Science.gov

Sample records for calb2 promoter acts

  1. Identification of cis- and trans-acting elements regulating calretinin expression in mesothelioma cells

    PubMed Central

    Kresoja-Rakic, Jelena; Kapaklikaya, Esra; Ziltener, Gabriela; Dalcher, Damian; Santoro, Raffaella; Christensen, Brock C.; Johnson, Kevin C.; Schwaller, Beat; Weder, Walter; Stahel, Rolf A.; Felley-Bosco, Emanuela

    2016-01-01

    Calretinin (CALB2) is a diagnostic marker for epithelioid mesothelioma. It is also a prognostic marker since patients with tumors expressing high calretinin levels have better overall survival. Silencing of calretinin decreases viability of epithelioid mesothelioma cells. Our aim was to elucidate mechanisms regulating calretinin expression in mesothelioma. Analysis of calretinin transcript and protein suggested a control at the mRNA level. Treatment with 5-aza-2′-deoxycytidine and analysis of TCGA data indicated that promoter methylation is not likely to be involved. Therefore, we investigated CALB2 promoter by analyzing ~1kb of genomic sequence surrounding the transcription start site (TSS) + 1 using promoter reporter assay. Deletion analysis of CALB2 proximal promoter showed that sequence spanning the −161/+80bp region sustained transcriptional activity. Site-directed analysis identified important cis-regulatory elements within this −161/+80bp CALB2 promoter. EMSA and ChIP assays confirmed binding of NRF-1 and E2F2 to the CALB2 promoter and siRNA knockdown of NRF-1 led to decreased expression of calretinin. Cell synchronization experiment showed that calretinin expression was cell cycle regulated with a peak of expression at G1/S phase. This study provides the first insight in the regulation of CALB2 expression in mesothelioma cells. PMID:26848772

  2. Spenito and Split ends act redundantly to promote Wingless signaling.

    PubMed

    Chang, Jinhee L; Lin, Hua V; Blauwkamp, Timothy A; Cadigan, Ken M

    2008-02-01

    Wingless (Wg)/Wnt signaling directs a variety of cellular processes during animal development by promoting the association of Armadillo/beta-catenin with TCFs on Wg-regulated enhancers (WREs). Split ends (Spen), a nuclear protein containing RNA recognition motifs (RRMs) and a SPOC domain, is required for optimal Wg signaling in several fly tissues. In this report, we demonstrate that Spenito (Nito), the only other fly protein containing RRMs and a SPOC domain, acts together with Spen to positively regulate Wg signaling. The partial defect in Wg signaling observed with spen RNAi was enhanced by simultaneous knockdown of nito while it was rescued by expression of nito in wing imaginal discs. In cell culture, depletion of both factors causes a greater defect in the activation of several Wg targets than RNAi of either spen or nito alone. These nuclear proteins are not required for Armadillo stabilization or the recruitment of TCF and Armadillo to a WRE. Loss of Wg target gene activation in cells depleted for spen and nito was not dependent on the transcriptional repressor Yan or Suppressor of Hairless, two previously identified targets of Spen. We propose that Spen and Nito act redundantly downstream of TCF/Armadillo to activate many Wg transcriptional targets.

  3. Promoting Prevention Through the Affordable Care Act: Workplace Wellness

    PubMed Central

    Roffenbender, Jason S.; Goetzel, Ron Z.; Millard, Francois; Wildenhaus, Kevin; DeSantis, Charles; Novelli, William

    2012-01-01

    Public health in the United States can be improved by building workplace “cultures of health” that support healthy lifestyles. The Affordable Care Act (ACA), which includes the Prevention and Public Health Fund, will support a new focus on prevention and wellness, offering opportunities to strengthen the public’s health through workplace wellness initiatives. This article describes the opportunity the ACA provides to improve worker wellness. PMID:23237245

  4. STAT1 acts as a tumor promoter for leukemia development.

    PubMed

    Kovacic, Boris; Stoiber, Dagmar; Moriggl, Richard; Weisz, Eva; Ott, René G; Kreibich, Rita; Levy, David E; Beug, Hartmut; Freissmuth, Michael; Sexl, Veronika

    2006-07-01

    The tumor suppressor STAT1 is considered a key regulator of the surveillance of developing tumors. Here, we describe an unexpected tumor-promoting role for STAT1 in leukemia. STAT1(-/-) mice are partially protected from leukemia development, and STAT1(-/-) tumor cells induce leukemia in RAG2(-/-) and immunocompetent mice with increased latency. The low MHC class I protein levels of STAT1(-/-) tumor cells enable efficient NK cell lysis and account for the enhanced tumor clearance. Strikingly, STAT1(-/-) tumor cells acquire increased MHC class I expression upon leukemia progression. These findings define STAT1 as a tumor promoter in leukemia development. Furthermore, we describe the upregulation of MHC class I expression as a general mechanism that allows for the escape of hematopoietic malignancies from immune surveillance.

  5. Characterization of cis-acting elements residing in the chitinase promoter of Bacillus pumilus SG2.

    PubMed

    Heravi, K Morabbi; Shali, A; Naghibzadeh, N; Ahmadian, G

    2014-05-01

    Bacillus pumilus SG2 is a chitinolytic bacterium that produces two chitinases, namely ChiS and ChiL. The chiS and chiL genes are consecutively expressed under a common promoter. Regulation of the chiS and chiL genes is under the control of carbon catabolite repression (CCR) in B. pumilus. This study aimed to investigate the cis-acting elements of the chitinase promoter. For this purpose, we transferred the chiS gene along with its specific promoter to Bacillus subtilis as a host. Primer extension analysis revealed two transcription start sites located 287 and 65 bp upstream of the chiS start codon. The distal promoter was highly compatible with the consensus sequence of the σ(A)-type promoters in B. subtilis, whereas the proximal promoter sequence showed less similarity to the σ(A)-type consensus sequence. A catabolite responsive element (cre), which is required for CCR in Bacillus species, was found to be 136 to 123 bp upstream of the chiS start codon. Interestingly, this cre site was located upstream of the -35 of the proximal promoter and downstream of the distal promoter. Deletion of this cre site sequence rendered the chiS expression constitutive.

  6. Perfluorooctanoic acid (PFOA) acts as a tumor promoter on Syrian hamster embryo (SHE) cells.

    PubMed

    Jacquet, N; Maire, M A; Rast, C; Bonnard, M; Vasseur, P

    2011-08-01

    Perfluorooctane sulfonate (PFOS) (C(8)F(17)SO(3)) and perfluorooctanoic acid (PFOA) (C(8)HF(15)O(2)) are synthetic chemicals widely used in industrial applications for their hydrophobic and oleophobic properties. They are persistent, bioaccumulative, and toxic to mammalian species. Their widespread distribution on earth and contamination of human serum raised concerns about long-term side effects. They are suspected to be carcinogenic through a nongenotoxic mode of action, a mechanism supported by recent findings that PFOS induced cell transformation but no genotoxicity in Syrian hamster embryo (SHE) cells. In the present study, we evaluated carcinogenic potential of PFOA using the cell transformation assay on SHE cells. The chemical was applied alone or in combination with a nontransformant concentration of benzo[a]pyrene (BaP, 0.4 μM) in order to detect PFOA ability to act as tumor initiator or tumor promoter. The results showed that PFOA tested alone in the range 3.7 × 10(-5) to 300 μM did not induce SHE cell transformation frequency in a 7-day treatment. On the other side, the combination BaP/PFOA induced cell transformation at all PFOA concentrations tested, which revealed synergistic effects. No genotoxicity of PFOA on SHE cells was detected using the comet assay after 5 and 24 h of exposure. No significant increase in DNA breakage was found in BaP-initiated cells exposed to PFOA in a 7-day treatment. The whole results showed that PFOA acts as a tumor promoter and a nongenotoxic carcinogen. Cell transformation in initiated cells was observed at concentrations equivalent to the ones found in human serum of nonoccupationally and occupationally exposed populations. An involvement of PFOA in increased incidence of cancer recorded in occupationally exposed population cannot be ruled out.

  7. Health promotion research and practice require sound policy analysis models: the case of Quebec's Tobacco Act.

    PubMed

    Breton, Eric; Richard, Lucie; Gagnon, France; Jacques, Marie; Bergeron, Pierre

    2008-12-01

    In this paper we illustrate how policy analysis models can deepen our understanding of the challenges facing health promoters advocating for policy change. Specifically we describe the factors underpinning the adoption of Québec's Tobacco Act (1998) and the role played by actors from governmental public health agencies (GPHAs). Data were collected through interviews (n=39), newspapers articles (n=569) and documents (n > 200) from GPHAs, NGOs, the Québec National Assembly, and opponents to the legislative measures. Data collection and analysis were based on Sabatier and Jenkins-Smith's Advocacy Coalition Framework (1999) and Lemieux's theorization of coalition structuring (1998). We explain the adoption of the Act by: (1) the broad recognition within the policy elite of the main parameters of tobacco use (i.e. lethality, addictive properties, and legitimacy of governmental intervention), (2) the impacts of a series of events (e.g. cigarette contraband crisis) that enabled tobacco control advocates to influence public debates, and the governmental agenda, (3) the critical contribution of a coalition of GPHAs pooling resources to address both the sanitary and economic aspects of the legislation while countering the opposition's strategy, and (4) the failure of the opponents to present an unified voice on the definition of the tobacco policy. This study illustrates the merits of applying a policy-change model to grasp the complexity of the process. Our findings call for the development of permanent policy analysis capabilities within public health agencies and for a broader scrutiny of the non-health-related dimensions of policy debates.

  8. Acidobacteria strains from subdivision 1 act as plant growth-promoting bacteria.

    PubMed

    Kielak, Anna M; Cipriano, Matheus A P; Kuramae, Eiko E

    2016-12-01

    Acidobacteria is one of the most abundant phyla in soils and has been detected in rhizosphere mainly based on cultivation-independent approaches such as 16S rRNA gene survey. Although putative interaction of Acidobacteria with plants was suggested, so far no plant-bacterial interactions were shown. Therefore, we performed several in vitro tests to evaluate Acidobacteria-plant interactions and the possible mechanisms involved in such interaction. We observed that Arabidopsis thaliana inoculated with three strains belonging to Acidobacteria subdivision 1 showed increase in biomass of roots and shoots as well as morphological changes in root system. Our results indicate that the plant hormone indole-3-acetic acid production and iron acquisition are plausibly involved in the plant and Acidobacteria interactions. Here, we confirm for the first time that Acidobacteria can actively interact with plants and act as plant growth-promoting bacteria. In addition, we show that Acidobacteria strains produce exopolysaccharide which supports the adhesion of bacteria to the root surfaces.

  9. SNM1A Acts Downstream of ATM to Promote the G1 Cell Cycle Checkpoint

    PubMed Central

    Akhter, Shamima; Legerski, Randy J.

    2008-01-01

    We have shown previously that SNM1A co-localizes with 53BP1 at sites of double-strand breaks (DSBs) induced by IR, and that these proteins interact with or without DNA damage. However, the role of SNM1A in the DNA damage response has not been elucidated. Here, we show that SNM1A is required for an efficient G1 checkpoint arrest after IR exposure. Interestingly, the localization of SNM1A to sites of DSBs does not require either 53BP1 or H2AX, nor does the localization of 53BP1 require SNM1A. However, the localization of SNM1A does require ATM. Furthermore, SNM1A is shown to be a phosphorylation substrate of ATM in vitro, and to interact with ATM in vivo particularly after exposure of cells to IR. In addition, in the absence of SNM1A the activation of the downstream ATM target p53 is reduced. These findings suggest that SNM1A acts with ATM to promote the G1 cell cycle checkpoint. PMID:18848520

  10. How to Preserve and Promote School Psychological Services through the American Recovery and Reinvestment Act (ARRA)

    ERIC Educational Resources Information Center

    Doescher, Heather

    2009-01-01

    The American Recovery and Reinvestment Act (ARRA), also known as the "Stimulus Act" and "Economic Recovery Act," was signed into law by President Obama on February 17, 2009. As a response to the economic downturn that Americans are all experiencing, the ARRA is an effort to jumpstart the economy, create or save millions of jobs, and make long-term…

  11. A dominantly acting murine allele of Mcm4 causes chromosomal abnormalities and promotes tumorigenesis.

    PubMed

    Bagley, Bruce N; Keane, Thomas M; Maklakova, Vilena I; Marshall, Jonathon G; Lester, Rachael A; Cancel, Michelle M; Paulsen, Alex R; Bendzick, Laura E; Been, Raha A; Kogan, Scott C; Cormier, Robert T; Kendziorski, Christina; Adams, David J; Collier, Lara S

    2012-01-01

    Here we report the isolation of a murine model for heritable T cell lymphoblastic leukemia/lymphoma (T-ALL) called Spontaneous dominant leukemia (Sdl). Sdl heterozygous mice develop disease with a short latency and high penetrance, while mice homozygous for the mutation die early during embryonic development. Sdl mice exhibit an increase in the frequency of micronucleated reticulocytes, and T-ALLs from Sdl mice harbor small amplifications and deletions, including activating deletions at the Notch1 locus. Using exome sequencing it was determined that Sdl mice harbor a spontaneously acquired mutation in Mcm4 (Mcm4(D573H)). MCM4 is part of the heterohexameric complex of MCM2-7 that is important for licensing of DNA origins prior to S phase and also serves as the core of the replicative helicase that unwinds DNA at replication forks. Previous studies in murine models have discovered that genetic reductions of MCM complex levels promote tumor formation by causing genomic instability. However, Sdl mice possess normal levels of Mcms, and there is no evidence for loss-of-heterozygosity at the Mcm4 locus in Sdl leukemias. Studies in Saccharomyces cerevisiae indicate that the Sdl mutation produces a biologically inactive helicase. Together, these data support a model in which chromosomal abnormalities in Sdl mice result from the ability of MCM4(D573H) to incorporate into MCM complexes and render them inactive. Our studies indicate that dominantly acting alleles of MCMs can be compatible with viability but have dramatic oncogenic consequences by causing chromosomal abnormalities.

  12. A Dominantly Acting Murine Allele of Mcm4 Causes Chromosomal Abnormalities and Promotes Tumorigenesis

    PubMed Central

    Bagley, Bruce N.; Keane, Thomas M.; Maklakova, Vilena I.; Marshall, Jonathon G.; Lester, Rachael A.; Cancel, Michelle M.; Paulsen, Alex R.; Bendzick, Laura E.; Been, Raha A.; Kogan, Scott C.; Cormier, Robert T.; Kendziorski, Christina; Adams, David J.; Collier, Lara S.

    2012-01-01

    Here we report the isolation of a murine model for heritable T cell lymphoblastic leukemia/lymphoma (T-ALL) called Spontaneous dominant leukemia (Sdl). Sdl heterozygous mice develop disease with a short latency and high penetrance, while mice homozygous for the mutation die early during embryonic development. Sdl mice exhibit an increase in the frequency of micronucleated reticulocytes, and T-ALLs from Sdl mice harbor small amplifications and deletions, including activating deletions at the Notch1 locus. Using exome sequencing it was determined that Sdl mice harbor a spontaneously acquired mutation in Mcm4 (Mcm4D573H). MCM4 is part of the heterohexameric complex of MCM2–7 that is important for licensing of DNA origins prior to S phase and also serves as the core of the replicative helicase that unwinds DNA at replication forks. Previous studies in murine models have discovered that genetic reductions of MCM complex levels promote tumor formation by causing genomic instability. However, Sdl mice possess normal levels of Mcms, and there is no evidence for loss-of-heterozygosity at the Mcm4 locus in Sdl leukemias. Studies in Saccharomyces cerevisiae indicate that the Sdl mutation produces a biologically inactive helicase. Together, these data support a model in which chromosomal abnormalities in Sdl mice result from the ability of MCM4D573H to incorporate into MCM complexes and render them inactive. Our studies indicate that dominantly acting alleles of MCMs can be compatible with viability but have dramatic oncogenic consequences by causing chromosomal abnormalities. PMID:23133403

  13. Hospital and Health Plan Partnerships: The Affordable Care Act's Impact on Promoting Health and Wellness

    PubMed Central

    Vu, Michelle; White, Annesha; Kelley, Virginia P.; Hopper, Jennifer Kuca; Liu, Cathy

    2016-01-01

    Background The Affordable Care Act (ACA) healthcare reforms, centered on achieving the Centers for Medicare & Medicaid Services (CMS) Triple Aim goals of improving patient care quality and satisfaction, improving population health, and reducing costs, have led to increasing partnerships between hospitals and insurance companies and the implementation of employee wellness programs. Hospitals and insurance companies have opted to partner to distribute the risk and resources and increase coordination of care. Objective To examine the ACA's impact on the health and wellness programs that have resulted from the joint ventures of hospitals and health plans based on the published literature. Method We conducted a review of the literature to identify successful mergers and best practices of health and wellness programs. Articles published between January 2007 and January 2015 were compiled from various search engines, using the search terms “corporate,” “health and wellness program,” “health plan,” “insurance plan,” “hospital,” “joint venture,” and “vertical merger.” Publications that described consolidations or wellness programs not tied to health insurance plans were excluded. Noteworthy characteristics of these programs were summarized and tabulated. Results A total of 44 eligible articles were included in the analysis. The findings showed that despite rising healthcare costs, joint ventures prevent hospitals from trading-off quality and services for cost reductions. Administrators believed that partnering would allow the companies to meet ACA standards for improving clinical outcomes at reduced costs. Before the implementation of the ACA, some employers had wellness programs, but these were not standardized and did not need to produce measurable results. The ACA encouraged improvement of employee wellness programs by providing funding for expanded health services and by mandating quality care. Successful workplace health and wellness

  14. Arabidopsis ACT11 modifies actin turnover to promote pollen germination and maintain the normal rate of tube growth.

    PubMed

    Chang, Ming; Huang, Shanjin

    2015-08-01

    Actin is an ancient conserved protein that is encoded by multiple isovariants in multicellular organisms. There are eight functional actin genes in the Arabidopsis genome, and the precise function and mechanism of action of each isovariant remain poorly understood. Here, we report the characterization of ACT11, a reproductive actin isovariant. Our studies reveal that loss of function of ACT11 causes a delay in pollen germination, but enhances pollen tube growth. Cytological analysis revealed that the amount of filamentous actin decreased, and the rate of actin turnover increased in act11 pollen. Convergence of actin filaments upon the germination aperture was impaired in act11 pollen, consistent with the observed delay of germination. Reduction of actin dynamics with jasplakinolide suppressed the germination and tube growth phenotypes in act11 pollen, suggesting that the underlying mechanisms involve an increase in actin dynamics. Thus, we demonstrate that ACT11 is required to maintain the rate of actin turnover in order to promote pollen germination and maintain the normal rate of pollen tube growth.

  15. [The Act of Promotion of Personal Autonomy and Long-Term Care. Reflections and recommendations for better development].

    PubMed

    López Casasnovas, Guillem

    2011-12-01

    The present article provides a critical analysis of the state of affairs of the care of dependent individuals and proposals for reform of social protection systems for dependency - especially the Act of Promotion of Personal Autonomy and Long-Term Care. The existing form of public coverage is linked to the theory of public finance. Against this background, a series of recommendations are made to achieve the goals of this important component of the welfare state.

  16. Implementing a Mentally Healthy Schools Framework Based on the Population Wide Act-Belong-Commit Mental Health Promotion Campaign: A Process Evaluation

    ERIC Educational Resources Information Center

    Anwar-McHenry, Julia; Donovan, Robert John; Nicholas, Amberlee; Kerrigan, Simone; Francas, Stephanie; Phan, Tina

    2016-01-01

    Purpose: Mentally Healthy WA developed and implemented the Mentally Healthy Schools Framework in 2010 in response to demand from schools wanting to promote the community-based Act-Belong-Commit mental health promotion message within a school setting. Schools are an important setting for mental health promotion, therefore, the Framework encourages…

  17. Reward Excellence and Promote Innovation. Reauthorizing the Elementary and Secondary Education Act

    ERIC Educational Resources Information Center

    US Department of Education, 2010

    2010-01-01

    To achieve President Obama's stated goal of providing a world-class education to every child in America, the administration has designed a blueprint for a reenvisioned federal role in education through the reauthorization of the "Elementary and Secondary Education Act" ("ESEA"). The new "ESEA" will raise the bar for…

  18. "Act Healthy": Promoting Health Behaviors and Self-Efficacy in the Workplace

    ERIC Educational Resources Information Center

    Schopp, Laura H.; Bike, Denise H.; Clark, Mary J.; Minor, Marian A.

    2015-01-01

    Chronic health conditions and multiple health risk factors afflict Americans and burden employers, but effective, affordable, workplace-based health promotion interventions have not been widely implemented. This is the first study to adapt the empirically validated Chronic Disease Self-Management Program for a general employee population in a…

  19. Act Healthy: promoting health behaviors and self-efficacy in the workplace.

    PubMed

    Schopp, Laura H; Bike, Denise H; Clark, Mary J; Minor, Marian A

    2015-08-01

    Chronic health conditions and multiple health risk factors afflict Americans and burden employers, but effective, affordable, workplace-based health promotion interventions have not been widely implemented. This is the first study to adapt the empirically validated Chronic Disease Self-Management Program for a general employee population in a workplace setting with an emphasis on disease prevention and health promotion. A quasi-experimental, wellness standard of care comparison, prospective cohort design was used among employee participants at a large University employer. Ninety-one individuals participated in the program. Participants reported significantly increased health behavior frequency and self-efficacy after the intervention, compared with their pre-intervention scores, and improvements were sustained at 3-month follow-up [self-rated abilities for health practices scale (SRA): F = 30.89, P < 0.001; health promoting lifestyle profile-II (HPLP-II): F = 36.30 P < 0.001]. Individuals in the intervention group reported improved self-efficacy and health behaviors compared with the wellness standard of care comparison group at post intervention (SRA: F = 12.45, P < 0.001; HPLP-II: F = 25.28, P < 0.001). Adapting lay-facilitated self-management for the workplace offers promise as a replicable, scalable, affordable model for culture change in organizations.

  20. AP-1 family members act with Sox9 to promote chondrocyte hypertrophy.

    PubMed

    He, Xinjun; Ohba, Shinsuke; Hojo, Hironori; McMahon, Andrew P

    2016-08-15

    An analysis of Sox9 binding profiles in developing chondrocytes identified marked enrichment of an AP-1-like motif. Here, we have explored the functional interplay between Sox9 and AP-1 in mammalian chondrocyte development. Among AP-1 family members, Jun and Fosl2 were highly expressed within prehypertrophic and early hypertrophic chondrocytes. Chromatin immunoprecipitation followed by DNA sequencing (ChIP-seq) showed a striking overlap in Jun- and Sox9-bound regions throughout the chondrocyte genome, reflecting direct binding of each factor to the same enhancers and a potential for protein-protein interactions within AP-1- and Sox9-containing complexes. In vitro reporter analysis indicated that direct co-binding of Sox9 and AP-1 at target motifs promoted gene activity. By contrast, where only one factor can engage its DNA target, the presence of the other factor suppresses target activation consistent with protein-protein interactions attenuating transcription. Analysis of prehypertrophic chondrocyte removal of Sox9 confirmed the requirement of Sox9 for hypertrophic chondrocyte development, and in vitro and ex vivo analyses showed that AP-1 promotes chondrocyte hypertrophy. Sox9 and Jun co-bound and co-activated a Col10a1 enhancer in Sox9 and AP-1 motif-dependent manners consistent with their combined action promoting hypertrophic gene expression. Together, the data support a model in which AP-1 family members contribute to Sox9 action in the transition of chondrocytes to the hypertrophic program.

  1. cis-acting elements involved in photoregulation of an oat phytochrome promoter in rice.

    PubMed Central

    Bruce, W B; Quail, P H

    1990-01-01

    Phytochrome negatively regulates the transcription of its own phyA genes. High levels of Pfr, the active, far-red-light absorbing form of phytochrome, repress phyA transcription; low Pfr levels result in derepression. We have utilized microprojectile-mediated gene transfer to identify regions of an oat phyA3 gene involved in this autoregulation. Chimeric constructs containing various deletion and sequence substitution mutants of the oat phyA3 gene fused to a chloramphenicol acetyltransferase reporter (phyA3/CAT) have been introduced into etiolated rice seedlings by particle bombardment. Low Pfr concentrations induce high phyA3/CAT expression, whereas high Pfr represses activity to near basal levels. Removal of phyA3 sequences 3' to the transcription start site reduces expression about fivefold, suggesting that intron 1 of the phyA3 gene may be required for high activity. The degree of high-Pfr-imposed repression is unaffected by any of a series of deletions or sequence substitutions in the phyA3 promoter, thus providing no evidence of any Pfr-activated negative elements. In contrast, 5' and internal deletions identify a minimum of three major positive promoter elements, designated PE1 [-381 base pairs (bp) to -348 bp], PE2 (-635 bp to -489 bp), and PE3 (-110 bp to -76 bp) that are necessary for high-level expression in low-Pfr cells. The data indicate that PE1 and PE2 are functionally redundant, but that PE3 is required in conjunction with either PE1 or PE2 for activity. PE3 contains a sequence element that is highly conserved between monocot phyA promoters, indicative of a critical role in phyA expression. PMID:2152109

  2. Effect of the act on promotion of personal autonomy and care for dependent persons on their family caregivers

    PubMed Central

    2012-01-01

    Background The need of home care services is becoming an increasingly common scenario. These cares are mainly provided by the dependents’ relatives specifically, by the women part of the family. This situation might take years, decreasing the physical and psychological health of the caregiver. In Spain, the Act of Promotion of Personal Autonomy and Care for dependent persons, guarantees those dependent persons and their caregivers to have access to social services or to financial grants. The aim of this study is to Know the possible effects of the benefits provided by this Act in regards to the mental health, the quality of life and use of health services by the family caregivers assisting their relatives in situation of dependency. Methods and design A longitudinal descriptive study following-up a cohort of patients and caregivers. The study shall be carried out in Andalusia. It shall include the baseline assessment of the variables in those caregivers free from the exposure factor (reception of assistance pursuant to the Act). Following, once the benefits have been received, this cohort shall be followed-up. The study shall take three years, and the starting date for its development as well as its funding is January 2011. Discussion The longitudinal assessment of the rate of change of the variables studied shall allow us to know the implications which might be potentially generated as well as the natural evolution of those. PMID:23244337

  3. Cbx8 Acts Non-canonically with Wdr5 to Promote Mammary Tumorigenesis.

    PubMed

    Chung, Chi-Yeh; Sun, Zhen; Mullokandov, Gavriel; Bosch, Almudena; Qadeer, Zulekha A; Cihan, Esma; Rapp, Zachary; Parsons, Ramon; Aguirre-Ghiso, Julio A; Farias, Eduardo F; Brown, Brian D; Gaspar-Maia, Alexandre; Bernstein, Emily

    2016-07-12

    Chromatin-mediated processes influence the development and progression of breast cancer. Using murine mammary carcinoma-derived tumorspheres as a functional readout for an aggressive breast cancer phenotype, we performed a loss-of-function screen targeting 60 epigenetic regulators. We identified the Polycomb protein Cbx8 as a key regulator of mammary carcinoma both in vitro and in vivo. Accordingly, Cbx8 is overexpressed in human breast cancer and correlates with poor survival. Our genomic analyses revealed that Cbx8 positively regulates Notch signaling by maintaining H3K4me3 levels on Notch-network gene promoters. Ectopic expression of Notch1 partially rescues tumorsphere formation in Cbx8-depleted cells. We find that Cbx8 associates with non-PRC1 complexes containing the H3K4 methyltransferase complex component WDR5, which together regulate Notch gene expression. Thus, our study implicates a key non-canonical role for Cbx8 in promoting breast tumorigenesis.

