Sample records for c677t homozygous mutation

  1. Methylenetetrahydrofolate reductase C677T mutation and risk of retinal vein thrombosis.

    PubMed

    Soltanpour, Mohammad Soleiman; Soheili, Zahra; Shakerizadeh, Ali; Pourfathollah, Ali Akbar; Samiei, Shahram; Meshkani, Reza; Shahjahani, Mohammad; Karimi, Abbas

    2013-06-01

    Elevated plasma homocysteine (Hcy) level has been established as a significant risk factor for venous thrombosis and cardiovascular disease. Homozygosity for the methylenetetrahydrofolate reductase (MTHFR) C677T mutation has been associated with elevated plasma Hcy concentration and may contribute to retinal vein thrombosis (RVT) development. The aim of the present study was to investigate whether the hyperhomocysteinemia and/or homozygosity for the MTHFR C677T mutation are associated with an increased risk for RVT. Our study population consisted of 73 consecutive patients (50-78 years old) with RVT and 73 control subjects (51-80 years old), matched for age and sex. Genotyping for the MTHFR C677T mutation was performed by polymerase chain reaction-restriction fragment length polymorphism technique and Hcy level was determined by an enzyme immunoassay kit. The prevalence of 677TT genotype was higher in patients than control subjects, but the difference in frequency didn't reach a significant value (P = 0.07). The frequency of the 677T allele was 26% and 21.2% in patients and controls, respectively and did not differ significantly between the two groups (odds ratio = 1.3, 95% confidence interval (0.75-2.24), P = 0.33). Fasting plasma total Hcy level was significantly higher in patients than controls (P = 0.001). Our study demonstrated that hyperhomocysteinemia, but not the MTHFR C677T mutation, is associated with RVT.

  2. Methylenetetrahydrofolate reductase C677T mutation and risk of retinal vein thrombosis

    PubMed Central

    Soltanpour, Mohammad Soleiman; Soheili, Zahra; Shakerizadeh, Ali; Pourfathollah, Ali Akbar; Samiei, Shahram; Meshkani, Reza; Shahjahani, Mohammad; Karimi, Abbas

    2013-01-01

    Background: Elevated plasma homocysteine (Hcy) level has been established as a significant risk factor for venous thrombosis and cardiovascular disease. Homozygosity for the methylenetetrahydrofolate reductase (MTHFR) C677T mutation has been associated with elevated plasma Hcy concentration and may contribute to retinal vein thrombosis (RVT) development. The aim of the present study was to investigate whether the hyperhomocysteinemia and/or homozygosity for the MTHFR C677T mutation are associated with an increased risk for RVT. Materials and Methods: Our study population consisted of 73 consecutive patients (50-78 years old) with RVT and 73 control subjects (51-80 years old), matched for age and sex. Genotyping for the MTHFR C677T mutation was performed by polymerase chain reaction-restriction fragment length polymorphism technique and Hcy level was determined by an enzyme immunoassay kit. Results: The prevalence of 677TT genotype was higher in patients than control subjects, but the difference in frequency didn't reach a significant value (P = 0.07). The frequency of the 677T allele was 26% and 21.2% in patients and controls, respectively and did not differ significantly between the two groups (odds ratio = 1.3, 95% confidence interval (0.75-2.24), P = 0.33). Fasting plasma total Hcy level was significantly higher in patients than controls (P = 0.001). Conclusion: Our study demonstrated that hyperhomocysteinemia, but not the MTHFR C677T mutation, is associated with RVT. PMID:24250697

  3. Association of MTHFR gene C677T mutation with diabetic peripheral neuropathy and diabetic retinopathy

    PubMed Central

    Yigit, Serbulent; Inanir, Ahmet

    2013-01-01

    Purpose Diabetic peripheral neuropathy (DPN) is one of the most common diabetic chronic complications. Methylenetetrahydrofolate reductase (MTHFR) gene variants have been associated with vasculopathy that has been linked to diabetic neuropathy. The aim of the present study was to investigate the possible association between MTHFR gene C677T mutation and DPN and evaluate if there is an association with clinical features in a relatively large cohort of Turkish patients. Methods The study included 230 patients affected by DPN and 282 healthy controls. Genomic DNA was isolated and genotyped using the polymerase chain reaction–based restriction fragment length polymorphism assay for the MTHFR gene C677T mutation. Results The genotype and allele frequencies of the C677T mutation showed statistically significant differences between the patients with DPN and the controls (p=0.003 and p=0.002, respectively). After the patients with DPN were stratified according to clinical and demographic characteristics, a significant association was observed between the C677T mutation and history of retinopathy (p=0.039). Conclusions A high association between the MTHFR gene C677T mutation and DPN was observed in the present study. In addition, history of retinopathy was associated with the MTHFR C677T mutation in patients with DPN. PMID:23901246

  4. Methylenetetrahydrofolate Reductase Gene Polymorphism (C677T) as a Risk Factor for Arterial Thrombosis in Georgian Patients.

    PubMed

    Garakanidze, Sopio; Costa, Elísio; Bronze-Rocha, Elsa; Santos-Silva, Alice; Nikolaishvili, Giorgi; Nakashidze, Irina; Kakauridze, Nona; Glonti, Salome; Khukhunaishvili, Rusudan; Koridze, Marina; Ahmad, Sarfraz

    2018-01-01

    Methylenetetrahydrofolate reductase ( MTHFR) gene polymorphism (C677T)] is a well-recognized genetic risk factor for venous thrombosis; however, its association with arterial thrombosis is still under debate. Herein, we evaluated the prevalence of MTHFR C677T polymorphism in Georgian patients in comparison with healthy individuals and its association with arterial thrombosis. We enrolled 214 participants: 101 with arterial thrombosis (71.3% males; mean age: 66.3 ± 12.1 years) and 113 controls (67.3% males; mean age: 56.6 ± 11.3 years). Genomic DNA was extracted from dry blood spot on Whatman filter paper. Polymerase chain reaction was performed to determine MTHFR C677T polymorphism. Frequency of C677T allele polymorphism in controls was 21.2%, which corresponded to heterozygous and homozygous stage frequencies of 35.4% and 3.5%, respectively. In patient group, an allelic frequency of 33.2% was found, which corresponded to the presence of 48.5% of heterozygous and 8.9% of homozygous individuals. Comparing the frequency of mutated alleles between the 2 groups, a significantly high frequency of mutated alleles was found in patient group ( P < .05). In conclusion, high frequency of MTHFR C677T polymorphism found in arterial thrombosis patient group suggests that this polymorphism might increase the risk of arterial thrombosis in Georgian patients.

  5. Evidence of Paternal N5, N10 - Methylenetetrahydrofolate Reductase (MTHFR) C677T Gene Polymorphism in Couples with Recurrent Spontaneous Abortions (RSAs) in Kolar District- A South West of India

    PubMed Central

    Vanilla, Shiny; Kotur, Pushpa F; Kutty, Moideen A; Vegi, Pradeep Kumar

    2015-01-01

    Introduction: Recurrent spontaneous abortion (RSA) is a multifactorial clinical obstetrics complication commonly occurring in pregnancy. Many research studies have noted the mutations such as C677T in N5, N10 - Methylenetetrahydrofolate reductase (MTHFR)gene which is regarded as RSA risk factor. This study was carried out to determine the occurrence of frequency of C677T of the MTHFR gene mutations with RSA. Aim: The purpose of present study is to determine the frequency of MTHFR C677T polymorphisms in couples with recurrent pregnancy loss and the impact of paternal polymorphisms of MTHFR C677T in recurrent pregnancy loss in population of couples living in Kolar district of Karnataka with RSA. Design: A total of 15 couples with a history of two or more unexplained RSA were enrolled as subjects in the study and a total of 15 couples with normal reproductive history, having two or more children and no history of miscarriages were enrolled as controls. Materials and Methods: DNA extraction from samples case and control group couples and its quantification by Agarose gel electrophoresis, assessment of DNA purity, MTHFR C 677T gene mutation detection by PCR-RFLP method. Statistical analysis: Carried out by web based online SPSS tool. Results: The frequency of C677T genotype showed homozygous wild type CC (80%), heterozygous CT type (13.3%) and homozygous mutation TT type (6.67%) observed in males. Similarly from female’s homozygous wild type CC (86.6%), heterozygous type (13.3%), and homozygous type mutations TT (0%) was recorded. In couple control groups, we observed homozygous wild type CC (86.6%), heterozygous CT type (13.3%) and homozygous type mutations TT type (0%). Conclusion: We noticed a high frequency of MTHFR specifically T allele associated with paternal side.Therefore, the present study indicated the impact of paternal gene polymorphism of MTHFR C677T on screening in couples with recurrent pregnancy loss. PMID:25859445

  6. Methylenetetrahydrofolate reductase C677T polymorphism in patients with lung cancer in a Korean population

    PubMed Central

    2011-01-01

    Background This study was designed to investigate an association between methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism and the risk of lung cancer in a Korean population. Methods We conducted a large-scale, case-control study involving 3938 patients with newly diagnosed lung cancer and 1700 healthy controls. Genotyping was performed with peripheral blood DNA for MTHFR C677T polymorphisms. Statistical significance was estimated by logistic regression analysis. Results The MTHFR C677T frequencies of CC, CT, and TT genotypes were 34.5%, 48.5%, and 17% among lung cancer patients, and 31.8%, 50.7%, and 17.5% in the controls, respectively. The MTHFR 677CT and TT genotype showed a weak protection against lung cancer compared with the homozygous CC genotype, although the results did not reach statistical significance. The age- and gender-adjusted odds ratio (OR) of overall lung cancer was 0.90 (95% confidence interval (CI), 0.77-1.04) for MTHFR 677 CT and 0.88 (95% CI, 0.71-1.07) for MTHFR 677TT. However, after stratification analysis by histological type, the MTHFR 677CT genotype showed a significantly decreased risk for squamous cell carcinoma (age- and gender-adjusted OR, 0.78; 95% CI, 0.64-0.96). The combination of 677 TT homozygous with 677 CT heterozygous also appeared to have a protection effect on the risk of squamous cell carcinoma. We observed no significant interaction between the MTHFR C677T polymorphism and age and gender or smoking habit. Conclusions This is the first reported study focusing on the association between MTHFR C677T polymorphisms and the risk of lung cancer in a Korean population. The T allele was found to provide a weak protective association with lung squamous cell carcinoma. PMID:21342495

  7. Presence of the 5,10-methylenetetrahydrofolate reductase C677T mutation in Puerto Rican patients with neural tube defects.

    PubMed

    García-Fragoso, Lourdes; García-García, Inés; de la Vega, Alberto; Renta, Jessicca; Cadilla, Carmen L

    2002-01-01

    Folic acid supplementation can reduce the incidence of neural tube defects. The first reported genetic risk factor for neural tube defects is a C677T mutation in the 5,10-methylenetetrahydrofolate reductase gene, resulting in decreased activity of the enzyme. We examined the enzyme mutation role of methylenetetrahydrofolate reductase in the etiology of neural tube defects in our population. The study group consisted of 204 Puerto Rican individuals including 37 pregnant females with a prenatal diagnosis of neural tube defects in their fetuses, 31 newborns, 36 fathers, and 100 healthy adults. The prevalence of the C677T mutation was examined. Homozygosity for the alanine to valine substitution (TT) was observed in 9% of the controls and 19% of the mothers with children with neural tube defects. Our results indicate that the presence of the T allele at the methylenetetrahydrofolate reductase 677 position may increase the risk of giving birth to an infant with a neural tube defect.

  8. Spectrum of MTHFR gene SNPs C677T and A1298C: a study among 23 population groups of India.

    PubMed

    Saraswathy, Kallur Nava; Asghar, Mohammad; Samtani, Ratika; Murry, Benrithung; Mondal, Prakash Ranjan; Ghosh, Pradeep Kumar; Sachdeva, Mohinder Pal

    2012-04-01

    Elevated homocysteine is a risk factor for many complex disorders. The role of methylenetetrahydrofolate reductase (MTHFR) gene in methylation of homocysteine makes it one of the most important candidate genes for these disorders. Considering the heterogeneity in its distribution in world populations, we screened MTHFR C677T and A1298C single nucleotide polymorphisms in a total of 23 Indian caste, tribal and religious population groups from five geographical regions of India and belonging to four major linguistic groups. The frequencies of MTHFR 677T and 1298C alleles were found to be 10.08 and 20.66%, respectively. MTHFR homozygous genotype 677TT was absent in eight population groups and homozygous 1298CC was absent in two population groups. 677T allele was found to be highest among north Indian populations with Indo-European tongue and 1298C was high among Dravidian-speaking tribes of east India and south India. The less common mutant haplotype 677T-1298C was observed among seven population groups and overall the frequency of this haplotype was 0.008, which is similar to that of African populations. cis configuration of 677T and 1298C was 0.94%. However, we could not find any individual with four mutant alleles which supports the earlier observation that presence of more than two mutant alleles may decrease the viability of foetus and possibly be a selective disadvantage in the population.

  9. Evaluation of Factor V Leiden, Prothrombin G20210A, MTHFR C677T and MTHFR A1298C gene polymorphisms in retinopathy of prematurity in a Turkish cohort.

    PubMed

    Aydin, Hatip; Gunay, Murat; Celik, Gokhan; Gunay, Betul Onal; Aydin, Umeyye Taka; Karaman, Ali

    2016-12-01

    To assess Factor V Leiden (FVL) (rs6025), Prothrombin G20210A (rs1799963), MTHFR C677T (rs1801133), and MTHFR A1298C (rs1801131) gene mutations as risk factors in the development of retinopathy of prematurity (ROP). A total of 105 children were included in this cross-sectional study. Patients were divided into two groups. The study group consisted of 55 infants with a history of ROP and the control group comprised 50 healthy infants with term birth. All subjects were screened for the presence of certain mutations (FVL, Prothrombin G20210A, MTHFR C677T and MTHFR A1298C) by Real-Time PCR at 1 year of age. The mean gestational age (GA) and birth weight (BW) of the study group were, 28.65 ± 2.85 weeks and 1171 ± 385.74 g, respectively. There were no significant differences of genotype and allele frequency of Prothrombin G20210A, MTHFR A1298C and MTHFR C677T between the study and control groups (p > 0.05). Eight children (14.5 %) had heterozygous and one child (1.8%) had homozygous FVL mutation in the study group. One child (2%) in the control group had heterozygous FVL mutation. There was statistically significant differences of FVL allele and genotype frequencies between the groups (p < 0.05). The prevalence of FVL polymorphism (16.3 %) was higher in ROP patients than control subjects in this Turkish cohort. We suggest a possible association of FVL mutation with ROP at the end of the study.

  10. [677T mutation of the MTHFR gene in adenomas and colorectal cancer in a population sample from the Northeastern Mexico. Preliminary results].

    PubMed

    Delgado-Enciso, I; Martínez-Garza, S G; Rojas-Martínez, A; Ortiz-López, R; Bosques-Padilla, F; Calderón-Garcidueñas, A L; Zárate-Gómez, M; Barrera-Saldaña, H A

    2001-01-01

    Adequate intake of folates has been associated to low prevalence of colon cancer. Methylenetetrahydrofolate reductase enzyme (MTHFR) plays an important role in folate metabolism. The role of the 677 mutation at the MTHFR gene in the risk for colorectal cancer remains controversial. A recent report established that this mutation has a high prevalence in the healthy Mexican population. To analyze the prevalence of 677T MTHFR mutation in patients with colorectal cancer and controls without chronic gastrointestinal disorders. Seventy-four colorectal cancer, 32 adenomas and 110 normal samples were analyzed. Patients and controls were matched for sex and age. For each sample, DNA isolation, PCR, and mutation detection by restriction enzyme digestion were performed to determine the allele at the 677 position in the MTHFR gene. Genotype 677C/677C was found in 18.7, 20.3, and 30.9% in adenomas, cancer lesions and controls, respectively. Frequencies of the 677C/677T genotype were 59.4, 56.7, and 47.3%, in adenomas, cancer lesions, and controls, respectively. Genotype 677T/677T was found in 21.9, 23.0, and 21.8% in adenomas, cancer lesions, and controls, respectively. The odds ratio between genotypes carrying the mutation (T/T and C/T) and normal genotype (CC) was 1.81 (IC 95% 0.97-3.3), chi 2 = 3.5, p = 0.06. Our results showed that persons who carry the 677T mutation at MTHFR locus have a tendency for an increased risk for colorectal cancer. This study supports the basic concept that low levels of folic acid contribute with the colorectal cancer pathogenesis. Our lack of statistic significance may be due to reduced sample size.

  11. Elevated total plasma homocysteine and 667C{r_arrow}T mutation of the 5,10-methylenetetrahydrofolate reductase gene in thrombotic vascular disease

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    De Franchis, R.; Sebastio, G.; Andria, G.

    1996-07-01

    Moderate elevation of total plasma homocysteine (tHcy) has been reported as an independent risk factor for thrombotic vascular disease, a well-known multifactorial disorder. Possible genetic causes of elevated tHcy include defects of the sulfur-containing amino acids metabolism due to deficiencies of cystathionine {Beta}-synthase, of 5,10-methylenetetrahydrofolate reductase (MTHFR), and of the enzymes of cobalamin metabolism. An impaired activity of MTHFR due to a thermolabile form of the enzyme has been observed in {le}28% of hyperhomocysteinemic patients with premature vascular disease. More recently, the molecular basis of such enzymatic thermolability has been related to a common mutation of the MTHFR gene, causingmore » a C-to-T substitution at nt 677 (677C{r_arrow}T). This mutation was found in 38% of unselected chromosomes from 57 French Canadian individuals. The homozygous state for the mutation was present in 12% of these subjects and correlated with significantly elevated tHcy. Preliminary evidence indicates that the frequency of homozygotes for the 677C{r_arrow}T mutation may vary significantly in populations from different geographic areas. 5 refs., 2 tabs.« less

  12. MTHFR C677T polymorphism, homocysteine and B-vitamins status in a sample of Chinese and Malay subjects in Universiti Putra Malaysia.

    PubMed

    Choo, S C; Loh, S P; Khor, G L; Sabariah, M N; Rozita, R

    2011-08-01

    Methylenetetrahydrofolate reductase (MTHFR) C677T is involved in folate and homocysteine metabolism. Disruption in the activity of this enzyme will alter their levels in the body. This study assessed MTHFR C677T polymorphism and its relationship with serum homocysteine and B-vitamins levels in a sample of Chinese and Malays subjects in UPM, Serdang. One hundred subjects were randomly selected from among the university population. Folate, vitamin B12, B6, and homocysteine levels were determined using MBA, ECLIA, and HPLC, respectively. PCR coupled with HinfI digestion was used for detection of MTHFR C677T polymorphism. The frequency of T allele was higher in the Chinese subjects (0.40) compared to the Malay (0.14). Folate, vitamin B12 and B6 levels were highest in the wild genotype in both ethnic groups. Subjects with heterozygous and homozygous genotype showed the highest homocysteine levels. The serum folate and homocysteine were mainly affected by homozygous genotype. MTHFR C677T polymorphism plays an important role in influencing the folate and homocysteine metabolism.

  13. The methylenetetrahydrofolate reductase C677T mutation induces cell-specific changes in genomic DNA methylation and uracil misincorporation: A possible molecular basis for the site-specific cancer risk modification

    PubMed Central

    Sohn, Kyoung-Jin; Jang, Hyeran; Campan, Mihaela; Weisenberger, Daniel J.; Dickhout, Jeffrey; Wang, Yi-Cheng; Cho, Robert C.; Yates, Zoe; Lucock, Mark; Chiang, En-Pei; Austin, Richard C.; Choi, Sang-Woon; Laird, Peter W.; Kim, Young-In

    2009-01-01

    The C677T polymorphism in the methylenetetrahydrofolate reductase (MTHFR) gene is associated with a decreased risk of colon cancer while it may increase the risk of breast cancer. This polymorphism is associated with changes in intracellular folate cofactors, which may affect DNA methylation and synthesis via altered one-carbon transfer reactions. We investigated the effect of this mutation on DNA methylation and uracil misincorporation and its interaction with exogenous folate in further modulating these biomarkers of one-carbon transfer reactions in an in vitro model of the MTHFR 677T mutation in HCT116 colon and MDA-MB-435 breast adenocarcinoma cells. In HCT116 cells, the MTHFR 677T mutation was associated with significantly increased genomic DNA methylation when folate supply was adequate or high; however, in the setting of folate insufficiency, this mutation was associated with significantly decreased genomic DNA methylation. In contrast, in MDA-MB-435 cells, the MTHFR 677T mutation was associated with significantly decreased genomic DNA methylation when folate supply was adequate or high and with no effect when folate supply was low. The MTHFR 677T mutation was associated with a nonsignificant trend toward decreased and increased uracil misincorporation in HCT116 and MDA-MB-435 cells, respectively. Our data demonstrate for the first time a functional consequence of changes in intracellular folate cofactors resulting from the MTHFR 677T mutation in cells derived from the target organs of interest, thus providing a plausible cellular mechanism that may partly explain the site-specific modification of colon and breast cancer risks associated with the MTHFR C677T mutation. PMID:19123462

  14. Association of Methylenetetrahydrofolate Reductase C677T and A1298C Gene Polymorphisms With Recurrent Pregnancy Loss in Syrian Women.

    PubMed

    Al-Achkar, Walid; Wafa, Abdulsamad; Ammar, Samer; Moassass, Faten; Jarjour, Rami A

    2017-09-01

    C677T polymorphism of the methylenetetrahydrofolate reductase ( MTHFR) gene was a risk factor for recurrent pregnancy loss (RPL), but few studies have confirmed a possible role of MTHFR A1298C polymorphism in RPL risk. This study was carried out to determine the influence of the MTHFR gene polymorphisms in RPL Syrian women. A case-control study was performed on 2 groups (106 healthy and 100 RPL women). The frequency of the MTHFR gene polymorphisms was determined by polymerase chain reaction based on restriction fragment length gene polymorphism. In the RPL group, the genotype frequencies of MTHFR C677T were CC (41%), CT (41%), and TT (18%), and in the control group, the frequencies were CC (62.2%), CT (36.7%), and TT (1%). Statistical analysis showed a homozygous TT genotype and T allele were significantly different in the RPL group ( P = .000003 and P = .000019, respectively). The genotype frequencies of MTHFR A1298C were AA (53%), AC (44%), and CC (8%) in the RPL group, whereas in the control group, these were AA (61.3%), AC (37.8%), and CC (1%). A significant difference in the CC genotype and C allelic frequencies in the RPL women was observed ( P = .014 and P = .064, respectively). The patients having compound heterozygous (677 CT/1298AC) were associated with an estimated 4.86-fold increase in risk of pregnancy loss compared to individuals with a wild type ( P = .012). Our findings indicate that RPL women with homozygous genotype for (C677T and A1298C) either alone or compound heterozygous genotypes have a high risk of pregnancy loss in Syrian women.

  15. Association between maternal, fetal and paternal MTHFR gene C677T and A1298C polymorphisms and risk of recurrent pregnancy loss: a comprehensive evaluation.

    PubMed

    Yang, Yi; Luo, Yunyao; Yuan, Jing; Tang, Yidan; Xiong, Lang; Xu, MangMang; Rao, XuDong; Liu, Hao

    2016-06-01

    Numerous studies have investigated the associations between methylenetetrahydrofolate reductase (MTHFR) gene C677T and A1298C polymorphisms and risk of recurrent pregnancy loss (RPL); however, the results remain controversial. The aim of this study is to drive a more precise estimation of association between MTHFR gene polymorphisms and risk of RPL. We searched PubMed, EMBASE, Cochrane library, Web of Science and China Knowledge Resource Integrated Database for papers on MTHFR gene C677T and A1298C polymorphisms and RPL risk. The pooled odds ratios (ORs) with 95 % confidence intervals (CIs) were used to assess the strength of association in the homozygous model, heterozygous model, dominant model, recessive model and an additive model. The software STATA (Version 13.0) was used for statistical analysis. Overall, 57 articles were included in the final meta-analysis. In maternal group the MTHFR C677T polymorphism showed pooled odds ratios for the homozygous comparison [OR = 2.285, 95 % CI (1.702, 3.067)] and the MTHFR A1298C polymorphism showed pooled odds ratios for recessive model [OR = 1.594, 95 % CI (1.136, 2.238)]. In fetal group the MTHFR C677T polymorphism showed pooled odds ratios for dominant model [OR = 1.037, 95 % CI (0.567, 1.894)] and the MTHFR A1298C polymorphism showed pooled odds ratios for dominant model [OR = 1.495, 95 % CI (1.102, 2.026)]. In summary, the results of our meta-analysis indicate that maternal and paternal MTHFR gene C677T and A1298C polymorphisms are associated with RPL. We also observed a significant association between fetal MTHFR A1298C polymorphism and RPL but not C677T.

  16. Association of PHB 1630 C>T and MTHFR 677 C>T polymorphisms with breast and ovarian cancer risk in BRCA1/2 mutation carriers: results from a multicenter study

    PubMed Central

    Jakubowska, A; Rozkrut, D; Antoniou, A; Hamann, U; Scott, R J; McGuffog, L; Healy, S; Sinilnikova, O M; Rennert, G; Lejbkowicz, F; Flugelman, A; Andrulis, I L; Glendon, G; Ozcelik, H; Thomassen, M; Paligo, M; Aretini, P; Kantala, J; Aroer, B; von Wachenfeldt, A; Liljegren, A; Loman, N; Herbst, K; Kristoffersson, U; Rosenquist, R; Karlsson, P; Stenmark-Askmalm, M; Melin, B; Nathanson, K L; Domchek, S M; Byrski, T; Huzarski, T; Gronwald, J; Menkiszak, J; Cybulski, C; Serrano, P; Osorio, A; Cajal, T R; Tsitlaidou, M; Benítez, J; Gilbert, M; Rookus, M; Aalfs, C M; Kluijt, I; Boessenkool-Pape, J L; Meijers-Heijboer, H E J; Oosterwijk, J C; van Asperen, C J; Blok, M J; Nelen, M R; van den Ouweland, A M W; Seynaeve, C; van der Luijt, R B; Devilee, P; Easton, D F; Peock, S; Frost, D; Platte, R; Ellis, S D; Fineberg, E; Evans, D G; Lalloo, F; Eeles, R; Jacobs, C; Adlard, J; Davidson, R; Eccles, D; Cole, T; Cook, J; Godwin, A; Bove, B; Stoppa-Lyonnet, D; Caux-Moncoutier, V; Belotti, M; Tirapo, C; Mazoyer, S; Barjhoux, L; Boutry-Kryza, N; Pujol, P; Coupier, I; Peyrat, J-P; Vennin, P; Muller, D; Fricker, J-P; Venat-Bouvet, L; Johannsson, O Th; Isaacs, C; Schmutzler, R; Wappenschmidt, B; Meindl, A; Arnold, N; Varon-Mateeva, R; Niederacher, D; Sutter, C; Deissler, H; Preisler-Adams, S; Simard, J; Soucy, P; Durocher, F; Chenevix-Trench, G; Beesley, J; Chen, X; Rebbeck, T; Couch, F; Wang, X; Lindor, N; Fredericksen, Z; Pankratz, V S; Peterlongo, P; Bonanni, B; Fortuzzi, S; Peissel, B; Szabo, C; Mai, P L; Loud, J T; Lubinski, J

    2012-01-01

    Background: The variable penetrance of breast cancer in BRCA1/2 mutation carriers suggests that other genetic or environmental factors modify breast cancer risk. Two genes of special interest are prohibitin (PHB) and methylene-tetrahydrofolate reductase (MTHFR), both of which are important either directly or indirectly in maintaining genomic integrity. Methods: To evaluate the potential role of genetic variants within PHB and MTHFR in breast and ovarian cancer risk, 4102 BRCA1 and 2093 BRCA2 mutation carriers, and 6211 BRCA1 and 2902 BRCA2 carriers from the Consortium of Investigators of Modifiers of BRCA1 and BRCA2 (CIMBA) were genotyped for the PHB 1630 C>T (rs6917) polymorphism and the MTHFR 677 C>T (rs1801133) polymorphism, respectively. Results: There was no evidence of association between the PHB 1630 C>T and MTHFR 677 C>T polymorphisms with either disease for BRCA1 or BRCA2 mutation carriers when breast and ovarian cancer associations were evaluated separately. Analysis that evaluated associations for breast and ovarian cancer simultaneously showed some evidence that BRCA1 mutation carriers who had the rare homozygote genotype (TT) of the PHB 1630 C>T polymorphism were at increased risk of both breast and ovarian cancer (HR 1.50, 95%CI 1.10–2.04 and HR 2.16, 95%CI 1.24–3.76, respectively). However, there was no evidence of association under a multiplicative model for the effect of each minor allele. Conclusion: The PHB 1630TT genotype may modify breast and ovarian cancer risks in BRCA1 mutation carriers. This association need to be evaluated in larger series of BRCA1 mutation carriers. PMID:22669161

  17. Methylenetetrahydrofolate reductase C677T polymorphism in patients with gastric and colorectal cancer in a Korean population

    PubMed Central

    2010-01-01

    Background This study was designed to investigate an association between the methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism and the risk of gastric and colorectal cancer in the Korean population. Methods We conducted a population-based large-scale case-control study involving 2,213 patients with newly diagnosed gastric cancer, 1,829 patients with newly diagnosed colorectal cancer, and 1,700 healthy controls. Genotyping was performed with peripheral blood DNA for MTHFR C677T polymorphisms. The statistical significance was estimated by logistic regression analysis. Results The MTHFR C677T frequencies of CC, CT, and TT genotypes were 35.2%, 47.5%, and 17.3% among stomach cancer, 34%, 50.5%, and 15.5% in colorectal cancer, and 31.8%, 50.7%, and 17.5% in the controls, respectively. The MTHFR 677TT genotype showed a weak opposite association with colorectal cancer compared to the homozygous CC genotype [adjusted age and sex odds ratio (OR) = 0.792, 95% confidence interval (CI) = 0.638-0.984, P = 0.035]. Subjects with the MTHFR 677CT showed a significantly reduced risk of gastric cancer compared whose with the 677CC genotype (age- and sex-adjusted OR = 0.810; 95% CI = 0.696-0.942, P = 0.006). We also observed no significant interactions between the MTHFR C677T polymorphism and smoking or drinking in the risk of gastric and colorectal cancer. Conclusions The T allele was found to provide a weak protective association with gastric cancer and colorectal cancer. PMID:20504332

  18. Association between Hcy levels and the CBS844ins68 and MTHFR C677T polymorphisms with essential hypertension.

    PubMed

    Cai, Weijuan; Yin, Liang; Yang, Fang; Zhang, Lei; Cheng, Jiang

    2014-11-01

    -D haplotype and EH (OR, 1.376). MTHFR C677T and CBS844ins68 polymorphisms were present in the populations studied and the CBS844ins68 homozygous mutation was not present. Therefore, there is a correlation between the polymorphisms of the MTHFR C677T gene and EH, and allele T may be one of the predisposing factors. MTHFR C677T and CBS844ins68 may exist with a certain linkage and the T-D haplotype may be a risk factor for EH.

  19. Association between Hcy levels and the CBS844ins68 and MTHFR C677T polymorphisms with essential hypertension

    PubMed Central

    CAI, WEIJUAN; YIN, LIANG; YANG, FANG; ZHANG, LEI; CHENG, JIANG

    2014-01-01

    and EH (OR, 1.376). MTHFR C677T and CBS844ins68 polymorphisms were present in the populations studied and the CBS844ins68 homozygous mutation was not present. Therefore, there is a correlation between the polymorphisms of the MTHFR C677T gene and EH, and allele T may be one of the predisposing factors. MTHFR C677T and CBS844ins68 may exist with a certain linkage and the T-D haplotype may be a risk factor for EH. PMID:25279160

  20. The association between methylenetetrahydrofolate reductase C677 > T polymorphisms and risk of pediatric acute lymphoblastic leukemia in Asia.

    PubMed

    Lin, Shiguang; Liu, Qin; Zeng, Xiaoming

    2014-11-01

    The association between methylenetetrahydrofolate reductase (MTHFR) C677 > T polymorphisms and pediatric acute lymphoblastic leukemia (ALL) risk in Asia is controversial. The aim of this meta-analysis was to further assess the relationship between MTHFR C677 > T polymorphisms and pediatric ALL for Chinese children. Studies about the MTHFR C677 > T polymorphisms and pediatric ALL risk were searched in the Medline, PubMed, EMBASE, Wanfang and CNIK databases. The genotype of the case and control group were extracted and pooled by meta-analysis. The association between ALL risk and C677 > T polymorphisms was demonstrated by odds ratio (OR) and its 95% confidence interval (CI). Twelve articles were included in this study with 1803 ALL cases and 4146 controls. In recessive genetic model (TT vs. CC + CT), the OR was 0.37 (95%CI: 0.31-0.43); in dominant genetic model (TT + CT vs. CC) the OR was 0.94 (95%CI: 0.82-1.06); and in the homozygous model the OR was 0.84 (95%CI: 0.69-1.03). The results indicated that Asian children with TT genotype of MTHFR gene may have less risk of developing ALL.

  1. Association study of methylenetetrahydrofolate reductase C677T mutation with cerebral venous thrombosis in an Iranian population.

    PubMed

    Ghaznavi, Habib; Soheili, Zahra; Samiei, Shahram; Soltanpour, Mohammad S

    2015-12-01

    There are limited data on the role of methylenetetrahydrofolate reductase C677T polymorphism and hyperhomocysteinemia as risk factors for cerebral venous thrombosis in Iranian population. We examined a possible association between fasting plasma homocysteine levels, methylenetetrahydrofolate reductase C677T polymorphism, and cerebral venous thrombosis in 50 patients with a diagnosis of cerebral venous thrombosis (20-63 years old) and 75 healthy controls (18-65 years old). Genotyping of the methylenetetrahydrofolate reductase C677T gene polymorphism was performed by PCR-restriction fragment length polymorphism analysis, and homocysteine levels were measured by enzyme immunoassay. Fasting plasma homocysteine levels were significantly higher in cerebral venous thrombosis patients than in controls (P = 0.015). Moreover, plasma homocysteine levels were significantly higher in methylenetetrahydrofolate reductase 677TT genotype compared to 677CT and 677CC genotypes in both cerebral venous thrombosis patients (P = 0.01) and controls (P = 0.03). Neither 677CT heterozygote genotype [odds ratio (OR) 1.35, 95% confidence interval (CI) 0.64-2.84, P = 0.556] nor 677TT homozygote genotype (OR 1.73, 95% CI 0.32-9.21, P = 0.833) was significantly associated with cerebral venous thrombosis. Additionally, no significant differences in the frequency of 677T allele between cerebral venous thrombosis patients and controls were identified (OR 1.31, 95% CI 0.69-2.50, P = 0.512). In conclusion, our study demonstrated that elevated plasma homocysteine levels are significant risk factors for cerebral venous thrombosis. Also, methylenetetrahydrofolate reductase 677TT genotype is not linked with cerebral venous thrombosis, but is a determinant of elevated plasma homocysteine levels.

  2. Folate restriction and methylenetetrahydrofolate reductase 677T polymorphism decreases adoMet synthesis via folate-dependent remethylation in human-transformed lymphoblasts.

    PubMed

    Chiang, E-P; Wang, Y-C; Tang, F-Y

    2007-04-01

    The homozygous mutation (677TT) in the methylenetetrahydrofolate reductase (MTHFR) gene reduces enzyme activity and alters cellular folate composition. Previous epidemiological studies reported a potential protective effect of MTHFR677C --> T against acute lymphocytic leukemia and malignant lymphoma, but the mechanism remains to be determined. We investigated the biochemical impacts of MTHFR677C --> T on cellular S-adenosyl methionine (adoMet) synthesis, global DNA methylation, and de novo purine synthesis, all of which are potential regulatory pathways involved in tumorigenesis. Metabolic fluxes of homocysteine remethylation and de novo purine synthesis were compared between Epstein-Barr virus-transformed lymphoblasts expressing MTHFR 677C and MTHFR 677T using stable isotopic tracers and GCMS. MTHFR TT genotype significantly reduced folate-dependent remethylation under folate restriction, reflecting limited methylated folates under folate restriction. Data also suggested increased formylated folate pool and increased purine synthesis when folate is adequate. The impacts of MTHFR 677T polymorphism appeared closely related to folate status, and such alterations may modulate metabolic pathways involved in cancer onset/progression. The advantage of de novo purine synthesis found in the MTHFR TT genotype may account for the protective effect of MTHFR in hematological malignancies. These transformed cells are potential models for studying the consequences of human genetic variation and cancer pathogenesis.

  3. MTHFR (C677T) polymorphism and PR (PROGINS) mutation as genetic factors for preterm delivery, fetal death and low birth weight: A Northeast Indian population based study.

    PubMed

    Tiwari, Diptika; Bose, Purabi Deka; Das, Somdatta; Das, Chandana Ray; Datta, Ratul; Bose, Sujoy

    2015-02-01

    Preterm delivery (PTD) is one of the most significant contributors to neonatal mortality, morbidity, and long-term adverse consequences for health; with highest prevalence reported from India. The incidence of PTD is alarmingly very high in Northeast India. The objective of the present study is to evaluate the associative role of MTHFR gene polymorphism and progesterone receptor (PR) gene mutation (PROGINS) in susceptibility to PTD, negative pregnancy outcome and low birth weights (LBW) in Northeast Indian population. A total of 209 PTD cases {extreme preterm (< 28 weeks of gestation, n = 22), very preterm (28-32 weeks of gestation, n = 43) and moderate preterm (32-37 weeks of gestation, n = 144) and 194 term delivery cases were studied for MTHFR C677T polymorphism and PR (PROGINS) gene mutation. Statistical analysis was performed using SPSS software. Distribution of MTHFR and PR mutation was higher in PTD cases. Presence of MTHFR C677T polymorphism was significantly associated and resulted in the increased risk of PTD (p < 0.001), negative pregnancy outcome (p < 0.001) and LBW (p = 0.001); more significantly in extreme and very preterm cases. Presence of PR mutation (PROGINS) also resulted in increased risk of PTD and negative pregnancy outcome; but importantly was found to increase the risk of LBW significantly in case of very preterm (p < 0.001) and moderately preterm (p < 0.001) delivery cases. Both MTHFR C677T polymorphism and PR (PROGINS) mutation are evident genetic risk factors associated with the susceptibility of PTD, negative pregnancy outcome and LBW. MTHFR C677T may be used as a prognostic marker to stratify subpopulation of pregnancy cases predisposed to PTD; thereby controlling the risks associated with PTD.

  4. Association of the 5,10-methylenetetrahydrofolate reductase (MTHFR C677T and A1298C) polymorphisms in Korean patients with adult acute lymphoblastic leukemia.

    PubMed

    Oh, Doyeun; Kim, Nam Keun; Jang, Moon Ju; Kim, Hugh Chul; Lee, Jae Hoon; Lee, Jung Ae; Ahn, Myung Ju; Kim, Chul Soo; Kim, Heung Sik; Park, Seonyang; Chio, Hyun Sook; Min, Yoo Hong

    2007-01-01

    Methylenetetrahydrofolate reductase (MTHFR) plays a central role in converting folate to methyl donor for DNA methylation. Because MTHFR is a key enzyme in folate metabolism, changes in its activity resulting from polymorphisms in the MTHFR gene could modify the susceptibility to cancer. Recently, the C677T and A1298C mutations of MTHFR were discovered to be associated with susceptibility in acute lymphoblastic leukemia (ALL). The association between MTHFR polymorphisms and susceptibility and clinical outcome in ALL was studied in 118 adult ALL patients and matched healthy controls (n =427). DNA samples taken from patients with ALL and controls were analyzed using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assays to detect the MTHFR C677T and A1298C mutations. No significant difference was found in the development of adult ALL among those with different MTHFR genotypes of the C677T or A1298C polymorphisms. However, the MTHFR 677CT+TT genotype showed a tendency to be associated with adult ALL [crude odds ratio (OR), 0.67; 95% confidence interval (CI), 0.44-1.02; adjusted OR, 0.74 95% CI, 0.47-1.14]. The MTHFR C677T and A1298C polymorphisms are not significant risk factors in adult acute leukemia in the Korean population.

  5. Coexistence of the 677C>T and 1298A>C MTHFR polymorphisms and its significance in the population of Polish women.

    PubMed

    Wolski, Hubert; Kocięcka, Maria; Mrozikiewicz, Aleksandra E; Barlik, Magdalena; Kurzawińska, Grażyna

    2015-10-01

    The aim of the study was to evaluate the frequency of the 677C>T and 1298A>C polymorphisms of the methylenetetrahydrofolate reductase (MTHFR) gene, as well as the coexistence of both these genetic variants in women from the Polish population. A total of 662 women from the Polish population were enrolled in the study group. The frequency of the investigated genotypes of the 677C>T and 1298A>C polymorphisms of the MTHFR gene was analyzed with the use of PCR/RFLP methods. The frequency of the 677CC, 677CT and 677TT genotypes in the studied population of women was 50.60%, 39.88% and 9.52%, respectively As to the 1298AA, 1298AC and 1298CC genotypes, the obtained results were as follows: 42.75%, 47.88% and 9.37%, respectively (Tables II and III). Simultaneous analysis revealed the most frequent coexistence of 677CC/1298AC (28.85%), 677CT/1298AA (20.85%) and 677CT/1298AC (19.03%) genotypes. The coexistence of 677CC/1298AA (12.39%), 677CC/1298CC (9.37%) and 677TT/1298AA (9.51%) genotypes was observed less frequently In the studied population of Polish women, the coexistence of 677CT/1298CC, 677TT/1298AC and 677TT/1298CC genotypes has been not observed. The frequency and coexistence of genotypes of the 677C>T and 1298A>C MTHFR gene polymorphisms in the studied population of Polish women is similar to other North-European populations. Women carriers of the mutated variants of both, 677C>T and 1298A>C polymorphisms of the MTHFR gene should receive special perinatal care in order to prevent fetal defects and thrombosis-related complications during pregnancy It is vital to emphasize the significance of proper education of folate supplementation, especially in pregnant patients and women of reproductive age.

  6. Methylenetetrahydrofolate reductase gene C677T and A1298C polymorphisms in patients with small cell and non-small cell lung cancer.

    PubMed

    Siemianowicz, Krzysztof; Gminski, Jan; Garczorz, Wojciech; Slabiak, Natalia; Goss, Malgorzata; Machalski, Marek; Magiera-Molendowska, Helena

    2003-01-01

    Two mutations of methylenetetrahydrofolate reductase (MTHFR) gene (C677T and A1298C) may lead to a decreased activity of the enzyme. These mutations may change a risk of some cancers. We evaluated these two polymorphisms of MTHFR in patients with small cell lung cancer (SCLC) and non-small cell lung cancer (NCSCL). All lung cancer patients had statistically significantly higher percentage of MTHFR 677TT genotype in comparison with non-cancer controls. There were no statistically significant differences in the distribution of MTHFR 1298 genotypes. Neither of the polymorphisms presented any statistically significant differences between SCLC and NSCLC.

  7. MTHFR C677T mutation increased the risk of Ischemic Stroke, especially in large-artery atherosclerosis in adults: an updated meta-analysis from 38 researches.

    PubMed

    Cui, Tao

    2016-01-01

    To date, many publications have evaluated the correlation between the Ethylenetetrahydrofolate reductase gene (MTHFR) C677T and Ischemic Stroke susceptibility in adults. However, the results remain inconclusive. The meta-analysis was performed to resolve the problem. Based on 38 studies, dichotomous data were presented as the odds ratio (OR) with a 95% confidence interval (CI). This study found, the carriers of the MTHFR 677C→T variation were more likely to increase the risk of Ischemic Stroke susceptibility in all over pooled population, including Asian and European, but not in African population (Europe: TT vs. CC+TC: OR = 1.364 95% CI = 1.010-1.841 p = 0.043; Asia subgroup: T vs. C: OR = 1.245, 95% CI = 1.141-1.358, p < 0.001; Africa: T vs. C: OR = 1.202, 95% CI = 0.990-1.459, p = 0.062). Among etiology stratified analysis, only large-artery atherosclerosis subgroups had a significant different, and the p value was less than 0.01 in all genetic models (T vs. C: OR = 1.29, 95% CI = 1.09-1.52, p = 0.002; TT+TC vs. CC: OR = 1.27, 95% CI = 1.06-1.51, p = 0.009; TT vs. CC+TC: OR = 1.62, 95% CI = 1.19-2.19, p = 0.002). This meta-analysis suggests that MTHFR C677T mutation increased the risk of Ischemic Stroke in adults, especially in large-artery atherosclerosis.

  8. Mutational Profile of Homozygous β-Thalassemia in Rio de Janeiro, Brazil.

    PubMed

    Carrocini, Gisele C S; Venancio, Larissa P R; Pessoa, Viviani L R; Lobo, Clarisse L C; Bonini-Domingos, Claudia R

    2017-01-01

    β-Thalassemia (β-thal) is a hemolytic anemia that is caused by point mutations in most cases. The Brazilian population is highly heterogeneous and knowledge of the mutations that make up the genotypic profile of individuals can contribute information about the formation of the population and clinical condition of patients. In this study, we evaluated the mutations present in homozygous β-thal patients from Rio de Janeiro, Brazil. We analyzed 24 samples of peripheral blood of patients with homozygous β-thal. To identify the mutations, we carried out allele-specific-polymerase chain reaction (AS-PCR) and DNA sequencing. We found 11 different mutations on the β-globin gene. Among the most frequent mutations observed were HBB: c.92 + 6T>C, followed by HBB: c.93-21G>A, HBB: c.118C>T and HBB: c.92 + 1G>A. We also identified the rare mutation HBB: c.75T>A that was reported in an individual carrying Hb S (HBB: c.20A>T)/β-thal (HBB: c.75T>A) but not in Brazilian thalassemic patients, thus, this is the first report of this mutation in Brazilian β-thal patients. For its multiethnic character, Brazil has different mutations that cause β-thal and that are distributed with different frequencies according to the regions of the country. Our findings contribute to the description of the mutational profile of Brazilian thalassemic patients, showing wide heterogeneity and genetic variability.

  9. Subacute methotrexate neurotoxicity and cerebral venous sinus thrombosis in a 12-year-old with acute lymphoblastic leukemia and methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism: homocysteine-mediated methotrexate neurotoxicity via direct endothelial injury.

    PubMed

    Mahadeo, Kris M; Dhall, Girish; Panigrahy, Ashok; Lastra, Carlos; Ettinger, Lawrence J

    2010-02-01

    From as early as the 1970s methotrexate has been associated with disseminated necrotizing leukoencephalopathy and other neurotoxic sequelae. Yet, a clear mechanism for methotrexate-induced neurotoxicity has not been established. The authors describe the case of a 12-year-old male with acute lymphoblastic leukemia and a homozygous methylenetetrahydrofolate reductase C677T mutation, who developed subacute methotrexate-induced toxicity and cerebral venous thrombosis after receiving intrathecal methotrexate. The role of homocysteine as a possible mediator in methotrexate-induced neurotoxicity via direct endothelial injury is discussed.

  10. Combined genotype and haplotype distributions of MTHFR C677T and A1298C polymorphisms

    PubMed Central

    Fan, Shujun; Yang, Boyi; Zhi, Xueyuan; Wang, Yanxun; Zheng, Quanmei; Sun, Guifan

    2016-01-01

    Abstract Methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C polymorphisms are, independently and/or in combination, associated with many disorders. However, data on the combined genotype and haplotype distributions of the 2 polymorphisms in Chinese population were limited. We recruited 13,473 adult women from 9 Chinese provinces, collected buccal cell samples, and determined genotypes, to estimate the combined genotype and haplotype distributions of the MTHFR C677T and A1298C polymorphisms. In the total sample, the 6 common combined genotypes were CT/AA (29.5%), TT/AA (21.9%), CC/AA (15.4%), CC/AC (14.9%), CT/AC (13.7%), and CC/CC (3.4%); the 3 frequent haplotypes were 677T-1298A (43.6%), 677C-1298A (37.9%), and 677C-1298C (17.6%). Importantly, we observed that there were 51 (0.4%) individuals with the CT/CC genotype, 92 (0.7%) with the TT/AC genotype, 17 (0.1%) with the TT/CC genotype, and that the frequency of the 677T-1298C haplotype was 0.9%. In addition, the prevalence of some combined genotypes and haplotypes varied among populations residing in different areas and even showed apparent geographical gradients. Further linkage disequilibrium analysis showed that the D’ and r2 values were 0.883 and 0.143, respectively. In summary, the findings of our study provide further strong evidence that the MTHFR C677T and A1298C polymorphisms are usually in trans and occasionally in cis configurations. The frequencies of mutant genotype combinations were relatively higher in Chinese population than other populations, and showed geographical variations. These baseline data would be useful for future related studies and for developing health management programs. PMID:27902594

  11. Association between methylenetetrahydrofolate reductase C677T polymorphism and epilepsy susceptibility: a meta-analysis.

    PubMed

    Wu, Yi-Le; Yang, Hui-Yun; Ding, Xiu-Xiu; Zhao, Xue; Chen, Jian; Bi, Peng; Sun, Ye-Huan

    2014-06-01

    Methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism has been implicated as a potential risk factor for epilepsy. To date, many case-control studies have investigated the association between MTHFR C677T polymorphism and epilepsy susceptibility. However, those findings were inconsistent. The objective of this study is to evaluate the precise association between MTHFR C677T polymorphism and epilepsy. An electronic search of PubMed, EMBASE for papers on the MTHFR C677T polymorphism and epilepsy susceptibility was performed. Odds ratios (ORs) with 95% confidence intervals (CIs) were calculated to assess the association. Ten case-control studies containing 1713 cases and 1867 controls regarding MTHFR C677T polymorphism were selected. A significant association between the MTHFR C677T polymorphism and epilepsy susceptibility was revealed in this meta-analysis (for T vs. C: OR=1.19, 95% CI=1.08-1.32; for TT+CT vs. CC: OR=1.20, 95% CI=1.05-1.38; for TT vs. CC: OR=1.48, 95% CI=1.20-1.83; for TT vs. CT+CC: OR=1.35, 95% CI=1.12-1.64). In subgroup analysis by ethnicity, the results also indicated the association between the MTHFR C677T polymorphism and epilepsy susceptibility within the Asian populations (for T vs. C: OR=1.55, 95% CI=1.15-2.07; for TT+CT vs. CC: OR=1.67, 95% CI=1.08-2.59; for TT vs. CC: OR=2.33, 95% CI=1.30-4.20; for TT vs. CT+CC: OR=1.89, 95% CI=1.12-3.18). The results indicated that MTHFR C677T polymorphism was associated with an increased risk of epilepsy. However, further studies in various regions are needed to confirm the findings from this meta-analysis. Copyright © 2014 British Epilepsy Association. Published by Elsevier Ltd. All rights reserved.

  12. Methylenetetrahydrofolate reductase C677T polymorphism and Factor V Leiden variant in Mexican women with preeclampsia/eclampsia.

    PubMed

    Dávalos, I P; Moran, M C; Martínez-Abundis, E; González-Ortiz, M; Flores-Martínez, S E; Machorro, V; Sandoval, L; Figuera, L E; Mena, J P; Oliva, J M; Tlacuilo-Parra, J A; Sánchez-Corona, J; Salazar-Páramo, M

    2005-01-01

    The etiology of preeclampsia is still a matter of controversy. An association between hyperhomocysteinemia and preeclamptic patients has been described. A common missense mutation in the methylenetetrahydrofolate reductase (MTHFR) gene is associated with increased plasma homocysteine concentrations. In addition, the polymorphism of gene encoding for Factor V Leiden G1691A is associated with a prothrombotic state in heterozygous subjects. Both mutations in these thrombophilic proteins appear to have different prevalence in the general population and in patients with preeclampsia/eclampsia (PE/E). We studied single nucleotide polymorphisms for MTHFR C677T and coagulation Factor V Leiden in 33 Mexican patients with PE/E as a genetic risk factor for these diseases, comparing with a normotensive pregnant control group. The genotype and allele frequencies of MTHFR C677T and Factor V Leiden mutations between Mexican women with PE/E and healthy controls were not different. We conclude that these polymorphisms do not contribute in the etiology of PE/E as it has been reported in other populations.

  13. The MTHFR C677T polymorphism and risk of acute lymphoblastic leukemia: an updated meta-analysis based on 37 case-control studies.

    PubMed

    Jiang, Yuan; Hou, Jing; Zhang, Qiang; Jia, Shu-Ting; Wang, Bo-Yuan; Zhang, Ji-Hong; Tang, Wen-Ru; Luo, Ying

    2013-01-01

    The C677T polymorphism of the methylenetetrahydrofolate reductase (MTHFR) has been associated with acute lymphoblastic leukemia (ALL). However, results were conflicting. The aim of this study was to quantitatively summarize the evidence for the MTHFRC677T polymorphism and ALL risk. Electronic searches of PubMed and the Chinese Biomedicine database were conducted to select case-control studies containing available genotype frequencies of C677T and the odds ratio (OR) with 95% confidence interval (CI) was used to assess the strength of any association. Case-control studies including 6,371 cases and 10,850 controls were identified. The meta-analysis stratified by ethnicity showed that individuals with the homozygous TT genotype had decreased risk of ALL (OR= 0.776, 95% CI: 0.687~0.877, p< 0.001) in Caucasians (OR= 0.715, 95% CI: 0.655~0.781, p= 0.000). However, results among Asians (OR=0.711, 95% CI: 0.591~1.005, p= 0.055) and others (OR=0.913, 95% CI: 0.656~1.271, p= 0. 590) did not suggest an association. A symmetric funnel plot, the Egger's test (P=0.093), and the Begg- test (P=0.072) were all suggestive of the lack of publication bias. This meta-analysis supports the idea that the MTHFR C677T genotype is associated with risk of ALL in Caucasians. To draw comprehensive and true conclusions, further prospective studies with larger numbers of participants worldwide are needed to examine associations between the MTHFRC677T polymorphism and ALL.

  14. The C677T polymorphism of the methylenetetrahydrofolate reductase gene in Mexican mestizo neural-tube defect parents, control mestizo and native populations.

    PubMed

    Dávalos, I P; Olivares, N; Castillo, M T; Cantú, J M; Ibarra, B; Sandoval, L; Morán, M C; Gallegos, M P; Chakraborty, R; Rivas, F

    2000-01-01

    The C677T mutation of the methylenetetrahydrofolate reductase (MTHFR) gene, associated with the thermolabile form of the enzyme, has reportedly been found to be increased in neural-tube defects (NTD), though this association is still unclear. A group of 107 mestizo parents of NTD children and five control populations: 101 mestizo (M), 50 Huichol (H), 38 Tarahumara (T), 21 Purepecha (P) and 20 Caucasian (C) individuals were typed for the MTHFR C677T variant by the PCR/RFLP (HinfI) method. Genotype frequencies were in agreement with the Hardy-Weinberg expectations in all six populations. Allele frequency (%) of the C677T variant was 45 in NTD, 44 in M, 56 in H, 36 in T, 57 in P, 35 in C. Pairwise inter-population comparisons of allele frequency disclosed a very similar distribution between NTD and M groups (exact test, P=0.92). Among controls, differences between M and individual native groups were NS (0.06C (P=0.29). A high frequency of the variant was found in H (56%) and P (57%). A similar allele frequency in groups M and NTD does not support a causal relationship between NTD and parental MTHFR C677T genotypes. Thus, the C677T variant cannot be regarded as a major genetic risk factor for NTD in Mexican mestizo parents. Otherwise, C677T in Mexico is very frequent, especially in Huichol and Purepecha natives, as compared with other groups world wide.

  15. A homozygous nonsense CEP250 mutation combined with a heterozygous nonsense C2orf71 mutation is associated with atypical Usher syndrome.

    PubMed

    Khateb, Samer; Zelinger, Lina; Mizrahi-Meissonnier, Liliana; Ayuso, Carmen; Koenekoop, Robert K; Laxer, Uri; Gross, Menachem; Banin, Eyal; Sharon, Dror

    2014-07-01

    Usher syndrome (USH) is a heterogeneous group of inherited retinitis pigmentosa (RP) and sensorineural hearing loss (SNHL) caused by mutations in at least 12 genes. Our aim is to identify additional USH-related genes. Clinical examination included visual acuity test, funduscopy and electroretinography. Genetic analysis included homozygosity mapping and whole exome sequencing (WES). A combination of homozygosity mapping and WES in a large consanguineous family of Iranian Jewish origin revealed nonsense mutations in two ciliary genes: c.3289C>T (p.Q1097*) in C2orf71 and c.3463C>T (p.R1155*) in centrosome-associated protein CEP250 (C-Nap1). The latter has not been associated with any inherited disease and the c.3463C>T mutation was absent in control chromosomes. Patients who were double homozygotes had SNHL accompanied by early-onset and severe RP, while patients who were homozygous for the CEP250 mutation and carried a single mutant C2orf71 allele had SNHL with mild retinal degeneration. No ciliary structural abnormalities in the respiratory system were evident by electron microscopy analysis. CEP250 expression analysis of the mutant allele revealed the generation of a truncated protein lacking the NEK2-phosphorylation region. A homozygous nonsense CEP250 mutation, in combination with a heterozygous C2orf71 nonsense mutation, causes an atypical form of USH, characterised by early-onset SNHL and a relatively mild RP. The severe retinal involvement in the double homozygotes indicates an additive effect caused by nonsense mutations in genes encoding ciliary proteins. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  16. Synergistic effect of methyltetrahydrofolate reductase (MTHFR) C677T and A1298C polymorphism as risk modifiers of pediatric acute lymphoblastic leukemia.

    PubMed

    Kamel, Azza M; Moussa, Heba S; Ebid, Gamal T; Bu, Rong R; Bhatia, Kishor G

    2007-06-01

    ALL is the most common pediatric cancer. The causes of the majority of pediatric acute leukemia are unknown and are likely to involve an interaction between genetic and environmental factors. Therefore, unfavourable gene-environmental interactions might be involved in the genesis of ALL. The aim of this work was to evaluate, in a case-control study, whether the common polymorphisms in 5, 10-methylenetetrahydrofolate reductase (MTHFR) namely (C677T and A1298C) and methionine synthase (MS) (A2756G) genes may play a role in altering susceptibility to pediatric ALL as individual genes and in combination. DNA of 88 ALL patients (age < or = 18 years) and 311 healthy control subjects was analyzed for the polymorphisms of MTHFR and MS genes using PCR-RFLP method. The frequencies of the wild types of MTHFR 677CC, MTHFR 1298AA and MS 2756AA, the homozygous genotypes of MTHFR 677TT, MTHFR 1298CC and MS 2756GG and heterozygous genotypes of MTHFR 677CT and MS 2756AG showed no statistically significant differences between patients and controls. The frequency of the MTHFR 1298AC heterozygous genotype was 25% among patients compared to 45.0% among controls; the difference was found to be statistically significant (p value =0.001, O.R=0.382 & 95% C.I=0.222-0.658). The frequency of the MTHFR1298AC heterozygous genotype plus 1298CC homozygous genotype was 34% among patients compared to 54.3% among controls and the difference was statistically significant (p value =0.001). A synergistic effect of 677CT and1298AC (CTAC) was observed, (p value=0.002) with 3.65 fold protection (OR 0.273 & 95% C.I=0.155-0.9) compared to 2.6 folds for MTHFR 1298AC alone. This protective effect of CTAC polymorphism was abolished when combined with MS 2756AA or AG. The present study provided further evidence for the protective role of MTHFR 1298AC mutant alleles in acute lymphoblastic leukemia in children (2.6 fold protection). This suggests that folate and methionine metabolism play an important role in the

  17. C677T methylenetetrahydrofolate reductase and plasma homocysteine levels among Thai vegans and omnivores.

    PubMed

    Kajanachumpol, Saowanee; Atamasirikul, Kalayanee; Tantibhedhyangkul, Phieuvit

    2013-01-01

    Hyperhomocysteinemia among vegetarians and vegans is caused mostly by vitamin B12 deficiency. A C-to-T mutation in the methylenetetrahydrofolate reductase (MTHFR) gene results in a thermolabile MTHFR, which may affect homocysteine (Hcy) levels. The importance of this gene mutation among populations depends on the T allele frequency. Blood Hcy, vitamin B12, folate, vitamin B6, and MTHFR C677T mutation status were determined in 109 vegans and 86 omnivores aged 30 - 50 years. The vegans had significantly higher Hcy levels than the omnivores, geometric means (95 % CI) 19.2 (17.0 - 21.7) µmol/L vs. 8.53 (8.12 - 8.95) µmol/L, p < 0.001. A C-to-T mutation in the vegans increased plasma Hcy, albeit insignificantly; geometric means 18.2 µmol/L, 20.4 µmol/L, and 30.0 µmol/L respectively in CC, CT, and TT MTHFR genotypes. There was also a significant decrease in serum folate; geometric means 12.1 ng/mL, 9.33 ng/mL, and 7.20 ng/mL respectively, in the CC, CT, and TT mutants, p = 0.006, and particularly, in the TT mutant compared with the CC wild type, 7.20 ng/mL vs. 12.1 ng/mL, p = 0.023. These findings were not seen in the omnivores. It was concluded that hyperhomocysteinemia is prevalent among Thai vegans due to vitamin B12 deficiency. C-to-T MTHFR mutation contributes only modestly to the hyperhomocysteinemia.

  18. Prevalence of factor V leiden, MTHFR C677T and MTHFR A1298C polymorphisms in patients with deep vein thrombosis in Central Iran.

    PubMed

    Ehsani, Majid; Imani, Aida; Moravveji, Alireza

    2018-05-31

    Deep vein thrombosis (DVT) is a common disease, especially among elderly patients, which is associated with high costs of treatment and high rates of recurrence. The risk factors for venous thrombosis are primarily related to hypercoagulability, which can be genetic or acquired, or because of immobilization and venous stasis. Among relevant genetic markers are a number of common polymorphisms and mutations in the genes coding for Factor V leiden and methylenetetrahydrofolate reductase. Differential associations of these polymorphisms have been reported in different populations with DVT due to ethnic variations. However, no study has been reported with respect to these polymorphisms in DVT in Iran. Thus, the aim of the present study is to determine the prevalence of FVL, MTHFR C677T and MTHFR A1298C gene polymorphisms in patients with DVT in central Iran. In the present cross-sectional study, a total of 100 patients with first and recurrent episodes of DVT and age less than 70 years were recruited during 2016-2017. Blood sample was collected from the recruited patients and FVL mutation was screened using ARMS-PCR method, MTHFR C677T and MTHFR A1298C mutations were screened using PCR-RFLP method. The results revealed that MTHFR A1298C gene polymorphism in both homozygote and heterozygote form was found to be most frequent i.e. 77% among cases, followed by MTHFR C677T (67%) and FVL (17%). The study highlights the importance of screening of these genetic markers among patients with DVT in this region.

  19. Role of Hyperhomocysteinemia and Methylene Tetrahydrofolate Reductase C677T Polymorphism in Idiopathic Portal Vein Thrombosis

    PubMed Central

    Ghaznavi, Habib; Soheili, Zahra; Samiei, Shahram; Soltanpour, Mohammad Soleiman

    2016-01-01

    Purpose: Portal vein thrombosis (PVT) is a rare and life-threatening vascular disorder characterized by obstruction or narrowing of the portal vein. Hyperhomocysteinemia and methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism has been studied in PVT patients with conflicting results. In the present study the association of hyperhomocysteinemia and MTHFR C677T polymorphism with PVT risk was investigated in Iranians. Materials and Methods: Our study population consisted of 10 idiopathic PVT patients and 80 healthy control subjects matched for age and sex. MTHFR C677T polymorphism was genotyped by the polymerase chain reaction technique combined with restriction enzyme fragment length polymorphism (PCR-RFLP) technique and plasma total homocysteine (tHcy) levels were determined by enzyme immunoassay method. Results: Mean plasma tHcy levels were significantly higher in PVT patients (20.2±6.8) than control subjects (10.9±4.7) (P=0.001). Moreover, plasma tHcy levels were significantly higher in 677T allele carriers relative to 677C allele carriers in both PVT patients (P=0.01) and control subjects (P=0.03). Neither homozygote nor heterozygote genotypes of MTHFR C677T polymorphism correlated significantly with PVT risk (P>0.05). Moreover, MTHFR C677T polymorphism didn’t increase the risk of PVT under dominant (CT+TT vs. CC) or recessive (TT vs. CC+CT) genetic models analyzed (P>0.05). The difference in frequency of minor 677T allele between PVT patients and control subjects was not statistically significant (P>0.05). Conclusion: Based on the current study, we suggest that hyperhomocysteinemia constitutes a significant and common risk factor for PVT. Also, MTHFR C677T polymorphism is not a risk factor for PVT but is a contributing factor for elevated plasma tHcy levels. PMID:27051654

  20. Role of Hyperhomocysteinemia and Methylene Tetrahydrofolate Reductase C677T Polymorphism in Idiopathic Portal Vein Thrombosis.

    PubMed

    Ghaznavi, Habib; Soheili, Zahra; Samiei, Shahram; Soltanpour, Mohammad Soleiman

    2016-03-01

    Portal vein thrombosis (PVT) is a rare and life-threatening vascular disorder characterized by obstruction or narrowing of the portal vein. Hyperhomocysteinemia and methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism has been studied in PVT patients with conflicting results. In the present study the association of hyperhomocysteinemia and MTHFR C677T polymorphism with PVT risk was investigated in Iranians. Our study population consisted of 10 idiopathic PVT patients and 80 healthy control subjects matched for age and sex. MTHFR C677T polymorphism was genotyped by the polymerase chain reaction technique combined with restriction enzyme fragment length polymorphism (PCR-RFLP) technique and plasma total homocysteine (tHcy) levels were determined by enzyme immunoassay method. Mean plasma tHcy levels were significantly higher in PVT patients (20.2±6.8) than control subjects (10.9±4.7) (P=0.001). Moreover, plasma tHcy levels were significantly higher in 677T allele carriers relative to 677C allele carriers in both PVT patients (P=0.01) and control subjects (P=0.03). Neither homozygote nor heterozygote genotypes of MTHFR C677T polymorphism correlated significantly with PVT risk (P>0.05). Moreover, MTHFR C677T polymorphism didn't increase the risk of PVT under dominant (CT+TT vs. CC) or recessive (TT vs. CC+CT) genetic models analyzed (P>0.05). The difference in frequency of minor 677T allele between PVT patients and control subjects was not statistically significant (P>0.05). Based on the current study, we suggest that hyperhomocysteinemia constitutes a significant and common risk factor for PVT. Also, MTHFR C677T polymorphism is not a risk factor for PVT but is a contributing factor for elevated plasma tHcy levels.

  1. Effects of Maternal 5,10-Methylenetetrahydrofolate Reductase C677T and A1298C Polymorphisms and Tobacco Smoking on Infant Birth Weight in a Japanese Population

    PubMed Central

    Yila, Thamar Ayo; Sasaki, Seiko; Miyashita, Chihiro; Braimoh, Titilola Serifat; Kashino, Ikuko; Kobayashi, Sumitaka; Okada, Emiko; Baba, Toshiaki; Yoshioka, Eiji; Minakami, Hisanori; Endo, Toshiaki; Sengoku, Kazuo; Kishi, Reiko

    2012-01-01

    Background Intracellular folate hemostasis depends on the 5,10-methylenetetrahydrofolate reductase (MTHFR) gene. Because 5,10-MTHFR 677TT homozygosity and tobacco smoking are associated with low folate status, we tested the hypothesis that smoking in mothers with 5,10-MTHFR C677T or A1298C polymorphisms would be independently associated with lower birth weight among their offspring. Methods We assessed 1784 native Japanese mother-child pairs drawn from the ongoing birth cohort of The Hokkaido Study on Environment and Children’s Health. Data (demographic information, hospital birth records, and biological specimens) were extracted from recruitments that took place during the period from February 2003 to March 2006. Maternal serum folate were assayed by chemiluminescent immunoassay, and genotyping of 5,10-MTHFR C677T/A1298C polymorphisms was done using a TaqMan allelic discrimination assay. Results The prevalence of folate deficiency (<6.8 nmol/L) was 0.3%. The 5,10-MTHFR 677CT genotype was independently associated with an increase of 36.40 g (95% CI: 2.60 to 70.30, P = 0.035) in mean infant birth weight and an increase of 90.70 g (95% CI: 6.00 to 175.50, P = 0.036) among male infants of nonsmokers. Female infants of 677TT homozygous passive smokers were 99.00 g (95% CI: −190.26 to −7.56, P = 0.034) lighter. The birth weight of the offspring of smokers with 5,10-MTHFR 1298AA homozygosity was lower by 107.00 g (95% CI: −180.00 to −33.90, P = 0.004). Conclusions The results suggest that, in this population, maternal 5,10-MTHFR C677T polymorphism, but not the 5,10-MTHFR A1298C variant, is independently associated with improvement in infant birth weight, especially among nonsmokers. However, 5,10-MTHFR 1298AA might be associated with folate impairment and could interact with tobacco smoke to further decrease birth weight. PMID:22277790

  2. CBS mutations and MTFHR SNPs causative of hyperhomocysteinemia in Pakistani children.

    PubMed

    Ibrahim, Shahnaz; Maqbool, Saadia; Azam, Maleeha; Iqbal, Mohammad Perwaiz; Qamar, Raheel

    2018-03-29

    Three index patients with hyperhomocysteinemia and ocular anomalies were screened for cystathionine beta synthase (CBS) and methylenetetrahydrofolate reductase (MTHFR) polymorphisms. Genotyping of hyperhomocysteinemia associated MTHFR polymorphisms C677T (rs1801133) and A1298C (rs1801131) was done by PCR-restriction fragment length polymorphism. Sanger sequencing was performed for CBS exonic sequences along with consensus splice sites. In the case of MTHFR polymorphisms, all the patients were heterozygous CT for the single nucleotide polymorphism (SNP) C677T and were therefore carriers of the risk allele (T), while the patients were homozygous CC for the risk genotype of the SNP A1298C. CBS sequencing resulted in the identification of two novel mutations, a missense change (c.467T>C; p.Leu156Pro) in exon 7 and an in-frame deletion (c.808_810del; p.Glu270del) in exon 10. In addition, a recurrent missense mutation (c.770C>T; p.Thr257Met) in exon 10 of the gene was also identified. The mutations were present homozygously in the patients and were inherited from the carrier parents. This is the first report from Pakistan where novel as well as recurrent CBS mutations causing hyperhomocysteinemia and lens dislocation in three patients from different families are being reported with the predicted effect of the risk allele of the MTHFR SNP in causing hyperhomocysteinemia.

  3. Phenotypic Variation in Patients with Homozygous c.1678G>T Mutation in EVC Gene: Report of Two Mexican Families with Ellis-van Creveld Syndrome

    PubMed Central

    Ibarra-Ramirez, Marisol; Campos-Acevedo, Luis Daniel; Lugo-Trampe, Jose; Martínez-Garza, Laura E.; Martinez-Glez, Víctor; Valencia-Benitez, María; Lapunzina, Pablo; Ruiz-Peréz, Víctor

    2017-01-01

    Case series Patient: — Final Diagnosis: Ellis van Creveld syndrome Symptoms: Conical teeth • polydactyly • short stature Medication: — Clinical Procedure: — Specialty: Pediatrics and Neonatology Objective: Rare disease Background: Ellis-van Creveld syndrome is an autosomal recessive chondro-ectodermal dysplasia characterized by disproportionate short stature, limb shortening, narrow chest, postaxial polydactyly and dysplastic nails and teeth. In addition, 60% of cases present congenital heart defects. Ellis-van Creveld syndrome is predominantly caused by mutations in the EVC or EVC2 (4p16) genes, with only a few cases caused by mutations in WDR35. Case Report: Here, we report on two Mexican families with patients diagnosed with Ellis-van Creveld syndrome. Family 1 includes four patients: three females of 15, 18, and 23 years of age and a 7-year old male. Family 2 has only one affected newborn male. All patients exhibited multiple features including hypodontia, dysplastic teeth, extra frenula, mild short stature, distal limb shortening, postaxial polydactyly of hands and feet, nail dystrophy, and knee joint abnormalities. Only two patients had an atrial septal defect. In all cases, molecular analysis by Sanger sequencing identified the same homozygous mutation in exon 12 of EVC, c.1678G>T, which leads to a premature stop codon. Conclusions: The mutation c.1678G>T has been previously reported in another Mexican patient and it appears to be a recurrent mutation in Mexico which could represent a founder mutation. The large number of patients in this case allows the clinical variability and spectrum of manifestations present in individuals with Ellis-van Creveld syndrome even if they carry the same homozygous mutation in a same family. PMID:29229899

  4. Clinical impact of factor V Leiden, prothrombin G20210A, and MTHFR C677T mutations among sickle cell disease patients of Central India.

    PubMed

    Nishank, Sudhansu Sekhar; Singh, Mendi Prema Shyam Sunder; Yadav, Rajiv

    2013-11-01

    It is known that patients with sickle cell disease (SCD) present activation of the blood coagulation and fibrinolytic systems, especially during vaso-occlusive crises and also during the steady state of the disease. We determined whether the presence of the factor prothrombin gene G20210A variant, factor V gene G1691A mutation (factor V Leiden), and methylenetetrahydrofolate reductase (MTHFR) C677T polymorphisms may be risk factors for vascular complications in individuals with SCD. The study involved 150 patients with sickle cell anemia and 150 healthy controls of Central India. Genotyping of three thrombophilic mutations was carried out by PCR-RFLP methods using MnlI, Hind III, and Hinf I, respectively, for factor V Leiden, prothrombin, and MTHFR mutations. Patients with SCD had significantly higher prevalence of mutant variants of MTHFR gene (28.0% heterozygotes and 14.6% homozygotes) and FVL gene (14.6% heterozygotes) as compared to normal/control individuals, but complete absence of mutant variants of prothrombin gene. The patients with SCD having mutant variants of MTHFR and FVL genes showed higher incidence of pain in chest, abdomen, and bone joints along with early age of onset of clinical manifestations as well as frequent dependence on blood transfusion than those patients with SCD having wild variants of these thrombotic genes. As compared to control subjects, SCD individuals having mutant variants of FVL and MTHFR genes had significant association with higher levels of prothrombin fragment (F1+2), D-dimer, thrombin-antithrombin (TAT), and lower level of protein C. MTHFR C677T and FVL G1691A polymorphisms may be risk factors for increased vascular complications in patient with SCD. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  5. A cystic fibrosis patient who is homozygous for the A559T mutation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McDowell, T.; Shackleton, S.; Dear, S.

    1995-09-01

    We have recently defined a cystic fibrosis (CF) patient who is homozygous for the A559T mutation in exon 11 of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. This mutation was detected by direct sequence analysis and confirmed to be carried by both parents (of West Indian origin) of the index case. The A559T mutation has not been detected in any Caucasian CF patients. The presence of this mutation in North American black CF patients and a British CF patient of West Indian origin is clearly of interest in designing CF screening tests that are tailored to specific ethnic groups.more » 1 ref.« less

  6. An Indian child with Kindler syndrome resulting from a new homozygous nonsense mutation (C468X) in the KIND1 gene.

    PubMed

    Sethuraman, G; Fassihi, H; Ashton, G H S; Bansal, A; Kabra, M; Sharma, V K; McGrath, J A

    2005-05-01

    Kindler syndrome is an inherited skin condition that presents with blistering followed by photosensitivity and a progressive poikiloderma. The disorder results from mutations in the KIND1 gene, encoding the protein kindlin-1, a recently characterized 677-amino acid protein involved in anchorage of the actin cytoskeleton to the extracellular matrix. We report the clinical features of an 11-year-old boy with Kindler syndrome from a consanguineous Indian family and the identification of a homozygous nonsense mutation (C468X) in exon 12 of the KIND1 gene in his genomic DNA. This mutation has not been described previously but is similar to the 17 previously published KIND1 mutations that are all predicted to lead to loss of kindlin-1 protein expression and function. The clinical features in this boy highlight the relevance of kindlin-1 in skin biology, specifically to epidermal adhesion and response to acute and chronic sun exposure. Delineation of this new pathogenic mutation in KIND1 is also useful for genetic counselling in this family and in assessing carrier status in unaffected family members.

  7. Novel homozygous mutation, c.400C>T (p.Arg134*), in the PVRL1 gene underlies cleft lip/palate-ectodermal dysplasia syndrome in an Asian patient.

    PubMed

    Yoshida, Kazue; Hayashi, Ryota; Fujita, Hideki; Kubota, Masaya; Kondo, Mai; Shimomura, Yutaka; Niizeki, Hironori

    2015-07-01

    Cleft lip/palate-ectodermal dysplasia syndrome is a rare, autosomal recessive disorder caused by homozygous loss-of-function mutations of the poliovirus receptor-like 1 (PVRL1) gene encoding nectin-1. Nectin-1 is a cell-cell adhesion molecule that is important for the initial step in the formation of adherens junctions and tight junctions; it is expressed in keratinocytes, neurons, and the developing face and palate. Clinical manifestations comprise a unique facial appearance with cleft lip/palate, ectodermal dysplasia, cutaneous syndactyly of the fingers and/or toes, and in some cases, mental retardation. We present the first report, to our knowledge, of an Asian individual with cleft lip/palate-ectodermal dysplasia syndrome with a novel PVRL1 mutation. A 7-year-old Japanese boy, the first child of a consanguineous marriage, showed hypohidrotic ectodermal dysplasia with sparse, brittle, fine, dry hair and hypodontia, the unique facial appearance with cleft lip/palate, cutaneous syndactyly of the fingers and mild mental retardation. Scanning electron microscopic examination of the hair demonstrated pili torti and pili trianguli et canaliculi. Mutation analysis of exon 2 of PVRL1 revealed a novel homozygous nonsense mutation, c.400C>T (p.Arg134*). His parents were heterozygous for the mutant alleles. All four PVRL1 mutations identified in cleft lip/palate-ectodermal dysplasia syndrome to date, including this study, resulted in truncated proteins that lack the transmembrane domain and intracellular domain of nectin-1, which is necessary to initiate the cell-cell adhesion process. © 2015 Japanese Dermatological Association.

  8. The effect of MTHFR(C677T) genotype on plasma homocysteine concentrations in healthy children is influenced by gender.

    PubMed

    Papoutsakis, C; Yiannakouris, N; Manios, Y; Papaconstantinou, E; Magkos, F; Schulpis, K H; Zampelas, A; Matalas, A L

    2006-02-01

    To explore the influence of gender, together with folate status, on the relation between the common methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism and plasma total homocysteine (tHcy) concentrations in healthy children. Cross-sectional study by face-to-face interview. A total of 186 sixth-grade students participated from twelve randomly selected primary schools in Volos, Greece. Fasting tHcy, folate, and vitamin B(12) were measured in plasma. The MTHFR genotypes were determined. Anthropometric and dietary intake data by 24-h recall were collected. Geometric means for plasma tHcy, plasma folate and energy-adjusted dietary folate did not differ between females and males. The homozygous mutant TT genotype was associated with higher tHcy only in children with lower plasma folate concentrations (<19.9 nmol/l, P = 0.012). As a significant gender interaction was observed (P = 0.050), we stratified the lower plasma folate group by gender and found that the association between the genotype and tHcy was restricted to males (P = 0.026). Similar results were obtained when folate status was based on estimated dietary folate. Specifically, only TT males that reported lower dietary folate consumption (<37 microg/MJ/day) had tHcy that was significantly higher than tHcy levels of C-allele carriers (P = 0.001). Under conditions of lower folate status (as estimated by either plasma concentration or reported dietary consumption), gender modifies the association of the MTHFR(C677T) polymorphism with tHcy concentrations in healthy children. Kellog Europe.

  9. Association of Methylenetetrahydrofolate Reductase C677T Polymorphism with Hyperhomocysteinemia and Deep Vein Thrombosis in the Iranian Population.

    PubMed

    Ghaznavi, Habib; Soheili, Zahra; Samiei, Shahram; Soltanpour, Mohammad Soleiman

    2015-12-01

    Deep venous thrombosis (DVT) is a common but elusive condition characterized by a high morbidity and mortality rate. The aim of the present study was to investigate the correlation between methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism with plasma total homocysteine (tHcy) levels and DVT risk in an Iranian population. Our study population consisted of 67 patients with a diagnosis of DVT and 67 healthy subjects as controls. Genotyping of MTHFR C677T polymorphism was performed by the polymerase chain reaction technique combined with restriction enzyme fragment length polymorphism (PCR-RFLP) and measurement of tHcy levels was done by enzyme immunoassay method. Plasma tHcy levels were significantly higher in DVT patients than controls (18.09±7.6 vs. 10.5±4.3, P=0.001). Also, plasma tHcy levels were significantly higher in MTHFR 677TT genotypes compared to 677CC genotypes in both DVT patients (P=0.016) and controls (P=0.03). Neither heterozygote nor homozygote genotypes of MTHFR C677T polymorphism was significantly correlated with DVT (P>0.05). The distribution of MTHFR C677T genotypes was similar between men and women in both DVT patients and controls (P>0.05). Moreover, the frequency of mutant 677T allele did not differ significantly between the two groups (28.3% vs. 21.6%, P=0.15). Based on this study, we propose that hyperhomocysteinemia but not homozygosity for MTHFR C677T polymorphism is a significant risk factor for DVT in the Iranian population. Also, MTHFR 677TT genotype is a determinant of elevated plasma tHcy levels.

  10. Influence of Methylenetetrahydrofolate Reductase C677T Polymorphism on the Risk of Lung Cancer and the Clinical Response to Platinum-Based Chemotherapy for Advanced Non-Small Cell Lung Cancer: An Updated Meta-Analysis

    PubMed Central

    Zhu, Ning; Gong, Yi; He, Jian; Xia, Jingwen

    2013-01-01

    Purpose Methylenetetrahydrofolate reductase (MTHFR) has been implicated in lung cancer risk and response to platinum-based chemotherapy in advanced non-small cell lung cancer (NSCLC). However, the results are controversial. We performed meta-analysis to investigate the effect of MTHFR C677T polymorphism on lung cancer risk and response to platinum-based chemotherapy in advanced NSCLC. Materials and Methods The databases of PubMed, Ovid, Wanfang and Chinese Biomedicine were searched for eligible studies. Nineteen studies on MTHFR C677T polymorphism and lung cancer risk and three articles on C677T polymorphism and response to platinum-based chemotherapy in advanced NSCLC, were identified. Results The results indicated that the allelic contrast, homozygous contrast and recessive model of the MTHFR C677T polymorphism were associated significantly with increased lung cancer risk. In the subgroup analysis, the C677T polymorphism was significantly correlated with an increased risk of NSCLC, with the exception of the recessive model. The dominant model and the variant T allele showed a significant association with lung cancer susceptibility of ever smokers. Male TT homozygote carriers had a higher susceptibility, but the allelic contrast and homozygote model had a protective effect in females. No relationship was observed for SCLC in any comparison model. In addition, MTHFR 677TT homozygote carriers had a better response to platinum-based chemotherapy in advanced NSCLC in the recessive model. Conclusion The MTHFR C677T polymorphism might be a genetic marker for lung cancer risk or response to platinum-based chemotherapy in advanced NSCLC. However, our results require further verification. PMID:24142642

  11. Krüppel-like factor 1 mutations and expression of hemoglobins F and A2 in homozygous hemoglobin E syndrome.

    PubMed

    Tepakhan, Wanicha; Yamsri, Supawadee; Fucharoen, Goonnapa; Sanchaisuriya, Kanokwan; Fucharoen, Supan

    2015-07-01

    The basis for variability of hemoglobin (Hb) F in homozygous Hb E disease is not well understood. We have examined multiple mutations of the Krüppel-like factor 1 (KLF1) gene; an erythroid specific transcription factor and determined their associations with Hbs F and A2 expression in homozygous Hb E. Four KLF1 mutations including G176AfsX179, T334R, R238H, and -154 (C-T) were screened using specific PCR assays on 461 subjects with homozygous Hb E and 100 normal controls. None of these four mutations were observed in 100 normal controls. Among 461 subjects with homozygous Hb E, 306 had high (≥5 %) and 155 had low (<5 %) Hb F. DNA analysis identified the KLF1 mutations in 35 cases of the former group with high Hb F, including the G176AfsX179 mutation (17/306 = 5.6 %), T334R mutation (9/306 = 2.9 %), -154 (C-T) mutation (7/306 = 2.3 %), and R328H mutation (2/306 = 0.7 %). Only two subjects in the latter group with low Hb F carried the G176AfsX179 and -154 (C-T) mutations. Significant higher Hb A2 level was observed in those of homozygous Hb E with the G176AfsX179 mutation as compared to those without KLF1 mutations. These results indicate that KLF1 is among the genetic factors associated with increased Hbs F and A2, and in combination with other factors could explain the variabilities of these Hb expression in Hb E syndrome.

  12. Methylenetetrahydrofolate reductase C677T and A1298C polymorphism and susceptibility to acute lymphoblastic leukemia in a cohort of Egyptian children.

    PubMed

    Mosaad, Youssef M; Abousamra, Nashwa K; Elashery, Rasha; Fawzy, Iman M; Eldein, Omar A Sharaf; Sherief, Doaa M; El Azab, Hend M M

    2015-01-01

    This case-control study was planned to investigate the possible role of methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C polymorphisms as a risk factor for the development of acute lymphoblastic leukemia (ALL) in a cohort of Egyptian children. Typing of MTHFR C677T and A1298C polymorphisms was done using restriction fragment length polymorphism (RFLP) for 100 children with ALL and 100 age- and sex-matched healthy controls. No significant differences were found between patients with ALL and controls for the frequency of MTHFR C677T and A1298C alleles, genotypes, combined genotypes or haplotypes. The C677T and A1298C genotype frequency was different from that in Korean and Chinese populations (p < 0.5) and was similar to that in British, French-Canadian and German-Caucasian populations (p > 0.5). Our findings suggest that MTHFR C677T and A1298C polymorphisms are unlikely to affect the development of childhood ALL in an Egyptian population from Delta.

  13. Prevalence of metilentetrahidrofolate reductase C677T polymorphism, consumption of vitamins B6, B9, B12 and determination of lipidic hydroperoxides in obese and normal weight Mexican population.

    PubMed

    Hernández-Guerrero, César; Romo-Palafox, Inés; Díaz-Gutiérrez, Mary Carmen; Iturbe-García, Mariana; Texcahua-Salazar, Alejandra; Pérez-Lizaur, Ana Bertha

    2013-11-01

    Oxidative stress is a key factor in the development of the principal comorbidities of obesity. Methylenetetrahydrofolate reductase enzyme (MTHFR) participates in the metabolism of folate with the action of vitamins B6 and B12. The gene of MTHFR may present a single nucleotide polymorphism (SNP) at position 677 (C677T), which can promote homocysteinemia associated to the production of free radicals. To determine the frequency of SNP C677T of the MTHFR, evaluate the consumption of vitamins B6, B9, B12 and determine the concentration of plasma lipid hydroperoxides (LOOH) in obese and control groups. 128 Mexican mestizo according to their body mass index were classified as normal weight (Nw; n=75) and obesity (ObeI-III; n=53). Identification of SNP C677T of MTHFR was performed by PCR-RFLP technic. The consumption of vitamins B6, B9 and B12 was assessed by a validate survey. LOOH was determined as an indicator of peripheral oxidative stress. There was no statistical difference in the frequency of the C677T polymorphism between the TT homozygous genotype in Nw (0.19) and ObeI-III (0.25). The frequency of T allele in Nw was 0.45 and 0.51 in ObI-III group. There were no statistical differences in the consumption of vitamins B6, B9 and B12 between Nw and ObI-III groups. The LOOH showed statistical difference (p < 0.05) between Nw and ObI–III group. Oxidative stress is present in all grades of obesity although there were no differences in the vitamin consumption and the SNP C677T between Nw and ObeI–III groups. Copyright AULA MEDICA EDICIONES 2013. Published by AULA MEDICA. All rights reserved.

  14. Association between the methylenetetrahydrofolate reductase c.677C>T polymorphism and bone mineral density: an updated meta-analysis.

    PubMed

    Li, Hong-Zhuo; Wang, Wei; Liu, Yi-Ling; He, Xiao-Feng

    2016-02-01

    Many studies have reported an association between the methylenetetrahydrofolate reductase (MTHFR) c.677C>T polymorphism and reduced bone mineral density (BMD), but results have been inconsistent. We, therefore, performed a meta-analysis to further explore this association. Twenty-one studies, comprising 33,045 subjects, analyzed the association of MTHFR c.677C>T with femoral neck BMD. Significant association with reduced BMD was observed in Caucasians (recessive model: WMD = -0.004 g/cm(2), 95 % CI -0.008 to -0.006), post-menopausal women (recessive model: WMD = -0.005 g/cm(2), 95 % CI -0.007 to -0.003), men (dominant model: WMD = -0.004 g/cm(2), 95 % CI -0.005 to -0.004; recessive model: WMD = -0.004 g/cm(2), 95 % CI -0.005 to -0.004; TT vs. CC: WMD = -0.006 g/cm(2), 95 % CI -0.006 to -0.006; CT vs. CC: WMD = -0.003 g/cm(2), 95 % CI -0.003 to -0.003), and cohort studies (recessive model: WMD = -0.003 g/cm(2), 95 % CI -0.006 to -0.001). Twenty-two studies, which included 32,271 subjects, analyzed the MTHFR c.677C>T association with lumbar spine BMD. Significant association with reduced BMD was observed in Caucasians, women, post-menopausal women, men, and cohort studies. Seven studies, comprising 6806 subjects, analyzed the MTHFR c.677C>T association with total hip BMD, but no significant association was observed in any population. Nine studies involving 5591 subjects analyzed the association with total body BMD. Significant association with reduced BMD was observed in overall and women subgroup analyses. In summary, this meta-analysis indicates that the MTHFR c.677C>T polymorphism is associated with reduced BMD in lumbar spine and femoral neck in Caucasians, post-menopausal women, and men, and with total body BMD in women. In addition, our results suggest that new studies examining the association between MTHFR c.677C>T polymorphism and BMD of lumbar spine and femoral neck in Asians is warranted, because I (2) > 75.0 % was observed.

  15. Molecular genetic analysis in mild hyperhomocysteinemia: A common mutation in the methylenetetrahydrofolate reductase gene is a genetic risk factor for cardiovascular disease

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kluijtmans, L.A.J.; Heuvel, L.P.W.J. van den; Stevens, E.M.B.

    1996-01-01

    Mild hyperhomocysteinemia is an established risk factor for cardiovascular disease. Genetic aberrations in the cystathionine P-synthase (CBS) and methylenetetrahydrofolate reductase (MTHFR) genes may account for reduced enzyme activities and elevated plasma homocysteine levels. In 15 unrelated Dutch patients with homozygous CBS deficiency, we observed the 833T{yields}C (1278T) mutation in 50% of the alleles. Very recently, we identified a common mutation (677C{yields}T; A{yields}V) in the MTHFR gene, which, in homozygous state, is responsible for the thermolabile phenotype and which is associated with decreased specific MTHFR activity and elevated homocysteine levels. We screened 60 cardiovascular patients and 111 controls for these twomore » mutations, to determine whether these mutations are risk factors for premature cardiovascular disease. Heterozygosity for the 833T{yields}C mutation in the CBS gene was observed in one individual of the control group but was absent in patients with premature cardiovascular disease. Homozygosity for the 677C-{yields}T mutation in the MTHFR gene was found in 9 (15%) of 60 cardiovascular patients and in only 6 ({approximately}5%) of 111 control individuals (odds ratio 3.1 [95% confidence interval 1.0-9.21]). Because of both the high prevalence of the 833T-{yields}C mutation among homozygotes for CBS deficiency and its absence in 60 cardiovascular patients, we may conclude that heterozygosity for CBS deficiency does not appear to be involved in premature cardiovascular disease. However, a frequent homozygous mutation in the MTHFR gene is associated with a threefold increase in risk for premature cardiovascular disease. 35 refs., 3 figs., 1 tab.« less

  16. Individual and Joint Associations of Methylenetetrahydrofolate Reductase C677T Genotype and Plasma Homocysteine With Dyslipidemia in a Chinese Population With Hypertension.

    PubMed

    Liu, Yanhong; Li, Kang; Venners, Scott A; Hsu, Yi-Hsiang; Jiang, Shanqun; Weinstock, Justin; Wang, Binyan; Tang, Genfu; Xu, Xiping

    2017-04-01

    We aimed to examine the cross-sectional associations of plasma total homocysteine (tHcy) concentrations and methylenetetrahydrofolate reductase ( MTHFR) C677T genotype with dyslipidemia. A total of 231 patients with mild-to-moderate essential hypertension were enrolled from the Huoqiu and Yuexi communities in Anhui Province, China. Plasma tHcy levels were measured by high-performance liquid chromatography. Genotyping was performed by TaqMan allelic discrimination technique. Compared with MTHFR 677 CC + CT genotype carriers, TT genotype carriers had higher odds of hypercholesterolemia (adjusted odds ratio [OR] [95% confidence interval (CI)]: 2.7 [1.4-5.2]; P = .004) and higher odds of abnormal low-density lipoprotein cholesterol (adjusted OR [95% CI]: 2.3 [1.1-4.8]; P = .030). The individuals with the TT genotype had higher concentrations of log(tHcy) than those with the 677 CC + CT genotype (adjusted β [standard error]: .2 [0.03]; P < .001). Patients with tHcy ≥ 10 μmol/L had significantly higher odds of hypercholesterolemia (adjusted OR [95% CI]: 2.4 [1.2-4.7]; P = .010). Furthermore, patients with both the TT genotype and the tHcy ≥ 10 μmol/L had the highest odds of hypercholesterolemia (adjusted OR [95% CI]: 4.1 [1.8-9.4]; P = .001) and low-density lipoprotein cholesterol (adjusted OR [95% CI]: 2.4 [1.0-6.0]; P = .064). This study suggests that both tHcy and the MTHFR C677T gene polymorphism may be important determinants of the incidence of dyslipidemia in Chinese patients with essential hypertension. Further studies are needed to confirm the role of tHcy and the MTHFR C677T mutation in the development of dyslipidemia in a larger sample.

  17. Association between MTHFR C677T polymorphism and abdominal aortic aneurysm risk

    PubMed Central

    Liu, Jie; Jia, Xin; Li, Haifeng; Jia, Senhao; Zhang, Minhong; Xu, Yongle; Du, Xin; Zhang, Nianrong; Lu, Weihang; Guo, Wei

    2016-01-01

    Abstract Background: Abdominal aortic aneurysm (AAA) is a life-threatening condition. A number of studies reported the association between methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism and AAA risk, but substantial controversial findings were observed and the strength of the association remains unclear. Objective: The aim of this study was to investigate the aforementioned association in the overall population and different subgroups. Methods: PUBMED and EMBASE databases were searched until March 2016 to identify eligible studies, restricted to humans and articles published in English. Summary odds ratios (ORs) and 95% confidence intervals (CIs) were used to evaluate the susceptibility to AAA. Subgroup meta-analyses were conducted on features of the population, such as ethnicity, sex of the participants, and study design (source of control). Results: Twelve case–control studies on MTHFR C677T polymorphism and AAA risk, including 3555 cases and 6568 case-free controls were identified. The results revealed no significant association between the MTHFR C677T polymorphism and AAA risk in the overall population and within Caucasian or Asian subpopulations in all 5 genetic models. Further subgroup meta-analysis indicated that significantly increased risks were observed among cases with a mean age <70 years (OR = 1.73, 95% CI = 1.10–2.12, P = 0.02), cases with prevalence of smoking <60% (OR = 1.39, 95% CI = 1.02–1.90, P = 0.04), and cases with aneurysm diameter ≥55 mm (OR = 1.55, 95% CI = 1.07–2.24, P = 0.02) in the dominant genetic model. No publication bias was detected in the present study. Conclusion: In conclusion, our comprehensive meta-analysis suggests that the MTHFR C677T polymorphism may play an important role in AAA susceptibility, especially in younger, non-smoking, larger AAA-diameter subgroups of patients PMID:27603386

  18. C677T polymorphism in the methylenetetrahydrofolate reductase gene is associated with primary closed angle glaucoma

    PubMed Central

    Michael, Shazia; Qamar, Raheel; Akhtar, Farah; Khan, Wajid Ali

    2008-01-01

    Purpose To determine whether or not there is an association of the methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism with disease in cohorts of primary open-angle glaucoma (POAG) and primary closed-angle glaucoma (PCAG) from Pakistan. Methods This was a prospective study consisting of 150 patients (90 POAG and 60 PCAG) and 70 control subjects. Genomic DNA was extracted from leukocytes of the peripheral blood. MTHFR C677T polymorphism analysis was performed by the polymerase chain reaction-restriction fragment length polymorphism (RFLP) technique. Results The prevalence of the MTHFR C/T genotype was 22.2% in POAG, 13.3% in PACG, and 18.6% in controls whereas the MTHFR T/T genotype was present solely in the PACG group (6.9%). The difference regarding the T/T genotype between PACG and controls was statistically significant (p<0.01). Conclusions The MTHFR C677T polymorphism was found to be associated with PCAG but not POAG in patients of Pakistani origin. PMID:18385801

  19. MTHFR A1298C and C677T gene polymorphisms and susceptibility to chronic myeloid leukemia in Egypt.

    PubMed

    Aly, Rabab M; Taalab, Mona M; Ghazy, Hayam F

    2014-01-01

    Methylenetetrahydrofolate reductase (MTHFR) is a key enzyme regulating the intracellular folate metabolism which plays an important role in carcinogenesis through DNA methylation. We aimed to evaluate the association between MTHFR A1298C and C677T polymorphisms and the risks of chronic myeloid leukemia (CML). Eighty-five patients with CML and a control group containing 100 healthy, age and sex matched individuals were examined for MTHFR C677T and A1298C polymorphisms using polymerase chain reaction-restriction fragment-length (PCR-RFLP) method. The frequency of 677TT genotype in patients with CML was significantly higher compared to controls (OR=2.513, 95% CI: 0.722-4.086, P=0.025). No such association was shown for heterozygous 677CT (OR=1.010, 95% CI: 0.460-2.218, P=0.981). Moreover, for A1298C genotype, a statistically significant higher frequency of 1298CC was also detected in CML patients compared to control group (OR=1.1816, 95% CI: 0.952-3.573, P=0.036), 0.036). No such statistical significance was demonstrable for heterozygote 1298AC (OR=1.046, 95% CI: 0.740-1.759, P=0.092). In addition, patients with joint 677CT/1298AC or 677TT/1298CC genotypes showed an association with increased risk of CML (OR=1.849, 95% CI: 0.935-2.540, P=0.024; OR=1.915, 95% CI: 1.202-3.845, P=0.020 respectively). .A statistically significant increased risk of resistant to therapy was observed with 677CT and 1298AC genotypes (P=0.001, P=0.002 respectively). We conclude that both MTHFR 677TT and 1298CC polymorphisms have been associated with risk of CML and both 677CT and 1298AC genotypes are associated with higher risk of resistant to therapy.

  20. MTHFR A1298C and C677T gene polymorphisms and susceptibility to chronic myeloid leukemia in Egypt

    PubMed Central

    Aly, Rabab M; Taalab, Mona M; Ghazy, Hayam F

    2014-01-01

    Methylenetetrahydrofolate reductase (MTHFR) is a key enzyme regulating the intracellular folate metabolism which plays an important role in carcinogenesis through DNA methylation. We aimed to evaluate the association between MTHFR A1298C and C677T polymorphisms and the risks of chronic myeloid leukemia (CML). Eighty-five patients with CML and a control group containing 100 healthy, age and sex matched individuals were examined for MTHFR C677T and A1298C polymorphisms using polymerase chain reaction-restriction fragment-length (PCR-RFLP) method. The frequency of 677TT genotype in patients with CML was significantly higher compared to controls (OR = 2.513, 95% CI: 0.722-4.086, P = 0.025). No such association was shown for heterozygous 677CT (OR = 1.010, 95% CI: 0.460-2.218, P = 0.981). Moreover, for A1298C genotype, a statistically significant higher frequency of 1298CC was also detected in CML patients compared to control group (OR = 1.1816, 95% CI: 0.952-3.573, P = 0.036), 0.036). No such statistical significance was demonstrable for heterozygote 1298AC (OR = 1.046, 95% CI: 0.740-1.759, P = 0.092). In addition, patients with joint 677CT/1298AC or 677TT/1298CC genotypes showed an association with increased risk of CML (OR = 1.849, 95% CI: 0.935-2.540, P = 0.024; OR = 1.915, 95% CI: 1.202-3.845, P = 0.020 respectively). .A statistically significant increased risk of resistant to therapy was observed with 677CT and 1298AC genotypes (P = 0.001, P = 0.002 respectively). We conclude that both MTHFR 677TT and 1298CC polymorphisms have been associated with risk of CML and both 677CT and 1298AC genotypes are associated with higher risk of resistant to therapy. PMID:24966971

  1. Methylenetetrahydrofolate Reductase (MTHFR) C677T Polymorphism and Alzheimer Disease Risk: a Meta-Analysis.

    PubMed

    Rai, Vandana

    2017-03-01

    Methylenetetrahydrofolate reductase (MTHFR) is key enzyme of folate/homocysteine pathway. Case control association studies on MTHFR C677T polymorphism and Alzheimer's disease (AD) have been repeatedly performed over the last two decades, but the results are inconclusive. The aim of the present study was to assess the risk of MTHFR C677T polymorphism for AD. Forty-one studies were identified by a search of PubMed, Google Scholar, Elsevier, and Springer Link databases, up to January 2015. Odds ratios (ORs) with corresponding 95 % confidence interval (CI) were calculated using fixed effect model or random effect model. The subgroup analyses based on ethnicity were performed. MTHFR C677T polymorphism had a significant association with susceptibility to AD in all genetic models (for T vs C OR = 1.29, 95 % CI = 1.07-1.56, p = 0.003; for TT + CT vs CC OR = 1.29, 95 % CI = 1.19-1.40, p = 0.0004; for TT vs CC OR = 1.31, 95 % CI = 1.16-1.48, p = 0.001; for CT vs CC OR = 1.24, 95 % CI = 1.13-1.35, p < 0.004; and for TT vs CT + CC OR = 1.13, 95 % CI = 1.00-1.28, p = 0.02). Results of present meta-analysis supported that the MTHFR C677T polymorphism was associated with an increased risk of AD.

  2. The methylenetetrahydrofolate reductase 677T-1298C haplotype is a risk factor for acute lymphoblastic leukemia in children

    PubMed Central

    Kałużna, Ewelina Maria; Strauss, Ewa; Świątek-Kościelna, Bogna; Zając-Spychała, Olga; Gowin, Ewelina; Nowak, Jerzy S.; Rembowska, Jolanta; Januszkiewicz-Lewandowska, Danuta

    2017-01-01

    Abstract The etiology of acute lymphoblastic leukemia (ALL) is complex, linked with both environmental exposures and genetic factors. Functional variants of the methylenetetrahydrofolate reductase (MTHFR) gene result in disturbance in folate metabolism and may affect susceptibility to cancer. The study was performed to evaluate whether MTHFR C677T and A1298C polymorphisms, analyzed separately and together, are associated with the development of ALL in a population under 18 years of age of Caucasian ancestry. The study included 117 pediatric patients (59% males, mean age at diagnosis 7.4 ± 5.2 years) with ALL, confirmed by conventional immunophenotyping surface-marker analysis and 404 healthy control subjects (48.5% men, mean age 37.7 ± 11.3 years). The MTHFR C677T and A1298C genotypes were analyzed using allele discrimination tests with Taq-Man fluorescent probes. The MTHFR 677TT genotype was related to a 2-fold increase in risk of ALL (P = .014). The 677T-1298C haplotype was found in ALL patients but not in controls (frequency 0.598%; P <.0001). The observed frequency of carriers of this rare haplotype was 12%, including 677CT/1298CC (1.7%), 677TT/1298AC (6.0%), and 677CT/1298AC (4.3%) genotypes. The MTHFR 677T allele alone or in combination with the MTHFR 1298C allele significantly increases the risk of development of ALL in Polish population under 18 years of age. Further studies of haplotype composition in subjects with the 677CT/1298AC genotype are necessary to assess the risk of childhood ALL. PMID:29390492

  3. Characterization of Homozygous Hb Setif (HBA2: c.283G>T) in the Iranian Population.

    PubMed

    Farashi, Samaneh; Garous, Negin F; Vakili, Shadi; Ashki, Mehri; Imanian, Hashem; Azarkeivan, Azita; Najmabadi, Hossein

    2016-01-01

    Hemoglobin (Hb) variants are abnormalities resulting from point mutations in either of the two α-globin genes (HBA2 or HBA1) or the β-globin gene (HBB). Various reports of Hb variants have been described in Iran and other countries around the world. Hb Setif (or HBA2: c.283G>T) is one of these variants with a mutation at codon 94 of of the α2-globin gene that is characterized in clinically normal heterozygous individuals. We here report clinical and hematological findings in two homozygous cases of Iranian origin for this unstable Hb variant.

