Central

2011-01-01

Background This study was designed to investigate an association between methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism and the risk of lung cancer in a Korean population. Methods We conducted a large-scale, case-control study involving 3938 patients with newly diagnosed lung cancer and 1700 healthy controls. Genotyping was performed with peripheral blood DNA for MTHFR C677T polymorphisms. Statistical significance was estimated by logistic regression analysis. Results The MTHFR C677T frequencies of CC, CT, and TT genotypes were 34.5%, 48.5%, and 17% among lung cancer patients, and 31.8%, 50.7%, and 17.5% in the controls, respectively. The MTHFR 677CT and TT genotype showed a weak protection against lung cancer compared with the homozygous CC genotype, although the results did not reach statistical significance. The age- and gender-adjusted odds ratio (OR) of overall lung cancer was 0.90 (95% confidence interval (CI), 0.77-1.04) for MTHFR 677 CT and 0.88 (95% CI, 0.71-1.07) for MTHFR 677TT. However, after stratification analysis by histological type, the MTHFR 677CT genotype showed a significantly decreased risk for squamous cell carcinoma (age- and gender-adjusted OR, 0.78; 95% CI, 0.64-0.96). The combination of 677 TT homozygous with 677 CT heterozygous also appeared to have a protection effect on the risk of squamous cell carcinoma. We observed no significant interaction between the MTHFR C677T polymorphism and age and gender or smoking habit. Conclusions This is the first reported study focusing on the association between MTHFR C677T polymorphisms and the risk of lung cancer in a Korean population. The T allele was found to provide a weak protective association with lung squamous cell carcinoma. PMID:21342495

Methylenetetrahydrofolate reductase C677T genetic polymorphisms and risk of leukaemia among the North Indian population.

PubMed

Hussain, Syed Rizwan; Naqvi, Hena; Raza, Syed Tasleem; Ahmed, Faisal; Babu, Sunil G; Kumar, Ashutosh; Zaidi, Zeashan Haider; Mahdi, Farzana

2012-08-01

Leukaemia is a heterogeneous disease in which haematopoietic progenitor cells acquire genetic lesions that lead to a block in differentiation, increased self-renewal, and unregulated proliferation. The enzyme 5,10-methylenetetrahydrofolate reductase (MTHFR), involved in folate metabolism, plays a crucial role in cells because folate availability is important for DNA integrity. The aim of this case-control study was to evaluate the association of the C677T MTHFR gene polymorphism with acute myeloid leukaemia (AML), acute lymphoblastic leukaemia (ALL), chronic myeloid leukaemia (CML) and chronic lymphocytic leukaemia (CLL). A total of 275 leukaemia cases - including AML (n = 112), ALL (n = 81), CML (n = 43), CLL (n = 39) - and 251 age/sex-matched healthy control individuals participated in this study. MTHFR C677T polymorphisms in the cases and controls were evaluated by polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP). The average MTHFR 677CC, 677CT, 677TT genotype frequencies of total leukaemia cases were 68.73%, 19.64%, and 11.64% in cases, and 71.71%, 24.30%, and 3.98% in healthy controls, respectively. The average frequency of the MTHFR 677T allele was 21.45% among the cases compared to 16.13% among the controls. In the present case-control study we have observed a higher frequency of the MTHFR 677TT genotype in cases of leukaemia (AML, ALL, CML and CLL) as compared with controls; this might be due to ethnic and geographic variation. As per our findings, although the frequency of the MTHFR 677T allele is moderately high in AML, ALL and CLL, no statistically significant association was found; on the other hand statistically significant association was found in the context of CML cases. Copyright © 2012 Elsevier Ltd. All rights reserved.

[Study on the association between 5,10-methylenetrahydrofolate reductase C677T polymorphism and acute lymphoblastic leukemia risk: a Meta-analysis].

PubMed

Li, Xiao-lei; Yu, Feng; Zhang, Yong; Qiu, Jin-chun; Liu, Si-ting; Liao, Qing-chuan

2011-10-01

To evaluate the association between polymorphism of 5,10-methylenetrahydrofolate reductase C677T and risk of acute lymphoblastic leukemia (ALL). Electronic search strategy was carried out among the databases from home and abroad to collect qualified research papers, according to the inclusion and exclusion criteria. Data on case-control studies on association between MTHFR C677T polymorphism and susceptibility to ALL were collected and analyzed by models of TT vs. CC + CT or TT vs. CC through Meta-analysis. Stratified analysis was carried out according to different age groups (children or adult). In systematical analysis, the pooled odds ratios of MTHFR C677T genetype TT vs. CC + CT or TT vs. CC were 0.87 (0.69 - 1.09) and 0.82 (0.63 - 1.06) respectively; in children's group, the pooled odds ratios of MTHFR C677T genetype TT vs. CC + CT or TT vs. CC were 0.92 (0.79 - 1.08), 0.88 (0.75 - 1.05) while in adult group, the pooled odds ratios of MTHFR C677T genetype TT vs. CC + CT or TT vs. CC were 0.45 (0.26 - 0.77), and 0.41 (0.22 - 0.72) respectively. The MTHFR gene 677T variant might not be associated with the risk of children's ALL but might be associated with a reduced risk on adult's ALL.

Role of genetic mutations in folate-related enzyme genes on Male Infertility

PubMed Central

Liu, Kang; Zhao, Ruizhe; Shen, Min; Ye, Jiaxin; Li, Xiao; Huang, Yuan; Hua, Lixin; Wang, Zengjun; Li, Jie

2015-01-01

Several studies showed that the genetic mutations in the folate-related enzyme genes might be associated with male infertility; however, the results were still inconsistent. We performed a meta-analysis with trial sequential analysis to investigate the associations between the MTHFR C677T, MTHFR A1298C, MTR A2756G, MTRR A66G mutations and the MTHFR haplotype with the risk of male infertility. Overall, a total of 37 studies were selected. Our meta-analysis showed that the MTHFR C677T mutation was a risk factor for male infertility in both azoospermia and oligoasthenoteratozoospermia patients, especially in Asian population. Men carrying the MTHFR TC haplotype were most liable to suffer infertility while those with CC haplotype had lowest risk. On the other hand, the MTHFR A1298C mutation was not related to male infertility. MTR A2756G and MTRR A66G were potential candidates in the pathogenesis of male infertility, but more case-control studies were required to avoid false-positive outcomes. All of these results were confirmed by the trial sequential analysis. Finally, our meta-analysis with trial sequential analysis proved that the genetic mutations in the folate-related enzyme genes played a significant role in male infertility. PMID:26549413

Association of Methylenetetrahydrofolate Reductase C677T Polymorphism with Hyperhomocysteinemia and Deep Vein Thrombosis in the Iranian Population.

PubMed

Ghaznavi, Habib; Soheili, Zahra; Samiei, Shahram; Soltanpour, Mohammad Soleiman

2015-12-01

Deep venous thrombosis (DVT) is a common but elusive condition characterized by a high morbidity and mortality rate. The aim of the present study was to investigate the correlation between methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism with plasma total homocysteine (tHcy) levels and DVT risk in an Iranian population. Our study population consisted of 67 patients with a diagnosis of DVT and 67 healthy subjects as controls. Genotyping of MTHFR C677T polymorphism was performed by the polymerase chain reaction technique combined with restriction enzyme fragment length polymorphism (PCR-RFLP) and measurement of tHcy levels was done by enzyme immunoassay method. Plasma tHcy levels were significantly higher in DVT patients than controls (18.09±7.6 vs. 10.5±4.3, P=0.001). Also, plasma tHcy levels were significantly higher in MTHFR 677TT genotypes compared to 677CC genotypes in both DVT patients (P=0.016) and controls (P=0.03). Neither heterozygote nor homozygote genotypes of MTHFR C677T polymorphism was significantly correlated with DVT (P>0.05). The distribution of MTHFR C677T genotypes was similar between men and women in both DVT patients and controls (P>0.05). Moreover, the frequency of mutant 677T allele did not differ significantly between the two groups (28.3% vs. 21.6%, P=0.15). Based on this study, we propose that hyperhomocysteinemia but not homozygosity for MTHFR C677T polymorphism is a significant risk factor for DVT in the Iranian population. Also, MTHFR 677TT genotype is a determinant of elevated plasma tHcy levels.

Synergistic effect of methyltetrahydrofolate reductase (MTHFR) C677T and A1298C polymorphism as risk modifiers of pediatric acute lymphoblastic leukemia.

PubMed

Kamel, Azza M; Moussa, Heba S; Ebid, Gamal T; Bu, Rong R; Bhatia, Kishor G

2007-06-01

ALL is the most common pediatric cancer. The causes of the majority of pediatric acute leukemia are unknown and are likely to involve an interaction between genetic and environmental factors. Therefore, unfavourable gene-environmental interactions might be involved in the genesis of ALL. The aim of this work was to evaluate, in a case-control study, whether the common polymorphisms in 5, 10-methylenetetrahydrofolate reductase (MTHFR) namely (C677T and A1298C) and methionine synthase (MS) (A2756G) genes may play a role in altering susceptibility to pediatric ALL as individual genes and in combination. DNA of 88 ALL patients (age < or = 18 years) and 311 healthy control subjects was analyzed for the polymorphisms of MTHFR and MS genes using PCR-RFLP method. The frequencies of the wild types of MTHFR 677CC, MTHFR 1298AA and MS 2756AA, the homozygous genotypes of MTHFR 677TT, MTHFR 1298CC and MS 2756GG and heterozygous genotypes of MTHFR 677CT and MS 2756AG showed no statistically significant differences between patients and controls. The frequency of the MTHFR 1298AC heterozygous genotype was 25% among patients compared to 45.0% among controls; the difference was found to be statistically significant (p value =0.001, O.R=0.382 & 95% C.I=0.222-0.658). The frequency of the MTHFR1298AC heterozygous genotype plus 1298CC homozygous genotype was 34% among patients compared to 54.3% among controls and the difference was statistically significant (p value =0.001). A synergistic effect of 677CT and1298AC (CTAC) was observed, (p value=0.002) with 3.65 fold protection (OR 0.273 & 95% C.I=0.155-0.9) compared to 2.6 folds for MTHFR 1298AC alone. This protective effect of CTAC polymorphism was abolished when combined with MS 2756AA or AG. The present study provided further evidence for the protective role of MTHFR 1298AC mutant alleles in acute lymphoblastic leukemia in children (2.6 fold protection). This suggests that folate and methionine metabolism play an important role in the

Human genetic selection on the MTHFR 677C>T polymorphism

PubMed Central

Mayor-Olea, Álvaro; Callejón, Gonzalo; Palomares, Arturo R; Jiménez, Ana J; Gaitán, María Jesús; Rodríguez, Alfonso; Ruiz, Maximiliano; Reyes-Engel, Armando

2008-01-01

Background The prevalence of genotypes of the 677C>T polymorphism for the MTHFR gene varies among humans. In previous studies, we found changes in the genotypic frequencies of this polymorphism in populations of different ages, suggesting that this could be caused by an increase in the intake of folate and multivitamins by women during the periconceptional period. The aim was to analyze changes in the allelic frequencies of this polymorphism in a Spanish population, including samples from spontaneous abortions (SA). Methods A total of 1305 subjects born in the 20th century were genotyped for the 677C>T polymorphism using allele specific real-time PCR with Taqman® probes. A section of our population (n = 276) born in 1980–1989 was compared with fetal samples (n = 344) from SA of unknown etiology from the same period. Results An increase in the frequency of the T allele (0.38 vs 0.47; p < 0.001) and of the TT genotype (0.14 vs 0.24; p < 0.001) in subjects born in the last quarter of the century was observed. In the 1980–1989 period, the results show that the frequency of the wild type genotype (CC) is about tenfold lower in the SA samples than in the controls (0.03 vs 0.33; p < 0.001) and that the frequency of the TT genotype increases in the controls (0.19 to 0.27) and in the SA samples (0.20 to 0.33 (p < 0.01)); r = 0.98. Conclusion Selection in favor of the T allele has been detected. This selection could be due to the increased fetal viability in early stages of embryonic development, as is deduced by the increase of mutants in both living and SA populations. PMID:19040733

Methylenetetrahydrofolate reductase C677T and A1298C polymorphism and susceptibility to acute lymphoblastic leukemia in a cohort of Egyptian children.

PubMed

Mosaad, Youssef M; Abousamra, Nashwa K; Elashery, Rasha; Fawzy, Iman M; Eldein, Omar A Sharaf; Sherief, Doaa M; El Azab, Hend M M

2015-01-01

This case-control study was planned to investigate the possible role of methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C polymorphisms as a risk factor for the development of acute lymphoblastic leukemia (ALL) in a cohort of Egyptian children. Typing of MTHFR C677T and A1298C polymorphisms was done using restriction fragment length polymorphism (RFLP) for 100 children with ALL and 100 age- and sex-matched healthy controls. No significant differences were found between patients with ALL and controls for the frequency of MTHFR C677T and A1298C alleles, genotypes, combined genotypes or haplotypes. The C677T and A1298C genotype frequency was different from that in Korean and Chinese populations (p < 0.5) and was similar to that in British, French-Canadian and German-Caucasian populations (p > 0.5). Our findings suggest that MTHFR C677T and A1298C polymorphisms are unlikely to affect the development of childhood ALL in an Egyptian population from Delta.

Association between the methylenetetrahydrofolate reductase c.677C>T polymorphism and bone mineral density: an updated meta-analysis.

PubMed

Li, Hong-Zhuo; Wang, Wei; Liu, Yi-Ling; He, Xiao-Feng

2016-02-01

Many studies have reported an association between the methylenetetrahydrofolate reductase (MTHFR) c.677C>T polymorphism and reduced bone mineral density (BMD), but results have been inconsistent. We, therefore, performed a meta-analysis to further explore this association. Twenty-one studies, comprising 33,045 subjects, analyzed the association of MTHFR c.677C>T with femoral neck BMD. Significant association with reduced BMD was observed in Caucasians (recessive model: WMD = -0.004 g/cm(2), 95 % CI -0.008 to -0.006), post-menopausal women (recessive model: WMD = -0.005 g/cm(2), 95 % CI -0.007 to -0.003), men (dominant model: WMD = -0.004 g/cm(2), 95 % CI -0.005 to -0.004; recessive model: WMD = -0.004 g/cm(2), 95 % CI -0.005 to -0.004; TT vs. CC: WMD = -0.006 g/cm(2), 95 % CI -0.006 to -0.006; CT vs. CC: WMD = -0.003 g/cm(2), 95 % CI -0.003 to -0.003), and cohort studies (recessive model: WMD = -0.003 g/cm(2), 95 % CI -0.006 to -0.001). Twenty-two studies, which included 32,271 subjects, analyzed the MTHFR c.677C>T association with lumbar spine BMD. Significant association with reduced BMD was observed in Caucasians, women, post-menopausal women, men, and cohort studies. Seven studies, comprising 6806 subjects, analyzed the MTHFR c.677C>T association with total hip BMD, but no significant association was observed in any population. Nine studies involving 5591 subjects analyzed the association with total body BMD. Significant association with reduced BMD was observed in overall and women subgroup analyses. In summary, this meta-analysis indicates that the MTHFR c.677C>T polymorphism is associated with reduced BMD in lumbar spine and femoral neck in Caucasians, post-menopausal women, and men, and with total body BMD in women. In addition, our results suggest that new studies examining the association between MTHFR c.677C>T polymorphism and BMD of lumbar spine and femoral neck in Asians is warranted, because I (2) > 75.0 % was observed.

MTHFR 677C --> T genotype disrupts prefrontal function in schizophrenia through an interaction with COMT 158Val --> Met.

PubMed

Roffman, Joshua L; Gollub, Randy L; Calhoun, Vince D; Wassink, Thomas H; Weiss, Anthony P; Ho, Beng C; White, Tonya; Clark, Vincent P; Fries, Jill; Andreasen, Nancy C; Goff, Donald C; Manoach, Dara S

2008-11-11

Understanding how risk genes cumulatively impair brain function in schizophrenia could provide critical insights into its pathophysiology. Working memory impairment in schizophrenia has been associated with abnormal dopamine signaling in the prefrontal cortex, which is likely under complex genetic control. The catechol-O-methyltransferase (COMT) 158Val --> Met polymorphism (rs4680), which affects the availability of prefrontal dopamine signaling, consistently stratifies prefrontal activation during working memory performance. However, the low-dopamine COMT 158Val allele does not confer increased risk for schizophrenia, and its effects on prefrontal function are not specific to the disorder. In the setting of other genetic variants influencing prefrontal dopamine signaling, COMT 158Val --> Met genotype may exert disease-specific effects. A second polymorphism, methylenetetrahydrofolate reductase (MTHFR) 677C --> T (rs1801133), has been associated with overall schizophrenia risk and executive function impairment in patients, and may influence dopamine signaling through mechanisms upstream of COMT effects. We found that the hypofunctional 677T variant was associated with decreased working memory load-dependent activation in the prefrontal and insular cortices in 79 schizophrenia patients, but not in 75 demographically matched healthy controls. Further, significant MTHFR x COMT genotype interactions were observed, which differed by diagnostic group: Reduced prefrontal activation was associated with the 677T and 158Val alleles in patients, but with 677C/C and 158Met/Met genotype in controls. These findings are consistent with epistatic effects of the COMT and MTHFR polymorphisms on prefrontal dopamine signaling, and suggest that in schizophrenia patients, the MTHFR 677T allele exacerbates prefrontal dopamine deficiency. The findings also suggest the importance of weighing COMT effects on prefrontal function within the context of MTHFR genotype.

Association between MTHFR C677T polymorphism and abdominal aortic aneurysm risk

PubMed Central

Liu, Jie; Jia, Xin; Li, Haifeng; Jia, Senhao; Zhang, Minhong; Xu, Yongle; Du, Xin; Zhang, Nianrong; Lu, Weihang; Guo, Wei

2016-01-01

Abstract Background: Abdominal aortic aneurysm (AAA) is a life-threatening condition. A number of studies reported the association between methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism and AAA risk, but substantial controversial findings were observed and the strength of the association remains unclear. Objective: The aim of this study was to investigate the aforementioned association in the overall population and different subgroups. Methods: PUBMED and EMBASE databases were searched until March 2016 to identify eligible studies, restricted to humans and articles published in English. Summary odds ratios (ORs) and 95% confidence intervals (CIs) were used to evaluate the susceptibility to AAA. Subgroup meta-analyses were conducted on features of the population, such as ethnicity, sex of the participants, and study design (source of control). Results: Twelve case–control studies on MTHFR C677T polymorphism and AAA risk, including 3555 cases and 6568 case-free controls were identified. The results revealed no significant association between the MTHFR C677T polymorphism and AAA risk in the overall population and within Caucasian or Asian subpopulations in all 5 genetic models. Further subgroup meta-analysis indicated that significantly increased risks were observed among cases with a mean age <70 years (OR = 1.73, 95% CI = 1.10–2.12, P = 0.02), cases with prevalence of smoking <60% (OR = 1.39, 95% CI = 1.02–1.90, P = 0.04), and cases with aneurysm diameter ≥55 mm (OR = 1.55, 95% CI = 1.07–2.24, P = 0.02) in the dominant genetic model. No publication bias was detected in the present study. Conclusion: In conclusion, our comprehensive meta-analysis suggests that the MTHFR C677T polymorphism may play an important role in AAA susceptibility, especially in younger, non-smoking, larger AAA-diameter subgroups of patients PMID:27603386

MTHFR gene C677T and A1298C polymorphisms and homocysteine levels in primary open angle and primary closed angle glaucoma

PubMed Central

Micheal, Shazia; Qamar, Raheel; Akhtar, Farah; Khan, Muhammad Imran; Khan, Wajid Ali

2009-01-01

Purpose To investigate the methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C genotypes and plasma concentrations of total homocysteine (tHcy) in Pakistani patients with primary open angle glaucoma (POAG) and primary closed angle glaucoma (PCAG). Methods This was a prospective case-control study. A total of 295 patients (173 POAG, 122 PCAG) and 143 age- and sex-matched controls were subdivided into two ethnic groups, Punjabis (Punjab province, central Pakistan) and Pathans (North-West Frontier Province, northern Pakistan). Genotypes of the MTHFR C677T and A1298C polymorphisms were detected by polymerase chain reaction–restriction fragment length polymorphism (PCR-RFLP). An enzyme-linked immunosorbent assay was used to determine the total serum homocysteine (tHcy) levels. Associations were determined by logistic regression analysis. Results Frequency distributions of genotypes and combined genotypes as well as homocysteine levels were obtained. The overall distribution of the C677T genotype was found to be significantly associated with PCAG (CC 69%, CT 21%, TT 10%; p=0.001, χ2=12.6), but not with POAG (CC 71%, CT 28%, TT 1%; p=0.98, χ2=0.02) as compared to the controls (CC 71%, CT 29%, TT 1%). The Pathan cohorts revealed no association with the disease; however, the Punjabis demonstrated a significant association with PCAG (CC 75%, CT 11%, TT 13%; p<0.001, χ2=17.2). PCAG in the Punjabi subjects was also significantly associated with the A1298C polymorphism (AA 43%, AC 54%, CC 3%; p<0.001, χ2=33.9) as compared to the controls. Combined genotype data showed no association with POAG; however, a significant association with all combined genotypes was observed in the overall PCAG subjects (p<0.05, χ2=20.1). This difference was particularly apparent in the TTAA and TTAC combinations that were completely absent in the control groups (p<0.05. χ2=49.6). Mean serum tHcy levels were found to be significantly increased in the POAG (15.2±1.28 µmol/l, p<0

Methylenetetrahydrofolate Reductase (MTHFR) C677T Polymorphism and Alzheimer Disease Risk: a Meta-Analysis.

PubMed

Rai, Vandana

2017-03-01

Methylenetetrahydrofolate reductase (MTHFR) is key enzyme of folate/homocysteine pathway. Case control association studies on MTHFR C677T polymorphism and Alzheimer's disease (AD) have been repeatedly performed over the last two decades, but the results are inconclusive. The aim of the present study was to assess the risk of MTHFR C677T polymorphism for AD. Forty-one studies were identified by a search of PubMed, Google Scholar, Elsevier, and Springer Link databases, up to January 2015. Odds ratios (ORs) with corresponding 95 % confidence interval (CI) were calculated using fixed effect model or random effect model. The subgroup analyses based on ethnicity were performed. MTHFR C677T polymorphism had a significant association with susceptibility to AD in all genetic models (for T vs C OR = 1.29, 95 % CI = 1.07-1.56, p = 0.003; for TT + CT vs CC OR = 1.29, 95 % CI = 1.19-1.40, p = 0.0004; for TT vs CC OR = 1.31, 95 % CI = 1.16-1.48, p = 0.001; for CT vs CC OR = 1.24, 95 % CI = 1.13-1.35, p < 0.004; and for TT vs CT + CC OR = 1.13, 95 % CI = 1.00-1.28, p = 0.02). Results of present meta-analysis supported that the MTHFR C677T polymorphism was associated with an increased risk of AD.

Status of vitamin B-12 and B-6 but not of folate, homocysteine and the methylenetetrahydrofolate reductase C677T polymorphism are associated with impaired cognition and depression in adults

USDA-ARS?s Scientific Manuscript database

The C677T polymorphism of the methylene tetrahydrofolate reductase (MTHFR) gene differs in frequency in different ethnic groups which have differing prevalence of age-related cognitive impairments. We used a battery of neuropsychological tests to examine association of the MTHFR C677T polymorphism w...

Association of methylenetetrahydrofolate reductase (MTHFR 677C>T) and thymidylate synthase (TSER and TS 1494del6) polymorphisms with premature ovarian failure in Korean women.

PubMed

Rah, HyungChul; Jeon, Young Joo; Choi, Youngsok; Shim, Sung Han; Yoon, Tae Ki; Choi, Dong Hee; Cha, Sun Hee; Kim, Nam Keun

2012-11-01

The aim of our study was to investigate whether methylenetetrahydrofolate reductase (MTHFR) gene variant (MTHFR 677C>T) and thymidylate synthase (TS) gene variants (TS enhancer region [TSER] and TS 1494del6) confer a risk for premature ovarian failure (POF). We genotyped 136 POF patients and 236 controls among Korean women for the three single nucleotide polymorphism sites using polymerase chain reaction restriction fragment length polymorphism analysis. Differences in the MTHFR 677C>T, TSER, and TS 1494del6 genotype frequencies between POF patients and controls were compared, and odds ratios (ORs) and 95% CIs were determined as a measure of the strength of the association between genotypes and POF. The MTHFR 677CT and CT + TT variant genotypes were more frequent in POF patients than in controls (OR, 2.249; 95% CI, 1.317-3.843; and OR, 2.132; 95% CI, 1.268-3.585, respectively). The combined genotype frequencies of MTHFR 677CT + TT/TSER 3R3R and 677CT + TT/TS 1494del6 del6/del6 were higher in patients than in controls (OR, 2.300; 95% CI, 1.219-4.337; and OR, 3.314; 95% CI, 1.623-6.767, respectively). The T-3R-del6 and T-2R-del6 (MTHFR 677C>T/TSER/TS 1494del6) haplotypes were more frequent in patients (OR, 1.450; 95% CI, 1.050-2.002; and OR, 2.911; 95% CI, 1.191-7.117, respectively), whereas the C-2R-del6 haplotype was less frequent in patients (OR, 0.372; 95% CI, 0.152-0.912). The T-del6 (MTHFR 677/TS 1494del6) haplotype frequency was higher among patients (OR, 1.653; 95% CI, 1.206-2.266), whereas the C-del6 haplotype frequency was lower among patients (OR, 0.700; 95% CI, 0.516-0.950). We did not find an association between TSER or TS 1494del6 polymorphisms and POF. Our data suggest that the MTHFR 677T allele may increase the risk for POF, which could lead to the development of novel genetic markers for predicting the risk of POF in patients.

Molecular genetic analysis in mild hyperhomocysteinemia: A common mutation in the methylenetetrahydrofolate reductase gene is a genetic risk factor for cardiovascular disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kluijtmans, L.A.J.; Heuvel, L.P.W.J. van den; Stevens, E.M.B.

1996-01-01

Mild hyperhomocysteinemia is an established risk factor for cardiovascular disease. Genetic aberrations in the cystathionine P-synthase (CBS) and methylenetetrahydrofolate reductase (MTHFR) genes may account for reduced enzyme activities and elevated plasma homocysteine levels. In 15 unrelated Dutch patients with homozygous CBS deficiency, we observed the 833T{yields}C (1278T) mutation in 50% of the alleles. Very recently, we identified a common mutation (677C{yields}T; A{yields}V) in the MTHFR gene, which, in homozygous state, is responsible for the thermolabile phenotype and which is associated with decreased specific MTHFR activity and elevated homocysteine levels. We screened 60 cardiovascular patients and 111 controls for these twomore » mutations, to determine whether these mutations are risk factors for premature cardiovascular disease. Heterozygosity for the 833T{yields}C mutation in the CBS gene was observed in one individual of the control group but was absent in patients with premature cardiovascular disease. Homozygosity for the 677C-{yields}T mutation in the MTHFR gene was found in 9 (15%) of 60 cardiovascular patients and in only 6 ({approximately}5%) of 111 control individuals (odds ratio 3.1 [95% confidence interval 1.0-9.21]). Because of both the high prevalence of the 833T-{yields}C mutation among homozygotes for CBS deficiency and its absence in 60 cardiovascular patients, we may conclude that heterozygosity for CBS deficiency does not appear to be involved in premature cardiovascular disease. However, a frequent homozygous mutation in the MTHFR gene is associated with a threefold increase in risk for premature cardiovascular disease. 35 refs., 3 figs., 1 tab.« less

Methylenetetrahydrofolate reductase C677T polymorphism in patients with gastric and colorectal cancer in a Korean population

PubMed Central

2010-01-01

Background This study was designed to investigate an association between the methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism and the risk of gastric and colorectal cancer in the Korean population. Methods We conducted a population-based large-scale case-control study involving 2,213 patients with newly diagnosed gastric cancer, 1,829 patients with newly diagnosed colorectal cancer, and 1,700 healthy controls. Genotyping was performed with peripheral blood DNA for MTHFR C677T polymorphisms. The statistical significance was estimated by logistic regression analysis. Results The MTHFR C677T frequencies of CC, CT, and TT genotypes were 35.2%, 47.5%, and 17.3% among stomach cancer, 34%, 50.5%, and 15.5% in colorectal cancer, and 31.8%, 50.7%, and 17.5% in the controls, respectively. The MTHFR 677TT genotype showed a weak opposite association with colorectal cancer compared to the homozygous CC genotype [adjusted age and sex odds ratio (OR) = 0.792, 95% confidence interval (CI) = 0.638-0.984, P = 0.035]. Subjects with the MTHFR 677CT showed a significantly reduced risk of gastric cancer compared whose with the 677CC genotype (age- and sex-adjusted OR = 0.810; 95% CI = 0.696-0.942, P = 0.006). We also observed no significant interactions between the MTHFR C677T polymorphism and smoking or drinking in the risk of gastric and colorectal cancer. Conclusions The T allele was found to provide a weak protective association with gastric cancer and colorectal cancer. PMID:20504332

Genetic polymorphism of MTHFR C677T and premature coronary artery disease susceptibility: A meta-analysis.

PubMed

Hou, Xiaowen; Chen, Xin; Shi, Jingpu

2015-07-01

The association between 5, 10-methylenetetrahydrofolate reductase (MTHFR) C677T gene polymorphism and premature coronary artery disease (PCAD) is controversial. To explore a more precise estimation of the association, a meta-analysis was conducted in the present study. The relevant studies were identified by searching PubMed, EMBASE, the Web of Science, Cochrane Collaboration Database, Chinese National Knowledge Infrastructure, Wanfang Database and China Biological Medicine up to November, 2014. The meta-analysis was performed by STATA 11. 21 studies with a total of 6912 subjects, including 2972 PCAD patients and 3940 controls. The pooled analysis showed that MTHFR C677T gene polymorphism was probably associated with PCAD (CT vs. CC: OR=1.13, 95% CI=1.01-1.27; dominant model: OR=1.16, 95% CI=1.04-1.29; recessive model: OR=1.19, 95% CI=1.00-1.40; allele analysis: OR=1.17, 95% CI=1.01-1.34). Subgroup analysis by plasma homocysteine concentration showed a significant association in the homocysteine >15μmol/L subgroup (CT vs. CC: OR=1.44, 95% CI=1.10-1.88; TT vs. CC: OR=2.51, 95% CI=1.12-5.63; dominant model: OR=1.51, 95% CI=1.16-1.96; recessive model: OR=2.33, 95% CI=1.05-5.20; allele analysis: OR=1.48, 95% CI=1.18-1.87). Subgroup analysis by continent displayed a significant association among the Asian population (CT vs. CC: OR=1.51, 95% CI=1.23-1.86; TT vs. CC: OR=2.81, 95% CI=1.87-4.23; dominant model: OR=1.65, 95% CI=1.35-2.01; recessive model: OR=2.22, 95% CI=1.53-3.21; allele analysis: OR=1.61, 95% CI=1.37-1.89). The statistical stability and reliability was demonstrated by sensitivity analysis and publication bias outcomes. In conclusion, the meta-analysis suggests that MTHFR C677T gene polymorphism may be associated with PCAD. Copyright © 2015 Elsevier B.V. All rights reserved.

Normal Weight Obese syndrome: role of single nucleotide polymorphism of IL-1 5Ralpha and MTHFR 677C-->T genes in the relationship between body composition and resting metabolic rate.

PubMed

Di Renzo, L; Bigioni, M; Bottini, F G; Del Gobbo, V; Premrov, M G; Cianci, R; De Lorenzo, A

2006-01-01

We have identified a subset of metabolically obese, but normal weight individuals, with potentially increased risks of developing the metabolic syndrome, despite their normal body mass index. We determined the relationship among body fat distribution, resting metabolic rate (RMR), total body water amount (%TBW), selected gene polymorphism on interleukin-15 receptor-alpha (IL-15Ralpha) and methylenetetrahydrofolate reductase 677C-->T (MTHFR 677C-->T), to distinguish normal weight obese (NWO) from nonobese with a normal metabolic profile and obese individuals. We analysed anthropometric variables, body composition by Dual energy X-ray Absorptiometry (DXA), RMR by indirect calorimetry, %TBW by bioimpedence analysis (BIA), MTHFR 677C-->T and IL-15Ralpha genotypes of 128 clinically healthy Caucasian individuals. We compared a group of female, defined as NWO and characterised by a BMI < or = 25 kg/m(2) and FM > or = 30% with groups of others female, and males, represented by nonobese with a BMI < or = 25 kg/m(2) and FM < or = 30%, and preobese-obese individuals with BMI > or = 25 kg/m(2) and %FM > or = 30%; none of the males was classified as NWO. Significant correlations were found among body fat mass distribution, metabolic variables, percentage of total body water distribution and selected genetic variations. The variables that contributed significantly to the separation of classes were body tissue (Tissue), %TBW, RMR, the volumes of both oxygen (VO2) and carbon dioxide (VCO2). The distribution of MTHFR 677C-->T and IL-15 genotypes was significantly different between classes. Our data highlight that NWO individuals showed a significant relationship between the decrease in the basal metabolism (RMR), body fat mass increasing and total water amount. Possession of wild type homozygotes genotypes regarding IL-15Ralpha cytokine and 677C-->T MTHFR enzyme characterised NWO individuals.

Response of serum and red blood cell folate concentrations to folic acid supplementation depends on methylenetetrahydrofolate reductase C677T genotype: Results from a crossover trial

PubMed Central

Anderson, Cheryl A.M.; Beresford, Shirley A. A.; McLerran, Dale; Lampe, Johanna W.; Deeb, Samir; Feng, Ziding; Motulsky, Arno G.

2013-01-01

Scope By increasing blood folate concentrations, folic acid supplementation reduces risk for neural tube defect-affected pregnancies, and lowers homocysteine concentrations. We assessed response of red blood cell (RBC) and serum folate to folic acid supplementation, and examined association of response with the genetic polymorphism C677T of the methylenetetrahydrofolate NAD(P)H (MTHFR) gene. Methods and Results Randomized, controlled, crossover trial with two folic acid supplement treatment periods and a 30-week washout period. The primary outcome is blood folate (serum and RBC) concentrations. Volunteers (n=142) aged 18-69 were randomized to two of three doses (0, 200, and 400 μg) of folic acid for twelve weeks. Serum folate response depended on treatment period with significant responses to 200 μg seen only in the second treatment periods (4.4 ng/mL or 3.4 ng/mL). Additionally, serum folate increased as folic acid dose increased to 400 μg (p< 0.01) and response was greater after the washout period (8.7 ng/mL), than after a 6-week run-in (2.3 ng/mL). The differential change attributable to a daily supplement of 400 μg compared to 200 μg was 96.8 ng/mL; while the change attributable to 400 μg compared to 0 μg was 121.4. Increases in RBC folate concentrations with 400 μg occurred within MTHFR gene mutation (C677T); and in the African American group. Conclusions Serum folate concentration is responsive to modest increases in folic acid intake. Red blood cell folate increases only with higher additional doses of folic acid supplementation, and this is true for each MTHFR C677T genotype. PMID:23456769

Methylenetetrahydrofolate reductase polymorphism C677T is a protective factor for pediatric acute lymphoblastic leukemia in the Chinese population: a meta-analysis.

PubMed

Wang, Haigang; Meng, Lujing; Zhao, Lixia; Wang, Jiali; Liu, Xinchun; Mi, Wenjie

2012-12-01

Two polymorphisms in the methylenetetrahydrofolate reductase (MTHFR) gene, C677T and A1298C, were hypothesized to decrease the risk of acute lymphoblastic leukemia (ALL). Studies examining the associations between these two polymorphisms and ALL susceptibility drew inconsistent results. To obtain a reliable conclusion in a Chinese population, we carried out a meta-analysis. In total, 11 studies on C677T polymorphism (1597 cases and 2295 controls) and 10 studies on A1298C polymorphism (1553 cases and 2224 controls) were included in the meta-analysis. We found a significant association between the 677T variant and reduced ALL risk in Chinese children (Dominant model: odds ratio [OR(FE)]=0.73, 95% confidence interval [CI]: 0.63-0.86, p<0.01). Heterogeneity between the studies in the children subgroup was weak and vanished after excluding one study deviating from HWE in the control group (p>0.1). In the adult subgroup, there was no significant association between the C677T variant and ALL risk (Dominant model: OR(RE)=0.88, 95% CI: 0.45-1.72, p=0.72). Significant heterogeneity was found in the adult subgroup in all the genetic model tests (p<0.1). The A1298C polymorphism had an effect on ALL risk neither in adults (Dominant model: OR(FE)=0.95, 95% CI: 0.71-1.27, p=0.72) nor in children (Dominant model: OR(FE)=1.02, 95% CI: 0.87-1.21, p=0.77). No significant heterogeneity between studies on A1298C polymorphism was found in the meta-analysis (p>0.1). The results showed that there was a protective effect of the MTHFR C677T variant on ALL risk in Chinese children.

A somatic T15091C mutation in the Cytb gene of mouse mitochondrial DNA dominantly induces respiration defects.

PubMed

Hayashi, Chisato; Takibuchi, Gaku; Shimizu, Akinori; Mito, Takayuki; Ishikawa, Kaori; Nakada, Kazuto; Hayashi, Jun-Ichi

2015-08-07

Our previous studies provided evidence that mammalian mitochondrial DNA (mtDNA) mutations that cause mitochondrial respiration defects behave in a recessive manner, because the induction of respiration defects could be prevented with the help of a small proportion (10%-20%) of mtDNA without the mutations. However, subsequent studies found the induction of respiration defects by the accelerated accumulation of a small proportion of mtDNA with various somatic mutations, indicating the presence of mtDNA mutations that behave in a dominant manner. Here, to provide the evidence for the presence of dominant mutations in mtDNA, we used mouse lung carcinoma P29 cells and examined whether some mtDNA molecules possess somatic mutations that dominantly induce respiration defects. Cloning and sequence analysis of 40-48 mtDNA molecules from P29 cells was carried out to screen for somatic mutations in protein-coding genes, because mutations in these genes could dominantly regulate respiration defects by formation of abnormal polypeptides. We found 108 missense mutations existing in one or more of 40-48 mtDNA molecules. Of these missense mutations, a T15091C mutation in the Cytb gene was expected to be pathogenic due to the presence of its orthologous mutation in mtDNA from a patient with cardiomyopathy. After isolation of many subclones from parental P29 cells, we obtained subclones with various proportions of T15091C mtDNA, and showed that the respiration defects were induced in a subclone with only 49% T15091C mtDNA. Because the induction of respiration defects could not be prevented with the help of the remaining 51% mtDNA without the T15091C mutation, the results indicate that the T15091C mutation in mtDNA dominantly induced the respiration defects. Copyright © 2015 Elsevier Inc. All rights reserved.

Methylenetetrahydrofolate reductase C677T and overall survival in pediatric acute lymphoblastic leukemia: a systematic review.

PubMed

Ojha, Rohit P; Gurney, James G

2014-01-01

A summary of the evidence pertaining to the association between methylenetetrahydrofolate reductase (MTHFR) C677T and overall survival in pediatric acute lymphoblastic leukemia (ALL) is not currently available. We thus reviewed the literature on the association between MTFHR C677T and overall survival in pediatric ALL. We searched PubMed/MEDLINE, Scopus and ISI Web of Knowledge literature databases without language restrictions to identify observational studies among children diagnosed between ages 0 and 19 years that assessed MTHFR 677 polymorphisms in relation to ALL survival. We identified six studies comprising 909 pediatric patients with ALL. The magnitude of relative risk (RR) for pediatric ALL mortality varied by genotype comparison and study population, ranging from RR = 0.84 (95% confidence limits [CL]: 0.24, 3.0) for a TT vs. CT/CC comparison to RR = 7.0 (95% CL: 0.98, 49) for a TT vs. CC comparison. The current evidence suggests that individuals with MTHFR 677 variants (i.e. at least one T allele) may have a higher relative risk of pediatric ALL mortality, with greater statistical support for MTHFR 677TT. With more detailed supporting evidence, MTHFR 677 genotyping at diagnosis could provide an option for individualizing therapy and further reducing pediatric ALL mortality in certain populations.