  4. Promotion

    PubMed Central

    Alam, Hasan B.

    2013-01-01

    This article gives an overview of the promotion process in an academic medical center. A description of different promotional tracks, tenure and endowed chairs, and the process of submitting an application is provided. Finally, some practical advice about developing skills and attributes that can help with academic growth and promotion is dispensed. PMID:24436683

  5. FAN1 acts with FANCI-FANCD2 to promote DNA interstrand cross-link repair.

    PubMed

    Liu, Ting; Ghosal, Gargi; Yuan, Jingsong; Chen, Junjie; Huang, Jun

    2010-08-06

    Fanconi anemia (FA) is caused by mutations in 13 Fanc genes and renders cells hypersensitive to DNA interstrand cross-linking (ICL) agents. A central event in the FA pathway is mono-ubiquitylation of the FANCI-FANCD2 (ID) protein complex. Here, we characterize a previously unrecognized nuclease, Fanconi anemia-associated nuclease 1 (FAN1), that promotes ICL repair in a manner strictly dependent on its ability to accumulate at or near sites of DNA damage and that relies on mono-ubiquitylation of the ID complex. Thus, the mono-ubiquitylated ID complex recruits the downstream repair protein FAN1 and facilitates the repair of DNA interstrand cross-links.

  6. Selfish third parties act as peacemakers by transforming conflicts and promoting cooperation

    PubMed Central

    Halevy, Nir; Halali, Eliran

    2015-01-01

    The tremendous costs of conflict have made humans resourceful not only at warfare but also at peacemaking. Although third parties have acted as peacemakers since the dawn of history, little is known about voluntary, informal third-party intervention in conflict. Here we introduce the Peacemaker Game, a novel experimental paradigm, to model and study the interdependence between disputants and third parties in conflict. In the game, two disputants choose whether to cooperate or compete and a third party chooses whether or not to intervene in the conflict. Intervention introduces side payments that transform the game disputants are playing; it also introduces risk for the third party by making it vulnerable to disputants’ choices. Six experiments revealed three robust effects: (i) The mere possibility of third-party intervention significantly increases cooperation in interpersonal and intergroup conflicts; (ii) reducing the risk to third parties dramatically increases intervention rates, to everyone’s benefit; and (iii) disputants’ cooperation rates are consistently higher than third parties’ intervention rates. These findings explain why, how, and when self-interested third parties facilitate peaceful conflict resolution. PMID:26038546

  7. Shootin1 acts in concert with KIF20B to promote polarization of migrating neurons.

    PubMed

    Sapir, Tamar; Levy, Talia; Sakakibara, Akira; Rabinkov, Aharon; Miyata, Takaki; Reiner, Orly

    2013-07-17

    Shootin1 has been ascribed a role in regulating polarization of primary hippocampal neurons. To better understand the possible role of Shootin1 in the developing brain, we identified a member of the kinesin superfamily, KIF20B, as a novel Shootin1 interacting protein and a potential mediator of Shootin1 interaction with microtubules. KIF20B/Shootin1 binding was mapped to a 57 aa KIF20B sequence, which was used as a dominant-negative fragment. Direct interaction between that peptide (MBD) and Shootin1 was confirmed by surface plasmon resonance-based technology and the affinity was determined in the 10⁻⁷ m range. The proteins are expressed in the developing brain and formed a complex in vivo based on coimmunoprecipitation experiments and coimmunostaining in primary neurons. In primary hippocampal neurons Kif20b knockdown reduced Shootin1 mobilization to the developing axon, as evidenced by immunostaining and fluorescence recovery after photobleaching analysis, suggesting that Shootin1 is a novel KIF20B cargo. shRNA targeting of Shootin1 reduced PIP3 accumulation in the growth cone, as did Kif20b shRNA. In the developing mouse brain, Kif20b knockdown or expression of the KIF20B minimal binding domain inhibited neuronal migration, and in vivo migration assays suggested that Shootin1/Kif20b acts in the same genetic pathway. Time-lapse imaging of multipolar cells in the subventricular zone revealed that downregulating levels of either Shootin1 or Kif20b hindered the transition from multipolar to bipolar cells. Collectively, our data demonstrate the importance of the Shootin1/KIF20B interaction to the dynamic process of pyramidal neuronal polarization and migration.

  8. Provider Bias in Long-Acting Reversible Contraception (LARC) Promotion and Removal: Perceptions of Young Adult Women

    PubMed Central

    Kramer, Renee D.; Ryder, Kristin M.

    2016-01-01

    Long-acting reversible contraception (LARC) is effective and acceptable. However, concern exists about potential provider bias in LARC promotion. No study has documented contraceptive users’ attitudes toward or experiences with provider influence and bias regarding LARC. We collected qualitative data in 2014 to address this gap. Participants were 50 young adult women with any history of contraceptive use (including LARC) in Dane County, Wisconsin. Women often described providers as a trusted source of contraceptive information. However, several women reported that their preferences regarding contraceptive selection or removal were not honored. Furthermore, many participants believed that providers recommend LARC disproportionately to socially marginalized women. We encourage contraceptive counseling and removal protocols that directly address historical reproductive injustices and that honor patients’ wishes. PMID:27631741

  9. TMF and glycitin act synergistically on keratinocytes and fibroblasts to promote wound healing and anti-scarring activity

    PubMed Central

    Seo, Ga Young; Lim, Yoongho; Koh, Dongsoo; Huh, Jung Sik; Hyun, Changlim; Kim, Young Mee; Cho, Moonjae

    2017-01-01

    Keratinocyte-fibroblast interactions are critical for skin repair after injury. During the proliferative phase of wound healing, proliferation, migration and differentiation of these cells are the major mechanisms leading to tissue remodeling. We have previously reported that glycitin, a major soy isoflavone, stimulates dermal fibroblast proliferation; and the phytochemical, 4′,6,7-trimethoxyisoflavone (TMF), induces migration of HaCaT keratinocyte cells. We therefore investigated whether these compounds display synergistic effects on skin cells during wound healing in vitro and in vivo. Co-treatment with TMF and glycitin synergistically promotes the proliferation and migration of both keratinocytes and dermal fibroblasts, with a 1:1 ratio of these compounds showing the greatest efficacy in our co-culture system. This keratinocyte-fibroblast interaction occurred via the secretion of TGF-β, and the induction of differentiation and proliferation was confirmed in both indirect and direct co-culture assays. In an excisional and burn wound animal model, mice treated with a 1:1 ratio of TMF and glycitin showed faster wound closure, regeneration and scar reduction than even the positive control drug. These data indicate that two isoflavones, TMF and glycitin, act synergistically to promote wound healing and anti-scarring and could potentially be developed together as a bioactive therapeutic for wound treatment. PMID:28303029

  10. Galectin-3 released in response to traumatic brain injury acts as an alarmin orchestrating brain immune response and promoting neurodegeneration.

    PubMed

    Yip, Ping Kei; Carrillo-Jimenez, Alejandro; King, Paul; Vilalta, Anna; Nomura, Koji; Chau, Chi Cheng; Egerton, Alexander Michael Scott; Liu, Zhuo-Hao; Shetty, Ashray Jayaram; Tremoleda, Jordi L; Davies, Meirion; Deierborg, Tomas; Priestley, John V; Brown, Guy Charles; Michael-Titus, Adina Teodora; Venero, Jose Luis; Burguillos, Miguel Angel

    2017-01-27

    Traumatic brain injury (TBI) is currently a major cause of morbidity and poor quality of life in Western society, with an estimate of 2.5 million people affected per year in Europe, indicating the need for advances in TBI treatment. Within the first 24 h after TBI, several inflammatory response factors become upregulated, including the lectin galectin-3. In this study, using a controlled cortical impact (CCI) model of head injury, we show a large increase in the expression of galectin-3 in microglia and also an increase in the released form of galectin-3 in the cerebrospinal fluid (CSF) 24 h after head injury. We report that galectin-3 can bind to TLR-4, and that administration of a neutralizing antibody against galectin-3 decreases the expression of IL-1β, IL-6, TNFα and NOS2 and promotes neuroprotection in the cortical and hippocampal cell populations after head injury. Long-term analysis demonstrated a significant neuroprotection in the cortical region in the galectin-3 knockout animals in response to TBI. These results suggest that following head trauma, released galectin-3 may act as an alarmin, binding, among other proteins, to TLR-4 and promoting inflammation and neuronal loss. Taking all together, galectin-3 emerges as a clinically relevant target for TBI therapy.

  11. HDGF-related protein-2 (HRP-2) acts as an oncogene to promote cell growth in hepatocellular carcinoma.

    PubMed

    Gao, Kun; Xu, Chen; Jin, Xiaofeng; Wumaier, Reziya; Ma, Jian; Peng, Jingtao; Wang, Yuqi; Tang, Yan; Yu, Long; Zhang, Pingzhao

    2015-03-20

    HDGFRP2 (HRP-2) belongs to the Hepatoma-derived growth factor (HDGF)-related proteins (HRPs) family, which are characterized by a conserved HATH/PWWP domain at a well-conserved region of the N-terminus. However, the cellular function of HRP-2 remains unknown. In this study, we showed for the first time that HRP-2 is frequently overexpressed in human HCC tissues at mRNA and protein levels. We further showed that HRP-2 can promote HCC cells growth in vitro and xenograft tumors in vivo. Using protein affinity purification methods, we searched for functional partners of HRP-2, and found that HRP-2 interacts with various proteins known to be involved in transcription elongation and processing. Furthermore, we demonstrate HRP-2 interacts and co-localizes with RNA processing regulator IWS1, and positively regulated the mRNA level of Cyclin D1. Together, our study suggests HRP-2 may act as an mRNA processing co-factor to promote cells growth by regulating the mRNA of key oncogenes, which can be explored further for cancer treatment.

  12. Galectin-3 released in response to traumatic brain injury acts as an alarmin orchestrating brain immune response and promoting neurodegeneration

    PubMed Central

    Yip, Ping Kei; Carrillo-Jimenez, Alejandro; King, Paul; Vilalta, Anna; Nomura, Koji; Chau, Chi Cheng; Egerton, Alexander Michael Scott; Liu, Zhuo-Hao; Shetty, Ashray Jayaram; Tremoleda, Jordi L.; Davies, Meirion; Deierborg, Tomas; Priestley, John V.; Brown, Guy Charles; Michael-Titus, Adina Teodora; Venero, Jose Luis; Burguillos, Miguel Angel

    2017-01-01

    Traumatic brain injury (TBI) is currently a major cause of morbidity and poor quality of life in Western society, with an estimate of 2.5 million people affected per year in Europe, indicating the need for advances in TBI treatment. Within the first 24 h after TBI, several inflammatory response factors become upregulated, including the lectin galectin-3. In this study, using a controlled cortical impact (CCI) model of head injury, we show a large increase in the expression of galectin-3 in microglia and also an increase in the released form of galectin-3 in the cerebrospinal fluid (CSF) 24 h after head injury. We report that galectin-3 can bind to TLR-4, and that administration of a neutralizing antibody against galectin-3 decreases the expression of IL-1β, IL-6, TNFα and NOS2 and promotes neuroprotection in the cortical and hippocampal cell populations after head injury. Long-term analysis demonstrated a significant neuroprotection in the cortical region in the galectin-3 knockout animals in response to TBI. These results suggest that following head trauma, released galectin-3 may act as an alarmin, binding, among other proteins, to TLR-4 and promoting inflammation and neuronal loss. Taking all together, galectin-3 emerges as a clinically relevant target for TBI therapy. PMID:28128358

  13. Acetylcholine acts through M3 muscarinic receptor to activate the EGFR signaling and promotes gastric cancer cell proliferation

    PubMed Central

    Yu, Huangfei; Xia, Hongwei; Tang, Qiulin; Xu, Huanji; Wei, Guoqing; Chen, Ying; Dai, Xinyu; Gong, Qiyong; Bi, Feng

    2017-01-01

    Acetylcholine (ACh), known as a neurotransmitter, regulates the functions of numerous fundamental central and peripheral nervous system. Recently, emerging evidences indicate that ACh also plays an important role in tumorigenesis. However, little is known about the role of ACh in gastric cancer. Here, we reported that ACh could be auto-synthesized and released from MKN45 and BGC823 gastric cancer cells. Exogenous ACh promoted cell proliferation in a does-dependent manner. The M3R antagonist 4-DAMP, but not M1R antagonist trihexyphenidyl and M2/4 R antagonist AFDX-116, could reverse the ACh-induced cell proliferation. Moreover, ACh, via M3R, activated the EGFR signaling to induce the phosphorylation of ERK1/2 and AKT, and blocking EGFR pathway by specific inhibitor AG1478 suppressed the ACh induced cell proliferation. Furthermore, the M3R antagonist 4-DAMP and darifenacin could markedly inhibit gastric tumor formation in vivo. 4-DAMP could also significantly enhance the cytotoxic activity of 5-Fu against the MKN45 and BGC823 cells, and induce the expression of apoptosis-related proteins such as Bax and Caspase-3. Together, these findings indicated that the autocrine ACh could act through M3R and the EGFR signaling to promote gastric cancer cells proliferation, targeting M3R or EGFR may provide us a potential therapeutic strategy for gastric cancer treatment. PMID:28102288

  14. State, District, and School Implementation of Reforms Promoted under the Recovery Act: 2009-10 through 2011-12. The Final Report from Charting the Progress of Education Reform: An Evaluation of the Recovery Act's Role. NCEE 2015-4016

    ERIC Educational Resources Information Center

    Troppe, Patricia; Milanowski, Anthony; Garrison-Mogren, Roberta; Webber, Ann; Gutmann, Babette; Reisner, Elizabeth; Goertz, Margaret

    2015-01-01

    This report, based on surveys completed by all 50 State Education Agencies (SEAs) and the District of Columbia (DC) and nationally representative samples of districts and schools during spring 2011 and 2012, examines implementation of the key education reform strategies promoted by the Recovery Act in 2011-12, the extent to which implementation…

  15. "America COMPETES Reauthorization Act of 2010" or the "America Creating Opportunities to Meaningfully Promote Excellence in Technology, Education, and Science Reauthorization Act of 2010." House of Representatives, One Hundred Eleventh Congress, Second Session. H.R. 5116

    ERIC Educational Resources Information Center

    US House of Representatives, 2010

    2010-01-01

    The America COMPETES (Creating Opportunities to Meaningfully Promote Excellence in Technology, Education, and Science) Reauthorization Act of 2010 documented here is divided into the following titles: (1) Office of Science and Technology Policy (Coordination of Federal STEM [science, technology, engineering, and mathematics] education;…

  16. American Savings Promotion Act

    THOMAS, 113th Congress

    Sen. Moran, Jerry [R-KS

    2013-10-29

    10/29/2013 Read twice and referred to the Committee on Banking, Housing, and Urban Affairs. (All Actions) Notes: For further action, see H.R.3374, which became Public Law 113-251 on 12/18/2014. Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  17. Business Incubator Promotion Act

    THOMAS, 111th Congress

    Rep. Ryan, Tim [D-OH-17

    2010-04-21

    04/22/2010 Referred to the Subcommittee on Economic Development, Public Buildings and Emergency Management. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  18. Promoting New Manufacturing Act

    THOMAS, 113th Congress

    Rep. Scalise, Steve [R-LA-1

    2014-05-30

    12/01/2014 Received in the Senate and Read twice and referred to the Committee on Environment and Public Works. (All Actions) Tracker: This bill has the status Passed HouseHere are the steps for Status of Legislation:

  19. Export Promotion Reform Act

    THOMAS, 112th Congress

    Rep. Berman, Howard L. [D-CA-28

    2012-02-15

    06/04/2012 Received in the Senate and Read twice and referred to the Committee on Banking, Housing, and Urban Affairs. (All Actions) Tracker: This bill has the status Passed HouseHere are the steps for Status of Legislation:

  20. [Health promotion in a workplace in The United Kingdom of Great Britain and Northern Ireland by taking into consideration acts prohibited tobacco smoking].

    PubMed

    Kurzepa-Hasan, Edyta; Adamek, Renata; Hasan, Kawa

    2008-01-01

    This study presents health promotion strategies in a workplace in The United Kingdom of Great Britain and Northern Ireland. A workplace is a very important area for health promotion activities because of almost unlimited access to target group--adult group, especially good opportunity to access to men, who rather seldom going to a doctor. In 2004 Committee on Tobacco and Heath (SCOTH) classified environmental tobacco smoking (ETS) for category: "serious hazards for public health" after conducted study of harmful effects of ETS. In 2007 England becomes "free" from ETS, because of acts prohibited tobacco smoking in public places and in workplaces. In 26th of March 2006 Health Act in Scotland and in the second of April 2007 in Wales also prohibited smoking in public places. The aim of a new act was to protect health and prevention illness caused by exposition to ETS. So, there is prohibition for everyone: employees, clients, employers and guests in a whole company, in closed area and fundamental closed areas (according act). The act is also about previous areas intended for tobacco smoking. In 30th of April in 2007 Northern Ireland also prohibited smoking in public places. There are many profits for everyone, for example: protection people's health exposed to ETS, much slower development some serious illness, reduction of medical care cost and improvement of environment for community. If smokers decide to quit smoking or even reduce the number of smoking cigarettes per day, a population would be healthier.

  1. Cell-specific activity of cis-acting regulatory elements in the promoter of the mouse multidrug resistance gene mdr1.

    PubMed

    Raymond, M; Gros, P

    1990-11-01

    To define cis-acting elements implicated in transcriptional regulation of the mouse multidrug resistance gene mdr1, we have cloned and characterized the 5' end of the gene. Nucleotide sequence analysis identified TATA, GGGCGG, and CCAAT consensus sequence elements at positions -27, -47, and -83, respectively. The transcriptional activities of 5' deletion fragments from the promoter linked to a reporter gene were tested in mouse cell lines of different tissue origins shown to express different levels of endogenous mdr1 RNA. Sequences located between nucleotides -93 and +84 were able to confer basal promoter activity and cell specificity to the reporter gene. The addition to the basal promoter of sequences upstream of position -141 was found to up or down regulate the basal level of expression of the reporter gene in a cell-specific manner.

  2. cis-Acting Elements within the Candida albicans ERG11 Promoter Mediate the Azole Response through Transcription Factor Upc2p▿

    PubMed Central

    Oliver, Brian G.; Song, Jia L.; Choiniere, Jake H.; White, Theodore C.

    2007-01-01

    The azole antifungal drugs are used to treat infections caused by Candida albicans and other fungi. These drugs interfere with the biosynthesis of ergosterol, the major sterol in fungal cells, by inhibiting an ergosterol biosynthetic enzyme, lanosterol 14 α-demethylase, encoded by the ERG11 gene. In vitro, these drugs as well as other ergosterol biosynthesis inhibitors increase ERG11 mRNA expression by activation of the ERG11 promoter. The signal for this activation most likely is the depletion of ergosterol, the end product of the pathway. To identify cis-acting regulatory elements that mediate this activation, ERG11 promoter fragments have been fused to the luciferase reporter gene from Renilla reniformis. Promoter deletions and linker scan mutations localized the region important for azole induction to a segment from bp −224 to −251 upstream of the start codon, specifically two 7-bp sequences separated by 13 bp. These sequences form an imperfect inverted repeat. The region is recognized by the transcription factor Upc2p and functions as an enhancer of transcription, as it can be placed upstream of a heterologous promoter in either direction, resulting in the azole induction of that promoter. The promoter constructs are not azole inducible in the upc2/upc2 homozygous deletion, demonstrating that Upc2p controls the azole induction of ERG11. These results identify an azole-responsive enhancer element (ARE) in the ERG11 promoter that is controlled by the Upc2p transcription factor. No other ARE is present in the promoter. Thus, this ARE and Upc2p are necessary and sufficient for azole induction of ERG11. PMID:17951521

  3. The nuclear orphan receptors COUP-TFII and Ear-2 act as silencers of the human oxytocin gene promoter.

    PubMed

    Chu, K; Zingg, H H

    1997-10-01

    We have previously shown that COUP-TFII and Ear-2, two members of the nuclear orphan receptor family, are able to repress oestrogen-stimulated transcriptional activity of the human oxytocin (OT) gene promoter by binding to a site that overlaps with the oestrogen response element (ERE) present in the 5' flanking region of the gene. Although most nuclear receptor-mediated transcriptional repression conforms with the paradigm of passive repression and involves competitive binding to an activator site, active repression, i.e. silencing of basal promoter activity, has been observed in a limited number of cases. Here we show by co-transfection experiments using COUP-TFII and Ear-2 expression vectors and reporter constructs containing OT gene promoter fragments linked to the chloramphenicol acetyltransferase gene that both COUP-TFII and Ear-2 are capable of silencing basal OT gene promoter activity by 54 and 75% respectively. 5' Deletion and footprint analyses revealed two areas of functionally important interaction sites: (1) a direct TGACC(T/C) repeat overlapping the ERE and (2) a more promoter-proximal area centred at - 90 containing three imperfect direct repeats (R1-R3) spaced by four nucleotides each. Mutagenesis of reporter constructs as well as electrophoretic mobility-shift assays demonstrated that each of the three proximal repeats R1-R3 contributed to orphan receptor binding and the silencing effect. Inasmuch as the orphan receptor-binding sites are not involved in mediating basal transcriptional activity of the OT gene promoter, the observed effects are best interpreted as active repression or promoter silencing. Moreover, since COUP-TFII and Ear-2 are both co-expressed in OT-expressing uterine epithelial cells, the novel transcriptional effects described here are likely to be of functional importance in the fine-tuning of uterine OT gene expression in vivo.

  4. Identification of a cis-acting element in the class I major histocompatibility complex gene promoter responsive to activation by retroviral sequences.

    PubMed Central

    Choi, S Y; van de Mark, K; Faller, D V

    1997-01-01

    The infection of cells with Moloney murine leukemia virus (M-MuLV) causes an increase in specific cellular gene products, including the major histocompatibility complex (MHC) class I antigens. This upregulation occurs through a transactivation process mediated by the long terminal repeat (LTR) of M-MuLV, and we show here that the gene activation response to the LTR requires at least one specific cis element within the MHC proximal promoter region. Nested deletions of MHC class I H-2Kb gene promoter sequence were subcloned into a chloramphenicol acetyltransferase (CAT) reporter vector and then transiently introduced into BALB/c-3T3 cells expressing M-MuLV or cotransfected into BALB/c-3T3 cells with a vector containing subgenomic portions of the virus, including the LTR. CAT activity assays demonstrated that a minimal H-2Kb gene promoter (-64 to +12) contained elements sufficient for this transactivation. DNase I footprinting assays located a protein-binding site in the region of -64 to -34 bp from the transcriptional start site, and point mutation analysis confirmed the location of this cis-acting element, designated the let response element (LRE), and defined a binding motif. This LRE is distinct from binding sites for currently known transcription factors in the class I MHC gene promoter and is conserved in the promoters of human and murine MHC class I genes. Mutation of the LRE resulted in dramatic reduction in both DNA-protein binding activity in electrophoretic mobility shift assay and in the ability of the mutated promoter to respond to retroviral transactivation. Addition of the LRE to a heterologous promoter conferred the ability to respond to retroviral transactivation. PMID:8995614

  5. Identification of cis-acting regulatory elements in the promoter region of the rat brain creatine kinase gene.

    PubMed Central

    Hobson, G M; Molloy, G R; Benfield, P A

    1990-01-01

    The functional organization of the rat brain creatine kinase (ckb) promoter was analyzed by deletion, linker scanning, and substitution mutagenesis. Mutations were introduced into the ckb promoter of hybrid ckb/neo (neomycin resistance gene) genes, and the mutant genes were expressed transiently in HeLa cells. Expression was assayed by primer extension analysis of neo RNA, which allowed the transcription start sites and the amount of transcription to be determined. Transfections and primer extension reactions were internally controlled by simultaneous analysis of transcription from the adenovirus VA gene located on the same plasmid as the hybrid ckb/neo gene. We demonstrate that 195 bp of the ckb promoter is sufficient for efficient in vivo expression in HeLa cells. A nonconsensus TTAA element at -28 bp appears to provide the TATA box function for the ckb promoter in vivo. Two CCAAT elements, one at -84 bp and the other at -54 bp, and a TATAAA TA element (a consensus TATA box sequence) at -66 bp are required for efficient transcription from the TTAA element. In addition, we present evidence that the consensus beta-globin TATA box responds to the TATAAATA element in the same way as the ckb nonconsensus TTAA element. Images PMID:2247071

  6. Transcriptional activation of the herpes simplex virus type 1 UL38 promoter conferred by the cis-acting downstream activation sequence is mediated by a cellular transcription factor.

    PubMed

    Guzowski, J F; Singh, J; Wagner, E K

    1994-12-01

    The herpes simplex virus (HSV) type 1 strict late (gamma) UL38 promoter contains three cis-acting transcriptional elements: a TATA box, a specific initiator element, and the downstream activation sequence (DAS). DAS is located between positions +20 and +33 within the 5' untranslated leader region and strongly influences transcript levels during productive infection. In this communication, we further characterize DAS and investigate its mechanism of action. DAS function has a strict spacing requirement, and DAS contains an essential 6-bp core element. A similarly positioned element from the gamma gC gene (UL44) has partial DAS function within the UL38 promoter context, and the promoter controlling expression of the gamma US11 transcript contains an identically located element with functional and sequence similarity to UL38 DAS. These data suggest that downstream elements are a common feature of many HSV gamma promoters. Results with recombinant viruses containing modifications of the TATA box or initiator element of the UL38 promoter suggest that DAS functions to increase transcription initiation and not the efficiency of transcription elongation. In vitro transcription assays using uninfected HeLa nuclear extracts show that, as in productive infection with recombinant viruses, the deletion of DAS from the UL38 promoter dramatically decreases RNA expression. Finally, electrophoretic mobility shift assays and UV cross-linking experiments show that DAS DNA forms a specific, stable complex with a cellular protein (the DAS-binding factor) of approximately 35 kDa. These data strongly suggest that the interaction of cellular DAS-binding factor with DAS is required for efficient expression of UL38 and other HSV late genes.

  7. miR-574-3p acts as a tumor promoter in osteosarcoma by targeting SMAD4 signaling pathway

    PubMed Central

    Xu, Haidong; Liu, Xiaozhou; Zhou, Juan; Chen, Xiaoyun; Zhao, Jianning

    2016-01-01

    Human osteosarcoma is the most common primary bone malignancy sarcoma that affects primarily children and people <20 years old. In the present study, it was demonstrated that miR-574-3p was downregulated in human osteosarcoma U2OS, SAOS and MG63 cells lines as well as in osteosarcoma tissue compared with the normal tissues. Downregulation of miR-574-3p by antisense miR-574-3p, inhibited cell growth and induced cell apoptosis. Overexpression of miR-574-3p by transfection with miR-574-3p mimics promoted the growth of U2OS cells. The present study then identified mothers against decapentaplegic homolog 4 (SMAD4) as a target of miR-574-3p and SMAD4 was suppressed in miR-574-3p transfected cells. Overexpression of SMAD4 could rescue the promoting effects of miR-574-3p on cancer cell growth. In conclusion, miR-574-3p exerts tumor-promoting roles by targeting the tumor-suppressing gene SMAD4 and its downstream signaling in human osteosarcoma, which provides a novel target for the treatment. PMID:28105233

  8. cis-acting DNA regulatory elements, including the retinoic acid response element, are required for tissue specific laminin B1 promoter/lacZ expression in transgenic mice.