  4. Methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C polymorphisms and the risk of primary Hepatocellular Carcinoma (HCC) in a Chinese population

    PubMed Central

    Cao, Wei; Zhang, Zuo-Feng; Cai, Lin; Jiang, Qing-Wu; You, Nai-Chieh; Goldstein, Binh Yang; Wei, Guo-Rong; Chen, Chuan-Wei; Lu, Qing-Yi; Zhou, Xue-Fu; Ding, Bao-Guo; Chang, Jun; Yu, Shun-Zhang

    2014-01-01

    Objectives Methylenetetrahydrofolate reductase (MTHFR), which is expressed in the liver, may be involved in both DNA methylation and DNA synthesis. It is also indicated as a potential risk factor of liver cancer in patients with chronic liver disease. To date, no study has been conducted on MTHFR and hepatocellular carcinoma (HCC) using a population-based design. The objective of this study was to evaluate the effects of polymorphisms of the MTHFR gene on the risk of primary liver cancer and their possible effect modifications on various environmental risk factors. Methods A population-based case–control study was conducted in Taixing, China. MTHFR C677T and A1298C were assayed by PCR-RFLP techniques. Results The frequency of MTHFR 677 C/C wild homo-zygotes genotype was 25.8% in cases, which was lower than that in controls (34.5%). The adjusted odds ratios (ORs) for the MTHFR 677 C/T and T/T genotype were 1.66(95% CI: 1.06–2.61), 1.21(95% CI: 0.65–2.28) respectively when compared with the MTHFR 677 C/C genotype. Subjects carrying any T genotype have the increased risk of 1.55(95% CI: 1.01–2.40) for development of primary hepatocellular carcinoma. A high degree of linkage disequilibrium was observed between the C677T and A1298C polymorphisms, with the D′ of 0.887 and p < 0.01. The MTHFR 677 any T genotype was suggested to have potentially more than multiplicative interactions with raw water drinking with p-value for adjusted interaction of 0.03. Conclusion We observed that the MTHFR 677 C/T genotype was associated with an increased risk of primary liver cancer in a Chinese population. The polymorphism of MTHFR 677 might modify the effects of raw water drinking on the risk of primary hepatocellular carcinoma. PMID:17503006

  5. The methylenetetrahydrofolate reductase (MTHFR) 677 C>T polymorphism increases the risk of developing chronic myeloid leukemia-a case-control study.

    PubMed

    Bănescu, Claudia; Iancu, Mihaela; Trifa, Adrian P; Macarie, Ioan; Dima, Delia; Dobreanu, Minodora

    2015-04-01

    The methylenetetrahydrofolate reductase (MTHFR) 677 C>T and 1298 A>C polymorphisms are associated with variations in folate levels, a phenomenon linked to the development of various malignancies. The aim of this study was to investigate the influence of the 677 C>T and 1298 A>C polymorphisms in the MTHFR gene on the risk of developing chronic myeloid leukemia (CML). Our study included 151 patients with CML and 305 controls. The MTHFR 677 C>T and 1298 A>C polymorphisms were investigated by polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) and allele-specific PCR techniques. The CT and TT genotypes of the MTHFR 677 C>T polymorphism were associated with an increased risk of developing CML (odds ratio (OR) = 1.556, 95% confidence interval (CI) = 1.017-2.381, p value = 0.041, and OR = 1.897, 95% CI = 1.046-3.44, p value = 0.035, respectively). No association was observed between the prognostic factors (blasts, basophils, additional chromosomal abnormalities, EUTOS score, Sokal and Hasford risk groups) and the MTHFR 677 C>T and 1298 A>C variant genotypes in CML patients. Our study shows that the MTHFR 677 C>T polymorphism is significantly associated with the risk of CML in Romanian patients.

  6. Homozygous p.V116* mutation in C12orf65 results in Leigh syndrome.

    PubMed

    Imagawa, Eri; Fattal-Valevski, Aviva; Eyal, Ori; Miyatake, Satoko; Saada, Ann; Nakashima, Mitsuko; Tsurusaki, Yoshinori; Saitsu, Hirotomo; Miyake, Noriko; Matsumoto, Naomichi

    2016-02-01

    Leigh syndrome (LS) is an early-onset progressive neurodegenerative disorder associated with mitochondrial dysfunction. LS is characterised by elevated lactate and pyruvate and bilateral symmetric hyperintense lesions in the basal ganglia, thalamus, brainstem, cerebral white matter or spinal cord on T2-weighted MRI. LS is a genetically heterogeneous disease, and to date mutations in approximately 40 genes related to mitochondrial function have been linked to the disorder. We investigated a pair of female monozygotic twins diagnosed with LS from consanguineous healthy parents of Indian origin. Their common clinical features included optic atrophy, ophthalmoplegia, spastic paraparesis and mild intellectual disability. High-blood lactate and high-intensity signal in the brainstem on T2-weighted MRI were consistent with a clinical diagnosis of LS. To identify the genetic cause of their condition, we performed whole exome sequencing. We identified a homozygous nonsense mutation in C12orf65 (NM_001143905; c.346delG, p.V116*) in the affected twins. Interestingly, the identical mutation was previously reported in an Indian family with Charcot-Marie Tooth disease type 6, which displayed some overlapping clinical features with the twins. We demonstrate that the identical nonsense mutation in C12orf65 can result in different clinical features, suggesting the involvement of unknown modifiers. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  7. Homozygous null mutations in ZMPSTE24 in restrictive dermopathy: evidence of genetic heterogeneity.

    PubMed

    Ahmad, Z; Phadke, S R; Arch, E; Glass, J; Agarwal, A K; Garg, A

    2012-02-01

    Restrictive dermopathy (RD) results in stillbirth or early neonatal death. RD is characterized by prematurity, intrauterine growth retardation, fixed facial expression, micrognathia, mouth in the 'o' position, rigid and tense skin with erosions and denudations and multiple joint contractures. Nearly all 25 previously reported neonates with RD had homozygous or compound heterozygous null mutations in the ZMPSTE24 gene. Here, we report three new cases of RD; all died within 3 weeks of birth. One of them had a previously reported homozygous c.1085dupT (p.Leu362PhefsX19) mutation, the second case had a novel homozygous c.1020G>A (p.Trp340X) null mutation in ZMPSTE24, but the third case, a stillborn with features of RD except for the presence of tapering rather than rounded, bulbous digits, harbored no disease-causing mutations in LMNA or ZMPSTE24. In the newborn with a novel ZMPSTE24 mutation, unique features included butterfly-shaped thoracic 5 vertebra and the bulbous appearance of the distal clavicles. Skin biopsies from both the stillborn fetus and the newborn with c.1020G>A ZMPSTE24 mutation showed absence of elastic fibers throughout the dermis. This report provides evidence of genetic heterogeneity among RD and concludes that there may be an additional locus for RD which remains to be identified. © 2010 John Wiley & Sons A/S.

  8. The importance of folate, vitamins B6 and B12 for the lowering of homocysteine concentrations for patients with recurrent pregnancy loss and MTHFR mutations.

    PubMed

    Serapinas, Danielius; Boreikaite, Evelina; Bartkeviciute, Agne; Bandzeviciene, Rita; Silkunas, Mindaugas; Bartkeviciene, Daiva

    2017-09-01

    In patients with MTHFR (methylenetetrahydrofolate reductase) mutations and hyperhomocysteinemia, recurrent pregnancy loss is a frequent feature. The aim of the study was to evaluate the impact of folic acid, vitamins B6 and B12 supplementation for the lowering of total homocysteine concentrations and pregnancy. 16 patients who had had 3 or more miscarriages and MTHFR mutations were used in the study. They received methylfolate (5mg/day), vitamin B6 (50mg/day) and vitamin B12 (1mg/week). Supplementation induced a decrease in homocysteine from 19.4±5.3μmol/L to 6.9±2.2μmol/L after folate supplementation (p<0.05). During one year 7 women became pregnant and delivered. Two women delivered from the homozygous C677T mutations group (7 patients) and combined heterozygous C677T/A1298C mutations group (5 patients), while 3 deliveries were in A1298C homozygous mutations group (4 patients). In conclusion, supraphysiologic methylfolate, vitamins B6 and B12 supplementation in woman with MTHFR mutations has a beneficial effect on pregnancy outcome. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Association between MTHFR C677T polymorphism and depression: a meta-analysis in the Chinese population.

    PubMed

    Jiang, Wei; Xu, Jun; Lu, Xiao-Jie; Sun, Yang

    2016-09-01

    Depression is a worldwide public health issue, and its prevalence increases each year. Although a number of studies have been conducted on the association between MTHFR C677T polymorphism and depression in China, this association remains elusive and controversial. To clarify the impact of MTHFR C677T polymorphism on the risk of depression, a meta-analysis was performed in the Chinese population. Relevant studies were identified using PubMed, Springer Link, Ovid, Chinese Wanfang Data Knowledge Service Platform, Chinese National Knowledge Infrastructure and Chinese Biology Medicine through May 5, 2015. Pooled odds ratios (ORs) and 95% confidence intervals (CIs) were used to assess the strength of the associations. A total of 13 case-control studies including 1895 patients and 1913 controls were involved in this meta-analysis. Overall, T variant of MTHFR C677T gene polymorphism was significantly associated with an increased risk of depression in the Chinese population (T vs. C: OR = 1.52, 95% CI = 1.24-1.85; TT + CT vs. CC: OR = 1.64, 95% CI = 1.16-2.30; TT vs. CC: OR = 2.19, 95% CI = 1.49-3.24; TT vs. CC + CT: OR = 1.80, 95% CI = 1.31-2.46). In subgroup analyses stratified by geographic area and source of controls, the significant results were found in population-based studies, in hospital-based studies, in North and South China. The risk conferred by MTHFR C677T polymorphism is higher in North China than in South China. In conclusion, this meta-analysis suggests that MTHFR C677T polymorphism is associated with depression in the Chinese population, but these associations vary in different geographic locations.

  10. The methylenetetrahydrofolate reductase 677T-1298C haplotype is a risk factor for acute lymphoblastic leukemia in children.

    PubMed

    Kałużna, Ewelina Maria; Strauss, Ewa; Świątek-Kościelna, Bogna; Zając-Spychała, Olga; Gowin, Ewelina; Nowak, Jerzy S; Rembowska, Jolanta; Januszkiewicz-Lewandowska, Danuta

    2017-12-01

    The etiology of acute lymphoblastic leukemia (ALL) is complex, linked with both environmental exposures and genetic factors. Functional variants of the methylenetetrahydrofolate reductase (MTHFR) gene result in disturbance in folate metabolism and may affect susceptibility to cancer. The study was performed to evaluate whether MTHFR C677T and A1298C polymorphisms, analyzed separately and together, are associated with the development of ALL in a population under 18 years of age of Caucasian ancestry.The study included 117 pediatric patients (59% males, mean age at diagnosis 7.4 ± 5.2 years) with ALL, confirmed by conventional immunophenotyping surface-marker analysis and 404 healthy control subjects (48.5% men, mean age 37.7 ± 11.3 years). The MTHFR C677T and A1298C genotypes were analyzed using allele discrimination tests with Taq-Man fluorescent probes.The MTHFR 677TT genotype was related to a 2-fold increase in risk of ALL (P = .014). The 677T-1298C haplotype was found in ALL patients but not in controls (frequency 0.598%; P <.0001). The observed frequency of carriers of this rare haplotype was 12%, including 677CT/1298CC (1.7%), 677TT/1298AC (6.0%), and 677CT/1298AC (4.3%) genotypes.The MTHFR 677T allele alone or in combination with the MTHFR 1298C allele significantly increases the risk of development of ALL in Polish population under 18 years of age. Further studies of haplotype composition in subjects with the 677CT/1298AC genotype are necessary to assess the risk of childhood ALL. Copyright © 2017 The Authors. Published by Wolters Kluwer Health, Inc. All rights reserved.

  11. Methylenetetrahydrofolate reductase C677T and overall survival in pediatric acute lymphoblastic leukemia: a systematic review.

    PubMed

    Ojha, Rohit P; Gurney, James G

    2014-01-01

    A summary of the evidence pertaining to the association between methylenetetrahydrofolate reductase (MTHFR) C677T and overall survival in pediatric acute lymphoblastic leukemia (ALL) is not currently available. We thus reviewed the literature on the association between MTFHR C677T and overall survival in pediatric ALL. We searched PubMed/MEDLINE, Scopus and ISI Web of Knowledge literature databases without language restrictions to identify observational studies among children diagnosed between ages 0 and 19 years that assessed MTHFR 677 polymorphisms in relation to ALL survival. We identified six studies comprising 909 pediatric patients with ALL. The magnitude of relative risk (RR) for pediatric ALL mortality varied by genotype comparison and study population, ranging from RR = 0.84 (95% confidence limits [CL]: 0.24, 3.0) for a TT vs. CT/CC comparison to RR = 7.0 (95% CL: 0.98, 49) for a TT vs. CC comparison. The current evidence suggests that individuals with MTHFR 677 variants (i.e. at least one T allele) may have a higher relative risk of pediatric ALL mortality, with greater statistical support for MTHFR 677TT. With more detailed supporting evidence, MTHFR 677 genotyping at diagnosis could provide an option for individualizing therapy and further reducing pediatric ALL mortality in certain populations.

  12. Phenotypic comparison of individuals with homozygous or heterozygous mutation of NOTCH3 in a large CADASIL family.

    PubMed

    Abou Al-Shaar, Hussam; Qadi, Najeeb; Al-Hamed, Mohamed H; Meyer, Brian F; Bohlega, Saeed

    2016-08-15

    Cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL) is a hereditary microangiopathy caused by mutations in NOTCH3, very rarely homoallelic. To describe the clinical, radiological, and neuropsychological features in an extended CADASIL family including members with either a homozygous or heterozygous NOTCH3 R1231C mutation. The pedigree included 3 generations of a family with 13 affected individuals. The patients were examined clinically and radiologically. Neuropsychological testing was performed on the proband. Sequencing of the entire coding DNA sequence (CDS) and flanking regions of NOTCH3 was undertaken using PCR amplification and direct Sanger sequencing. Homozygous C3769T mutation, predicting R1231C in exon 22 of NOTCH3 was found in 7 family members. Six other family members harbored the same in the heterozygous state. Homozygous individuals showed a slightly more severe clinical and radiological phenotype of earlier onset compared to their heterozygous counterparts. This study reports the largest number of patients with homozygous NOTCH3 mutation. The phenotype and imaging features of homozygous individuals is within the spectrum of CADASIL, although slightly at the severe end when compared to heterozygotes carrying the same mutation. Both genetic modifiers and environmental factors may play an essential role in modification and alteration of the clinical phenotype and white matter changes among CADASIL patients. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. MTHFR polymorphisms C677T and A1298C and associations with IVF outcomes in Brazilian women.

    PubMed

    D'Elia, Priscila Queiroz; dos Santos, Aline Amaro; Bianco, Bianca; Barbosa, Caio Parente; Christofolini, Denise Maria; Aoki, Tsutomu

    2014-06-01

    The aim of this study was to investigate the association between MTHFR gene polymorphisms and IVF outcomes in Brazilian women undergoing assisted reproduction treatment. A prospective study was conducted in the Human Reproduction Department at the ABC University School of Medicine and the Ideia Fertility Institute between December 2010 and April 2012. The patient population was 82 women undergoing assisted reproduction cycles. The MTHFR polymorphisms C677T and A1298C were evaluated and compared with laboratory results and pregnancy rates. The C677T variant was associated with proportions of mature (P=0.006) and immature (P=0.003) oocytes whereas the A1298C variant was associated with number of oocytes retrieved (P=0.044). The polymorphisms, whether alone or in combination, were not associated with normal fertilization, good-quality embryo or clinical pregnancy rates. This study suggests that the number and maturity of oocytes retrieved may be related to the MTHFR polymorphisms C677T and A1298C. It is believed that folate has a crucial function in human reproduction and that folate deficiency can compromise the function of the metabolic pathways it is involved in, leading to an accumulation of homocysteine. The gene MTHFR encodes the 5-MTHFR enzyme, which is involved in folate metabolism, and C677T/A1298C polymorphisms of this gene are related to decreased enzyme activity and consequent changes in homocysteine concentration. Folate deficiency and hyperhomocysteinaemia can also compromise fertility and lead to pregnancy complications by affecting the development of oocytes, preparation of endometrial receptivity, implantation of the embryo and pregnancy. In folliculogenesis, hyperhomocysteinaemia can activate apoptosis, leading to follicular atresia and affecting the maturity of oocytes and the quality of embryos cultured in vitro. This study was performed to investigate the association between MTHFR polymorphisms and IVF outcomes in women undergoing assisted

  14. Interaction between MTHFR 677C>T and periconceptional folic acid supplementation in the risk of Hypospadias.

    PubMed

    Dokter, Elisabeth M J; van Rooij, Iris A L M; Wijers, Charlotte H W; Groothuismink, Johanne M; van der Biezen, Jan Jaap; Feitz, Wout F J; Roeleveld, Nel; van der Zanden, Loes F M

    2016-04-01

    Hypospadias is a congenital malformation with both environmental factors and genetic predisposition involved in the pathogenesis. The role of maternal periconceptional folic acid supplement use in the development of hypospadias is unclear. As folate levels may also be influenced by the C677T polymorphism in the methylenetetrahydrofolate reductase (MTHFR) gene, we hypothesize that a gene-environment interaction between this polymorphism and folic acid use is involved in the etiology of hypospadias. We conducted a case-control study among 855 hypospadias cases and 713 population-based controls from the AGORA data- and biobank. Folic acid supplement use was derived from maternal questionnaires and infant and maternal DNA was used to determine the MTHFR C677T polymorphism using Taqman assays. We performed separate analyses for different hypospadias phenotypes (anterior/middle/posterior). Hypospadias was neither associated with folic acid use or the MTHFR C677T polymorphism, nor with their interaction. However, we did find an association with middle hypospadias when no supplements were used (odds ratio = 1.6; 95% confidence interval, 1.1-2.4), especially in infants carrying the CT/TT genotype (odds ratio = 2.5; 95% confidence interval, 1.4-4.7). In addition, more infants with these genotypes seemed to have posterior hypospadias, regardless of folic acid use. Our study does not suggest a major role for folic acid supplements or the MTHFR C677T polymorphism in the etiology of hypospadias in general, but not using folic acid and/or carrying the MTHFR C677T polymorphism may be associated with middle and posterior hypospadias. Therefore, we stress the importance of studying gene-environment interactions preferably in stratified analyses for different hypospadias phenotypes. © 2016 Wiley Periodicals, Inc.

  15. Methylenetetrahydrofolate reductase C677T genetic polymorphisms and risk of leukaemia among the North Indian population.

    PubMed

    Hussain, Syed Rizwan; Naqvi, Hena; Raza, Syed Tasleem; Ahmed, Faisal; Babu, Sunil G; Kumar, Ashutosh; Zaidi, Zeashan Haider; Mahdi, Farzana

    2012-08-01

    Leukaemia is a heterogeneous disease in which haematopoietic progenitor cells acquire genetic lesions that lead to a block in differentiation, increased self-renewal, and unregulated proliferation. The enzyme 5,10-methylenetetrahydrofolate reductase (MTHFR), involved in folate metabolism, plays a crucial role in cells because folate availability is important for DNA integrity. The aim of this case-control study was to evaluate the association of the C677T MTHFR gene polymorphism with acute myeloid leukaemia (AML), acute lymphoblastic leukaemia (ALL), chronic myeloid leukaemia (CML) and chronic lymphocytic leukaemia (CLL). A total of 275 leukaemia cases - including AML (n = 112), ALL (n = 81), CML (n = 43), CLL (n = 39) - and 251 age/sex-matched healthy control individuals participated in this study. MTHFR C677T polymorphisms in the cases and controls were evaluated by polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP). The average MTHFR 677CC, 677CT, 677TT genotype frequencies of total leukaemia cases were 68.73%, 19.64%, and 11.64% in cases, and 71.71%, 24.30%, and 3.98% in healthy controls, respectively. The average frequency of the MTHFR 677T allele was 21.45% among the cases compared to 16.13% among the controls. In the present case-control study we have observed a higher frequency of the MTHFR 677TT genotype in cases of leukaemia (AML, ALL, CML and CLL) as compared with controls; this might be due to ethnic and geographic variation. As per our findings, although the frequency of the MTHFR 677T allele is moderately high in AML, ALL and CLL, no statistically significant association was found; on the other hand statistically significant association was found in the context of CML cases. Copyright © 2012 Elsevier Ltd. All rights reserved.

  16. [Cytochrome c oxydase-deficient Leigh syndrome with homozygous mutation in SURF1 gene].

    PubMed

    Monnot, S; Chabrol, B; Cano, A; Pellissier, J F; Collignon, P; Montfort, M F; Paquis-Flucklinger, V

    2005-05-01

    Leigh syndrome is a heterogeneous disorder, usually due to a defect in oxidative metabolism. Mutations in SURF1 gene have been identified in patients with cytochrome c oxidase deficiency. We report a homozygous splice site deletion [516-2_516-1delAG] in a young girl presenting with cytochrome c oxidase-deficient Leigh syndrome. Identification of molecular defect is indispensable for genetic counselling and prenatal diagnosis.

  17. Association between C677T and A1298C polymorphisms of the MTHFR gene and risk of male infertility: a meta-analysis.

    PubMed

    Yang, Y; Luo, Y Y; Wu, S; Tang, Y D; Rao, X D; Xiong, L; Tan, M; Deng, M Z; Liu, H

    2016-04-26

    Published studies on the association between the C677T and A1298C polymorphisms of the methylenetetrahydrofolate reductase (MTHFR) gene and male infertility risk are controversial. To obtain a more precise evaluation, we performed a meta-analysis based on published case-control studies. We conducted an electronic search of PubMed, EMBASE, the Cochrane Library, the Web of Science, and the China Knowledge Resource Integrated Database for papers on MTHFR gene C677T and A1298C polymorphisms and male infertility risk. Pooled odds ratios (ORs) with 95% confidence intervals (95%CIs) were used to assess the strength of association in homozygote, heterozygote, dominant, recessive, and additive models. Statistical heterogeneity, test of publication bias, and sensitivity analysis were carried out using the STATA software (Version 13.0). Overall, 21 studies of C677T (4505 cases and 4024 controls) and 13 studies of A1298C (2785 cases and 3094 controls) were included in this meta-analysis. For C677T, the homozygote comparison results were OR = 1.629, 95%CI (1.215- 2.184), and the recessive model results were OR = 1.462 (1.155- 1.850). For A1298C, the homozygote comparison results were OR = 1.289 (1.029-1.616), and the recessive model results were OR = 1.288 (1.034-1.604). In conclusion, the current meta-analysis showed that the MTHFR C677T polymorphism was associated with a significantly increased male infertility risk in the Asian and overall populations, but not in the Caucasian population, and there was a significant association between the A1298C polymorphism and male infertility risk in the Asian, Caucasian, and overall groups.

  18. High prevalence of three prothrombotic polymorphisms among Palestinians: factor V G1691A, factor II G20210A and methylenetetrahydrofolate reductase C677T.

    PubMed

    Hussein, Ayman S

    2012-10-01

    Factor V leiden G1691A/R506Q (FVL), prothrombin G20210A (FII) and methylenetetrahydrofolate reductase (MTHFR) C677T are related genetic risk factors for venous thromboembolism. Analysis for those mutations is increasingly being performed on patients exhibiting hypercoagulability. The objective of this study was to determine the prevalence of FVL, FII-G20210A and MTHFR-C677T polymorphisms and their coexistence among apparently healthy Palestinians. After institutional approval, 303 apparently healthy students from An-Najah University representative to North and South regions of West Bank with no previous history of cardiovascular diseases participated in this study. A uniform questionnaire was used to collect relevant information through personal interview with the subjects. The collected information included gender, age, smoking habits, weight and height, diseases such as diabetes, cardiovascular and family history of CVD. The frequencies of allelic distribution of the three prothrombotic polymorphisms factor V G1691A/R506Q), prothrombin G2010A, and MTHFR-C677T were 0.114, 0.050 and 0.071, respectively. The prevalence of the three thrombotic polymorphisms (FVL, FII G20210A and MTHFR-C677T) were 20.1, 9.1 and 13.8 %, respectively. Statistical analysis for factor V leiden showed no significant association between place of residence (P value = 0.953) and gender (P value >0.082). The data presented in this study showed the highest prevalence of FVL among healthy Palestinians compared to other populations and this important finding should be followed in terms of clinical significance.

  19. Association of Methylenetetrahydrofolate Reductase (MTHFR 677C>T and 1298A>C) Polymorphisms and Haplotypes with Silent Brain Infarction and Homocysteine Levels in a Korean Population

    PubMed Central

    Han, In Bo; Kim, Ok Joon; Ahn, Jung Yong; Oh, Doyeun; Hong, Sun Pyo; Huh, Ryoong; Chung, Sang Sup

    2010-01-01

    Purpose Methylenetetrahydrofolate reductase (MTHFR) is the main regulatory enzyme for homocysteine metabolism. In the present study, we evaluated whether the MTHFR 677C>T and 1298A>C gene polymorphisms are associated with SBI and plasma homocysteine concentration in a Korean population. Materials and Methods We enrolled 264 patients with SBI and 234 healthy controls in South Korea. Fasting plasma total homocysteine (tHcy) concentrations were measured, and genotype analysis of the MTHFR gene was carried out. Results The plasma tHcy levels were significantly higher in patients with SBI than in healthy controls. Despite a significant association between the MTHFR 677TT genotype and hyperhomocysteinemia, the MTHFR 677C>T genotypes did not appear to influence susceptibility to SBI. However, odds ratios of the 1298AC and 1298AC + CC genotypes for the 1298AA genotype were significantly different between SBI patients and normal controls. The frequencies of 677C-1298A and 677C-1298C haplotypes were significantly higher in the SBI group than in the control group. Conclusion This study demonstrates that the MTHFR 1298A>C polymorphism is a risk factor for SBI in a Korean population. The genotypes of 677C>T and 1298A>C polymorphisms interact additively, and increase the risk of SBI in Korean subjects. PMID:20191019

  20. Association between methylenetetrahydrofolate reductase polymorphism C677T and risk of chronic myeloid leukemia in Serbian population.

    PubMed

    Jakovljevic, Ksenija; Malisic, Emina; Cavic, Milena; Radulovic, Sinisa; Jankovic, Radmila

    2012-07-01

    Methylenetetrahydrofolate reductase (MTHFR) is a key enzyme regulating the intracellular folate metabolism which plays an important role in carcinogenesis through DNA methylation and nucleotide synthesis. The common MTHFR single nucleotide polymorphism C677T has been reported to be associated with reduced enzymatic activity. In order to investigate the influence of this polymorphism on the risk of chronic myeloid leukemia (CML), we performed a case-control study in a Serbian population of 52 patients with CML and 53 healthy control subjects. MTHFR C677T polymorphism genotyping was assessed using the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. The results demonstrated no statistical difference in MTHFR 677 frequency distribution between patient and control groups. Our findings suggest that MTHFR 677 gene variants have no significant influence on the susceptibility to CML in a Serbian population.

  1. [Study on the association between 5,10-methylenetrahydrofolate reductase C677T polymorphism and acute lymphoblastic leukemia risk: a Meta-analysis].

    PubMed

    Li, Xiao-lei; Yu, Feng; Zhang, Yong; Qiu, Jin-chun; Liu, Si-ting; Liao, Qing-chuan

    2011-10-01

    To evaluate the association between polymorphism of 5,10-methylenetrahydrofolate reductase C677T and risk of acute lymphoblastic leukemia (ALL). Electronic search strategy was carried out among the databases from home and abroad to collect qualified research papers, according to the inclusion and exclusion criteria. Data on case-control studies on association between MTHFR C677T polymorphism and susceptibility to ALL were collected and analyzed by models of TT vs. CC + CT or TT vs. CC through Meta-analysis. Stratified analysis was carried out according to different age groups (children or adult). In systematical analysis, the pooled odds ratios of MTHFR C677T genetype TT vs. CC + CT or TT vs. CC were 0.87 (0.69 - 1.09) and 0.82 (0.63 - 1.06) respectively; in children's group, the pooled odds ratios of MTHFR C677T genetype TT vs. CC + CT or TT vs. CC were 0.92 (0.79 - 1.08), 0.88 (0.75 - 1.05) while in adult group, the pooled odds ratios of MTHFR C677T genetype TT vs. CC + CT or TT vs. CC were 0.45 (0.26 - 0.77), and 0.41 (0.22 - 0.72) respectively. The MTHFR gene 677T variant might not be associated with the risk of children's ALL but might be associated with a reduced risk on adult's ALL.

  2. MTHFR C677T gene polymorphism and head and neck cancer risk: a meta-analysis based on 23 publications.

    PubMed

    Niu, Yu-Ming; Deng, Mo-Hong; Chen, Wen; Zeng, Xian-Tao; Luo, Jie

    2015-01-01

    Conflicting results on the association between MTHFR polymorphism and head and neck cancer (HNC) risk were reported. We therefore performed a meta-analysis to derive a more precise relationship between MTHFR C677T polymorphism and HNC risk. Three online databases of PubMed, Embase, and CNKI were researched on the associations between MTHFR C677T polymorphism and HNC risk. Twenty-three published case-control studies involving 4,955 cases and 8,805 controls were collected. Odds ratios (ORs) with 95% confidence interval (CI) were used to evaluate the relationship between MTHFR C677T polymorphism and HNC risk. Sensitivity analysis, cumulative analyses, and publication bias were conducted to validate the strength of the results. Overall, no significant association between MTHFR C677T polymorphism and HNC risk was found in this meta-analysis (T versus C: OR = 1.04, 95% CI = 0.92-1.18; TT versus CC: OR = 1.15, 95% CI = 0.90-1.46; CT versus CC: OR = 1.00, 95% CI = 0.85-1.17; CT + TT versus CC: OR = 1.01, 95% CI = 0.87-1.18; TT versus CC + CT: OR = 1.11, 95% CI = 0.98-1.26). In the subgroup analysis by HWE, ethnicity, study design, cancer location, and negative significant associations were detected in almost all genetic models, except for few significant risks that were found in thyroid cancer. This meta-analysis demonstrates that MTHFR C677T polymorphism may not be a risk factor for the developing of HNC.

  3. The methylenetetrahydrofolate reductase c.c.677 C>T and c.c.1298 A>C polymorphisms in reproductive failures: Experience from an RSA and RIF study on a Polish population.

    PubMed

    Nowak, Izabela; Bylińska, Aleksandra; Wilczyńska, Karolina; Wiśniewski, Andrzej; Malinowski, Andrzej; Wilczyński, Jacek R; Radwan, Paweł; Radwan, Michał; Barcz, Ewa; Płoski, Rafał; Motak-Pochrzęst, Hanna; Banasik, Małgorzata; Sobczyński, Maciej; Kuśnierczyk, Piotr

    2017-01-01

    Almost 1600 individuals from the Polish population were recruited to this study. Among them 319 were fertile couples, 289 were recurrent spontaneous abortion (RSA) couples, and 131 were in the group of recurrent implantation failure (RIF) following in vitro fertilization. The aim of this study was to evaluate the MTHFR c.c.677 C>T and c.c.1298 A>C polymorphisms' association with RSA and RIF. We used PCR-RFLP with HinfI (677 C>T) and MboII (1298 A>C) digestion. We observed a protective effect of the female AC genotype (OR = 0.64, p = 0.01) and the C allele (AC+CC genotypes; OR = 0.65, p = 0.009) against RSA. Moreover, 1298 AA/677 CT women were more frequent in RSA (31.14%) and RIF (25.20%) groups in comparison to fertile women (22.88%), although this difference was significant only in the case of RSA (p = 0.022, OR = 1.52). Male combined genotype analysis revealed no association with reproductive failure of their partners. Nevertheless, the female/male combination AA/AC of the 1298 polymorphism was more frequent in RSA couples (p = 0.049, OR = 1.49). However, the significant results became insignificant after Bonferroni correction. In addition, analysis of haplotypes showed significantly higher frequency of the C/C haplotype (1298 C/677 C) in the female control group than in the female RSA group (p = 0.03, OR = 0.77). Moreover, the association between elevated homocysteine (Hcy) level in plasma of RSA and RIF women and MTHFR polymorphisms was investigated but did not reveal significant differences. In conclusion, for clinical practice, it is better to check the homocysteine level in plasma and, if the Hcy level is increased, to recommend patients to take folic acid supplements rather than undergo screening of MTHFR for 1298 A>C and 677 C>T polymorphisms.

  4. The methylenetetrahydrofolate reductase c.c.677 C>T and c.c.1298 A>C polymorphisms in reproductive failures: Experience from an RSA and RIF study on a Polish population

    PubMed Central

    Bylińska, Aleksandra; Wilczyńska, Karolina; Wiśniewski, Andrzej; Malinowski, Andrzej; Wilczyński, Jacek R.; Radwan, Paweł; Radwan, Michał; Barcz, Ewa; Płoski, Rafał; Motak-Pochrzęst, Hanna; Banasik, Małgorzata; Sobczyński, Maciej; Kuśnierczyk, Piotr

    2017-01-01

    Almost 1600 individuals from the Polish population were recruited to this study. Among them 319 were fertile couples, 289 were recurrent spontaneous abortion (RSA) couples, and 131 were in the group of recurrent implantation failure (RIF) following in vitro fertilization. The aim of this study was to evaluate the MTHFR c.c.677 C>T and c.c.1298 A>C polymorphisms’ association with RSA and RIF. We used PCR-RFLP with HinfI (677 C>T) and MboII (1298 A>C) digestion. We observed a protective effect of the female AC genotype (OR = 0.64, p = 0.01) and the C allele (AC+CC genotypes; OR = 0.65, p = 0.009) against RSA. Moreover, 1298 AA/677 CT women were more frequent in RSA (31.14%) and RIF (25.20%) groups in comparison to fertile women (22.88%), although this difference was significant only in the case of RSA (p = 0.022, OR = 1.52). Male combined genotype analysis revealed no association with reproductive failure of their partners. Nevertheless, the female/male combination AA/AC of the 1298 polymorphism was more frequent in RSA couples (p = 0.049, OR = 1.49). However, the significant results became insignificant after Bonferroni correction. In addition, analysis of haplotypes showed significantly higher frequency of the C/C haplotype (1298 C/677 C) in the female control group than in the female RSA group (p = 0.03, OR = 0.77). Moreover, the association between elevated homocysteine (Hcy) level in plasma of RSA and RIF women and MTHFR polymorphisms was investigated but did not reveal significant differences. In conclusion, for clinical practice, it is better to check the homocysteine level in plasma and, if the Hcy level is increased, to recommend patients to take folic acid supplements rather than undergo screening of MTHFR for 1298 A>C and 677 C>T polymorphisms. PMID:29073227

  5. Lack of association between MTHFR C677T and A1298C polymorphisms and risk of childhood acute lymphoblastic leukemia in the Kurdish population from Western Iran.

    PubMed

    Azhar, Mohammad-Reza; Rahimi, Zohreh; Vaisi-Raygani, Asad; Akramipour, Reza; Madani, Hamid; Rahimi, Ziba; Parsian, Abbas

    2012-03-01

    Polymorphism in genes involved in folate metabolism may influence the susceptibility to acute lymphoblastic leukemia (ALL). The aim of the present study was to determine the role of the two most common polymorphisms of the 5, 10-methylenetetrahydrofolate reductase (MTHFR) gene, MTHFR C677T and A1298C, and their interaction on the susceptibility to ALL. Seventy-two children with ALL and 109 age- and sex-matched healthy children from Western Iran were screened for MTHFR C677T and A1298C variants by using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). The frequencies of MTHFR 677T and 1298C alleles in patients were 29.9% and 43.1%, respectively, that were higher than those in controls (24.8% and 38.1%, respectively). Logistic regression analysis was performed and its result in the odds ratios (ORs) for possession of either MTHFR 677T or 1298C allele was found to be 1.98 [95% confidence interval (CI) 0.72-5.4, p = 0.18] and 1.48 (95% CI 0.59-3.69, p = 0.4), respectively. Also the concomitant presence of both MTHFR 677T and 1298C alleles was not associated with the risk of ALL [OR = 2.12 (95% CI 0.8-5.7, p = 0.13)]. Our results in a homogenous population with Kurdish ethnic background indicated that neither the MTHFR 677T allele nor the MTHFR 1298C allele is associated with increased risk of ALL.

  6. Spectrum of mutations in homozygous familial hypercholesterolemia in India, with four novel mutations.

    PubMed

    Setia, Nitika; Saxena, Renu; Arora, Anjali; Verma, Ishwar C

    2016-12-01

    Homozygous familial hypercholesterolemia (FH) is a rare but serious, inherited disorder of lipid metabolism characterized by very high total and LDL cholesterol levels from birth. It presents as cutaneous and tendon xanthomas since childhood, with or without cardiac involvement. FH is commonly caused by mutations in three genes, i.e. LDL receptor (LDLR), apolipoprotein B (ApoB) and PCSK9. We aimed to determine the spectrum of mutations in cases of homozygous FH in Asian Indians and evaluate if there was any similarity to the mutations observed in Caucasians. Sixteen homozygous FH subjects from eleven families were analyzed for mutations by Sanger sequencing. Large rearrangements in LDLR gene were evaluated by multiplex ligation probe dependent amplification (MLPA) technique. Ten mutations were observed in LDLR gene, of which four mutations were novel. No mutation was detected in ApoB gene and common PCSK9 mutation (p.D374Y). Fourteen cases had homozygous mutations; one had compound heterozygous mutation, while no mutation was detected in one clinically homozygous case. We report an interesting "Triple hit" case with features of homozygous FH. The spectrum of mutations in the Asian Indian population is quite heterogeneous. Of the mutations identified, 40% were novel. No mutation was observed in exons 3, 9 and 14 of LDLR gene, which are considered to be hot spots in studies done on Asian Indians in South Africa. Early detection followed by aggressive therapy, and cascade screening of extended families has been initiated to reduce the morbidity and mortality in these patients. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  7. MTHFR GENE C677T POLYMORPHISM AND LEVELS OF DNA METHYLTRASFERASES IN SUBCLINICAL HYPOTHYROIDISM.

    PubMed

    Kvaratskhelia, T; Kvaratskhelia, E; Kankava, K; Abzianidze, E

    2017-04-01

    The aim of our study was to investigate the link between MTHFR gene C677T polymorphism and DNMTs levels in patients with Subclinical Hypothyroidism (SCH). In this study 19 adult patients with subclinical hypothyroidism and 19 healthy controls (mean age 31±5.5 and 33±5.1 years respectively) were recruited. All patients were diagnosed based on serum levels of TSH, FT4, anti-TG and anti-TPO antibodies. Written informed consents were obtained from all study subjects. Genomic DNA was extracted using Quick-DNA Universal Kit (Zymo Research, USA). The MTHFR C677T polymorphism was genotyped by PCR-RFLP method. Levels of DNMT1 and 3a were measured in nuclear extracts of PBMC using DNMTs assay kits (Abcam). Our data indicates that the frequency of genotypes and alleles were different among the patient and the control group. There is a significant increase in CC genotype distribution in the control group when compared to the SCH patient group, while the CT as well as TT genotype distribution were not increased significantly in SCH group versus control group. However the C allele is significantly prevalent in the control group compared to the SCH group, while T allele is prevalent in patients compared to the control group with a statically significant difference. In addition, individuals with TT and CT genotypes and hypothyroidism showed elevated amount of DNMT3a in nuclear extracts of PBMC compared with controls, while no significant difference in DNMT1 levels was observed. This study indicates the MTHFR C677T variant may contribute in alteration of epigenetic regulation such as DNA methylation mediated by DNA methyltransferases in patients with subclinical hypothyroidism and also, carriers of the T allele might have an increasing risk of developing SCH.

  8. Associations of methylenetetrahydrofolate reductase C677T genotype with blood pressure levels in Chinese population with essential hypertension.

    PubMed

    Cheng, Jun; Tao, Fang; Liu, Yanhong; Venners, Scott A; Hsu, Yi-Hsiang; Jiang, Shanqun; Weinstock, Justin; Wang, Binyan; Tang, Genfu; Xu, Xiping

    2018-01-01

    To confirm the association between baseline blood pressure (BP) levels and the methylenetetrahydrofolate reductase (MTHFR) C677T gene polymorphism in patients with essential hypertension. A total of 347 patients were enrolled from the Dongzhi community in Anhui Province, China. The C677T polymorphism of the MTHFR gene was detected using high-throughput TaqMan allelic discrimination assay. Baseline BP was measured using a standardized mercury-gravity monometer. In the whole sample, the frequency of the MTHFR C677T genotypes CC, CT, and TT were 38.6%, 48.1%, and 13.3%, respectively. In a recessive model (CC+CT versus TT genotypes), baseline diastolic blood pressure (DBP) was significantly higher in patients with the TT genotype compared to those with the CT or CC genotypes (P= 0.013). We also divided all patients into three groups based on the tertiles of the baseline BP distribution. Compared to subjects in the lowest tertile of DBP, the adjusted odds of having the TT genotype among subjects in the highest tertile was 2.6 (95% CI: 1.1 to 6.2). However, no significant associations were observed between baseline systolic blood pressure (SBP) and the MTHFR C677T polymorphism. The MTHFR gene polymorphism could be an important genetic determinant of baseline DBP levels in Chinese essential hypertensive patients.

  9. A literature review of MTHFR (C677T and A1298C polymorphisms) and cancer risk.

    PubMed

    Izmirli, Muzeyyen

    2013-01-01

    5,10-Methlenetetrahydrofolate reductase (MTHFR) is one of the most important enzymes for folate metabolism. This enzyme is mapped on chromosome 1, which is located at the end of the short arm (1p36.3). The C677T and A1298C are MTHFR polymorphisms that decrease in vitro MTHFR enzyme activity. Folate metabolism plays a key role in cell metabolism. These reactions are associated with purine-pyrimidine synthesis: DNA, RNA, and protein methylation. Polymorphism is also a factor in biodiversity, and be affected by ethnic heritage and geographic locale. In the case of unknown outcomes, not only should all geographical regions be investigated to ascertain biodiversity, but all populations as well to fully understand the variations in the effect. PUBMED was searched from January 2006 to December 2011 to develop an investigatory pursuit strategy. MTHFR, cancer, C677T, A1298C, and polymorphisms were key words used to focus the search. The literature review included all published relevant cancer types and MTHFR polymorphisms for that 5 years period. All selected polymorphisms data for cancer types was listed in tables for easy access and retrieval.

  10. Human genetic selection on the MTHFR 677C>T polymorphism

    PubMed Central

    Mayor-Olea, Álvaro; Callejón, Gonzalo; Palomares, Arturo R; Jiménez, Ana J; Gaitán, María Jesús; Rodríguez, Alfonso; Ruiz, Maximiliano; Reyes-Engel, Armando

    2008-01-01

    Background The prevalence of genotypes of the 677C>T polymorphism for the MTHFR gene varies among humans. In previous studies, we found changes in the genotypic frequencies of this polymorphism in populations of different ages, suggesting that this could be caused by an increase in the intake of folate and multivitamins by women during the periconceptional period. The aim was to analyze changes in the allelic frequencies of this polymorphism in a Spanish population, including samples from spontaneous abortions (SA). Methods A total of 1305 subjects born in the 20th century were genotyped for the 677C>T polymorphism using allele specific real-time PCR with Taqman® probes. A section of our population (n = 276) born in 1980–1989 was compared with fetal samples (n = 344) from SA of unknown etiology from the same period. Results An increase in the frequency of the T allele (0.38 vs 0.47; p < 0.001) and of the TT genotype (0.14 vs 0.24; p < 0.001) in subjects born in the last quarter of the century was observed. In the 1980–1989 period, the results show that the frequency of the wild type genotype (CC) is about tenfold lower in the SA samples than in the controls (0.03 vs 0.33; p < 0.001) and that the frequency of the TT genotype increases in the controls (0.19 to 0.27) and in the SA samples (0.20 to 0.33 (p < 0.01)); r = 0.98. Conclusion Selection in favor of the T allele has been detected. This selection could be due to the increased fetal viability in early stages of embryonic development, as is deduced by the increase of mutants in both living and SA populations. PMID:19040733

  11. Methylenetetrahydrofolate reductase C677T and A1298C gene polymorphisms and therapy-related toxicity in children treated for acute lymphoblastic leukemia and non-Hodgkin lymphoma.

    PubMed

    Kantar, Mehmet; Kosova, Buket; Cetingul, Nazan; Gumus, Sevinc; Toroslu, Ertug; Zafer, Nur; Topcuoglu, Nejat; Aksoylar, Serap; Cinar, Mehtap; Tetik, Asli; Eroglu, Zuhal

    2009-06-01

    This study aimed to investigate the association of the methylenetetrahydrofolate reductase (MTHFR) gene C677T and A1298C polymorphisms with serum drug levels and toxicities after high-dose methotrexate (MTX) infusion. The study included 37 children with acute lymphoblastic leukemia or non-Hodgkin lymphoma. Serum MTX levels and toxicities of bone marrow, liver and kidney were analysed. Genotype analysis of the C677T and A1298C gene polymorphisms from genomic DNA of the subjects was performed by real-time PCR. Subjects with MTHFR polymorphism for C677T (CT, TT) had significantly higher MTX levels at 24 h (p = 0.009), and these genotypes did not seem to cause toxicity. Subjects with MTHFR polymorphism for A1298C (AC, CC) had significantly higher MTX levels at 48 h (p = 0.02), and had more grade III/IV anemia (p = 0.02), thrombocytopenia (p = 0.0001), elevated AST levels (p = 0.04) and frequent febrile neutropenic episodes (p = 0.004). The present study suggests that A1298C gene, but not C677T polymorphism is associated with MTX-related toxicity.

  12. Mutations in HAMP and HJV genes and their impact on expression of clinical hemochromatosis in a cohort of 100 Spanish patients homozygous for the C282Y mutation of HFE gene.

    PubMed

    Altès, Albert; Bach, Vanessa; Ruiz, Angels; Esteve, Anna; Felez, Jordi; Remacha, Angel F; Sardà, M Pilar; Baiget, Montserrat

    2009-10-01

    Most hereditary hemochromatosis (HH) patients are homozygous for the C282Y mutation of the HFE gene. Nevertheless, penetrance of the disease is very variable. In some patients, penetrance can be mediated by concomitant mutations in other iron master genes. We evaluated the clinical impact of hepcidin (HAMP) and hemojuvelin mutations in a cohort of 100 Spanish patients homozygous for the C282Y mutation of the HFE gene. HAMP and hemojuvelin mutations were evaluated in all patients by bidirectional direct cycle sequencing. Phenotype-genotype interactions were evaluated. A heterozygous mutation of the HAMP gene (G71D) was found in only one out of 100 cases. Following, we performed a study of several members of that family, and we observed several members had a digenic inheritance of the C282Y mutation of the HFE gene and the G71D mutation of the HAMP gene. This mutation in the HAMP gene did not modify the phenotype of the individuals who were homozygous for the C282Y mutation. One other patient presented a new polymorphism in the hemojuvelin gene, without consequences in iron load or clinical course of the disease. In conclusion, HAMP and hemojuvelin mutations are rare among Spanish HH patients, and their impact in this population is not significant.

  13. A meta-analysis of MTHFR C677T and A1298C polymorphisms and risk of acute lymphoblastic leukemia in children.

    PubMed

    Yan, Jingrong; Yin, Ming; Dreyer, ZoAnn E; Scheurer, Michael E; Kamdar, Kala; Wei, Qingyi; Okcu, M Fatih

    2012-04-01

    Methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C polymorphisms have been implicated in childhood acute lymphoblastic leukemia (ALL) risk, but previously published studies were inconsistent and recent meta-analyses were not adequate. In a meta-analysis of 21 publications with 4,706 cases and 7,414 controls, we used more stringent inclusion method and summarized data on associations between MTHFR C677T and A1298C polymorphisms and childhood ALL risk. We found an overall association between 677T variant genotypes and reduced childhood ALL risk. Specifically, in the dominant genetic model, an association was found in a fixed-effect (TT + CT vs. CC: OR = 0.92; 95% CI = 0.85-0.99) but not random-effect model, whereas such an association was observed in both homozygote genetic model (TT vs. CC: OR = 0.80; 95% CI = 0.70-0.93 by fixed effects and OR = 0.78; 95% CI = 0.65-0.93 by random effects) and recessive genetic model (TT vs. CC + CT: OR = 0.83; 95% CI = 0.72-0.95 by fixed effects and OR = 0.84; 95% CI = 0.73-0.97 by random effects). These associations were also observed in subgroups by ethnicity: for Asians in all models except for the dominant genetic model by random effect and for Caucasians in all models except for the recessive genetic model. However, the A1298C polymorphism did not appear to have an effect on childhood ALL risk. These results suggest that the MTHFR C677T, but not A1298C, polymorphism is a potential biomarker for childhood ALL risk. Copyright © 2011 Wiley Periodicals, Inc.

  14. Two homozygous mutations in the exon 5 of BCKDHB gene that may cause the classic form of maple syrup urine disease.

    PubMed

    Su, Ling; Lu, Zhikun; Li, Fatao; Shao, Yongxian; Sheng, Huiying; Cai, Yanna; Liu, Li

    2017-06-01

    Maple syrup urine disease (MSUD) is a rare autosomal recessive genetic disorder caused by defects in the catabolism of the branched-chain amino acids (BCAAs). Classic form of MSUD (CMSUD) is caused by mutations in BCKDHA, BCKDHB, DBT genes mostly. In this study, we analyzed the clinical and genetic characteristics of two patients with CMSUD. Two homozygous mutations, c.517G > T (p.Asp173Tyr) and c.503G > A (p.Arg168His), both in the exon 5 of BCKDHB were detected respectively. The novel mutation p.Asp173Tyr of patient A, inherited from his parents, is predicted to affect conformation of protein by computer analysis. The reported mutation p.Arg168His observed in patient B seemed to occur in a maternal uniparental disomy inheritance manner. Review of related literature revealed that most missense mutations in exon 5 of BCKDHB in homozygous genotype often result in CMSUD because of its incorrect conformation, and exon 5 of BCKDHB might be a susceptible region. Thus the novel homozygous mutation p.Asp173Tyr and the founder homozygous mutation p.Arg168His may be responsible for the clinical presentation of the two CMSUD patients, facilitating the future genetic counselling and prenatal diagnosis.

  15. MTHFR 677C --> T genotype disrupts prefrontal function in schizophrenia through an interaction with COMT 158Val --> Met.

    PubMed

    Roffman, Joshua L; Gollub, Randy L; Calhoun, Vince D; Wassink, Thomas H; Weiss, Anthony P; Ho, Beng C; White, Tonya; Clark, Vincent P; Fries, Jill; Andreasen, Nancy C; Goff, Donald C; Manoach, Dara S

    2008-11-11

    Understanding how risk genes cumulatively impair brain function in schizophrenia could provide critical insights into its pathophysiology. Working memory impairment in schizophrenia has been associated with abnormal dopamine signaling in the prefrontal cortex, which is likely under complex genetic control. The catechol-O-methyltransferase (COMT) 158Val --> Met polymorphism (rs4680), which affects the availability of prefrontal dopamine signaling, consistently stratifies prefrontal activation during working memory performance. However, the low-dopamine COMT 158Val allele does not confer increased risk for schizophrenia, and its effects on prefrontal function are not specific to the disorder. In the setting of other genetic variants influencing prefrontal dopamine signaling, COMT 158Val --> Met genotype may exert disease-specific effects. A second polymorphism, methylenetetrahydrofolate reductase (MTHFR) 677C --> T (rs1801133), has been associated with overall schizophrenia risk and executive function impairment in patients, and may influence dopamine signaling through mechanisms upstream of COMT effects. We found that the hypofunctional 677T variant was associated with decreased working memory load-dependent activation in the prefrontal and insular cortices in 79 schizophrenia patients, but not in 75 demographically matched healthy controls. Further, significant MTHFR x COMT genotype interactions were observed, which differed by diagnostic group: Reduced prefrontal activation was associated with the 677T and 158Val alleles in patients, but with 677C/C and 158Met/Met genotype in controls. These findings are consistent with epistatic effects of the COMT and MTHFR polymorphisms on prefrontal dopamine signaling, and suggest that in schizophrenia patients, the MTHFR 677T allele exacerbates prefrontal dopamine deficiency. The findings also suggest the importance of weighing COMT effects on prefrontal function within the context of MTHFR genotype.

  16. The association between MTHFR gene C677T polymorphism and ALL risk based on a meta-analysis involving 17,469 subjects.

    PubMed

    Zhang, Beibei; Zhang, Weiming; Yan, Liang; Wang, Daogang

    2017-03-01

    The methylenetetrahydrofolate reductase (MTHFR) gene C677T polymorphism is closely related to the acute lymphoblastic leukaemia (ALL) indicated by many previous epidemiologic studies. However, their conclusions were still conflicting. Our aim is to evaluate their associations using a more comprehensive updated meta-analysis. Electronic searches were conducted to select published studies prior to February, 2016. Totally, 39 case-control studies including 6551 ALL cases and 10,918 controls were selected in current meta-analysis. The association was detected significantly between MTHFR C677T polymorphism and ALL reducing susceptibility. Our results indicate that the MTHFR C677T polymorphism may be a promising ALL biomarker and studies to explore the protein levels of the variants and their functional role are required for the definitive conclusions. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Association between MTHFR C677T polymorphism and risk of acute lymphoblastic leukemia: a meta-analysis based on 51 case-control studies.

    PubMed

    Li, Su-yi; Ye, Jie-yu; Liang, En-yu; Zhou, Li-xia; Yang, Mo

    2015-03-12

    Studies and systematic reviews have reached inconsistent conclusions on the role of 5, 10-methylenetetrahydrofolate reductase (MTHFR) polymorphism C677T in acute lymphoblastic leukemia (ALL) risk. The present meta-analysis comprising of 51 case-control studies, including 7892 cases and 14 280 controls was performed to reevaluate the association between MTHFR C677T polymorphism and ALL risk. Statistical differences were found in the dominant model (TT+CT vs. CC, odd ratio (OR)=0.89, 95% CI, 0.79-1.00, P=0.04) and the CT vs. CC (OR=0.89, 95% CI, 0.80-1.00, P=0.05), but not in the allele contrast model (T vs. C, OR=0.92, 95% CI, 0.84-1.01, P=0.08), additive model (TT vs. CC, OR=0.87, 95% CI, 0.73-1.05, P=0.15), or recessive model (TT vs. CT+CC, OR=0.94, 95% CI, 0.81-1.10, P=0.44) in overall populations. In the subgroup analyses stratified by age (children and adults) and ethnicity (Asian and Caucasian), no significant associations between MTHFR C677T polymorphism and ALL risk were observed. The current study found no sufficient evidence of a protective role of MTHFR C677T polymorphism in ALL susceptibility.

  18. Homozygous mutation of VPS16 gene is responsible for an autosomal recessive adolescent-onset primary dystonia.

    PubMed

    Cai, Xiaodong; Chen, Xin; Wu, Song; Liu, Wenlan; Zhang, Xiejun; Zhang, Doudou; He, Sijie; Wang, Bo; Zhang, Mali; Zhang, Yuan; Li, Zongyang; Luo, Kun; Cai, Zhiming; Li, Weiping

    2016-05-12

    Dystonia is a neurological movement disorder that is clinically and genetically heterogeneous. Herein, we report the identification a novel homozygous missense mutation, c.156 C > A in VPS16, co-segregating with disease status in a Chinese consanguineous family with adolescent-onset primary dystonia by whole exome sequencing and homozygosity mapping. To assess the biological role of c.156 C > A homozygous mutation of VPS16, we generated mice with targeted mutation site of Vps16 through CRISPR-Cas9 genome-editing approach. Vps16 c.156 C > A homozygous mutant mice exhibited significantly impaired motor function, suggesting that VPS16 is a new causative gene for adolescent-onset primary dystonia.

  19. MTHFR 677C>T Polymorphism and the Risk of Breast Cancer: Evidence from an Original Study and Pooled Data for 28031 Cases and 31880 Controls

    PubMed Central

    Sekhar, Deepa; Francis, Amirtharaj; Gupta, Nishi; Konwar, Rituraj; Kumar, Sandeep; Kumar, Surender; Thangaraj, Kumarasamy; Rajender, Singh

    2015-01-01

    Background Methylenetetrahydrofolate reductase (MTHFR) acts at an important metabolic point in the regulation of cellular methylation reaction. It assists in the conversion of 5, 10-methylenetetrahydrofolate to 5-methyltetrahydrofolate. The latter aids in remethylation of homocysteine to de novo methionine that is required for DNA synthesis. The objective of this study was to examine the effect of MTHFR 677 C>T polymorphism on the risk of breast cancer in the Indian sub-continent. Methods and Results We genotyped 677 C>T locus in 1096 individuals that were classified into cases (N=588) and controls (N=508). Genotype data were analyzed using chi-square test. No significant difference was observed in the distribution of genotypes between cases and controls in north Indian (P = 0.932), south Indian (P = 0.865), and pooled data (P = 0.680). To develop a consensus regarding the impact of 677C>T polymorphism on breast cancer risk, we also conducted a meta-analysis on 28031 cases and 31880 controls that were pooled from sixty one studies. The overall summary estimate upon meta-analysis suggested no significant correlation between the 677C>T substitution and breast cancer in the dominant model (Fixed effect model: OR = 0.97, P=0.072, Random effects model: OR = 0.96, P = 0.084) or the recessive model (Fixed effect model: OR = 1.05, P = 0.089; Random effects model: OR= 1.08, P= 0.067). Conclusion 677 C>T substitution does not affect breast cancer risk in the Indo-European and Dravidian populations of India. Analysis on pooled data further ruled out association between the 677 C>T polymorphism and breast cancer. Therefore, 677 C>T substitution does not appear to influence the risk of breast cancer. PMID:25803740

  20. Somatic overgrowth associated with homozygous mutations in both MAN1B1 and SEC23A

    PubMed Central

    Gupta, Swati; Fahiminiya, Somayyeh; Wang, Tracy; Dempsey Nunez, Laura; Rosenblatt, David S.; Gibson, William T.; Gilfix, Brian; Bergeron, John J. M.; Jerome-Majewska, Loydie A.

    2016-01-01

    Using whole-exome sequencing, we identified homozygous mutations in two unlinked genes, SEC23A c.1200G>C (p.M400I) and MAN1B1 c.1000C>T (p.R334C), associated with congenital birth defects in two patients from a consanguineous family. Patients presented with carbohydrate-deficient transferrin, tall stature, obesity, macrocephaly, and maloccluded teeth. The parents were healthy heterozygous carriers for both mutations and an unaffected sibling with tall stature carried the heterozygous mutation in SEC23A only. Mutations in SEC23A are responsible for craniolenticosultura dysplasia (CLSD). CLSD patients are short, have late-closing fontanels, and have reduced procollagen (pro-COL1A1) secretion because of abnormal pro-COL1A1 retention in the endoplasmic reticulum (ER). The mutation we identified in MAN1B1 was previously associated with reduced MAN1B1 protein and congenital disorders of glycosylation (CDG). CDG patients are also short, are obese, and have abnormal glycan remodeling. Molecular analysis of fibroblasts from the family revealed normal levels of SEC23A in all cells and reduced levels of MAN1B1 in cells with heterozygous or homozygous mutations in SEC23A and MAN1B1. Secretion of pro-COL1A1 was increased in fibroblasts from the siblings and patients, and pro-COL1A1 was retained in Golgi of heterozygous and homozygous mutant cells, although intracellular pro-COL1A1 was increased in patient fibroblasts only. We postulate that increased pro-COL1A1 secretion is responsible for tall stature in these patients and an unaffected sibling, and not previously discovered in patients with mutations in either SEC23A or MAN1B1. The patients in this study share biochemical and cellular characteristics consistent with mutations in MAN1B1 and SEC23A, indicating a digenic disease. PMID:27148587

  1. Pregnancy-associated osteoporosis with a heterozygous deactivating LDL receptor-related protein 5 (LRP5) mutation and a homozygous methylenetetrahydrofolate reductase (MTHFR) polymorphism.

    PubMed

    Cook, Fiona J; Mumm, Steven; Whyte, Michael P; Wenkert, Deborah

    2014-04-01

    Pregnancy-associated osteoporosis (PAO) is a rare, idiopathic disorder that usually presents with vertebral compression fractures (VCFs) within 6 months of a first pregnancy and delivery. Spontaneous improvement is typical. There is no known genetic basis for PAO. A 26-year-old primagravida with a neonatal history of unilateral blindness attributable to hyperplastic primary vitreous sustained postpartum VCFs consistent with PAO. Her low bone mineral density (BMD) seemed to respond to vitamin D and calcium therapy, with no fractures after her next successful pregnancy. Investigation of subsequent fetal losses revealed homozygosity for the methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism associated both with fetal loss and with osteoporosis (OP). Because her neonatal unilateral blindness and OP were suggestive of loss-of-function mutation(s) in the gene that encodes LDL receptor-related protein 5 (LRP5), LRP5 exon and splice site sequencing was also performed. This revealed a unique heterozygous 12-bp deletion in exon 21 (c.4454_4465del, p.1485_1488del SSSS) in the patient, her mother and sons, but not her father or brother. Her mother had a normal BMD, no history of fractures, PAO, ophthalmopathy, or fetal loss. Her two sons had no ophthalmopathy and no skeletal issues. Her osteoporotic father (with a family history of blindness) and brother had low BMDs first documented at ages ∼40 and 32 years, respectively. Serum biochemical and bone turnover studies were unremarkable in all subjects. We postulate that our patient's heterozygous LRP5 mutation together with her homozygous MTHFR polymorphism likely predisposed her to low peak BMD. However, OP did not cosegregate in her family with the LRP5 mutation, the homozygous MTHFR polymorphism, or even the combination of the two, implicating additional genetic or nongenetic factors in her PAO. Nevertheless, exploration for potential genetic contributions to PAO may explain part of the pathogenesis of this

  2. C677T (RS1801133 ) MTHFR gene polymorphism frequency in a colombian population.

    PubMed

    Romero-Sánchez, Consuelo; Gómez-Gutierrez, Alberto; Gómez, Piedad Elena; Casas-Gomez, Maria Consuelo; Briceño, Ignacio

    2015-01-01

    Abnormal levels of the enzyme methylenetetrahydrofolate reductase (MTHFR) are associated with an increased risk of both cardiovascular and cerebrovascular disease and higher concentrations of homocysteine. Abnormal levels are also related to birth defects, pregnancy complications, cancer and toxicity to methotrexate (MTX). Polymorphisms of MTHFR affect the activity of the enzyme. Genetic associations have been related to treatment efficacy. To establish the frequency of the C> T polymorphism at nucleotide 677 of the MTHFR gene in a group of Colombian individuals. Data from pharmacogenetic microarrays that include MTX sensibility-associated polymorphisms were retrospectively collected (Pathway Genomics(®)). The frequency of the C> T MTHFR rs1801133 marker polymorphism was analyzed. Microarray data from 68 men and 84 women were analyzed. Comparisons of genotype C/C vs. C/T and T/T were statistically significantly different (p= 0.00, p= 0.026, respectively), as were C/T and T / T (p= 0.0001). Results for the C/C and C/T genotypes in a Colombian population are similar to other previously studied groups of healthy subjects. Subjects from our population might be at risk of developing diseases associated with MTHFR polymorphisms and might present toxicity and adverse effects if treated with MTX, which suggests the need to evaluate therapeutic alternatives based on individual pharmacogenetic studies.

  3. Carnitine-acylcarnitine translocase deficiency with c.199-10 T>G and novel c.1A>G mutation

    PubMed Central

    Yan, Hui-ming; Hu, Hao; Ahmed, Aisha; Feng, Bing-bing; Liu, Jing; Jia, Zheng-jun; Wang, Hua

    2017-01-01

    Abstract Rationale: Carnitine-acylcarnitine translocate deficiency (CACTD) is a rare and life-threatening, autosomal recessive disorder of fatty acid β-oxidation characterized by hypoketotic hypoglycemia, hyperammonemia, cardiomyopathy, liver dysfunction, and muscle weakness; culminating in early death. To date, CACTD cases screened from the Chinese mainland population, especially patient with compound heterozygote with c.199-10T>G and a novel c.1A>G mutation in the SLC25A20 gene has never been described. Patient concerns: Herein, we report 2 neonatal cases of CACTD identified from the mainland China. These 2 patients were presented with severe metabolic crisis and their clinical conditions deteriorate rapidly and both died of cardiorespiratory collapse in the first week of life. We present the clinical and biochemical features of 2 probands and a brief literature review of previously reported CACTD cases with the c.199-10T>G mutation. Diagnoses: The acylcarnitine profiles by tandem-mass-spectrometry and the mutation analysis of SLC25A20 gene confirmed the diagnosis of CACTD in both patients. Mutation analysis demonstrated that patient No. 1 was homozygous for c.199-10T>G mutation, while patient No. 2 was a compound heterozygote for 2 mutations, a maternally-inherited c.199-10T>G and a paternally-inherited, novel c.1A>G mutation. Interventions: Both patients were treated with an aggressive treatment regimen include high glucose and arginine infusion, respiratory, and circulatory support. Outcomes: The first proband died 3 days after delivery due to sudden cardiac arrest. The second patient's clinical condition, at one time, was improved by high glucose infusion, intravenous arginine, and circulatory support. However, the patient failed to wean from mechanical ventilation. Unfortunately, her parents refused further treatment due to fear of financial burdens. The patient died of congestive heart failure in the 6th day of life. Lessons: We report the first 2 cases of

  4. COMT Val158Met and MTHFR C677T moderate risk of schizophrenia in response to childhood adversity.

    PubMed

    Debost, J-C; Debost, M; Grove, J; Mors, O; Hougaard, D M; Børglum, A D; Mortensen, P B; Petersen, L

    2017-07-01

    Mesolimbic dopamine sensitization has been hypothesized to be a mediating factor of childhood adversity (CA) on schizophrenia risk. Activity of catechol-O-methyltransferase (COMT) Val158Met increases mesolimbic dopamine signaling and may be further regulated by methylenetetrahydrofolate reductase (MTHFR) C677T. This study investigates the three-way interaction between CA, COMT, and MTHFR. We conducted a nested case-control study on individuals born after 1981, linking population-based registers to study the three-way interaction. We included 1699 schizophrenia cases and 1681 controls, and used conditional logistic regression to report incidence rate ratios (IRRs). Childhood adversity was robustly associated with schizophrenia. No main genetic effects were observed. MTHFR C677T increased schizophrenia risk in a dose-dependent manner per MTHFR T allele (P = 0.005) consequent upon CA exposure. After inclusion of the significant (P = 0.03) COMT × MTHFR × CA interaction, the risk was further increased per high-activity COMT Val allele. Hence, exposed COMT Val/Val and MTHFR T/T carriers had an IRR of 2.76 (95% CI, 1.66-4.61). Additional adjustments for ancestry and parental history of mental illness attenuated the results with the interaction being only marginally significant. MTHFR C677T and COMT Val158Met interact with CA to increase risk of schizophrenia. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  5. Methylenetetrahydrofolate reductase C677T polymorphism is associated with increased risk of coronary artery disease in young South African Indians.

    PubMed

    Ramkaran, Prithiksha; Phulukdaree, Alisa; Khan, Sajidah; Moodley, Devapregasan; Chuturgoon, Anil A

    2015-10-15

    Methylenetetrahydrofolate reductase (MTHFR) reduces 5',10'-methylenetetrahydrofolate to 5'-methyltetrahydrofolate, and is involved in remethylation of homocysteine to methionine, two important reactions involved in folate metabolism and methylation pathways. The common MTHFR C677T single nucleotide polymorphism (SNP) (rs1801133) has been associated with raised levels of homocysteine, a well known risk factor for coronary artery disease (CAD). CAD is a major cause of mortality worldwide. The age of onset of this chronic disorder is on the decline, particularly in the Indian population. Indians in South Africa (SA) have a higher prevalence of premature CAD compared to Black South Africans. The MTHFR C677T SNP has not been investigated in the SA Indian population. The present study therefore investigated the MTHFR C677T SNP in young SA Indian males with CAD compared to young Indian and Black male controls. A total of 290 subjects were recruited into this study which included 106 CAD patients (diagnosed on angiography, mean age 37.5, range 24-45 years), 100 Indian male controls (mean age 37.5, range 28-45 years), and 84 Black male controls (mean age 36.4, range 25-45). Polymerase chain reaction (PCR) followed by restriction fragment length polymorphism (RFLP) was used to genotype CAD patients and healthy controls. Data for clinical markers were obtained from pathology reports. There was a significant association between the 677 MTHFR variant (T) allele and CAD patients compared to the healthy Indian controls (p=0.0353, OR=2.105 95% CI 1.077-4.114). Indian controls presented with a higher frequency of the variant allele compared to Black controls (7% vs. 2% respectively, p=0.0515 OR=3.086 95% CI 0.9958-9.564). The MTHFR C677T SNP did not influence levels of total cholesterol, LDL, HDL, triglycerides, fasting glucose, fasting insulin, HbA1c or hsCRP. The higher frequency of the MTHFR 677 variant allele in South African Indians may be a contributing factor to the higher

  6. Methylenetetrahydrofolate reductase polymorphism C677T is a protective factor for pediatric acute lymphoblastic leukemia in the Chinese population: a meta-analysis.

    PubMed

    Wang, Haigang; Meng, Lujing; Zhao, Lixia; Wang, Jiali; Liu, Xinchun; Mi, Wenjie

    2012-12-01

    Two polymorphisms in the methylenetetrahydrofolate reductase (MTHFR) gene, C677T and A1298C, were hypothesized to decrease the risk of acute lymphoblastic leukemia (ALL). Studies examining the associations between these two polymorphisms and ALL susceptibility drew inconsistent results. To obtain a reliable conclusion in a Chinese population, we carried out a meta-analysis. In total, 11 studies on C677T polymorphism (1597 cases and 2295 controls) and 10 studies on A1298C polymorphism (1553 cases and 2224 controls) were included in the meta-analysis. We found a significant association between the 677T variant and reduced ALL risk in Chinese children (Dominant model: odds ratio [OR(FE)]=0.73, 95% confidence interval [CI]: 0.63-0.86, p<0.01). Heterogeneity between the studies in the children subgroup was weak and vanished after excluding one study deviating from HWE in the control group (p>0.1). In the adult subgroup, there was no significant association between the C677T variant and ALL risk (Dominant model: OR(RE)=0.88, 95% CI: 0.45-1.72, p=0.72). Significant heterogeneity was found in the adult subgroup in all the genetic model tests (p<0.1). The A1298C polymorphism had an effect on ALL risk neither in adults (Dominant model: OR(FE)=0.95, 95% CI: 0.71-1.27, p=0.72) nor in children (Dominant model: OR(FE)=1.02, 95% CI: 0.87-1.21, p=0.77). No significant heterogeneity between studies on A1298C polymorphism was found in the meta-analysis (p>0.1). The results showed that there was a protective effect of the MTHFR C677T variant on ALL risk in Chinese children.

  7. Association between MTHFR C677T Polymorphism and Risk of Acute Lymphoblastic Leukemia: A Meta-Analysis Based on 51 Case-Control Studies

    PubMed Central

    Li, Su-yi; Ye, Jie-yu; Liang, En-yu; Zhou, Li-xia; Yang, Mo

    2015-01-01

    Background Studies and systematic reviews have reached inconsistent conclusions on the role of 5, 10-methylenetetrahydrofolate reductase (MTHFR) polymorphism C677T in acute lymphoblastic leukemia (ALL) risk. Material/Methods The present meta-analysis comprising of 51 case-control studies, including 7892 cases and 14 280 controls was performed to reevaluate the association between MTHFR C677T polymorphism and ALL risk. Results Statistical differences were found in the dominant model (TT+CT vs. CC, odd ratio (OR)=0.89, 95% CI, 0.79–1.00, P=0.04) and the CT vs. CC (OR=0.89, 95% CI, 0.80–1.00, P=0.05), but not in the allele contrast model (T vs. C, OR=0.92, 95% CI, 0.84–1.01, P=0.08), additive model (TT vs. CC, OR=0.87, 95% CI, 0.73–1.05, P=0.15), or recessive model (TT vs. CT+CC, OR=0.94, 95% CI, 0.81–1.10, P=0.44) in overall populations. In the subgroup analyses stratified by age (children and adults) and ethnicity (Asian and Caucasian), no significant associations between MTHFR C677T polymorphism and ALL risk were observed. Conclusions The current study found no sufficient evidence of a protective role of MTHFR C677T polymorphism in ALL susceptibility. PMID:25761797

  8. Association of MTHFR C677T Genotype With Ischemic Stroke Is Confined to Cerebral Small Vessel Disease Subtype

    PubMed Central

    Traylor, Matthew; Adib-Samii, Poneh; Thijs, Vincent; Sudlow, Cathie; Rothwell, Peter M.; Boncoraglio, Giorgio; Dichgans, Martin; Meschia, James; Maguire, Jane; Levi, Christopher; Rost, Natalia S.; Rosand, Jonathan; Hassan, Ahamad; Bevan, Steve; Markus, Hugh S.

    2016-01-01

    Background and Purpose— Elevated plasma homocysteine levels are associated with stroke. However, this might be a reflection of bias or confounding because trials have failed to demonstrate an effect from homocysteine lowering in stroke patients, although a possible benefit has been suggested in lacunar stroke. Genetic studies could potentially overcome these issues because genetic variants are inherited randomly and are fixed at conception. Therefore, we tested the homocysteine levels–associated genetic variant MTHFR C677T for association with magnetic resonance imaging–confirmed lacunar stroke and compared this with associations with large artery and cardioembolic stroke subtypes. Methods— We included 1359 magnetic resonance imaging–confirmed lacunar stroke cases, 1824 large artery stroke cases, 1970 cardioembolic stroke cases, and 14 448 controls, all of European ancestry. Furthermore, we studied 3670 ischemic stroke patients in whom white matter hyperintensities volume was measured. We tested MTHFR C677T for association with stroke subtypes and white matter hyperintensities volume. Because of the established association of homocysteine with hypertension, we additionally stratified for hypertension status. Results— MTHFR C677T was associated with lacunar stroke (P=0.0003) and white matter hyperintensity volume (P=0.04), but not with the other stroke subtypes. Stratifying the lacunar stroke cases for hypertension status confirmed this association in hypertensive individuals (P=0.0002), but not in normotensive individuals (P=0.30). Conclusions— MTHFR C677T was associated with magnetic resonance imaging–confirmed lacunar stroke, but not large artery or cardioembolic stroke. The association may act through increased susceptibility to, or interaction with, high blood pressure. This heterogeneity of association might explain the lack of effect of lowering homocysteine in secondary prevention trials which included all strokes. PMID:26839351

  9. Folate intake and the MTHFR C677T genotype influence choline status in young Mexican American women☆

    PubMed Central

    Abratte, Christian M.; Wang, Wei; Li, Rui; Moriarty, David J.; Caudill, Marie A.

    2009-01-01

    Numerous studies have reported a relationship between folate status, the methylenetetrahydrofolate reductase (MTHFR) 677C→T variant and disease risk. Although folate and choline metabolism are inter-related, only limited data are available on the relationship between choline and folate status in humans. This study sought to examine the influences of folate intake and the MTHFR 677C→T variant on choline status. Mexican-American women (n =43; 14 CC, 12 CT and 17 TT) consumed 135 μg/day as dietary folate equivalents (DFE) for 7 weeks followed by randomization to 400 or 800 μg DFE/day for 7 weeks. Throughout the study, total choline intake remained unchanged at ∼350 mg/day. Plasma concentrations of betaine, choline, glycerophosphocholine, phosphatidylcholine and sphingomyelin were measured via LC-MS/MS for Weeks 0, 7 and 14. Phosphatidylcholine and sphingomyelin declined ( P=.001, P=.009, respectively) in response to folate restriction and increased ( P=.08, P=.029, respectively) in response to folate treatment. The increase in phosphatidylcholine occurred in response to 800 ( P=.03) not 400 ( P=.85) μg DFE/day (week×folate interaction, P=.017). The response of phosphatidylcholine to folate intake appeared to be influenced by MTHFR C677T genotype. The decline in phosphatidylcholine during folate restriction occurred primarily in women with the CC or CT genotype and not in the TT genotype (week×genotype interaction, P=.089). Moreover, when examined independent of folate status, phosphatidylcholine was higher ( P <.05) in the TT genotype relative to the CT genotype. These data suggest that folate intake and the MTHFR C677T genotype influence choline status in humans. PMID:17588738

  10. C677T and A1298C polymorphisms of the methylenetetrahydrofolate reductase gene: effect on methotrexate-related toxicity in adult acute lymphoblastic leukaemia.

    PubMed

    Eissa, Deena Samir; Ahmed, Tamer Mohamed

    2013-03-01

    Methylenetetrahydrofolate reductase (MTHFR) is a key enzyme involved in folate metabolism. Two polymorphisms, C677T and A1298C, were described leading to reduced enzyme activity. Methotrexate (MTX) is an antifolate agent of consolidation and maintenance therapy of acute lymphoblastic leukaemia (ALL). Despite its clinical success, MTX can be associated with serious toxicities resulting in treatment interruption or discontinuation, impacting disease outcome. There is evidence that MTX toxicity can be affected by polymorphisms in genes encoding for drug-metabolizing enzymes such as MTHFR. Therefore, we aimed to investigate the influence of MTHFR C677T and A1298C polymorphisms on the frequency of MTX-related toxicity, disease outcome and patients' survival. MTHFR polymorphisms were assessed in 50 adult patients with de novo ALL using real-time PCR. Patients were followed-up for the development of haematologic and/or nonhaematologic toxicity and assessment of clinical outcome. Frequency of C677T polymorphisms was 42% for TT, 24% for CT and 34% for CC; A1298C polymorphisms were 28, 6 and 66% for CC, AC and AA, respectively. MTX therapy was significantly associated with neutropaenia, hepatic and gastrointestinal toxicities, unfavourable response at day 14 of induction therapy, increased relapse and mortality rates and shorter survival in patients with 677 TT genotype than in those with CC and CT, whereas 1298 CC genotype patients had lower frequency of neutropaenia, hepatic toxicity and relapse than in those with AA and AC. Our study suggests MTHFR polymorphism as an attractive predictor of MTX-related toxicity in adult ALL, considering it a potential prognostic factor influencing disease outcome.

  11. C677T (RS1801133 ) MTHFR gene polymorphism frequency in a colombian population

    PubMed Central

    Gómez-Gutierrez, Alberto; Gómez, Piedad Elena; Casas-Gomez, Maria Consuelo; Briceño, Ignacio

    2015-01-01

    Introduction: Abnormal levels of the enzyme methylenetetrahydrofolate reductase (MTHFR) are associated with an increased risk of both cardiovascular and cerebrovascular disease and higher concentrations of homocysteine. Abnormal levels are also related to birth defects, pregnancy complications, cancer and toxicity to methotrexate (MTX). Polymorphisms of MTHFR affect the activity of the enzyme. Genetic associations have been related to treatment efficacy. Objective: To establish the frequency of the C> T polymorphism at nucleotide 677 of the MTHFR gene in a group of Colombian individuals. Methods: Data from pharmacogenetic microarrays that include MTX sensibility-associated polymorphisms were retrospectively collected (Pathway Genomics®). The frequency of the C> T MTHFR rs1801133 marker polymorphism was analyzed. Results: Microarray data from 68 men and 84 women were analyzed. Comparisons of genotype C/C vs. C/T and T/T were statistically significantly different (p= 0.00, p= 0.026, respectively), as were C/T and T / T (p= 0.0001). Conclusions: Results for the C/C and C/T genotypes in a Colombian population are similar to other previously studied groups of healthy subjects. Subjects from our population might be at risk of developing diseases associated with MTHFR polymorphisms and might present toxicity and adverse effects if treated with MTX, which suggests the need to evaluate therapeutic alternatives based on individual pharmacogenetic studies. PMID:26309343

  12. Four Novel p.N385K, p.V36A, c.1033–1034insT and c.1417–1418delCT Mutations in the Sphingomyelin Phosphodiesterase 1 (SMPD1) Gene in Patients with Types A and B Niemann-Pick Disease (NPD)

    PubMed Central

    Manshadi, Masoumeh Dehghan; Kamalidehghan, Behnam; Keshavarzi, Fatemeh; Aryani, Omid; Dadgar, Sepideh; Arastehkani, Ahoora; Tondar, Mahdi; Ahmadipour, Fatemeh; Meng, Goh Yong; Houshmand, Massoud

    2015-01-01

    Background: Types A and B Niemann-Pick disease (NPD) are autosomal-recessive lysosomal storage disorders caused by the deficient activity of acid sphingomyelinase due to mutations in the sphingomyelin phosphodiesterase 1 (SMPD1) gene. Methods: In order to determine the prevalence and distribution of SMPD1 gene mutations, the genomic DNA of 15 unrelated Iranian patients with types A and B NPD was examined using PCR, DNA sequencing and bioinformatics analysis. Results: Of 8 patients with the p.G508R mutation, 5 patients were homozygous, while the other 3 were heterozygous. One patient was heterozygous for both the p.N385K and p.G508R mutations. Another patient was heterozygous for both the p.A487V and p.G508R mutations. Two patients (one homozygous and one heterozygous) showed the p.V36A mutation. One patient was homozygous for the c.1033–1034insT mutation. One patient was homozygous for the c.573delT mutation, and 1 patient was homozygous for the c.1417–1418delCT mutation. Additionally, bioinformatics analysis indicated that two new p.V36A and p.N385K mutations decreased the acid sphingomyelinase (ASM) protein stability, which might be evidence to suggest the pathogenicity of these mutations. Conclusion: with detection of these new mutations, the genotypic spectrum of types A and B NPD is extended, facilitating the definition of disease-related mutations. However, more research is essential to confirm the pathogenic effect of these mutations. PMID:25811928

  13. Association of methylenetetrahydrofolate reductase gene C677T polymorphism with polycystic ovary syndrome risk: a systematic review and meta-analysis update.

    PubMed

    Fu, Li-yuan; Dai, Li-meng; Li, Xiao-gang; Zhang, Kun; Bai, Yun

    2014-01-01

    To re-estimate the association between methylenetetrahydrofolate reductase gene (MTHFR) C677T polymorphism and polycystic ovary syndrome (PCOS) risk by critically reviewing, analyzing and updating the current evidence. MTHFR C677T polymorphism has been studied as a possible risk factor for a variety of common conditions including heart disease, stroke and hypertension. Its association with PCOS was negative in a previous meta-analysis which had possible shortcomings. More studies have now been done but their results remain inconclusive. Available case-control studies containing genotype frequencies of MTHFR C677T were chosen, and odds ratio (OR) with 95% confidence interval (CI) was used to assess the strength of the association. Statistical analyses were performed using software Review Manager (Version 5. 2) and Stata (Version 11.0). Nine case-control studies including 638 PCOS and 759 healthy controls were identified. Meta-analysis showed a significant effect in the dominant model (TT+CT vs. CC: OR=1.65, 95%CI=1.28-2.12, P<0.0001) and heterozygote comparison (CT vs. CC: OR=1.83, 95%CI=1.17-2.87, P=0.008). In subgroup analysis stratified by ethnicity, MTHFR C677T variant was statistically significantly relevant to PCOS risk in European populations (TT+CT vs. CC: OR=2.16, 95%CI=1.50-3.12, P<0.0001; CT vs. CC: OR=2.11, 95%CI=1.15-3.87, P=0.02) but not in Asian populations (TT+CT vs. CC: OR=1.29, 95%CI=0.91-1.82, P=0.15; CT vs. CC: OR=1.31, 95%CI=0.91-1.90, P=0.15). This meta-analysis indicates that the 677T allele increases PCOS susceptibility, and this relevance seems to be more intense in Europeans than in Asians. Copyright © 2013. Published by Elsevier Ireland Ltd.

  14. Evaluation of Factor V G1691A, prothrombin G20210A, Factor XIII V34L, MTHFR A1298C, MTHFR C677T and PAI-1 4G/5G genotype frequencies of patients subjected to cardiovascular disease (CVD) panel in south-east region of Turkey.

    PubMed

    Oztuzcu, Serdar; Ergun, Sercan; Ulaşlı, Mustafa; Nacarkahya, Gülper; Iğci, Yusuf Ziya; Iğci, Mehri; Bayraktar, Recep; Tamer, Ali; Çakmak, Ecir Ali; Arslan, Ahmet

    2014-06-01

    Cardiovascular disease (CVD) risk factors, such as arterial hypertension, obesity, dyslipidemia or diabetes mellitus, as well as CVDs, including myocardial infarction, coronary artery disease or stroke, are the most prevalent diseases and account for the major causes of death worldwide. In the present study, 4,709 unrelated patients subjected to CVD panel in south-east part of Turkey between the years 2010 and 2013 were enrolled and DNA was isolated from the blood samples of these patients. Mutation analyses were conducted using the real-time polymerase chain reaction method to screen six common mutations (Factor V G1691A, PT G20210A, Factor XIII V34L, MTHFR A1298C and C677T and PAI-1 -675 4G/5G) found in CVD panel. The prevalence of these mutations were 0.57, 0.25, 2.61, 13.78, 9.34 and 24.27 % in homozygous form, respectively. Similarly, the mutation percent of them in heterozygous form were 7.43, 3.44, 24.91, 44.94, 41.09 and 45.66%, respectively. No mutation was detected in 92 (1.95%) patients in total. Because of the fact that this is the first study to screen six common mutations in CVD panel in south-east region of Turkey, it has a considerable value on the diagnosis and treatment of these diseases. Upon the results of the present and previous studied a careful examination for these genetic variants should be carried out in thrombophilia screening programs, particularly in Turkish population.

  15. A common mutation in the 5,10-methylenetetrahydrofolate reductase gene affects genomic DNA methylation through an interaction with folate status

    PubMed Central

    Friso, Simonetta; Choi, Sang-Woon; Girelli, Domenico; Mason, Joel B.; Dolnikowski, Gregory G.; Bagley, Pamela J.; Olivieri, Oliviero; Jacques, Paul F.; Rosenberg, Irwin H.; Corrocher, Roberto; Selhub, Jacob

    2002-01-01

    DNA methylation, an essential epigenetic feature of DNA that modulates gene expression and genomic integrity, is catalyzed by methyltransferases that use the universal methyl donor S-adenosyl-l-methionine. Methylenetetrahydrofolate reductase (MTHFR) catalyzes the synthesis of 5-methyltetrahydrofolate (5-methylTHF), the methyl donor for synthesis of methionine from homocysteine and precursor of S-adenosyl-l-methionine. In the present study we sought to determine the effect of folate status on genomic DNA methylation with an emphasis on the interaction with the common C677T mutation in the MTHFR gene. A liquid chromatography/MS method for the analysis of nucleotide bases was used to assess genomic DNA methylation in peripheral blood mononuclear cell DNA from 105 subjects homozygous for this mutation (T/T) and 187 homozygous for the wild-type (C/C) MTHFR genotype. The results show that genomic DNA methylation directly correlates with folate status and inversely with plasma homocysteine (tHcy) levels (P < 0.01). T/T genotypes had a diminished level of DNA methylation compared with those with the C/C wild-type (32.23 vs.62.24 ng 5-methylcytosine/μg DNA, P < 0.0001). When analyzed according to folate status, however, only the T/T subjects with low levels of folate accounted for the diminished DNA methylation (P < 0.0001). Moreover, in T/T subjects DNA methylation status correlated with the methylated proportion of red blood cell folate and was inversely related to the formylated proportion of red blood cell folates (P < 0.03) that is known to be solely represented in those individuals. These results indicate that the MTHFR C677T polymorphism influences DNA methylation status through an interaction with folate status. PMID:11929966

  16. Association of methylenetetrahydrofolate reductase (MTHFR 677C>T) and thymidylate synthase (TSER and TS 1494del6) polymorphisms with premature ovarian failure in Korean women.

    PubMed

    Rah, HyungChul; Jeon, Young Joo; Choi, Youngsok; Shim, Sung Han; Yoon, Tae Ki; Choi, Dong Hee; Cha, Sun Hee; Kim, Nam Keun

    2012-11-01

    The aim of our study was to investigate whether methylenetetrahydrofolate reductase (MTHFR) gene variant (MTHFR 677C>T) and thymidylate synthase (TS) gene variants (TS enhancer region [TSER] and TS 1494del6) confer a risk for premature ovarian failure (POF). We genotyped 136 POF patients and 236 controls among Korean women for the three single nucleotide polymorphism sites using polymerase chain reaction restriction fragment length polymorphism analysis. Differences in the MTHFR 677C>T, TSER, and TS 1494del6 genotype frequencies between POF patients and controls were compared, and odds ratios (ORs) and 95% CIs were determined as a measure of the strength of the association between genotypes and POF. The MTHFR 677CT and CT + TT variant genotypes were more frequent in POF patients than in controls (OR, 2.249; 95% CI, 1.317-3.843; and OR, 2.132; 95% CI, 1.268-3.585, respectively). The combined genotype frequencies of MTHFR 677CT + TT/TSER 3R3R and 677CT + TT/TS 1494del6 del6/del6 were higher in patients than in controls (OR, 2.300; 95% CI, 1.219-4.337; and OR, 3.314; 95% CI, 1.623-6.767, respectively). The T-3R-del6 and T-2R-del6 (MTHFR 677C>T/TSER/TS 1494del6) haplotypes were more frequent in patients (OR, 1.450; 95% CI, 1.050-2.002; and OR, 2.911; 95% CI, 1.191-7.117, respectively), whereas the C-2R-del6 haplotype was less frequent in patients (OR, 0.372; 95% CI, 0.152-0.912). The T-del6 (MTHFR 677/TS 1494del6) haplotype frequency was higher among patients (OR, 1.653; 95% CI, 1.206-2.266), whereas the C-del6 haplotype frequency was lower among patients (OR, 0.700; 95% CI, 0.516-0.950). We did not find an association between TSER or TS 1494del6 polymorphisms and POF. Our data suggest that the MTHFR 677T allele may increase the risk for POF, which could lead to the development of novel genetic markers for predicting the risk of POF in patients.

  17. Deficiency in GnRH receptor trafficking due to a novel homozygous mutation causes idiopathic hypogonadotropic hypogonadism in three prepubertal siblings.

    PubMed

    Zhang, Rui; Linpeng, Siyuan; Li, Zhuo; Cao, Yingxi; Tan, Hu; Liang, Desheng; Wu, Lingqian

    2018-08-30

    Idiopathic hypogonadotropic hypogonadism (IHH) is characterized by low levels of gonadotropins and delayed or absent sexual development. Most of the patients are diagnosed in late adolescence or early adulthood. Determining the diagnosis of IHH in prepubertal patients can be challenging. Making a timely, correct diagnosis has important clinical implications. Here we aimed to identify the genetic cause of IHH in three prepubertal siblings from a Chinese Han family and give appropriate treatment advice. Using whole exome sequencing (WES), we identified a novel homozygous GNRHR mutation (NM_000406; c.364C>T, p.L122F) in two prepubertal boys with cryptorchidism and micropenis. Sanger sequencing showed that their younger asymptomatic sister also had the homozygous GNRHR mutation. This mutation was inherited from the father and the mother. Immunofluorescence analysis showed that in permeabilized cells, expression of the mutant receptor on the cell membrane was significantly lower than that of wild-type. Calcium mobilization assays demonstrated that c.364C>T in the GNRHR gene is a complete loss-of-function mutation that caused IHH. These results may contribute to the genetic diagnosis of the three prepubertal siblings with IHH. According to this diagnosis, timely hormonal treatment can be given for the three prepubertal patients to induce pubertal development, especially for the asymptomatic female. Copyright © 2018 Elsevier B.V. All rights reserved.

  18. MTHFR gene C677T and A1298C polymorphisms and homocysteine levels in primary open angle and primary closed angle glaucoma

    PubMed Central

    Micheal, Shazia; Qamar, Raheel; Akhtar, Farah; Khan, Muhammad Imran; Khan, Wajid Ali

    2009-01-01

    Purpose To investigate the methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C genotypes and plasma concentrations of total homocysteine (tHcy) in Pakistani patients with primary open angle glaucoma (POAG) and primary closed angle glaucoma (PCAG). Methods This was a prospective case-control study. A total of 295 patients (173 POAG, 122 PCAG) and 143 age- and sex-matched controls were subdivided into two ethnic groups, Punjabis (Punjab province, central Pakistan) and Pathans (North-West Frontier Province, northern Pakistan). Genotypes of the MTHFR C677T and A1298C polymorphisms were detected by polymerase chain reaction–restriction fragment length polymorphism (PCR-RFLP). An enzyme-linked immunosorbent assay was used to determine the total serum homocysteine (tHcy) levels. Associations were determined by logistic regression analysis. Results Frequency distributions of genotypes and combined genotypes as well as homocysteine levels were obtained. The overall distribution of the C677T genotype was found to be significantly associated with PCAG (CC 69%, CT 21%, TT 10%; p=0.001, χ2=12.6), but not with POAG (CC 71%, CT 28%, TT 1%; p=0.98, χ2=0.02) as compared to the controls (CC 71%, CT 29%, TT 1%). The Pathan cohorts revealed no association with the disease; however, the Punjabis demonstrated a significant association with PCAG (CC 75%, CT 11%, TT 13%; p<0.001, χ2=17.2). PCAG in the Punjabi subjects was also significantly associated with the A1298C polymorphism (AA 43%, AC 54%, CC 3%; p<0.001, χ2=33.9) as compared to the controls. Combined genotype data showed no association with POAG; however, a significant association with all combined genotypes was observed in the overall PCAG subjects (p<0.05, χ2=20.1). This difference was particularly apparent in the TTAA and TTAC combinations that were completely absent in the control groups (p<0.05. χ2=49.6). Mean serum tHcy levels were found to be significantly increased in the POAG (15.2±1.28 µmol/l, p<0

  19. Identification of a novel homozygous TRAPPC9 gene mutation causing non-syndromic intellectual disability, speech disorder, and secondary microcephaly.

    PubMed

    Abbasi, Ansar A; Blaesius, Kathrin; Hu, Hao; Latif, Zahid; Picker-Minh, Sylvie; Khan, Muhammad N; Farooq, Sundas; Khan, Muzammil A; Kaindl, Angela M

    2017-12-01

    TRAPPC9 gene mutations have been linked recently to autosomal recessive mental retardation 13 (MRT13; MIM#613192) with only eight families reported world-wide. We assessed patients from two consanguineous pedigrees of Pakistani descent with non-syndromic intellectual disability and postnatal microcephaly through whole exome sequencing (WES) and cosegregation analysis. Here we report six further patients from two pedigrees with homozygous TRAPPC9 gene mutations, the novel nonsense mutation c.2065G>T (p.E689*) and the previously identified nonsense mutation c.1423C>T (p.R475*). We provide an overview of previously reported clinical features and highlight common symptoms and variability of MRT13. Common findings are intellectual disability and absent speech, and frequently microcephaly, motor delay and pathological findings on MRI including diminished cerebral white matter volume are present. Mutations in TRAPPC9 should be considered in non-syndromic autosomal recessive intellectual disability with severe speech disorder. © 2017 Wiley Periodicals, Inc.

  20. A novel homozygous HOXB1 mutation in a Turkish family with hereditary congenital facial paresis.

    PubMed

    Sahin, Yavuz; Güngör, Olcay; Ayaz, Akif; Güngör, Gülay; Sahin, Bedia; Yaykasli, Kursad; Ceylaner, Serdar

    2017-02-01

    Hereditary congenital facial paresis (HCFP) is characterized by isolated dysfunction of the facial nerve (CN VII) due to congenital cranial dysinnervation disorders. HCFP has genetic heterogeneity and HOXB1 is the first identified gene. We report the clinical, radiologic and molecular investigations of three patients admitted for HCFP in a large consanguineous Turkish family. High-throughput sequencing and Sanger sequencing of all patients revealed a novel homozygous mutation p.Arg230Trp (c.688C>T) within the HOXB1 gene. The report of the mutation brings the total number of HOXB1 mutations identified in HCFP to four. The results of this study emphasize that in individuals with congenital facial palsy accompanied by hearing loss and dysmorphic facial features, HOXB1 mutation causing HCFP should be kept in mind. Copyright © 2016 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

  1. Diploid yeast cells yield homozygous spontaneous mutations

    NASA Technical Reports Server (NTRS)

    Esposito, M. S.; Bruschi, C. V.; Brushi, C. V. (Principal Investigator)

    1993-01-01

    A leucine-requiring hybrid of Saccharomyces cerevisiae, homoallelic at the LEU1 locus (leu1-12/leu1-12) and heterozygous for three chromosome-VII genetic markers distal to the LEU1 locus, was employed to inquire: (1) whether spontaneous gene mutation and mitotic segregation of heterozygous markers occur in positive nonrandom association and (2) whether homozygous LEU1/LEU1 mutant diploids are generated. The results demonstrate that gene mutation of leu1-12 to LEU1 and mitotic segregation of heterozygous chromosome-VII markers occur in strong positive nonrandom association, suggesting that the stimulatory DNA lesion is both mutagenic and recombinogenic. In addition, genetic analysis of diploid Leu+ revertants revealed that approximately 3% of mutations of leu1-12 to LEU1 result in LEU1/LEU1 homozygotes. Red-white sectored Leu+ colonies exhibit genotypes that implicate post-replicational chromatid breakage and exchange near the site of leu1-12 reversion, chromosome loss, and subsequent restitution of diploidy, in the sequence of events leading to mutational homozygosis. By analogy, diploid cell populations can yield variants homozygous for novel recessive gene mutations at biologically significant rates. Mutational homozygosis may be relevant to both carcinogenesis and the evolution of asexual diploid organisms.

  2. Homozygous STIL Mutation Causes Holoprosencephaly and Microcephaly in Two Siblings

    PubMed Central

    Mouden, Charlotte; de Tayrac, Marie; Dubourg, Christèle; Rose, Sophie; Carré, Wilfrid; Hamdi-Rozé, Houda; Babron, Marie-Claude; Akloul, Linda; Héron-Longe, Bénédicte; Odent, Sylvie; Dupé, Valérie; Giet, Régis; David, Véronique

    2015-01-01

    Holoprosencephaly (HPE) is a frequent congenital malformation of the brain characterized by impaired forebrain cleavage and midline facial anomalies. Heterozygous mutations in 14 genes have been identified in HPE patients that account for only 30% of HPE cases, suggesting the existence of other HPE genes. Data from homozygosity mapping and whole-exome sequencing in a consanguineous Turkish family were combined to identify a homozygous missense mutation (c.2150G>A; p.Gly717Glu) in STIL, common to the two affected children. STIL has a role in centriole formation and has previously been described in rare cases of microcephaly. Rescue experiments in U2OS cells showed that the STIL p.Gly717Glu mutation was not able to fully restore the centriole duplication failure following depletion of endogenous STIL protein indicating the deleterious role of the mutation. In situ hybridization experiments using chick embryos demonstrated that expression of Stil was in accordance with a function during early patterning of the forebrain. It is only the second time that a STIL homozygous mutation causing a recessive form of HPE was reported. This result also supports the genetic heterogeneity of HPE and increases the panel of genes to be tested for HPE diagnosis. PMID:25658757

  3. The association of factor V G1961A (factor V Leiden), prothrombin G20210A, MTHFR C677T and PAI-1 4G/5G polymorphisms with recurrent pregnancy loss in Bosnian women.

    PubMed

    Jusić, Amela; Balić, Devleta; Avdić, Aldijana; Pođanin, Maja; Balić, Adem

    2018-08-01

    Aim To investigate association of factor V Leiden, prothrombin G20210A, MTHFR C677T and PAI-1 4G/5G polymorphisms with recurrent pregnancy loss in Bosnian women. Methods A total of 60 women with two or more consecutive miscarriages before 20 weeks of gestation with the same partners and without history of known causes or recurrent pregnancy loss were included. A control group included 80 healthy women who had one or more successful pregnancies without history of any complication which could be associated with miscarriages. Genotyping of factor V Leiden, prothrombin G20210A, MTHFR C677T and PAI-1 4G/5G polymorphisms were performed by polymerase chain reaction/restriction fragments length polymorphism method (PCR/RFLP). Results Both factor V Leiden and MTHFR C677T polymorphisms were significantly associated with recurrent pregnancy loss (RPL) in Bosnian women while prothrombin G20210A and PAI-1 4G/5G polymorphisms did not show strongly significant association. Conclusion The presence of thrombophilic polymorphisms may predispose women to recurrent pregnancy loss. Future investigation should be addressed in order to find when carriers of those mutations, polymorphisms should be treated with anticoagulant therapy. Copyright© by the Medical Assotiation of Zenica-Doboj Canton.

  4. Clinical and Molecular Genetic Analysis in Three Children with Wolfram Syndrome: A Novel WFS1 Mutation (c.2534T>A)

    PubMed Central

    Çelmeli, Gamze; Türkkahraman, Doğa; Çürek, Yusuf; Houghton, Jayne; Akçurin, Sema; Bircan, İffet

    2017-01-01

    Wolfram syndrome (WS) is an autosomal recessive disorder caused by mutations in WFS1 gene. The clinical features include diabetes insipidus, diabetes mellitus (DM), optic atrophy, deafness, and other variable clinical manifestations. In this paper, we present the clinical and genetic characteristics of 3 WS patients from 3 unrelated Turkish families. Clinical characteristics of the patients and the age of onset of symptoms were quite different in each pedigree. The first two cases developed all symptoms of the disease in their first decade of life. The heterozygous father of case 2 was symptomatic with bilateral deafness. The first ocular finding of one patient (patient 3) was bilateral cataract which was accompanying DM as a first feature of the syndrome. In this patient’s family, there were two members with features suggestive of WS. Previously known homozygous mutations, c.460+1G>A in intron 4 and c.1885C>T in exon 8, were identified in these cases. A novel homozygous c.2534T>A mutation was also detected in the exon 8 of WFS1 gene. Because of the rarity and heterogeneity of WS, detection of specific and nonspecific clinical signs including ocular findings and family history in non-autoimmune, insulinopenic diabetes cases should lead to a tentative diagnosis of WS. Genetic testing is required to confirm the diagnosis. PMID:27468121

  5. Plasminogen activator inhibitor-1 4G/5G and the MTHFR 677C/T polymorphisms and susceptibility to polycystic ovary syndrome: a meta-analysis.