The mutY gene: a mutator locus in Escherichia coli that generates G.C----T.A transversions.

PubMed Central

Nghiem, Y; Cabrera, M; Cupples, C G; Miller, J H

1988-01-01

We have used a strain with an altered lacZ gene, which reverts to wild type via only certain transversions, to detect transversion-specific mutators in Escherichia coli. Detection relied on a papillation technique that uses a combination of beta-galactosides to reveal blue Lac+ papillae. One class of mutators is specific for the G.C----T.A transversion as determined by the reversion pattern of a set of lacZ mutations and by the distribution of forward nonsense mutations in the lacI gene. The locus responsible for the mutator phenotype is designated mutY and maps near 64 min on the genetic map of E. coli. The mutY locus may act in a similar but reciprocal fashion to the previously characterized mutT locus, which results in A.T----C.G transversions. Images PMID:3128795

High prevalence of three prothrombotic polymorphisms among Palestinians: factor V G1691A, factor II G20210A and methylenetetrahydrofolate reductase C677T.

PubMed

Hussein, Ayman S

2012-10-01

Factor V leiden G1691A/R506Q (FVL), prothrombin G20210A (FII) and methylenetetrahydrofolate reductase (MTHFR) C677T are related genetic risk factors for venous thromboembolism. Analysis for those mutations is increasingly being performed on patients exhibiting hypercoagulability. The objective of this study was to determine the prevalence of FVL, FII-G20210A and MTHFR-C677T polymorphisms and their coexistence among apparently healthy Palestinians. After institutional approval, 303 apparently healthy students from An-Najah University representative to North and South regions of West Bank with no previous history of cardiovascular diseases participated in this study. A uniform questionnaire was used to collect relevant information through personal interview with the subjects. The collected information included gender, age, smoking habits, weight and height, diseases such as diabetes, cardiovascular and family history of CVD. The frequencies of allelic distribution of the three prothrombotic polymorphisms factor V G1691A/R506Q), prothrombin G2010A, and MTHFR-C677T were 0.114, 0.050 and 0.071, respectively. The prevalence of the three thrombotic polymorphisms (FVL, FII G20210A and MTHFR-C677T) were 20.1, 9.1 and 13.8 %, respectively. Statistical analysis for factor V leiden showed no significant association between place of residence (P value = 0.953) and gender (P value >0.082). The data presented in this study showed the highest prevalence of FVL among healthy Palestinians compared to other populations and this important finding should be followed in terms of clinical significance.

Association of methylenetetrahytrofolate reductase (MTHFR) C677T and A1298C polymorphisms with the susceptibility of childhood acute lymphoblastic leukaemia (ALL) in Chinese population

PubMed Central

2014-01-01

Background The aim of this study was to investigate the relationship between the polymorphisms of the methylenetetrahytrofolate reductase (MTHFR) gene and susceptibility to childhood acute lymphoblastic leukemia (ALL). Methods A case–control study was conducted among 98 children with ALL and 93 age- and sex- matched non-ALL controls. Genotyping of MTHFR C677T and A1298C polymorphisms was performed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). The odds ratios (ORs) of MTHFR genotypes were used to assess the associations of these polymorphisms with childhood ALL susceptibility. Results No significant differences were observed for frequencies of the 677CC, 677CT and 677TT genotypes between patients and controls. Frequencies of the 1298AA, 1298 AC and 1298CC genotypes between the two groups were significantly different. The risk of ALL with the 1298C allele carriers (AC + CC) was elevated by 1.1 times compared with the AA genotype [OR = 2.100; 95% CI (1.149; 3.837); P = 0.015]. Conclusions The MTHFR A1298C polymorphism is associated with susceptibility to childhood ALL in the Chinese population. PMID:24476575

Association of methylenetetrahytrofolate reductase (MTHFR) C677T and A1298C polymorphisms with the susceptibility of childhood acute lymphoblastic leukaemia (ALL) in Chinese population.

PubMed

Li, Xiaolei; Liao, Qingchuan; Zhang, Shunguo; Chen, Minling

2014-01-29

The aim of this study was to investigate the relationship between the polymorphisms of the methylenetetrahytrofolate reductase (MTHFR) gene and susceptibility to childhood acute lymphoblastic leukemia (ALL). A case-control study was conducted among 98 children with ALL and 93 age- and sex- matched non-ALL controls. Genotyping of MTHFR C677T and A1298C polymorphisms was performed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). The odds ratios (ORs) of MTHFR genotypes were used to assess the associations of these polymorphisms with childhood ALL susceptibility. No significant differences were observed for frequencies of the 677CC, 677CT and 677TT genotypes between patients and controls. Frequencies of the 1298AA, 1298 AC and 1298CC genotypes between the two groups were significantly different. The risk of ALL with the 1298C allele carriers (AC + CC) was elevated by 1.1 times compared with the AA genotype [OR = 2.100; 95% CI (1.149; 3.837); P = 0.015]. The MTHFR A1298C polymorphism is associated with susceptibility to childhood ALL in the Chinese population.

Effects of Maternal 5,10-Methylenetetrahydrofolate Reductase C677T and A1298C Polymorphisms and Tobacco Smoking on Infant Birth Weight in a Japanese Population

PubMed Central

Yila, Thamar Ayo; Sasaki, Seiko; Miyashita, Chihiro; Braimoh, Titilola Serifat; Kashino, Ikuko; Kobayashi, Sumitaka; Okada, Emiko; Baba, Toshiaki; Yoshioka, Eiji; Minakami, Hisanori; Endo, Toshiaki; Sengoku, Kazuo; Kishi, Reiko

2012-01-01

Background Intracellular folate hemostasis depends on the 5,10-methylenetetrahydrofolate reductase (MTHFR) gene. Because 5,10-MTHFR 677TT homozygosity and tobacco smoking are associated with low folate status, we tested the hypothesis that smoking in mothers with 5,10-MTHFR C677T or A1298C polymorphisms would be independently associated with lower birth weight among their offspring. Methods We assessed 1784 native Japanese mother-child pairs drawn from the ongoing birth cohort of The Hokkaido Study on Environment and Children’s Health. Data (demographic information, hospital birth records, and biological specimens) were extracted from recruitments that took place during the period from February 2003 to March 2006. Maternal serum folate were assayed by chemiluminescent immunoassay, and genotyping of 5,10-MTHFR C677T/A1298C polymorphisms was done using a TaqMan allelic discrimination assay. Results The prevalence of folate deficiency (<6.8 nmol/L) was 0.3%. The 5,10-MTHFR 677CT genotype was independently associated with an increase of 36.40 g (95% CI: 2.60 to 70.30, P = 0.035) in mean infant birth weight and an increase of 90.70 g (95% CI: 6.00 to 175.50, P = 0.036) among male infants of nonsmokers. Female infants of 677TT homozygous passive smokers were 99.00 g (95% CI: −190.26 to −7.56, P = 0.034) lighter. The birth weight of the offspring of smokers with 5,10-MTHFR 1298AA homozygosity was lower by 107.00 g (95% CI: −180.00 to −33.90, P = 0.004). Conclusions The results suggest that, in this population, maternal 5,10-MTHFR C677T polymorphism, but not the 5,10-MTHFR A1298C variant, is independently associated with improvement in infant birth weight, especially among nonsmokers. However, 5,10-MTHFR 1298AA might be associated with folate impairment and could interact with tobacco smoke to further decrease birth weight. PMID:22277790

[C677T-SNP of methylenetetrahydrofolate reductase gene and breast cancer in Mexican women].

PubMed

Calderón-Garcidueñas, Ana Laura; Cerda-Flores, Ricardo Martín; Castruita-Ávila, Ana Lilia; González-Guerrero, Juan Francisco; Barrera-Saldaña, Hugo Alberto

2017-01-01

Low-penetrance susceptibility genes such as 5,10-methylenetetrahydrofolate reductase gene (MTHFR) have been considered in the progression of breast cancer (BC). Cancer is a result of genetic, environmental and epigenetic interactions; therefore, these genes should be studied in environmental context, because the results can vary between populations and even within the same country. The objective was to analyze the allelic and genotypic frequencies of the MTHFR C667T SNP in Mexican Mestizo patients with BC and controls from Northeastern Mexico. 243 patients and 118 healthy women were studied. The analysis of the polymorphism was performed with a DNA microarray. Once the frequency of the polymorphism was obtained, Hardy-Weinberg equilibrium test was carried out for the genotypes. Chi square test was used to compare the distribution of frequencies. The allele frequency in patients was: C = 0.5406; T = 0.4594 and in controls C = 0.5678, T = 0.4322. Genotype in BC patients was: C / C = 29.9%, C / T = 48.3% and T / T = 21.8. The distribution in controls was: C / C = 31.4%, C / T = 50.8%, T / T = 17.8% (chi squared 0.77, p = 0.6801). Northeastern Mexican women in this study showed no association between MTFHR C667T SNP and the risk of BC. It seems that the contribution of this polymorphism to BC in Mexico varies depending on various factors, both genetic and environmental.

The methylenetetrahydrofolate reductase c.c.677 C>T and c.c.1298 A>C polymorphisms in reproductive failures: Experience from an RSA and RIF study on a Polish population.

PubMed

Nowak, Izabela; Bylińska, Aleksandra; Wilczyńska, Karolina; Wiśniewski, Andrzej; Malinowski, Andrzej; Wilczyński, Jacek R; Radwan, Paweł; Radwan, Michał; Barcz, Ewa; Płoski, Rafał; Motak-Pochrzęst, Hanna; Banasik, Małgorzata; Sobczyński, Maciej; Kuśnierczyk, Piotr

2017-01-01

Almost 1600 individuals from the Polish population were recruited to this study. Among them 319 were fertile couples, 289 were recurrent spontaneous abortion (RSA) couples, and 131 were in the group of recurrent implantation failure (RIF) following in vitro fertilization. The aim of this study was to evaluate the MTHFR c.c.677 C>T and c.c.1298 A>C polymorphisms' association with RSA and RIF. We used PCR-RFLP with HinfI (677 C>T) and MboII (1298 A>C) digestion. We observed a protective effect of the female AC genotype (OR = 0.64, p = 0.01) and the C allele (AC+CC genotypes; OR = 0.65, p = 0.009) against RSA. Moreover, 1298 AA/677 CT women were more frequent in RSA (31.14%) and RIF (25.20%) groups in comparison to fertile women (22.88%), although this difference was significant only in the case of RSA (p = 0.022, OR = 1.52). Male combined genotype analysis revealed no association with reproductive failure of their partners. Nevertheless, the female/male combination AA/AC of the 1298 polymorphism was more frequent in RSA couples (p = 0.049, OR = 1.49). However, the significant results became insignificant after Bonferroni correction. In addition, analysis of haplotypes showed significantly higher frequency of the C/C haplotype (1298 C/677 C) in the female control group than in the female RSA group (p = 0.03, OR = 0.77). Moreover, the association between elevated homocysteine (Hcy) level in plasma of RSA and RIF women and MTHFR polymorphisms was investigated but did not reveal significant differences. In conclusion, for clinical practice, it is better to check the homocysteine level in plasma and, if the Hcy level is increased, to recommend patients to take folic acid supplements rather than undergo screening of MTHFR for 1298 A>C and 677 C>T polymorphisms.

The methylenetetrahydrofolate reductase c.c.677 C>T and c.c.1298 A>C polymorphisms in reproductive failures: Experience from an RSA and RIF study on a Polish population

PubMed Central

Bylińska, Aleksandra; Wilczyńska, Karolina; Wiśniewski, Andrzej; Malinowski, Andrzej; Wilczyński, Jacek R.; Radwan, Paweł; Radwan, Michał; Barcz, Ewa; Płoski, Rafał; Motak-Pochrzęst, Hanna; Banasik, Małgorzata; Sobczyński, Maciej; Kuśnierczyk, Piotr

2017-01-01

Almost 1600 individuals from the Polish population were recruited to this study. Among them 319 were fertile couples, 289 were recurrent spontaneous abortion (RSA) couples, and 131 were in the group of recurrent implantation failure (RIF) following in vitro fertilization. The aim of this study was to evaluate the MTHFR c.c.677 C>T and c.c.1298 A>C polymorphisms’ association with RSA and RIF. We used PCR-RFLP with HinfI (677 C>T) and MboII (1298 A>C) digestion. We observed a protective effect of the female AC genotype (OR = 0.64, p = 0.01) and the C allele (AC+CC genotypes; OR = 0.65, p = 0.009) against RSA. Moreover, 1298 AA/677 CT women were more frequent in RSA (31.14%) and RIF (25.20%) groups in comparison to fertile women (22.88%), although this difference was significant only in the case of RSA (p = 0.022, OR = 1.52). Male combined genotype analysis revealed no association with reproductive failure of their partners. Nevertheless, the female/male combination AA/AC of the 1298 polymorphism was more frequent in RSA couples (p = 0.049, OR = 1.49). However, the significant results became insignificant after Bonferroni correction. In addition, analysis of haplotypes showed significantly higher frequency of the C/C haplotype (1298 C/677 C) in the female control group than in the female RSA group (p = 0.03, OR = 0.77). Moreover, the association between elevated homocysteine (Hcy) level in plasma of RSA and RIF women and MTHFR polymorphisms was investigated but did not reveal significant differences. In conclusion, for clinical practice, it is better to check the homocysteine level in plasma and, if the Hcy level is increased, to recommend patients to take folic acid supplements rather than undergo screening of MTHFR for 1298 A>C and 677 C>T polymorphisms. PMID:29073227

Complex I deficiency related to T10158C mutation ND3 gene: A further definition of the clinical spectrum.

PubMed

Grosso, Salvatore; Carluccio, Maria Alessandra; Cardaioli, Elena; Cerase, Alfonso; Malandrini, Alessandro; Romano, Chiara; Federico, Antonio; Dotti, Maria Teresa

2017-03-01

Complex I deficiency is the most common energy generation disorder which may clinically present at any age with a wide spectrum of symptoms and signs. The T10158C mutation ND3 gene is rare and occurs in patients showing an early rapid neurological deterioration invariably leading to death after a few months. We report a 9year-old boy with a mtDNA T10158C mutation showing a mild MELAS-like phenotype and brain MRI features congruent with both MELAS and Leigh syndrome. Epilepsia partialis continua also occurred in the clinical course and related to a mild cortical atrophy of the left perisylvian area. The present case confirms that the clinical spectrum of Complex I deficiency related to T10158C mutation ND3 gene is wider than previously described. Our observation further suggests that testing mutation in the MT-ND3 gene should be included in the diagnostic work-up of patients presenting with epilepsia partialis continua accompanied by suspicion of mitochondrial disorder. Copyright © 2016 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

Association of methylenetetrahydrofolate reductase C677T polymorphism and serum lipid levels in the Guangxi Bai Ku Yao and Han populations

PubMed Central

2010-01-01

Background The association of methylenetetrahydrofolate reductase (MTHFR) gene polymorphism and serum lipid profiles is still controversial in diverse ethnics. Bai Ku Yao is an isolated subgroup of the Yao minority in China. The aim of the present study was to eveluate the association of MTHFR C677T polymorphism and several environmental factors with serum lipid levels in the Guangxi Bai Ku Yao and Han populations. Methods A total of 780 subjects of Bai Ku Yao and 686 participants of Han Chinese were randomly selected from our previous stratified randomized cluster samples. Genotyping of the MTHFR C677T was performed by polymerase chain reaction and restriction fragment length polymorphism combined with gel electrophoresis, and then confirmed by direct sequencing. Results The levels of serum total cholesterol (TC), high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), apolipoprotein (Apo) AI and ApoB were lower in Bai Ku Yao than in Han (P < 0.05-0.001). The frequency of C and T alleles was 77.4% and 22.6% in Bai Ku Yao, and 60.9% and 39.1% in Han (P < 0.001); respectively. The frequency of CC, CT and TT genotypes was 58.7%, 37.3% and 4.0% in Bai Ku Yao, and 32.6%, 56.4% and 11.0% in Han (P < 0.001); respectively. The levels of TC and LDL-C in both ethnic groups were significant differences among the three genotypes (P < 0.05-0.01). The T allele carriers had higher serum TC and LDL-C levels than the T allele noncarriers. The levels of ApoB in Han were significant differences among the three genotypes (P < 0.05). The T allele carriers had higher serum ApoB levels as compared with the T allele noncarriers. The levels of TC, TG and LDL-C in Bai Ku Yao were correlated with genotypes (P < 0.05-0.001), whereas the levels of LDL-C in Han were associated with genotypes (P < 0.001). Serum lipid parameters were also correlated with sex, age, body mass index, alcohol consumption, cigarette smoking, and blood pressure in the both ethnic

MTHFR C677T genotype influences the isotopic enrichment of one-carbon metabolites in folate-compromised men consuming d9-choline.

PubMed

Yan, Jian; Wang, Wei; Gregory, Jesse F; Malysheva, Olga; Brenna, J Thomas; Stabler, Sally P; Allen, Robert H; Caudill, Marie A

2011-02-01

Homozygosity for the variant 677T allele in the methylenetetrahydrofolate reductase (MTHFR) gene increases the requirement for folate and may alter the metabolic use of choline. The choline adequate intake is 550 mg/d for men, although the metabolic consequences of consuming extra choline are unclear. Deuterium-labeled choline (d9-choline) as tracer was used to determine the differential effects of the MTHFR C677T genotype and the effect of various choline intakes on the isotopic enrichment of choline derivatives in folate-compromised men. Mexican American men with the MTHFR 677CC or 677TT genotype consumed a diet providing 300 mg choline/d plus supplemental choline chloride for total choline intakes of 550 (n = 11; 4 with 677CC and 7 with 677TT) or 1100 (n = 12; 4 with 677CC and 8 with 677TT) mg/d for 12 wk. During the last 3 wk, 15% of the total choline intake was provided as d9-choline. Low but measurable enrichments of the choline metabolites were achieved, including that of d3-phosphatidylcholine (d3-PtdCho)--a metabolite produced in the de novo pathway via choline-derived methyl groups. Men with the MTHFR 677TT genotype had a higher urinary enrichment ratio of betaine to choline (P = 0.041), a higher urinary enrichment of sarcosine (P = 0.041), and a greater plasma enrichment ratio of d9-betaine to d9-PtdCho with the 1100 mg choline/d intake (P = 0.033). These data show for the first time in humans that choline itself is a source of methyl groups for de novo PtdCho biosynthesis and indicate that the MTHFR 677TT genotype favors the use of choline as a methyl donor.

Methotrexate elimination and toxicity: MTHFR 677C>T polymorphism in patients with primary CNS lymphoma treated with high-dose methotrexate.

PubMed

Choi, Yun Jung; Park, Hyangmin; Lee, Ji Sung; Lee, Ju-Yeon; Kim, Shin; Kim, Tae Won; Park, Jung Sun; Kim, Jeong Eun; Yoon, Dok Hyun; Suh, Cheolwon

2017-12-01

The genetic association of the methylenetetrahydrofolate reductase gene (MTHFR) 677C>T polymorphism with methotrexate (MTX)-associated toxicity has been evaluated and conflicting results have been reported. The substantial heterogeneity of the studied population was suggested to be a possible explanation because ethnicity, MTX dose, coadministered chemotherapeutic agents, and folinate rescue dosage regimen could alter the MTX toxicity profile. The patient population was homogenized by limiting the cancer type to primary central nervous system lymphoma and chemotherapy protocol to a high-dose MTX monotherapy regimen. A total of 111 patients with 402 chemotherapy courses were analyzed. MTHFR 677C>T polymorphism was identified as an independent predictive marker for MTX-associated hematologic toxicity (odds ratio, 2.60; 95% confidence interval, 1.32-5.09; P = .0055). Clinically significant nephrotoxicity occurred in patients without delayed elimination, suggesting roles for factors other than serum MTX levels. MTX-induced hepatotoxicity and oral mucositis occurred independently of plasma MTX levels. Copyright © 2016 John Wiley & Sons, Ltd.

MTHFR c.677C>T is a risk factor for non-syndromic cleft lip with or without cleft palate in Chile.

PubMed

Ramírez-Chau, C; Blanco, R; Colombo, A; Pardo, R; Suazo, J

2016-10-01

The functional variant within the 5,10-methylenetetrahydrofolate reductase (MTHFR) gene c.677C>T, producing alterations in folate metabolism, has been associated with the risk of non-syndromic cleft lip with or without cleft palate (NSCL/P). We assessed this association in a Chilean population using a combined analysis of case-control and case-parent trio samples. Samples of 165 cases and 291 controls and 121 case-parent trios (sharing the cases) were genotyped. Odds ratio (OR) was estimated for case-control (allele and genotype frequency differences), and this result was confirmed by allele transmission distortion in trios. Due to that these samples are not independent, a combined OR was also computed. Maternal genotype effect was additionally evaluated based on a log-linear method. Borderline but not significant OR (1.28; CI 0.97-1.69) was observed for risk allele (T) in the case-control sample. However, triad sample showed a significant association (OR 1.56: CI 1.09-2.25) which was confirmed by the combined OR (1.37; CI 1.11-1.71). Maternal genotype has been also associated with the phenotype (P = 0.002). In contrast to previous reports considering Chilean subjects, our results demonstrated that the offspring and maternal genotypes for MTHFR c.677C>T variant are strongly associated with NSCL/P in this Chilean population. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

A literature review of MTHFR (C677T and A1298C polymorphisms) and cancer risk.

PubMed

Izmirli, Muzeyyen

2013-01-01

5,10-Methlenetetrahydrofolate reductase (MTHFR) is one of the most important enzymes for folate metabolism. This enzyme is mapped on chromosome 1, which is located at the end of the short arm (1p36.3). The C677T and A1298C are MTHFR polymorphisms that decrease in vitro MTHFR enzyme activity. Folate metabolism plays a key role in cell metabolism. These reactions are associated with purine-pyrimidine synthesis: DNA, RNA, and protein methylation. Polymorphism is also a factor in biodiversity, and be affected by ethnic heritage and geographic locale. In the case of unknown outcomes, not only should all geographical regions be investigated to ascertain biodiversity, but all populations as well to fully understand the variations in the effect. PUBMED was searched from January 2006 to December 2011 to develop an investigatory pursuit strategy. MTHFR, cancer, C677T, A1298C, and polymorphisms were key words used to focus the search. The literature review included all published relevant cancer types and MTHFR polymorphisms for that 5 years period. All selected polymorphisms data for cancer types was listed in tables for easy access and retrieval.

Correlations of MTHFR 677C>T Polymorphism with Cardiovascular Disease in Patients with End-Stage Renal Disease: A Meta-Analysis

PubMed Central

Gao, Xian-Hui; Zhang, Guo-Yi; Wang, Ying; Zhang, Hui-Ying

2014-01-01

Objective This meta-analysis was conducted to evaluate the correlations of a common polymorphism (677C>T) in the methylenetetrahydrofolate reductase (MTHFR) gene with risk of cardiovascular disease (CVD) in patients with end-stage renal disease (ESRD). Method The following electronic databases were searched without language restrictions: Web of Science (1945∼2013), the Cochrane Library Database (Issue 12, 2013), MEDLINE (1966∼2013), EMBASE (1980∼2013), CINAHL (1982∼2013) and the Chinese Biomedical Database (CBM) (1982∼2013). Meta-analysis was performed using STATA statistical software. Odds ratios (ORs) with their 95% confidence intervals (95%CIs) were calculated. Results Eight cohort studies met all inclusion criteria and were included in this meta-analysis. A total of 2,292 ESRD patients with CVD were involved in this meta-analysis. Our meta-analysis results revealed that the MTHFR 677C>T polymorphism might increase the risk of CVD in ESRD patients (TT vs. CC: OR = 2.75, 95%CI = 1.35∼5.59, P = 0.005; CT+TT vs. CC: OR = 1.39, 95%CI = 1.09∼1.78, P = 0.008; TT vs. CC+CT: OR = 2.52, 95%CI = 1.25∼5.09, P = 0.010; respectively). Further subgroup analysis by ethnicity suggested that the MTHFR 677C>T polymorphism was associated with an elevated risk for CVD in ESRD patients among Asians (TT vs. CC: OR = 3.38, 95%CI = 1.11∼10.28, P = 0.032; CT+TT vs. CC: OR = 1.44, 95%CI = 1.05∼1.97, P = 0.022; TT vs. CC+CT: OR = 3.15, 95%CI = 1.02∼9.72, P = 0.046; respectively), but not among Africans or Caucasians (all P>0.05). Conclusion Our findings indicate that the MTHFR 677C>T polymorphism may be associated with an elevated risk for CVD in ESRD patients, especially among Asians. PMID:25050994

A meta-analysis of MTHFR C677T and A1298C polymorphisms and risk of acute lymphoblastic leukemia in children.

PubMed

Yan, Jingrong; Yin, Ming; Dreyer, ZoAnn E; Scheurer, Michael E; Kamdar, Kala; Wei, Qingyi; Okcu, M Fatih

2012-04-01

Methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C polymorphisms have been implicated in childhood acute lymphoblastic leukemia (ALL) risk, but previously published studies were inconsistent and recent meta-analyses were not adequate. In a meta-analysis of 21 publications with 4,706 cases and 7,414 controls, we used more stringent inclusion method and summarized data on associations between MTHFR C677T and A1298C polymorphisms and childhood ALL risk. We found an overall association between 677T variant genotypes and reduced childhood ALL risk. Specifically, in the dominant genetic model, an association was found in a fixed-effect (TT + CT vs. CC: OR = 0.92; 95% CI = 0.85-0.99) but not random-effect model, whereas such an association was observed in both homozygote genetic model (TT vs. CC: OR = 0.80; 95% CI = 0.70-0.93 by fixed effects and OR = 0.78; 95% CI = 0.65-0.93 by random effects) and recessive genetic model (TT vs. CC + CT: OR = 0.83; 95% CI = 0.72-0.95 by fixed effects and OR = 0.84; 95% CI = 0.73-0.97 by random effects). These associations were also observed in subgroups by ethnicity: for Asians in all models except for the dominant genetic model by random effect and for Caucasians in all models except for the recessive genetic model. However, the A1298C polymorphism did not appear to have an effect on childhood ALL risk. These results suggest that the MTHFR C677T, but not A1298C, polymorphism is a potential biomarker for childhood ALL risk. Copyright © 2011 Wiley Periodicals, Inc.

Genetic effect of MTHFR C677T polymorphism on the structural covariance network and white-matter integrity in Alzheimer's disease.

PubMed

Chang, Yu-Tzu; Hsu, Shih-Wei; Tsai, Shih-Jen; Chang, Ya-Ting; Huang, Chi-Wei; Liu, Mu-En; Chen, Nai-Ching; Chang, Wen-Neng; Hsu, Jung-Lung; Lee, Chen-Chang; Chang, Chiung-Chih

2017-06-01

The 677 C to T transition in the MTHFR gene is a genetic determinant for hyperhomocysteinemia. We investigated whether this polymorphism modulates gray matter (GM) structural covariance networks independently of white-matter integrity in patients with Alzheimer's disease (AD). GM structural covariance networks were constructed by 3D T1-magnetic resonance imaging and seed-based analysis. The patients were divided into two genotype groups: C homozygotes (n = 73) and T carriers (n = 62). Using diffusion tensor imaging and white-matter parcellation, 11 fiber bundle integrities were compared between the two genotype groups. Cognitive test scores were the major outcome factors. The T carriers had higher homocysteine levels, lower posterior cingulate cortex GM volume, and more clusters in the dorsal medial lobe subsystem showing stronger covariance strength. Both posterior cingulate cortex seed and interconnected peak cluster volumes predicted cognitive test scores, especially in the T carriers. There were no between-group differences in fiber tract diffusion parameters. The MTHFR 677T polymorphism modulates posterior cingulate cortex-anchored structural covariance strength independently of white matter integrities. Hum Brain Mapp 38:3039-3051, 2017. © 2017 The Authors Human Brain Mapping Published Wiley by Periodicals, Inc. © 2017 The Authors Human Brain Mapping Published Wiley by Periodicals, Inc.

A mitochondrial tRNA(His) gene mutation causing pigmentary retinopathy and neurosensorial deafness.

PubMed

Crimi, M; Galbiati, S; Perini, M P; Bordoni, A; Malferrari, G; Sciacco, M; Biunno, I; Strazzer, S; Moggio, M; Bresolin, N; Comi, G P

2003-04-08

We have identified a heteroplasmic G to A mutation at position 12,183 of the mitochondrial transfer RNA Histidine (tRNA(His)) gene in three related patients. These phenotypes varied according to mutation heteroplasmy: one had severe pigmentary retinopathy, neurosensorial deafness, testicular dysfunction, muscle hypotrophy, and ataxia; the other two had only retinal and inner ear involvement. The mutation is in a highly conserved region of the T(psi)C stem of the tRNA(His) gene and may alter secondary structure formation. This is the first described pathogenic, maternally inherited mutation of the mitochondrial tRNA(His) gene.

Prevalence of MTHFR C677T and MS A2756G polymorphisms in major depressive disorder, and their impact on response to fluoxetine treatment

USDA-ARS?s Scientific Manuscript database

To examine the prevalence of the C677T polymorphism of the methylene tetrahydrofolate reductase (MTHFR) gene and the A2756G polymorphism of methionine synthase (MS), and their impact on antidepressant response. We screened 224 subjects (52% female, mean age 39 +/- 11 years) with SCID-diagnosed major...

Prevalence of metilentetrahidrofolate reductase C677T polymorphism, consumption of vitamins B6, B9, B12 and determination of lipidic hydroperoxides in obese and normal weight Mexican population.

PubMed

Hernández-Guerrero, César; Romo-Palafox, Inés; Díaz-Gutiérrez, Mary Carmen; Iturbe-García, Mariana; Texcahua-Salazar, Alejandra; Pérez-Lizaur, Ana Bertha

2013-11-01

Oxidative stress is a key factor in the development of the principal comorbidities of obesity. Methylenetetrahydrofolate reductase enzyme (MTHFR) participates in the metabolism of folate with the action of vitamins B6 and B12. The gene of MTHFR may present a single nucleotide polymorphism (SNP) at position 677 (C677T), which can promote homocysteinemia associated to the production of free radicals. To determine the frequency of SNP C677T of the MTHFR, evaluate the consumption of vitamins B6, B9, B12 and determine the concentration of plasma lipid hydroperoxides (LOOH) in obese and control groups. 128 Mexican mestizo according to their body mass index were classified as normal weight (Nw; n=75) and obesity (ObeI-III; n=53). Identification of SNP C677T of MTHFR was performed by PCR-RFLP technic. The consumption of vitamins B6, B9 and B12 was assessed by a validate survey. LOOH was determined as an indicator of peripheral oxidative stress. There was no statistical difference in the frequency of the C677T polymorphism between the TT homozygous genotype in Nw (0.19) and ObeI-III (0.25). The frequency of T allele in Nw was 0.45 and 0.51 in ObI-III group. There were no statistical differences in the consumption of vitamins B6, B9 and B12 between Nw and ObI-III groups. The LOOH showed statistical difference (p < 0.05) between Nw and ObI–III group. Oxidative stress is present in all grades of obesity although there were no differences in the vitamin consumption and the SNP C677T between Nw and ObeI–III groups. Copyright AULA MEDICA EDICIONES 2013. Published by AULA MEDICA. All rights reserved.

MTHFR C677T polymorphism, homocysteine and B-vitamins status in a sample of Chinese and Malay subjects in Universiti Putra Malaysia.

PubMed

Choo, S C; Loh, S P; Khor, G L; Sabariah, M N; Rozita, R

2011-08-01

Methylenetetrahydrofolate reductase (MTHFR) C677T is involved in folate and homocysteine metabolism. Disruption in the activity of this enzyme will alter their levels in the body. This study assessed MTHFR C677T polymorphism and its relationship with serum homocysteine and B-vitamins levels in a sample of Chinese and Malays subjects in UPM, Serdang. One hundred subjects were randomly selected from among the university population. Folate, vitamin B12, B6, and homocysteine levels were determined using MBA, ECLIA, and HPLC, respectively. PCR coupled with HinfI digestion was used for detection of MTHFR C677T polymorphism. The frequency of T allele was higher in the Chinese subjects (0.40) compared to the Malay (0.14). Folate, vitamin B12 and B6 levels were highest in the wild genotype in both ethnic groups. Subjects with heterozygous and homozygous genotype showed the highest homocysteine levels. The serum folate and homocysteine were mainly affected by homozygous genotype. MTHFR C677T polymorphism plays an important role in influencing the folate and homocysteine metabolism.

Identification of XLRS1 gene mutation (608C > T) in a Portuguese family with juvenile retinoschisis.

PubMed

Teixeira, C; Rocha-Sousa, A; Trump, D; Brandão, E; Falcão-Reis, F

2005-01-01

To characterize electroretinogram (ERG) and molecular genetic findings in a family with XLRS1 mutation. The authors present two cases of a Portuguese family with juvenile retinoschisis with a mutation in exon 6. Two brothers and their parents, grandmother, and uncle underwent a full ophthalmic examination. The two brothers with ophthalmic disease were evaluated with color fundus photography, fluorescein angiography, optical coherence tomography (OCT), molecular genetic study (Group VI of Retinoschisis Consortium), pattern visual evoked potential (PVEP), and full field ERG. Both patients presented funduscopic manifestations of vitre o retinal degeneration. They presented peripheral schisis and retinal detachment. However, foveal schisis had never been observed at funduscopy. A negative ERG was recorded in both. Six months after that, the younger brother showed a typical foveal schisis at fundus examination. A retinoschisis gene (XLRS1) mutation with transition of cytosine by thymine at position 608 (608C > T) had been identified in both. Negative ERG is the most secure clinical marker to establish the diagnosis of juvenile retinoschisis. XLRS1 gene 608C > T mutation was described for the first time in a Portuguese family.

Association between MTHFR C677T polymorphism and risk of acute lymphoblastic leukemia: a meta-analysis based on 51 case-control studies.

PubMed

Li, Su-yi; Ye, Jie-yu; Liang, En-yu; Zhou, Li-xia; Yang, Mo

2015-03-12

Studies and systematic reviews have reached inconsistent conclusions on the role of 5, 10-methylenetetrahydrofolate reductase (MTHFR) polymorphism C677T in acute lymphoblastic leukemia (ALL) risk. The present meta-analysis comprising of 51 case-control studies, including 7892 cases and 14 280 controls was performed to reevaluate the association between MTHFR C677T polymorphism and ALL risk. Statistical differences were found in the dominant model (TT+CT vs. CC, odd ratio (OR)=0.89, 95% CI, 0.79-1.00, P=0.04) and the CT vs. CC (OR=0.89, 95% CI, 0.80-1.00, P=0.05), but not in the allele contrast model (T vs. C, OR=0.92, 95% CI, 0.84-1.01, P=0.08), additive model (TT vs. CC, OR=0.87, 95% CI, 0.73-1.05, P=0.15), or recessive model (TT vs. CT+CC, OR=0.94, 95% CI, 0.81-1.10, P=0.44) in overall populations. In the subgroup analyses stratified by age (children and adults) and ethnicity (Asian and Caucasian), no significant associations between MTHFR C677T polymorphism and ALL risk were observed. The current study found no sufficient evidence of a protective role of MTHFR C677T polymorphism in ALL susceptibility.

MTHFR 677C>T Polymorphism and the Risk of Breast Cancer: Evidence from an Original Study and Pooled Data for 28031 Cases and 31880 Controls

PubMed Central

Sekhar, Deepa; Francis, Amirtharaj; Gupta, Nishi; Konwar, Rituraj; Kumar, Sandeep; Kumar, Surender; Thangaraj, Kumarasamy; Rajender, Singh

2015-01-01

Background Methylenetetrahydrofolate reductase (MTHFR) acts at an important metabolic point in the regulation of cellular methylation reaction. It assists in the conversion of 5, 10-methylenetetrahydrofolate to 5-methyltetrahydrofolate. The latter aids in remethylation of homocysteine to de novo methionine that is required for DNA synthesis. The objective of this study was to examine the effect of MTHFR 677 C>T polymorphism on the risk of breast cancer in the Indian sub-continent. Methods and Results We genotyped 677 C>T locus in 1096 individuals that were classified into cases (N=588) and controls (N=508). Genotype data were analyzed using chi-square test. No significant difference was observed in the distribution of genotypes between cases and controls in north Indian (P = 0.932), south Indian (P = 0.865), and pooled data (P = 0.680). To develop a consensus regarding the impact of 677C>T polymorphism on breast cancer risk, we also conducted a meta-analysis on 28031 cases and 31880 controls that were pooled from sixty one studies. The overall summary estimate upon meta-analysis suggested no significant correlation between the 677C>T substitution and breast cancer in the dominant model (Fixed effect model: OR = 0.97, P=0.072, Random effects model: OR = 0.96, P = 0.084) or the recessive model (Fixed effect model: OR = 1.05, P = 0.089; Random effects model: OR= 1.08, P= 0.067). Conclusion 677 C>T substitution does not affect breast cancer risk in the Indo-European and Dravidian populations of India. Analysis on pooled data further ruled out association between the 677 C>T polymorphism and breast cancer. Therefore, 677 C>T substitution does not appear to influence the risk of breast cancer. PMID:25803740

MTHFR C677T Polymorphism is Associated with Tumor Response to Preoperative Chemoradiotherapy: A Result Based on Previous Reports.

PubMed

Zhao, Yue; Li, Xingde; Kong, Xiangjun

2015-10-12

Preoperative chemoradiotherapy (pRCT) followed by surgery has been widely practiced in locally advanced rectal cancer, esophageal cancer, gastric cancer and other cancers. However, the therapy also exerts some severe adverse effects and some of the patients show poor or no response. It is very important to develop biomarkers (e.g., gene polymorphisms) to identify patients who have a higher likelihood of responding to pRCT. Recently, a series of reports have investigated the association of the genetic polymorphisms in methylenetetrahydrofolate reductase (MTHFR) and epidermal growth factor receptor (EGFR) genes with the tumor response to pRCT; however, the results were inconsistent and inconclusive. A systematic review and meta-analysis was performed by searching relevant studies about the association of MTHFR and EGFR polymorphisms with the tumor regression grade (TRG) in response to pRCT in databases of PubMed, EMBAS, Web of science, Chinese National Knowledge Infrastructure, and Wanfang database up to March 30, 2015. The pooled odds ratios (ORs) with corresponding 95% confidence intervals (95% CIs) were calculated to assess the strength of the association under 5 genetic models. A total of 11 eligible articles were included in the present meta-analysis, of which 8 studies were performed in rectal cancer and 3 studies were performed in esophageal cancer. We finally included 8 included studies containing 839 cases for MTHFR C677T, 5 studies involving 634 cases for MTHFR A1298C, 3 studies containing 340 cases for EGFR G497A, and 4 studies containing 396 cases for EGFR CA repeat. The pooled analysis results indicated that MTHFR C677T might be correlated with the tumor response to pRCT under the recessive model (CC vs. CTTT) in overall analysis (OR=1.426(1.074-1.894), P=0.014), rectal cancer (OR=1.483(1.102-1.996), P=0.009), and TRG 1-2 vs. 3-5 group (OR=1.423(1.046-1.936), P=0.025), while other polymorphism including MTHFR A1298C, EGFR G497A, and EGFR CA repeat

VHL c.505 T>C mutation confers a high age related penetrance but no increased overall mortality

PubMed Central

Bender, B.; Eng, C.; Olschewski, M.; Berger, D.; Laubenberger, J.; Altehofer, C.; Kirste, G.; Orszagh, M.; van Velthoven, V.; Miosczka, H.; Schmidt, D.; Neumann, H.