    PubMed

    Sharif, K A; Li, C; Gudas, L J

    2001-05-01

    The LAMB1 gene encodes the laminin beta1 subunit of laminin, an extracellular matrix protein. Using several transgenic mouse lines containing various lengths of the LAMB1 promoter driving lacZ reporter gene expression, regions of LAMB1 promoter that contain cis-acting DNA regulatory element(s) have been identified. The 3.9LAMB1betagal transgene is expressed in various tissues during development. LAMB1 transgene expression is observed in a selective set of nephrons of the neonatal and adult kidneys. The cis-acting DNA regulatory elements responsible for LAMB1 transgene expression in ovaries and in juvenile kidneys are present between -'1.4 and -0.7 kb relative to the transcription start site, while those of adult kidneys are located between -2.5 and -1.4 kb. The LAMB1 transgene is also expressed in the epididymis of 1 week old transgenic mice. Mutation of the retinoic acid response element (RARE) in the context of the 3.9LAMB1betagal transgene results in loss of LAMB1 transgene expression in all tissues. Thus, sequences between -2.5 and -0.7 kb plus the RARE are required for appropriate expression of the LAMB1 transgene in mice.

  9. Promoting Mentalizing in Pupils by Acting on Teachers: Preliminary Italian Evidence of the “Thought in Mind” Project

    PubMed Central

    Valle, Annalisa; Massaro, Davide; Castelli, Ilaria; Sangiuliano Intra, Francesca; Lombardi, Elisabetta; Bracaglia, Edoardo; Marchetti, Antonella

    2016-01-01

    Mentalization research focuses on different aspects of this topic, highlighting individual differences in mentalizing and proposing programs of intervention for children and adults to increase this ability. The “Thought in Mind Project” (TiM Project) provides training targeted to adults—teachers or parents—to increase their mentalization and, consequently, to obtain mentalization improvement in children. The present research aimed to explore for the first time ever the potential of training for teachers based on the TiM Project, regarding the enhancement of mentalizing of an adult who would have interacted as a teacher with children. For this reason, two teachers – similar for meta-cognitive and meta-emotional skills - and their classes (N = 46) were randomly assigned to the training or control condition. In the first case, the teacher participated in training on the implementation of promotion of mentalizing in everyday school teaching strategies; in the second case the teacher participated in a control activity, similar to training for scheduling and methods, but without promoting the implementation of mentalization (in both conditions two meetings lasting about 3 h at the beginning of the school year and two supervisions during the school year were conducted). The children were tested by tasks assessing several aspects of mentalization (second and third-order false belief understanding, Strange Stories, Reading the mind in the Eyes, Mentalizing Task) both before and after the teacher participate in the TiM or control training (i.e., at the beginning and at the end of the school year). The results showed that, although some measured components of mentalization progressed over time, only the TiM Project training group significantly improved in third order false belief understanding and changed - in a greater way compared to the control group – in two of the three components of the Mentalizing Task. These evidences are promising about the idea that the

  10. Recent trends in population-based cancer registries in Japan: the Act on Promotion of Cancer Registries and drastic changes in the historical registry.

    PubMed

    Matsuda, Tomohiro; Sobue, Tomotaka

    2015-02-01

    Cancer registration in Japan has a long history spanning over 60 years; the first population-based cancer registry was established in Miyagi prefecture in 1951. The progress made in the regional population-based cancer registries in terms of standardization and quality improvement during the 10 years of the third comprehensive strategy for cancer control was highlighted in the history of cancer registration in Japan. However, there were still weak points regarding local government-oriented cancer registries that remained, e.g., the reporting of cancer cases to the population-based cancer registries was not a mandatory task for medical institutions. After the Cancer Control Act in 2006, the Act on Promotion of Cancer Registries was finally enacted in Japan on December 6, 2013. According to that Act, hospital managers must report information on any primary cancer that was first diagnosed in their institutions from January 1, 2016 to the prefectural governors. Given the increasing number of cases and amount of information recorded, it would have been almost impossible to maintain our cancer registries using the same system, and changes were required to obtain reliable cancer statistics. This was particularly important in Japan, because the country is facing a hyper-aging society, with two to three million cancer patients requiring entry of detailed information. We appreciate the long history of the Japanese cancer registry, but it is necessary to make dramatic changes to bring the registry up to date and to be able to track the increasing amount of information.

  11. Synthetic promoters consisting of defined cis-acting elements link multiple signaling pathways to probenazole-inducible system * #

    PubMed Central

    Zhu, Zheng; Gao, Jiong; Yang, Jin-xiao; Wang, Xiao-yan; Ren, Guo-dong; Ding, Yu-long; Kuai, Ben-ke

    2015-01-01

    Probenazole (3-allyloxy-1,2-benzisothiazole-1,1-dioxide, PBZ), the active component of Oryzemate, could induce systemic acquired resistance (SAR) in plants through the induction of salicylic acid (SA) biosynthesis. As a widely used chemical inducer, PBZ is a good prospect for establishing a new chemical-inducible system. We first designed artificially synthetic promoters with tandem copies of a single type of cis-element (SARE, JERE, GCC, GST1, HSRE, and W-box) that could mediate the expression of the β-glucuronidase (GUS) reporter gene in plants upon PBZ treatment. Then we combined different types of elements in order to improve inducibility in the PBZ-inducible system. On the other hand, we were surprised to find that the cis-elements, which are responsive to jasmonic acid (JA) and ethylene, also responded to PBZ, implying that SA, JA, and ethylene pathways also would play important roles in PBZ’s action. Further analysis demonstrated that PBZ also induced early events of innate immunity via a signaling pathway in which Ca2+ influx and mitogen-activated protein kinase (MAPK) activity were involved. We constructed synthesized artificial promoters to establish a PBZ chemical-inducible system, and preliminarily explored SA, JA, ethylene, calcium, and MAPK signaling pathways via PBZ-inducible system, which could provide an insight for in-depth study. PMID:25845359

  12. Evidence that TSC2 acts as a transcription factor and binds to and represses the promoter of Epiregulin.

    PubMed

    Pradhan, Shalmali Avinash; Rather, Mohammad Iqbal; Tiwari, Ankana; Bhat, Vishwanath Kumble; Kumar, Arun

    2014-06-01

    The TSC2 gene, mutated in patients with tuberous sclerosis complex (TSC), encodes a 200 kDa protein TSC2 (tuberin). The importance of TSC2 in the regulation of cell growth and proliferation is irrefutable. TSC2 in complex with TSC1 negatively regulates the mTOR complex 1 (mTORC1) via RHEB in the PI3K-AKT-mTOR pathway and in turn regulates cell proliferation. It shows nuclear as well as cytoplasmic localization. However, its nuclear function remains elusive. In order to identify the nuclear function of TSC2, a whole-genome expression profiling of TSC2 overexpressing cells was performed, and the results showed differential regulation of 266 genes. Interestingly, transcription was found to be the most populated functional category. EREG (Epiregulin), a member of the epidermal growth factor family, was found to be the most downregulated gene in the microarray analysis. Previous reports have documented elevated levels of EREG in TSC lesions, making its regulatory aspects intriguing. Using the luciferase reporter, ChIP and EMSA techniques, we show that TSC2 binds to the EREG promoter between -352 bp and -303 bp and negatively regulates its expression. This is the first evidence for the role of TSC2 as a transcription factor and of TSC2 binding to the promoter of any gene.

  13. Evidence that TSC2 acts as a transcription factor and binds to and represses the promoter of Epiregulin

    PubMed Central

    Pradhan, Shalmali Avinash; Rather, Mohammad Iqbal; Tiwari, Ankana; Bhat, Vishwanath Kumble; Kumar, Arun

    2014-01-01

    The TSC2 gene, mutated in patients with tuberous sclerosis complex (TSC), encodes a 200 kDa protein TSC2 (tuberin). The importance of TSC2 in the regulation of cell growth and proliferation is irrefutable. TSC2 in complex with TSC1 negatively regulates the mTOR complex 1 (mTORC1) via RHEB in the PI3K-AKT-mTOR pathway and in turn regulates cell proliferation. It shows nuclear as well as cytoplasmic localization. However, its nuclear function remains elusive. In order to identify the nuclear function of TSC2, a whole-genome expression profiling of TSC2 overexpressing cells was performed, and the results showed differential regulation of 266 genes. Interestingly, transcription was found to be the most populated functional category. EREG (Epiregulin), a member of the epidermal growth factor family, was found to be the most downregulated gene in the microarray analysis. Previous reports have documented elevated levels of EREG in TSC lesions, making its regulatory aspects intriguing. Using the luciferase reporter, ChIP and EMSA techniques, we show that TSC2 binds to the EREG promoter between −352 bp and −303 bp and negatively regulates its expression. This is the first evidence for the role of TSC2 as a transcription factor and of TSC2 binding to the promoter of any gene. PMID:24748662

  14. The ribonucleotidyl transferase USIP-1 acts with SART3 to promote U6 snRNA recycling

    PubMed Central

    Rüegger, Stefan; Miki, Takashi S.; Hess, Daniel; Großhans, Helge

    2015-01-01

    The spliceosome is a large molecular machine that serves to remove the intervening sequences that are present in most eukaryotic pre-mRNAs. At its core are five small nuclear ribonucleoprotein complexes, the U1, U2, U4, U5 and U6 snRNPs, which undergo dynamic rearrangements during splicing. Their reutilization for subsequent rounds of splicing requires reversion to their original configurations, but little is known about this process. Here, we show that ZK863.4/USIP-1 (U Six snRNA-Interacting Protein-1) is a ribonucleotidyl transferase that promotes accumulation of the Caenorhabditis elegans U6 snRNA. Endogenous USIP-1–U6 snRNA complexes lack the Lsm proteins that constitute the protein core of the U6 snRNP, but contain the U6 snRNP recycling factor SART3/B0035.12. Furthermore, co-immunoprecipitation experiments suggest that SART3 but not USIP-1 occurs also in a separate complex containing both the U4 and U6 snRNPs. Based on this evidence, genetic interaction between usip-1 and sart-3, and the apparent dissociation of Lsm proteins from the U6 snRNA during spliceosome activation, we propose that USIP-1 functions upstream of SART3 to promote U6 snRNA recycling. PMID:25753661

  15. Long noncoding RNA CCAT1 acts as an oncogene and promotes chemoresistance in docetaxel-resistant lung adenocarcinoma cells

    PubMed Central

    Wang, Rui; Chu, Xiaoyuan; Chen, Longbang

    2016-01-01

    Chemoresistance remains one of the major obstacles in clinical treatment of lung adenocarcinoma (LAD). Indeed, docetaxel-resistant LAD cells present chemoresistance and epithelial-to-mesenchymal transition phenotypes. Long non-coding RNAs (lncRNAs) are known to promote tumorigenesis in many cancer types. Here, we showed that the lncRNA colon cancer-associated transcript-1 (CCAT1) was upregulated in docetaxel-resistant LAD cells. Furthermore, downregulation of CCAT1 decreased chemoresistance, inhibited proliferation, enhanced apoptosis and reversed the epithelial-to-mesenchymal transition phenotype of docetaxel-resistant LAD cells. We also found that the oncogenic function of CCAT1 in docetaxel-resistant LAD cells depended on the sponging of let-7c. In turn, the sponging of let-7c by CCAT1 released Bcl-xl (a let-7c target), thereby promoting the acquisition of chemoresistance and epithelial-to-mesenchymal transition phenotypes in docetaxel-resistant LAD cells. Our data reveal a novel pathway underlying chemoresistance and the epithelial-to-mesenchymal transition in docetaxel-resistant LAD cells. PMID:27566568

  16. Clobetasol and Halcinonide Act as Smoothened Agonists to Promote Myelin Gene Expression and RxRγ Receptor Activation

    PubMed Central

    De Nardis, Velia; Di Giandomenico, Daniele; Lucisano, Giuseppe; Scardapane, Marco; Poma, Anna; Ragnini-Wilson, Antonella

    2015-01-01

    One of the causes of permanent disability in chronic multiple sclerosis patients is the inability of oligodendrocyte progenitor cells (OPCs) to terminate their maturation program at lesions. To identify key regulators of myelin gene expression acting at the last stages of OPC maturation we developed a drug repositioning strategy based on the mouse immortalized oligodendrocyte (OL) cell line Oli-neu brought to the premyelination stage by stably expressing a key factor regulating the last stages of OL maturation. The Prestwick Chemical Library® of 1,200 FDA-approved compound(s) was repositioned at three dosages based on the induction of Myelin Basic Protein (MBP) expression. Drug hits were further validated using dosage-dependent reproducibility tests and biochemical assays. The glucocorticoid class of compounds was the most highly represented and we found that they can be divided in three groups according to their efficacy on MBP up-regulation. Since target identification is crucial before bringing compounds to the clinic, we searched for common targets of the primary screen hits based on their known chemical-target interactomes, and the pathways predicted by top ranking compounds were validated using specific inhibitors. Two of the top ranking compounds, Halcinonide and Clobetasol, act as Smoothened (Smo) agonists to up-regulate myelin gene expression in the Oli-neuM cell line. Further, RxRγ activation is required for MBP expression upon Halcinonide and Clobetasol treatment. These data indicate Clobetasol and Halcinonide as potential promyelinating drugs and also provide a mechanistic understanding of their mode of action in the pathway leading to myelination in OPCs. Furthermore, our classification of glucocorticoids with respect to MBP expression provides important novel insights into their effects in the CNS and a rational criteria for their choice in combinatorial therapies in de-myelinating diseases. PMID:26658258

  17. Clobetasol and Halcinonide Act as Smoothened Agonists to Promote Myelin Gene Expression and RxRγ Receptor Activation.

    PubMed

    Porcu, Giampiero; Serone, Eliseo; De Nardis, Velia; Di Giandomenico, Daniele; Lucisano, Giuseppe; Scardapane, Marco; Poma, Anna; Ragnini-Wilson, Antonella

    2015-01-01

    One of the causes of permanent disability in chronic multiple sclerosis patients is the inability of oligodendrocyte progenitor cells (OPCs) to terminate their maturation program at lesions. To identify key regulators of myelin gene expression acting at the last stages of OPC maturation we developed a drug repositioning strategy based on the mouse immortalized oligodendrocyte (OL) cell line Oli-neu brought to the premyelination stage by stably expressing a key factor regulating the last stages of OL maturation. The Prestwick Chemical Library of 1,200 FDA-approved compound(s) was repositioned at three dosages based on the induction of Myelin Basic Protein (MBP) expression. Drug hits were further validated using dosage-dependent reproducibility tests and biochemical assays. The glucocorticoid class of compounds was the most highly represented and we found that they can be divided in three groups according to their efficacy on MBP up-regulation. Since target identification is crucial before bringing compounds to the clinic, we searched for common targets of the primary screen hits based on their known chemical-target interactomes, and the pathways predicted by top ranking compounds were validated using specific inhibitors. Two of the top ranking compounds, Halcinonide and Clobetasol, act as Smoothened (Smo) agonists to up-regulate myelin gene expression in the Oli-neuM cell line. Further, RxRγ activation is required for MBP expression upon Halcinonide and Clobetasol treatment. These data indicate Clobetasol and Halcinonide as potential promyelinating drugs and also provide a mechanistic understanding of their mode of action in the pathway leading to myelination in OPCs. Furthermore, our classification of glucocorticoids with respect to MBP expression provides important novel insights into their effects in the CNS and a rational criteria for their choice in combinatorial therapies in de-myelinating diseases.

  18. Reg proteins promote acinar-to-ductal metaplasia and act as novel diagnostic and prognostic markers in pancreatic ductal adenocarcinoma

    PubMed Central

    Zogopoulos, George; Shao, Qin; Dong, Kun; Lv, Fudong; Nwilati, Karam; Gui, Xian-yong; Cuggia, Adeline; Liu, Jun-Li; Gao, Zu-hua

    2016-01-01

    Pancreatic ductal adenocarcinoma (PDAC) is a highly aggressive malignant tumor. Acinar-to-ductal metaplasia (ADM) and pancreatic intraepithelial neoplasia (PanIN) are both precursor lesions that lead to the development of PDAC. Reg family proteins (Reg1A, 1B, 3A/G, 4) are a group of calcium-dependent lectins that promote islet growth in response to inflammation and/or injuries. The aim of this study was to establish a role for Reg proteins in the development of PDAC and their clinical value as biomarkers. We found that Reg1A and Reg3A/G were highly expressed in the ADM tissues by immunohistochemistry. In the 3-dimensional culture of mouse acinar cells, Reg3A promoted ADM formation with concurrent activation of mitogen-acitvated protein kinase. Upregulation of Reg1A and Reg1B levels was observed as benign ductal epithelium progresses from PanIN to invasive PDAC. Patients with PDAC showed significantly higher serum levels of Reg1A and Reg1B than matching healthy subjects. These results were further validated by the quantification of Reg 1A and 1B mRNA levels in the microdissected tissues (22- and 6-fold increases vs. non-tumor tissues). Interestingly, patients with higher levels of Reg1A and 1B exhibited improved survival rate than those with lower levels. Furthermore, tissue expressions of Reg1A, Reg1B, and Reg4 could differentiate metastatic PDAC in the liver from intrahepatic cholangiocarcinoma with 92% sensitivity and 95% specificity. Overall, our results demonstrate the upregulation of Reg proteins during PDAC development. If validated in larger scale, Reg1A and Reg1B could become clinical markers for detecting early stages of PDAC, monitoring therapeutic response, and/or predicting patient's prognosis. PMID:27788482

  19. Id4, a New Candidate Gene for Senile Osteoporosis, Acts as a Molecular Switch Promoting Osteoblast Differentiation

    PubMed Central

    Yamashita, Yzumi; Nakachi, Yutaka; Nikaido, Itoshi; Bono, Hidemasa; Ninomiya, Yuichi; Kanesaki-Yatsuka, Yukiko; Akita, Masumi; Motegi, Hiromi; Wakana, Shigeharu; Noda, Tetsuo; Sablitzky, Fred; Arai, Shigeki; Kurokawa, Riki; Fukuda, Toru; Katagiri, Takenobu; Schönbach, Christian; Suda, Tatsuo; Mizuno, Yosuke; Okazaki, Yasushi

    2010-01-01

    Excessive accumulation of bone marrow adipocytes observed in senile osteoporosis or age-related osteopenia is caused by the unbalanced differentiation of MSCs into bone marrow adipocytes or osteoblasts. Several transcription factors are known to regulate the balance between adipocyte and osteoblast differentiation. However, the molecular mechanisms that regulate the balance between adipocyte and osteoblast differentiation in the bone marrow have yet to be elucidated. To identify candidate genes associated with senile osteoporosis, we performed genome-wide expression analyses of differentiating osteoblasts and adipocytes. Among transcription factors that were enriched in the early phase of differentiation, Id4 was identified as a key molecule affecting the differentiation of both cell types. Experiments using bone marrow-derived stromal cell line ST2 and Id4-deficient mice showed that lack of Id4 drastically reduces osteoblast differentiation and drives differentiation toward adipocytes. On the other hand knockdown of Id4 in adipogenic-induced ST2 cells increased the expression of Pparγ2, a master regulator of adipocyte differentiation. Similar results were observed in bone marrow cells of femur and tibia of Id4-deficient mice. However the effect of Id4 on Pparγ2 and adipocyte differentiation is unlikely to be of direct nature. The mechanism of Id4 promoting osteoblast differentiation is associated with the Id4-mediated release of Hes1 from Hes1-Hey2 complexes. Hes1 increases the stability and transcriptional activity of Runx2, a key molecule of osteoblast differentiation, which results in an enhanced osteoblast-specific gene expression. The new role of Id4 in promoting osteoblast differentiation renders it a target for preventing the onset of senile osteoporosis. PMID:20628571

  20. Sea Changes - ACT : Artists and Scientists collaborating to promote ocean activism and conservation. (www.seachanges.org)

    NASA Astrophysics Data System (ADS)

    Lueker, T.

    2012-12-01

    We are a group of ocean scientists, artists, and educators working to publicize the urgent environmental problems facing our ocean environs, including overfishing, climate change and ocean acidification, and environmental degradation due to plastic and other forms of pollution. Our team leader, Kira Carrillo Corser, is an artist and educator known nationally for affecting policy and social change. Our collaboration results from the DNA of Creativity Project - the brainchild of Patricia Frischer, co-ordinator for the San Diego Visual Arts Network (http://dnaofc.weebly.com). The DNA of Creativity funded teams composed of artists and scientists with the goal of fusing the creative energies of both into projects that will enhance the public's perception of creativity, and make the complexities of art and science collaborations accessible to a new and larger audience. Sea Changes - ACT was funded initially by the DNA of Creativity Project. Our project goals are : 1) To entice people to participate in the joys of discovery of art AND science and 2) To motivate the public to work for real, committed and innovative change to protect our oceans. Part of our strategy for achieving our goals is to create a traveling art installation to illustrate the beauty of the oceans and to instill in our viewers the joys of discovery and creativity that we as scientists and artists pursue. And following this, to make the destructive changes occurring in the ocean and the future consequences more visible and understandable. We will develop lesson plans to integrate our ideas into the educational system and we are documenting our collaborative and creative process to inform future art-science collaborations. Finally, after emotionally connecting with our viewers to provide a means to ACT to make real and positive CHANGES for the future. Our project aims to build commitment and action for environmental conservation and stewardship as we combine scientific research with ways to take action

  1. 7 CFR 1207.302 - Act.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE POTATO RESEARCH AND PROMOTION PLAN Potato Research and Promotion Plan Definitions § 1207.302 Act. Act means the Potato Research...

  2. 7 CFR 1207.302 - Act.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE POTATO RESEARCH AND PROMOTION PLAN Potato Research and Promotion Plan Definitions § 1207.302 Act. Act means the Potato Research...

  3. 7 CFR 1207.302 - Act.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE POTATO RESEARCH AND PROMOTION PLAN Potato Research and Promotion Plan Definitions § 1207.302 Act. Act means the Potato Research...

  4. 7 CFR 1207.302 - Act.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE POTATO RESEARCH AND PROMOTION PLAN Potato Research and Promotion Plan Definitions § 1207.302 Act. Act means the Potato Research...

  5. 7 CFR 1207.302 - Act.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE POTATO RESEARCH AND PROMOTION PLAN Potato Research and Promotion Plan Definitions § 1207.302 Act. Act means the Potato Research...

  6. 7 CFR 1221.1 - Act.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE SORGHUM PROMOTION, RESEARCH, AND INFORMATION ORDER Sorghum Promotion, Research, and Information Order Definitions § 1221.1 Act. Act means...

  7. 7 CFR 1221.1 - Act.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE SORGHUM PROMOTION, RESEARCH, AND INFORMATION ORDER Sorghum Promotion, Research, and Information Order Definitions § 1221.1 Act. Act means...

  8. 7 CFR 1221.1 - Act.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE SORGHUM PROMOTION, RESEARCH, AND INFORMATION ORDER Sorghum Promotion, Research, and Information Order Definitions § 1221.1 Act. Act means...

  9. 7 CFR 1221.1 - Act.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE SORGHUM PROMOTION, RESEARCH, AND INFORMATION ORDER Sorghum Promotion, Research, and Information Order Definitions § 1221.1 Act. Act means...

  10. 7 CFR 1221.1 - Act.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE SORGHUM PROMOTION, RESEARCH, AND INFORMATION ORDER Sorghum Promotion, Research, and Information Order Definitions § 1221.1 Act. Act means...

  11. 7 CFR 1218.1 - Act.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE BLUEBERRY PROMOTION, RESEARCH, AND INFORMATION ORDER Blueberry Promotion, Research, and Information Order Definitions § 1218.1 Act. Act means...

  12. 7 CFR 1218.1 - Act.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE BLUEBERRY PROMOTION, RESEARCH, AND INFORMATION ORDER Blueberry Promotion, Research, and Information Order Definitions § 1218.1 Act. Act means...

  13. 7 CFR 1218.1 - Act.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE BLUEBERRY PROMOTION, RESEARCH, AND INFORMATION ORDER Blueberry Promotion, Research, and Information Order Definitions § 1218.1 Act. Act means...

  14. 7 CFR 1218.1 - Act.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE BLUEBERRY PROMOTION, RESEARCH, AND INFORMATION ORDER Blueberry Promotion, Research, and Information Order Definitions § 1218.1 Act. Act means...

  15. 7 CFR 1218.1 - Act.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE BLUEBERRY PROMOTION, RESEARCH, AND INFORMATION ORDER Blueberry Promotion, Research, and Information Order Definitions § 1218.1 Act. Act means...

  16. 7 CFR 1216.1 - Act.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE PEANUT PROMOTION, RESEARCH, AND INFORMATION ORDER Peanut Promotion, Research, and Information Order Definitions § 1216.1 Act. Act means...

  17. 7 CFR 1216.1 - Act.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE PEANUT PROMOTION, RESEARCH, AND INFORMATION ORDER Peanut Promotion, Research, and Information Order Definitions § 1216.1 Act. Act means...

  18. 7 CFR 1216.1 - Act.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE PEANUT PROMOTION, RESEARCH, AND INFORMATION ORDER Peanut Promotion, Research, and Information Order Definitions § 1216.1 Act. Act means...

  19. 7 CFR 1216.1 - Act.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE PEANUT PROMOTION, RESEARCH, AND INFORMATION ORDER Peanut Promotion, Research, and Information Order Definitions § 1216.1 Act. Act means...

  20. 7 CFR 1216.1 - Act.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE PEANUT PROMOTION, RESEARCH, AND INFORMATION ORDER Peanut Promotion, Research, and Information Order Definitions § 1216.1 Act. Act means...

  1. 7 CFR 1206.1 - Act.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE MANGO PROMOTION, RESEARCH, AND INFORMATION Mango Promotion, Research, and Information Order Definitions § 1206.1 Act. Act means the...

  2. 7 CFR 1206.1 - Act.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE MANGO PROMOTION, RESEARCH, AND INFORMATION Mango Promotion, Research, and Information Order Definitions § 1206.1 Act. Act means the...

  3. 7 CFR 1206.1 - Act.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE MANGO PROMOTION, RESEARCH, AND INFORMATION Mango Promotion, Research, and Information Order Definitions § 1206.1 Act. Act means the...

  4. 7 CFR 1206.1 - Act.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE MANGO PROMOTION, RESEARCH, AND INFORMATION Mango Promotion, Research, and Information Order Definitions § 1206.1 Act. Act means the...

  5. 7 CFR 1206.1 - Act.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE MANGO PROMOTION, RESEARCH, AND INFORMATION Mango Promotion, Research, and Information Order Definitions § 1206.1 Act. Act means the...

  6. 7 CFR 1280.101 - Act.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE LAMB PROMOTION, RESEARCH, AND INFORMATION ORDER Lamb Promotion, Research, and Information Order Definitions § 1280.101 Act. Act means...

  7. NER and HR pathways act sequentially to promote UV-C-induced germ cell apoptosis in Caenorhabditis elegans

    PubMed Central

    Stergiou, L; Eberhard, R; Doukoumetzidis, K; Hengartner, M O

    2011-01-01

    Ultraviolet (UV) radiation-induced DNA damage evokes a complex network of molecular responses, which culminate in DNA repair, cell cycle arrest and apoptosis. Here, we provide an in-depth characterization of the molecular pathway that mediates UV-C-induced apoptosis of meiotic germ cells in the nematode Caenorhabditis elegans. We show that UV-C-induced DNA lesions are not directly pro-apoptotic. Rather, they must first be recognized and processed by the nucleotide excision repair (NER) pathway. Our data suggest that NER pathway activity transforms some of these lesions into other types of DNA damage, which in turn are recognized and acted upon by the homologous recombination (HR) pathway. HR pathway activity is in turn required for the recruitment of the C. elegans homolog of the yeast Rad9-Hus1-Rad1 (9-1-1) complex and activation of downstream checkpoint kinases. Blocking either the NER or HR pathway abrogates checkpoint pathway activation and UV-C-induced apoptosis. Our results show that, following UV-C, multiple DNA repair pathways can cooperate to signal to the apoptotic machinery to eliminate potentially hazardous cells. PMID:21151025

  8. Grape seed proanthocyanidins and metformin act by different mechanisms to promote insulin signaling in rats fed high calorie diet.