    PubMed

    Lee, Young Ho; Song, Gwan Gyu

    2014-04-01

    The aim of this study was to explore whether the plasminogen activator inhibitor-1 (PAI-1) 4G/5G and the methylenetetrahydrofolate reductase (MTHFR) 677C/T polymorphisms are associated with susceptibility to polycystic ovary syndrome (PCOS). Meta-analyses were conducted to determine the association between the PAI-1 4G/5G and MTHFR 677C/T polymorphisms and PCOS using: (1) allele contrast (2) homozygote contrast, (3) recessive, and (4) dominant models. For meta-analysis, nine studies of the PAI-1 4G/5G polymorphism with 2384 subjects (PCOS, 1615; controls, 769) and eight studies of the MTHFR 677C/T polymorphism with 1270 study subjects were included. Meta-analysis of all study subjects showed no association between PCOS and the PAI-1 4G allele (OR=0.949, 95% CI=0.671-1.343, p=0.767). Stratification by ethnicity, however, indicated a significant association between the PAI-1 4G allele and PCOS in Turkish and Asian populations (OR=0.776, 95% CI=0.602-0.999, p=0.049; OR=1.749, 95% CI=1.297-2.359, p=2.5×10(-5) respectively). In addition, meta-analysis indicated an association between PCOS and the PAI-1 4G4G+4G5G genotype in Europeans (OR=1.406, 95% CI=1.025-1.928, p=0.035). However, meta-analysis of all study subjects showed no association between PCOS and the MTHFR 677T allele (OR=0.998, 95% CI=0.762-1.307, p=0.989), including Europeans (OR=0.806, 95% CI=0.610-1.063, p=0.126). Meta-analysis showed no association between PCOS and the MTHFR 677C/T polymorphism using homozygote contrast, and recessive and dominant models. In conclusion, meta-analysis suggests the PAI-1 4G/5G polymorphism is associated with susceptibility to PCOS in European, Turkish, and Asian populations, but the MTHFR 677C/T polymorphism is not associated with susceptibility to PCOS in Europeans. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  6. Response of serum and red blood cell folate concentrations to folic acid supplementation depends on methylenetetrahydrofolate reductase C677T genotype: Results from a crossover trial

    PubMed Central

    Anderson, Cheryl A.M.; Beresford, Shirley A. A.; McLerran, Dale; Lampe, Johanna W.; Deeb, Samir; Feng, Ziding; Motulsky, Arno G.

    2013-01-01

    Scope By increasing blood folate concentrations, folic acid supplementation reduces risk for neural tube defect-affected pregnancies, and lowers homocysteine concentrations. We assessed response of red blood cell (RBC) and serum folate to folic acid supplementation, and examined association of response with the genetic polymorphism C677T of the methylenetetrahydrofolate NAD(P)H (MTHFR) gene. Methods and Results Randomized, controlled, crossover trial with two folic acid supplement treatment periods and a 30-week washout period. The primary outcome is blood folate (serum and RBC) concentrations. Volunteers (n=142) aged 18-69 were randomized to two of three doses (0, 200, and 400 μg) of folic acid for twelve weeks. Serum folate response depended on treatment period with significant responses to 200 μg seen only in the second treatment periods (4.4 ng/mL or 3.4 ng/mL). Additionally, serum folate increased as folic acid dose increased to 400 μg (p< 0.01) and response was greater after the washout period (8.7 ng/mL), than after a 6-week run-in (2.3 ng/mL). The differential change attributable to a daily supplement of 400 μg compared to 200 μg was 96.8 ng/mL; while the change attributable to 400 μg compared to 0 μg was 121.4. Increases in RBC folate concentrations with 400 μg occurred within MTHFR gene mutation (C677T); and in the African American group. Conclusions Serum folate concentration is responsive to modest increases in folic acid intake. Red blood cell folate increases only with higher additional doses of folic acid supplementation, and this is true for each MTHFR C677T genotype. PMID:23456769

  7. Association of methylenetetrahytrofolate reductase (MTHFR) C677T and A1298C polymorphisms with the susceptibility of childhood acute lymphoblastic leukaemia (ALL) in Chinese population

    PubMed Central

    2014-01-01

    Background The aim of this study was to investigate the relationship between the polymorphisms of the methylenetetrahytrofolate reductase (MTHFR) gene and susceptibility to childhood acute lymphoblastic leukemia (ALL). Methods A case–control study was conducted among 98 children with ALL and 93 age- and sex- matched non-ALL controls. Genotyping of MTHFR C677T and A1298C polymorphisms was performed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). The odds ratios (ORs) of MTHFR genotypes were used to assess the associations of these polymorphisms with childhood ALL susceptibility. Results No significant differences were observed for frequencies of the 677CC, 677CT and 677TT genotypes between patients and controls. Frequencies of the 1298AA, 1298 AC and 1298CC genotypes between the two groups were significantly different. The risk of ALL with the 1298C allele carriers (AC + CC) was elevated by 1.1 times compared with the AA genotype [OR = 2.100; 95% CI (1.149; 3.837); P = 0.015]. Conclusions The MTHFR A1298C polymorphism is associated with susceptibility to childhood ALL in the Chinese population. PMID:24476575

  8. Association of methylenetetrahytrofolate reductase (MTHFR) C677T and A1298C polymorphisms with the susceptibility of childhood acute lymphoblastic leukaemia (ALL) in Chinese population.

    PubMed

    Li, Xiaolei; Liao, Qingchuan; Zhang, Shunguo; Chen, Minling

    2014-01-29

    The aim of this study was to investigate the relationship between the polymorphisms of the methylenetetrahytrofolate reductase (MTHFR) gene and susceptibility to childhood acute lymphoblastic leukemia (ALL). A case-control study was conducted among 98 children with ALL and 93 age- and sex- matched non-ALL controls. Genotyping of MTHFR C677T and A1298C polymorphisms was performed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). The odds ratios (ORs) of MTHFR genotypes were used to assess the associations of these polymorphisms with childhood ALL susceptibility. No significant differences were observed for frequencies of the 677CC, 677CT and 677TT genotypes between patients and controls. Frequencies of the 1298AA, 1298 AC and 1298CC genotypes between the two groups were significantly different. The risk of ALL with the 1298C allele carriers (AC + CC) was elevated by 1.1 times compared with the AA genotype [OR = 2.100; 95% CI (1.149; 3.837); P = 0.015]. The MTHFR A1298C polymorphism is associated with susceptibility to childhood ALL in the Chinese population.

  9. Elevated heart rate triggers action potential alternans and sudden death. translational study of a homozygous KCNH2 mutation.

    PubMed

    Schweigmann, Ulrich; Biliczki, Peter; Ramirez, Rafael J; Marschall, Christoph; Takac, Ina; Brandes, Ralf P; Kotzot, Dieter; Girmatsion, Zenawit; Hohnloser, Stefan H; Ehrlich, Joachim R

    2014-01-01

    Long QT syndrome (LQTS) leads to arrhythmic events and increased risk for sudden cardiac death (SCD). Homozygous KCNH2 mutations underlying LQTS-2 have previously been termed "human HERG knockout" and typically express severe phenotypes. We studied genotype-phenotype correlations of an LQTS type 2 mutation identified in the homozygous index patient from a consanguineous Turkish family after his brother died suddenly during febrile illness. Clinical work-up, DNA sequencing, mutagenesis, cell culture, patch-clamp, in silico mathematical modelling, protein biochemistry, confocal microscopy were performed. Genetic analysis revealed a homozygous C-terminal KCNH2 mutation (p.R835Q) in the index patient (QTc ∼506 ms with notched T waves). Parents were I° cousins - both heterozygous for the mutation and clinically unremarkable (QTc ∼447 ms, father and ∼396 ms, mother). Heterologous expression of KCNH2-R835Q showed mildly reduced current amplitudes. Biophysical properties of ionic currents were also only nominally changed with slight acceleration of deactivation and more negative V50 in R835Q-currents. Protein biochemistry and confocal microscopy revealed similar expression patterns and trafficking of WT and R835Q, even at elevated temperature. In silico analysis demonstrated mildly prolonged ventricular action potential duration (APD) compared to WT at a cycle length of 1000 ms. At a cycle length of 350 ms M-cell APD remained stable in WT, but displayed APD alternans in R835Q. Kv11.1 channels affected by the C-terminal R835Q mutation display mildly modified biophysical properties, but leads to M-cell APD alternans with elevated heart rate and could precipitate SCD under specific clinical circumstances associated with high heart rates.

  10. Influence of Combined Methionine Synthase (MTR 2756A > G) and Methylenetetrahydrofolate Reductase (MTHFR 677C > T) Polymorphisms to Plasma Homocysteine Levels in Korean Patients with Ischemic Stroke

    PubMed Central

    Kim, Ok Joon; Hong, Sun Pyo; Ahn, Jung Yong; Hong, Seung Ho; Hwang, Tae Sun; Kim, Soo Ok; Yoo, Wangdon; Oh, Doyeun

    2007-01-01

    Purpose Methionine synthase (MTR) and 5,10-methylenetetrahydrofolate reductase (MTHFR) are the main regulatory enzymes for homocysteine metabolism. The present case-control study was conducted to determine whether there is an association between the MTR 2756A > G or MTHFR 677C > T polymorphism and plasma homocysteine concentration in Korean subjects with ischemic stroke. Materials and Methods DNA samples of 237 patients who had an ischemic stroke and 223 age and sex-matched controls were studied. MTR 2756A > G and MTHFR 677C > T genotypes were determined by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). Results Frequencies of mutant alleles for MTR and MTHFR polymorphisms were not significantly different between the controls and cases. The patient group, however, had significantly higher homocysteine concentrations of the MTR 2756AA and MTHFR 677TT genotypes than the control group (p = 0.04 for MTR, p = 0.01 for MTHFR). The combined MTR 2756AA and MTHFR 677TT genotype (p = 0.04) and the homocysteine concentrations of the patient group were also higher than those of the controls. In addition, the genotype distribution was significant in the MTHFR 677TT genotype (p = 0.008) and combined MTR 2756AA and MTHFR 677TT genotype (p = 0.03), which divided the groups into the top 20% and bottom 20% based on their homocysteine levels. Conclusion The results of the present study demonstrate that the MTR 2756A > G and MTHFR 677C > T polymorphisms interact with elevated total homocysteine (tHcy) levels, leading to an increased risk of ischemic stroke. PMID:17461517

  11. Correlations of MTHFR 677C>T Polymorphism with Cardiovascular Disease in Patients with End-Stage Renal Disease: A Meta-Analysis

    PubMed Central

    Gao, Xian-Hui; Zhang, Guo-Yi; Wang, Ying; Zhang, Hui-Ying

    2014-01-01

    Objective This meta-analysis was conducted to evaluate the correlations of a common polymorphism (677C>T) in the methylenetetrahydrofolate reductase (MTHFR) gene with risk of cardiovascular disease (CVD) in patients with end-stage renal disease (ESRD). Method The following electronic databases were searched without language restrictions: Web of Science (1945∼2013), the Cochrane Library Database (Issue 12, 2013), MEDLINE (1966∼2013), EMBASE (1980∼2013), CINAHL (1982∼2013) and the Chinese Biomedical Database (CBM) (1982∼2013). Meta-analysis was performed using STATA statistical software. Odds ratios (ORs) with their 95% confidence intervals (95%CIs) were calculated. Results Eight cohort studies met all inclusion criteria and were included in this meta-analysis. A total of 2,292 ESRD patients with CVD were involved in this meta-analysis. Our meta-analysis results revealed that the MTHFR 677C>T polymorphism might increase the risk of CVD in ESRD patients (TT vs. CC: OR = 2.75, 95%CI = 1.35∼5.59, P = 0.005; CT+TT vs. CC: OR = 1.39, 95%CI = 1.09∼1.78, P = 0.008; TT vs. CC+CT: OR = 2.52, 95%CI = 1.25∼5.09, P = 0.010; respectively). Further subgroup analysis by ethnicity suggested that the MTHFR 677C>T polymorphism was associated with an elevated risk for CVD in ESRD patients among Asians (TT vs. CC: OR = 3.38, 95%CI = 1.11∼10.28, P = 0.032; CT+TT vs. CC: OR = 1.44, 95%CI = 1.05∼1.97, P = 0.022; TT vs. CC+CT: OR = 3.15, 95%CI = 1.02∼9.72, P = 0.046; respectively), but not among Africans or Caucasians (all P>0.05). Conclusion Our findings indicate that the MTHFR 677C>T polymorphism may be associated with an elevated risk for CVD in ESRD patients, especially among Asians. PMID:25050994

  12. Rare intracranial cholesterol deposition and a homozygous mutation of LDLR in a familial hypercholesterolemia patient.

    PubMed

    Li, Haoxian; Zhang, Yanghui; Wei, Xianda; Peng, Ying; Yang, Pu; Tan, Hu; Chen, Chen; Pan, Qian; Liang, Desheng; Wu, Lingqian

    2015-09-15

    Familial hypercholesterolemia (FH MIM# 143890) is one of the most common autosomal inherited diseases. FH is characterized by elevated plasma levels of total cholesterol and low-density lipoprotein-cholesterol. Mutation in the LDLR gene, which encodes the LDL receptor protein, is responsible for most of the morbidity of FH. The incidence of heterozygous FH is about 1/500, whereas the incidence of homozygous FH is only 1/1,000,000 in Caucasian population. In this study, we report a homozygous LDLR mutation (c.298G>A) in a familial hypercholesterolemia patient, who exhibited intracranial cholesterol deposition, which is a rare addition to the common FH phenotypes. The proband's consanguineous parents have the same heterozygous mutation with elevated concentrations of LDL-C but no xanthoma. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. MTHFR C677T genotype influences the isotopic enrichment of one-carbon metabolites in folate-compromised men consuming d9-choline.

    PubMed

    Yan, Jian; Wang, Wei; Gregory, Jesse F; Malysheva, Olga; Brenna, J Thomas; Stabler, Sally P; Allen, Robert H; Caudill, Marie A

    2011-02-01

    Homozygosity for the variant 677T allele in the methylenetetrahydrofolate reductase (MTHFR) gene increases the requirement for folate and may alter the metabolic use of choline. The choline adequate intake is 550 mg/d for men, although the metabolic consequences of consuming extra choline are unclear. Deuterium-labeled choline (d9-choline) as tracer was used to determine the differential effects of the MTHFR C677T genotype and the effect of various choline intakes on the isotopic enrichment of choline derivatives in folate-compromised men. Mexican American men with the MTHFR 677CC or 677TT genotype consumed a diet providing 300 mg choline/d plus supplemental choline chloride for total choline intakes of 550 (n = 11; 4 with 677CC and 7 with 677TT) or 1100 (n = 12; 4 with 677CC and 8 with 677TT) mg/d for 12 wk. During the last 3 wk, 15% of the total choline intake was provided as d9-choline. Low but measurable enrichments of the choline metabolites were achieved, including that of d3-phosphatidylcholine (d3-PtdCho)--a metabolite produced in the de novo pathway via choline-derived methyl groups. Men with the MTHFR 677TT genotype had a higher urinary enrichment ratio of betaine to choline (P = 0.041), a higher urinary enrichment of sarcosine (P = 0.041), and a greater plasma enrichment ratio of d9-betaine to d9-PtdCho with the 1100 mg choline/d intake (P = 0.033). These data show for the first time in humans that choline itself is a source of methyl groups for de novo PtdCho biosynthesis and indicate that the MTHFR 677TT genotype favors the use of choline as a methyl donor.

  14. Genetic polymorphism of MTHFR C677T and premature coronary artery disease susceptibility: A meta-analysis.

    PubMed

    Hou, Xiaowen; Chen, Xin; Shi, Jingpu

    2015-07-01

    The association between 5, 10-methylenetetrahydrofolate reductase (MTHFR) C677T gene polymorphism and premature coronary artery disease (PCAD) is controversial. To explore a more precise estimation of the association, a meta-analysis was conducted in the present study. The relevant studies were identified by searching PubMed, EMBASE, the Web of Science, Cochrane Collaboration Database, Chinese National Knowledge Infrastructure, Wanfang Database and China Biological Medicine up to November, 2014. The meta-analysis was performed by STATA 11. 21 studies with a total of 6912 subjects, including 2972 PCAD patients and 3940 controls. The pooled analysis showed that MTHFR C677T gene polymorphism was probably associated with PCAD (CT vs. CC: OR=1.13, 95% CI=1.01-1.27; dominant model: OR=1.16, 95% CI=1.04-1.29; recessive model: OR=1.19, 95% CI=1.00-1.40; allele analysis: OR=1.17, 95% CI=1.01-1.34). Subgroup analysis by plasma homocysteine concentration showed a significant association in the homocysteine >15μmol/L subgroup (CT vs. CC: OR=1.44, 95% CI=1.10-1.88; TT vs. CC: OR=2.51, 95% CI=1.12-5.63; dominant model: OR=1.51, 95% CI=1.16-1.96; recessive model: OR=2.33, 95% CI=1.05-5.20; allele analysis: OR=1.48, 95% CI=1.18-1.87). Subgroup analysis by continent displayed a significant association among the Asian population (CT vs. CC: OR=1.51, 95% CI=1.23-1.86; TT vs. CC: OR=2.81, 95% CI=1.87-4.23; dominant model: OR=1.65, 95% CI=1.35-2.01; recessive model: OR=2.22, 95% CI=1.53-3.21; allele analysis: OR=1.61, 95% CI=1.37-1.89). The statistical stability and reliability was demonstrated by sensitivity analysis and publication bias outcomes. In conclusion, the meta-analysis suggests that MTHFR C677T gene polymorphism may be associated with PCAD. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. A case of recurrent pancytopenia in a patient with acute promyelocytic leukemia on maintenance chemotherapy and concomitant methyltetrahydrofolate reductase and thiopurine S-methyltransferase mutation - review of literature.

    PubMed

    Keung, Yi-Kong; Keung, Lap-Woon; Hong-Lung Hu, Eddie

    2016-06-01

    Pharmacogenetics is a study of how genetic variation of an individual affects the drug response. We report a case of recurrent pancytopenia resulting from maintenance chemotherapy in a patient with acute promyelocytic leukemia and two pharmacogenetic mutations, namely, methylene tetrahydrofolate reductase C677T homozygous mutation and thiopurine methyltransferase mutation. © The Author(s) 2015.

  16. Status of vitamin B-12 and B-6 but not of folate, homocysteine and the methylenetetrahydrofolate reductase C677T polymorphism are associated with impaired cognition and depression in adults

    USDA-ARS?s Scientific Manuscript database

    The C677T polymorphism of the methylene tetrahydrofolate reductase (MTHFR) gene differs in frequency in different ethnic groups which have differing prevalence of age-related cognitive impairments. We used a battery of neuropsychological tests to examine association of the MTHFR C677T polymorphism w...

  17. Methylenetetrahydrofolate Reductase Gene Polymorphisms (C677T and A1298C) and Hemorrhagic Stroke in Moroccan Patients.

    PubMed

    Abidi, Omar; Haissam, Mohammed; Nahili, Halima; El Azhari, Abdessamad; Hilmani, Said; Barakat, Abdelhamid

    2018-07-01

    The number of deaths from hemorrhagic strokes is about twice as high than the number of deaths from ischemic strokes. Genetic risk assessment could play important roles in preventive and therapeutic strategies. The present study was aimed to evaluate whether the MTHFR gene polymorphisms could increase the risk of cerebral hemorrhage in Moroccan patients. A total of 113 patients with hemorrhagic stroke and 323 healthy controls were included in this case-control study. The C677T (rs1801133) and A1298C (rs1801131) MTHFR gene polymorphisms were genotyped by Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) method in all patients and controls. The genotype and allele frequencies were compared between groups using appropriate statistical analyses. Both groups, patients and controls, were in accordance with the Hardy-Weinberg Equilibrium. For the C677T polymorphism, the frequencies of the CC, CT, and TT genotypes were 50.44% versus 46.13%, 39.82% versus 43.03, and 9.73% versus 10.84% in controls versus patients, respectively, whereas for the A1298C polymorphism, the frequencies of the AA, AC, and CC genotypes were 56.64% versus 57.59%, 40.71% versus 37.15, and 2.65% versus 5.26% in controls versus patients, respectively. No statistically significant difference has been proved between patients and controls frequencies (P >.05) for all additive, recessive, and dominant models. Additional analyses including genotypes combination, allelic frequencies, and hemorrhagic stroke patient subtypes did not show any statistically significant difference between controls and patients/subgroup patients. Our findings suggested no association between MTHFR gene polymorphisms and susceptibility to hemorrhagic strokes in Moroccan patients. Further investigations should be conducted to elucidate the roles of other gene variants in the pathogenesis of this condition. Copyright © 2018 National Stroke Association. Published by Elsevier Inc. All rights reserved.

  18. Additive Interaction of MTHFR C677T and MTRR A66G Polymorphisms with Being Overweight/Obesity on the Risk of Type 2 Diabetes.

    PubMed

    Zhi, Xueyuan; Yang, Boyi; Fan, Shujun; Li, Yongfang; He, Miao; Wang, Da; Wang, Yanxun; Wei, Jian; Zheng, Quanmei; Sun, Guifan

    2016-12-15

    Although both methylenetetrahydrofolate reductase ( MTHFR ) C677T and methionine synthase reductase ( MTRR ) A66G polymorphisms have been associated with type 2 diabetes (T2D), their interactions with being overweight/obesity on T2D risk remain unclear. To evaluate the associations of the two polymorphisms with T2D and their interactions with being overweight/obesity on T2D risk, a case-control study of 180 T2D patients and 350 healthy controls was conducted in northern China. Additive interaction was estimated using relative excess risk due to interaction (RERI), attributable proportion due to interaction (AP) and synergy index (S). After adjustments for age and gender, borderline significant associations of the MTHFR C677T and MTRR A66G polymorphisms with T2D were observed under recessive (OR = 1.43, 95% CI: 0.98-2.10) and dominant (OR = 1.43, 95% CI: 1.00-2.06) models, respectively. There was a significant interaction between the MTHFR 677TT genotype and being overweight/obesity on T2D risk (AP = 0.404, 95% CI: 0.047-0.761), in addition to the MTRR 66AG/GG genotypes (RERI = 1.703, 95% CI: 0.401-3.004; AP = 0.528, 95% CI: 0.223-0.834). Our findings suggest that individuals with the MTHFR 677TT or MTRR 66AG/GG genotypes are more susceptible to the detrimental effect of being overweight/obesity on T2D. Further large-scale studies are still needed to confirm our findings.

  19. GNE Myopathy in Turkish Sisters with a Novel Homozygous Mutation

    PubMed Central

    Diniz, Gulden; Secil, Yaprak; Ceylaner, Serdar; Tokucoglu, Figen; Türe, Sabiha; Celebisoy, Mehmet; İncesu, Tülay Kurt; Akhan, Galip

    2016-01-01

    Background. Hereditary inclusion body myopathy is caused by biallelic defects in the GNE gene located on chromosome 9p13. It generally affects adults older than 20 years of age. Methods and Results. In this study, we present two Turkish sisters with progressive myopathy and describe a novel mutation in the GNE gene. Both sisters had slightly higher levels of creatine kinase (CK) and muscle weakness. The older sister presented at 38 years of age with an inability to climb steps, weakness, and a steppage gait. Her younger sister was 36 years old and had similar symptoms. The first symptoms of the disorder were seen when the sisters were 30 and 34 years old, respectively. The muscle biopsy showed primary myopathic features and presence of rimmed vacuoles. DNA analysis demonstrated the presence of previously unknown homozygous mutations [c.2152 G>A (p.A718T)] in the GNE genes. Conclusion. Based on our literature survey, we believe that ours is the first confirmed case of primary GNE myopathy with a novel missense mutation in Turkey. These patients illustrate that the muscle biopsy is still an important method for the differential diagnosis of vacuolar myopathies in that the detection of inclusions is required for the definitive diagnosis. PMID:27298745

  20. Identification of a novel homozygous mutation in MYO3A in a Chinese family with DFNB30 non-syndromic hearing impairment.

    PubMed

    Qu, Ronggui; Sang, Qing; Xu, Yao; Feng, Ruizhi; Jin, Li; He, Lin; Wang, Lei

    2016-05-01

    Hearing loss is a common sensory impairment. Several genetic loci or genes responsible for non-syndrome hearing loss have been identified, including the well-known deafness genes GJB2, MT-RNR1 and SLC26A4. MYO3A belongs to the myosin superfamily. Previously only three mutations in this gene have been found in an Isreali family with DFNB30, in which patients demonstrated progressive hearing loss. In this study, we characterized a consanguineous Kazakh family with congenital hearing loss. By targeted sequence capture and next-generation sequencing, we identified a homozygous mutation and did bioinformatics analysis to this mutation. A homozygous mutation, MYO3A:c.1841C>T (p.S614F), was identified to be responsible for the disease. Ser614 is located in the motor domain of MYO3A that is highly conserved among different species. Molecular modeling predicts that the conserved Ser614 may play an important role in maintaining the stability of β-sheet and the interaction between neighboring β-strand. This is the second report on MYO3A mutations in deafness and the first report in China. The finding help facilitate establishing a better relationship between MYO3A mutation and hearing phenotypes. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  1. MTHFR c.677C>T is a risk factor for non-syndromic cleft lip with or without cleft palate in Chile.

    PubMed

    Ramírez-Chau, C; Blanco, R; Colombo, A; Pardo, R; Suazo, J

    2016-10-01

    The functional variant within the 5,10-methylenetetrahydrofolate reductase (MTHFR) gene c.677C>T, producing alterations in folate metabolism, has been associated with the risk of non-syndromic cleft lip with or without cleft palate (NSCL/P). We assessed this association in a Chilean population using a combined analysis of case-control and case-parent trio samples. Samples of 165 cases and 291 controls and 121 case-parent trios (sharing the cases) were genotyped. Odds ratio (OR) was estimated for case-control (allele and genotype frequency differences), and this result was confirmed by allele transmission distortion in trios. Due to that these samples are not independent, a combined OR was also computed. Maternal genotype effect was additionally evaluated based on a log-linear method. Borderline but not significant OR (1.28; CI 0.97-1.69) was observed for risk allele (T) in the case-control sample. However, triad sample showed a significant association (OR 1.56: CI 1.09-2.25) which was confirmed by the combined OR (1.37; CI 1.11-1.71). Maternal genotype has been also associated with the phenotype (P = 0.002). In contrast to previous reports considering Chilean subjects, our results demonstrated that the offspring and maternal genotypes for MTHFR c.677C>T variant are strongly associated with NSCL/P in this Chilean population. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  2. DPYD*2A and MTHFR C677T predict toxicity and efficacy, respectively, in patients on chemotherapy with 5-fluorouracil for colorectal cancer.

    PubMed

    Nahid, Noor Ahmed; Apu, Mohd Nazmul Hasan; Islam, Md Reazul; Shabnaz, Samia; Chowdhury, Surid Mohammad; Ahmed, Maizbha Uddin; Nahar, Zabun; Islam, Md Siddiqul; Islam, Mohammad Safiqul; Hasnat, Abul

    2018-01-01

    Significant inter-individual variation in the sensitivity to 5-fluorouracil (5-FU) represents a major therapeutic hindrance either by impairing drug response or inducing adverse drug reactions (ADRs). This study aimed at exploring the cause behind this inter-individual alterations in consequences of 5-fluorouracil-based chemotherapy by investigating the effects of DPYD*2A and MTHFR C677T polymorphisms on toxicity and response of 5-FU in Bangladeshi colorectal cancer patients. Colorectal cancer patients (n = 161) receiving 5-FU-based chemotherapy were prospectively enrolled. DPYD and MTHFR polymorphisms were assessed in peripheral leukocytes. Multivariate analyses were applied to evaluate which variables could predict chemotherapy-induced toxicity and efficacy. Multivariate analyses showed that DPYD*2A polymorphism was a predictive factor (P = 0.023) for grade 3 and grade 4 5-fluorouracil-related toxicities. Although MTHFR C677T polymorphism might act as forecasters for grade 3 or grade 4 neutropenia, diarrhea, and mucositis, this polymorphism was found to increase significantly (P = 0.006) the response of 5-FU. DPYD*2A and MTHFR C677T polymorphisms could explain 5-FU toxicity or clinical outcome in Bangladeshi colorectal patients.

  3. Homozygous SLC2A9 Mutations Cause Severe Renal Hypouricemia

    PubMed Central

    Gray, Nicola K.; Campbell, Susan; Shu, Xinhua; Sawyer, Lindsay; Richardson, William; Rechavi, Gideon; Amariglio, Ninette; Ganon, Liat; Sela, Ben-Ami; Bahat, Hilla; Goldman, Michael; Weissgarten, Joshua; Millar, Michael R.; Wright, Alan F.; Holtzman, Eliezer J.

    2010-01-01

    Hereditary hypouricemia may result from mutations in the renal tubular uric acid transporter URAT1. Whether mutation of other uric acid transporters produces a similar phenotype is unknown. We studied two families who had severe hereditary hypouricemia and did not have a URAT1 defect. We performed a genome-wide homozygosity screen and linkage analysis and identified the candidate gene SLC2A9, which encodes the glucose transporter 9 (GLUT9). Both families had homozygous SLC2A9 mutations: A missense mutation (L75R) in six affected members of one family and a 36-kb deletion, resulting in a truncated protein, in the other. In vitro, the L75R mutation dramatically impaired transport of uric acid. The mean concentration of serum uric acid of seven homozygous individuals was 0.17 ± 0.2 mg/dl, and all had a fractional excretion of uric acid >150%. Three individuals had nephrolithiasis, and three had a history of exercise-induced acute renal failure. In conclusion, homozygous loss-of-function mutations of GLUT9 cause a total defect of uric acid absorption, leading to severe renal hypouricemia complicated by nephrolithiasis and exercise-induced acute renal failure. In addition to clarifying renal handling of uric acid, our findings may provide a better understanding of the pathophysiology of acute renal failure, nephrolithiasis, hyperuricemia, and gout. PMID:19926891

  4. Association between the MTHFR C677T polymorphism and risk of cancer: evidence from 446 case-control studies.

    PubMed

    Xie, Shu-Zhe; Liu, Zhi-Zhong; Yu, Jun-hua; Liu, Li; Wang, Wei; Xie, Dao-Lin; Qin, Jiang-Bo

    2015-11-01

    Many molecular epidemiological studies have been performed to explore the association between MTHFR C677T polymorphism and cancer risk in diverse populations. However, the results were inconsistent. Hence, we performed a meta-analysis to investigate the association between cancer risk and MTHFR C677T (150,086 cases and 200,699 controls from 446 studies) polymorphism. Overall, significantly increased cancer risk was found when all eligible studies were pooled into the meta-analysis. In the further stratified and sensitivity analyses, significantly increased breast cancer risk was found in Asians and Indians, significantly decreased colon cancer risk was found, significantly decreased colorectal cancer risk was found in male population, significantly increased gastric cancer risk was found in Caucasians and Asians, significantly increased hepatocellular cancer risk was found in Asians, significantly decreased adult acute lymphoblastic leukemia (AALL) risk was found in Caucasians, significantly decreased childhood acute lymphoblastic leukemia (CALL) risk was found in Asians, and significantly increased multiple myeloma and NHL risk was found in Caucasians. In summary, this meta-analysis suggests that MTHFR C677T polymorphism is associated with increased breast cancer, gastric cancer, and hepatocellular cancer risk in Asians, is associated with increased gastric cancer, multiple myeloma, and NHL risk in Caucasians, is associated with decreased AALL risk in Caucasians, is associated with decreased CALL risk in Asians, is associated with increased breast cancer risk in Asians, is associated with decreased colon cancer risk, and is associated with decreased colorectal cancer risk in male population. Moreover, this meta-analysis also points out the importance of new studies, such as Asians of HNC, Asians of lung cancer, and Indians of breast cancer, because they had high heterogeneity in this meta-analysis (I(2) > 75%).

  5. Gender-specific interactions of MTHFR C677T and MTRR A66G polymorphisms with overweight/obesity on serum lipid levels in a Chinese Han population.

    PubMed

    Zhi, Xueyuan; Yang, Boyi; Fan, Shujun; Wang, Yanxun; Wei, Jian; Zheng, Quanmei; Sun, Guifan

    2016-10-28

    Little is known regarding the interactions of methylenetetrahydrofolate reductase (MTHFR) C677T and methionine synthase reductase (MTRR) A66G polymorphisms with overweight/obesity on serum lipid profiles. The aim of the current study was to explore interactions between the two polymorphisms and overweight/obesity on four common lipid levels in a Chinese Han population and further to evaluate whether these interactions exhibit gender-specificity. A total of 2239 participants (750 females and 1489 males) were enrolled into this study. The genotypes of the MTHFR C677T and MTRR A66G were determined by a TaqMan assay. Overweight and obesity were defined as a body mass index between 24 and 27.99 and ≥ 28 kg/m 2 , respectively. The interactions were examined by factorial design covariance analysis, and further multiple comparisons were conducted by Bonferroni correction. There was no significant difference in the genotypic and allelic frequencies between females and males (MTHFR 677 T allele: 54.47 % for females and 54.40 % for males; MTRR 66G allele: 24.73 % for females and 24.71 % for males). Interaction between the MTHFR C677T polymorphism and overweight/obesity on serum triglyceride levels, and interaction between the MTRR A66G polymorphism and overweight/obesity on serum high-density lipoprotein cholesterol levels were detected in women (P = 0.015 and P = 0.056, respectively). For female subjects with overweight/obesity, the serum triglyceride levels in MTHFR 677TT genotype [1.09 (0.78-1.50) mmol/L] were significantly higher as compared with MTHFR 677CC genotype [0.90 (0.60-1.15) mmol/L, P = 0.007], and the MTRR 66GG genotype carriers had higher serum high-density lipoprotein cholesterol levels than those with MTRR 66AG genotype (1.46 ± 0.50 vs. 1.19 ± 0.31 mmol/L, P = 0.058). Furthermore, in male subjects with overweight/obesity, the MTHFR 677CT genotype carriers had higher low-density lipoprotein cholesterol levels than those

  6. Homozygous Mutations in WEE2 Cause Fertilization Failure and Female Infertility.

    PubMed

    Sang, Qing; Li, Bin; Kuang, Yanping; Wang, Xueqian; Zhang, Zhihua; Chen, Biaobang; Wu, Ling; Lyu, Qifeng; Fu, Yonglun; Yan, Zheng; Mao, Xiaoyan; Xu, Yao; Mu, Jian; Li, Qiaoli; Jin, Li; He, Lin; Wang, Lei

    2018-04-05

    Fertilization is a fundamental process of development and is a prerequisite for successful human reproduction. In mice, although several receptor proteins have been shown to play important roles in the process of fertilization, only three genes have been shown to cause fertilization failure and infertility when deleted in vivo. In clinical practice, some infertility case subjects suffer from recurrent failure of in vitro fertilization and intracytoplasmic sperm injection attempts due to fertilization failure, but the genetic basis of fertilization failure in humans remains largely unknown. Wee2 is a key oocyte-specific kinase involved in the control of meiotic arrest in mice, but WEE2 has not been associated with any diseases in humans. In this study, we identified homozygous mutations in WEE2 that are responsible for fertilization failure in humans. All four independent affected individuals had homozygous loss-of-function missense mutations or homozygous frameshift protein-truncating mutations, and the phenotype of fertilization failure was shown to follow a Mendelian recessive inheritance pattern. All four mutations significantly decreased the amount of WEE2 protein in vitro and in affected individuals' oocytes in vivo, and they all led to abnormal serine phosphorylation of WEE2 and reduced tyrosine 15 phosphorylation of Cdc2 in vitro. In addition, injection of WEE2 cRNA into affected individuals' oocytes rescued the fertilization failure phenotype and led to the formation of blastocysts in vitro. This work presents a novel gene responsible for human fertilization failure and has implications for future therapeutic treatments for infertility cases. Copyright © 2018 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  7. Fundamental Role of Methylenetetrahydrofolate Reductase 677 C → T Genotype and Flavin Compounds in Biochemical Phenotypes for Schizophrenia and Schizoaffective Psychosis

    PubMed Central

    Fryar-Williams, Stephanie

    2016-01-01

    The Mental Health Biomarker Project (2010–2016) explored variables for psychosis in schizophrenia and schizoaffective disorder. Blood samples from 67, highly characterized symptomatic cases and 67 gender and age matched control participants were analyzed for methyl tetrahydrofolate reductase (MTHFR) 677C → T gene variants and for vitamin B6, B12 and D, folate, unbound copper, zinc cofactors for enzymes in the methylation cycle, and related catecholamine pathways. Urine samples were analyzed for indole-catecholamines, their metabolites, and oxidative-stress marker, hydroxylpyrolline-2-one (HPL). Rating scales were Brief Psychiatric Rating Scale, Positive and Negative Syndrome Scale, Global Assessment of Function scale, Clinical Global Impression (CGI) score, and Social and Occupational Functioning Assessment Scale (SOFAS). Analysis used Spearman’s correlates, receiver operating characteristics and structural equation modeling (SEM). The correlative pattern of variables in the overall participant sample strongly implicated monoamine oxidase (MAO) enzyme inactivity so the significant role of MAO’s cofactor flavin adenine nucleotide and its precursor flavin adenine mononucleotide (FMN) within the biochemical pathways was investigated and confirmed as 71% on SEM of the total sample. Splitting the data sets for MTHFR 677C → T polymorphism variants coding for the MTHFR enzyme, discovered that biochemistry variables relating to the wild-type enzyme differed markedly in pattern from those coded by the homozygous variant and that the hereozygous-variant pattern resembled the wild-type-coded pattern. The MTHFR 677C → T-wild and -heterozygous gene variants have a pattern of depleted vitamin cofactors characteristic of flavin insufficiency with under-methylation and severe oxidative stress. The second homozygous MTHFR 677TT pattern related to elevated copper:zinc ratio and a vitamin pattern related to flavin sufficiency and risk of over-methylation. The

  8. Fundamental Role of Methylenetetrahydrofolate Reductase 677 C → T Genotype and Flavin Compounds in Biochemical Phenotypes for Schizophrenia and Schizoaffective Psychosis.

    PubMed

    Fryar-Williams, Stephanie

    2016-01-01

    The Mental Health Biomarker Project (2010-2016) explored variables for psychosis in schizophrenia and schizoaffective disorder. Blood samples from 67, highly characterized symptomatic cases and 67 gender and age matched control participants were analyzed for methyl tetrahydrofolate reductase (MTHFR) 677C → T gene variants and for vitamin B6, B12 and D, folate, unbound copper, zinc cofactors for enzymes in the methylation cycle, and related catecholamine pathways. Urine samples were analyzed for indole-catecholamines, their metabolites, and oxidative-stress marker, hydroxylpyrolline-2-one (HPL). Rating scales were Brief Psychiatric Rating Scale, Positive and Negative Syndrome Scale, Global Assessment of Function scale, Clinical Global Impression (CGI) score, and Social and Occupational Functioning Assessment Scale (SOFAS). Analysis used Spearman's correlates, receiver operating characteristics and structural equation modeling (SEM). The correlative pattern of variables in the overall participant sample strongly implicated monoamine oxidase (MAO) enzyme inactivity so the significant role of MAO's cofactor flavin adenine nucleotide and its precursor flavin adenine mononucleotide (FMN) within the biochemical pathways was investigated and confirmed as 71% on SEM of the total sample. Splitting the data sets for MTHFR 677C → T polymorphism variants coding for the MTHFR enzyme, discovered that biochemistry variables relating to the wild-type enzyme differed markedly in pattern from those coded by the homozygous variant and that the hereozygous-variant pattern resembled the wild-type-coded pattern. The MTHFR 677C → T-wild and -heterozygous gene variants have a pattern of depleted vitamin cofactors characteristic of flavin insufficiency with under-methylation and severe oxidative stress. The second homozygous MTHFR 677TT pattern related to elevated copper:zinc ratio and a vitamin pattern related to flavin sufficiency and risk of over-methylation. The two

  9. A Novel Homozygous Mutation in FOXC1 Causes Axenfeld Rieger Syndrome with Congenital Glaucoma

    PubMed Central

    Micheal, Shazia; Villanueva-Mendoza, Cristina; Cortés-González, Vianney; Khan, Muhammad Imran; den Hollander, Anneke I.

    2016-01-01

    Background Anterior segment dysgenesis (ASD) disorders are a group of clinically and genetically heterogeneous phenotypes in which frequently cornea, iris, and lens are affected. This study aimed to identify novel mutations in PAX6, PITX2 and FOXC1 in families with anterior segment dysgenesis disorders. Methods We studied 14 Pakistani and one Mexican family with Axenfeld Rieger syndrome (ARS; n = 10) or aniridia (n = 5). All affected and unaffected family members underwent full ophthalmologic and general examinations. Total genomic DNA was isolated from peripheral blood. PCR and Sanger sequencing were performed for the exons and intron-exon boundaries of the FOXC1, PAX6, and PITX2 genes. Results Mutations were identified in five of the 15 probands; four variants were novel and one variant was described previously. A novel de novo variant (c.225C>A; p.Tyr75*) was identified in the PAX6 gene in two unrelated probands with aniridia. In addition, a known variant (c.649C>T; p.Arg217*) in PAX6 segregated in a family with aniridia. In the FOXC1 gene, a novel heterozygous variant (c.454T>C; p.Trp152Arg) segregated with the disease in a Mexican family with ARS. A novel homozygous variant (c.92_100del; p.Ala31_Ala33del) in the FOXC1 gene segregated in a Pakistani family with ARS and congenital glaucoma. Conclusions Our study expands the mutation spectrum of the PAX6 and FOXC1 genes in individuals with anterior segment dysgenesis disorders. In addition, our study suggests that FOXC1 mutations, besides typical autosomal dominant ARS, can also cause ARS with congenital glaucoma through an autosomal recessive inheritance pattern. Our results thus expand the disease spectrum of FOXC1, and may lead to a better understanding of the role of FOXC1 in development. PMID:27463523

  10. A Novel Homozygous Mutation in FOXC1 Causes Axenfeld Rieger Syndrome with Congenital Glaucoma.

    PubMed

    Micheal, Shazia; Siddiqui, Sorath Noorani; Zafar, Saemah Nuzhat; Villanueva-Mendoza, Cristina; Cortés-González, Vianney; Khan, Muhammad Imran; den Hollander, Anneke I

    2016-01-01

    Anterior segment dysgenesis (ASD) disorders are a group of clinically and genetically heterogeneous phenotypes in which frequently cornea, iris, and lens are affected. This study aimed to identify novel mutations in PAX6, PITX2 and FOXC1 in families with anterior segment dysgenesis disorders. We studied 14 Pakistani and one Mexican family with Axenfeld Rieger syndrome (ARS; n = 10) or aniridia (n = 5). All affected and unaffected family members underwent full ophthalmologic and general examinations. Total genomic DNA was isolated from peripheral blood. PCR and Sanger sequencing were performed for the exons and intron-exon boundaries of the FOXC1, PAX6, and PITX2 genes. Mutations were identified in five of the 15 probands; four variants were novel and one variant was described previously. A novel de novo variant (c.225C>A; p.Tyr75*) was identified in the PAX6 gene in two unrelated probands with aniridia. In addition, a known variant (c.649C>T; p.Arg217*) in PAX6 segregated in a family with aniridia. In the FOXC1 gene, a novel heterozygous variant (c.454T>C; p.Trp152Arg) segregated with the disease in a Mexican family with ARS. A novel homozygous variant (c.92_100del; p.Ala31_Ala33del) in the FOXC1 gene segregated in a Pakistani family with ARS and congenital glaucoma. Our study expands the mutation spectrum of the PAX6 and FOXC1 genes in individuals with anterior segment dysgenesis disorders. In addition, our study suggests that FOXC1 mutations, besides typical autosomal dominant ARS, can also cause ARS with congenital glaucoma through an autosomal recessive inheritance pattern. Our results thus expand the disease spectrum of FOXC1, and may lead to a better understanding of the role of FOXC1 in development.

  11. Creatine kinase MM TaqI and methylenetetrahydrofolate reductase C677T and A1298C gene polymorphisms influence exercise-induced C-reactive protein levels.

    PubMed

    Miranda-Vilela, Ana Luisa; Akimoto, Arthur K; Lordelo, Graciana S; Pereira, Luiz C S; Grisolia, Cesar K; Klautau-Guimarães, Maria de Nazaré

    2012-01-01

    Physical training induces beneficial adaptations, but exhausting exercise increases reactive oxygen species, which can cause muscular injuries with consequent inflammatory processes, implying jeopardized performance and possibly overtraining. Acute strenuous exercise almost certainly exceeds the benefits of physical activity; it can compromise performance and may contribute to increased future risk of cardiovascular disease (CVD) in athletes. Polymorphisms in the muscle-type creatine kinase (CK-MM) gene may influence performance and adaptation to training, while many potentially significant genetic variants are reported as risk factors for CVD. Therefore, we investigated the influence of polymorphisms in CK-MM TaqI and NcoI, methylenetetrahydrofolate reductase (MTHFR C677T and A1298C) and C-reactive protein (CRP G1059C) genes on exercise-induced damage and inflammation markers. Blood samples were taken immediately after a race (of at least 4 km) that took place outdoors on flat tracks, and were submitted to genotyping and biochemical evaluation of aspartate aminotransferase (AST), CK, CRP and high-sensitivity CRP (hs-CRP). CK-MM TaqI polymorphism significantly influenced results of AST, CK and hs-CRP, and an association between MTHFR C677T and A1298C with CRP level was found, although these levels did not exceed reference values. Results indicate that these polymorphisms can indirectly influence performance, contribute to higher susceptibility to exercise-induced inflammation or protection against it, and perhaps affect future risks of CVD in athletes.

  12. Creatine kinase MM TaqI and methylenetetrahydrofolate reductase C677T and A1298C gene polymorphisms influence exercise-induced C-reactive protein levels.

    PubMed

    Miranda-Vilela, Ana Luisa; Akimoto, Arthur K; Lordelo, Graciana S; Pereira, Luiz C S; Grisolia, Cesar K; Klautau-Guimarães, Maria de Nazaré

    2012-03-01

    Physical training induces beneficial adaptations, but exhausting exercise increases reactive oxygen species, which can cause muscular injuries with consequent inflammatory processes, implying jeopardized performance and possibly overtraining. Acute strenuous exercise almost certainly exceeds the benefits of physical activity; it can compromise performance and may contribute to increased future risk of cardiovascular disease (CVD) in athletes. Polymorphisms in the muscle-type creatine kinase (CK-MM) gene may influence performance and adaptation to training, while many potentially significant genetic variants are reported as risk factors for CVD. Therefore, we investigated the influence of polymorphisms in CK-MM TaqI and NcoI, methylenetetrahydrofolate reductase (MTHFR C677T and A1298C) and C-reactive protein (CRP G1059C) genes on exercise-induced damage and inflammation markers. Blood samples were taken immediately after a race (of at least 4 km) that took place outdoors on flat tracks, and were submitted to genotyping and biochemical evaluation of aspartate aminotransferase (AST), CK, CRP and high-sensitivity CRP (hs-CRP). CK-MM TaqI polymorphism significantly influenced results of AST, CK and hs-CRP, and an association between MTHFR C677T and A1298C with CRP level was found, although these levels did not exceed reference values. The results indicate that these polymorphisms can indirectly influence performance, contribute to higher susceptibility to exercise-induced inflammation or protection against it, and perhaps affect future risks of CVD in athletes.

  13. Association of methylenetetrahydrofolate reductase C677T polymorphism and serum lipid levels in the Guangxi Bai Ku Yao and Han populations

    PubMed Central

    2010-01-01

    Background The association of methylenetetrahydrofolate reductase (MTHFR) gene polymorphism and serum lipid profiles is still controversial in diverse ethnics. Bai Ku Yao is an isolated subgroup of the Yao minority in China. The aim of the present study was to eveluate the association of MTHFR C677T polymorphism and several environmental factors with serum lipid levels in the Guangxi Bai Ku Yao and Han populations. Methods A total of 780 subjects of Bai Ku Yao and 686 participants of Han Chinese were randomly selected from our previous stratified randomized cluster samples. Genotyping of the MTHFR C677T was performed by polymerase chain reaction and restriction fragment length polymorphism combined with gel electrophoresis, and then confirmed by direct sequencing. Results The levels of serum total cholesterol (TC), high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), apolipoprotein (Apo) AI and ApoB were lower in Bai Ku Yao than in Han (P < 0.05-0.001). The frequency of C and T alleles was 77.4% and 22.6% in Bai Ku Yao, and 60.9% and 39.1% in Han (P < 0.001); respectively. The frequency of CC, CT and TT genotypes was 58.7%, 37.3% and 4.0% in Bai Ku Yao, and 32.6%, 56.4% and 11.0% in Han (P < 0.001); respectively. The levels of TC and LDL-C in both ethnic groups were significant differences among the three genotypes (P < 0.05-0.01). The T allele carriers had higher serum TC and LDL-C levels than the T allele noncarriers. The levels of ApoB in Han were significant differences among the three genotypes (P < 0.05). The T allele carriers had higher serum ApoB levels as compared with the T allele noncarriers. The levels of TC, TG and LDL-C in Bai Ku Yao were correlated with genotypes (P < 0.05-0.001), whereas the levels of LDL-C in Han were associated with genotypes (P < 0.001). Serum lipid parameters were also correlated with sex, age, body mass index, alcohol consumption, cigarette smoking, and blood pressure in the both ethnic

  14. Effects of folic acid deficiency and MTHFRC677T polymorphisms on cytotoxicity in human peripheral blood lymphocytes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wu Xiayu; Liang Ziqing; Zou Tianning

    2009-02-13

    Apoptosis (APO) and necrosis (NEC) are two different types of cell death occurring in response to cellular stress factors. Cells with DNA damage may undergo APO or NEC. Folate is an essential micronutrient associated with DNA synthesis, repair and methylation. Methylenetetrahydrofolate reductase (MTHFR) regulates intracellular folate metabolism. Folate deficiency and MTHFR C677T polymorphisms have been shown to be related to DNA damage. To verify the cytotoxic effects of folate deficiency on cells with different MTHFR C677T genotypes, 15 human peripheral lymphocyte cases with different MTHFR C677T genotypes were cultured in folic acid (FA)-deficient and -sufficient media for 9 days. Cytotoxicitymore » was quantified using the frequencies of APO and NEC as endpoints, the nuclear division index (NDI), and the number of viable cells (NVC). These results showed that FA is an important factor in reducing cytotoxicity and increasing cell proliferation. Lymphocytes with the TT genotype proliferated easily under stress and exhibited different responses to FA deficiency than lymphocytes with the CC and CT genotypes. A TT individual may accumulate more cytotoxicity under cytotoxic stress, suggesting that the effects of FA deficiency on cytotoxicity are greater than the effects in individuals with the other MTHFR C677T variants.« less

  15. Genetic effect of MTHFR C677T polymorphism on the structural covariance network and white-matter integrity in Alzheimer's disease.

    PubMed

    Chang, Yu-Tzu; Hsu, Shih-Wei; Tsai, Shih-Jen; Chang, Ya-Ting; Huang, Chi-Wei; Liu, Mu-En; Chen, Nai-Ching; Chang, Wen-Neng; Hsu, Jung-Lung; Lee, Chen-Chang; Chang, Chiung-Chih

    2017-06-01

    The 677 C to T transition in the MTHFR gene is a genetic determinant for hyperhomocysteinemia. We investigated whether this polymorphism modulates gray matter (GM) structural covariance networks independently of white-matter integrity in patients with Alzheimer's disease (AD). GM structural covariance networks were constructed by 3D T1-magnetic resonance imaging and seed-based analysis. The patients were divided into two genotype groups: C homozygotes (n = 73) and T carriers (n = 62). Using diffusion tensor imaging and white-matter parcellation, 11 fiber bundle integrities were compared between the two genotype groups. Cognitive test scores were the major outcome factors. The T carriers had higher homocysteine levels, lower posterior cingulate cortex GM volume, and more clusters in the dorsal medial lobe subsystem showing stronger covariance strength. Both posterior cingulate cortex seed and interconnected peak cluster volumes predicted cognitive test scores, especially in the T carriers. There were no between-group differences in fiber tract diffusion parameters. The MTHFR 677T polymorphism modulates posterior cingulate cortex-anchored structural covariance strength independently of white matter integrities. Hum Brain Mapp 38:3039-3051, 2017. © 2017 The Authors Human Brain Mapping Published Wiley by Periodicals, Inc. © 2017 The Authors Human Brain Mapping Published Wiley by Periodicals, Inc.

  16. Maternal segmental disomy in Leigh syndrome with cytochrome c oxidase deficiency caused by homozygous SURF1 mutation.

    PubMed

    van Riesen, A K J; Antonicka, H; Ohlenbusch, A; Shoubridge, E A; Wilichowski, E K G

    2006-04-01

    Cytochrome c oxidase deficiency (COX) is the most frequent cause of Leigh syndrome (LS), a mitochondrial subacute necrotizing encephalomyelopathy. Most of these LS (COX-) patients show mutations in SURF1 on chromosome 9 (9q34), which encodes a protein essential for the assembly of the COX complex. We describe a family whose first-born boy developed characteristic features of LS. Severe COX deficiency in muscle was caused by a novel homozygous nonsense mutation in SURF1. Segregation analysis of this mutation in the family was incompatible with autosomal recessive inheritance but consistent with a maternal disomy. Haplotype analysis of microsatellite markers confirmed isodisomy involving nearly the complete long arm of chromosome 9 (9q21-9tel). No additional physical abnormalities were present in the boy, suggesting that there are no imprinted genes on the long arm of chromosome 9 which are crucial for developmental processes. This case of segmental isodisomy illustrates that genotyping of parents is crucial for correct genetic counseling.

  17. Carnitine-acylcarnitine translocase deficiency with c.199-10 T>G and novel c.1A>G mutation: Two case reports and brief literature review.

    PubMed

    Yan, Hui-Ming; Hu, Hao; Ahmed, Aisha; Feng, Bing-Bing; Liu, Jing; Jia, Zheng-Jun; Wang, Hua

    2017-11-01

    Carnitine-acylcarnitine translocate deficiency (CACTD) is a rare and life-threatening, autosomal recessive disorder of fatty acid β-oxidation characterized by hypoketotic hypoglycemia, hyperammonemia, cardiomyopathy, liver dysfunction, and muscle weakness; culminating in early death. To date, CACTD cases screened from the Chinese mainland population, especially patient with compound heterozygote with c.199-10T>G and a novel c.1A>G mutation in the SLC25A20 gene has never been described. Herein, we report 2 neonatal cases of CACTD identified from the mainland China. These 2 patients were presented with severe metabolic crisis and their clinical conditions deteriorate rapidly and both died of cardiorespiratory collapse in the first week of life. We present the clinical and biochemical features of 2 probands and a brief literature review of previously reported CACTD cases with the c.199-10T>G mutation. The acylcarnitine profiles by tandem-mass-spectrometry and the mutation analysis of SLC25A20 gene confirmed the diagnosis of CACTD in both patients. Mutation analysis demonstrated that patient No. 1 was homozygous for c.199-10T>G mutation, while patient No. 2 was a compound heterozygote for 2 mutations, a maternally-inherited c.199-10T>G and a paternally-inherited, novel c.1A>G mutation. Both patients were treated with an aggressive treatment regimen include high glucose and arginine infusion, respiratory, and circulatory support. The first proband died 3 days after delivery due to sudden cardiac arrest. The second patient's clinical condition, at one time, was improved by high glucose infusion, intravenous arginine, and circulatory support. However, the patient failed to wean from mechanical ventilation. Unfortunately, her parents refused further treatment due to fear of financial burdens. The patient died of congestive heart failure in the 6th day of life. We report the first 2 cases of CACTD identified from the mainland China. Apart from a founder mutation c.199-10T

  18. Methotrexate elimination and toxicity: MTHFR 677C>T polymorphism in patients with primary CNS lymphoma treated with high-dose methotrexate.

    PubMed

    Choi, Yun Jung; Park, Hyangmin; Lee, Ji Sung; Lee, Ju-Yeon; Kim, Shin; Kim, Tae Won; Park, Jung Sun; Kim, Jeong Eun; Yoon, Dok Hyun; Suh, Cheolwon

    2017-12-01

    The genetic association of the methylenetetrahydrofolate reductase gene (MTHFR) 677C>T polymorphism with methotrexate (MTX)-associated toxicity has been evaluated and conflicting results have been reported. The substantial heterogeneity of the studied population was suggested to be a possible explanation because ethnicity, MTX dose, coadministered chemotherapeutic agents, and folinate rescue dosage regimen could alter the MTX toxicity profile. The patient population was homogenized by limiting the cancer type to primary central nervous system lymphoma and chemotherapy protocol to a high-dose MTX monotherapy regimen. A total of 111 patients with 402 chemotherapy courses were analyzed. MTHFR 677C>T polymorphism was identified as an independent predictive marker for MTX-associated hematologic toxicity (odds ratio, 2.60; 95% confidence interval, 1.32-5.09; P = .0055). Clinically significant nephrotoxicity occurred in patients without delayed elimination, suggesting roles for factors other than serum MTX levels. MTX-induced hepatotoxicity and oral mucositis occurred independently of plasma MTX levels. Copyright © 2016 John Wiley & Sons, Ltd.

  19. Novel homozygous VHL mutation in exon 2 is associated with congenital polycythemia but not with cancer.

    PubMed

    Lanikova, Lucie; Lorenzo, Felipe; Yang, Chunzhang; Vankayalapati, Hari; Drachtman, Richard; Divoky, Vladimir; Prchal, Josef T

    2013-05-09

    Germline von Hippel-Lindau (VHL) gene mutations underlie dominantly inherited familial VHL tumor syndrome comprising a predisposition for renal cell carcinoma, pheochromocytoma/paraganglioma, cerebral hemangioblastoma, and endolymphatic sac tumors. However, recessively inherited congenital polycythemia, exemplified by Chuvash polycythemia, has been associated with 2 separate 3' VHL gene mutations in exon 3. It was proposed that different positions of loss-of-function VHL mutations are associated with VHL syndrome cancer predisposition and only C-terminal domain-encoding VHL mutations would cause polycythemia. However, now we describe a new homozygous VHL exon 2 mutation of the VHL gene:(c.413C>T):P138L, which is associated in the affected homozygote with congenital polycythemia but not in her, or her-heterozygous relatives, with cancer or other VHL syndrome tumors. We show that VHL(P138L) has perturbed interaction with hypoxia-inducible transcription factor (HIF)1α. Further, VHL(P138L) protein has decreased stability in vitro. Similarly to what was reported in Chuvash polycythemia and some other instances of HIFs upregulation, VHL(P138L) erythroid progenitors are hypersensitive to erythropoietin. Interestingly, the level of RUNX1/AML1 and NF-E2 transcripts that are specifically upregulated in acquired polycythemia vera were also upregulated in VHL(P138L) granulocytes.

  20. Methylenetetrahydrofolate reductase C677T polymorphism predicts response and time to progression to gemcitabine-based chemotherapy for advanced non-small cell lung cancer in a Chinese Han population*

    PubMed Central

    Hong, Wei; Wang, Kai; Zhang, Yi-ping; Kou, Jun-yan; Hong, Dan; Su, Dan; Mao, Wei-min; Yu, Xin-min; Xie, Fa-jun; Wang, Xiao-jian

    2013-01-01

    Objective: The aim of this study was to evaluate the association between the methylenetetrahydrofolate reductase (MTHFR) C677T excision repair cross-complementation group 1 (ERCC1) genetic polymorphisms and the clinical efficacy of gemcitabine-based chemotherapy in advanced non-small cell lung cancer (NSCLC). Methods: A total of 135 chemonaive patients with unresectable advanced NSCLC were treated with gemcitabine/platinum regimens. The polymorphisms of MTHFR C677T, ERCC1 C8092A, and ERCC1 C118T were genotyped using the TaqMan methods. Results: The overall response rate was 28.9%. Patients with MTHFR CC genotype had a higher rate of objective response than patients with variant genotype (TT or CT) (41.2% versus 19.1%, P=0.01). Median time to progression (TTP) of patients with MTHFR CC genotype was longer than that of patients with variant genotype (7.6 months versus 5.0 months, P=0.003). No significant associations were obtained between ERCC1 C118T and C8092A polymorphisms and both response and survival. Conclusions: Our data suggest the value of MTHFR C677T polymorphism as a possible predictive marker of response and TTP in advanced NSCLC patients treated with gemcitabine/platinum. PMID:23463763

  1. A novel homozygous mutation in the FSHR gene is causative for primary ovarian insufficiency.

    PubMed

    Liu, Hongli; Xu, Xiaofei; Han, Ting; Yan, Lei; Cheng, Lei; Qin, Yingying; Liu, Wen; Zhao, Shidou; Chen, Zi-Jiang

    2017-12-01

    To identify the potential FSHR mutation in a Chinese woman with primary ovarian insufficiency (POI). Genetic and functional studies. University-based reproductive medicine center. A POI patient, her family members, and another 192 control women with regular menstruation. Ovarian biopsy was performed in the patient. Sanger sequencing was carried out for the patient, her sister, and parents. The novel variant identified was further confirmed with the use of control subjects. Sanger sequencing and genotype analysis to identify the potential variant of the FSHR gene; hematoxylin and eosin staining of the ovarian section to observe the follicular development; Western blotting and immunofluorescence to detect FSH receptor (FSHR) expression; and cyclic adenosine monophosphate (cAMP) assay to monitor FSH-induced signaling. Histologic examination of the ovaries in the patient revealed follicular development up to the early antral stage. Mutational screening and genotype analysis of the FSHR gene identified a novel homozygous mutation c.175C>T (p.R59X) in exon 2, which was inherited in the autosomal recessive mode from her heterozygous parents but was absent in her sister and the 192 control women. Functional studies demonstrated that in vitro the nonsense mutation caused the loss of full-length FSHR expression and that p.R59X mutant showed no response to FSH stimulation in the cAMP level. The mutation p.R59X in FSHR is causative for POI by means of arresting folliculogenesis. Copyright © 2017 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  2. MTHFR Functional Polymorphism C677T and Genomic Instability in the Etiology of Idiopathic Autism in Simplex Families

    DTIC Science & Technology

    2014-12-01

    facts that de novo CNVs rates are consistently high in SPX ASD (5.8%-10.2%) versus familial ASD (2-3%), we hypothesize that low-activity MTHFR 677T...allele leads to increase global DNA hypomethylation and consequently results in increased generation of de novo CNVs bringing about a higher risk for...developing sporadic cases of autism. We proposed to test 1) the association of MTHFR 677T allele with rate of ASD related de novo CNVs ; 2) the

  3. Homocysteine and the C677T Gene Polymorphism of Its Key Metabolic Enzyme MTHFR Are Risk Factors of Early Renal Damage in Hypertension in a Chinese Han Population

    PubMed Central

    Yun, Lin; Xu, Rui; Li, Guohua; Yao, Yucai; Li, Jiamin; Cong, Dehong; Xu, Xingshun; Zhang, Lihua

    2015-01-01

    Abstract The combined hyperhomocysteinemia condition is a feature of the Chinese hypertensive population. This study used the case-control method to investigate the association between plasma homocysteine and the C677T gene polymorphism of its key metabolic enzyme, 5, 10-methylenetetrahydrofolate reductase (MTHFR), and early renal damage in a hypertensive Chinese Han population. A total of 379 adult essential hypertensive patients were selected as the study subjects. The personal information, clinical indicators, and the C677T gene polymorphism of MTHFR were texted. This study used the urine microalbumin/urine creatinine ratio (UACR) as a grouping basis: the hypertension without renal damage group (NRD group) and the hypertension combined with early renal damage group (ERD group). Early renal damage in the Chinese hypertensive population was associated with body weight, systolic pressure, diastolic pressure, urea nitrogen, serum creatinine, cystatin C, uric acid, aldosterone, and glomerular filtration rate. The homocysteine level and the UACR in the TT genotype group were higher than those in the CC genotype group. The binary logistic regression analysis results showed that after sex and age were adjusted, the MTHFR C677T gene polymorphism was correlated with early renal damage in hypertension in both the recessive model and in the additive model. Plasma homocysteine and the C677T gene polymorphism of its key metabolic enzyme MTHFR might be independent risk factors of early renal damage in the hypertensive Chinese Han population. PMID:26717388

  4. Homocysteine and the C677T Gene Polymorphism of Its Key Metabolic Enzyme MTHFR Are Risk Factors of Early Renal Damage in Hypertension in a Chinese Han Population.

    PubMed

    Yun, Lin; Xu, Rui; Li, Guohua; Yao, Yucai; Li, Jiamin; Cong, Dehong; Xu, Xingshun; Zhang, Lihua

    2015-12-01

    The combined hyperhomocysteinemia condition is a feature of the Chinese hypertensive population. This study used the case-control method to investigate the association between plasma homocysteine and the C677T gene polymorphism of its key metabolic enzyme, 5, 10-methylenetetrahydrofolate reductase (MTHFR), and early renal damage in a hypertensive Chinese Han population.A total of 379 adult essential hypertensive patients were selected as the study subjects. The personal information, clinical indicators, and the C677T gene polymorphism of MTHFR were texted. This study used the urine microalbumin/urine creatinine ratio (UACR) as a grouping basis: the hypertension without renal damage group (NRD group) and the hypertension combined with early renal damage group (ERD group).Early renal damage in the Chinese hypertensive population was associated with body weight, systolic pressure, diastolic pressure, urea nitrogen, serum creatinine, cystatin C, uric acid, aldosterone, and glomerular filtration rate. The homocysteine level and the UACR in the TT genotype group were higher than those in the CC genotype group. The binary logistic regression analysis results showed that after sex and age were adjusted, the MTHFR C677T gene polymorphism was correlated with early renal damage in hypertension in both the recessive model and in the additive model.Plasma homocysteine and the C677T gene polymorphism of its key metabolic enzyme MTHFR might be independent risk factors of early renal damage in the hypertensive Chinese Han population.

  5. A syndrome of microcephaly, short stature, polysyndactyly, and dental anomalies caused by a homozygous KATNB1 mutation.

    PubMed

    Yigit, Gökhan; Wieczorek, Dagmar; Bögershausen, Nina; Beleggia, Filippo; Möller-Hartmann, Claudia; Altmüller, Janine; Thiele, Holger; Nürnberg, Peter; Wollnik, Bernd

    2016-03-01

    Using whole-exome sequencing, we identified a homozygous acceptor splice-site mutation in intron 6 of the KATNB1 gene in a patient from a consanguineous Turkish family who presented with congenital microcephaly, lissencephaly, short stature, polysyndactyly, and dental abnormalities. cDNA analysis revealed complete loss of the natural acceptor splice-site resulting either in the usage of an alternative, exonic acceptor splice-site inducing a frame-shift and premature protein truncation or, to a minor extent, in complete skipping of exon 7. Both effects most likely lead to complete loss of KATNB1 function. Homozygous and compound heterozygous mutations in KATNB1 have very recently been described as a cause of microcephaly with brain malformations and seizures. We extend the KATNB1 associated phenotype by describing a syndrome characterized by primordial dwarfism, lissencephaly, polysyndactyly, and dental anomalies, which is caused by a homozygous truncating KATNB1 mutation. © 2015 Wiley Periodicals, Inc.

  6. The phenotype of polycythemia due to Croatian homozygous VHL (571C>G:H191D) mutation is different from that of Chuvash polycythemia (VHL 598C>T:R200W)

    PubMed Central

    Tomasic, Nikica Ljubas; Piterkova, Lucie; Huff, Chad; Bilic, Ernest; Yoon, Donghoon; Miasnikova, Galina Y.; Sergueeva, Adelina I.; Niu, Xiaomei; Nekhai, Sergei; Gordeuk, Victor; Prchal, Josef T.

    2013-01-01

    Mutations of VHL (a negative regulator of hypoxia-inducible factors) have position-dependent distinct cancer phenotypes. Only two known inherited homozygous VHL mutations exist and they cause polycythemia: Chuvash R200W and Croatian H191D. We report a second polycythemic Croatian H191D homozygote distantly related to the first propositus. Three generations of both families were genotyped for analysis of shared ancestry. Biochemical and molecular tests were performed to better define their phenotypes, with an emphasis on a comparison with Chuvash polycythemia. The VHL H191D mutation did not segregate in the family defined by the known common ancestors of the two subjects, suggesting a high prevalence in Croatians, but haplotype analysis indicated an undocumented common ancestor ∼six generations ago as the founder of this mutation. We show that erythropoietin levels in homozygous VHL H191D individuals are higher than in VHL R200W patients of similar ages, and their native erythroid progenitors, unlike Chuvash R200W, are not hypersensitive to erythropoietin. This observation contrasts with a report suggesting that polycythemia in VHL R200W and H191D homozygotes is due to the loss of JAK2 regulation from VHL R200W and H191D binding to SOCS1. In conclusion, our studies further define the hematologic phenotype of VHL H191D and provide additional evidence for phenotypic heterogeneity associated with the positional effects of VHL mutations. PMID:23403324

  7. The phenotype of polycythemia due to Croatian homozygous VHL (571C>G:H191D) mutation is different from that of Chuvash polycythemia (VHL 598C>T:R200W).

    PubMed

    Tomasic, Nikica Ljubas; Piterkova, Lucie; Huff, Chad; Bilic, Ernest; Yoon, Donghoon; Miasnikova, Galina Y; Sergueeva, Adelina I; Niu, Xiaomei; Nekhai, Sergei; Gordeuk, Victor; Prchal, Josef T

    2013-04-01

    Mutations of VHL (a negative regulator of hypoxia-inducible factors) have position-dependent distinct cancer phenotypes. Only two known inherited homozygous VHL mutations exist and they cause polycythemia: Chuvash R200W and Croatian H191D. We report a second polycythemic Croatian H191D homozygote distantly related to the first propositus. Three generations of both families were genotyped for analysis of shared ancestry. Biochemical and molecular tests were performed to better define their phenotypes, with an emphasis on a comparison with Chuvash polycythemia. The VHL H191D mutation did not segregate in the family defined by the known common ancestors of the two subjects, suggesting a high prevalence in Croatians, but haplotype analysis indicated an undocumented common ancestor ∼six generations ago as the founder of this mutation. We show that erythropoietin levels in homozygous VHL H191D individuals are higher than in VHL R200W patients of similar ages, and their native erythroid progenitors, unlike Chuvash R200W, are not hypersensitive to erythropoietin. This observation contrasts with a report suggesting that polycythemia in VHL R200W and H191D homozygotes is due to the loss of JAK2 regulation from VHL R200W and H191D binding to SOCS1. In conclusion, our studies further define the hematologic phenotype of VHL H191D and provide additional evidence for phenotypic heterogeneity associated with the positional effects of VHL mutations.

  8. Molecular analysis of congenital goitres with hypothyroidism caused by defective thyroglobulin synthesis. Identification of a novel c.7006C>T [p.R2317X] mutation and expression of minigenes containing nonsense mutations in exon 7.

    PubMed

    Machiavelli, Gloria A; Caputo, Mariela; Rivolta, Carina M; Olcese, María C; Gruñeiro-Papendieck, Laura; Chiesa, Ana; González-Sarmiento, Rogelio; Targovnik, Héctor M

    2010-01-01

    Thyroglobulin (TG) deficiency is an autosomal-recessive disorder that results in thyroid dyshormonogenesis. A number of distinct mutations have been identified as causing human hypothyroid goitre. The purpose of this study was to identify and characterize new mutations in the TG gene in an attempt to increase the understanding of the genetic mechanism responsible for this disorder. A total of six patients from four nonconsanguineous families with marked impairment of TG synthesis were studied. Single-strand conformation polymorphism (SSCP) analysis, sequencing of DNA, genotyping, expression of chimeric minigenes and bioinformatic analysis were performed. Four different inactivating TG mutations were identified: one novel mutation (c.7006C>T [p.R2317X]) and three previously reported (c.886C>T [p.R277X], c.6701C>A [p.A2215D] and c.6725G>A [p.R2223H]). Consequently, one patient carried a compound heterozygous for p.R2223H/p.R2317X mutations; two brothers showed a homozygous p.A2215D substitution and the remaining three patients, from two families with typical phenotype, had a single p.R277X mutated allele. We also showed functional evidences that premature stop codons inserted at different positions in exon 7, which disrupt exonic splicing enhancer (ESE) sequences, do not interfere with exon definition and processing. In this study, we have identified a novel nonsense mutation p.R2317X in the acetylcholinesterase homology domain of TG. We have also observed that nonsense mutations do not interfere with the pre-mRNA splicing of exon 7. The results are in accordance with previous observations confirming the genetic heterogeneity of TG defects.

  9. The association between MTHFR 677C>T genotype and folate status and genomic and gene-specific DNA methylation in the colon of individuals without colorectal neoplasia.

    PubMed

    Hanks, Joanna; Ayed, Iyeman; Kukreja, Neil; Rogers, Chris; Harris, Jessica; Gheorghiu, Alina; Liu, Chee Ling; Emery, Peter; Pufulete, Maria

    2013-12-01

    Decreased genomic and increased gene-specific DNA methylation predispose to colorectal cancer. Dietary folate intake and the methylenetetrahydrofolate reductase polymorphism (MTHFR 677C>T) may influence risk by modifying DNA methylation. We investigated the associations between MTHFR 677C>T genotype, folate status, and DNA methylation in the colon. We conducted a cross-sectional study of 336 men and women (age 19-92 y) in the United Kingdom without colorectal neoplasia. We obtained blood samples for measurement of serum and red blood cell folate, plasma homocysteine, and MTHFR 677C>T genotype and colonic tissue biopsies for measurement of colonic tissue folate and DNA methylation (genomic- and gene-specific, estrogen receptor 1, ESR1; myoblast determination protein 1, MYOD1; insulin-like growth factor II, IGF2; tumor suppressor candidate 33, N33; adenomatous polyposis coli, APC; mut-L homolog 1, MLH1; and O(6)-methylguanine-DNA methyltransferase, MGMT) by liquid chromatography/electrospray ionization mass spectrometry and pyrosequencing, respectively. Of the 336 subjects recruited, 185 (55%) carried the CC, 119 (35%) the CT, and 32 (10%) the TT alleles. No significant differences in systemic markers of folate status and colonic tissue folate between genotypes were found. The MTHFR TT genotype was not associated with genomic or gene-specific DNA methylation. Biomarkers of folate status were not associated with genomic DNA methylation. Relations between biomarkers of folate status and gene-specific methylation were inconsistent. However, low serum folate was associated with high MGMT methylation (P = 0.001). MTHFR 677C>T genotype and folate status were generally not associated with DNA methylation in the colon of a folate-replete population without neoplasia.

  10. Homozygous Loss-of-function Mutations in SOHLH1 in Patients With Nonsyndromic Hypergonadotropic Hypogonadism

    PubMed Central

    Bayram, Yavuz; Gulsuner, Suleyman; Guran, Tulay; Abaci, Ayhan; Yesil, Gozde; Gulsuner, Hilal Unal; Atay, Zeynep; Pierce, Sarah B.; Gambin, Tomasz; Lee, Ming; Turan, Serap; Bober, Ece; Atik, Mehmed M.; Walsh, Tom; Karaca, Ender; Pehlivan, Davut; Jhangiani, Shalini N.; Muzny, Donna; Bereket, Abdullah; Buyukgebiz, Atilla; Boerwinkle, Eric; Gibbs, Richard A.

    2015-01-01

    Context: Hypergonadotropic hypogonadism presents in females with delayed or arrested puberty, primary or secondary amenorrhea due to gonadal dysfunction, and is further characterized by elevated gonadotropins and low sex steroids. Chromosomal aberrations and various specific gene defects can lead to hypergonadotropic hypogonadism. Responsible genes include those with roles in gonadal development or maintenance, sex steroid synthesis, or end-organ resistance to gonadotropins. Identification of novel causative genes in this disorder will contribute to our understanding of the regulation of human reproductive function. Objectives: The aim of this study was to identify and report the gene responsible for autosomal-recessive hypergonadotropic hypogonadism in two unrelated families. Design and Participants: Clinical evaluation and whole-exome sequencing were performed in two pairs of sisters with nonsyndromic hypergonadotropic hypogonadism from two unrelated families. Results: Exome sequencing analysis revealed two different truncating mutations in the same gene: SOHLH1 c.705delT (p.Pro235fs*4) and SOHLH1 c.27C>G (p.Tyr9stop). Both mutations were unique to the families and segregation was consistent with Mendelian expectations for an autosomal-recessive mode of inheritance. Conclusions: Sohlh1 was known from previous mouse studies to be a transcriptional regulator that functions in the maintenance and survival of primordial ovarian follicles, but loss-of-function mutations in human females have not been reported. Our results provide evidence that homozygous-truncating mutations in SOHLH1 cause female nonsyndromic hypergonadotropic hypogonadism. PMID:25774885

  11. Homozygous MYH7 R1820W mutation results in recessive myosin storage myopathy: scapuloperoneal and respiratory weakness with dilated cardiomyopathy.

    PubMed

    Yüceyar, Nur; Ayhan, Özgecan; Karasoy, Hatice; Tolun, Aslıhan

    2015-04-01

    Myosin storage myopathy (MSM) is a protein aggregate myopathy caused by the accumulation of myosin in muscle fibres and results from MYH7 mutation. Although MYH7 mutation is also an established cause of variable cardiomyopathy with or without skeletal myopathy, cardiomyopathy with MSM is a rare combination. Here, we update the clinical findings in the two brothers that we previously reported as having recessively inherited MSM characterized by scapuloperoneal distribution of weakness and typical hyaline-like bodies in type 1 muscle fibres. One of the patients, weak from childhood but not severely symptomatic until 28 years of age, had an unusual combination of MSM, severe dilated cardiomyopathy, and respiratory impairment at the age of 44 years. We identified homozygous missense mutation c.5458C>T (p.R1820W) in exon 37 in these patients as the second recessive MYH7 mutation reported to date. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. A novel homozygous mutation IVS6+5G>T in CYP11B1 gene in a Vietnamese patient with 11β-hydroxylase deficiency.

    PubMed

    Nguyen, Thi Phuong Mai; Nguyen, Thu Hien; Ngo, Diem Ngoc; Vu, Chi Dung; Nguyen, Thi Kim Lien; Nong, Van Hai; Nguyen, Huy Hoang

    2015-07-10

    Congenital adrenal hyperplasia (CAH) is an autosomal recessive disease which is characterized by a deficiency of one of the enzymes involved in the synthesis of cortisol from cholesterol by the adrenal cortex. CAH cases arising from impaired 11β-hydroxylase are the second most common form. Mutations in the CYP11B1 gene are the cause of 11β-hydroxylase deficiency. This study was performed on a patient with congenital adrenal hyperplasia and with premature development such as enlarged penis, muscle development, high blood pressure, and bone age equivalent of 5 years old at 2 years of chronological age. Biochemical tests for steroids confirmed the diagnosis of CAH. We used PCR and sequencing to screen for mutations in CYP11B1 gene. Results showed that the patient has a novel homozygous mutation of guanine (G) to thymine (T) in intron 6 (IVS6+5G>T). The analysis of this mutation by MaxEntScan boundary software indicated that this mutant could affect the gene splicing during transcription. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. Normal Weight Obese syndrome: role of single nucleotide polymorphism of IL-1 5Ralpha and MTHFR 677C-->T genes in the relationship between body composition and resting metabolic rate.

    PubMed

    Di Renzo, L; Bigioni, M; Bottini, F G; Del Gobbo, V; Premrov, M G; Cianci, R; De Lorenzo, A

    2006-01-01

    We have identified a subset of metabolically obese, but normal weight individuals, with potentially increased risks of developing the metabolic syndrome, despite their normal body mass index. We determined the relationship among body fat distribution, resting metabolic rate (RMR), total body water amount (%TBW), selected gene polymorphism on interleukin-15 receptor-alpha (IL-15Ralpha) and methylenetetrahydrofolate reductase 677C-->T (MTHFR 677C-->T), to distinguish normal weight obese (NWO) from nonobese with a normal metabolic profile and obese individuals. We analysed anthropometric variables, body composition by Dual energy X-ray Absorptiometry (DXA), RMR by indirect calorimetry, %TBW by bioimpedence analysis (BIA), MTHFR 677C-->T and IL-15Ralpha genotypes of 128 clinically healthy Caucasian individuals. We compared a group of female, defined as NWO and characterised by a BMI < or = 25 kg/m(2) and FM > or = 30% with groups of others female, and males, represented by nonobese with a BMI < or = 25 kg/m(2) and FM < or = 30%, and preobese-obese individuals with BMI > or = 25 kg/m(2) and %FM > or = 30%; none of the males was classified as NWO. Significant correlations were found among body fat mass distribution, metabolic variables, percentage of total body water distribution and selected genetic variations. The variables that contributed significantly to the separation of classes were body tissue (Tissue), %TBW, RMR, the volumes of both oxygen (VO2) and carbon dioxide (VCO2). The distribution of MTHFR 677C-->T and IL-15 genotypes was significantly different between classes. Our data highlight that NWO individuals showed a significant relationship between the decrease in the basal metabolism (RMR), body fat mass increasing and total water amount. Possession of wild type homozygotes genotypes regarding IL-15Ralpha cytokine and 677C-->T MTHFR enzyme characterised NWO individuals.

  14. Association of 5, 10- methylenetetrahydrofolate reductase C677T polymorphism in susceptibility to tropical chronic pancreatitis in north Indian population.

    PubMed

    Singh, S; Choudhuri, G; Kumar, R; Agarwal, S

    2012-12-22

    MTHFR is a key enzyme in folate metabolism that catalyzes the conversion of 5, 10—methlenetetrahydrofolate (5, 10— methylene THF) to 5—methyltetrahydrofolate (5—methyl THF), a predominant circulatory form of folate and methyl donor for the remethylation of homocysteine to methionine. Some studies have shown that C667T polymorphism increases the risk of pancreatic cancer. Since MTHFR is involved in methylation, inflammation and protection against oxidative stress, the processes especially important for pancreatic homeostasis. The altered enzyme activity could play a role in pancreatic injury. The role of MTHFR C677T polymorphism in chronic pancreatitis has been explored by conducting a hospital based; case—control study involving 100 patients radiologically confirmed chronic pancreatitis and 329 healthy controls. All samples were analyzed for MTHFR C677T polymorphism using PCR—RFLP method. Restriction enzyme Hinf I was used to digest the 198 bp amplified product. The frequency of the MTHFR was 57.3%, 34.1% and 8.5% among cases compared with 87.2%,11.2% and 1.5% of controls for CC, CT and TT genotypes, respectively. The T Allele frequency was found significantly higher in patients than in controls. A significant association with T allele was observed with p—value (< 0.0001) odds ratio 4.475 and (95% CI=2.961—7.046). It could be predisposing to the traditional risk factors such as diabetes, dietary, alcohal and smoking habit that are known to be associated with chronic pancreatitis. Additionally it was observed that smoking increases the risk of chronic pancreatitis by 4.1 times. The T allele frequency of MTHFR (C667T) was found to be a significant risk factor for chronic pancreatitis playing a crucial role in altered folate metabolsim.

  15. MTHFR Functional Polymorphism C677T and Genomic Instability in the Etiology of Idiopathic Autism in Simplex Families. Revision

    DTIC Science & Technology

    2013-10-01

    that de novo CNVs rates are consistently high in SPX ASD (5.8%-10.2%) versus familial ASD (2-3%), we hypothesize that low-activity MTHFR 677T allele...leads to increase global DNA hypomethylation and consequently results in increased generation of de novo CNVs bringing about a higher risk for...developing sporadic cases of autism. We proposed to test 1) the association of MTHFR 677T allele with rate of ASD related de novo CNVs ; 2) the

  16. Digital PCR (dPCR) analysis reveals that the homozygous c.315-48T>C variant in the FECH gene might cause erythropoietic protoporphyria (EPP).

    PubMed

    Brancaleoni, Valentina; Granata, Francesca; Missineo, Pasquale; Fustinoni, Silvia; Graziadei, Giovanna; Di Pierro, Elena

    2018-06-13

    Alterations in the ferrochelatase gene (FECH) are the basis of the phenotypic expressions in erythropoietic protoporphyria. The phenotype is due to the presence of a mutation in the FECH gene associated in trans to the c.315-48 T > C variant in the intron 3. The latter is able to increase the physiological quota of alternative splicing events in the intron 3. Other two variants in the FECH gene (c.1-252A > G and c.68-23C > T) have been found to be associated to the intron 3 variant in some populations and together, they constitute a haplotype (ACT/GTC), but eventually, their role in the alternative splicing event has never been elucidated. The absolute number of the aberrantly spliced FECH mRNA molecules and the absolute expression of the FECH gene were evaluated by digital PCR technique in a comprehensive cohort. The number of splicing events that rose in the presence of the c.315-48 T > C variant, both in the heterozygous and homozygous condition was reported for the first time. Also, the percentage of the inserted FECH mRNA increased, even doubled in the T/C cases, compared to T/T cases. The constant presence of variants in the promoter and intron 2 did not influence or modulate the aberrant splicing. The results of FECH gene expression suggested that the homozygosity for the c.315-48 T > C variant could be considered pathological. Thus, this study identified the homozygotes for the c.315-48 T > C variant as pathological. By extension, when the samples were categorised according to the haplotypes, the GTC haplotype in homozygosis was pathological. Copyright © 2018 Elsevier Inc. All rights reserved.

  17. Mitochondrial tRNALeu(UUR) C3275T, tRNAGln T4363C and tRNALys A8343G mutations may be associated with PCOS and metabolic syndrome.

    PubMed

    Ding, Yu; Xia, Bo-Hou; Zhang, Cai-Juan; Zhuo, Guang-Chao

    2018-02-05

    Polycystic ovary syndrome (PCOS) is a very prevalent endocrine disease affecting reproductive women. Clinically, patients with this disorder are more vulnerable to develop type 2 diabetes mellitus (T2DM), cardiovascular events, as well as metabolic syndrome (MetS). To date, the molecular mechanism underlying PCOS remains largely unknown. Previously, we showed that mitochondrial dysfunction caused by mitochondrial DNA (mtDNA) mutation was an important cause for PCOS. In the current study, we described the clinical and biochemical features of a three-generation pedigree with maternally transmitted MetS, combined with PCOS. A total of three matrilineal relatives exhibited MetS including obesity, high triglyceride (TG) and Hemoglobin A1c (HbA1c) levels, and hypertension. Whereas one patient from the third generation manifestated PCOS. Mutational analysis of the whole mitochondrial genes from the affected individuals identified a set of genetic variations belonging to East Asia haplogroup B4b1c. Among these variants, the homoplasmic C3275T mutation disrupted a highly evolutionary conserved base-pairing (28A-46C) on the variable region of tRNA Leu(UUR) , whereas the T4363C mutation created a new base-pairing (31T-37A) in the anticodon stem of tRNA Gln , furthermore, the A8343G mutation occurred at the very conserved position of tRNA Lys and may result the failure in mitochondrial tRNAs (mt-tRNAs) metabolism. Biochemical analysis revealed the deficiency in mitochondrial functions including lower levels of mitochondrial membrane potential (MMP), ATP production and mtDNA copy number, while a significantly increased reactive oxygen species (ROS) generation was observed in polymononuclear leukocytes (PMNs) from the individuals carrying these mt-tRNA mutations, suggesting that these mutations may cause mitochondrial dysfunction that was responsible for the clinical phenotypes. Taken together, our data indicated that mt-tRNA mutations were associated with MetS and PCOS in this

  18. Hemolysis and Mediterranean G6PD mutation (c.563 C>T) and c.1311 C>T polymorphism among Palestinians at Gaza Strip.

    PubMed

    Sirdah, Mahmoud; Reading, N Scott; Perkins, Sherrie L; Shubair, Mohammad; Aboud, Lina; Prchal, Josef T

    2012-04-15

    The G6PD c.563 C>T deficient mutation is endemic among Mediterranean populations but its clinical significance is not well delineated. We set up to estimate the proportion of G6PD deficient children presenting with hemolytic anemia at Al Nasser Pediatric Hospital at Gaza Strip, Palestine. We then established the prevalence of c.563T Mediterranean mutation and its linkage to c.1311 C>T polymorphism in this population. G6PD deficiency was identified in children presenting with hemolytic anemia at Al Nasser Pediatric Hospital by spectrophotometric measurement of G6PD activity. G6PD exon 6 and exon 11 were amplified from genomic DNA and evaluated for c.563T mutation by sequencing and the c.1311T polymorphism by restriction fragment analysis. Seventy X-chromosomes (60 males and 5 females) from G6PD deficient patients and 40 X-chromosomes from a control group known to be not G6PD deficient were tested. Over 80% of these children presenting with hemolytic anemia were G6PD deficient and 34% of these had the Mediterranean G6PD deficient variant. The allelic frequencies of Mediterranean c.563T and c.1311T polymorphisms among G6PD deficient patients were 0.33 and 0.38 respectively. The c.1311T polymorphism was linked in 95.2% of patients with the Mediterranean mutation, an allele frequency of 0.87, compared to the control non-G6PD deficient group with an allele frequency of 0.18. We conclude that G6PD deficiency accounts for majority of hemolytic anemia encountered in Gaza children treated at Al Nasser Pediatric Hospital Emergency department. The Mediterranean mutation c.563T, while not accounting for a majority of G6PD deficiency, is common among G6PD deficient Gaza Strip Palestinians and is frequently, but not always, linked to the c.1311T polymorphism. This work provides a foundation for the population screening of Palestinians for G6PD deficiency and for investigations of ancestral origin of the Mediterranean variant in world populations. Copyright © 2012 Elsevier Inc

  19. mtDNA mutation C1494T, haplogroup A, and hearing loss in Chinese

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang Chengye; Laboratory for Conservation and Utilization of Bio-resource, Yunnan University, Kunming 650091; Graduate University of the Chinese Academy of Sciences, Beijing 100039

    2006-09-22

    Mutation C1494T in mitochondrial 12S rRNA gene was recently reported in two large Chinese families with aminoglycoside-induced and nonsyndromic hearing loss (AINHL) and was claimed to be pathogenic. This mutation, however, was first reported in a sample from central China in our previous study that was aimed to reconstruct East Asian mtDNA phylogeny. All these three mtDNAs formed a subclade defined by mutation C1494T in mtDNA haplogroup A. It thus seems that mutation C1494T is a haplogroup A-associated mutation and this matrilineal background may contribute a high risk for the penetrance of mutation C1494T in Chinese with AINHL. To testmore » this hypothesis, we first genotyped mutation C1494T in 553 unrelated individuals from three regional Chinese populations and performed an extensive search for published complete or near-complete mtDNA data sets (>3000 mtDNAs), we then screened the C1494T mutation in 111 mtDNAs with haplogroup A status that were identified from 1823 subjects across China. The search for published mtDNA data sets revealed no other mtDNA besides the above-mentioned three carrying mutation C1494T. None of the 553 randomly selected individuals and the 111 haplogroup A mtDNAs was found to bear this mutation. Therefore, our results suggest that C1494T is a very rare event. The mtDNA haplogroup A background in general is unlikely to play an active role in the penetrance of mutation C1494T in AINHL.« less

  20. Arg753gln and Arg677 Trp Polymorphisms of Toll-Like Receptor 2 In Acute Apical Abscess.

    PubMed

    Miri-Moghaddam, Ebrahim; Farhad Mollashahi, Narges; Naghibi, Nava; Garme, Yasaman; Bazi, Ali

    2018-06-01

    Genetic polymorphisms can alter immunity response against pathogens, which in turn influence individuals' susceptibility to certain infections. Our aim was to determine the association of Arg753Gln (rs5743708) and Arg677Trp (rs12191786) polymorphisms of toll like receptor-2 gene with the two clinical forms of apical periodontitis: acute apical abscess (AAA) and asymptomatic apical periodontitis (AAP). There were 50 patients with AAA as case group and 50 with AAP as control group. Genotyping was done using Tetra-ARMS (amplification refractory mutation system) PCR. Heterozygous genotype of Arg677Trp polymorphism was associated with risk of AAA (OR=1.9, 95% CI: 0.7-5.5, p = 0.05). Although statistically insignificant, Arg677Trp polymorphism promoted the risk of AAA in dominant model (OR=2.1, 95% CI: 0.7-5.9, p > 0.05). The frequency of mutant allele (T) of Arg677Trp polymorphism was higher in AAA (14%) than AAP (7%) subjects (OR=1.7, 95% CI: 0.6-4.7). For Arg753Gln polymorphism, wild homozygous (GG) represented the dominant genotype in both cases (96%) and controls (100%). Variant allele (A) of Arg753Gln polymorphism was identified in 2% of AAA, while no individual represented with this allele in AAP subjects. Individuals with Arg753Gln; Arg677Trp (GG; TC) combination showed an elevated risk of AAA (OR=1.6, 95% CI: 0.5- 4.2, p > 0.05). Arg677Trp polymorphism of TLR-2 rendered a higher risk for the development of abscesses in apical periodontitis. It is recommended to explore role of this polymorphism in other populations.

  1. A homozygous CARD9 mutation in a family with susceptibility to fungal infections.

    PubMed

    Glocker, Erik-Oliver; Hennigs, Andre; Nabavi, Mohammad; Schäffer, Alejandro A; Woellner, Cristina; Salzer, Ulrich; Pfeifer, Dietmar; Veelken, Hendrik; Warnatz, Klaus; Tahami, Fariba; Jamal, Sarah; Manguiat, Annabelle; Rezaei, Nima; Amirzargar, Ali Akbar; Plebani, Alessandro; Hannesschläger, Nicole; Gross, Olaf; Ruland, Jürgen; Grimbacher, Bodo

    2009-10-29

    Chronic mucocutaneous candidiasis may be manifested as a primary immunodeficiency characterized by persistent or recurrent infections of the mucosa or the skin with candida species. Most cases are sporadic, but both autosomal dominant inheritance and autosomal recessive inheritance have been described. We performed genetic studies in 36 members of a large, consanguineous five-generation family, in which 4 members had recurrent fungal infections and an additional 3 members died during adolescence, 2 after invasive infection of the brain with candida species. All 36 family members were enrolled in the study, and 22 had blood samples taken for DNA analysis. Homozygosity mapping was used to locate the mutated gene. In the 4 affected family members (patients) and the 18 unaffected members we sequenced CARD9, the gene encoding the caspase recruitment domain-containing protein 9, carried out T-cell phenotyping, and performed functional studies, with the use of either leukocytes from the patients or a reconstituted murine model of the genetic defect. We found linkage (lod score, 3.6) to a genomic interval on chromosome 9q, including CARD9. All four patients had a homozygous point mutation in CARD9, resulting in a premature termination codon (Q295X). Healthy family members had wild-type expression of the CARD9 protein; the four patients lacked wild-type expression, which was associated with low numbers of Th17 cells (helper T cells producing interleukin-17). Functional studies based on genetic reconstitution of myeloid cells from Card9(-/-) mice showed that the Q295X mutation impairs innate signaling from the antifungal pattern-recognition receptor dectin-1. An autosomal recessive form of susceptibility to chronic mucocutaneous candidiasis is associated with homozygous mutations in CARD9. 2009 Massachusetts Medical Society

  2. Supplementation with Watermelon Extract Reduces Total Cholesterol and LDL Cholesterol in Adults with Dyslipidemia under the Influence of the MTHFR C677T Polymorphism.

    PubMed

    Massa, Nayara M L; Silva, Alexandre S; de Oliveira, Caio V C; Costa, Maria J C; Persuhn, Darlene C; Barbosa, Carlos V S; Gonçalves, Maria da C R

    2016-08-01

    Dyslipidemia and genetic polymorphisms are associated with increased risk for developing cardiovascular diseases, and watermelon appears to have the potential to improve hyperlipidemia due to the presence of nutrients such as arginine and citrulline. To test the hypolipidemic effect of watermelon extract (Citrullus lanatus) and the influence of the methylenetetrahydrofolate reductase genotype (MTHFR C677T) on supplementation response. This is an experimental clinical phase II randomized and double-blind study. Forty-three subjects with dyslipidemia were randomly divided into 2 groups: experimental (n = 22) and control (n = 21) groups. The subjects were supplemented daily for 42 days with 6 g of watermelon extract or a mixture of carbohydrates (sucrose/glucose/fructose). The use of watermelon extract reduced plasma total cholesterol (p < 0.05) and low-density lipoprotein (p < 0.01) without modifying triglycerides, high-density lipoprotein, and very low-density lipoprotein values. Only carriers of the T allele (MTHFR C677T) showed decreasing concentrations of low-density lipoprotein (p < 0.01). No changes in anthropometric parameters analyzed were observed. This is the first study to demonstrate the beneficial effect of the consumption of watermelon extract in reducing plasma levels of lipids in humans. The MTHFR C677T polymorphism did not affect the plasma lipid concentration but made individuals more responsive to treatment with watermelon. The consumption of this functional food represents an alternative therapy in the combined treatment of patients with dyslipidemia, promoting health and minimizing the development of risk factors for cardiovascular diseases.

  3. Hypophosphatemic osteomalacia and bone sclerosis caused by a novel homozygous mutation of the FAM20C gene in an elderly man with a mild variant of Raine syndrome.

    PubMed

    Takeyari, Shinji; Yamamoto, Takehisa; Kinoshita, Yuka; Fukumoto, Seiji; Glorieux, Francis H; Michigami, Toshimi; Hasegawa, Kosei; Kitaoka, Taichi; Kubota, Takuo; Imanishi, Yasuo; Shimotsuji, Tsunesuke; Ozono, Keiichi

    2014-10-01

    Hypophosphatemia and increased serum fibroblast growth factor 23 (FGF23) levels have been reported in young brothers with compound heterozygous mutations for the FAM20C gene; however, rickets was not observed in these cases. We report an adult case of Raine syndrome accompanying hypophosphatemic osteomalacia with a homozygous FAM20C mutation (R408W) associated with increased periosteal bone formation in the long bones and an increase in bone mineral density in the femoral neck. The patient, a 61-year-old man, was born from a cousin-to-cousin marriage. A short stature and severe dental demineralization were reported at an elementary school age. Hypophosphatemia was noted inadvertently at 27years old, at which time he started to take an active vitamin D metabolite (alphacalcidol) and phosphate. He also manifested ossification of the posterior longitudinal ligament. On bone biopsy performed at the age of 41years, we found severe osteomalacia surrounding osteocytes, which appeared to be an advanced form of periosteocytic hypomineralized lesions compared to those reported in patients with X-linked hypophosphatemic rickets. Laboratory data at 61years of age revealed markedly increased serum intact-FGF23 levels, which were likely to be the cause of hypophosphatemia and the decreased level of 1,25(OH)2D. We recently identified a homozygous FAM20C mutation, which was R408W, in this patient. When expressed in HEK293 cells, the R408W mutant protein exhibited impaired kinase activity and secretion. Our findings suggest that certain homozygous FAM20C mutations can cause FGF23-related hypophosphatemic osteomalacia and indicate the multiple roles of FAM20C in bone. Copyright © 2014 Elsevier Inc. All rights reserved.

  4. High-dose folic acid supplementation alters the human sperm methylome and is influenced by the MTHFR C677T polymorphism

    PubMed Central

    Aarabi, Mahmoud; San Gabriel, Maria C.; Chan, Donovan; Behan, Nathalie A.; Caron, Maxime; Pastinen, Tomi; Bourque, Guillaume; MacFarlane, Amanda J.; Zini, Armand; Trasler, Jacquetta

    2015-01-01

    Dietary folate is a major source of methyl groups required for DNA methylation, an epigenetic modification that is actively maintained and remodeled during spermatogenesis. While high-dose folic acid supplementation (up to 10 times the daily recommended dose) has been shown to improve sperm parameters in infertile men, the effects of supplementation on the sperm epigenome are unknown. To assess the impact of 6 months of high-dose folic acid supplementation on the sperm epigenome, we studied 30 men with idiopathic infertility. Blood folate concentrations increased significantly after supplementation with no significant improvements in sperm parameters. Methylation levels of the differentially methylated regions of several imprinted loci (H19, DLK1/GTL2, MEST, SNRPN, PLAGL1, KCNQ1OT1) were normal both before and after supplementation. Reduced representation bisulfite sequencing (RRBS) revealed a significant global loss of methylation across different regions of the sperm genome. The most marked loss of DNA methylation was found in sperm from patients homozygous for the methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism, a common polymorphism in a key enzyme required for folate metabolism. RRBS analysis also showed that most of the differentially methylated tiles were located in DNA repeats, low CpG-density and intergenic regions. Ingenuity Pathway Analysis revealed that methylation of promoter regions was altered in several genes involved in cancer and neurobehavioral disorders including CBFA2T3, PTPN6, COL18A1, ALDH2, UBE4B, ERBB2, GABRB3, CNTNAP4 and NIPA1. Our data reveal alterations of the human sperm epigenome associated with high-dose folic acid supplementation, effects that were exacerbated by a common polymorphism in MTHFR. PMID:26307085

  5. Normosmic idiopathic hypogonadotropic hypogonadism due to a novel homozygous nonsense c.C969A (p.Y323X) mutation in the KISS1R gene in three unrelated families.

    PubMed

    Demirbilek, Huseyin; Ozbek, M Nuri; Demir, Korcan; Kotan, L Damla; Cesur, Yasar; Dogan, Murat; Temiz, Fatih; Mengen, Eda; Gurbuz, Fatih; Yuksel, Bilgin; Topaloglu, A Kemal

    2015-03-01

    The spectrum of genetic alterations in cases of hypogonadotropic hypogonadism continue to expand. However, KISS1R mutations remain rare. The aim of this study was to understand the molecular basis of normosmic idiopathic hypogonadotropic hypogonadism. Clinical characteristics, hormonal studies and genetic analyses of seven cases with idiopathic normosmic hypogonadotropic hypogonadism (nIHH) from three unrelated consanguineous families are presented. One male presented with absence of pubertal onset and required surgery for severe penoscrotal hypospadias and cryptorchidism, while other two males had absence of pubertal onset. Two of four female cases required replacement therapy for pubertal onset and maintenance, whereas the other two had spontaneous pubertal onset but incomplete maturation. In sequence analysis, we identified a novel homozygous nonsense (p.Y323X) mutation (c.C969A) in the last exon of the KISS1R gene in all clinically affected cases. We identified a homozygous nonsense mutation in the KISS1R gene in three unrelated families with nIHH, which enabled us to observe the phenotypic consequences of this rare condition. Escape from nonsense-mediated decay, and thus production of abnormal proteins, may account for the variable severity of the phenotype. Although KISS1R mutations are extremely rare and can cause a heterogeneous phenotype, analysis of the KISS1R gene should be a part of genetic analysis of patients with nIHH, to allow better understanding of phenotype-genotype relationship of KISS1R mutations and the underlying genetic basis of patients with nIHH. © 2014 John Wiley & Sons Ltd.

  6. dRTA and hemolytic anemia: first detailed description of SLC4A1 A858D mutation in homozygous state.

    PubMed

    Fawaz, Naglaa A; Beshlawi, Ismail O; Al Zadjali, Shoaib; Al Ghaithi, Hamed K; Elnaggari, Mohamed A; Elnour, Ibtisam; Wali, Yasser A; Al-Said, Bushra B; Rehman, Jalil U; Pathare, Anil V; Knox-Macaulay, Huxley; Alkindi, Salam S

    2012-04-01

    Mutations in the anion exchanger 1 (AE1) gene encoding the erythroid and kidney anion (chloride-bicarbonate) exchanger 1 may result in familial distal renal tubular acidosis (dRTA) in association with membrane defect hemolytic anemia. Seven children presenting with hyperchloremic normal anion gap metabolic acidosis, failure to thrive, and compensated hemolytic anemia were studied. Analysis of red cell AE1/Band 3 surface expression by Eosin 5'-maleimide (E5M) was performed in patients and their family members using flow cytometry. Genetic studies showed that all patients carried a common SLC4A1 mutation, c.2573C>A; p.Ala858Asp in exon 19, found as homozygous (A858D/A858D) mutation in the patients and heterozygous (A858D/N) in the parents. Analysis by flowcytometry revealed a single uniform fluorescence peak, with the mean channel fluorescence (MCF) markedly reduced in cases with homozygous mutation, along with a left shift of fluorescence signal but was only mildly reduced in the heterozygous state. Red cell morphology showed striking acanthocytosis in the homozygous state [patients] and only a mild acanthocytosis in heterozygous state [parents]. In conclusion, this is the first description of a series of homozygous cases with the A858D mutation. The E5M flowcytometry test is specific for reduction in the Band 3 membrane protein and was useful in conjunction with a careful morphological examination of peripheral blood smears in our patient cohort. © 2012 John Wiley & Sons A/S.