2001-01-01

BACKGROUND—Germline mutations of the VHL gene cause von Hippel-Lindau syndrome (VHL). In southern Germany, a specific mutation in this gene, c.505 T>C, is one of the most frequent alterations owing to a founder effect.
METHODS—This study was conducted to evaluate morbidity, specific clinical risk profile, and mortality among a series of VHL c.505 T/C mutation carriers. A total of 125 eligible subjects carrying VHL c.505 T/C underwent ophthalmoscopy and gadolinium enhanced magnetic resonance imaging of the brain, the spinal cord, and the abdomen. Age related penetrance, morbidity, and mortality were assessed.
RESULTS—Frequently observed lesions were phaeochromocytoma (47%), retinal angiomas (36%), haemangioblastoma of the spine (36%), and haemangioblastoma of the brain (16%). Four patients developed renal cell carcinoma. VHL was symptomatic in 47% of subjects; 30% were asymptomatic despite the presence of at least one VHL related tumour and 23% of the carriers had no detectable VHL lesion. Of the 19 patients who had died (15%), 10 died of symptomatic VHL lesions. Overall penetrance by cumulative incidence functions is estimated at 48% by 35 years and 88% by 70 years. In contrast to the only existing published report based on patients with presumably unselected VHL germline mutations, the mortality rate for c.505 T/C mutation carriers is comparable to that of the general population of Germany.
CONCLUSIONS—Our results are an important example that a specific genotype, at least in the case of VHL c.505 T/C, can favourably impact on mortality despite a high age related penetrance. Our study also indirectly provides objective data which might be useful to the life and health insurance industry; it would appear that c.505 T>C mutation positive subjects have similar disease specific mortality to that of the general population owing to a combination of phenotype and timely detection of mutation carrier status followed by aggressive clinical screening and

Methylenetetrahydrofolate reductase C677T polymorphism is associated with increased risk of coronary artery disease in young South African Indians.

PubMed

Ramkaran, Prithiksha; Phulukdaree, Alisa; Khan, Sajidah; Moodley, Devapregasan; Chuturgoon, Anil A

2015-10-15

Methylenetetrahydrofolate reductase (MTHFR) reduces 5',10'-methylenetetrahydrofolate to 5'-methyltetrahydrofolate, and is involved in remethylation of homocysteine to methionine, two important reactions involved in folate metabolism and methylation pathways. The common MTHFR C677T single nucleotide polymorphism (SNP) (rs1801133) has been associated with raised levels of homocysteine, a well known risk factor for coronary artery disease (CAD). CAD is a major cause of mortality worldwide. The age of onset of this chronic disorder is on the decline, particularly in the Indian population. Indians in South Africa (SA) have a higher prevalence of premature CAD compared to Black South Africans. The MTHFR C677T SNP has not been investigated in the SA Indian population. The present study therefore investigated the MTHFR C677T SNP in young SA Indian males with CAD compared to young Indian and Black male controls. A total of 290 subjects were recruited into this study which included 106 CAD patients (diagnosed on angiography, mean age 37.5, range 24-45 years), 100 Indian male controls (mean age 37.5, range 28-45 years), and 84 Black male controls (mean age 36.4, range 25-45). Polymerase chain reaction (PCR) followed by restriction fragment length polymorphism (RFLP) was used to genotype CAD patients and healthy controls. Data for clinical markers were obtained from pathology reports. There was a significant association between the 677 MTHFR variant (T) allele and CAD patients compared to the healthy Indian controls (p=0.0353, OR=2.105 95% CI 1.077-4.114). Indian controls presented with a higher frequency of the variant allele compared to Black controls (7% vs. 2% respectively, p=0.0515 OR=3.086 95% CI 0.9958-9.564). The MTHFR C677T SNP did not influence levels of total cholesterol, LDL, HDL, triglycerides, fasting glucose, fasting insulin, HbA1c or hsCRP. The higher frequency of the MTHFR 677 variant allele in South African Indians may be a contributing factor to the higher

COMT Val158Met and MTHFR C677T moderate risk of schizophrenia in response to childhood adversity.

PubMed

Debost, J-C; Debost, M; Grove, J; Mors, O; Hougaard, D M; Børglum, A D; Mortensen, P B; Petersen, L

2017-07-01

Mesolimbic dopamine sensitization has been hypothesized to be a mediating factor of childhood adversity (CA) on schizophrenia risk. Activity of catechol-O-methyltransferase (COMT) Val158Met increases mesolimbic dopamine signaling and may be further regulated by methylenetetrahydrofolate reductase (MTHFR) C677T. This study investigates the three-way interaction between CA, COMT, and MTHFR. We conducted a nested case-control study on individuals born after 1981, linking population-based registers to study the three-way interaction. We included 1699 schizophrenia cases and 1681 controls, and used conditional logistic regression to report incidence rate ratios (IRRs). Childhood adversity was robustly associated with schizophrenia. No main genetic effects were observed. MTHFR C677T increased schizophrenia risk in a dose-dependent manner per MTHFR T allele (P = 0.005) consequent upon CA exposure. After inclusion of the significant (P = 0.03) COMT × MTHFR × CA interaction, the risk was further increased per high-activity COMT Val allele. Hence, exposed COMT Val/Val and MTHFR T/T carriers had an IRR of 2.76 (95% CI, 1.66-4.61). Additional adjustments for ancestry and parental history of mental illness attenuated the results with the interaction being only marginally significant. MTHFR C677T and COMT Val158Met interact with CA to increase risk of schizophrenia. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Association between MTHFR C677T Polymorphism and Risk of Acute Lymphoblastic Leukemia: A Meta-Analysis Based on 51 Case-Control Studies

PubMed Central

Li, Su-yi; Ye, Jie-yu; Liang, En-yu; Zhou, Li-xia; Yang, Mo

2015-01-01

Background Studies and systematic reviews have reached inconsistent conclusions on the role of 5, 10-methylenetetrahydrofolate reductase (MTHFR) polymorphism C677T in acute lymphoblastic leukemia (ALL) risk. Material/Methods The present meta-analysis comprising of 51 case-control studies, including 7892 cases and 14 280 controls was performed to reevaluate the association between MTHFR C677T polymorphism and ALL risk. Results Statistical differences were found in the dominant model (TT+CT vs. CC, odd ratio (OR)=0.89, 95% CI, 0.79–1.00, P=0.04) and the CT vs. CC (OR=0.89, 95% CI, 0.80–1.00, P=0.05), but not in the allele contrast model (T vs. C, OR=0.92, 95% CI, 0.84–1.01, P=0.08), additive model (TT vs. CC, OR=0.87, 95% CI, 0.73–1.05, P=0.15), or recessive model (TT vs. CT+CC, OR=0.94, 95% CI, 0.81–1.10, P=0.44) in overall populations. In the subgroup analyses stratified by age (children and adults) and ethnicity (Asian and Caucasian), no significant associations between MTHFR C677T polymorphism and ALL risk were observed. Conclusions The current study found no sufficient evidence of a protective role of MTHFR C677T polymorphism in ALL susceptibility. PMID:25761797

Association of MTHFR C677T Genotype With Ischemic Stroke Is Confined to Cerebral Small Vessel Disease Subtype

PubMed Central

Traylor, Matthew; Adib-Samii, Poneh; Thijs, Vincent; Sudlow, Cathie; Rothwell, Peter M.; Boncoraglio, Giorgio; Dichgans, Martin; Meschia, James; Maguire, Jane; Levi, Christopher; Rost, Natalia S.; Rosand, Jonathan; Hassan, Ahamad; Bevan, Steve; Markus, Hugh S.

2016-01-01

Background and Purpose— Elevated plasma homocysteine levels are associated with stroke. However, this might be a reflection of bias or confounding because trials have failed to demonstrate an effect from homocysteine lowering in stroke patients, although a possible benefit has been suggested in lacunar stroke. Genetic studies could potentially overcome these issues because genetic variants are inherited randomly and are fixed at conception. Therefore, we tested the homocysteine levels–associated genetic variant MTHFR C677T for association with magnetic resonance imaging–confirmed lacunar stroke and compared this with associations with large artery and cardioembolic stroke subtypes. Methods— We included 1359 magnetic resonance imaging–confirmed lacunar stroke cases, 1824 large artery stroke cases, 1970 cardioembolic stroke cases, and 14 448 controls, all of European ancestry. Furthermore, we studied 3670 ischemic stroke patients in whom white matter hyperintensities volume was measured. We tested MTHFR C677T for association with stroke subtypes and white matter hyperintensities volume. Because of the established association of homocysteine with hypertension, we additionally stratified for hypertension status. Results— MTHFR C677T was associated with lacunar stroke (P=0.0003) and white matter hyperintensity volume (P=0.04), but not with the other stroke subtypes. Stratifying the lacunar stroke cases for hypertension status confirmed this association in hypertensive individuals (P=0.0002), but not in normotensive individuals (P=0.30). Conclusions— MTHFR C677T was associated with magnetic resonance imaging–confirmed lacunar stroke, but not large artery or cardioembolic stroke. The association may act through increased susceptibility to, or interaction with, high blood pressure. This heterogeneity of association might explain the lack of effect of lowering homocysteine in secondary prevention trials which included all strokes. PMID:26839351

Folate intake and the MTHFR C677T genotype influence choline status in young Mexican American women☆

PubMed Central

Abratte, Christian M.; Wang, Wei; Li, Rui; Moriarty, David J.; Caudill, Marie A.

2009-01-01

Numerous studies have reported a relationship between folate status, the methylenetetrahydrofolate reductase (MTHFR) 677C→T variant and disease risk. Although folate and choline metabolism are inter-related, only limited data are available on the relationship between choline and folate status in humans. This study sought to examine the influences of folate intake and the MTHFR 677C→T variant on choline status. Mexican-American women (n =43; 14 CC, 12 CT and 17 TT) consumed 135 μg/day as dietary folate equivalents (DFE) for 7 weeks followed by randomization to 400 or 800 μg DFE/day for 7 weeks. Throughout the study, total choline intake remained unchanged at ∼350 mg/day. Plasma concentrations of betaine, choline, glycerophosphocholine, phosphatidylcholine and sphingomyelin were measured via LC-MS/MS for Weeks 0, 7 and 14. Phosphatidylcholine and sphingomyelin declined ( P=.001, P=.009, respectively) in response to folate restriction and increased ( P=.08, P=.029, respectively) in response to folate treatment. The increase in phosphatidylcholine occurred in response to 800 ( P=.03) not 400 ( P=.85) μg DFE/day (week×folate interaction, P=.017). The response of phosphatidylcholine to folate intake appeared to be influenced by MTHFR C677T genotype. The decline in phosphatidylcholine during folate restriction occurred primarily in women with the CC or CT genotype and not in the TT genotype (week×genotype interaction, P=.089). Moreover, when examined independent of folate status, phosphatidylcholine was higher ( P <.05) in the TT genotype relative to the CT genotype. These data suggest that folate intake and the MTHFR C677T genotype influence choline status in humans. PMID:17588738

Leber's hereditary optic neuropathy is associated with mitochondrial ND1 T3394C mutation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liang, Min; Zhejiang Provincial Key Laboratory of Medical Genetics, School of Life Sciences, Wenzhou Medical College, Wenzhou, Zhejiang 325003; Guan, Minqiang

2009-06-05

We report here the clinical, genetic and molecular characterization of four Chinese families with Leber's hereditary optic neuropathy (LHON). There were variable severity and age-of-onset in visual impairment among these families. Strikingly, there were extremely low penetrances of visual impairment in these Chinese families. Sequence analysis of complete mitochondrial genomes in these pedigrees showed the homoplasmic T3394C (Y30H) mutation, which localized at a highly conserved tyrosine at position 30 of ND1, and distinct sets of mtDNA polymorphisms belonging to haplogroups D4b and M9a. The occurrence of T3394C mutation in these several genetically unrelated subjects affected by visual impairment strongly indicatesmore » that this mutation is involved in the pathogenesis of visual impairment. However, there was the absence of functionally significant mtDNA mutations in these four Chinese pedigrees carrying the T3394C mutation. Therefore, nuclear modifier gene(s) or environmental factor(s) may play a role in the phenotypic expression of the LHON-associated T3394C mutation.« less

mtDNA mutation C1494T, haplogroup A, and hearing loss in Chinese

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang Chengye; Laboratory for Conservation and Utilization of Bio-resource, Yunnan University, Kunming 650091; Graduate University of the Chinese Academy of Sciences, Beijing 100039

2006-09-22

Mutation C1494T in mitochondrial 12S rRNA gene was recently reported in two large Chinese families with aminoglycoside-induced and nonsyndromic hearing loss (AINHL) and was claimed to be pathogenic. This mutation, however, was first reported in a sample from central China in our previous study that was aimed to reconstruct East Asian mtDNA phylogeny. All these three mtDNAs formed a subclade defined by mutation C1494T in mtDNA haplogroup A. It thus seems that mutation C1494T is a haplogroup A-associated mutation and this matrilineal background may contribute a high risk for the penetrance of mutation C1494T in Chinese with AINHL. To testmore » this hypothesis, we first genotyped mutation C1494T in 553 unrelated individuals from three regional Chinese populations and performed an extensive search for published complete or near-complete mtDNA data sets (>3000 mtDNAs), we then screened the C1494T mutation in 111 mtDNAs with haplogroup A status that were identified from 1823 subjects across China. The search for published mtDNA data sets revealed no other mtDNA besides the above-mentioned three carrying mutation C1494T. None of the 553 randomly selected individuals and the 111 haplogroup A mtDNAs was found to bear this mutation. Therefore, our results suggest that C1494T is a very rare event. The mtDNA haplogroup A background in general is unlikely to play an active role in the penetrance of mutation C1494T in AINHL.« less

Methylenetetrahydrofolate reductase (MTHFR) gene 677C>T and 1298A>C polymorphisms are associated with differential apoptosis of leukemic B cells in vitro and disease progression in chronic lymphocytic leukemia.

PubMed

Nückel, H; Frey, U H; Dürig, J; Dührsen, U; Siffert, W

2004-11-01

Methylenetetrahydrofolate reductase (MTHFR) regulates the metabolism of folate and methionine, essential components of DNA synthesis and methylation. We investigated whether the two genetic MTHFR polymorphisms (677C>T and 1298A>C) are associated with an increased risk for chronic lymphocytic leukemia (CLL) or may predict disease progression. Moreover, we measured potential genotype effects on apoptosis of B-CLL cells.Allele frequencies and genotype distributions for both polymorphisms were not significantly different in 111 patients vs 92 healthy controls. While progression-free survival (PFS) was not significantly different in individuals with CLL including all stages, in patients with Binet stage A PFS was significantly longer in patients displaying the MTHFR 677CC (P=0.043) and the MTHFR 1298A/C or CC genotypes (P=0.019). In a multivariate analysis, MTHFR haplotype (677CC plus 1298CC or A/C) was the best independent prognostic factor for PFS compared with other known prognostic factors. Spontaneous apoptosis of B-CLL cells in vitro was significantly increased in the favorable risk group with MTHFR 677CC and MTHFR 1298AC, which may constitute the cellular basis of the observed associations. While MTHFR polymorphisms do not affect the risk for B-CLL, they may be independent prognostic markers that influence the PFS in patients with early-stage B-CLL.

The MTHFR C677T polymorphism and risk of acute lymphoblastic leukemia: an updated meta-analysis based on 37 case-control studies.

PubMed

Jiang, Yuan; Hou, Jing; Zhang, Qiang; Jia, Shu-Ting; Wang, Bo-Yuan; Zhang, Ji-Hong; Tang, Wen-Ru; Luo, Ying

2013-01-01

The C677T polymorphism of the methylenetetrahydrofolate reductase (MTHFR) has been associated with acute lymphoblastic leukemia (ALL). However, results were conflicting. The aim of this study was to quantitatively summarize the evidence for the MTHFRC677T polymorphism and ALL risk. Electronic searches of PubMed and the Chinese Biomedicine database were conducted to select case-control studies containing available genotype frequencies of C677T and the odds ratio (OR) with 95% confidence interval (CI) was used to assess the strength of any association. Case-control studies including 6,371 cases and 10,850 controls were identified. The meta-analysis stratified by ethnicity showed that individuals with the homozygous TT genotype had decreased risk of ALL (OR= 0.776, 95% CI: 0.687~0.877, p< 0.001) in Caucasians (OR= 0.715, 95% CI: 0.655~0.781, p= 0.000). However, results among Asians (OR=0.711, 95% CI: 0.591~1.005, p= 0.055) and others (OR=0.913, 95% CI: 0.656~1.271, p= 0. 590) did not suggest an association. A symmetric funnel plot, the Egger's test (P=0.093), and the Begg- test (P=0.072) were all suggestive of the lack of publication bias. This meta-analysis supports the idea that the MTHFR C677T genotype is associated with risk of ALL in Caucasians. To draw comprehensive and true conclusions, further prospective studies with larger numbers of participants worldwide are needed to examine associations between the MTHFRC677T polymorphism and ALL.

Phenotype of Usher syndrome type II assosiated with compound missense mutations of c.721 C>T and c.1969 C>T in MYO7A in a Chinese Usher syndrome family.

PubMed

Zhai, Wei; Jin, Xin; Gong, Yan; Qu, Ling-Hui; Zhao, Chen; Li, Zhao-Hui

2015-01-01

To identify the pathogenic mutations in a Chinese pedigree affected with Usher syndrome type II (USH2). The ophthalmic examinations and audiometric tests were performed to ascertain the phenotype of the family. To detect the genetic defect, exons of 103 known RDs -associated genes including 12 Usher syndrome (USH) genes of the proband were captured and sequencing analysis was performed to exclude known genetic defects and find potential pathogenic mutations. Subsequently, candidate mutations were validated in his pedigree and 100 normal controls using polymerase chain reaction (PCR) and Sanger sequencing. The patient in the family occurred hearing loss (HL) and retinitis pigmentosa (RP) without vestibular dysfunction, which were consistent with standards of classification for USH2. He carried the compound heterozygous mutations, c.721 C>T and c.1969 C>T, in the MYO7A gene and the unaffected members carried only one of the two mutations. The mutations were not present in the 100 normal controls. We suggested that the compound heterozygous mutations of the MYO7A could lead to USH2, which had revealed distinguished clinical phenotypes associated with MYO7A and expanded the spectrum of clinical phenotypes of the MYO7A mutations.

Mitochondrial tRNALeu(UUR) C3275T, tRNAGln T4363C and tRNALys A8343G mutations may be associated with PCOS and metabolic syndrome.

PubMed

Ding, Yu; Xia, Bo-Hou; Zhang, Cai-Juan; Zhuo, Guang-Chao

2018-02-05

Polycystic ovary syndrome (PCOS) is a very prevalent endocrine disease affecting reproductive women. Clinically, patients with this disorder are more vulnerable to develop type 2 diabetes mellitus (T2DM), cardiovascular events, as well as metabolic syndrome (MetS). To date, the molecular mechanism underlying PCOS remains largely unknown. Previously, we showed that mitochondrial dysfunction caused by mitochondrial DNA (mtDNA) mutation was an important cause for PCOS. In the current study, we described the clinical and biochemical features of a three-generation pedigree with maternally transmitted MetS, combined with PCOS. A total of three matrilineal relatives exhibited MetS including obesity, high triglyceride (TG) and Hemoglobin A1c (HbA1c) levels, and hypertension. Whereas one patient from the third generation manifestated PCOS. Mutational analysis of the whole mitochondrial genes from the affected individuals identified a set of genetic variations belonging to East Asia haplogroup B4b1c. Among these variants, the homoplasmic C3275T mutation disrupted a highly evolutionary conserved base-pairing (28A-46C) on the variable region of tRNA Leu(UUR) , whereas the T4363C mutation created a new base-pairing (31T-37A) in the anticodon stem of tRNA Gln , furthermore, the A8343G mutation occurred at the very conserved position of tRNA Lys and may result the failure in mitochondrial tRNAs (mt-tRNAs) metabolism. Biochemical analysis revealed the deficiency in mitochondrial functions including lower levels of mitochondrial membrane potential (MMP), ATP production and mtDNA copy number, while a significantly increased reactive oxygen species (ROS) generation was observed in polymononuclear leukocytes (PMNs) from the individuals carrying these mt-tRNA mutations, suggesting that these mutations may cause mitochondrial dysfunction that was responsible for the clinical phenotypes. Taken together, our data indicated that mt-tRNA mutations were associated with MetS and PCOS in this

A common mutation in the 5,10-methylenetetrahydrofolate reductase gene affects genomic DNA methylation through an interaction with folate status

PubMed Central

Friso, Simonetta; Choi, Sang-Woon; Girelli, Domenico; Mason, Joel B.; Dolnikowski, Gregory G.; Bagley, Pamela J.; Olivieri, Oliviero; Jacques, Paul F.; Rosenberg, Irwin H.; Corrocher, Roberto; Selhub, Jacob

2002-01-01

DNA methylation, an essential epigenetic feature of DNA that modulates gene expression and genomic integrity, is catalyzed by methyltransferases that use the universal methyl donor S-adenosyl-l-methionine. Methylenetetrahydrofolate reductase (MTHFR) catalyzes the synthesis of 5-methyltetrahydrofolate (5-methylTHF), the methyl donor for synthesis of methionine from homocysteine and precursor of S-adenosyl-l-methionine. In the present study we sought to determine the effect of folate status on genomic DNA methylation with an emphasis on the interaction with the common C677T mutation in the MTHFR gene. A liquid chromatography/MS method for the analysis of nucleotide bases was used to assess genomic DNA methylation in peripheral blood mononuclear cell DNA from 105 subjects homozygous for this mutation (T/T) and 187 homozygous for the wild-type (C/C) MTHFR genotype. The results show that genomic DNA methylation directly correlates with folate status and inversely with plasma homocysteine (tHcy) levels (P < 0.01). T/T genotypes had a diminished level of DNA methylation compared with those with the C/C wild-type (32.23 vs.62.24 ng 5-methylcytosine/μg DNA, P < 0.0001). When analyzed according to folate status, however, only the T/T subjects with low levels of folate accounted for the diminished DNA methylation (P < 0.0001). Moreover, in T/T subjects DNA methylation status correlated with the methylated proportion of red blood cell folate and was inversely related to the formylated proportion of red blood cell folates (P < 0.03) that is known to be solely represented in those individuals. These results indicate that the MTHFR C677T polymorphism influences DNA methylation status through an interaction with folate status. PMID:11929966

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

PubMed

Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

2017-10-01

Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

Novel and recurrent mutations in the C1NH gene of Arab patients affected with hereditary angioedema.

PubMed

Faiyaz-Ul-Haque, Muhammad; Al-Gazlan, Sulaiman; Abalkhail, Halah A; Al-Abdulatif, Ahmad; Toulimat, Mohamed; Peltekova, Iskra; Khaliq, Agha M R; Al-Dayel, Fouad; Zaidi, Syed H E

2010-01-01

Autosomal dominant hereditary angioedema (HAE) results in episodes of subcutaneous edema in any body part and/or submucosal edema of the upper respiratory or gastrointestinal tracts. This disorder is caused by mutations in the C1NH gene, many of which have been described primarily in European patients. However, the genetic cause of HAE in Middle Eastern Arab patients has not yet been determined. Four unrelated Arab families, in which 15 patients were diagnosed with HAE, were studied. DNA from 13 patients was analyzed for mutations in the C1NH gene by DNA sequencing. Three novel and 2 recurrent mutations were identified in the C1NH gene of HAE patients. In family 1, the patient was heterozygous for a novel c.856C>T and a recurrent c.1361T>A missense mutation encoding for p.Arg264Cys and p.Val432Glu, respectively. In patients from family 2, a novel c.509C>T missense mutation encoding for a p.Ser148Phe was identified. In patients from family 3, a novel c.1142delC nonsense mutation encoding for a p.Ala359AlafsX15 was discovered. In family 4, a recurrent c.1397G>A missense mutation encoding for a p.Arg444His was present. This is the first ever report of C1NH gene mutations in Middle Eastern Arab patients. Our study suggests that, despite the numerous existing mutations in the C1NH gene, there are novel and recurrent mutations in HAE patients of non-European origin. We conclude that the spectrum of C1NH gene mutations in HAE patients is wider due to the likely presence of novel and recurrent mutations in patients of other ethnicities. 2009 S. Karger AG, Basel.

MTHFR 677C-->T and 1298A-->C polymorphisms in children with Down syndrome and acute myeloid leukemia in Brazil.

PubMed

Amorim, Marcia R; Zanrosso, Crisiane Wais; Magalhães, Isis Q; Pereira, Simone C; Figueiredo, Alexandre; Emerenciano, Mariana; Pinheiro, Vitoria Regia; d'Andréa, Maria Lydia; Orioli, Ieda M; Koifman, Sergio; Pombo-de-Oliveira, Maria S

2008-12-01

Down syndrome (DS) is an important risk factor associated with acute leukemia (AL). The presence of polymorphisms that reduce 5,10-methylenetetrahydrofolate reductase (MTHFR) activity has been linked to the multifactorial leukemogenic process. The authors have conducted a study to test whether 677C-->T and/or 1298A-->C polymorphisms of MTHFR would play an additional role in susceptibility of acute myeloid leukemia (AML) in DS children. They also verified whether any polymorphism in the MTHFR gene was associated with the risk of DS. Genetic polymorphisms determination was carried out in 248 samples from healthy individuals as controls and a total of 115 DS children (65 without leukemia and 50 with AML). The present study failed to reveal any association between these polymorphisms and risk of AML in DS children. The data also indicate that MTHFR polymorphisms are not associated with risk of being a DS child.

The association of factor V G1961A (factor V Leiden), prothrombin G20210A, MTHFR C677T and PAI-1 4G/5G polymorphisms with recurrent pregnancy loss in Bosnian women.

PubMed

Jusić, Amela; Balić, Devleta; Avdić, Aldijana; Pođanin, Maja; Balić, Adem

2018-08-01

Aim To investigate association of factor V Leiden, prothrombin G20210A, MTHFR C677T and PAI-1 4G/5G polymorphisms with recurrent pregnancy loss in Bosnian women. Methods A total of 60 women with two or more consecutive miscarriages before 20 weeks of gestation with the same partners and without history of known causes or recurrent pregnancy loss were included. A control group included 80 healthy women who had one or more successful pregnancies without history of any complication which could be associated with miscarriages. Genotyping of factor V Leiden, prothrombin G20210A, MTHFR C677T and PAI-1 4G/5G polymorphisms were performed by polymerase chain reaction/restriction fragments length polymorphism method (PCR/RFLP). Results Both factor V Leiden and MTHFR C677T polymorphisms were significantly associated with recurrent pregnancy loss (RPL) in Bosnian women while prothrombin G20210A and PAI-1 4G/5G polymorphisms did not show strongly significant association. Conclusion The presence of thrombophilic polymorphisms may predispose women to recurrent pregnancy loss. Future investigation should be addressed in order to find when carriers of those mutations, polymorphisms should be treated with anticoagulant therapy. Copyright© by the Medical Assotiation of Zenica-Doboj Canton.

Frequent mutations in the p53 tumor suppressor gene in human leukemia T-cell lines.

PubMed Central

Cheng, J; Haas, M

1990-01-01

Human T-cell leukemia and T-cell acute lymphoblastic leukemia cell lines were studied for alterations in the p53 tumor suppressor gene. Southern blot analysis of 10 leukemic T-cell lines revealed no gross genomic deletions or rearrangements. Reverse transcription-polymerase chain reaction analysis of p53 mRNA indicated that all 10 lines produced p53 mRNA of normal size. By direct sequencing of polymerase chain reaction-amplified cDNA, we detected 11 missense and nonsense point mutations in 5 of the 10 leukemic T-cell lines studied. The mutations are primarily located in the evolutionarily highly conserved regions of the p53 gene. One of the five cell lines in which a mutation was detected possesses a homozygous point mutation in both p53 alleles, while the other four cell lines harbor from two to four different point mutations. An allelic study of two of the lines (CEM, A3/Kawa) shows that the two missense mutations found in each line are located on separate alleles, thus both alleles of the p53 gene may have been functionally inactivated by two different point mutations. Since cultured leukemic T-cell lines represent a late, fully tumorigenic stage of leukemic T cells, mutation of both (or more) alleles of the p53 gene may reflect the selection of cells possessing an increasingly tumorigenic phenotype, whether the selection took place in vivo or in vitro. Previously, we have shown that the HSB-2 T-cell acute lymphoblastic leukemia cell line had lost both alleles of the retinoblastoma tumor suppressor gene. Taken together, our data show that at least 6 of 10 leukemic T-cell lines examined may have lost the normal function of a known tumor suppressor gene, suggesting that this class of genes serves a critical role in the generation of fully tumorigenic leukemic T cells. Images PMID:2144611

CBS mutations and MTFHR SNPs causative of hyperhomocysteinemia in Pakistani children.

PubMed

Ibrahim, Shahnaz; Maqbool, Saadia; Azam, Maleeha; Iqbal, Mohammad Perwaiz; Qamar, Raheel

2018-03-29

Three index patients with hyperhomocysteinemia and ocular anomalies were screened for cystathionine beta synthase (CBS) and methylenetetrahydrofolate reductase (MTHFR) polymorphisms. Genotyping of hyperhomocysteinemia associated MTHFR polymorphisms C677T (rs1801133) and A1298C (rs1801131) was done by PCR-restriction fragment length polymorphism. Sanger sequencing was performed for CBS exonic sequences along with consensus splice sites. In the case of MTHFR polymorphisms, all the patients were heterozygous CT for the single nucleotide polymorphism (SNP) C677T and were therefore carriers of the risk allele (T), while the patients were homozygous CC for the risk genotype of the SNP A1298C. CBS sequencing resulted in the identification of two novel mutations, a missense change (c.467T>C; p.Leu156Pro) in exon 7 and an in-frame deletion (c.808_810del; p.Glu270del) in exon 10. In addition, a recurrent missense mutation (c.770C>T; p.Thr257Met) in exon 10 of the gene was also identified. The mutations were present homozygously in the patients and were inherited from the carrier parents. This is the first report from Pakistan where novel as well as recurrent CBS mutations causing hyperhomocysteinemia and lens dislocation in three patients from different families are being reported with the predicted effect of the risk allele of the MTHFR SNP in causing hyperhomocysteinemia.

Leber's hereditary optic neuropathy is associated with mitochondrial ND6 T14502C mutation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhao, Fuxin; Zhejiang Provincial Key Laboratory of Medical Genetics, School of Life Sciences, Wenzhou Medical College, Wenzhou, Zhejiang 325003; Guan, Minqiang

2009-11-20

We report here the clinical, genetic, and molecular characterization of three Chinese families with Leber's hereditary optic neuropathy (LHON). There were variable severity and age of onset in visual impairment among these families. Strikingly, there were extremely low penetrances of visual impairment in these Chinese families. Sequence analysis of complete mitochondrial genomes in these pedigrees showed the homoplasmic T14502C (I58V) mutation, which localized at a highly conserved isoleucine at position 58 of ND6, and distinct sets of mtDNA polymorphisms belonging to haplogroups M10a, F1a1, and H2. The occurrence of T14502C mutation in these several genetically unrelated subjects affected by visualmore » impairment strongly indicates that this mutation is involved in the pathogenesis of visual impairment. Here, mtDNA variants I187T in the ND1, A122V in CO1, S99A in the A6, and V254I in CO3 exhibited an evolutionary conservation, indicating a potential modifying role in the development of visual impairment associated with T14502C mutation in those families. Furthermore, nuclear modifier gene(s) or environmental factor(s) may play a role in the phenotypic manifestation of the LHON-associated T14502C mutation in these Chinese families.« less

Carnitine-acylcarnitine translocase deficiency with c.199-10 T>G and novel c.1A>G mutation

PubMed Central

Yan, Hui-ming; Hu, Hao; Ahmed, Aisha; Feng, Bing-bing; Liu, Jing; Jia, Zheng-jun; Wang, Hua

2017-01-01

Abstract Rationale: Carnitine-acylcarnitine translocate deficiency (CACTD) is a rare and life-threatening, autosomal recessive disorder of fatty acid β-oxidation characterized by hypoketotic hypoglycemia, hyperammonemia, cardiomyopathy, liver dysfunction, and muscle weakness; culminating in early death. To date, CACTD cases screened from the Chinese mainland population, especially patient with compound heterozygote with c.199-10T>G and a novel c.1A>G mutation in the SLC25A20 gene has never been described. Patient concerns: Herein, we report 2 neonatal cases of CACTD identified from the mainland China. These 2 patients were presented with severe metabolic crisis and their clinical conditions deteriorate rapidly and both died of cardiorespiratory collapse in the first week of life. We present the clinical and biochemical features of 2 probands and a brief literature review of previously reported CACTD cases with the c.199-10T>G mutation. Diagnoses: The acylcarnitine profiles by tandem-mass-spectrometry and the mutation analysis of SLC25A20 gene confirmed the diagnosis of CACTD in both patients. Mutation analysis demonstrated that patient No. 1 was homozygous for c.199-10T>G mutation, while patient No. 2 was a compound heterozygote for 2 mutations, a maternally-inherited c.199-10T>G and a paternally-inherited, novel c.1A>G mutation. Interventions: Both patients were treated with an aggressive treatment regimen include high glucose and arginine infusion, respiratory, and circulatory support. Outcomes: The first proband died 3 days after delivery due to sudden cardiac arrest. The second patient's clinical condition, at one time, was improved by high glucose infusion, intravenous arginine, and circulatory support. However, the patient failed to wean from mechanical ventilation. Unfortunately, her parents refused further treatment due to fear of financial burdens. The patient died of congestive heart failure in the 6th day of life. Lessons: We report the first 2 cases of

Plasminogen activator inhibitor-1 4G/5G and the MTHFR 677C/T polymorphisms and susceptibility to polycystic ovary syndrome: a meta-analysis.

PubMed

Lee, Young Ho; Song, Gwan Gyu

2014-04-01

The aim of this study was to explore whether the plasminogen activator inhibitor-1 (PAI-1) 4G/5G and the methylenetetrahydrofolate reductase (MTHFR) 677C/T polymorphisms are associated with susceptibility to polycystic ovary syndrome (PCOS). Meta-analyses were conducted to determine the association between the PAI-1 4G/5G and MTHFR 677C/T polymorphisms and PCOS using: (1) allele contrast (2) homozygote contrast, (3) recessive, and (4) dominant models. For meta-analysis, nine studies of the PAI-1 4G/5G polymorphism with 2384 subjects (PCOS, 1615; controls, 769) and eight studies of the MTHFR 677C/T polymorphism with 1270 study subjects were included. Meta-analysis of all study subjects showed no association between PCOS and the PAI-1 4G allele (OR=0.949, 95% CI=0.671-1.343, p=0.767). Stratification by ethnicity, however, indicated a significant association between the PAI-1 4G allele and PCOS in Turkish and Asian populations (OR=0.776, 95% CI=0.602-0.999, p=0.049; OR=1.749, 95% CI=1.297-2.359, p=2.5×10(-5) respectively). In addition, meta-analysis indicated an association between PCOS and the PAI-1 4G4G+4G5G genotype in Europeans (OR=1.406, 95% CI=1.025-1.928, p=0.035). However, meta-analysis of all study subjects showed no association between PCOS and the MTHFR 677T allele (OR=0.998, 95% CI=0.762-1.307, p=0.989), including Europeans (OR=0.806, 95% CI=0.610-1.063, p=0.126). Meta-analysis showed no association between PCOS and the MTHFR 677C/T polymorphism using homozygote contrast, and recessive and dominant models. In conclusion, meta-analysis suggests the PAI-1 4G/5G polymorphism is associated with susceptibility to PCOS in European, Turkish, and Asian populations, but the MTHFR 677C/T polymorphism is not associated with susceptibility to PCOS in Europeans. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Influence of Combined Methionine Synthase (MTR 2756A > G) and Methylenetetrahydrofolate Reductase (MTHFR 677C > T) Polymorphisms to Plasma Homocysteine Levels in Korean Patients with Ischemic Stroke

PubMed Central

Kim, Ok Joon; Hong, Sun Pyo; Ahn, Jung Yong; Hong, Seung Ho; Hwang, Tae Sun; Kim, Soo Ok; Yoo, Wangdon; Oh, Doyeun

2007-01-01

Purpose Methionine synthase (MTR) and 5,10-methylenetetrahydrofolate reductase (MTHFR) are the main regulatory enzymes for homocysteine metabolism. The present case-control study was conducted to determine whether there is an association between the MTR 2756A > G or MTHFR 677C > T polymorphism and plasma homocysteine concentration in Korean subjects with ischemic stroke. Materials and Methods DNA samples of 237 patients who had an ischemic stroke and 223 age and sex-matched controls were studied. MTR 2756A > G and MTHFR 677C > T genotypes were determined by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). Results Frequencies of mutant alleles for MTR and MTHFR polymorphisms were not significantly different between the controls and cases. The patient group, however, had significantly higher homocysteine concentrations of the MTR 2756AA and MTHFR 677TT genotypes than the control group (p = 0.04 for MTR, p = 0.01 for MTHFR). The combined MTR 2756AA and MTHFR 677TT genotype (p = 0.04) and the homocysteine concentrations of the patient group were also higher than those of the controls. In addition, the genotype distribution was significant in the MTHFR 677TT genotype (p = 0.008) and combined MTR 2756AA and MTHFR 677TT genotype (p = 0.03), which divided the groups into the top 20% and bottom 20% based on their homocysteine levels. Conclusion The results of the present study demonstrate that the MTR 2756A > G and MTHFR 677C > T polymorphisms interact with elevated total homocysteine (tHcy) levels, leading to an increased risk of ischemic stroke. PMID:17461517

[Gene mutation analysis of X-linked hypophosphatemic rickets].

PubMed

Song, Ying; Ma, Hong-Wei; Li, Fang; Hu, Man; Ren, Shuang; Yu, Ya-Fen; Zhao, Gui-Jie

2013-11-01

To investigate the frequency and type of PHEX gene mutations in children with X-linked hypophosphatemic rickets (XLH), the possible presence of mutational hot spots, and the relationship between genotype and clinical phenotype. Clinical data of 10 children with XLH was retrospectively reviewed. The relationship between gene mutation type and severity of XLH was evaluated. PHEX gene mutations were detected in all 10 children with XLH, including 6 cases of missense mutation, 2 cases of splice site mutation, 1 case of frameshift mutation, and 1 case of nonsense mutation. Two new mutations, c.2048T>C and IVS14+1delAG, were found. The type of PHEX gene mutation was not associated with the degree of short stature and leg deformity (P=0.571 and 0.467), and the mutation site was also not associated with the degree of short stature and leg deformity (P=0.400 and 1.000). Missense mutation is the most common type of PHEX gene mutation in children with XLH, and c.2048T>C and IVS14+1delAG are two new PHEX gene mutations. The type and site of PHEX gene mutation are not associated with the severity of XLH.

Additive Interaction of MTHFR C677T and MTRR A66G Polymorphisms with Being Overweight/Obesity on the Risk of Type 2 Diabetes.

PubMed

Zhi, Xueyuan; Yang, Boyi; Fan, Shujun; Li, Yongfang; He, Miao; Wang, Da; Wang, Yanxun; Wei, Jian; Zheng, Quanmei; Sun, Guifan

2016-12-15

Although both methylenetetrahydrofolate reductase ( MTHFR ) C677T and methionine synthase reductase ( MTRR ) A66G polymorphisms have been associated with type 2 diabetes (T2D), their interactions with being overweight/obesity on T2D risk remain unclear. To evaluate the associations of the two polymorphisms with T2D and their interactions with being overweight/obesity on T2D risk, a case-control study of 180 T2D patients and 350 healthy controls was conducted in northern China. Additive interaction was estimated using relative excess risk due to interaction (RERI), attributable proportion due to interaction (AP) and synergy index (S). After adjustments for age and gender, borderline significant associations of the MTHFR C677T and MTRR A66G polymorphisms with T2D were observed under recessive (OR = 1.43, 95% CI: 0.98-2.10) and dominant (OR = 1.43, 95% CI: 1.00-2.06) models, respectively. There was a significant interaction between the MTHFR 677TT genotype and being overweight/obesity on T2D risk (AP = 0.404, 95% CI: 0.047-0.761), in addition to the MTRR 66AG/GG genotypes (RERI = 1.703, 95% CI: 0.401-3.004; AP = 0.528, 95% CI: 0.223-0.834). Our findings suggest that individuals with the MTHFR 677TT or MTRR 66AG/GG genotypes are more susceptible to the detrimental effect of being overweight/obesity on T2D. Further large-scale studies are still needed to confirm our findings.

A Founder Effect of c.257 + 2T > C Mutation in NCF2 Gene Underlies Severe Chronic Granulomatous Disease in Eleven Patients.