    PubMed

    Yogalakshmi, Baskaran; Bhuvaneswari, Saravanan; Sreeja, S; Anuradha, Carani Venkatraman

    2014-03-01

    Key pathways like insulin signaling, AMP activated kinase (AMPK) activation and inflammatory signaling are involved in the complex pathological network of hepatic insulin resistance. Our aim is to investigate whether grape seed proanthocyanidins (GSP) and metformin (MET) target any of these pathways in insulin resistant rat liver. Albino Wistar rats were rendered insulin resistant by feeding a high fat-fructose diet (HFFD). Either GSP (100 mg/kg b.w), MET(50 mg/kg b.w) or both were administered to insulin resistant rats as therapeutic options. HFFD-feeding caused hyperglycemia, hyperinsulinemia, increased gluconeogenesis, decreased tyrosine phosphorylation of insulin receptor-β(IR-β) and insulin receptor substrate-1 (IRS-1) and increased serine phosphorylation of IRS-1. The association of p85α subunit of phosphotidyl inositol 3 kinase(PI3K) with IRS-1 and subsequent Akt phosphorylation were reduced while the expression of mitogen activated protein kinases (MAPK) were increased in HFFD rats. Both MET and GSP reduced hyperglycemia and hyperinsulinemia and improved glycolysis, tyrosine phosphorylation of IR-β and IRS-1, IRS-1-PI3K association and Akt activation. However, activation of tumor necrosis factor-α, interleukin-6, leptin and suppressor of cytokine signaling-3 and reduction in adiponectin caused by chronic HFFD feeding were reversed by GSP better than by MET. Activation of AMPK by GSP was much less compared to that by MET. These findings suggest that GSP might activate PI3K pathway and promote insulin action by reducing serine kinase activation and cytokine signaling and MET by targeting AMPK. The beneficial effects were enhanced during combination therapy. Thus, combination therapy with MET and GSP may be considered for the management of metabolic syndrome.

  9. Polo-like kinase 2 acting as a promoter in human tumor cells with an abundance of TAp73

    PubMed Central

    Hu, ZhengBo; Xu, ZunYing; Liao, XiaoHong; Yang, Xiao; Dong, Cao; Luk, KuaDi; Jin, AnMin; Lu, Hai

    2015-01-01

    suppresses TAp73 functions. PLK2 promotes the survival of human tumor cells, a novel insight into the workings of malignant tumors characterized by TAp73 overexpression, and one that could speed the development of therapies. PMID:26640387

  10. Identification of fungus-responsive cis-acting element in the promoter of Brassica juncea chitinase gene, BjCHI1.

    PubMed

    Gao, Ying; Zan, Xin-Li; Wu, Xue-Feng; Yao, Lei; Chen, Yu-Ling; Jia, Shuang-Wei; Zhao, Kai-Jun

    2014-02-01

    Chitinases are a group of pathogenesis-related proteins. The Brassica juncea chitinase gene BjCHI1 is highly inducible by pathogenic fungal infection, suggesting that the promoter of BjCHI1 might contain specific cis-acting element responsive to fungal attack. To identify the fungus-responsive element in BjCHI1 promoter (BjC-P), a series of binary plant transformation vectors were constructed by fusing the BjC-P or its deletion-derivatives to β-glucuronidase (GUS) reporter gene. Expression of the GUS reporter gene was systematically assayed by a transient gene expression system in Nicotiana benthamiana leaves treated with fungal elicitor Hexa-N-Acetyl-Chitohexaose, as well as in transgenic Arabidopsis plants inoculated with fungus Botrytis cinerea. The histochemical and quantitative GUS assays showed that the W-box-like element (GTAGTGACTCAT) in the region (-668 to -657) was necessary for the fungus-response, although there were another five W-box-like elements in BjC-P. In addition, gain-of-function analysis demonstrated that the fragment (-409 to -337) coupled to the W-box-like element was needed for full magnitude of the fungal induction. These results revealed the existence of a novel regulation mechanism of W-box-like element involved in plant pathogenic resistance, and will benefit the potential application of BjC-P in engineering crops.

  11. Novel lentiviral vectors displaying "early-acting cytokines" selectively promote survival and transduction of NOD/SCID repopulating human hematopoietic stem cells.

    PubMed

    Verhoeyen, Els; Wiznerowicz, Maciej; Olivier, Delphine; Izac, Brigitte; Trono, Didier; Dubart-Kupperschmitt, Anne; Cosset, François-Loïc

    2005-11-15

    A major limitation of current lentiviral vectors (LVs) is their inability to govern efficient gene transfer into quiescent cells, such as human CD34(+) cells, that reside in the G(0) phase of the cell cycle and that are highly enriched in hematopoietic stem cells. This hampers their application for gene therapy of hematopoietic cells. Here, we designed novel LVs that overcome this restriction by displaying "early-acting cytokines" on their surface. Display of thrombopoietin, stem cell factor, or both cytokines on the LV surface allowed efficient gene delivery into quiescent cord blood CD34(+) cells. Moreover, these surface-engineered LVs preferentially transduced and promoted survival of resting CD34(+) cells rather than cycling cells. Finally, and most importantly, these novel LVs allowed superior gene transfer in the most immature CD34(+) cells as compared to conventional LVs, even when the latter vectors were used to transduce cells in the presence of recombinant cytokines. This was demonstrated by their capacity to promote selective transduction of CD34(+) cell in in vitro derived long-term culture-initiating cell (LTC-IC) colonies and of long-term NOD/SCID repopulating cells (SRCs) in vivo.

  12. DLX1 acts as a crucial target of FOXM1 to promote ovarian cancer aggressiveness by enhancing TGF-β/SMAD4 signaling

    PubMed Central

    Chan, D W; Hui, W W Y; Wang, J J; Yung, M M H; Hui, L M N; Qin, Y; Liang, R R; Leung, T H Y; Xu, D; Chan, K K L; Yao, K-M; Tsang, B K; Ngan, H Y S

    2017-01-01

    Recent evidence from a comprehensive genome analysis and functional studies have revealed that FOXM1 is a crucial metastatic regulator that drives cancer progression. However, the regulatory mechanism by which FOXM1 exerts its metastatic functions in cancer cells remains obscure. Here, we report that DLX1 acts as a FOXM1 downstream target, exerting pro-metastatic function in ovarian cancers. Both FOXM1 isoforms (FOXM1B or FOXM1C) could transcriptionally upregulate DLX1 through two conserved binding sites, located at +61 to +69bp downstream (TFBS1) and −675 to −667bp upstream (TFBS2) of the DLX1 promoter, respectively. This regulation was further accentuated by the significant correlation between the nuclear expression of FOXM1 and DLX1 in high-grade serous ovarian cancers. Functionally, the ectopic expression of DLX1 promoted ovarian cancer cell growth, cell migration/invasion and intraperitoneal dissemination of ovarian cancer in mice, whereas small interfering RNA-mediated DLX1 knockdown in FOXM1-overexpressing ovarian cancer cells abrogated these oncogenic capacities. In contrast, depletion of FOXM1 by shRNAi only partially attenuated tumor growth and exerted almost no effect on cell migration/invasion and the intraperitoneal dissemination of DLX1-overexpressing ovarian cancer cells. Furthermore, the mechanistic studies showed that DLX1 positively modulates transforming growth factor-β (TGF-β) signaling by upregulating PAI-1 and JUNB through direct interaction with SMAD4 in the nucleus upon TGF-β1 induction. Taken together, these data strongly suggest that DLX1 has a pivotal role in FOXM1 signaling to promote cancer aggressiveness through intensifying TGF-β/SMAD4 signaling in high-grade serous ovarian cancer cells. PMID:27593933

  13. Nitrogen transporter and assimilation genes exhibit developmental stage-selective expression in maize (Zea mays L.) associated with distinct cis-acting promoter motifs.

    PubMed

    Liseron-Monfils, Christophe; Bi, Yong-Mei; Downs, Gregory S; Wu, Wenqing; Signorelli, Tara; Lu, Guangwen; Chen, Xi; Bondo, Eddie; Zhu, Tong; Lukens, Lewis N; Colasanti, Joseph; Rothstein, Steven J; Raizada, Manish N

    2013-10-01

    Nitrogen is considered the most limiting nutrient for maize (Zea mays L.), but there is limited understanding of the regulation of nitrogen-related genes during maize development. An Affymetrix 82K maize array was used to analyze the expression of ≤ 46 unique nitrogen uptake and assimilation probes in 50 maize tissues from seedling emergence to 31 d after pollination. Four nitrogen-related expression clusters were identified in roots and shoots corresponding to, or overlapping, juvenile, adult, and reproductive phases of development. Quantitative real time PCR data was consistent with the existence of these distinct expression clusters. Promoters corresponding to each cluster were screened for over-represented cis-acting elements. The 8-bp distal motif of the Arabidopsis 43-bp nitrogen response element (NRE) was over-represented in nitrogen-related maize gene promoters. This conserved motif, referred to here as NRE43-d8, was previously shown to be critical for nitrate-activated transcription of nitrate reductase (NIA1) and nitrite reductase (NIR1) by the NIN-LIKE PROTEIN 6 (NLP6) in Arabidopsis. Here, NRE43-d8 was over-represented in the promoters of maize nitrate and ammonium transporter genes, specifically those that showed peak expression during early-stage vegetative development. This result predicts an expansion of the NRE-NLP6 regulon and suggests that it may have a developmental component in maize. We also report leaf expression of putative orthologs of nitrite transporters (NiTR1), a transporter not previously reported in maize. We conclude by discussing how each of the four transcriptional modules may be responsible for the different nitrogen uptake and assimilation requirements of leaves and roots at different stages of maize development.

  14. LeMYC2 acts as a negative regulator of blue light mediated photomorphogenic growth, and promotes the growth of adult tomato plants

    PubMed Central

    2014-01-01

    Background Arabidopsis ZBF1/MYC2bHLH transcription factor is a repressor of photomorphogenesis, and acts as a point of cross talk in light, abscisic acid (ABA) and jasmonic acid (JA) signaling pathways. MYC2 also functions as a positive regulator of lateral root development and flowering time under long day conditions. However, the function of MYC2 in growth and development remains unknown in crop plants. Results Here, we report the functional analyses of LeMYC2 in tomato (Lycopersicon esculentum). The amino acid sequence of LeMYC2 showed extensive homology with Arabidopsis MYC2, containing the conserved bHLH domain. To study the function of LeMYC2 in tomato, overexpression and RNA interference (RNAi) LeMYC2 tomato transgenic plants were generated. Examination of seedling morphology, physiological responses and light regulated gene expression has revealed that LeMYC2 works as a negative regulator of blue light mediated photomorphogenesis. Furthermore, LeMYC2 specifically binds to the G-box of LeRBCS-3A promoter. Overexpression of LeMYC2 has led to increased root length with more number of lateral roots. The tomato plants overexpressing LeMYC2 have reduced internode distance with more branches, and display the opposite morphology to RNAi transgenic lines. Furthermore, this study shows that LeMYC2 promotes ABA and JA responsiveness. Conclusions Collectively, this study highlights that working in light, ABA and JA signaling pathways LeMYC2 works as an important regulator for growth and development in tomato plants. PMID:24483714

  15. Travel Promotion Act of 2009

    THOMAS, 111th Congress

    Sen. Dorgan, Byron L. [D-ND

    2009-05-12

    09/23/2010 Message received in the Senate: Returned to the Senate pursuant to the provisions of H.Res. 1653. (All Actions) Notes: For further action, see H.R.1299, which became Public Law 111-145 on 3/4/2010. Tracker: This bill has the status Passed SenateHere are the steps for Status of Legislation:

  16. Collinsville Renewable Energy Promotion Act

    THOMAS, 112th Congress

    Rep. Murphy, Christopher S. [D-CT-5

    2012-05-08

    06/27/2012 Received in the Senate and Read twice and referred to the Committee on Energy and Natural Resources. (All Actions) Tracker: This bill has the status Passed HouseHere are the steps for Status of Legislation:

  17. Travel Promotion Act of 2009

    THOMAS, 111th Congress

    Rep. Delahunt, William D. [D-MA-10

    2009-06-18

    07/23/2009 Referred to the Subcommittee on Immigration, Citizenship, Refugees, Border Security, and International Law. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  18. Collinsville Renewable Energy Promotion Act

    THOMAS, 112th Congress

    Sen. Lieberman, Joseph I. [ID-CT

    2011-04-04

    06/23/2011 Committee on Energy and Natural Resources Subcommittee on Water and Power. Hearings held. With printed Hearing: S.Hrg. 112-129. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  19. Collinsville Renewable Energy Promotion Act

    THOMAS, 111th Congress

    Rep. Murphy, Christopher S. [D-CT-5

    2010-01-13

    06/17/2010 Received in the Senate and Read twice and referred to the Committee on Energy and Natural Resources. (All Actions) Tracker: This bill has the status Passed HouseHere are the steps for Status of Legislation:

  20. 7 CFR 1150.101 - Act.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... Orders; Milk), DEPARTMENT OF AGRICULTURE DAIRY PROMOTION PROGRAM Dairy Promotion and Research Order Definitions § 1150.101 Act. Act means Title I, Subtitle B, of the Dairy and Tobacco Adjustment Act of...

  1. Identification of two novel Rhizoctonia solani-inducible cis-acting elements in the promoter of the maize gene, GRMZM2G315431

    PubMed Central

    Li, Ning; Chen, Jing; Yang, Fangfang; Wei, Shutong; Kong, Lingguang; Ding, Xinhua; Chu, Zhaohui

    2017-01-01

    Plants are continuously exposed to myriad pathogen stresses. However, the molecular mechanisms by which these stress signals are perceived and transduced are poorly understood. In this study, the maize gene GRMZM2G315431 was identified to be highly inducible by Rhizoctonia solani infection, suggesting that the promoter of GRMZM2G315431 (pGRMZM2G315431) might contain a specific cis-acting element responsive to R. solani attack. To identify the R. solani-responsive element in pGRMZM2G315431, a series of binary plant transformation vectors were constructed by fusing pGRMZM2G315431 or its deletion-derivatives with the reporter genes. In the transient gene expression system of Nicotiana benthamiana leaves inoculated with R. solani, GUS quantification suggested that the DNA fragment contains the unknown pathogen-inducible cis-elements in the −1323 to −1212 region. Furthermore, detailed quantitative assays showed that two novel cis-elements, GTTGA in the −1243 to −1239 region and TATTT in the −1232 to −1228 region, were responsible for the R. solani-inducible activity. These two cis-elements were also identified to have R. solani-specific-inducible activity in stable transgenic rice plants, suggesting the existence of a novel regulation mechanism involved in the interaction between R. solani and Zea mays. PMID:28163300

  2. Long non-coding RNA MALAT1 acts as a competing endogenous RNA to promote malignant melanoma growth and metastasis by sponging miR-22

    PubMed Central

    Bu, Xuefeng; Xia, Yun; Wang, Jinlong; Djangmah, Henry Siaw; Liu, Xiaohui; You, Yongping; Xu, Bin

    2016-01-01

    Long non-coding RNAs (lncRNAs) are involved in tumorigenesis. Metastasis-associated lung adenocarcinoma transcript 1 (MALAT1), an lncRNAs, is associated with the growth and metastasis of many human tumors, but its biological roles in malignant melanoma remain unclear. In this study, the aberrant up-regulation of MALAT1 was detected in melanoma. We determined that MALAT1 promotes melanoma cells proliferation, invasion and migration by sponging miR-22. MiR-22 was decreased and acted as a tumor suppressor in melanoma, and MMP14 and Snail were the functional targets of miR-22. Furthermore, MALAT1 could modulate MMP14 and Snail by operating as a competing endogenous RNA (ceRNA) for miR-22. The effects of MALAT1 in malignant melanoma is verified using a xenograft model. This finding elucidates a new mechanism for MALAT1 in melanoma development and provides a potential target for melanoma therapeutic intervention. PMID:27564100

  3. U-box E3 ubiquitin ligase PUB17 acts in the nucleus to promote specific immune pathways triggered by Phytophthora infestans.

    PubMed

    He, Qin; McLellan, Hazel; Boevink, Petra C; Sadanandom, Ari; Xie, Conghua; Birch, Paul R J; Tian, Zhendong

    2015-06-01

    Ubiquitination regulates many processes in plants, including immunity. The E3 ubiquitin ligase PUB17 is a positive regulator of programmed cell death (PCD) triggered by resistance proteins CF4/9 in tomato. Its role in immunity to the potato late blight pathogen, Phytophthora infestans, was investigated here. Silencing StPUB17 in potato by RNAi and NbPUB17 in Nicotiana benthamiana by virus-induced gene silencing (VIGS) each enhanced P. infestans leaf colonization. PAMP-triggered immunity (PTI) transcriptional responses activated by flg22, and CF4/Avr4-mediated PCD were attenuated by silencing PUB17. However, silencing PUB17 did not compromise PCD triggered by P. infestans PAMP INF1, or co-expression of R3a/AVR3a, demonstrating that not all PTI- and PCD-associated responses require PUB17. PUB17 localizes to the plant nucleus and especially in the nucleolus. Transient over-expression of a dominant-negative StPUB17(V314I,V316I) mutant, which retained nucleolar localization, suppressed CF4-mediated cell death and enhanced P. infestans colonization. Exclusion of the StPUB17(V314I,V316I) mutant from the nucleus abolished its dominant-negative activity, demonstrating that StPUB17 functions in the nucleus. PUB17 is a positive regulator of immunity to late blight that acts in the nucleus to promote specific PTI and PCD pathways.

  4. LncRNA-RMRP promotes carcinogenesis by acting as a miR-206 sponge and is used as a novel biomarker for gastric cancer.

    PubMed

    Shao, Yongfu; Ye, Meng; Li, Qier; Sun, Weiliang; Ye, Guoliang; Zhang, Xinjun; Yang, Yunben; Xiao, Bingxiu; Guo, Junming

    2016-06-21

    Long noncoding RNAs (lncRNAs) play crucial roles in tumorigenesis. However, the mechanisms of most lncRNAs in cancers are largely unknown. Because the RNA component of mitochondrial RNA processing endoribonuclease (RMRP) is one of the dysregulated lncRNAs in gastric cancer, this study explored its molecular mechanisms in carcinogenesis. RMRP levels in 792 tissues, plasma and gastric juices from patients with various stages of gastric tumorigenesis were analyzed by quantitative reverse transcription-polymerase chain reaction. Overexpression and RNA interference were used to manipulate RMRP expression by RMRP expression vector and small interfering RNAs, respectively. Its mechanisms were evaluated by flow cytometry, real-time cell analysis, plate colony formation assays, and xenograft models. RMRP levels in tissue, plasma and gastric juices from patients with gastric cancer were significantly different from those from controls. Its levels were significantly associated with Borrmann type and metastasis. Plasma and gastric juice RMRP had higher sensitivity and specificity than commonly used markers (such as carcinoembryonic antigen and carbohydrate antigen 19-9). Knockdown of RMRP significantly inhibited cell proliferation in vitro and in vivo, whereas overexpression of RMRP promoted cell growth. Acting as a miR-206 sponge, RMRP modulated cell cycle by regulating Cyclin D2 expression. RMRP plays a crucial role in gastric cancer occurrence and can be used as a novel biomarker for gastric cancer.

  5. Methanol-Independent Protein Expression by AOX1 Promoter with trans-Acting Elements Engineering and Glucose-Glycerol-Shift Induction in Pichia pastoris.

    PubMed

    Wang, Jinjia; Wang, Xiaolong; Shi, Lei; Qi, Fei; Zhang, Ping; Zhang, Yuanxing; Zhou, Xiangshan; Song, Zhiwei; Cai, Menghao

    2017-02-02

    The alcohol oxidase 1 promoter (PAOX1) of Pichia pastoris is commonly used for high level expression of recombinant proteins. While the safety risk of methanol and tough process control for methanol induction usually cause problems especially in large-scale fermentation. By testing the functions of trans-acting elements of PAOX1 and combinatorially engineering of them, we successfully constructed a methanol-free PAOX1 start-up strain, in which, three transcription repressors were identified and deleted and, one transcription activator were overexpressed. The strain expressed 77% GFP levels in glycerol compared to the wide-type in methanol. Then, insulin precursor (IP) was expressed, taking which as a model, we developed a novel glucose-glycerol-shift induced PAOX1 start-up for this methanol-free strain. A batch phase with glucose of 40 g/L followed by controlling residual glucose not lower than 20 g/L was compatible for supporting cell growth and suppressing PAOX1. Then, glycerol induction was started after glucose used up. Accordingly, an optimal bioprocess was further determined, generating a high IP production of 2.46 g/L in a 5-L bioreactor with dramatical decrease of oxygen consumption and heat evolution comparing with the wild-type in methanol. This mutant and bioprocess represent a safe and efficient alternative to the traditional glycerol-repressed/methanol-induced PAOX1 system.

  6. Methanol-Independent Protein Expression by AOX1 Promoter with trans-Acting Elements Engineering and Glucose-Glycerol-Shift Induction in Pichia pastoris

    PubMed Central

    Wang, Jinjia; Wang, Xiaolong; Shi, Lei; Qi, Fei; Zhang, Ping; Zhang, Yuanxing; Zhou, Xiangshan; Song, Zhiwei; Cai, Menghao

    2017-01-01

    The alcohol oxidase 1 promoter (PAOX1) of Pichia pastoris is commonly used for high level expression of recombinant proteins. While the safety risk of methanol and tough process control for methanol induction usually cause problems especially in large-scale fermentation. By testing the functions of trans-acting elements of PAOX1 and combinatorially engineering of them, we successfully constructed a methanol-free PAOX1 start-up strain, in which, three transcription repressors were identified and deleted and, one transcription activator were overexpressed. The strain expressed 77% GFP levels in glycerol compared to the wide-type in methanol. Then, insulin precursor (IP) was expressed, taking which as a model, we developed a novel glucose-glycerol-shift induced PAOX1 start-up for this methanol-free strain. A batch phase with glucose of 40 g/L followed by controlling residual glucose not lower than 20 g/L was compatible for supporting cell growth and suppressing PAOX1. Then, glycerol induction was started after glucose used up. Accordingly, an optimal bioprocess was further determined, generating a high IP production of 2.46 g/L in a 5-L bioreactor with dramatical decrease of oxygen consumption and heat evolution comparing with the wild-type in methanol. This mutant and bioprocess represent a safe and efficient alternative to the traditional glycerol-repressed/methanol-induced PAOX1 system. PMID:28150747

  7. Verification of the in vivo activity of three distinct cis-acting elements within the Gata1 gene promoter-proximal enhancer in mice.

    PubMed

    Shimizu, Ritsuko; Hasegawa, Atsushi; Ottolenghi, Sergio; Ronchi, Antonella; Yamamoto, Masayuki

    2013-11-01

    The transcription factor GATA1 is essential for erythroid and megakaryocytic cell differentiation. Gata1 hematopoietic regulatory domain (G1HRD) has been shown to recapitulate endogenous Gata1 gene expression in transgenic mouse assays in vivo. G1HRD contains a promoter-proximal enhancer composed of a GATA-palindrome motif, four CP2-binding sites and two CACCC boxes. We prepared transgenic reporter mouse lines in which green fluorescent protein and β-galactosidase expression are driven by wild-type G1HRD (as a positive control) and the G1HRD harboring mutations within these cis-acting elements (as the experimental conditions), respectively. Exploiting this transgenic dual reporter (TDR) assay, we show here that in definitive erythropoiesis, G1HRD activity was markedly affected by individual mutations in the GATA-palindrome motif and the CACCC boxes. Mutation of CP2-binding sites also moderately decreased G1HRD activity. The combined mutation of the CP2-binding sites and the GATA-palindrome motif resulted in complete loss of G1HRD activity. In contrast, in primitive erythroid cells, individual mutations of each element did not affect G1HRD activity; G1HRD activity was abolished only when these three mutations were combined. These results thus show that all three elements independently and cooperatively contribute to G1HRD activity in vivo in definitive erythropoiesis, although these are contributing redundantly to primitive erythropoiesis.

  8. The Indian Health Promotion and Disease Prevention Act of 1985. Hearing before the Select Committee on Indian Affairs. United States Senate, Ninety-Ninth Congress, First Session on S. 400. (Gallup, NM, June 1, 1985).

    ERIC Educational Resources Information Center

    Congress of the U.S., Washington, DC. Senate Select Committee on Indian Affairs.

    The document contains transcripts of a Congressional hearing on providing health promotion and disease prevention services to American Indians. The bill under consideration would add the following programs to the Indian Health Care Improvement Act (25, U.S.C. 1603): reduction of drug, alcohol, and tobacco use; improvement of nutrition and physical…

  9. Biochar and flyash inoculated with plant growth promoting rhizobacteria act as potential biofertilizer for luxuriant growth and yield of tomato plant.

    PubMed

    Tripti; Kumar, Adarsh; Usmani, Zeba; Kumar, Vipin; Anshumali

    2017-04-01

    Overuse of agrochemical fertilizers alarmingly causes deterioration in soil health and soil-flora. Persistence of these agrochemicals exerts detrimental effects on environment, potentially inducing toxic effects on human health, thus pronouncing an urgent need for a safer substitute. The present study investigates the potential use of agricultural and industrial wastes as carrier materials, viz. biochar and flyash, respectively, for preparation of bioformulations (or biofertilizers) using two plant growth promoting rhizobacteria, Bacillus sp. strain A30 and Burkholderia sp. strain L2, and its effect on growth of Lycopersicon esculentum Mill. (tomato). The viability of strains was determined based on colony forming units (cfu) count of each bioformulation at an interval of 60 days for a period of 240 days. Seeds were coated with different carrier based bioformulations and pot experiment(s) were carried out to access its effects on plant growth parameters. Biochar based bioformulations showed higher cfu count and maximum viability for strain L2 (10(7) cfu g(-1)) at 240 days of storage. Maximum percentage of seed germination was also observed in biochar inoculated with strain L2. Significant (p < 0.05) increase in plant growth parameters (dry and fresh biomass, length, number of flowers) were ascertained from the pot experiment and amongst all bioformulations, biochar inoculated with strain L2 performed consistently thriving results for tomato yield. Furthermore, post-harvest study of this bioformulation treated soil improved physico-chemical properties and dehydrogenase activity as compared to pre-plantation soil status. Overall, we show that prepared biochar based bioformulation using Burkholderia sp. L2 as inoculum can tremendously enhance the productivity of tomato, soil fertility, and can also act as a sustainable substitute for chemical fertilizers. In addition, mixture of biochar and flyash inoculated with strain L2 also showed noteworthy results for the

  10. Validation of trans-acting elements that promote exon 7 skipping of SMN2 in SMN2-GFP stable cell line.

    PubMed

    Cho, Sunghee; Moon, Heegyum; Yang, Xiaoming; Zhou, Jianhua; Kim, Hye-Ran; Shin, Myung-Geun; Loh, Tiing Jen; Zheng, Xuexiu; Shen, Haihong

    2012-07-06

    Spinal muscular atrophy is a genetic disease in which the SMN1 gene is deleted. The SMN2 gene exists in all of the patients. Alternative splicing of these two genes are different. More than 90% of exon 7 included form is produced from SMN1 pre-mRNA, whereas only ∼20% of exon 7 included form is produced from SMN2 pre-mRNA. Only exon 7 inclusion form produces functional protein. Exon 7 skipped SMN isoform is unstable. Here we constructed a GFP reporter system that recapitulates the alternative splicing of SMN1 and SMN2 pre-mRNA. We designed a system in which GFP protein is expressed only when exon 7 of is included in alternative splicing. The stable cell that expresses SMN1-GFP produces ∼4 times more GFP protein than the stable cell line that expresses SMN2-GFP; as demonstrated by microscopy, FACS analysis and immunoblotting. In addition the ratio of exon 7 inclusion and skipping of SMN1-GFP and SMN2-GFP pre-mRNA was similar to endogenous SMN1 and SMN2 pre-mRNA as shown in RT-PCR. Furthermore the knockdown with hnRNP A1 shRNA, a known protein which promotes exon 7 skipping of SMN2, induces exon 7 inclusion of exon 7 in SMN2-GFP pre-mRNA in SMN2-GFP cell line. We conclude that we have established the stable cell lines that recapitulate alternative splicing of the SMN1 and SMN2 genes. The stable cell line can be used to identify the trans-acting elements with siRNA.