  7. The p.Thr11Met mutation in c19orf12 is frequent among adult Turkish patients with MPAN.

    PubMed

    Olgiati, Simone; Doğu, Okan; Tufekcioglu, Zeynep; Diler, Yunus; Saka, Esen; Gultekin, Murat; Kaleagasi, Hakan; Kuipers, Demy; Graafland, Josja; Breedveld, Guido J; Quadri, Marialuisa; Sürmeli, Reyhan; Sünter, Gülin; Doğan, Tuğrul; Yalçın, Ayşe Destina; Bilgiç, Başar; Elibol, Bülent; Emre, Murat; Hanagasi, Hasmet A; Bonifati, Vincenzo

    2017-06-01

    Mutations in the C19orf12 gene cause mitochondrial membrane protein associated neurodegeneration (MPAN), an autosomal recessive form of neurodegeneration with brain iron accumulation (NBIA). A limited number of patients with C19orf12 mutations, particularly those with adult onset of symptoms, have been reported. We sequenced the entire coding region of C19orf12 in 15 Turkish adult probands with idiopathic NBIA. We also performed haplotype analysis in families with a recurrent C19orf12 mutation. Clinical features were collected using a standardized form. Nine of our 15 probands (60%) carried the homozygous c.32C > T mutation in C19orf12 (predicted protein effect: p.Thr11Met). This homozygous mutation co-segregated with the disease in all affected relatives available for testing (16 homozygous subjects). Haplotypes across the C19orf12 locus were identical for a very small region, closest to the mutation, suggesting an old founder, or, two independent founders. The clinical phenotype was characterized by adult onset in most cases (mean 24.5 years, range 10-36), and broad spectrum, including prominent parkinsonism, pyramidal signs, psychiatric disturbances, cognitive decline, and motor axonal neuropathy, in various combinations. On T2- or susceptibility weighted-MRI images, all patients displayed bilateral hypointensities in globus pallidus and substantia nigra, without an eye-of-the-tiger sign; however, hyperintense streaking of the medial medullary lamina between the external and internal parts of globus pallidus was observed frequently. The C19orf12 p.Thr11Met mutation is frequent among adult Turkish patients with MPAN. These findings contribute to the characterization of this important NBIA form, and have direct implications for genetic testing of patients of Turkish origin. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. MTHFR C677T Polymorphism is Associated with Tumor Response to Preoperative Chemoradiotherapy: A Result Based on Previous Reports.

    PubMed

    Zhao, Yue; Li, Xingde; Kong, Xiangjun

    2015-10-12

    Preoperative chemoradiotherapy (pRCT) followed by surgery has been widely practiced in locally advanced rectal cancer, esophageal cancer, gastric cancer and other cancers. However, the therapy also exerts some severe adverse effects and some of the patients show poor or no response. It is very important to develop biomarkers (e.g., gene polymorphisms) to identify patients who have a higher likelihood of responding to pRCT. Recently, a series of reports have investigated the association of the genetic polymorphisms in methylenetetrahydrofolate reductase (MTHFR) and epidermal growth factor receptor (EGFR) genes with the tumor response to pRCT; however, the results were inconsistent and inconclusive. A systematic review and meta-analysis was performed by searching relevant studies about the association of MTHFR and EGFR polymorphisms with the tumor regression grade (TRG) in response to pRCT in databases of PubMed, EMBAS, Web of science, Chinese National Knowledge Infrastructure, and Wanfang database up to March 30, 2015. The pooled odds ratios (ORs) with corresponding 95% confidence intervals (95% CIs) were calculated to assess the strength of the association under 5 genetic models. A total of 11 eligible articles were included in the present meta-analysis, of which 8 studies were performed in rectal cancer and 3 studies were performed in esophageal cancer. We finally included 8 included studies containing 839 cases for MTHFR C677T, 5 studies involving 634 cases for MTHFR A1298C, 3 studies containing 340 cases for EGFR G497A, and 4 studies containing 396 cases for EGFR CA repeat. The pooled analysis results indicated that MTHFR C677T might be correlated with the tumor response to pRCT under the recessive model (CC vs. CTTT) in overall analysis (OR=1.426(1.074-1.894), P=0.014), rectal cancer (OR=1.483(1.102-1.996), P=0.009), and TRG 1-2 vs. 3-5 group (OR=1.423(1.046-1.936), P=0.025), while other polymorphism including MTHFR A1298C, EGFR G497A, and EGFR CA repeat

  9. Highly Prevalent LIPH Founder Mutations Causing Autosomal Recessive Woolly Hair/Hypotrichosis in Japan and the Genotype/Phenotype Correlations

    PubMed Central

    Kono, Michihiro; Takama, Hiromichi; Hamajima, Nobuyuki; Akiyama, Masashi

    2014-01-01

    Mutations in LIPH cause of autosomal recessive woolly hair/hypotrichosis (ARWH), and the 2 missense mutations c.736T>A (p.Cys246Ser) and c.742C>A (p.His248Asn) are considered prevalent founder mutations for ARWH in the Japanese population. To reveal genotype/phenotype correlations in ARWH cases in Japan and the haplotypes in 14 Japanese patients from 14 unrelated Japanese families. 13 patients had woolly hair, and 1 patient had complete baldness since birth. An LIPH mutation search revealed homozygous c.736T>A mutations in 10 of the patients. Compound heterozygous c.736T>A and c.742C>A mutations were found in 3 of the patients, and homozygous c.742C>A mutation in 1 patient. The phenotype of mild hypotrichosis with woolly hair was restricted to the patients with the homozygous c.736T>A mutation. The severe phenotype of complete baldness was seen in only 1 patient with homozygous c.742C>A. Haplotype analysis revealed that the alleles containing the LIPH c.736T>A mutation had a haplotype identical to that reported previously, although 4 alleles out of 5 chromosomes containing the LIPH c.742C>A mutation had a different haplotype from the previously reported founder allele. These alleles with c.742C>A are thought to be the third founder LIPH mutation causing ARWH. To accurately determine the prevalence of the founder mutations, we investigated allele frequencies of those mutations in 819 Japanese controls. Heterozygous c.736T>A mutations were found in 13 controls (allele frequency: 0.0079; carrier rate: 0.016), and heterozygous c.742C>A mutations were found in 2 controls (allele frequency: 0.0012; carrier rate: 0.0024). In conclusion, this study confirms the more accurate allele frequencies of the pathogenic founder mutations of LIPH and shows that there is a third founder mutation in Japan. In addition, the present findings suggest that the mutation patterns of LIPH might be associated with hypotrichosis severity in ARWH. PMID:24586639

  10. Methylenetetrahydrofolate reductase (MTHFR) gene 677C>T and 1298A>C polymorphisms are associated with differential apoptosis of leukemic B cells in vitro and disease progression in chronic lymphocytic leukemia.

    PubMed

    Nückel, H; Frey, U H; Dürig, J; Dührsen, U; Siffert, W

    2004-11-01

    Methylenetetrahydrofolate reductase (MTHFR) regulates the metabolism of folate and methionine, essential components of DNA synthesis and methylation. We investigated whether the two genetic MTHFR polymorphisms (677C>T and 1298A>C) are associated with an increased risk for chronic lymphocytic leukemia (CLL) or may predict disease progression. Moreover, we measured potential genotype effects on apoptosis of B-CLL cells.Allele frequencies and genotype distributions for both polymorphisms were not significantly different in 111 patients vs 92 healthy controls. While progression-free survival (PFS) was not significantly different in individuals with CLL including all stages, in patients with Binet stage A PFS was significantly longer in patients displaying the MTHFR 677CC (P=0.043) and the MTHFR 1298A/C or CC genotypes (P=0.019). In a multivariate analysis, MTHFR haplotype (677CC plus 1298CC or A/C) was the best independent prognostic factor for PFS compared with other known prognostic factors. Spontaneous apoptosis of B-CLL cells in vitro was significantly increased in the favorable risk group with MTHFR 677CC and MTHFR 1298AC, which may constitute the cellular basis of the observed associations. While MTHFR polymorphisms do not affect the risk for B-CLL, they may be independent prognostic markers that influence the PFS in patients with early-stage B-CLL.

  11. Neurologic syndrome associated with homozygous mutation at MAG sialic acid binding site.

    PubMed

    Roda, Ricardo H; FitzGibbon, Edmond J; Boucekkine, Houda; Schindler, Alice B; Blackstone, Craig

    2016-08-01

    The MAG gene encodes myelin-associated glycoprotein (MAG), an abundant protein involved in axon-glial interactions and myelination during nerve regeneration. Several members of a consanguineous family with a clinical syndrome reminiscent of Pelizaeus-Merzbacher disease and demyelinating leukodystrophy on brain MRI were recently found to harbor a homozygous missense p.Ser133Arg MAG mutation. Here, we report two brothers from a nonconsanguineous family afflicted with progressive cognitive impairment, neuropathy, ataxia, nystagmus, and gait disorder. Exome sequencing revealed the homozygous missense mutation p.Arg118His in MAG. This Arg118 residue in immunoglobulin domain 1 is critical for sialic acid binding, providing a compelling mechanistic basis for disease pathogenesis.

  12. DCLRE1C (ARTEMIS) mutations causing phenotypes ranging from atypical severe combined immunodeficiency to mere antibody deficiency

    PubMed Central

    Volk, Timo; Pannicke, Ulrich; Reisli, Ismail; Bulashevska, Alla; Ritter, Julia; Björkman, Andrea; Schäffer, Alejandro A.; Fliegauf, Manfred; Sayar, Esra H.; Salzer, Ulrich; Fisch, Paul; Pfeifer, Dietmar; Di Virgilio, Michela; Cao, Hongzhi; Yang, Fang; Zimmermann, Karin; Keles, Sevgi; Caliskaner, Zafer; Güner, S¸ükrü; Schindler, Detlev; Hammarström, Lennart; Rizzi, Marta; Hummel, Michael; Pan-Hammarström, Qiang; Schwarz, Klaus; Grimbacher, Bodo

    2015-01-01

    Null mutations in genes involved in V(D)J recombination cause a block in B- and T-cell development, clinically presenting as severe combined immunodeficiency (SCID). Hypomorphic mutations in the non-homologous end-joining gene DCLRE1C (encoding ARTEMIS) have been described to cause atypical SCID, Omenn syndrome, Hyper IgM syndrome and inflammatory bowel disease—all with severely impaired T-cell immunity. By whole-exome sequencing, we investigated the molecular defect in a consanguineous family with three children clinically diagnosed with antibody deficiency. We identified perfectly segregating homozygous variants in DCLRE1C in three index patients with recurrent respiratory tract infections, very low B-cell numbers and serum IgA levels. In patients, decreased colony survival after irradiation, impaired proliferative response and reduced counts of naïve T cells were observed in addition to a restricted T-cell receptor repertoire, increased palindromic nucleotides in the complementarity determining regions 3 and long stretches of microhomology at switch junctions. Defective V(D)J recombination was complemented by wild-type ARTEMIS protein in vitro. Subsequently, homozygous or compound heterozygous DCLRE1C mutations were identified in nine patients from the same geographic region. We demonstrate that DCLRE1C mutations can cause a phenotype presenting as only antibody deficiency. This novel association broadens the clinical spectrum associated with ARTEMIS mutations. Clinicians should consider the possibility that an immunodeficiency with a clinically mild initial presentation could be a combined immunodeficiency, so as to provide appropriate care for affected patients. PMID:26476407

  13. Role of treatment-modifying MTHFR677C>T and 1298A>C polymorphisms in metformin-treated Puerto Rican patients with type-2 diabetes mellitus and peripheral neuropathy.

    PubMed

    Jiménez-Ramírez, Francisco J; Castro, Liza M; Ortiz, Clarymar; Concepción, Jennifer; Renta, Jessicca Y; Morales-Borges, Raúl H; Miranda-Massari, Jorge R; Duconge, Jorge

    2017-03-01

    The study was conducted to investigate potential association between MTHFR genotypes and diabetic peripheral neuropathy (DPN) in Puerto Ricans with type-2 diabetes mellitus (T2DM) treated with metformin. The prevalence of major MTHFR polymorphisms in this cohort was also ascertained. DNAs from 89 metformin-treated patients with T2DM and DPN were genotyped using the PCR-based RFLP assay for MTHFR677C>T and 1298A>C polymorphisms. Frequency distributions of these variants in the study cohort were compared to those reported for three reference populations (HapMap project) and controls (400 newborn specimens). Chi-square (or Fischer's exact) tests and odds ratios (OR) were used to assess association with DPN susceptibility risk (patients vs. controls) and biochemical markers (wild types vs. carriers). Sixty-seven percent (67%) of participants carry at least one of these MTHFR polymorphisms. No deviations from Hardy-Weinberg equilibrium were detected. The genotype and allele frequencies showed statistically significant differences between participants and controls (p<0.0001 and p=0.03, respectively). Results suggest that 1298A>C but not 677C>T is associated with DPN susceptibility in this cohort (p=0.018). Different patterns of allelic dissimilarities are observed when comparing our cohort vs. the three parental ancestries. After sorting individuals by their carrier status, no significant associations were observed between these genetic variants (independently or combined) and any of the biochemical markers (HbA1c, folate, vitamin B12, homocysteine). Prevalence of major MTHFR variants in Puerto Rican patients with T2DM is first time ever reported. The study provides further evidence on the use of this genetic marker as an independent risk factor for DPN.

  14. Arg753gln and Arg677 Trp Polymorphisms of Toll-Like Receptor 2 In Acute Apical Abscess

    PubMed Central

    Miri-Moghaddam, Ebrahim; Farhad Mollashahi, Narges; Naghibi, Nava; Garme, Yasaman; Bazi, Ali

    2018-01-01

    Statement of the Problem: Genetic polymorphisms can alter immunity response against pathogens, which in turn influence individuals’ susceptibility to certain infections. Purpose: Our aim was to determine the association of Arg753Gln (rs5743708) and Arg677Trp (rs12191786) polymorphisms of toll like receptor-2 gene with the two clinical forms of apical periodontitis: acute apical abscess (AAA) and asymptomatic apical periodontitis (AAP). Materials and Method: There were 50 patients with AAA as case group and 50 with AAP as control group. Genotyping was done using Tetra-ARMS (amplification refractory mutation system) PCR. Results: Heterozygous genotype of Arg677Trp polymorphism was associated with risk of AAA (OR=1.9, 95% CI: 0.7-5.5, p= 0.05). Although statistically insignificant, Arg677Trp polymorphism promoted the risk of AAA in dominant model (OR=2.1, 95% CI: 0.7-5.9, p> 0.05). The frequency of mutant allele (T) of Arg677Trp polymorphism was higher in AAA (14%) than AAP (7%) subjects (OR=1.7, 95% CI: 0.6-4.7). For Arg753Gln polymorphism, wild homozygous (GG) represented the dominant genotype in both cases (96%) and controls (100%). Variant allele (A) of Arg753Gln polymorphism was identified in 2% of AAA, while no individual represented with this allele in AAP subjects. Individuals with Arg753Gln; Arg677Trp (GG; TC) combination showed an elevated risk of AAA (OR=1.6, 95% CI: 0.5- 4.2, p> 0.05). Conclusion: Arg677Trp polymorphism of TLR-2 rendered a higher risk for the development of abscesses in apical periodontitis. It is recommended to explore role of this polymorphism in other populations. PMID:29854884

  15. Homozygous SALL1 Mutation Causes a Novel Multiple Congenital Anomaly—Mental Retardation Syndrome

    PubMed Central

    Vodopiutz, Julia; Zoller, Heinz; Fenwick, Aimée L.; Arnhold, Richard; Schmid, Max; Prayer, Daniela; Müller, Thomas; Repa, Andreas; Pollak, Arnold; Aufricht, Christoph; Wilkie, Andrew O.M.; Janecke, Andreas R.

    2013-01-01

    Objective To delineate a novel autosomal recessive multiple congenital anomaly-mental retardation (MCA-MR) syndrome in 2 female siblings of a consanguineous pedigree and to identify the disease-causing mutation. Study design Both siblings were clinically characterized and homozygosity mapping and sequencing of candidate genes were applied. The contribution of nonsense-mediated messenger RNA (mRNA) decay to the expression of mutant mRNA in fibroblasts of a healthy carrier and a control was studied by pyrosequencing. Results We identified the first homozygous SALL1 mutation, c.3160C > T (p.R1054*), in 2 female siblings presenting with multiple congenital anomalies, central nervous system defects, cortical blindness, and absence of psychomotor development (ie, a novel recognizable, autosomal recessive MCA-MR). The mutant SALL1 transcript partially undergoes nonsense-mediated mRNA decay and is present at 43% of the normal transcript level in the fibroblasts of a healthy carrier. Conclusion Previously heterozygous SALL1 mutations and deletions have been associated with dominantly inherited anal-renal-radial-ear developmental anomalies. We identified an allelic recessive SALL1-related MCA-MR. Our findings imply that quantity and quality of SALL1 transcript are important for SALL1 function and determine phenotype, and mode of inheritance, of allelic SALL1-related disorders. This novel MCA-MR emphasizes SALL1 function as critical for normal central nervous system development and warrants a detailed neurologic investigation in all individuals with SALL1 mutations. PMID:23069192

  16. High-dose folic acid supplementation alters the human sperm methylome and is influenced by the MTHFR C677T polymorphism.

    PubMed

    Aarabi, Mahmoud; San Gabriel, Maria C; Chan, Donovan; Behan, Nathalie A; Caron, Maxime; Pastinen, Tomi; Bourque, Guillaume; MacFarlane, Amanda J; Zini, Armand; Trasler, Jacquetta

    2015-11-15

    Dietary folate is a major source of methyl groups required for DNA methylation, an epigenetic modification that is actively maintained and remodeled during spermatogenesis. While high-dose folic acid supplementation (up to 10 times the daily recommended dose) has been shown to improve sperm parameters in infertile men, the effects of supplementation on the sperm epigenome are unknown. To assess the impact of 6 months of high-dose folic acid supplementation on the sperm epigenome, we studied 30 men with idiopathic infertility. Blood folate concentrations increased significantly after supplementation with no significant improvements in sperm parameters. Methylation levels of the differentially methylated regions of several imprinted loci (H19, DLK1/GTL2, MEST, SNRPN, PLAGL1, KCNQ1OT1) were normal both before and after supplementation. Reduced representation bisulfite sequencing (RRBS) revealed a significant global loss of methylation across different regions of the sperm genome. The most marked loss of DNA methylation was found in sperm from patients homozygous for the methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism, a common polymorphism in a key enzyme required for folate metabolism. RRBS analysis also showed that most of the differentially methylated tiles were located in DNA repeats, low CpG-density and intergenic regions. Ingenuity Pathway Analysis revealed that methylation of promoter regions was altered in several genes involved in cancer and neurobehavioral disorders including CBFA2T3, PTPN6, COL18A1, ALDH2, UBE4B, ERBB2, GABRB3, CNTNAP4 and NIPA1. Our data reveal alterations of the human sperm epigenome associated with high-dose folic acid supplementation, effects that were exacerbated by a common polymorphism in MTHFR. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  17. Adult siblings with homozygous G6PC3 mutations expand our understanding of the severe congenital neutropenia type 4 (SCN4) phenotype.

    PubMed

    Fernandez, Bridget A; Green, Jane S; Bursey, Ford; Barrett, Brendan; MacMillan, Andrée; McColl, Sarah; Fernandez, Sara; Rahman, Proton; Mahoney, Krista; Pereira, Sergio L; Scherer, Stephen W; Boycott, Kym M; Woods, Michael O

    2012-11-21

    Severe congenital neutropenia type 4 (SCN4) is an autosomal recessive disorder caused by mutations in the third subunit of the enzyme glucose-6-phosphatase (G6PC3). Its core features are congenital neutropenia and a prominent venous skin pattern, and affected individuals have variable birth defects. Oculocutaneous albinism type 4 (OCA4) is caused by autosomal recessive mutations in SLC45A2. We report a sister and brother from Newfoundland, Canada with complex phenotypes. The sister was previously reported by Cullinane et al., 2011. We performed homozygosity mapping, next generation sequencing and conventional Sanger sequencing to identify mutations that cause the phenotype in this family. We have also summarized clinical data from 49 previously reported SCN4 cases with overlapping phenotypes and interpret the medical histories of these siblings in the context of the literature. The siblings' phenotype is due in part to a homozygous mutation in G6PC3, [c.829C > T, p.Gln277X]. Their ages are 38 and 37 years respectively and they are the oldest SCN4 patients published to date. Both presented with congenital neutropenia and later developed Crohn disease. We suggest that the latter is a previously unrecognized SCN4 manifestation and that not all affected individuals have an intellectual disability. The sister also has a homozygous mutation in SLC45A2, which explains her severe oculocutaneous hypopigmentation. Her brother carried one SLC45A2 mutation and was diagnosed with "partial OCA" in childhood. This family highlights that apparently novel syndromes can in fact be caused by two known autosomal recessive disorders.

  18. Recessive Mutations in ACPT, Encoding Testicular Acid Phosphatase, Cause Hypoplastic Amelogenesis Imperfecta.

    PubMed

    Seymen, Figen; Kim, Youn Jung; Lee, Ye Ji; Kang, Jenny; Kim, Tak-Heun; Choi, Hwajung; Koruyucu, Mine; Kasimoglu, Yelda; Tuna, Elif Bahar; Gencay, Koray; Shin, Teo Jeon; Hyun, Hong-Keun; Kim, Young-Jae; Lee, Sang-Hoon; Lee, Zang Hee; Zhang, Hong; Hu, Jan C-C; Simmer, James P; Cho, Eui-Sic; Kim, Jung-Wook

    2016-11-03

    Amelogenesis imperfecta (AI) is a heterogeneous group of genetic disorders affecting tooth enamel. The affected enamel can be hypoplastic and/or hypomineralized. In this study, we identified ACPT (testicular acid phosphatase) biallelic mutations causing non-syndromic, generalized hypoplastic autosomal-recessive amelogenesis imperfecta (AI) in individuals from six apparently unrelated Turkish families. Families 1, 4, and 5 were affected by the homozygous ACPT mutation c.713C>T (p.Ser238Leu), family 2 by the homozygous ACPT mutation c.331C>T (p.Arg111Cys), family 3 by the homozygous ACPT mutation c.226C>T (p.Arg76Cys), and family 6 by the compound heterozygous ACPT mutations c.382G>C (p.Ala128Pro) and 397G>A (p.Glu133Lys). Analysis of the ACPT crystal structure suggests that these mutations damaged the activity of ACPT by altering the sizes and charges of key amino acid side chains, limiting accessibility of the catalytic core, and interfering with homodimerization. Immunohistochemical analysis confirmed localization of ACPT in secretory-stage ameloblasts. The study results provide evidence for the crucial function of ACPT during amelogenesis. Copyright © 2016 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  19. Prevalence of MTHFR C677T and MS A2756G polymorphisms in major depressive disorder, and their impact on response to fluoxetine treatment

    USDA-ARS?s Scientific Manuscript database

    To examine the prevalence of the C677T polymorphism of the methylene tetrahydrofolate reductase (MTHFR) gene and the A2756G polymorphism of methionine synthase (MS), and their impact on antidepressant response. We screened 224 subjects (52% female, mean age 39 +/- 11 years) with SCID-diagnosed major...

  20. Widespread correlations between dominance and homozygous effects of mutations: implications for theories of dominance.

    PubMed

    Phadnis, Nitin; Fry, James D

    2005-09-01

    The dominance of deleterious mutations has important consequences for phenomena such as inbreeding depression, the evolution of diploidy, and levels of natural genetic variation. Kacser and Burns' metabolic theory provides a paradigmatic explanation for why most large-effect mutations are recessive. According to the metabolic theory, the recessivity of large-effect mutations is a consequence of a diminishing-returns relationship between flux through a metabolic pathway and enzymatic activity at any step in the pathway, which in turn is an inevitable consequence of long metabolic pathways. A major line of support for this theory was the demonstration of a negative correlation between homozygous effects and dominance of mutations in Drosophila, consistent with a central prediction of the metabolic theory. Using data on gene deletions in yeast, we show that a negative correlation between homozygous effects and dominance of mutations exists for all major categories of genes analyzed, not just those encoding enzymes. The relationship between dominance and homozygous effects is similar for duplicated and single-copy genes and for genes whose products are members of protein complexes and those that are not. A complete explanation of dominance therefore requires either a generalization of Kacser and Burns' theory to nonenzyme genes or a new theory.

  1. Identification of a novel homozygous mutation (S144I) in a Malay patient with maple syrup urine disease.

    PubMed

    Ali, Ernie Zuraida; Yunus, Zabedah Md; Desa, Norsiah Md; Hock, Ngu Lock

    2013-01-01

    Maple syrup urine disease (MSUD) is a rare autosomal recessive metabolic disorder of branched-chain amino acid metabolism caused by the defective function of branched-chain α-ketoacid dehydrogenase complex (BCKDH). It is characterised by increased plasma leucine, isoleucine, and valine levels, and mutations can be detected in any one of the BCKDHA, BCKDHB, and DBT genes. In this study, we describe the molecular basis of a novel mutation found in one MSUD Malay patient from consanguineous parents. A homozygous mutation has been detected in this patient whose both parents carried a heterozygous mutation at DNA coding region c.431G>T in exon 4, which resulted in a substitution of serine to isoleucine at codon 144 (p.S144I). In silico analysis predicted S144I to be potentially damaging. The mutation was located on the alpha helical region of the BCKDHA protein, and it is predicted to affect the stability of protein due to the loss of various polar interactions between local secondary structures. Homology analysis revealed that this mutation occurred in a highly conserved region (100%). This result indicates that S144I mutation is likely pathogenic and may contribute to the classic form of MSUD in this patient.

  2. Role of treatment-modifying MTHFR677C>T and 1298A > C polymorphisms in metformin-treated Puerto Rican patients with type-2 diabetes mellitus and peripheral neuropathy

    PubMed Central

    Jiménez-Ramírez, Francisco J.; Castro, Liza M.; Ortiz, Clarymar; Concepción, Jennifer; Renta, Jessicca Y.; Morales-Borges, Raúl H.; Miranda-Massari, Jorge R.; Duconge, Jorge

    2017-01-01

    Background The study was conducted to investigate potential association between MTHFR genotypes and diabetic peripheral neuropathy (DPN) in Puerto Ricans with type-2 diabetes mellitus (T2DM) treated with metformin. The prevalence of major MTHFR polymorphisms in this cohort was also ascertained. Methods DNAs from 89 metformin-treated patients with T2DM and DPN were genotyped using the PCR-based RFLP assay for MTHFR677C > T and 1298A > C polymorphisms. Frequency distributions of these variants in the study cohort were compared to those reported for three reference populations (HapMap project) and controls (400 newborn specimens). Chi-square (or Fischer’s exact) tests and odds ratios (OR) were used to assess association with DPN susceptibility risk (patients vs. controls) and biochemical markers (wild types vs. carriers). Results Sixty-seven percent (67%) of participants carry at least one of these MTHFR polymorphisms. No deviations from Hardy-Weinberg equilibrium were detected. The genotype and allele frequencies showed statistically significant differences between participants and controls (p < 0.0001 and p = 0.03, respectively). Results suggest that 1298A > C but not 677C > T is associated with DPN susceptibility in this cohort (p = 0.018). Different patterns of allelic dissimilarities are observed when comparing our cohort vs. the three parental ancestries. After sorting individuals by their carrier status, no significant associations were observed between these genetic variants (independently or combined) and any of the biochemical markers (HbA1c, folate, vitamin B12, homocysteine). Conclusions Prevalence of major MTHFR variants in Puerto Rican patients with T2DM is first time ever reported. The study provides further evidence on the use of this genetic marker as an independent risk factor for DPN. PMID:28231061

  3. Correction of the Middle Eastern M712T mutation causing GNE myopathy by trans-splicing.

    PubMed

    Tal-Goldberg, Tzukit; Lorain, Stéphanie; Mitrani-Rosenbaum, Stella

    2014-06-01

    GNE myopathy is a rare neuromuscular autosomal recessive disease, resulting from mutations in the gene UDP N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase (GNE). The most frequent mutation is the single homozygous missense mutation, M712T-the Middle Eastern mutation-located ten amino acids before the end of the protein. We have used an adeno-associated virus (AAV)-based trans-splicing (TS) vector as a gene therapy tool to overcome this mutation by replacing the mutated last exon of GNE by the wild-type exon while preserving the natural endogenous regulatory machinery. We have designed relevant plasmids directed either to mouse or to human GNE. Following transfection of C2C12 murine muscle cells with the mouse TS vectors, we have been able to detect by nested RT-PCR trans-spliced molecules carrying the wild-type exon 12 of GNE. Similarly, transfection of HEK293 human cells with the human-directed TS vectors resulted in the generation of trans-spliced human GNE RNA molecules. Furthermore, infection of primary muscle cells from a GNE myopathy patient carrying the homozygous M712T mutation, with an AAV8-based viral vector carrying a human-directed TS construct, resulted in the generation of wild-type GNE transcripts in addition to the mutated ones. These studies provide a proof of concept that the TS approach could be used to partially correct the Middle Eastern mutation in GNE myopathy patients. These results provide the basis for in vivo research in animal models using the AAV platform with TS plasmids as a potential genetic therapy for GNE myopathy.

  4. Report of Chinese family with severe dermatitis, multiple allergies and metabolic wasting syndrome caused by novel homozygous desmoglein-1 gene mutation.

    PubMed

    Cheng, Ruhong; Yan, Ming; Ni, Cheng; Zhang, Jia; Li, Ming; Yao, Zhirong

    2016-10-01

    Recently, homozygous mutations in the desmoglein-1 (DSG1) gene and heterozygous mutation in the desmoplakin (DSP) gene have been demonstrated to be associated with severe dermatitis, multiple allergies and metabolic wasting (SAM) syndrome (Mendelian Inheritance in Man no. 615508). We aim to identify the molecular basis for a Chinese pedigree of SAM syndrome. A Chinese pedigree of SAM syndrome was subjected to mutation detection in the DSG1 gene. Sequence analysis of the DSG1 gene and quantitative reverse transcriptase polymerase chain reaction analysis for gene expression of DSG1 using cDNA derived from the epidermis of patients and controls were both performed. Skin biopsies were also taken from patients for pathological study and transmission electron microscopy observation. Novel homozygous splicing mutation c.1892-1delG in the exon-intron border of the DSG1 gene has been demonstrated to be associated with SAM syndrome. We report a new family of SAM syndrome of Asian decent and expand the spectrum of mutations in the DSG1 gene. © 2016 Japanese Dermatological Association.

  5. DCLRE1C (ARTEMIS) mutations causing phenotypes ranging from atypical severe combined immunodeficiency to mere antibody deficiency.

    PubMed

    Volk, Timo; Pannicke, Ulrich; Reisli, Ismail; Bulashevska, Alla; Ritter, Julia; Björkman, Andrea; Schäffer, Alejandro A; Fliegauf, Manfred; Sayar, Esra H; Salzer, Ulrich; Fisch, Paul; Pfeifer, Dietmar; Di Virgilio, Michela; Cao, Hongzhi; Yang, Fang; Zimmermann, Karin; Keles, Sevgi; Caliskaner, Zafer; Güner, S Ükrü; Schindler, Detlev; Hammarström, Lennart; Rizzi, Marta; Hummel, Michael; Pan-Hammarström, Qiang; Schwarz, Klaus; Grimbacher, Bodo

    2015-12-20

    Null mutations in genes involved in V(D)J recombination cause a block in B- and T-cell development, clinically presenting as severe combined immunodeficiency (SCID). Hypomorphic mutations in the non-homologous end-joining gene DCLRE1C (encoding ARTEMIS) have been described to cause atypical SCID, Omenn syndrome, Hyper IgM syndrome and inflammatory bowel disease-all with severely impaired T-cell immunity. By whole-exome sequencing, we investigated the molecular defect in a consanguineous family with three children clinically diagnosed with antibody deficiency. We identified perfectly segregating homozygous variants in DCLRE1C in three index patients with recurrent respiratory tract infections, very low B-cell numbers and serum IgA levels. In patients, decreased colony survival after irradiation, impaired proliferative response and reduced counts of naïve T cells were observed in addition to a restricted T-cell receptor repertoire, increased palindromic nucleotides in the complementarity determining regions 3 and long stretches of microhomology at switch junctions. Defective V(D)J recombination was complemented by wild-type ARTEMIS protein in vitro. Subsequently, homozygous or compound heterozygous DCLRE1C mutations were identified in nine patients from the same geographic region. We demonstrate that DCLRE1C mutations can cause a phenotype presenting as only antibody deficiency. This novel association broadens the clinical spectrum associated with ARTEMIS mutations. Clinicians should consider the possibility that an immunodeficiency with a clinically mild initial presentation could be a combined immunodeficiency, so as to provide appropriate care for affected patients. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  6. Prognostic impact of KRAS mutation subtypes in 677 patients with metastatic lung adenocarcinomas

    PubMed Central

    Yu, Helena A.; Sima, Camelia S.; Shen, Ronglai; Kass, Samantha; Gainor, Justin; Shaw, Alice; Hames, Megan; Iams, Wade; Aston, Jonathan; Lovly, Christine M.; Horn, Leora; Lydon, Christine; Oxnard, Geoffrey R.; Kris, Mark G.; Ladanyi, Marc; Riely, Gregory J.

    2015-01-01

    Background We previously demonstrated that patients with metastatic KRAS mutant lung cancers have a shorter survival compared to patients with KRAS wild type cancers. Recent reports have suggested different clinical outcomes and distinct activated signaling pathways depending on KRAS mutation subtype. To better understand the impact of KRAS mutation subtype, we analyzed data from 677 patients with KRAS mutant metastatic lung cancer. Methods We reviewed all patients with metastatic or recurrent lung cancers found to have KRAS mutations over a 6 year time period. We evaluated the associations between KRAS mutation type, clinical factors, and overall survival in univariate and multivariate analyses. Any significant findings were validated in an external multi-institution patient data set. Results Among 677 patients with KRAS mutant lung cancers (53 at codon 13, 624 at codon 12), there was no difference in overall survival for patients when comparing KRAS transition versus transversion mutations (p=0.99), smoking status (p=0.33) or when comparing specific amino acid substitutions (p=0.20). In our data set, patients with KRAS codon 13 mutant tumors (n=53) had shorter overall survival compared to patients with codon 12 mutant tumors (n=624)( 1.1 vs 1.3 years, respectively, p=0.009), and the findings were confirmed in a multivariate Cox model controlling for age, sex and smoking status (HR 1.52 95% CI 1.11-2.08, p=0.008). In an independent validation set of tumors from 682 patients with stage IV KRAS mutant lung cancers, there was no difference in survival between patients with KRAS codon 13 versus codon 12 mutations (1.0 vs 1.1 years respectively, p=0.41). Conclusions Among individuals with KRAS mutant metastatic lung cancers treated with conventional therapy, there are apparent differences in outcome based on KRAS mutation subtype PMID:25415430

  7. A Homozygous Missense Mutation in TGM5 Abolishes Epidermal Transglutaminase 5 Activity and Causes Acral Peeling Skin Syndrome

    PubMed Central

    Cassidy, Andrew J.; van Steensel, Maurice A. M.; Steijlen, Peter M.; van Geel, Michel; Velden, Jaap van der; Morley, Susan M.; Terrinoni, Alessandro; Melino, Gerry; Candi, Eleonora; McLean, W. H. Irwin

    2005-01-01

    Peeling skin syndrome is an autosomal recessive genodermatosis characterized by the shedding of the outer epidermis. In the acral form, the dorsa of the hands and feet are predominantly affected. Ultrastructural analysis has revealed tissue separation at the junction between the granular cells and the stratum corneum in the outer epidermis. Genomewide linkage analysis in a consanguineous Dutch kindred mapped the gene to 15q15.2 in the interval between markers D15S1040 and D15S1016. Two homozygous missense mutations, T109M and G113C, were found in TGM5, which encodes transglutaminase 5 (TG5), in all affected persons in two unrelated families. The mutation was present on the same haplotype in both kindreds, indicating a probable ancestral mutation. TG5 is strongly expressed in the epidermal granular cells, where it cross-links a variety of structural proteins in the terminal differentiation of the epidermis to form the cornified cell envelope. An established, in vitro, biochemical cross-linking assay revealed that, although T109M is not pathogenic, G113C completely abolishes TG5 activity. Three-dimensional modeling of TG5 showed that G113C lies close to the catalytic domain, and, furthermore, that this glycine residue is conserved in all known transglutaminases, which is consistent with pathogenicity. Other families with more-widespread peeling skin phenotypes lacked TGM5 mutations. This study identifies the first causative gene in this heterogeneous group of skin disorders and demonstrates that the protein cross-linking function performed by TG5 is vital for maintaining cell-cell adhesion between the outermost layers of the epidermis. PMID:16380904

  8. [Association between homozygous c.318A>GT mutation in exon 2 of the EIF2B5 gene and the infantile form of vanishing white matter leukoencephalopathy].

    PubMed

    Esmer, Carmen; Blanco Hernández, Gabriela; Saavedra Alanís, Víctor; Reyes Vaca, Jorge Guillermo; Bravo Oro, Antonio

    Vanishing white matter disease is one of the most frequent leukodystrophies in childhood with an autosomal recessive inheritance. A mutation in one of the genes encoding the five subunits of the eukaryotic initiation factor 2 (EIF2B5) is present in 90% of the cases. The diagnosis can be accomplished by the clinical and neuroradiological findings and molecular tests. We describe a thirteen-month-old male with previous normal neurodevelopment, who was hospitalized for vomiting, hyperthermia and irritability. On examination, cephalic perimeter and cranial pairs were normal. Hypotonia, increased muscle stretching reflexes, generalized white matter hypodensity on cranial tomography were found. Fifteen days after discharge, he suffered minor head trauma presenting drowsiness and focal seizures. Magnetic resonance showed generalized hypointensity of white matter. Vanishing white matter disease was suspected, and confirmed by sequencing of the EIF2B5 gene, revealing a homozygous c.318A> T mutation in exon 2. Subsequently, visual acuity was lost and cognitive and motor deterioration was evident. The patient died at six years of age due to severe pneumonia. This case contributes to the knowledge of the mutational spectrum present in Mexican patients and allows to extend the phenotype associated to this mutation. Copyright © 2017. Publicado por Masson Doyma México S.A.

  9. Validation of Deleterious Mutations in Vorderwald Cattle

    PubMed Central

    Reinartz, Sina; Distl, Ottmar

    2016-01-01

    In Montbéliarde cattle two candidate mutations on bovine chromosomes 19 and 29 responsible for embryonic lethality have been detected. Montbéliarde bulls have been introduced into Vorderwald cattle to improve milk and fattening performance. Due to the small population size of Vorderwald cattle and the wide use of a few Montbéliarde bulls through artificial insemination, inbreeding on Montbéliarde bulls in later generations was increasing. Therefore, we genotyped an aborted fetus which was inbred on Montbéliarde as well as Vorderwald x Montbéliarde crossbred bulls for both deleterious mutations. The abortion was observed in an experimental herd of Vorderwald cattle. The objectives of the present study were to prove if one or both lethal mutations may be assumed to have caused this abortion and to show whether these deleterious mutations have been introduced into the Vorderwald cattle population through Montbéliarde bulls. The aborted fetus was homozygous for the SLC37A2:g.28879810C>T mutation (ss2019324563) on BTA29 and both parents as well as the paternal and maternal grandsire were heterozygous for this mutation. In addition, the parents and the paternal grandsire were carriers of the MH2-haplotype linked with the T-allele of the SLC37A2:g.28879810C>T mutation. For the SHBG:g.27956790C>T mutation (rs38377500) on BTA19 (MH1), the aborted fetus and its sire were heterozygous. Among all further 341 Vorderwald cattle genotyped we found 27 SLC37A2:g.28879810C>T heterozygous animals resulting in an allele frequency of 0.0396. Among the 120 male Vorderwald cattle, there were 12 heterozygous with an allele frequency of 0.05. The SLC37A2:g.28879810C>T mutation could not be found in further nine cattle breeds nor in Vorderwald cattle with contributions from Ayrshire bulls. In 69 Vorderwald cattle without genes from Montbéliarde bulls the mutated allele of SLC37A2:g.28879810C>T could not be detected. The SHBG:g.27956790C>T mutation appeared unlikely to be responsible

  10. Novel homozygous FANCL mutation and somatic heterozygous SETBP1 mutation in a Chinese girl with Fanconi Anemia.

    PubMed

    Wu, Weiqing; Liu, Yang; Zhou, Qinghua; Wang, Qin; Luo, Fuwei; Xu, Zhiyong; Geng, Qian; Li, Peining; Zhang, Hui Z; Xie, Jiansheng

    2017-07-01

    Fanconi Anemia (FA) is a rare genetically heterogeneous disorder with 17 known complement groups caused by mutations in different genes. FA complementation group L (FA-L, OMIM #608111) occurred in 0.2% of all FA and only eight mutant variants in the FANCL gene were documented. Phenotype and genotype correlation in FANCL associated FA is still obscure. Here we describe a Chinese girl with FA-L caused by a novel homozygous mutation c.822_823insCTTTCAGG (p.Asp275LeufsX13) in the FANCL gene. The patient's clinical course was typical for FA with progression to bone marrow failure, and death from acute myelomonocytic leukemia (AML-M4) at 9 years of age. Mutation analysis also detected a likely somatic c.2608G > A (p.Gly870Ser) in the SETBP1 gene. Consistent copy number losses of 7q and 18p and gains of 3q and 21q and accumulated non-clonal single cell chromosomal abnormalities were detected in blood leukocytes as her FA progressed. This is the first Chinese FA-L case caused by a novel FANCL mutation. The somatic gene mutation and copy number aberrations could be used to monitor disease progression and the clinical findings provide further information for genotype-phenotype correlation for FA-L. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  11. Dihydrofolate Reductase Deficiency Due to a Homozygous DHFR Mutation Causes Megaloblastic Anemia and Cerebral Folate Deficiency Leading to Severe Neurologic Disease

    PubMed Central

    Cario, Holger; Smith, Desirée E.C.; Blom, Henk; Blau, Nenad; Bode, Harald; Holzmann, Karlheinz; Pannicke, Ulrich; Hopfner, Karl-Peter; Rump, Eva-Maria; Ayric, Zuleya; Kohne, Elisabeth; Debatin, Klaus-Michael; Smulders, Yvo; Schwarz, Klaus

    2011-01-01

    The importance of intracellular folate metabolism is illustrated by the severity of symptoms and complications caused by inborn disorders of folate metabolism or by folate deficiency. We examined three children of healthy, distantly related parents presenting with megaloblastic anemia and cerebral folate deficiency causing neurologic disease with atypical childhood absence epilepsy. Genome-wide homozygosity mapping revealed a candidate region on chromosome 5 including the dihydrofolate reductase (DHFR) locus. DHFR sequencing revealed a homozygous DHFR mutation, c.458A>T (p.Asp153Val), in all siblings. The patients' folate profile in red blood cells (RBC), plasma, and cerebrospinal fluid (CSF), analyzed by liquid chromatography tandem mass spectrometry, was compatible with DHFR deficiency. DHFR activity and fluorescein-labeled methotrexate (FMTX) binding were severely reduced in EBV-immortalized lymphoblastoid cells of all patients. Heterozygous cells displayed intermediate DHFR activity and FMTX binding. RT-PCR of DHFR mRNA revealed no differences between wild-type and DHFR mutation-carrying cells, whereas protein expression was reduced in cells with the DHFR mutation. Treatment with folinic acid resulted in the resolution of hematological abnormalities, normalization of CSF folate levels, and improvement of neurological symptoms. In conclusion, the homozygous DHFR mutation p.Asp153Val causes DHFR deficiency and leads to a complex hematological and neurological disease that can be successfully treated with folinic acid. DHFR is necessary for maintaining sufficient CSF and RBC folate levels, even in the presence of adequate nutritional folate supply and normal plasma folate. PMID:21310277

  12. Erythrocyte volume, folate levels, and the presence of methylenetetrahydrofolate reductase polymorphism.

    PubMed

    García-García, Inés; García-Fragoso, Lourdes; Renta, Jessicca; Arce, Sylvia; Cadilla, Carmen L

    2002-03-01

    Homozygosity for a common polymorphism in the 5,10 methylenetetrahydrofolate reductase (MTHFR) gene (C677T) has been associated to an increased risk of neural tube defects as well as derangements in folate, homocysteine, and hematological parameters. This study analyzed the relationship between folate levels, the erythrocyte volume, and the presence of homozygosity for the C677T polymorphism in a group of 126 Puerto Rican healthy women of childbearing age. Blood samples were analyzed for erythrocyte mean corpuscular volume (MCV), mean erythrocyte hemoglobin content (MCH), folate, and RBC folate. Homozygosity for the C677T mutation was determined by PCR. Thirty-two percent (32%) of women used a folic acid supplement during the three months prior to sampling. Mean folate and RBC folate levels were within the normal range. Individuals homozygous for the MTHFR C677T polymorphism had no elevation of MCV (p = 0.70) or MCH (p = 0.68). Women in the lower quartile of folate levels did not show differences in their MCV or MCH. In this sample of Puerto Rican women, homozygosity for the C677T MTHFR polymorphism was not associated to elevations of MCV or MCH even in the presence of lower folate levels.

  13. Whole-exome sequencing identifies novel homozygous mutation in NPAS2 in family with nonobstructive azoospermia.

    PubMed

    Ramasamy, Ranjith; Bakırcıoğlu, M Emre; Cengiz, Cenk; Karaca, Ender; Scovell, Jason; Jhangiani, Shalini N; Akdemir, Zeynep C; Bainbridge, Matthew; Yu, Yao; Huff, Chad; Gibbs, Richard A; Lupski, James R; Lamb, Dolores J

    2015-08-01

    To investigate the genetic cause of nonobstructive azoospermia (NOA) in a consanguineous Turkish family through homozygosity mapping followed by targeted exon/whole-exome sequencing to identify genetic variations. Whole-exome sequencing (WES). Research laboratory. Two siblings in a consanguineous family with NOA. Validating all variants passing filter criteria with Sanger sequencing to confirm familial segregation and absence in the control population. Discovery of a mutation that could potentially cause NOA. A novel nonsynonymous mutation in the neuronal PAS-2 domain (NPAS2) was identified in a consanguineous family from Turkey. This mutation in exon 14 (chr2: 101592000 C>G) of NPAS2 is likely a disease-causing mutation as it is predicted to be damaging, it is a novel variant, and it segregates with the disease. Family segregation of the variants showed the presence of the homozygous mutation in the three brothers with NOA and a heterozygous mutation in the mother as well as one brother and one sister who were both fertile. The mutation is not found in the single-nucleotide polymorphism database, the 1000 Genomes Project, the Baylor College of Medicine cohort of 500 Turkish patients (not a population-specific polymorphism), or the matching 50 fertile controls. With the use of WES we identified a novel homozygous mutation in NPAS2 as a likely disease-causing variant in a Turkish family diagnosed with NOA. Our data reinforce the clinical role of WES in the molecular diagnosis of highly heterogeneous genetic diseases for which conventional genetic approaches have previously failed to find a molecular diagnosis. Copyright © 2015 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  14. Hb Midnapore [β53(D4)Ala→Val; HBB: c.161C>T]: A Novel Hemoglobin Variant with a Structural Abnormality Associated with IVS-I-5 (G>C) (HBB: c.92+5G>C) Found in a Bengali Indian Family.

    PubMed

    Panja, Amrita; Chowdhury, Prosanto; Basu, Anupam

    2016-09-01

    We describe a novel C>T substitution at codon 53 of the HBB gene (HBB: c.161C>T). The proband was a transfusion-dependent β-thalassemia major (β-TM) patient. DNA was extracted and subsequently, DNA sequencing was done to detect the mutations on the HBB gene. Capillary zone electrophoresis (CZE) revealed the presence of an unknown peak. She inherited this mutation from her grandmother through her mother. This mutation exists in cis with the common β 0 mutation IVS-I-5 (G>C) (HBB: c.92+5G>C). The proband is homozygous for HBB: c.92+5G>C and needs monthly transfusions. On the other hand, her grandmother, mother and sister all possess this novel mutation cis with the heterozygous HBB: c.92+5G>C. They are carriers not thalassemic. This mutation produces the substitution β53(D4)Ala→Val; HBB: c.161C>T, a new structural hemoglobin (Hb) variant. As this variant was identified in a Bengali family from Paschim Midnapore district of West Bengal, India, it has been designated as Hb Midnapore. This variant has now been reported to the HbVar database.

  15. VHL c.505 T>C mutation confers a high age related penetrance but no increased overall mortality

    PubMed Central

    Bender, B.; Eng, C.; Olschewski, M.; Berger, D.; Laubenberger, J.; Altehofer, C.; Kirste, G.; Orszagh, M.; van Velthoven, V.; Miosczka, H.; Schmidt, D.; Neumann, H.

    2001-01-01

    BACKGROUND—Germline mutations of the VHL gene cause von Hippel-Lindau syndrome (VHL). In southern Germany, a specific mutation in this gene, c.505 T>C, is one of the most frequent alterations owing to a founder effect.
METHODS—This study was conducted to evaluate morbidity, specific clinical risk profile, and mortality among a series of VHL c.505 T/C mutation carriers. A total of 125 eligible subjects carrying VHL c.505 T/C underwent ophthalmoscopy and gadolinium enhanced magnetic resonance imaging of the brain, the spinal cord, and the abdomen. Age related penetrance, morbidity, and mortality were assessed.
RESULTS—Frequently observed lesions were phaeochromocytoma (47%), retinal angiomas (36%), haemangioblastoma of the spine (36%), and haemangioblastoma of the brain (16%). Four patients developed renal cell carcinoma. VHL was symptomatic in 47% of subjects; 30% were asymptomatic despite the presence of at least one VHL related tumour and 23% of the carriers had no detectable VHL lesion. Of the 19 patients who had died (15%), 10 died of symptomatic VHL lesions. Overall penetrance by cumulative incidence functions is estimated at 48% by 35 years and 88% by 70 years. In contrast to the only existing published report based on patients with presumably unselected VHL germline mutations, the mortality rate for c.505 T/C mutation carriers is comparable to that of the general population of Germany.
CONCLUSIONS—Our results are an important example that a specific genotype, at least in the case of VHL c.505 T/C, can favourably impact on mortality despite a high age related penetrance. Our study also indirectly provides objective data which might be useful to the life and health insurance industry; it would appear that c.505 T>C mutation positive subjects have similar disease specific mortality to that of the general population owing to a combination of phenotype and timely detection of mutation carrier status followed by aggressive clinical screening and

  16. HFE gene C282Y, H63D and S65C mutations frequency in the Transylvania region, Romania.

    PubMed

    Trifa, Adrian P; Popp, Radu A; Militaru, Mariela S; Farcaş, Marius F; Crişan, Tania O; Gana, Ionuţ; Cucuianu, Andrei; Pop, Ioan V

    2012-06-01

    HFE-associated haemochromatosis is one of the most frequent autosomal recessive disorders in the Caucasian population. Although most of the cases are homozygous individuals for the C282Y mutation, another two mutations, H63D and S65C, have been reported to be associated with milder forms of the disease. This study was a first attempt to evaluate the distribution of these HFE gene mutations in the Transylvania region. Two-hundred and twenty-five healthy, unrelated volunteers originating from the Transylvania region, Romania, were screened for the HFE gene C282Y, H63D and S65C mutations, using molecular genetics assays (Polymerase Chain Reaction-Restriction Fragments Length Polymorphism). For the C282Y mutation, 7 heterozygotes (3.1%) were found, but no homozygous individual. In the case of the H63D mutation, 40 heterozygotes (17.8%) and 4 homozygotes (1.75%) for the mutant allele were evidenced. We found a compound heterozygous genotype (C282Y/H63D) in one individual (0.45%). Thus, the allele frequencies of the C282Y and H63D were 1.75% and 10.9%, respectively. Three individuals (1.3%) were found to harbour the S65C mutation in a heterozygous state, but none in a homozygous state: the allele frequency of the mutant allele was 0.75%. The distribution of the HFE gene C282Y, H63D and S65C mutations found in our group matches the tendencies observed in other European countries: a decreasing gradient from Northern to Southern Europe for the C282Y mutation; high frequency for the H63D mutation, and low frequency for the S65C mutation in most of the countries.

  17. MTHFR 677C-->T and 1298A-->C polymorphisms in children with Down syndrome and acute myeloid leukemia in Brazil.

    PubMed

    Amorim, Marcia R; Zanrosso, Crisiane Wais; Magalhães, Isis Q; Pereira, Simone C; Figueiredo, Alexandre; Emerenciano, Mariana; Pinheiro, Vitoria Regia; d'Andréa, Maria Lydia; Orioli, Ieda M; Koifman, Sergio; Pombo-de-Oliveira, Maria S

    2008-12-01

    Down syndrome (DS) is an important risk factor associated with acute leukemia (AL). The presence of polymorphisms that reduce 5,10-methylenetetrahydrofolate reductase (MTHFR) activity has been linked to the multifactorial leukemogenic process. The authors have conducted a study to test whether 677C-->T and/or 1298A-->C polymorphisms of MTHFR would play an additional role in susceptibility of acute myeloid leukemia (AML) in DS children. They also verified whether any polymorphism in the MTHFR gene was associated with the risk of DS. Genetic polymorphisms determination was carried out in 248 samples from healthy individuals as controls and a total of 115 DS children (65 without leukemia and 50 with AML). The present study failed to reveal any association between these polymorphisms and risk of AML in DS children. The data also indicate that MTHFR polymorphisms are not associated with risk of being a DS child.

  18. Genetic Mapping of Glutaric Aciduria, Type 3, to Chromosome 7 and Identification of Mutations in C7orf10

    PubMed Central

    Sherman, Eric A.; Strauss, Kevin A.; Tortorelli, Silvia; Bennett, Michael J.; Knerr, Ina; Morton, D. Holmes; Puffenberger, Erik G.

    2008-01-01

    While screening Old Order Amish children for glutaric aciduria type 1 (GA1) between 1989 and 1993, we found three healthy children who excreted abnormal quantities of glutaric acid but low 3-hydroxyglutaric acid, a pattern consistent with glutaric aciduria type 3 (GA3). None of these children had the GCDH c.1262C→T mutation that causes GA1 among the Amish. Using single-nucleotide polymorphism (SNP) genotypes, we identified a shared homozygous 4.7 Mb region on chromosome 7. This region contained 25 genes including C7orf10, an open reading frame with a putative mitochondrial targeting sequence and coenzyme-A transferase domain. Direct sequencing of C7orf10 revealed that the three Amish individuals were homozygous for a nonsynonymous sequence variant (c.895C→T, Arg299Trp). We then sequenced three non-Amish children with GA3 and discovered two nonsense mutations (c.322C→T, Arg108Ter, and c.424C→T, Arg142Ter) in addition to the Amish mutation. Two pathogenic alleles were identified in each of the six patients. There was no consistent clinical phenotype associated with GA3. In affected individuals, urine molar ratios of glutarate to its derivatives (3-hydroxyglutarate, glutarylcarnitine, and glutarylglycine) were elevated, suggesting impaired formation of glutaryl-CoA. These observations refine our understanding of the lysine-tryptophan degradation pathway and have important implications for the pathophysiology of GA1. PMID:18926513

  19. Spinal motor neuron involvement in a patient with homozygous PRUNE mutation.

    PubMed

    Iacomino, Michele; Fiorillo, Chiara; Torella, Annalaura; Severino, Mariasavina; Broda, Paolo; Romano, Catia; Falsaperla, Raffaele; Pozzolini, Giulia; Minetti, Carlo; Striano, Pasquale; Nigro, Vincenzo; Zara, Federico

    2018-05-01

    In the last few years, whole exome sequencing (WES) allowed the identification of PRUNE mutations in patients featuring a complex neurological phenotype characterized by severe neurodevelopmental delay, microcephaly, epilepsy, optic atrophy, and brain or cerebellar atrophy. We describe an additional patient with homozygous PRUNE mutation who presented with spinal muscular atrophy phenotype, in addition to the already known brain developmental disorder. This novel feature expands the clinical consequences of PRUNE mutations and allow to converge PRUNE syndrome with previous descriptions of neurodevelopmental/neurodegenerative disorders linked to altered microtubule dynamics. Copyright © 2017 European Paediatric Neurology Society. Published by Elsevier Ltd. All rights reserved.

  20. A Homozygous Nme7 Mutation Is Associated with Situs Inversus Totalis.

    PubMed

    Reish, Orit; Aspit, Liam; Zouella, Arielle; Roth, Yehudah; Polak-Charcon, Sylvie; Baboushkin, Tatiana; Benyamini, Lilach; Scheetz, Todd E; Mussaffi, Huda; Sheffield, Val C; Parvari, Ruti

    2016-08-01

    We investigated the cause of situs inversus totalis (SIT) in two siblings from a consanguineous family. Genotyping and whole-exome analysis revealed a homozygous change in NME7, resulting in deletion of an exon causing an in-frame deletion of 34 amino acids located in the second NDK domain of the protein and segregated with the defective lateralization in the family. NME7 is an important developmental gene, and NME7 protein is a component of the γ-tubulin ring complex. This mutation is predicted to affect the interaction of NME7 protein with this complex as it deletes the amino acids crucial for the binding. SIT associated with homozygous deletion in our patients is in line with Nme7(-/-) mutant mice phenotypes consisting of congenital hydrocephalus and SIT, indicating a novel human laterality patterning role for NME7. Further cases are required to elaborate the full human phenotype associated with NME7 mutations. © 2016 WILEY PERIODICALS, INC.

  1. Mutations in the mitochondrial seryl-tRNA synthetase cause hyperuricemia, pulmonary hypertension, renal failure in infancy and alkalosis, HUPRA syndrome.

    PubMed

    Belostotsky, Ruth; Ben-Shalom, Efrat; Rinat, Choni; Becker-Cohen, Rachel; Feinstein, Sofia; Zeligson, Sharon; Segel, Reeval; Elpeleg, Orly; Nassar, Suheir; Frishberg, Yaacov

    2011-02-11

    An uncharacterized multisystemic mitochondrial cytopathy was diagnosed in two infants from consanguineous Palestinian kindred living in a single village. The most significant clinical findings were tubulopathy (hyperuricemia, metabolic alkalosis), pulmonary hypertension, and progressive renal failure in infancy (HUPRA syndrome). Analysis of the consanguineous pedigree suggested that the causative mutation is in the nuclear DNA. By using genome-wide SNP homozygosity analysis, we identified a homozygous identity-by-descent region on chromosome 19 and detected the pathogenic mutation c.1169A>G (p.Asp390Gly) in SARS2, encoding the mitochondrial seryl-tRNA synthetase. The same homozygous mutation was later identified in a third infant with HUPRA syndrome. The carrier rate of this mutation among inhabitants of this Palestinian isolate was found to be 1:15. The mature enzyme catalyzes the ligation of serine to two mitochondrial tRNA isoacceptors: tRNA(Ser)(AGY) and tRNA(Ser)(UCN). Analysis of amino acylation of the two target tRNAs, extracted from immortalized peripheral lymphocytes derived from two patients, revealed that the p.Asp390Gly mutation significantly impacts on the acylation of tRNA(Ser)(AGY) but probably not that of tRNA(Ser)(UCN). Marked decrease in the expression of the nonacylated transcript and the complete absence of the acylated tRNA(Ser)(AGY) suggest that this mutation leads to significant loss of function and that the uncharged transcripts undergo degradation. Copyright © 2011 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  2. Case report of a novel homozygous splice site mutation in PLA2G6 gene causing infantile neuroaxonal dystrophy in a Sudanese family.

    PubMed

    Elsayed, Liena E O; Mohammed, Inaam N; Hamed, Ahlam A A; Elseed, Maha A; Salih, Mustafa A M; Yahia, Ashraf; Siddig, Rayan A; Amin, Mutaz; Koko, Mahmoud; Elbashir, Mustafa I; Ibrahim, Muntaser E; Brice, Alexis; Ahmed, Ammar E; Stevanin, Giovanni

    2018-05-08

    Infantile neuroaxonal dystrophy (INAD) is a rare hereditary neurological disorder caused by mutations in PLA2G6. The disease commonly affects children below 3 years of age and presents with delay in motor skills, optic atrophy and progressive spastic tetraparesis. Studies of INAD in Africa are extremely rare, and genetic studies from Sub Saharan Africa are almost non-existent. Two Sudanese siblings presented, at ages 18 and 24 months, with regression in both motor milestones and speech development and hyper-reflexia. Brain MRI showed bilateral and symmetrical T2/FLAIR hyperintense signal changes in periventricular areas and basal ganglia and mild cerebellar atrophy. Whole exome sequencing with confirmatory Sanger sequencing were performed for the two patients and healthy family members. A novel variant (NM_003560.2 c.1427 + 2 T > C) acting on a splice donor site and predicted to lead to skipping of exon 10 was found in PLA2G6. It was found in a homozygous state in the two patients and homozygous reference or heterozygous in five healthy family members. This variant has one very strong (loss of function mutation) and three supporting evidences for its pathogenicity (segregation with the disease, multiple computational evidence and specific patients' phenotype). Therefore this variant can be currently annotated as "pathogenic". This is the first study to report mutations in PLA2G6 gene in patients from Sudan.

  3. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

    PubMed

    Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

    2017-10-01

    Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

  4. Dihydrofolate reductase deficiency due to a homozygous DHFR mutation causes megaloblastic anemia and cerebral folate deficiency leading to severe neurologic disease.

    PubMed

    Cario, Holger; Smith, Desirée E C; Blom, Henk; Blau, Nenad; Bode, Harald; Holzmann, Karlheinz; Pannicke, Ulrich; Hopfner, Karl-Peter; Rump, Eva-Maria; Ayric, Zuleya; Kohne, Elisabeth; Debatin, Klaus-Michael; Smulders, Yvo; Schwarz, Klaus

    2011-02-11

    The importance of intracellular folate metabolism is illustrated by the severity of symptoms and complications caused by inborn disorders of folate metabolism or by folate deficiency. We examined three children of healthy, distantly related parents presenting with megaloblastic anemia and cerebral folate deficiency causing neurologic disease with atypical childhood absence epilepsy. Genome-wide homozygosity mapping revealed a candidate region on chromosome 5 including the dihydrofolate reductase (DHFR) locus. DHFR sequencing revealed a homozygous DHFR mutation, c.458A>T (p.Asp153Val), in all siblings. The patients' folate profile in red blood cells (RBC), plasma, and cerebrospinal fluid (CSF), analyzed by liquid chromatography tandem mass spectrometry, was compatible with DHFR deficiency. DHFR activity and fluorescein-labeled methotrexate (FMTX) binding were severely reduced in EBV-immortalized lymphoblastoid cells of all patients. Heterozygous cells displayed intermediate DHFR activity and FMTX binding. RT-PCR of DHFR mRNA revealed no differences between wild-type and DHFR mutation-carrying cells, whereas protein expression was reduced in cells with the DHFR mutation. Treatment with folinic acid resulted in the resolution of hematological abnormalities, normalization of CSF folate levels, and improvement of neurological symptoms. In conclusion, the homozygous DHFR mutation p.Asp153Val causes DHFR deficiency and leads to a complex hematological and neurological disease that can be successfully treated with folinic acid. DHFR is necessary for maintaining sufficient CSF and RBC folate levels, even in the presence of adequate nutritional folate supply and normal plasma folate. Copyright © 2011 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  5. A homozygous FANCM mutation underlies a familial case of non-syndromic primary ovarian insufficiency

    PubMed Central

    Caburet, Sandrine; Guigon, Celine; Mäkinen, Marika; Tanner, Laura; Hietala, Marja; Urbanska, Kaja; Bellutti, Laura; Legois, Bérangère; Bessieres, Bettina; Gougeon, Alain; Benachi, Alexandra; Livera, Gabriel; Rosselli, Filippo

    2017-01-01

    Primary Ovarian Insufficiency (POI) affects ~1% of women under forty. Exome sequencing of two Finnish sisters with non-syndromic POI revealed a homozygous mutation in FANCM, leading to a truncated protein (p.Gln1701*). FANCM is a DNA-damage response gene whose heterozygous mutations predispose to breast cancer. Compared to the mother's cells, the patients’ lymphocytes displayed higher levels of basal and mitomycin C (MMC)-induced chromosomal abnormalities. Their lymphoblasts were hypersensitive to MMC and MMC-induced monoubiquitination of FANCD2 was impaired. Genetic complementation of patient's cells with wild-type FANCM improved their resistance to MMC re-establishing FANCD2 monoubiquitination. FANCM was more strongly expressed in human fetal germ cells than in somatic cells. FANCM protein was preferentially expressed along the chromosomes in pachytene cells, which undergo meiotic recombination. This mutation may provoke meiotic defects leading to a depleted follicular stock, as in Fancm-/- mice. Our findings document the first Mendelian phenotype due to a biallelic FANCM mutation. PMID:29231814

  6. Leber's hereditary optic neuropathy is associated with mitochondrial ND1 T3394C mutation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liang, Min; Zhejiang Provincial Key Laboratory of Medical Genetics, School of Life Sciences, Wenzhou Medical College, Wenzhou, Zhejiang 325003; Guan, Minqiang

    2009-06-05

    We report here the clinical, genetic and molecular characterization of four Chinese families with Leber's hereditary optic neuropathy (LHON). There were variable severity and age-of-onset in visual impairment among these families. Strikingly, there were extremely low penetrances of visual impairment in these Chinese families. Sequence analysis of complete mitochondrial genomes in these pedigrees showed the homoplasmic T3394C (Y30H) mutation, which localized at a highly conserved tyrosine at position 30 of ND1, and distinct sets of mtDNA polymorphisms belonging to haplogroups D4b and M9a. The occurrence of T3394C mutation in these several genetically unrelated subjects affected by visual impairment strongly indicatesmore » that this mutation is involved in the pathogenesis of visual impairment. However, there was the absence of functionally significant mtDNA mutations in these four Chinese pedigrees carrying the T3394C mutation. Therefore, nuclear modifier gene(s) or environmental factor(s) may play a role in the phenotypic expression of the LHON-associated T3394C mutation.« less

  7. Diagnosis of Xeroderma Pigmentosum Groups A and C by Detection of Two Prevalent Mutations in West Algerian Population: A Rapid Genotyping Tool for the Frequent XPC Mutation c.1643_1644delTG.

    PubMed

    Bensenouci, Salima; Louhibi, Lotfi; De Verneuil, Hubert; Mahmoudi, Khadidja; Saidi-Mehtar, Nadhira

    2016-01-01

    Xeroderma pigmentosum (XP) is a rare autosomal recessive disorder. Considering that XP patients have a defect of the nucleotide excision repair (NER) pathway which enables them to repair DNA damage caused by UV light, they have an increased risk of developing skin and eyes cancers. In the present study, we investigated the involvement of the prevalent XPA and XPC genes mutations-nonsense mutation (c.682C>T, p.Arg228X) and a two-base-pair (2 bp) deletion (c.1643_1644delTG or p.Val548Ala fsX25), respectively-in 19 index cases from 19 unrelated families in the West of Algeria. For the genetic diagnosis of XPA gene, we proceeded to PCR-RFLP. For the XPC gene, we validated a routine analysis which includes a specific amplification of a short region surrounding the 2 bp deletion using a fluorescent primer and fragment sizing (GeneScan size) on a sequencing gel. Among the 19 index cases, there were 17 homozygous patients for the 2 bp deletion in the XPC gene and 2 homozygous patients carrying the nonsense XPA mutation. Finally, XPC appears to be the major disease-causing gene concerning xeroderma pigmentosum in North Africa. The use of fragment sizing is the simplest method to analyze this 2 bp deletion for the DNA samples coming from countries where the mutation c.1643_1644delTG of XPC gene is prevalent.

  8. Primary hyperoxaluria type 1: diagnostic relevance of mutations and polymorphisms in the alanine:glyoxylate aminotransferase gene (AGXT).

    PubMed

    Tarn, A C; von Schnakenburg, C; Rumsby, G

    1997-09-01

    Primary hyperoxaluria type 1 (PH1) is an autosomal recessive disorder of glyoxylate metabolism caused by deficiency of the hepatic peroxisomal enzyme alanine:glyoxylate aminotransferase (AGT). The disease shows considerable phenotypic, enzymatic and genetic heterogeneity. To date, 7 polymorphisms and 11 point mutations have been described in the gene encoding AGT. We report on the prevalence of these polymorphisms and mutations in 79 patients with PH1 with the aim of assessing their diagnostic relevance. A strong association of the C154T, intron 1 insertion and C386T polymorphisms is confirmed and this linkage extends to include the type 1 variant of a polymorphic tandem repeat in intron 4. Only 64 of 158 (40%) PH1 alleles have one of the defined mutations, with the G630A mutation accounting for 39 of these and T853C for 14. Overall only 20 (25%) of the patients studied had the genetic basis of their disease fully explained: 7 were homozygous for the G630A mutation, 5 were homozygous for the T853C mutation, 1 was homozygous for the C819T mutation, and 7 had two different mutations identified and were presumed to be compound heterozygotes. Only the two more frequent G630A and T853C mutations are of general diagnostic relevance for mutation screening. It seems likely that there are a significant number of other mutations, perhaps family-specific, still to be described. There was no apparent difference in the types of mutations in patients presenting in the first year of life (36%), suggesting that other factors, such as periods of dehydration or urinary tract infections, might contribute more to the clinical manifestation than genotype.

  9. [Breeding of transgenic mice expressing human tau isoform with P301L mutation and identification of homozygous transgenic mice].

    PubMed

    Wang, Yan-yan; Chen, Ru-zhui; Zhu, Xiao-nani; Liu, Jing; Li, Zhi-hui; Liu, Xiu-juan; Li, Zhi-hui; Na, Xin; Liang, Shan-shan; Qiu, Guo-guang; Zhang, Wei; Wang, Hai; Wang, Xue-lan

    2012-05-01

    To establish homozygous transgenic mouse strain expressing human tau isoform with P301L mutation. Five transgenic mice expressing human tau isoform with P301L mutation were obtained by microinjection into male nuclei. Homozygote and hemizygote were identified by PCR and real-time fluorescent quantitative PCR. Ninety five homozygous transgenic mice were selected, and the results indicated that homozygous transgenic mice were superior to hemizygote in simulating the changes of biological characteristics. Exogenous gene tau is able to stably transmit to next generation and the combination of SYBR Green real-time fluorescent quantitative PCR with the traditional mating is a fast, reliable and economical way to screen homozygous and hemizygous transgenic mice.

  10. An homozygous mutation in KCNK3 is associated with an aggressive form of hereditary pulmonary arterial hypertension.

    PubMed

    Navas Tejedor, P; Tenorio Castaño, J; Palomino Doza, J; Arias Lajara, P; Gordo Trujillo, G; López Meseguer, M; Román Broto, A; Lapunzina Abadía, P; Escribano Subía, P

    2017-03-01

    Pulmonary arterial hypertension (PAH) is a rare devastating disease characterized by a high genetic heterogeneity with several related genes recently described, including BMPR2,TBX4 and KCNK3. The association between KCNK3 and PAH has been recently identified, but the prognosis and phenotype associated with these mutations have been poorly described. We studied a series of 136 idiopathic and hereditary PAH Spanish patients for BMPR2, TBX4 and KCNK3 mutations. We report the results of KCNK3 in which we were able to describe two new mutations (p.Gly106Arg and p.Leu214Arg) in three patients. The first one was found in a patient belonging to a consanguineous Romani family, who carried a homozygous mutation in KCNK3 and developed a severe and early form of the disease. To the best of our knowledge, this is the first time that a homozygous mutation in KCNK3 is reported in a PAH patient. The second one was found in a patient who presented at the young adult age a severe form of the disease. The present report supports the contribution of KCNK3 mutations to the genetic etiology of PAH and strongly suggests that mutations in KCNK3 follow incomplete dominance with worsening of the clinical features in homozygous patients. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  11. The m.3291T>C mt-tRNALeu(UUR) mutation is definitely pathogenic and causes multisystem mitochondrial disease

    PubMed Central

    Yarham, John W.; Blakely, Emma L.; Alston, Charlotte L.; Roberts, Mark E.; Ealing, John; Pal, Piyali; Turnbull, Douglass M.; McFarland, Robert; Taylor, Robert W.

    2013-01-01

    Mitochondrial tRNA point mutations are important causes of human disease, and have been associated with a diverse range of clinical phenotypes. Definitively proving the pathogenicity of any given mt-tRNA mutation requires combined molecular, genetic and functional studies. Subsequent evaluation of the mutation using a pathogenicity scoring system is often very helpful in concluding whether or not the mutation is causing disease. Despite several independent reports linking the m.3291T>C mutation to disease in humans, albeit in association with several different phenotypes, its pathogenicity remains controversial. A lack of conclusive functional evidence and an over-emphasis on the poor evolutionary conservation of the affected nucleotide have contributed to this controversy. Here we describe an adult patient who presented with deafness and lipomas and evidence of mitochondrial abnormalities in his muscle biopsy, who harbours the m.3291T > C mutation, providing conclusive evidence of pathogenicity through analysis of mutation segregation with cytochrome c oxidase (COX) deficiency in single muscle fibres, underlining the importance of performing functional studies when assessing pathogenicity. PMID:23273904

  12. Homozygous Mutations in NEUROD1 Are Responsible for a Novel Syndrome of Permanent Neonatal Diabetes and Neurological Abnormalities

    PubMed Central

    Rubio-Cabezas, Oscar; Minton, Jayne A.L.; Kantor, Iren; Williams, Denise; Ellard, Sian; Hattersley, Andrew T.

    2010-01-01

    OBJECTIVE NEUROD1 is expressed in both developing and mature β-cells. Studies in mice suggest that this basic helix-loop-helix transcription factor is critical in the development of endocrine cell lineage. Heterozygous mutations have previously been identified as a rare cause of maturity-onset diabetes of the young (MODY). We aimed to explore the potential contribution of NEUROD1 mutations in patients with permanent neonatal diabetes. RESEARCH DESIGN AND METHODS We sequenced the NEUROD1 gene in 44 unrelated patients with permanent neonatal diabetes of unknown genetic etiology. RESULTS Two homozygous mutations in NEUROD1 (c.427_ 428del and c.364dupG) were identified in two patients. Both mutations introduced a frameshift that would be predicted to generate a truncated protein completely lacking the activating domain. Both patients had permanent diabetes diagnosed in the first 2 months of life with no evidence of exocrine pancreatic dysfunction and a morphologically normal pancreas on abdominal imaging. In addition to diabetes, they had learning difficulties, severe cerebellar hypoplasia, profound sensorineural deafness, and visual impairment due to severe myopia and retinal dystrophy. CONCLUSIONS We describe a novel clinical syndrome that results from homozygous loss of function mutations in NEUROD1. It is characterized by permanent neonatal diabetes and a consistent pattern of neurological abnormalities including cerebellar hypoplasia, learning difficulties, sensorineural deafness, and visual impairment. This syndrome highlights the critical role of NEUROD1 in both the development of the endocrine pancreas and the central nervous system in humans. PMID:20573748

  13. Efficient introduction of specific homozygous and heterozygous mutations using CRISPR/Cas9.

    PubMed

    Paquet, Dominik; Kwart, Dylan; Chen, Antonia; Sproul, Andrew; Jacob, Samson; Teo, Shaun; Olsen, Kimberly Moore; Gregg, Andrew; Noggle, Scott; Tessier-Lavigne, Marc

    2016-05-05

    The bacterial CRISPR/Cas9 system allows sequence-specific gene editing in many organisms and holds promise as a tool to generate models of human diseases, for example, in human pluripotent stem cells. CRISPR/Cas9 introduces targeted double-stranded breaks (DSBs) with high efficiency, which are typically repaired by non-homologous end-joining (NHEJ) resulting in nonspecific insertions, deletions or other mutations (indels). DSBs may also be repaired by homology-directed repair (HDR) using a DNA repair template, such as an introduced single-stranded oligo DNA nucleotide (ssODN), allowing knock-in of specific mutations. Although CRISPR/Cas9 is used extensively to engineer gene knockouts through NHEJ, editing by HDR remains inefficient and can be corrupted by additional indels, preventing its widespread use for modelling genetic disorders through introducing disease-associated mutations. Furthermore, targeted mutational knock-in at single alleles to model diseases caused by heterozygous mutations has not been reported. Here we describe a CRISPR/Cas9-based genome-editing framework that allows selective introduction of mono- and bi-allelic sequence changes with high efficiency and accuracy. We show that HDR accuracy is increased dramatically by incorporating silent CRISPR/Cas-blocking mutations along with pathogenic mutations, and establish a method termed 'CORRECT' for scarless genome editing. By characterizing and exploiting a stereotyped inverse relationship between a mutation's incorporation rate and its distance to the DSB, we achieve predictable control of zygosity. Homozygous introduction requires a guide RNA targeting close to the intended mutation, whereas heterozygous introduction can be accomplished by distance-dependent suboptimal mutation incorporation or by use of mixed repair templates. Using this approach, we generated human induced pluripotent stem cells with heterozygous and homozygous dominant early onset Alzheimer's disease-causing mutations in

  14. A common mutation in the methylenetetrahydrofolate reductase gene is associated with an accumulation of formylated tetrahydrofolates in red blood cells

    PubMed Central

    Bagley, Pamela J.; Selhub, Jacob

    1998-01-01

    A common mutation (C677T) in the gene encoding for methylenetetrahydrofolate reductase (MTHFR) (5-methyltetrahydrofolate:(acceptor) oxidoreductase, EC 1.7.99.5), a key regulatory enzyme in one-carbon metabolism, results in a thermolabile variant of the MTHFR enzyme with reduced activity in vitro. In the present study we used a chromatographic method for folate analysis to test the hypothesis that this mutation would be associated with altered distribution of red blood cell (RBC) folates. An alteration was found as manifested by the presence of formylated tetrahydrofolate polyglutamates in addition to methylated derivatives in the RBCs from homozygous mutant individuals. 5-Methyltetrahydrofolate polyglutamates were the only folate form found in RBCs from individuals with the wild-type genotype. Existence of formylated folates in RBCs only from individuals with the thermolabile MTHFR is consistent with the hypothesis that there is in vivo impairment in the activity of the thermolabile variant of MTHFR and that this impairment results in an altered distribution of RBC folates. PMID:9789068

  15. A novel homozygous truncating GNAT1 mutation implicated in retinal degeneration.

    PubMed

    Carrigan, Matthew; Duignan, Emma; Humphries, Pete; Palfi, Arpad; Kenna, Paul F; Farrar, G Jane

    2016-04-01

    The GNAT1 gene encodes the α subunit of the rod transducin protein, a key element in the rod phototransduction cascade. Variants in GNAT1 have been implicated in stationary night-blindness in the past, but unlike other proteins in the same pathway, it has not previously been implicated in retinitis pigmentosa. A panel of 182 retinopathy-associated genes was sequenced to locate disease-causing mutations in patients with inherited retinopathies. Sequencing revealed a novel homozygous truncating mutation in the GNAT1 gene in a patient with significant pigmentary disturbance and constriction of visual fields, a presentation consistent with retinitis pigmentosa. This is the first report of a patient homozygous for a complete loss-of-function GNAT1 mutation. The clinical data from this patient provide definitive evidence of retinitis pigmentosa with late onset in addition to the lifelong night-blindness that would be expected from a lack of transducin function. These data suggest that some truncating GNAT1 variants can indeed cause a recessive, mild, late-onset retinal degeneration in human beings rather than just stationary night-blindness as reported previously, with notable similarities to the phenotype of the Gnat1 knockout mouse. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  16. Novel homozygous mutations in the osteoprotegerin gene TNFRSF11B in two unrelated patients with juvenile Paget's disease.

    PubMed

    Naot, Dorit; Choi, Ally; Musson, David Shaun; Simsek Kiper, Pelin Özlem; Utine, Gulen Eda; Boduroglu, Koray; Peacock, Munro; DiMeglio, Linda A; Cundy, Tim

    2014-11-01

    Most patients with juvenile Paget's disease (JPD) are homozygous for mutations in the gene TNFRSF11B that result in deficiency of osteoprotegerin (OPG) - a key regulator of bone turnover. So far, about 10 different OPG mutations have been described. The current study presents two novel OPG mutations in JPD patients. Patient 1 was diagnosed at the age of 9months when he presented with inability to sit up, slow growth, marked bone pain and very high levels of serum alkaline phosphatase. Patient 2 presented a milder phenotype. He was initially diagnosed with osteogenesis imperfecta, and although he had numerous fractures and bone deformity, he was still independently mobile at the age of 19years, when a diagnosis of JPD was confirmed. Sequence analysis of DNA samples from the patients determined two novel homozygous mutations in TNFSRF11B. Patient 1 (severe phenotype) had a large (245-251kbp) homozygous deletion beginning in intron 1 that resulted in loss of 4 of the 5 exons of TNFSRF11B, including the whole ligand-binding domain. Patient 2 had a homozygous missense mutation resulting in a Thr>Pro change in exon 2 of TNFSRF11B that is predicted to disrupt the OPG ligand-binding domain. Taken in conjunction with other published cases, these results are consistent with the hypothesis that the most severe phenotypes in JPD are seen in patients with major gene deletions or mutations affecting cysteine residues in the ligand-binding domain. Copyright © 2014 Elsevier Inc. All rights reserved.

  17. Novel compound heterozygous Thyroglobulin mutations c.745+1G>A/c.7036+2T>A associated with congenital goiter and hypothyroidism in a Vietnamese family. Identification of a new cryptic 5' splice site in the exon 6.

    PubMed

    Citterio, Cintia E; Morales, Cecilia M; Bouhours-Nouet, Natacha; Machiavelli, Gloria A; Bueno, Elena; Gatelais, Frédérique; Coutant, Regis; González-Sarmiento, Rogelio; Rivolta, Carina M; Targovnik, Héctor M

    2015-03-15

    Several patients were identified with dyshormonogenesis caused by mutations in the thyroglobulin (TG) gene. These defects are inherited in an autosomal recessive manner and affected individuals are either homozygous or compound heterozygous for the mutations. The aim of the present study was to identify new TG mutations in a patient of Vietnamese origin affected by congenital hypothyroidism, goiter and low levels of serum TG. DNA sequencing identified the presence of compound heterozygous mutations in the TG gene: the maternal mutation consists of a novel c.745+1G>A (g.IVS6 + 1G>A), whereas the hypothetical paternal mutation consists of a novel c.7036+2T>A (g.IVS40 + 2T>A). The father was not available for segregation analysis. Ex-vivo splicing assays and subsequent RT-PCR analyses were performed on mRNA isolated from the eukaryotic-cells transfected with normal and mutant expression vectors. Minigene analysis of the c.745+1G>A mutant showed that the exon 6 is skipped during pre-mRNA splicing or partially included by use of a cryptic 5' splice site located to 55 nucleotides upstream of the authentic exon 6/intron 6 junction site. The functional analysis of c.7036+2T>A mutation showed a complete skipping of exon 40. The theoretical consequences of splice site mutations, predicted with the bioinformatics tool NNSplice, Fsplice, SPL, SPLM and MaxEntScan programs were investigated and evaluated in relation with the experimental evidence. These analyses predicted that both mutant alleles would result in the abolition of the authentic splice donor sites. The c.745+1G>A mutation originates two putative truncated proteins of 200 and 1142 amino acids, whereas c.7036+2T>A mutation results in a putative truncated protein of 2277 amino acids. In conclusion, we show that the c.745+1G>A mutation promotes the activation of a new cryptic donor splice site in the exon 6 of the TG gene. The functional consequences of these mutations could be structural changes in the protein

  18. A hybrid stochastic model of folate-mediated one-carbon metabolism: Effect of the common C677T MTHFR variant on de novo thymidylate biosynthesis.

    PubMed

    Misselbeck, Karla; Marchetti, Luca; Field, Martha S; Scotti, Marco; Priami, Corrado; Stover, Patrick J

    2017-04-11

    Folate-mediated one-carbon metabolism (FOCM) is an interconnected network of metabolic pathways, including those required for the de novo synthesis of dTMP and purine nucleotides and for remethylation of homocysteine to methionine. Mouse models of folate-responsive neural tube defects (NTDs) indicate that impaired de novo thymidylate (dTMP) synthesis through changes in SHMT expression is causative in folate-responsive NTDs. We have created a hybrid computational model comprised of ordinary differential equations and stochastic simulation. We investigated whether the de novo dTMP synthesis pathway was sensitive to perturbations in FOCM that are known to be associated with human NTDs. This computational model shows that de novo dTMP synthesis is highly sensitive to the common MTHFR C677T polymorphism and that the effect of the polymorphism on FOCM is greater in folate deficiency. Computational simulations indicate that the MTHFR C677T polymorphism and folate deficiency interact to increase the stochastic behavior of the FOCM network, with the greatest instability observed for reactions catalyzed by serine hydroxymethyltransferase (SHMT). Furthermore, we show that de novo dTMP synthesis does not occur in the cytosol at rates sufficient for DNA replication, supporting empirical data indicating that impaired nuclear de novo dTMP synthesis results in uracil misincorporation into DNA.

  19. Methylenetetrahydrofolate reductase C677T polymorphism: association with risk for childhood acute lymphoblastic leukemia and response during the initial phase of chemotherapy in greek patients.

    PubMed

    Chatzidakis, Konstantinos; Goulas, Antonis; Athanassiadou-Piperopoulou, Fani; Fidani, Liana; Koliouskas, Dimitrios; Mirtsou, Vassiliki

    2006-08-01

    As of late, a number of studies have focused on the association of the gene for methyletetrahydrofolate reductase (MTHFR) with risk for acute lymphoblastic leukemia (ALL) in children and in adults, as well as with response to chemotherapy. The degree of this association may vary according to the ethnic background and geographic localization of the population under study, or the phase of treatment when response to chemotherapy is concerned. We have analyzed the MTHFR C677T polymorphism in 52 patients and 88 control individuals, all ethnic Greek residents of northern Greece, and examined the association of this polymorphism with (a) susceptibility to childhood ALL and (b) the distribution of average plasma alanine aminotransferase (ALT) levels, white blood cell counts (WBC), and hemoglobin levels (Hb) during the induction and consolidation phases of treatment. We were able to detect a statistically significant protective effect, with respect to ALL, associated with carriage of the MTHFR 677T allele [OR = 0.387 (95% CI = 0.193-0.776)]. In addition, we observed a general tendency towards lower values in all three parameters studied, associated with the MTHFR 677CC genotype, which was more evident in the transition from the induction to the consolidation phase, indicating that MTHFR genotyping may be of prognostic value in the early phase of treatment for childhood ALL, in our population.

  20. Identification and molecular characterisation of a homozygous missense mutation in the ADAMTS10 gene in a patient with Weill-Marchesani syndrome.

    PubMed

    Steinkellner, Hannes; Etzler, Julia; Gogoll, Laura; Neesen, Jürgen; Stifter, Eva; Brandau, Oliver; Laccone, Franco

    2015-09-01

    Weill-Marchesani syndrome is a rare disorder of the connective tissue. Functional variants in ADAMTS10 are associated with Weill-Marchesani syndrome-1. We identified a homozygous missense mutation, c.41T>A, of the ADAMTS10 gene in a 19-year-old female with typical symptoms of WMS1: proportionate short stature, brachydactyly, joint stiffness, and microspherophakia. The ADAMTS10 missense mutation was analysed in silico, with conflicting results as to its effects on protein function, but it was predicted to affect the leader sequence. Molecular characterisation in HEK293 Ebna cells revealed an intracellular mis-targeting of the ADAMTS10 protein with a reduced concentration of the polypeptide in the endoplasmic reticulum. A large reduction in glycosylation of the cytoplasmic fraction of the mutant ADAMTS10 protein versus the wild-type protein and a lack of secretion of the mutant protein are also evident in our results.In conclusion, we identified a novel missense mutation of the ADAMTS10 gene and confirmed the functional consequences suggested by the in silico analysis by conducting molecular studies.

  1. Clinical expression of C282Y homozygous HFE haemochromatosis at 14 years of age.

    PubMed

    Rossi, Enrico; Wallace, Daniel F; Subramaniam, V Nathan; St Pierre, Timothy G; Mews, Catherine; Jeffrey, Gary P

    2006-05-01

    A 14-year-old boy who presented with debilitating lethargy was shown to have an elevated serum ferritin of 572 microg/L and a C282Y homozygous HFE genotype. Liver iron concentration was measured non-invasively by magnetic resonance imaging, which revealed a liver iron concentration of 59 micromol/g dry weight (children's reference range < 14). The early phenotypic expression was further investigated by screening genomic DNA for the presence of co-inherited mutations in genes responsible for non-HFE haemochromatosis. Coding regions and splice sites in genes encoding hepcidin and haemojuvelin were sequenced and previously described mutations in ferroportin 1 and transferrin receptor 2 genes were screened. Although no mutations were found, the most likely cause for the early expression is the presence of novel mutations or gene(s).

  2. A syndrome of congenital microcephaly, intellectual disability and dysmorphism with a homozygous mutation in FRMD4A.

    PubMed

    Fine, Dina; Flusser, Hagit; Markus, Barak; Shorer, Zamir; Gradstein, Libe; Khateeb, Shareef; Langer, Yshia; Narkis, Ginat; Birk, Ruth; Galil, Aharon; Shelef, Ilan; Birk, Ohad S

    2015-12-01

    A consanguineous Bedouin Israeli kindred presented with a novel autosomal recessive intellectual disability syndrome of congenital microcephaly, low anterior hairline, bitemporal narrowing, low-set protruding ears, strabismus and tented thick eyebrows with sparse hair in their medial segment. Brain imaging demonstrated various degrees of agenesis of corpus callosum and hypoplasia of the vermis and cerebellum. Genome-wide linkage analysis followed by fine mapping defined a 7.67 Mb disease-associated locus (LOD score 4.99 at θ=0 for marker D10S1653). Sequencing of the 48 genes within the locus identified a single non-synonymous homozygous duplication frameshift mutation of 13 nucleotides (c.2134_2146dup13) within the coding region of FRMD4A, that was common to all affected individuals and not found in 180 non-related Bedouin controls. Three of 50 remotely related healthy controls of the same tribe were heterozygous for the mutation. FRMD4A, member of the FERM superfamily, is involved in cell structure, transport and signaling. It regulates cell polarity by playing an important role in the activation of ARF6, mediating the interaction between Par3 and the ARF6 guanine nucleotide exchange factor. ARF6 is known to modulate cell polarity in neurons, and regulates dendritic branching in hippocampal neurons and neurite outgrowth. The FRMD4 domain that is essential for determining cell polarity through interaction with Par3 is truncated by the c.2134_2146dup13 mutation. FRMD4A polymorphisms were recently suggested to be a risk factor for Alzheimer's disease. We now show a homozygous frameshift mutation of the same gene in a severe neurologic syndrome with unique dysmorphism.

  3. A Lower Degree of PBMC L1 Methylation in Women with Lower Folate Status May Explain the MTHFR C677T Polymorphism Associated Higher Risk of CIN in the US Post Folic Acid Fortification Era

    PubMed Central

    Badiga, Suguna; Johanning, Gary L.; Macaluso, Maurizio; Azuero, Andres; Chambers, Michelle M.; Siddiqui, Nuzhat R.; Piyathilake, Chandrika J.

    2014-01-01

    Background Studies in populations unexposed to folic acid (FA) fortification have demonstrated that MTHFR C677T polymorphism is associated with increased risk of higher grades of cervical intraepithelial neoplasia (CIN 2+). However, it is unknown whether exposure to higher folate as a result of the FA fortification program has altered the association between MTHFR C677T and risk of CIN, or the mechanisms involved with such alterations. The current study investigated the following in a FA fortified population: 1) The association between MTHFR C677T polymorphism and risk of CIN 2+; 2) The modifying effects of plasma folate concentrations on this association; and 3) The modifying effects of plasma folate on the association between the polymorphism and degree of methylation of long interspersed nucleotide elements (L1s), in peripheral blood mononuclear cell (PBMC) DNA, a documented biomarker of CIN risk. Methods The study included 457 US women diagnosed with either CIN 2+ (cases) or ≤ CIN 1 (non-cases). Unconditional logistic regression models were used to test the associations after adjusting for relevant risk factors for CIN. Results The 677CT/TT MTHFR genotypes were not associated with the risk of CIN 2+. Women with CT/TT genotype with lower folate, however, were more likely to be diagnosed with CIN 2+ compared to women with CT/TT genotype with higher folate (OR = 2.41, P = 0.030). Women with CT/TT genotype with lower folate were less likely to have a higher degree of PBMC L1 methylation compared to women with CT/TT genotype with higher folate (OR = 0.28, P = 0.017). Conclusions This study provides the first evidence that the MTHFR 677CT/TT genotype-associated lower degree of PBMC L1 methylation increases the risk of CIN 2+ in women in the US post-FA fortification era. Thus, even in the post-FA fortification era, not all women have adequate folate status to overcome MTHFR 677CT/TT genotype-associated lower degree of L1 methylation. PMID:25302494

  4. Diagnosis of Xeroderma Pigmentosum Groups A and C by Detection of Two Prevalent Mutations in West Algerian Population: A Rapid Genotyping Tool for the Frequent XPC Mutation c.1643_1644delTG

    PubMed Central

    Bensenouci, Salima; Louhibi, Lotfi; De Verneuil, Hubert; Mahmoudi, Khadidja; Saidi-Mehtar, Nadhira

    2016-01-01

    Xeroderma pigmentosum (XP) is a rare autosomal recessive disorder. Considering that XP patients have a defect of the nucleotide excision repair (NER) pathway which enables them to repair DNA damage caused by UV light, they have an increased risk of developing skin and eyes cancers. In the present study, we investigated the involvement of the prevalent XPA and XPC genes mutations—nonsense mutation (c.682C>T, p.Arg228X) and a two-base-pair (2 bp) deletion (c.1643_1644delTG or p.Val548Ala fsX25), respectively—in 19 index cases from 19 unrelated families in the West of Algeria. For the genetic diagnosis of XPA gene, we proceeded to PCR-RFLP. For the XPC gene, we validated a routine analysis which includes a specific amplification of a short region surrounding the 2 bp deletion using a fluorescent primer and fragment sizing (GeneScan size) on a sequencing gel. Among the 19 index cases, there were 17 homozygous patients for the 2 bp deletion in the XPC gene and 2 homozygous patients carrying the nonsense XPA mutation. Finally, XPC appears to be the major disease-causing gene concerning xeroderma pigmentosum in North Africa. The use of fragment sizing is the simplest method to analyze this 2 bp deletion for the DNA samples coming from countries where the mutation c.1643_1644delTG of XPC gene is prevalent. PMID:27413738

  5. MERRF/MELAS overlap syndrome due to the m.3291T>C mutation.

    PubMed

    Liu, Kaiming; Zhao, Hui; Ji, Kunqian; Yan, Chuanzhu

    2014-03-01

    We report the case of a 19-year-old Chinese female harboring the m.3291T>C mutation in the MT-TL1 gene encoding the mitochondrial transfer RNA for leucine. She presented with a complex phenotype characterized by progressive cerebellar ataxia, frequent myoclonus seizures, recurrent stroke-like episodes, migraine-like headaches with nausea and vomiting, and elevated resting lactate blood level. It is known that the myoclonus epilepsy with ragged-red fibers (MERRF) is characterized by cerebellar ataxia and myoclonus epilepsy, while that the mitochondrial encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) is characterized by recurrent stroke-like episodes, migraine-like headaches, and elevated resting lactate blood level. So the patient's clinical manifestations suggest the presence of a MERRF/MELAS overlap syndrome. Muscle biopsy of the patient showed the presence of numerous scattered ragged-red fibers, some cytochrome c oxidase-deficient fibers, and several strongly succinate dehygrogenase-reactive vessels, suggestive of a mitochondrial disorder. Direct sequencing of the complete mitochondrial genome of the proband revealed no mutations other than the T-to-C transition at nucleotide position 3291. Restriction fragment length polymorphism analysis of the proband and her family revealed maternal inheritance of the mutation in a heteroplasmic manner. The analysis of aerobic respiration and glycolysis demonstrated that the fibroblasts from the patient had mitochondrial dysfunction. Our results suggest that the m.3291T>C is pathogenic. This study is the first to describe the m.3291T>C mutation in association with the MERRF/MELAS overlap syndrome.

  6. Exome sequencing identifies a novel homozygous mutation in the phosphate transporter SLC34A1 in hypophosphatemia and nephrocalcinosis.

    PubMed

    Rajagopal, Abbhirami; Braslavsky, Débora; Lu, James T; Kleppe, Soledad; Clément, Florencia; Cassinelli, Hamilton; Liu, David S; Liern, Jose Miguel; Vallejo, Graciela; Bergadá, Ignacio; Gibbs, Richard A; Campeau, Phillipe M; Lee, Brendan H

    2014-11-01

    Two Argentinean siblings (a boy and a girl) from a nonconsanguineous family presented with hypercalcemia, hypercalciuria, hypophosphatemia, low parathyroid hormone (PTH), and nephrocalcinosis. The goal of this study was to identify genetic causes of the clinical findings in the two siblings. Whole exome sequencing was performed to identify disease-causing mutations in the youngest sibling, and a candidate variant was screened in other family members by Sanger sequencing. In vitro experiments were conducted to determine the effects of the mutation that was identified. Affected siblings (2 y.o. female and 10 y.o male) and their parents were included in the study. Informed consent was obtained for genetic studies. A novel homozygous mutation in the gene encoding the renal sodium-dependent phosphate transporter SLC34A1 was identified in both siblings (c.1484G>A, p.Arg495His). In vitro studies showed that the p.Arg495His mutation resulted in decreased phosphate uptake when compared to wild-type SLC34A1. The homozygous G>A transition that results in the substitution of histidine for arginine at position 495 of the renal sodium-dependent phosphate transporter, SLC34A1, is involved in disease pathogenesis in these patients. Our report of the second family with two mutated SLC34A1 alleles expands the known phenotype of this rare condition.

  7. Association of a homozygous nonsense mutation in the ABCA4 (ABCR) gene with cone-rod dystrophy phenotype in an Italian family.

    PubMed

    Simonelli, Francesca; Testa, Francesco; Zernant, Jana; Nesti, Anna; Rossi, Settimio; Rinaldi, Ernesto; Allikmets, Rando

    2004-01-01

    Genetic variation in the ABCA4 (ABCR) gene has been associated with several distinct retinal phenotypes, including Stargardt disease/fundus flavimaculatus (STGD/FFM), cone-rod dystrophy (CRD), retinitis pigmentosa (RP) and age-related macular degeneration. The current model of genotype/phenotype association suggests that patients harboring deleterious mutations in both ABCR alleles would develop RP-like retinal pathology. Here we describe ABCA4-associated phenotypes, including a proband with a homozygous nonsense mutation in a family from Southern Italy. The proband had been originally diagnosed with STGD. Ophthalmologic examination included kinetic perimetry, electrophysiological studies and fluorescein angiography. DNA of the affected individual and family members was analyzed for variants in all 50 exons of the ABCA4 gene by screening on the ABCR400 microarray. A homozygous nonsense mutation 2971G>T (G991X) was detected in a patient initially diagnosed with STGD based on funduscopic evidence, including bull's eye depigmentation of the fovea and flecks at the posterior pole extending to the mid-peripheral retina. Since this novel nucleotide substitution results in a truncated, nonfunctional, ABCA4 protein, the patient was examined in-depth for the severity of the disease phenotype. Indeed, subsequent electrophysiological studies determined severely reduced cone amplitude as compared to the rod amplitude, suggesting the diagnosis of CRD. ABCR400 microarray is an efficient tool for determining causal genetic variation, including new mutations. A homozygous protein-truncating mutation in ABCA4 can cause a phenotype ranging from STGD to CRD as diagnosed at an early stage of the disease. Only a combination of comprehensive genotype/phenotype correlation studies will determine the proper diagnosis and prognosis of ABCA4-associated pathology. Copyright 2004 S. Karger AG, Basel

  8. Homozygous SLC6A17 Mutations Cause Autosomal-Recessive Intellectual Disability with Progressive Tremor, Speech Impairment, and Behavioral Problems

    PubMed Central

    Iqbal, Zafar; Willemsen, Marjolein H.; Papon, Marie-Amélie; Musante, Luciana; Benevento, Marco; Hu, Hao; Venselaar, Hanka; Wissink-Lindhout, Willemijn M.; Vulto-van Silfhout, Anneke T.; Vissers, Lisenka E.L.M.; de Brouwer, Arjan P.M.; Marouillat, Sylviane; Wienker, Thomas F.; Ropers, Hans Hilger; Kahrizi, Kimia; Nadif Kasri, Nael; Najmabadi, Hossein; Laumonnier, Frédéric; Kleefstra, Tjitske; van Bokhoven, Hans

    2015-01-01

    We report on Dutch and Iranian families with affected individuals who present with moderate to severe intellectual disability and additional phenotypes including progressive tremor, speech impairment, and behavioral problems in certain individuals. A combination of exome sequencing and homozygosity mapping revealed homozygous mutations c.484G>A (p.Gly162Arg) and c.1898C>G (p.Pro633Arg) in SLC6A17. SLC6A17 is predominantly expressed in the brain, encodes a synaptic vesicular transporter of neutral amino acids and glutamate, and plays an important role in the regulation of glutamatergic synapses. Prediction programs and 3D modeling suggest that the identified mutations are deleterious to protein function. To directly test the functional consequences, we investigated the neuronal subcellular localization of overexpressed wild-type and mutant variants in mouse primary hippocampal neuronal cells. Wild-type protein was present in soma, axons, dendrites, and dendritic spines. p.Pro633Arg altered SLC6A17 was found in soma and proximal dendrites but did not reach spines. p.Gly162Arg altered SLC6A17 showed a normal subcellular distribution but was associated with an abnormal neuronal morphology mainly characterized by the loss of dendritic spines. In summary, our genetic findings implicate homozygous SLC6A17 mutations in autosomal-recessive intellectual disability, and their pathogenic role is strengthened by genetic evidence and in silico and in vitro functional analyses. PMID:25704603

  9. Role of genetic mutations in folate-related enzyme genes on Male Infertility

    PubMed Central

    Liu, Kang; Zhao, Ruizhe; Shen, Min; Ye, Jiaxin; Li, Xiao; Huang, Yuan; Hua, Lixin; Wang, Zengjun; Li, Jie

    2015-01-01

    Several studies showed that the genetic mutations in the folate-related enzyme genes might be associated with male infertility; however, the results were still inconsistent. We performed a meta-analysis with trial sequential analysis to investigate the associations between the MTHFR C677T, MTHFR A1298C, MTR A2756G, MTRR A66G mutations and the MTHFR haplotype with the risk of male infertility. Overall, a total of 37 studies were selected. Our meta-analysis showed that the MTHFR C677T mutation was a risk factor for male infertility in both azoospermia and oligoasthenoteratozoospermia patients, especially in Asian population. Men carrying the MTHFR TC haplotype were most liable to suffer infertility while those with CC haplotype had lowest risk. On the other hand, the MTHFR A1298C mutation was not related to male infertility. MTR A2756G and MTRR A66G were potential candidates in the pathogenesis of male infertility, but more case-control studies were required to avoid false-positive outcomes. All of these results were confirmed by the trial sequential analysis. Finally, our meta-analysis with trial sequential analysis proved that the genetic mutations in the folate-related enzyme genes played a significant role in male infertility. PMID:26549413

  10. Leber's hereditary optic neuropathy is associated with mitochondrial ND6 T14502C mutation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhao, Fuxin; Zhejiang Provincial Key Laboratory of Medical Genetics, School of Life Sciences, Wenzhou Medical College, Wenzhou, Zhejiang 325003; Guan, Minqiang

    2009-11-20

    We report here the clinical, genetic, and molecular characterization of three Chinese families with Leber's hereditary optic neuropathy (LHON). There were variable severity and age of onset in visual impairment among these families. Strikingly, there were extremely low penetrances of visual impairment in these Chinese families. Sequence analysis of complete mitochondrial genomes in these pedigrees showed the homoplasmic T14502C (I58V) mutation, which localized at a highly conserved isoleucine at position 58 of ND6, and distinct sets of mtDNA polymorphisms belonging to haplogroups M10a, F1a1, and H2. The occurrence of T14502C mutation in these several genetically unrelated subjects affected by visualmore » impairment strongly indicates that this mutation is involved in the pathogenesis of visual impairment. Here, mtDNA variants I187T in the ND1, A122V in CO1, S99A in the A6, and V254I in CO3 exhibited an evolutionary conservation, indicating a potential modifying role in the development of visual impairment associated with T14502C mutation in those families. Furthermore, nuclear modifier gene(s) or environmental factor(s) may play a role in the phenotypic manifestation of the LHON-associated T14502C mutation in these Chinese families.« less

  11. Vincristine-induced central neurotoxicity in a collie homozygous for the ABCB1Δ mutation.

    PubMed

    Krugman, L; Bryan, J N; Mealey, K L; Chen, A

    2012-03-01

    A six-year-old, neutered, female collie was presented to an oncology specialty service after developing tetraparesis and self-mutilation that progressively worsened while receiving chemotherapy for lymphoma. Neurologic examination revealed ataxia, paresis and diminished conscious proprioception in all limbs with entire spinal reflexes. Magnetic resonance imaging of the brain and spinal cord was normal. Electromyography of the limbs ruled out a vincristine-induced peripheral neuropathy. Cerebrospinal fluid analysis and cerebrospinal fluid and serum testing for Neospora and Toxoplasma were normal. Results of MDR1 genotyping revealed that the dog was homozygous for the ABCB1-1Δ (MDR1) mutation. This clinical presentation strongly resembled the effects seen from inadvertent intrathecal administration of vincristine in humans. Dogs that are homozygous for the ABCB1-1Δ (MDR1) mutation should not receive standard dosages of chemotherapy drugs known to be eliminated by P-glycoprotein, the gene product of ABCB1. Testing for this mutation is strongly recommended before chemotherapy initiation for at-risk breeds. © 2011 British Small Animal Veterinary Association.