PubMed

Ben-Farhat, Khaoula; Ben-Mustapha, Imen; Ben-Ali, Meriem; Rouault, Karen; Hamami, Saber; Mekki, Najla; Ben-Chehida, Amel; Larguèche, Beya; Fitouri, Zohra; Abdelmoula, Selim; Khemiri, Monia; Guediche, Mohamed-Neji; Boukthir, Samir; Barsaoui, Sihem; Chemli, Jalel; Barbouche, Mohamed-Ridha

2016-08-01

Chronic granulomatous disease (CGD) is the prototypic functional neutrophil disorder caused by genetic defects in one of the five genes encoding the superoxide-generating nicotinamide adenine dinucleotide phosphate (NADPH)-oxidase subunits of phagocytes. Mutations causing the most prevalent form of CGD in western populations are located in the X-linked-CYBB gene. The four remaining autosomal recessive (AR) forms collectively account for one-third of CGD cases. We investigated the clinical and molecular features of eleven patients with CGD from 6 consanguineous families, originating from contiguous regions in the west of Tunisia. The patients' clinical phenotype is characterized by a high incidence of mycobacterial infections. Five out of the eleven patients died despite treatment arguing in favor of a severe clinical form of CGD. These findings correlated with the absence of functional p67phox protein as well as the absence of residual reactive oxygen intermediates (ROI) production. Genetic analysis showed the presence, in all patients, of a unique mutation (c.257 + 2T > C) in NCF2 gene predicted to affect RNA splicing. Segregating analysis using nine polymorphic markers overlapping the NCF2 gene revealed a common haplotype spanning 4.1 Mb. The founder event responsible for this mutation was estimated to have arisen approximately 175 years ago. These findings will facilitate the implementation of preventive approaches through genetic counseling in affected consanguineous families.

Identification of fifteen novel mutations in the SLC12A3 gene encoding the Na-Cl Co-transporter in Italian patients with Gitelman syndrome.

PubMed

Syrén, Marie-Louise; Tedeschi, Silvana; Cesareo, Laila; Bellantuono, Rosa; Colussi, Giacomo; Procaccio, Mirella; Alì, Anna; Domenici, Raffaele; Malberti, Fabio; Sprocati, Monica; Sacco, Michele; Miglietti, Nunzia; Edefonti, Alberto; Sereni, Fabio; Casari, Giorgio; Coviello, Domenico A; Bettinelli, Alberto

2002-07-01

The SLC12A3 gene encodes the thiazide-sensitive Na-Cl co-transporter (NCCT) expressed in the apical membrane of the distal convoluted tubule of the kidney. Inactivating mutations of this gene are responsible for Gitelman syndrome (GS), a disorder inherited as an autosomal recessive trait. We searched for SLC12A3 gene mutations in 21 Italian patients with the clinical and biochemical features of GS (hypokalemia, hypomagnesemia, metabolic alkalosis, hypocalciuria, and the absence of nephrocalcinosis). All coding regions with their intron-exon boundaries were analyzed using PCR and SSCP techniques followed by sequencing analysis. We identified 21 different mutations evenly distributed throughout the gene without any mutation hot-spot. Fifteen are novel variants, including 12 missense mutations, one deletion, one deletion-insertion and one splice site mutation: R158Q, T163M, W172R, G316V, G374V, G463E, A464T, S615W, V677M, R852S, R958G, C985Y, 2114-2120delACCAAGT, 2144-2158delGCCTTCTACTCGGATinsTG, and 531-2A>G. Copyright 2002 Wiley-Liss, Inc.

DPYD*2A and MTHFR C677T predict toxicity and efficacy, respectively, in patients on chemotherapy with 5-fluorouracil for colorectal cancer.

PubMed

Nahid, Noor Ahmed; Apu, Mohd Nazmul Hasan; Islam, Md Reazul; Shabnaz, Samia; Chowdhury, Surid Mohammad; Ahmed, Maizbha Uddin; Nahar, Zabun; Islam, Md Siddiqul; Islam, Mohammad Safiqul; Hasnat, Abul

2018-01-01

Significant inter-individual variation in the sensitivity to 5-fluorouracil (5-FU) represents a major therapeutic hindrance either by impairing drug response or inducing adverse drug reactions (ADRs). This study aimed at exploring the cause behind this inter-individual alterations in consequences of 5-fluorouracil-based chemotherapy by investigating the effects of DPYD*2A and MTHFR C677T polymorphisms on toxicity and response of 5-FU in Bangladeshi colorectal cancer patients. Colorectal cancer patients (n = 161) receiving 5-FU-based chemotherapy were prospectively enrolled. DPYD and MTHFR polymorphisms were assessed in peripheral leukocytes. Multivariate analyses were applied to evaluate which variables could predict chemotherapy-induced toxicity and efficacy. Multivariate analyses showed that DPYD*2A polymorphism was a predictive factor (P = 0.023) for grade 3 and grade 4 5-fluorouracil-related toxicities. Although MTHFR C677T polymorphism might act as forecasters for grade 3 or grade 4 neutropenia, diarrhea, and mucositis, this polymorphism was found to increase significantly (P = 0.006) the response of 5-FU. DPYD*2A and MTHFR C677T polymorphisms could explain 5-FU toxicity or clinical outcome in Bangladeshi colorectal patients.

Association between the MTHFR C677T polymorphism and risk of cancer: evidence from 446 case-control studies.

PubMed

Xie, Shu-Zhe; Liu, Zhi-Zhong; Yu, Jun-hua; Liu, Li; Wang, Wei; Xie, Dao-Lin; Qin, Jiang-Bo

2015-11-01

Many molecular epidemiological studies have been performed to explore the association between MTHFR C677T polymorphism and cancer risk in diverse populations. However, the results were inconsistent. Hence, we performed a meta-analysis to investigate the association between cancer risk and MTHFR C677T (150,086 cases and 200,699 controls from 446 studies) polymorphism. Overall, significantly increased cancer risk was found when all eligible studies were pooled into the meta-analysis. In the further stratified and sensitivity analyses, significantly increased breast cancer risk was found in Asians and Indians, significantly decreased colon cancer risk was found, significantly decreased colorectal cancer risk was found in male population, significantly increased gastric cancer risk was found in Caucasians and Asians, significantly increased hepatocellular cancer risk was found in Asians, significantly decreased adult acute lymphoblastic leukemia (AALL) risk was found in Caucasians, significantly decreased childhood acute lymphoblastic leukemia (CALL) risk was found in Asians, and significantly increased multiple myeloma and NHL risk was found in Caucasians. In summary, this meta-analysis suggests that MTHFR C677T polymorphism is associated with increased breast cancer, gastric cancer, and hepatocellular cancer risk in Asians, is associated with increased gastric cancer, multiple myeloma, and NHL risk in Caucasians, is associated with decreased AALL risk in Caucasians, is associated with decreased CALL risk in Asians, is associated with increased breast cancer risk in Asians, is associated with decreased colon cancer risk, and is associated with decreased colorectal cancer risk in male population. Moreover, this meta-analysis also points out the importance of new studies, such as Asians of HNC, Asians of lung cancer, and Indians of breast cancer, because they had high heterogeneity in this meta-analysis (I(2) > 75%).

The effect of MTHFR(C677T) genotype on plasma homocysteine concentrations in healthy children is influenced by gender.

PubMed

Papoutsakis, C; Yiannakouris, N; Manios, Y; Papaconstantinou, E; Magkos, F; Schulpis, K H; Zampelas, A; Matalas, A L

2006-02-01

To explore the influence of gender, together with folate status, on the relation between the common methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism and plasma total homocysteine (tHcy) concentrations in healthy children. Cross-sectional study by face-to-face interview. A total of 186 sixth-grade students participated from twelve randomly selected primary schools in Volos, Greece. Fasting tHcy, folate, and vitamin B(12) were measured in plasma. The MTHFR genotypes were determined. Anthropometric and dietary intake data by 24-h recall were collected. Geometric means for plasma tHcy, plasma folate and energy-adjusted dietary folate did not differ between females and males. The homozygous mutant TT genotype was associated with higher tHcy only in children with lower plasma folate concentrations (<19.9 nmol/l, P = 0.012). As a significant gender interaction was observed (P = 0.050), we stratified the lower plasma folate group by gender and found that the association between the genotype and tHcy was restricted to males (P = 0.026). Similar results were obtained when folate status was based on estimated dietary folate. Specifically, only TT males that reported lower dietary folate consumption (<37 microg/MJ/day) had tHcy that was significantly higher than tHcy levels of C-allele carriers (P = 0.001). Under conditions of lower folate status (as estimated by either plasma concentration or reported dietary consumption), gender modifies the association of the MTHFR(C677T) polymorphism with tHcy concentrations in healthy children. Kellog Europe.

Influence of Methylenetetrahydrofolate Reductase C677T Polymorphism on the Risk of Lung Cancer and the Clinical Response to Platinum-Based Chemotherapy for Advanced Non-Small Cell Lung Cancer: An Updated Meta-Analysis

PubMed Central

Zhu, Ning; Gong, Yi; He, Jian; Xia, Jingwen

2013-01-01

Purpose Methylenetetrahydrofolate reductase (MTHFR) has been implicated in lung cancer risk and response to platinum-based chemotherapy in advanced non-small cell lung cancer (NSCLC). However, the results are controversial. We performed meta-analysis to investigate the effect of MTHFR C677T polymorphism on lung cancer risk and response to platinum-based chemotherapy in advanced NSCLC. Materials and Methods The databases of PubMed, Ovid, Wanfang and Chinese Biomedicine were searched for eligible studies. Nineteen studies on MTHFR C677T polymorphism and lung cancer risk and three articles on C677T polymorphism and response to platinum-based chemotherapy in advanced NSCLC, were identified. Results The results indicated that the allelic contrast, homozygous contrast and recessive model of the MTHFR C677T polymorphism were associated significantly with increased lung cancer risk. In the subgroup analysis, the C677T polymorphism was significantly correlated with an increased risk of NSCLC, with the exception of the recessive model. The dominant model and the variant T allele showed a significant association with lung cancer susceptibility of ever smokers. Male TT homozygote carriers had a higher susceptibility, but the allelic contrast and homozygote model had a protective effect in females. No relationship was observed for SCLC in any comparison model. In addition, MTHFR 677TT homozygote carriers had a better response to platinum-based chemotherapy in advanced NSCLC in the recessive model. Conclusion The MTHFR C677T polymorphism might be a genetic marker for lung cancer risk or response to platinum-based chemotherapy in advanced NSCLC. However, our results require further verification. PMID:24142642

Gender-specific interactions of MTHFR C677T and MTRR A66G polymorphisms with overweight/obesity on serum lipid levels in a Chinese Han population.

PubMed

Zhi, Xueyuan; Yang, Boyi; Fan, Shujun; Wang, Yanxun; Wei, Jian; Zheng, Quanmei; Sun, Guifan

2016-10-28

Little is known regarding the interactions of methylenetetrahydrofolate reductase (MTHFR) C677T and methionine synthase reductase (MTRR) A66G polymorphisms with overweight/obesity on serum lipid profiles. The aim of the current study was to explore interactions between the two polymorphisms and overweight/obesity on four common lipid levels in a Chinese Han population and further to evaluate whether these interactions exhibit gender-specificity. A total of 2239 participants (750 females and 1489 males) were enrolled into this study. The genotypes of the MTHFR C677T and MTRR A66G were determined by a TaqMan assay. Overweight and obesity were defined as a body mass index between 24 and 27.99 and ≥ 28 kg/m 2 , respectively. The interactions were examined by factorial design covariance analysis, and further multiple comparisons were conducted by Bonferroni correction. There was no significant difference in the genotypic and allelic frequencies between females and males (MTHFR 677 T allele: 54.47 % for females and 54.40 % for males; MTRR 66G allele: 24.73 % for females and 24.71 % for males). Interaction between the MTHFR C677T polymorphism and overweight/obesity on serum triglyceride levels, and interaction between the MTRR A66G polymorphism and overweight/obesity on serum high-density lipoprotein cholesterol levels were detected in women (P = 0.015 and P = 0.056, respectively). For female subjects with overweight/obesity, the serum triglyceride levels in MTHFR 677TT genotype [1.09 (0.78-1.50) mmol/L] were significantly higher as compared with MTHFR 677CC genotype [0.90 (0.60-1.15) mmol/L, P = 0.007], and the MTRR 66GG genotype carriers had higher serum high-density lipoprotein cholesterol levels than those with MTRR 66AG genotype (1.46 ± 0.50 vs. 1.19 ± 0.31 mmol/L, P = 0.058). Furthermore, in male subjects with overweight/obesity, the MTHFR 677CT genotype carriers had higher low-density lipoprotein cholesterol levels than those

An Indian child with Kindler syndrome resulting from a new homozygous nonsense mutation (C468X) in the KIND1 gene.

PubMed

Sethuraman, G; Fassihi, H; Ashton, G H S; Bansal, A; Kabra, M; Sharma, V K; McGrath, J A

2005-05-01

Kindler syndrome is an inherited skin condition that presents with blistering followed by photosensitivity and a progressive poikiloderma. The disorder results from mutations in the KIND1 gene, encoding the protein kindlin-1, a recently characterized 677-amino acid protein involved in anchorage of the actin cytoskeleton to the extracellular matrix. We report the clinical features of an 11-year-old boy with Kindler syndrome from a consanguineous Indian family and the identification of a homozygous nonsense mutation (C468X) in exon 12 of the KIND1 gene in his genomic DNA. This mutation has not been described previously but is similar to the 17 previously published KIND1 mutations that are all predicted to lead to loss of kindlin-1 protein expression and function. The clinical features in this boy highlight the relevance of kindlin-1 in skin biology, specifically to epidermal adhesion and response to acute and chronic sun exposure. Delineation of this new pathogenic mutation in KIND1 is also useful for genetic counselling in this family and in assessing carrier status in unaffected family members.

[Maple syrup urine disease and gene mutations in twin neonates].

PubMed

Li, Tao; Wang, Yu; Li, Cui; Xu, Wei-Wei; Niu, Feng-Hai; Zhang, Di

2016-12-01

To investigate the clinical features of one pair of twin neonates with maple syrup urine disease (MSUD) in the Chinese Han population and pathogenic mutations in related genes, and to provide guidance for the early diagnosis and treatment of MSUD. The clinical and imaging data of the twin neonates were collected. The peripheral blood samples were collected from the twin neonates and their parents to detect the genes related to MSUD (BCKDHA, BCKDHB, DBT, and DLD). The loci with gene mutations were identified, and a bioinformatic analysis was performed. Two mutations were detected in the BCKDHB gene, missense mutation c.304G>A (p.Gly102Arg) and nonsense mutation c.331C>T (p.Arg111*), and both of them were heterozygotes. The mutation c.304G>A (p.Gly102Arg) had not been reported in the world. Their father carried the missense mutation c.304G>A (p.Gly102Arg), and their mother carried the nonsense mutation c.331C>T (p.Arg111*). The c.331C>T (p.Arg111*) heterozygous mutation in BCKDHB gene is the pathogenic mutation in these twin neonates and provides a genetic and molecular basis for the clinical features of children with MSUD.

MTHFR Gene Polymorphism-Mutations and Air Pollution as Risk Factors for Breast Cancer

PubMed Central

Gonzales, Mildred C.; Yu, Pojui; Shiao, S. Pamela K.

2017-01-01

Background The methylenetetrahydrofolate reductase gene (MTHFR) is one of the most investigated genes associated with breast cancer for its role in epigenetic pathways. Objectives The objectives of this metaprediction study were to examine the polymorphism-mutation risk subtypes of MTHFR and air pollution as contributing factors for breast cancer. Methods For triangulation purposes in metapredictive analyses, we used a recursive partition tree, nonlinear association curve fit, and heat maps for data visualization, in addition to the conventional comparison procedure and pooled analyses. Results We included 36,683 breast cancer cases and 40,689 controls across 82 studies for MTHFR 677 and 23,252 cases and 27,094 controls across 50 studies for MTHFR 1298. MTHFR 677 TT was a risk genotype for breast cancer (p = .0004) and in the East Asian subgroup (p = .005). On global maps, the most polymorphism-mutations on MTHFR 677 TT were found in the Middle East, Europe, Asia, and the Americas, whereas the most mutations on MTHFR 1298 CC were located in Europe and the Middle East for the control group. The geographic information system maps further revealed that MTHFR 677 TT mutations yielded a higher risk of breast cancer for Australia, East Asia, the Middle East, South Europe, Morocco, and the Americas and that MTHFR 1298 CC mutations yielded a higher risk in Asia, the Middle East, South Europe, and South America. Metapredictive analysis revealed that air pollution level was significantly associated with MTHFR 677 TT polymorphism-mutation genotype. Discussion We present the most comprehensive analyses to date of MTHFR polymorphism-mutations and breast cancer risk. Future nursing studies are needed to investigate the health impact on breast cancer of epigenetics and air pollution across populations. PMID:28114181

Methylenetetrahydrofolate reductase C677T polymorphism: association with risk for childhood acute lymphoblastic leukemia and response during the initial phase of chemotherapy in greek patients.

PubMed

Chatzidakis, Konstantinos; Goulas, Antonis; Athanassiadou-Piperopoulou, Fani; Fidani, Liana; Koliouskas, Dimitrios; Mirtsou, Vassiliki

2006-08-01

As of late, a number of studies have focused on the association of the gene for methyletetrahydrofolate reductase (MTHFR) with risk for acute lymphoblastic leukemia (ALL) in children and in adults, as well as with response to chemotherapy. The degree of this association may vary according to the ethnic background and geographic localization of the population under study, or the phase of treatment when response to chemotherapy is concerned. We have analyzed the MTHFR C677T polymorphism in 52 patients and 88 control individuals, all ethnic Greek residents of northern Greece, and examined the association of this polymorphism with (a) susceptibility to childhood ALL and (b) the distribution of average plasma alanine aminotransferase (ALT) levels, white blood cell counts (WBC), and hemoglobin levels (Hb) during the induction and consolidation phases of treatment. We were able to detect a statistically significant protective effect, with respect to ALL, associated with carriage of the MTHFR 677T allele [OR = 0.387 (95% CI = 0.193-0.776)]. In addition, we observed a general tendency towards lower values in all three parameters studied, associated with the MTHFR 677CC genotype, which was more evident in the transition from the induction to the consolidation phase, indicating that MTHFR genotyping may be of prognostic value in the early phase of treatment for childhood ALL, in our population.

Effects of folic acid deficiency and MTHFRC677T polymorphisms on cytotoxicity in human peripheral blood lymphocytes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu Xiayu; Liang Ziqing; Zou Tianning

2009-02-13

Apoptosis (APO) and necrosis (NEC) are two different types of cell death occurring in response to cellular stress factors. Cells with DNA damage may undergo APO or NEC. Folate is an essential micronutrient associated with DNA synthesis, repair and methylation. Methylenetetrahydrofolate reductase (MTHFR) regulates intracellular folate metabolism. Folate deficiency and MTHFR C677T polymorphisms have been shown to be related to DNA damage. To verify the cytotoxic effects of folate deficiency on cells with different MTHFR C677T genotypes, 15 human peripheral lymphocyte cases with different MTHFR C677T genotypes were cultured in folic acid (FA)-deficient and -sufficient media for 9 days. Cytotoxicitymore » was quantified using the frequencies of APO and NEC as endpoints, the nuclear division index (NDI), and the number of viable cells (NVC). These results showed that FA is an important factor in reducing cytotoxicity and increasing cell proliferation. Lymphocytes with the TT genotype proliferated easily under stress and exhibited different responses to FA deficiency than lymphocytes with the CC and CT genotypes. A TT individual may accumulate more cytotoxicity under cytotoxic stress, suggesting that the effects of FA deficiency on cytotoxicity are greater than the effects in individuals with the other MTHFR C677T variants.« less

Compound Heterozygosity for Hb Alperton (HBB: c.407C>T) and IVS-I-5 (G>C) (HBB: c.92+5G>C) Mutations Presenting as a Moderate Anemia in an Indian Family.

PubMed

Godbole, Koumudi G; Ramachandran, Angelina; Karkamkar, Ashwini S; Dalal, Ashwin B

2018-04-13

While knowledge of HBB gene mutations is necessary for offering prenatal diagnosis (PND) of β-thalassemia (β-thal), a genotype-phenotype correlation may not always be available for rare variants. We present for the first time, genotype-phenotype correlation for a compound heterozygous status with IVS-I-5 (G>C) (HBB: c.92+5G>C) and HBB: c.407C>T (Hb Alperton) mutations on the HBB gene in an Indian family. Hb Alperton is a very rare hemoglobin (Hb) variant with scant published information about its clinical presentation, especially when accompanied with another HBB gene mutation. Here we provide biochemical as well as clinical details of this variant.

Methylenetetrahydrofolate reductase C677T polymorphism predicts response and time to progression to gemcitabine-based chemotherapy for advanced non-small cell lung cancer in a Chinese Han population*

PubMed Central

Hong, Wei; Wang, Kai; Zhang, Yi-ping; Kou, Jun-yan; Hong, Dan; Su, Dan; Mao, Wei-min; Yu, Xin-min; Xie, Fa-jun; Wang, Xiao-jian

2013-01-01

Objective: The aim of this study was to evaluate the association between the methylenetetrahydrofolate reductase (MTHFR) C677T excision repair cross-complementation group 1 (ERCC1) genetic polymorphisms and the clinical efficacy of gemcitabine-based chemotherapy in advanced non-small cell lung cancer (NSCLC). Methods: A total of 135 chemonaive patients with unresectable advanced NSCLC were treated with gemcitabine/platinum regimens. The polymorphisms of MTHFR C677T, ERCC1 C8092A, and ERCC1 C118T were genotyped using the TaqMan methods. Results: The overall response rate was 28.9%. Patients with MTHFR CC genotype had a higher rate of objective response than patients with variant genotype (TT or CT) (41.2% versus 19.1%, P=0.01). Median time to progression (TTP) of patients with MTHFR CC genotype was longer than that of patients with variant genotype (7.6 months versus 5.0 months, P=0.003). No significant associations were obtained between ERCC1 C118T and C8092A polymorphisms and both response and survival. Conclusions: Our data suggest the value of MTHFR C677T polymorphism as a possible predictive marker of response and TTP in advanced NSCLC patients treated with gemcitabine/platinum. PMID:23463763

In vivo levels of S-adenosylmethionine modulate C:G to T:A mutations associated with repeat-induced point mutation in Neurospora crassa.

PubMed

Rosa, Alberto Luis; Folco, Hernán Diego; Mautino, Mario Ricardo

2004-04-14

In Neurospora crassa, the mutagenic process termed repeat-induced point mutation (RIP) inactivates duplicated DNA sequences during the sexual cycle by the introduction of C:G to T:A transition mutations. In this work, we have used a collection of N. crassa strains exhibiting a wide range of cellular levels of S-adenosylmethionine (AdoMet), the universal donor of methyl groups, to explore whether frequencies of RIP are dependent on the cellular levels of this metabolite. Mutant strains met-7 and eth-1 carry mutations in genes of the AdoMet pathway and have low levels of AdoMet. Wild type strains with high levels of AdoMet were constructed by introducing a chimeric transgene of the AdoMet synthetase (AdoMet-S) gene fused to the constitutive promoter trpC from Aspergillus nidulans. Crosses of these strains against tester duplications of the pan-2 and am genes showed that frequencies of RIP, as well as the total number of C:G to T:A transition mutations found in randomly selected am(RIP) alleles, are inversely correlated to the cellular level of AdoMet. These results indicate that AdoMet modulates the biochemical pathway leading to RIP.

MTHFR Functional Polymorphism C677T and Genomic Instability in the Etiology of Idiopathic Autism in Simplex Families

DTIC Science & Technology

2014-12-01

facts that de novo CNVs rates are consistently high in SPX ASD (5.8%-10.2%) versus familial ASD (2-3%), we hypothesize that low-activity MTHFR 677T...allele leads to increase global DNA hypomethylation and consequently results in increased generation of de novo CNVs bringing about a higher risk for...developing sporadic cases of autism. We proposed to test 1) the association of MTHFR 677T allele with rate of ASD related de novo CNVs ; 2) the

ACE I/D sequence variants but not MTHFR C677T, is strongly linked to malignant glioma risk and its variant DD genotype may act as a promising predictive biomarker for overall survival of glioma patients.

PubMed

Pandith, Arshad A; Qasim, Iqbal; Zahoor, Wani; Shah, Parveen; Bhat, Abdul R

2018-01-10

ACE I/D and MTHFR C677T gene polymorphisms can be seen as candidate genes for glioma on the basis of their biological functions and their involvement in different cancers. The aim of this study was to analyze potential association and overall survival between MTHFR C677T and ACE I/D polymorphism in glioma patients in our population. We tested genotype distribution of 112 glioma patients against 141 cancer-free controls from the same region. Kaplan-Meier survival analysis was performed to evaluate overall survival of patients for both genes. No significant differences were found among MTHFR C677T wild type C and variant genotypes CT/TT with glioma patients. In ACE, the distribution of variant ID and DD was found to be significantly higher in glioma cases as compared to controls (p<0.0001). ACE DD genotypes were highly presented in glioma cases 26.8% versus 10.6% in controls (p<0.0001) and conferred 5-fold risk for predisposition in glioma cases. Per copy D allele frequency was found higher in cases than in controls (0.54 versus 0.25: p<0.0001). Interestingly we found a significant overall survival (with log rank p<0.01) in patients who presented with ACE DD genotypes had the least estimated overall survival of 13.4months in comparison to 21. 7 and 17.6months for ACE II and I/D genotypes respectively. We conclude ACE I/D polymorphism plays a vital role in predisposition of higher risk for glioma. We also suggest that ACE DD genotypes may act as an important predictive biomarker for overall survival of glioma patients. Copyright © 2017. Published by Elsevier B.V.

Haplotype analysis suggest that the MLH1 c.2059C > T mutation is a Swedish founder mutation.

PubMed

von Salomé, Jenny; Liu, Tao; Keihäs, Markku; Morak, Moni; Holinski-Feder, Elke; Berry, Ian R; Moilanen, Jukka S; Baert-Desurmont, Stéphanie; Lindblom, Annika; Lagerstedt-Robinson, Kristina

2017-12-29

Lynch syndrome (LS) predisposes to a spectrum of cancers and increases the lifetime risk of developing colorectal- or endometrial cancer to over 50%. Lynch syndrome is dominantly inherited and is caused by defects in DNA mismatch-repair genes MLH1, MSH2, MSH6 or PMS2, with the vast majority detected in MLH1 and MSH2. Recurrent LS-associated variants observed in apparently unrelated individuals, have either arisen de novo in different families due to mutation hotspots, or are inherited from a founder (a common ancestor) that lived several generations back. There are variants that recur in some populations while also acting as founders in other ethnic groups. Testing for founder mutations can facilitate molecular diagnosis of Lynch Syndrome more efficiently and more cost effective than screening for all possible mutations. Here we report a study of the missense mutation MLH1 c.2059C > T (p.Arg687Trp), a potential founder mutation identified in eight Swedish families and one Finnish family with Swedish ancestors. Haplotype analysis confirmed that the Finnish and Swedish families shared a haplotype of between 0.9 and 2.8 Mb. While MLH1 c.2059C > T exists worldwide, the Swedish haplotype was not found among mutation carriers from Germany or France, which indicates a common founder in the Swedish population. The geographic distribution of MLH1 c.2059C > T in Sweden suggests a single, ancient mutational event in the northern part of Sweden.

Subacute methotrexate neurotoxicity and cerebral venous sinus thrombosis in a 12-year-old with acute lymphoblastic leukemia and methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism: homocysteine-mediated methotrexate neurotoxicity via direct endothelial injury.

PubMed

Mahadeo, Kris M; Dhall, Girish; Panigrahy, Ashok; Lastra, Carlos; Ettinger, Lawrence J

2010-02-01

From as early as the 1970s methotrexate has been associated with disseminated necrotizing leukoencephalopathy and other neurotoxic sequelae. Yet, a clear mechanism for methotrexate-induced neurotoxicity has not been established. The authors describe the case of a 12-year-old male with acute lymphoblastic leukemia and a homozygous methylenetetrahydrofolate reductase C677T mutation, who developed subacute methotrexate-induced toxicity and cerebral venous thrombosis after receiving intrathecal methotrexate. The role of homocysteine as a possible mediator in methotrexate-induced neurotoxicity via direct endothelial injury is discussed.

MERRF/MELAS overlap syndrome due to the m.3291T>C mutation.

PubMed

Liu, Kaiming; Zhao, Hui; Ji, Kunqian; Yan, Chuanzhu

2014-03-01

We report the case of a 19-year-old Chinese female harboring the m.3291T>C mutation in the MT-TL1 gene encoding the mitochondrial transfer RNA for leucine. She presented with a complex phenotype characterized by progressive cerebellar ataxia, frequent myoclonus seizures, recurrent stroke-like episodes, migraine-like headaches with nausea and vomiting, and elevated resting lactate blood level. It is known that the myoclonus epilepsy with ragged-red fibers (MERRF) is characterized by cerebellar ataxia and myoclonus epilepsy, while that the mitochondrial encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) is characterized by recurrent stroke-like episodes, migraine-like headaches, and elevated resting lactate blood level. So the patient's clinical manifestations suggest the presence of a MERRF/MELAS overlap syndrome. Muscle biopsy of the patient showed the presence of numerous scattered ragged-red fibers, some cytochrome c oxidase-deficient fibers, and several strongly succinate dehygrogenase-reactive vessels, suggestive of a mitochondrial disorder. Direct sequencing of the complete mitochondrial genome of the proband revealed no mutations other than the T-to-C transition at nucleotide position 3291. Restriction fragment length polymorphism analysis of the proband and her family revealed maternal inheritance of the mutation in a heteroplasmic manner. The analysis of aerobic respiration and glycolysis demonstrated that the fibroblasts from the patient had mitochondrial dysfunction. Our results suggest that the m.3291T>C is pathogenic. This study is the first to describe the m.3291T>C mutation in association with the MERRF/MELAS overlap syndrome.

Novel mutations in the USH1C gene in Usher syndrome patients.

PubMed

Aparisi, María José; García-García, Gema; Jaijo, Teresa; Rodrigo, Regina; Graziano, Claudio; Seri, Marco; Simsek, Tulay; Simsek, Enver; Bernal, Sara; Baiget, Montserrat; Pérez-Garrigues, Herminio; Aller, Elena; Millán, José María

2010-12-31

Usher syndrome type I (USH1) is an autosomal recessive disorder characterized by severe-profound sensorineural hearing loss, retinitis pigmentosa, and vestibular areflexia. To date, five USH1 genes have been identified. One of these genes is Usher syndrome 1C (USH1C), which encodes a protein, harmonin, containing PDZ domains. The aim of the present work was the mutation screening of the USH1C gene in a cohort of 33 Usher syndrome patients, to identify the genetic cause of the disease and to determine the relative involvement of this gene in USH1 pathogenesis in the Spanish population. Thirty-three patients were screened for mutations in the USH1C gene by direct sequencing. Some had already been screened for mutations in the other known USH1 genes (myosin VIIA [MYO7A], cadherin-related 23 [CDH23], protocadherin-related 15 [PCDH15], and Usher syndrome 1G [USH1G]), but no mutation was found. Two novel mutations were found in the USH1C gene: a non-sense mutation (p.C224X) and a frame-shift mutation (p.D124TfsX7). These mutations were found in a homozygous state in two unrelated USH1 patients. In the present study, we detected two novel pathogenic mutations in the USH1C gene. Our results suggest that mutations in USH1C are responsible for 1.5% of USH1 disease in patients of Spanish origin (considering the total cohort of 65 Spanish USH1 patients since 2005), indicating that USH1C is a rare form of USH in this population.

Novel mutations in the USH1C gene in Usher syndrome patients

PubMed Central

Aparisi, María José; García-García, Gema; Jaijo, Teresa; Rodrigo, Regina; Graziano, Claudio; Seri, Marco; Simsek, Tulay; Simsek, Enver; Bernal, Sara; Baiget, Montserrat; Pérez-Garrigues, Herminio; Millán, José María

2010-01-01

Purpose Usher syndrome type I (USH1) is an autosomal recessive disorder characterized by severe-profound sensorineural hearing loss, retinitis pigmentosa, and vestibular areflexia. To date, five USH1 genes have been identified. One of these genes is Usher syndrome 1C (USH1C), which encodes a protein, harmonin, containing PDZ domains. The aim of the present work was the mutation screening of the USH1C gene in a cohort of 33 Usher syndrome patients, to identify the genetic cause of the disease and to determine the relative involvement of this gene in USH1 pathogenesis in the Spanish population. Methods Thirty-three patients were screened for mutations in the USH1C gene by direct sequencing. Some had already been screened for mutations in the other known USH1 genes (myosin VIIA [MYO7A], cadherin-related 23 [CDH23], protocadherin-related 15 [PCDH15], and Usher syndrome 1G [USH1G]), but no mutation was found. Results Two novel mutations were found in the USH1C gene: a non-sense mutation (p.C224X) and a frame-shift mutation (p.D124TfsX7). These mutations were found in a homozygous state in two unrelated USH1 patients. Conclusions In the present study, we detected two novel pathogenic mutations in the USH1C gene. Our results suggest that mutations in USH1C are responsible for 1.5% of USH1 disease in patients of Spanish origin (considering the total cohort of 65 Spanish USH1 patients since 2005), indicating that USH1C is a rare form of USH in this population. PMID:21203349

Involvement of MTHFR and TPMT genes in susceptibility to childhood acute lymphoblastic leukemia (ALL) in Mexicans.

PubMed

Gutiérrez-Álvarez, Ossyneidee; Lares-Asseff, Ismael; Galaviz-Hernández, Carlos; Reyes-Espinoza, Elio-Aarón; Almanza-Reyes, Horacio; Sosa-Macías, Martha; Chairez Hernández, Isaías; Salas-Pacheco, José-Manuel; Bailón-Soto, Claudia E

2016-03-01

Folate metabolism plays an essential role in the processes of DNA synthesis and methylation. Deviations in the folate flux resulting from single-nucleotide polymorphisms in genes encoding folate-dependent enzymes may affect the susceptibility to leukemia. This case-control study aimed to assess associations among MTHFR (C677T, A1298C) and TPMT (*2, *3A) mutations as well as to evaluate the synergistic effects of combined genotypes for both genes. Therefore, these genetic variants may lead to childhood acute lymphoblastic leukemia (ALL) susceptibility, in a Mexican population study. DNA samples obtained from 70 children with ALL and 152 age-matched controls (range, 1-15 years) were analyzed by real-time reverse transcription polymerase chain reaction (RT-qPCR) to detect MTHFR C677T and A1298C and TPMT*2 and TPMT*3A genotypes. The frequency of the MTHFR A1298C CC genotype was statistically significant (odds ratio [OR], 6.48; 95% 95% confidence intervals [CI], 1.26-33.2; p=0.025). In addition, the combined 677CC+1298AC genotype exhibited a statistically significant result (OR, 0.23; 95% CI, 0.06-0.82; p=0.023). No significant results were obtained from the MTHFR (C677T CT, C677T TT) or TPMT (*2, *3A) genotypes. More importantly, no association between the synergistic effects of either gene (MTHFR and/or TPMT) and susceptibility to ALL was found. The MTHFR A1298C CC genotype was associated with an increased risk of developing childhood ALL. However, a decreased risk to ALL with the combination of MTHFR 677CC+1298AC genotypes was found.

Meta-Prediction of MTHFR Gene Polymorphism Mutations and Associated Risk for Colorectal Cancer

PubMed Central

Yu, C. H.

2016-01-01

The methylenetetrahydrofolate reductase (MTHFR) gene is one of the most investigated of the genes associated with chronic human diseases because of its associations with hyperhomocysteinemia and toxicity. It has been proposed as a prototype gene for the prevention of colorectal cancer (CRC). The major objectives of this meta-analysis were to examine the polymorphism-mutation patterns of MTHFR and their associations with risk for CRC as well as potential contributing factors for mutations and disease risks. This analysis included 33,626 CRC cases and 48,688 controls across 92 studies for MTHFR 677 and 16,367 cases and 24,874 controls across 54 studies for MTHFR 1298, comprising data for various racial and ethnic groups, both genders, and multiple cancer sites. MTHFR 677 homozygous TT genotype was protective (p < .05) for CRC for all included populations; however, with heterogeneity across various racial–ethnic groups and opposing findings, it was a risk genotype for the subgroup of Hispanics (p < .01). Additional countries for which subgroup analyses resulted in 677 TT as a risk genotype included Turkey, Romania, Croatia, Hungary, Portugal, Mexico, Brazil, U.S. Hawai’i, Taiwan, India, and Egypt. Countries with the highest mutation rates and risks for both MTHFR 677 and 1298 genotypes are presented using global maps to visualize the grouping patterns. Meta-predictive analyses revealed that air pollution levels were associated with gene polymorphisms for both genotypes. Future nursing research should be conducted to develop proactive measures to protect populations in cities where air pollution causes more deaths. PMID:26858257

DNA polymerase θ contributes to the generation of C/G mutations during somatic hypermutation of Ig genes

PubMed Central

Masuda, Keiji; Ouchida, Rika; Takeuchi, Arata; Saito, Takashi; Koseki, Haruhiko; Kawamura, Kiyoko; Tagawa, Masatoshi; Tokuhisa, Takeshi; Azuma, Takachika; O-Wang, Jiyang

2005-01-01

Somatic hypermutation of Ig variable region genes is initiated by activation-induced cytidine deaminase; however, the activity of multiple DNA polymerases is required to ultimately introduce mutations. DNA polymerase η (Polη) has been implicated in mutations at A/T, but polymerases involved in C/G mutations have not been identified. We have generated mutant mice expressing DNA polymerase (Polθ) specifically devoid of polymerase activity. Compared with WT mice, Polq-inactive (Polq, the gene encoding Polθ) mice exhibited a reduced level of serum IgM and IgG1. The mutant mice mounted relatively normal primary and secondary immune responses to a T-dependent antigen, but the production of high-affinity specific antibodies was partially impaired. Analysis of the JH4 intronic sequences revealed a slight reduction in the overall mutation frequency in Polq-inactive mice. Remarkably, although mutations at A/T were unaffected, mutations at C/G were significantly decreased, indicating an important, albeit not exclusive, role for Polθ activity. The reduction of C/G mutations was particularly focused on the intrinsic somatic hypermutation hotspots and both transitions and transversions were similarly reduced. These findings, together with the recent observation that Polθ efficiently catalyzes the bypass of abasic sites, lead us to propose that Polθ introduces mutations at C/G by replicating over abasic sites generated via uracil-DNA glycosylase. PMID:16172387

MTHFR Gene Polymorphism-Mutations and Air Pollution as Risk Factors for Breast Cancer: A Metaprediction Study.

PubMed

Gonzales, Mildred C; Yu, Pojui; Shiao, S Pamela K

The methylenetetrahydrofolate reductase gene (MTHFR) is one of the most investigated genes associated with breast cancer for its role in epigenetic pathways. The objectives of this metaprediction study were to examine the polymorphism-mutation risk subtypes of MTHFR and air pollution as contributing factors for breast cancer. For triangulation purposes in metapredictive analyses, we used a recursive partition tree, nonlinear association curve fit, and heat maps for data visualization, in addition to the conventional comparison procedure and pooled analyses. We included 36,683 breast cancer cases and 40,689 controls across 82 studies for MTHFR 677 and 23,252 cases and 27,094 controls across 50 studies for MTHFR 1298. MTHFR 677 TT was a risk genotype for breast cancer (p = .0004) and in the East Asian subgroup (p = .005). On global maps, the most polymorphism-mutations on MTHFR 677 TT were found in the Middle East, Europe, Asia, and the Americas, whereas the most mutations on MTHFR 1298 CC were located in Europe and the Middle East for the control group. The geographic information system maps further revealed that MTHFR 677 TT mutations yielded a higher risk of breast cancer for Australia, East Asia, the Middle East, South Europe, Morocco, and the Americas and that MTHFR 1298 CC mutations yielded a higher risk in Asia, the Middle East, South Europe, and South America. Metapredictive analysis revealed that air pollution level was significantly associated with MTHFR 677 TT polymorphism-mutation genotype. We present the most comprehensive analyses to date of MTHFR polymorphism-mutations and breast cancer risk. Future nursing studies are needed to investigate the health impact on breast cancer of epigenetics and air pollution across populations.

[Gene mutation analysis and prenatal diagnosis of a family with Bartter syndrome].