  11. Growth-associated protein GAP-43 and L1 act synergistically to promote regenerative growth of Purkinje cell axons in vivo.

    PubMed

    Zhang, Yi; Bo, Xuenong; Schoepfer, Ralf; Holtmaat, Anthony J D G; Verhaagen, Joost; Emson, Piers C; Lieberman, A Robert; Anderson, Patrick N

    2005-10-11

    Neuronal expression of growth-associated protein 43 (GAP-43) and the cell adhesion molecule L1 has been correlated with CNS axonal growth and regeneration, but it is not known whether expression of these molecules is necessary for axonal regeneration to occur. We have taken advantage of the fact that Purkinje cells do not express GAP-43 or L1 in adult mammals or regenerate axons into peripheral nerve grafts to test the importance of these molecules for axonal regeneration in vivo. Transgenic mice were generated in which Purkinje cells constitutively express L1 or both L1 and GAP-43 under the Purkinje cell-specific L7 promoter, and regeneration of Purkinje cell axons into peripheral nerve grafts implanted into the cerebellum was examined. Purkinje cells expressing GAP-43 or L1 showed minor enhancement of axonal sprouting. Purkinje cells expressing both GAP-43 and L1 showed more extensive axonal sprouting and axonal growth into the proximal portion of the graft. When a predegenerated nerve graft was implanted into double-transgenic mice, penetration of the graft by Purkinje cell axonal sprouts was strongly enhanced, and some axons grew along the entire intracerebral length of the graft (2.5-3.0 mm) and persisted for several months. The results demonstrate that GAP-43 and L1 coexpressed in Purkinje cells can act synergistically to switch these regeneration-incompetent CNS neurons into a regeneration-competent phenotype and show that coexpression of these molecules is a key regulator of the regenerative ability of intrinsic CNS neurons in vivo.

  12. State Implementation of Reforms Promoted under the Recovery Act. A Report from Charting the Progress of Education Reform: An Evaluation of the Recovery Act's Role. NCEE 2014-4011

    ERIC Educational Resources Information Center

    Webber, Ann; Troppe, Patricia; Milanowski, Anthony; Gutmann, Babette; Reisner, Elizabeth; Goertz, Margaret

    2014-01-01

    The American Recovery and Reinvestment Act (ARRA or the Recovery Act) of 2009 provided an unprecedented level of funding for K-12 education. The program created a "historic opportunity to save hundreds of thousands of jobs, support states and school districts, and advance reforms and improvements that will create long-lasting results for our…

  13. 7 CFR 1220.600 - Act.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE SOYBEAN PROMOTION, RESEARCH, AND CONSUMER INFORMATION Procedures To Request a Referendum Definitions § 1220.600 Act. Act means the...

  14. 7 CFR 1220.600 - Act.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE SOYBEAN PROMOTION, RESEARCH, AND CONSUMER INFORMATION Procedures To Request a Referendum Definitions § 1220.600 Act. Act means the...

  15. 7 CFR 1220.600 - Act.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE SOYBEAN PROMOTION, RESEARCH, AND CONSUMER INFORMATION Procedures To Request a Referendum Definitions § 1220.600 Act. Act means the...

  16. 7 CFR 1220.600 - Act.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE SOYBEAN PROMOTION, RESEARCH, AND CONSUMER INFORMATION Procedures To Request a Referendum Definitions § 1220.600 Act. Act means the...

  17. 7 CFR 1220.600 - Act.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE SOYBEAN PROMOTION, RESEARCH, AND CONSUMER INFORMATION Procedures To Request a Referendum Definitions § 1220.600 Act. Act means the...

  18. 7 CFR 1214.1 - Act.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE CHRISTMAS TREE PROMOTION, RESEARCH, AND INFORMATION ORDER Christmas Tree Promotion, Research, and Information Order Definitions § 1214.1 Act....

  19. 7 CFR 1214.1 - Act.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE CHRISTMAS TREE PROMOTION, RESEARCH, AND INFORMATION ORDER Christmas Tree Promotion, Research, and Information Order Definitions § 1214.1 Act....

  20. 7 CFR 1214.1 - Act.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE CHRISTMAS TREE PROMOTION, RESEARCH, AND INFORMATION ORDER Christmas Tree Promotion, Research, and Information Order Definitions § 1214.1 Act....

  1. 7 CFR 1260.630 - Paperwork Reduction Act assigned number.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... BEEF PROMOTION AND RESEARCH Beef Promotion and Research: Certification and Nomination Procedures for the Cattlemen's Beef Promotion and Research Board § 1260.630 Paperwork Reduction Act assigned...

  2. Human cytomegalovirus contains a tegument protein that enhances transcription from promoters with upstream ATF and AP-1 cis-acting elements.

    PubMed Central

    Liu, B; Stinski, M F

    1992-01-01

    The tegument proteins of human cytomegalovirus are introduced into cells as components of infectious virus. The tegument proteins may affect viral and cellular transcription prior to the synthesis of the immediate-early viral regulatory proteins. The phosphorylated tegument protein of 71 kDa (pp71) is reported to be encoded by the UL82 gene. The UL82 gene products transactivated promoters containing upstream ATF or AP-1 binding sites. In contrast, the phosphorylated tegument protein of 65 kDa (pp65), encoded by the UL83 gene, had no detectable effect on these promoters. Enhancement by UL82 of downstream transcription was directly proportional to the number of upstream ATF sites. Response to UL82 transactivation was abolished by mutation of the ATF site. Mutation in the carboxy-terminal region of UL82 also eliminated transactivation. Even though the major immediate-early promoter of human cytomegalovirus is a strong enhancer-containing promoter, UL82 further enhanced its transcription as much as 20-fold. The mechanism of UL82 enhancement of transcription from viral or cellular promoters is not known, but the enhancement may be mediated by triggering one of the protein kinase signaling pathways, increasing the affinity of ATF or AP-1 for the target sequence, or stabilizing the complex between the eucaryotic transcription factor and the target sequence. Images PMID:1318413

  3. The heptanucleotide motif GAGACGC is a key component of a cis-acting promoter element that is critical for SnSAG1 expression in Sarcocystis neurona.

    PubMed

    Gaji, Rajshekhar Y; Howe, Daniel K

    2009-07-01

    The apicomplexan parasite Sarcocystis neurona undergoes a complex process of intracellular development, during which many genes are temporally regulated. The described study was undertaken to begin identifying the basic promoter elements that control gene expression in S. neurona. Sequence analysis of the 5'-flanking region of five S. neurona genes revealed a conserved heptanucleotide motif GAGACGC that is similar to the WGAGACG motif described upstream of multiple genes in Toxoplasma gondii. The promoter region for the major surface antigen gene SnSAG1, which contains three heptanucleotide motifs within 135 bases of the transcription start site, was dissected by functional analysis using a dual luciferase reporter assay. These analyses revealed that a minimal promoter fragment containing all three motifs was sufficient to drive reporter molecule expression, with the presence and orientation of the 5'-most heptanucleotide motif being absolutely critical for promoter function. Further studies should help to identify additional sequence elements important for promoter function and for controlling gene expression during intracellular development by this apicomplexan pathogen.

  4. 7 CFR 1209.1 - Act.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE MUSHROOM PROMOTION, RESEARCH, AND CONSUMER INFORMATION ORDER Mushroom Promotion, Research, and Consumer Information Order Definitions § 1209.1 Act. Act means the Mushroom Promotion, Research, and Consumer Information Act of 1990, subtitle B of title XIX...

  5. 7 CFR 1209.1 - Act.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE MUSHROOM PROMOTION, RESEARCH, AND CONSUMER INFORMATION ORDER Mushroom Promotion, Research, and Consumer Information Order Definitions § 1209.1 Act. Act means the Mushroom Promotion, Research, and Consumer Information Act of 1990, subtitle B of title XIX...

  6. 7 CFR 1209.1 - Act.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE MUSHROOM PROMOTION, RESEARCH, AND CONSUMER INFORMATION ORDER Mushroom Promotion, Research, and Consumer Information Order Definitions § 1209.1 Act. Act means the Mushroom Promotion, Research, and Consumer Information Act of 1990, subtitle B of title XIX...

  7. 7 CFR 1209.1 - Act.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE MUSHROOM PROMOTION, RESEARCH, AND CONSUMER INFORMATION ORDER Mushroom Promotion, Research, and Consumer Information Order Definitions § 1209.1 Act. Act means the Mushroom Promotion, Research, and Consumer Information Act of 1990, subtitle B of title XIX...

  8. 7 CFR 1209.1 - Act.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE MUSHROOM PROMOTION, RESEARCH, AND CONSUMER INFORMATION ORDER Mushroom Promotion, Research, and Consumer Information Order Definitions § 1209.1 Act. Act means the Mushroom Promotion, Research, and Consumer Information Act of 1990, subtitle B of title XIX...

  9. 7 CFR 1220.101 - Act.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE SOYBEAN PROMOTION, RESEARCH, AND CONSUMER INFORMATION Soybean Promotion and Research Order Definitions § 1220.101 Act. The term Act means the Soybean Promotion, Research, and Consumer Information Act, subtitle E of title XIX, of the...

  10. 7 CFR 1220.101 - Act.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE SOYBEAN PROMOTION, RESEARCH, AND CONSUMER INFORMATION Soybean Promotion and Research Order Definitions § 1220.101 Act. The term Act means the Soybean Promotion, Research, and Consumer Information Act, subtitle E of title XIX, of the...

  11. 7 CFR 1220.101 - Act.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE SOYBEAN PROMOTION, RESEARCH, AND CONSUMER INFORMATION Soybean Promotion and Research Order Definitions § 1220.101 Act. The term Act means the Soybean Promotion, Research, and Consumer Information Act, subtitle E of title XIX, of the...

  12. 7 CFR 1220.101 - Act.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE SOYBEAN PROMOTION, RESEARCH, AND CONSUMER INFORMATION Soybean Promotion and Research Order Definitions § 1220.101 Act. The term Act means the Soybean Promotion, Research, and Consumer Information Act, subtitle E of title XIX, of the...

  13. 7 CFR 1220.101 - Act.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE SOYBEAN PROMOTION, RESEARCH, AND CONSUMER INFORMATION Soybean Promotion and Research Order Definitions § 1220.101 Act. The term Act means the Soybean Promotion, Research, and Consumer Information Act, subtitle E of title XIX, of the...

  14. 7 CFR 1219.1 - Act.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE HASS AVOCADO PROMOTION, RESEARCH, AND INFORMATION Hass Avocado Promotion, Research, and Information Order Definitions § 1219.1 Act. Act means the Hass Avocado Promotion, Research, and Information Act of 2000, Public Law 106-387, 7 U.S.C....

  15. 7 CFR 1219.1 - Act.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE HASS AVOCADO PROMOTION, RESEARCH, AND INFORMATION Hass Avocado Promotion, Research, and Information Order Definitions § 1219.1 Act. Act means the Hass Avocado Promotion, Research, and Information Act of 2000, Public Law 106-387, 7 U.S.C....

  16. 7 CFR 1219.1 - Act.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE HASS AVOCADO PROMOTION, RESEARCH, AND INFORMATION Hass Avocado Promotion, Research, and Information Order Definitions § 1219.1 Act. Act means the Hass Avocado Promotion, Research, and Information Act of 2000, Public Law 106-387, 7 U.S.C....

  17. 7 CFR 1219.1 - Act.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE HASS AVOCADO PROMOTION, RESEARCH, AND INFORMATION Hass Avocado Promotion, Research, and Information Order Definitions § 1219.1 Act. Act means the Hass Avocado Promotion, Research, and Information Act of 2000, Public Law 106-387, 7 U.S.C....

  18. 7 CFR 1219.1 - Act.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE HASS AVOCADO PROMOTION, RESEARCH, AND INFORMATION Hass Avocado Promotion, Research, and Information Order Definitions § 1219.1 Act. Act means the Hass Avocado Promotion, Research, and Information Act of 2000, Public Law 106-387, 7 U.S.C....

  19. Activation of the major immediate early gene of human cytomegalovirus by cis-acting elements in the promoter-regulatory sequence and by virus-specific trans-acting components.

    PubMed Central

    Stinski, M F; Roehr, T J

    1985-01-01

    Upstream of the major immediate early gene of human cytomegalovirus (Towne) is a strong promoter-regulatory region that promotes the synthesis of 1.95-kilobase mRNA (D. R. Thomsen, R. M. Stenberg, W. F. Goins, and M. F. Stinski, Proc. Natl. Acad. Sci. U.S.A. 81:659-663, 1984; M. F. Stinski, D. R. Thomsen, R. M. Stenberg, and L. C. Goldstein, J. Virol. 46:1-14, 1983). The wild-type promoter-regulatory region as well as deletions within this region were ligated upstream of the thymidine kinase, chloramphenicol acetyltransferase, or ovalbumin genes. These gene chimeras were constructed to investigate the role of the regulatory sequences in enhancing downstream expression. The regulatory region extends to approximately 465 nucleotides upstream of the cap site for the initiation of transcription. The extent and type of regulatory sequences upstream of the promoter influences the level of in vitro transcription as well as the amount of in vivo expression of the downstream gene. The regulatory elements for cis-activation appear to be repeated several times within the regulatory region. A direct correlation was established between the distribution of the 19 (5' CCCCAGTTGACGTCAATGGG 3')- and 18 (5' CACTAACGGGACTTTCCAA 3')-nucleotide repeats and the level of downstream expression. In contrast, the 16 (5' CTTGGCAGTACATCAA 3')-nucleotide repeat is not necessary for the enhancement of downstream expression. In a domain associated with the 19- or 18-nucleotide repeats are elements that can be activated in trans by a human cytomegalovirus-specified component but not a herpes simplex virus-specified component. Therefore, the regulatory sequences of the major immediate early gene of human cytomegalovirus have an important role in interacting with cellular and virus-specific factors of the transcription complex to enhance downstream expression of this critical viral gene. Images PMID:2991567

  20. Promoting College Completion through Leadership among Underrepresented Urban College Students: A Theory of Change and Evaluation of College Retention Outcomes for the Act Six Leadership and Scholarship Initiative

    ERIC Educational Resources Information Center

    Herron, Timothy J.

    2012-01-01

    The Act Six Leadership and Scholarship Initiative is a leadership development and college retention and success program developed by the Northwest Leadership Foundation that provides intensive cohort-based training and support, along with full-tuition, full-need scholarships, to underrepresented urban college students to attend religiously…

  1. A short, highly repetitive element in intron -1 of the human c-Ha-ras gene acts as a block to transcriptional readthrough by a viral promoter.

    PubMed Central

    Lowndes, N F; Bushel, P; Mendelsohn, L; Wu, J; Yen, M Y; Allan, M

    1990-01-01

    We have identified a short, highly repetitive element within intron -1 of the human c-Ha-ras gene. This element was found to be transcribed in both orientations and to be homologous to heterogeneous nonpolyadenylated transcripts. The repetitive element blocked transcriptional readthrough from a strong upstream viral promoter but allowed unimpaired readthrough from the c-Has-ras promoter. We suggest that it may serve to prevent excessive transcription into the coding region of the gene under such circumstances as viral insertion. Images PMID:2201911

  2. Endoglin expression in the endothelium is regulated by Fli-1, Erg, and Elf-1 acting on the promoter and a -8-kb enhancer.

    PubMed

    Pimanda, John E; Chan, W Y Iris; Donaldson, Ian J; Bowen, Mark; Green, Anthony R; Göttgens, Berthold

    2006-06-15

    Angiogenesis is critical to the growth and regeneration of tissue but is also a key component of tumor growth and chronic inflammatory disorders. Endoglin plays a key role in angiogenesis by modulating cellular responses to transforming growth factor-beta (TGF-beta) signaling and is upregulated in proliferating endothelial cells. To gain insights into the transcriptional hierarchies that govern endoglin expression, we used a combination of comparative genomic, biochemical, and transgenic approaches. Both the promoter and a region 8 kb upstream of exon 1 were active in transfection assays in endothelial cells. In transgenic mice, the promoter directed low-level expression to a subset of endothelial cells. By contrast, inclusion of the -8 enhancer resulted in robust endothelial activity with additional staining in developing ear mesenchyme. Subsequent molecular analysis demonstrated that both the -8 enhancer and the promoter depend on conserved Ets sites, which were bound in endothelial cells in vivo by Fli-1, Erg, and Elf-1. This study therefore establishes the transcriptional framework within which endoglin functions during angiogenesis.

  3. Privacy Act

    EPA Pesticide Factsheets

    Learn about the Privacy Act of 1974, the Electronic Government Act of 2002, the Federal Information Security Management Act, and other information about the Environmental Protection Agency maintains its records.

  4. DPL-1 DP, LIN-35 Rb and EFL-1 E2F act with the MCD-1 zinc-finger protein to promote programmed cell death in Caenorhabditis elegans.

    PubMed

    Reddien, Peter W; Andersen, Erik C; Huang, Michael C; Horvitz, H Robert

    2007-04-01

    The genes egl-1, ced-9, ced-4, and ced-3 play major roles in programmed cell death in Caenorhabditis elegans. To identify genes that have more subtle activities, we sought mutations that confer strong cell-death defects in a genetically sensitized mutant background. Specifically, we screened for mutations that enhance the cell-death defects caused by a partial loss-of-function allele of the ced-3 caspase gene. We identified mutations in two genes not previously known to affect cell death, dpl-1 and mcd-1 (modifier of cell death). dpl-1 encodes the C. elegans homolog of DP, the human E2F-heterodimerization partner. By testing genes known to interact with dpl-1, we identified roles in cell death for four additional genes: efl-1 E2F, lin-35 Rb, lin-37 Mip40, and lin-52 dLin52. mcd-1 encodes a novel protein that contains one zinc finger and that is synthetically required with lin-35 Rb for animal viability. dpl-1 and mcd-1 act with efl-1 E2F and lin-35 Rb to promote programmed cell death and do so by regulating the killing process rather than by affecting the decision between survival and death. We propose that the DPL-1 DP, MCD-1 zinc finger, EFL-1 E2F, LIN-35 Rb, LIN-37 Mip40, and LIN-52 dLin52 proteins act together in transcriptional regulation to promote programmed cell death.

  5. The Werner Protein Acts as a Coactivator of Nuclear Factor κB (NF-κB) on HIV-1 and Interleukin-8 (IL-8) Promoters.

    PubMed

    Mizutani, Taketoshi; Ishizaka, Aya; Furuichi, Yasuhiro

    2015-07-24

    The Werner syndrome helicase (WRN) plays a role in maintaining genomic stability. The lack of WRN results in Werner syndrome, a rare autosomal recessive genetic disorder, which causes premature aging accompanied by many complications such as rare forms of cancer and type 2 diabetes. However, the underlying mechanisms of these complications, arising due to the loss of WRN, are poorly understood. In this study, we demonstrated the function of WRN in transcriptional regulation of NF-κB targets. WRN physically interacts via its RecQ C-terminal (RQC) domain with the Rel homology domain of both the RelA (p65) and the p50 subunits of NF-κB. In the steady state, WRN is recruited to HIV-1 long terminal repeat (LTR), a typical NF-κB-responsive promoter, as well as the p50/p50 homodimer, in an NF-κB site-dependent manner. The amount of WRN on LTR increased along with the transactivating RelA/p50 heterodimer in response to TNF-α stimulation. Further, a knockdown of WRN reduced the transactivation of LTR in exogenous RelA/p50-introduced or TNF-α-stimulated cells. Additionally, knockdown of WRN reduced TNF-α stimulation-induced activation of the endogenous promoter of IL-8, an NF-κB-responsive gene, and WRN increased its association with the IL-8 promoter region together with RelA/p50 after TNF-α stimulation. In conjunction with studies that have shown NF-κB to be a key regulator of aging and inflammation, our results indicate a novel role of WRN in transcriptional regulation. Along with NF-κB, the loss of WRN is expected to result in incorrect regulation of downstream targets and leads to immune abnormalities and homeostatic disruption.

  6. The Werner Protein Acts as a Coactivator of Nuclear Factor κB (NF-κB) on HIV-1 and Interleukin-8 (IL-8) Promoters*

    PubMed Central

    Mizutani, Taketoshi; Ishizaka, Aya; Furuichi, Yasuhiro

    2015-01-01

    The Werner syndrome helicase (WRN) plays a role in maintaining genomic stability. The lack of WRN results in Werner syndrome, a rare autosomal recessive genetic disorder, which causes premature aging accompanied by many complications such as rare forms of cancer and type 2 diabetes. However, the underlying mechanisms of these complications, arising due to the loss of WRN, are poorly understood. In this study, we demonstrated the function of WRN in transcriptional regulation of NF-κB targets. WRN physically interacts via its RecQ C-terminal (RQC) domain with the Rel homology domain of both the RelA (p65) and the p50 subunits of NF-κB. In the steady state, WRN is recruited to HIV-1 long terminal repeat (LTR), a typical NF-κB-responsive promoter, as well as the p50/p50 homodimer, in an NF-κB site-dependent manner. The amount of WRN on LTR increased along with the transactivating RelA/p50 heterodimer in response to TNF-α stimulation. Further, a knockdown of WRN reduced the transactivation of LTR in exogenous RelA/p50-introduced or TNF-α-stimulated cells. Additionally, knockdown of WRN reduced TNF-α stimulation-induced activation of the endogenous promoter of IL-8, an NF-κB-responsive gene, and WRN increased its association with the IL-8 promoter region together with RelA/p50 after TNF-α stimulation. In conjunction with studies that have shown NF-κB to be a key regulator of aging and inflammation, our results indicate a novel role of WRN in transcriptional regulation. Along with NF-κB, the loss of WRN is expected to result in incorrect regulation of downstream targets and leads to immune abnormalities and homeostatic disruption. PMID:26037922

  7. Collagen triple helix repeat containing 1 (CTHRC1) acts via ERK-dependent induction of MMP9 to promote invasion of colorectal cancer cells.

    PubMed

    Kim, Hee Cheol; Kim, Yong Sung; Oh, Hyun-Woo; Kim, Kwoneel; Oh, Sang-Seok; Kim, Jong-Tae; Kim, Bo Yeon; Lee, Seon-Jin; Choe, Yong-Kyung; Kim, Dong Hyeok; Kim, Seok-Hyung; Chae, Seoung Wan; Kim, Kwang Dong; Lee, Hee Gu

    2014-01-30

    Collagen triple helix repeat-containing 1 (CTHRC1) is known to be aberrantly upregulated in most human solid tumors, although the functional roles of CTHRC1 in colorectal cancer remain unclear. In this study, we investigated the occurrence of CTHRC1 upregulation and its role in vivo and in vitro. The expression profile and clinical importance of CTHRC1 were examined by reverse transcription-polymerase chain reaction and immunohistochemical analyses in normal and tumor patient samples. CTHRC1 was detectable in normal tissues, but also was highly expressed in tumor specimens. CTHRC1 upregulation was significantly associated with demethylation of the CTHRC1 promoter in colon cancer cell lines and tumor tissues. Clinicopathologic analyses showed that nodal status and expression of CTHRC1 (95% CI 0.999-3.984, p=0.05) were significant prognostic factors for disease-free survival. Promoter CpG methylation and hypermethylation status were measured by bisulfite sequencing and pyrosequencing analysis. Furthermore, we showed that overexpression of CTHRC1 in the SW480 and HT-29 cell lines increased invasiveness, an effect mediated by extracellular signal-regulated kinase (ERK)-dependent upregulation of matrix metalloproteinase 9 (MMP9). Consistent with this, we found that knockdown of CTHRC1 attenuated ERK activation and cancer cell invasivity. These results demonstrate that CTHRC1 expression is elevated in human colon cancer cell lines and clinical specimens, and promotes cancer cell invasivity through ERK-dependent induction of MMP9 expression. Our results further suggest that high levels of CTHRC1 expression are associated with poor clinical outcomes.

  8. 7 CFR 33.1 - Act.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... AUTHORITY OF THE EXPORT APPLE ACT Definitions § 33.1 Act. Act and Export Apple Act are synonymous and mean “An act to promote the foreign trade of the United States in apples to protect the reputation of American-grown apples in foreign markets, to prevent deception or misrepresentation as to the quality...

  9. 7 CFR 33.1 - Act.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... AUTHORITY OF THE EXPORT APPLE ACT Definitions § 33.1 Act. Act and Export Apple Act are synonymous and mean “An act to promote the foreign trade of the United States in apples to protect the reputation of American-grown apples in foreign markets, to prevent deception or misrepresentation as to the quality...

  10. 7 CFR 33.1 - Act.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... AUTHORITY OF THE EXPORT APPLE ACT Definitions § 33.1 Act. Act and Export Apple Act are synonymous and mean “An act to promote the foreign trade of the United States in apples to protect the reputation of American-grown apples in foreign markets, to prevent deception or misrepresentation as to the quality...

  11. 7 CFR 33.1 - Act.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... AUTHORITY OF THE EXPORT APPLE ACT Definitions § 33.1 Act. Act and Export Apple Act are synonymous and mean “An act to promote the foreign trade of the United States in apples to protect the reputation of American-grown apples in foreign markets, to prevent deception or misrepresentation as to the quality...

  12. 7 CFR 33.1 - Act.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... AUTHORITY OF THE EXPORT APPLE ACT Definitions § 33.1 Act. Act and Export Apple Act are synonymous and mean “An act to promote the foreign trade of the United States in apples to protect the reputation of American-grown apples in foreign markets, to prevent deception or misrepresentation as to the quality...

  13. p11 is up-regulated in the forebrain of stressed rats by glucocorticoid acting via two specific glucocorticoid response elements in the p11 promoter.

    PubMed

    Zhang, L; Li, H; Su, T P; Barker, J L; Maric, D; Fullerton, C S; Webster, M J; Hough, C J; Li, X X; Ursano, R

    2008-06-02

    Posttraumatic stress disorder (PTSD) is one of the most common psychiatric disorders. Despite the extensive study of the neurobiological correlates of this disorder, the underlying mechanisms of PTSD are still poorly understood. Recently, a study demonstrated that dexamethasone (Dex), a synthetic glucocorticoid, can up-regulate p11, known as S100A10-protein which is down-regulated in patients with depression, (Yao et al., 1999; Huang et al., 2003) a common comorbid disorder in PTSD. These observations led to our hypothesis that traumatic stress may alter expression of p11 mediated through a glucocorticoid receptor. Here, we demonstrate that inescapable tail shock increased both prefrontal cortical p11 mRNA levels and plasma corticosterone levels in rats. We also found that Dex up-regulated p11 expression in SH-SY5Y cells through glucocorticoid response elements (GREs) within the p11 promoter. This response was attenuated by either RU486, a glucocorticoid receptor (GR) antagonist or mutating two of three glucocorticoid response elements (GRE2 and GRE3) in the p11 promoter. Finally, we showed that p11 mRNA levels were increased in postmortem prefrontal cortical tissue (area 46) of patients with PTSD. The data obtained from our work in a rat model of inescapable tail shock, a p11-transfected cell line and postmortem brain tissue from PTSD patients outline a possible mechanism by which p11 is regulated by glucocorticoids elevated by traumatic stress.