  12. A homozygous FITM2 mutation causes a deafness-dystonia syndrome with motor regression and signs of ichthyosis and sensory neuropathy.

    PubMed

    Zazo Seco, Celia; Castells-Nobau, Anna; Joo, Seol-Hee; Schraders, Margit; Foo, Jia Nee; van der Voet, Monique; Velan, S Sendhil; Nijhof, Bonnie; Oostrik, Jaap; de Vrieze, Erik; Katana, Radoslaw; Mansoor, Atika; Huynen, Martijn; Szklarczyk, Radek; Oti, Martin; Tranebjærg, Lisbeth; van Wijk, Erwin; Scheffer-de Gooyert, Jolanda M; Siddique, Saadat; Baets, Jonathan; de Jonghe, Peter; Kazmi, Syed Ali Raza; Sadananthan, Suresh Anand; van de Warrenburg, Bart P; Khor, Chiea Chuen; Göpfert, Martin C; Qamar, Raheel; Schenck, Annette; Kremer, Hannie; Siddiqi, Saima

    2017-02-01

    A consanguineous family from Pakistan was ascertained to have a novel deafness-dystonia syndrome with motor regression, ichthyosis-like features and signs of sensory neuropathy. By applying a combined strategy of linkage analysis and whole-exome sequencing in the presented family, a homozygous nonsense mutation, c.4G>T (p.Glu2*), in FITM2 was identified. FITM2 and its paralog FITM1 constitute an evolutionary conserved protein family involved in partitioning of triglycerides into cellular lipid droplets. Despite the role of FITM2 in neutral lipid storage and metabolism, no indications for lipodystrophy were observed in the affected individuals. In order to obtain independent evidence for the involvement of FITM2 in the human pathology, downregulation of the single Fitm ortholog, CG10671, in Drosophila melanogaster was pursued using RNA interference. Characteristics of the syndrome, including progressive locomotor impairment, hearing loss and disturbed sensory functions, were recapitulated in Drosophila, which supports the causative nature of the FITM2 mutation. Mutation-based genetic counseling can now be provided to the family and insight is obtained into the potential impact of genetic variation in FITM2. © 2017. Published by The Company of Biologists Ltd.

  13. Efficacy of Rosuvastatin in Children With Homozygous Familial Hypercholesterolemia and Association With Underlying Genetic Mutations.

    PubMed

    Stein, Evan A; Dann, Eldad J; Wiegman, Albert; Skovby, Flemming; Gaudet, Daniel; Sokal, Etienne; Charng, Min-Ji; Mohamed, Mafauzy; Luirink, Ilse; Raichlen, Joel S; Sundén, Mattias; Carlsson, Stefan C; Raal, Frederick J; Kastelein, John J P

    2017-08-29

    Homozygous familial hypercholesterolemia (HoFH), a rare genetic disorder, is characterized by extremely elevated levels of low-density lipoprotein cholesterol (LDL-C) and accelerated atherosclerotic cardiovascular disease. Statin treatment starts at diagnosis, but no statin has been formally evaluated in, or approved for, HoFH children. The authors sought to assess the LDL-C efficacy of rosuvastatin versus placebo in HoFH children, and the relationship with underlying genetic mutations. This was a randomized, double-blind, 12-week, crossover study of rosuvastatin 20 mg versus placebo, followed by 12 weeks of open-label rosuvastatin. Patients discontinued all lipid-lowering treatment except ezetimibe and/or apheresis. Clinical and laboratory assessments were performed every 6 weeks. The relationship between LDL-C response and genetic mutations was assessed by adding children and adults from a prior HoFH rosuvastatin trial. Twenty patients were screened, 14 randomized, and 13 completed the study. The mean age was 10.9 years; 8 patients were on ezetimibe and 7 on apheresis. Mean LDL-C was 481 mg/dl (range: 229 to 742 mg/dl) on placebo and 396 mg/dl (range: 130 to 700 mg/dl) on rosuvastatin, producing a mean 85.4 mg/dl (22.3%) difference (p = 0.005). Efficacy was similar regardless of age or use of ezetimibe or apheresis, and was maintained for 12 weeks. Adverse events were few and not serious. Patients with 2 defective versus 2 negative LDL receptor mutations had mean LDL-C reductions of 23.5% (p = 0.0044) and 14% (p = 0.038), respectively. This first-ever pediatric HoFH statin trial demonstrated safe and effective LDL-C reduction with rosuvastatin 20 mg alone or added to ezetimibe and/or apheresis. The LDL-C response in children and adults was related to underlying genetic mutations. (A Study to Evaluate the Efficacy and Safety of Rosuvastatin in Children and Adolescents With Homozygous Familial Hypercholesterolemia [HYDRA]; NCT02226198

  14. Plasma homocysteine and vitamin B12 serum levels, red blood cell folate concentrations, C677T methylenetetrahydrofolate reductase gene mutation and risk of recurrent miscarriage: a case-control study in Spain.

    PubMed

    Creus, Montserrat; Deulofeu, Ramon; Peñarrubia, Joana; Carmona, Francisco; Balasch, Juan

    2013-03-01

    Hyperhomocysteinemia and methylenetetrahydrofolate reductase (MTHFR) gene mutation have been postulated as a possible cause of recurrent miscarriage (RM). There is a wide variation in the prevalence of MTHFR polymorphisms and homocysteine (Hcy) plasma levels among populations around the world. The present study was undertaken to investigate the possible association between hyperhomocysteinemia and its causative genetic or acquired factors and RM in Catalonia, a Mediterranean region in Spain. Sixty consecutive patients with ≥ 3 unexplained RM and 30 healthy control women having at least one child but no previous miscarriage were included. Plasma Hcy levels, MTHFR gene mutation, red blood cell (RBC) folate and vitamin B12 serum levels were measured in all subjects. No significant differences were observed neither in plasma Hcy levels, RBC folate and vitamin B12 serum levels nor in the prevalence of homozygous and heterozygous MTHFR gene mutation between the two groups studied. In the present study RM is not associated with hyperhomocysteinemia, and/or the MTHFR gene mutation.

  15. Haplotype analysis suggest that the MLH1 c.2059C > T mutation is a Swedish founder mutation.

    PubMed

    von Salomé, Jenny; Liu, Tao; Keihäs, Markku; Morak, Moni; Holinski-Feder, Elke; Berry, Ian R; Moilanen, Jukka S; Baert-Desurmont, Stéphanie; Lindblom, Annika; Lagerstedt-Robinson, Kristina

    2017-12-29

    Lynch syndrome (LS) predisposes to a spectrum of cancers and increases the lifetime risk of developing colorectal- or endometrial cancer to over 50%. Lynch syndrome is dominantly inherited and is caused by defects in DNA mismatch-repair genes MLH1, MSH2, MSH6 or PMS2, with the vast majority detected in MLH1 and MSH2. Recurrent LS-associated variants observed in apparently unrelated individuals, have either arisen de novo in different families due to mutation hotspots, or are inherited from a founder (a common ancestor) that lived several generations back. There are variants that recur in some populations while also acting as founders in other ethnic groups. Testing for founder mutations can facilitate molecular diagnosis of Lynch Syndrome more efficiently and more cost effective than screening for all possible mutations. Here we report a study of the missense mutation MLH1 c.2059C > T (p.Arg687Trp), a potential founder mutation identified in eight Swedish families and one Finnish family with Swedish ancestors. Haplotype analysis confirmed that the Finnish and Swedish families shared a haplotype of between 0.9 and 2.8 Mb. While MLH1 c.2059C > T exists worldwide, the Swedish haplotype was not found among mutation carriers from Germany or France, which indicates a common founder in the Swedish population. The geographic distribution of MLH1 c.2059C > T in Sweden suggests a single, ancient mutational event in the northern part of Sweden.

  16. Primary Ciliary Dyskinesia Caused by Homozygous Mutation in DNAL1, Encoding Dynein Light Chain 1

    PubMed Central

    Mazor, Masha; Alkrinawi, Soliman; Chalifa-Caspi, Vered; Manor, Esther; Sheffield, Val C.; Aviram, Micha; Parvari, Ruti

    2011-01-01

    In primary ciliary dyskinesia (PCD), genetic defects affecting motility of cilia and flagella cause chronic destructive airway disease, randomization of left-right body asymmetry, and, frequently, male infertility. The most frequent defects involve outer and inner dynein arms (ODAs and IDAs) that are large multiprotein complexes responsible for cilia-beat generation and regulation, respectively. Although it has long been suspected that mutations in DNAL1 encoding the ODA light chain1 might cause PCD such mutations were not found. We demonstrate here that a homozygous point mutation in this gene is associated with PCD with absent or markedly shortened ODA. The mutation (NM_031427.3: c.449A>G; p.Asn150Ser) changes the Asn at position150, which is critical for the proper tight turn between the β strand and the α helix of the leucine-rich repeat in the hydrophobic face that connects to the dynein heavy chain. The mutation reduces the stability of the axonemal dynein light chain 1 and damages its interactions with dynein heavy chain and with tubulin. This study adds another important component to understanding the types of mutations that cause PCD and provides clinical information regarding a specific mutation in a gene not yet known to be associated with PCD. PMID:21496787

  17. The p.M292T NDUFS2 mutation causes complex I-deficient Leigh syndrome in multiple families.

    PubMed

    Tuppen, Helen A L; Hogan, Vanessa E; He, Langping; Blakely, Emma L; Worgan, Lisa; Al-Dosary, Mazhor; Saretzki, Gabriele; Alston, Charlotte L; Morris, Andrew A; Clarke, Michael; Jones, Simon; Devlin, Anita M; Mansour, Sahar; Chrzanowska-Lightowlers, Zofia M A; Thorburn, David R; McFarland, Robert; Taylor, Robert W

    2010-10-01

    Isolated complex I deficiency is the most frequently observed oxidative phosphorylation defect in children with mitochondrial disease, leading to a diverse range of clinical presentations, including Leigh syndrome. For most patients the genetic cause of the biochemical defect remains unknown due to incomplete understanding of the complex I assembly process. Nonetheless, a plethora of pathogenic mutations have been described to date in the seven mitochondrial-encoded subunits of complex I as well as in 12 of the nuclear-encoded subunits and in six assembly factors. Whilst several mitochondrial DNA mutations are recurrent, the majority of these mutations are reported in single families. We have sequenced core structural and functional nuclear-encoded subunits of complex I in a cohort of 34 paediatric patients with isolated complex I deficiency, identifying pathogenic mutations in 6 patients. These included a novel homozygous NDUFS1 mutation in an Asian child with Leigh syndrome, a previously identified NDUFS8 mutation (c.236C>T, p.P79L) in a second Asian child with Leigh-like syndrome and six novel, compound heterozygous NDUFS2 mutations in four white Caucasian patients with Leigh or Leigh-like syndrome. Three of these children harboured an identical NDUFS2 mutation (c.875T>C, p.M292T), which was also identified in conjunction with a novel NDUFS2 splice site mutation (c.866+4A>G) in a fourth Caucasian child who presented to a different diagnostic centre, with microsatellite and single nucleotide polymorphism analyses indicating that this was due to an ancient common founder event. Our results confirm that NDUFS2 is a mutational hotspot in Caucasian children with isolated complex I deficiency and recommend the routine diagnostic investigation of this gene in patients with Leigh or Leigh-like phenotypes.

  18. Neonatal diabetes caused by a homozygous KCNJ11 mutation demonstrates that tiny changes in ATP sensitivity markedly affect diabetes risk.

    PubMed

    Vedovato, Natascia; Cliff, Edward; Proks, Peter; Poovazhagi, Varadarajan; Flanagan, Sarah E; Ellard, Sian; Hattersley, Andrew T; Ashcroft, Frances M

    2016-07-01

    The pancreatic ATP-sensitive potassium (KATP) channel plays a pivotal role in linking beta cell metabolism to insulin secretion. Mutations in KATP channel genes can result in hypo- or hypersecretion of insulin, as in neonatal diabetes mellitus and congenital hyperinsulinism, respectively. To date, all patients affected by neonatal diabetes due to a mutation in the pore-forming subunit of the channel (Kir6.2, KCNJ11) are heterozygous for the mutation. Here, we report the first clinical case of neonatal diabetes caused by a homozygous KCNJ11 mutation. A male patient was diagnosed with diabetes shortly after birth. At 5 months of age, genetic testing revealed he carried a homozygous KCNJ11 mutation, G324R, (Kir6.2-G324R) and he was successfully transferred to sulfonylurea therapy (0.2 mg kg(-1) day(-1)). Neither heterozygous parent was affected. Functional properties of wild-type, heterozygous and homozygous mutant KATP channels were examined after heterologous expression in Xenopus oocytes. Functional studies indicated that the Kir6.2-G324R mutation reduces the channel ATP sensitivity but that the difference in ATP inhibition between homozygous and heterozygous channels is remarkably small. Nevertheless, the homozygous patient developed neonatal diabetes, whereas the heterozygous parents were, and remain, unaffected. Kir6.2-G324R channels were fully shut by the sulfonylurea tolbutamide, which explains why the patient's diabetes was well controlled by sulfonylurea therapy. The data demonstrate that tiny changes in KATP channel activity can alter beta cell electrical activity and insulin secretion sufficiently to cause diabetes. They also aid our understanding of how the Kir6.2-E23K variant predisposes to type 2 diabetes.

  19. Phenotype of Usher syndrome type II assosiated with compound missense mutations of c.721 C>T and c.1969 C>T in MYO7A in a Chinese Usher syndrome family.

    PubMed

    Zhai, Wei; Jin, Xin; Gong, Yan; Qu, Ling-Hui; Zhao, Chen; Li, Zhao-Hui

    2015-01-01

    To identify the pathogenic mutations in a Chinese pedigree affected with Usher syndrome type II (USH2). The ophthalmic examinations and audiometric tests were performed to ascertain the phenotype of the family. To detect the genetic defect, exons of 103 known RDs -associated genes including 12 Usher syndrome (USH) genes of the proband were captured and sequencing analysis was performed to exclude known genetic defects and find potential pathogenic mutations. Subsequently, candidate mutations were validated in his pedigree and 100 normal controls using polymerase chain reaction (PCR) and Sanger sequencing. The patient in the family occurred hearing loss (HL) and retinitis pigmentosa (RP) without vestibular dysfunction, which were consistent with standards of classification for USH2. He carried the compound heterozygous mutations, c.721 C>T and c.1969 C>T, in the MYO7A gene and the unaffected members carried only one of the two mutations. The mutations were not present in the 100 normal controls. We suggested that the compound heterozygous mutations of the MYO7A could lead to USH2, which had revealed distinguished clinical phenotypes associated with MYO7A and expanded the spectrum of clinical phenotypes of the MYO7A mutations.

  20. The contribution of the SPINK1 c.194+2T>C mutation to the clinical course of idiopathic chronic pancreatitis in Chinese patients.

    PubMed

    Sun, Chang; Liao, Zhuan; Jiang, Lili; Yang, Fu; Xue, Geng; Zhou, Qi; Chen, Ruiwen; Sun, Shuhan; Li, Zhaoshen

    2013-01-01

    Recent data suggest that the serine protease inhibitor Kazal type 1 (SPINK1) gene mutation is associated with idiopathic chronic pancreatitis. However, few studies have focused on the serine protease inhibitor Kazal type 1 c.194+2T>C mutation. Therefore, our goal was to study the prevalence and impact of serine protease inhibitor Kazal type 1 mutations on the clinical profile of idiopathic chronic pancreatitis patients in China. A retrospective-cohort study of 118 Chinese patients with idiopathic chronic pancreatitis was performed, and genetic tests were carried out to detect SPINK1 mutations. Subjects without pancreatitis were used as controls. In total, 118 idiopathic chronic pancreatitis patients and 100 control subjects were evaluated. The serine protease inhibitor Kazal type 1 c.194+2T>C variant was present in 44.9% of patients with idiopathic chronic pancreatitis. The frequency of diabetes in idiopathic chronic pancreatitis patients with the serine protease inhibitor Kazal type 1 c.194+2T>C mutation (39.6%) was higher than that of patients without the mutation (9.2%). The time to occurrence of diabetes mellitus after idiopathic chronic pancreatitis symptom onset is significantly influenced by the c.194+2T>C mutation (p<0.001). In addition, the mean age of diabetes onset in patients with the serine protease inhibitor Kazal type 1 c.194+2T>C mutation (38.33 ± 9.50) was significantly younger than that of patients without this mutation (49.67 ± 6.74). The presence of the serine protease inhibitor Kazal type 1 c.194+2T>C mutation seems to be associated with idiopathic chronic pancreatitis and could predispose individuals to pancreatic diabetes onset at an earlier age. Copyright © 2012 Editrice Gastroenterologica Italiana S.r.l. Published by Elsevier Ltd. All rights reserved.

  1. Mutations in the von Hippel-Lindau (VHL) tumor suppressor gene and VHL-haplotype analysis in patients with presumable congenital erythrocytosis.

    PubMed

    Cario, Holger; Schwarz, Klaus; Jorch, Norbert; Kyank, Ulrike; Petrides, Petro E; Schneider, Dominik T; Uhle, Renate; Debatin, Klaus-Michael; Kohne, Elisabeth

    2005-01-01

    Congenital erythrocytoses or polycythemias are rare and heterogeneous. A homozygous mutation (C598T->Arg200Trp) in the von Hippel-Lindau (VHL) gene was originally identified as the cause of the endemic Chuvash polycythemia. Subsequently this and other mutations in the VHL gene were also detected in several patients of different ethnic origin. Haplotype analyses of the VHL gene suggested a common origin for the Chuvash-type mutation. Thirty-four patients with presumable congenital erythrocytosis due to an unknown underlying disorder were examined for VHL gene mutations and VHL region haplotypes. Four patients were homozygous and one patient heterozygous for the Chuvash-type mutation. One additional patient presented a previously not described heterozygous mutation G311->T VHL in exon 1. The haplotype analyses were in agreement with recently published data for three of the four patients with homozygous mutations as well as for the patient with a heterozygous Chuvash-type mutation. One patient of Turkish origin with homozygous Chuvash-type mutation had a haplotype not previously found in individuals with Chuvash-type mutation. These results confirm that mutations in the VHL gene are responsible for a substantial proportion of patients with congenital erythrocytoses. Erythrocytoses due to a C598->T mutation of the VHL gene are not geographically restricted. The majority of patients with Chuvash polycythemia share a common VHL gene haplotype. The different haplotype in one of the patients with Chuvash-type mutation indicates that this mutation was not spread only from a single founder but developed independently in other individuals.

  2. Differential functional readthrough over homozygous nonsense mutations contributes to the bleeding phenotype in coagulation factor VII deficiency.

    PubMed

    Branchini, A; Ferrarese, M; Lombardi, S; Mari, R; Bernardi, F; Pinotti, M

    2016-10-01

    Essentials Potentially null homozygous Factor(F)7 nonsense mutations are associated to variable bleeding symptoms. Readthrough of p.Ser112X (life-threatening) and p.Cys132X (moderate) stop codons was investigated. Readthrough-mediated insertion of wild-type or tolerated residues produce functional proteins. Functional readthrough over homozygous F7 nonsense mutations contributes to the bleeding phenotype. Background Whereas the rare homozygous nonsense mutations causing factor (F)VII deficiency may predict null conditions that are almost completely incompatible with life, they are associated with appreciable differences in hemorrhagic symptoms. The misrecognition of premature stop codons (readthrough) may account for variable levels of functional full-length proteins. Objectives To experimentally evaluate the basal and drug-induced levels of FVII resulting from the homozygous p.Cys132X and p.Ser112X nonsense mutations that are associated with moderate (132X) or life-threatening (112X) symptoms, and that are predicted to undergo readthrough with (132X) or without (112X) production of wild-type FVII. Methods We transiently expressed recombinant FVII (rFVII) nonsense and missense variants in human embryonic kidney 293 cells, and evaluated secreted FVII protein and functional levels by ELISA, activated FX generation, and coagulation assays. Results The levels of functional FVII produced by p.Cys132X and p.Ser112X mutants (rFVII-132X, 1.1% ± 0.2% of wild-type rFVII; rFVII-112X, 0.5% ± 0.1% of wild-type rFVII) were compatible with the occurrence of spontaneous readthrough, which was magnified by the addition of G418 - up to 12% of the wild-type value for the rFVII-132X nonsense variant. The predicted missense variants arising from readthrough abolished (rFVII-132Trp/Arg) or reduced (rFVII-112Trp/Cys/Arg, 22-45% of wild-type levels) secretion and function. These data suggest that the appreciable rescue of p.Cys132X function was driven by reinsertion of the wild

  3. Novel Mutations Causing C5 Deficiency in Three North-African Families.

    PubMed

    Colobran, Roger; Franco-Jarava, Clara; Martín-Nalda, Andrea; Baena, Neus; Gabau, Elisabeth; Padilla, Natàlia; de la Cruz, Xavier; Pujol-Borrell, Ricardo; Comas, David; Soler-Palacín, Pere; Hernández-González, Manuel

    2016-05-01

    The complement system plays a central role in defense to encapsulated bacteria through opsonization and membrane attack complex (MAC) dependent lysis. The three activation pathways (classical, lectin, and alternative) converge in the cleavage of C5, which initiates MAC formation and target lysis. C5 deficiency is associated to recurrent infections by Neisseria spp. In the present study, complement deficiency was suspected in three families of North-African origin after one episode of invasive meningitis due to a non-groupable and two uncommon Meningococcal serotypes (E29, Y). Activity of alternative and classical pathways of complement were markedly reduced and the measurement of terminal complement components revealed total C5 absence. C5 gene analysis revealed two novel mutations as causative of the deficiency: Family A propositus carried a homozygous deletion of two adenines in the exon 21 of C5 gene, resulting in a frameshift and a truncated protein (c.2607_2608del/p.Ser870ProfsX3 mutation). Families B and C probands carried the same homozygous deletion of three consecutive nucleotides (CAA) in exon 9 of the C5 gene, leading to the deletion of asparagine 320 (c.960_962del/p.Asn320del mutation). Family studies confirmed an autosomal recessive inheritance pattern. Although sharing the same geographical origin, families B and C were unrelated. This prompted us to investigate this mutation prevalence in a cohort of 768 North-African healthy individuals. We identified one heterozygous carrier of the p.Asn320del mutation (allelic frequency = 0.065 %), indicating that this mutation is present at low frequency in North-African population.

  4. Methylenetetrahydrofolate reductase (MTHFR) C677T and thymidylate synthase promoter (TSER) polymorphisms in Indonesian children with and without leukemia.

    PubMed

    Giovannetti, Elisa; Ugrasena, Dewa G; Supriyadi, Eddy; Vroling, Laura; Azzarello, Antonino; de Lange, Desiree; Peters, Godefridus J; Veerman, Anjo J P; Cloos, Jacqueline

    2008-01-01

    Genetic variations in the polymorphic tandem repeat sequence of the enhancer region of the thymidylate synthase promoter (TSER), as well as in methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism, influence methotrexate sensitivity. We studied these polymorphisms in children with acute lymphoblastic leukaemia (ALL) and in subjects without malignancy in Indonesia and Holland. The frequencies of TT and CT genotypes were two-fold higher in Dutch children. The TSER 3R/3R repeat was three-fold more frequent in the Indonesian children, while the 2R/2R repeat was only 1% compared to 21% in the Dutch children. No differences of these polymorphisms were found between ALL cells and normal blood cells, indicating an ethnic rather than leukemic origin. These results may have implications for treatment of Indonesian children with ALL.

  5. Exome Sequencing Identifies a Novel Homozygous Mutation in the Phosphate Transporter SLC34A1 in Hypophosphatemia and Nephrocalcinosis

    PubMed Central

    Rajagopal, Abbhirami; Braslavsky, Débora; Lu, James T.; Kleppe, Soledad; Clément, Florencia; Cassinelli, Hamilton; Liu, David S.; Liern, Jose Miguel; Vallejo, Graciela; Bergadá, Ignacio; Gibbs, Richard A.; Campeau, Phillipe M.

    2014-01-01

    Context: Two Argentinean siblings (a boy and a girl) from a nonconsanguineous family presented with hypercalcemia, hypercalciuria, hypophosphatemia, low parathyroid hormone (PTH), and nephrocalcinosis. Objective: The goal of this study was to identify genetic causes of the clinical findings in the two siblings. Design: Whole exome sequencing was performed to identify disease-causing mutations in the youngest sibling, and a candidate variant was screened in other family members by Sanger sequencing. In vitro experiments were conducted to determine the effects of the mutation that was identified. Patients and Other Participants: Affected siblings (2 y.o. female and 10 y.o male) and their parents were included in the study. Informed consent was obtained for genetic studies. Results: A novel homozygous mutation in the gene encoding the renal sodium-dependent phosphate transporter SLC34A1 was identified in both siblings (c.1484G>A, p.Arg495His). In vitro studies showed that the p.Arg495His mutation resulted in decreased phosphate uptake when compared to wild-type SLC34A1. Conclusions: The homozygous G>A transition that results in the substitution of histidine for arginine at position 495 of the renal sodium-dependent phosphate transporter, SLC34A1, is involved in disease pathogenesis in these patients. Our report of the second family with two mutated SLC34A1 alleles expands the known phenotype of this rare condition. PMID:25050900

  6. Charcot-Marie-Tooth disease type 2 caused by homozygous MME gene mutation superimposed by chronic inflammatory demyelinating polyneuropathy.

    PubMed

    Fujisawa, Miwako; Sano, Yasuteru; Omoto, Masatoshi; Ogasawara, Jyun-Ichi; Koga, Michiaki; Takashima, Hiroshi; Kanda, Takashi

    2017-09-30

    We report a 59-year-old Japanese male who developed gradually worsening weakness and numbness of distal four extremities since age 50. His parents were first cousins, and blood and cerebral spinal examinations were unremarkable. Homozygous mutation of MME gene was detected and thus he was diagnosed as autosomal-recessive Charcot-Marie-Tooth disease 2T (AR-CMT2T); however, electrophysiological examinations revealed scattered demyelinative changes including elongated terminal latency in several peripheral nerve trunks. Sural nerve biopsy showed endoneurial edema and a lot of thinly myelinated nerve fibers with uneven distribution of remnant myelinated fibers within and between fascicles. Immunoglobulin treatment was initiated considering the possibility of superimposed inflammation and demyelination, and immediate clinical as well as electrophysiological improvements were noted. Our findings indicate that AR-CMT2T caused by MME mutation predisposes to a superimposed inflammatory demyelinating neuropathy. This is the first report which documented the co-existence of CMT2 and chronic inflammatory demyelinating polyneuropathy (CIDP); however, in the peripheral nervous system, neprilysin, a product of MME gene, is more abundant in myelin sheath than in axonal component. The fragility of myelin sheath due to mutated neprilysin may trigger the detrimental immune response against peripheral myelin in this patient.

  7. Methylene tetrahydrofolate reductase (MTHFR) gene polymorphisms in chronic myeloid leukemia: an Egyptian study.

    PubMed

    Khorshied, Mervat Mamdooh; Shaheen, Iman Abdel Mohsen; Abu Khalil, Reham E; Sheir, Rania Elsayed

    2014-01-01

    Methylenetetrahydrofolate reductase (MTHFR) gene plays a pivotal role in folate metabolism. Several genetic variations in MTHFR gene as MTHFR-C677T and MTHFR-A1298C result in decreased MTHFR activity, which could influence efficient DNA methylation and explain susceptibility to different cancers. The etiology of chronic myeloid leukemia (CML) is obscure and little is known about individual's susceptibility to CML. In order to assess the influence of these genetic polymorphisms on the susceptibility to CML and its effect on the course of the disease among Egyptians, we performed an age-gender-ethnic matched case-control study. The study included 97 CML patients and 130 healthy controls. Genotyping of MTHFR-C677T and -A1298C was performed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique. The results showed no statistical difference in the distribution of MTHFR-C677T and -A1298C polymorphic genotypes between CML patients and controls. The frequency of MTHFR 677-TT homozygous variant was significantly higher in patients with accelerated/blastic transformation phase when compared to those in the chronic phase of the disease. In conclusion, our study revealed that MTHFR-C677T and -A1298C polymorphisms could not be considered as genetic risk factors for CML in Egyptians. However, MTHFR 677-TT homozygous variant might be considered as a molecular predictor for disease progression.

  8. A homozygous PMS2 founder mutation with an attenuated constitutional mismatch repair deficiency phenotype.

    PubMed

    Li, Lili; Hamel, Nancy; Baker, Kristi; McGuffin, Michael J; Couillard, Martin; Gologan, Adrian; Marcus, Victoria A; Chodirker, Bernard; Chudley, Albert; Stefanovici, Camelia; Durandy, Anne; Hegele, Robert A; Feng, Bing-Jian; Goldgar, David E; Zhu, Jun; De Rosa, Marina; Gruber, Stephen B; Wimmer, Katharina; Young, Barbara; Chong, George; Tischkowitz, Marc D; Foulkes, William D

    2015-05-01

    Inherited mutations in DNA mismatch repair genes predispose to different cancer syndromes depending on whether they are mono-allelic or bi-allelic. This supports a causal relationship between expression level in the germline and phenotype variation. As a model to study this relationship, our study aimed to define the pathogenic characteristics of a recurrent homozygous coding variant in PMS2 displaying an attenuated phenotype identified by clinical genetic testing in seven Inuit families from Northern Quebec. Pathogenic characteristics of the PMS2 mutation NM_000535.5:c.2002A>G were studied using genotype-phenotype correlation, single-molecule expression detection and single genome microsatellite instability analysis. This PMS2 mutation generates a de novo splice site that competes with the authentic site. In homozygotes, expression of the full-length protein is reduced to a level barely detectable by conventional diagnostics. Median age at primary cancer diagnosis is 22 years among 13 NM_000535.5:c.2002A>G homozygotes, versus 8 years in individuals carrying bi-allelic truncating mutations. Residual expression of full-length PMS2 transcript was detected in normal tissues from homozygotes with cancers in their 20s. Our genotype-phenotype study of c.2002A>G illustrates that an extremely low level of PMS2 expression likely delays cancer onset, a feature that could be exploited in cancer preventive intervention. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  9. Homozygous SLC6A17 mutations cause autosomal-recessive intellectual disability with progressive tremor, speech impairment, and behavioral problems.

    PubMed

    Iqbal, Zafar; Willemsen, Marjolein H; Papon, Marie-Amélie; Musante, Luciana; Benevento, Marco; Hu, Hao; Venselaar, Hanka; Wissink-Lindhout, Willemijn M; Vulto-van Silfhout, Anneke T; Vissers, Lisenka E L M; de Brouwer, Arjan P M; Marouillat, Sylviane; Wienker, Thomas F; Ropers, Hans Hilger; Kahrizi, Kimia; Nadif Kasri, Nael; Najmabadi, Hossein; Laumonnier, Frédéric; Kleefstra, Tjitske; van Bokhoven, Hans

    2015-03-05

    We report on Dutch and Iranian families with affected individuals who present with moderate to severe intellectual disability and additional phenotypes including progressive tremor, speech impairment, and behavioral problems in certain individuals. A combination of exome sequencing and homozygosity mapping revealed homozygous mutations c.484G>A (p.Gly162Arg) and c.1898C>G (p.Pro633Arg) in SLC6A17. SLC6A17 is predominantly expressed in the brain, encodes a synaptic vesicular transporter of neutral amino acids and glutamate, and plays an important role in the regulation of glutamatergic synapses. Prediction programs and 3D modeling suggest that the identified mutations are deleterious to protein function. To directly test the functional consequences, we investigated the neuronal subcellular localization of overexpressed wild-type and mutant variants in mouse primary hippocampal neuronal cells. Wild-type protein was present in soma, axons, dendrites, and dendritic spines. p.Pro633Arg altered SLC6A17 was found in soma and proximal dendrites but did not reach spines. p.Gly162Arg altered SLC6A17 showed a normal subcellular distribution but was associated with an abnormal neuronal morphology mainly characterized by the loss of dendritic spines. In summary, our genetic findings implicate homozygous SLC6A17 mutations in autosomal-recessive intellectual disability, and their pathogenic role is strengthened by genetic evidence and in silico and in vitro functional analyses. Copyright © 2015 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  10. Mutations of the aminoacyl-tRNA-synthetases SARS and WARS2 are implicated in the etiology of autosomal recessive intellectual disability.

    PubMed

    Musante, Luciana; Püttmann, Lucia; Kahrizi, Kimia; Garshasbi, Masoud; Hu, Hao; Stehr, Henning; Lipkowitz, Bettina; Otto, Sabine; Jensen, Lars R; Tzschach, Andreas; Jamali, Payman; Wienker, Thomas; Najmabadi, Hossein; Ropers, Hans Hilger; Kuss, Andreas W

    2017-06-01

    Intellectual disability (ID) is the hallmark of an extremely heterogeneous group of disorders that comprises a wide variety of syndromic and non-syndromic phenotypes. Here, we report on mutations in two aminoacyl-tRNA synthetases that are associated with ID in two unrelated Iranian families. In the first family, we identified a homozygous missense mutation (c.514G>A, p.Asp172Asn) in the cytoplasmic seryl-tRNA synthetase (SARS) gene. The mutation affects the enzymatic core domain of the protein and impairs its enzymatic activity, probably leading to reduced cytoplasmic tRNA Ser concentrations. The mutant protein was predicted to be unstable, which could be substantiated by investigating ectopic mutant SARS in transfected HEK293T cells. In the second family, we found a compound heterozygous genotype of the mitochondrial tryptophanyl-tRNA synthetase (WARS2) gene, comprising a nonsense mutation (c.325delA, p.Ser109Alafs*15), which very likely entails nonsense-mediated mRNA decay and a missense mutation (c.37T>G, p.Trp13Gly). The latter affects the mitochondrial localization signal of WARS2, causing protein mislocalization. Including AIMP1, which we have recently implicated in the etiology of ID, three genes with a role in tRNA-aminoacylation are now associated with this condition. We therefore suggest that the functional integrity of tRNAs in general is an important factor in the development and maintenance of human cognitive functions. © 2017 Wiley Periodicals, Inc.

  11. Long-term outcome of Leigh syndrome caused by the NARP-T8993C mtDNA mutation.

    PubMed

    Debray, François-Guillaume; Lambert, Marie; Lortie, Anne; Vanasse, Michel; Mitchell, Grant A

    2007-09-01

    Mutations at mitochondrial DNA (mtDNA) nucleotide 8993 can cause neurogenic weakness, ataxia and retinitis pigmentosa (NARP syndrome), or maternally inherited Leigh syndrome (LS), with a correlation between the amount of mutant mtDNA and the severity of the neurological disease. The T8993C mutation is generally considered to be clinically milder than the T8993G mutation but when the level of heteroplasmy exceeds 90%, progressive neurodegeneration has been found. We report on a long-term follow-up of a patient who presented at 4 years of age with typical LS but showed an unexpected resolution of his symptoms and a favorable outcome. At 18 years of age, his neurological examination was near normal, with neither peripheral neuropathy nor retinopathy. mtDNA analysis identified the presence of T8993C mutation at high level (>95%) in the patient's blood leukocytes. This case report and literature review emphasizes the variability of the phenotypic expression of the T8993C mutation and the need for caution in predictive counseling in such patients. (c) 2007 Wiley-Liss, Inc. Copyright 2007 Wiley-Liss, Inc.

  12. Frequent mutations in the p53 tumor suppressor gene in human leukemia T-cell lines.

    PubMed Central

    Cheng, J; Haas, M

    1990-01-01

    Human T-cell leukemia and T-cell acute lymphoblastic leukemia cell lines were studied for alterations in the p53 tumor suppressor gene. Southern blot analysis of 10 leukemic T-cell lines revealed no gross genomic deletions or rearrangements. Reverse transcription-polymerase chain reaction analysis of p53 mRNA indicated that all 10 lines produced p53 mRNA of normal size. By direct sequencing of polymerase chain reaction-amplified cDNA, we detected 11 missense and nonsense point mutations in 5 of the 10 leukemic T-cell lines studied. The mutations are primarily located in the evolutionarily highly conserved regions of the p53 gene. One of the five cell lines in which a mutation was detected possesses a homozygous point mutation in both p53 alleles, while the other four cell lines harbor from two to four different point mutations. An allelic study of two of the lines (CEM, A3/Kawa) shows that the two missense mutations found in each line are located on separate alleles, thus both alleles of the p53 gene may have been functionally inactivated by two different point mutations. Since cultured leukemic T-cell lines represent a late, fully tumorigenic stage of leukemic T cells, mutation of both (or more) alleles of the p53 gene may reflect the selection of cells possessing an increasingly tumorigenic phenotype, whether the selection took place in vivo or in vitro. Previously, we have shown that the HSB-2 T-cell acute lymphoblastic leukemia cell line had lost both alleles of the retinoblastoma tumor suppressor gene. Taken together, our data show that at least 6 of 10 leukemic T-cell lines examined may have lost the normal function of a known tumor suppressor gene, suggesting that this class of genes serves a critical role in the generation of fully tumorigenic leukemic T cells. Images PMID:2144611

  13. Mutation of A677 in histone methyltransferase EZH2 in human B-cell lymphoma promotes hypertrimethylation of histone H3 on lysine 27 (H3K27).

    PubMed

    McCabe, Michael T; Graves, Alan P; Ganji, Gopinath; Diaz, Elsie; Halsey, Wendy S; Jiang, Yong; Smitheman, Kimberly N; Ott, Heidi M; Pappalardi, Melissa B; Allen, Kimberly E; Chen, Stephanie B; Della Pietra, Anthony; Dul, Edward; Hughes, Ashley M; Gilbert, Seth A; Thrall, Sara H; Tummino, Peter J; Kruger, Ryan G; Brandt, Martin; Schwartz, Benjamin; Creasy, Caretha L

    2012-02-21

    Trimethylation of histone H3 on lysine 27 (H3K27me3) is a repressive posttranslational modification mediated by the histone methyltransferase EZH2. EZH2 is a component of the polycomb repressive complex 2 and is overexpressed in many cancers. In B-cell lymphomas, its substrate preference is frequently altered through somatic mutation of the EZH2 Y641 residue. Herein, we identify mutation of EZH2 A677 to a glycine (A677G) among lymphoma cell lines and primary tumor specimens. Similar to Y641 mutant cell lines, an A677G mutant cell line revealed aberrantly elevated H3K27me3 and decreased monomethylated H3K27 (H3K27me1) and dimethylated H3K27 (H3K27me2). A677G EZH2 possessed catalytic activity with a substrate specificity that was distinct from those of both WT EZH2 and Y641 mutants. Whereas WT EZH2 displayed a preference for substrates with less methylation [unmethylated H3K27 (H3K27me0):me1:me2 k(cat)/K(m) ratio = 9:6:1] and Y641 mutants preferred substrates with greater methylation (H3K27me0:me1:me2 k(cat)/K(m) ratio = 1:2:13), the A677G EZH2 demonstrated nearly equal efficiency for all three substrates (H3K27me0:me1:me2 k(cat)/K(m) ratio = 1.1:0.6:1). When transiently expressed in cells, A677G EZH2, but not WT EZH2, increased global H3K27me3 and decreased H3K27me2. Structural modeling of WT and mutant EZH2 suggested that the A677G mutation acquires the ability to methylate H3K27me2 through enlargement of the lysine tunnel while preserving activity with H3K27me0/me1 substrates through retention of the Y641 residue that is crucial for orientation of these smaller substrates. This mutation highlights the interplay between Y641 and A677 residues in the substrate specificity of EZH2 and identifies another lymphoma patient population that harbors an activating mutation of EZH2.

  14. Mutation of A677 in histone methyltransferase EZH2 in human B-cell lymphoma promotes hypertrimethylation of histone H3 on lysine 27 (H3K27)

    PubMed Central

    McCabe, Michael T.; Graves, Alan P.; Ganji, Gopinath; Diaz, Elsie; Halsey, Wendy S.; Jiang, Yong; Smitheman, Kimberly N.; Ott, Heidi M.; Pappalardi, Melissa B.; Allen, Kimberly E.; Chen, Stephanie B.; Della Pietra, Anthony; Dul, Edward; Hughes, Ashley M.; Gilbert, Seth A.; Thrall, Sara H.; Tummino, Peter J.; Kruger, Ryan G.; Brandt, Martin; Schwartz, Benjamin; Creasy, Caretha L.

    2012-01-01

    Trimethylation of histone H3 on lysine 27 (H3K27me3) is a repressive posttranslational modification mediated by the histone methyltransferase EZH2. EZH2 is a component of the polycomb repressive complex 2 and is overexpressed in many cancers. In B-cell lymphomas, its substrate preference is frequently altered through somatic mutation of the EZH2 Y641 residue. Herein, we identify mutation of EZH2 A677 to a glycine (A677G) among lymphoma cell lines and primary tumor specimens. Similar to Y641 mutant cell lines, an A677G mutant cell line revealed aberrantly elevated H3K27me3 and decreased monomethylated H3K27 (H3K27me1) and dimethylated H3K27 (H3K27me2). A677G EZH2 possessed catalytic activity with a substrate specificity that was distinct from those of both WT EZH2 and Y641 mutants. Whereas WT EZH2 displayed a preference for substrates with less methylation [unmethylated H3K27 (H3K27me0):me1:me2 kcat/Km ratio = 9:6:1] and Y641 mutants preferred substrates with greater methylation (H3K27me0:me1:me2 kcat/Km ratio = 1:2:13), the A677G EZH2 demonstrated nearly equal efficiency for all three substrates (H3K27me0:me1:me2 kcat/Km ratio = 1.1:0.6:1). When transiently expressed in cells, A677G EZH2, but not WT EZH2, increased global H3K27me3 and decreased H3K27me2. Structural modeling of WT and mutant EZH2 suggested that the A677G mutation acquires the ability to methylate H3K27me2 through enlargement of the lysine tunnel while preserving activity with H3K27me0/me1 substrates through retention of the Y641 residue that is crucial for orientation of these smaller substrates. This mutation highlights the interplay between Y641 and A677 residues in the substrate specificity of EZH2 and identifies another lymphoma patient population that harbors an activating mutation of EZH2. PMID:22323599

  15. Homozygous YME1L1 mutation causes mitochondriopathy with optic atrophy and mitochondrial network fragmentation.

    PubMed

    Hartmann, Bianca; Wai, Timothy; Hu, Hao; MacVicar, Thomas; Musante, Luciana; Fischer-Zirnsak, Björn; Stenzel, Werner; Gräf, Ralph; van den Heuvel, Lambert; Ropers, Hans-Hilger; Wienker, Thomas F; Hübner, Christoph; Langer, Thomas; Kaindl, Angela M

    2016-08-06

    Mitochondriopathies often present clinically as multisystemic disorders of primarily high-energy consuming organs. Assembly, turnover, and surveillance of mitochondrial proteins are essential for mitochondrial function and a key task of AAA family members of metalloproteases. We identified a homozygous mutation in the nuclear encoded mitochondrial escape 1-like 1 gene YME1L1, member of the AAA protease family, as a cause of a novel mitochondriopathy in a consanguineous pedigree of Saudi Arabian descent. The homozygous missense mutation, located in a highly conserved region in the mitochondrial pre-sequence, inhibits cleavage of YME1L1 by the mitochondrial processing peptidase, which culminates in the rapid degradation of YME1L1 precursor protein. Impaired YME1L1 function causes a proliferation defect and mitochondrial network fragmentation due to abnormal processing of OPA1. Our results identify mutations in YME1L1 as a cause of a mitochondriopathy with optic nerve atrophy highlighting the importance of YME1L1 for mitochondrial functionality in humans.

  16. Homozygous YME1L1 mutation causes mitochondriopathy with optic atrophy and mitochondrial network fragmentation

    PubMed Central

    Hartmann, Bianca; Wai, Timothy; Hu, Hao; MacVicar, Thomas; Musante, Luciana; Fischer-Zirnsak, Björn; Stenzel, Werner; Gräf, Ralph; van den Heuvel, Lambert; Ropers, Hans-Hilger; Wienker, Thomas F; Hübner, Christoph; Langer, Thomas; Kaindl, Angela M

    2016-01-01

    Mitochondriopathies often present clinically as multisystemic disorders of primarily high-energy consuming organs. Assembly, turnover, and surveillance of mitochondrial proteins are essential for mitochondrial function and a key task of AAA family members of metalloproteases. We identified a homozygous mutation in the nuclear encoded mitochondrial escape 1-like 1 gene YME1L1, member of the AAA protease family, as a cause of a novel mitochondriopathy in a consanguineous pedigree of Saudi Arabian descent. The homozygous missense mutation, located in a highly conserved region in the mitochondrial pre-sequence, inhibits cleavage of YME1L1 by the mitochondrial processing peptidase, which culminates in the rapid degradation of YME1L1 precursor protein. Impaired YME1L1 function causes a proliferation defect and mitochondrial network fragmentation due to abnormal processing of OPA1. Our results identify mutations in YME1L1 as a cause of a mitochondriopathy with optic nerve atrophy highlighting the importance of YME1L1 for mitochondrial functionality in humans. DOI: http://dx.doi.org/10.7554/eLife.16078.001 PMID:27495975

  17. A Novel Homozygous Missense Mutation in HOXC13 Leads to Autosomal Recessive Pure Hair and Nail Ectodermal Dysplasia.

    PubMed

    Li, Xiaoxiao; Orseth, Meredith Lee; Smith, J Michael; Brehm, Mary Abigail; Agim, Nnenna Gebechi; Glass, Donald Alexander

    2017-03-01

    Pure hair and nail ectodermal dysplasia (PHNED) is a rare disorder that presents with hypotrichosis and nail dystrophy while sparing other ectodermal structures such as teeth and sweat glands. We describe a homozygous novel missense mutation in the HOXC13 gene that resulted in autosomal recessive PHNED in a Hispanic child. The mutation c.812A>G (p.Gln271Arg) is located within the DNA-binding domain of the HOXC13 gene, cosegregates within the family, and is predicted to be maximally damaging. This is the first reported case of a missense HOXC13 mutation resulting in PHNED and the first reported case of PHNED identified in a North American family. Our findings illustrate the critical role of HOXC13 in human hair and nail development. © 2017 Wiley Periodicals, Inc.

  18. Primary ciliary dyskinesia caused by homozygous mutation in DNAL1, encoding dynein light chain 1.

    PubMed

    Mazor, Masha; Alkrinawi, Soliman; Chalifa-Caspi, Vered; Manor, Esther; Sheffield, Val C; Aviram, Micha; Parvari, Ruti

    2011-05-13

    In primary ciliary dyskinesia (PCD), genetic defects affecting motility of cilia and flagella cause chronic destructive airway disease, randomization of left-right body asymmetry, and, frequently, male infertility. The most frequent defects involve outer and inner dynein arms (ODAs and IDAs) that are large multiprotein complexes responsible for cilia-beat generation and regulation, respectively. Although it has long been suspected that mutations in DNAL1 encoding the ODA light chain1 might cause PCD such mutations were not found. We demonstrate here that a homozygous point mutation in this gene is associated with PCD with absent or markedly shortened ODA. The mutation (NM_031427.3: c.449A>G; p.Asn150Ser) changes the Asn at position150, which is critical for the proper tight turn between the β strand and the α helix of the leucine-rich repeat in the hydrophobic face that connects to the dynein heavy chain. The mutation reduces the stability of the axonemal dynein light chain 1 and damages its interactions with dynein heavy chain and with tubulin. This study adds another important component to understanding the types of mutations that cause PCD and provides clinical information regarding a specific mutation in a gene not yet known to be associated with PCD. Copyright © 2011 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  19. Status of Vitamins B-12 and B-6 but Not of Folate, Homocysteine, and the Methylenetetrahydrofolate Reductase C677T Polymorphism Are Associated with Impaired Cognition and Depression in Adults123

    PubMed Central

    Moorthy, Denish; Peter, Inga; Scott, Tammy M.; Parnell, Laurence D.; Lai, Chao-Qiang; Crott, Jimmy W.; Ordovás, José M.; Selhub, Jacob; Griffith, John; Rosenberg, Irwin H.; Tucker, Katherine L.; Troen, Aron M.

    2012-01-01

    The C677T polymorphism of the methylenetetrahydrofolate reductase (MTHFR) gene differs in frequency in various ethnic groups that have differing prevalence of age-related cognitive impairments. We used a series of neuro-psychological tests to examine the association of the MTHFR C677T polymorphism with cognition and depression and also to assess whether genotype modifies the association of folate and homocysteine with these outcomes. This study analyzed pooled cross-sectional data from 2 ethnically diverse cohorts of community-living adults: the Boston Puerto Rican Health Study (n = 939) and the Nutrition, Aging, and Memory in Elders study (n = 1017). Individuals in both cohorts underwent anthropometric and laboratory measurements and dietary and health assessments using validated questionnaires between the years 2003 and 2007. Cognitive outcomes included measures of global cognition [Mini-Mental Status Exam (MMSE)], depression (Center for Epidemiological Studies Depression Scale), and 3 factor scores for the domains of attention, executive function, and memory that were derived from a detailed set of neuropsychological tests. Low plasma vitamin B-12 concentrations were associated with poorer MMSE scores and higher depression scores, and low vitamin B-6 concentrations were associated with lower MMSE and worse attention and executive function in the multivariate analysis. In contrast, MTHFR genotype, folate, and homocysteine were not associated with cognition or depression in either ethnicity-pooled or stratified analysis. The current study did not find evidence of an association between the MTHFR C677T TT genotype and impaired cognition or depression in a population with adequate folate status and a high prevalence of cognitive impairment and depression. PMID:22739363

  20. Meconium ileus caused by mutations in GUCY2C, encoding the CFTR-activating guanylate cyclase 2C.

    PubMed

    Romi, Hila; Cohen, Idan; Landau, Daniella; Alkrinawi, Suliman; Yerushalmi, Baruch; Hershkovitz, Reli; Newman-Heiman, Nitza; Cutting, Garry R; Ofir, Rivka; Sivan, Sara; Birk, Ohad S

    2012-05-04

    Meconium ileus, intestinal obstruction in the newborn, is caused in most cases by CFTR mutations modulated by yet-unidentified modifier genes. We now show that in two unrelated consanguineous Bedouin kindreds, an autosomal-recessive phenotype of meconium ileus that is not associated with cystic fibrosis (CF) is caused by different homozygous mutations in GUCY2C, leading to a dramatic reduction or fully abrogating the enzymatic activity of the encoded guanlyl cyclase 2C. GUCY2C is a transmembrane receptor whose extracellular domain is activated by either the endogenous ligands, guanylin and related peptide uroguanylin, or by an external ligand, Escherichia coli (E. coli) heat-stable enterotoxin STa. GUCY2C is expressed in the human intestine, and the encoded protein activates the CFTR protein through local generation of cGMP. Thus, GUCY2C is a likely candidate modifier of the meconium ileus phenotype in CF. Because GUCY2C heterozygous and homozygous mutant mice are resistant to E. coli STa enterotoxin-induced diarrhea, it is plausible that GUCY2C mutations in the desert-dwelling Bedouin kindred are of selective advantage. Copyright © 2012 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  1. Serine Protease Inhibitor Kazal Type 1 (SPINK1) c.194+2T > C Mutation May Predict Long-term Outcome of Endoscopic Treatments in Idiopathic Chronic Pancreatitis.

    PubMed

    Sun, Chang; Liu, Mu-Yun; Liu, Xiao-Gang; Hu, Liang-Hao; Xia, Tian; Liao, Zhuan; Li, Zhao-Shen

    2015-11-01

    Endoscopic interventional is a commonly used treatment method for idiopathic chronic pancreatitis. Serine protease inhibitor Kazal type 1 (SPINK1) 194+2T>C mutation is most frequently observed in Chinese pancreatitis patients and influences the clinical course of idiopathic chronic pancreatitis patients. We conducted this study to determine the impacts of this mutation on the outcome of endoscopic treatments.In this study, we enrolled 423 patients. Among them, 101 idiopathic chronic pancreatitis patients without other relevant mutations had a successful endoscopic procedure and completed follow-up. Clinical characteristics including Izbicki pain score, exocrine and endocrine function, were evaluated. Genetic sequencing was conducted to detect SPINK1 194+2T>C mutations.The c.194+2T>C mutation was found in 58 (57.43%) patients. Factors relevant to pain relief are c.194+2T>C mutation (P = 0.011), severe pain before treatment (P = 0.005), and necessary subsequent endoscopic treatments (P < 0.001). More patients with the intronic mutation had deteriorated endocrine function (P = 0.001) relative to those patients without the mutation.Patients carrying the c.194+2T>C mutation were less likely to achieve pain relief through endoscopic treatments. They also have a higher risk of endocrine function deterioration. SPINK1 c.194+2T>C mutation may be applied as a pretreatment predictor in idiopathic chronic pancreatitis patients.

  2. Homozygous TREM2 mutation in a family with atypical frontotemporal dementia.

    PubMed

    Le Ber, Isabelle; De Septenville, Anne; Guerreiro, Rita; Bras, José; Camuzat, Agnès; Caroppo, Paola; Lattante, Serena; Couarch, Philippe; Kabashi, Edor; Bouya-Ahmed, Kawtar; Dubois, Bruno; Brice, Alexis

    2014-10-01

    TREM2 mutations were first identified in Nasu-Hakola disease, a rare autosomal recessive disease characterized by recurrent fractures because of bone cysts and presenile dementia. Recently, homozygous and compound heterozygous TREM2 mutations were identified in rare families with frontotemporal lobar degeneration (FTLD) but without bone involvement. We identified a p.Thr66Met heterozygous mutation in a new consanguineous Italian family. Two sibs had early onset autosomal recessive FTLD without severe bone disorders. Atypical signs were present in this family: early parietal and hippocampus involvement, parkinsonism, epilepsy, and corpus callosum thickness on brain magnetic resonance imaging. This study further demonstrates the implication of TREM2 mutations in FTLD phenotypes. It illustrates the variability of bone phenotype and underlines the frequency of atypical signs in TREM2 carriers. This and previous studies evidence that TREM2 mutation screening should be limited to autosomal recessive FTLD with atypical phenotypes characterized by: (1) a very young age at onset (20-50 years); (2) early parietal and hippocampal deficits; (3) the presence of seizures and parkinsonism; (4) suggestive extensive white matter lesions and corpus callosum thickness on brain magnetic resonance imaging. Copyright © 2014 Elsevier Inc. All rights reserved.

  3. Homozygous TREM2 mutation in a family with atypical frontotemporal dementia

    PubMed Central

    Bras, José; Camuzat, Agnès; Caroppo, Paola; Lattante, Serena; Couarch, Philippe; Kabashi, Edor; Bouya-Ahmed, Kawtar; Dubois, Bruno; Brice, Alexis

    2014-01-01

    TREM2 mutations were first identified in Nasu-Hakola disease, a rare autosomal recessive disease characterized by recurrent fractures because of bone cysts and presenile dementia. Recently, homozygous and compound heterozygous TREM2 mutations were identified in rare families with frontotemporal lobar degeneration (FTLD) but without bone involvement. We identified a p.Thr66Met heterozygous mutation in a new consanguineous Italian family. Two sibs had early onset autosomal recessive FTLD without severe bone disorders. Atypical signs were present in this family: early parietal and hippocampus involvement, parkinsonism, epilepsy, and corpus callosum thickness on brain magnetic resonance imaging. This study further demonstrates the implication of TREM2 mutations in FTLD phenotypes. It illustrates the variability of bone phenotype and underlines the frequency of atypical signs in TREM2 carriers. This and previous studies evidence that TREM2 mutation screening should be limited to autosomal recessive FTLD with atypical phenotypes characterized by: (1) a very young age at onset (20–50 years); (2) early parietal and hippocampal deficits; (3) the presence of seizures and parkinsonism; (4) suggestive extensive white matter lesions and corpus callosum thickness on brain magnetic resonance imaging. PMID:24910390

  4. Early Clinical Diagnosis of PC1/3 Deficiency in a Patient With a Novel Homozygous PCSK1 Splice-Site Mutation.

    PubMed

    Härter, Bettina; Fuchs, Irene; Müller, Thomas; Akbulut, Ulas Emre; Cakir, Murat; Janecke, Andreas R

    2016-04-01

    Autosomal recessive proprotein convertase 1/3 (PC1/3) deficiency, caused by mutations in the PCSK1 gene, is characterized by severe congenital malabsorptive diarrhea, early-onset obesity, and certain endocrine abnormalities. We suspected PC1/3 deficiency in a 4-month-old girl based on the presence of congenital diarrhea and polyuria. Sequencing the whole coding region and splice sites detected a novel homozygous PCSK1 splice-site mutation, c.544-2A>G, in the patient. The mutation resulted in the skipping of exon 5, the generation of a premature termination codon, and nonsense-mediated PCSK1 messenger ribonucleic acid decay, which was demonstrated in complementary DNA derived from fibroblasts.

  5. A SIGMAR1 splice-site mutation causes distal hereditary motor neuropathy.

    PubMed

    Li, Xiaobo; Hu, Zhengmao; Liu, Lei; Xie, Yongzhi; Zhan, Yajing; Zi, Xiaohong; Wang, Junling; Wu, Lixiang; Xia, Kun; Tang, Beisha; Zhang, Ruxu

    2015-06-16

    To identify the underlying genetic cause in a consanguineous Chinese family segregating distal hereditary motor neuropathy (dHMN) in an autosomal recessive pattern. We used whole-exome sequencing and homozygosity mapping to detect the genetic variant in 2 affected individuals of the consanguineous Chinese family with dHMN. RNA analysis of peripheral blood leukocytes and immunofluorescence and immunoblotting of stable cell lines were performed to support the pathogenicity of the identified mutation. We identified 3 shared novel homozygous variants in 3 shared homozygous regions of the affected individuals. Sequencing of these 3 variants in family members revealed the c.151+1G>T mutation in SIGMAR1 gene, which located in homozygous region spanning approximately 5.3 Mb at chromosome 9p13.1-p13.3, segregated with the dHMN phenotype. The mutation causes an alternative splicing event and generates a transcript variant with an in-frame deletion of 60 base pairs in exon 1 (c.92_151del), and results in an internally shortened protein σ1R(31_50del). The proteasomal inhibitor treatment increased the intracellular amount of σ1R(31_50del) and led to the formation of nuclear aggregates. Stable expressing σ1R(31_50del) induced endoplasmic reticulum stress and enhanced apoptosis. The homozygous c.151+1G>T mutation in SIGMAR1 caused a novel form of autosomal recessive dHMN in a Chinese consanguineous family. Endoplasmic reticulum stress may have a role in the pathogenesis of dHMN. © 2015 American Academy of Neurology.

  6. Identification of a novel homozygous mutation Arg459Pro in SYNJ1 gene of an Indian family with autosomal recessive juvenile Parkinsonism.

    PubMed

    Kirola, Laxmi; Behari, Madhuri; Shishir, Chandan; Thelma, B K

    2016-10-01

    A novel homozygous missense mutation (c.773G > A, p.Arg258Gln) in Synaptojanin 1 (SYNJ1, 21q22.2) has recently been reported in two Italian and one Iranian consanguineous families with autosomal recessive juvenile Parkinsonism (ARJP). Contribution of this synaptic gene related to Parkinsonism phenotypes in other populations still remains unidentified. An ARJP family with two affected siblings characterized by frequent tremor with bradykinesia and rigidity was recruited in this study. Both siblings showed intense dyskinesia and dystonia on administration of Syndopa. The family was analyzed for both mutations and exon dosage variations in PARKIN, PINK1 and DJ1. Further, whole exome sequencing was performed in two affected and one unaffected sibling in the family. We identified a novel homozygous mutation (c.1376C > G, p.Arg459Pro) in SYNJ1 segregating in this family. This p.Arg459Pro mutation was not observed in 285 additional Parkinson disease (PD) samples (32 familial, 81 early onset and 172 late onset) screened by PCR-Sanger-sequencing. It was also absent in dbSNP, 1000 Genomes, ExAC, NHLBI-ESP database and in >250 ethnically matched exomes available in our laboratory. The arginine residue is highly conserved across species and predicted to be damaging by several in silico tools. As with the previous mutation p.Arg258Gln, p.Arg459Pro is also present in Sac 1 domain of SYNJ1 wherein p.Arg258Gln mutation has already been described to impair the phosphatase activity. We report another novel mutation in SYNJ1 of an Indian consanguineous ARJP family. Finding an additional mutation in this gene further supports the involvement of SYNJ1 in PD pathogenesis across different ethnicities. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. The FTD-like syndrome causing TREM2 T66M mutation impairs microglia function, brain perfusion, and glucose metabolism.

    PubMed

    Kleinberger, Gernot; Brendel, Matthias; Mracsko, Eva; Wefers, Benedikt; Groeneweg, Linda; Xiang, Xianyuan; Focke, Carola; Deußing, Maximilian; Suárez-Calvet, Marc; Mazaheri, Fargol; Parhizkar, Samira; Pettkus, Nadine; Wurst, Wolfgang; Feederle, Regina; Bartenstein, Peter; Mueggler, Thomas; Arzberger, Thomas; Knuesel, Irene; Rominger, Axel; Haass, Christian

    2017-07-03

    Genetic variants in the triggering receptor expressed on myeloid cells 2 (TREM2) increase the risk for several neurodegenerative diseases including Alzheimer's disease and frontotemporal dementia (FTD). Homozygous TREM2 missense mutations, such as p.T66M, lead to the FTD-like syndrome, but how they cause pathology is unknown. Using CRISPR/Cas9 genome editing, we generated a knock-in mouse model for the disease-associated Trem2 p.T66M mutation. Consistent with a loss-of-function mutation, we observe an intracellular accumulation of immature mutant Trem2 and reduced generation of soluble Trem2 similar to patients with the homozygous p.T66M mutation. Trem2 p.T66M knock-in mice show delayed resolution of inflammation upon in vivo lipopolysaccharide stimulation and cultured macrophages display significantly reduced phagocytic activity. Immunohistochemistry together with in vivo TSPO small animal positron emission tomography (μPET) demonstrates an age-dependent reduction in microglial activity. Surprisingly, perfusion magnetic resonance imaging and FDG-μPET imaging reveal a significant reduction in cerebral blood flow and brain glucose metabolism. Thus, we demonstrate that a TREM2 loss-of-function mutation causes brain-wide metabolic alterations pointing toward a possible function of microglia in regulating brain glucose metabolism. © 2017 The Authors.

  8. Carriers of the Complex Allele HFE c.[187C>G;340+4T>C] Have Increased Risk of Iron Overload in São Miguel Island Population (Azores, Portugal).

    PubMed

    Branco, Claudia C; Gomes, Cidália T; De Fez, Laura; Bulhões, Sara; Brilhante, Maria José; Pereirinha, Tânia; Cabral, Rita; Rego, Ana Catarina; Fraga, Cristina; Miguel, António G; Brasil, Gracinda; Macedo, Paula; Mota-Vieira, Luisa

    2015-01-01

    Iron overload is associated with acquired and genetic conditions, the most common being hereditary hemochromatosis (HH) type-I, caused by HFE mutations. Here, we conducted a hospital-based case-control study of 41 patients from the São Miguel Island (Azores, Portugal), six belonging to a family with HH type-I pseudodominant inheritance, and 35 unrelated individuals fulfilling the biochemical criteria of iron overload compatible with HH type-I. For this purpose, we analyzed the most common HFE mutations- c.845G>A [p.Cys282Tyr], c.187C>G [p.His63Asp], and c.193A>T [p.Ser65Cys]. Results revealed that the family's HH pseudodominant pattern is due to consanguineous marriage of HFE-c.845G>A carriers, and to marriage with a genetically unrelated spouse that is a -c.187G carrier. Regarding unrelated patients, six were homozygous for c.845A, and three were c.845A/c.187G compound heterozygous. We then performed sequencing of HFE exons 2, 4, 5 and their intron-flanking regions. No other mutations were observed, but we identified the -c.340+4C [IVS2+4C] splice variant in 26 (74.3%) patients. Functionally, the c.340+4C may generate alternative splicing by HFE exon 2 skipping and consequently, a protein missing the α1-domain essential for HFE/ transferrin receptor-1 interactions. Finally, we investigated HFE mutations configuration with iron overload by determining haplotypes and genotypic profiles. Results evidenced that carriers of HFE-c.187G allele also carry -c.340+4C, suggesting in-cis configuration. This data is corroborated by the association analysis where carriers of the complex allele HFE-c.[187C>G;340+4T>C] have an increased iron overload risk (RR = 2.08, 95% CI = 1.40-2.94, p<0.001). Therefore, homozygous for this complex allele are at risk of having iron overload because they will produce two altered proteins--the p.63Asp [c.187G], and the protein lacking 88 amino acids encoded by exon 2. In summary, we provide evidence that the complex allele HFE-c.[187C>G;340+4T>C

  9. A somatic T15091C mutation in the Cytb gene of mouse mitochondrial DNA dominantly induces respiration defects.

    PubMed

    Hayashi, Chisato; Takibuchi, Gaku; Shimizu, Akinori; Mito, Takayuki; Ishikawa, Kaori; Nakada, Kazuto; Hayashi, Jun-Ichi

    2015-08-07

    Our previous studies provided evidence that mammalian mitochondrial DNA (mtDNA) mutations that cause mitochondrial respiration defects behave in a recessive manner, because the induction of respiration defects could be prevented with the help of a small proportion (10%-20%) of mtDNA without the mutations. However, subsequent studies found the induction of respiration defects by the accelerated accumulation of a small proportion of mtDNA with various somatic mutations, indicating the presence of mtDNA mutations that behave in a dominant manner. Here, to provide the evidence for the presence of dominant mutations in mtDNA, we used mouse lung carcinoma P29 cells and examined whether some mtDNA molecules possess somatic mutations that dominantly induce respiration defects. Cloning and sequence analysis of 40-48 mtDNA molecules from P29 cells was carried out to screen for somatic mutations in protein-coding genes, because mutations in these genes could dominantly regulate respiration defects by formation of abnormal polypeptides. We found 108 missense mutations existing in one or more of 40-48 mtDNA molecules. Of these missense mutations, a T15091C mutation in the Cytb gene was expected to be pathogenic due to the presence of its orthologous mutation in mtDNA from a patient with cardiomyopathy. After isolation of many subclones from parental P29 cells, we obtained subclones with various proportions of T15091C mtDNA, and showed that the respiration defects were induced in a subclone with only 49% T15091C mtDNA. Because the induction of respiration defects could not be prevented with the help of the remaining 51% mtDNA without the T15091C mutation, the results indicate that the T15091C mutation in mtDNA dominantly induced the respiration defects. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. ABCD syndrome is caused by a homozygous mutation in the EDNRB gene.

    PubMed

    Verheij, Joke B G M; Kunze, Jürgen; Osinga, Jan; van Essen, Anthonie J; Hofstra, Robert M W

    2002-03-15

    ABCD syndrome is an autosomal recessive syndrome characterized by albinism, black lock, cell migration disorder of the neurocytes of the gut (Hirschsprung disease [HSCR]), and deafness. This phenotype clearly overlaps with the features of the Shah-Waardenburg syndrome, comprising sensorineural deafness; hypopigmentation of skin, hair, and irides; and HSCR. Therefore, we screened DNA of the index patient of the ABCD syndrome family for mutations in the endothelin B receptor (EDNRB) gene, a gene known to be involved in Shah-Waardenburg syndrome. A homozygous nonsense mutation in exon 3 (R201X) of the EDNRB gene was found. We therefore suggest that ABCD syndrome is not a separate entity, but an expression of Shah-Waardenburg syndrome.

  11. A novel FKRP-related muscular dystrophy founder mutation in South African Afrikaner patients with a phenotype suggestive of a dystrophinopathy.

    PubMed

    Mudau, M M; Essop, F; Krause, A

    2016-12-21

    Fukutin-related protein (FKRP) muscular dystrophy is an autosomal recessive disorder caused by mutations in the FKRP gene. The condition is often misdiagnosed as a dystrophinopathy. A previously unreported mutation, c.1100T>C in exon 4 of FKRP, had been identified in homozygous form in two white South African (SA) Afrikaner patients clinically diagnosed with a dystrophinopathy. To investigate whether the c.1100T>C mutation and the common European FKRP mutation c.826C>A are present in other patients of Afrikaner origin with suspected dystrophinopathy, and whether a founder haplotype exists. The c.1100T>C mutation was initially tested for using an amplification refractory mutation system technique in 45 white SA Afrikaner patients who had tested negative using multiplex ligation probe amplification screening for exonic deletions/duplications in the dystrophin gene. Sequencing analysis was used to confirm the c.1100T>C mutation and screen for the c.826C>A mutation. Two cohorts (each numbering 100) of Afrikaans and other white controls were screened for the c.1100T>C and c.826C>A mutations, respectively. Of the 45 patients, 8 patients (17.8%) were homozygous for c.1100T>C, 2 (4.4%) were compound heterozygotes for c.1100T>C and c.826C>A, and 1 (2.2%) was heterozygous for c.1100T>C with a second unidentified mutation. The c.1100T>C mutation was found in 1/100 controls, but no heterozygotes for the c.826C>A mutation were identified. Linked marker analysis for c.1100T>C showed a common haplotype, suggesting a probable founder mutation in the SA Afrikaner population. FKRP mutations may be relatively common in Afrikaners, and screening should be considered in patients who have a suggestive phenotype and test negative for a dystrophinopathy. This test will be useful for offering diagnostic, carrier and prenatal testing for affected individuals and their families. As FKRP muscular dystrophy is autosomal recessive in inheritance, the

  12. Uncommon runs of homozygosity disclose homozygous missense mutations in two ciliopathy-related genes (SPAG17 and WDR35) in a patient with multiple brain and skeletal anomalies.

    PubMed

    Córdova-Fletes, Carlos; Becerra-Solano, Luis E; Rangel-Sosa, Martha M; Rivas-Estilla, Ana María; Alberto Galán-Huerta, Kame; Ortiz-López, Rocío; Rojas-Martínez, Augusto; Juárez-Vázquez, Clara I; García-Ortiz, José E

    2018-03-01

    We describe a patient severely affected with multiple congenital anomalies, including brain malformations and skeletal dysplasia suggestive of cranioectodermal dysplasia (CED) ciliopathy, who unusually carries several homozygosity tracts involving homozygous missense mutations in SPAG17 (exon 8; c.1069G > C; p.Asp357His) and WDR35 (exon 13; c.1415G > A; p.Arg472Gln) as revealed by homozygosity mapping and next generation sequencing. SPAG17 is essential for the function and structure of motile cilia, while WDR35 belongs to the same intraflagellar transport (IFT) gene family whose protein products are part of functional IFT A and B complexes. Formerly, SPAG17 was related - through polymorphic variants - to an influence on individuals' height; more recently, Spag17-/- mice models were reported to present skeletal and bone defects, reduced mucociliary clearance, respiratory distress, and cerebral ventricular enlargement. Homozygous or compound heterozygous mutations in WDR35 have mainly been related to CED2 or short-rib thoracic dysplasia 7, with only three cases showing some brain anomalies. Given that our patient presents these clinical features and the close functional relationship between SPAG17 and WDR35, it is feasible that the combined effects from both mutations contribute to his phenotype. To our knowledge, this patient is the first to harbor a likely pathogenic homozygous mutation in both genes at the same time. Thus, the resulting complex phenotype of this patient illustrates the heterogeneity associated with ciliopathies and further expands the clinical and mutational spectrum of these diseases. Finally, we highlight the combined use of high-throughput tools to diagnose and support the proper handling of this and other patients. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  13. XPC gene mutations in families with xeroderma pigmentosum from Pakistan; prevalent founder effect.

    PubMed

    Ijaz, Ambreen; Basit, Sulman; Gul, Ajab; Batool, Lilas; Hussain, Abrar; Afzal, Sibtain; Ramzan, Khushnooda; Ahmad, Jamil; Wali, Abdul

    2018-03-23

    Xeroderma pigmentosum (XP) is a rare autosomal recessive skin disorder characterized by hyperpigmentation, premature skin aging, ocular and cutaneous photosensitivity, and increased risk of skin carcinoma. We investigated seven consanguineous XP families with nine patients from Pakistan. All the Patients exhibited typical clinical symptoms of XP since first year of life. Whole genome SNP genotyping identified a 14 Mb autozygous region segregating with the disease phenotype on chromosome 3p25.1. DNA sequencing of XPC gene revealed a founder homozygous splice site mutation (c.2251-1G>C) in patients from six families (A-F) and a homozygous nonsense mutation (c.1399C>T; p.Gln467*) in patients of family G. This is the first report of XPC mutations, underlying XP phenotype, in Pakistani population. © 2018 Japanese Teratology Society.

  14. The novel mitochondrial 16S rRNA 2336T>C mutation is associated with hypertrophic cardiomyopathy

    PubMed Central

    Liu, Zhong; Song, Yanrui; Li, Dan; He, Xiangyu; Li, Shishi; Wu, Bifeng; Wang, Wei; Gu, Shulian; Zhu, Xiaoyu; Wang, Xuexiang; Zhou, Qiyin; Dai, Yu; Yan, Qingfeng

    2014-01-01

    Background Hypertrophic cardiomyopathy (HCM) is a primary disorder characterised by asymmetric thickening of septum and left ventricular wall, with a prevalence of 0.2% in the general population. Objective To describe a novel mitochondrial DNA mutation and its association with the pathogenesis of HCM. Methods and results All maternal members of a Chinese family with maternally transmitted HCM exhibited variable severity and age at onset, and were implanted permanent pacemakers due to complete atrioventricular block (AVB). Nuclear gene screening (MYH7, MYBPC3, TNNT2 and TNNI3) was performed, and no potential pathogenic mutation was identified. Mitochondrial DNA sequencing analysis identified a novel homoplasmic 16S rRNA 2336T>C mutation. This mutation was exclusively present in maternal members and absent in non-maternal members. Conservation index by comparison to 16 other vertebrates was 94.1%. This mutation disturbs the 2336U-A2438 base pair in the stem–loop structure of 16S rRNA domain III, which is involved in the assembly of mitochondrial ribosome. Oxygen consumption rate of the lymphoblastoid cells carrying 2336T>C mutation had decreased by 37% compared with controls. A reduction in mitochondrial ATP synthesis and an increase in reactive oxidative species production were also observed. Electron microscopic analysis indicated elongated mitochondria and abnormal mitochondrial cristae shape in mutant cells. Conclusions It is suggested that the 2336T>C mutation is one of pathogenic mutations of HCM. This is the first report of mitochondrial 16S rRNA 2336T>C mutation and an association with maternally inherited HCM combined with AVB. Our findings provide a new insight into the pathogenesis of HCM. PMID:24367055

  15. Novel C8orf37 mutations cause retinitis pigmentosa in consanguineous families of Pakistani origin

    PubMed Central

    Ravesh, Zeinab; El Asrag, Mohammed E.; Weisschuh, Nicole; McKibbin, Martin; Reuter, Peggy; Watson, Christopher M.; Baumann, Britta; Poulter, James A.; Sajid, Sundus; Panagiotou, Evangelia S.; O’Sullivan, James; Abdelhamed, Zakia; Bonin, Michael; Soltanifar, Mehdi; Black, Graeme C.M.; Din, Muhammad Amin-ud; Toomes, Carmel; Ansar, Muhammad; Inglehearn, Chris F.; Wissinger, Bernd

    2015-01-01

    Purpose To investigate the molecular basis of retinitis pigmentosa in two consanguineous families of Pakistani origin with multiple affected members. Methods Homozygosity mapping and Sanger sequencing of candidate genes were performed in one family while the other was analyzed with whole exome next-generation sequencing. A minigene splicing assay was used to confirm the splicing defects. Results In family MA48, a novel homozygous nucleotide substitution in C8orf37, c.244–2A>C, that disrupted the consensus splice acceptor site of exon 3 was found. The minigene splicing assay revealed that this mutation activated a cryptic splice site within exon 3, causing a 22 bp deletion in the transcript that is predicted to lead to a frameshift followed by premature protein truncation. In family MA13, a novel homozygous null mutation in C8orf37, c.555G>A, p.W185*, was identified. Both mutations segregated with the disease phenotype as expected in a recessive manner and were absent in 8,244 unrelated individuals of South Asian origin. Conclusions In this report, we describe C8orf37 mutations that cause retinal dystrophy in two families of Pakistani origin, contributing further data on the phenotype and the spectrum of mutations in this form of retinitis pigmentosa. PMID:25802487

  16. Surfactant protein B deficiency and gene mutations for neonatal respiratory distress syndrome in China Han ethnic population

    PubMed Central

    Yin, Xiaojuan; Meng, Fanping; wang, Yan; Xie, Lu; Kong, Xiangyong; Feng, Zhichun

    2013-01-01

    Objective: To determine whether the SP-B deficiency and gene mutations in exon 4 is associated with neonatal RDS in China Han ethnic population. Methods: The study population consisted of 40 neonates with RDS and 40 neonates with other diseases as control in China Han ethnic population. We Compared SP-B expression in lung tissue and bronchoalveolar lavage fluid with immunoblotting, and analyzed mutations in the SP-B gene with polymerase chain reaction (PCR) and gene sequencing. Results: In RDS group, low mature Surfactant protein B was found in both lung tissue and bronchoalveolar lavage fluid in 8 neonates. In control group, only 4 neonates with low mature Surfactant protein B in both lung tissue and bronchoalveolar lavage fluid. In RDS group, 20 neonates were found to have mutations in exon 4, 12 homozygous mutations with C/C genotype and 8 heterozygous mutations with C/T genotype in surfactant protein B gene+1580 polymorphism. There were 8 cases mutations in control group, 1 in C/C and 7 in C/T genotype. The frequency of homozygotes with C/C genotype was 0.3 and frequency of heterozygotes with C/T genotype was 0.02 in RDS group. In control group, frequency of homozygotes with C/C genotype was 0.025 and frequency of heterozygote with C/T genotype was 0.175. Conclusion: Low mature Surfactant protein B is associated with the pathogenesis of neonatal respiratory distress syndrome (RDS) in China Han ethnic population. Mutations in exon 4 of the surfactant protein B gene demonstrate an association between homozygous mutations with C/C genotype in SP-B gene and neonatal RDS. PMID:23330012

  17. A homozygous mutation in HESX1 is associated with evolving hypopituitarism due to impaired repressor-corepressor interaction

    PubMed Central

    Carvalho, Luciani R.; Woods, Kathryn S.; Mendonca, Berenice B.; Marcal, Nathalie; Zamparini, Andrea L.; Stifani, Stefano; Brickman, Joshua M.; Arnhold, Ivo J.P.; Dattani, Mehul T.

    2003-01-01

    The paired-like homeobox gene expressed in embryonic stem cells Hesx1/HESX1 encodes a developmental repressor and is expressed in early development in a region fated to form the forebrain, with subsequent localization to Rathke’s pouch, the primordium of the anterior pituitary gland. Mutations within the gene have been associated with septo-optic dysplasia, a constellation of phenotypes including eye, forebrain, and pituitary abnormalities, or milder degrees of hypopituitarism. We identified a novel homozygous nonconservative missense mutation (I26T) in the critical Engrailed homology repressor domain (eh1) of HESX1, the first, to our knowledge, to be described in humans, in a girl with evolving combined pituitary hormone deficiency born to consanguineous parents. Neuroimaging revealed a thin pituitary stalk with anterior pituitary hypoplasia and an ectopic posterior pituitary, but no midline or optic nerve abnormalities. This I26T mutation did not affect the DNA-binding ability of HESX1 but led to an impaired ability to recruit the mammalian Groucho homolog/Transducin-like enhancer of split-1 (Gro/TLE1), a crucial corepressor for HESX1, thereby leading to partial loss of repression. Thus, the novel pituitary phenotype highlighted here appears to be a specific consequence of the inability of HESX1 to recruit Groucho-related corepressors, suggesting that other molecular mechanisms govern HESX1 function in the forebrain. PMID:14561704

  18. Identification of homozygous WFS1 mutations (p.Asp211Asn, p.Gln486*) causing severe Wolfram syndrome and first report of male fertility

    PubMed Central

    Haghighi, Amirreza; Haghighi, Alireza; Setoodeh, Aria; Saleh-Gohari, Nasrollah; Astuti, Dewi; Barrett, Timothy G

    2013-01-01

    Wolfram syndrome (WFS) is a neurodegenerative genetic condition characterized by juvenile-onset of diabetes mellitus and optic atrophy. We studied clinical features and the molecular basis of severe WFS (neurodegenerative complications) in two consanguineous families from Iran. A clinical and molecular genetic investigation was performed in the affected and healthy members of two families. The clinical diagnosis of WFS was confirmed by the existence of diabetes mellitus and optic atrophy in the affected patients, who in addition had severe neurodegenerative complications. Sequencing of WFS1 was undertaken in one affected member from each family. Targeted mutations were tested in all members of relevant families. Patients had most of the reported features of WFS. Two affected males in the first family had fathered unaffected children. We identified two homozygous mutations previously reported with apparently milder phenotypes: family 1: c.631G>A (p.Asp211Asn) in exon 5, and family 2: c.1456C>T (p.Gln486*) in exon 8. Heterozygous carriers were unaffected. This is the first report of male Wolfram patients who have successfully fathered children. Surprisingly, they also had almost all the complications associated with WFS. Our report has implications for genetic counseling and family planning advice for other affected families. PMID:22781099

  19. Juvenile Paget’s Disease In An Iranian Kindred With Vitamin D Deficiency And Novel Homozygous TNFRSF11B Mutation

    PubMed Central

    Saki, Forough; Karamizadeh, Zohreh; Nasirabadi, Shiva; Mumm, Steven; McAlister, William H.; Whyte, Michael P.

    2013-01-01

    Juvenile Paget’s disease (JPD) is a rare heritable osteopathy characterized biochemically by markedly increased serum alkaline phosphatase (ALP) activity emanating from generalized acceleration of skeletal turnover. Affected infants and children typically suffer bone pain and fractures and deformities, become deaf, and have macrocranium. Some who survive to young adult life develop blindness from retinopathy engendered by vascular microcalcification. Most cases of JPD are caused by osteoprotegerin (OPG) deficiency due to homozygous loss-of-function mutations within the TNFRSF11B gene that encodes OPG. We report a 3-year-old Iranian girl with JPD and craniosynostosis who had vitamin D deficiency in infancy. She presented with fractures during the first year-of-life followed by bone deformities, delayed development, failure-to-thrive, and pneumonias. At 1 year-of-age, biochemical studies of serum revealed marked hyperphosphatasemia together with low-normal calcium and low inorganic phosphate and 25-hydroxyvitamin D levels. Several family members in previous generations of this consanguineous kindred may also have had JPD and vitamin D deficiency. Mutation analysis showed homozygosity for a unique missense change (c.130T>C, p.Cys44Arg) in TNFRSF11B that would compromise the cysteine-rich domain of OPG that binds receptor activator of NF-κB ligand (RANKL). Both parents were heterozygous for this mutation. The patient’s serum OPG level was extremely low and RANKL level markedly elevated. She responded well to rapid oral vitamin D repletion followed by pamidronate treatment given intravenously. Our patient is the first Iranian reported with JPD. Her novel mutation in TNFRSF11B plus vitamin D deficiency in infancy was associated with severe JPD uniquely complicated by craniosynostosis. Pamidronate treatment with vitamin D sufficiency can be effective treatment for the skeletal disease caused by the OPG deficiency form of JPD. PMID:23322328

  20. Homozygous and compound heterozygous mutations in the FBN1 gene: unexpected findings in molecular diagnosis of Marfan syndrome.

    PubMed

    Arnaud, Pauline; Hanna, Nadine; Aubart, Mélodie; Leheup, Bruno; Dupuis-Girod, Sophie; Naudion, Sophie; Lacombe, Didier; Milleron, Olivier; Odent, Sylvie; Faivre, Laurence; Bal, Laurence; Edouard, Thomas; Collod-Beroud, Gwenaëlle; Langeois, Maud; Spentchian, Myrtille; Gouya, Laurent; Jondeau, Guillaume; Boileau, Catherine

    2017-02-01

    Marfan syndrome (MFS) is an autosomal-dominant connective tissue disorder usually associated with heterozygous mutations in the gene encoding fibrillin-1 (FBN1). Homozygous and compound heterozygous cases are rare events and have been associated with a clinical severe presentation. Report unexpected findings of homozygosity and compound heterozygosity in the course of molecular diagnosis of heterozygous MFS and compare the findings with published cases. In the context of molecular diagnosis of heterozygous MFS, systematic sequencing of the FBN1 gene was performed in 2500 probands referred nationwide. 1400 probands carried a heterozygous mutation in this gene. Unexpectedly, among them four homozygous cases (0.29%) and five compound heterozygous cases (0.36%) were identified (total: 0.64%). Interestingly, none of these cases carried two premature termination codon mutations in the FBN1 gene. Clinical features for these carriers and their families were gathered and compared. There was a large spectrum of severity of the disease in probands carrying two mutated FBN1 alleles, but none of them presented extremely severe manifestations of MFS in any system compared with carriers of only one mutated FBN1 allele. This observation is not in line with the severe clinical features reported in the literature for four homozygous and three compound heterozygous probands. Homozygotes and compound heterozygotes were unexpectedly identified in the course of molecular diagnosis of MFS. Contrary to previous reports, the presence of two mutated alleles was not associated with severe forms of MFS. Although homozygosity and compound heterozygosity are rarely found in molecular diagnosis, they should not be overlooked, especially among consanguineous families. However, no predictive evaluation of severity should be provided. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  1. A novel XPD mutation in a compound heterozygote; the mutation in the second allele is present in three homozygous patients with mild sun sensitivity.

    PubMed

    Falik-Zaccai, Tzipora C; Erel-Segal, Reut; Horev, Liran; Bitterman-Deutsch, Ora; Koka, Sivan; Chaim, Sara; Keren, Zohar; Kalfon, Limor; Gross, Bella; Segal, Zvi; Orgal, Shlomi; Shoval, Yishay; Slor, Hanoch; Spivak, Graciela; Hanawalt, Philip C

    2012-08-01

    The XPD protein plays a pivotal role in basal transcription and in nucleotide excision repair (NER) as one of the ten known components of the transcription factor TFIIH. Mutations in XPD can result in the DNA repair-deficient diseases xeroderma pigmentosum (XP), trichothiodystrophy (TTD), cerebro-oculo-facial-skeletal syndrome, and in combined phenotypes such as XP/Cockayne syndrome and XP/TTD. We describe here an 18-year-old individual with mild sun sensitivity, no neurological abnormalities and no tumors, who carries a p.R683Q mutation in one allele, and the novel p.R616Q mutation in the other allele of the XPD gene. We also describe four patients from one family, homozygous for the identical p.R683Q mutation in XPD, who exhibit mild skin pigmentation and loss of tendon reflexes. Three homozygous patients presented with late-onset skin tumors, and two with features of premature aging and moderate cognitive decline. Cells from the compound heterozygous individual and from one of the patients homozygous for p.R683Q exhibited similar responses to UV irradiation: reduced viability and defective overall removal of UV-induced cyclobutane pyrimidine dimers, implying deficient global genomic NER. Cells from the compound heterozygous subject also failed to recover RNA synthesis after UV, indicating defective transcription-coupled NER. Mutations affecting codon 616 in XPD generally result in functionally null proteins; we hypothesize that the phenotype of the heterozygous patient results solely from expression of the p.R683Q allele. This study illustrates the importance of detailed follow up with sun sensitive individuals, to ensure appropriate prophylaxis and to understand the mechanistic basis of the implicated hereditary disease. Copyright © 2012 Wiley Periodicals, Inc.

  2. Novel Homozygous Missense Mutation in RYR1 Leads to Severe Congenital Ptosis, Ophthalmoplegia, and Scoliosis in the Absence of Myopathy.

    PubMed

    Dilaver, Nafi; Mazaheri, Neda; Maroofian, Reza; Zeighami, Jawaher; Seifi, Tahere; Zamani, Mina; Sedaghat, Alireza; Shariati, Gholam Reza; Galehdari, Hamid

    2017-12-01

    Ryanodine receptor 1 ( RYR1 ) is an intracellular calcium receptor primarily expressed in skeletal muscle with a role in excitation contraction. Both dominant and recessive mutations in the RYR1 gene cause a range of RYR1 -related myopathies and/or susceptibility to malignant hyperthermia (MH). Recently, an atypical manifestation of ptosis, variably presenting with ophthalmoplegia, facial paralysis, and scoliosis but without significant muscle weakness, has been reported in 9 cases from 4 families with bialleic variants in RYR1 . Two affected children from a consanguineous family with severe congenital ptosis, ophthalmoplegia, scoliosis, and distinctive long faces but without skeletal myopathy were studied. To identify the cause of the hereditary condition, DNA from the proband was subjected to whole exome sequencing (WES). WES revealed a novel homozygous missense variant in RYR1 (c.14066T>A; p.IIe4689Asn), which segregated within the family. Although the phenotype of the affected siblings in this study was similar to previously described cases, the clinical features were more severely expressed. Our findings contribute to the expansion of phenotypes related to RYR1 dysfunction. Additionally, it supports a new RYR1 -related clinical presentation without musculoskeletal involvement. It is important that individuals with RYR1 mutations are considered susceptible to MH, as 70% of the MH cases are caused by mutations in the RYR1 gene.

  3. Hereditary Angioedema Nationwide Study in Slovenia Reveals Four Novel Mutations in SERPING1 Gene

    PubMed Central

    Rijavec, Matija; Korošec, Peter; Šilar, Mira; Zidarn, Mihaela; Miljković, Jovan; Košnik, Mitja

    2013-01-01

    Hereditary angioedema (HAE) is a rare autosomal dominant disease characterized by swelling of the face, lips, tongue, larynx, genitalia, or extremities, with abdominal pain caused by intra-abdominal edema. HAE is caused by mutations affecting the C1 inhibitor gene, SERPING1, resulting in low levels of C1 inhibitor (Type I HAE) or normal levels of ineffective C1 inhibitor (Type II HAE). A nationwide survey identified nine unrelated families with HAE in Slovenia, among whom 17 individuals from eight families were recruited for genetic analyses. A diagnosis of HAE was established in the presence of clinical and laboratory criteria (low C1 inhibitor antigenic levels and/or function), followed up by a positive family history. Genetic studies were carried out using PCR and sequencing to detect SERPING1 mutations in promoter, noncoding exon 1, the 7 coding exons, and exon-intron boundaries. Multiplex ligation-dependent probe amplification was performed in order to search for large deletions/duplications in SERPING1 gene. A mutation responsible for HAE was identified in patients from seven families with the disease. In HAE type I families, one previously reported substitution (Gln67Stop, c.265C>T) and four novel mutations were identified. The new mutations included two missense substitutions, Ser128Phe (c.449C>T), and Glu429Lys (c.1351G>A), together with two frameshift mutations, indel (c.49delGinsTT) and deletion (c.593_594delCT). Both families with HAE type II harbored the two well-known substitutions affecting the arginyl residue at the reactive center in exon 8, Arg444Cys (c.1396C>T) and Arg444His (c.1397G>A), respectively. In one patient only the homozygous variant g.566T>C (c.-21T>C) was identified. Our study identified four novel mutations in the Slovenian HAE population, highlighting the heterogeneity of mutations in the SERPING1 gene causing C1 inhibitor deficiency and HAE. In a single patient with HAE a homozygous variant g.566T>C (c.-21T>C) might be responsible

  4. Hereditary angioedema nationwide study in Slovenia reveals four novel mutations in SERPING1 gene.

    PubMed

    Rijavec, Matija; Korošec, Peter; Šilar, Mira; Zidarn, Mihaela; Miljković, Jovan; Košnik, Mitja

    2013-01-01

    Hereditary angioedema (HAE) is a rare autosomal dominant disease characterized by swelling of the face, lips, tongue, larynx, genitalia, or extremities, with abdominal pain caused by intra-abdominal edema. HAE is caused by mutations affecting the C1 inhibitor gene, SERPING1, resulting in low levels of C1 inhibitor (Type I HAE) or normal levels of ineffective C1 inhibitor (Type II HAE). A nationwide survey identified nine unrelated families with HAE in Slovenia, among whom 17 individuals from eight families were recruited for genetic analyses. A diagnosis of HAE was established in the presence of clinical and laboratory criteria (low C1 inhibitor antigenic levels and/or function), followed up by a positive family history. Genetic studies were carried out using PCR and sequencing to detect SERPING1 mutations in promoter, noncoding exon 1, the 7 coding exons, and exon-intron boundaries. Multiplex ligation-dependent probe amplification was performed in order to search for large deletions/duplications in SERPING1 gene. A mutation responsible for HAE was identified in patients from seven families with the disease. In HAE type I families, one previously reported substitution (Gln67Stop, c.265C>T) and four novel mutations were identified. The new mutations included two missense substitutions, Ser128Phe (c.449C>T), and Glu429Lys (c.1351G>A), together with two frameshift mutations, indel (c.49delGinsTT) and deletion (c.593_594delCT). Both families with HAE type II harbored the two well-known substitutions affecting the arginyl residue at the reactive center in exon 8, Arg444Cys (c.1396C>T) and Arg444His (c.1397G>A), respectively. In one patient only the homozygous variant g.566T>C (c.-21T>C) was identified. Our study identified four novel mutations in the Slovenian HAE population, highlighting the heterogeneity of mutations in the SERPING1 gene causing C1 inhibitor deficiency and HAE. In a single patient with HAE a homozygous variant g.566T>C (c.-21T>C) might be responsible

  5. A homozygous MYO7A mutation associated to Usher syndrome and unilateral auditory neuropathy spectrum disorder.

    PubMed

    Xia, Hong; Hu, Pengzhi; Yuan, Lamei; Xiong, Wei; Xu, Hongbo; Yi, Junhui; Yang, Zhijian; Deng, Xiong; Guo, Yi; Deng, Hao

    2017-10-01

    Usher syndrome (USH) is an autosomal recessive disorder characterized by sensorineural hearing loss, progressive visual loss and night blindness due to retinitis pigmentosa (RP), with or without vestibular dysfunction. The purpose of this study was to detect the causative gene in a consanguineous Chinese family with USH. A c.3696_3706del (p.R1232Sfs*72) variant in the myosin VIIa gene (MYO7A) was identified in the homozygous state by exome sequencing. The co‑segregation of the MYO7A c.3696_3706del variant with the phenotype of deafness and progressive visual loss in the USH family was confirmed by Sanger sequencing. The variant was absent in 200 healthy controls. Therefore, the c.3696_3706del variant may disrupt the interaction between myosin VIIa and other USH1 proteins, and impair melanosome transport in retinal pigment epithelial cells. Notably, bilateral auditory brainstem responses were absent in two patients of the USH family, while distortion product otoacoustic emissions were elicited in the right ears of the two patients, consistent with clinical diagnosis of unilateral auditory neuropathy spectrum disorder. These data suggested that the homozygous c.3696_3706del variant in the MYO7A gene may be the disease‑causing mutation for the disorder in this family. These findings broaden the phenotype spectrum of the MYO7A gene, and may facilitate understanding of the molecular pathogenesis of the disease, and genetic counseling for the family.

  6. A homozygous missense mutation in human KLOTHO causes severe tumoral calcinosis

    PubMed Central

    Ichikawa, Shoji; Imel, Erik A.; Kreiter, Mary L.; Yu, Xijie; Mackenzie, Donald S.; Sorenson, Andrea H.; Goetz, Regina; Mohammadi, Moosa; White, Kenneth E.; Econs, Michael J.

    2007-01-01

    Familial tumoral calcinosis is characterized by ectopic calcifications and hyperphosphatemia due to inactivating mutations in FGF23 or UDP-N-acetyl-α-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 3 (GALNT3). Herein we report a homozygous missense mutation (H193R) in the KLOTHO (KL) gene of a 13-year-old girl who presented with severe tumoral calcinosis with dural and carotid artery calcifications. This patient exhibited defects in mineral ion homeostasis with marked hyperphosphatemia and hypercalcemia as well as elevated serum levels of parathyroid hormone and FGF23. Mapping of H193R mutation onto the crystal structure of myrosinase, a plant homolog of KL, revealed that this histidine residue was at the base of the deep catalytic cleft and mutation of this histidine to arginine should destabilize the putative glycosidase domain (KL1) of KL, thereby attenuating production of membrane-bound and secreted KL. Indeed, compared with wild-type KL, expression and secretion of H193R KL were markedly reduced in vitro, resulting in diminished ability of FGF23 to signal via its cognate FGF receptors. Taken together, our findings provide what we believe to be the first evidence that loss-of-function mutations in human KL impair FGF23 bioactivity, underscoring the essential role of KL in FGF23-mediated phosphate and vitamin D homeostasis in humans. PMID:17710231

  7. Hb Dartmouth (HBA2: c.200T>C): An α2-Globin Gene Associated with Hb H Disease in One Homozygous Patient.

    PubMed

    Farashi, Samaneh; Faramarzi Garous, Negin; Ashki, Mehri; Vakili, Shadi; Zeinali, Fatemah; Imanian, Hashem; Azarkeivan, Azita; Najmabadi, Hossein

    2015-01-01

    Hb H (β4) disease is caused by deletion or inactivation of three out of four α-globin genes. A high incidence of Hb H disease has been reported all over the world. There is a wide spectrum of phenotypic presentations, from clinically asymptomatic to having significant hepatosplenomegaly and requiring occasional or even regular blood transfusions, even more severe anemia, Hb Bart's (γ4) hydrops fetalis syndrome that can cause death in the affected fetuses late in gestation. We here present a case who was diagnosed with Hb H disease that represents a new genotype for this hereditary disorder. Hb Dartmouth is a variant caused by a missense mutation at codon 66 of the α2-globin gene (HBA2: c.200T>C), resulting in the substitution of leucine by proline. We here emphasize the importance of this point mutation involving Hb H disease and also the necessity for prenatal diagnosis (PND) for those who carry this point mutation in the heterozygous state.

  8. [Analysis of H63D mutation in hemochromatosis (HFE) gene in populations of central Eurasia].

    PubMed

    Khusainova, R I; Khusnutdinova, N N; Litvinov, S S; Khusnutdinova, E K

    2013-02-01

    An analysis of the frequency of H63D (c. 187C>G) mutations in the HFEgene in 19 populations from Central Eurasia demonstrated that the distribution of the mutation in the region of interest was not uniform and that there were the areas of H63D accumulation. The investigation of three polymorphic variants, c.340+4T>C (rs2071303, IVS2(+4)T>C), c.893-44T>C (rs1800708, IVS4(-44)T>C), and c.1007-47G>A (rs1572982, IVS5(-47)A>G), in the HFE gene in individuals homozygous for H63D mutations in the HFE gene revealed the linkage of H63D with three haplotypes, *CTA, *TG, and *TTA. These findings indicated the partial spread of the mutation in Central Eurasia from Western Europe, as well as the possible repeated appearance of the mutation on the territory on interest.

  9. A homozygous NOP14 variant is likely to cause recurrent pregnancy loss.

    PubMed

    Suzuki, Toshifumi; Behnam, Mahdiyeh; Ronasian, Firooze; Salehi, Mansoor; Shiina, Masaaki; Koshimizu, Eriko; Fujita, Atsushi; Sekiguchi, Futoshi; Miyatake, Satoko; Mizuguchi, Takeshi; Nakashima, Mitsuko; Ogata, Kazuhiro; Takeda, Satoru; Matsumoto, Naomichi; Miyake, Noriko

    2018-04-01

    Recurrent pregnancy loss is newly defined as more than two consecutive miscarriages. Recurrent pregnancy loss occurs in <5% of total pregnancies. The cause in approximately 40-60% of recurrent pregnancy loss cases remains elusive and must be determined. We investigated two unrelated Iranian consanguineous families with recurrent pregnancy loss. We performed exome sequencing using DNA from a miscarriage tissue and identified a homozygous NOP14 missense variant (c.[136C>G];[136C>G]) in both families. NOP14 is an evolutionally conserved protein among eukaryotes and is required for 18S rRNA processing and 40S ribosome biogenesis. Interestingly, in zebrafish, homozygous mutation of nop14 (possibly loss of function) resulting from retrovirus-mediated insertional mutagenesis led to embryonic lethality at 5 days after fertilization, mimicking early pregnancy loss in humans. Similarly, it is known that the nop14-null yeast is inviable. These data suggest that the homozygous NOP14 mutation is likely to cause recurrent pregnancy loss. Furthermore, this study shows that exome sequencing is very useful to determine the etiology of unsolved recurrent pregnancy loss.

  10. Increased risk of recurrent thrombosis in patients with essential thrombocythemia carrying the homozygous JAK2 V617F mutation.

    PubMed

    De Stefano, Valerio; Za, Tommaso; Rossi, Elena; Vannucchi, Alessandro M; Ruggeri, Marco; Elli, Elena; Micò, Caterina; Tieghi, Alessia; Cacciola, Rossella R; Santoro, Cristina; Vianelli, Nicola; Guglielmelli, Paola; Pieri, Lisa; Scognamiglio, Francesca; Cacciola, Emma; Rodeghiero, Francesco; Pogliani, Enrico M; Finazzi, Guido; Gugliotta, Luigi; Leone, Giuseppe; Barbui, Tiziano

    2010-02-01

    Evidence suggests that the JAK2 V617F mutation is associated with an increased risk of first thrombosis in patients with essential thrombocythemia (ET). Whether this mutation is also a risk factor for recurrent thrombosis is currently unknown. To investigate the impact of the JAK2 V617F mutation on the risk of recurrent thrombosis in patients with ET, we carried out a multicentre retrospective cohort study. We recruited 143 patients with previous arterial (64.4%) or venous major thrombosis (34.8%) or both (0.8%); 98 of them (68.5%) carried the mutation. Thrombosis recurred in 43 of the patients (30%); overall, after adjustment for sex, age, presence of vascular risk factors, and treatment after the first thrombosis, the presence of the JAK2 mutation did not predict recurrence (multivariable hazard ratio, HR, 0.88, 95% CI 0.46-1.68). Indeed, the individuals homozygous for the JAK2 V617F (allele burden >50%) mutation had an increased risk of recurrence in comparison with wild-type patients (HR 6.15, 95% CI 1.51-24.92). In conclusion, a homozygous JAK2 V617F mutation is an independent risk factor for recurrent thrombosis in patients with ET.