PubMed

Li, Long; Ma, Na; Li, Xiu-Rong; Gong, Fei; DU, Juan

2016-08-01

To investigate the mutation of related genes and prenatal diagnosis of a family with Bartter syndrome (BS). The high-throughput capture sequencing technique and PCR-Sanger sequencing were used to detect pathogenic genes in the proband of this family and analyze the whole family at the genomic level. After the genetic cause was clarified, the amniotic fluid was collected from the proband's mother who was pregnant for 5 months for prenatal diagnosis. The proband carried compound heterozygous mutations of c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene; c.88C>T(p.Arg30*) had been reported as a pathogenic mutation, and c.968+2T>A was a new mutation. Pedigree analysis showed that the two mutations were inherited from the mother and father, respectively. Prenatal diagnosis showed that the fetus did not inherit the mutations from parents and had no mutations at the two loci. The follow-up visit confirmed that the infant was in a healthy state, which proved the accuracy of genetic diagnosis and prenatal diagnosis. The compound heterozygous mutations c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene are the cause of BS in the proband, and prenatal diagnosis can prevent the risk of recurrence of BS in this family.

Effects of Common Polymorphisms in the MTHFR and ACE Genes on Diabetic Peripheral Neuropathy Progression: a Meta-Analysis.

PubMed

Wu, Shuai; Han, Yan; Hu, Qiang; Zhang, Xiaojie; Cui, Guangcheng; Li, Zezhi; Guan, Yangtai

2017-05-01

Diabetic peripheral neuropathy (DPN) is a microvascular complication of diabetes mellitus. The aim of this meta-analysis was to evaluate the effects of methylenetetrahydrofolate reductase (MTHFR) 677 C>T and ACE I/D polymorphisms in the development of DPN. We systematically reviewed published studies on MTHFR 677 C>T and ACE I/D polymorphisms and DPN found in various types of electronic databases. Strengthening the Reporting of Observational studies in Epidemiology (STROBE) quality score systems were used to determine the quality of the articles selected for inclusion. Odds ratios (ORs) and its corresponding 95 % confidence interval (95 % CI) were calculated. We used STATA statistical software (version 12.0, Stata Corporation, College Station, TX, USA) to deal with statistical data. Our results indicated an association of ACE D>I mutation (OR = 1.43, 95 % CI 1.12-1.83, P = 0.004) and MTHFR 677 C>T mutation (OR = 1.43, 95 % CI 1.08-1.90, P = 0.014) with DPN under the allele model, and similar results were also found under the dominant model (all P < 0.05). Subgroup analysis by country indicated that the MTHFR 677 C>T polymorphism may be the main risk factor for DPN in Turkey under four genetic models. ACE D>I mutation was correlated with DPN in Japanese and Pakistani populations in the majority of groups. The relationships of MTHFR 677 C>T and ACE I/D polymorphisms with DPN patients presented in this meta-analyses support the view that the MTHFR and ACE genes might play an important role in the development of DPN.

The Frequency of c.550delA Mutation of the CANP3 Gene in the Polish LGMD2A Population.

PubMed

Dorobek, Małgorzata; Ryniewicz, Barbara; Kabzińska, Dagmara; Fidziańska, Anna; Styczyńska, Maria; Hausmanowa-Petrusewicz, Irena

2015-11-01

Limb girdle muscular dystrophy 2A (LGMD2A) is the most frequent LGMD variant in the European population, representing about 40% of LGMD. The c.550delA mutation in the CANP3 (calcium activated neutral protease 3) gene is the most commonly reported mutation in LGMD2A. Prevalence of this mutation in the Polish population has not been previously investigated. The aim of this study was to identify and estimate the frequency of the c.550delA mutation in Polish LGMD2A patients. Polymerase chain reaction-sequencing analysis, restriction fragment length polymorphism polymerase chain reaction method. We analyzed 76 families affected with LGMD and identified 62 probands with mutations in the CANP3 gene. C.550delA was the most common mutation identified, being found in 78% of the LGMD2A families. The remaining mutations observed multiple times were as follows: c.598-612del15ntd; c.2242C>T; c.418dupC; c.1356insT, listed in terms of decreasing frequency. Two novel variants in the CANP3 gene, that is, c.700G>A Gly234Arg and c.661G>A Gly221Ser were also characterized. Overall, mutations in the LGMD2A gene were estimated to be present in 81% of patients with the LGMD phenotype who were without sarcoglycans and dysferlin deficiency on immunocytochemical analysis. The frequency of the heterozygous c.550delA mutation in the healthy Polish population was estimated at 1/124. The c.550delA is the most frequent CANP3 mutation in the Polish population, thus sequencing of exon 4 of this gene could identify the majority of LGMD2A patients in Poland.

The hepcidin gene promoter nc.-1010C > T; -582A > G haplotype modulates serum ferritin in individuals carrying the common H63D mutation in HFE gene.

PubMed

Silva, Bruno; Pita, Lina; Gomes, Susana; Gonçalves, João; Faustino, Paula

2014-12-01

Hereditary hemochromatosis is an autosomal recessive disorder characterized by severe iron overload. It is usually associated with homozygosity for the HFE gene mutation c.845G > A; p.C282Y. However, in some cases, another HFE mutation (c.187C > G; p.H63D) seems to be associated with the disease. Its penetrance is very low, suggesting the possibility of other iron genetic modulators being involved. In this work, we have screened for HAMP promoter polymorphisms in 409 individuals presenting normal or increased serum ferritin levels together with normal or H63D-mutated HFE genotypes. Our results show that the hepcidin gene promoter TG haplotype, originated by linkage of the nc.-1010C > T and nc.-582A > G polymorphisms, is more frequent in the HFE_H63D individuals presenting serum ferritin levels higher than 300 μg/L than in those presenting the HFE_H63D mutation but with normal serum ferritin levels or in the normal control group.Moreover, it was observed that the TG haplotype was associated to increased serum ferritin levels in the overall pool of HFE_H63D individuals. Thus, our data suggest that screening for these polymorphisms could be of interest in order to explain the phenotype. However, this genetic condition seems to have no clinical significance.

Association of 5, 10- methylenetetrahydrofolate reductase C677T polymorphism in susceptibility to tropical chronic pancreatitis in north Indian population.

PubMed

Singh, S; Choudhuri, G; Kumar, R; Agarwal, S

2012-12-22

MTHFR is a key enzyme in folate metabolism that catalyzes the conversion of 5, 10—methlenetetrahydrofolate (5, 10— methylene THF) to 5—methyltetrahydrofolate (5—methyl THF), a predominant circulatory form of folate and methyl donor for the remethylation of homocysteine to methionine. Some studies have shown that C667T polymorphism increases the risk of pancreatic cancer. Since MTHFR is involved in methylation, inflammation and protection against oxidative stress, the processes especially important for pancreatic homeostasis. The altered enzyme activity could play a role in pancreatic injury. The role of MTHFR C677T polymorphism in chronic pancreatitis has been explored by conducting a hospital based; case—control study involving 100 patients radiologically confirmed chronic pancreatitis and 329 healthy controls. All samples were analyzed for MTHFR C677T polymorphism using PCR—RFLP method. Restriction enzyme Hinf I was used to digest the 198 bp amplified product. The frequency of the MTHFR was 57.3%, 34.1% and 8.5% among cases compared with 87.2%,11.2% and 1.5% of controls for CC, CT and TT genotypes, respectively. The T Allele frequency was found significantly higher in patients than in controls. A significant association with T allele was observed with p—value (< 0.0001) odds ratio 4.475 and (95% CI=2.961—7.046). It could be predisposing to the traditional risk factors such as diabetes, dietary, alcohal and smoking habit that are known to be associated with chronic pancreatitis. Additionally it was observed that smoking increases the risk of chronic pancreatitis by 4.1 times. The T allele frequency of MTHFR (C667T) was found to be a significant risk factor for chronic pancreatitis playing a crucial role in altered folate metabolsim.

MTHFR Functional Polymorphism C677T and Genomic Instability in the Etiology of Idiopathic Autism in Simplex Families. Revision

DTIC Science & Technology

2013-10-01

that de novo CNVs rates are consistently high in SPX ASD (5.8%-10.2%) versus familial ASD (2-3%), we hypothesize that low-activity MTHFR 677T allele...leads to increase global DNA hypomethylation and consequently results in increased generation of de novo CNVs bringing about a higher risk for...developing sporadic cases of autism. We proposed to test 1) the association of MTHFR 677T allele with rate of ASD related de novo CNVs ; 2) the

The contribution of the SPINK1 c.194+2T>C mutation to the clinical course of idiopathic chronic pancreatitis in Chinese patients.

PubMed

Sun, Chang; Liao, Zhuan; Jiang, Lili; Yang, Fu; Xue, Geng; Zhou, Qi; Chen, Ruiwen; Sun, Shuhan; Li, Zhaoshen

2013-01-01

Recent data suggest that the serine protease inhibitor Kazal type 1 (SPINK1) gene mutation is associated with idiopathic chronic pancreatitis. However, few studies have focused on the serine protease inhibitor Kazal type 1 c.194+2T>C mutation. Therefore, our goal was to study the prevalence and impact of serine protease inhibitor Kazal type 1 mutations on the clinical profile of idiopathic chronic pancreatitis patients in China. A retrospective-cohort study of 118 Chinese patients with idiopathic chronic pancreatitis was performed, and genetic tests were carried out to detect SPINK1 mutations. Subjects without pancreatitis were used as controls. In total, 118 idiopathic chronic pancreatitis patients and 100 control subjects were evaluated. The serine protease inhibitor Kazal type 1 c.194+2T>C variant was present in 44.9% of patients with idiopathic chronic pancreatitis. The frequency of diabetes in idiopathic chronic pancreatitis patients with the serine protease inhibitor Kazal type 1 c.194+2T>C mutation (39.6%) was higher than that of patients without the mutation (9.2%). The time to occurrence of diabetes mellitus after idiopathic chronic pancreatitis symptom onset is significantly influenced by the c.194+2T>C mutation (p<0.001). In addition, the mean age of diabetes onset in patients with the serine protease inhibitor Kazal type 1 c.194+2T>C mutation (38.33 ± 9.50) was significantly younger than that of patients without this mutation (49.67 ± 6.74). The presence of the serine protease inhibitor Kazal type 1 c.194+2T>C mutation seems to be associated with idiopathic chronic pancreatitis and could predispose individuals to pancreatic diabetes onset at an earlier age. Copyright © 2012 Editrice Gastroenterologica Italiana S.r.l. Published by Elsevier Ltd. All rights reserved.

A Novel c.125 T>G (p.Val42Gly) Mutation in The Human INS Gene Leads to Neonatal Diabetes Mellitus via a Decrease in Insulin Synthesis.

PubMed

Sun, Fei; Du, Wenhua; Ma, Junhua; Gu, Mingjun; Wang, Jingnan; Zhu, Hongling; Song, Huaidong; Gao, Guanqi

2018-06-11

Neonatal diabetes mellitus is likely caused by monogenic mutations, several of which have been identified. INS mutations have a broad spectrum of clinical presentations, ranging from severe neonatal onset to mild adult onset, which suggests that the products of different mutant INS alleles behave differently and utilize distinct mechanisms to induce diabetes. In this study, a neonatal diabetes mellitus patient's INS gene was sequenced, and functional experiments were conducted. The neonatal diabetes mellitus patient's genomic DNA was extracted, and the patient's KCNJ11, ABCC8, and INS genes were sequenced. A novel mutation was identified in INS, and the open reading frame of this human mutant INS gene was inserted into the pMSCV-PIG plasmid. The constructed pMSCV-PIG plasmid was combined with VSV-g and Gag-pol and transfected into 293T cells to package the lentivirus. To stably overexpress the mutant gene, INS-1 cells were infected with the virus. The levels of insulin in the cell culture medium and cytoplasm were determined by ELISA and immunocytochemistry, respectively. A heterozygous mutation, c.125T>G (p. Val42Gly), was identified in a neonatal diabetes mellitus patient's INS gene. The human mutant INS open reading frame was overexpressed in INS-1 cells, and the mutant insulin was undetectable in the cell culture medium and cytoplasm. The novel heterozygous activating mutation c.125 T>G (p.Val42Gly) impairs the synthesis of insulin by pancreatic beta cells, resulting in diabetes. © Georg Thieme Verlag KG Stuttgart · New York.

Hemolysis and Mediterranean G6PD mutation (c.563 C>T) and c.1311 C>T polymorphism among Palestinians at Gaza Strip.

PubMed

Sirdah, Mahmoud; Reading, N Scott; Perkins, Sherrie L; Shubair, Mohammad; Aboud, Lina; Prchal, Josef T

2012-04-15

The G6PD c.563 C>T deficient mutation is endemic among Mediterranean populations but its clinical significance is not well delineated. We set up to estimate the proportion of G6PD deficient children presenting with hemolytic anemia at Al Nasser Pediatric Hospital at Gaza Strip, Palestine. We then established the prevalence of c.563T Mediterranean mutation and its linkage to c.1311 C>T polymorphism in this population. G6PD deficiency was identified in children presenting with hemolytic anemia at Al Nasser Pediatric Hospital by spectrophotometric measurement of G6PD activity. G6PD exon 6 and exon 11 were amplified from genomic DNA and evaluated for c.563T mutation by sequencing and the c.1311T polymorphism by restriction fragment analysis. Seventy X-chromosomes (60 males and 5 females) from G6PD deficient patients and 40 X-chromosomes from a control group known to be not G6PD deficient were tested. Over 80% of these children presenting with hemolytic anemia were G6PD deficient and 34% of these had the Mediterranean G6PD deficient variant. The allelic frequencies of Mediterranean c.563T and c.1311T polymorphisms among G6PD deficient patients were 0.33 and 0.38 respectively. The c.1311T polymorphism was linked in 95.2% of patients with the Mediterranean mutation, an allele frequency of 0.87, compared to the control non-G6PD deficient group with an allele frequency of 0.18. We conclude that G6PD deficiency accounts for majority of hemolytic anemia encountered in Gaza children treated at Al Nasser Pediatric Hospital Emergency department. The Mediterranean mutation c.563T, while not accounting for a majority of G6PD deficiency, is common among G6PD deficient Gaza Strip Palestinians and is frequently, but not always, linked to the c.1311T polymorphism. This work provides a foundation for the population screening of Palestinians for G6PD deficiency and for investigations of ancestral origin of the Mediterranean variant in world populations. Copyright © 2012 Elsevier Inc

Supplementation with Watermelon Extract Reduces Total Cholesterol and LDL Cholesterol in Adults with Dyslipidemia under the Influence of the MTHFR C677T Polymorphism.

PubMed

Massa, Nayara M L; Silva, Alexandre S; de Oliveira, Caio V C; Costa, Maria J C; Persuhn, Darlene C; Barbosa, Carlos V S; Gonçalves, Maria da C R

2016-08-01

Dyslipidemia and genetic polymorphisms are associated with increased risk for developing cardiovascular diseases, and watermelon appears to have the potential to improve hyperlipidemia due to the presence of nutrients such as arginine and citrulline. To test the hypolipidemic effect of watermelon extract (Citrullus lanatus) and the influence of the methylenetetrahydrofolate reductase genotype (MTHFR C677T) on supplementation response. This is an experimental clinical phase II randomized and double-blind study. Forty-three subjects with dyslipidemia were randomly divided into 2 groups: experimental (n = 22) and control (n = 21) groups. The subjects were supplemented daily for 42 days with 6 g of watermelon extract or a mixture of carbohydrates (sucrose/glucose/fructose). The use of watermelon extract reduced plasma total cholesterol (p < 0.05) and low-density lipoprotein (p < 0.01) without modifying triglycerides, high-density lipoprotein, and very low-density lipoprotein values. Only carriers of the T allele (MTHFR C677T) showed decreasing concentrations of low-density lipoprotein (p < 0.01). No changes in anthropometric parameters analyzed were observed. This is the first study to demonstrate the beneficial effect of the consumption of watermelon extract in reducing plasma levels of lipids in humans. The MTHFR C677T polymorphism did not affect the plasma lipid concentration but made individuals more responsive to treatment with watermelon. The consumption of this functional food represents an alternative therapy in the combined treatment of patients with dyslipidemia, promoting health and minimizing the development of risk factors for cardiovascular diseases.

Status of Vitamins B-12 and B-6 but Not of Folate, Homocysteine, and the Methylenetetrahydrofolate Reductase C677T Polymorphism Are Associated with Impaired Cognition and Depression in Adults123

PubMed Central

Moorthy, Denish; Peter, Inga; Scott, Tammy M.; Parnell, Laurence D.; Lai, Chao-Qiang; Crott, Jimmy W.; Ordovás, José M.; Selhub, Jacob; Griffith, John; Rosenberg, Irwin H.; Tucker, Katherine L.; Troen, Aron M.

2012-01-01

The C677T polymorphism of the methylenetetrahydrofolate reductase (MTHFR) gene differs in frequency in various ethnic groups that have differing prevalence of age-related cognitive impairments. We used a series of neuro-psychological tests to examine the association of the MTHFR C677T polymorphism with cognition and depression and also to assess whether genotype modifies the association of folate and homocysteine with these outcomes. This study analyzed pooled cross-sectional data from 2 ethnically diverse cohorts of community-living adults: the Boston Puerto Rican Health Study (n = 939) and the Nutrition, Aging, and Memory in Elders study (n = 1017). Individuals in both cohorts underwent anthropometric and laboratory measurements and dietary and health assessments using validated questionnaires between the years 2003 and 2007. Cognitive outcomes included measures of global cognition [Mini-Mental Status Exam (MMSE)], depression (Center for Epidemiological Studies Depression Scale), and 3 factor scores for the domains of attention, executive function, and memory that were derived from a detailed set of neuropsychological tests. Low plasma vitamin B-12 concentrations were associated with poorer MMSE scores and higher depression scores, and low vitamin B-6 concentrations were associated with lower MMSE and worse attention and executive function in the multivariate analysis. In contrast, MTHFR genotype, folate, and homocysteine were not associated with cognition or depression in either ethnicity-pooled or stratified analysis. The current study did not find evidence of an association between the MTHFR C677T TT genotype and impaired cognition or depression in a population with adequate folate status and a high prevalence of cognitive impairment and depression. PMID:22739363

Promoter hypermethylation of the DNA repair gene O(6)-methylguanine-DNA methyltransferase is associated with the presence of G:C to A:T transition mutations in p53 in human colorectal tumorigenesis.

PubMed

Esteller, M; Risques, R A; Toyota, M; Capella, G; Moreno, V; Peinado, M A; Baylin, S B; Herman, J G

2001-06-15

Defects in DNA repair may be responsible for the genesis of mutations in key genes in cancer cells. The tumor suppressor gene p53 is commonly mutated in human cancer by missense point mutations, most of them G:C to A:T transitions. A recognized cause for this type of change is spontaneous deamination of the methylcytosine. However, the persistence of a premutagenic O(6)-methylguanine can also be invoked. This last lesion is removed in the normal cell by the DNA repair enzyme O(6)-methylguanine-DNA methyltransferase (MGMT). In many tumor types, epigenetic silencing of MGMT by promoter hypermethylation has been demonstrated and linked to the appearance of G to A mutations in the K-ras oncogene in colorectal tumors. To study the relevance of defective MGMT function by aberrant methylation in relation to the presence of p53 mutations, we studied 314 colorectal tumors for MGMT promoter hypermethylation and p53 mutational spectrum. Inactivation of MGMT by aberrant methylation was associated with the appearance of G:C to A:T transition mutations at p53 (Fischer's exact test, two-tailed; P = 0.01). Overall, MGMT methylated tumors displayed p53 transition mutations in 43 of 126 (34%) cases, whereas MGMT unmethylated tumors only showed G:C to A:T changes in 37 of 188 (19%) tumors. A more striking association was found in G:C to A:T transitions in non-CpG dinucleotides; 71% (12 of 17) of the total non-CpG transition mutations in p53 were observed in MGMT aberrantly methylated tumors (Fischer's exact test, two-tailed; P = 0.008). Our data suggest that epigenetic silencing of MGMT by promoter hypermethylation may lead to G:C to A:T transition mutations in p53.

Prevalence of c.2268dup and detection of two novel alterations, c.670_672del and c.1186C>T, in the TPO gene in a cohort of Malaysian–Chinese with thyroid dyshormonogenesis

PubMed Central

Lee, Ching Chin; Harun, Fatimah; Jalaludin, Muhammad Yazid; Heh, Choon Han; Othman, Rozana; Junit, Sarni Mat

2015-01-01

Objectives The c.2268dup mutation in the thyroid peroxidase (TPO) gene is the most common TPO alteration reported in Taiwanese patients with thyroid dyshormonogenesis. The ancestors of these patients are believed to originate from the southern province of China. Our previous study showed that this mutation leads to reduced abundance of the TPO protein and loss of TPO enzyme activity in a Malaysian–Chinese family with goitrous hypothyroidism. The aim of our study was to provide further data on the incidence of the c.2268dup mutation in a cohort of Malaysian–Chinese and its possible phenotypic effects. Setting Cohort study. Participants Twelve biologically unrelated Malaysian–Chinese patients with congenital hypothyroidism were recruited in this study. All patients showed high thyrotropin and low free thyroxine levels at the time of diagnosis with proven presence of a thyroid gland. Primary outcome measure Screening of the c.2268dup mutation in the TPO gene in all patients was carried out using a PCR–direct DNA sequencing method. Secondary outcome measure Further screening for mutations in other exonic regions of the TPO gene was carried out if the patient was a carrier of the c.2268dup mutation. Results The c.2268dup mutation was detected in 4 of the 12 patients. Apart from the c.2268dup and a previously documented mutation (c.2647C>T), two novel TPO alterations, c.670_672del and c.1186C>T, were also detected in our patients. In silico analyses predicted that the novel alterations affect the structure/function of the TPO protein. Conclusions The c.2268dup mutation was detected in approximately one-third of the Malaysian–Chinese patients with thyroid dyshormonogenesis. The detection of the novel c.670_672del and c.1186C>T alterations expand the mutation spectrum of TPO associated with thyroid dyshormonogenesis. PMID:25564141

Inherited thrombophilia in pregnant women with intrauterine growth restriction.

PubMed

Coriu, Letitia; Copaciu, Elena; Tulbure, Dan; Talmaci, Rodica; Secara, Diana; Coriu, Daniel; Cirstoiu, Monica

2014-12-01

Intrauterine growth restriction (IUGR) is a major cause of fetal morbidity and mortality during pregnancy. The role of mutation in the factor V gene, prothrombin gene, MTHFR gene, as risk factors for intrauterine growth restriction during pregnancy, is not very well known so far. This is a retrospective study of 151 pregnant women with a history of complicated pregnancy: intrauterine growth restriction, preeclampsia, recurrent pregnancy loss or maternal venous thromboembolism, who were admitted in Bucharest Emergency University Hospital, during the period January 2010 to July 2014. Genetic testing was performed for all the cases to detect: factor V Leiden mutation, G20210A mutation in the prothrombin gene, C677T mutation and A1298C mutation in methylenetetrahydrofolate reductase (MTHFR) gene. Blood samples were obtained as soon as the diagnosis of intrauterine growth restriction was established with ultrasonography. The following gene mutations were associated with increased risk of IUGR: G20210A prothrombin gene mutation (OR 4.81, 95% CI 1.05 - 2.22, p= 0.043), G1691A factor V gene mutation (factor V Leiden) (OR 1.58, 95% CI 0.61 - 4.080, p= 0.347), C677T MTHFR gene mutation (OR 1.61, 95% CI 0.79 to 3.26, p= 0.186), compound heterozygous MTHFR C677T and A1298C (OR 1.66, 95% CI 0.81- 3.42, p= 0.169). Particularly, for G20210A prothrombin gene mutation we found statistically significant risk (p≤0.05) of IUGR.

Severe epilepsy as the major symptom of new mutations in the mitochondrial tRNA(Phe) gene.

PubMed

Zsurka, G; Hampel, K G; Nelson, I; Jardel, C; Mirandola, S R; Sassen, R; Kornblum, C; Marcorelles, P; Lavoué, S; Lombès, A; Kunz, W S

2010-02-09

To present 2 families with maternally inherited severe epilepsy as the main symptom of mitochondrial disease due to point mutations at position 616 in the mitochondrial tRNA(Phe) (MT-TF) gene. Histologic stainings were performed on skeletal muscle slices from the 2 index patients. Oxidative phosphorylation activity was measured by oxygraphic and spectrophotometric methods. The patients' complete mitochondrial DNA (mtDNA) and the relevant mtDNA region in maternal relatives were sequenced. Muscle histology showed only decreased overall COX staining, while a combined respiratory chain defect, most severely affecting complex IV, was noted in both patients' skeletal muscle. Sequencing of the mtDNA revealed in both patients a mutation at position 616 in the MT-TF gene (T>C or T>G). These mutations disrupt a base pair in the anticodon stem at a highly conserved position. They were apparently homoplasmic in both patients, and had different heteroplasmy levels in the investigated maternal relatives. Deleterious mutations in the mitochondrial tRNA(Phe) may solely manifest with epilepsy when segregating to homoplasmy. They may be overlooked in the absence of lactate accumulation and typical mosaic mitochondrial defects in muscle.

Effect of the mutation (C3435T) at exon 26 of the MDR1 gene on expression level of MDR1 messenger ribonucleic acid in duodenal enterocytes of healthy Japanese subjects.

PubMed

Nakamura, Tsutomu; Sakaeda, Toshiyuki; Horinouchi, Masanori; Tamura, Takao; Aoyama, Nobuo; Shirakawa, Toshiro; Matsuo, Masafumi; Kasuga, Masato; Okumura, Katsuhiko

2002-04-01

The effect of the C3435T mutation at exon 26 of the MDR1 gene on the expression levels of MDR1 messenger ribonucleic acid (mRNA) was evaluated by means of real-time polymerase chain reaction in 51 biopsy specimens of duodenum obtained from 13 healthy Japanese subjects. The mRNA levels of MDR1 were 0.38 +/- 0.15, 0.56 +/- 0.14, and 1.13 +/- 0.42 (mean value +/- SE) in the subjects with the homozygote of wild-type allele (C/C), compound heterozygote with mutant T allele (C/T), and the homozygote of the mutant allele (T/T), respectively, reasonably explaining the lower digoxin serum concentration after administration of a single oral dose to subjects harboring a mutant T allele. Good correlation (r =.797; P <.01) was observed between the mRNA concentrations of MDR1 and CYP3A4 in the individual biopsy specimens. This finding suggested a lower plasma concentration of the substrates for CYP3A4 in subjects harboring the C3435T mutation of the MDR1 gene.

Carnitine-acylcarnitine translocase deficiency with c.199-10 T>G and novel c.1A>G mutation: Two case reports and brief literature review.

PubMed

Yan, Hui-Ming; Hu, Hao; Ahmed, Aisha; Feng, Bing-Bing; Liu, Jing; Jia, Zheng-Jun; Wang, Hua

2017-11-01

Carnitine-acylcarnitine translocate deficiency (CACTD) is a rare and life-threatening, autosomal recessive disorder of fatty acid β-oxidation characterized by hypoketotic hypoglycemia, hyperammonemia, cardiomyopathy, liver dysfunction, and muscle weakness; culminating in early death. To date, CACTD cases screened from the Chinese mainland population, especially patient with compound heterozygote with c.199-10T>G and a novel c.1A>G mutation in the SLC25A20 gene has never been described. Herein, we report 2 neonatal cases of CACTD identified from the mainland China. These 2 patients were presented with severe metabolic crisis and their clinical conditions deteriorate rapidly and both died of cardiorespiratory collapse in the first week of life. We present the clinical and biochemical features of 2 probands and a brief literature review of previously reported CACTD cases with the c.199-10T>G mutation. The acylcarnitine profiles by tandem-mass-spectrometry and the mutation analysis of SLC25A20 gene confirmed the diagnosis of CACTD in both patients. Mutation analysis demonstrated that patient No. 1 was homozygous for c.199-10T>G mutation, while patient No. 2 was a compound heterozygote for 2 mutations, a maternally-inherited c.199-10T>G and a paternally-inherited, novel c.1A>G mutation. Both patients were treated with an aggressive treatment regimen include high glucose and arginine infusion, respiratory, and circulatory support. The first proband died 3 days after delivery due to sudden cardiac arrest. The second patient's clinical condition, at one time, was improved by high glucose infusion, intravenous arginine, and circulatory support. However, the patient failed to wean from mechanical ventilation. Unfortunately, her parents refused further treatment due to fear of financial burdens. The patient died of congestive heart failure in the 6th day of life. We report the first 2 cases of CACTD identified from the mainland China. Apart from a founder mutation c.199-10T

Functional examination of MLH1, MSH2, and MSH6 intronic mutations identified in Danish colorectal cancer patients.

PubMed

Petersen, Sanne M; Dandanell, Mette; Rasmussen, Lene J; Gerdes, Anne-Marie; Krogh, Lotte N; Bernstein, Inge; Okkels, Henrik; Wikman, Friedrik; Nielsen, Finn C; Hansen, Thomas V O

2013-10-03

Germ-line mutations in the DNA mismatch repair genes MLH1, MSH2, and MSH6 predispose to the development of colorectal cancer (Lynch syndrome or hereditary nonpolyposis colorectal cancer). These mutations include disease-causing frame-shift, nonsense, and splicing mutations as well as large genomic rearrangements. However, a large number of mutations, including missense, silent, and intronic variants, are classified as variants of unknown clinical significance. Intronic MLH1, MSH2, or MSH6 variants were investigated using in silico prediction tools and mini-gene assay to asses the effect on splicing. We describe in silico and in vitro characterization of nine intronic MLH1, MSH2, or MSH6 mutations identified in Danish colorectal cancer patients, of which four mutations are novel. The analysis revealed aberrant splicing of five mutations (MLH1 c.588 + 5G > A, MLH1 c.677 + 3A > T, MLH1 c.1732-2A > T, MSH2 c.1276 + 1G > T, and MSH2 c.1662-2A > C), while four mutations had no effect on splicing compared to wild type (MLH1 c.117-34A > T, MLH1 c.1039-8 T > A, MSH2 c.2459-18delT, and MSH6 c.3439-16C > T). In conclusion, we classify five MLH1/MSH2 mutations as pathogenic, whereas four MLH1/MSH2/MSH6 mutations are classified as neutral. This study supports the notion that in silico prediction tools and mini-gene assays are important for the classification of intronic variants, and thereby crucial for the genetic counseling of patients and their family members.

Analysis of gene mutations among South Indian patients with maple syrup urine disease: identification of four novel mutations.

PubMed

Narayanan, M P; Menon, Krishnakumar N; Vasudevan, D M

2013-10-01

Maple syrup urine disease (MSUD) is predominantly caused by mutations in the BCKDHA, BCKDHB and DBT genes, which encode for the E1alpha, E1beta and E2 subunits of the branched-chain alpha-keto acid dehydrogenase complex, respectively. Because disease causing mutations play a major role in the development of the disease, prenatal diagnosis at gestational level may have significance in making decisions by parents. Thus, this study was aimed to screen South Indian MSUD patients for mutations and assess the genotype-phenotype correlation. Thirteen patients diagnosed with MSUD by conventional biochemical screening such as urine analysis by DNPH test, thin layer chromatography for amino acids and blood amino acid quantification by HPLC were selected for mutation analysis. The entire coding regions of the BCKDHA, BCKDHB and DBT genes were analyzed for mutations by PCR-based direct DNA sequencing. BCKDHA and BCKDHB mutations were seen in 43% of the total ten patients, while disease-causing DBT gene mutation was observed only in 14%. Three patients displayed no mutations. Novel mutations were c.130C>T in BCKDHA gene, c. 599C>T and c.121_122delAC in BCKDHB gene and c.190G>A in DBT gene. Notably, patients harbouring these mutations were non-responsive to thiamine supplementation and other treatment regimens and might have a worse prognosis as compared to the patients not having such mutations. Thus, identification of these mutations may have a crucial role in the treatment as well as understanding the molecular mechanisms in MSUD.

The novel mitochondrial 16S rRNA 2336T>C mutation is associated with hypertrophic cardiomyopathy

PubMed Central

Liu, Zhong; Song, Yanrui; Li, Dan; He, Xiangyu; Li, Shishi; Wu, Bifeng; Wang, Wei; Gu, Shulian; Zhu, Xiaoyu; Wang, Xuexiang; Zhou, Qiyin; Dai, Yu; Yan, Qingfeng

2014-01-01

Background Hypertrophic cardiomyopathy (HCM) is a primary disorder characterised by asymmetric thickening of septum and left ventricular wall, with a prevalence of 0.2% in the general population. Objective To describe a novel mitochondrial DNA mutation and its association with the pathogenesis of HCM. Methods and results All maternal members of a Chinese family with maternally transmitted HCM exhibited variable severity and age at onset, and were implanted permanent pacemakers due to complete atrioventricular block (AVB). Nuclear gene screening (MYH7, MYBPC3, TNNT2 and TNNI3) was performed, and no potential pathogenic mutation was identified. Mitochondrial DNA sequencing analysis identified a novel homoplasmic 16S rRNA 2336T>C mutation. This mutation was exclusively present in maternal members and absent in non-maternal members. Conservation index by comparison to 16 other vertebrates was 94.1%. This mutation disturbs the 2336U-A2438 base pair in the stem–loop structure of 16S rRNA domain III, which is involved in the assembly of mitochondrial ribosome. Oxygen consumption rate of the lymphoblastoid cells carrying 2336T>C mutation had decreased by 37% compared with controls. A reduction in mitochondrial ATP synthesis and an increase in reactive oxidative species production were also observed. Electron microscopic analysis indicated elongated mitochondria and abnormal mitochondrial cristae shape in mutant cells. Conclusions It is suggested that the 2336T>C mutation is one of pathogenic mutations of HCM. This is the first report of mitochondrial 16S rRNA 2336T>C mutation and an association with maternally inherited HCM combined with AVB. Our findings provide a new insight into the pathogenesis of HCM. PMID:24367055

Response to immunotherapy in a patient with adult onset Leigh syndrome and T9176C mtDNA mutation.

PubMed

Chuquilin, Miguel; Govindarajan, Raghav; Peck, Dawn; Font-Montgomery, Esperanza

2016-09-01

Leigh syndrome is a mitochondrial disease caused by mutations in different genes, including ATP6A for which no known therapy is available. We report a case of adult-onset Leigh syndrome with response to immunotherapy. A twenty year-old woman with baseline learning difficulties was admitted with progressive behavioral changes, diplopia, headaches, bladder incontinence, and incoordination. Brain MRI and PET scan showed T2 hyperintensity and increased uptake in bilateral basal ganglia, respectively. Autoimmune encephalitis was suspected and she received plasmapheresis with clinical improvement. She was readmitted 4 weeks later with dysphagia and aspiration pneumonia. Plasmapheresis was repeated with resolution of her symptoms. Given the multisystem involvement and suggestive MRI changes, genetic testing was done, revealing a homoplasmic T9176C ATPase 6 gene mtDNA mutation. Monthly IVIG provided clinical improvement with worsening when infusions were delayed. Leigh syndrome secondary to mtDNA T9176C mutations could have an autoimmune mechanism that responds to immunotherapy.

Role of treatment-modifying MTHFR677C>T and 1298A>C polymorphisms in metformin-treated Puerto Rican patients with type-2 diabetes mellitus and peripheral neuropathy.

PubMed

Jiménez-Ramírez, Francisco J; Castro, Liza M; Ortiz, Clarymar; Concepción, Jennifer; Renta, Jessicca Y; Morales-Borges, Raúl H; Miranda-Massari, Jorge R; Duconge, Jorge

2017-03-01

The study was conducted to investigate potential association between MTHFR genotypes and diabetic peripheral neuropathy (DPN) in Puerto Ricans with type-2 diabetes mellitus (T2DM) treated with metformin. The prevalence of major MTHFR polymorphisms in this cohort was also ascertained. DNAs from 89 metformin-treated patients with T2DM and DPN were genotyped using the PCR-based RFLP assay for MTHFR677C>T and 1298A>C polymorphisms. Frequency distributions of these variants in the study cohort were compared to those reported for three reference populations (HapMap project) and controls (400 newborn specimens). Chi-square (or Fischer's exact) tests and odds ratios (OR) were used to assess association with DPN susceptibility risk (patients vs. controls) and biochemical markers (wild types vs. carriers). Sixty-seven percent (67%) of participants carry at least one of these MTHFR polymorphisms. No deviations from Hardy-Weinberg equilibrium were detected. The genotype and allele frequencies showed statistically significant differences between participants and controls (p<0.0001 and p=0.03, respectively). Results suggest that 1298A>C but not 677C>T is associated with DPN susceptibility in this cohort (p=0.018). Different patterns of allelic dissimilarities are observed when comparing our cohort vs. the three parental ancestries. After sorting individuals by their carrier status, no significant associations were observed between these genetic variants (independently or combined) and any of the biochemical markers (HbA1c, folate, vitamin B12, homocysteine). Prevalence of major MTHFR variants in Puerto Rican patients with T2DM is first time ever reported. The study provides further evidence on the use of this genetic marker as an independent risk factor for DPN.

The role of the methylenetetrahydrofolate reductase 677 and 1298 polymorphisms in Cretan children with acute lymphoblastic leukemia.

PubMed

Karathanasis, Nikolaos V; Stiakaki, Eftichia; Goulielmos, George N; Kalmanti, Maria

2011-01-01

Acute lymphoblastic leukemia (ALL) is the most common form of malignancy in children. Recently, many studies have examined factors influencing both the susceptibility to ALL and the metabolism of widely used chemotherapeutic agents. These factors include, among others, single-nucleotide polymorphisms in various genes, such as the gene encoding for methylenetetrahydrofolate reductase (MTHFR), which has been proven polymorphic at the nucleotide positions 677 and 1298. Thirty-five children with ALL and 48 healthy adults of Cretan origin were genotyped for the presence of the MTHFR 677 and 1298 single-nucleotide polymorphisms. The possible correlation of the polymorphisms with the risk for ALL and the presence of methotrexate-induced toxicities were examined. No significant association between the MTHFR genotypes and the susceptibility to ALL was observed. A borderline statistically significant relationship was detected after methotrexate administration, between the C677T genotype (polymorphisms) and leukopenia (p = 0.050) and between the A1298C polymorphism and normal aspartate transaminase and alanine transaminase values (p = 0.065 and p = 0.053, respectively), which was strengthened for aspartate transaminase, after grouping the A1298A and A1298C genotypes together (p = 0.039). In our population the MTHFR C677T and A1298C polymorphisms are related with hematologic toxicity and hepatotoxicity, respectively, and could be suggested as prognostic factors for these adverse events.

Plasma homocysteine and vitamin B12 serum levels, red blood cell folate concentrations, C677T methylenetetrahydrofolate reductase gene mutation and risk of recurrent miscarriage: a case-control study in Spain.

PubMed

Creus, Montserrat; Deulofeu, Ramon; Peñarrubia, Joana; Carmona, Francisco; Balasch, Juan

2013-03-01

Hyperhomocysteinemia and methylenetetrahydrofolate reductase (MTHFR) gene mutation have been postulated as a possible cause of recurrent miscarriage (RM). There is a wide variation in the prevalence of MTHFR polymorphisms and homocysteine (Hcy) plasma levels among populations around the world. The present study was undertaken to investigate the possible association between hyperhomocysteinemia and its causative genetic or acquired factors and RM in Catalonia, a Mediterranean region in Spain. Sixty consecutive patients with ≥ 3 unexplained RM and 30 healthy control women having at least one child but no previous miscarriage were included. Plasma Hcy levels, MTHFR gene mutation, red blood cell (RBC) folate and vitamin B12 serum levels were measured in all subjects. No significant differences were observed neither in plasma Hcy levels, RBC folate and vitamin B12 serum levels nor in the prevalence of homozygous and heterozygous MTHFR gene mutation between the two groups studied. In the present study RM is not associated with hyperhomocysteinemia, and/or the MTHFR gene mutation.

Juvenile Leigh syndrome, optic atrophy, ataxia, dystonia, and epilepsy due to T14487C mutation in the mtDNA-ND6 gene: a mitochondrial syndrome presenting from birth to adolescence.