  14. Dpr Acts as a molecular switch, inhibiting Wnt signaling when unphosphorylated, but promoting Wnt signaling when phosphorylated by casein kinase Idelta/epsilon.

    PubMed

    Teran, Evelyn; Branscomb, Aron D; Seeling, Joni M

    2009-01-01

    The Wnt pathway is a key regulator of development and tumorigenesis. Dpr (Dact/Frodo) influences Wnt signaling in part through the interaction of its PDZ-B domain with Dsh's PDZ domain. Studies have shown that XDpr1a and its close relative, Frodo, are involved in multiple steps of the Wnt pathway in either inhibitory or activating roles. We found that XDpr1a is phosphorylated by casein kinase Idelta/epsilon (CKIdelta/epsilon), an activator of Wnt signaling, in the presence of XDsh. Abrogating XDpr1a's ability to bind XDsh through mutation of XDpr1a's PDZ-B domain blocks CK1delta/epsilon's phosphorylation of XDpr1a. Conversely, XDsh possessing a mutation in its PDZ domain that is unable to bind XDpr1a does not promote XDpr1a phosphorylation. Phosphorylation of XDpr1a and XDsh by CKIdelta/epsilon decreases their interaction. Moreover, the phosphorylation of XDpr1a by CKIdelta/epsilon not only abrogates XDpr1a's promotion of beta-catenin degradation but blocks beta-catenin degradation. Our data suggest that XDpr1a phosphorylation by CKIdelta/epsilon is dependent on the interaction of XDpr1a's PDZ-B domain with XDsh's PDZ domain, and that the phosphorylation state of XDpr1a determines whether it inhibits or activates Wnt signaling.

  15. Inhibitor of differentiation 4 (ID4) acts as an inhibitor of ID-1, -2 and -3 and promotes basic helix loop helix (bHLH) E47 DNA binding and transcriptional activity.

    PubMed

    Sharma, Pankaj; Chinaranagari, Swathi; Chaudhary, Jaideep

    2015-05-01

    The four known ID proteins (ID1-4, Inhibitor of Differentiation) share a homologous helix loop helix (HLH) domain and act as dominant negative regulators of basic-HLH transcription factors. ID proteins also interact with many non-bHLH proteins in complex networks. The expression of ID proteins is increasingly observed in many cancers. Whereas ID-1, ID-2 and ID-3, are generally considered as tumor promoters, ID4 on the contrary has emerged as a tumor suppressor. In this study we demonstrate that ID4 heterodimerizes with ID-1, -2 and -3 and promote bHLH DNA binding, essentially acting as an inhibitor of inhibitors of differentiation proteins. Interaction of ID4 was observed with ID1, ID2 and ID3 that was dependent on intact HLH domain of ID4. Interaction with bHLH protein E47 required almost 3 fold higher concentration of ID4 as compared to ID1. Furthermore, inhibition of E47 DNA binding by ID1 was restored by ID4 in an EMSA binding assay. ID4 and ID1 were also colocalized in prostate cancer cell line LNCaP. The alpha helix forming alanine stretch N-terminal, unique to HLH ID4 domain was required for optimum interaction. Ectopic expression of ID4 in DU145 prostate cancer line promoted E47 dependent expression of CDKNI p21. Thus counteracting the biological activities of ID-1, -2 and -3 by forming inactive heterodimers appears to be a novel mechanism of action of ID4. These results could have far reaching consequences in developing strategies to target ID proteins for cancer therapy and understanding biologically relevant ID-interactions.

  16. MiR-371-373 cluster acts as a tumor-suppressor-miR and promotes cell cycle arrest in unrestricted somatic stem cells.

    PubMed

    Langroudi, Lida; Jamshidi-Adegani, Fatemeh; Shafiee, Abbas; Rad, Seyed Mohammad Ali Hosseini; Keramati, Farid; Azadmanesh, Kayhan; Arefian, Ehsan; Soleimani, Masoud

    2015-09-01

    Recent advances in small RNA research have implicated microRNAs (miRNAs) as important regulators of proliferation and development. The miR-371-373 cluster is prominently expressed in human embryonic stem cells (ESCs) and rapidly decreases after cell differentiation. MiR-371-373 cluster was investigated as one of the key factors of stem cell maintenance and pluripotency in unrestricted somatic stem cells (USSCs) using a lentivirus system. Gene expression showed a dual effect on proliferation, which revealed a transient cell cycle progression and consequent repression in pluripotency factors and cell cycle genes. Cell proliferation analysis with CFU, MTT, and DNA content assays further confirmed the dual effect of cluster after prolonged exposure. Analyzing the course of action, it seems that miR-371-373 cluster acts as an onco/tumor suppressor-miR. MiR371-373 cluster acts by modulating the function of these factors and limiting the excessive cell cycle propagation upon oncogenic stimuli to protect cells from replicative stress, but also activate CDK inhibitors and transcriptional repressors of the retinoblastoma family to cause cell cycle arrest. In contrast to the previous studies, we believe that miR-371-373 cluster functions as a self-renewal miRNA to induce and maintain the pluripotent state but also to potentially inhibit dysregulated proliferation through cell cycle arrest. It seems that miR-371-373 cluster presents with a dual effect in this cellular context which may possess different actions in various cells. This not only expands the basic knowledge of the cluster but may offer a great chance for therapeutic interventions.

  17. H2O2-Sensitive Isoforms of Drosophila melanogaster TRPA1 Act in Bitter-Sensing Gustatory Neurons to Promote Avoidance of UV During Egg-Laying.

    PubMed

    Guntur, Ananya R; Gou, Bin; Gu, Pengyu; He, Ruo; Stern, Ulrich; Xiang, Yang; Yang, Chung-Hui

    2017-02-01

    The evolutionarily conserved TRPA1 channel can sense various stimuli including temperatures and chemical irritants. Recent results have suggested that specific isoforms of Drosophila TRPA1 (dTRPA1) are UV-sensitive and that their UV sensitivity is due to H2O2 sensitivity. However, whether such UV sensitivity served any physiological purposes in animal behavior was unclear. Here, we demonstrate that H2O2-sensitive dTRPA1 isoforms promote avoidance of UV when adult Drosophila females are selecting sites for egg-laying. First, we show that blind/visionless females are still capable of sensing and avoiding UV during egg-laying when intensity of UV is high yet within the range of natural sunlight. Second, we show that such vision-independent UV avoidance is mediated by a group of bitter-sensing neurons on the proboscis that express H2O2-sensitive dTRPA1 isoforms. We show that these bitter-sensing neurons exhibit dTRPA1-dependent UV sensitivity. Importantly, inhibiting activities of these bitter-sensing neurons, reducing their dTRPA1 expression, or reducing their H2O2-sensitivity all significantly reduced blind females' UV avoidance, whereas selectively restoring a H2O2-sensitive isoform of dTRPA1 in these neurons restored UV avoidance. Lastly, we show that specifically expressing the red-shifted channelrhodopsin CsChrimson in these bitter-sensing neurons promotes egg-laying avoidance of red light, an otherwise neutral cue for egg-laying females. Together, these results demonstrate a physiological role of the UV-sensitive dTRPA1 isoforms, reveal that adult Drosophila possess at least two sensory systems for detecting UV, and uncover an unexpected role of bitter-sensing taste neurons in UV sensing.

  18. TNF{alpha} acting on TNFR1 promotes breast cancer growth via p42/P44 MAPK, JNK, Akt and NF-{kappa}B-dependent pathways

    SciTech Connect

    Rivas, Martin A.; Carnevale, Romina P.; Proietti, Cecilia J.; Rosemblit, Cinthia; Beguelin, Wendy; Salatino, Mariana; Charreau, Eduardo H.; Frahm, Isabel; Sapia, Sandra; Brouckaert, Peter; Elizalde, Patricia V.; Schillaci, Roxana

    2008-02-01

    Tumor necrosis factor {alpha} (TNF{alpha}) enhances proliferation of chemically-induced mammary tumors and of T47D human cell line through not fully understood pathways. Here, we explored the intracellular signaling pathways triggered by TNF{alpha}, the participation of TNF{alpha} receptor (TNFR) 1 and TNFR2 and the molecular mechanism leading to breast cancer growth. We demonstrate that TNF{alpha} induced proliferation of C4HD murine mammary tumor cells and of T47D cells through the activation of p42/p44 MAPK, JNK, PI3-K/Akt pathways and nuclear factor-kappaB (NF-{kappa}B) transcriptional activation. A TNF{alpha}-specific mutein selectively binding to TNFR1 induced p42/p44 MAPK, JNK, Akt activation, NF-{kappa}B transcriptional activation and cell proliferation, just like wild-type TNF{alpha}, while a mutein selective for TNFR2 induced only p42/p44 MAPK activation. Interestingly, blockage of TNFR1 or TNFR2 with specific antibodies was enough to impair TNF{alpha} signaling and biological effect. Moreover, in vivo TNF{alpha} administration supported C4HD tumor growth. We also demonstrated, for the first time, that injection of a selective inhibitor of NF-{kappa}B activity, Bay 11-7082, resulted in regression of TNF{alpha}-promoted tumor. Bay 11-7082 blocked TNF{alpha} capacity to induce cell proliferation and up-regulation of cyclin D1 and of Bcl-x{sub L}in vivo and in vitro. Our results reveal evidence for TNF{alpha} as a breast tumor promoter, and provide novel data for a future therapeutic approach using TNF{alpha} antagonists and NF-{kappa}B pharmacological inhibitors in established breast cancer treatment.

  19. BubR1 Acts as a Promoter in Cellular Motility of Human Oral Squamous Cancer Cells through Regulating MMP-2 and MMP-9.

    PubMed

    Chou, Chou-Kit; Wu, Chang-Yi; Chen, Jeff Yi-Fu; Ng, Ming-Chong; Wang, Hui-Min David; Chen, Jen-Hao; Yuan, Shyng-Shiou F; Tsai, Eing-Mei; Chang, Jan-Gowth; Chiu, Chien-Chih

    2015-07-03

    BubR1 is a critical component of spindle assembly checkpoint, ensuring proper chromatin segregation during mitosis. Recent studies showed that BubR1 was overexpressed in many cancer cells, including oral squamous cell carcinomas (OSCC). However, the effect of BubR1 on metastasis of OSCC remains unclear. This study aimed to unravel the role of BubR1 in the progression of OSCC and confirm the expression of BubR1 in a panel of malignant OSCC cell lines with different invasive abilities. The results of quantitative real-time PCR showed that the mRNA level of BubR1 was markedly increased in four OSCC cell lines, Ca9-22, HSC3, SCC9 and Cal-27 cells, compared to two normal cells, normal human oral keratinocytes (HOK) and human gingival fibroblasts (HGF). Moreover, the expression of BubR1 in these four OSCC cell lines was positively correlated with their motility. Immunofluorescence revealed that BubR1 was mostly localized in the cytosol of human gingival carcinoma Ca9-22 cells. BubR1 knockdown significantly decreased cellular invasion but slightly affect cellular proliferation on both Ca9-22 and Cal-27 cells. Consistently, the activities of metastasis-associated metalloproteinases MMP-2 and MMP-9 were attenuated in BubR1 knockdown Ca9-22 cells, suggesting the role of BubR1 in promotion of OSCC migration. Our present study defines an alternative pathway in promoting metastasis of OSCC cells, and the expression of BubR1 could be a prognostic index in OSCC patients.

  20. ttm-1 encodes CDF transporters that excrete zinc from intestinal cells of C. elegans and act in a parallel negative feedback circuit that promotes homeostasis.

    PubMed

    Roh, Hyun Cheol; Collier, Sara; Deshmukh, Krupa; Guthrie, James; Robertson, J David; Kornfeld, Kerry

    2013-05-01

    Zinc is an essential metal involved in a wide range of biological processes, and aberrant zinc metabolism is implicated in human diseases. The gastrointestinal tract of animals is a critical site of zinc metabolism that is responsible for dietary zinc uptake and distribution to the body. However, the role of the gastrointestinal tract in zinc excretion remains unclear. Zinc transporters are key regulators of zinc metabolism that mediate the movement of zinc ions across membranes. Here, we identified a comprehensive list of 14 predicted Cation Diffusion Facilitator (CDF) family zinc transporters in Caenorhabditis elegans and demonstrated that zinc is excreted from intestinal cells by one of these CDF proteins, TTM-1B. The ttm-1 locus encodes two transcripts, ttm-1a and ttm-1b, that use different transcription start sites. ttm-1b expression was induced by high levels of zinc specifically in intestinal cells, whereas ttm-1a was not induced by zinc. TTM-1B was localized to the apical plasma membrane of intestinal cells, and analyses of loss-of-function mutant animals indicated that TTM-1B promotes zinc excretion into the intestinal lumen. Zinc excretion mediated by TTM-1B contributes to zinc detoxification. These observations indicate that ttm-1 is a component of a negative feedback circuit, since high levels of cytoplasmic zinc increase ttm-1b transcript levels and TTM-1B protein functions to reduce the level of cytoplasmic zinc. We showed that TTM-1 isoforms function in tandem with CDF-2, which is also induced by high levels of cytoplasmic zinc and reduces cytoplasmic zinc levels by sequestering zinc in lysosome-related organelles. These findings define a parallel negative feedback circuit that promotes zinc homeostasis and advance the understanding of the physiological roles of the gastrointestinal tract in zinc metabolism in animals.

  1. Insulin-like growth factors act synergistically with basic fibroblast growth factor and nerve growth factor to promote chromaffin cell proliferation.

    PubMed Central

    Frödin, M; Gammeltoft, S

    1994-01-01

    We have investigated the effects of insulin-like growth factors (IGFs), basic fibroblast growth factor (bFGF), and nerve growth factor (NGF) on DNA synthesis in cultured chromaffin cells from fetal, neonatal, and adult rats by using 5-bromo-2'-deoxyuridine (BrdUrd) pulse labeling for 24 or 48 h and immunocytochemical staining of cell nuclei. After 6 days in culture in the absence of growth factors, nuclear BrdUrd incorporation was detected in 30% of fetal chromaffin cells, 1.5% of neonatal cells, and 0.1% of adult cells. Addition of 10 nM IGF-I or IGF-II increased the fraction of BrdUrd-labeled nuclei to 50% of fetal, 20% of neonatal, and 2% of adult chromaffin cells. The ED50 value of IGF-I- and IGF-II-stimulated BrdUrd labeling in neonatal chromaffin cells was 0.3 nM and 0.8 nM, respectively. In neonatal and adult chromaffin cells, addition of 1 nM bFGF or 2 nM NGF stimulated nuclear BrdUrd incorporation to approximately the same level as 10 nM IGF-I or IGF-II. However, the response to bFGF or NGF in combination with either IGF-I or IGF-II was more than additive, indicating that the combined effect of the IGFs and bFGF or NGF is synergistic. The degree of synergism was 2- to 4-fold in neonatal chromaffin cells and 10- to 20-fold in adult chromaffin cells compared with the effect of each growth factor alone. In contrast, the action of bFGF and NGF added together in the absence of IGFs was not synergistic or additive. IGF-II acted also as a survival factor on neonatal chromaffin cells and the cell survival was further improved when bFGF or NGF was added together with IGF-II. In conclusion, we propose that IGF-I and IGF-II act in synergy with bFGF and NGF to stimulate proliferation and survival of chromaffin cells during neonatal growth and adult maintenance of the adrenal medulla. Our findings may have implications for improving the survival of chromaffin cell implants in diseased human brain. PMID:8127879

  2. The CCR4 deadenylase acts with Nanos and Pumilio in the fine-tuning of Mei-P26 expression to promote germline stem cell self-renewal.

    PubMed

    Joly, Willy; Chartier, Aymeric; Rojas-Rios, Patricia; Busseau, Isabelle; Simonelig, Martine

    2013-01-01

    Translational regulation plays an essential role in Drosophila ovarian germline stem cell (GSC) biology. GSC self-renewal requires two translational repressors, Nanos (Nos) and Pumilio (Pum), which repress the expression of differentiation factors in the stem cells. The molecular mechanisms underlying this translational repression remain unknown. Here, we show that the CCR4 deadenylase is required for GSC self-renewal and that Nos and Pum act through its recruitment onto specific mRNAs. We identify mei-P26 mRNA as a direct and major target of Nos/Pum/CCR4 translational repression in the GSCs. mei-P26 encodes a protein of the Trim-NHL tumor suppressor family that has conserved functions in stem cell lineages. We show that fine-tuning Mei-P26 expression by CCR4 plays a key role in GSC self-renewal. These results identify the molecular mechanism of Nos/Pum function in GSC self-renewal and reveal the role of CCR4-NOT-mediated deadenylation in regulating the balance between GSC self-renewal and differentiation.

  3. CCR4 promotes metastasis via ERK/NF-κB/MMP13 pathway and acts downstream of TNF-α in colorectal cancer

    PubMed Central

    Feng, Hao; Wangpu, Xiongzhi; Zhu, Congcong; Zong, Yaping; Ma, Junjun; Sun, Jing; Shen, Xiaohui; Zheng, Minhua; Lu, Aiguo

    2016-01-01

    Chemokines and chemokine receptors are causally involved in the metastasis of human malignancies. As a crucial chemokine receptor for mediating immune homeostasis, however, the role of CCR4 in colorectal cancer (CRC) remains unknown. In this study, we found that high expression of CCR4 in CRC tissues was correlated with shorter overall survival and disease free survival. In vitro and in vivo experiments revealed that silencing CCR4 attenuated the invasion and metastasis of CRC cells, whereas ectopic overexpression of CCR4 contributed to the forced metastasis of these cells. We further demonstrated that matrix metalloproteinase 13 (MMP13) played an important role in CCR4-mediated cancer cell invasion, which is up-regulated by ERK/NF-κB signaling. Positive correlation between CCR4 and MMP13 expression was also observed in CRC tissues. Moreover, our investigations showed that the level of CCR4 could be induced by TNF-α dependent of NF-κB activation in CRC cells. CCR4 might be implicated in TNF-α-regulated cancer cells metastasis. Combination of CCR4 and TNF-α is a more powerful prognostic marker for CRC patients. These findings suggest that CCR4 facilitates metastasis through ERK/NF-κB/MMP13 signaling and acts as a downstream target of TNF-α. CCR4 inhibition may be a promising therapeutic option for suppressing CRC metastasis. PMID:27356745

  4. PKBalpha/Akt1 acts downstream of DNA-PK in the DNA double-strand break response and promotes survival.

    PubMed

    Bozulic, Lana; Surucu, Banu; Hynx, Debby; Hemmings, Brian A

    2008-04-25

    Protein kinase B (PKB/Akt) is a well-established regulator of several essential cellular processes. Here, we report a route by which activated PKB promotes survival in response to DNA insults in vivo. PKB activation following DNA damage requires 3-phosphoinositide-dependent kinase 1 (PDK1) and DNA-dependent protein kinase (DNA-PK). Active PKB localizes in the nucleus of gamma-irradiated cells adjacent to DNA double-strand breaks, where it colocalizes and interacts with DNA-PK. Levels of active PKB inversely correlate with DNA damage-induced apoptosis. A significant portion of p53- and DNA damage-regulated genes are misregulated in cells lacking PKBalpha. PKBalpha knockout mice show impaired DNA damage-dependent induction of p21 and increased tissue apoptosis after single-dose whole-body irradiation. Our findings place PKB downstream of DNA-PK in the DNA damage response signaling cascade, where it provides a prosurvival signal, in particular by affecting transcriptional p21 regulation. Furthermore, this function is apparently restricted to the PKBalpha isoform.

  5. Acidosis Acts through HSP90 in a PHD/VHL-Independent Manner to Promote HIF Function and Stem Cell Maintenance in Glioma.

    PubMed

    Filatova, Alina; Seidel, Sascha; Böğürcü, Nuray; Gräf, Sabine; Garvalov, Boyan K; Acker, Till

    2016-10-01

    Hypoxia is a common feature of solid tumors, which controls multiple aspects of cancer progression. One important function of hypoxia and the hypoxia-inducible factors (HIF) is the maintenance of cancer stem-like cells (CSC), a population of tumor cells that possess stem cell-like properties and drives tumor growth. Among the changes promoted by hypoxia is a metabolic shift resulting in acidification of the tumor microenvironment. Here, we show that glioma hypoxia and acidosis functionally cooperate in inducing HIF transcription factors and CSC maintenance. We found that these effects did not involve the classical PHD/VHL pathway for HIF upregulation, but instead involved the stress-induced chaperone protein HSP90. Genetic or pharmacologic inactivation of HSP90 inhibited the increase in HIF levels and abolished the self-renewal and tumorigenic properties of CSCs induced by acidosis. In clinical specimens of glioma, HSP90 was upregulated in the hypoxic niche and was correlated with a CSC phenotype. Our findings highlight the role of tumor acidification within the hypoxic niche in the regulation of HIF and CSC function through HSP90, with implications for therapeutic strategies to target CSC in gliomas and other hypoxic tumors. Cancer Res; 76(19); 5845-56. ©2016 AACR.

  6. HSPRO acts via SnRK1-mediated signaling in the regulation of Nicotiana attenuata seedling growth promoted by Piriformospora indica

    PubMed Central

    Schuck, Stefan; Baldwin, Ian T.; Bonaventure, Gustavo

    2013-01-01

    Nicotiana attenuata HSPRO (NaHSPRO) is a negative regulator of seedling growth promoted by the fungus Piriformospora indica. Homologs of NaHSPRO in Arabidopsis thaliana (i.e., AtHSPRO1 and AtHSPRO2) are known to physically interact with the AKINβγ subunit of the SnRK1 complex.2 To investigate whether NaHSPRO is associated with SnRK1 function during the stimulation of seedling growth by P. indica, we studied N. attenuata plants silenced in the expression of NaGAL83 (as-gal83 plants)—a gene that encodes for the regulatory β-subunit of SnRK1—and plants silenced in the expression of both NaHSPRO and NaGAL83 (ir-hspro/as-gal83 plants). The results showed that P. indica differentially stimulated the growth of both as-gal83 and ir-hspro/as-gal83 seedlings compared with control seedlings, with a magnitude similar to that observed in ir-hspro seedlings. Thus, we showed that, similar to NaHSPRO, NaGAL83 is a negative regulator of seedling growth stimulated by P. indica. We propose that the effect of NaHSPRO on seedling growth is associated with SnRK1 signaling. PMID:23333980

  7. Free Sialic Acid Acts as a Signal That Promotes Streptococcus pneumoniae Invasion of Nasal Tissue and Nonhematogenous Invasion of the Central Nervous System

    PubMed Central

    Hatcher, Brandon L.; Hale, Joanetha Y.

    2016-01-01

    Streptococcus pneumoniae (pneumococcus) is a leading cause of bacterial meningitis and neurological sequelae in children worldwide. Acute bacterial meningitis is widely considered to result from bacteremia that leads to blood-brain barrier breakdown and bacterial dissemination throughout the central nervous system (CNS). Previously, we showed that pneumococci can gain access to the CNS through a nonhematogenous route without peripheral blood infection. This access is thought to occur when the pneumococci in the upper sinus follow the olfactory nerves and enter the CNS through the olfactory bulbs. In this study, we determined whether the addition of exogenous sialic acid postcolonization promotes nonhematogenous invasion of the CNS. Previously, others showed that treatment with exogenous sialic acid post-pneumococcal infection increased the numbers of CFU recovered from an intranasal mouse model of infection. Using a pneumococcal colonization model, an in vivo imaging system, and a multiplex assay for cytokine expression, we demonstrated that sialic acid can increase the number of pneumococci recovered from the olfactory bulbs and brains of infected animals. We also show that pneumococci primarily localize to the olfactory bulb, leading to increased expression levels of proinflammatory cytokines and chemokines. These findings provide evidence that sialic acid can enhance the ability of pneumococci to disseminate into the CNS and provide details about the environment needed to establish nonhematogenous pneumococcal meningitis. PMID:27354445

  8. Thrombospondin 1 acts as a strong promoter of transforming growth factor β effects via two distinct mechanisms in hepatic stellate cells

    PubMed Central

    Breitkopf, K; Sawitza, I; Westhoff, J H; Wickert, L; Dooley, S; Gressner, A M

    2005-01-01

    Background and aims: Thrombospondin 1 (TSP-1) is an important activator of latent transforming growth factor β (TGF-β) but little is known of the expression patterns and functions of TSP-1 in liver cells. We therefore analysed if and how TSP-1 acts on TGF-β during fibrogenesis. Methods and results: Using reverse transcription-polymerase chain reaction, we demonstrated that hepatocytes from normal liver expressed no TSP-1 mRNA whereas Kupffer cells and sinusoidal endothelial cells did. TSP-1 mRNA and protein were detected in quiescent and activated cultured hepatic stellate cells (HSC) and TSP-1 expression was highly inducible by platelet derived growth factor BB (PDGF-BB) and, to a lesser extent, by tumour necrosis factor α in activated HSC. Furthermore, addition of PDGF-BB directly led to enhanced TGF-β mRNA expression and a TSP-1 dependent increase in TGF-β/Smad signalling. Using either a peptide specifically blocking the interaction of TSP-1 with latent TGF-β or antibodies against TSP-1 not only abrogated activation of latent TGF-β but also reduced the effects of the active dimer itself. Conclusions: Our data suggest that TSP-1 expression is important for TGF-β effects and that it is regulated by the profibrogenic mediator PDGF-BB in HSC. Furthermore, the presence of TSP-1 seems to be a prerequisite for effective signal transduction by active TGF-β not only in rat HSC but also in other cell types such as human dermal fibroblasts. PMID:15831915

  9. How safe is our "place of safety"? Clinical guidance promoting safer medical care of patients detained under section 136 of the Mental Health Act.

    PubMed

    Mouko, Josie; Goddard, Aurielle; Nimmo-Smith, Victoria

    2015-01-01

    A new four-bed unit was opened in Bristol, UK, in 2014, for people detained under section 136 of the Mental Health Act. Police bring individuals posing a risk to themselves or others to a Place of Safety (PoS) in order to receive a mental health assessment. Individuals may be held for up to 72 hours, but cannot receive treatment against their will, unless assessed as lacking the capacity to refuse treatment. Issues requiring medical input arose in more than a third of patients, yet there was little guidance for trainees around the PoS. We conducted a survey which confirmed that robust clinical guidance was needed for junior doctors around medical assistance in this unique environment. We identified specific concerns around patient safety in relation to alcohol withdrawal, uncertainties around legislation and lack of clarity of who to call out of hours. Trainees felt they were working outside of their expertise. We collaborated with a variety of professionals to produce clinical guidance in line with best evidence, and made this easily accessible. We also gained a consensus that more experienced core trainees (SHOs) in Psychiatry should be the first point of contact. We then conducted a survey in June 2015, and found that doctors covering the PoS now felt there was sufficient guidance on most clinical scenarios, 100% consensus on who to contact and improved confidence in their ability to manage issues arising. In August 2015 we held an informal training session for the new intake of trainees on the rota. A subsequent survey revealed similarly positive results. Through this project, we were able to identify defects in a system, provide needed guidance to enable safer and more equitable care to a vulnerable group, and foster closer collaboration between junior doctors and managers in the design and use of services.

  10. Long-Acting PASylated Leptin Ameliorates Obesity by Promoting Satiety and Preventing Hypometabolism in Leptin-Deficient Lep(ob/ob) Mice.