  11. The mutY gene: a mutator locus in Escherichia coli that generates G.C----T.A transversions.

    PubMed Central

    Nghiem, Y; Cabrera, M; Cupples, C G; Miller, J H

    1988-01-01

    We have used a strain with an altered lacZ gene, which reverts to wild type via only certain transversions, to detect transversion-specific mutators in Escherichia coli. Detection relied on a papillation technique that uses a combination of beta-galactosides to reveal blue Lac+ papillae. One class of mutators is specific for the G.C----T.A transversion as determined by the reversion pattern of a set of lacZ mutations and by the distribution of forward nonsense mutations in the lacI gene. The locus responsible for the mutator phenotype is designated mutY and maps near 64 min on the genetic map of E. coli. The mutY locus may act in a similar but reciprocal fashion to the previously characterized mutT locus, which results in A.T----C.G transversions. Images PMID:3128795

  12. Homozygous EDNRB mutation in a patient with Waardenburg syndrome type 1.

    PubMed

    Morimoto, Noriko; Mutai, Hideki; Namba, Kazunori; Kaneko, Hiroki; Kosaki, Rika; Matsunaga, Tatsuo

    2018-04-01

    To examine and expand the genetic spectrum of Waardenburg syndrome type 1 (WS1). Clinical features related to Waardenburg syndrome (WS) were examined in a five-year old patient. Mutation analysis of genes related to WS was performed in the proband and her parents. Molecular modeling of EDNRB and the p.R319W mutant was conducted to predict the pathogenicity of the mutation. The proband showed sensorineural hearing loss, heterochromia iridis, and dystopia canthorum, fulfilling the clinical criteria of WS1. Genetic analyses revealed that the proband had no mutation in PAX3 which has been known as the cause of WS1, but had a homozygous missense mutation (p.R319W) in endothelin receptor type B (EDNRB) gene. The asymptomatic parents had the mutation in a heterozygote state. This mutation has been previously reported in a heterozygous state in a patient with Hirschsprung's disease unaccompanied by WS, but the patient and her parents did not show any symptoms in gastrointestinal tract. Molecular modeling of EDNRB with the p.R319W mutation demonstrated reduction of the positively charged surface area in this region, which might reduce binding ability of EDNRB to G protein and lead to abnormal signal transduction underlying the WS phenotype. Our findings suggested that autosomal recessive mutation in EDNRB may underlie a part of WS1 with the current diagnostic criteria, and supported that Hirschsprung's disease is a multifactorial genetic disease which requires additional factors. Further molecular analysis is necessary to elucidate the gene interaction and to reappraise the current WS classification. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. First description of phosphofructokinase deficiency in spain: identification of a novel homozygous missense mutation in the PFKM gene

    PubMed Central

    Vives-Corrons, Joan-Lluis; Koralkova, Pavla; Grau, Josep M.; Mañú Pereira, Maria del Mar; Van Wijk, Richard

    2013-01-01

    Phosphofructokinase deficiency is a very rare autosomal recessive disorder, which belongs to group of rare inborn errors of metabolism called glycogen storage disease. Here we report on a new mutation in the phosphofructokinase (PFK) gene PFKM identified in a 65-years-old woman who suffered from lifelong intermittent muscle weakness and painful spasms of random occurrence, episodic dark urines, and slight haemolytic anemia. After ruling out the most common causes of chronic haemolytic anemia, the study of a panel of 24 enzyme activities showed a markedly decreased PFK activity in red blood cells (RBCs) from the patient. DNA sequence analysis of the PFKM gene subsequently revealed a novel homozygous mutation: c.926A>G; p.Asp309Gly. This mutation is predicted to severely affect enzyme catalysis thereby accounting for the observed enzyme deficiency. This case represents a prime example of classical PFK deficiency and is the first reported case of this very rare red blood cell disorder in Spain. PMID:24427140

  14. Neonatal-Onset Chronic Diarrhea Caused by Homozygous Nonsense WNT2B Mutations.

    PubMed

    O'Connell, Amy E; Zhou, Fanny; Shah, Manasvi S; Murphy, Quinn; Rickner, Hannah; Kelsen, Judith; Boyle, John; Doyle, Jefferson J; Gangwani, Bharti; Thiagarajah, Jay R; Kamin, Daniel S; Goldsmith, Jeffrey D; Richmond, Camilla; Breault, David T; Agrawal, Pankaj B

    2018-06-04

    Homozygous nonsense mutations in WNT2B were identified in three individuals from two unrelated families with severe, neonatal-onset osmotic diarrhea after whole-exome sequencing was performed on trios from the two families. Intestinal biopsy samples from affected individuals were used for histology and immunofluorescence and to generate enteroids ex vivo. Histopathologic evaluation demonstrated chronic inflammatory changes in the stomach, duodenum, and colon. Immunofluorescence demonstrated diminished staining for OLFM4, a marker for intestinal stem cells (ISCs). The enteroids generated from WNT2B-deficient intestinal epithelium could not be expanded and did not survive passage. Addition of CHIR-99021 (a GSK3A and GSK3B inhibitor and activator of canonical WNT/β-CATENIN signaling) could not rescue WNT2B-deficient enteroids. Addition of supplemental recombinant murine WNT2B was able to perpetuate small enteroids for multiple passages but failed to expand their number. Enteroids showed a 10-fold increase in the expression of LEF1 mRNA and a 100-fold reduction in TLR4 expression, compared with controls by quantitative RT-PCR, indicating alterations in canonical WNT and microbial pattern-recognition signaling. In summary, individuals with homozygous nonsense mutations in WNT2B demonstrate severe intestinal dysregulation associated with decreased ISC number and function, likely explaining their diarrheal phenotype. WNT2B deficiency should be considered for individuals with neonatal-onset diarrhea. Copyright © 2018 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  15. High prevalence of factor V Leiden and prothrombin G20101A mutations in Kashmiri patients with venous thromboembolism.

    PubMed

    Shafia, Syed; Zargar, Mahrukh H; Khan, Nabeela; Ahmad, Rehana; Shah, Zafar Amin; Asimi, Ravouf

    2018-05-15

    The genetic variants of the factor V (G1691A), prothrombin (G20210A) and MTHFR (C677T) genes have been widely implicated as inherited risk factors for developing venous thrombosis. This study was undertaken to reveal the frequency of these mutations in Kashmiri patients with venous thromboembolism. A case-control study was designed with 250 VTE patients and 250 healthy controls. The mutations were analysed using ARMS-PCR and PCR-RFLP approach. The factor V Leiden G1691A mutation was found in 17/250 (6.8%) VTE patients and prothrombin G20210A mutation was found in 7/250 (2.8%) VTE patients while no mutation was found in any of the healthy controls. Both the mutations were found to be significantly associated with the increased risk of VTE (p = 0.0001 and 0.0150 respectively) while no association of VTE risk with MTHFR C677T polymorphism was found (p = 0.53). The increased frequency of factor V Leiden G1691A and prothrombin G20210A mutation in VTE patients indicates a significant role of these mutations in the development of VTE in our population. We therefore suggest the routine screening of these two mutations as thrombophilic markers in Kashmiri patients with venous thromboembolism. Copyright © 2018 Elsevier B.V. All rights reserved.

  16. Carriers of the Complex Allele HFE c.[187C>G;340+4T>C] Have Increased Risk of Iron Overload in São Miguel Island Population (Azores, Portugal)

    PubMed Central

    Bulhões, Sara; Brilhante, Maria José; Pereirinha, Tânia; Cabral, Rita; Rego, Ana Catarina; Fraga, Cristina; Miguel, António G.; Brasil, Gracinda; Macedo, Paula; Mota-Vieira, Luisa

    2015-01-01

    Iron overload is associated with acquired and genetic conditions, the most common being hereditary hemochromatosis (HH) type-I, caused by HFE mutations. Here, we conducted a hospital-based case-control study of 41 patients from the São Miguel Island (Azores, Portugal), six belonging to a family with HH type-I pseudodominant inheritance, and 35 unrelated individuals fulfilling the biochemical criteria of iron overload compatible with HH type-I. For this purpose, we analyzed the most common HFE mutations– c.845G>A [p.Cys282Tyr], c.187C>G [p.His63Asp], and c.193A>T [p.Ser65Cys]. Results revealed that the family’s HH pseudodominant pattern is due to consanguineous marriage of HFE-c.845G>A carriers, and to marriage with a genetically unrelated spouse that is a -c.187G carrier. Regarding unrelated patients, six were homozygous for c.845A, and three were c.845A/c.187G compound heterozygous. We then performed sequencing of HFE exons 2, 4, 5 and their intron-flanking regions. No other mutations were observed, but we identified the -c.340+4C [IVS2+4C] splice variant in 26 (74.3%) patients. Functionally, the c.340+4C may generate alternative splicing by HFE exon 2 skipping and consequently, a protein missing the α1-domain essential for HFE/ transferrin receptor-1 interactions. Finally, we investigated HFE mutations configuration with iron overload by determining haplotypes and genotypic profiles. Results evidenced that carriers of HFE-c.187G allele also carry -c.340+4C, suggesting in-cis configuration. This data is corroborated by the association analysis where carriers of the complex allele HFE-c.[187C>G;340+4T>C] have an increased iron overload risk (RR = 2.08, 95% CI = 1.40−2.94, p<0.001). Therefore, homozygous for this complex allele are at risk of having iron overload because they will produce two altered proteins—the p.63Asp [c.187G], and the protein lacking 88 amino acids encoded by exon 2. In summary, we provide evidence that the complex allele HFE-c.[187C

  17. Homozygous ARHGEF2 mutation causes intellectual disability and midbrain-hindbrain malformation.

    PubMed

    Ravindran, Ethiraj; Hu, Hao; Yuzwa, Scott A; Hernandez-Miranda, Luis R; Kraemer, Nadine; Ninnemann, Olaf; Musante, Luciana; Boltshauser, Eugen; Schindler, Detlev; Hübner, Angela; Reinecker, Hans-Christian; Ropers, Hans-Hilger; Birchmeier, Carmen; Miller, Freda D; Wienker, Thomas F; Hübner, Christoph; Kaindl, Angela M

    2017-04-01

    Mid-hindbrain malformations can occur during embryogenesis through a disturbance of transient and localized gene expression patterns within these distinct brain structures. Rho guanine nucleotide exchange factor (ARHGEF) family members are key for controlling the spatiotemporal activation of Rho GTPase, to modulate cytoskeleton dynamics, cell division, and cell migration. We identified, by means of whole exome sequencing, a homozygous frameshift mutation in the ARHGEF2 as a cause of intellectual disability, a midbrain-hindbrain malformation, and mild microcephaly in a consanguineous pedigree of Kurdish-Turkish descent. We show that loss of ARHGEF2 perturbs progenitor cell differentiation and that this is associated with a shift of mitotic spindle plane orientation, putatively favoring more symmetric divisions. The ARHGEF2 mutation leads to reduction in the activation of the RhoA/ROCK/MLC pathway crucial for cell migration. We demonstrate that the human brain malformation is recapitulated in Arhgef2 mutant mice and identify an aberrant migration of distinct components of the precerebellar system as a pathomechanism underlying the midbrain-hindbrain phenotype. Our results highlight the crucial function of ARHGEF2 in human brain development and identify a mutation in ARHGEF2 as novel cause of a neurodevelopmental disorder.

  18. Homozygous ARHGEF2 mutation causes intellectual disability and midbrain-hindbrain malformation

    PubMed Central

    Yuzwa, Scott A.; Hernandez-Miranda, Luis R.; Musante, Luciana; Boltshauser, Eugen; Schindler, Detlev; Hübner, Angela; Reinecker, Hans-Christian; Ropers, Hans-Hilger; Miller, Freda D.; Hübner, Christoph; Kaindl, Angela M.

    2017-01-01

    Mid-hindbrain malformations can occur during embryogenesis through a disturbance of transient and localized gene expression patterns within these distinct brain structures. Rho guanine nucleotide exchange factor (ARHGEF) family members are key for controlling the spatiotemporal activation of Rho GTPase, to modulate cytoskeleton dynamics, cell division, and cell migration. We identified, by means of whole exome sequencing, a homozygous frameshift mutation in the ARHGEF2 as a cause of intellectual disability, a midbrain-hindbrain malformation, and mild microcephaly in a consanguineous pedigree of Kurdish-Turkish descent. We show that loss of ARHGEF2 perturbs progenitor cell differentiation and that this is associated with a shift of mitotic spindle plane orientation, putatively favoring more symmetric divisions. The ARHGEF2 mutation leads to reduction in the activation of the RhoA/ROCK/MLC pathway crucial for cell migration. We demonstrate that the human brain malformation is recapitulated in Arhgef2 mutant mice and identify an aberrant migration of distinct components of the precerebellar system as a pathomechanism underlying the midbrain-hindbrain phenotype. Our results highlight the crucial function of ARHGEF2 in human brain development and identify a mutation in ARHGEF2 as novel cause of a neurodevelopmental disorder. PMID:28453519

  19. Meta-Prediction of MTHFR Gene Polymorphism Mutations and Associated Risk for Colorectal Cancer

    PubMed Central

    Yu, C. H.

    2016-01-01

    The methylenetetrahydrofolate reductase (MTHFR) gene is one of the most investigated of the genes associated with chronic human diseases because of its associations with hyperhomocysteinemia and toxicity. It has been proposed as a prototype gene for the prevention of colorectal cancer (CRC). The major objectives of this meta-analysis were to examine the polymorphism-mutation patterns of MTHFR and their associations with risk for CRC as well as potential contributing factors for mutations and disease risks. This analysis included 33,626 CRC cases and 48,688 controls across 92 studies for MTHFR 677 and 16,367 cases and 24,874 controls across 54 studies for MTHFR 1298, comprising data for various racial and ethnic groups, both genders, and multiple cancer sites. MTHFR 677 homozygous TT genotype was protective (p < .05) for CRC for all included populations; however, with heterogeneity across various racial–ethnic groups and opposing findings, it was a risk genotype for the subgroup of Hispanics (p < .01). Additional countries for which subgroup analyses resulted in 677 TT as a risk genotype included Turkey, Romania, Croatia, Hungary, Portugal, Mexico, Brazil, U.S. Hawai’i, Taiwan, India, and Egypt. Countries with the highest mutation rates and risks for both MTHFR 677 and 1298 genotypes are presented using global maps to visualize the grouping patterns. Meta-predictive analyses revealed that air pollution levels were associated with gene polymorphisms for both genotypes. Future nursing research should be conducted to develop proactive measures to protect populations in cities where air pollution causes more deaths. PMID:26858257

  20. Identifying mutations in Tunisian families with retinal dystrophy.

    PubMed

    Habibi, Imen; Chebil, Ahmed; Falfoul, Yosra; Allaman-Pillet, Nathalie; Kort, Fedra; Schorderet, Daniel F; El Matri, Leila

    2016-11-22

    Retinal dystrophies (RD) are a rare genetic disorder with high genetic heterogeneity. This study aimed at identifying disease-causing variants in fifteen consanguineous Tunisian families. Full ophthalmic examination was performed. Index patients were subjected to IROme analysis or whole exome sequencing followed by homozygosity mapping. All detected variations were confirmed by direct Sanger sequencing. Mutation analysis in our patients revealed two compound heterozygous mutations p.(R91W);(V172D) in RPE65, and five novel homozygous mutations: p.R765C in CNGB1, p.H337R in PDE6B, splice site variant c.1129-2A > G and c.678_681delGAAG in FAM161A and c.1133 + 3_1133 + 6delAAGT in CERKL. The latter mutation impacts pre-mRNA splicing of CERKL. The other changes detected were six previously reported mutations in CNGB3 (p.R203*), ABCA4 (p.W782*), NR2E3 (p.R311Q), RPE65 (p.H182Y), PROM1 (c.1354dupT) and EYS (c.5928-2A > G). Segregation analysis in each family showed that all affected individuals were homozygotes and unaffected individuals were either heterozygote carriers or homozygous wild type allele. These results confirm the involvement of a large number of genes in RD in the Tunisian population.

  1. Digenic mutations involving both the BSND and GJB2 genes detected in Bartter syndrome type IV.

    PubMed

    Wang, Hong-Han; Feng, Yong; Li, Hai-Bo; Wu, Hong; Mei, Ling-Yun; Wang, Xing-Wei; Jiang, Lu; He, Chu-Feng

    2017-01-01

    Bartter syndrome type IV, characterized by salt-losing nephropathies and sensorineural deafness, is caused by mutations of BSND or simultaneous mutations of both CLCNKA and CLCNKB. GJB2 is the primary causative gene for non-syndromic sensorineural deafness and associated with several syndromic sensorineural deafness. Owing to the rarity of Bartter syndrome, only a few mutations have been reported in the abovementioned causative genes. To investigate the underlying mutations in a Chinese patient with Bartter syndrome type IV, genetic analysis of BSND, CLCNKA, CLCNKB and GJB2 were performed by polymerase chain reaction and direct sequencing. Finally, double homozygous mutations c.22C > T (p.Arg8Trp) and c.127G > A (Val43Ile) were detected in exon 1 of BSND. Intriguingly, compound heterozygous mutations c.235delC (p.Leu79CysfsX3) and c.109G > A (p.Val37Ile) were also revealed in exon 2 of GJB2 in the same patient. No pathogenic mutations were found in CLCNKA and CLCNKB. Our results indicated that the homozygous mutation c.22C > T was the key genetic reason for the proband, and a digenic effect of BSND and GJB2 might contributed to sensorineural deafness. To our knowledge, it was the first report showing that the GJB2 gene mutations were detected in Bartter syndrome. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  2. Methotrexate-induced mucositis in acute leukemia patients is not associated with the MTHFR 677T allele in Mexico.

    PubMed

    Ruiz-Argüelles, Guillermo J; Coconi-Linares, Lucia Nancy; Garcés-Eisele, Javier; Reyes-Núñez, Virginia

    2007-10-01

    Methylenetetrahydrofolate reductase (MTHFR) has two common variants with reduced activity due to polymorphisms at nucleotides 677 and 1298. Both affect folate metabolism and thus remethylation of homocysteine, but are also thought to affect nucleotide synthesis and DNA methylation. Methotrexate (MTX), which interrupts folate metabolism, is used in the treatment of a variety of diseases including acute lymphoblastic leukemia (ALL), but exerts in some patients toxic effects on fast dividing tissues such as mucosal epithelia. The enhanced toxicity may be due to cooperative effects between MTX and MTHFR variants. Accordingly, it has been reported that carrying the 677T allele of the MTHFR is a risk factor for MTX-associated mucositis. As in the Mexican population, which is characterized by a high prevalence of the 677T MTHFR variant, several of its commonly associated defects have not been observed, we investigated the relationship between MTX toxicity and the 677T allele. Out of 28 patients with ALL (CC: 2, CT: 10, TT: 16), 16 had episodes of MTX-associated mucositis (CC: 0, CT: 6, TT: 10). Neither at the gene level nor at the genotype level was a significant association with mucositis found. It may be postulated that the risk of higher MTX toxicity in patients with decreased MTHFR activity could be neutralized by the normally folate rich diet in Mexico.

  3. A novel mutation in the albumin gene (c.1A>C) resulting in analbuminemia.

    PubMed

    Caridi, Gianluca; Dagnino, Monica; Lugani, Francesca; Shalev, Stavit A; Campagnoli, Monica; Galliano, Monica; Spiegel, Ronen; Minchiotti, Lorenzo

    2013-01-01

    Analbuminemia (OMIM # 103600) is a rare autosomal recessive disorder manifested by the absence or severe reduction of circulating serum albumin in homozygous or compound heterozygous subjects. The trait is caused by a variety of mutations within the albumin gene. We report here the clinical and molecular characterisation of two new cases of congenital analbuminemia diagnosed in two members of the Druze population living in a Galilean village (Northern Israel) on the basis of their low level of circulating albumin. The albumin gene was screened by single-strand conformation polymorphism and heteroduplex analysis, and the mutated region was submitted to DNA sequencing. Both the analbuminemic subjects resulted homozygous for a previously unreported c.1 A>C transversion, for which we suggest the name Afula from the hospital where the two cases were investigated. This mutation causes the loss of the primary start codon ATG for Met1, which is replaced by a - then untranslated - triplet CTG for Leu. (p.Met1Leu). The use of an alternative downstream ATG codon would probably give rise to a completely aberrant polypeptide chain, leading to a misrouted intracellular transport and a premature degradation. The discovery of this new ALB mutation, probably inherited from a common ancestor, sheds light on the molecular mechanism underlying the analbuminemic trait and may serve in the development of a rapid genetic test for the identification of a-symptomatic heterozygous carriers in the Druze population in the Galilee. © 2012 The Authors. European Journal of Clinical Investigation © 2012 Stichting European Society for Clinical Investigation Journal Foundation.

  4. Glucose-6-Phosphate Dehydrogenase (G6PD) deficiency in Greek newborns: the Mediterranean C563T mutation screening.

    PubMed

    Molou, Elina; Schulpis, Kleopatra H; Thodi, Georgia; Georgiou, Vassiliki; Dotsikas, Yannis; Papadopoulos, Konstantinos; Biti, Sofia; Loukas, Yannis L

    2014-04-01

    Glucose-6-Phosphate Dehydrogenase (G6PD) gene is located at the X-chromosome at Xq28 and the disease is recessively inherited predominantly in males. More than 400 variants have been proposed based on clinical and enzymatic studies. The aim of the current study was to identify C563T mutation in G6PD-deficient newborns and to correlate the enzyme residual activity with the presence of the mutation. Some 1189 full-term neonates aged 3-5 days old were tested for G6PD activity in dried blood spots from Guthrie cards using a commercial kit. DNA extraction from Guthrie cards and mutation identification among the deficient samples were performed with current techniques. A total of 92 (7.7%) newborns were G6PD-deficient. In 46 (50%), the mutation C563T was identified. The residual activity in C563T hemizygote males (n = 28) was statistically significantly lower (1.23 ± 0.93 U/g Hb) than that in non-C563T G6PD-deficient males (n = 25) (4.01 ± 1.20 U/g Hb, p < 0.0001) and in controls (13.6 ± 2.9 U/g Hb, p < 0.0001). In C563T heterozygote females, the estimated enzyme activity was lower than that determined in non-C563T females. Male C563T hemizygotes suffer from G6PD deficiency and severe neonatal jaundice. G6PD activity showed statistically significant correlation with total bilirubin blood levels.

  5. [A novel homozygous mutation p.E25X in the HSD3B2 gene causing salt wasting 3β-hydroxysteroid dehydrogenases deficiency in a Chinese pubertal girl: a delayed diagnosis until recurrent ovary cysts].

    PubMed

    Huang, Yonglan; Zheng, Jipeng; Xie, Ting; Xiao, Qing; Lu, Shaomei; Li, Xiuzhen; Cheng, Jing; Chen, Lihe; Liu, Li

    2014-12-01

    3β- hydroxysteroid dehydrogenase deficiency (3βHSD), a rare form of congenital adrenal hyperplasia (CAH) resulted from mutations in the HSD3B2 gene that impair steroidogenesis in both adrenals and gonads. We report clinical features and the results of HSD3B2 gene analysis of a Chinese pubertal girl with salt wasting 3βHSD deficiency. We retrospectively reviewed clinical presentations and steroid profiles of the patient diagnosed in Guangzhou Women and Children's Medical Center in 2013. PCR and direct sequencing were used to identify any mutation in the HSD3B2 gene. A 13-year-old girl was diagnosed as CAH after birth because of salt-wasting with mild clitorimegaly and then was treated with glucocorticoid replacement. Breast and pubic hair development were normal, and menarche occurred at 12 yr, followed by menstrual bleeding about every 45 days. In the last one year laparoscopic operation and ovariocentesis were performed one after another for recurrent ovary cysts. Under corticoid acetate therapy, ACTH 17.10 pmol/L (normal 0-10.12), testosterone 1.31 nmol/L (normal <0.7), dehydroepiandrosterone sulfate 13.30 µmol/L (normal 0.95 - 11.67), cortisol 720 nmol/L (normal 130-772.8), androstenedione, 17-hydroxyprogesterone and progesterone were normal. Estradiol 461 pmol/L, follicle-stimulating hormone 3.04 IU/L, luteinizing hormone 8.52 IU/L in follicular phase. A pelvic ultrasound showed lateral ovaries cysts (58 mm × 50 mm × 35 mm) and a midcycle-type endometrium. A novel nonsense mutation c.73G >T (p.E25X) was identified in HSD3B2 gene. The girl was homozygous and her mother was heterozygous, while her father was not identified with this mutation. A classic 3βHSD deficiency is characterized by salt wasting and mild virilization in female. Ovary cysts may be the one of features of gonad phenotype indicating ovary 3βHSD deficiency. A novel homozygous mutation c.73G >T(p.E25X) was related to the classical phenotype.

  6. Meta-Prediction of MTHFR Gene Polymorphisms and Air Pollution on the Risk of Hypertensive Disorders in Pregnancy Worldwide.

    PubMed

    Yang, Ya-Ling; Yang, Hsiao-Ling; Shiao, S Pamela K

    2018-02-13

    Hypertensive disorders in pregnancy (HDP) are devastating health hazards for both women and children. Both methylenetetrahydrofolate reductase ( MTHFR ) gene polymorphisms and air pollution can affect health status and result in increased risk of HDP for women. The major objective of this study was to investigate the effect of MTHFR polymorphisms, air pollution, and their interaction on the risk of HDP by using meta-predictive analytics. We searched various databases comprehensively to access all available studies conducted for various ethnic populations from countries worldwide, from 1997 to 2017. Seventy-one studies with 8064 cases and 13,232 controls for MTHFR C677T and 11 studies with 1425 cases and 1859 controls for MTHFR A1298C were included. MTHFR C677T homozygous TT (risk ratio (RR) = 1.28, p < 0.0001) and CT plus TT (RR = 1.07, p = 0.0002) were the risk genotypes, while wild-type CC played a protective role (RR = 0.94, p = 0.0017) for HDP. The meta-predictive analysis found that the percentage of MTHFR C677T TT plus CT ( p = 0.044) and CT ( p = 0.043) genotypes in the HDP case group were significantly increased with elevated levels of air pollution worldwide. Additionally, in countries with higher air pollution levels, the pregnant women with wild-type CC MTHFR 677 had a protection effect against HDP ( p = 0.014), whereas, the homozygous TT of MTHFR C677T polymorphism was a risk genotype for developing HDP. Air pollution level is an environmental factor interacting with increased MTHFR C677T polymorphisms, impacting the susceptibility of HDP for women.

  7. Meta-Prediction of MTHFR Gene Polymorphisms and Air Pollution on the Risk of Hypertensive Disorders in Pregnancy Worldwide

    PubMed Central

    Yang, Ya-Ling; Yang, Hsiao-Ling; Shiao, S. Pamela K.

    2018-01-01

    Hypertensive disorders in pregnancy (HDP) are devastating health hazards for both women and children. Both methylenetetrahydrofolate reductase (MTHFR) gene polymorphisms and air pollution can affect health status and result in increased risk of HDP for women. The major objective of this study was to investigate the effect of MTHFR polymorphisms, air pollution, and their interaction on the risk of HDP by using meta-predictive analytics. We searched various databases comprehensively to access all available studies conducted for various ethnic populations from countries worldwide, from 1997 to 2017. Seventy-one studies with 8064 cases and 13,232 controls for MTHFR C677T and 11 studies with 1425 cases and 1859 controls for MTHFR A1298C were included. MTHFR C677T homozygous TT (risk ratio (RR) = 1.28, p < 0.0001) and CT plus TT (RR = 1.07, p = 0.0002) were the risk genotypes, while wild-type CC played a protective role (RR = 0.94, p = 0.0017) for HDP. The meta-predictive analysis found that the percentage of MTHFR C677T TT plus CT (p = 0.044) and CT (p = 0.043) genotypes in the HDP case group were significantly increased with elevated levels of air pollution worldwide. Additionally, in countries with higher air pollution levels, the pregnant women with wild-type CC MTHFR 677 had a protection effect against HDP (p = 0.014), whereas, the homozygous TT of MTHFR C677T polymorphism was a risk genotype for developing HDP. Air pollution level is an environmental factor interacting with increased MTHFR C677T polymorphisms, impacting the susceptibility of HDP for women. PMID:29438331

  8. Novel mutations in CRB1 and ABCA4 genes cause Leber congenital amaurosis and Stargardt disease in a Swedish family

    PubMed Central

    Jonsson, Frida; Burstedt, Marie S; Sandgren, Ola; Norberg, Anna; Golovleva, Irina

    2013-01-01

    This study aimed to identify genetic mechanisms underlying severe retinal degeneration in one large family from northern Sweden, members of which presented with early-onset autosomal recessive retinitis pigmentosa and juvenile macular dystrophy. The clinical records of affected family members were analysed retrospectively and ophthalmological and electrophysiological examinations were performed in selected cases. Mutation screening was initially performed with microarrays, interrogating known mutations in the genes associated with recessive retinitis pigmentosa, Leber congenital amaurosis and Stargardt disease. Searching for homozygous regions with putative causative disease genes was done by high-density SNP-array genotyping, followed by segregation analysis of the family members. Two distinct phenotypes of retinal dystrophy, Leber congenital amaurosis and Stargardt disease were present in the family. In the family, four patients with Leber congenital amaurosis were homozygous for a novel c.2557C>T (p.Q853X) mutation in the CRB1 gene, while of two cases with Stargardt disease, one was homozygous for c.5461-10T>C in the ABCA4 gene and another was carrier of the same mutation and a novel ABCA4 mutation c.4773+3A>G. Sequence analysis of the entire ABCA4 gene in patients with Stargardt disease revealed complex alleles with additional sequence variants, which were evaluated by bioinformatics tools. In conclusion, presence of different genetic mechanisms resulting in variable phenotype within the family is not rare and can challenge molecular geneticists, ophthalmologists and genetic counsellors. PMID:23443024

  9. ACE I/D sequence variants but not MTHFR C677T, is strongly linked to malignant glioma risk and its variant DD genotype may act as a promising predictive biomarker for overall survival of glioma patients.

    PubMed

    Pandith, Arshad A; Qasim, Iqbal; Zahoor, Wani; Shah, Parveen; Bhat, Abdul R

    2018-01-10

    ACE I/D and MTHFR C677T gene polymorphisms can be seen as candidate genes for glioma on the basis of their biological functions and their involvement in different cancers. The aim of this study was to analyze potential association and overall survival between MTHFR C677T and ACE I/D polymorphism in glioma patients in our population. We tested genotype distribution of 112 glioma patients against 141 cancer-free controls from the same region. Kaplan-Meier survival analysis was performed to evaluate overall survival of patients for both genes. No significant differences were found among MTHFR C677T wild type C and variant genotypes CT/TT with glioma patients. In ACE, the distribution of variant ID and DD was found to be significantly higher in glioma cases as compared to controls (p<0.0001). ACE DD genotypes were highly presented in glioma cases 26.8% versus 10.6% in controls (p<0.0001) and conferred 5-fold risk for predisposition in glioma cases. Per copy D allele frequency was found higher in cases than in controls (0.54 versus 0.25: p<0.0001). Interestingly we found a significant overall survival (with log rank p<0.01) in patients who presented with ACE DD genotypes had the least estimated overall survival of 13.4months in comparison to 21. 7 and 17.6months for ACE II and I/D genotypes respectively. We conclude ACE I/D polymorphism plays a vital role in predisposition of higher risk for glioma. We also suggest that ACE DD genotypes may act as an important predictive biomarker for overall survival of glioma patients. Copyright © 2017. Published by Elsevier B.V.

  10. Phenotypic variability in patients with ADA2 deficiency due to identical homozygous R169Q mutations.

    PubMed

    Van Montfrans, Joris M; Hartman, Esther A R; Braun, Kees P J; Hennekam, Eric A M; Hak, Elisabeth A; Nederkoorn, Paul J; Westendorp, Willeke F; Bredius, Robbert G M; Kollen, Wouter J W; Schölvinck, Elisabeth H; Legger, G Elizabeth; Meyts, Isabelle; Liston, Adrian; Lichtenbelt, Klaske D; Giltay, Jacques C; Van Haaften, Gijs; De Vries Simons, Gaby M; Leavis, Helen; Sanders, Cornelis J G; Bierings, Marc B; Nierkens, Stefan; Van Gijn, Marielle E

    2016-05-01

    To determine the genotype-phenotype association in patients with adenosine deaminase-2 (ADA2) deficiency due to identical homozygous R169Q mutations inCECR1 METHODS: We present a case series of nine ADA2-deficient patients with an identical homozygous R169Q mutation. Clinical and diagnostic data were collected and available MRI studies were reviewed. We performed genealogy and haplotype analyses and measured serum ADA2 activity. ADA2 activity values were correlated to clinical symptoms. Age of presentation differed widely between the nine presented patients (range: 0 months to 8 years). The main clinical manifestations were (hepato)splenomegaly (8/9), skin involvement (8/9) and neurological involvement (8/9, of whom 6 encountered stroke). Considerable variation was seen in type, frequency and intensity of other symptoms, which included aplastic anaemia, acute myeloid leukaemia and cutaneous ulcers. Common laboratory abnormalities included cytopenias and hypogammaglobulinaemia. ADA2 enzyme activity in patients was significantly decreased compared with healthy controls. ADA2 activity levels tended to be lower in patients with stroke compared with patients without stroke. Genealogical studies did not identify a common ancestor; however, based on allele frequency, a North-West European founder effect can be noted. Three patients underwent haematopoietic cell transplantation, after which ADA2 activity was restored and clinical symptoms resolved. This case series revealed large phenotypic variability in patients with ADA2 deficiency though they were homozygous for the same R169Q mutation inCECR1 Disease modifiers, including epigenetic and environmental factors, thus seem important in determining the phenotype. Furthermore, haematopoietic cell transplantation appears promising for those patients with a severe clinical phenotype. © The Author 2016. Published by Oxford University Press on behalf of the British Society for Rheumatology. All rights reserved. For Permissions

  11. Screening of LDLR and APOB gene mutations in Mexican patients with homozygous familial hypercholesterolemia.

    PubMed

    Hernández Flores, Teresita De Jesús; González García, Juan Ramón; Colima Fausto, Ana Gabriela; Vázquez Cárdenas, Norma Alejandra; Sánchez López, Yoaly; Zarate Morales, César Augusto; Magaña Torres, María Teresa

    Familial hypercholesterolemia (FH) is an autosomal dominant disorder that causes accumulation of serum low-density lipoprotein cholesterol and premature cardiovascular disease. It is mainly related to mutations in the LDLR gene. Homozygous FH (HoFH) patients have the most severe form of the disease accounting for a worldwide prevalence of 1:1,000,000. In Mexico, at least 5 cases of HoFH have been reported. The aim of this study was to describe the clinical, biochemical, and molecular data observed in patients with HoFH phenotype. We included 13 patients, belonging to 11 families, with clinical and biochemical diagnoses suggestive of HoFH. Molecular analyses of the LDLR and APOB genes were performed by means of polymerase chain reaction followed by Sanger sequencing. The causal mutation of HoFH was found in 8 of 11 unrelated patients. Excepting 1, all were true homozygotes. Six different variants in LDLR were identified: c.-139delCTCCCCCTGC, p.Glu140Lys, p.Asp360His, p.Asn405Lys, p.Ala755Glyfs*7, and p.Leu759Serfs*6. Of these, p.Asp360His and p.Asn405Lys were detected for the first time in Mexico; p.Leu759Serfs*6 showed to be the most frequent (43.7% of the alleles 7/16), and c.-139delCTCCCCCTGC is a new variant located in the promoter region. This work increases knowledge of biochemical and genetic features in Mexican patients with HoFH. A novel mutation in the LDLR gene promoter was detected: c.-139delCTCCCCCTGC, which possibly inhibits its expression. Copyright © 2018 National Lipid Association. Published by Elsevier Inc. All rights reserved.

  12. Severe early onset retinitis pigmentosa in a Moroccan patient with Heimler syndrome due to novel homozygous mutation of PEX1 gene.

    PubMed

    Ratbi, Ilham; Jaouad, Imane Cherkaoui; Elorch, Hamza; Al-Sheqaih, Nada; Elalloussi, Mustapha; Lyahyai, Jaber; Berraho, Amina; Newman, William G; Sefiani, Abdelaziz

    2016-10-01

    Heimler syndrome (HS) is a rare recessive disorder characterized by sensorineural hearing loss (SNHL), amelogenesis imperfecta, nail abnormalities, and occasional or late-onset retinal pigmentation. It is the mildest form known to date of peroxisome biogenesis disorder caused by hypomorphic mutations of PEX1 and PEX6 genes. We report on a second Moroccan family with Heimler syndrome with early onset, severe visual impairment and important phenotypic overlap with Usher syndrome. The patient carried a novel homozygous missense variant c.3140T > C (p.Leu1047Pro) of PEX1 gene. As standard biochemical screening of blood for evidence of a peroxisomal disorder did not provide a diagnosis in the individuals with HS, patients with SNHL and retinal pigmentation should have mutation analysis of PEX1 and PEX6 genes. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  13. New splicing-site mutations in the SURF1 gene in Leigh syndrome patients.

    PubMed

    Pequignot, M O; Desguerre, I; Dey, R; Tartari, M; Zeviani, M; Agostino, A; Benelli, C; Fouque, F; Prip-Buus, C; Marchant, D; Abitbol, M; Marsac, C

    2001-05-04

    The gene SURF1 encodes a factor involved in the biogenesis of cytochrome c oxidase, the last complex in the respiratory chain. Mutations of the SURF1 gene result in Leigh syndrome and severe cytochrome c oxidase deficiency. Analysis of seven unrelated patients with cytochrome c oxidase deficiency and typical Leigh syndrome revealed different SURF1 mutations in four of them. Only these four cases had associated demyelinating neuropathy. Three mutations were novel splicing-site mutations that lead to the excision of exon 6. Two different novel heterozygous mutations were found at the same guanine residue at the donor splice site of intron 6; one was a deletion, whereas the other was a transition [588+1G>A]. The third novel splicing-site mutation was a homozygous [516-2_516-1delAG] in intron 5. One patient only had a homozygous polymorphism in the middle of the intron 8 [835+25C>T]. Western blot analysis showed that Surf1 protein was absent in all four patients harboring mutations. Our studies confirm that the SURF1 gene is an important nuclear gene involved in the cytochrome c oxidase deficiency. We also show that Surf1 protein is not implicated in the assembly of other respiratory chain complexes or the pyruvate dehydrogenase complex.

  14. Validation of dye-binding/high-resolution thermal denaturation for the identification of mutations in the SLC22A5 gene.

    PubMed

    Dobrowolski, Steven F; McKinney, Jason T; Amat di San Filippo, Cristina; Giak Sim, Keow; Wilcken, Bridget; Longo, Nicola

    2005-03-01

    Primary carnitine deficiency is an autosomal recessive disorder of fatty acid oxidation resulting from defective carnitine transport. This disease is caused by mutations in the OCTN2 carnitine transporter encoded by the SLC22A5 gene. Here we validate dye-binding/high-resolution thermal denaturation as a screening procedure to identify novel mutations in this gene. This procedure is based on the amplification of DNA by PCR in capillaries with the dsDNA binding dye LCGreen I. The PCR reaction is then analyzed in the same capillary by high-resolution thermal denaturation. Samples with abnormal melting profiles are sequenced. This technique correctly identified all known patients who were compound heterozygotes for different mutations in the carnitine transporter gene and about 30% of homozygous patients. The remaining 70% of homozygous patients were identified by a second amplification, in which the patient's DNA was mixed with the DNA of a normal control. This screening system correctly identified eight novel mutations and both abnormal alleles in six new families with primary carnitine deficiency. The causative role of the missense mutations identified (c.3G>T/p.M1I, c.695C>T/p.T232M, and c.1403 C>G/p.T468R) was confirmed by expression in Chinese hamster ovary (CHO) cells. These results expand the mutational spectrum in primary carnitine deficiency and indicate dye-binding/high-resolution thermal denaturation as an ideal system to screen for mutations in diseases with no prevalent molecular alteration. (c) 2005 Wiley-Liss, Inc.

  15. Alzheimer’s Protective A2T Mutation Changes the Conformational Landscape of the Aβ1–42 Monomer Differently Than Does the A2V Mutation

    PubMed Central

    Das, Payel; Murray, Brian; Belfort, Georges

    2015-01-01

    The aggregation of amyloid-β (Aβ) peptides plays a crucial role in the etiology of Alzheimer’s disease (AD). Recently, it has been reported that an A2T mutation in Aβ can protect against AD. Interestingly, a nonpolar A2V mutation also has been found to offer protection against AD in the heterozygous state, although it causes early-onset AD in homozygous carriers. Since the conformational landscape of the Aβ monomer is known to directly contribute to the early-stage aggregation mechanism, it is important to characterize the effects of the A2T and A2V mutations on Aβ1–42 monomer structure. Here, we have performed extensive atomistic replica-exchange molecular dynamics simulations of the solvated wild-type (WT), A2V, and A2T Aβ1–42 monomers. Our simulations reveal that although all three variants remain as collapsed coils in solution, there exist significant structural differences among them at shorter timescales. A2V exhibits an enhanced double-hairpin population in comparison to the WT, similar to those reported in toxic WT Aβ1–42 oligomers. Such double-hairpin formation is caused by hydrophobic clustering between the N-terminus and the central and C-terminal hydrophobic patches. In contrast, the A2T mutation causes the N-terminus to engage in unusual electrostatic interactions with distant residues, such as K16 and E22, resulting in a unique population comprising only the C-terminal hairpin. These findings imply that a single A2X (where X = V or T) mutation in the primarily disordered N-terminus of the Aβ1–42 monomer can dramatically alter the β-hairpin population and switch the equilibrium toward alternative structures. The atomistically detailed, comparative view of the structural landscapes of A2V and A2T variant monomers obtained in this study can enhance our understanding of the mechanistic differences in their early-stage aggregation. PMID:25650940

  16. Consequences of the pathogenic T9176C mutation of human mitochondrial DNA on yeast mitochondrial ATP synthase

    PubMed Central

    Kucharczyk, Roza; Ezkurdia, Nahia; Couplan, Elodie; Procaccio, Vincent; Ackerman, Sharon H.; Blondel, Marc; di Rago, Jean-Paul

    2010-01-01

    Summary Several human neurological disorders have been associated with various mutations affecting mitochondrial enzymes involved in cellular ATP production. One of these mutations, T9176C in the mitochondrial DNA (mtDNA), changes a highly conserved leucine residue into proline at position 217 of the mitochondrially encoded Atp6p (or a) subunit of the F1FO-ATP synthase. The consequences of this mutation on the mitochondrial ATP synthase are still poorly defined. To gain insight into the primary pathogenic mechanisms induced by T9176C, we have investigated the consequences of this mutation on the ATP synthase of yeast where Atp6p is also encoded by the mtDNA. In vitro, yeast atp6-T9176C mitochondria showed a 30% decrease in the rate of ATP synthesis. When forcing the F1FO complex to work in the reverse mode, i.e. F1-catalyzed hydrolysis of ATP coupled to proton transport out of the mitochondrial matrix, the mutant showed a normal proton-pumping activity and this activity was fully sensitive to oligomycin, an inhibitor of the ATP synthase proton channel. However, under conditions of maximal ATP hydrolytic activity, using non-osmotically protected mitochondria, the mutant ATPase activity was less efficiently inhibited by oligomycin (60% inhibition versus 85% for the wild type control). BN-PAGE analyses revealed that atp6-T9176C yeast accumulated rather good levels of fully assembled ATP synthase complexes. However, a number of subcomplexes (F1, Atp9p-ring, unassembled α-F1 subunits) could be detected as well, presumably because of a decreased stability of Atp6p within the ATP synthase. Although the oxidative phosphorylation capacity was reduced in atp6-T9176C yeast, the number of ATP molecules synthesized per electron transferred to oxygen was similar compared with wild type yeast. It can therefore be inferred that the coupling efficiency within the ATP synthase was mostly unaffected and that the T9176C mutation did not increase the proton permeability of the

  17. Mutations of human NARS2, encoding the mitochondrial asparaginyl-tRNA synthetase, cause nonsyndromic deafness and Leigh syndrome.

    PubMed

    Simon, Mariella; Richard, Elodie M; Wang, Xinjian; Shahzad, Mohsin; Huang, Vincent H; Qaiser, Tanveer A; Potluri, Prasanth; Mahl, Sarah E; Davila, Antonio; Nazli, Sabiha; Hancock, Saege; Yu, Margret; Gargus, Jay; Chang, Richard; Al-Sheqaih, Nada; Newman, William G; Abdenur, Jose; Starr, Arnold; Hegde, Rashmi; Dorn, Thomas; Busch, Anke; Park, Eddie; Wu, Jie; Schwenzer, Hagen; Flierl, Adrian; Florentz, Catherine; Sissler, Marie; Khan, Shaheen N; Li, Ronghua; Guan, Min-Xin; Friedman, Thomas B; Wu, Doris K; Procaccio, Vincent; Riazuddin, Sheikh; Wallace, Douglas C; Ahmed, Zubair M; Huang, Taosheng; Riazuddin, Saima

    2015-03-01

    Here we demonstrate association of variants in the mitochondrial asparaginyl-tRNA synthetase NARS2 with human hearing loss and Leigh syndrome. A homozygous missense mutation ([c.637G>T; p.Val213Phe]) is the underlying cause of nonsyndromic hearing loss (DFNB94) and compound heterozygous mutations ([c.969T>A; p.Tyr323*] + [c.1142A>G; p.Asn381Ser]) result in mitochondrial respiratory chain deficiency and Leigh syndrome, which is a neurodegenerative disease characterized by symmetric, bilateral lesions in the basal ganglia, thalamus, and brain stem. The severity of the genetic lesions and their effects on NARS2 protein structure cosegregate with the phenotype. A hypothetical truncated NARS2 protein, secondary to the Leigh syndrome mutation p.Tyr323* is not detectable and p.Asn381Ser further decreases NARS2 protein levels in patient fibroblasts. p.Asn381Ser also disrupts dimerization of NARS2, while the hearing loss p.Val213Phe variant has no effect on NARS2 oligomerization. Additionally we demonstrate decreased steady-state levels of mt-tRNAAsn in fibroblasts from the Leigh syndrome patients. In these cells we show that a decrease in oxygen consumption rates (OCR) and electron transport chain (ETC) activity can be rescued by overexpression of wild type NARS2. However, overexpression of the hearing loss associated p.Val213Phe mutant protein in these fibroblasts cannot complement the OCR and ETC defects. Our findings establish lesions in NARS2 as a new cause for nonsyndromic hearing loss and Leigh syndrome.

  18. Novel homozygous missense mutation in ALDH7A1 causes neonatal pyridoxine dependent epilepsy.

    PubMed

    Coci, Emanuele G; Codutti, Luca; Fink, Christian; Bartsch, Sophie; Grüning, Gunnar; Lücke, Thomas; Kurth, Ingo; Riedel, Joachim

    2017-04-01

    Pyridoxine dependent epilepsy (PDE) (OMIM#266100) is a neonatal form of epilepsy, caused by dysfunction of the enzyme α-aminoadipic semialdehyde dehydrogenase (ALDH7A1 or Antiquitin). This enzyme converts α-aminoadipic semialdehyde (α-AASA) into α-aminoadipate (AAA), a critical step in the lysine metabolism of the brain. ALDH7A1 dysfunction causes an accumulation of α-AASA and δ 1 -piperideine-6-carboxylic acid (P6C), which are in equilibrium with each other. P6C binds and inactivates pyridoxal 5'-phosphate (PLP), the active form of pyridoxine. Individuals affected by ALDH7A1 deficiency show pre-natal and post-natal seizures, which respond to oral pyridoxine but not to other pediatric anti-epileptic drugs. We discovered a novel missense mutation (c.566G > A, p.Gly189Glu) in homozygous state residing in the NAD+ binding domain coding region of exon 6 and affecting an highly conserved amino acid residue. The seizures stopped under post-natal pyridoxine therapy, nevertheless a longer follow-up is needed to evaluate the intellectual development of the child, who is additionally treated with oral l-arginine since the 13th month of life. Developmental delay with or without structural cortex abnormalities were reported in several patients. A brain MRI scan revealed hyperintense white matter in the right cerebellum compatible with cerebellar gliosis. Taken together, our studies enlarge the group of missense pathogenic mutations of ALDH7A1 gene and reveal a novel cerebellar finding within the PDE patients cohort. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. Clinical features of patients with homozygous complement C4A or C4B deficiency.

    PubMed

    Liesmaa, Inka; Paakkanen, Riitta; Järvinen, Asko; Valtonen, Ville; Lokki, Marja-Liisa

    2018-01-01

    Homozygous deficiencies of complement C4A or C4B are detected in 1-10% of populations. In genome-wide association studies C4 deficiencies are missed because the genetic variation of C4 is complex. There are no studies where the clinical presentation of these patients is analyzed. This study was aimed to characterize the clinical features of patients with homozygous C4A or C4B deficiency. Thirty-two patients with no functional C4A, 87 patients with no C4B and 120 with normal amount of C4 genes were included. C4A and C4B numbers were assessed with genomic quantitative real-time PCR. Medical history was studied retrospectively from patients' files. Novel associations between homozygous C4A deficiency and lymphoma, coeliac disease and sarcoidosis were detected. These conditions were present in 12.5%, (4/32 in patients vs. 0.8%, 1/120, in controls, OR = 17.00, 95%CI = 1.83-158.04, p = 0.007), 12.5% (4/32 in patients vs. 0%, 0/120 in controls, OR = 1.14, 95%CI = 1.00-1.30, p = 0.002) and 12.5%, respectively (4/32 in patients vs. 2.5%, 3/120 in controls, OR = 5.571, 95%CI = 1.79-2.32, p = 0.036). In addition, C4A and C4B deficiencies were both associated with adverse drug reactions leading to drug discontinuation (34.4%, 11/32 in C4A-deficient patients vs. 14.2%, 17/120 in controls, OR = 3.174, 95%CI = 1.30-7.74, p = 0.009 and 28.7%, 25/87 in C4B-deficient patients, OR = 2.44, 95%CI = 1.22-4.88, p = 0.010). This reported cohort of homozygous deficiencies of C4A or C4B suggests that C4 deficiencies may have various unrecorded disease associations. C4 gene should be considered as a candidate gene in studying these selected disease associations.

  20. MTHFR 677CC/1298CC genotypes are highly associated with chronic myelogenous leukemia: a case-control study in Korea.

    PubMed

    Moon, Hee Won; Kim, Tae Young; Oh, Bo Ra; Min, Hyun Chung; Cho, Han Ik; Bang, Soo Mee; Lee, Jae Hoon; Yoon, Sung Soo; Lee, Dong Soon

    2007-09-01

    Methylenetetrahydrofolate reductase (MTHFR) is an enzyme involved in folate metabolism and DNA methylation. Studies on MTHFR polymorphism in leukemia have largely focused on the protective role of MTHFR polymorphism in acute lymphoblastic leukemia (ALL). We evaluated the C677T and A1298C polymorphisms using the TaqMan allelic discrimination assay in various malignancies. The study population included 115 subjects with chronic myelogenous leukemia (CML), 200 with acute myelogenous leukemia (AML), 196 with multiple myeloma (MM) and 434 healthy control subjects. The frequency of 1298CC was statistically significantly higher in subjects with CML than that of the controls (OR=5.12, 95% CI: 1.75-14.9, P-value=.003). Of note, the frequencies of 677CC/1298CC genotype were statistically significantly higher in subjects with CML, AML and MM than that of the controls (OR=8.8, 3.5, 3.83, P-value=.002, 0.036, 0.023, respectively). Our results demonstrate that the MTHFR 1298CC homozygote variant is strongly associated with an increased risk of CML, while MTHFR C677T does not significantly affect the risk of CML. Moreover, we demonstrated that MTHFR 677CC and 1298CC genotype might have combined effect on risk of CML, AML and MM and it is inferred that the A1298C may play a different role in carcinogenesis, depending on the types of organs involved, the types of disease entities and the genotype of C677T.

  1. Chronic Granulomatous Disease Due to Neutrophil Cytosolic Factor (NCF2) Gene Mutations in Three Unrelated Families.

    PubMed

    Vignesh, Pandiarajan; Rawat, Amit; Kumar, Ankur; Suri, Deepti; Gupta, Anju; Lau, Yu L; Chan, Koon W; Singh, Surjit

    2017-02-01

    Chronic granulomatous disease (CGD) is an inheritable and genetically heterogeneous disease resulting from mutations in different subcomponents of the NADPH oxidase system. Mutations in the NCF2 gene account for <5% of all cases of CGD. We analyzed the clinical and laboratory findings of CGD with mutations in the NCF2 gene from amongst our cohort of CGD patients. A homozygous mutation (c.835_836delAC, p.T279fsX294), a deletion in NCF2 gene was found in two cases. In the third case, two heterozygous mutations were detected, IVS13-2A>T on one allele and c.1099C>T (p.) on the other allele. The mother of this child was a carrier for the IVS13-2A>T mutation. All three cases had colitis, and it was the initial symptom in two patients. One of the patients also developed a lung abscess due to Nocardia cyriacigeorgica.

  2. Frequency of the S65C mutation in the hemochromatosis gene in Brazil.

    PubMed

    Oliveira, V C; Caxito, F A; Gomes, K B; Castro, A M; Pardini, V C; Ferreira, A C S

    2009-07-14

    Development of hereditary hemochromatosis is associated with the C282Y, H63D or S65C mutations in the hemochromatosis gene. Though there is extensive knowledge about the former two, there is little information on the mechanism of action and the allelic frequency of the S65C mutation. We examined the prevalence of the S65C mutation of the hemochromatosis gene in Brazilians with clinical suspicion of hereditary hemochromatosis. Genotyping for this mutation was carried out in 633 individuals with clinical suspicion of hereditary hemochromatosis, using the polymerase chain reaction, followed by enzymatic digestion. The sample comprised 77.1% men and 22.9% women, giving a ratio of approximately 3:1; the mean age was 48.8 +/- 13.8 years. More than half (57.3%) of the individuals in the sample were 41 to 60 years old. The frequency of heterozygotes for this mutation was 0.016; no homozygous mutant patients were found. This is the first analysis of the S65C mutation in individuals suspected of having hereditary hemochromatosis in Brazil.

  3. Aromatase Deficiency due to a Homozygous CYP19A1 Mutation in a 46,XX Egyptian Patient with Ambiguous Genitalia.

    PubMed

    Mazen, Inas; McElreavey, Ken; Elaidy, Aya; Kamel, Alaa K; Abdel-Hamid, Mohamed S

    2017-01-01

    Aromatase deficiency (AD) is a very rare disorder resulting from mutations in the CYP19A1 gene encoding aromatase, a cytochrome P450 enzyme that plays a pivotal role in androgen conversion to estrogens. AD is inherited in an autosomal recessive trait, and to date only 35 cases have been described in the literature. Herein, we depict a new patient reared as a male, who presented at the age of 21 years with no palpable testis, hypoplastic scrotum, penis-like phallus (3 cm), and penoscrotal hypospadias. The patient was born to consanguineous parents, his karyotype was 46,XX, and SRY was negative. Pelvic sonar showed a small hypoplastic uterus, and no testis could be identified. Serum testosterone was within the reference range of females along with high gonadotropins. Pathology of gonadal biopsy showed ovarian stroma negative for oocytic follicle consistent with streak gonads. All these data were suggestive of AD, which was subsequently confirmed by molecular investigation of the CYP19A1 gene. A homozygous splice site mutation in the donor splice site of exon 9 was identified, c.1263 + 1G>T. This is the first report of such a rare disorder in an Egyptian patient. Our results reinforce the importance of considering AD in patients with 46,XX disorders of sex development after ruling out congenital adrenal hyperplasia. © 2018 S. Karger AG, Basel.

  4. Tricho-odonto-onycho-dermal dysplasia and WNT10A mutations.

    PubMed

    Kantaputra, P; Kaewgahya, M; Jotikasthira, D; Kantaputra, W

    2014-04-01

    We report on three novel (IVS2+1G>A splice site, c.1066G>T, and c.1039G>T, and one previously reported (c.637G>A) WNT10A mutations in three patients affected with odonto-onycho-dermal dysplasia (OODD; OMIM 275980). OODD is a rare form of autosomal recessive ectodermal dysplasia involving hair, teeth, nails, and skin, characterized by hypodontia (tooth agenesis), smooth tongue with marked reduction of filiform and fungiform papillae, nail dysplasia, dry skin, palmoplantar keratoderma, and hyperhidrosis of palms and soles. The novel IVS+1G>A splice site mutation is predicted to cause significant protein alteration. The other novel mutations we found including c.1066G>T and c.1039G>T are predicted to cause p.Gly356Cys and p.Glu347X, respectively. Barrel-shaped mandibular incisors and severe hypodontia appear to be associated with homozygous or compound heterozygous mutations of WNT10A. The name "tricho-odonto-onycho-dermal dysplasia" is suggested to replace "odonto-onycho-dermal dysplasia" because hair anomalies including hypotrichosis and slow-growing hair have been reported in numerous reported patients with this syndrome. © 2014 Wiley Periodicals, Inc.

  5. Loss-of-Function Mutations in SERPINB8 Linked to Exfoliative Ichthyosis with Impaired Mechanical Stability of Intercellular Adhesions.

    PubMed

    Pigors, Manuela; Sarig, Ofer; Heinz, Lisa; Plagnol, Vincent; Fischer, Judith; Mohamad, Janan; Malchin, Natalia; Rajpopat, Shefali; Kharfi, Monia; Lestringant, Giles G; Sprecher, Eli; Kelsell, David P; Blaydon, Diana C

    2016-08-04

    SERPINS comprise a large and functionally diverse family of serine protease inhibitors. Here, we report three unrelated families with loss-of-function mutations in SERPINB8 in association with an autosomal-recessive form of exfoliative ichthyosis. Whole-exome sequencing of affected individuals from a consanguineous Tunisian family and a large Israeli family revealed a homozygous frameshift mutation, c.947delA (p.Lys316Serfs(∗)90), and a nonsense mutation, c.850C>T (p.Arg284(∗)), respectively. These two mutations are located in the last exon of SERPINB8 and, hence, would not be expected to lead to nonsense-mediated decay of the mRNA; nonetheless, both mutations are predicted to lead to loss of the reactive site loop of SERPINB8, which is crucial for forming the SERPINB8-protease complex. Using Sanger sequencing, a homozygous missense mutation, c.2T>C (p.Met1?), predicted to result in an N-terminal truncated protein, was identified in an additional family from UAE. Histological analysis of a skin biopsy from an individual homozygous for the variant p.Arg284(∗) showed disadhesion of keratinocytes in the lower epidermal layers plus decreased SERPINB8 levels compared to control. In vitro studies utilizing siRNA-mediated knockdown of SERPINB8 in keratinocytes demonstrated that in the absence of the protein, there is a cell-cell adhesion defect, particularly when cells are subjected to mechanical stress. In addition, immunoblotting and immunostaining revealed an upregulation of desmosomal proteins. In conclusion, we report mutations in SERPINB8 that are associated with exfoliative ichthyosis and provide evidence that SERPINB8 contributes to the mechanical stability of intercellular adhesions in the epidermis. Copyright © 2016 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  6. Homozygous/Compound Heterozygous Triadin Mutations Associated With Autosomal-Recessive Long-QT Syndrome and Pediatric Sudden Cardiac Arrest: Elucidation of the Triadin Knockout Syndrome.

    PubMed

    Altmann, Helene M; Tester, David J; Will, Melissa L; Middha, Sumit; Evans, Jared M; Eckloff, Bruce W; Ackerman, Michael J

    2015-06-09

    Long-QT syndrome (LQTS) may result in syncope, seizures, or sudden cardiac arrest. Although 16 LQTS-susceptibility genes have been discovered, 20% to 25% of LQTS remains genetically elusive. We performed whole-exome sequencing child-parent trio analysis followed by recessive and sporadic inheritance modeling and disease-network candidate analysis gene ranking to identify a novel underlying genetic mechanism for LQTS. Subsequent mutational analysis of the candidate gene was performed with polymerase chain reaction, denaturing high-performance liquid chromatography, and DNA sequencing on a cohort of 33 additional unrelated patients with genetically elusive LQTS. After whole-exome sequencing and variant filtration, a homozygous p.D18fs*13 TRDN-encoded triadin frameshift mutation was discovered in a 10-year-old female patient with LQTS with a QTc of 500 milliseconds who experienced recurrent exertion-induced syncope/cardiac arrest beginning at 1 year of age. Subsequent mutational analysis of TRDN revealed either homozygous or compound heterozygous frameshift mutations in 4 of 33 unrelated cases of LQTS (12%). All 5 TRDN-null patients displayed extensive T-wave inversions in precordial leads V1 through V4, with either persistent or transient QT prolongation and severe disease expression of exercise-induced cardiac arrest in early childhood (≤3 years of age) and required aggressive therapy. The overall yield of TRDN mutations was significantly greater in patients ≤10 years of age (5 of 10, 50%) compared with older patients (0 of 24, 0%; P=0.0009). We identified TRDN as a novel underlying genetic basis for recessively inherited LQTS. All TRDN-null patients had strikingly similar phenotypes. Given the recurrent nature of potential lethal arrhythmias, patients fitting this phenotypic profile should undergo cardiac TRDN genetic testing. © 2015 American Heart Association, Inc.

  7. Mutations in STT3A and STT3B cause two congenital disorders of glycosylation

    PubMed Central

    Shrimal, Shiteshu; Ng, Bobby G.; Losfeld, Marie-Estelle; Gilmore, Reid; Freeze, Hudson H.

    2013-01-01

    We describe two unreported types of congenital disorders of glycosylation (CDG) which are caused by mutations in different isoforms of the catalytic subunit of the oligosaccharyltransferase (OST). Each isoform is encoded by a different gene (STT3A or STT3B), resides in a different OST complex and has distinct donor and acceptor substrate specificities with partially overlapping functions in N-glycosylation. The two cases from unrelated consanguineous families both show neurologic abnormalities, hypotonia, intellectual disability, failure to thrive and feeding problems. A homozygous mutation (c.1877T > C) in STT3A causes a p.Val626Ala change and a homozygous intronic mutation (c.1539 + 20G > T) in STT3B causes the other disorder. Both mutations impair glycosylation of a GFP biomarker and are rescued with the corresponding cDNA. Glycosylation of STT3A- and STT3B-specific acceptors is decreased in fibroblasts carrying the corresponding mutated gene and expression of the STT3A (p.Val626Ala) allele in STT3A-deficient HeLa cells does not rescue glycosylation. No additional cases were found in our collection or in reviewing various databases. The STT3A mutation significantly impairs glycosylation of the biomarker transferrin, but the STT3B mutation only slightly affects its glycosylation. Additional cases of STT3B-CDG may be missed by transferrin analysis and will require exome or genome sequencing. PMID:23842455

  8. Defective complex I assembly due to C20orf7 mutations as a new cause of Leigh syndrome

    PubMed Central

    Gerards, M; Sluiter, W; van den Bosch, B J C; de Wit, L E A; Calis, C M H; Frentzen, M; Akbari, H; Schoonderwoerd, K; Scholte, H R; Jongbloed, R J; Hendrickx, A T M; de Coo, I F M

    2009-01-01

    Background Leigh syndrome is an early onset, progressive, neurodegenerative disorder with developmental and motor skills regression. Characteristic magnetic resonance imaging abnormalities consist of focal bilateral lesions in the basal ganglia and/or the brainstem. The main cause is a deficiency in oxidative phosphorylation due to mutations in an mtDNA or nuclear oxidative phosphorylation gene. Methods and results A consanguineous Moroccan family with Leigh syndrome comprise 11 children, three of which are affected. Marker analysis revealed a homozygous region of 11.5 Mb on chromosome 20, containing 111 genes. Eight possible mitochondrial candidate genes were sequenced. Patients were homozygous for an unclassified variant (p.P193L) in the cardiolipin synthase gene (CRLS1). As this variant was present in 20% of a Moroccan control population and enzyme activity was only reduced to 50%, this could not explain the rare clinical phenotype in our family. Patients were also homozygous for an amino acid substitution (p.L159F) in C20orf7, a new complex I assembly factor. Parents were heterozygous and unaffected sibs heterozygous or homozygous wild type. The mutation affects the predicted S-adenosylmethionine (SAM) dependent methyltransferase domain of C20orf7, possibly involved in methylation of NDUFB3 during the assembly process. Blue native gel electrophoresis showed an altered complex I assembly with only 30–40% of mature complex I present in patients and 70–90% in carriers. Conclusions A new cause of Leigh syndrome can be a defect in early complex I assembly due to C20orf7 mutations. PMID:19542079

  9. In vivo levels of S-adenosylmethionine modulate C:G to T:A mutations associated with repeat-induced point mutation in Neurospora crassa.

    PubMed

    Rosa, Alberto Luis; Folco, Hernán Diego; Mautino, Mario Ricardo

    2004-04-14

    In Neurospora crassa, the mutagenic process termed repeat-induced point mutation (RIP) inactivates duplicated DNA sequences during the sexual cycle by the introduction of C:G to T:A transition mutations. In this work, we have used a collection of N. crassa strains exhibiting a wide range of cellular levels of S-adenosylmethionine (AdoMet), the universal donor of methyl groups, to explore whether frequencies of RIP are dependent on the cellular levels of this metabolite. Mutant strains met-7 and eth-1 carry mutations in genes of the AdoMet pathway and have low levels of AdoMet. Wild type strains with high levels of AdoMet were constructed by introducing a chimeric transgene of the AdoMet synthetase (AdoMet-S) gene fused to the constitutive promoter trpC from Aspergillus nidulans. Crosses of these strains against tester duplications of the pan-2 and am genes showed that frequencies of RIP, as well as the total number of C:G to T:A transition mutations found in randomly selected am(RIP) alleles, are inversely correlated to the cellular level of AdoMet. These results indicate that AdoMet modulates the biochemical pathway leading to RIP.

  10. Homozygous HAX1 mutations in severe congenital neutropenia patients with sporadic disease: a novel mutation in two unrelated British kindreds.

    PubMed

    Smith, Bradley N; Ancliff, Phil J; Pizzey, Arnold; Khwaja, Asim; Linch, David C; Gale, Rosemary E

    2009-03-01

    Patients with autosomal dominant (AD), sporadic and X-linked severe congenital neutropenia (SCN) may have mutations in the elastase 2 (ELA2) or Wiskott-Aldrich syndrome (WAS) genes. Homozygous mutations in the HAX1 gene have recently been reported in autosomal recessive (AR) cases of primarily Middle-Eastern descent and the original Kostmann family. We screened 109 predominantly Caucasian SCN kindreds for mutations in these genes; 33 (30%) had 24 different ELA2 mutations, five of them novel, two kindreds (2%) had WAS mutations and four kindreds (4%) had three different HAX1 mutations, two of them novel. One HAX1 mutation (p.Ser43LeufsX11) was found in an AR Ashkenazi Jewish kindred, the other (p.Glu31LysfsX54) in two unrelated British patients with sporadic disease. Microsatellite analysis of the HAX1 locus revealed a common haplotype (maximum distance 4.1 Megabases) for the p.Glu31LysfsX54 patients, suggesting a possible ancestral founder. In functional assays, the level of spontaneous and staurosporine-induced apoptosis was increased in neutrophils from both p.Ser43LeufsX11 patients but not a p.Glu31LysfsX54 patient, suggesting the possible presence of modifying factors. The low incidence of HAX1 mutations in our study suggests that the frequency may vary between racial groups but suggests that irrespective of inheritance or racial origin, SCN patients should be screened for HAX1 mutations.

  11. Permanent neonatal diabetes caused by a homozygous nonsense mutation in the glucokinase gene.

    PubMed

    Rubio-Cabezas, O; Díaz González, F; Aragonés, A; Argente, J; Campos-Barros, A

    2008-06-01

    Glucokinase deficiency is an unfrequent cause of permanent neonatal diabetes (PND), as only seven patients have been reported, either homozygous for a missense or frameshift mutation or compound heterozygous for both of them. We report here the first known case caused by a homozygous nonsense mutation (Y61X) in the glucokinase gene (GCK) that introduces a premature stop codon, generating a truncated protein that is predicted to be completely inactive as it lacks both the glucose- and the adenosine triphosphate-binding sites. The proband, born to consanguineous parents, was a full-term, intra-uterine growth-retarded male newborn who presented with a glycaemia of 129 mg/dL (7.16 mmol/L) on his second day of life, increasing thereafter up to 288 mg/dL (15.98 mmol/L) and 530 mg/dL (29.41 mmol/L) over the next 24 h, in the face of low serum insulin (<3 muIU/mL; <20.83 pmol/L). He was put on insulin on the third day of life. Insulin has never been discontinued since then. The patient was tested negative for anti-insulin and islet cell antibodies at age 5 months. His father had non-progressive, impaired fasting glucose for several years. The mother was found to be mildly hyperglycaemic only when her glucose was checked after the child was diagnosed. In conclusion, biallelic GCK loss should be considered as a potential cause of PND in children born to consanguineous parents, even if they are not known to be diabetic at the time of PND presentation.

  12. Phenotypic diversity in patients with lipodystrophy associated with LMNA mutations.

    PubMed

    Mory, Patricia B; Crispim, Felipe; Freire, Maria Beatriz S; Salles, João Eduardo N; Valério, Cynthia M; Godoy-Matos, Amelio F; Dib, Sérgio A; Moisés, Regina S

    2012-09-01

    Mutations in LMNA have been linked to diverse disorders called laminopathies, which display heterogeneous phenotypes and include diseases affecting muscles, axonal neurons, progeroid syndromes, and lipodystrophies. Among the lipodystrophies, LMNA mutations have been reported most frequently in patients with familial partial lipodystrophy (FPLD) of the Dunnigan variety; however, phenotypic heterogeneity in the pattern of body fat loss has been observed. In this study, we searched for LMNA mutations in patients with various forms of lipodystrophy. We studied 21 unrelated individuals with lipodystrophy. Subjects underwent a complete clinical evaluation and were classified as typical FPLD (n=12), atypical partial lipodystrophy (n=7), or generalized lipodystrophy (n=2). Molecular analysis of LMNA gene, analysis of body fat by dual-energy X-ray absorptiometry, and biochemical measurements were performed. ALL PATIENTS WITH TYPICAL FPLD WERE FOUND TO CARRY LMNA MUTATIONS: seven patients harbored the heterozygous p.R482W (c.1444C>T), two patients harbored the p.R482Q (c.1445G>A), and two individuals harbored the novel heterozygous variant p.N466D (c.1396A>G), all in exon 8. Also, a homozygous p.R584H (c.1751 G>A) mutation in exon 11 was found. Among patients with atypical partial lipodystrophy, two of them were found to have LMNA mutations: a novel heterozygous p.R582C variation (c.1744 C>T) in exon 11 and a heterozygous substitution p.R349W (c.1045C>T) in exon 6. Among patients with generalized lipodystrophy, only one harbored LMNA mutation, a heterozygous p.T10I (c.29C>T) in exon 1. We have identified LMNA mutations in phenotypically diverse lipodystrophies. Also, our study broadens the spectrum of LMNA mutations in lipodystrophy.

  13. Novel mutations of endothelin-B receptor gene in Pakistani patients with Waardenburg syndrome.

    PubMed

    Jabeen, Raheela; Babar, Masroor Ellahi; Ahmad, Jamil; Awan, Ali Raza

    2012-01-01

    Mutations in EDNRB gene have been reported to cause Waardenburg-Shah syndrome (WS4) in humans. We investigated 17 patients with WS4 for identification of mutations in EDNRB gene using PCR and direct sequencing technique. Four genomic mutations were detected in four patients; a G to C transversion in codon 335 (S335C) in exon 5 and a transition of T to C in codon (S361L) in exon 5, a transition of A to G in codon 277 (L277L) in exon 4, a non coding transversion of T to A at -30 nucleotide position of exon 5. None of these mutations were found in controls. One of the patients harbored two novel mutations (S335C, S361L) in exon 5 and one in Intronic region (-30exon5 A>G). All of the mutations were homozygous and novel except the mutation observed in exon 4. In this study, we have identified 3 novel mutations in EDNRB gene associated with WS4 in Pakistani patients.

  14. A novel homozygous Arg222Trp missense mutation in WNT7A in two sisters with severe Al-Awadi/Raas-Rothschild/Schinzel phocomelia syndrome.

    PubMed

    Kantaputra, Piranit N; Mundlos, Stefan; Sripathomsawat, Warissara

    2010-11-01

    Al-Awadi/Raas-Rothschild/Schinzel phocomelia (AARRS) syndrome, a rare autosomal recessive disorder, comprises malformations of upper and lower limbs with severely hypoplastic pelvis and abnormal genitalia. Mutations in WNT7A have been reported as cause of the syndrome. We report on two sisters in a Thai family with short and malformed long bones, absent fibulae, flexion contracture of digits, and a/hypoplastic nails. Fusion between severely malformed femora and slender tibiae has never been reported in patients with WNT7A mutations. Lower limbs were more severely malformed than the upper ones and the pelvis was also severely affected. Multiple fusions of long bones and of the femoral heads to the acetabula were evident. A novel homozygous missense mutation in coding exon 4 of the WNT7A was detected in both affected daughters (c.664C > T) leading to an amino acid exchange from arginine to tryptophan (p.Arg222Trp; R222W). The phenotype is likely to result from an abnormality of all three signaling centers in the developing limb resulting in ventralization with a loss of dorsal structures (aplasia/hypoplasia of nails) a loss of anterior-posterior identity (single distal bones in lower limb without polarity) and an outgrowth defect resulting in distal truncations. © 2010 Wiley-Liss, Inc.

  15. Homozygous NOTCH3 null mutation and impaired NOTCH3 signaling in recessive early-onset arteriopathy and cavitating leukoencephalopathy.

    PubMed

    Pippucci, Tommaso; Maresca, Alessandra; Magini, Pamela; Cenacchi, Giovanna; Donadio, Vincenzo; Palombo, Flavia; Papa, Valentina; Incensi, Alex; Gasparre, Giuseppe; Valentino, Maria Lucia; Preziuso, Carmela; Pisano, Annalinda; Ragno, Michele; Liguori, Rocco; Giordano, Carla; Tonon, Caterina; Lodi, Raffaele; Parmeggiani, Antonia; Carelli, Valerio; Seri, Marco

    2015-06-01

    Notch signaling is essential for vascular physiology. Neomorphic heterozygous mutations in NOTCH3, one of the four human NOTCH receptors, cause cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL). Hypomorphic heterozygous alleles have been occasionally described in association with a spectrum of cerebrovascular phenotypes overlapping CADASIL, but their pathogenic potential is unclear. We describe a patient with childhood-onset arteriopathy, cavitating leukoencephalopathy with cerebral white matter abnormalities presented as diffuse cavitations, multiple lacunar infarctions and disseminated microbleeds. We identified a novel homozygous c.C2898A (p.C966*) null mutation in NOTCH3 abolishing NOTCH3 expression and causing NOTCH3 signaling impairment. NOTCH3 targets acting in the regulation of arterial tone (KCNA5) or expressed in the vasculature (CDH6) were downregulated. Patient's vessels were characterized by smooth muscle degeneration as in CADASIL, but without deposition of granular osmiophilic material (GOM), the CADASIL hallmark. The heterozygous parents displayed similar but less dramatic trends in decrease in the expression of NOTCH3 and its targets, as well as in vessel degeneration. This study suggests a functional link between NOTCH3 deficiency and pathogenesis of vascular leukoencephalopathies. © 2015 The Authors. Published under the terms of the CC BY 4.0 license.

  16. [C677T-SNP of methylenetetrahydrofolate reductase gene and breast cancer in Mexican women].

    PubMed

    Calderón-Garcidueñas, Ana Laura; Cerda-Flores, Ricardo Martín; Castruita-Ávila, Ana Lilia; González-Guerrero, Juan Francisco; Barrera-Saldaña, Hugo Alberto

    2017-01-01

    Low-penetrance susceptibility genes such as 5,10-methylenetetrahydrofolate reductase gene (MTHFR) have been considered in the progression of breast cancer (BC). Cancer is a result of genetic, environmental and epigenetic interactions; therefore, these genes should be studied in environmental context, because the results can vary between populations and even within the same country. The objective was to analyze the allelic and genotypic frequencies of the MTHFR C667T SNP in Mexican Mestizo patients with BC and controls from Northeastern Mexico. 243 patients and 118 healthy women were studied. The analysis of the polymorphism was performed with a DNA microarray. Once the frequency of the polymorphism was obtained, Hardy-Weinberg equilibrium test was carried out for the genotypes. Chi square test was used to compare the distribution of frequencies. The allele frequency in patients was: C = 0.5406; T = 0.4594 and in controls C = 0.5678, T = 0.4322. Genotype in BC patients was: C / C = 29.9%, C / T = 48.3% and T / T = 21.8. The distribution in controls was: C / C = 31.4%, C / T = 50.8%, T / T = 17.8% (chi squared 0.77, p = 0.6801). Northeastern Mexican women in this study showed no association between MTFHR C667T SNP and the risk of BC. It seems that the contribution of this polymorphism to BC in Mexico varies depending on various factors, both genetic and environmental.

  17. A homozygous mutation in the stem II domain of RNU4ATAC causes typical Roifman syndrome.

    PubMed

    Dinur Schejter, Yael; Ovadia, Adi; Alexandrova, Roumiana; Thiruvahindrapuram, Bhooma; Pereira, Sergio L; Manson, David E; Vincent, Ajoy; Merico, Daniele; Roifman, Chaim M

    2017-01-01

    Roifman syndrome (OMIM# 616651) is a complex syndrome encompassing skeletal dysplasia, immunodeficiency, retinal dystrophy and developmental delay, and is caused by compound heterozygous mutations involving the Stem II region and one of the other domains of the RNU4ATAC gene. This small nuclear RNA gene is essential for minor intron splicing. The Canadian Centre for Primary Immunodeficiency Registry and Repository were used to derive patient information as well as tissues. Utilising RNA sequencing methodologies, we analysed samples from patients with Roifman syndrome and assessed intron retention. We demonstrate that a homozygous mutation in Stem II is sufficient to cause the full spectrum of features associated with typical Roifman syndrome. Further, we demonstrate the same pattern of aberration in minor intron retention as found in cases with compound heterozygous mutations.

  18. CRISPR Correction of a Homozygous Low-Density Lipoprotein Receptor Mutation in Familial Hypercholesterolemia Induced Pluripotent Stem Cells.

    PubMed

    Omer, Linda; Hudson, Elizabeth A; Zheng, Shirong; Hoying, James B; Shan, Yuan; Boyd, Nolan L

    2017-11-01

    Familial hypercholesterolemia (FH) is a hereditary disease primarily due to mutations in the low-density lipoprotein receptor (LDLR) that lead to elevated cholesterol and premature development of cardiovascular disease. Homozygous FH patients (HoFH) with two dysfunctional LDLR alleles are not as successfully treated with standard hypercholesterol therapies, and more aggressive therapeutic approaches to control cholesterol levels must be considered. Liver transplant can resolve HoFH, and hepatocyte transplantation has shown promising results in animals and humans. However, demand for donated livers and high-quality hepatocytes overwhelm the supply. Human pluripotent stem cells can differentiate to hepatocyte-like cells (HLCs) with the potential for experimental and clinical use. To be of future clinical use as autologous cells, LDLR genetic mutations in derived FH-HLCs need to be corrected. Genome editing technology clustered-regularly-interspaced-short-palindromic-repeats/CRISPR-associated 9 (CRISPR/Cas9) can repair pathologic genetic mutations in human induced pluripotent stem cells. We used CRISPR/Cas9 genome editing to permanently correct a 3-base pair homozygous deletion in LDLR exon 4 of patient-derived HoFH induced pluripotent stem cells. The genetic correction restored LDLR-mediated endocytosis in FH-HLCs and demonstrates the proof-of-principle that CRISPR-mediated genetic modification can be successfully used to normalize HoFH cholesterol metabolism deficiency at the cellular level.

  19. Growth hormone receptor gene mutations in two Italian patients with Laron Syndrome.

    PubMed

    Fassone, L; Corneli, G; Bellone, S; Camacho-Hübner, C; Aimaretti, G; Cappa, M; Ubertini, G; Bona, G

    2007-05-01

    Laron Syndrome (LS) represents a condition characterized by GH insensitivity caused by molecular defects in the GH receptor (GHR) gene or in the post-receptor signalling pathway. We report the molecular characterization of two unrelated Italian girls from Sicily diagnosed with LS. The DNA sequencing of the GHR gene revealed the presence of different nonsense mutations, occurring in the same background haplotype. The molecular defects occurred in the extracellular domain of the GHR leading to a premature termination signal and to a truncated non-functional receptor. In one patient, a homozygous G to T transversion, in exon 6, led to the mutation GAA to TAA at codon 180 (E180X), while in the second patient a homozygous C to T transition in exon 7 was detected, causing the CGA to TAA substitution at codon 217 (R217X). Both probands presented the polymorphisms Gly168Gly and Ile544Leu in a homozygous state in exons 6 and 10, respectively. The E180X represents a novel defect of the GHR gene, while the R217X mutation has been previously reported in several patients from different ethnic backgrounds but all from countries located in the Mediterranean and Middle Eastern region.

  20. Association of neural tube defects in children of mothers with MTHFR 677TT genotype and abnormal carbohydrate metabolism risk: a case-control study.

    PubMed

    Cadenas-Benitez, N M; Yanes-Sosa, F; Gonzalez-Meneses, A; Cerrillos, L; Acosta, D; Praena-Fernandez, J M; Neth, O; Gomez de Terreros, I; Ybot-González, P

    2014-03-26

    Abnormalities in maternal folate and carbohydrate metabolism have both been shown to induce neural tube defects (NTD) in humans and animal models. However, the relationship between these two factors in the development of NTDs remains unclear. Data from mothers of children with spina bifida seen at the Unidad de Espina Bífida del Hospital Infantil Virgen del Rocío (case group) were compared to mothers of healthy children with no NTD (control group) who were randomly selected from patients seen at the outpatient ward in the same hospital. There were 25 individuals in the case group and 41 in the control group. Analysis of genotypes for the methylenetetrahydrofolate reductase (MTHFR) 677CT polymorphism in women with or without risk factors for abnormal carbohydrate metabolism revealed that mothers who were homozygous for the MTHFR 677TT polymorphism and at risk of abnormal carbohydrate metabolism were more likely to have offspring with spina bifida and high levels of homocysteine, compared to the control group. The increased incidence of NTDs in mothers homozygous for the MTHFR 677TT polymorphism and at risk of abnormal carbohydrate metabolism stresses the need for careful metabolic screening in pregnant women, and, if necessary, determination of the MTHFR 677CT genotype in those mothers at risk of developing abnormal carbohydrate metabolism.

  1. Choline Intake, Plasma Riboflavin, and the Phosphatidylethanolamine N-Methyltransferase G5465A Genotype Predict Plasma Homocysteine in Folate-Deplete Mexican-American Men with the Methylenetetrahydrofolate Reductase 677TT Genotype12

    PubMed Central

    Caudill, Marie A.; Dellschaft, Neele; Solis, Claudia; Hinkis, Sabrina; Ivanov, Alexandre A.; Nash-Barboza, Susan; Randall, Katharine E.; Jackson, Brandi; Solomita, Gina N.; Vermeylen, Francoise

    2009-01-01

    We previously showed that provision of the folate recommended dietary allowance and either 300, 550, 1100, or 2200 mg/d choline for 12 wk resulted in diminished folate status and a tripling of plasma total homocysteine (tHcy) in men with the methylenetetrahydrofolate reductase (MTHFR) 677TT genotype. However, the substantial variation in tHcy within the 677TT genotype at wk 12 implied that several factors were interacting with this genotype to affect homocysteine. As an extension of this work, the present study sought to identify the main predictors of wk-12 plasma tHcy, alone and together with the MTHFR C677T genotype (29 TT, 31 CC), using linear regression analysis. A basic model explaining 82.5% of the variation (i.e. adjusted R2 = 0.825) was constructed. However, the effects of the variables within this model were dependent upon the MTHFR C677T genotype (P for interaction ≤ 0.021). Within the 677TT genotype, serum folate (P = 0.005) and plasma riboflavin (P = 0.002) were strong negative predictors (inversely related) explaining 12 and 15%, respectively, of the variation in tHcy, whereas choline intake (P = 0.003) and serum creatinine (P < 0.001) were strong positive predictors, explaining 19 and 25% of the variation. None of these variables, except creatinine (P = 0.021), correlated with tHcy within the 677CC genotype. Of the 8 additional polymorphisms tested, none appeared to influence tHcy. However, when creatinine was not in the model, the phosphatidylethanolamine N-methyltransferase 5465G→A variant predicted lower tHcy (P < 0.001); an effect confined to the MTHFR 677TT genotype. Thus, in folate-deplete men, several factors with roles in 1-carbon metabolism interact with the MTHFR C677T genotype to affect plasma tHcy. PMID:19211833

  2. The role of the methylenetetrahydrofolate reductase 677 and 1298 polymorphisms in Cretan children with acute lymphoblastic leukemia.

    PubMed

    Karathanasis, Nikolaos V; Stiakaki, Eftichia; Goulielmos, George N; Kalmanti, Maria

    2011-01-01

    Acute lymphoblastic leukemia (ALL) is the most common form of malignancy in children. Recently, many studies have examined factors influencing both the susceptibility to ALL and the metabolism of widely used chemotherapeutic agents. These factors include, among others, single-nucleotide polymorphisms in various genes, such as the gene encoding for methylenetetrahydrofolate reductase (MTHFR), which has been proven polymorphic at the nucleotide positions 677 and 1298. Thirty-five children with ALL and 48 healthy adults of Cretan origin were genotyped for the presence of the MTHFR 677 and 1298 single-nucleotide polymorphisms. The possible correlation of the polymorphisms with the risk for ALL and the presence of methotrexate-induced toxicities were examined. No significant association between the MTHFR genotypes and the susceptibility to ALL was observed. A borderline statistically significant relationship was detected after methotrexate administration, between the C677T genotype (polymorphisms) and leukopenia (p = 0.050) and between the A1298C polymorphism and normal aspartate transaminase and alanine transaminase values (p = 0.065 and p = 0.053, respectively), which was strengthened for aspartate transaminase, after grouping the A1298A and A1298C genotypes together (p = 0.039). In our population the MTHFR C677T and A1298C polymorphisms are related with hematologic toxicity and hepatotoxicity, respectively, and could be suggested as prognostic factors for these adverse events.

  3. Exome Sequencing Identified a Recessive RDH12 Mutation in a Family with Severe Early-Onset Retinitis Pigmentosa

    PubMed Central

    Gong, Bo; Wei, Bo; Huang, Lulin; Hao, Jilong; Li, Xiulan; Yang, Yin; Zhou, Yu; Hao, Fang; Cui, Zhihua; Zhang, Dingding; Wang, Le

    2015-01-01

    Retinitis pigmentosa (RP) is the most important hereditary retinal disease caused by progressive degeneration of the photoreceptor cells. This study is to identify gene mutations responsible for autosomal recessive retinitis pigmentosa (arRP) in a Chinese family using next-generation sequencing technology. A Chinese family with 7 members including two individuals affected with severe early-onset RP was studied. All patients underwent a complete ophthalmic examination. Exome sequencing was performed on a single RP patient (the proband of this family) and direct Sanger sequencing on other family members and normal controls was followed to confirm the causal mutations. A homozygous mutation c.437Thomozygous mutation was detected in the two affected patients, but not present in other family members and 600 normal controls. Another three normal members in the family were found to carry this heterozygous missense mutation. Our results emphasize the importance of c.437Tmutation in the pathogenesis and clinical diagnosis of RP. PMID:26124963

  4. Exome Sequencing Identifies Mitochondrial Alanyl-tRNA Synthetase Mutations in Infantile Mitochondrial Cardiomyopathy

    PubMed Central

    Götz, Alexandra; Tyynismaa, Henna; Euro, Liliya; Ellonen, Pekka; Hyötyläinen, Tuulia; Ojala, Tiina; Hämäläinen, Riikka H.; Tommiska, Johanna; Raivio, Taneli; Oresic, Matej; Karikoski, Riitta; Tammela, Outi; Simola, Kalle O.J.; Paetau, Anders; Tyni, Tiina; Suomalainen, Anu

    2011-01-01

    Infantile cardiomyopathies are devastating fatal disorders of the neonatal period or the first year of life. Mitochondrial dysfunction is a common cause of this group of diseases, but the underlying gene defects have been characterized in only a minority of cases, because tissue specificity of the manifestation hampers functional cloning and the heterogeneity of causative factors hinders collection of informative family materials. We sequenced the exome of a patient who died at the age of 10 months of hypertrophic mitochondrial cardiomyopathy with combined cardiac respiratory chain complex I and IV deficiency. Rigorous data analysis allowed us to identify a homozygous missense mutation in AARS2, which we showed to encode the mitochondrial alanyl-tRNA synthetase (mtAlaRS). Two siblings from another family, both of whom died perinatally of hypertrophic cardiomyopathy, had the same mutation, compound heterozygous with another missense mutation. Protein structure modeling of mtAlaRS suggested that one of the mutations affected a unique tRNA recognition site in the editing domain, leading to incorrect tRNA aminoacylation, whereas the second mutation severely disturbed the catalytic function, preventing tRNA aminoacylation. We show here that mutations in AARS2 cause perinatal or infantile cardiomyopathy with near-total combined mitochondrial respiratory chain deficiency in the heart. Our results indicate that exome sequencing is a powerful tool for identifying mutations in single patients and allows recognition of the genetic background in single-gene disorders of variable clinical manifestation and tissue-specific disease. Furthermore, we show that mitochondrial disorders extend to prenatal life and are an important cause of early infantile cardiac failure. PMID:21549344

  5. Compound Heterozygosity for Hb Alperton (HBB: c.407C>T) and IVS-I-5 (G>C) (HBB: c.92+5G>C) Mutations Presenting as a Moderate Anemia in an Indian Family.

    PubMed

    Godbole, Koumudi G; Ramachandran, Angelina; Karkamkar, Ashwini S; Dalal, Ashwin B

    2018-04-13

    While knowledge of HBB gene mutations is necessary for offering prenatal diagnosis (PND) of β-thalassemia (β-thal), a genotype-phenotype correlation may not always be available for rare variants. We present for the first time, genotype-phenotype correlation for a compound heterozygous status with IVS-I-5 (G>C) (HBB: c.92+5G>C) and HBB: c.407C>T (Hb Alperton) mutations on the HBB gene in an Indian family. Hb Alperton is a very rare hemoglobin (Hb) variant with scant published information about its clinical presentation, especially when accompanied with another HBB gene mutation. Here we provide biochemical as well as clinical details of this variant.

  6. Homozygosity for a novel missense mutation in the leptin receptor gene (P316T) in two Egyptian cousins with severe early onset obesity.

    PubMed

    Mazen, I; El-Gammal, M; Abdel-Hamid, M; Farooqi, I S; Amr, K

    2011-04-01

    Congenital deficiency of the leptin receptor is a very rare cause of severe early-onset obesity. To date, only 9 families have been reported in the literature to have mutations in the leptin receptor gene. The clinical features include severe early onset obesity, severe hyperphagia, hypogonadotropic hypogonadism, and T cell and neuroendocrine/metabolic dysfunction. Here we report two cousins with severe early onset obesity and recurrent respiratory tract infections. Their serum leptin levels were elevated but they were within the range predicted by the elevated fat mass in both cousins. Direct sequencing of the entire coding sequence of the leptin receptor gene revealed a novel homozygous missense mutation in exon 6, P316T. The mutation was found in the homozygous form in both cousins and in the heterozygote state in their parents. This mutation was not found in 200 chromosomes from 100 unrelated normal weight control subjects of Egyptian origin using PCR-RFLP analysis. In conclusion, finding this new mutation in the LEPR beside our previous mutation in the LEP gene implies that monogenic obesity syndromes may be common in the Egyptian population owing to the high rates of consanguineous marriages. Further screening of more families for mutations in LEP, LEPR, and MC4 might confirm this assumption. Copyright © 2010 Elsevier Inc. All rights reserved.

  7. ACE I/D and MTHFR C677T polymorphisms are significantly associated with type 2 diabetes in Arab ethnicity: a meta-analysis.

    PubMed

    Al-Rubeaan, Khalid; Siddiqui, Khalid; Saeb, Amr T M; Nazir, Nyla; Al-Naqeb, Dhekra; Al-Qasim, Sara

    2013-05-15

    In this meta-analysis study, SNPs were investigated for their association with type 2 diabetes (T2D) in both Arab and Caucasian ethnicities. A total of 55 SNPs were analyzed, of which 11 fulfilled the selection criteria, and were used for analysis. It was found that TCF7L2 rs7903146 was significantly associated with a pooled OR of 1.155 (95%C.I.=1.059-1.259), p<0.0001 and I(2)=78.30% among the Arab population, whereas among Caucasians, the pooled OR was 1.45 (95%C.I.=1.386-1.516), p<0.0001 and I(2)=77.20%. KCNJ11 rs5219 was significantly associated in both the populations with a pooled OR of 1.176(1.092-1.268), p<0.0001 and I(2)=32.40% in Caucasians and a pooled OR of 1.28(1.111-1.475), p=0.001 among Arabs. The ACE I/D polymorphism was found to be significantly associated with a pooled OR of 1.992 (95%C.I.=1.774-2.236), p<0.0001 and I(2)=83.20% among the Arab population, whereas among Caucasians, the pooled OR was 1.078 (95%C.I.=0.993-1.17), p=0.073 and I(2)=0%. Similarly, MTHFR C677T polymorphism was also found to be significantly associated among Arabs with a pooled OR of 1.924 (95%C.I.=1.606-2.304), p<0.0001 and I(2)=27.20%, whereas among Caucasians, the pooled OR was 0.986 (95%C.I.=0.868-1.122), p=0.835 and I(2)=0%. Meanwhile PPARG-2 Pro12Ala, CDKN2A/2B rs10811661, IGF2BP2 rs4402960, HHEX rs7923837, CDKAL1 rs7754840, EXT2 rs1113132 and SLC30A8 rs13266634 were found to have no significant association with T2D among Arabs. In conclusion, it seems from this study that both Arabs and Caucasians have different SNPs associated with T2D. Moreover, this study sheds light on the profound necessity for further investigations addressing the question of the genetic components of T2D in Arabs. Copyright © 2013 Elsevier B.V. All rights reserved.

  8. Complex I deficiency related to T10158C mutation ND3 gene: A further definition of the clinical spectrum.

    PubMed

    Grosso, Salvatore; Carluccio, Maria Alessandra; Cardaioli, Elena; Cerase, Alfonso; Malandrini, Alessandro; Romano, Chiara; Federico, Antonio; Dotti, Maria Teresa

    2017-03-01

    Complex I deficiency is the most common energy generation disorder which may clinically present at any age with a wide spectrum of symptoms and signs. The T10158C mutation ND3 gene is rare and occurs in patients showing an early rapid neurological deterioration invariably leading to death after a few months. We report a 9year-old boy with a mtDNA T10158C mutation showing a mild MELAS-like phenotype and brain MRI features congruent with both MELAS and Leigh syndrome. Epilepsia partialis continua also occurred in the clinical course and related to a mild cortical atrophy of the left perisylvian area. The present case confirms that the clinical spectrum of Complex I deficiency related to T10158C mutation ND3 gene is wider than previously described. Our observation further suggests that testing mutation in the MT-ND3 gene should be included in the diagnostic work-up of patients presenting with epilepsia partialis continua accompanied by suspicion of mitochondrial disorder. Copyright © 2016 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

  9. ITGB6 loss-of-function mutations cause autosomal recessive amelogenesis imperfecta.

    PubMed

    Wang, Shih-Kai; Choi, Murim; Richardson, Amelia S; Reid, Bryan M; Lin, Brent P; Wang, Susan J; Kim, Jung-Wook; Simmer, James P; Hu, Jan C-C

    2014-04-15

    Integrins are cell-surface adhesion receptors that bind to extracellular matrices (ECM) and mediate cell-ECM interactions. Some integrins are known to play critical roles in dental enamel formation. We recruited two Hispanic families with generalized hypoplastic amelogenesis imperfecta (AI). Analysis of whole-exome sequences identified three integrin beta 6 (ITGB6) mutations responsible for their enamel malformations. The female proband of Family 1 was a compound heterozygote with an ITGB6 transition mutation in Exon 4 (g.4545G > A c.427G > A p.Ala143Thr) and an ITGB6 transversion mutation in Exon 6 (g.27415T > A c.825T > A p.His275Gln). The male proband of Family 2 was homozygous for an ITGB6 transition mutation in Exon 11 (g.73664C > T c.1846C > T p.Arg616*) and hemizygous for a transition mutation in Exon 6 of Nance-Horan Syndrome (NHS Xp22.13; g.355444T > C c.1697T > C p.Met566Thr). These are the first disease-causing ITGB6 mutations to be reported. Immunohistochemistry of mouse mandibular incisors localized ITGB6 to the distal membrane of differentiating ameloblasts and pre-ameloblasts, and then ITGB6 appeared to be internalized by secretory stage ameloblasts. ITGB6 expression was strongest in the maturation stage and its localization was associated with ameloblast modulation. Our findings demonstrate that early and late amelogenesis depend upon cell-matrix interactions. Our approach (from knockout mouse phenotype to human disease) demonstrates the power of mouse reverse genetics in mutational analysis of human genetic disorders and attests to the need for a careful dental phenotyping in large-scale knockout mouse projects.

  10. Novel mutations in the USH1C gene in Usher syndrome patients.

    PubMed

    Aparisi, María José; García-García, Gema; Jaijo, Teresa; Rodrigo, Regina; Graziano, Claudio; Seri, Marco; Simsek, Tulay; Simsek, Enver; Bernal, Sara; Baiget, Montserrat; Pérez-Garrigues, Herminio; Aller, Elena; Millán, José María

    2010-12-31

    Usher syndrome type I (USH1) is an autosomal recessive disorder characterized by severe-profound sensorineural hearing loss, retinitis pigmentosa, and vestibular areflexia. To date, five USH1 genes have been identified. One of these genes is Usher syndrome 1C (USH1C), which encodes a protein, harmonin, containing PDZ domains. The aim of the present work was the mutation screening of the USH1C gene in a cohort of 33 Usher syndrome patients, to identify the genetic cause of the disease and to determine the relative involvement of this gene in USH1 pathogenesis in the Spanish population. Thirty-three patients were screened for mutations in the USH1C gene by direct sequencing. Some had already been screened for mutations in the other known USH1 genes (myosin VIIA [MYO7A], cadherin-related 23 [CDH23], protocadherin-related 15 [PCDH15], and Usher syndrome 1G [USH1G]), but no mutation was found. Two novel mutations were found in the USH1C gene: a non-sense mutation (p.C224X) and a frame-shift mutation (p.D124TfsX7). These mutations were found in a homozygous state in two unrelated USH1 patients. In the present study, we detected two novel pathogenic mutations in the USH1C gene. Our results suggest that mutations in USH1C are responsible for 1.5% of USH1 disease in patients of Spanish origin (considering the total cohort of 65 Spanish USH1 patients since 2005), indicating that USH1C is a rare form of USH in this population.

  11. Novel mutations in the USH1C gene in Usher syndrome patients

    PubMed Central

    Aparisi, María José; García-García, Gema; Jaijo, Teresa; Rodrigo, Regina; Graziano, Claudio; Seri, Marco; Simsek, Tulay; Simsek, Enver; Bernal, Sara; Baiget, Montserrat; Pérez-Garrigues, Herminio; Millán, José María

    2010-01-01

    Purpose Usher syndrome type I (USH1) is an autosomal recessive disorder characterized by severe-profound sensorineural hearing loss, retinitis pigmentosa, and vestibular areflexia. To date, five USH1 genes have been identified. One of these genes is Usher syndrome 1C (USH1C), which encodes a protein, harmonin, containing PDZ domains. The aim of the present work was the mutation screening of the USH1C gene in a cohort of 33 Usher syndrome patients, to identify the genetic cause of the disease and to determine the relative involvement of this gene in USH1 pathogenesis in the Spanish population. Methods Thirty-three patients were screened for mutations in the USH1C gene by direct sequencing. Some had already been screened for mutations in the other known USH1 genes (myosin VIIA [MYO7A], cadherin-related 23 [CDH23], protocadherin-related 15 [PCDH15], and Usher syndrome 1G [USH1G]), but no mutation was found. Results Two novel mutations were found in the USH1C gene: a non-sense mutation (p.C224X) and a frame-shift mutation (p.D124TfsX7). These mutations were found in a homozygous state in two unrelated USH1 patients. Conclusions In the present study, we detected two novel pathogenic mutations in the USH1C gene. Our results suggest that mutations in USH1C are responsible for 1.5% of USH1 disease in patients of Spanish origin (considering the total cohort of 65 Spanish USH1 patients since 2005), indicating that USH1C is a rare form of USH in this population. PMID:21203349

  12. The c.301_302delAG PROP1 gene mutation in Romanian patients with multiple pituitary hormone deficiency.

    PubMed

    Lazea, Cecilia; Grigorescu-Sido, Paula; Popp, Radu; Legendre, Marie; Amselem, Serge; Al-Khzouz, Camelia; Bucerzan, Simona; Creţ, Victoria; Crişan, Mirela; Brad, Cristian

    2015-09-01

    To establish the frequency of the c.301_302 delAG mutation of the PROP1 gene in Romanian patients with multiple pituitary hormone deficiency (MPHD). Somatic assessment, hormonal test, bone age, magnetic resonance imaging of the pituitary gland, and molecular diagnosis were performed in 26 patients with MPHD (7 patients with familial form of MPHD and 19 patients with sporadic form of MPHD). The c.301_302delAG mutation was detected in the homozygous state in 10 patients belonging to 5 unrelated families (7 patients with familial history of MPHD and 3 patients with sporadic form of MPHD). Those 10 patients presented variable pituitary hormone deficiency and pituitary morphology. The c.301_302delAG homozygous genotype had a high frequency of 38% (10/26), reaching 100% (7/7) in group with familial cases of MPHD and 16% (3/19) in group with sporadic forms of MPHD.

  13. In silico analysis of novel mutations in maple syrup urine disease patients from Iran.

    PubMed

    Abiri, Maryam; Karamzadeh, Razieh; Mojbafan, Marziyeh; Alaei, Mohammad Reza; Jodaki, Atefeh; Safi, Masomeh; Kianfar, Soodeh; Bandehi Sarhaddi, Ameneh; Noori-Daloii, Mohammad Reza; Karimipoor, Morteza; Zeinali, Sirous

    2017-02-01

    Maple Syrup Urine Disease (MSUD) is a rare autosomal recessive disorder of branched-chain amino acid (BCAA) metabolism. The disease is mainly caused by mutations either in the BCKDHA, BCKDHB, DBT or DLD genes encoding components of the E1α, E1β, E2 and E3 subunits of branched-chain α-keto acid dehydrogenase complex (BCKDC), respectively. BCKDC is a mitochondrial enzyme which is responsible for the normal breakdown of BCAA. The rate of consanguineous marriage in Iran is 38.6 %, so the prevalence of autosomal recessive disorders is higher in comparison to other countries. Consanguinity increases the chance of the presence of pathogenic mutations in a homoallelic state. This phenomenon has made homozygosity mapping a powerful tool for finding the probable causative gene in heterogeneous disorders like IEM (Inborn Errors of Metabolism). In this study, two sets of multiplex polymorphic STR (Short Tandem Repeat) markers linked to the above-mentioned genes were selected to identify the probable pathogenic gene in the studied families. The families who showed a homozygous haplotype for the STR markers of the BCKDHB gene were subsequently sequenced. Four novel mutations including c.633 + 1G > A, c.988G > A, c.833_834insCAC, and a homozygous deletion of whole exon 3 c. (274 + 1_275-1) _(343 + 1_344-1), as well as one recently reported (c. 508G > T) mutation have been identified. Interestingly, three families shared a common haplotype structure along with the c. 508G > T mutation. Also, four other families revealed another similar haplotype with c.988G > A mutation. Founder effect can be a suggestive mechanism for the disease. Additionally, structural models of MSUD mutations have been performed to predict the pathogenesis of the newly identified variants.