PubMed

Leshinsky-Silver, Esther; Shuvalov, Ruslan; Inbar, Shani; Cohen, Sarit; Lev, Dorit; Lerman-Sagie, Tally

2011-04-01

An increasing number of reports describe mutations in mitochondrial DNA coding regions, especially in mitochondrial DNA- encoded nicotinamide adenine dinucleotide dehydrogenase subunit genes of the respiratory chain complex I, as causing early-onset Leigh syndrome. The authors report the molecular findings in a 24-year-old patient with juvenile-onset Leigh syndrome presenting with optic atrophy, ataxia dystonia, and epilepsy. A brain magnetic resonance imaging revealed bilateral basal ganglia and thalamic hypointensities, and a magnetic resonance spectroscopy revealed an increased lactate peak. The authors identified a T14487C change causing M63V substitution in the mitochondrial ND6 gene. The mutation was heteroplasmic in muscle and blood samples, with different mutation loads, and was absent in the patient's mother's urine and blood samples. They suggest that the T14487C mtDNA mutation should be analyzed in Leigh syndrome, presenting with optic atrophy, ataxia, dystonia, and epilepsy, regardless of age.

Prevalence of C282Y, H63D, and S65C mutations in hereditary HFE-hemochromatosis gene in Lithuanian population.

PubMed

Kucinskas, Laimutis; Juzenas, Simonas; Sventoraityte, Jurgita; Cedaviciute, Ruta; Vitkauskiene, Astra; Kalibatas, Vytenis; Kondrackiene, Jurate; Kupcinskas, Limas

2012-04-01

HFE-hemochromatosis is a common autosomal recessive disease caused by HFE gene mutations and characterized as iron overload and failure of different organs. The aim of this study was to determine the prevalence of C282Y (c.845 G>A), H63D (c.187 C>G), and S65C (c.193A>T) alleles of HFE gene in the Lithuanian population. One thousand and eleven healthy blood donors of Lithuanian nationality were examined in four different ethnic Lithuanian regions to determine HFE gene alleles and genotype frequencies. The samples of DNA were analyzed for the presence of restriction fragment length polymorphism and validated by DNA sequencing. Among 1,011 blood donors tested, the frequency of C282Y, H63D, and S65C alleles were 2.6%, 15.9%, and 1.9%, respectively. One third of the tested subjects (n = 336) had at least one of the C282Y or H63D HFE gene mutations. The screening of Lithuanian blood donors has detected 13 (1.3%) subjects with a genotype C282Y/C282Y or C282Y/H63D responsible for the development of HFE-hemochromatosis. The prevalence of C282Y mutation was significantly higher among the inhabitants of Zemaitija (Somogitia) at the Baltic Sea area (5.9%) in comparison to the regions of continental part of Lithuania (2.4% in Dzukija, 2.3% in Aukstaitija, and 2% in Suvalkija, p < 0.05). These data support the hypothesis that the p.C282Y mutation originated from Scandinavia and spread with the Vikings along the Baltic Sea coast. The first epidemiological investigation of HFE gene mutations in ethnic Lithuanians showed that the frequencies of H63D, C282Y, and S65C of HFE gene alleles are similar to the other North-Eastern Europeans, especially in the Baltic region (Estonia, Latvia), Poland, and part of Russia (Moscow region).

Prognostic impact of KRAS mutation subtypes in 677 patients with metastatic lung adenocarcinomas

PubMed Central

Yu, Helena A.; Sima, Camelia S.; Shen, Ronglai; Kass, Samantha; Gainor, Justin; Shaw, Alice; Hames, Megan; Iams, Wade; Aston, Jonathan; Lovly, Christine M.; Horn, Leora; Lydon, Christine; Oxnard, Geoffrey R.; Kris, Mark G.; Ladanyi, Marc; Riely, Gregory J.

2015-01-01

Background We previously demonstrated that patients with metastatic KRAS mutant lung cancers have a shorter survival compared to patients with KRAS wild type cancers. Recent reports have suggested different clinical outcomes and distinct activated signaling pathways depending on KRAS mutation subtype. To better understand the impact of KRAS mutation subtype, we analyzed data from 677 patients with KRAS mutant metastatic lung cancer. Methods We reviewed all patients with metastatic or recurrent lung cancers found to have KRAS mutations over a 6 year time period. We evaluated the associations between KRAS mutation type, clinical factors, and overall survival in univariate and multivariate analyses. Any significant findings were validated in an external multi-institution patient data set. Results Among 677 patients with KRAS mutant lung cancers (53 at codon 13, 624 at codon 12), there was no difference in overall survival for patients when comparing KRAS transition versus transversion mutations (p=0.99), smoking status (p=0.33) or when comparing specific amino acid substitutions (p=0.20). In our data set, patients with KRAS codon 13 mutant tumors (n=53) had shorter overall survival compared to patients with codon 12 mutant tumors (n=624)( 1.1 vs 1.3 years, respectively, p=0.009), and the findings were confirmed in a multivariate Cox model controlling for age, sex and smoking status (HR 1.52 95% CI 1.11-2.08, p=0.008). In an independent validation set of tumors from 682 patients with stage IV KRAS mutant lung cancers, there was no difference in survival between patients with KRAS codon 13 versus codon 12 mutations (1.0 vs 1.1 years respectively, p=0.41). Conclusions Among individuals with KRAS mutant metastatic lung cancers treated with conventional therapy, there are apparent differences in outcome based on KRAS mutation subtype PMID:25415430

High prevalence of factor V Leiden and prothrombin G20101A mutations in Kashmiri patients with venous thromboembolism.

PubMed

Shafia, Syed; Zargar, Mahrukh H; Khan, Nabeela; Ahmad, Rehana; Shah, Zafar Amin; Asimi, Ravouf

2018-05-15

The genetic variants of the factor V (G1691A), prothrombin (G20210A) and MTHFR (C677T) genes have been widely implicated as inherited risk factors for developing venous thrombosis. This study was undertaken to reveal the frequency of these mutations in Kashmiri patients with venous thromboembolism. A case-control study was designed with 250 VTE patients and 250 healthy controls. The mutations were analysed using ARMS-PCR and PCR-RFLP approach. The factor V Leiden G1691A mutation was found in 17/250 (6.8%) VTE patients and prothrombin G20210A mutation was found in 7/250 (2.8%) VTE patients while no mutation was found in any of the healthy controls. Both the mutations were found to be significantly associated with the increased risk of VTE (p = 0.0001 and 0.0150 respectively) while no association of VTE risk with MTHFR C677T polymorphism was found (p = 0.53). The increased frequency of factor V Leiden G1691A and prothrombin G20210A mutation in VTE patients indicates a significant role of these mutations in the development of VTE in our population. We therefore suggest the routine screening of these two mutations as thrombophilic markers in Kashmiri patients with venous thromboembolism. Copyright © 2018 Elsevier B.V. All rights reserved.

[Analysis of MAT1A gene mutations in a child affected with simple hypermethioninemia].

PubMed

Sun, Yun; Ma, Dingyuan; Wang, Yanyun; Yang, Bin; Jiang, Tao

2017-02-10

To detect potential mutations of MAT1A gene in a child suspected with simple hypermethioninemia by MS/MS neonatal screening. Clinical data of the child was collected. Genomic DNA was extracted by a standard method and subjected to targeted sequencing using an Ion Ampliseq TM Inherited Disease Panel. Detected mutations were verified by Sanger sequencing. The child showed no clinical features except evaluated methionine. A novel compound mutation of the MAT1A gene, i.e., c.345delA and c.529C>T, was identified in the child. His father and mother were found to be heterozygous for the c.345delA mutation and c.529C>T mutation, respectively. The compound mutation c.345delA and c.529C>T of the MAT1A gene probably underlie the disease in the child. The semi-conductor sequencing has provided an important means for the diagnosis of hereditary diseases.

Prevalence of c.2268dup and detection of two novel alterations, c.670_672del and c.1186C>T, in the TPO gene in a cohort of Malaysian-Chinese with thyroid dyshormonogenesis.

PubMed

Lee, Ching Chin; Harun, Fatimah; Jalaludin, Muhammad Yazid; Heh, Choon Han; Othman, Rozana; Junit, Sarni Mat

2015-01-05

The c.2268dup mutation in the thyroid peroxidase (TPO) gene is the most common TPO alteration reported in Taiwanese patients with thyroid dyshormonogenesis. The ancestors of these patients are believed to originate from the southern province of China. Our previous study showed that this mutation leads to reduced abundance of the TPO protein and loss of TPO enzyme activity in a Malaysian-Chinese family with goitrous hypothyroidism. The aim of our study was to provide further data on the incidence of the c.2268dup mutation in a cohort of Malaysian-Chinese and its possible phenotypic effects. Cohort study. Twelve biologically unrelated Malaysian-Chinese patients with congenital hypothyroidism were recruited in this study. All patients showed high thyrotropin and low free thyroxine levels at the time of diagnosis with proven presence of a thyroid gland. Screening of the c.2268dup mutation in the TPO gene in all patients was carried out using a PCR-direct DNA sequencing method. Further screening for mutations in other exonic regions of the TPO gene was carried out if the patient was a carrier of the c.2268dup mutation. The c.2268dup mutation was detected in 4 of the 12 patients. Apart from the c.2268dup and a previously documented mutation (c.2647C>T), two novel TPO alterations, c.670_672del and c.1186C>T, were also detected in our patients. In silico analyses predicted that the novel alterations affect the structure/function of the TPO protein. The c.2268dup mutation was detected in approximately one-third of the Malaysian-Chinese patients with thyroid dyshormonogenesis. The detection of the novel c.670_672del and c.1186C>T alterations expand the mutation spectrum of TPO associated with thyroid dyshormonogenesis. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

A new mtDNA mutation in the tRNA[sup Lys] gene associated with myoclonic epilepsy and ragged-red fibers (MERRF)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Silvestri, G.; Moraes, C.T.; Shanske, S.

1992-12-01

Myoclonic epilepsy with ragged-red fibers (MERRF) has been associated with an A[r arrow]G transition at mtDNA nt 8344, within a conserved region of the tRNA[sup Lys] gene. Although the 8344 mutation is highly prevalent in patients with MERRF, it is not observed in 10%-20% of the cases, suggesting genetic heterogeneity. The authors have sequenced the tRNA[sup Lys] gene of five MERRF patients lacking the common 8344 mutation. One of these showed a novel T[r arrow]C transition at nucleotide position 8356, disrupting a highly conserved base pair in the T[Psi]C stem. The mutant mtDNA population was essentially homoplasmic in muscle butmore » was heteroplasmic in blood (47%). Neither 20 patients with other mitochondrial diseases nor 25 controls carried this mutation. These findings suggest that tRNA[sup Lys] alterations may play a specific role in the pathogenesis of MERRF syndrome. 21 refs., 4 figs.« less

Role of treatment-modifying MTHFR677C>T and 1298A > C polymorphisms in metformin-treated Puerto Rican patients with type-2 diabetes mellitus and peripheral neuropathy

PubMed Central

Jiménez-Ramírez, Francisco J.; Castro, Liza M.; Ortiz, Clarymar; Concepción, Jennifer; Renta, Jessicca Y.; Morales-Borges, Raúl H.; Miranda-Massari, Jorge R.; Duconge, Jorge

2017-01-01

Background The study was conducted to investigate potential association between MTHFR genotypes and diabetic peripheral neuropathy (DPN) in Puerto Ricans with type-2 diabetes mellitus (T2DM) treated with metformin. The prevalence of major MTHFR polymorphisms in this cohort was also ascertained. Methods DNAs from 89 metformin-treated patients with T2DM and DPN were genotyped using the PCR-based RFLP assay for MTHFR677C > T and 1298A > C polymorphisms. Frequency distributions of these variants in the study cohort were compared to those reported for three reference populations (HapMap project) and controls (400 newborn specimens). Chi-square (or Fischer’s exact) tests and odds ratios (OR) were used to assess association with DPN susceptibility risk (patients vs. controls) and biochemical markers (wild types vs. carriers). Results Sixty-seven percent (67%) of participants carry at least one of these MTHFR polymorphisms. No deviations from Hardy-Weinberg equilibrium were detected. The genotype and allele frequencies showed statistically significant differences between participants and controls (p < 0.0001 and p = 0.03, respectively). Results suggest that 1298A > C but not 677C > T is associated with DPN susceptibility in this cohort (p = 0.018). Different patterns of allelic dissimilarities are observed when comparing our cohort vs. the three parental ancestries. After sorting individuals by their carrier status, no significant associations were observed between these genetic variants (independently or combined) and any of the biochemical markers (HbA1c, folate, vitamin B12, homocysteine). Conclusions Prevalence of major MTHFR variants in Puerto Rican patients with T2DM is first time ever reported. The study provides further evidence on the use of this genetic marker as an independent risk factor for DPN. PMID:28231061

Methotrexate-induced mucositis in acute leukemia patients is not associated with the MTHFR 677T allele in Mexico.

PubMed

Ruiz-Argüelles, Guillermo J; Coconi-Linares, Lucia Nancy; Garcés-Eisele, Javier; Reyes-Núñez, Virginia

2007-10-01

Methylenetetrahydrofolate reductase (MTHFR) has two common variants with reduced activity due to polymorphisms at nucleotides 677 and 1298. Both affect folate metabolism and thus remethylation of homocysteine, but are also thought to affect nucleotide synthesis and DNA methylation. Methotrexate (MTX), which interrupts folate metabolism, is used in the treatment of a variety of diseases including acute lymphoblastic leukemia (ALL), but exerts in some patients toxic effects on fast dividing tissues such as mucosal epithelia. The enhanced toxicity may be due to cooperative effects between MTX and MTHFR variants. Accordingly, it has been reported that carrying the 677T allele of the MTHFR is a risk factor for MTX-associated mucositis. As in the Mexican population, which is characterized by a high prevalence of the 677T MTHFR variant, several of its commonly associated defects have not been observed, we investigated the relationship between MTX toxicity and the 677T allele. Out of 28 patients with ALL (CC: 2, CT: 10, TT: 16), 16 had episodes of MTX-associated mucositis (CC: 0, CT: 6, TT: 10). Neither at the gene level nor at the genotype level was a significant association with mucositis found. It may be postulated that the risk of higher MTX toxicity in patients with decreased MTHFR activity could be neutralized by the normally folate rich diet in Mexico.

NDP gene mutations in 14 French families with Norrie disease.

PubMed

Royer, Ghislaine; Hanein, Sylvain; Raclin, Valérie; Gigarel, Nadine; Rozet, Jean-Michel; Munnich, Arnold; Steffann, Julie; Dufier, Jean-Louis; Kaplan, Josseline; Bonnefont, Jean-Paul

2003-12-01

Norrie disease is a rare X-inked recessive condition characterized by congenital blindness and occasionally deafness and mental retardation in males. This disease has been ascribed to mutations in the NDP gene on chromosome Xp11.1. Previous investigations of the NDP gene have identified largely sixty disease-causing sequence variants. Here, we report on ten different NDP gene allelic variants in fourteen of a series of 21 families fulfilling inclusion criteria. Two alterations were intragenic deletions and eight were nucleotide substitutions or splicing variants, six of them being hitherto unreported, namely c.112C>T (p.Arg38Cys), c.129C>G (p.His43Gln), c.133G>A (p.Val45Met), c.268C>T (p.Arg90Cys), c.382T>C (p.Cys128Arg), c.23479-1G>C (unknown). No NDP gene sequence variant was found in seven of the 21 families. This observation raises the issue of misdiagnosis, phenocopies, or existence of other X-linked or autosomal genes, the mutations of which would mimic the Norrie disease phenotype. Copyright 2003 Wiley-Liss, Inc.

Association of MTHFR C667T polymorphism with bone mineral density and fracture risk: an updated meta-analysis.

PubMed

Wang, H; Liu, C

2012-11-01

This meta-analysis investigated the association of C677T polymorphism in MTHFR gene with bone mineral density (BMD) and fracture risk. The results suggested that C677T polymorphism was marginally associated with fracture risk. In addition, this polymorphism was modestly associated with BMD of lumbar spine, femoral neck, total hip, and total body, respectively. The methylenetetrahydrofolate reductase (MTHFR) gene has been implicated in the regulation of BMD and, thus, may serve as a potential risk factor for the development of fracture. However, results have been inconsistent. In this study, a meta-analysis was performed to clarify the association of C677T polymorphism in MTHFR gene with BMD and fracture risk. Published literature from PubMed and EMBASE were searched for eligible publications. Pooled odds ratio (OR) or weighted mean difference (WMD) and 95% confidence interval (CI) were calculated using a fixed- or random-effects model. Twenty studies (3,525 cases and 17,909 controls) were included in this meta-analysis. The TT genotype of C677T polymorphism was marginally associated with an increased risk of fracture under recessive model (TT vs. TC + CC: OR = 1.23, 95% CI 1.04-1.47). Using this model, similar results were found among East Asians (OR = 1.40, 95% CI 1.07-1.83), female subpopulation (1.27, 95% CI 1.04-1.55), cohort studies (OR = 1.24, 95% CI 1.08-1.44), and subjects younger than aged 60 years (OR = 1.51, 95% CI 1.10-2.07). In addition, under homogeneous co-dominant model, there was a modest association of C677T polymorphism with BMD of lumbar spine (WMD = -0.017 g/cm(2); 95%CI, -0.030-(-0.005) g/cm(2)), femoral neck (WMD = -0.010 g/cm(2); 95% CI -0.017-(-0.003) g/cm(2)), total hip (WMD = -0.013 g/cm(2), 95% CI -0.022-(-0.004) g/cm(2)), and total body (WMD = -0.020 g/cm(2); 95% CI -0.027-(-0.013) g/cm(2)), respectively. This meta-analysis suggested that C677T polymorphism was marginally associated with fracture risk. In addition, this polymorphism was

A novel alpha-thalassemia nonsense mutation in HBA2: C.382 A > T globin gene.

PubMed

Hamid, Mohammad; Bokharaei Merci, Hanieh; Galehdari, Hamid; Saberi, Ali Hossein; Kaikhaei, Bijan; Mohammadi-Anaei, Marziye; Ahmadzadeh, Ahmad; Shariati, Gholamreza

2014-07-01

In this study, a new alpha globin gene mutation on the α2-globin gene is reported. This mutation resulted in a Lys > stop codon substitution at position 127 which was detected in four individuals (three males and one female). DNA sequencing revealed this mutation in unrelated persons in Khuzestan province, Southwestern Iran of Lor ethnicity. This mutation caused no severe hematological abnormalities in the carriers. From the nature of substituted residues in α2-globin, it is widely expected that this mutation leads to unstable and truncated protein and should be detected in couples at risk for α-thalassemia.

Leber's Hereditary Optic Neuropathy Is Associated with the T3866C Mutation in Mitochondrial ND1 Gene in Three Han Chinese Families

PubMed Central

Zhou, Xiangtian; Qian, Yaping; Zhang, Juanjuan; Tong, Yi; Jiang, Pingping; Liang, Min; Dai, Xianning; Zhou, Huihui; Zhao, Fuxin; Ji, Yanchun; Mo, Jun Qin; Qu, Jia; Guan, Min-Xin

2012-01-01

Purpose. To investigate the pathophysiology of Leber's hereditary optic neuropathy (LHON). Methods. Seventy-one subjects from three Chinese families with LHON underwent clinical, genetic, molecular, and biochemical evaluations. Biochemical characterizations included the measurements of the rates of endogenous, substrate-dependent respirations, the adenosine triphosphate (ATP) production and generation of reactive oxygen species using lymphoblastoid cell lines derived from five affected matrilineal relatives of these families and three control subjects. Results. Ten of 41 matrilineal relatives exhibited variable severity and age at onset of optic neuropathy. The average age at onset of optic neuropathy in matrilineal relatives of the three families was 5, 11, and 24 years, respectively. Molecular analysis identified the ND1 T3866C (I187T) mutation and distinct sets of polymorphisms belonging to the Eastern Asian haplogroups D4a, M10a, and R, respectively. The I187T mutation is localized at the highly conserved isoleucine at a transmembrane domain of the ND1 polypeptide. The marked reductions in the rate of endogenous, malate/glutamate-promoted and succinate/glycerol-3-phosphate-promoted respiration were observed in mutant cell lines carrying the T3866C mutation. The deficient respiration is responsible for the reduced ATP synthesis and increased generation of reactive oxygen species. Conclusions. Our data convincingly show that the ND1 T3866C mutation leads to LHON. This mutation may be insufficient to produce a clinical phenotype. Other modifier factors may contribute to the phenotypic manifestation of the T3866C mutation. The T3866C mutation should be added to the list of inherited factors for molecular diagnosis of LHON. Thus, our findings may provide new insights into the understanding of pathophysiology and valuable information on the management of LHON. PMID:22577081

The tRNA(Gly) T10003C mutation in mitochondrial haplogroup M11b in a Chinese family with diabetes decreases the steady-state level of tRNA(Gly), increases aberrant reactive oxygen species production, and reduces mitochondrial membrane potential.

PubMed

Li, Wei; Wen, Chaowei; Li, Weixing; Wang, Hailing; Guan, Xiaomin; Zhang, Wanlin; Ye, Wei; Lu, Jianxin

2015-10-01

Mitochondrial diabetes originates mainly from mutations located in maternally transmitted, mitochondrial tRNA-coding genes. In a genetic screening program of type 2 diabetes conducted with a Chinese Han population, we found one family with suggestive maternally transmitted diabetes. The proband's mitochondrial genome was analyzed using DNA sequencing. Total 42 known nucleoside changes and 1 novel variant were identified, and the entire mitochondrial DNA sequence was assigned to haplogroup M11b. Phylogenetic analysis showed that a homoplasmic mutation, 10003T>C transition, occurred at the highly conserved site in the gene encoding tRNA(Gly). Using a transmitochondrial cybrid cell line harboring this mutation, we observed that the steady-state level of tRNA(Gly) significantly affected and the amount of tRNA(Gly) decreased by 97%, production of reactive oxygen species was enhanced, and mitochondrial membrane potential, mtDNA copy number and cellular oxygen consumption rate were remarkably decreased compared with wild-type cybrid cells. The homoplasmic 10003T>C mutation in the mitochondrial tRNA(Gly) gene suggested to be as a pathogenesis-related mutation which might contribute to the maternal inherited diabetes in the Han Chinese family.

Novel mutations of the AGXT gene causing primary hyperoxaluria type 1.

PubMed

Yuen, Yuet-Ping; Lai, Chi-Kong; Tong, Gensy Mei-Wah; Wong, Ping-Nam; Wong, Francis Kim-Ming; Mak, Siu-Ka; Lo, Kin-Yee; Wong, Andrew Kui-Man; Tong, Sui-Fan; Chan, Yan-Wo; Lam, Ching-Wan

2004-01-01

Primary hyperoxaluria type 1 (PH1), an inherited cause of nephrolithiasis, is due to a functional defect of the liver-specific peroxisomal enzyme alanine:glyoxylate aminotransferase (AGT). A definitive PH1 diagnosis can be established by analyzing AGT activity in liver tissue or mutation analysis of the AGXT gene. The molecular basis of PH1 in three Chinese patients, two with adult-onset and one with childhood-onset recurrent nephrolithiasis, was established by analyzing the entire AGXT gene. Three novel mutations (c2T>C, c817insAG and c844C>T) and two previously reported mutations (c33insC and 679-IVS6+2delAAgt) were identified. c2T>C converts the initiation codon from ATG to ACG, which predicts significant reduction, if not complete abolition, of protein translation. c817insAG leads to a frameshift and changes the amino acid sequence after codon 274. c844C>T changes glutamine at codon 282 to a termination codon, resulting in protein truncation. This is the first report describing AGXT gene mutations in Chinese patients with PH1. AGXT genotypes cannot fully explain the clinical heterogeneity of PH1, and other factors involved in disease pathogenesis remain to be identified. Our experience emphasizes the importance of excluding PH1 in patients with recurrent nephrolithiasis to avoid delay or inappropriate management.

Glucose-6-Phosphate Dehydrogenase (G6PD) deficiency in Greek newborns: the Mediterranean C563T mutation screening.

PubMed

Molou, Elina; Schulpis, Kleopatra H; Thodi, Georgia; Georgiou, Vassiliki; Dotsikas, Yannis; Papadopoulos, Konstantinos; Biti, Sofia; Loukas, Yannis L

2014-04-01

Glucose-6-Phosphate Dehydrogenase (G6PD) gene is located at the X-chromosome at Xq28 and the disease is recessively inherited predominantly in males. More than 400 variants have been proposed based on clinical and enzymatic studies. The aim of the current study was to identify C563T mutation in G6PD-deficient newborns and to correlate the enzyme residual activity with the presence of the mutation. Some 1189 full-term neonates aged 3-5 days old were tested for G6PD activity in dried blood spots from Guthrie cards using a commercial kit. DNA extraction from Guthrie cards and mutation identification among the deficient samples were performed with current techniques. A total of 92 (7.7%) newborns were G6PD-deficient. In 46 (50%), the mutation C563T was identified. The residual activity in C563T hemizygote males (n = 28) was statistically significantly lower (1.23 ± 0.93 U/g Hb) than that in non-C563T G6PD-deficient males (n = 25) (4.01 ± 1.20 U/g Hb, p < 0.0001) and in controls (13.6 ± 2.9 U/g Hb, p < 0.0001). In C563T heterozygote females, the estimated enzyme activity was lower than that determined in non-C563T females. Male C563T hemizygotes suffer from G6PD deficiency and severe neonatal jaundice. G6PD activity showed statistically significant correlation with total bilirubin blood levels.

Mutation Frequency of the Major Frontotemporal Dementia Genes, MAPT, GRN and C9ORF72 in a Turkish Cohort of Dementia Patients.

PubMed

Guven, Gamze; Lohmann, Ebba; Bras, Jose; Gibbs, J Raphael; Gurvit, Hakan; Bilgic, Basar; Hanagasi, Hasmet; Rizzu, Patrizia; Heutink, Peter; Emre, Murat; Erginel-Unaltuna, Nihan; Just, Walter; Hardy, John; Singleton, Andrew; Guerreiro, Rita

2016-01-01

'Microtubule-associated protein tau' (MAPT), 'granulin' (GRN) and 'chromosome 9 open reading frame72' (C9ORF72) gene mutations are the major known genetic causes of frontotemporal dementia (FTD). Recent studies suggest that mutations in these genes may also be associated with other forms of dementia. Therefore we investigated whether MAPT, GRN and C9ORF72 gene mutations are major contributors to dementia in a random, unselected Turkish cohort of dementia patients. A combination of whole-exome sequencing, Sanger sequencing and fragment analysis/Southern blot was performed in order to identify pathogenic mutations and novel variants in these genes as well as other FTD-related genes such as the 'charged multivesicular body protein 2B' (CHMP2B), the 'FUS RNA binding protein' (FUS), the 'TAR DNA binding protein' (TARDBP), the 'sequestosome1' (SQSTM1), and the 'valosin containing protein' (VCP). We determined one pathogenic MAPT mutation (c.1906C>T, p.P636L) and one novel missense variant (c.38A>G, p.D13G). In GRN we identified a probably pathogenic TGAG deletion in the splice donor site of exon 6. Three patients were found to carry the GGGGCC expansions in the non-coding region of the C9ORF72 gene. In summary, a complete screening for mutations in MAPT, GRN and C9ORF72 genes revealed a frequency of 5.4% of pathogenic mutations in a random cohort of 93 Turkish index patients with dementia.

Complete mtDNA sequencing reveals mutations m.9185T>C and m.13513G>A in three patients with Leigh syndrome.

PubMed

Pelnena, Dita; Burnyte, Birute; Jankevics, Eriks; Lace, Baiba; Dagyte, Evelina; Grigalioniene, Kristina; Utkus, Algirdas; Krumina, Zita; Rozentale, Jolanta; Adomaitiene, Irina; Stavusis, Janis; Pliss, Liana; Inashkina, Inna

2017-12-12

The most common mitochondrial disorder in children is Leigh syndrome, which is a progressive and genetically heterogeneous neurodegenerative disorder caused by mutations in nuclear genes or mitochondrial DNA (mtDNA). In the present study, a novel and robust method of complete mtDNA sequencing, which allows amplification of the whole mitochondrial genome, was tested. Complete mtDNA sequencing was performed in a cohort of patients with suspected mitochondrial mutations. Patients from Latvia and Lithuania (n = 92 and n = 57, respectively) referred by clinical geneticists were included. The de novo point mutations m.9185T>C and m.13513G>A, respectively, were detected in two patients with lactic acidosis and neurodegenerative lesions. In one patient with neurodegenerative lesions, the mutation m.9185T>C was identified. These mutations are associated with Leigh syndrome. The present data suggest that full-length mtDNA sequencing is recommended as a supplement to nuclear gene testing and enzymatic assays to enhance mitochondrial disease diagnostics.

Histone modifier gene mutations in peripheral T-cell lymphoma not otherwise specified.

PubMed

Ji, Meng-Meng; Huang, Yao-Hui; Huang, Jin-Yan; Wang, Zhao-Fu; Fu, Di; Liu, Han; Liu, Feng; Leboeuf, Christophe; Wang, Li; Ye, Jing; Lu, Yi-Ming; Janin, Anne; Cheng, Shu; Zhao, Wei-Li

2018-04-01

Due to heterogeneous morphological and immunophenotypic features, approximately 50% of peripheral T-cell lymphomas are unclassifiable and categorized as peripheral T-cell lymphomas, not otherwise specified. These conditions have an aggressive course and poor clinical outcome. Identification of actionable biomarkers is urgently needed to develop better therapeutic strategies. Epigenetic alterations play a crucial role in tumor progression. Histone modifications, particularly methylation and acetylation, are generally involved in chromatin state regulation. Here we screened the core set of genes related to histone methylation ( KMT2D , SETD2 , KMT2A , KDM6A ) and acetylation ( EP300 , CREBBP ) and identified 59 somatic mutations in 45 of 125 (36.0%) patients with peripheral T-cell lymphomas, not otherwise specified. Histone modifier gene mutations were associated with inferior progression-free survival time of the patients, irrespective of chemotherapy regimens, but an increased response to the histone deacetylase inhibitor chidamide. In vitro , chidamide significantly inhibited the growth of EP300-mutated T-lymphoma cells and KMT2D-mutated T-lymphoma cells when combined with the hypomethylating agent decitabine. Mechanistically, decitabine acted synergistically with chidamide to enhance the interaction of KMT2D with transcription factor PU.1, regulated H3K4me-associated signaling pathways, and sensitized T-lymphoma cells to chidamide. In a xenograft KMT2D-mutated T-lymphoma model, dual treatment with chidamide and decitabine significantly retarded tumor growth and induced cell apoptosis through modulation of the KMT2D/H3K4me axis. Our work thus contributes to the understanding of aberrant histone modification in peripheral T-cell lymphomas, not otherwise specified and the stratification of a biological subset that can benefit from epigenetic treatment. Copyright© 2018 Ferrata Storti Foundation.

Methylenetetrahydrofolate reductase gene, homocysteine and coronary artery disease: the A1298C polymorphism does matter. Inferences from a case study (Madeira, Portugal).

PubMed

Freitas, Ana I; Mendonça, Isabel; Guerra, Graça; Brión, Maria; Reis, Roberto P; Carracedo, Angel; Brehm, António

2008-01-01

Elevated levels of plasma homocysteine, an independent risk factor and a strong predictor of mortality in patients with coronary artery disease (CAD), can result from nutritional deficiencies or genetic errors, including methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C polymorphisms. The contribution of these polymorphisms in the development of CAD remains controversial. We analysed the impact of MTHFR C677T and A1298C on fasting homocysteine and CAD in 298 CAD patients proved by angiography and 510 control subjects from the Island of Madeira (Portugal). After adjustment for other risk factors, plasma homocysteine remained independently correlated with CAD. Serum homocysteine was significantly higher in individuals with 677TT and 1298AA genotypes. There was no difference in the distribution of MTHFR677 genotypes between cases and controls but a significant increase in 1298AA prevalence was found in CAD patients. In spite of the clear effect of C677T mutation on elevated homocysteine levels we only found an association between 1298AA genotype and CAD in this population. The simultaneous presence of 677CT and 1298AA genotypes provides a significant risk of developing the disease, while the 1298AC genotype, combined with 677CC, shows a significant trend towards a decrease in CAD occurrence. The data shows an independent association between elevated levels of homocysteine and CAD. Both MTHFR polymorphisms are associated with increased fasting homocysteine (677TT and 1298AA genotypes), but only the 1298AA variant shows an increased prevalence in CAD group. Odds ratio seem to indicate that individuals with the MTHFR 1298AA genotype and the 677CT/1298AA compound genotype had a 1.6-fold increased risk for developing CAD suggesting a possible association of MTHFR polymorphisms with the risk of CAD in Madeira population.

Detection of epidermal growth factor receptor gene T790M mutation in cytology samples using the cobas® EGFR mutation test.

PubMed

Satouchi, Miyako; Tanaka, Hiroshi; Yoshioka, Hiroshige; Shimokawaji, Tadasuke; Mizuno, Keiko; Takeda, Koji; Yoshino, Ichiro; Seto, Takashi; Kurata, Takayasu; Tashiro, Naoki; Hagiwara, Koichi

2017-09-01

Detection of epidermal growth factor receptor (EGFR) gene mutations is essential in deciding therapeutic strategy in non-small cell lung cancer (NSCLC) patients at initial diagnosis. Moreover, in EGFR mutation-positive (EGFRm) NSCLC patients, re-biopsy at disease progression to clarify resistance mechanisms is also important. However, collecting histology samples is often difficult because of inaccessibility and invasiveness. In some cases, only cytology samples can be collected, and studies have reported that cytology samples are appropriate for EGFR gene mutation testing. The cobas ® EGFR Mutation Test (Roche Molecular Systems Inc., Branchburg, New Jersey, USA) is approved as a companion diagnostic for osimertinib, a third-generation EGFR-tyrosine kinase inhibitor approved in Japan. However, it is not clear whether the EGFR T790M mutation can be detected in cytology samples using this test. The primary objective of this study was to assess concordance of EGFR T790M gene mutation detection between histology and matched cytology samples using the cobas ® EGFR Mutation Test. We conducted a multicenter, observational study in Japan. Overall, 41 EGFRm NSCLC patients who had both histology and cytology samples collected at the same time at re-biopsy and with the results of EGFR mutation test using histology samples were enrolled. The EGFR mutation status of both sample types was tested using the cobas ® EGFR Mutation Test and the concordance rates were calculated. The EGFR T790M mutation detection rate in histology and cytology samples was 42.5% and 37.5%, respectively. The overall percent agreement between the histology and cytology samples was 91.7%. These data demonstrate that the cobas ® EGFR Mutation Test can detect the EGFR T790M mutation in both cytology and histology samples. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

HAEdb: a novel interactive, locus-specific mutation database for the C1 inhibitor gene.

PubMed

Kalmár, Lajos; Hegedüs, Tamás; Farkas, Henriette; Nagy, Melinda; Tordai, Attila

2005-01-01

Hereditary angioneurotic edema (HAE) is an autosomal dominant disorder characterized by episodic local subcutaneous and submucosal edema and is caused by the deficiency of the activated C1 esterase inhibitor protein (C1-INH or C1INH; approved gene symbol SERPING1). Published C1-INH mutations are represented in large universal databases (e.g., OMIM, HGMD), but these databases update their data rather infrequently, they are not interactive, and they do not allow searches according to different criteria. The HAEdb, a C1-INH gene mutation database (http://hae.biomembrane.hu) was created to contribute to the following expectations: 1) help the comprehensive collection of information on genetic alterations of the C1-INH gene; 2) create a database in which data can be searched and compared according to several flexible criteria; and 3) provide additional help in new mutation identification. The website uses MySQL, an open-source, multithreaded, relational database management system. The user-friendly graphical interface was written in the PHP web programming language. The website consists of two main parts, the freely browsable search function, and the password-protected data deposition function. Mutations of the C1-INH gene are divided in two parts: gross mutations involving DNA fragments >1 kb, and micro mutations encompassing all non-gross mutations. Several attributes (e.g., affected exon, molecular consequence, family history) are collected for each mutation in a standardized form. This database may facilitate future comprehensive analyses of C1-INH mutations and also provide regular help for molecular diagnostic testing of HAE patients in different centers.

EDAR-induced hypohidrotic ectodermal dysplasia: a clinical study on signs and symptoms in individuals with a heterozygous c.1072C > T mutation

PubMed Central

2014-01-01

Background Mutations in the EDAR-gene cause hypohidrotic ectodermal dysplasia, however, the oral phenotype has been described in a limited number of cases. The aim of the present study was to clinically describe individuals with the c.1072C > T mutation (p. Arg358X) in the EDAR gene with respect to dental signs and saliva secretion, symptoms from other ectodermal structures and to assess orofacial function. Methods Individuals in three families living in Sweden, where some members had a known c.1072C > T mutation in the EDAR gene with an autosomal dominant inheritance (AD), were included in a clinical investigation on oral signs and symptoms and self-reported symptoms from other ectodermal structures (n = 37). Confirmation of the c.1072C > T mutation in the EDAR gene were performed by genomic sequencing. Orofacial function was evaluated with NOT-S. Results The mutation was identified in 17 of 37 family members. The mean number of missing teeth due to agenesis was 10.3 ± 4.1, (range 4–17) in the mutation group and 0.1 ± 0.3, (range 0–1) in the non-mutation group (p < 0.01). All individuals with the mutation were missing the maxillary lateral incisors and one or more of the mandibular incisors; and 81.3% were missing all four. Stimulated saliva secretion was 0.9 ± 0.5 ml/min in the mutation group vs 1.7 ± 0.6 ml/min in the non-mutation group (p < 0.01). Reduced ability to sweat was reported by 82% in the mutation group and by 20% in the non-mutation group (p < 0.01). The mean NOT-S score was 3.0 ± 1.9 (range 0–6) in the mutation group and 1.5 ± 1.1 (range 0–5) in the non-mutation group (p < 0.01). Lisping was present in 56% of individuals in the mutation group. Conclusions Individuals with a c.1072C > T mutation in the EDAR-gene displayed a typical pattern of congenitally missing teeth in the frontal area with functional consequences. They therefore have a need for special attention in dental

[Application of gene capture technology on mutation screening of RB1 gene in retinoblastoma patients].

PubMed

Meng, Q Y; Huang, L Z; Wang, B; Li, X X; Liang, J H

2017-06-11

Objectives: To analyze RB1 gene mutation in retinoblastoma (RB) patients using gene capture technology. Methods: Experimental research. The clinical data of 17 RB patients were collected at Department of Ophthalmology, Peking University People's Hospital from June 2010 to Jun 2014. Peripheral blood samples of seventeen RB patients and their parents were collected and genomic DNA were extracted. DNA library from RB patients was mixed with designed gene capture probe of RB1 exons and its flanking sequences. The data were analyzed using bioinformatics software. To avoid the false positive, the abnormal sites were verified using the Sanger sequencing method. Results: Totally, there were 17 RB patients, including 12 males and 5 females, from 0.5 to 23 years old, average ages were (3.2±5.2) years old. Both eyes were involved in 6 patients. The other 11 cases were only one eye was attacked. Four RB patients were found to have germline mutations, among whom 2 had bilateral tumors and 2 had unilateral tumors. 2 novel missense mutations were identified, including 15(th) exon c.1408A>T (p. Ile470Phe) and c.1960G>C (p. Val654Leu) at 19(th) exon. No RB1 mutation was identified in any of their parents. We also identified 2 mutations reported previously. One is c.1030C>T termination mutation at 10(th) exon in a bilateral RB patients and his father, who was diagnosed with unilateral RB. The other is c.371-372delTA frame shift mutation at 3(rd) exon. No mutation was found in their parents. Conclusions: Two novel germline RB1 mutations were found using gene capture technology, which enriched RB1 mutations library. (Chin J Ophthalmol, 2017, 53: 455-459) .

Detection of c. -32T>G (IVS1-13T>G) mutation of Pompe disease by real-time PCR in dried blood spot specimen.