    PubMed

    Bolze, Florian; Morath, Volker; Bast, Andrea; Rink, Nadine; Schlapschy, Martin; Mocek, Sabine; Skerra, Arne; Klingenspor, Martin

    2016-01-01

    Body weight loss of Lep(ob/ob) mice in response to leptin is larger than expected from the reduction in energy intake alone, suggesting a thermogenic action of unknown magnitude. We exploited the superior pharmacological properties of a novel long-acting leptin prepared via PASylation to study the contribution of its anorexigenic and thermogenic effects. PASylation, the genetic fusion of leptin with a conformationally disordered polypeptide comprising 600 Pro/Ala/Ser (PAS) residues, provides a superior way to increase the hydrodynamic volume of the fusion protein, thus retarding kidney filtration and extending plasma half-life. Here a single PAS(600)-leptin injection (300 pmol/g) resulted in a maximal weight reduction of 21% 6 days after application. The negative energy balance of 300 kJ/(4 d) was driven by a decrease in energy intake, whereas energy expenditure remained stable. Mice that were food restricted to the same extent showed an energy deficit of only 220 kJ/(4 d) owing to recurring torpor bouts. Therefore, the anorexigenic effect of PAS(600)-leptin contributes 75% to weight loss, whereas the thermogenic action accounts for 25% by preventing hypometabolism. In a second experiment, just four injections of PAS(600)-leptin (100 pmol/g) administered in 5- to 6-day intervals rectified the Lep(ob/ob) phenotype. In total, 16 nmol of PAS(600)-leptin per mouse triggered a weight loss of 43% within 20 days and normalized hypothermia and glucose homeostasis as well as hepatic steatosis. The beneficial properties of PAS(600)-leptin are substantiated by a comparison with previous studies in which approximately 400 nmol (∼25-fold) unmodified leptin was mandatory to achieve similar improvements.

  11. 7 CFR 35.1 - Act.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ...), DEPARTMENT OF AGRICULTURE COMMODITY STANDARDS AND STANDARD CONTAINER REGULATIONS EXPORT GRAPES AND PLUMS Definitions § 35.1 Act. Act or Export Grape and Plum Act means “An Act to promote the foreign trade of the United States in grapes and plums, to protect the reputation of American-grown grapes and plums...

  12. 7 CFR 35.1 - Act.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ...), DEPARTMENT OF AGRICULTURE COMMODITY STANDARDS AND STANDARD CONTAINER REGULATIONS EXPORT GRAPES AND PLUMS Definitions § 35.1 Act. Act or Export Grape and Plum Act means “An Act to promote the foreign trade of the United States in grapes and plums, to protect the reputation of American-grown grapes and plums...

  13. 7 CFR 35.1 - Act.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ...), DEPARTMENT OF AGRICULTURE COMMODITY STANDARDS AND STANDARD CONTAINER REGULATIONS EXPORT GRAPES AND PLUMS Definitions § 35.1 Act. Act or Export Grape and Plum Act means “An Act to promote the foreign trade of the United States in grapes and plums, to protect the reputation of American-grown grapes and plums...

  14. 7 CFR 35.1 - Act.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ...), DEPARTMENT OF AGRICULTURE COMMODITY STANDARDS AND STANDARD CONTAINER REGULATIONS EXPORT GRAPES AND PLUMS Definitions § 35.1 Act. Act or Export Grape and Plum Act means “An Act to promote the foreign trade of the United States in grapes and plums, to protect the reputation of American-grown grapes and plums...

  15. 7 CFR 35.1 - Act.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ...), DEPARTMENT OF AGRICULTURE COMMODITY STANDARDS AND STANDARD CONTAINER REGULATIONS EXPORT GRAPES AND PLUMS Definitions § 35.1 Act. Act or Export Grape and Plum Act means “An Act to promote the foreign trade of the United States in grapes and plums, to protect the reputation of American-grown grapes and plums...

  16. 75 FR 62889 - Sunshine Act Meetings

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-10-13

    ... Legal Services Committee (``Promotion & Provision Committee''). 2. Governance & Performance Review... solely of staff briefings does not fall within the Sunshine Act's definition of the term ``meeting'' and... other business. 7. Consider and act on adjournment of meeting. Governance and Performance...

  17. Promoting Health Care Purchasing Cooperatives Act

    THOMAS, 111th Congress

    Sen. Feingold, Russell D. [D-WI

    2009-06-02

    06/02/2009 Read twice and referred to the Committee on Health, Education, Labor, and Pensions. (text of measure as introduced: CR S5949-5950) (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  18. Renewable Electricity Promotion Act of 2010

    THOMAS, 111th Congress

    Sen. Bingaman, Jeff [D-NM

    2010-09-21

    09/22/2010 Read the second time. Placed on Senate Legislative Calendar under General Orders. Calendar No. 576. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  19. Promoting Jobs for Veterans Act of 2009

    THOMAS, 111th Congress

    Rep. Buyer, Steve [R-IN-4

    2009-12-08

    01/04/2010 Referred to the Subcommittee on Higher Education, Lifelong Learning, and Competitiveness. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  20. Promoting Electric Vehicles Act of 2011

    THOMAS, 112th Congress

    Sen. Merkley, Jeff [D-OR

    2011-05-11

    05/19/2011 Committee on Energy and Natural Resources. Hearings held. Hearings printed: S.Hrg. 112-38. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  1. Prescription Drug Labeling Promotion Act of 2012

    THOMAS, 112th Congress

    Rep. Markey, Edward J. [D-MA-7

    2012-02-24

    02/24/2012 Referred to the House Committee on Energy and Commerce. (All Actions) Notes: For further action, see S.3187, which became Public Law 112-144 on 7/9/2012. Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  2. Acting Atoms.

    ERIC Educational Resources Information Center

    Farin, Susan Archie

    1997-01-01

    Describes a fun game in which students act as electrons, protons, and neutrons. This activity is designed to help students develop a concrete understanding of the abstract concept of atomic structure. (DKM)

  3. Freedom of Information Act

    USGS Publications Warehouse

    Newman, D.J.

    2012-01-01

    The Freedom of Information Act( FOIA), 5 U.S.C.§ 552, as amended, generally provides that any person has a right to request access to Federal agency records. The USGS proactively promotes information disclosure as inherent to its mission of providing objective science to inform decisionmakers and the general public. USGS scientists disseminate up-to-date and historical scientific data that are critical to addressing national and global priorities.

  4. 7 CFR 1210.302 - Act.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Act. 1210.302 Section 1210.302 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS... PLAN Watermelon Research and Promotion Plan Definitions § 1210.302 Act. Act means the...

  5. Balancing Act

    ERIC Educational Resources Information Center

    Kennedy, Mike

    2007-01-01

    For some administrators and planners, designing and building education facilities may sometimes seem like a circus act--trying to project a persona of competence and confidence while juggling dozens of issues. Meanwhile, the audience--students, staff members and taxpayers--watch and wait with anticipation in hopes of getting what they paid for and…

  6. 7 CFR 1210.312 - Promotion.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE WATERMELON RESEARCH AND PROMOTION PLAN Watermelon Research and Promotion Plan Definitions § 1210.312 Promotion. Promotion means any action taken by the Board, pursuant to the Act, to present a favorable image for watermelons to...

  7. 7 CFR 1210.312 - Promotion.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE WATERMELON RESEARCH AND PROMOTION PLAN Watermelon Research and Promotion Plan Definitions § 1210.312 Promotion. Promotion means any action taken by the Board, pursuant to the Act, to present a favorable image for watermelons to...

  8. 7 CFR 1210.312 - Promotion.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE WATERMELON RESEARCH AND PROMOTION PLAN Watermelon Research and Promotion Plan Definitions § 1210.312 Promotion. Promotion means any action taken by the Board, pursuant to the Act, to present a favorable image for watermelons to...

  9. 7 CFR 1210.312 - Promotion.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE WATERMELON RESEARCH AND PROMOTION PLAN Watermelon Research and Promotion Plan Definitions § 1210.312 Promotion. Promotion means any action taken by the Board, pursuant to the Act, to present a favorable image for watermelons to...

  10. Exopolyphosphatase of Pseudomonas aeruginosa is essential for the production of virulence factors, and its expression is controlled by NtrC and PhoB acting at two interspaced promoters.

    PubMed

    Gallarato, Lucas A; Sánchez, Diego G; Olvera, Leticia; Primo, Emiliano D; Garrido, Mónica N; Beassoni, Paola R; Morett, Enrique; Lisa, Angela T

    2014-02-01

    The exopolyphosphatase (Ppx) of Pseudomonas aeruginosa is encoded by the PA5241 gene (ppx). Ppx catalyses the hydrolysis of inorganic polyphosphates to orthophosphate (Pi). In the present work, we identified and characterized the promoter region of ppx and its regulation under environmental stress conditions. The role of Ppx in the production of several virulence factors was demonstrated through studies performed on a ppx null mutant. We found that ppx is under the control of two interspaced promoters, dually regulated by nitrogen and phosphate limitation. Under nitrogen-limiting conditions, its expression was controlled from a σ(54)-dependent promoter activated by the response regulator NtrC. However, under Pi limitation, the expression was controlled from a σ(70) promoter, activated by PhoB. Results obtained from the ppx null mutant demonstrated that Ppx is involved in the production of virulence factors associated with both acute infection (e.g. motility-promoting factors, blue/green pigment production, C6-C12 quorum-sensing homoserine lactones) and chronic infection (e.g. rhamnolipids, biofilm formation). Molecular and physiological approaches used in this study indicated that P. aeruginosa maintains consistently proper levels of Ppx regardless of environmental conditions. The precise control of ppx expression appeared to be essential for the survival of P. aeruginosa and the occurrence of either acute or chronic infection in the host.

  11. 7 CFR 1212.1 - Act.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS AND..., PROMOTION, CONSUMER EDUCATION AND INDUSTRY INFORMATION ORDER Honey Packers and Importers Research, Promotion, Consumer Education, and Industry Information Order Definitions § 1212.1 Act. “Act” means the...

  12. Health Promotion

    DTIC Science & Technology

    1986-03-11

    Department of Defense DIRECTIVEAD-A269 638 , , AD-A29 638March 11, 1986 IIIIii!IN 111111111,11 Ii1111,111111[NUMBER 1010.10 SUBJECT: Health Promotion ...34 March 13, 1985 INC A. URPOSE SThis Directive establishes a health promotion policy within the Department of Defense to improve and maintain military...civilian employees. C. DEFINITIONS 1. Health Promotion . Any combination of health education and related organizational, social, economic or health care

  13. 76 FR 36281 - Mango Promotion, Research, and Information Order; Reapportionment

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-06-22

    ... Service 7 CFR Part 1206 Mango Promotion, Research, and Information Order; Reapportionment AGENCY.../retailer positions. In accordance with the Mango Promotion, Research, and Information Order (Order), which is authorized under the Commodity Promotion, Research, and Information Act of 1996 (Act), a review...

  14. 77 FR 26911 - Processed Raspberry Promotion, Research, and Information Order

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-05-08

    ... Service 7 CFR Part 1208 RIN 0581-AC79 Processed Raspberry Promotion, Research, and Information Order... Processed Raspberry Promotion, Research, and Information Order (Order). The program will be implemented under the Commodity Promotion, Research, and Information Act of 1996 (1996 Act). Under the...

  15. Health Promotion

    PubMed Central

    Wilson, Ron

    1992-01-01

    How physicians address issues of disease prevention and health promotion is discussed and current standards of screening for disease and counseling practices are reviewed. Collaboration among all health professionals is necessary if preventive medicine is to be effective. PMID:21221259

  16. The viral oncogene Np9 acts as a critical molecular switch for co-activating β-catenin, ERK, Akt and Notch1 and promoting the growth of human leukemia stem/progenitor cells.

    PubMed

    Chen, T; Meng, Z; Gan, Y; Wang, X; Xu, F; Gu, Y; Xu, X; Tang, J; Zhou, H; Zhang, X; Gan, X; Van Ness, C; Xu, G; Huang, L; Zhang, X; Fang, Y; Wu, J; Zheng, S; Jin, J; Huang, W; Xu, R

    2013-07-01

    HERV-K (human endogenous retrovirus type K) type 1-encoded Np9 is a tumor-specific biomarker, but its oncogenic role and targets in human leukemia remain elusive. We first identified Np9 as a potent viral oncogene in human leukemia. Silencing of Np9 inhibited the growth of myeloid and lymphoblastic leukemic cells, whereas expression of Np9 significantly promoted the growth of leukemia cells in vitro and in vivo. Np9 not only activated ERK, AKT and Notch1 pathways but also upregulated β-catenin essential for survival of leukemia stem cells. In human leukemia, Np9 protein level in leukemia patients was substantially higher than that in normal donors (56% vs 4.5%). Moreover, Np9 protein level was correlated with the number of leukemia stem/progenitor cells but not detected in normal CD34(+) hematopoietic stem cells. In addition, Np9-positive samples highly expressed leukemia-specific pol-env polyprotein, env and transmembrane proteins as well as viral particles. Thus, the viral oncogene Np9 is a critical molecular switch of multiple signaling pathways regulating the growth of leukemia stem/progenitor cells. These findings open a new perspective to understand the etiology of human common leukemia and provide a novel target for treating leukemia.

  17. Using Data to Promote Equity

    ERIC Educational Resources Information Center

    Shum, Brenda

    2016-01-01

    Data plays a starring role in promoting educational equity, and data-driven decision making begins with good state policies. With the recent passage of the Every Student Succeeds Act (ESSA) and a proposed federal rule to address racial disproportionality in special education, states will shoulder increased responsibility for eliminating…

  18. 76 FR 69110 - Christmas Tree Promotion, Research, and Information Order; Referendum Procedures

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-11-08

    ... Agricultural Marketing Service 7 CFR Part 1214 RIN 0581-AD00 Christmas Tree Promotion, Research, and... whether the continuation ] of the Christmas Promotion, Research, and Information Order (Order) is favored... Commodity Promotion, Research, and Information Act of 1996 (1996 Act). The 1996 Act allows for a...

  19. 78 FR 32228 - Cotton Research and Promotion Program: Determination of Whether To Conduct a Referendum Regarding...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-05-29

    ... Agricultural Marketing Service Cotton Research and Promotion Program: Determination of Whether To Conduct a Referendum Regarding 1990 Amendments to the Cotton Research and Promotion Act AGENCY: Agricultural Marketing... Promotion Act (Act). The 1990 amendments require the Secretary of Agriculture, once every 5 years,...

  20. Health Promotion

    PubMed Central

    Karmali-Rawji, Shameela; Kassim-Lakha, Shaheen; Taylor, Karmel

    1992-01-01

    Perceived lack or loss of control, stress, a rapidly again population and rising costs of health care necessitate effective health promotion and disease prevention in the elderly. In a collaborative health promotion effort, the private sector, public sector, and community partners have joined to increase the South Asian elders' sense of control over the decisions and circumstances that affect their everyday lives. The project was designed to help elders come to terms with the fragmentation of their extended families, cultural alienation, decreased autonomy, need for information, and greater risk of cardiovascular disease. Imagesp622-a

  1. Privacy Act Statement

    EPA Pesticide Factsheets

    Any information you provide to the Environmental Protection Agency’s (EPA) Suspension and Debarment Program will be governed by the Privacy Act and will be included in the EPA Debarment and Suspension Files, a Privacy Act system of records.

  2. ACTS data center

    NASA Technical Reports Server (NTRS)

    Syed, Ali; Vogel, Wolfhard J.

    1993-01-01

    Viewgraphs on ACTS Data Center status report are included. Topics covered include: ACTS Data Center Functions; data flow overview; PPD flow; RAW data flow; data compression; PPD distribution; RAW Data Archival; PPD Audit; and data analysis.

  3. Recovery Act Milestones

    ScienceCinema

    Rogers, Matt

    2016-07-12

    Every 100 days, the Department of Energy is held accountable for a progress report on the American Recovery and Reinvestment Act. Update at 200 days, hosted by Matt Rogers, Senior Advisor to Secretary Steven Chu for Recovery Act Implementation.

  4. Autism: Why Act Early?

    MedlinePlus

    ... What's this? Submit Button Past Emails CDC Features Autism: Why Act Early? Language: English Español (Spanish) Recommend ... helped the world make sense." Florida teenager with Autism Spectrum Disorder "Because my parents acted early, I ...

  5. Recovery Act Milestones

    SciTech Connect

    Rogers, Matt

    2009-01-01

    Every 100 days, the Department of Energy is held accountable for a progress report on the American Recovery and Reinvestment Act. Update at 200 days, hosted by Matt Rogers, Senior Advisor to Secretary Steven Chu for Recovery Act Implementation.

  6. The dermatology acting internship.

    PubMed

    Stephens, John B; Raimer, Sharon S; Wagner, Richard F

    2011-07-15

    Acting internships are an important component of modern day medical school curriculum. Several specialties outside of internal medicine now offer acting internship experiences to fourth year medical students. We have found that a dermatology acting internship is a valuable experience for fourth year medical students who are interested in pursuing a residency in dermatology. Our experience with the dermatology acting internship over the 2010-2011 academic year is described.

  7. Identifying Opinion Leaders to Promote Behavior Change

    ERIC Educational Resources Information Center

    Valente, Thomas W.; Pumpuang, Patchareeya

    2007-01-01

    This article reviews 10 techniques used to identify opinion leaders to promote behavior change. Opinion leaders can act as gatekeepers for interventions, help change social norms, and accelerate behavior change. Few studies document the manner in which opinion leaders are identified, recruited, and trained to promote health. The authors categorize…

  8. 27 CFR 6.96 - Consumer promotions.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2011-04-01 2011-04-01 false Consumer promotions. 6.96... OF THE TREASURY LIQUORS âTIED-HOUSEâ Exceptions § 6.96 Consumer promotions. (a) Coupons. The act by an industry member of furnishing to consumers coupons which are redeemable at a retail...

  9. 27 CFR 6.96 - Consumer promotions.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Consumer promotions. 6.96 Section 6.96 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS âTIED-HOUSEâ Exceptions § 6.96 Consumer promotions. (a) Coupons. The act...

  10. Energy Independence and Security Act of 2007

    SciTech Connect

    2011-12-30

    An Act passed in 2007 to move the United States toward greater energy independence and security, to increase the production of clean renewable fuels, to protect consumers, to increase the efficiency of products, buildings, and vehicles, to promote research on and deploy greenhouse gas capture and storage options, and to improve the energy performance of the Federal Government, and for other purposes.

  11. Quantum Measurement Act as a Speech Act

    NASA Astrophysics Data System (ADS)

    Schneider, Jean

    2005-10-01

    I show that the quantum measurement problem can be understood if the measurement is seen as a "speech act" in the sense of modern language theory. The reduction of the state vector is in this perspective an intersubjective -- or, better, a-subjective -- symbolic process. I then give some perspectives on applications to the "Mind-Body Problem".

  12. Internet Freedom, Broadband Promotion, and Consumer Protection Act of 2011

    THOMAS, 112th Congress

    Sen. Cantwell, Maria [D-WA

    2011-01-25

    01/25/2011 Read twice and referred to the Committee on Commerce, Science, and Transportation. (text of measure as introduced: CR S183-185) (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  13. Iran Human Rights and Democracy Promotion Act of 2011

    THOMAS, 112th Congress

    Sen. Kirk, Mark Steven [R-IL

    2011-05-04

    05/04/2011 Read twice and referred to the Committee on Foreign Relations. (All Actions) Notes: For further action, see H.R.1905, which became Public Law 112-158 on 8/10/2012. Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  14. Algae-based Renewable Fuel Promotion Act of 2010

    THOMAS, 111th Congress

    Rep. Teague, Harry [D-NM-2

    2009-12-01

    11/15/2010 Read the second time. Placed on Senate Legislative Calendar under General Orders. Calendar No. 639. (All Actions) Tracker: This bill has the status Passed HouseHere are the steps for Status of Legislation:

  15. Algae-based Renewable Fuel Promotion Act of 2009

    THOMAS, 111th Congress

    Sen. Nelson, Bill [D-FL

    2009-06-11

    06/11/2009 Read twice and referred to the Committee on Finance. (text of measure as introduced: CR S6557) (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  16. Travel Promotion, Enhancement, and Modernization Act of 2014

    THOMAS, 113th Congress

    Rep. Bilirakis, Gus M. [R-FL-12

    2014-04-10

    07/31/2014 Read twice. Placed on Senate Legislative Calendar under General Orders. Calendar No. 521. (All Actions) Tracker: This bill has the status Passed HouseHere are the steps for Status of Legislation:

  17. Promoting Transparency in Financial Reporting Act of 2009

    THOMAS, 111th Congress

    Rep. Lee, Christopher J. [R-NY-26

    2009-06-02

    09/10/2009 Received in the Senate and Read twice and referred to the Committee on Banking, Housing, and Urban Affairs. (All Actions) Tracker: This bill has the status Passed HouseHere are the steps for Status of Legislation:

  18. United States-China Market Engagement and Export Promotion Act

    THOMAS, 111th Congress

    Sen. Cantwell, Maria [D-WA

    2009-08-06

    08/06/2009 Read twice and referred to the Committee on Banking, Housing, and Urban Affairs. (text of measure as introduced: CR S9016-9017) (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  19. Concrete Masonry Products Research, Education, and Promotion Act of 2013

    THOMAS, 113th Congress

    Sen. Nelson, Bill [D-FL

    2013-02-28

    12/12/2014 By Senator Rockefeller from Committee on Commerce, Science, and Transportation filed written report. Report No. 113-319. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  20. Promoting Job Creation and Reducing Small Business Burdens Act

    THOMAS, 113th Congress

    Rep. Fitzpatrick, Michael G. [R-PA-8

    2014-09-08

    09/17/2014 Received in the Senate and Read twice and referred to the Committee on Banking, Housing, and Urban Affairs. (All Actions) Tracker: This bill has the status Passed HouseHere are the steps for Status of Legislation:

  1. Marine and Hydrokinetic Renewable Energy Promotion Act of 2011

    THOMAS, 112th Congress

    Rep. Inslee, Jay [D-WA-1

    2011-09-21

    09/19/2012 PERMISSION TO BE ADDED AS A COSPONSOR - Ms. Bonamici asked unanimous consent that she be added as a cosponsor of H.R. 2994 since the original sponsor is no longer a Member of Congress. Agreed to without objection. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  2. Promoting Health as Youth Skills In Classrooms And Life Act

    THOMAS, 112th Congress

    Rep. Fudge, Marcia L. [D-OH-11

    2011-08-12

    11/18/2011 Referred to the Subcommittee on Early Childhood, Elementary, and Secondary Education. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  3. Promoting Health as Youth Skills In Classrooms And Life Act

    THOMAS, 113th Congress

    Rep. Fudge, Marcia L. [D-OH-11

    2013-05-23

    07/08/2013 Referred to the Subcommittee on Early Childhood, Elementary, and Secondary Education. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  4. Promoting health at the community level: thinking globally, acting locally.

    PubMed

    Economos, Christina D; Tovar, Alison

    2012-02-01

    Prevention of childhood obesity is a societal priority. Despite our knowledge about the scope of the problem and the determinants that lead to it, we have yet to produce meaningful declines in obesity rates. Recent attention has been given to interventions that employ multiple strategies across multiple settings involving whole communities given their promising results. The next era of science calls for interdisciplinary teams who will envision a whole system approach to advance the community-based obesity prevention model. This perspective describes some of the more recent discussions of community-based methodologies such as the ANGELO (Analysis Grid for Environments Linked to Obesity) framework, best-practice principles, and a whole system intervention approach to obesity prevention. The proposed required elements to advance community-based research to address childhood obesity are: A systems perspective and approach, training of future leaders in community research methodology and social change, applying transdisciplinary strategies, funding to conduct rigorous trials to determine efficacy and effectiveness, enhanced design and analysis approaches, new and improved tools and methodologies to collect quantitative and qualitative data, enhanced community engagement models and sustainability frameworks, advancement of a bold public policy agenda, economic modeling, and acknowledgment of the approach as viable. To reverse childhood obesity, we need to embrace and integrate complex strategies at multiple levels within communities across the globe.

  5. Protecting States' Rights to Promote American Energy Security Act

    THOMAS, 113th Congress

    Rep. Flores, Bill [R-TX-17

    2013-07-18

    12/09/2013 Read the second time. Placed on Senate Legislative Calendar under General Orders. Calendar No. 255. (All Actions) Tracker: This bill has the status Passed HouseHere are the steps for Status of Legislation:

  6. Promoting Natural Gas and Electric Vehicles Act of 2010

    THOMAS, 111th Congress

    Sen. Reid, Harry [D-NV

    2010-09-21

    11/17/2010 Cloture motion on the motion to proceed to the bill withdrawn by unanimous consent in Senate. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  7. Medicare, Medicaid, and MCH Tobacco Cessation Promotion Act of 2009

    THOMAS, 111th Congress

    Sen. Durbin, Richard [D-IL

    2009-04-01

    04/01/2009 Read twice and referred to the Committee on Finance. (text of measure as introduced: CR S4180-4191) (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  8. Promoting Wellness for Individuals with Disabilities Act of 2009

    THOMAS, 111th Congress

    Rep. Lowey, Nita M. [D-NY-18

    2009-04-02

    05/14/2009 Referred to the Subcommittee on Higher Education, Lifelong Learning, and Competitiveness. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  9. Iran Human Rights and Democracy Promotion Act of 2011

    THOMAS, 112th Congress

    Rep. Dold, Robert J. [R-IL-10

    2011-05-04

    08/02/2011 Referred to the Subcommittee on Middle East and South Asia . (All Actions) Notes: For further action, see H.R.1905, which became Public Law 112-158 on 8/10/2012. Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  10. Critical Minerals and Materials Promotion Act of 2011

    THOMAS, 112th Congress

    Sen. Udall, Mark [D-CO

    2011-02-17

    06/09/2011 Committee on Energy and Natural Resources Subcommittee on Energy. Hearings held. With printed Hearing: S.Hrg. 112-117. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  11. United States-Panama Trade Promotion Agreement Implementation Act

    THOMAS, 112th Congress

    Sen. Baucus, Max [D-MT

    2011-10-03

    09/20/2012 By Senator Baucus from Committee on Finance filed written report. Report No. 112-224. Additional views filed. (All Actions) Notes: For further action, see H.R.3079, which became Public Law 112-43 on 10/21/2011. Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  12. United States-Colombia Trade Promotion Agreement Implementation Act

    THOMAS, 112th Congress

    Sen. Baucus, Max [D-MT

    2011-10-03

    09/20/2012 By Senator Baucus from Committee on Finance filed written report. Report No. 112-222. Additional views filed. (All Actions) Notes: For further action, see H.R.3078, which became Public Law 112-42 on 10/21/2011. Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  13. Promoting Healthy Minds for Safer Communities Act of 2014

    THOMAS, 113th Congress

    Rep. Thompson, Mike [D-CA-5

    2014-05-30

    07/21/2014 Referred to the Subcommittee on Crime, Terrorism, Homeland Security, and Investigations. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  14. Promoting Innovations to 21st Century Careers Act

    THOMAS, 111th Congress

    Rep. Tierney, John F. [D-MA-6

    2009-07-29

    10/22/2009 Referred to the Subcommittee on Higher Education, Lifelong Learning, and Competitiveness. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  15. The Indian Child Welfare Act in the Face of Extinction.

    ERIC Educational Resources Information Center

    Philips, Sloan

    1997-01-01

    Discusses the history, purposes, and provisions of the Indian Child Welfare Act (ICWA); recent high-profile transracial adoption cases; the debate over whether ICWA purposes have been realized; the proposed Adoption Promotion and Stability Act, which would severely limit application of ICWA to adoption cases; and proposed compromise amendments to…

  16. Indian Child Welfare Act of 1978: Questions and Answers.

    ERIC Educational Resources Information Center

    Administration for Native Americans (DHEW/OHDS), Washington, DC.