  14. Leber's Hereditary Optic Neuropathy Is Associated with the T3866C Mutation in Mitochondrial ND1 Gene in Three Han Chinese Families

    PubMed Central

    Zhou, Xiangtian; Qian, Yaping; Zhang, Juanjuan; Tong, Yi; Jiang, Pingping; Liang, Min; Dai, Xianning; Zhou, Huihui; Zhao, Fuxin; Ji, Yanchun; Mo, Jun Qin; Qu, Jia; Guan, Min-Xin

    2012-01-01

    Purpose. To investigate the pathophysiology of Leber's hereditary optic neuropathy (LHON). Methods. Seventy-one subjects from three Chinese families with LHON underwent clinical, genetic, molecular, and biochemical evaluations. Biochemical characterizations included the measurements of the rates of endogenous, substrate-dependent respirations, the adenosine triphosphate (ATP) production and generation of reactive oxygen species using lymphoblastoid cell lines derived from five affected matrilineal relatives of these families and three control subjects. Results. Ten of 41 matrilineal relatives exhibited variable severity and age at onset of optic neuropathy. The average age at onset of optic neuropathy in matrilineal relatives of the three families was 5, 11, and 24 years, respectively. Molecular analysis identified the ND1 T3866C (I187T) mutation and distinct sets of polymorphisms belonging to the Eastern Asian haplogroups D4a, M10a, and R, respectively. The I187T mutation is localized at the highly conserved isoleucine at a transmembrane domain of the ND1 polypeptide. The marked reductions in the rate of endogenous, malate/glutamate-promoted and succinate/glycerol-3-phosphate-promoted respiration were observed in mutant cell lines carrying the T3866C mutation. The deficient respiration is responsible for the reduced ATP synthesis and increased generation of reactive oxygen species. Conclusions. Our data convincingly show that the ND1 T3866C mutation leads to LHON. This mutation may be insufficient to produce a clinical phenotype. Other modifier factors may contribute to the phenotypic manifestation of the T3866C mutation. The T3866C mutation should be added to the list of inherited factors for molecular diagnosis of LHON. Thus, our findings may provide new insights into the understanding of pathophysiology and valuable information on the management of LHON. PMID:22577081

  15. The glucokinase mutation p.T206P is common among MODY patients of Jewish Ashkenazi descent.

    PubMed

    Gozlan, Yael; Tenenbaum, Ariel; Shalitin, Shlomit; Lebenthal, Yael; Oron, Tal; Cohen, Ohad; Phillip, Moshe; Gat-Yablonski, Galia

    2012-09-01

    Maturity-onset diabetes of the young (MODY) is characterized by an autosomal dominant mode of inheritance; a primary defect in insulin secretion with non-ketotic hyperglycemia, age of onset under 25 yr; and lack of autoantibodies. Heterozygous mutations in glucokinase (GCK) are associated with mild fasting hyperglycemia and gestational diabetes mellitus while homozygous or compound heterozygous GCK mutations result in permanent neonatal diabetes mellitus. Given that both the Israeli-Arabic and the various Israeli-Jewish communities tend to maintain ethnic seclusion, we speculated that it would be possible to identify a relatively narrow spectrum of mutations in the Israeli population. To characterize the genetic basis of GCK-MODY in the different ethnic groups of the Israeli population. Patients with clinically identified GCK-MODY and their first degree family members. Molecular analysis of GCK was performed on genomic DNA using polymerase chain reaction, denaturing gradient gel electrophoresis (DGGE), and sequencing. Bioinformatic model was preformed using the NEST program. Mutations in GCK were identified in 25 families and were all family-specific, except c.616A>C. p.T206P. This mutation was identified in six unrelated families, all patients from a Jewish-Ashkenazi descent, thus indicating an ethno-genetic correlation. A simple, fast, and relatively cheap DGGE/restriction-digestion assay was developed. The high incidence of the mutant allele in GCK-MODY patients of Jewish-Ashkenazi descent suggests a founder effect. We propose that clinically identified GCK-MODY patients of Jewish-Ashkenazi origin be first tested for this mutation. © 2011 John Wiley & Sons A/S.

  16. Gene Dose Influences Cellular and Calcium Channel Dysregulation in Heterozygous and Homozygous T4826I-RYR1 Malignant Hyperthermia-susceptible Muscle*

    PubMed Central

    Barrientos, Genaro C.; Feng, Wei; Truong, Kim; Matthaei, Klaus I.; Yang, Tianzhong; Allen, Paul D.; Lopez, José R.; Pessah, Isaac N.

    2012-01-01

    Malignant hyperthermia susceptibility (MHS) is primarily conferred by mutations within ryanodine receptor type 1 (RYR1). Here we address how the MHS mutation T4826I within the S4-S5 linker influences excitation-contraction coupling and resting myoplasmic Ca2+ concentration ([Ca2+]rest) in flexor digitorum brevis (FDB) and vastus lateralis prepared from heterozygous (Het) and homozygous (Hom) T4826I-RYR1 knock-in mice (Yuen, B. T., Boncompagni, S., Feng, W., Yang, T., Lopez, J. R., Matthaei, K. I., Goth, S. R., Protasi, F., Franzini-Armstrong, C., Allen, P. D., and Pessah, I. N. (2011) FASEB J. doi:22131268). FDB responses to electrical stimuli and acute halothane (0.1%, v/v) exposure showed a rank order of Hom ≫ Het ≫ WT. Release of Ca2+ from the sarcoplasmic reticulum and Ca2+ entry contributed to halothane-triggered increases in [Ca2+]rest in Hom FDBs and elicited pronounced Ca2+ oscillations in ∼30% of FDBs tested. Genotype contributed significantly elevated [Ca2+]rest (Hom > Het > WT) measured in vivo using ion-selective microelectrodes. Het and Hom oxygen consumption rates measured in intact myotubes using the Seahorse Bioscience (Billerica, MA) flux analyzer and mitochondrial content measured with MitoTracker were lower than WT, whereas total cellular calpain activity was higher than WT. Muscle membranes did not differ in RYR1 expression nor in Ser2844 phosphorylation among the genotypes. Single channel analysis showed highly divergent gating behavior with Hom and WT favoring open and closed states, respectively, whereas Het exhibited heterogeneous gating behaviors. [3H]Ryanodine binding analysis revealed a gene dose influence on binding density and regulation by Ca2+, Mg2+, and temperature. Pronounced abnormalities inherent in T4826I-RYR1 channels confer MHS and promote basal disturbances of excitation-contraction coupling, [Ca2+]rest, and oxygen consumption rates. Considering that both Het and Hom T4826I-RYR1 mice are viable, the remarkable isolated

  17. Mitochondrial C4375T mutation might be a molecular risk factor in a maternal Chinese hypertensive family under haplotype C.

    PubMed

    Chen, Hong; Sun, Min; Fan, Zhen; Tong, Maoqing; Chen, Guodong; Li, Danhui; Ye, Jihui; Yang, Yumin; Zhu, Yongding; Zhu, Jianhua

    2017-12-04

    Here, we reported a Han Chinese essential hypertensive pedigree based on clinical hereditary and molecular data. To know the molecular basis on this family, mitochondrial genome of one proband from the family was identified through direct sequencing analysis. The age of onset year and affected degree of patients are different in this family. And matrilineal family members carrying C4375T mutation and belong to Eastern Asian halopgroup C. Phylogenetic analysis shows 4375C is highly conservative in 17 species. It is suggested that these mutations might participate in the development of hypertension in this family. And halopgroup C might play a modifying role on the phenotype in this Chinese hypertensive family.

  18. Methylenetetrahydrofolate reductase gene, homocysteine and coronary artery disease: the A1298C polymorphism does matter. Inferences from a case study (Madeira, Portugal).

    PubMed

    Freitas, Ana I; Mendonça, Isabel; Guerra, Graça; Brión, Maria; Reis, Roberto P; Carracedo, Angel; Brehm, António

    2008-01-01

    Elevated levels of plasma homocysteine, an independent risk factor and a strong predictor of mortality in patients with coronary artery disease (CAD), can result from nutritional deficiencies or genetic errors, including methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C polymorphisms. The contribution of these polymorphisms in the development of CAD remains controversial. We analysed the impact of MTHFR C677T and A1298C on fasting homocysteine and CAD in 298 CAD patients proved by angiography and 510 control subjects from the Island of Madeira (Portugal). After adjustment for other risk factors, plasma homocysteine remained independently correlated with CAD. Serum homocysteine was significantly higher in individuals with 677TT and 1298AA genotypes. There was no difference in the distribution of MTHFR677 genotypes between cases and controls but a significant increase in 1298AA prevalence was found in CAD patients. In spite of the clear effect of C677T mutation on elevated homocysteine levels we only found an association between 1298AA genotype and CAD in this population. The simultaneous presence of 677CT and 1298AA genotypes provides a significant risk of developing the disease, while the 1298AC genotype, combined with 677CC, shows a significant trend towards a decrease in CAD occurrence. The data shows an independent association between elevated levels of homocysteine and CAD. Both MTHFR polymorphisms are associated with increased fasting homocysteine (677TT and 1298AA genotypes), but only the 1298AA variant shows an increased prevalence in CAD group. Odds ratio seem to indicate that individuals with the MTHFR 1298AA genotype and the 677CT/1298AA compound genotype had a 1.6-fold increased risk for developing CAD suggesting a possible association of MTHFR polymorphisms with the risk of CAD in Madeira population.

  19. Association of MTHFR C667T polymorphism with bone mineral density and fracture risk: an updated meta-analysis.

    PubMed

    Wang, H; Liu, C

    2012-11-01

    This meta-analysis investigated the association of C677T polymorphism in MTHFR gene with bone mineral density (BMD) and fracture risk. The results suggested that C677T polymorphism was marginally associated with fracture risk. In addition, this polymorphism was modestly associated with BMD of lumbar spine, femoral neck, total hip, and total body, respectively. The methylenetetrahydrofolate reductase (MTHFR) gene has been implicated in the regulation of BMD and, thus, may serve as a potential risk factor for the development of fracture. However, results have been inconsistent. In this study, a meta-analysis was performed to clarify the association of C677T polymorphism in MTHFR gene with BMD and fracture risk. Published literature from PubMed and EMBASE were searched for eligible publications. Pooled odds ratio (OR) or weighted mean difference (WMD) and 95% confidence interval (CI) were calculated using a fixed- or random-effects model. Twenty studies (3,525 cases and 17,909 controls) were included in this meta-analysis. The TT genotype of C677T polymorphism was marginally associated with an increased risk of fracture under recessive model (TT vs. TC + CC: OR = 1.23, 95% CI 1.04-1.47). Using this model, similar results were found among East Asians (OR = 1.40, 95% CI 1.07-1.83), female subpopulation (1.27, 95% CI 1.04-1.55), cohort studies (OR = 1.24, 95% CI 1.08-1.44), and subjects younger than aged 60 years (OR = 1.51, 95% CI 1.10-2.07). In addition, under homogeneous co-dominant model, there was a modest association of C677T polymorphism with BMD of lumbar spine (WMD = -0.017 g/cm(2); 95%CI, -0.030-(-0.005) g/cm(2)), femoral neck (WMD = -0.010 g/cm(2); 95% CI -0.017-(-0.003) g/cm(2)), total hip (WMD = -0.013 g/cm(2), 95% CI -0.022-(-0.004) g/cm(2)), and total body (WMD = -0.020 g/cm(2); 95% CI -0.027-(-0.013) g/cm(2)), respectively. This meta-analysis suggested that C677T polymorphism was marginally associated with fracture risk. In addition, this polymorphism was

  20. Identification of a new mutation in platelet glycoprotein IX (GPIX) in a patient with Bernard-Soulier syndrome.

    PubMed

    Rivera, C E; Villagra, J; Riordan, M; Williams, S; Lindstrom, K J; Rick, M E

    2001-01-01

    We describe a new mutation in glycoprotein IX (GPIX) in a patient with Bernard-Soulier syndrome (BSS). Sequencing of GPIX revealed a homozygous (T-->C) transition at nucleotide 1717 (GenBank/HUMGPIX/M80478), resulting in a Cys(8) (TGT)-->Arg (CGT) replacement in the mature peptide. DNA restriction enzyme analysis using BsaAI revealed that the patient was homozygous and that his parents were heterozygous for the defect. This mutation disrupts a putative disulphide bond between the Cys(8) and Cys(12) that would alter the secondary structure of GPIX and which probably accounts for the absence of the GPIb/IX/V complex from the platelet surface in this patient.

  1. A Homozygous TPO Gene Duplication (c.1184_1187dup4) Causes Congenital Hypothyroidism in Three Siblings Born to a Consanguineous Family

    PubMed Central

    Cangul, Hakan; Aydin, Banu K.; Bas, Firdevs

    2015-01-01

    Congenital hypothyroidism (CH) is the most common neonatal endocrine disease, and germ-line mutations in the TPO gene cause the inherited form of the disease. Our aim in this study was to determine the genetic basis of congenital hypothyroidism in three affected children coming from a consanguineous Turkish family. Because CH is usually inherited in autosomal recessive manner in consanguineous/multicase families, we adopted a two-stage strategy of genetic linkage studies and targeted sequencing of the candidate genes. First, we investigated the potential genetic linkage of the family to any known CH locus, using microsatellite markers, and then screened for mutations in linked-gene by conventional sequencing. The family showed potential linkage to the TPO gene and we detected a homozygous duplication (c.1184_1187dup4) in all cases. The mutation segregated with disease status in the family. This study confirms the pathogenicity of the c.1184_1187dup4 mutation in the TPO gene and helps establish a genotype/phenotype correlation associated with this mutation. It also highlights the importance of molecular genetic studies in the definitive diagnosis and accurate classification of CH. PMID:27617131

  2. Functional examination of MLH1, MSH2, and MSH6 intronic mutations identified in Danish colorectal cancer patients.

    PubMed

    Petersen, Sanne M; Dandanell, Mette; Rasmussen, Lene J; Gerdes, Anne-Marie; Krogh, Lotte N; Bernstein, Inge; Okkels, Henrik; Wikman, Friedrik; Nielsen, Finn C; Hansen, Thomas V O

    2013-10-03

    Germ-line mutations in the DNA mismatch repair genes MLH1, MSH2, and MSH6 predispose to the development of colorectal cancer (Lynch syndrome or hereditary nonpolyposis colorectal cancer). These mutations include disease-causing frame-shift, nonsense, and splicing mutations as well as large genomic rearrangements. However, a large number of mutations, including missense, silent, and intronic variants, are classified as variants of unknown clinical significance. Intronic MLH1, MSH2, or MSH6 variants were investigated using in silico prediction tools and mini-gene assay to asses the effect on splicing. We describe in silico and in vitro characterization of nine intronic MLH1, MSH2, or MSH6 mutations identified in Danish colorectal cancer patients, of which four mutations are novel. The analysis revealed aberrant splicing of five mutations (MLH1 c.588 + 5G > A, MLH1 c.677 + 3A > T, MLH1 c.1732-2A > T, MSH2 c.1276 + 1G > T, and MSH2 c.1662-2A > C), while four mutations had no effect on splicing compared to wild type (MLH1 c.117-34A > T, MLH1 c.1039-8 T > A, MSH2 c.2459-18delT, and MSH6 c.3439-16C > T). In conclusion, we classify five MLH1/MSH2 mutations as pathogenic, whereas four MLH1/MSH2/MSH6 mutations are classified as neutral. This study supports the notion that in silico prediction tools and mini-gene assays are important for the classification of intronic variants, and thereby crucial for the genetic counseling of patients and their family members.

  3. Clinical spectrum in homozygotes and compound heterozygotes inheriting cystic fibrosis mutation 3849+10kbC>T: Significance for geneticists

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gilbert, F.; Li, Zhen; Arzimanoglou, I.

    We describe patients inheriting cystic fibrosis (CF) mutation 3849+10kbC>T as homozygotes or compound heterozygotes. Three unrelated homozygotes for this mutation were all pancreatic-sufficient and sweat test-negative or inconclusive. Among the compound heterozygotes, both pancreatic sufficiency and insufficiency, as well as positive and negative/inconclusive sweat test results are reported, expanding the range of clinical expression associated with inheritance of this mutation. 3849+10kbC>T is one of several CF mutations that can result in atypical or variant forms of CF. For geneticists, the diagnosis of variant CF has implications for recurrence risk and prognosis counseling of the families of affected individuals, and possiblymore » for CF carrier screening in the general population. 19 refs., 1 tab.« less

  4. Acral peeling skin syndrome resulting from a homozygous nonsense mutation in the CSTA gene encoding cystatin A.

    PubMed

    Krunic, Aleksandar L; Stone, Kristina L; Simpson, Michael A; McGrath, John A

    2013-01-01

    Acral peeling skin syndrome (APSS) is a clinically and genetically heterogeneous disorder. We used whole-exome sequencing to identify the molecular basis of APSS in a consanguineous Jordanian-American pedigree. We identified a homozygous nonsense mutation (p.Lys22X) in the CSTA gene, encoding cystatin A, that was confirmed using Sanger sequencing. Cystatin A is a protease inhibitor found in the cornified cell envelope, and loss-of-function mutations have previously been reported in two cases of exfoliative ichthyosis. Our study expands the molecular pathology of APSS and demonstrates the value of next-generation sequencing in the genetic characterization of inherited skin diseases. © 2013 Wiley Periodicals, Inc.

  5. Phenotypes in siblings with homozygous mutations of TRAPPC9 and/or MCPH1 support a bifunctional model of MCPH1.

    PubMed

    Duerinckx, Sarah; Meuwissen, Marije; Perazzolo, Camille; Desmyter, Laurence; Pirson, Isabelle; Abramowicz, Marc

    2018-04-24

    Autosomal recessive intellectual disability (ARID) is vastly heterogeneous. Truncating mutations of TRAPPC9 were reported in 8 ARID families. Autosomal recessive primary microcephaly (MCPH) represents another subgroup of ARID, itself very heterogeneous, where the size of the brain is very small since birth. MCPH1 plays a role at the centrosome via a BRCT1 domain, and in DNA Damage Repair (DDR) via BRCT2 and BRCT3, and it is not clear which of these two mechanisms causes MCPH in man. We studied the phenotype and sequenced the exome in two siblings with MCPH and their unaffected sister. Homozygous mutations of TRAPPC9 (p.Leu178Pro) and of MCPH1 (p.Arg741X) were found in both affected siblings. Brain MRI showed anomalies previously associated with TRAPPC9 defects, supporting the implication of TRAPPC9 in the phenotype. Importantly, the asymptomatic sister with normal head size was homozygous for the MCPH1 truncating mutation and heterozygous for the TRAPPC9 mutation. The affected siblings represent the first ARID cases with a TRAPPC9 missense mutation and with microcephaly of prenatal onset of. Furthermore, their unaffected sister represents strong evidence that the lack of MCPH1 BRCT3 domain does not cause MCPH in man, supporting a bifunctional model of MCPH1 where the centrosomal function is involved in brain volumic development and not the DDR function. © 2018 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.

  6. Exome Sequencing Identifies a Founder Frameshift Mutation in an Alternative Exon of USH1C as the Cause of Autosomal Recessive Retinitis Pigmentosa with Late-Onset Hearing Loss

    PubMed Central

    Khateb, Samer; Zelinger, Lina; Ben-Yosef, Tamar; Crystal-Shalit, Ornit; Gross, Menachem; Banin, Eyal; Sharon, Dror

    2012-01-01

    We used a combined approach of homozygosity mapping and whole exome sequencing (WES) to search for the genetic cause of autosomal recessive retinitis pigmentosa (arRP) in families of Yemenite Jewish origin. Homozygosity mapping of two arRP Yemenite Jewish families revealed a few homozygous regions. A subsequent WES analysis of the two index cases revealed a shared homozygous novel nucleotide deletion (c.1220delG) leading to a frameshift (p.Gly407Glufs*56) in an alternative exon (#15) of USH1C. Screening of additional Yemenite Jewish patients revealed a total of 16 homozygous RP patients (with a carrier frequency of 0.008 in controls). Funduscopic and electroretinography findings were within the spectrum of typical RP. While other USH1C mutations usually cause Usher type I (including RP, vestibular dysfunction and congenital deafness), audiometric screening of 10 patients who are homozygous for c.1220delG revealed that patients under 40 years of age had normal hearing while older patients showed mild to severe high tone sensorineural hearing loss. This is the first report of a mutation in a known USH1 gene that causes late onset rather than congenital sensorineural hearing loss. The c.1220delG mutation of USH1C accounts for 23% of RP among Yemenite Jewish patients in our cohort. PMID:23251578

  7. Identification of XLRS1 gene mutation (608C > T) in a Portuguese family with juvenile retinoschisis.

    PubMed

    Teixeira, C; Rocha-Sousa, A; Trump, D; Brandão, E; Falcão-Reis, F

    2005-01-01

    To characterize electroretinogram (ERG) and molecular genetic findings in a family with XLRS1 mutation. The authors present two cases of a Portuguese family with juvenile retinoschisis with a mutation in exon 6. Two brothers and their parents, grandmother, and uncle underwent a full ophthalmic examination. The two brothers with ophthalmic disease were evaluated with color fundus photography, fluorescein angiography, optical coherence tomography (OCT), molecular genetic study (Group VI of Retinoschisis Consortium), pattern visual evoked potential (PVEP), and full field ERG. Both patients presented funduscopic manifestations of vitre o retinal degeneration. They presented peripheral schisis and retinal detachment. However, foveal schisis had never been observed at funduscopy. A negative ERG was recorded in both. Six months after that, the younger brother showed a typical foveal schisis at fundus examination. A retinoschisis gene (XLRS1) mutation with transition of cytosine by thymine at position 608 (608C > T) had been identified in both. Negative ERG is the most secure clinical marker to establish the diagnosis of juvenile retinoschisis. XLRS1 gene 608C > T mutation was described for the first time in a Portuguese family.

  8. Partial lipodystrophy and insulin resistant diabetes in a patient with a homozygous nonsense mutation in CIDEC

    PubMed Central

    Rubio-Cabezas, Oscar; Puri, Vishwajeet; Murano, Incoronata; Saudek, Vladimir; Semple, Robert K; Dash, Satya; Hyden, Caroline S S; Bottomley, William; Vigouroux, Corinne; Magré, Jocelyne; Raymond-Barker, Philippa; Murgatroyd, Peter R; Chawla, Anil; Skepper, Jeremy N; Chatterjee, V Krishna; Suliman, Sara; Patch, Ann-Marie; Agarwal, Anil K; Garg, Abhimanyu; Barroso, Inês; Cinti, Saverio; Czech, Michael P; Argente, Jesús; O'Rahilly, Stephen; Savage, David B

    2009-01-01

    Lipodystrophic syndromes are characterized by adipose tissue deficiency. Although rare, they are of considerable interest as they, like obesity, typically lead to ectopic lipid accumulation, dyslipidaemia and insulin resistant diabetes. In this paper we describe a female patient with partial lipodystrophy (affecting limb, femorogluteal and subcutaneous abdominal fat), white adipocytes with multiloculated lipid droplets and insulin-resistant diabetes, who was found to be homozygous for a premature truncation mutation in the lipid droplet protein cell death-inducing Dffa-like effector C (CIDEC) (E186X). The truncation disrupts the highly conserved CIDE-C domain and the mutant protein is mistargeted and fails to increase the lipid droplet size in transfected cells. In mice, Cidec deficiency also reduces fat mass and induces the formation of white adipocytes with multilocular lipid droplets, but in contrast to our patient, Cidec null mice are protected against diet-induced obesity and insulin resistance. In addition to describing a novel autosomal recessive form of familial partial lipodystrophy, these observations also suggest that CIDEC is required for unilocular lipid droplet formation and optimal energy storage in human fat. PMID:20049731

  9. Partial lipodystrophy and insulin resistant diabetes in a patient with a homozygous nonsense mutation in CIDEC.

    PubMed

    Rubio-Cabezas, Oscar; Puri, Vishwajeet; Murano, Incoronata; Saudek, Vladimir; Semple, Robert K; Dash, Satya; Hyden, Caroline S S; Bottomley, William; Vigouroux, Corinne; Magré, Jocelyne; Raymond-Barker, Philippa; Murgatroyd, Peter R; Chawla, Anil; Skepper, Jeremy N; Chatterjee, V Krishna; Suliman, Sara; Patch, Ann-Marie; Agarwal, Anil K; Garg, Abhimanyu; Barroso, Inês; Cinti, Saverio; Czech, Michael P; Argente, Jesús; O'Rahilly, Stephen; Savage, David B

    2009-08-01

    Lipodystrophic syndromes are characterized by adipose tissue deficiency. Although rare, they are of considerable interest as they, like obesity, typically lead to ectopic lipid accumulation, dyslipidaemia and insulin resistant diabetes. In this paper we describe a female patient with partial lipodystrophy (affecting limb, femorogluteal and subcutaneous abdominal fat), white adipocytes with multiloculated lipid droplets and insulin-resistant diabetes, who was found to be homozygous for a premature truncation mutation in the lipid droplet protein cell death-inducing Dffa-like effector C (CIDEC) (E186X). The truncation disrupts the highly conserved CIDE-C domain and the mutant protein is mistargeted and fails to increase the lipid droplet size in transfected cells. In mice, Cidec deficiency also reduces fat mass and induces the formation of white adipocytes with multilocular lipid droplets, but in contrast to our patient, Cidec null mice are protected against diet-induced obesity and insulin resistance. In addition to describing a novel autosomal recessive form of familial partial lipodystrophy, these observations also suggest that CIDEC is required for unilocular lipid droplet formation and optimal energy storage in human fat.

  10. Microcephaly-capillary malformation syndrome: Brothers with a homozygous STAMBP mutation, uncovered by exome sequencing.

    PubMed

    Naseer, Muhammad Imran; Sogaty, Sameera; Rasool, Mahmood; Chaudhary, Adeel G; Abutalib, Yousif Ahmed; Walker, Susan; Marshall, Christian R; Merico, Daniele; Carter, Melissa T; Scherer, Stephen W; Al-Qahtani, Mohammad H; Zarrei, Mehdi

    2016-11-01

    We describe two brothers from a consanguineous family of Egyptian ancestry, presenting with microcephaly, apparent global developmental delay, seizures, spasticity, congenital blindness, and multiple cutaneous capillary malformations. Through exome sequencing, we uncovered a homozygous missense variant in STAMBP (p.K303R) in the two siblings, inherited from heterozygous carrier parents. Mutations in STAMBP are known to cause microcephaly-capillary malformation syndrome (MIC-CAP) and the phenotype in this family is consistent with this diagnosis. We compared the findings in the present brothers with those of earlier reported patients. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  11. Mutation Spectrum and Birth Prevalence of Inborn Errors of Metabolism among Emiratis

    PubMed Central

    Al-Shamsi, Aisha; Hertecant, Jozef L.; Al-Hamad, Sania; Souid, Abdul-Kader; Al-Jasmi, Fatma

    2014-01-01

    Objectives: This study aimed to determine the mutation spectrum and prevalence of inborn errors of metabolism (IEM) among Emiratis. Methods: The reported mutation spectrum included all patients who were diagnosed with IEM (excluding those with lysosomal storage diseases [LSD]) at Tawam Hospital Metabolic Center in Abu Dhabi, United Arab Emirates, between January 1995 and May 2013. Disease prevalence (per 100,000 live births) was estimated from data available for 1995–2011. Results: In 189 patients, 57 distinct IEM were diagnosed, of which 20 (35%) entities were previously reported LSD (65 patients with 39 mutations), with a birth prevalence of 26.87/100,000. This study investigated the remaining 37 (65%) patients with other IEM (124 patients with 62 mutations). Mutation analysis was performed on 108 (87%) of the 124 patients. Five patients with biotinidase deficiency had compound heterozygous mutations, and two siblings with lysinuric protein intolerance had two homozygous mutations. The remaining 103 (95%) patients had homozygous mutations. As of this study, 29 (47%) of the mutations have been reported only in Emiratis. Two mutations were found in three tribes (biotinidase deficiency [BTD, c.1330G>C] and phenylketonuria [PAH, c.168+5G>C]). Two mutations were found in two tribes (isovaleric aciduria [IVD, c.1184G>A] and propionic aciduria [PCCB, c.990dupT]). The remaining 58 (94%) mutations were each found in individual tribes. The prevalence was 48.37/100,000. The most prevalent diseases (2.2–4.9/100,000) were biotinidase deficiency; tyrosinemia type 1; phenylketonuria; propionic aciduria; glutaric aciduria type 1; glycogen storage disease type Ia, and mitochondrial deoxyribonucleic acid depletion. Conclusion: The IEM birth prevalence (LSD and non-LSD) was 75.24/100,000. These results justify implementing prevention programmes that incorporate genetic counselling and screening. PMID:24516753

  12. Hyperchlorhidrosis caused by homozygous mutation in CA12, encoding carbonic anhydrase XII.

    PubMed

    Feldshtein, Maya; Elkrinawi, Suliman; Yerushalmi, Baruch; Marcus, Barak; Vullo, Daniela; Romi, Hila; Ofir, Rivka; Landau, Daniel; Sivan, Sara; Supuran, Claudiu T; Birk, Ohad S

    2010-11-12

    Excessive chloride secretion in sweat (hyperchlorhidrosis), leading to a positive sweat test, is most commonly indicative of cystic fibrosis yet is found also in conjunction with various metabolic, endocrine, and dermatological disorders. There is conflicting evidence regarding the existence of autosomal-recessive hyperchlorhidrosis. We now describe a consanguineous Israeli Bedouin kindred with autosomal-recessive hyperchlohidrosis whose sole symptoms are visible salt precipitates after sweating, a preponderance to hyponatremic dehydration, and poor feeding and slow weight gain at infancy. Through genome-wide linkage analysis, we demonstrate that the phenotype is due to a homozygous mutation in CA12, encoding carbonic anhydrase XII. The mutant (c.427G>A [p.Glu143Lys]) protein showed 71% activity of the wild-type enzyme for catalyzing the CO₂ hydration to bicarbonate and H(+), and it bound the clinically used sulfonamide inhibitor acetazolamide with high affinity (K(I) of 10 nM). Unlike the wild-type enzyme, which is not inhibited by chloride, bromide, or iodide (K(I)s of 73-215 mM), the mutant is inhibited in the submicromolar range by these anions (K(I)s of 0.37-0.73 mM). Copyright © 2010 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  13. Identification of Bangladeshi domestic cats with GM1 gangliosidosis caused by the c.1448G>C mutation of the feline GLB1 gene: case study.

    PubMed

    Uddin, Mohammad Mejbah; Hossain, Mohammad Alamgir; Rahman, Mohammad Mahbubur; Chowdhury, Morshedul Alam; Tanimoto, Takeshi; Yabuki, Akira; Mizukami, Keijiro; Chang, Hye-Sook; Yamato, Osamu

    2013-01-01

    GM1 gangliosidosis is a fatal, progressive neurodegenerative lysosomal storage disease caused by mutations in the β-galactosidase (GLB1) gene. In feline GM1 gangliosidosis, a pathogenic mutation (c.1448G>C) in the feline GLB1 gene was identified in Siamese cats in the United States and Japan and in Korat cats in Western countries. The present study found the homozygous c.1448G>C mutation in 2 apparent littermate native kittens in Bangladesh that were exhibiting neurological signs. This is the first identification of GM1 gangliosidosis in native domestic cats in Southeast Asia. This pathogenic mutation seems to have been present in the domestic cat population in the Siamese region and may have been transferred to pure breeds such as Siamese and Korat cats originating in this region.

  14. Mutations in STRA6 Cause a Broad Spectrum of Malformations Including Anophthalmia, Congenital Heart Defects, Diaphragmatic Hernia, Alveolar Capillary Dysplasia, Lung Hypoplasia, and Mental Retardation

    PubMed Central

    Pasutto, Francesca; Sticht, Heinrich; Hammersen, Gerhard; Gillessen-Kaesbach, Gabriele; FitzPatrick, David R.; Nürnberg, Gudrun; Brasch, Frank; Schirmer-Zimmermann, Heidemarie; Tolmie, John L.; Chitayat, David; Houge, Gunnar; Fernández-Martínez, Lorena; Keating, Sarah; Mortier, Geert; Hennekam, Raoul C. M.; von der Wense, Axel; Slavotinek, Anne; Meinecke, Peter; Bitoun, Pierre; Becker, Christian; Nürnberg, Peter; Reis, André; Rauch, Anita

    2007-01-01

    We observed two unrelated consanguineous families with malformation syndromes sharing anophthalmia and distinct eyebrows as common signs, but differing for alveolar capillary dysplasia or complex congenital heart defect in one and diaphragmatic hernia in the other family. Homozygosity mapping revealed linkage to a common locus on chromosome 15, and pathogenic homozygous mutations were identified in STRA6, a member of a large group of “stimulated by retinoic acid” genes encoding novel transmembrane proteins, transcription factors, and secreted signaling molecules or proteins of largely unknown function. Subsequently, homozygous STRA6 mutations were also demonstrated in 3 of 13 patients chosen on the basis of significant phenotypic overlap to the original cases. While a homozygous deletion generating a premature stop codon (p.G50AfsX22) led to absence of the immunoreactive protein in patient’s fibroblast culture, structural analysis of three missense mutations (P90L, P293L, and T321P) suggested significant effects on the geometry of the loops connecting the transmembrane helices of STRA6. Two further variations in the C-terminus (T644M and R655C) alter specific functional sites, an SH2-binding motif and a phosphorylation site, respectively. STRA6 mutations thus define a pleiotropic malformation syndrome representing the first human phenotype associated with mutations in a gene from the “STRA” group. PMID:17273977

  15. Novel mutations in RASGRP2, which encodes CalDAG-GEFI, abrogate Rap1 activation, causing platelet dysfunction

    PubMed Central

    Lozano, María Luisa; Cook, Aaron; Bastida, José María; Paul, David S.; Iruin, Gemma; Cid, Ana Rosa; Adan-Pedroso, Rosa; Ramón González-Porras, José; Hernández-Rivas, Jesús María; Fletcher, Sarah J.; Johnson, Ben; Morgan, Neil; Ferrer-Marin, Francisca; Vicente, Vicente; Sondek, John; Watson, Steve P.; Bergmeier, Wolfgang

    2016-01-01

    In addition to mutations in ITG2B or ITGB3 genes that cause defective αIIbβ3 expression and/or function in Glanzmann’s thrombasthenia patients, platelet dysfunction can be a result of genetic variability in proteins that mediate inside-out activation of αIIbβ3. The RASGRP2 gene is strongly expressed in platelets and neutrophils, where its encoded protein CalDAG-GEFI facilitates the activation of Rap1 and subsequent activation of integrins. We used next-generation sequencing (NGS) and whole-exome sequencing (WES) to identify 2 novel function-disrupting mutations in RASGRP2 that account for bleeding diathesis and platelet dysfunction in 2 unrelated families. By using a panel of 71 genes, we identified a homozygous change (c.1142C>T) in exon 10 of RASGRP2 in a 9-year-old child of Chinese origin (family 1). This variant led to a p.Ser381Phe substitution in the CDC25 catalytic domain of CalDAG-GEFI. In 2 Spanish siblings from family 2, WES identified a nonsense homozygous variation (c.337C>T) (p.Arg113X) in exon 5 of RASGRP2. CalDAG-GEFI expression was markedly reduced in platelets from all patients, and by using a novel in vitro assay, we found that the nucleotide exchange activity was dramatically reduced in CalDAG-GEFI p.Ser381Phe. Platelets from homozygous patients exhibited agonist-specific defects in αIIbβ3 integrin activation and aggregation. In contrast, α- and δ-granule secretion, platelet spreading, and clot retraction were not markedly affected. Integrin activation in the patients’ neutrophils was also impaired. These patients are the first cases of a CalDAG-GEFI deficiency due to homozygous RASGRP2 mutations that are linked to defects in both leukocyte and platelet integrin activation. PMID:27235135

  16. Response to immunotherapy in a patient with adult onset Leigh syndrome and T9176C mtDNA mutation.

    PubMed

    Chuquilin, Miguel; Govindarajan, Raghav; Peck, Dawn; Font-Montgomery, Esperanza

    2016-09-01

    Leigh syndrome is a mitochondrial disease caused by mutations in different genes, including ATP6A for which no known therapy is available. We report a case of adult-onset Leigh syndrome with response to immunotherapy. A twenty year-old woman with baseline learning difficulties was admitted with progressive behavioral changes, diplopia, headaches, bladder incontinence, and incoordination. Brain MRI and PET scan showed T2 hyperintensity and increased uptake in bilateral basal ganglia, respectively. Autoimmune encephalitis was suspected and she received plasmapheresis with clinical improvement. She was readmitted 4 weeks later with dysphagia and aspiration pneumonia. Plasmapheresis was repeated with resolution of her symptoms. Given the multisystem involvement and suggestive MRI changes, genetic testing was done, revealing a homoplasmic T9176C ATPase 6 gene mtDNA mutation. Monthly IVIG provided clinical improvement with worsening when infusions were delayed. Leigh syndrome secondary to mtDNA T9176C mutations could have an autoimmune mechanism that responds to immunotherapy.

  17. Whole exome sequencing identifies a homozygous nonsense variation in ALMS1 gene in a patient with syndromic obesity.

    PubMed

    Das Bhowmik, Aneek; Gupta, Neerja; Dalal, Ashwin; Kabra, Madhulika

    In the present study we report on genetic analysis in a patient with developmental delay, truncal obesity and vision problem, to find the causative mutation. Whole exome sequencing was performed on genomic DNA extracted from whole blood of the patient which revealed a homozygous nonsense variant (c.2816T>A) in exon 8 of ALMS1 gene that results in a stop codon and premature truncation at codon 939 (p.L939Ter) of the protein. The mutation was confirmed by Sanger sequencing. Exome sequencing was helpful in establishing diagnosis of Alstrom syndrome in this patient. This case highlights the utility of exome sequencing in clinical practice. Copyright © 2016 Asia Oceania Association for the Study of Obesity. Published by Elsevier Ltd. All rights reserved.

  18. Homozygous G320V mutation in the HJV gene causing juvenile hereditary haemochromatosis type A. A case report.

    PubMed

    Militaru, Mariela S; Popp, Radu A; Trifa, Adrian P

    2010-06-01

    While classical hereditary haemochromatosis, usually associated with mutations in the HFE gene, has an adult age onset and a long, progressive evolution, juvenile haemochromatosis, most often associated with mutations in the HJV gene, is a more severe, rapidly progressive condition and has an onset before the age of 30. We report a 26-year old woman with a severe iron overload, affected by hypogonadotropic hypogonadism and moderate dilative cardiomyopathy, in whom the molecular analysis revealed a homozygous genotype for G320V mutation in the HJV gene. As juvenile haemochromatosis is a severe disease, death usually occurring from cardiac involvement, an efficient iron removal from the body strategy should be started as soon as possible, in order to prevent irreversible damage.

  19. ITGB6 loss-of-function mutations cause autosomal recessive amelogenesis imperfecta

    PubMed Central

    Wang, Shih-Kai; Choi, Murim; Richardson, Amelia S.; Reid, Bryan M.; Lin, Brent P.; Wang, Susan J.; Kim, Jung-Wook; Simmer, James P.; Hu, Jan C.-C.

    2014-01-01

    Integrins are cell-surface adhesion receptors that bind to extracellular matrices (ECM) and mediate cell–ECM interactions. Some integrins are known to play critical roles in dental enamel formation. We recruited two Hispanic families with generalized hypoplastic amelogenesis imperfecta (AI). Analysis of whole-exome sequences identified three integrin beta 6 (ITGB6) mutations responsible for their enamel malformations. The female proband of Family 1 was a compound heterozygote with an ITGB6 transition mutation in Exon 4 (g.4545G > A c.427G > A p.Ala143Thr) and an ITGB6 transversion mutation in Exon 6 (g.27415T > A c.825T > A p.His275Gln). The male proband of Family 2 was homozygous for an ITGB6 transition mutation in Exon 11 (g.73664C > T c.1846C > T p.Arg616*) and hemizygous for a transition mutation in Exon 6 of Nance–Horan Syndrome (NHS Xp22.13; g.355444T > C c.1697T > C p.Met566Thr). These are the first disease-causing ITGB6 mutations to be reported. Immunohistochemistry of mouse mandibular incisors localized ITGB6 to the distal membrane of differentiating ameloblasts and pre-ameloblasts, and then ITGB6 appeared to be internalized by secretory stage ameloblasts. ITGB6 expression was strongest in the maturation stage and its localization was associated with ameloblast modulation. Our findings demonstrate that early and late amelogenesis depend upon cell–matrix interactions. Our approach (from knockout mouse phenotype to human disease) demonstrates the power of mouse reverse genetics in mutational analysis of human genetic disorders and attests to the need for a careful dental phenotyping in large-scale knockout mouse projects. PMID:24305999

  20. Extending Jak2V617F and MplW515 mutation analysis to single hematopoietic colonies and B and T lymphocytes.

    PubMed

    Pardanani, Animesh; Lasho, Terra L; Finke, Christy; Mesa, Ruben A; Hogan, William J; Ketterling, Rhett P; Gilliland, Dwight Gary; Tefferi, Ayalew

    2007-09-01

    JAK2V617F and MPLW515L/K are myeloproliferative disorder (MPD)-associated mutations. We genotyped 552 individual hematopoietic colonies obtained by CD34+ cell culture from 16 affected patients (13 JAK2V617F and 3 MPLW515L/K) to determine (a) the proportion of colonies harboring a particular mutation in the presence or absence of cytokines, (b) the lineage distribution of endogenous colonies for each mutation, and (c) the differences (if any) in the pattern of mutation among the various MPDs, as established by genotyping of individual colonies. Genotyping analysis revealed cohabitation of mutation-negative and mutation-positive endogenous colonies in polycythemia vera as well as other MPDs. Culture of progenitor cells harboring MPLW515L/K yielded virtually no endogenous erythroid colonies in contrast to JAK2V617F-harboring progenitor cells. The mutation pattern (i.e., relative distribution of homozygous, heterozygous, or wild-type colonies) was not a distinguishing feature among the MPDs, and MPLW515 mutations were detected in B and/or T lymphocytes in all three patients tested. These observations suggest that clonal myelopoiesis antedates acquisition of JAK2V617F or MPLW515L/K mutations and that the latter is acquired in a lympho-myeloid progenitor cell.

  1. Homozygous Mutation G539R in the Gene for P450 Oxidoreductase in a Family Previously Diagnosed as Having 17,20-Lyase Deficiency

    PubMed Central

    Hershkovitz, Eli; Parvari, Ruthi; Wudy, Stefan A.; Hartmann, Michaela F.; Gomes, Larissa G.; Loewental, Neta; Miller, Walter L.

    2008-01-01

    Context: Very few patients have been described with isolated 17,20-lyase deficiency who have had their mutations in P450c17 (17α-hydroxylase/17,20-lyase) proven by DNA sequencing and in vitro characterization of the mutations. Most patients with 17,20-lyase deficiency have mutations in the domain of P450c17 that interact with the electron-donating redox partner, P450 oxidoreductase (POR). Objective: Our objective was to clarify the genetic and functional basis of isolated 17,20-lyase deficiency in familial cases who were previously reported as having 17,20-lyase deficiency. Patients: Four undervirilized males of an extended Bedouin family were investigated. One of these has previously been reported to carry mutations in the CYP17A1 gene encoding P450c17 causing isolated 17,20-lyase deficiency. Methods: Serum hormones were evaluated before and after stimulation with ACTH. Urinary steroid metabolites were profiled by gas chromatography-mass spectrometry. Exons 1 and 8 of CYP17A1 previously reported to harbor mutations in one of these patients and all 15 coding exons of POR were sequenced. Results: Gas chromatography-mass spectrometry (GC-MS) urinary steroid profiling and serum steroid measurements showed combined deficiencies of 17,20-lyase and 21-hydroxylase. Sequencing of exons 1 and 8 of CYP17A1 in two different laboratories showed no mutations. Sequencing of POR showed that all four patients were homozygous for G539R, a previously studied mutation that retains 46% of normal capacity to support the 17α-hydroxylase activity but only 8% of the 17,20-lyase activity of P450c17. Conclusion: POR deficiency can masquerade clinically as isolated 17,20-lyase deficiency. PMID:18559916

  2. Homozygous mutation G539R in the gene for P450 oxidoreductase in a family previously diagnosed as having 17,20-lyase deficiency.

    PubMed

    Hershkovitz, Eli; Parvari, Ruthi; Wudy, Stefan A; Hartmann, Michaela F; Gomes, Larissa G; Loewental, Neta; Miller, Walter L

    2008-09-01

    Very few patients have been described with isolated 17,20-lyase deficiency who have had their mutations in P450c17 (17alpha-hydroxylase/17,20-lyase) proven by DNA sequencing and in vitro characterization of the mutations. Most patients with 17,20-lyase deficiency have mutations in the domain of P450c17 that interact with the electron-donating redox partner, P450 oxidoreductase (POR). Our objective was to clarify the genetic and functional basis of isolated 17,20-lyase deficiency in familial cases who were previously reported as having 17,20-lyase deficiency. Four undervirilized males of an extended Bedouin family were investigated. One of these has previously been reported to carry mutations in the CYP17A1 gene encoding P450c17 causing isolated 17,20-lyase deficiency. Serum hormones were evaluated before and after stimulation with ACTH. Urinary steroid metabolites were profiled by gas chromatography-mass spectrometry. Exons 1 and 8 of CYP17A1 previously reported to harbor mutations in one of these patients and all 15 coding exons of POR were sequenced. Gas chromatography-mass spectrometry (GC-MS) urinary steroid profiling and serum steroid measurements showed combined deficiencies of 17,20-lyase and 21-hydroxylase. Sequencing of exons 1 and 8 of CYP17A1 in two different laboratories showed no mutations. Sequencing of POR showed that all four patients were homozygous for G539R, a previously studied mutation that retains 46% of normal capacity to support the 17alpha-hydroxylase activity but only 8% of the 17,20-lyase activity of P450c17. POR deficiency can masquerade clinically as isolated 17,20-lyase deficiency.

  3. The clinical spectrum of the m.10191T>C mutation in complex I-deficient Leigh syndrome.

    PubMed

    Nesbitt, Victoria; Morrison, Patrick J; Crushell, Ellen; Donnelly, Deirdre E; Alston, Charlotte L; He, Langping; McFarland, Robert; Taylor, Robert W

    2012-06-01

    Mitochondrial respiratory chain diseases represent one of the most common inherited neurometabolic disorders of childhood, affecting a minimum of 1 in 7500 live births. The marked clinical, biochemical, and genetic heterogeneity means that accurate genetic counselling relies heavily upon the identification of the underlying causative mutation in the individual and determination of carrier status in the parents. Isolated complex I deficiency is the most common respiratory chain defect observed in children, resulting in organ-specific or multisystem disease, but most often presenting as Leigh syndrome, for which mitochondrial DNA mutations are important causes. Several recurrent, pathogenic point mutations in the MTND3 gene - including m.10191T>C (p.Ser45Pro) - have been previously identified. In this short clinical review we evaluate the case reports of the m.10191T>C mutation causing complex I-deficient Leigh syndrome described in the literature, in addition to two new ones diagnosed in our laboratory. Both of these appear to have arisen de novo without transmission of the mutation from mother to offspring, illustrating the importance not only of fully characterizing the mitochondrial genome as part of the investigation of children with complex I-deficient Leigh syndrome but also of assessing maternal samples to provide crucial genetic advice for families. © The Authors. Developmental Medicine & Child Neurology © 2012 Mac Keith Press.

  4. Homozygous PPT1 Splice Donor Mutation in a Cane Corso Dog With Neuronal Ceroid Lipofuscinosis.

    PubMed

    Kolicheski, A; Barnes Heller, H L; Arnold, S; Schnabel, R D; Taylor, J F; Knox, C A; Mhlanga-Mutangadura, T; O'Brien, D P; Johnson, G S; Dreyfus, J; Katz, M L

    2017-01-01

    A 10-month-old spayed female Cane Corso dog was evaluated after a 2-month history of progressive blindness, ataxia, and lethargy. Neurologic examination abnormalities indicated a multifocal lesion with primarily cerebral and cerebellar signs. Clinical worsening resulted in humane euthanasia. On necropsy, there was marked astrogliosis throughout white matter tracts of the cerebrum, most prominently in the corpus callosum. In the cerebral cortex and midbrain, most neurons contained large amounts of autofluorescent storage material in the perinuclear area of the cells. Cerebellar storage material was present in the Purkinje cells, granular cell layer, and perinuclear regions of neurons in the deep nuclei. Neuronal ceroid lipofuscinosis (NCL) was diagnosed. Whole genome sequencing identified a PPT1c.124 + 1G>A splice donor mutation. This nonreference assembly allele was homozygous in the affected dog, has not previously been reported in dbSNP, and was absent from the whole genome sequences of 45 control dogs and 31 unaffected Cane Corsos. Our findings indicate a novel mutation causing the CLN1 form of NCL in a previously unreported dog breed. A canine model for CLN1 disease could provide an opportunity for therapeutic advancement, benefiting both humans and dogs with this disorder. Copyright © 2016 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of the American College of Veterinary Internal Medicine.

  5. Minimal phenotype of mice homozygous for a null mutation in the forkhead/winged helix gene, Mf2.

    PubMed

    Kume, T; Deng, K; Hogan, B L

    2000-02-01

    Mf2 (mesoderm/mesenchyme forkhead 2) encodes a forkhead/winged helix transcription factor expressed in numerous tissues of the mouse embryo, including paraxial mesoderm, somites, branchial arches, vibrissae, developing central nervous system, and developing kidney. We have generated mice homozygous for a null mutation in the Mf2 gene (Mf2(lacZ)) to examine its role during embryonic development. The lacZ allele also allows monitoring of Mf2 gene expression. Homozygous null mutants are viable and fertile and have no major developmental defects. Some mutants show renal abnormalities, including kidney hypoplasia and hydroureter, but the penetrance of this phenotype is only 40% or lower, depending on the genetic background. These data suggest that Mf2 can play a unique role in kidney development, but there is functional redundancy in this organ and other tissues with other forkhead/winged helix genes.

  6. A Case of Inflammatory Generalized Type of Peeling Skin Syndrome Possibly Caused by a Homozygous Missense Mutation of CDSN

    PubMed Central

    Kawakami, Hiroshi; Uchiyama, Masaki; Maeda, Tatsuo; Tsunoda, Takahiko; Mitsuhashi, Yoshihiko; Tsuboi, Ryoji

    2014-01-01

    A 54-year-old Japanese woman had repetitive superficial skin peeling and ensuing erythematous changes in the sites since infancy. Her parents had a consanguineous marriage, and she was the only individual affected in her family tree. The erythematous changes seemed to worsen in the summer. Histologically, hyperkeratosis and splitting of the epidermis within the stratum corneum was noted, and electron microscopy revealed shedding of corneal cells in the horny layer and normal-looking corneodesmosomes. Gene analysis revealed a homozygous missense mutation at c.1358G>A in CDSN. Electron microscopic examination of the length and number of corneodesmosomes revealed statistically significant shortness and sparsity in the affected individual (mean ± SD 386.2 ± 149.5 nm) compared with that of an age- and site-matched control (406.6 ± 182.3 nm). We speculate that this size shrinkage of corneodesmosomes might be the result of a missense mutation of CDSN and that this could be one of the factors contributing to the pathological process of skin peeling. PMID:25473393

  7. A Case of Inflammatory Generalized Type of Peeling Skin Syndrome Possibly Caused by a Homozygous Missense Mutation of CDSN.

    PubMed

    Kawakami, Hiroshi; Uchiyama, Masaki; Maeda, Tatsuo; Tsunoda, Takahiko; Mitsuhashi, Yoshihiko; Tsuboi, Ryoji

    2014-09-01

    A 54-year-old Japanese woman had repetitive superficial skin peeling and ensuing erythematous changes in the sites since infancy. Her parents had a consanguineous marriage, and she was the only individual affected in her family tree. The erythematous changes seemed to worsen in the summer. Histologically, hyperkeratosis and splitting of the epidermis within the stratum corneum was noted, and electron microscopy revealed shedding of corneal cells in the horny layer and normal-looking corneodesmosomes. Gene analysis revealed a homozygous missense mutation at c.1358G>A in CDSN. Electron microscopic examination of the length and number of corneodesmosomes revealed statistically significant shortness and sparsity in the affected individual (mean ± SD 386.2 ± 149.5 nm) compared with that of an age- and site-matched control (406.6 ± 182.3 nm). We speculate that this size shrinkage of corneodesmosomes might be the result of a missense mutation of CDSN and that this could be one of the factors contributing to the pathological process of skin peeling.

  8. Compound heterozygous HAX1 mutations in a Swedish patient with severe congenital neutropenia and no neurodevelopmental abnormalities.

    PubMed

    Carlsson, Göran; Elinder, Göran; Malmgren, Helena; Trebinska, Alicja; Grzybowska, Ewa; Dahl, Niklas; Nordenskjöld, Magnus; Fadeel, Bengt

    2009-12-01

    Kostmann disease or severe congenital neutropenia (SCN) is an autosomal recessive disorder of neutrophil production. Homozygous HAX1 mutations were recently identified in SCN patients belonging to the original family in northern Sweden described by Kostmann. Moreover, recent studies have suggested an association between neurological dysfunction and HAX1 deficiency. Here we describe a patient with a compound heterozygous HAX1 mutation consisting of a nonsense mutation (c.568C > T, p.Glu190X) and a frame-shift mutation (c.91delG, p.Glu31LysfsX54) resulting in a premature stop codon. The patient has a history of neutropenia and a propensity for infections, but has shown no signs of neurodevelopmental abnormalities.

  9. A Novel Homozygous Mutation in SPTBN2 Leads to Spinocerebellar Ataxia in a Consanguineous Family: Report of a New Infantile-Onset Case and Brief Review of the Literature.

    PubMed

    Al-Muhaizea, Mohammad A; AlMutairi, Faten; Almass, Rawan; AlHarthi, Safinaz; Aldosary, Mazhor S; Alsagob, Maysoon; AlOdaib, Ali; Colak, Dilek; Kaya, Namik

    2018-06-01

    The objective of this study was the identification of likely genes and mutations associated with an autosomal recessive (AR) rare spinocerebellar ataxia (SCA) phenotype in two patients with infantile onset, from a consanguineous family. Using genome-wide SNP screening, autozygosity mapping, targeted Sanger sequencing and nextgen sequencing, family segregation analysis, and comprehensive neuropanel, we discovered a novel mutation in SPTBN2. Next, we utilized multiple sequence alignment of amino acids from various species as well as crystal structures provided by protein data bank (PDB# 1WYQ and 1WJM) to model the mutation site and its effect on β-III-spectrin. Finally, we used various bioinformatic classifiers to determine pathogenicity of the missense variant. A comprehensive clinical and diagnostic workup including radiological exams were performed on the patients as part of routine patient care. The homozygous missense variant (c.1572C>T; p.R414C) detected in exon 2 was fully segregated in the family and absent in a large ethnic cohort as well as publicly available data sets. Our comprehensive targeted sequencing approaches did not reveal any other likely candidate variants or mutations in both patients. The two male siblings presented with delayed motor milestones and cognitive and learning disability. Brain MRI revealed isolated cerebellar atrophy more marked in midline inferior vermis at ages of 3 and 6.5 years. Sequence alignments of the amino acids for β-III-spectrin indicated that the arginine at 414 is highly conserved among various species and located towards the end of first spectrin repeat domain. Inclusive bioinformatic analysis predicted that the variant is to be damaging and disease causing. In addition to the novel mutation, a brief literature review of the previously reported mutations as well as clinical comparison of the cases were also presented. Our study reviews the previously reported SPTBN2 mutations and cases. Moreover, the novel

  10. Clinical implications of mutation analysis in primary hyperoxaluria type 1.

    PubMed

    van Woerden, Christiaan S; Groothoff, Jaap W; Wijburg, Frits A; Annink, Carla; Wanders, Ronald J A; Waterham, Hans R

    2004-08-01

    Primary hyperoxaluria type 1 (PH1) is an inborn error of glyoxylate metabolism with an extensive clinical and genetic heterogeneity. Although over 50 disease-causing mutations have been identified, the relationship between genotype and clinical outcome remains unclear. The aim of this study was to determine this association in order to find clues for improvement of patient care. AGXT mutation analysis and assessment of biochemical characteristics and clinical outcome were performed on patients from a Dutch PH1 cohort. Thirty-three of a cohort of 57 PH1 patients, identified in The Netherlands over a period of 30 years, were analyzed. Ten different mutations were found. The most common mutations were the Gly170Arg, Phe152Ile, and the 33insC mutations, with an allele frequency of 43%, 19%, and 15%, respectively. Homozygous Gly170Arg and Phe152Ile mutations were associated with pyridoxine responsiveness and a preserved renal function over time when treatment was timely initiated. All patients homozygous for the 33insC mutation had end-stage renal disease (ESRD) before the first year of age. In two unrelated patients, a new Val336Asp mutation was found coupled with the Gly170Arg mutation on the minor allele. We also found 3 patients homozygous for a novel Gly82Arg mutation with adverse outcome in 2 of them. Early detection of Gly170Arg and Phe152Ile mutations in PH1 has important clinical implications because of their association with pyridoxine responsiveness and clinical outcome. The association of a homozygous 33insC mutation with severe infantile ESRD, resulting in early deaths in 2 out of 3 cases, warrants a choice for prenatal diagnostics in affected families.

  11. PAI-1 4G/5G and MTHFR C677T polymorphisms increased the accuracy of two prediction scores for the risk of acute lower extremity deep vein thrombosis.

    PubMed

    Pop, Tudor Radu; Vesa, Ştefan Cristian; Trifa, Adrian Pavel; Crişan, Sorin; Buzoianu, Anca Dana

    2014-01-01

    This study investigates the accuracy of two scores in predicting the risk of acute lower extremity deep vein thrombosis. The study included 170 patients [85 (50%) women and 85 (50%) men] who were diagnosed with acute lower extremity deep vein thrombosis (DVT) with duplex ultrasonography. Median age was 62 (52.75; 72) years. The control group consisted of 166 subjects [96 (57.8%) women and 70 (42.2%) men], without DVT, matched for age (± one year) to those in the group with DVT. The patients and controls were selected from those admitted to the internal medicine, cardiology and geriatrics wards within the Municipal Hospital of Cluj-Napoca, Romania, between October 2009 and June 2011. Clinical, demographic and lab data were recorded for each patient. For each patient we calculated the prior risk of DVT using two prediction scores: Caprini and Padua. According to the Padua score only 93 (54.7%) patients with DVT had been at high risk of developing DVT, while 48 (28.9%) of controls were at high risk of developing DVT. When Padua score included PAI-1 4G/5G and MTHFR C677T polymorphisms, the sensitivity increased at 71.7%. Using the Caprini score, we determined that 147 (86.4%) patients with DVT had been at high risk of developing DVT, while 103 (62%) controls were at high risk of developing DVT. A Caprini score higher than 5 was the strongest predictor of acute lower extremity DVT risk. The Caprini prediction score was more sensitive than the Padua score in assessing the high risk of DVT in medical patients. PAI-1 4G/5G and MTHFR C677T polymorphisms increased the sensitivity of Padua score.

  12. The silent mutation MLH1 c.543C>T resulting in aberrant splicing can cause Lynch syndrome: a case report.

    PubMed

    Yamaguchi, Tatsuro; Wakatsuki, Tomokazu; Kikuchi, Mari; Horiguchi, Shin-Ichiro; Akagi, Kiwamu

    2017-06-01

    The proband was a 67-year-old man with transverse and sigmoid colon cancer. Microsatellite instability analysis revealed a high frequency of microsatellite instability, and immunohistochemical staining showed the absence of both MLH1 and PMS2 proteins in the sigmoid colon cancer tissue specimens from the patient. DNA sequencing revealed a nucleotide substitution c.543C>T in MLH1, but this variant did not substitute an amino acid. The MLH1 c.543C>T variant was located 3 bases upstream from the end of exon 6 and created a new splice donor site 4 bases upstream from the end of exon 6. Consequently, the last 4 bases of exon 6 were deleted and frameshift occurred. Thus, the MLH1 c.543C>T silent mutation is considered 'pathogenic'. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  13. Minimal Phenotype of Mice Homozygous for a Null Mutation in the Forkhead/Winged Helix Gene, Mf2

    PubMed Central

    Kume, Tsutomu; Deng, Keyu; Hogan, Brigid L. M.

    2000-01-01

    Mf2 (mesoderm/mesenchyme forkhead 2) encodes a forkhead/winged helix transcription factor expressed in numerous tissues of the mouse embryo, including paraxial mesoderm, somites, branchial arches, vibrissae, developing central nervous system, and developing kidney. We have generated mice homozygous for a null mutation in the Mf2 gene (Mf2lacZ) to examine its role during embryonic development. The lacZ allele also allows monitoring of Mf2 gene expression. Homozygous null mutants are viable and fertile and have no major developmental defects. Some mutants show renal abnormalities, including kidney hypoplasia and hydroureter, but the penetrance of this phenotype is only 40% or lower, depending on the genetic background. These data suggest that Mf2 can play a unique role in kidney development, but there is functional redundancy in this organ and other tissues with other forkhead/winged helix genes. PMID:10648626

  14. Phenotypical features of two patients diagnosed with PHARC syndrome and carriers of a new homozygous mutation in the ABHD12 gene.

    PubMed

    Frasquet, Marina; Lupo, Vincenzo; Chumillas, María José; Vázquez-Costa, Juan Francisco; Espinós, Carmen; Sevilla, Teresa

    2018-04-15

    PHARC (Polyneuropathy, Hearing loss, Ataxia, Retinitis pigmentosa and Cataracts) (MIM# 612674) is an autosomal recessive neurodegenerative disease caused by mutations in the ABHD12 gene. We evaluated two Spanish siblings affected with pes cavus, sensorimotor neuropathy, hearing loss, retinitis pigmentosa and juvenile cataracts in whom the genetic test of ABHD12 revealed a novel homozygous frameshift mutation, c.211_223del (p.Arg71Tyrfs*26). The earliest clinical manifestation in these patients was a demyelinating neuropathy manifested with a Charcot-Marie-Tooth phenotype over three decades. Progressive hearing loss, cataracts and retinitis pigmentosa appeared after the age of 30. We herein describe the complete clinical picture of these two patients, and focus particularly on neuropathy characteristics. This study supports the fact that although PHARC is rare, its phenotype is very characteristic and we should include its study in patients affected with demyelinating polyneuropathy, hearing loss and retinopathy. Copyright © 2018 Elsevier B.V. All rights reserved.

  15. Linkage Study Revealed Complex Haplotypes in a Multifamily due to Different Mutations in CAPN3 Gene in an Iranian Ethnic Group.

    PubMed

    Mojbafan, Marzieh; Tonekaboni, Seyed Hassan; Abiri, Maryam; Kianfar, Soudeh; Sarhadi, Ameneh; Nilipour, Yalda; Tavakkoly-Bazzaz, Javad; Zeinali, Sirous

    2016-07-01

    Calpainopathy is an autosomal recessive form of limb girdle muscular dystrophies which is caused by mutation in CAPN3 gene. In the present study, co-segregation of this disorder was analyzed with four short tandem repeat markers linked to the CAPN3 gene. Three apparently unrelated Iranian families with same ethnicity were investigated. Haplotype analysis and sequencing of the CAPN3 gene were performed. DNA sample from one of the patients was simultaneously sent for next-generation sequencing. DNA sequencing identified two mutations. It was seen as a homozygous c.2105C>T in exon 19 in one family, a homozygous novel mutation c.380G>A in exon 3 in another family, and a compound heterozygote form of these two mutations in the third family. Next-generation sequencing also confirmed our results. It was expected that, due to the rare nature of limb girdle muscular dystrophies, affected individuals from the same ethnic group share similar mutations. Haplotype analysis showed two different homozygote patterns in two families, yet a compound heterozygote pattern in the third family as seen in the mutation analysis. This study shows that haplotype analysis would help in determining presence of different founders.

  16. Thrombophilic gene polymorphisms and recurrent pregnancy loss in Greek women.

    PubMed

    Chatzidimitriou, M; Chatzidimitriou, D; Mavridou, M; Anetakis, C; Chatzopoulou, F; Lialiaris, T; Mitka, S

    2017-12-01

    Recurrent pregnancy loss (RPL) is a multifactorial disorder. The aim of this study was the detection of various genetic polymorphisms and their correlation to RPL, in Greek women. The impact of 12 thrombophilic polymorphisms was evaluated, among 48 Greek women with a history of RPL, vs 27 healthy parous women. Multiplex PCR and in situ hybridization on nitrocellulose films were performed, to investigate 12 genetic polymorphisms previously reported as risk factors for RPL. Heterozygous FV Leiden, homozygous PAI-1 4G/4G, heterozygous MTHFR C677T, homozygous MTHFR A1298C, as much as the combined thrombophilic genotypes MTHFR 677T + ACE Ι/D, MTHFR 677T/1298C + ACE D/D, ACE I/D + b-fibrinogen -455 G/A, FV HR2 + b-fibrinogen -455 G/A showed a correlation as risk factors for RPL, whereas the rest of the investigated polymorphisms and their combinations did not render statistically significant differences between the two groups in study. The results of this study, as well as those of similar studies, concerning the detection of genetic, environmental, and physiological factors underlying RPL, will prove of critical significance in the investigation and treatment of thrombophilic predisposition, in cases of RPL. © 2017 John Wiley & Sons Ltd.

  17. The novel homozygous KCNJ10 c.986T>C (p.(Leu329Pro)) variant is pathogenic for the SeSAME/EAST homologue in Malinois dogs

    PubMed Central

    Van Poucke, Mario; Stee, Kimberley; Bhatti, Sofie F M; Vanhaesebrouck, An; Bosseler, Leslie; Peelman, Luc J; Van Ham, Luc

    2017-01-01

    SeSAME/EAST syndrome is a multisystemic disorder in humans, characterised by seizures, sensorineural deafness, ataxia, developmental delay and electrolyte imbalance. It is exclusively caused by homozygous or compound heterozygous variations in the KCNJ10 gene. Here we describe a similar syndrome in two families belonging to the Malinois dog breed, based on clinical, neurological, electrodiagnostic and histopathological examination. Genetic analysis detected a novel pathogenic KCNJ10 c.986T>C (p.(Leu329Pro)) variant that is inherited in an autosomal recessive way. This variant has an allele frequency of 2.9% in the Belgian Malinois population, but is not found in closely related dog breeds or in dog breeds where similar symptoms have been already described. The canine phenotype is remarkably similar to humans, including ataxia and seizures. In addition, in half of the dogs clinical and electrophysiological signs of neuromyotonia were observed. Because there is currently no cure and treatment is nonspecific and unsatisfactory, this canine translational model could be used for further elucidating the genotype/phenotype correlation of this monogenic multisystem disorder and as an excellent intermediate step for drug safety testing and efficacy evaluations before initiating human studies. PMID:27966545

  18. Severe coagulation factor VII deficiency caused by a novel homozygous mutation (p. Trp284Gly) in loop 140s.

    PubMed

    Hao, Xiuping; Cheng, XiaoLi; Ye, Jiajia; Wang, Yingyu; Yang, LiHong; Wang, Mingshan; Jin, Yanhui

    2016-06-01

    Congenital coagulation factor VII (FVII) deficiency is a rare disorder caused by mutation in F7 gene. Herein, we reported a patient who had unexplained hematuria and vertigo with consanguineous parents. He has been diagnosed as having FVII deficiency based on the results of reduced FVII activity (2.0%) and antigen (12.8%). The thrombin generation tests verified that the proband has obstacles in producing thrombin. Direct sequencing analysis revealed a novel homozygous missense mutation p.Trp284Gly. Also noteworthy is the fact that the mutational residue belongs to structurally conserved loop 140s, which majorly undergo rearrangement after FVII activation. Model analysis indicated that the substitution disrupts these native hydrophobic interactions, which are of great importance to the conformation in the activation domain of FVIIa.

  19. Lynch syndrome: the influence of environmental factors on extracolonic cancer risk in hMLH1 c.C1528T mutation carriers and their mutation-negative sisters.

    PubMed

    Blokhuis, M M; Pietersen, G E; Goldberg, P A; Algar, U; Van der Merwe, L; Mbatani, N; Vorster, A A; Ramesar, R S

    2010-09-01

    Lynch Syndrome (LS) is a cancer susceptibility syndrome caused mostly by mutations in the mismatch repair genes, hMLH1, hMSH2 and hMSH6. Mutation carriers are at risk of colorectal and endometrial cancer and, less frequently, cancer of the ovaries, stomach, small bowel, hepatobiliary tract, ureter, renal pelvis and brain. The influence of environmental factors on extracolonic cancer risk in LS patients has not been investigated thus far. The aim of this study was to investigate some of these factors in South African females carrying the hMLH1 c.C1528T mutation and their mutation-negative relatives. Data were collected from 87 mutation-positive females and 121 mutation-negative female relatives regarding age, cancer history, hormonal contraceptive use, parity, duration of breast feeding, height, weight and age at first birth, last birth, menarche and menopause. Influence of these factors on cancer risk was analysed by mixed-effects generalised linear models. Extracolonic cancer occurred in 14% (12/87) of mutation-positive females versus 7% (8/121) of mutation-negative females, (P = 0.0279, adjusted for age and relatedness between women). Breast cancer was the most common extracolonic cancer. An association was found for oral contraceptive use and extracolonic cancer risk in mutation-negative females only. No association was found for any of the other risk factors investigated, when adjusted for age. This might be due to the scarcity of extracolonic cancers in our data. Future knowledge on the influence of additional environmental factors on cancer risk in LS females can lead to evidence-based lifestyle advice for mutation carriers, thereby complementing the prevention strategies available today. In addition, it can contribute to an integrated model of cancer aetiology. Therefore, this study should be taken as a thrust for further research.

  20. WNT10A missense mutation associated with a complete Odonto-Onycho-Dermal Dysplasia syndrome

    PubMed Central

    Nawaz, Sadia; Klar, Joakim; Wajid, Muhammad; Aslam, Muhammad; Tariq, Muhammad; Schuster, Jens; Baig, Shahid Mahmood; Dahl, Niklas

    2009-01-01

    Wnt signalling is one of a few pathways that are crucial for controlling genetic programs during embryonic development as well as in adult tissues. WNT10A is expressed in the skin and epidermis and it has shown to be critical for the development of ectodermal appendages. A nonsense mutation in WNT10A was recently identified in odonto-onycho-dermal dysplasia (OODD; MIM 257980), a rare syndrome characterised by severe hypodontia, nail dystrophy, smooth tongue, dry skin, keratoderma and hyperhydrosis of palms and soles. We identified a large consanguineous Pakistani pedigree comprising six individuals affected by a complete OODD syndrome. Autozygosity mapping using SNP array analysis showed that the affected individuals are homozygous for the WNT10A gene region. Subsequent mutation screening showed a homozygous c.392C>T transition in exon 3 of WNT10A, which predicts a p.A131V substitution in a conserved α-helix domain. We report here on the first inherited missense mutation in WNT10A with associated ectodermal features. PMID:19471313

  1. WNT10A missense mutation associated with a complete odonto-onycho-dermal dysplasia syndrome.

    PubMed

    Nawaz, Sadia; Klar, Joakim; Wajid, Muhammad; Aslam, Muhammad; Tariq, Muhammad; Schuster, Jens; Baig, Shahid Mahmood; Dahl, Niklas

    2009-12-01

    Wnt signalling is one of a few pathways that are crucial for controlling genetic programs during embryonic development as well as in adult tissues. WNT10A is expressed in the skin and epidermis and it has shown to be critical for the development of ectodermal appendages. A nonsense mutation in WNT10A was recently identified in odonto-onycho-dermal dysplasia (OODD; MIM 257980), a rare syndrome characterised by severe hypodontia, nail dystrophy, smooth tongue, dry skin, keratoderma and hyperhydrosis of palms and soles. We identified a large consanguineous Pakistani pedigree comprising six individuals affected by a complete OODD syndrome. Autozygosity mapping using SNP array analysis showed that the affected individuals are homozygous for the WNT10A gene region. Subsequent mutation screening showed a homozygous c.392C>T transition in exon 3 of WNT10A, which predicts a p.A131V substitution in a conserved alpha-helix domain. We report here on the first inherited missense mutation in WNT10A with associated ectodermal features.

  2. Analysis of mouse models carrying the I26T and R160C substitutions in the transcriptional repressor HESX1 as models for septo-optic dysplasia and hypopituitarism

    PubMed Central

    Sajedi, Ezat; Gaston-Massuet, Carles; Signore, Massimo; Andoniadou, Cynthia L.; Kelberman, Daniel; Castro, Sandra; Etchevers, Heather C.; Gerrelli, Dianne; Dattani, Mehul T.; Martinez-Barbera, Juan Pedro

    2008-01-01

    SUMMARY A homozygous substitution of the highly conserved isoleucine at position 26 by threonine (I26T) in the transcriptional repressor HESX1 has been associated with anterior pituitary hypoplasia in a human patient, with no forebrain or eye defects. Two individuals carrying a homozygous substitution of the conserved arginine at position 160 by cysteine (R160C) manifest septo-optic dysplasia (SOD), a condition characterised by pituitary abnormalities associated with midline telencephalic structure defects and optic nerve hypoplasia. We have generated two knock-in mouse models containing either the I26T or R160C substitution in the genomic locus. Hesx1I26T/I26T embryos show pituitary defects comparable with Hesx1−/− mouse mutants, with frequent occurrence of ocular abnormalities, although the telencephalon develops normally. Hesx1R160C/R160C mutants display forebrain and pituitary defects that are identical to those observed in Hesx1−/− null mice. We also show that the expression pattern of HESX1 during early human development is very similar to that described in the mouse, suggesting that the function of HESX1 is conserved between the two species. Together, these results suggest that the I26T mutation yields a hypomorphic allele, whereas R160C produces a null allele and, consequently, a more severe phenotype in both mice and humans. PMID:19093031

  3. Cardiac myosin binding protein C regulates postnatal myocyte cytokinesis

    PubMed Central

    Jiang, Jianming; Burgon, Patrick G.; Wakimoto, Hiroko; Onoue, Kenji; Gorham, Joshua M.; O’Meara, Caitlin C.; Fomovsky, Gregory; McConnell, Bradley K.; Lee, Richard T.; Seidman, J. G.; Seidman, Christine E.

    2015-01-01

    Homozygous cardiac myosin binding protein C-deficient (Mybpct/t) mice develop dramatic cardiac dilation shortly after birth; heart size increases almost twofold. We have investigated the mechanism of cardiac enlargement in these hearts. Throughout embryogenesis myocytes undergo cell division while maintaining the capacity to pump blood by rapidly disassembling and reforming myofibrillar components of the sarcomere throughout cell cycle progression. Shortly after birth, myocyte cell division ceases. Cardiac MYBPC is a thick filament protein that regulates sarcomere organization and rigidity. We demonstrate that many Mybpct/t myocytes undergo an additional round of cell division within 10 d postbirth compared with their wild-type counterparts, leading to increased numbers of mononuclear myocytes. Short-hairpin RNA knockdown of Mybpc3 mRNA in wild-type mice similarly extended the postnatal window of myocyte proliferation. However, adult Mybpct/t myocytes are unable to fully regenerate the myocardium after injury. MYBPC has unexpected inhibitory functions during postnatal myocyte cytokinesis and cell cycle progression. We suggest that human patients with homozygous MYBPC3-null mutations develop dilated cardiomyopathy, coupled with myocyte hyperplasia (increased cell number), as observed in Mybpct/t mice. Human patients, with heterozygous truncating MYBPC3 mutations, like mice with similar mutations, have hypertrophic cardiomyopathy. However, the mechanism leading to hypertrophic cardiomyopathy in heterozygous MYBPC3+/− individuals is myocyte hypertrophy (increased cell size), whereas the mechanism leading to cardiac dilation in homozygous Mybpc3−/− mice is primarily myocyte hyperplasia. PMID:26153423

  4. Whole-Exome Sequencing Identifies Homozygous AFG3L2 Mutations in a Spastic Ataxia-Neuropathy Syndrome Linked to Mitochondrial m-AAA Proteases

    PubMed Central

    Martinelli, Paola; Cherukuri, Praveen F.; Teer, Jamie K.; Hansen, Nancy F.; Cruz, Pedro; Mullikin for the NISC Comparative Sequencing Program, James C.; Blakesley, Robert W.; Golas, Gretchen; Kwan, Justin; Sandler, Anthony; Fuentes Fajardo, Karin; Markello, Thomas; Tifft, Cynthia; Blackstone, Craig; Rugarli, Elena I.; Langer, Thomas; Gahl, William A.; Toro, Camilo

    2011-01-01

    We report an early onset spastic ataxia-neuropathy syndrome in two brothers of a consanguineous family characterized clinically by lower extremity spasticity, peripheral neuropathy, ptosis, oculomotor apraxia, dystonia, cerebellar atrophy, and progressive myoclonic epilepsy. Whole-exome sequencing identified a homozygous missense mutation (c.1847G>A; p.Y616C) in AFG3L2, encoding a subunit of an m-AAA protease. m-AAA proteases reside in the mitochondrial inner membrane and are responsible for removal of damaged or misfolded proteins and proteolytic activation of essential mitochondrial proteins. AFG3L2 forms either a homo-oligomeric isoenzyme or a hetero-oligomeric complex with paraplegin, a homologous protein mutated in hereditary spastic paraplegia type 7 (SPG7). Heterozygous loss-of-function mutations in AFG3L2 cause autosomal-dominant spinocerebellar ataxia type 28 (SCA28), a disorder whose phenotype is strikingly different from that of our patients. As defined in yeast complementation assays, the AFG3L2Y616C gene product is a hypomorphic variant that exhibited oligomerization defects in yeast as well as in patient fibroblasts. Specifically, the formation of AFG3L2Y616C complexes was impaired, both with itself and to a greater extent with paraplegin. This produced an early-onset clinical syndrome that combines the severe phenotypes of SPG7 and SCA28, in additional to other “mitochondrial” features such as oculomotor apraxia, extrapyramidal dysfunction, and myoclonic epilepsy. These findings expand the phenotype associated with AFG3L2 mutations and suggest that AFG3L2-related disease should be considered in the differential diagnosis of spastic ataxias. PMID:22022284

  5. A novel homozygous variant in the SMOC1 gene underlying Waardenburg anophthalmia syndrome.

    PubMed

    Ullah, Asmat; Umair, Muhammad; Ahmad, Farooq; Muhammad, Dost; Basit, Sulman; Ahmad, Wasim

    2017-01-01

    Waardenburg anophthalmia syndrome (WAS), also known as ophthalmo-acromelic syndrome or anophthalmia-syndactyly, is a rare congenital disorder that segregates in an autosomal recessive pattern. Clinical features of the syndrome include malformation of the eyes and the skeleton. Mostly, WAS is caused by mutations in the SMOC-1 gene. The present report describes a large consanguineous family of Pakistani origin segregating Waardenburg anophthalmia syndrome in an autosomal recessive pattern. Genotyping followed by Sanger sequencing was performed to search for a candidate gene. SNP genotyping using AffymetrixGeneChip Human Mapping 250K Nsp array established a single homozygous region among affected members on chromosome 14q23.1-q24.3 harboring the SMOC1 gene. Sequencing of the gene revealed a novel homozygous missense mutation (c.812G>A; p.Cys271Tyr) in the family. This is the first report of Waardenburg anophthalmia syndrome caused by a SMOC1 variant in a Pakistani population. The mutation identified in the present investigation extends the body of evidence implicating the gene SMOC-1 in causing WAS.

  6. Novel Tay-Sachs disease mutations from China.

    PubMed

    Akalin, N; Shi, H P; Vavougios, G; Hechtman, P; Lo, W; Scriver, C R; Mahuran, D; Kaplan, F

    1992-01-01

    We describe three HEXA mutations associated with infantile Tay-Sachs disease (TSD) in three unrelated nonconsanguineous Chinese families. Novel mutations were found in two of these families. The third is a previously reported mutation (G-->A transition at nt 1444) (Nakano et al., 1988). Direct sequencing of PCR products identified a novel insertion of an A after nt 547 in family 1. This change generates an early termination codon 6 bp downstream from the insertion site. Allele-specific oligonucleotide hybridization confirmed homozygosity in the proband. Single strand conformational polymorphism analysis and direct sequencing of amplified exon 13 revealed a T-->C transition at nt 1453 with the corresponding amino acid substitution W485R in the second family. This mutation creates an Fnu4HI restriction site. The proband is homozygous for this allele. When the site-specific mutagenized alpha cDNA carrying the T-->C transition at nt 1453 was expressed in COS 1 cells hexosaminidase S activity was not detectable above background. A G-->A transition at nt 1444 (exon 13) corresponding to the E482K substitution was found in the third family. This mutation occurs at a CpG dinucleotide. It has been reported in an Italian TSD proband and causes defective intracellular transport of the alpha-subunit from the rough endoplasmic reticulum to the Golgi apparatus.

  7. Temporal frequency of knockdown resistance mutations, F1534C and V1016G, in Aedes aegypti in Chiang Mai city, Thailand and the impact of the mutations on the efficiency of thermal fogging spray with pyrethroids.

    PubMed

    Plernsub, Suriya; Saingamsook, Jassada; Yanola, Jintana; Lumjuan, Nongkran; Tippawangkosol, Pongsri; Walton, Catherine; Somboon, Pradya

    2016-10-01

    In Thailand, control of dengue outbreaks is currently attained by the use of space sprays, particularly thermal fogging using pyrethroids, with the aim of killing infected Aedes mosquito vectors in epidemic areas. However, the principal dengue vector, Aedes aegypti, is resistant to pyrethroids conferred mainly by mutations in the voltage-gated sodium channel gene, F1534C and V1016G, termed knockdown resistance (kdr). The objectives of this study were to determine the temporal frequencies of F1534C and V1016G in Ae. aegypti populations in relation to pyrethroid resistance in Chiang Mai city, and to evaluate the impact of the mutations on the efficacy of thermal fogging with the pyrethroid deltamethrin. Larvae and pupae were collected from several areas around Chiang Mai city during 2011-2015 and reared to adulthood for bioassays for deltamethrin susceptibility. These revealed no trend of increasing deltamethrin resistance during the study period (mortality 58.0-69.5%, average 62.8%). This corresponded to no overall change in the frequencies of the C1534 allele (0.55-0.66, average 0.62) and G1016 allele (0.34-0.45, average 0.38), determined using allele specific amplification. Only three genotypes of kdr mutations were detected: C1534 homozygous (VV/CC); G1016/C1534 double heterozygous (VG/FC); and G1016 homozygous (GG/FF) indicating that the F1534C and V1016G mutations occurred on separate haplotypic backgrounds and a lack of recombination between them to date. The F1 progeny females were used to evaluate the efficacy of thermal fogging spray with Damthrin-SP(®) (deltamethrin+S-bioallethrin+piperonyl butoxide) using a caged mosquito bioassay. The thermal fogging spray killed 100% and 61.3% of caged mosquito bioassay placed indoors and outdoors, respectively. The outdoor spray had greater killing effect on C1534 homozygous and had partially effect on double heterozygous mosquitoes, but did not kill any G1016 homozygous mutants living outdoors. As this selection

  8. Prospective study of MTHFR genetic polymorphisms as a possible etiology of male infertility.

    PubMed

    Li, S-S; Li, J; Xiao, Z; Ren, A-G; Jin, L

    2014-03-24

    The aim of this study was to explore the relationship between 2 genetic polymorphisms of the methylenetetrahydrofolate reductase gene (MTHFR), C677T and A1298C, and determine the long-term reproductive outcome in infertile men. This was a prospective study conducted in an andrology clinic. Men with a 1-year history of infertility were assessed for the MTHFR polymorphisms at a 5-year follow-up. We compared the MTHFR C677T and A1298C polymorphisms by polymerase chain reaction-restriction fragment length polymorphism between men who did and did not bear children during follow-up. Of the 215 men who were infertile at 1 year, 82 (38.1%) remained infertile and 133 (61.9%) achieved natural conception during the 5-year follow-up, with the highest rate in the first year (32.6%). The MTHFR 677TT genotype (homozygote) was associated with a substantially increased risk of infertility during follow-up [odds ratio (OR) = 10.242; 95% confidence interval (CI) = 1.257-83.464] relative to the MTHFR 677CC genotype (wild-type). Risk of infertility was not increased by the MTHFR A1298C polymorphism alone, but was increased by the combination of polymorphisms MTHFR C677T and MTHFR A1298C (OR = 11.818; 95%CI = 1.415-98.674). The homozygous MTHFR C677T genotype was a risk factor for male infertility during 5-year follow-up, whereas a correlation between MTHFR A1298C and infertility was not observed. The MTHFR C677T and MTHFR A1298C polymorphisms had additive effects on male infertility.

  9. A Novel Nonsense Mutation in Exon 5 of KIND1 Gene in an Iranian Family with Kindler Syndrome.

    PubMed

    Heidari, Mohammad Mehdi; Khatami, Mehri; Kargar, Saeed; Azari, Mojdeh; Hoseinzadeh, Hassan; Fallah, Hamedeh

    2016-06-01

    Kindler syndrome (KS) is an autosomal recessive skin disease characterized by actual blistering, photosensitivity and a progressive poikiloderma. The disorder results from rare mutations in the KIND1 gene. This gene contains 15 exons and expresses two kindlin-1 isoforms. The aim of this investigation was to analyze mutations in the exons 1 to 15 of KIND1 gene in an Iranian family clinically affected with Kindler syndrome. The mutations analysis of 15 coding exons of KIND1 gene was performed with PCR-SSCP and direct sequencing in 14 subjects from one Iranian family clinically affected with Kindler syndrome. We identified eight new nucleotide changes in KIND1 in this family. These changes were found in g.3892delA, g.3951T>C, g.3962T>G, g.4190G>T, g.7497G>A, g.11076T>C, g.11102C>T and g.13177C>T positions. Among them, the g.13177C>T mutation resulting in the formation of a premature stop codon (Q226X) was detected only in seven affected family individuals as homozygous but was not present in 100 unrelated healthy controls. This study suggests that nonsense mutation may lead to incomplete and non-functional protein products and is pathogenic and has meaningful implications for the diagnosis of patients with Kindler syndrome.

  10. Varied clinical presentations of seven patients with mutations in CYP11A1 encoding the cholesterol side-chain cleavage enzyme, P450scc.

    PubMed

    Tee, Meng Kian; Abramsohn, Michal; Loewenthal, Neta; Harris, Mark; Siwach, Sudeep; Kaplinsky, Ana; Markus, Barak; Birk, Ohad; Sheffield, Val C; Parvari, Ruti; Pavari, Ruti; Hershkovitz, Eli; Miller, Walter L

    2013-02-01

    The cholesterol side-chain cleavage enzyme P450scc, encoded by CYP11A1, converts cholesterol to pregnenolone to initiate steroidogenesis. P450scc deficiency can disrupt adrenal and gonadal steroidogenesis, resembling congenital lipoid adrenal hyperplasia clinically and hormonally; only 12 such patients have been reported previously. We sought to expand clinical and genetic experience with P450scc deficiency. We sequenced candidate genes in 7 children with adrenal insufficiency who lacked disordered sexual development. P450scc missense mutations were recreated in the F2 vector, which expresses the fusion protein P450scc-Ferredoxin Reductase-Ferredoxin. COS-1 cells were transfected, production of pregnenolone was assayed, and apparent kinetic parameters were calculated. Previously described P450scc mutants were assayed in parallel. Four of five Bedouin children in one kindred were compound heterozygotes for mutations c.694C>T (Arg232Stop) and c.644T>C (Phe215Ser). Single-nucleotide polymorphism analysis confirmed segregation of these mutations. The fifth kindred member and another Bedouin patient presented in infancy and were homozygous for Arg232Stop. A patient from Fiji presenting in infancy was homozygous for c.358T>C (Arg120Stop). All mutations are novel. As assayed in the F2 fusion protein, P450scc Phe215Ser retained 2.5% of wild-type activity; previously described mutants Leu141Trp and Ala269Val had 2.6% and 12% of wild-type activity, respectively, and Val415Glu and c.835delA lacked detectable activity. Although P450scc is required to produce placental progesterone required to maintain pregnancy, severe mutations in P450scc are compatible with term gestation; milder P450scc mutations may present later without disordered sexual development. Enlarged adrenals usually distinguish steroidogenic acute regulatory protein deficiency from P450scc deficiency, but only DNA sequencing is definitive.

  11. Recessive HYDIN Mutations Cause Primary Ciliary Dyskinesia without Randomization of Left-Right Body Asymmetry

    PubMed Central

    Olbrich, Heike; Schmidts, Miriam; Werner, Claudius; Onoufriadis, Alexandros; Loges, Niki T.; Raidt, Johanna; Banki, Nora Fanni; Shoemark, Amelia; Burgoyne, Tom; Al Turki, Saeed; Hurles, Matthew E.; Köhler, Gabriele; Schroeder, Josef; Nürnberg, Gudrun; Nürnberg, Peter; Chung, Eddie M.K.; Reinhardt, Richard; Marthin, June K.; Nielsen, Kim G.; Mitchison, Hannah M.; Omran, Heymut

    2012-01-01

    Primary ciliary dyskinesia (PCD) is a genetically heterogeneous recessive disorder characterized by defective cilia and flagella motility. Chronic destructive-airway disease is caused by abnormal respiratory-tract mucociliary clearance. Abnormal propulsion of sperm flagella contributes to male infertility. Genetic defects in most individuals affected by PCD cause randomization of left-right body asymmetry; approximately half show situs inversus or situs ambiguous. Almost 70 years after the hy3 mouse possessing Hydin mutations was described as a recessive hydrocephalus model, we report HYDIN mutations in PCD-affected persons without hydrocephalus. By homozygosity mapping, we identified a PCD-associated locus, chromosomal region 16q21-q23, which contains HYDIN. However, a nearly identical 360 kb paralogous segment (HYDIN2) in chromosomal region 1q21.1 complicated mutational analysis. In three affected German siblings linked to HYDIN, we identified homozygous c.3985G>T mutations that affect an evolutionary conserved splice acceptor site and that subsequently cause aberrantly spliced transcripts predicting premature protein termination in respiratory cells. Parallel whole-exome sequencing identified a homozygous nonsense HYDIN mutation, c.922A>T (p.Lys307∗), in six individuals from three Faroe Island PCD-affected families that all carried an 8.8 Mb shared haplotype across HYDIN, indicating an ancestral founder mutation in this isolated population. We demonstrate by electron microscopy tomography that, consistent with the effects of loss-of-function mutations, HYDIN mutant respiratory cilia lack the C2b projection of the central pair (CP) apparatus; similar findings were reported in Hydin-deficient Chlamydomonas and mice. High-speed videomicroscopy demonstrated markedly reduced beating amplitudes of respiratory cilia and stiff sperm flagella. Like the hy3 mouse model, all nine PCD-affected persons had normal body composition because nodal cilia function is apparently

  12. CYBRD1 as a modifier gene that modulates iron phenotype in HFE p.C282Y homozygous patients.

    PubMed

    Pelucchi, Sara; Mariani, Raffaella; Calza, Stefano; Fracanzani, Anna Ludovica; Modignani, Giulia Litta; Bertola, Francesca; Busti, Fabiana; Trombini, Paola; Fraquelli, Mirella; Forni, Gian Luca; Girelli, Domenico; Fargion, Silvia; Specchia, Claudia; Piperno, Alberto

    2012-12-01

    Most patients with hereditary hemochromatosis in the Caucasian population are homozygous for the p.C282Y mutation in the HFE gene. The penetrance and expression of hereditary hemochromatosis differ largely among cases of homozygous p.C282Y. Genetic factors might be involved in addition to environmental factors. In the present study, we analyzed 50 candidate genes involved in iron metabolism and evaluated the association between 214 single nucleotide polymorphisms in these genes and three phenotypic outcomes of iron overload (serum ferritin, iron removed and transferrin saturation) in a large group of 296 p.C282Y homozygous Italians. Polymorphisms were tested for genetic association with each single outcome using linear regression models adjusted for age, sex and alcohol consumption. We found a series of 17 genetic variants located in different genes with possible additive effects on the studied outcomes. In order to evaluate whether the selected polymorphisms could provide a predictive signature for adverse phenotype, we re-evaluated data by dividing patients in two extreme phenotype classes based on the three phenotypic outcomes. We found that only a small improvement in prediction could be achieved by adding genetic information to clinical data. Among the selected polymorphisms, a significant association was observed between rs3806562, located in the 5'UTR of CYBRD1, and transferrin saturation. This variant belongs to the same haplotype block that contains the CYBRD1 polymorphism rs884409, found to be associated with serum ferritin in another population of p.C282Y homozygotes, and able to modulate promoter activity. A luciferase assay indicated that rs3806562 does not have a significant functional role, suggesting that it is a genetic marker linked to the putative genetic modifier rs884409. While our results support the hypothesis that polymorphisms in genes regulating iron metabolism may modulate penetrance of HFE-hereditary hemochromatosis, with emphasis on

  13. CYBRD1 as a modifier gene that modulates iron phenotype in HFE p.C282Y homozygous patients

    PubMed Central

    Pelucchi, Sara; Mariani, Raffaella; Calza, Stefano; Fracanzani, Anna Ludovica; Modignani, Giulia Litta; Bertola, Francesca; Busti, Fabiana; Trombini, Paola; Fraquelli, Mirella; Forni, Gian Luca; Girelli, Domenico; Fargion, Silvia; Specchia, Claudia; Piperno, Alberto

    2012-01-01

    Background Most patients with hereditary hemochromatosis in the Caucasian population are homozygous for the p.C282Y mutation in the HFE gene. The penetrance and expression of hereditary hemochromatosis differ largely among cases of homozygous p.C282Y. Genetic factors might be involved in addition to environmental factors. Design and Methods: In the present study, we analyzed 50 candidate genes involved in iron metabolism and evaluated the association between 214 single nucleotide polymorphisms in these genes and three phenotypic outcomes of iron overload (serum ferritin, iron removed and transferrin saturation) in a large group of 296 p.C282Y homozygous Italians. Polymorphisms were tested for genetic association with each single outcome using linear regression models adjusted for age, sex and alcohol consumption. Results We found a series of 17 genetic variants located in different genes with possible additive effects on the studied outcomes. In order to evaluate whether the selected polymorphisms could provide a predictive signature for adverse phenotype, we re-evaluated data by dividing patients in two extreme phenotype classes based on the three phenotypic outcomes. We found that only a small improvement in prediction could be achieved by adding genetic information to clinical data. Among the selected polymorphisms, a significant association was observed between rs3806562, located in the 5'UTR of CYBRD1, and transferrin saturation. This variant belongs to the same haplotype block that contains the CYBRD1 polymorphism rs884409, found to be associated with serum ferritin in another population of p.C282Y homozygotes, and able to modulate promoter activity. A luciferase assay indicated that rs3806562 does not have a significant functional role, suggesting that it is a genetic marker linked to the putative genetic modifier rs884409. Conclusions While our results support the hypothesis that polymorphisms in genes regulating iron metabolism may modulate penetrance of

  14. A homozygous missense variant in VWA2, encoding an interactor of the Fraser-complex, in a patient with vesicoureteral reflux.

    PubMed

    van der Ven, Amelie T; Kobbe, Birgit; Kohl, Stefan; Shril, Shirlee; Pogoda, Hans-Martin; Imhof, Thomas; Ityel, Hadas; Vivante, Asaf; Chen, Jing; Hwang, Daw-Yang; Connaughton, Dervla M; Mann, Nina; Widmeier, Eugen; Taglienti, Mary; Schmidt, Johanna Magdalena; Nakayama, Makiko; Senguttuvan, Prabha; Kumar, Selvin; Tasic, Velibor; Kehinde, Elijah O; Mane, Shrikant M; Lifton, Richard P; Soliman, Neveen; Lu, Weining; Bauer, Stuart B; Hammerschmidt, Matthias; Wagener, Raimund; Hildebrandt, Friedhelm

    2018-01-01

    Congenital anomalies of the kidney and urinary tract (CAKUT) are the most common cause (40-50%) of chronic kidney disease (CKD) in children. About 40 monogenic causes of CAKUT have so far been discovered. To date less than 20% of CAKUT cases can be explained by mutations in these 40 genes. To identify additional monogenic causes of CAKUT, we performed whole exome sequencing (WES) and homozygosity mapping (HM) in a patient with CAKUT from Indian origin and consanguineous descent. We identified a homozygous missense mutation (c.1336C>T, p.Arg446Cys) in the gene Von Willebrand factor A domain containing 2 (VWA2). With immunohistochemistry studies on kidneys of newborn (P1) mice, we show that Vwa2 and Fraser extracellular matrix complex subunit 1 (Fras1) co-localize in the nephrogenic zone of the renal cortex. We identified a pronounced expression of Vwa2 in the basement membrane of the ureteric bud (UB) and derivatives of the metanephric mesenchyme (MM). By applying in vitro assays, we demonstrate that the Arg446Cys mutation decreases translocation of monomeric VWA2 protein and increases translocation of aggregated VWA2 protein into the extracellular space. This is potentially due to the additional, unpaired cysteine residue in the mutated protein that is used for intermolecular disulfide bond formation. VWA2 is a known, direct interactor of FRAS1 of the Fraser-Complex (FC). FC-encoding genes and interacting proteins have previously been implicated in the pathogenesis of syndromic and/or isolated CAKUT phenotypes in humans. VWA2 therefore constitutes a very strong candidate in the search for novel CAKUT-causing genes. Our results from in vitro experiments indicate a dose-dependent neomorphic effect of the Arg446Cys homozygous mutation in VWA2.

  15. Leigh syndrome T8993C mitochondrial DNA mutation: Heteroplasmy and the first clinical presentation in a Vietnamese family.

    PubMed

    Weerasinghe, Chamara Arachchighe Lahiru; Bui, Bich-Hong Thi; Vu, Thu Thi; Nguyen, Hong-Loan Thi; Phung, Bao-Khanh; Nguyen, Van-Minh; Pham, Van-Anh; Cao, Vu-Hung; Phan, Tuan-Nghia

    2018-05-01

    Leigh syndrome is a rare inherited, heterogeneous and progressive neurometabolic disorder that is mainly caused by specific mutations in nuclear DNA (nDNA) or mitochondrial DNA (mtDNA). The present study reported a case of childhood Leigh syndrome with a point mutation at bp 8,993 in the mitochondrial ATPase6 gene. A 21‑month‑old male child had developed epilepsy, muscular weakness and vomiting, which was accompanied by high fever. Magnetic resonance imaging indicated typical characteristics of Leigh syndrome, including a symmetric abnormal signal in the dorsal medulla oblongata and Sylvian fissure enlargement in association with an abnormal signal in the periventricular white matter and in the putamina and caudate heads. The diagnosis was further supported with genetic tests including polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), sequencing, and quantitative PCR. The patient was found to carry a mitochondrial T8993C (m.T8993C) mutation in peripheral blood with 94.00±1.34% heteroplasmy. Eight of his relatives were also subjected to quantification of the m.T8993C mutation. The percentages of heteroplasmy in samples taken from the grandmother, mother, aunt, cousin 1, and cousin 2 were 16.33±1.67, 66.81±0.85, 71.66±3.22, 87.00±1.79, and 91.24±2.50%, respectively. The mutation was not found in samples taken from the father, the husband of the aunt, or the grandfather of the patient. The obtained data showed that the mutation was maternally inherited and accumulated through generations. Even though the heteroplasmy levels of his mother, aunt, cousin 1, and cousin 2 were relatively high (66.81‑91.24%), they remained asymptomatic, indicating that the threshold at which this mutation shows effects is high. To the best of our knowledge, this is the first report of a case of Leigh syndrome in a Vietnamese individual harboring a mtDNA mutation at the 8,993 bp site, and showing a correlation between the heteroplasmy and clinical

  16. Mutational spectrum of Xeroderma pigmentosum group A in Egyptian patients.

    PubMed

    Amr, Khalda; Messaoud, Olfa; El Darouti, Mohamad; Abdelhak, Sonia; El-Kamah, Ghada

    2014-01-01

    Xeroderma pigmentosum (XP) is a rare autosomal recessive hereditary disease characterized by hyperphotosensitivity, DNA repair defects and a predisposition to skin cancers. The most frequently occurring type worldwide is the XP group A (XPA). There is a close relationship between the clinical features that ranged from severe to mild form and the mutational site in XPA gene. The aim of this study is to carry out the mutational analysis in Egyptian patients with XP-A. This study was carried out on four unrelated Egyptian XP-A families. Clinical features were examined and direct sequencing of the coding region of XPA gene was performed in patients and their parents. Direct sequencing of the whole coding region of the XPA gene revealed the identification of two homozygous nonsense mutations: (c.553C >T; p.(Gln185)) and (c.331G>T; p.(Glu111)), which create premature, stop codon and a homodeletion (c.374delC: p.Thr125Ilefs 15) that leads to frameshift and premature translation termination. We report the identification of one novel XPA gene mutation and two known mutations in four unrelated Egyptian families with Xermoderma pigmentosum. All explored patients presented severe neurological abnormalities and have mutations located in the DNA binding domain. This report gives insight on the mutation spectrum of XP-A in Egypt. This would provide a valuable tool for early diagnosis of this severe disease. © 2013 Elsevier B.V. All rights reserved.

  17. Analysis of the surface expression of c-kit and occurrence of the c-kit Asp816Val activating mutation in T cells, B cells, and myelomonocytic cells in patients with mastocytosis.

    PubMed

    Akin, C; Kirshenbaum, A S; Semere, T; Worobec, A S; Scott, L M; Metcalfe, D D

    2000-02-01

    The Asp816Val c-kit activating mutation is detectable in the peripheral blood cells of some patients with mastocytosis and in lesional skin biopsies obtained from adult patients with urticaria pigmentosa. These observations led to the conclusion that this mutation is present in mast cells and mast cell precursors that express c-kit. However, the distribution of the Asp816Val mutation among hematopoietic lineages is unknown. To determine the distribution of the Asp816Val mutation among hematopoietic lineages and to explore its relationship to clinical disease, we examined cells bearing differentiation markers for myelomonocytic cells as well as T and B lymphocytes, in both peripheral blood and bone marrow obtained from patients with mastocytosis. The presence of Asp816Val c-kit mutation in cells magnetically sorted from peripheral blood or bone marrow according to surface differentiation markers was studied by reverse transcriptase polymerase chain reaction (RT-PCR) restriction fragment length polymorphism (RFLP) analysis. The surface expression of c-kit was determined by flow cytometry. The mutation was detectable by RT-PCR in at least one cell lineage in the bone marrow in 7 of 7 patients examined and in the peripheral blood of 11 of 11 adult patients with urticaria pigmentosa and indolent disease. The mutation was identified most frequently in B cells and myeloid cells. Flow cytometric analysis demonstrated that the differentiated cells expressing mutated c-kit were negative for surface KIT. These results are consistent with the conclusion that the c-kit Asp816Val mutation occurs in an early progenitor cell and is carried by myelomonocytic cells, T cells, and B cells in addition to mast cells. However, unlike mast cells, these myelomonocytic cells, T cells, and B cells do not concomitantly express surface c-kit and thus may be less susceptible to the effects of this mutation.