PubMed

Bobillo Lobato, Joaquin; Sánchez Peral, Blas A; Durán Parejo, Pilar; Jiménez Jiménez, Luis M

2013-03-15

Pompe disease, or acid maltase deficiency, is a genetic muscle disorder caused by mutations in the gene encoding the acid alpha-glucosidase (GAA) enzyme, which is essential for the degradation of glycogen to glucose in lysosomes. The wide clinical variability is resulted from genetic heterogeneity, and many different mutations of the GAA gene have been reported. Some of these mutations are associated with specific phenotypes, such as the c. -32T>G (IVS1-13T>G) mutation seen in late-onset Pompe disease. We used a real-time PCR, after genomic DNA extraction isolated from DBS (dried blood spots) and PCR amplification. Our results successfully detected in controls and patients have been 100% concordant with sequencing results. This assay combines simple sample processing and rapid analysis and it allows to detect the patients with a milder form and slower progression of this disease with a high reliability. Copyright © 2013 Elsevier B.V. All rights reserved.

Pms2 and uracil-DNA glycosylases act jointly in the mismatch repair pathway to generate Ig gene mutations at A-T base pairs.

PubMed

Girelli Zubani, Giulia; Zivojnovic, Marija; De Smet, Annie; Albagli-Curiel, Olivier; Huetz, François; Weill, Jean-Claude; Reynaud, Claude-Agnès; Storck, Sébastien

2017-04-03

During somatic hypermutation (SHM) of immunoglobulin genes, uracils introduced by activation-induced cytidine deaminase are processed by uracil-DNA glycosylase (UNG) and mismatch repair (MMR) pathways to generate mutations at G-C and A-T base pairs, respectively. Paradoxically, the MMR-nicking complex Pms2/Mlh1 is apparently dispensable for A-T mutagenesis. Thus, how detection of U:G mismatches is translated into the single-strand nick required for error-prone synthesis is an open question. One model proposed that UNG could cooperate with MMR by excising a second uracil in the vicinity of the U:G mismatch, but it failed to explain the low impact of UNG inactivation on A-T mutagenesis. In this study, we show that uracils generated in the G1 phase in B cells can generate equal proportions of A-T and G-C mutations, which suggests that UNG and MMR can operate within the same time frame during SHM. Furthermore, we show that Ung -/- Pms2 -/- mice display a 50% reduction in mutations at A-T base pairs and that most remaining mutations at A-T bases depend on two additional uracil glycosylases, thymine-DNA glycosylase and SMUG1. These results demonstrate that Pms2/Mlh1 and multiple uracil glycosylases act jointly, each one with a distinct strand bias, to enlarge the immunoglobulin gene mutation spectrum from G-C to A-T bases. © 2017 Girelli Zubani et al.

Pms2 and uracil-DNA glycosylases act jointly in the mismatch repair pathway to generate Ig gene mutations at A-T base pairs

PubMed Central

De Smet, Annie; Albagli-Curiel, Olivier; Huetz, François; Weill, Jean-Claude

2017-01-01

During somatic hypermutation (SHM) of immunoglobulin genes, uracils introduced by activation-induced cytidine deaminase are processed by uracil-DNA glycosylase (UNG) and mismatch repair (MMR) pathways to generate mutations at G-C and A-T base pairs, respectively. Paradoxically, the MMR-nicking complex Pms2/Mlh1 is apparently dispensable for A-T mutagenesis. Thus, how detection of U:G mismatches is translated into the single-strand nick required for error-prone synthesis is an open question. One model proposed that UNG could cooperate with MMR by excising a second uracil in the vicinity of the U:G mismatch, but it failed to explain the low impact of UNG inactivation on A-T mutagenesis. In this study, we show that uracils generated in the G1 phase in B cells can generate equal proportions of A-T and G-C mutations, which suggests that UNG and MMR can operate within the same time frame during SHM. Furthermore, we show that Ung−/−Pms2−/− mice display a 50% reduction in mutations at A-T base pairs and that most remaining mutations at A-T bases depend on two additional uracil glycosylases, thymine-DNA glycosylase and SMUG1. These results demonstrate that Pms2/Mlh1 and multiple uracil glycosylases act jointly, each one with a distinct strand bias, to enlarge the immunoglobulin gene mutation spectrum from G-C to A-T bases. PMID:28283534

Prenatal diagnosis for a Chinese family with a de novo DMD gene mutation

PubMed Central

Li, Tao; Zhang, Zhao-jing; Ma, Xin; Lv, Xue; Xiao, Hai; Guo, Qian-nan; Liu, Hong-yan; Wang, Hong-dan; Wu, Dong; Lou, Gui-yu; Wang, Xin; Zhang, Chao-yang; Liao, Shi-xiu

2017-01-01

Abstract Background: Patients with Duchenne muscular dystrophy (DMD) usually have severe and fatal symptoms. At present, there is no effective treatment for DMD, thus it is very important to avoid the birth of children with DMD by effective prenatal diagnosis. We identified a de novo DMD gene mutation in a Chinese family, and make a prenatal diagnosis. Methods: First, multiplex ligation-dependent probe amplification (MLPA) was applied to analyze DMD gene exon deletion/duplication in all family members. The coding sequences of 79 exons in DMD gene were analyzed by Sanger sequencing in the patient; and then according to DMD gene exon mutation in the patient, DMD gene sequencing was performed in the family members. On the basis of results above, the pathogenic mutation in DMD gene was identified. Results: MLPA showed no DMD gene exon deletion/duplication in all family members. Sanger sequencing revealed c.2767_2767delT [p.Ser923LeufsX26] mutation in DMD gene of the patient. Heterozygous deletion mutation (T/-) at this locus was observed in the pregnant woman and her mother and younger sister. The analyses of amniotic fluid samples indicated negative Y chromosome sex-determining gene, no DMD gene exon deletion/duplication, no mutations at c.2767 locus, and the inherited maternal X chromosome different from that of the patient. Conclusion: The pathogenic mutation in DMD gene, c.2767_2767delT [p.Ser923LeufsX26], identified in this family is a de novo mutation. On the basis of specific conditions, it is necessary to select suitable methods to make prenatal diagnosis more effective, accurate, and economic. PMID:29390271

Mutational analysis in patients with Autosomal Dominant Polycystic Kidney Disease (ADPKD): Identification of five mutations in the PKD1 gene.

PubMed

Abdelwahed, Mayssa; Hilbert, Pascale; Ahmed, Asma; Mahfoudh, Hichem; Bouomrani, Salem; Dey, Mouna; Hachicha, Jamil; Kamoun, Hassen; Keskes-Ammar, Leila; Belguith, Neïla

2018-05-31

Autosomal Dominant Polycystic Kidney Disease (ADPKD), the most frequent genetic disorder of the kidneys, is characterized by a typical presenting symptoms include cysts development in different organs and a non-cysts manifestations. ADPKD is caused by mutations in PKD1 or PKD2 genes. In this study, we aimed to search for molecular causative defects among PKD1 and PKD2 genes. Eighteen patients were diagnosed based on renal ultrasonography and renal/extra-renal manifestations. Then, Sanger sequencing was performed for PKD1 and PKD2 genes. Multiplex Ligation dependent Probe Amplification method (MLPA) methods was performed for both PKD genes. Mutational analysis of the PKD2 gene revealed the absence of variants and no deletions or duplications of both PKD genes were detected. But three novels mutations i.e. p.S463C exon 7; c. c.11156+2T>C IVS38 and c.8161-1G>A IVS22 and two previously reported c.1522T>C exon 7 and c.412C>T exon 4 mutations in the PKD1 gene were detected. Bioinformatics tools predicted that the novel variants have a pathogenic effects on splicing machinery, pre-mRNA secondary structure and stability and protein stability. Our results highlighted molecular features of Tunisian patients with ADPKD and revealed novel variations that can be utilized in clinical diagnosis and in the evaluation of living kidney donor. To the best of our knowledge, this is the first report of Autosomal Polycystic Kidney Disease in Tunisia. Copyright © 2017. Published by Elsevier B.V.

Management of Gene Variants of Unknown Significance: Analysis Method and Risk Assessment of the VHL Mutation p.P81S (c.241C>T).

PubMed

Alosi, Daniela; Bisgaard, Marie Luise; Hemmingsen, Sophie Nowak; Krogh, Lotte Nylandsted; Mikkelsen, Hanne Birte; Binderup, Marie Louise Mølgaard

2017-02-01

Evaluation of the pathogenicity of a gene variant of unknown significance (VUS) is crucial for molecular diagnosis and genetic counseling, but can be challenging. This is especially so in phenotypically variable diseases, such as von Hippel-Lindau disease (vHL). vHL is caused by germline mutations in the VHL gene, which predispose to the development of multiple tumors such as central nervous system hemangioblastomas and renal cell carcinoma (RCC). We propose a method for the evaluation of VUS pathogenicity through our experience with the VHL missense mutation c.241C>T (p.P81S). 1) Clinical evaluation of known variant carriers: We evaluated a family of five VHL p.P81S carriers, as well as the clinical characteristics of all the p.P81S carriers reported in the literature; 2) Evaluation of tumor tissue via genetic analysis, histology, and immunohistochemistry (IHC); 3) Assessment of the variant's impact on protein structure and function, using multiple databases, in silico algorithms, and reports of functional studies. Only one family member had clinical signs of vHL with early-onset RCC. IHC analysis showed no VHL protein expressed in the tumor, consistent with biallelic VHL inactivation. The majority of in silico algorithms reported p.P81S as possibly pathogenic in relation to vHL or RCC, but there were discrepancies. Functional studies suggest that p.P81S impairs the VHL protein's function. The VHL p.P81S mutation is most likely a low-penetrant pathogenic variant predisposing to RCC development. We suggest the above-mentioned method for VUS evaluation with use of different methods, especially a variety of in silico methods and tumor tissue analysis.

Mutations in the ADAR1 gene in Chinese families with dyschromatosis symmetrica hereditaria.

PubMed

Zhang, G L; Shi, H J; Shao, M H; Li, M; Mu, H J; Gu, Y; Du, X F; Xie, P

2013-01-04

We investigated 2 Chinese families with dyschromatosis symmetrica hereditaria (DSH) and search for mutations in the adenosine deaminase acting on RNA1 (ADAR1) gene in these 2 pedigrees. We performed a mutation analysis of the ADAR1 gene in 2 Chinese families with DSH and reviewed all articles published regarding ADAR1 mutations reported since 2003 by using PubMed. By direct sequencing, a 2-nucleotide AG deletion, 2099-2100delAG, was found in family 1, and a C→T mutation was identified at nucleotide 1420 that changed codon 474 from arginine to a translational termination codon in family 2. Two different pathogenic mutations were identified, c.2099-2100delAG and c.1420C>T, the former being a novel mutation, and the latter previously reported in 3 other families with DSH. To date, a total of 110 mutations in the ADAR1 gene have been reported, and 10 of them were recurrent; the mutations R474X, R1083C, R1096X, and R1155W might be the DSH-related hotspots.

Novel mutations of endothelin-B receptor gene in Pakistani patients with Waardenburg syndrome.

PubMed

Jabeen, Raheela; Babar, Masroor Ellahi; Ahmad, Jamil; Awan, Ali Raza

2012-01-01

Mutations in EDNRB gene have been reported to cause Waardenburg-Shah syndrome (WS4) in humans. We investigated 17 patients with WS4 for identification of mutations in EDNRB gene using PCR and direct sequencing technique. Four genomic mutations were detected in four patients; a G to C transversion in codon 335 (S335C) in exon 5 and a transition of T to C in codon (S361L) in exon 5, a transition of A to G in codon 277 (L277L) in exon 4, a non coding transversion of T to A at -30 nucleotide position of exon 5. None of these mutations were found in controls. One of the patients harbored two novel mutations (S335C, S361L) in exon 5 and one in Intronic region (-30exon5 A>G). All of the mutations were homozygous and novel except the mutation observed in exon 4. In this study, we have identified 3 novel mutations in EDNRB gene associated with WS4 in Pakistani patients.

[Analysis of SOX10 gene mutation in a family affected with Waardenburg syndrome type II].

PubMed

Zheng, Lei; Yan, Yousheng; Chen, Xue; Zhang, Chuan; Zhang, Qinghua; Feng, Xuan; Hao, Shen

2018-02-10

OBJECTIVE To detect potential mutation of SOX10 gene in a pedigree affected with Warrdenburg syndrome type II. METHODS Genomic DNA was extracted from peripheral blood samples of the proband and his family members. Exons and flanking sequences of MITF, PAX3, SOX10, SNAI2, END3 and ENDRB genes were analyzed by chip capturing and high throughput sequencing. Suspected mutations were verified with Sanger sequencing. RESULTS A c.127C>T (p.R43X) mutation of the SOX10 gene was detected in the proband, for which both parents showed a wild-type genotype. CONCLUSION The c.127C>T (p.R43X) mutation of SOX10 gene probably underlies the ocular symptoms and hearing loss of the proband.

[Study of gene mutation and pathogenetic mechanism for a family with Waardenburg syndrome].

PubMed

Chen, Hongsheng; Liao, Xinbin; Liu, Yalan; He, Chufeng; Zhang, Hua; Jiang, Lu; Feng, Yong; Mei, Lingyun

2017-08-10

To explore the pathogenetic mechanism of a family affected with Waardenburg syndrome. Clinical data of the family was collected. Potential mutation of the MITF, SOX10 and SNAI2 genes were screened. Plasmids for wild type (WT) and mutant MITF proteins were constructed to determine their exogenous expression and subcellular distribution by Western blotting and immunofluorescence assay, respectively. A heterozygous c.763C>T (p.R255X) mutation was detected in exon 8 of the MITF gene in the proband and all other patients from the family. No pathological mutation of the SOX10 and SNAI2 genes was detected. The DNA sequences of plasmids of MITF wild and mutant MITF R255X were confirmed. Both proteins were detected with the expected size. WT MITF protein only localized in the nucleus, whereas R255X protein showed aberrant localization in the nucleus as well as the cytoplasm. The c.763C>T mutation of the MITF gene probably underlies the disease in this family. The mutation can affect the subcellular distribution of MITF proteins in vitro, which may shed light on the molecular mechanism of Waardenburg syndrome caused by mutations of the MITF gene.

Novel compound heterozygous mutations in the GPR98 (USH2C) gene identified by whole exome sequencing in a Moroccan deaf family.

PubMed

Bousfiha, Amale; Bakhchane, Amina; Charoute, Hicham; Detsouli, Mustapha; Rouba, Hassan; Charif, Majida; Lenaers, Guy; Barakat, Abdelhamid

2017-10-01

In the present work, we identified two novel compound heterozygote mutations in the GPR98 (G protein-coupled receptor 98) gene causing Usher syndrome. Whole-exome sequencing was performed to study the genetic causes of Usher syndrome in a Moroccan family with three affected siblings. We identify two novel compound heterozygote mutations (c.1054C > A, c.16544delT) in the GPR98 gene in the three affected siblings carrying post-linguale bilateral moderate hearing loss with normal vestibular functions and before installing visual disturbances. This is the first time that mutations in the GPR98 gene are described in the Moroccan deaf patients.

[Analysis of H63D mutation in hemochromatosis (HFE) gene in populations of central Eurasia].

PubMed

Khusainova, R I; Khusnutdinova, N N; Litvinov, S S; Khusnutdinova, E K

2013-02-01

An analysis of the frequency of H63D (c. 187C>G) mutations in the HFEgene in 19 populations from Central Eurasia demonstrated that the distribution of the mutation in the region of interest was not uniform and that there were the areas of H63D accumulation. The investigation of three polymorphic variants, c.340+4T>C (rs2071303, IVS2(+4)T>C), c.893-44T>C (rs1800708, IVS4(-44)T>C), and c.1007-47G>A (rs1572982, IVS5(-47)A>G), in the HFE gene in individuals homozygous for H63D mutations in the HFE gene revealed the linkage of H63D with three haplotypes, *CTA, *TG, and *TTA. These findings indicated the partial spread of the mutation in Central Eurasia from Western Europe, as well as the possible repeated appearance of the mutation on the territory on interest.

Atypical juvenile presentation of GM2 gangliosidosis AB in a patient compound-heterozygote for c.259G > T and c.164C > T mutations in the GM2A gene.

PubMed

Martins, Carla; Brunel-Guitton, Catherine; Lortie, Anne; Gauvin, France; Morales, Carlos R; Mitchell, Grant A; Pshezhetsky, Alexey V

2017-06-01

G M2 -gangliosidosis, AB variant is an extremely rare autosomal recessive inherited disorder caused by mutations in the GM2A gene that encodes G M2 ganglioside activator protein (GM2AP). GM2AP is necessary for solubilisation of G M2 ganglioside in endolysosomes and its presentation to β-hexosaminidase A. Conversely GM2AP deficiency impairs lysosomal catabolism of G M2 ganglioside, leading to its storage in cells and tissues. We describe a 9-year-old child with an unusual juvenile clinical onset of G M2 -gangliosidosis AB. At the age of 3 years he presented with global developmental delay, progressive epilepsy, intellectual disability, axial hypertonia, spasticity, seizures and ataxia, but without the macular cherry-red spots typical for G M2 gangliosidosis. Brain MRI detected a rapid onset of diffuse atrophy, whereas whole exome sequencing showed that the patient is a compound heterozygote for two mutations in GM2A : a novel nonsense mutation, c.259G > T (p.E87X) and a missense mutation c.164C > T (p.P55L) that was recently identified in homozygosity in patients of a Saudi family with a progressive chorea-dementia syndrome. Western blot analysis showed an absence of GM2AP in cultured fibroblasts from the patient, suggesting that both mutations interfere with the synthesis and/or folding of the protein. Finally, impaired catabolism of G M2 ganglioside in the patient's fibroblasts was demonstrated by metabolic labeling with fluorescently labeled G M1 ganglioside and by immunohistochemistry with anti-G M2 and anti-G M3 antibodies. Our observation expands the molecular and clinical spectrum of molecular defects linked to G M2 -gangliosidosis and suggests novel diagnostic approach by whole exome sequencing and perhaps ganglioside analysis in cultured patient's cells.

Mutations in HAMP and HJV genes and their impact on expression of clinical hemochromatosis in a cohort of 100 Spanish patients homozygous for the C282Y mutation of HFE gene.

PubMed

Altès, Albert; Bach, Vanessa; Ruiz, Angels; Esteve, Anna; Felez, Jordi; Remacha, Angel F; Sardà, M Pilar; Baiget, Montserrat

2009-10-01

Most hereditary hemochromatosis (HH) patients are homozygous for the C282Y mutation of the HFE gene. Nevertheless, penetrance of the disease is very variable. In some patients, penetrance can be mediated by concomitant mutations in other iron master genes. We evaluated the clinical impact of hepcidin (HAMP) and hemojuvelin mutations in a cohort of 100 Spanish patients homozygous for the C282Y mutation of the HFE gene. HAMP and hemojuvelin mutations were evaluated in all patients by bidirectional direct cycle sequencing. Phenotype-genotype interactions were evaluated. A heterozygous mutation of the HAMP gene (G71D) was found in only one out of 100 cases. Following, we performed a study of several members of that family, and we observed several members had a digenic inheritance of the C282Y mutation of the HFE gene and the G71D mutation of the HAMP gene. This mutation in the HAMP gene did not modify the phenotype of the individuals who were homozygous for the C282Y mutation. One other patient presented a new polymorphism in the hemojuvelin gene, without consequences in iron load or clinical course of the disease. In conclusion, HAMP and hemojuvelin mutations are rare among Spanish HH patients, and their impact in this population is not significant.

Surfactant protein B deficiency and gene mutations for neonatal respiratory distress syndrome in China Han ethnic population

PubMed Central

Yin, Xiaojuan; Meng, Fanping; wang, Yan; Xie, Lu; Kong, Xiangyong; Feng, Zhichun

2013-01-01

Objective: To determine whether the SP-B deficiency and gene mutations in exon 4 is associated with neonatal RDS in China Han ethnic population. Methods: The study population consisted of 40 neonates with RDS and 40 neonates with other diseases as control in China Han ethnic population. We Compared SP-B expression in lung tissue and bronchoalveolar lavage fluid with immunoblotting, and analyzed mutations in the SP-B gene with polymerase chain reaction (PCR) and gene sequencing. Results: In RDS group, low mature Surfactant protein B was found in both lung tissue and bronchoalveolar lavage fluid in 8 neonates. In control group, only 4 neonates with low mature Surfactant protein B in both lung tissue and bronchoalveolar lavage fluid. In RDS group, 20 neonates were found to have mutations in exon 4, 12 homozygous mutations with C/C genotype and 8 heterozygous mutations with C/T genotype in surfactant protein B gene+1580 polymorphism. There were 8 cases mutations in control group, 1 in C/C and 7 in C/T genotype. The frequency of homozygotes with C/C genotype was 0.3 and frequency of heterozygotes with C/T genotype was 0.02 in RDS group. In control group, frequency of homozygotes with C/C genotype was 0.025 and frequency of heterozygote with C/T genotype was 0.175. Conclusion: Low mature Surfactant protein B is associated with the pathogenesis of neonatal respiratory distress syndrome (RDS) in China Han ethnic population. Mutations in exon 4 of the surfactant protein B gene demonstrate an association between homozygous mutations with C/C genotype in SP-B gene and neonatal RDS. PMID:23330012

FANCA Gene Mutations with 8 Novel Molecular Changes in Indian Fanconi Anemia Patients.

PubMed

Solanki, Avani; Mohanty, Purvi; Shukla, Pallavi; Rao, Anita; Ghosh, Kanjaksha; Vundinti, Babu Rao

2016-01-01

Fanconi anemia (FA), a rare heterogeneous genetic disorder, is known to be associated with 19 genes and a spectrum of clinical features. We studied FANCA molecular changes in 34 unrelated and 2 siblings of Indian patients with FA and have identified 26 different molecular changes of FANCA gene, of which 8 were novel mutations (a small deletion c.2500delC, 4 non-sense mutations c.2182C>T, c.2630C>G, c.3677C>G, c.3189G>A; and 3 missense mutations; c.1273G>C, c.3679 G>C, and c.3992 T>C). Among these only 16 patients could be assigned FA-A complementation group, because we could not confirm single exon deletions detected by MLPA or cDNA amplification by secondary confirmation method and due to presence of heterozygous non-pathogenic variations or heterozygous pathogenic mutations. An effective molecular screening strategy should be developed for confirmation of these mutations and determining the breakpoints for single exon deletions.

FANCA Gene Mutations with 8 Novel Molecular Changes in Indian Fanconi Anemia Patients

PubMed Central

Solanki, Avani; Mohanty, Purvi; Shukla, Pallavi; Rao, Anita; Ghosh, Kanjaksha; Vundinti, Babu Rao

2016-01-01

Fanconi anemia (FA), a rare heterogeneous genetic disorder, is known to be associated with 19 genes and a spectrum of clinical features. We studied FANCA molecular changes in 34 unrelated and 2 siblings of Indian patients with FA and have identified 26 different molecular changes of FANCA gene, of which 8 were novel mutations (a small deletion c.2500delC, 4 non-sense mutations c.2182C>T, c.2630C>G, c.3677C>G, c.3189G>A; and 3 missense mutations; c.1273G>C, c.3679 G>C, and c.3992 T>C). Among these only 16 patients could be assigned FA-A complementation group, because we could not confirm single exon deletions detected by MLPA or cDNA amplification by secondary confirmation method and due to presence of heterozygous non-pathogenic variations or heterozygous pathogenic mutations. An effective molecular screening strategy should be developed for confirmation of these mutations and determining the breakpoints for single exon deletions. PMID:26799702

Two new mutations in the MTATP6 gene associated with Leigh syndrome.

PubMed

Moslemi, A-R; Darin, N; Tulinius, M; Oldfors, A; Holme, E

2005-10-01

In this study we have analyzed the mtDNA encoded ATPase 6 and 8 genes ( MTATP6 and MTATP8) in two children with Leigh syndrome (LS) and reduced Mg (2+) ATPase activity in muscle mitochondria. In patient 1, with a mild and reversible phenotype, mutational analysis revealed a heteroplasmic T --> C mutation at nt position 9185 (T9185C) in the MTATP6. The mutation resulted in substitution of a highly conserved leucine to proline at codon 220. The proportion of the mutation was > 97 % in the patient's blood and muscle and 85 % in blood of his asymptomatic mother. Patient 2, with severe clinical phenotype and death at 2 years of age, exhibited a novel heteroplasmic T9191C missense mutation in the MTATP6, which converted a highly conserved leucine to a proline at position 222 of the polypeptide. The proportion of the mutation was 90 % in fibroblasts and 94 % muscle tissue. This mutation was absent in the patient's parents and sister suggesting that the mutation was de novo. Our findings expand the spectrum of mutations causing LS and emphasize the role of MTATP6 gene mutations in pathogenesis of LS.

A common mutation in the methylenetetrahydrofolate reductase gene is associated with an accumulation of formylated tetrahydrofolates in red blood cells

PubMed Central

Bagley, Pamela J.; Selhub, Jacob

1998-01-01

A common mutation (C677T) in the gene encoding for methylenetetrahydrofolate reductase (MTHFR) (5-methyltetrahydrofolate:(acceptor) oxidoreductase, EC 1.7.99.5), a key regulatory enzyme in one-carbon metabolism, results in a thermolabile variant of the MTHFR enzyme with reduced activity in vitro. In the present study we used a chromatographic method for folate analysis to test the hypothesis that this mutation would be associated with altered distribution of red blood cell (RBC) folates. An alteration was found as manifested by the presence of formylated tetrahydrofolate polyglutamates in addition to methylated derivatives in the RBCs from homozygous mutant individuals. 5-Methyltetrahydrofolate polyglutamates were the only folate form found in RBCs from individuals with the wild-type genotype. Existence of formylated folates in RBCs only from individuals with the thermolabile MTHFR is consistent with the hypothesis that there is in vivo impairment in the activity of the thermolabile variant of MTHFR and that this impairment results in an altered distribution of RBC folates. PMID:9789068

Phenotypic Variation in Patients with Homozygous c.1678G>T Mutation in EVC Gene: Report of Two Mexican Families with Ellis-van Creveld Syndrome

PubMed Central

Ibarra-Ramirez, Marisol; Campos-Acevedo, Luis Daniel; Lugo-Trampe, Jose; Martínez-Garza, Laura E.; Martinez-Glez, Víctor; Valencia-Benitez, María; Lapunzina, Pablo; Ruiz-Peréz, Víctor

2017-01-01

Case series Patient: — Final Diagnosis: Ellis van Creveld syndrome Symptoms: Conical teeth • polydactyly • short stature Medication: — Clinical Procedure: — Specialty: Pediatrics and Neonatology Objective: Rare disease Background: Ellis-van Creveld syndrome is an autosomal recessive chondro-ectodermal dysplasia characterized by disproportionate short stature, limb shortening, narrow chest, postaxial polydactyly and dysplastic nails and teeth. In addition, 60% of cases present congenital heart defects. Ellis-van Creveld syndrome is predominantly caused by mutations in the EVC or EVC2 (4p16) genes, with only a few cases caused by mutations in WDR35. Case Report: Here, we report on two Mexican families with patients diagnosed with Ellis-van Creveld syndrome. Family 1 includes four patients: three females of 15, 18, and 23 years of age and a 7-year old male. Family 2 has only one affected newborn male. All patients exhibited multiple features including hypodontia, dysplastic teeth, extra frenula, mild short stature, distal limb shortening, postaxial polydactyly of hands and feet, nail dystrophy, and knee joint abnormalities. Only two patients had an atrial septal defect. In all cases, molecular analysis by Sanger sequencing identified the same homozygous mutation in exon 12 of EVC, c.1678G>T, which leads to a premature stop codon. Conclusions: The mutation c.1678G>T has been previously reported in another Mexican patient and it appears to be a recurrent mutation in Mexico which could represent a founder mutation. The large number of patients in this case allows the clinical variability and spectrum of manifestations present in individuals with Ellis-van Creveld syndrome even if they carry the same homozygous mutation in a same family. PMID:29229899

[Analysis on mutation of S gene and P gene of hepatitis B virus in two counties of Sichuan Province].

PubMed

Tong, Wen-Bin; He, Ji-Lan; Sun, Li

2009-02-01

To analyze HBV S gene/P gene mutation in 2 counties (districts) of Sichuan province. HBV DNA were extracted from sera positive both for HBsAg and HBeAg. After PCR and nucleotide sequencing, nucleotide/amino acid mutation in S and P gene were compared and analyzed. Of 47 serum samples from patients with chronic HBV infection, amino acid mutation in 'a' determinant occurred in 12 samples (25.53%,12/47), correlating with T126A, I126T/S, P127T, T131N, M133L, M133T and T140I; high proportion of mutation clustered in first loop of 'a' determinant (92.86%,13/14), rtV207I mutation in C domain of reverse transcription occured in one sample. Naturally occurring mutation in 'a' determinant clustered predominantly in the first loop and usually associated with altered antigenicity, posing a potential threat to successfully vaccinated individuals; Lamivudine-resistant mutant might occur in patient even without nucleotide analogue treatment.

Frequency of the S65C mutation in the hemochromatosis gene in Brazil.

PubMed

Oliveira, V C; Caxito, F A; Gomes, K B; Castro, A M; Pardini, V C; Ferreira, A C S

2009-07-14

Development of hereditary hemochromatosis is associated with the C282Y, H63D or S65C mutations in the hemochromatosis gene. Though there is extensive knowledge about the former two, there is little information on the mechanism of action and the allelic frequency of the S65C mutation. We examined the prevalence of the S65C mutation of the hemochromatosis gene in Brazilians with clinical suspicion of hereditary hemochromatosis. Genotyping for this mutation was carried out in 633 individuals with clinical suspicion of hereditary hemochromatosis, using the polymerase chain reaction, followed by enzymatic digestion. The sample comprised 77.1% men and 22.9% women, giving a ratio of approximately 3:1; the mean age was 48.8 +/- 13.8 years. More than half (57.3%) of the individuals in the sample were 41 to 60 years old. The frequency of heterozygotes for this mutation was 0.016; no homozygous mutant patients were found. This is the first analysis of the S65C mutation in individuals suspected of having hereditary hemochromatosis in Brazil.

A variety of gene polymorphisms associated with idiopathic granulomatous mastitis

PubMed Central

Destek, Sebahattin; Gul, Vahit Onur; Ahioglu, Serkan

2016-01-01

Idiopathic granulomatous mastitis (IGM) is a rare and chronic inflammatory disorder. IGM mimics breast cancer regarding its clinical and radiological features. Etiology of IGM remains unclarified. Our patient was 37-year-old and 14 weeks pregnant. There was pain, redness and swelling in the right breast. The mass suggestive of malignancy was detected in sonography. Serum CA 125 and CA 15-3 levels were high. Genetic analysis was performed for the etiology. methylenetetrahydrofolate reductase (MTHFR) C 677 TT, β-fibrinogen-455 G>A, plasminogen activator inhibitor (PAI)-1 5 G/5 G, angiotensin-converting enzyme (ACE) I/D mutation was found. IGM was diagnosed by cor biopsy. An association was also reported between breast cancer and mutations in MTHFR-C 677 T, PAI-1, ACE genes. Genetic polymorphisms may involve in the development of IGM as it was seen in our case. Further studies should be conducted to better clarify this plausible association. PMID:27619324

Fundamental Role of Methylenetetrahydrofolate Reductase 677 C → T Genotype and Flavin Compounds in Biochemical Phenotypes for Schizophrenia and Schizoaffective Psychosis

PubMed Central

Fryar-Williams, Stephanie

2016-01-01

The Mental Health Biomarker Project (2010–2016) explored variables for psychosis in schizophrenia and schizoaffective disorder. Blood samples from 67, highly characterized symptomatic cases and 67 gender and age matched control participants were analyzed for methyl tetrahydrofolate reductase (MTHFR) 677C → T gene variants and for vitamin B6, B12 and D, folate, unbound copper, zinc cofactors for enzymes in the methylation cycle, and related catecholamine pathways. Urine samples were analyzed for indole-catecholamines, their metabolites, and oxidative-stress marker, hydroxylpyrolline-2-one (HPL). Rating scales were Brief Psychiatric Rating Scale, Positive and Negative Syndrome Scale, Global Assessment of Function scale, Clinical Global Impression (CGI) score, and Social and Occupational Functioning Assessment Scale (SOFAS). Analysis used Spearman’s correlates, receiver operating characteristics and structural equation modeling (SEM). The correlative pattern of variables in the overall participant sample strongly implicated monoamine oxidase (MAO) enzyme inactivity so the significant role of MAO’s cofactor flavin adenine nucleotide and its precursor flavin adenine mononucleotide (FMN) within the biochemical pathways was investigated and confirmed as 71% on SEM of the total sample. Splitting the data sets for MTHFR 677C → T polymorphism variants coding for the MTHFR enzyme, discovered that biochemistry variables relating to the wild-type enzyme differed markedly in pattern from those coded by the homozygous variant and that the hereozygous-variant pattern resembled the wild-type-coded pattern. The MTHFR 677C → T-wild and -heterozygous gene variants have a pattern of depleted vitamin cofactors characteristic of flavin insufficiency with under-methylation and severe oxidative stress. The second homozygous MTHFR 677TT pattern related to elevated copper:zinc ratio and a vitamin pattern related to flavin sufficiency and risk of over-methylation. The

Fundamental Role of Methylenetetrahydrofolate Reductase 677 C → T Genotype and Flavin Compounds in Biochemical Phenotypes for Schizophrenia and Schizoaffective Psychosis.

PubMed

Fryar-Williams, Stephanie

2016-01-01

The Mental Health Biomarker Project (2010-2016) explored variables for psychosis in schizophrenia and schizoaffective disorder. Blood samples from 67, highly characterized symptomatic cases and 67 gender and age matched control participants were analyzed for methyl tetrahydrofolate reductase (MTHFR) 677C → T gene variants and for vitamin B6, B12 and D, folate, unbound copper, zinc cofactors for enzymes in the methylation cycle, and related catecholamine pathways. Urine samples were analyzed for indole-catecholamines, their metabolites, and oxidative-stress marker, hydroxylpyrolline-2-one (HPL). Rating scales were Brief Psychiatric Rating Scale, Positive and Negative Syndrome Scale, Global Assessment of Function scale, Clinical Global Impression (CGI) score, and Social and Occupational Functioning Assessment Scale (SOFAS). Analysis used Spearman's correlates, receiver operating characteristics and structural equation modeling (SEM). The correlative pattern of variables in the overall participant sample strongly implicated monoamine oxidase (MAO) enzyme inactivity so the significant role of MAO's cofactor flavin adenine nucleotide and its precursor flavin adenine mononucleotide (FMN) within the biochemical pathways was investigated and confirmed as 71% on SEM of the total sample. Splitting the data sets for MTHFR 677C → T polymorphism variants coding for the MTHFR enzyme, discovered that biochemistry variables relating to the wild-type enzyme differed markedly in pattern from those coded by the homozygous variant and that the hereozygous-variant pattern resembled the wild-type-coded pattern. The MTHFR 677C → T-wild and -heterozygous gene variants have a pattern of depleted vitamin cofactors characteristic of flavin insufficiency with under-methylation and severe oxidative stress. The second homozygous MTHFR 677TT pattern related to elevated copper:zinc ratio and a vitamin pattern related to flavin sufficiency and risk of over-methylation. The two

Chronic Granulomatous Disease Due to Neutrophil Cytosolic Factor (NCF2) Gene Mutations in Three Unrelated Families.

PubMed

Vignesh, Pandiarajan; Rawat, Amit; Kumar, Ankur; Suri, Deepti; Gupta, Anju; Lau, Yu L; Chan, Koon W; Singh, Surjit

2017-02-01

Chronic granulomatous disease (CGD) is an inheritable and genetically heterogeneous disease resulting from mutations in different subcomponents of the NADPH oxidase system. Mutations in the NCF2 gene account for <5% of all cases of CGD. We analyzed the clinical and laboratory findings of CGD with mutations in the NCF2 gene from amongst our cohort of CGD patients. A homozygous mutation (c.835_836delAC, p.T279fsX294), a deletion in NCF2 gene was found in two cases. In the third case, two heterozygous mutations were detected, IVS13-2A>T on one allele and c.1099C>T (p.) on the other allele. The mother of this child was a carrier for the IVS13-2A>T mutation. All three cases had colitis, and it was the initial symptom in two patients. One of the patients also developed a lung abscess due to Nocardia cyriacigeorgica.

The m.3291T>C mt-tRNALeu(UUR) mutation is definitely pathogenic and causes multisystem mitochondrial disease

PubMed Central

Yarham, John W.; Blakely, Emma L.; Alston, Charlotte L.; Roberts, Mark E.; Ealing, John; Pal, Piyali; Turnbull, Douglass M.; McFarland, Robert; Taylor, Robert W.

2013-01-01

Mitochondrial tRNA point mutations are important causes of human disease, and have been associated with a diverse range of clinical phenotypes. Definitively proving the pathogenicity of any given mt-tRNA mutation requires combined molecular, genetic and functional studies. Subsequent evaluation of the mutation using a pathogenicity scoring system is often very helpful in concluding whether or not the mutation is causing disease. Despite several independent reports linking the m.3291T>C mutation to disease in humans, albeit in association with several different phenotypes, its pathogenicity remains controversial. A lack of conclusive functional evidence and an over-emphasis on the poor evolutionary conservation of the affected nucleotide have contributed to this controversy. Here we describe an adult patient who presented with deafness and lipomas and evidence of mitochondrial abnormalities in his muscle biopsy, who harbours the m.3291T > C mutation, providing conclusive evidence of pathogenicity through analysis of mutation segregation with cytochrome c oxidase (COX) deficiency in single muscle fibres, underlining the importance of performing functional studies when assessing pathogenicity. PMID:23273904

Passenger mutations and aberrant gene expression in congenic tissue plasminogen activator-deficient mouse strains.

PubMed

Szabo, R; Samson, A L; Lawrence, D A; Medcalf, R L; Bugge, T H

2016-08-01

Essentials C57BL/6J-tissue plasminogen activator (tPA)-deficient mice are widely used to study tPA function. Congenic C57BL/6J-tPA-deficient mice harbor large 129-derived chromosomal segments. The 129-derived chromosomal segments contain gene mutations that may confound data interpretation. Passenger mutation-free isogenic tPA-deficient mice were generated for study of tPA function. Background The ability to generate defined null mutations in mice revolutionized the analysis of gene function in mammals. However, gene-deficient mice generated by using 129-derived embryonic stem cells may carry large segments of 129 DNA, even when extensively backcrossed to reference strains, such as C57BL/6J, and this may confound interpretation of experiments performed in these mice. Tissue plasminogen activator (tPA), encoded by the PLAT gene, is a fibrinolytic serine protease that is widely expressed in the brain. A number of neurological abnormalities have been reported in tPA-deficient mice. Objectives To study genetic contamination of tPA-deficient mice. Materials and methods Whole genome expression array analysis, RNAseq expression profiling, low- and high-density single nucleotide polymorphism (SNP) analysis, bioinformatics and genome editing were used to analyze gene expression in tPA-deficient mouse brains. Results and conclusions Genes differentially expressed in the brain of Plat(-/-) mice from two independent colonies highly backcrossed onto the C57BL/6J strain clustered near Plat on chromosome 8. SNP analysis attributed this anomaly to about 20 Mbp of DNA flanking Plat being of 129 origin in both strains. Bioinformatic analysis of these 129-derived chromosomal segments identified a significant number of mutations in genes co-segregating with the targeted Plat allele, including several potential null mutations. Using zinc finger nuclease technology, we generated novel 'passenger mutation'-free isogenic C57BL/6J-Plat(-/-) and FVB/NJ-Plat(-/-) mouse strains by introducing

A new nonsense mutation in the NF1 gene with neurofibromatosis-Noonan syndrome phenotype.

PubMed

Yimenicioğlu, Sevgi; Yakut, Ayten; Karaer, Kadri; Zenker, Martin; Ekici, Arzu; Carman, Kürşat Bora

2012-12-01

Neurofibromatosis-Noonan syndrome is a rare autosomal dominant disorder which combines neurofibromatosis type 1 (NF1) features with Noonan syndrome. NF1 gene mutations are reported in the majority of these patients. Sequence analysis of the established genes for Noonan syndrome revealed no mutation; a heterozygous NF1 point mutation c.7549C>T in exon 51, creating a premature stop codon (p.R2517X), had been demonstrated. Neurofibromatosis-Noonan syndrome recently has been considered a subtype of NF1 and caused by different NF1 mutations. We report the case of a 14-year-old boy with neurofibromatosis type 1 with Noonan-like features, who complained of headache with triventricular hydrocephaly and a heterozygous NF1 point mutation c.7549C>T in exon 51.