  18. Delineation of C12orf65-related phenotypes: a genotype-phenotype relationship.

    PubMed

    Spiegel, Ronen; Mandel, Hanna; Saada, Ann; Lerer, Issy; Burger, Ayala; Shaag, Avraham; Shalev, Stavit A; Jabaly-Habib, Haneen; Goldsher, Dorit; Gomori, John M; Lossos, Alex; Elpeleg, Orly; Meiner, Vardiella

    2014-08-01

    C12orf65 participates in the process of mitochondrial translation and has been shown to be associated with a spectrum of phenotypes, including early onset optic atrophy, progressive encephalomyopathy, peripheral neuropathy, and spastic paraparesis.We used whole-genome homozygosity mapping as well as exome sequencing and targeted gene sequencing to identify novel C12orf65 disease-causing mutations in seven affected individuals originating from two consanguineous families. In four family members affected with childhood-onset optic atrophy accompanied by slowly progressive peripheral neuropathy and spastic paraparesis, we identified a homozygous frame shift mutation c.413_417 delAACAA, which predicts a truncated protein lacking the C-terminal portion. In the second family, we studied three affected individuals who presented with early onset optic atrophy, peripheral neuropathy, and spastic gait in addition to moderate intellectual disability. Muscle biopsy in two of the patients revealed decreased activities of the mitochondrial respiratory chain complexes I and IV. In these patients, we identified a homozygous splice mutation, g.21043 T>A (c.282+2 T>A) which leads to skipping of exon 2. Our study broadens the phenotypic spectrum of C12orf65 defects and highlights the triad of optic atrophy, axonal neuropathy and spastic paraparesis as its key clinical features. In addition, a clear genotype-phenotype correlation is anticipated in which deleterious mutations which disrupt the GGQ-containing domain in the first coding exon are expected to result in a more severe phenotype, whereas down-stream C-terminal mutations may result in a more favorable phenotype, typically lacking cognitive impairment.

  19. Severe infantile leigh syndrome associated with a rare mitochondrial ND6 mutation, m.14487T>C.

    PubMed

    Tarnopolsky, Mark; Meaney, Brandon; Robinson, Brian; Sheldon, Katherine; Boles, Richard G

    2013-08-01

    We describe a case of severe infantile-onset complex I deficiency in association with an apparent de novo near-homoplasmic mutation (m.14487T>C) in the mitochondrial ND6 gene, which was previously associated with Leigh syndrome and other neurological disorders. The mutation was near-homoplasmic in muscle by NextGen sequencing (99.4% mutant), homoplasmic in muscle by Sanger sequencing, and it was associated with a severe complex I deficiency in both muscle and fibroblasts. This supports previous data regarding Leigh syndrome being on the severe end of a phenotypic spectrum including progressive myoclonic epilepsy, childhood-onset dystonia, bilateral striatal necrosis, and optic atrophy, depending on the proportion of mutant heteroplasmy. While the mother in all previously reported cases was heteroplasmic, the mother and brother of this case were homoplasmic for the wild-type, m.14487T. Importantly, the current data demonstrate the potential for cases of mutations that were previously reported to be homoplasmic by Sanger sequencing to be less homoplasmic by NextGen sequencing. This case underscores the importance of considering mitochondrial DNA mutations in families with a negative family history, even in offspring of those who have tested negative for a specific mtDNA mutation. Copyright © 2013 Wiley Periodicals, Inc.

  20. Two novel mutations in the BCKDK (branched-chain keto-acid dehydrogenase kinase) gene are responsible for a neurobehavioral deficit in two pediatric unrelated patients.

    PubMed

    García-Cazorla, Angels; Oyarzabal, Alfonso; Fort, Joana; Robles, Concepción; Castejón, Esperanza; Ruiz-Sala, Pedro; Bodoy, Susanna; Merinero, Begoña; Lopez-Sala, Anna; Dopazo, Joaquín; Nunes, Virginia; Ugarte, Magdalena; Artuch, Rafael; Palacín, Manuel; Rodríguez-Pombo, Pilar; Alcaide, Patricia; Navarrete, Rosa; Sanz, Paloma; Font-Llitjós, Mariona; Vilaseca, Ma Antonia; Ormaizabal, Aida; Pristoupilova, Anna; Agulló, Sergi Beltran

    2014-04-01

    Inactivating mutations in the BCKDK gene, which codes for the kinase responsible for the negative regulation of the branched-chain α-keto acid dehydrogenase complex (BCKD), have recently been associated with a form of autism in three families. In this work, two novel exonic BCKDK mutations, c.520C>G/p.R174G and c.1166T>C/p.L389P, were identified at the homozygous state in two unrelated children with persistently reduced body fluid levels of branched-chain amino acids (BCAAs), developmental delay, microcephaly, and neurobehavioral abnormalities. Functional analysis of the mutations confirmed the missense character of the c.1166T>C change and showed a splicing defect r.[520c>g;521_543del]/p.R174Gfs1*, for c.520C>G due to the presence of a new donor splice site. Mutation p.L389P showed total loss of kinase activity. Moreover, patient-derived fibroblasts showed undetectable (p.R174Gfs1*) or barely detectable (p.L389P) levels of BCKDK protein and its phosphorylated substrate (phospho-E1α), resulting in increased BCKD activity and the very rapid BCAA catabolism manifested by the patients' clinical phenotype. Based on these results, a protein-rich diet plus oral BCAA supplementation was implemented in the patient homozygous for p.R174Gfs1*. This treatment normalized plasma BCAA levels and improved growth, developmental and behavioral variables. Our results demonstrate that BCKDK mutations can result in neurobehavioral deficits in humans and support the rationale for dietary intervention. © 2014 WILEY PERIODICALS, INC.

  1. A novel homozygous missense variant in NECTIN4 (PVRL4) causing ectodermal dysplasia cutaneous syndactyly syndrome.

    PubMed

    Ahmad, Farooq; Nasir, Abdul; Thiele, Holger; Umair, Muhammad; Borck, Guntram; Ahmad, Wasim

    2018-02-12

    Ectodermal dysplasia syndactyly syndrome 1 (EDSS1) is a rare form of ectodermal dysplasia including anomalies of hair, nails, and teeth along with bilateral cutaneous syndactyly of hands and feet. In the present report, we performed a clinical and genetic characterization of a consanguineous Pakistani family with four individuals affected by EDSS1. We performed exome sequencing using DNA of one affected individual. Exome data analysis identified a novel homozygous missense variant (c.242T>C; p.(Leu81Pro)) in NECTIN4 (PVRL4). Sanger sequencing validated this variant and confirmed its cosegregation with the disease phenotype in the family members. Thus, our report adds a novel variant to the NECTIN4 mutation spectrum and contributes to the NECTIN4-related clinical characterization. © 2018 John Wiley & Sons Ltd/University College London.

  2. Complete mtDNA sequencing reveals mutations m.9185T>C and m.13513G>A in three patients with Leigh syndrome.

    PubMed

    Pelnena, Dita; Burnyte, Birute; Jankevics, Eriks; Lace, Baiba; Dagyte, Evelina; Grigalioniene, Kristina; Utkus, Algirdas; Krumina, Zita; Rozentale, Jolanta; Adomaitiene, Irina; Stavusis, Janis; Pliss, Liana; Inashkina, Inna

    2017-12-12

    The most common mitochondrial disorder in children is Leigh syndrome, which is a progressive and genetically heterogeneous neurodegenerative disorder caused by mutations in nuclear genes or mitochondrial DNA (mtDNA). In the present study, a novel and robust method of complete mtDNA sequencing, which allows amplification of the whole mitochondrial genome, was tested. Complete mtDNA sequencing was performed in a cohort of patients with suspected mitochondrial mutations. Patients from Latvia and Lithuania (n = 92 and n = 57, respectively) referred by clinical geneticists were included. The de novo point mutations m.9185T>C and m.13513G>A, respectively, were detected in two patients with lactic acidosis and neurodegenerative lesions. In one patient with neurodegenerative lesions, the mutation m.9185T>C was identified. These mutations are associated with Leigh syndrome. The present data suggest that full-length mtDNA sequencing is recommended as a supplement to nuclear gene testing and enzymatic assays to enhance mitochondrial disease diagnostics.

  3. Oxidative Stress in Dilated Cardiomyopathy Caused by MYBPC3 Mutation

    PubMed Central

    Lynch, Thomas L.; Sivaguru, Mayandi; Velayutham, Murugesan; Cardounel, Arturo J.; Michels, Michelle; Barefield, David; Govindan, Suresh; dos Remedios, Cristobal; van der Velden, Jolanda; Sadayappan, Sakthivel

    2015-01-01

    Cardiomyopathies can result from mutations in genes encoding sarcomere proteins including MYBPC3, which encodes cardiac myosin binding protein-C (cMyBP-C). However, whether oxidative stress is augmented due to contractile dysfunction and cardiomyocyte damage in MYBPC3-mutated cardiomyopathies has not been elucidated. To determine whether oxidative stress markers were elevated in MYBPC3-mutated cardiomyopathies, a previously characterized 3-month-old mouse model of dilated cardiomyopathy (DCM) expressing a homozygous MYBPC3 mutation (cMyBP-C(t/t)) was used, compared to wild-type (WT) mice. Echocardiography confirmed decreased percentage of fractional shortening in DCM versus WT hearts. Histopathological analysis indicated a significant increase in myocardial disarray and fibrosis while the second harmonic generation imaging revealed disorganized sarcomeric structure and myocyte damage in DCM hearts when compared to WT hearts. Intriguingly, DCM mouse heart homogenates had decreased glutathione (GSH/GSSG) ratio and increased protein carbonyl and lipid malondialdehyde content compared to WT heart homogenates, consistent with elevated oxidative stress. Importantly, a similar result was observed in human cardiomyopathy heart homogenate samples. These results were further supported by reduced signals for mitochondrial semiquinone radicals and Fe-S clusters in DCM mouse hearts measured using electron paramagnetic resonance spectroscopy. In conclusion, we demonstrate elevated oxidative stress in MYPBC3-mutated DCM mice, which may exacerbate the development of heart failure. PMID:26508994

  4. Recurrent truncating mutations in alanine-glyoxylate aminotransferase gene in two South Indian families with primary hyperoxaluria type 1 causing later onset end-stage kidney disease

    PubMed Central

    Dutta, A. K.; Paulose, B. K.; Danda, S.; Alexander, S.; Tamilarasi, V.; Omprakash, S.

    2016-01-01

    Primary hyperoxaluria type 1 is an autosomal recessive inborn error of metabolism due to liver-specific peroxisomal enzyme alanine-glyoxylate transaminase deficiency. Here, we describe two unrelated patients who were diagnosed to have primary hyperoxaluria. Homozygous c.445_452delGTGCTGCT (p.L151Nfs*14) (Transcript ID: ENST00000307503; human genome assembly GRCh38.p2) (HGMD ID CD073567) mutation was detected in both the patients and the parents were found to be heterozygous carriers. Our patients developed end-stage renal disease at 23 years and 35 years of age. However, in the largest series published from OxalEurope cohort, the median age of end-stage renal disease for null mutations carriers was 9.9 years, which is much earlier than our cases. Our patients had slower progressions as compared to three unrelated patients from North India and Pakistan, who had homozygous c.302T>C (p.L101P) (HGMD ID CM093792) mutation in exon 2. Further, patients need to be studied to find out if c.445_452delGTGCTGCT mutation represents a founder mutation in Southern India. PMID:27512303

  5. Malonyl CoA decarboxylase deficiency: C to T transition in intron 2 of the MCD gene.

    PubMed

    Surendran, S; Sacksteder, K A; Gould, S J; Coldwell, J G; Rady, P L; Tyring, S K; Matalon, R

    2001-09-15

    Malonyl CoA decarboxylase (MCD) is an enzyme involved in the metabolism of fatty acids synthesis. Based on reports of MCD deficiency, this enzyme is particular important in muscle and brain metabolism. Mutations in the MCD gene result in a deficiency of MCD activity, that lead to psychomotor retardation, cardiomyopathy and neonatal death. To date however, only a few patients have been reported with defects in MCD. We report here studies of a patient with MCD deficiency, who presented with hypotonia, cardiomyopathy and psychomotor retardation. DNA sequencing of MCD revealed a homozygous intronic mutation, specifically a -5 C to T transition near the acceptor site for exon 3. RT-PCR amplification of exons 2 and 3 revealed that although mRNA from a normal control sample yielded one major DNA band, the mutant mRNA sample resulted in two distinct DNA fragments. Sequencing of the patient's two RT-PCR products revealed that the larger molecular weight fragments contained exons 2 and 3 as well as the intervening intronic sequence. The smaller size band from the patient contained the properly spliced exons, similar to the normal control. Western blotting analysis of the expressed protein showed only a faint band in the patient sample in contrast to a robust band in the control. In addition, the enzyme activity of the mutant protein was lower than that of the control protein. The data indicate that homozygous mutation in intron 2 disrupt normal splicing of the gene, leading to lower expression of the MCD protein and MCD deficiency. Copyright 2001 Wiley-Liss, Inc.

  6. Mutations in the interleukin receptor IL11RA cause autosomal recessive Crouzon-like craniosynostosis

    PubMed Central

    Keupp, Katharina; Li, Yun; Vargel, Ibrahim; Hoischen, Alexander; Richardson, Rebecca; Neveling, Kornelia; Alanay, Yasemin; Uz, Elif; Elcioğlu, Nursel; Rachwalski, Martin; Kamaci, Soner; Tunçbilek, Gökhan; Akin, Burcu; Grötzinger, Joachim; Konas, Ersoy; Mavili, Emin; Müller-Newen, Gerhard; Collmann, Hartmut; Roscioli, Tony; Buckley, Michael F; Yigit, Gökhan; Gilissen, Christian; Kress, Wolfram; Veltman, Joris; Hammerschmidt, Matthias; Akarsu, Nurten A; Wollnik, Bernd

    2013-01-01

    We have characterized a novel autosomal recessive Crouzon-like craniosynostosis syndrome in a 12-affected member family from Antakya, Turkey, the presenting features of which include: multiple suture synostosis, midface hypoplasia, variable degree of exophthalmos, relative prognathism, a beaked nose, and conductive hearing loss. Homozygosity mapping followed by targeted next-generation sequencing identified a c.479+6T>G mutation in the interleukin 11 receptor alpha gene (IL11RA) on chromosome 9p21. This donor splice-site mutation leads to a high percentage of aberrant IL11RA mRNA transcripts in an affected individual and altered mRNA splicing determined by in vitro exon trapping. An extended IL11RA mutation screen was performed in a cohort of 79 patients with an initial clinical diagnosis of Crouzon syndrome, pansynostosis, or unclassified syndromic craniosynostosis. We identified mutations segregating with the disease in five families: a German patient of Turkish origin and a Turkish family with three affected sibs all of whom were homozygous for the previously identified IL11RA c.479+6T>G mutation; a family with pansynostosis with compound heterozygous missense mutations, p.Pro200Thr and p.Arg237Pro; and two further Turkish families with Crouzon-like syndrome carrying the homozygous nonsense mutations p.Tyr232* and p.Arg292*. Using transient coexpression in HEK293T and COS7 cells, we demonstrated dramatically reduced IL11-mediated STAT3 phosphorylation for all mutations. Immunofluorescence analysis of mouse Il11ra demonstrated specific protein expression in cranial mesenchyme which was localized around the coronal suture tips and in the lambdoidal suture. In situ hybridization analysis of adult zebrafish also detected zfil11ra expression in the coronal suture between the overlapping frontal and parietal plates. This study demonstrates that mutations in the IL11RA gene cause an autosomal recessive Crouzon-like craniosynostosis. PMID:24498618

  7. Evaluation of mutation screening as a first line test for the diagnosis of the primary hyperoxalurias.

    PubMed

    Rumsby, Gill; Williams, Emma; Coulter-Mackie, Marion

    2004-09-01

    A definitive diagnosis of primary hyperoxaluria type 1 (PH1) and primary hyperoxaluria type 2 (PH2) requires the measurement of alanine:glyoxylate aminotransferase (AGT) and glyoxylate reductase (GR) activities, respectively, in a liver biopsy. We have evaluated a molecular genetic approach for the diagnosis of these autosomal-recessive diseases. Polymerase chain reaction (PCR) was used to detect three common mutations in the AGXT gene (c.33_34insC, c.508G>A, and c.731T>C) and one, c.103delG, in the GRHPR gene in DNA samples from 365 unrelated individuals referred for diagnosis of PH1 and/or PH2 by liver enzyme analysis. One or more of these mutations was found in 183 (68.8%) biopsy proven cases of PH1 and PH2 with a test negative predictive value of 62% and 2%, respectively. 102 (34.1%) patients were homozygous or compound heterozygous, making a molecular diagnosis possible. Age of onset and presenting features were similar in patients homozygous for any of the four mutations. Of the AGXT homozygotes, only the c.508G>A mutant was associated with significant AGT catalytic activity and in two of these activity was in the low normal range, possibly reflecting variation in mitochondrial content of the biopsy as this particular mutation is associated with mitochondrial mistargeting. Limited mutation analysis can provide a useful first line test for PH1 and PH2 in patients in whom primary hyperoxaluria is suspected and in whom secondary causes have been excluded. Those patients in whom a single mutation, or no mutation, is found can then be selectively targeted for liver biopsy.

  8. Mutation spectrum of fork-head transcriptional factor gene (FOXL2) in Indian Blepharophimosis Ptosis Epicanthus Inversus Syndrome (BPES) patients.

    PubMed

    Kaur, Inderjeet; Hussain, Avid; Naik, Milind N; Murthy, Ramesh; Honavar, Santosh G

    2011-06-01

    The fork-head transcription factor gene (FOXL2) gene has been implicated in Blepharophimosis Ptosis Epicanthus Inversus Syndrome (BPES) type I and type II. The authors aimed to evaluate the involvement of FOXL2 in familial and sporadic cases of BPES in an Indian cohort. The present cohort comprised clinically well-characterised BPES cases that included six affected families, two sporadic cases and 60 unaffected normal controls. The 5' untranslated and coding region of FOXL2 was screened by resequencing and confirmed by restriction digestion. Further, genotype-phenotype correlations were done to understand the implications of the observed mutation. Six mutations were observed in eight cases (87.5%). These included a novel deletion (c.860delC), three previously reported duplications (c.663-692dup 30, c.672-701dup30 and c.843-859dup17), a frame shift (c.804dupC) and a homozygous missense mutation (p.E69K). The p.E69k mutation was seen in both heterozygous and homozygous form in a large four-generational family, and disease severity was found to be directly linked to the allelic dosage. Two SNPs (c.501C→T, c.536C→G) were also noted. An unusual coexistence of polycystic ovarian disease (PCOD) with BPES was also seen in one of the families. Mutations in the region downstream of the fork-head domain were predominantly responsible for BPES among Indian patients.

  9. A novel homozygous mutation in G6PC3 presenting as cyclic neutropenia and severe congenital neutropenia in the same family.

    PubMed

    Alangari, Abdullah A; Alsultan, Abdulrahman; Osman, Mohamed Elfaki; Anazi, Shamsa; Alkuraya, Fowzan S

    2013-11-01

    Patients with autosomal recessive cyclic neutropenia have no known causative genetic defect yet. Autozygosity mapping on two branches of an extended multiplex consanguineous family presenting with cyclic neutropenia or severe congenital neutropenia to look for candidate gene, followed by candidate gene selection and sequencing. A single autozygous interval on Chr17:33,901,938-45,675,414 that is exclusively shared by the affected members was identified. This interval spans 11.8 Mb and contains 30 genes. Review of these genes highlighted G6PC3 as the most likely candidate given its known role in neutrophil biology. Direct sequencing revealed a novel homozygous mutation (NM_138387.3, c.974T > G, p.Leu325Arg). Two of our patients had associated congenital defects that are known to occur in patients with G6PC3 mutations, including congenital heart disease and intermittent thrombocytopenia. Biallelic G6PC3 defects should be considered in patients with autosomal recessive cyclic neutropenia, especially those with typical associated congenital defects.

  10. Plasma lipoprotein(a) levels in patients with homozygous autosomal dominant hypercholesterolemia.

    PubMed

    Sjouke, Barbara; Yahya, Reyhana; Tanck, Michael W T; Defesche, Joep C; de Graaf, Jacqueline; Wiegman, Albert; Kastelein, John J P; Mulder, Monique T; Hovingh, G Kees; Roeters van Lennep, Jeanine E

    Patients with autosomal dominant hypercholesterolemia (ADH), caused by mutations in either low-density lipoprotein receptor (LDLR), apolipoprotein B (APOB), or proprotein convertase subtilisin-kexin type 9 (PCSK9) are characterized by high low-density lipoprotein cholesterol levels and in some studies also high lipoprotein(a) (Lp(a)) levels were observed. The question remains whether this effect on Lp(a) levels is gene-dose-dependent in individuals with either 0, 1, or 2 LDLR or APOB mutations. We set out to study whether Lp(a) levels differ among bi-allelic ADH mutation carriers, and their relatives, in the Netherlands. Bi-allelic ADH mutation carriers were identified in the database of the national referral laboratory for DNA diagnostics of inherited dyslipidemias. Family members were invited by the index cases to participate. Clinical parameters and Lp(a) levels were measured in bi-allelic ADH mutation carriers and their heterozygous and unaffected relatives. We included a total of 119 individuals; 34 bi-allelic ADH mutation carriers (20 homozygous/compound heterozygous LDLR mutation carriers (HoFH), 2 homozygous APOB mutation carriers (HoFDB), and 12 double heterozygotes for an LDLR and APOB mutation), 63 mono-allelic ADH mutation carriers (50 heterozygous LDLR [HeFH], 13 heterozygous APOB [HeFDB] mutation carriers), and 22 unaffected family members. Median Lp(a) levels in unaffected relatives, HeFH, and HoFH patients were 19.9 (11.1-41.5), 24.4 (5.9-70.6), and 47.3 (14.9-111.7) mg/dL, respectively (P = .150 for gene-dose dependency). Median Lp(a) levels in HeFDB and HoFDB patients were 50.3 (18.7-120.9) and 205.5 (no interquartile range calculated), respectively (P = .012 for gene-dose-dependency). Double heterozygous carriers of LDLR and APOB mutations had median Lp(a) levels of 27.0 (23.5-45.0), which did not significantly differ from HoFH and HoFDB patients (P = .730 and .340, respectively). A (trend toward) increased plasma Lp(a) levels in homozygous

  11. To pace or not to pace: a pilot study of four- and five-gaited Icelandic horses homozygous for the DMRT3 'Gait Keeper' mutation.

    PubMed

    Jäderkvist Fegraeus, K; Hirschberg, I; Árnason, T; Andersson, L; Velie, B D; Andersson, L S; Lindgren, G

    2017-12-01

    The Icelandic horse is a breed known mainly for its ability to perform the ambling four-beat gait 'tölt' and the lateral two-beat gait pace. The natural ability of the breed to perform these alternative gaits is highly desired by breeders. Therefore, the discovery that a nonsense mutation (C>A) in the DMRT3 gene was the main genetic factor for horses' ability to perform gaits in addition to walk, trot and canter was of great interest. Although several studies have demonstrated that homozygosity for the DMRT3 mutation is important for the ability to pace, only about 70% of the homozygous mutant (AA) Icelandic horses are reported to pace. The aim of the study was to genetically compare four- and five-gaited (i.e. horses with and without the ability to pace) AA Icelandic horses by performing a genome-wide association (GWA) analysis. All horses (n = 55) were genotyped on the 670K Axiom Equine Genotyping Array, and a GWA analysis was performed using the genabel package in r. No SNP demonstrated genome-wide significance, implying that the ability to pace goes beyond the presence of a single gene variant. Despite its limitations, the current study provides additional information regarding the genetic complexity of pacing ability in horses. However, to fully understand the genetic differences between four- and five-gaited AA horses, additional studies with larger sample materials and consistent phenotyping are needed. © 2017 Stichting International Foundation for Animal Genetics.

  12. Mutations participating in interallelic complementation in propionic acidemia

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gravel, R.A.; Akerman, B.R.; Lamhonwah, A.M.

    1994-07-01

    Deficiency of propionyl-CoA carboxylase (PCC; [alpha][sub 4][beta][sub 4]) results in the rare, autosomal recessive disease propionic acidemia. Cell fusion experiments have revealed two complementation groups, pccA and pccB, corresponding to defects of the PCCA ([alpha]-subunit) and PCCB ([beta]-subunit) genes, respectively. The pccBCC group includes subgroups, pccB and pccC, which are thought to reflect interallelic complementation between certain mutations of the PCCB gene. In this study, the authors have identified the mutations in two pccB, one pccC, and two pccBC cell lines and have deduced those alleles participating in interallelic complementation. One pccB line was a compound hetrozygote of Pro228Leu andmore » Asn536Asp. The latter mutation was also detected in a noncomplementing pccBC line. This leaves Pro228Leu responsible for complementation in the pccB cells. The second pccB line contained an insertional duplication, dupKICK140-143, and a splice mutation IVS+1 G[yields]T, located after Lys466. The authors suggest that the dupKICK mutation is the complementing allele, since the second allele is incompatible with normal splicing. The pccC line studied was homozygous for Arg410Trp, which is necessarily the complementing allele in that line. For a second pccC line, they previously had proposed that [Delta]Ile408 was the complementing allele. They now show that its second allele, [open quotes]Ins[center dot]Del[close quotes], a 14-bp deletion replaced by a 12-bp insertion beginning at codon 407, fails to complement in homozygous form. The authors conclude that the interallelic complementation results from mutations in domains that can interact between [beta]-subunits in the PCC heteromer to restore enzymatic function. On the basis of sequence homology with the Propionibacterium shermanii transcarboxylase 12S subunit, they suggest that the pccC domain, defined by Ile408 and Arg410, may involve the propionyl-CoA binding site. 37 refs., 5 figs., 2 tabs.« less

  13. Novel Founder Mutation in FANCA Gene (c.3446_3449dupCCCT) Among Romani Patients from the Balkan Region.

    PubMed

    Dimishkovska, Marija; Kotori, Vjosa Mulliqi; Gucev, Zoran; Kocheva, Svetlana; Polenakovic, Momir; Plaseska-Karanfilska, Dijana

    2018-01-20

    Fanconi anemia is a rare autosomal recessive or X-linked disorder characterised by clinical and genetic heterogeneity. Most fanconi anemia patients harbour homozygous or double heterozygous mutations in the FANCA (60-65%), FANCC (10-15%), FANCG (~10%) or FANCD2 (3-6%) genes. We have already reported the FANCA variant c.190-256_283+1680del2040dupC as a founder mutation among Macedonian fanconi anemia patients of Gypsy-like ethnic origin. Here, we present a novel FANCA mutation in two patients from Macedonia and Kosovo. The novel FANCA mutation c.3446_3449dupCCCT was identified in two fanconi anemia patients with Romany ethnicity; a 2-year-old girl from Macedonia who is a compound heterozygote for a previously reported FANCA c.190-256_283+1680del2040dupC and the novel mutation and a 10-year-old girl from Kosovo who is a homozygote for the novel FANCA c.3446_3449dupCCCT mutation. The novel mutation is located in exon 35 in the FAAP20-binding domain which plays a crucial role in the FANCA -FAAP20 interaction and is required for integrity of the fanconi anemia pathway. The finding of the FANCA c.3446_3449dupCCCT mutation in two unrelated FA patients with Romani ethnicity from Macedonia and Kosovo suggests it is a founder mutation in the Romani population living in the Balkan region.

  14. Detection of c. -32T>G (IVS1-13T>G) mutation of Pompe disease by real-time PCR in dried blood spot specimen.

    PubMed

    Bobillo Lobato, Joaquin; Sánchez Peral, Blas A; Durán Parejo, Pilar; Jiménez Jiménez, Luis M

    2013-03-15

    Pompe disease, or acid maltase deficiency, is a genetic muscle disorder caused by mutations in the gene encoding the acid alpha-glucosidase (GAA) enzyme, which is essential for the degradation of glycogen to glucose in lysosomes. The wide clinical variability is resulted from genetic heterogeneity, and many different mutations of the GAA gene have been reported. Some of these mutations are associated with specific phenotypes, such as the c. -32T>G (IVS1-13T>G) mutation seen in late-onset Pompe disease. We used a real-time PCR, after genomic DNA extraction isolated from DBS (dried blood spots) and PCR amplification. Our results successfully detected in controls and patients have been 100% concordant with sequencing results. This assay combines simple sample processing and rapid analysis and it allows to detect the patients with a milder form and slower progression of this disease with a high reliability. Copyright © 2013 Elsevier B.V. All rights reserved.

  15. Expanding sialidosis spectrum by genome-wide screening: NEU1 mutations in adult-onset myoclonus.

    PubMed

    Canafoglia, Laura; Robbiano, Angela; Pareyson, Davide; Panzica, Ferruccio; Nanetti, Lorenzo; Giovagnoli, Anna Rita; Venerando, Anna; Gellera, Cinzia; Franceschetti, Silvana; Zara, Federico

    2014-06-03

    To identify the genetic cause of a familial form of late-onset action myoclonus in 2 unrelated patients. Both probands had 2 siblings displaying a similar disorder. Extensive laboratory examinations, including biochemical assessment for urine sialic acid in the 2 probands, were negative. Exome sequencing was performed in the probands using an Illumina platform. Segregation analysis of putative mutations was performed in all family members by standard Sanger sequencing protocols. NEU1 mutations were detected in 3 siblings of each family with prominent cortical myoclonus presenting in the third decade of life and having a mild and slowly progressive course. They did not have macular cherry-red spot and their urinary sialic acid excretion was within normal values. Genetic analysis demonstrated a homozygous mutation in family 1 (c.200G>T, p.S67I) and 2 compound heterozygous mutations in family 2 (c.679G>A, p.G227R; c.913C>T, p.R305C). Our observation indicates that sialidosis should be suspected and the NEU1 gene analyzed in patients with isolated action myoclonus presenting in adulthood in the absence of other typical clinical and laboratory findings. © 2014 American Academy of Neurology.

  16. Biallelic Mutations in MRPS34 Lead to Instability of the Small Mitoribosomal Subunit and Leigh Syndrome.

    PubMed

    Lake, Nicole J; Webb, Bryn D; Stroud, David A; Richman, Tara R; Ruzzenente, Benedetta; Compton, Alison G; Mountford, Hayley S; Pulman, Juliette; Zangarelli, Coralie; Rio, Marlene; Boddaert, Nathalie; Assouline, Zahra; Sherpa, Mingma D; Schadt, Eric E; Houten, Sander M; Byrnes, James; McCormick, Elizabeth M; Zolkipli-Cunningham, Zarazuela; Haude, Katrina; Zhang, Zhancheng; Retterer, Kyle; Bai, Renkui; Calvo, Sarah E; Mootha, Vamsi K; Christodoulou, John; Rötig, Agnes; Filipovska, Aleksandra; Cristian, Ingrid; Falk, Marni J; Metodiev, Metodi D; Thorburn, David R

    2017-08-03

    The synthesis of all 13 mitochondrial DNA (mtDNA)-encoded protein subunits of the human oxidative phosphorylation (OXPHOS) system is carried out by mitochondrial ribosomes (mitoribosomes). Defects in the stability of mitoribosomal proteins or mitoribosome assembly impair mitochondrial protein translation, causing combined OXPHOS enzyme deficiency and clinical disease. Here we report four autosomal-recessive pathogenic mutations in the gene encoding the small mitoribosomal subunit protein, MRPS34, in six subjects from four unrelated families with Leigh syndrome and combined OXPHOS defects. Whole-exome sequencing was used to independently identify all variants. Two splice-site mutations were identified, including homozygous c.321+1G>T in a subject of Italian ancestry and homozygous c.322-10G>A in affected sibling pairs from two unrelated families of Puerto Rican descent. In addition, compound heterozygous MRPS34 mutations were identified in a proband of French ancestry; a missense (c.37G>A [p.Glu13Lys]) and a nonsense (c.94C>T [p.Gln32 ∗ ]) variant. We demonstrated that these mutations reduce MRPS34 protein levels and the synthesis of OXPHOS subunits encoded by mtDNA. Examination of the mitoribosome profile and quantitative proteomics showed that the mitochondrial translation defect was caused by destabilization of the small mitoribosomal subunit and impaired monosome assembly. Lentiviral-mediated expression of wild-type MRPS34 rescued the defect in mitochondrial translation observed in skin fibroblasts from affected subjects, confirming the pathogenicity of MRPS34 mutations. Our data establish that MRPS34 is required for normal function of the mitoribosome in humans and furthermore demonstrate the power of quantitative proteomic analysis to identify signatures of defects in specific cellular pathways in fibroblasts from subjects with inherited disease. Copyright © 2017 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  17. Treatment of homozygous familial hypercholesterolaemia in paediatric patients: A monocentric experience.

    PubMed

    Buonuomo, Paola S; Macchiaiolo, Marina; Leone, Giovanna; Valente, Paola; Mastrogiorgio, Gerarda; Gnazzo, Maria; Rana, Ippolita; Gonfiantini, Michaela V; Gagliardi, Maria G; Romano, Francesca; Bartuli, Andrea

    2018-01-01

    Background Homozygous familial hypercholesterolaemia is a rare life-threatening disease characterized by markedly elevated low-density lipoprotein cholesterol (LDL-C) concentrations and accelerated atherosclerosis. The presence of double gene defects in the LDL-Receptor, either the same defect (homozygous) or two different LDL-raising mutations (compound heterozygotes) or other variants, identify the homozygous phenotype (HopFH). Apheresis is a procedure in which plasma is separated from red blood cells before the physical removal of LDL-C or the LDL-C is directly removed from whole blood. It is currently the treatment of choice for patients with HopFH whose LDL-C levels are not able to be reduced to target levels with conventional lipid-lowering drug therapy. Design The aim of this study is to report a cohort of six paediatric patients and to evaluate the long term efficacy of combined medical therapy and LDL-apheresis on LDL-C reduction. Methods We collected data from six children with confirmed diagnosis of HopFH (two females and four males; age range at diagnosis 3-8 years, mean 6 ± 1 years) from a single clinical hospital in Italy from 2007 to 2017. Results Clinical manifestations and outcomes may greatly vary in children with HopFH. Medical therapy and LDL-apheresis for the severe form should be started promptly in order to prevent cardiovascular disease. Conclusions Lipoprotein apheresis is a very important tool in managing patients with HopFH at high risk of cardiovascular disease. Based on our experience and the literature data, the method is feasible in very young children, efficient regarding biological results and cardiac events, and safe with minor side-effects and technical problems. We advise treating homozygous and compound heterozygous children as soon as possible.

  18. Identification of a pathogenic FTO mutation by next-generation sequencing in a newborn with growth retardation and developmental delay.

    PubMed

    Daoud, Hussein; Zhang, Dong; McMurray, Fiona; Yu, Andrea; Luco, Stephanie M; Vanstone, Jason; Jarinova, Olga; Carson, Nancy; Wickens, James; Shishodia, Shifali; Choi, Hwanho; McDonough, Michael A; Schofield, Christopher J; Harper, Mary-Ellen; Dyment, David A; Armour, Christine M

    2016-03-01

    A homozygous loss-of-function mutation p.(Arg316Gln) in the fat mass and obesity-associated (FTO) gene, which encodes for an iron and 2-oxoglutarate-dependent oxygenase, was previously identified in a large family in which nine affected individuals present with a lethal syndrome characterised by growth retardation and multiple malformations. To date, no other pathogenic mutation in FTO has been identified as a cause of multiple congenital malformations. We investigated a 21-month-old girl who presented distinctive facial features, failure to thrive, global developmental delay, left ventricular cardiac hypertrophy, reduced vision and bilateral hearing loss. We performed targeted next-generation sequencing of 4813 clinically relevant genes in the patient and her parents. We identified a novel FTO homozygous missense mutation (c.956C>T; p.(Ser319Phe)) in the affected individual. This mutation affects a highly conserved residue located in the same functional domain as the previously characterised mutation p.(Arg316Gln). Biochemical studies reveal that p.(Ser319Phe) FTO has reduced 2-oxoglutarate turnover and N-methyl-nucleoside demethylase activity. Our findings are consistent with previous reports that homozygous mutations in FTO can lead to rare growth retardation and developmental delay syndrome, and further support the proposal that FTO plays an important role in early development of human central nervous and cardiovascular systems. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  19. Relative high frequency of the c.255delA parkin gene mutation in Spanish patients with autosomal recessive parkinsonism

    PubMed Central

    Munoz, E; Tolosa, E; Pastor, P; Marti, M; Valldeoriola, F; Campdelacreu, J; Oliva, R

    2002-01-01

    Objectives: To search for the presence of parkin gene mutations in Spanish patients with Parkinson's disease (PD) and characterise the phenotype associated with these mutations. Methods: Thirty seven PD patients with either early onset or autosomal recessive pattern of inheritance were selected for genetic study. Results: Mutations were identified in seven index patients (19%). Homozygous mutations were detected in six patients and a heterozygous mutation in one. The age at onset was lower in patients with mutations than in patients without mutations. Dystonia at onset was present in two patients with parkin gene mutations. The disease began in two patients with postural tremor in the upper limbs mimicking essential tremor. Four patients exhibited a long term response to dopamine agonists. The c.255delA mutation was identified in four unrelated families. This is a frameshift mutation leading to protein truncation. Conclusions: Parkin gene mutations are present in Spanish patients with early onset and/or an autosomal recessive parkinsonism. The c.255delA is the most frequent mutation found, suggesting a relative high prevalence in the Spanish population. PMID:12397156

  20. Founder Fukutin mutation causes Walker-Warburg syndrome in four Ashkenazi Jewish families.

    PubMed

    Chang, Wendy; Winder, Thomas L; LeDuc, Charles A; Simpson, Lynn L; Millar, William S; Dungan, Jeffrey; Ginsberg, Norman; Plaga, Stacey; Moore, Steven A; Chung, Wendy K

    2009-06-01

    Walker-Warburg syndrome (WWS) is a genetically heterogeneous congenital muscular dystrophy caused by abnormal glycosylation of alpha-dystroglycan (alpha-DG) that is associated with brain malformations and eye anomalies. The Fukutin (FKTN) gene, which causes autosomal recessively inherited WWS is most often associated with Fukuyama congenital muscular dystrophy in Japan. We describe the clinical features of four nonconsanguinous Ashkenazi Jewish families with WWS and identify the underlying genetic basis for WWS. We screened for mutations in POMGnT1, POMT1, POMT2, and FKTN, genes causing WWS, by dideoxy sequence analysis. We identified an identical homozygous c.1167insA mutation in the FKTN gene on a common haplotype in all four families and identified 2/299 (0.7%) carriers for the c.1167insA mutation among normal American Ashkenazi Jewish adults. These data suggest that the c.1167insA FKTN mutation described by us is a founder mutation that can be used to target diagnostic testing and carrier screening in the Ashkenazi Jewish population. Copyright (c) 2009 John Wiley & Sons, Ltd.

  1. A Novel Dominant Hyperekplexia Mutation Y705C Alters Trafficking and Biochemical Properties of the Presynaptic Glycine Transporter GlyT2*

    PubMed Central

    Giménez, Cecilio; Pérez-Siles, Gonzalo; Martínez-Villarreal, Jaime; Arribas-González, Esther; Jiménez, Esperanza; Núñez, Enrique; de Juan-Sanz, Jaime; Fernández-Sánchez, Enrique; García-Tardón, Noemí; Ibáñez, Ignacio; Romanelli, Valeria; Nevado, Julián; James, Victoria M.; Topf, Maya; Chung, Seo-Kyung; Thomas, Rhys H.; Desviat, Lourdes R.; Aragón, Carmen; Zafra, Francisco; Rees, Mark I.; Lapunzina, Pablo; Harvey, Robert J.; López-Corcuera, Beatriz

    2012-01-01

    Hyperekplexia or startle disease is characterized by an exaggerated startle response, evoked by tactile or auditory stimuli, producing hypertonia and apnea episodes. Although rare, this orphan disorder can have serious consequences, including sudden infant death. Dominant and recessive mutations in the human glycine receptor (GlyR) α1 gene (GLRA1) are the major cause of this disorder. However, recessive mutations in the presynaptic Na+/Cl−-dependent glycine transporter GlyT2 gene (SLC6A5) are rapidly emerging as a second major cause of startle disease. In this study, systematic DNA sequencing of SLC6A5 revealed a new dominant GlyT2 mutation: pY705C (c.2114A→G) in transmembrane domain 11, in eight individuals from Spain and the United Kingdom. Curiously, individuals harboring this mutation show significant variation in clinical presentation. In addition to classical hyperekplexia symptoms, some individuals had abnormal respiration, facial dysmorphism, delayed motor development, or intellectual disability. We functionally characterized this mutation using molecular modeling, electrophysiology, [3H]glycine transport, cell surface expression, and cysteine labeling assays. We found that the introduced cysteine interacts with the cysteine pair Cys-311–Cys-320 in the second external loop of GlyT2. This interaction impairs transporter maturation through the secretory pathway, reduces surface expression, and inhibits transport function. Additionally, Y705C presents altered H+ and Zn2+ dependence of glycine transport that may affect the function of glycinergic neurotransmission in vivo. PMID:22753417

  2. Central nervous system involvement in severe congenital neutropenia: neurological and neuropsychological abnormalities associated with specific HAX1 mutations.

    PubMed

    Carlsson, G; van't Hooft, I; Melin, M; Entesarian, M; Laurencikas, E; Nennesmo, I; Trebińska, A; Grzybowska, E; Palmblad, J; Dahl, N; Nordenskjöld, M; Fadeel, B; Henter, J-I

    2008-10-01

    Homozygous mutations in the HAX1 gene were recently identified in severe congenital neutropenia patients belonging to the original Kostmann family in northern Sweden. Our observations suggested that these patients also develop neurological and neuropsychological symptoms. Detailed clinical studies and mutation analyses were performed in the surviving patients belonging to the Kostmann kindred and in two patients not related to this family, along with studies of HAX1 splice variant expression in normal human tissues. Five of six Kostmann family patients and one other patient from northern Sweden harboured homozygous HAX1 mutations (568C-->T, Q190X) and one carried a heterozygous ELA2 gene mutation. One Swedish patient of Kurdish extraction carried alternative homozygous HAX1 mutations (131G-->A, W44X). All the three patients with Q190X mutations who were alive and available for evaluation developed neurological disease with decreased cognitive function, and three of four patients who reached 10 years developed epilepsy. In contrast, the patients with the ELA2 and W44X HAX1 mutations, respectively, showed no obvious neurological abnormalities. Moreover, two alternative HAX1 splice variants were identified in normal human tissues, including the brain. Both transcripts contained exon 5, harbouring the Q190X mutation, whereas the 5' end of exon 2 containing the W44X mutation was spliced out from the second transcript. We describe neurological and neuropsychological abnormalities for the first time in Kostmann disease patients. These central nervous system symptoms appear to be associated with specific HAX1 mutations.

  3. Expanding the mutation and clinical spectrum of Roberts syndrome.

    PubMed

    Afifi, Hanan H; Abdel-Salam, Ghada M H; Eid, Maha M; Tosson, Angie M S; Shousha, Wafaa Gh; Abdel Azeem, Amira A; Farag, Mona K; Mehrez, Mennat I; Gaber, Khaled R

    2016-07-01

    Roberts syndrome and SC phocomelia syndrome are rare autosomal recessive genetic disorders representing the extremes of the spectrum of severity of the same condition, caused by mutations in ESCO2 gene. We report three new patients with Roberts syndrome from three unrelated consanguineous Egyptian families. All patients presented with growth retardation, mesomelic shortening of the limbs more in the upper than in the lower limbs and microcephaly. Patients were subjected to clinical, cytogenetic and radiologic examinations. Cytogenetic analysis showed the characteristic premature separation of centromeres and puffing of heterochromatic regions. Further, sequencing of the ESCO2 gene identified a novel mutation c.244_245dupCT (p.T83Pfs*20) in one family besides two previously reported mutations c.760_761insA (p.T254Nfs*27) and c.764_765delTT (p.F255Cfs*25). All mutations were in homozygous state, in exon 3. The severity of the mesomelic shortening of the limbs and craniofacial anomalies showed variability among patients. Interestingly, patient 1 had abnormal skin hypopigmentation. Serial fetal ultrasound examinations and measurements of long bones diagnosed two affected fetuses in two of the studied families. A literature review and case comparison was performed. In conclusion, we report a novel ESCO2 mutation and expand the clinical spectrum of Roberts syndrome. © 2015 Japanese Teratology Society.

  4. Frequency of mutations in PROP-1 gene in Turkish children with combined pituitary hormone deficiency.

    PubMed

    Kandemir, Nurgün; Vurallı, Doğuş; Taşkıran, Ekim; Gönç, Nazlı; Özön, Alev; Alikaşifoğlu, Ayfer; Yılmaz, Engin

    2012-01-01

    Mutations in the prophet of Pit-1 (PROP-1) gene are responsible for most of the cases of combined pituitary hormone deficiencies (CPHD). We performed this study to determine the prevalence of PROP-1 mutations in a group of Turkish children with CPHD. Fifty-three children with the diagnosis of CPHD were included in this study. Clinical data were obtained from medical files, and hormonal evaluation and genetic screening for PROP-1 mutations were performed. A homozygous S109X mutation was found in the second exon in two brothers, and they had growth hormone (GH) and thyroid-stimulating hormone (TSH) deficiencies and normal prolactin levels. In the third exon of the PROP-1 gene, a heterozygous A142T polymorphism was found in 14 patients and a homozygous A142T polymorphism was found in 3 patients. In the first exon, a homozygous A9A polymorphism was found in 7 patients and a heterozygous A9A polymorphism was found in 31 patients. We assumed that mutations in the PROP-1 gene in cases with CPHD were expected to be more prevalent in our population due to consanguinity, but it was found that these mutations were far less than expected and that it was rare in non-familial cases.

  5. Odonto-onycho-dermal dysplasia in a patient homozygous for a WNT10A nonsense mutation and mild manifestations of ectodermal dysplasia in carriers of the mutation.

    PubMed

    Krøigård, Anne Bruun; Clemmensen, Ole; Gjørup, Hans; Hertz, Jens Michael; Bygum, Anette

    2016-03-10

    Odonto-onycho-dermal dysplasia (OODD) is a rare form of ectodermal dysplasia characterized by severe oligodontia, onychodysplasia, palmoplantar hyperkeratosis, dry skin, hypotrichosis, and hyperhidrosis of the palms and soles. The ectodermal dysplasias resulting from biallelic mutations in the WNT10A gene result in highly variable phenotypes, ranging from isolated tooth agenesis to OODD and Schöpf-Schulz-Passarge syndrome (SSPS). We identified a female patient, with consanguineous parents, who was clinically diagnosed with OODD. Genetic testing showed that she was homozygous for a previously reported pathogenic mutation in the WNT10A gene, c.321C > A, p.Cys107*. The skin and nail abnormalities were for many years interpreted as psoriasis and treated accordingly. A thorough clinical examination revealed hypotrichosis and hyperhidrosis of the soles and dental examination revealed agenesis of permanent teeth except the two maxillary central incisors. Skin biopsies from the hyperkeratotic palms and soles showed the characteristic changes of eccrine syringofibroadenomatosis, which has been described in patients with ectodermal dysplasias. Together with a family history of tooth anomalies, this lead to the clinical suspicion of a hereditary ectodermal dysplasia. This case illustrates the challenges of diagnosing ectodermal dysplasia like OODD and highlights the relevance of interdisciplinary cooperation in the diagnosis of rare conditions.

  6. The tRNA(Gly) T10003C mutation in mitochondrial haplogroup M11b in a Chinese family with diabetes decreases the steady-state level of tRNA(Gly), increases aberrant reactive oxygen species production, and reduces mitochondrial membrane potential.

    PubMed

    Li, Wei; Wen, Chaowei; Li, Weixing; Wang, Hailing; Guan, Xiaomin; Zhang, Wanlin; Ye, Wei; Lu, Jianxin

    2015-10-01

    Mitochondrial diabetes originates mainly from mutations located in maternally transmitted, mitochondrial tRNA-coding genes. In a genetic screening program of type 2 diabetes conducted with a Chinese Han population, we found one family with suggestive maternally transmitted diabetes. The proband's mitochondrial genome was analyzed using DNA sequencing. Total 42 known nucleoside changes and 1 novel variant were identified, and the entire mitochondrial DNA sequence was assigned to haplogroup M11b. Phylogenetic analysis showed that a homoplasmic mutation, 10003T>C transition, occurred at the highly conserved site in the gene encoding tRNA(Gly). Using a transmitochondrial cybrid cell line harboring this mutation, we observed that the steady-state level of tRNA(Gly) significantly affected and the amount of tRNA(Gly) decreased by 97%, production of reactive oxygen species was enhanced, and mitochondrial membrane potential, mtDNA copy number and cellular oxygen consumption rate were remarkably decreased compared with wild-type cybrid cells. The homoplasmic 10003T>C mutation in the mitochondrial tRNA(Gly) gene suggested to be as a pathogenesis-related mutation which might contribute to the maternal inherited diabetes in the Han Chinese family.

  7. Spectrum of mutations in RARS-T patients includes TET2 and ASXL1 mutations.

    PubMed

    Szpurka, Hadrian; Jankowska, Anna M; Makishima, Hideki; Bodo, Juraj; Bejanyan, Nelli; Hsi, Eric D; Sekeres, Mikkael A; Maciejewski, Jaroslaw P

    2010-08-01

    While a majority of patients with refractory anemia with ring sideroblasts and thrombocytosis harbor JAK2V617F and rarely MPLW515L, JAK2/MPL-negative cases constitute a diagnostic problem. 23 RARS-T cases were investigated applying immunohistochemical phospho-STAT5, sequencing and SNP-A-based karyotyping. Based on the association of TET2/ASXL1 mutations with MDS/MPN we studied molecular pattern of these genes. Two patients harbored ASXL1 and another 2 TET2 mutations. Phospho-STAT5 activation was present in one mutated TET2 and ASXL1 case. JAK2V617F/MPLW515L mutations were absent in TET2/ASXL1 mutants, indicating that similar clinical phenotype can be produced by various MPN-associated mutations and that additional unifying lesions may be present in RARS-T. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

  8. Association of HFE gene C282Y and H63D mutations with liver cirrhosis in the Lithuanian population.

    PubMed

    Juzėnas, Simonas; Kupčinskas, Juozas; Valantienė, Irena; Šumskienė, Jolanta; Petrenkienė, Vitalija; Kondrackienė, Jūrate; Kučinskas, Laimutis; Kiudelis, Gediminas; Skiecevičienė, Jurgita; Kupčinskas, Limas

    2016-01-01

    Liver cirrhosis is the end-stage disease of chronic liver injury. Due to differences in the natural course of chronic liver diseases, identification of genetic factors that influence individual outcomes is warranted. HFE-linked hereditary hemochromatosis (HH) predisposes disease progression to cirrhosis; however, the role of heterozygous C282Y or H63D mutations in the development of cirrhosis in the presence of other etiological factors is still debated. The aim of this study was to determine the association between heterozygous C282Y and H63D mutations and non-HH liver cirrhosis in Lithuanian population. The patient cohort consisted of 209 individuals. Diagnosis of cirrhosis was confirmed by clinical, laboratory parameters, liver biopsy, and radiological imaging. Control samples were obtained from 1005 randomly selected unrelated healthy individuals. HFE gene mutations were determined using the PCR-RFLP method. The most common causes of cirrhosis were hepatitis C (33.9%), hepatitis B (13.6%), and alcohol (25.8%). C282Y allele was associated with the presence of cirrhosis (OR=2.07; P=0.005); this was also observed under recessive model for C282Y (OR=2.06, P=0.008). The prevalence of C282Y allele was higher in cirrhotic men than in controls (7.0% vs. 2.8%, P=0.002). The carriage of H63D risk allele (OR=1.54; P=0.02), heterozygous C282Y/wt and homozygous H63D/H63D genotypes were associated with liver cirrhosis in males (OR=2.48, P=0.008, and OR=4.13, P=0.005, respectively). Heterozygous C282Y mutation of the HFE gene was associated with liver cirrhosis in the Lithuanian population. In gender-related analysis, heterozygous C282Y and homozygous H63D mutations were linked to liver cirrhosis in men, not in women. Copyright © 2016 The Lithuanian University of Health Sciences. Production and hosting by Elsevier Urban & Partner Sp. z o.o. All rights reserved.

  9. MTRR A66G, RFC1 G80A, and MTHFR C677T and A1298C Polymorphisms and Disease Activity in Mexicans with Rheumatoid Arthritis Treated with Methotrexate.

    PubMed

    González-Mercado, Mirna Gisel; Rivas, Fernando; Gallegos-Arreola, M Patricia; Morán-Moguel, M Cristina; Salazar-Páramo, Mario; González-López, Laura; Gámez-Nava, J Iván; Muñoz-Valle, J Francisco; Medina-Coss Y León, Ricardo; González-Mercado, Anahí; Aceves, Mario A; Dávalos, Nory O; Macías-Chumacera, Agustín; Dávalos, Ingrid P

    2017-11-01

    To investigate the relationships of polymorphisms in genes whose protein products are related in the metabolic pathway of folic acid, particularly MTRR A66G, RFC1 G80A, and MTHFR C677T and A1298C, and disease activity in Mexican patients with rheumatoid arthritis (RA) treated with methotrexate (MTX). Sixty-eight patients with RA were included in the study who were being treated with MTX, either with or without other drugs. In addition to general data, disease activity was measured by the disease activity score 28 (DAS28). Single nucleotide polymorphisms (SNPs) genotyping was performed by allelic discrimination using real-time polymerase chain reaction. Differences in genotype (homozygotic or heterozygotic for each allele), allele distributions, and phenotype were not statistically different between the RA group and control populations. We did not find any association between the studied polymorphisms and disease activity nor with the intragroup variables (e.g., clinical activity, body mass index, and single- or combined-drug treatment) or between genetic markers; we also did not find any association within the RA group or between the RA group and control populations. Additional studies of more polymorphisms related to this or other metabolic pathways are required to determine the influence of genetics on disease activity in RA.

  10. Cardiac muscle activation blunted by a mutation to the regulatory component, troponin T.

    PubMed

    Kobayashi, Minae; Debold, Edward P; Turner, Matthew A; Kobayashi, Tomoyoshi

    2013-09-06

    The striated muscle thin filament comprises actin, tropomyosin, and troponin. The Tn complex consists of three subunits, troponin C (TnC), troponin I (TnI), and troponin T (TnT). TnT may serve as a bridge between the Ca(2+) sensor (TnC) and the actin filament. In the short helix preceding the IT-arm region, H1(T2), there are known dilated cardiomyopathy-linked mutations (among them R205L). Thus we hypothesized that there is an element in this short helix that plays an important role in regulating the muscle contraction, especially in Ca(2+) activation. We mutated Arg-205 and several other amino acid residues within and near the H1(T2) helix. Utilizing an alanine replacement method to compare the effects of the mutations, the biochemical and mechanical impact on the actomyosin interaction was assessed by solution ATPase activity assay, an in vitro motility assay, and Ca(2+) binding measurements. Ca(2+) activation was markedly impaired by a point mutation of the highly conserved basic residue R205A, residing in the short helix H1(T2) of cTnT, whereas the mutations to nearby residues exhibited little effect on function. Interestingly, rigor activation was unchanged between the wild type and R205A TnT. In addition to the reduction in Ca(2+) sensitivity observed in Ca(2+) binding to the thin filament, myosin S1-ADP binding to the thin filament was significantly affected by the same mutation, which was also supported by a series of S1 concentration-dependent ATPase assays. These suggest that the R205A mutation alters function through reduction in the nature of cooperative binding of S1.

  11. EDAR-induced hypohidrotic ectodermal dysplasia: a clinical study on signs and symptoms in individuals with a heterozygous c.1072C > T mutation

    PubMed Central

    2014-01-01

    Background Mutations in the EDAR-gene cause hypohidrotic ectodermal dysplasia, however, the oral phenotype has been described in a limited number of cases. The aim of the present study was to clinically describe individuals with the c.1072C > T mutation (p. Arg358X) in the EDAR gene with respect to dental signs and saliva secretion, symptoms from other ectodermal structures and to assess orofacial function. Methods Individuals in three families living in Sweden, where some members had a known c.1072C > T mutation in the EDAR gene with an autosomal dominant inheritance (AD), were included in a clinical investigation on oral signs and symptoms and self-reported symptoms from other ectodermal structures (n = 37). Confirmation of the c.1072C > T mutation in the EDAR gene were performed by genomic sequencing. Orofacial function was evaluated with NOT-S. Results The mutation was identified in 17 of 37 family members. The mean number of missing teeth due to agenesis was 10.3 ± 4.1, (range 4–17) in the mutation group and 0.1 ± 0.3, (range 0–1) in the non-mutation group (p < 0.01). All individuals with the mutation were missing the maxillary lateral incisors and one or more of the mandibular incisors; and 81.3% were missing all four. Stimulated saliva secretion was 0.9 ± 0.5 ml/min in the mutation group vs 1.7 ± 0.6 ml/min in the non-mutation group (p < 0.01). Reduced ability to sweat was reported by 82% in the mutation group and by 20% in the non-mutation group (p < 0.01). The mean NOT-S score was 3.0 ± 1.9 (range 0–6) in the mutation group and 1.5 ± 1.1 (range 0–5) in the non-mutation group (p < 0.01). Lisping was present in 56% of individuals in the mutation group. Conclusions Individuals with a c.1072C > T mutation in the EDAR-gene displayed a typical pattern of congenitally missing teeth in the frontal area with functional consequences. They therefore have a need for special attention in dental

  12. CHEK2 1100delC, IVS2+1G>A and I157T mutations are not present in colorectal cancer cases from Turkish population.

    PubMed

    Bayram, Süleyman; Topaktaş, Mehmet; Akkız, Hikmet; Bekar, Aynur; Akgöllü, Ersin

    2012-10-01

    The cell cycle checkpoint kinase 2 (CHEK2) protein participates in the DNA damage response in many cell types. Germline mutations in CHEK2 (1100delC, IVS2+1G>A and I157T) have been impaired serine/threonine kinase activity and associated with a range of cancer types. This hospital-based case-control study aimed to investigate whether CHEK2 1100delC, IVS2+1G>A and I157T mutations play an important role in the development of colorectal cancer (CRC) in Turkish population. A total of 210 CRC cases and 446 cancer-free controls were genotyped for CHEK2 mutations by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and allele specific-polymerase chain reaction (AS-PCR) methods. We did not find the CHEK2 1100delC, IVS2+1G>A and I157T mutations in any of the Turkish subjects. Our result demonstrate for the first time that CHEK2 1100delC, IVS2+1G>A and I157T mutations have not been agenetic susceptibility factor for CRC in the Turkish population. Overall, our data suggest that genotyping of CHEK2 mutations in clinical settings in the Turkish population should not be recommended. However, independent studies are need to validate our findings in a larger series, as well as in patients of different ethnic origins. Copyright © 2012 Elsevier Ltd. All rights reserved.

  13. Electroclinical presentation and genotype-phenotype relationships in patients with Unverricht-Lundborg disease carrying compound heterozygous CSTB point and indel mutations.

    PubMed

    Canafoglia, Laura; Gennaro, Elena; Capovilla, Giuseppe; Gobbi, Giuseppe; Boni, Antonella; Beccaria, Francesca; Viri, Maurizio; Michelucci, Roberto; Agazzi, Pamela; Assereto, Stefania; Coviello, Domenico A; Di Stefano, Maria; Rossi Sebastiano, Davide; Franceschetti, Silvana; Zara, Federico

    2012-12-01

    Unverricht-Lundborg disease (EPM1A) is frequently due to an unstable expansion of a dodecamer repeat in the CSTB gene, whereas other types of mutations are rare. EPM1A due to homozygous expansion has a rather stereotyped presentation with prominent action myoclonus. We describe eight patients with five different compound heterozygous CSTB point or indel mutations in order to highlight their particular phenotypical presentations and evaluate their genotype-phenotype relationships. We screened CSTB mutations by means of Southern blotting and the sequencing of the genomic DNA of each proband. CSTB messenger RNA (mRNA) aberrations were characterized by sequencing the complementary DNA (cDNA) of lymphoblastoid cells, and assessing the protein concentrations in the lymphoblasts. The patient evaluations included the use of a simplified myoclonus severity rating scale, multiple neurophysiologic tests, and electroencephalography (EEG)-polygraphic recordings. To highlight the particular clinical features and disease time-course in compound heterozygous patients, we compared some of their characteristics with those observed in a series of 40 patients carrying the common homozygous expansion mutation observed at the C. Besta Foundation, Milan, Italy. The eight compound heterozygous patients belong to six EPM1A families (out of 52; 11.5%) diagnosed at the Laboratory of Genetics of the Galliera Hospitals in Genoa, Italy. They segregated five different heterozygous point or indel mutations in association with the common dodecamer expansion. Four patients from three families had previously reported CSTB mutations (c.67-1G>C and c.168+1_18del); one had a novel nonsense mutation at the first exon (c.133C>T) leading to a premature stop codon predicting a short peptide; the other three patients from two families had a complex novel indel mutation involving the donor splice site of intron 2 (c.168+2_169+21delinsAA) and leading to an aberrant transcript with a partially retained intron

  14. A Rare Missense Mutation and a Polymorphism with High Frequency in LDLR Gene among Iranian Patients with Familial Hypercholesterolemia

    PubMed Central

    Tajamolian, Masoud; Kolahdouz, Parisa; Nikpour, Parvaneh; Forouzannia, Seyed Khalil; Sheikhha, Mohammad Hasan; Yazd, Ehsan Farashahi

    2018-01-01

    Background: Familial hypercholesterolemia (FH) is a disorder that is inherited by autosomal dominant pattern. The main cause of FH disease is the occurrence of mutations in low-density lipoprotein receptor (LDLR) gene sequence, as well as apolipoprotein B and proprotein convertase subtilisin/kexin type 9 genes, located in the next ranks, respectively. Materials and Methods: Forty-five unrelated Iranian patients with FH were screened using a high-resolution melting (HRM) method for exon 9 along with intron/exon boundaries of LDLR gene. Samples with shift in resultant HRM curves were compared to normal ones, sequenced, and analyzed. Results: Our findings revealed a missense mutation c. 1246C>T and a known variant IVS9-30C>T (rs1003723) that was recognized in 71% of the patients (22%: homozygous and 49%: heterozygous genotypes). In silico analysis, predicted the pathological effect of the c. 1246C>T mutation in LDLR protein structure, but IVS9-30C>T variant had no predicted effect on splice site and branch point function. Conclusion: FH is a hereditary type of hypercholesterolemia that leads to premature cardiovascular disease and atherosclerosis, and early diagnosis is needed. We detected a rare missense mutation (1246C>T) and a common single nucleotide polymorphism (SNP) in the Iranian population. These reports could help in the genetic diagnosis and counseling of FH patients. PMID:29531935

  15. Positive association of the hepatic lipase gene polymorphism c.514C > T with estrogen replacement therapy response

    PubMed Central

    2011-01-01

    Background Hepatic lipase (HL), an enzyme present in the hepatic sinusoids, is responsible for the lipolysis of lipoproteins. Human HL contains four polymorphic sites: G-250A, T-710C, A-763G, and C-514T single-nucleotide polymorphism (SNPs). The last polymorphism is the focus of the current study. The genotypes associated with the C-514T polymorphism are CC (normal homozygous - W), CT (heterozygous - H), and TT (minor-allele homozygous - M). HL activity is significantly impaired in individuals of the TT and CT genotypes. A total of 58 post-menopausal women were studied. The subjects were hysterectomized women receiving hormone replacement therapy consisting of 0.625 mg of conjugated equine estrogen once a day. The inclusion criteria were menopause of up to three years and normal blood tests, radiographs, cervical-vaginal cytology, and densitometry. DNA was extracted from the buccal and blood cells of all 58 patients using a commercially available kit (GFX® - Amersham-Pharmacia, USA). Results Statistically significant reductions in triglycerides (t = 2.16; n = 58; p = 0.03) but not in total cholesterol (t = 0.14; n = 58; p = 0.89) were found after treatment. This group of good responders were carriers of the T allele; the CT and TT genotypes were present significantly more frequently than in the group of non-responders (p = 0.02 or p = 0.07, respectively). However, no significant difference in HDL-C (t = 0.94; n = 58; p = 0.35) or LDL-C (t = -0.83; n = 58; p = 0.41) was found in these patients. Conclusions The variation in lipid profile associated with the C-514T polymorphism is significant, and the T allele is associated with the best response to ERT. PMID:22047520

  16. iMARS--mutation analysis reporting software: an analysis of spontaneous cII mutation spectra.

    PubMed

    Morgan, Claire; Lewis, Paul D

    2006-01-31

    The sensitivity of any mutational assay is determined by the level at which spontaneous mutations occur in the corresponding untreated controls. Establishing the type and frequency at which mutations occur naturally within a test system is essential if one is to draw scientifically sound conclusions regarding chemically induced mutations. Currently, mutation-spectra analysis is laborious and time-consuming. Thus, we have developed iMARS, a comprehensive mutation-spectrum analysis package that utilises routinely used methodologies and visualisation tools. To demonstrate the use and capabilities of iMARS, we have analysed the distribution, types and sequence context of spontaneous base substitutions derived from the cII gene mutation assay in transgenic animals. Analysis of spontaneous mutation spectra revealed variation both within and between the transgenic rodent test systems Big Blue Mouse, MutaMouse and Big Blue Rat. The most common spontaneous base substitutions were G:C-->A:T transitions and G:C-->T:A transversions. All Big Blue Mouse spectra were significantly different from each other by distribution and nearly all by mutation type, whereas the converse was true for the other test systems. Twenty-eight mutation hotspots were observed across all spectra generally occurring in CG, GA/TC, GG and GC dinucleotides. A mutation hotspot at nucleotide 212 occurred at a higher frequency in MutaMouse and Big Blue Rat. In addition, CG dinucleotides were the most mutable in all spectra except two Big Blue Mouse spectra. Thus, spontaneous base-substitution spectra showed more variation in distribution, type and sequence context in Big Blue Mouse relative to spectra derived from MutaMouse and Big Blue Rat. The results of our analysis provide a baseline reference for mutation studies utilising the cII gene in transgenic rodent models. The potential differences in spontaneous base-substitution spectra should be considered when making comparisons between these test systems

  17. Homozygous variegate porphyria presenting with developmental and language delay in childhood.

    PubMed

    Pinder, V A E; Holden, S T; Deshpande, C; Siddiqui, A; Mellerio, J E; Wraige, E; Powell, A M

    2013-10-01

    Variegate porphyria is an autosomal dominant disorder that usually presents with photosensitivity and acute neurological crises in adulthood. It is caused by heterozygous mutations in the protoporphyrinogen oxidase gene (PPOX). A rarer variant, homozygous variegate porphyria (HVP), presents in childhood with recurrent skin blisters and scarring. More variable features of HVP are short stature, brachydactyly, nystagmus, epilepsy, developmental delay and mental retardation. We describe a child who presented with nystagmus, developmental delay and ataxia, combined with a photosensitive eruption. Analysis of porphyrins in plasma, urine and stool supported a clinical diagnosis of HVP. DNA from the patient showed that he is compound heterozygous for two novel missense mutations in the PPOX coding region: c.169G>C (p.Gly57Arg) and c.1259C>G (Pro420Arg). Interestingly, cranial magnetic resonance imaging showed an absence of myelin, a feature not previously reported in HVP, which expands the differential diagnosis of childhood hypomyelinating leucoencephalopathies. © 2013 British Association of Dermatologists.

  18. Primary Hyperoxaluria Type 1 with Homozygosity for a Double-mutated AGXT Allele in a 2-year-old Child.

    PubMed

    Krishnamurthy, S; Kartha, G B; Venkateswaran, V S; Prasannakumar, M; Mahadevan, S; Gowda, M; Pelle, A; Giachino, D

    2017-01-01

    Primary hyperoxaluria (PH) Type 1 is a rare, genetic disorder caused by deficiency of the liver enzyme alanine-glyoxylate aminotransferase, which is encoded by AGXT gene. We report a 2-year-old South Indian Tamil child with nephrocalcinosis due to PH Type 1, in whom a homozygous genotype for two missense mutations in the AGXT gene was found: first, a C to G transversion (c. 32C>G) in exon 1 resulting in the amino acid substitution p.Pro11Arg; second, a T to A transversion (c. 167T>A) in exon 2 resulting in p.Ile56Asn. A therapy based on potassium citrate and pyridoxine was started. This is the first report of molecular testing-proven childhood onset-PH Type 1 from South India and is notable for the co-occurrence of two missense mutations in one AGXT allele, which might lead to different and more severe phenotype than each mutation alone. To the best of our knowledge, AGXT allele carrying two already known mutations has not been previously reported.

  19. Primary Hyperoxaluria Type 1 with Homozygosity for a Double-mutated AGXT Allele in a 2-year-old Child

    PubMed Central

    Krishnamurthy, S.; Kartha, G. B.; Venkateswaran, V. S.; Prasannakumar, M.; Mahadevan, S.; Gowda, M.; Pelle, A.; Giachino, D.

    2017-01-01

    Primary hyperoxaluria (PH) Type 1 is a rare, genetic disorder caused by deficiency of the liver enzyme alanine-glyoxylate aminotransferase, which is encoded by AGXT gene. We report a 2-year-old South Indian Tamil child with nephrocalcinosis due to PH Type 1, in whom a homozygous genotype for two missense mutations in the AGXT gene was found: first, a C to G transversion (c. 32C>G) in exon 1 resulting in the amino acid substitution p.Pro11Arg; second, a T to A transversion (c. 167T>A) in exon 2 resulting in p.Ile56Asn. A therapy based on potassium citrate and pyridoxine was started. This is the first report of molecular testing-proven childhood onset-PH Type 1 from South India and is notable for the co-occurrence of two missense mutations in one AGXT allele, which might lead to different and more severe phenotype than each mutation alone. To the best of our knowledge, AGXT allele carrying two already known mutations has not been previously reported. PMID:28904440

  20. Selected AGXT gene mutations analysis provides a genetic diagnosis in 28% of Tunisian patients with primary hyperoxaluria

    PubMed Central

    2011-01-01

    Background Primary hyperoxaluria type I (PH1) is a rare genetic disorder characterized by allelic and clinical heterogeneity. Four mutations (G170R, 33_34insC, I244T and F152I) account for more than 50% of PH1 alleles and form the basis for diagnostic genetic screening for PH1. We aimed to analyze the prevalence of these specific mutations causing PH1, and to provide an accurate tool for diagnosis of presymptomatic patients as well as for prenatal diagnosis in the affected families. Methods Polymerase chain reaction/Restriction Fragment Length Polymorphism, were used to detect the four mutations in the AGXT gene in DNA samples from 57 patients belonging to 40 families. Results Two mutations causing PH1 were detected in 24 patients (42.1%), with a predominance of the I244T mutation (68% of patients) and 33_34insC (in the remaining 32%). In 92% of cases, mutated alleles were in homozygous state. The presented clinical features were similar for the two mutations. The age of onset was heterogeneous with a higher frequency of the pediatric age. In 58.3% of cases, the presentation corresponded to advanced renal disease which occurred early (< 5 years) in the two mutations. In adolescents, only the I244T mutation was detected (41.1%). I244T and 33_34insC mutations were observed in adult patients, with 17.6% and 12.5% respectively. Conclusion Limited mutation analysis can provide a useful first line investigation for PH1. I244T and 33_34insC presented 28.2% of identified mutations causing disease in our cohort. This identification could provide an accurate tool for prenatal diagnosis in the affected families, for genetic counselling and for detection of presymptomatic individuals. PMID:21612638

  1. Selected AGXT gene mutations analysis provides a genetic diagnosis in 28% of Tunisian patients with primary hyperoxaluria.

    PubMed

    Benhaj Mbarek, Ibtihel; Abroug, Saoussen; Omezzine, Asma; Zellama, Dorsaf; Achour, Abdellatif; Harbi, Abdelaziz; Bouslama, Ali

    2011-05-25

    Primary hyperoxaluria type I (PH1) is a rare genetic disorder characterized by allelic and clinical heterogeneity. Four mutations (G170R, 33_34insC, I244T and F152I) account for more than 50% of PH1 alleles and form the basis for diagnostic genetic screening for PH1. We aimed to analyze the prevalence of these specific mutations causing PH1, and to provide an accurate tool for diagnosis of presymptomatic patients as well as for prenatal diagnosis in the affected families. Polymerase chain reaction/Restriction Fragment Length Polymorphism, were used to detect the four mutations in the AGXT gene in DNA samples from 57 patients belonging to 40 families. Two mutations causing PH1 were detected in 24 patients (42.1%), with a predominance of the I244T mutation (68% of patients) and 33_34insC (in the remaining 32%). In 92% of cases, mutated alleles were in homozygous state. The presented clinical features were similar for the two mutations. The age of onset was heterogeneous with a higher frequency of the pediatric age. In 58.3% of cases, the presentation corresponded to advanced renal disease which occurred early (< 5 years) in the two mutations. In adolescents, only the I244T mutation was detected (41.1%). I244T and 33_34insC mutations were observed in adult patients, with 17.6% and 12.5% respectively. Limited mutation analysis can provide a useful first line investigation for PH1. I244T and 33_34insC presented 28.2% of identified mutations causing disease in our cohort. This identification could provide an accurate tool for prenatal diagnosis in the affected families, for genetic counselling and for detection of presymptomatic individuals.

  2. Leber's hereditary optic neuropathy is associated with the mitochondrial ND6 T14484C mutation in three Chinese families

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sun Yanhong; Wei Qiping; Zhou Xiangtian

    2006-08-18

    We report here the clinical, genetic, and molecular characterization of three Chinese families with maternally transmitted Leber's hereditary optic neuropathy (LHON). Clinical and genetic evaluations revealed the variable severity and age-of-onset in visual impairment in these families. In the affected matrilineal relatives, the loss of central vision is bilateral, the fellow eye becoming affected either simultaneously (45%) or sequentially (55%). The penetrances of vision loss in these pedigrees were 27%, 50%, and 60%, respectively. The age-at-onset of vision loss in these families was 14, 19, and 24 years, respectively. Furthermore, the ratios between affected male and female matrilineal relatives weremore » 1:1, 1:1.2, and 1:2, respectively. Mutational analysis of mitochondrial DNA revealed the presence of homoplasmic ND6 T14484C mutation, which has been associated with LHON. The incomplete penetrance and phenotypic variability implicate the involvement of nuclear modifier gene(s), environmental factor(s) or mitochondrial haplotype(s) in the phenotypic expression of the LHON-associated T14484C mutation in these Chinese pedigrees.« less

  3. Founder Fukutin mutation causes Walker-Warburg syndrome in four Ashkenazi Jewish families†

    PubMed Central

    Chang, Wendy; Winder, Thomas L.; LeDuc, Charles A.; Simpson, Lynn L.; Millar, William S.; Dungan, Jeffrey; Ginsberg, Norman; Plaga, Stacey; Moore, Steven A.; Chung, Wendy K.

    2009-01-01

    Objective Walker-Warburg syndrome (WWS) is a genetically heterogeneous congenital muscular dystrophy caused by abnormal glycosylation of α-dystroglycan (α-DG) that is associated with brain malformations and eye anomalies. The Fukutin (FKTN) gene, which causes autosomal recessively inherited WWS is most often associated with Fukuyama congenital muscular dystrophy in Japan. We describe the clinical features of four nonconsanguinous Ashkenazi Jewish families with WWS and identify the underlying genetic basis for WWS. Method We screened for mutations in POMGnT1, POMT1, POMT2, and FKTN, genes causing WWS, by dideoxy sequence analysis. Results We identified an identical homozygous c.1167insA mutation in the FKTN gene on a common haplotype in all four families and identified 2/299 (0.7%) carriers for the c.1167insA mutation among normal American Ashkenazi Jewish adults. Conclusion These data suggest that the c.1167insA FKTN mutation described by us is a founder mutation that can be used to target diagnostic testing and carrier screening in the Ashkenazi Jewish population. PMID:19266496

  4. Absence of PITX3 mutation in a Tunisian family with congenital cataract and mental retardation

    PubMed Central

    Chograni, Manèl; Chaabouni, Myriam; Chelly, Imen; Helayem, Mohamed Bechir

    2010-01-01

    Purpose The PITX3 (pituitary homeobox 3) gene encodes for a homeobox bicoid-like transcription factor. When one allele is mutated, it leads to dominant cataract and anterior segment mesenchymal dysgenesis in humans. When both copies are mutated, homozygous mutation contributes to microphtalmia with brain malformations. In the current study, a family with autosomal recessive congenital cataract (ARCC) associated with mental retardation (MR) was examined to identify PITX3 mutations. Methods Sequencing of the PITX3 gene was performed on two affected and three unaffected members of the studied Tunisian family. The results were analyzed with Sequencing Analysis 5.2 and SeqScape. Results No mutation in the four exons of PITX3 was revealed. Two substitution polymorphisms, c.439C>T and c.930C>A, were detected in exons 3 and 4, respectively. These alterations did not segregate with the disease. Conclusions Although PITX3 was shown to be essential to normal embryonic eye and brain development in vertebrates, we report the absence of PITX3 mutations in a family presenting congenital cataract and mental retardation. PMID:20376326

  5. Biallelic SCN10A mutations in neuromuscular disease and epileptic encephalopathy.

    PubMed

    Kambouris, Marios; Thevenon, Julien; Soldatos, Ariane; Cox, Allison; Stephen, Joshi; Ben-Omran, Tawfeg; Al-Sarraj, Yasser; Boulos, Hala; Bone, William; Mullikin, James C; Masurel-Paulet, Alice; St-Onge, Judith; Dufford, Yannis; Chantegret, Corrine; Thauvin-Robinet, Christel; Al-Alami, Jamil; Faivre, Laurence; Riviere, Jean Baptiste; Gahl, William A; Bassuk, Alexander G; Malicdan, May Christine V; El-Shanti, Hatem

    2017-01-01

    Two consanguineous families, one of Sudanese ethnicity presenting progressive neuromuscular disease, severe cognitive impairment, muscle weakness, upper motor neuron lesion, anhydrosis, facial dysmorphism, and recurrent seizures and the other of Egyptian ethnicity presenting with neonatal hypotonia, bradycardia, and recurrent seizures, were evaluated for the causative gene mutation. Homozygosity mapping and whole exome sequencing (WES) identified damaging homozygous variants in SCN10A , namely c.4514C>T; p.Thr1505Met in the first family and c.4735C>T; p.Arg1579* in the second family. A third family, of Western European descent, included a child with febrile infection-related epilepsy syndrome (FIRES) who also had compound heterozygous missense mutations in SCN10A , namely, c.3482T>C; p.Met1161Thr and c.4709C>A; p.Thr1570Lys. A search for SCN10A variants in three consortia datasets (EuroEPINOMICS, Epi4K/EPGP, Autism/dbGaP) identified an additional five individuals with compound heterozygous variants. A Hispanic male with infantile spasms [c.2842G>C; p.Val948Leu and c.1453C>T; p.Arg485Cys], and a Caucasian female with Lennox-Gastaut syndrome [c.1529C>T; p.Pro510Leu and c.4984G>A; p.Gly1662Ser] in the epilepsy databases and three in the autism databases with [c.4009T>A; p.Ser1337Thr and c.1141A>G; p.Ile381Val], [c.2972C>T; p.Pro991Leu and c.2470C>T; p.His824Tyr], and [c.4009T>A; p.Ser1337Thr and c.2052G>A; p.Met684Ile]. SCN10A is a member of the voltage-gated sodium channel (VGSC) gene family. Sodium channels are responsible for the instigation and proliferation of action potentials in central and peripheral nervous systems. Heterozygous mutations in VGSC genes cause a wide range of epileptic and peripheral nervous system disorders. This report presents autosomal recessive mutations in SCN10A that may be linked to epilepsy-related phenotypes, Lennox-Gastaut syndrome, infantile spasms, and Autism Spectrum Disorder.

  6. [Value of pre-gestational deafness-related mutation screening for the prevention and intervention of congenital deafness].

    PubMed

    Sun, Xuejing; Xing, Xinli; He, Qingqing; Zhou, Lin; Zhang, Jing; Zhao, Qing; Hou, Huili; Xi, Zuoming

    2017-10-10

    To assess the value of pre-gestational deafness-related mutation screening for the prevention and intervention of congenital deafness. In this study, 2168 couples with normal hearing were screened for common mutations associated with congenital deafness using real-time fluorescence quantitative PCR. The mutations have included GJB2 c.235delC and c.299_300delAT, SLC26A4 c.2168A>G and c.IVS7-2A>G, and mtDNA 12SrRNA c.1494C>T and c.1555A>G. For couples who have both carried heterozygous mutations of the same gene, genetic counseling and prenatal diagnosis were provided. Among of the 4 336 individuals, 178 (4.06%) were found to carry a mutation. Mutation rate for c.235delC and c.299_300delAT of GJB2 gene, c.IVS7-2 A>G and c.2168 A>G of SLC26A4 gene, c.1555 A>G and c.1494 C>T of DNA 12S rRNA gene were 0.91%, 0.20%, 0.68%, 0.11%, 0.1% and 0.01%, respectively. For six couples who have both carried mutations of the same gene, all fetuses showed a normal karyotype, while DNA sequencing indicated that two fetuses have carried homozygous c.235delC mutation of the GJB2 gene, one carried a heterozygous c.235delC mutation of the GJB2 gene, one carried heterozygous mutation of GJB2 gene (c.299_300delAT), and two have carried a heterozygous mutation of c.IVS7-2A>G of the SLC26A4 gene. Pre-gestational screening for deafness gene mutation can facilitate avoidance the birth of affected children and has a great clinical value for the prevention and intervention of birth defect.

  7. SLC52A2 [p.P141T] and SLC52A3 [p.N21S] causing Brown-Vialetto-Van Laere Syndrome in an Indian patient: First genetically proven case with mutations in two riboflavin transporters.

    PubMed

    Udhayabanu, Tamilarasan; Subramanian, Veedamali S; Teafatiller, Trevor; Gowda, Vykuntaraju K; Raghavan, Varun S; Varalakshmi, Perumal; Said, Hamid M; Ashokkumar, Balasubramaniem

    2016-11-01

    Brown-Vialetto-Van Laere Syndrome (BVVLS), a rare neurological disorder characterized by bulbar palsies and sensorineural deafness, is mainly associated with defective riboflavin transporters encoded by the SLC52A2 and SLC52A3 genes. Here we present a 16-year-old BVVLS patient belonging to a five generation consanguineous family from Indian ethnicity with two homozygous missense mutations viz., c.421C>A [p.P141T] in SLC52A2 and c.62A>G [p.N21S] in SLC52A3. Functional characterization based on 3 H-riboflavin uptake assay and live-cell confocal imaging revealed that the effect of mutation c.421C>A [p.P141T] identified in SLC52A2 had a slight reduction in riboflavin uptake; on the other hand, the c.62A>G [p.N21S] identified in SLC52A3 showed a drastic reduction in riboflavin uptake, which appeared to be due to impaired trafficking and membrane targeting of the hRFVT-3 protein. This is the first report presenting mutations in both riboflavin transporters hRFVT-2 and hRFVT-3 in the same BVVLS patient. Also, c.62A>G [p.N21S] in SLC52A3 appears to contribute more to the disease phenotype in this patient than c.421C>A [p.P141T] in SLC52A2. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. SLC52A2 [p.P141T] and SLC52A3 [p.N21S] causing Brown-Vialetto-Van Laere Syndrome in an Indian patient: First genetically proven case with mutations in two riboflavin transporters

    PubMed Central

    Udhayabanu, Tamilarasan; Subramanian, Veedamali S; Teafatiller, Trevor; Gowda, Vykuntaraju K; Raghavan, Varun S; Varalakshmi, Perumal; Said, Hamid M; Ashokkumar, Balasubramaniem

    2017-01-01

    Background Brown-Vialetto-Van Laere Syndrome (BVVLS), a rare neurological disorder characterized by bulbar palsies and sensorineural deafness, is mainly associated with defective riboflavin transporters encoded by the SLC52A2 and SLC52A3 genes. Methods Here we present a 16-year-old BVVLS patient belonging to a five generation consanguineous family from Indian ethnicity with two homozygous missense mutations viz., c.421C>A [p.P141T] in SLC52A2 and c.62A>G [p.N21S] in SLC52A3. Results Functional characterization based on 3H-riboflavin uptake assay and live-cell confocal imaging revealed that the effect of mutation c.421C>A [p.P141T] identified in SLC52A2 had a slight reduction in riboflavin uptake; on the other hand, the c.62A>G [p.N21S] identified in SLC52A3 showed a drastic reduction in riboflavin uptake, which appeared to be due to impaired trafficking and membrane targeting of the hRFVT-3 protein. Conclusions This is the first report presenting mutations in both riboflavin transporters hRFVT-2 and hRFVT-3 in the same BVVLS patient. Also, c.62A>G [p.N21S] in SLC52A3 appears to contribute more to the disease phenotype in this patient than c.421C>A [p.P141T] in SLC52A2. PMID:27702554

  9. LDLR promoter variant and exon 14 mutation on the same chromosome are associated with an unusually severe FH phenotype and treatment resistance

    PubMed Central

    Snozek, Christine LH; Lagerstedt, Susan A; Khoo, Teck K; Rubenfire, Melvyn; Isley, William L; Train, Laura J; Baudhuin, Linnea M

    2009-01-01

    Familial hypercholesterolemia (FH) is the most common form of autosomal-dominant hypercholesterolemia, and is caused by mutations in the low-density lipoprotein receptor (LDLR) gene. Heterozygous FH is characterized by elevated low-density lipoprotein (LDL) cholesterol and early-onset cardiovascular disease, whereas homozygous FH results in more severe LDL cholesterol elevation with death by 20 years of age. We present here the case of an African-American female FH patient presenting with a myocardial infarction at the age of 48, recurrent angina pectoris and numerous coronary artery stents. Her pretreated LDL cholesterol levels were more typical of a homozygous FH pattern and she was resistant to conventional lipid-lowering treatment, yet her other clinical parameters were not necessarily consistent with homozygous FH. Genetic testing revealed two LDLR variants on the same chromosome: one a novel missense mutation in exon 14 (Cys681Gly) and the other a promoter variant (IVS1-217C>T) previously shown to result in increased LDLR transcription. Disease-associated PCSK9 or APOB mutations were not identified in this individual. Overall, her genetic and clinical profile suggests that enhanced expression of the mutant LDLR allele resulted in a severe phenotype with characteristics of both heterozygous and homozygous FH. PMID:18648394

  10. Homozygous inactivation of CHEK2 is linked to a familial case of multiple primary lung cancer with accompanying cancers in other organs

    PubMed Central

    Kukita, Yoji; Okami, Jiro; Yoneda-Kato, Noriko; Nakamae, Ikuko; Kawabata, Takeshi; Higashiyama, Masahiko; Kato, Junya; Kodama, Ken; Kato, Kikuya

    2016-01-01

    In clinical practice, there are a number of cancer patients with clear family histories, but the patients lack mutations in known familial cancer syndrome genes. Recent advances in genomic technologies have enhanced the possibility of identifying causative genes in such cases. Two siblings, an elder sister and a younger brother, were found to have multiple primary lung cancers at the age of 60. The former subsequently developed breast cancer and had a history of uterine myoma. The latter had initially developed prostate cancer at the age of 59 and had a history of colon cancer. Single-nucleotide polymorphism (SNP) genotyping revealed that ∼10% of the genomes were homozygous in both patients. Exome sequencing revealed nonsynonymous mutations in five genes in the runs of homozygosity: CHEK2, FCGRT, INPP5J, MYO18B, and SFI1. Evolutionary conservation of primary protein structures suggested the functional importance of the CHEK2 mutation, p.R474C. This mutation altered the tertiary structure of CHK2 by disrupting the salt bridge between p.R474 and p.E394. No such structural changes were observed with the other mutated genes. Subsequent cell-based transfection analysis revealed that CHK2 p.R474C was unstable and scarcely activated. We concluded that the homozygous CHEK2 variant was contributory in this case of familial cancer. Although homozygous inactivation of CHEK2 in mice led to cancers in multiple organs, accumulation of additional human cases is needed to establish its pathogenic role in humans. PMID:27900359

  11. Homozygous inactivation of CHEK2 is linked to a familial case of multiple primary lung cancer with accompanying cancers in other organs.

    PubMed

    Kukita, Yoji; Okami, Jiro; Yoneda-Kato, Noriko; Nakamae, Ikuko; Kawabata, Takeshi; Higashiyama, Masahiko; Kato, Junya; Kodama, Ken; Kato, Kikuya

    2016-11-01

    In clinical practice, there are a number of cancer patients with clear family histories, but the patients lack mutations in known familial cancer syndrome genes. Recent advances in genomic technologies have enhanced the possibility of identifying causative genes in such cases. Two siblings, an elder sister and a younger brother, were found to have multiple primary lung cancers at the age of 60. The former subsequently developed breast cancer and had a history of uterine myoma. The latter had initially developed prostate cancer at the age of 59 and had a history of colon cancer. Single-nucleotide polymorphism (SNP) genotyping revealed that ∼10% of the genomes were homozygous in both patients. Exome sequencing revealed nonsynonymous mutations in five genes in the runs of homozygosity: CHEK2 , FCGRT , INPP5J , MYO18B , and SFI1 . Evolutionary conservation of primary protein structures suggested the functional importance of the CHEK2 mutation, p.R474C. This mutation altered the tertiary structure of CHK2 by disrupting the salt bridge between p.R474 and p.E394. No such structural changes were observed with the other mutated genes. Subsequent cell-based transfection analysis revealed that CHK2 p.R474C was unstable and scarcely activated. We concluded that the homozygous CHEK2 variant was contributory in this case of familial cancer. Although homozygous inactivation of CHEK2 in mice led to cancers in multiple organs, accumulation of additional human cases is needed to establish its pathogenic role in humans.

  12. Analyses of MMP20 Missense Mutations in Two Families with Hypomaturation Amelogenesis Imperfecta.

    PubMed

    Kim, Youn Jung; Kang, Jenny; Seymen, Figen; Koruyucu, Mine; Gencay, Koray; Shin, Teo Jeon; Hyun, Hong-Keun; Lee, Zang Hee; Hu, Jan C-C; Simmer, James P; Kim, Jung-Wook

    2017-01-01

    Amelogenesis imperfecta is a group of rare inherited disorders that affect tooth enamel formation, quantitatively and/or qualitatively. The aim of this study was to identify the genetic etiologies of two families presenting with hypomaturation amelogenesis imperfecta. DNA was isolated from peripheral blood samples obtained from participating family members. Whole exome sequencing was performed using DNA samples from the two probands. Sequencing data was aligned to the NCBI human reference genome (NCBI build 37.2, hg19) and sequence variations were annotated with the dbSNP build 138. Mutations in MMP20 were identified in both probands. A homozygous missense mutation (c.678T>A; p.His226Gln) was identified in the consanguineous Family 1. Compound heterozygous MMP20 mutations (c.540T>A, p.Tyr180 * and c.389C>T, p.Thr130Ile) were identified in the non-consanguineous Family 2. Affected persons in Family 1 showed hypomaturation AI with dark brown discoloration, which is similar to the clinical phenotype in a previous report with the same mutation. However, the dentition of the Family 2 proband exhibited slight yellowish discoloration with reduced transparency. Functional analysis showed that the p.Thr130Ile mutant protein had reduced activity of MMP20, while there was no functional MMP20 in the Family 1 proband. These results expand the mutational spectrum of the MMP20 and broaden our understanding of genotype-phenotype correlations in amelogenesis imperfecta.

  13. Relation of polymorphism C1236T and C3435T in ABCB1 gene with bone marrow suppression in chemotherapy-treated breast cancer patients

    NASA Astrophysics Data System (ADS)

    Syarifah, S.; Hamdi, T.; Widyawati, T.; Sari, M. I.; Anggraini, D. R.

    2018-03-01

    ABCB1 is agene that encoded P-glycoprotein (P-gp), a transmembrane active efflux pump for a variety of carcinogens and cytostatics.ABCB1 polymorphisms C1236T and C3435T contribute to the variability oftherapeutic outcome and side effects.The present study was conducted to investigatethe relation of C1236T and C3435T polymorphisms in ABCB1 gene with bone marrow suppression in breast cancer patients treated withchemotherapy72 Indonesian womens isolated DNA sampleswere amplified using the PCR method. The analysis process of ABCB1 C1236T and C3435T polymorphism was by using thePCR-RFLP method. The frequencies of ABCB1 C1236T genotype for homozygous CC,heterozygous CT and variant TT was 11(15.28%), 42(58.33%), 19(26.39%), respectively. No associationwas between ABCB1 C1236T and C3435T polymorphisms in both individually and haplotypes with bone marrow suppression event (p > 0.05). There was no specific deviation of allele and genotype frequency from Hardy-Weinberg Equilibrium. There was a linkage between heterozygous CT-heterozygous CT in position 1236 and 3435 within 25 people (35%).

  14. The homozygous VHL(D126N) missense mutation is associated with dramatically elevated erythropoietin levels, consequent polycythemia, and early onset severe pulmonary hypertension.

    PubMed

    Sarangi, Susmita; Lanikova, Lucie; Kapralova, Katarina; Acharya, Suchitra; Swierczek, Sabina; Lipton, Jeffrey M; Wolfe, Lawrence; Prchal, Josef T

    2014-11-01

    von Hippel-Lindau (VHL) protein is the principal negative regulator of hypoxia sensing mediated by transcription factors. Mutations in exon 3 of the VHL gene lead to Chuvash (VHL(R200W)) and Croatian (VHL(H191D)) polycythemias. Here, we describe an infant of Bangladesh ethnicity with a novel homozygous VHL(D126N) mutation with congenital polycythemia and dramatically elevated erythropoietin (EPO) levels, who developed severe fatal pulmonary hypertension. In contrast to Chuvash polycythemia, erythroid progenitors (BFU-Es) did not reveal a marked EPO hypersensitivity. Further, NF-E2 and RUNX1 transcripts that correlate with BFU-Es EPO hypersensitivity in polycythemic mutations were not elevated. © 2014 Wiley Periodicals, Inc.

  15. Mutations in C8ORF37 cause Bardet Biedl syndrome (BBS21)

    PubMed Central

    Heon, Elise; Kim, Gunhee; Qin, Sophie; Garrison, Janelle E.; Tavares, Erika; Vincent, Ajoy; Nuangchamnong, Nina; Scott, C. Anthony; Slusarski, Diane C.; Sheffield, Val C.

    2016-01-01

    Bardet Biedl syndrome (BBS) is a multisystem genetically heterogeneous ciliopathy that most commonly leads to obesity, photoreceptor degeneration, digit anomalies, genito-urinary abnormalities, as well as cognitive impairment with autism, among other features. Sequencing of a DNA sample from a 17-year-old female affected with BBS did not identify any mutation in the known BBS genes. Whole-genome sequencing identified a novel loss-of-function disease-causing homozygous mutation (K102*) in C8ORF37, a gene coding for a cilia protein. The proband was overweight (body mass index 29.1) with a slowly progressive rod-cone dystrophy, a mild learning difficulty, high myopia, three limb post-axial polydactyly, horseshoe kidney, abnormally positioned uterus and elevated liver enzymes. Mutations in C8ORF37 were previously associated with severe autosomal recessive retinal dystrophies (retinitis pigmentosa RP64 and cone-rod dystrophy CORD16) but not BBS. To elucidate the functional role of C8ORF37 in a vertebrate system, we performed gene knockdown in Danio rerio and assessed the cardinal features of BBS and visual function. Knockdown of c8orf37 resulted in impaired visual behavior and BBS-related phenotypes, specifically, defects in the formation of Kupffer’s vesicle and delays in retrograde transport. Specificity of these phenotypes to BBS knockdown was shown with rescue experiments. Over-expression of human missense mutations in zebrafish also resulted in impaired visual behavior and BBS-related phenotypes. This is the first functional validation and association of C8ORF37 mutations with the BBS phenotype, which identifies BBS21. The zebrafish studies hereby show that C8ORF37 variants underlie clinically diagnosed BBS-related phenotypes as well as isolated retinal degeneration. PMID:27008867

  16. Hereditary spastic paraplegia type 43 (SPG43) is caused by mutation in C19orf12

    PubMed Central

    Landouré, Guida; Zhu, Peng-Peng; Lourenço, Charles M.; Johnson, Janel O.; Toro, Camilo; Bricceno, Katherine V.; Rinaldi, Carlo; Meilleur, Katherine G.; Sangaré, Modibo; Diallo, Oumarou; Pierson, Tyler M.; Ishiura, Hiroyuki; Tsuji, Shoji; Hein, Nichole; Fink, John K.; Stoll, Marion; Nicholson, Garth; Gonzalez, Michael; Speziani, Fiorella; Dürr, Alexandra; Stevanin, Giovanni; Biesecker, Leslie G.; Accardi, John; Landis, Dennis M. D.; Gahl, William A.; Traynor, Bryan J.; Marques, Wilson; Züchner, Stephan; Blackstone, Craig; Fischbeck, Kenneth H.; Burnett, Barrington G.

    2013-01-01

    We report here the genetic basis for a form of progressive hereditary spastic paraplegia (SPG43) previously described in two Malian sisters. Exome sequencing revealed a homozygous missense variant (c.187G>C; p.Ala63Pro) in C19orf12, a gene recently implicated in neurodegeneration with brain iron accumulation (NBIA). The same mutation was subsequently also found in a Brazilian family with features of NBIA, and we identified another NBIA patient with a three-nucleotide deletion (c.197_199del; p.Gly66del). Haplotype analysis revealed that the p.Ala63Pro mutations have a common origin, but MRI scans showed no brain iron deposition in the Malian SPG43 subjects. Heterologous expression of these SPG43 and NBIA variants resulted in similar alterations in the subcellular distribution of C19orf12. The SPG43 and NBIA variants reported here as well as the most common C19orf12 missense mutation reported in NBIA patients are found within a highly-conserved, extended hydrophobic domain in C19orf12, underscoring the functional importance of this domain. PMID:23857908

  17. Effects of Common Polymorphisms in the MTHFR and ACE Genes on Diabetic Peripheral Neuropathy Progression: a Meta-Analysis.

    PubMed

    Wu, Shuai; Han, Yan; Hu, Qiang; Zhang, Xiaojie; Cui, Guangcheng; Li, Zezhi; Guan, Yangtai

    2017-05-01

    Diabetic peripheral neuropathy (DPN) is a microvascular complication of diabetes mellitus. The aim of this meta-analysis was to evaluate the effects of methylenetetrahydrofolate reductase (MTHFR) 677 C>T and ACE I/D polymorphisms in the development of DPN. We systematically reviewed published studies on MTHFR 677 C>T and ACE I/D polymorphisms and DPN found in various types of electronic databases. Strengthening the Reporting of Observational studies in Epidemiology (STROBE) quality score systems were used to determine the quality of the articles selected for inclusion. Odds ratios (ORs) and its corresponding 95 % confidence interval (95 % CI) were calculated. We used STATA statistical software (version 12.0, Stata Corporation, College Station, TX, USA) to deal with statistical data. Our results indicated an association of ACE D>I mutation (OR = 1.43, 95 % CI 1.12-1.83, P = 0.004) and MTHFR 677 C>T mutation (OR = 1.43, 95 % CI 1.08-1.90, P = 0.014) with DPN under the allele model, and similar results were also found under the dominant model (all P < 0.05). Subgroup analysis by country indicated that the MTHFR 677 C>T polymorphism may be the main risk factor for DPN in Turkey under four genetic models. ACE D>I mutation was correlated with DPN in Japanese and Pakistani populations in the majority of groups. The relationships of MTHFR 677 C>T and ACE I/D polymorphisms with DPN patients presented in this meta-analyses support the view that the MTHFR and ACE genes might play an important role in the development of DPN.

  18. A mitochondrial tRNA(His) gene mutation causing pigmentary retinopathy and neurosensorial deafness.

    PubMed

    Crimi, M; Galbiati, S; Perini, M P; Bordoni, A; Malferrari, G; Sciacco, M; Biunno, I; Strazzer, S; Moggio, M; Bresolin, N; Comi, G P

    2003-04-08

    We have identified a heteroplasmic G to A mutation at position 12,183 of the mitochondrial transfer RNA Histidine (tRNA(His)) gene in three related patients. These phenotypes varied according to mutation heteroplasmy: one had severe pigmentary retinopathy, neurosensorial deafness, testicular dysfunction, muscle hypotrophy, and ataxia; the other two had only retinal and inner ear involvement. The mutation is in a highly conserved region of the T(psi)C stem of the tRNA(His) gene and may alter secondary structure formation. This is the first described pathogenic, maternally inherited mutation of the mitochondrial tRNA(His) gene.

  19. Evaluation of the need for routine clinical testing of PALB2 c.1592delT mutation in BRCA negative Northern Finnish breast cancer families.

    PubMed

    Haanpää, Maria; Pylkäs, Katri; Moilanen, Jukka S; Winqvist, Robert

    2013-08-13

    Testing for mutations in the BRCA1 and BRCA2 genes among high-risk breast cancer patients has become a routine practice among clinical geneticists. Unfortunately, however, the genetic background of a majority of the cases coming to the clinics remains currently unexplained, making genetic counseling rather challenging. In recent years it has become evident world-wide that also women carrying a heterozygous germline mutation in PALB2 are at significantly increased risk of getting breast cancer. We have previously studied the clinical as well as biological impact of the PALB2 c.1592delT founder mutation occurring in about 1% of Finnish breast cancer patients unselected for their family history of disease, and our results demonstrated a 40% increased breast cancer risk by age 70 for female mutation carriers. Thus, this relatively common mutation in PALB2 is associated with a high risk of developing breast cancer. The aim of the current study was to analyze whether female index individuals of breast cancer families who had tested negative for germline mutations in BRCA1/BRCA2 as part of genetic counseling services should be offered mutation testing for PALB2 c.1592delT. The study cohort consisted of altogether 223 individuals who had contacted the Department of Clinical Genetics at the Oulu University Hospital in Finland between the years 1997 and 2011 for counseling on hereditary breast and/or ovarian cancer risk. 101 of them met our inclusion criteria. Of these, 10 persons were now deceased, but 6 of them had participated in one of our previous studies on PALB2. Seventy (77%) of the remaining 91 persons responded positively to our study invitation. Chart review of updated pedigree data led to the exclusion of 14 further individuals not meeting the selection criteria. Of the 56 alive affected female individuals screened for PALB2 c.1592delT, altogether two (3.6%) tested positive for this mutation. In addition, of the previously tested but now deceased 6 persons

  20. Neuronal ceroid lipofuscinosis associated with an MFSD8 mutation in Chihuahuas.

    PubMed

    Ashwini, Akanksha; D'Angelo, Antonio; Yamato, Osamu; Giordano, Cristina; Cagnotti, Giulia; Harcourt-Brown, Tom; Mhlanga-Mutangadura, Tendai; Guo, Juyuan; Johnson, Gary S; Katz, Martin L

    2016-08-01

    The neuronal ceroid lipofuscinoses (NCLs) are hereditary neurodegenerative disorders characterized by progressive declines in neurological functions, seizures, and premature death. NCLs result from mutations in at least 13 different genes. Canine versions of the NCLs can serve as important models in developing effective therapeutic interventions for these diseases. NCLs have been described in a number of dog breeds, including Chihuahuas. Studies were undertaken to further characterize the pathology of Chihuahua NCL and to verify its molecular genetic basis. Four unrelated client owned Chihuahuas from Japan, Italy and England that exhibited progressive neurological signs consistent with a diagnosis of NCL underwent neurological examinations. Brain and in some cases also retinal and heart tissues were examined postmortem for the presence of lysosomal storage bodies characteristic of NCL. The affected dogs exhibited massive accumulation of autofluorescent lysosomal storage bodies in the brain, retina and heart accompanied by brain atrophy and retinal degeneration. The dogs were screened for known canine NCL mutations previously reported in a variety of dog breeds. All 4 dogs were homozygous for the MFSD8 single base pair deletion (MFSD8:c.843delT) previously associated with NCL in a Chinese Crested dog and in 2 affected littermate Chihuahuas from Scotland. The dogs were all homozygous for the normal alleles at the other genetic loci known to cause different forms of canine NCL. The MFSD8:c.843delT mutation was not present in 57 Chihuahuas that were either clinically normal or suffered from unrelated diseases or in 1761 unaffected dogs representing 186 other breeds. Based on these data it is almost certain that the MFSD8:c.843delT mutation is the cause of NCL in Chihuahuas. Because the disorder occurred in widely separated geographic locations or in unrelated dogs from the same country, it is likely that the mutant allele is widespread among Chihuahuas. Genetic testing