Rates of Spontaneous Mutation in Bacteriophage T4 Are Independent of Host Fidelity Determinants

PubMed Central

Santos, M. E.; Drake, J. W.

1994-01-01

Bacteriophage T4 encodes most of the genes whose products are required for its DNA metabolism, and host (Escherichia coli) genes can only infrequently complement mutationally inactivated T4 genes. We screened the following host mutator mutations for effects on spontaneous mutation rates in T4: mutT (destruction of aberrant dGTPs), polA, polB and polC (DNA polymerases), dnaQ (exonucleolytic proofreading), mutH, mutS, mutL and uvrD (methyl-directed DNA mismatch repair), mutM and mutY (excision repair of oxygen-damaged DNA), mutA (function unknown), and topB and osmZ (affecting DNA topology). None increased T4 spontaneous mutation rates within a resolving power of about twofold (nor did optA, which is not a mutator but overexpresses a host dGTPase). Previous screens in T4 have revealed strong mutator mutations only in the gene encoding the viral DNA polymerase and proofreading 3'-exonuclease, plus weak mutators in several polymerase accessory proteins or determinants of dNTP pool sizes. T4 maintains a spontaneous mutation rate per base pair about 30-fold greater than that of its host. Thus, the joint high fidelity of insertion by T4 DNA polymerase and proofreading by its associated 3'-exonuclease appear to determine the T4 spontaneous mutation rate, whereas the host requires numerous additional systems to achieve high replication fidelity. PMID:7851754

Leber's hereditary optic neuropathy is associated with the mitochondrial ND6 T14484C mutation in three Chinese families

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sun Yanhong; Wei Qiping; Zhou Xiangtian

2006-08-18

We report here the clinical, genetic, and molecular characterization of three Chinese families with maternally transmitted Leber's hereditary optic neuropathy (LHON). Clinical and genetic evaluations revealed the variable severity and age-of-onset in visual impairment in these families. In the affected matrilineal relatives, the loss of central vision is bilateral, the fellow eye becoming affected either simultaneously (45%) or sequentially (55%). The penetrances of vision loss in these pedigrees were 27%, 50%, and 60%, respectively. The age-at-onset of vision loss in these families was 14, 19, and 24 years, respectively. Furthermore, the ratios between affected male and female matrilineal relatives weremore » 1:1, 1:1.2, and 1:2, respectively. Mutational analysis of mitochondrial DNA revealed the presence of homoplasmic ND6 T14484C mutation, which has been associated with LHON. The incomplete penetrance and phenotypic variability implicate the involvement of nuclear modifier gene(s), environmental factor(s) or mitochondrial haplotype(s) in the phenotypic expression of the LHON-associated T14484C mutation in these Chinese pedigrees.« less

Four Novel p.N385K, p.V36A, c.1033–1034insT and c.1417–1418delCT Mutations in the Sphingomyelin Phosphodiesterase 1 (SMPD1) Gene in Patients with Types A and B Niemann-Pick Disease (NPD)

PubMed Central

Manshadi, Masoumeh Dehghan; Kamalidehghan, Behnam; Keshavarzi, Fatemeh; Aryani, Omid; Dadgar, Sepideh; Arastehkani, Ahoora; Tondar, Mahdi; Ahmadipour, Fatemeh; Meng, Goh Yong; Houshmand, Massoud

2015-01-01

Background: Types A and B Niemann-Pick disease (NPD) are autosomal-recessive lysosomal storage disorders caused by the deficient activity of acid sphingomyelinase due to mutations in the sphingomyelin phosphodiesterase 1 (SMPD1) gene. Methods: In order to determine the prevalence and distribution of SMPD1 gene mutations, the genomic DNA of 15 unrelated Iranian patients with types A and B NPD was examined using PCR, DNA sequencing and bioinformatics analysis. Results: Of 8 patients with the p.G508R mutation, 5 patients were homozygous, while the other 3 were heterozygous. One patient was heterozygous for both the p.N385K and p.G508R mutations. Another patient was heterozygous for both the p.A487V and p.G508R mutations. Two patients (one homozygous and one heterozygous) showed the p.V36A mutation. One patient was homozygous for the c.1033–1034insT mutation. One patient was homozygous for the c.573delT mutation, and 1 patient was homozygous for the c.1417–1418delCT mutation. Additionally, bioinformatics analysis indicated that two new p.V36A and p.N385K mutations decreased the acid sphingomyelinase (ASM) protein stability, which might be evidence to suggest the pathogenicity of these mutations. Conclusion: with detection of these new mutations, the genotypic spectrum of types A and B NPD is extended, facilitating the definition of disease-related mutations. However, more research is essential to confirm the pathogenic effect of these mutations. PMID:25811928

HFE gene C282Y, H63D and S65C mutations frequency in the Transylvania region, Romania.

PubMed

Trifa, Adrian P; Popp, Radu A; Militaru, Mariela S; Farcaş, Marius F; Crişan, Tania O; Gana, Ionuţ; Cucuianu, Andrei; Pop, Ioan V

2012-06-01

HFE-associated haemochromatosis is one of the most frequent autosomal recessive disorders in the Caucasian population. Although most of the cases are homozygous individuals for the C282Y mutation, another two mutations, H63D and S65C, have been reported to be associated with milder forms of the disease. This study was a first attempt to evaluate the distribution of these HFE gene mutations in the Transylvania region. Two-hundred and twenty-five healthy, unrelated volunteers originating from the Transylvania region, Romania, were screened for the HFE gene C282Y, H63D and S65C mutations, using molecular genetics assays (Polymerase Chain Reaction-Restriction Fragments Length Polymorphism). For the C282Y mutation, 7 heterozygotes (3.1%) were found, but no homozygous individual. In the case of the H63D mutation, 40 heterozygotes (17.8%) and 4 homozygotes (1.75%) for the mutant allele were evidenced. We found a compound heterozygous genotype (C282Y/H63D) in one individual (0.45%). Thus, the allele frequencies of the C282Y and H63D were 1.75% and 10.9%, respectively. Three individuals (1.3%) were found to harbour the S65C mutation in a heterozygous state, but none in a homozygous state: the allele frequency of the mutant allele was 0.75%. The distribution of the HFE gene C282Y, H63D and S65C mutations found in our group matches the tendencies observed in other European countries: a decreasing gradient from Northern to Southern Europe for the C282Y mutation; high frequency for the H63D mutation, and low frequency for the S65C mutation in most of the countries.

Severe hypertriglyceridemia due to two novel loss-of-function lipoprotein lipase gene mutations (C310R/E396V) in a Chinese family associated with recurrent acute pancreatitis.

PubMed

Lun, Yu; Sun, Xiaofang; Wang, Ping; Chi, Jingwei; Hou, Xu; Wang, Yangang

2017-07-18

Lipoprotein lipase (LPL) is widely expressed in skeletal muscles, cardiac muscles as well as adipose tissue and involved in the catabolism of triglyceride. Herein we have systematically characterized two novel loss-of-function mutations in LPL from a Chinese family in which afflicted members were manifested by severe hypertriglyceridemia and recurrent pancreatitis. DNA sequencing revealed that the proband was a heterozygote carrying a novel c.T928C (p.C310R) mutation in exon 6 of the LPL gene. Another member of the family was detected to be a compound heterozygote who along with the c.T928C mutation also carried a novel missense mutation c.A1187T (p.E396V) in exon 8 of the LPL gene. Furthermore, COS-1 cells were transfected with lentiviruses containing the mutant LPL genes. While C310R markedly reduced the overall LPL protein level, COS-1 cells carrying E396V or double mutations contained similar overall LPL protein levels to the wild-type. The specific activity of the LPL mutants remained at comparable magnitude to the wild-type. However, few LPL were detected in the culture medium for the mutants, suggesting that both mutations caused aberrant triglyceride catabolism. More specifically, E396V and double mutations dampened the transport of LPL to the cell surface, while for the C310R mutation, reducing LPL protein level might be involved. By characterizing these two novel LPL mutations, this study has expanded our understanding on the pathogenesis of familial hypertriglyceridemia (FHTG).

Hereditary Angioedema Nationwide Study in Slovenia Reveals Four Novel Mutations in SERPING1 Gene

PubMed Central

Rijavec, Matija; Korošec, Peter; Šilar, Mira; Zidarn, Mihaela; Miljković, Jovan; Košnik, Mitja

2013-01-01

Hereditary angioedema (HAE) is a rare autosomal dominant disease characterized by swelling of the face, lips, tongue, larynx, genitalia, or extremities, with abdominal pain caused by intra-abdominal edema. HAE is caused by mutations affecting the C1 inhibitor gene, SERPING1, resulting in low levels of C1 inhibitor (Type I HAE) or normal levels of ineffective C1 inhibitor (Type II HAE). A nationwide survey identified nine unrelated families with HAE in Slovenia, among whom 17 individuals from eight families were recruited for genetic analyses. A diagnosis of HAE was established in the presence of clinical and laboratory criteria (low C1 inhibitor antigenic levels and/or function), followed up by a positive family history. Genetic studies were carried out using PCR and sequencing to detect SERPING1 mutations in promoter, noncoding exon 1, the 7 coding exons, and exon-intron boundaries. Multiplex ligation-dependent probe amplification was performed in order to search for large deletions/duplications in SERPING1 gene. A mutation responsible for HAE was identified in patients from seven families with the disease. In HAE type I families, one previously reported substitution (Gln67Stop, c.265C>T) and four novel mutations were identified. The new mutations included two missense substitutions, Ser128Phe (c.449C>T), and Glu429Lys (c.1351G>A), together with two frameshift mutations, indel (c.49delGinsTT) and deletion (c.593_594delCT). Both families with HAE type II harbored the two well-known substitutions affecting the arginyl residue at the reactive center in exon 8, Arg444Cys (c.1396C>T) and Arg444His (c.1397G>A), respectively. In one patient only the homozygous variant g.566T>C (c.-21T>C) was identified. Our study identified four novel mutations in the Slovenian HAE population, highlighting the heterogeneity of mutations in the SERPING1 gene causing C1 inhibitor deficiency and HAE. In a single patient with HAE a homozygous variant g.566T>C (c.-21T>C) might be responsible

Hereditary angioedema nationwide study in Slovenia reveals four novel mutations in SERPING1 gene.

PubMed

Rijavec, Matija; Korošec, Peter; Šilar, Mira; Zidarn, Mihaela; Miljković, Jovan; Košnik, Mitja

2013-01-01

Hereditary angioedema (HAE) is a rare autosomal dominant disease characterized by swelling of the face, lips, tongue, larynx, genitalia, or extremities, with abdominal pain caused by intra-abdominal edema. HAE is caused by mutations affecting the C1 inhibitor gene, SERPING1, resulting in low levels of C1 inhibitor (Type I HAE) or normal levels of ineffective C1 inhibitor (Type II HAE). A nationwide survey identified nine unrelated families with HAE in Slovenia, among whom 17 individuals from eight families were recruited for genetic analyses. A diagnosis of HAE was established in the presence of clinical and laboratory criteria (low C1 inhibitor antigenic levels and/or function), followed up by a positive family history. Genetic studies were carried out using PCR and sequencing to detect SERPING1 mutations in promoter, noncoding exon 1, the 7 coding exons, and exon-intron boundaries. Multiplex ligation-dependent probe amplification was performed in order to search for large deletions/duplications in SERPING1 gene. A mutation responsible for HAE was identified in patients from seven families with the disease. In HAE type I families, one previously reported substitution (Gln67Stop, c.265C>T) and four novel mutations were identified. The new mutations included two missense substitutions, Ser128Phe (c.449C>T), and Glu429Lys (c.1351G>A), together with two frameshift mutations, indel (c.49delGinsTT) and deletion (c.593_594delCT). Both families with HAE type II harbored the two well-known substitutions affecting the arginyl residue at the reactive center in exon 8, Arg444Cys (c.1396C>T) and Arg444His (c.1397G>A), respectively. In one patient only the homozygous variant g.566T>C (c.-21T>C) was identified. Our study identified four novel mutations in the Slovenian HAE population, highlighting the heterogeneity of mutations in the SERPING1 gene causing C1 inhibitor deficiency and HAE. In a single patient with HAE a homozygous variant g.566T>C (c.-21T>C) might be responsible

Mutation analysis of 12 genes in Chinese families with congenital cataracts

PubMed Central

Sun, Wenmin; Xiao, Xueshan; Li, Shiqiang; Guo, Xiangming

2011-01-01

Purpose To identify mutations in 12 genes in Chinese families with congenital cataracts. Methods Twenty five families with congenital cataracts involved in this study. The coding exons and adjacent intronic regions of 12 genes were analyzed by cycle sequencing, including the alpha A crystallin (CRYAA), alpha B crystallin (CRYAB), beta A1 crystallin (CRYBA1), beta A4 crystallin (CRYBA4), beta B1 crystallin (CRYBB1), beta B2 crystallin (CRYBB2), beta B3 crystallin (CRYBB3), gamma C crystallin (CRYGC), gamma D crystallin (CRYGD), gamma S crystallin (CRYGS), alpha 3 gap junction protein (GJA3), and alpha 8 gap junction protein (GJA8) genes. Novel variants were further evaluated in 96 normal controls. Results Nine mutations were identified in 10 of the 25 families (40%), including 5 novel (c.350_352delGCT in CRYAA, c.205C>T in CRYAB, c.106G>C in CRYGD, c.77A>G in CRYGS, c.1143_1165del23 in GJA3) and 4 known (c.292G>A in CRYAA; c.215+1G>A and c.272_274delGAG in CRYBA1, and c.176C>T in GJA3). All novel mutations were predicted to be pathogenic and were not present in 96 controls. Conclusions Mutations in the 12 genes encoding crystallins and connexins were responsible for 40% Chinese families with congenital cataracts. Our results enriched our knowledge on the molecular basis of congenital cataracts in Chinese population. PMID:21866213

Glucokinase gene mutations (MODY 2) in Asian Indians.

PubMed

Kanthimathi, Sekar; Jahnavi, Suresh; Balamurugan, Kandasamy; Ranjani, Harish; Sonya, Jagadesan; Goswami, Soumik; Chowdhury, Subhankar; Mohan, Viswanathan; Radha, Venkatesan

2014-03-01

Heterozygous inactivating mutations in the glucokinase (GCK) gene cause a hyperglycemic condition termed maturity-onset diabetes of the young (MODY) 2 or GCK-MODY. This is characterized by mild, stable, usually asymptomatic, fasting hyperglycemia that rarely requires pharmacological intervention. The aim of the present study was to screen for GCK gene mutations in Asian Indian subjects with mild hyperglycemia. Of the 1,517 children and adolescents of the population-based ORANGE study in Chennai, India, 49 were found to have hyperglycemia. These children along with the six patients referred to our center with mild hyperglycemia were screened for MODY 2 mutations. The GCK gene was bidirectionally sequenced using BigDye(®) Terminator v3.1 (Applied Biosystems, Foster City, CA) chemistry. In silico predictions of the pathogenicity were carried out using the online tools SIFT, Polyphen-2, and I-Mutant 2.0 software programs. Direct sequencing of the GCK gene in the patients referred to our Centre revealed one novel mutation, Thr206Ala (c.616A>G), in exon 6 and one previously described mutation, Met251Thr (c.752T>C), in exon 7. In silico analysis predicted the novel mutation to be pathogenic. The highly conserved nature and critical location of the residue Thr206 along with the clinical course suggests that the Thr206Ala is a MODY 2 mutation. However, we did not find any MODY 2 mutations in the 49 children selected from the population-based study. Hence prevalence of GCK mutations in Chennai is <1:1,517. This is the first study of MODY 2 mutations from India and confirms the importance of considering GCK gene mutation screening in patients with mild early-onset hyperglycemia who are negative for β-cell antibodies.

Are the methylenetetrahydrofolate reductase 1298 and 677 gene polymorphisms related to optic glioma and hamartoma risk in neurofibromatosis type 1 patients?

PubMed

Tanyıldız, Hikmet Gülşah; Yeşil, Şule; Bozkurt, Ceyhun; Çandır, Mehmet Onur; Akpınar-Tekgündüz, Sibel; Toprak, Şule; Yüksel, Deniz; Şahin, Gürses

2016-01-01

The methylenetetrahydrofolate reductase (MTHFR) gene plays a key role in carcinogenesis through its effects on DNA synthesis and methylation and also has a significant role in the etiology of many disorders, such as diabetes, migraine, and cardiovascular disease. Neurofibromatoses (NF) are autosomal dominant inherited diseases that can affect tissues such as bone and skin and predispose individuals to tumor development in various parts of the nervous system or body. Optic nerve glioma and brain tumors are common in children with NF, and leukemia and lymphoma incidence is also higher than normal. We therefore aimed to investigate the possible relationship between the MTHFR gene polymorphism and accompanying tumors such as neurofibroma, hamartoma, and optic glioma in children with NF1 found to have the MTHFR 677 and MTHFR 1298 gene polymorphism in this study. We included 55 pediatric patients diagnosed with NF1 between 2005 and 2014 in the study group. The control group included 44 healthy subjects without acute or chronic disease findings. A significant relationship was found between the MTHFR A1298C polymorphism and the incidence of optic glioma (p=0.014) (AA vs. AC: OR 11, 95% CI 1.27-95.17; AA vs. CC: OR 7.33, 95% CI 0.35-150.70). We also found a significant relationship between the MTHFR C1298C polymorphism and the incidence of hamartoma (p=0.019) (AA vs. AC: OR 2.12, 95% CI 0.662-6.809; p=0.203). Epilepsy incidence was high in subjects with MTHFR C677C. The MTHFR A1298C, C1298C, and C677C gene polymorphisms can be associated with a higher optic glioma, hamartoma, and epilepsy incidence, respectively, in patients diagnosed with neurofibromatosis type 1.

Ocular phenotypes associated with two mutations (R121W, C126X) in the Norrie disease gene.

PubMed

Kellner, U; Fuchs, S; Bornfeld, N; Foerster, M H; Gal, A

1996-06-01

To describe the ocular phenotypes associated with 2 mutations in the Norrie disease gene including a manifesting carrier. Ophthalmological examinations were performed in 2 affected males and one manifesting carrier. Genomic DNA was analyzed by direct sequencing of the Norrie disease gene. Family I: A 29-year-old male had the right eye enucleated at the age of 3 years. His left eye showed severe temporal dragging of the retina and central scars. Visual acuity was 20/300. DNA analysis revealed a C-to-T transition of the first nucleotide in codon 121 predicting the replacement of arginine-121 by tryptophan (R121W). Both the mother and maternal grandmother carry the same mutation in heterozygous form. Family 2: A 3-month-old boy presented with severe temporal dragging of the retina on both eyes and subsequently developed retinal detachment. Visual acuity was limited to light perception. His mother's left eye was amaurotic and phthitic. Her right eye showed severe retinal dragging, visual acuity was reduced to 20/60. DNA analysis revealed a T-to-A transversion of the third nucleotide in codon 126 creating a stop codon (C126X). The mother and maternal grandmother were carriers. Mutations in the Norrie disease gene can lead to retinal malformations of variable severity both in hemizygous males and manifesting carriers.

Punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori in Colombian populations.

PubMed

Matta, Andrés Jenuer; Zambrano, Diana Carolina; Pazos, Alvaro Jairo

2018-04-14

To characterize punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori ( H. pylori ) and determine their association with therapeutic failure. PCR products of 23S rRNA gene V domain of 74 H. pylori isolates; 34 resistant to clarithromycin (29 from a low-risk gastric cancer (GC) population: Tumaco-Colombia, and 5 from a high-risk population: Tuquerres-Colombia) and 40 from a susceptible population (28 from Tumaco and 12 from Túquerres) were sequenced using capillary electrophoresis. The concordance between mutations of V domain 23S rRNA gene of H. pylori and therapeutic failure was determined using the Kappa coefficient and McNemar's test was performed to determine the relationship between H. pylori mutations and clarithromycin resistance. 23S rRNA gene from H. pylori was amplified in 56/74 isolates, of which 25 were resistant to clarithromycin (20 from Tumaco and 5 from Túquerres, respectively). In 17 resistant isolates (13 from Tumaco and 4 from Túquerres) the following mutations were found: A1593T1, A1653G2, C1770T, C1954T1, and G1827C in isolates from Tumaco, and A2144G from Túquerres. The mutations T2183C, A2144G and C2196T in H. pylori isolates resistant to clarithromycin from Colombia are reported for the first time. No association between the H. pylori mutations and in vitro clarithromycin resistance was found. However, therapeutic failure of eradication treatment was associated with mutations of 23S rRNA gene in clarithromycin-resistant H. pylori ( κ = 0.71). The therapeutic failure of eradication treatment in the two populations from Colombia was associated with mutations of the 23S rRNA gene in clarithromycin-resistant H. pylori .

Punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori in Colombian populations

PubMed Central

Matta, Andrés Jenuer; Zambrano, Diana Carolina; Pazos, Alvaro Jairo

2018-01-01

AIM To characterize punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori (H. pylori) and determine their association with therapeutic failure. METHODS PCR products of 23S rRNA gene V domain of 74 H. pylori isolates; 34 resistant to clarithromycin (29 from a low-risk gastric cancer (GC) population: Tumaco-Colombia, and 5 from a high-risk population: Tuquerres-Colombia) and 40 from a susceptible population (28 from Tumaco and 12 from Túquerres) were sequenced using capillary electrophoresis. The concordance between mutations of V domain 23S rRNA gene of H. pylori and therapeutic failure was determined using the Kappa coefficient and McNemar’s test was performed to determine the relationship between H. pylori mutations and clarithromycin resistance. RESULTS 23S rRNA gene from H. pylori was amplified in 56/74 isolates, of which 25 were resistant to clarithromycin (20 from Tumaco and 5 from Túquerres, respectively). In 17 resistant isolates (13 from Tumaco and 4 from Túquerres) the following mutations were found: A1593T1, A1653G2, C1770T, C1954T1, and G1827C in isolates from Tumaco, and A2144G from Túquerres. The mutations T2183C, A2144G and C2196T in H. pylori isolates resistant to clarithromycin from Colombia are reported for the first time. No association between the H. pylori mutations and in vitro clarithromycin resistance was found. However, therapeutic failure of eradication treatment was associated with mutations of 23S rRNA gene in clarithromycin-resistant H. pylori (κ = 0.71). CONCLUSION The therapeutic failure of eradication treatment in the two populations from Colombia was associated with mutations of the 23S rRNA gene in clarithromycin-resistant H. pylori. PMID:29662291

A Novel Dominant Hyperekplexia Mutation Y705C Alters Trafficking and Biochemical Properties of the Presynaptic Glycine Transporter GlyT2*

PubMed Central

Giménez, Cecilio; Pérez-Siles, Gonzalo; Martínez-Villarreal, Jaime; Arribas-González, Esther; Jiménez, Esperanza; Núñez, Enrique; de Juan-Sanz, Jaime; Fernández-Sánchez, Enrique; García-Tardón, Noemí; Ibáñez, Ignacio; Romanelli, Valeria; Nevado, Julián; James, Victoria M.; Topf, Maya; Chung, Seo-Kyung; Thomas, Rhys H.; Desviat, Lourdes R.; Aragón, Carmen; Zafra, Francisco; Rees, Mark I.; Lapunzina, Pablo; Harvey, Robert J.; López-Corcuera, Beatriz

2012-01-01

Hyperekplexia or startle disease is characterized by an exaggerated startle response, evoked by tactile or auditory stimuli, producing hypertonia and apnea episodes. Although rare, this orphan disorder can have serious consequences, including sudden infant death. Dominant and recessive mutations in the human glycine receptor (GlyR) α1 gene (GLRA1) are the major cause of this disorder. However, recessive mutations in the presynaptic Na+/Cl−-dependent glycine transporter GlyT2 gene (SLC6A5) are rapidly emerging as a second major cause of startle disease. In this study, systematic DNA sequencing of SLC6A5 revealed a new dominant GlyT2 mutation: pY705C (c.2114A→G) in transmembrane domain 11, in eight individuals from Spain and the United Kingdom. Curiously, individuals harboring this mutation show significant variation in clinical presentation. In addition to classical hyperekplexia symptoms, some individuals had abnormal respiration, facial dysmorphism, delayed motor development, or intellectual disability. We functionally characterized this mutation using molecular modeling, electrophysiology, [3H]glycine transport, cell surface expression, and cysteine labeling assays. We found that the introduced cysteine interacts with the cysteine pair Cys-311–Cys-320 in the second external loop of GlyT2. This interaction impairs transporter maturation through the secretory pathway, reduces surface expression, and inhibits transport function. Additionally, Y705C presents altered H+ and Zn2+ dependence of glycine transport that may affect the function of glycinergic neurotransmission in vivo. PMID:22753417

A hybrid stochastic model of folate-mediated one-carbon metabolism: Effect of the common C677T MTHFR variant on de novo thymidylate biosynthesis.

PubMed

Misselbeck, Karla; Marchetti, Luca; Field, Martha S; Scotti, Marco; Priami, Corrado; Stover, Patrick J

2017-04-11

Folate-mediated one-carbon metabolism (FOCM) is an interconnected network of metabolic pathways, including those required for the de novo synthesis of dTMP and purine nucleotides and for remethylation of homocysteine to methionine. Mouse models of folate-responsive neural tube defects (NTDs) indicate that impaired de novo thymidylate (dTMP) synthesis through changes in SHMT expression is causative in folate-responsive NTDs. We have created a hybrid computational model comprised of ordinary differential equations and stochastic simulation. We investigated whether the de novo dTMP synthesis pathway was sensitive to perturbations in FOCM that are known to be associated with human NTDs. This computational model shows that de novo dTMP synthesis is highly sensitive to the common MTHFR C677T polymorphism and that the effect of the polymorphism on FOCM is greater in folate deficiency. Computational simulations indicate that the MTHFR C677T polymorphism and folate deficiency interact to increase the stochastic behavior of the FOCM network, with the greatest instability observed for reactions catalyzed by serine hydroxymethyltransferase (SHMT). Furthermore, we show that de novo dTMP synthesis does not occur in the cytosol at rates sufficient for DNA replication, supporting empirical data indicating that impaired nuclear de novo dTMP synthesis results in uracil misincorporation into DNA.

Mutations in the human GlyT2 gene define a presynaptic component of human startle disease

PubMed Central

Rees, Mark I.; Harvey, Kirsten; Pearce, Brian R.; Chung, Seo-Kyung; Duguid, Ian C.; Thomas, Philip; Beatty, Sarah; Graham, Gail E.; Armstrong, Linlea; Shiang, Rita; Abbott, Kim J.; Zuberi, Sameer M.; Stephenson, John B.P.; Owen, Michael J.; Tijssen, Marina A.J.; van den Maagdenberg, Arn M.J.M.; Smart, Trevor G.; Supplisson, Stéphane; Harvey, Robert J.

2011-01-01

Hyperekplexia is a human neurological disorder characterized by an excessive startle response and is typically caused by missense and nonsense mutations in the gene encoding the inhibitory glycine receptor (GlyR) α1 subunit (GLRA1)1-3. Genetic heterogeneity has been confirmed in isolated sporadic cases with mutations in other postsynaptic glycinergic proteins including the GlyR β subunit (GLRB)4, gephyrin (GPHN)5 and RhoGEF collybistin (ARHGEF9)6. However, many sporadic patients diagnosed with hyperekplexia do not carry mutations in these genes2-7. Here we reveal that missense, nonsense and frameshift mutations in the presynaptic glycine transporter 2 (GlyT2) gene (SLC6A5)8 also cause hyperekplexia. Patients harbouring mutations in SLC6A5 presented with hypertonia, an exaggerated startle response to tactile or acoustic stimuli, and life-threatening neonatal apnoea episodes. GlyT2 mutations result in defective subcellular localisation and/or decreased glycine uptake, with selected mutations affecting predicted glycine and Na+ binding sites. Our results demonstrate that SLC6A5 is a major gene for hyperekplexia and define the first neurological disorder linked to mutations in a Na+/Cl−-dependent transporter for a classical fast neurotransmitter. By analogy, we suggest that in other human disorders where defects in postsynaptic receptors have been identified, similar symptoms could result from defects in the cognate presynaptic neurotransmitter transporter. PMID:16751771

Novel homozygous mutation, c.400C>T (p.Arg134*), in the PVRL1 gene underlies cleft lip/palate-ectodermal dysplasia syndrome in an Asian patient.

PubMed

Yoshida, Kazue; Hayashi, Ryota; Fujita, Hideki; Kubota, Masaya; Kondo, Mai; Shimomura, Yutaka; Niizeki, Hironori

2015-07-01

Cleft lip/palate-ectodermal dysplasia syndrome is a rare, autosomal recessive disorder caused by homozygous loss-of-function mutations of the poliovirus receptor-like 1 (PVRL1) gene encoding nectin-1. Nectin-1 is a cell-cell adhesion molecule that is important for the initial step in the formation of adherens junctions and tight junctions; it is expressed in keratinocytes, neurons, and the developing face and palate. Clinical manifestations comprise a unique facial appearance with cleft lip/palate, ectodermal dysplasia, cutaneous syndactyly of the fingers and/or toes, and in some cases, mental retardation. We present the first report, to our knowledge, of an Asian individual with cleft lip/palate-ectodermal dysplasia syndrome with a novel PVRL1 mutation. A 7-year-old Japanese boy, the first child of a consanguineous marriage, showed hypohidrotic ectodermal dysplasia with sparse, brittle, fine, dry hair and hypodontia, the unique facial appearance with cleft lip/palate, cutaneous syndactyly of the fingers and mild mental retardation. Scanning electron microscopic examination of the hair demonstrated pili torti and pili trianguli et canaliculi. Mutation analysis of exon 2 of PVRL1 revealed a novel homozygous nonsense mutation, c.400C>T (p.Arg134*). His parents were heterozygous for the mutant alleles. All four PVRL1 mutations identified in cleft lip/palate-ectodermal dysplasia syndrome to date, including this study, resulted in truncated proteins that lack the transmembrane domain and intracellular domain of nectin-1, which is necessary to initiate the cell-cell adhesion process. © 2015 Japanese Dermatological Association.

A large GLC1C Greek family with a myocilin T377M mutation: inheritance and phenotypic variability.

PubMed

Petersen, Michael B; Kitsos, George; Samples, John R; Gaudette, N Donna; Economou-Petersen, Effrosini; Sykes, Renée; Rust, Kristal; Grigoriadou, Maria; Aperis, George; Choi, Dongseok; Psilas, Konstantinos; Craig, Jamie E; Kramer, Patricia L; Mackey, David A; Wirtz, Mary K

2006-02-01

POAG is a complex disease; therefore, families in which a glaucoma gene has been mapped may carry additional POAG genes. The goal of this study was to determine whether mutations in the myocilin (MYOC) gene on chromosome 1 are present in two POAG families, which have previously been mapped to the GLC1C locus on chromosome 3. The three exons of MYOC were screened by denaturing (d)HPLC. Samples with heteroduplex peaks were sequenced. Clinical findings were compared with genotype status in all available family members over the age of 20 years. A T377M coding sequence change in MYOC was identified in family members of the Greek GLC1C family but not in the Oregon GLC1C family. Individuals carrying both the MYOC T377M variant and the GLC1C haplotype were more severely affected at an earlier age than individuals with just one of the POAG genes, suggesting that these two genes interact or that both contribute to the POAG phenotype in a cumulative way.

Novel mutations in the homogentisate 1,2 dioxygenase gene identified in Jordanian patients with alkaptonuria.

PubMed

Al-sbou, Mohammed

2012-06-01

This study was conducted to identify mutations in the homogentisate 1,2 dioxygenase gene (HGD) in alkaptonuria patients among Jordanian population. Blood samples were collected from four alkaptonuria patients, four carriers, and two healthy volunteers. DNA was isolated from peripheral blood. All 14 exons of the HGD gene were amplified using the polymerase chain reaction (PCR) technique. The PCR products were then purified and analyzed by sequencing. Five mutations were identified in our samples. Four of them were novel C1273A, T1046G, 551-552insG, T533G and had not been previously reported, and one mutation T847C has been described before. The types of mutations identified were two missense mutations, one splice site mutation, one frameshift mutation, and one polymorphism. We present the first molecular study of the HGD gene in Jordanian alkaptonuria patients. This study provides valuable information about the molecular basis of alkaptonuria in Jordanian population.

A double mutation in AGXT gene in families with primary hyperoxaluria type 1.

PubMed

Kanoun, Houda; Jarraya, Faiçal; Hadj Salem, Ikhlass; Mahfoudh, Hichem; Chaabouni, Yosr; Makni, Fatma; Hachicha, Jamil; Fakhfakh, Faiza

2013-12-01

Primary hyperoxaluria type 1 (PH1) is a severe autosomal recessive inherited disorder of glyoxylate metabolism caused by mutations in the AGXT gene on chromosome 2q37.3 that encodes the hepatic peroxisomal enzyme alanine:glyoxylate aminotransferase. These mutations are found throughout the entire gene and cause a wide spectrum of clinical severity. Rare in Europe, PH1 is responsible for 13% of the end stage renal failure in the Tunisian child. In the present work, we identified the double mutation c.32C>T (Pro11Leu) and c.731T>C (p.Ile244Thr) in AGXT gene in five unrelated Tunisian families with PH1 disease. Our results provide evidence regarding the potential involvement of c.32C>T, originally described as common polymorphism, on the resulting phenotype. We also reported an extreme intrafamilial heterogeneity in clinical presentation of PH1. Despite the same genetic background, the outcome of the affected members differs widely. The significant phenotypic heterogeneity observed within a same family, with a same genotype, suggests the existence of relevant modifier factors. © 2013.

A case of a Tunisian Rett patient with a novel double-mutation of the MECP2 gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fendri-Kriaa, Nourhene, E-mail: nourhene.fendri@gmail.com; Hsairi, Ines; Kifagi, Chamseddine

2011-06-03

Highlights: {yields} Sequencing of the MECP2 gene, modeling and comparison of the two variants were performed in a Tunisian classical Rett patient. {yields} A double-mutation: a new and de novo mutation c.535C > T and the common one c.763C > T of the MECP2 gene was identified. {yields} The P179S transition may change local electrostatic properties which may affect the function and stability of the protein MeCP2. -- Abstract: Rett syndrome is an X-linked dominant disorder caused frequently by mutations in the methyl-CpG-binding protein 2 gene (MECP2). Rett patients present an apparently normal psychomotor development during the first 6-18 monthsmore » of life. Thereafter, they show a short period of developmental stagnation followed by a rapid regression in language and motor development. The aim of this study was to perform a mutational analysis of the MECP2 gene in a classical Rett patient by sequencing the corresponding gene and modeling the found variants. The results showed the presence of a double-mutation: a new and de novo mutation c.535C > T (p.P179S) and the common c.763C > T (p.R255X) transition of the MECP2 gene. The p.P179S mutation was located in a conserved amino acid in CRIR domain (corepressor interacting region). Modeling results showed that the P179S transition could change local electrostatic properties by adding a negative charge due to serine hydroxyl group of this region of MeCP2 which may affect the function and stability of the protein. The p.R255X mutation is located in TRD-NLS domain (transcription repression domain-nuclear localization signal) of MeCP2 protein.« less

SAMHD1 Gene Mutations Are Associated with Cerebral Large-Artery Atherosclerosis

PubMed Central

Xin, Baozhong; Yan, Junpeng; Wu, Ying; Hu, Bo; Liu, Liping; Wang, Yilong; Ahn, Jinwoo; Skowronski, Jacek; Zhang, Zaiqiang; Wang, Yongjun; Wang, Heng

2015-01-01

Background. To investigate whether one or more SAMHD1 gene mutations are associated with cerebrovascular disease in the general population using a Chinese stroke cohort. Methods. Patients with a Chinese Han background (N = 300) diagnosed with either cerebral large-artery atherosclerosis (LAA, n = 100), cerebral small vessel disease (SVD, n = 100), or other stroke-free neurological disorders (control, n = 100) were recruited. Genomic DNA from the whole blood of each patient was isolated, and direct sequencing of the SAMHD1 gene was performed. Both wild type and mutant SAMHD1 proteins identified from the patients were expressed in E. coli and purified; then their dNTPase activities and ability to form stable tetramers were analysed in vitro. Results. Three heterozygous mutations, including two missense mutations c.64C>T (P22S) and c.841G>A (p.E281K) and one splice site mutation c.696+2T>A, were identified in the LAA group with a prevalence of 3%. No mutations were found in the patients with SVD or the controls (p = 0.05). The mutant SAMHD1 proteins were functionally impaired in terms of their catalytic activity as a dNTPase and ability to assemble stable tetramers. Conclusions. Heterozygous SAMHD1 gene mutations might cause genetic predispositions that interact with other risk factors, resulting in increased vulnerability to stroke. PMID:26504826

The clinical spectrum of the m.10191T>C mutation in complex I-deficient Leigh syndrome.

PubMed

Nesbitt, Victoria; Morrison, Patrick J; Crushell, Ellen; Donnelly, Deirdre E; Alston, Charlotte L; He, Langping; McFarland, Robert; Taylor, Robert W

2012-06-01

Mitochondrial respiratory chain diseases represent one of the most common inherited neurometabolic disorders of childhood, affecting a minimum of 1 in 7500 live births. The marked clinical, biochemical, and genetic heterogeneity means that accurate genetic counselling relies heavily upon the identification of the underlying causative mutation in the individual and determination of carrier status in the parents. Isolated complex I deficiency is the most common respiratory chain defect observed in children, resulting in organ-specific or multisystem disease, but most often presenting as Leigh syndrome, for which mitochondrial DNA mutations are important causes. Several recurrent, pathogenic point mutations in the MTND3 gene - including m.10191T>C (p.Ser45Pro) - have been previously identified. In this short clinical review we evaluate the case reports of the m.10191T>C mutation causing complex I-deficient Leigh syndrome described in the literature, in addition to two new ones diagnosed in our laboratory. Both of these appear to have arisen de novo without transmission of the mutation from mother to offspring, illustrating the importance not only of fully characterizing the mitochondrial genome as part of the investigation of children with complex I-deficient Leigh syndrome but also of assessing maternal samples to provide crucial genetic advice for families. © The Authors. Developmental Medicine & Child Neurology © 2012 Mac Keith Press.

A homozygous nonsense CEP250 mutation combined with a heterozygous nonsense C2orf71 mutation is associated with atypical Usher syndrome.

PubMed

Khateb, Samer; Zelinger, Lina; Mizrahi-Meissonnier, Liliana; Ayuso, Carmen; Koenekoop, Robert K; Laxer, Uri; Gross, Menachem; Banin, Eyal; Sharon, Dror

2014-07-01

Usher syndrome (USH) is a heterogeneous group of inherited retinitis pigmentosa (RP) and sensorineural hearing loss (SNHL) caused by mutations in at least 12 genes. Our aim is to identify additional USH-related genes. Clinical examination included visual acuity test, funduscopy and electroretinography. Genetic analysis included homozygosity mapping and whole exome sequencing (WES). A combination of homozygosity mapping and WES in a large consanguineous family of Iranian Jewish origin revealed nonsense mutations in two ciliary genes: c.3289C>T (p.Q1097*) in C2orf71 and c.3463C>T (p.R1155*) in centrosome-associated protein CEP250 (C-Nap1). The latter has not been associated with any inherited disease and the c.3463C>T mutation was absent in control chromosomes. Patients who were double homozygotes had SNHL accompanied by early-onset and severe RP, while patients who were homozygous for the CEP250 mutation and carried a single mutant C2orf71 allele had SNHL with mild retinal degeneration. No ciliary structural abnormalities in the respiratory system were evident by electron microscopy analysis. CEP250 expression analysis of the mutant allele revealed the generation of a truncated protein lacking the NEK2-phosphorylation region. A homozygous nonsense CEP250 mutation, in combination with a heterozygous C2orf71 nonsense mutation, causes an atypical form of USH, characterised by early-onset SNHL and a relatively mild RP. The severe retinal involvement in the double homozygotes indicates an additive effect caused by nonsense mutations in genes encoding ciliary proteins. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.