    The question and answer booklet highlights the provisions of the Indian Child Welfare Act of 1978 which was designed to protect the best interests of Indian children and to promote the stability and security of Indian tribes and families. The booklet attempts to answer 28 important questions concerning title I of the Act. Examples of questions…

  17. ACT and College Success

    ERIC Educational Resources Information Center

    Bleyaert, Barbara

    2010-01-01

    What is the relationship between ACT scores and success in college? For decades, admissions policies in colleges and universities across the country have required applicants to submit scores from a college entrance exam, most typically the ACT (American College Testing) or SAT (Scholastic Aptitude Test). This requirement suggests that high school…

  18. Clean Air Act Text

    EPA Pesticide Factsheets

    The Clean Air Act is the law that defines EPA's responsibilities for protecting and improving the nation's air quality and the stratospheric ozone layer. The last major change in the law, the Clean Air Act Amendments of 1990, enacted in 1990 by Congress.

  19. Americans With Disabilities Act.

    PubMed

    Walk, E E; Ahn, H C; Lampkin, P M; Nabizadeh, S A; Edlich, R F

    1993-01-01

    The Americans with Disabilities Act gives all Americans with disabilities a chance to achieve the same quality of life that individuals without disabilities enjoy. This act prohibits discrimination on the basis of disabilities in employment, public services, privately operated public accommodations, services, and telecommunications. The Americans with Disabilities Act is divided into five titles. Title I of the act pertains to discrimination against the disabled in the workplace. Title II prevents discrimination against persons with a disability in state and local government services. Title III prohibits discrimination against persons with disabilities in places of public accommodations and commercial facilities. Title IV ensures that companies offering telephone services to the general public provide special services for individuals with hearing and speech impairments. Under the enforcement provisions of the Americans with Disabilities Act, stringent penalties will be implemented for failure to comply with its provisions.

  20. Learning activism, acting with phronesis

    NASA Astrophysics Data System (ADS)

    Lee, Yew-Jin

    2015-12-01

    The article "Socio-political development of private school children mobilising for disadvantaged others" by Darren Hoeg, Natalie Lemelin, and Lawrence Bencze described a language-learning curriculum that drew on elements of Socioscientific issues and Science, Technology, Society and Environment. Results showed that with a number of enabling factors acting in concert, learning about and engagement in practical action for social justice and equity are possible. An alternative but highly compatible framework is now introduced—phronetic social research—as an action-oriented, wisdom-seeking research stance for the social sciences. By so doing, it is hoped that forms of phronetic social research can gain wider currency among those that promote activism as one of many valued outcomes of an education in science.

  1. Promoting Retention

    PubMed Central

    Hall, LaToya N.; Ficker, Lisa J.; Chadiha, Letha A.; Green, Carmen R.; Jackson, James S.; Lichtenberg, Peter A.

    2016-01-01

    Objectives: The objectives of this study were to evaluate the capability of a research volunteer registry to retain community-dwelling African American older adults, and to explore demographic and health factors associated with retention. Method: A logistic regression model was used to determine the influence of demographics, health factors, and registry logic model activities on retention in a sample of 1,730 older African American adults. Results: Almost 80% of participants active in the volunteer research registry between January 2012 and June 2015 were retained. Employment, being referred to research studies, a higher number of medical conditions, and more follow-up contacts were associated with an increased likelihood of retention. Older age, more months in the registry, and more mobility problems decreased the likelihood of retention. Discussion: These results suggest the Michigan Center for Urban African American Aging Research logic model promotes retention through involving older African American adults in research through study referrals and intensive follow-up. The loss of participants due to age- and mobility-related issues indicate the registry may be losing its most vulnerable participants. PMID:28138501

  2. Acts of kindness and acts of novelty affect life satisfaction.

    PubMed

    Buchanan, Kathryn E; Bardi, Anat

    2010-01-01

    The present experiment was designed to establish the effects of acts of kindness and acts of novelty on life satisfaction. Participants aged 18-60 took part on a voluntary basis. They were randomly assigned to perform either acts of kindness, acts of novelty, or no acts on a daily basis for 10 days. Their life satisfaction was measured before and after the 10-day experiment. As expected, performing acts of kindness or acts of novelty resulted in an increase in life satisfaction.

  3. [Acceptance and Commitment Therapy (ACT): Behaviorism, mindfulness and values].

    PubMed

    Coletti, Juan P; Teti, Germán L

    2015-01-01

    Over the last decades a series of psychological treatments labeled 'Third Generation Therapies' have been developed. Acceptance and Commitment Therapy (ACT) is a third generation therapy that essentially seeks to promote the acceptance of private events in opposition to their modification or change, with the aim of promoting cognitive flexibility. Thus, it is intended that the subject be permitted to choose their behavior consistent with personal values. The current work aims to provide overview specific to the contextual conditions that promoted the emergence of ACT, the underlying philosophy and theory, and the particularities of the intervention model.

  4. [ACCEPTANCE AND COMMITMENT THERAPY (ACT): BEHAVIORISM, MINDFULNESS AND VALUES].

    PubMed

    Coletti, Juan Pablo; Teti, Germán Leandro

    2015-01-01

    Over the last decades a series of psychological treatments labeled have been developed. Acceptance and Commitment Therapy (ACT) is a third generation therapy that essentially seeks to promote the acceptance of private events in opposition to their modification or change, with the aim of promoting cognitive flexibility. Thus, it is intended that the subject be permitted to choose their behavior consistent with personal values. The current work aims to provide overview specific to the contextual conditions that promoted the emergence of ACT, the underlying philosophy and theory, and the particularities of the intervention model.

  5. Draconian dress act repealed.

    PubMed

    Mhone, C

    1994-01-01

    The Dress Act was put into place in Malawi by the government of President Kamuzu Banda after the long period of direct colonialism. The act made it illegal for women in Malawi to be seen publicly wearing dresses which did not completely cover their knees or wearing pants; men had to wear their hair short. Police officers even scrutinized women's attire at private house parties and in homes. The autocratic political structure established by Banda, however, was voted out in a referendum June 14, 1993. Pressure by opposition forces such as the United Democratic Front forced a repeal of the act on November 16 of the same year. The repeal was vigorously attacked by female Parliament members as a move which would result in moral degradation and an increase in the level of sexual harassment against women. Other citizens and tourists have generally detested the act. The act has most certainly kept many potential visitors from vacationing in Malawi. Some expert observers think that repeals of the Dress Act, the Forfeiture Act, and legislation which allowed the government to detain opposition figures without trial were done to garner support from the Paris Club for the resumption of balance of payments support suspended due to the country's poor human rights record.

  6. 75 FR 47701 - Electronic System for Travel Authorization (ESTA): Travel Promotion Fee and Fee for Use of the...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-08-09

    ... Authorization (ESTA): Travel Promotion Fee and Fee for Use of the System AGENCY: U.S. Customs and Border... promotion fee for an approved ESTA statutorily set by the Travel Promotion Act and a $4.00 operational fee... Contents I. Public Comments II. Background A. Travel Promotion Act of 2009 B. Operational Fee Amount C....

  7. 75 FR 18430 - Establishment of a U.S. Honey Producer Research, Promotion, and Consumer Information Order

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-04-12

    ..., Promotion, and Consumer Information Order AGENCY: Agricultural Marketing Service, USDA. ACTION: Proposed... research and promotion program under the Commodity Promotion, Research, and Information Act of 1996 (1996 Act). The proposed U.S. Honey Producer Research, Promotion and Consumer Information Order (Proposed...

  8. 75 FR 31730 - Popcorn Promotion, Research, and Consumer Information Order; Reapportionment

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-06-04

    ... Agricultural Marketing Service 7 CFR Part 1215 Popcorn Promotion, Research, and Consumer Information Order... the Popcorn Promotion, Research and Consumer Information Order (Order) which is authorized by the Popcorn Promotion, Research and Consumer Information Act (Act), the number of members on the Board may...

  9. 76 FR 28625 - Sorghum Promotion, Research, and Information Program; State Referendum Results

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-05-18

    ... Service 7 CFR 1221 Sorghum Promotion, Research, and Information Program; State Referendum Results AGENCY..., 2011, through February 28, 2011, have approved the continuation of the Sorghum Promotion, Research, and... Promotion, Research, and Information Act of 1996 (Act) (7 U.S.C. 7411-7425), the Department of...

  10. 77 FR 52597 - Beef Promotion and Research; Amendment to the Order

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-08-30

    ... Agricultural Marketing Service 7 CFR Part 1260 Beef Promotion and Research; Amendment to the Order AGENCY... authority of the Beef Promotion and Research Order (Order). The Beef Research and Information Act (Act) requires that the Beef Promotion Operating Committee (BPOC) enter into contracts with established...

  11. 78 FR 8441 - Mango Promotion, Research, and Information Order; Nominations of Foreign Producers and Election...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-02-06

    ... Agricultural Marketing Service 7 CFR Part 1206 Mango Promotion, Research, and Information Order; Nominations of... provisions of the Mango Promotion, Research, and Information Order (Order) which is authorized under the Commodity Promotion, Research, and Information Act of 1996 (Act). DATES: Comments must be received...

  12. 76 FR 26946 - Mango Promotion, Research, and Information Order; Assessment Increase

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-05-10

    ...; ] DEPARTMENT OF AGRICULTURE Agricultural Marketing Service 7 CFR Part 1206 Mango Promotion, Research, and.... SUMMARY: This rule proposes amendment of the Mango Promotion, Research, and Information Order (Order) to... the Commodity Promotion, Research, and Information Act of 1996 (Act). The National Mango Board...

  13. 75 FR 31279 - Blueberry Promotion, Research, and Information Order; Increase Membership

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-06-03

    ... Agricultural Marketing Service 7 CFR Part 1218 Blueberry Promotion, Research, and Information Order; Increase... Council in accordance with the provisions of the Blueberry Promotion, Research, and Information Order (Order) which is authorized by the Commodity Promotion, Research, and Information Act of 1996 (Act)....

  14. 75 FR 24373 - Cotton Research and Promotion Program: Designation of Cotton-Producing States

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-05-05

    ... Service 7 CFR Part 1205 RIN 0581-AC84 Cotton Research and Promotion Program: Designation of Cotton... Marketing Service (AMS) is amending the Cotton Research and Promotion Order (Cotton Order) following a... Bill) that amended the Cotton Research and Promotion Act (Cotton Act). The 2008 Farm Bill provided...

  15. 77 FR 12752 - Beef Promotion and Research; Amendment to the Order

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-03-02

    ... Agricultural Marketing Service 7 CFR Part 1260 Beef Promotion and Research; Amendment to the Order AGENCY... contracting authority as established under the Beef Promotion and Research (Order). The Beef Research and Information Act (Act) requires that the Beef Promotion Operating Committee (BPOC) enter into contracts...

  16. ACTS mobile SATCOM experiments

    NASA Technical Reports Server (NTRS)

    Abbe, Brian S.; Frye, Robert E.; Jedrey, Thomas C.

    1993-01-01

    Over the last decade, the demand for reliable mobile satellite communications (satcom) for voice, data, and video applications has increased dramatically. As consumer demand grows, the current spectrum allocation at L-band could become saturated. For this reason, NASA and the Jet Propulsion Laboratory are developing the Advanced Communications Technology Satellites (ACTS) mobile terminal (AMT) and are evaluating the feasibility of K/Ka-band (20/30 GHz) mobile satcom to meet these growing needs. U.S. industry and government, acting as co-partners, will evaluate K/Ka-band mobile satcom and develop new technologies by conducting a series of applications-oriented experiments. The ACTS and the AMT testbed will be used to conduct these mobile satcom experiments. The goals of the ACTS Mobile Experiments Program and the individual experiment configurations and objectives are further presented.

  17. Disabilities Act in Action.

    ERIC Educational Resources Information Center

    Daynes, Kristine S.

    1990-01-01

    Eight true or false questions explore implications of the Americans with Disabilities Act of 1990. Topics include AIDS, drug abuse, undue hardship, reasonable accommodation, and company size affected by the law. (SK)

  18. Freedom of Information Act-Employee responsibilities

    USGS Publications Warehouse

    Newman, David J.

    2012-01-01

    The Freedom of Information Act( FOIA), 5 U.S.C. § 552, as amended, generally provides that any person has a right to request access to Federal agency records. The USGS proactively promotes information disclosure as inherent to its mission of providing objective science to inform decisionmakers and the general public. USGS scientists disseminate up-to-date and historical scientific data that are critical to addressing national and global priorities.

  19. Human Rights Act, 12 February 1987.

    PubMed

    1987-01-01

    This document reprints major provisions of the Yukon's (Canada) 1987 Human Rights Act. The Act furthers the public policy that every individual is free and equal in dignity and rights, seeks to discourage and eliminate discrimination, and promotes the underlying principles of Canadian and international human rights instruments. Part 1 contains a Bill of Rights that protects the right to freedom of: 1) religion and conscience, 2) expression, 3) assembly and association, and 4) to enjoyment and disposition of property. Part 2 prohibits discrimination based on ancestry (including color and race), national origin, ethnic or linguistic background or origin, age, sex (including pregnancy), and marital or family status. Discrimination is also prohibited when offering services, goods, or facilities to the public; in connection with employment; in connection with membership in trade unions or trade, occupational, or professional associations; and in negotiation or performance of public contracts. The Bill of Rights lists reasonable causes for discrimination as well as exemptions, including preferential treatment for organization or family members or employment in a private home. Special programs and affirmative action programs are specifically not considered discrimination under this Act. The Act sets forth rules for providing equal pay for work of equal value and creates a Yukon Human Rights Commission to promote human rights and assist adjudication of complaints.

  20. 78 FR 78325 - National Research, Promotion, and Consumer Information Programs; Request for Extension and...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-12-26

    ..., peanuts, popcorn, pork, potatoes, processed raspberries, softwood lumber, sorghum, soybeans, and... Information Act of 1985 ; the Potato Research and Promotion Act [7 U.S.C. 2611-26271; the Soybean...

  1. The ACTS multibeam antenna

    NASA Technical Reports Server (NTRS)

    Regier, Frank A.

    1992-01-01

    The Advanced Communications Technology Satellite (ACTS) to be launched in 1993 is briefly introduced. Its multibeam antenna, consisting of electrically similar 30 GHz receive and 20 GHz transmit offset Cassegrain systems, both utilizing orthogonal polarizations, is described. Dual polarization is achieved by using one feed assembly for each polarization in conjunction with nested front and back subreflectors, the gridded front subreflector acting as a window for one polarization and a reflector for the other. The antennas produce spot beams with approximately 0.3 degree beamwidth and gains of approximately 50 dbi. High surface accuracy and high edge taper produce low sidelobe levels and high cross-polarization isolation. A brief description is given of several Ka-band components fabricated for ACTS. These include multiflare antenna feedhorns, beam-forming networks utilizing latching ferrite waveguide switches, a 30 GHz HEMT low-noise amplifier and a 20 GHz TWT power amplifier.

  2. The ACTS multibeam antenna

    NASA Astrophysics Data System (ADS)

    Regier, Frank A.

    1992-06-01

    The Advanced Communications Technology Satellite (ACTS) to be launched in 1993 is briefly introduced. Its multibeam antenna, consisting of electrically similar 30 GHz receive and 20 GHz transmit offset Cassegrain systems, both utilizing orthogonal polarizations, is described. Dual polarization is achieved by using one feed assembly for each polarization in conjunction with nested front and back subreflectors, the gridded front subreflector acting as a window for one polarization and a reflector for the other. The antennas produce spot beams with approximately 0.3 degree beamwidth and gains of approximately 50 dbi. High surface accuracy and high edge taper produce low sidelobe levels and high cross-polarization isolation. A brief description is given of several Ka-band components fabricated for ACTS. These include multiflare antenna feedhorns, beam-forming networks utilizing latching ferrite waveguide switches, a 30 GHz HEMT low-noise amplifier and a 20 GHz TWT power amplifier.

  3. Affordable Care Act.

    PubMed

    Rak, Sofija; Coffin, Janis

    2013-01-01

    The Patient Protection and Affordable Care Act of 2010 (PPACA), although a subject of much debate in the Unites States, was enacted on March 23, 2010, and upheld by the Supreme Court on June 28, 2012. This act advocates that "healthcare is a right, not a privilege." The main goals of PPACA are to minimize the number of uninsured Americans and make healthcare available to everyone at an affordable price. The Congressional Budget Office has determined that 94% of Americans will have healthcare coverage while staying under the $900 billion limit that President Barack Obama established by bending the healthcare cost curve and reducing the deficit over the next 10 years.

  4. The Export Trading Company Act of 1982 and the photovoltaics industry: An assessment

    NASA Technical Reports Server (NTRS)

    Enfield, S.; Laporta, C.

    1983-01-01

    The potential advantages of recent export promotion legislation for the U.S. photovoltaics industry were assessed. The provisions of the Export Trading Company Act of 1982 were reviewed and the export trade sector was surveyed to determine what impact the Act is haviang on export company activity. The photovoltaics industry was then studied to determine whether the Act offers particular advantages for promoting its product overseas.

  5. The Pregnancy Discrimination Act of 1978 and Its Impact on Educational Institutions.

    ERIC Educational Resources Information Center

    Association of American Colleges, Washington, DC. Project on the Status and Education of Women.

    The Pregnancy Discrimination Act of 1978--which amends Title VII of the Civil Rights Act of 1964--and its impact on educational institutions are discussed. The Act prohibits discrimination against women employees because of pregnancy, childbirth, or related medical conditions. It covers hiring, promotion, firing, and seniority rights as well as…

  6. The Kentucky Civil Rights Act: Explanation, the Act, Regulations.

    ERIC Educational Resources Information Center

    Kentucky State Commission on Human Rights, Frankfort.

    The Kentucky Civil Rights Act, introduced on January 4, 1966, enacted January 27, 1966 and effective July 1, 1966 is said to meet the requirements of the Federal Civil Rights Act of 1964. In 1968, the Act was amended to prohibit housing discrimination. In 1972, the coverage of the Act was extended to prohibit employment discrimination because of…

  7. The USA PATRIOT Act.

    ERIC Educational Resources Information Center

    Minow, Mary; Coyle, Karen; Kaufman, Paula

    2002-01-01

    Explains the USA PATRIOT (Uniting and Strengthening America by Providing Appropriate Tools Required to Intercept and Obstruct Terrorism) Act, passed after the September 11 terrorist attacks, and its implications for libraries and patron records. Considers past dealings with the FBI; court orders; search warrants; wiretaps; and subpoenas. Includes:…

  8. The Equal Access Act.

    ERIC Educational Resources Information Center

    Catron, J. Gregory

    1987-01-01

    Reviews past history of access of religious activities in public schools in relation to the establishment clause of the First Amendment and sets forth the prerequisites in the Equal Access Act of 1984 for creating a well-defined forum for student-initiated free speech including religious groups in public high schools. (MD)

  9. Special Appropriation Act Projects

    EPA Pesticide Factsheets

    EPA is sometimes directed to provide funding to a specific entity for study, purpose, or activity.This information will be of interest to a community or other entity that has been identified in one of EPA's appropriations acts to receive such funding.

  10. Job Training Partnership Act.

    ERIC Educational Resources Information Center

    Tindall, Lloyd W.; Hedberg, Sally B.

    1987-01-01

    The Job Training Partnership Act, which provides money to programs preparing disadvantaged (including disabled) individuals for entry into the labor force, has helped special education students in such programs as the Special Education Local Plan Areas Job Project and the Day Training Activity Center at the Las Trampas School, Inc. in Lafayette,…

  11. Acting like a Pro

    ERIC Educational Resources Information Center

    Walker, Marlon A.

    2012-01-01

    The Saturday morning acting class in the Pearson Hall auditorium at Miles College boasts the school's highest attendance all year. The teacher, actress Robin Givens, was a lure few students--and others from surrounding areas--could resist. Some came to learn about their prospective field from a professional. Others were there for pointers to…

  12. ACTS Mobile Terminals

    NASA Technical Reports Server (NTRS)

    Abbe, Brian S.; Agan, Martin J.; Jedrey, Thomas C.

    1997-01-01

    The development of the Advanced Communications Technology Satellite (ACTS) Mobile Terminal (AMT) and its follow-on, the Broadband Aeronautical Terminal (BAT), have provided an excellent testbed for the evaluation of K- and Ka-band mobile satellite communications systems. An overview of both of these terminals is presented in this paper.

  13. Improving America's Schools Act

    NASA Technical Reports Server (NTRS)

    Cradler, John; Bridgforth, Elizabeth

    1995-01-01

    The Improving America's Schools ACT (IASA) emphasizes coherent systemic education reform, with Goals 2000 setting common standards for IASA and the recently authorized School-to-Work Program. IASA addresses the need to raise academic achievement, increase opportunities to learn, improve professional development, increase community involvement, utilize instructional applications of technology, and improve assessment, and allow more local flexibility in the use of funds.

  14. Plant growth-promoting bacterial endophytes.

    PubMed

    Santoyo, Gustavo; Moreno-Hagelsieb, Gabriel; Orozco-Mosqueda, Ma del Carmen; Glick, Bernard R

    2016-02-01

    Bacterial endophytes ubiquitously colonize the internal tissues of plants, being found in nearly every plant worldwide. Some endophytes are able to promote the growth of plants. For those strains the mechanisms of plant growth-promotion known to be employed by bacterial endophytes are similar to the mechanisms used by rhizospheric bacteria, e.g., the acquisition of resources needed for plant growth and modulation of plant growth and development. Similar to rhizospheric plant growth-promoting bacteria, endophytic plant growth-promoting bacteria can act to facilitate plant growth in agriculture, horticulture and silviculture as well as in strategies for environmental cleanup (i.e., phytoremediation). Genome comparisons between bacterial endophytes and the genomes of rhizospheric plant growth-promoting bacteria are starting to unveil potential genetic factors involved in an endophytic lifestyle, which should facilitate a better understanding of the functioning of bacterial endophytes.

  15. The Gun Violence Prevention Act of 1994: Public Health and Child Safety. Hearing on S. 1882, A Bill To Amend Title 18, United States Code, To Promote the Safe Use of Guns and To Reduce Gun Violence before the Subcommittee on the Constitution of the Committee on the Judiciary. United States Senate, One Hundred Third Congress, Second Session (March 23, 1994).

    ERIC Educational Resources Information Center

    Congress of the U. S., Washington, DC. Senate Subcommittee on the Constitution.

    The first of several hearings on the Gun Violence Prevention Act of 1994 introduced and discussed the Act as comprehensive legislation to address gun violence through six discrete initiatives: (1) handgun licensing; (2) prohibition of firearms possession by persons convicted of violent misdemeanors; (3) regulation of gun dealers; (4) limitation of…

  16. Plant-growth-promoting rhizobacteria.

    PubMed

    Lugtenberg, Ben; Kamilova, Faina

    2009-01-01

    Several microbes promote plant growth, and many microbial products that stimulate plant growth have been marketed. In this review we restrict ourselves to bacteria that are derived from and exert this effect on the root. Such bacteria are generally designated as PGPR (plant-growth-promoting rhizobacteria). The beneficial effects of these rhizobacteria on plant growth can be direct or indirect. This review begins with describing the conditions under which bacteria live in the rhizosphere. To exert their beneficial effects, bacteria usually must colonize the root surface efficiently. Therefore, bacterial traits required for root colonization are subsequently described. Finally, several mechanisms by which microbes can act beneficially on plant growth are described. Examples of direct plant growth promotion that are discussed include (a) biofertilization, (b) stimulation of root growth, (c) rhizoremediation, and (d) plant stress control. Mechanisms of biological control by which rhizobacteria can promote plant growth indirectly, i.e., by reducing the level of disease, include antibiosis, induction of systemic resistance, and competition for nutrients and niches.

  17. An engineered strong promoter for streptomycetes.

    PubMed

    Wang, Weishan; Li, Xiao; Wang, Juan; Xiang, Sihai; Feng, Xiaozhou; Yang, Keqian

    2013-07-01

    Well-characterized promoters are essential tools for metabolic engineering and synthetic biology. In Streptomyces coelicolor, the native kasOp is a temporally expressed promoter strictly controlled by two regulators, ScbR and ScbR2. In this work, first, kasOp was engineered to remove a common binding site of ScbR and ScbR2 upstream of its core region, thus generating a stronger promoter, kasOp3. Second, another ScbR binding site internal to the kasOp3 core promoter region was abolished by random mutation and screening of the mutant library to obtain the strongest promoter, kasOp* (where the asterisk is used to distinguish the engineered promoter from the native promoter). The activities of kasOp* were compared with those of two known strong promoters, ermEp* and SF14p, in three Streptomyces species. kasOp* showed the highest activity at the transcription and protein levels in all three hosts. Furthermore, relative to ermEp* and SF14p, kasOp* was shown to confer the highest actinorhodin production level when used to drive the expression of actII-ORF4 in S. coelicolor. Therefore, kasOp* is a simple and well-defined strong promoter useful for gene overexpression in streptomycetes.

  18. An Engineered Strong Promoter for Streptomycetes

    PubMed Central

    Wang, Weishan; Li, Xiao; Wang, Juan; Xiang, Sihai; Feng, Xiaozhou

    2013-01-01

    Well-characterized promoters are essential tools for metabolic engineering and synthetic biology. In Streptomyces coelicolor, the native kasOp is a temporally expressed promoter strictly controlled by two regulators, ScbR and ScbR2. In this work, first, kasOp was engineered to remove a common binding site of ScbR and ScbR2 upstream of its core region, thus generating a stronger promoter, kasOp3. Second, another ScbR binding site internal to the kasOp3 core promoter region was abolished by random mutation and screening of the mutant library to obtain the strongest promoter, kasOp* (where the asterisk is used to distinguish the engineered promoter from the native promoter). The activities of kasOp* were compared with those of two known strong promoters, ermEp* and SF14p, in three Streptomyces species. kasOp* showed the highest activity at the transcription and protein levels in all three hosts. Furthermore, relative to ermEp* and SF14p, kasOp* was shown to confer the highest actinorhodin production level when used to drive the expression of actII-ORF4 in S. coelicolor. Therefore, kasOp* is a simple and well-defined strong promoter useful for gene overexpression in streptomycetes. PMID:23686264

  19. ACTS of Education

    NASA Technical Reports Server (NTRS)

    Bauer, Robert; Krawczyk, Richard; Gargione, Frank; Kruse, Hans; Vrotsos, Pete (Technical Monitor)

    2002-01-01

    Now in its ninth year of operations, the Advanced Communications Technology Satellite (ACTS) program has continued, although since May 2000 in a new operations arrangement involving a university based consortium, the Ohio Consortium for Advanced Communications Technology (OCACT), While NASA has concluded its experimental intentions of ACTS, the spacecraft's ongoing viability has permitted its further operations to provide educational opportunities to engineering and communications students interested in satellite operations, as well as a Ka-band test bed for commercial interests in utilizing Kaband space communications. The consortium has reached its first year of operations. This generous opportunity by NASA has already resulted in unique educational opportunities for students in obtaining "hands-on" experience, such as, in satellite attitude control. An update is presented on the spacecraft and consortium operations.

  20. Toxic Substances Control Act

    SciTech Connect

    Not Available

    1992-05-15

    This Reference Book contains a current copy of the Toxic Substances Control Act and those regulations that implement the statute and appear to be most relevant to DOE activities. The document is provided to DOE and contractor staff for informational purposes only and should not be interpreted as legal guidance. Questions concerning this Reference Book may be directed to Mark Petts, EH-231 (202/586-2609).

  1. ACTE Wing Loads Analysis

    NASA Technical Reports Server (NTRS)

    Horn, Nicholas R.

    2015-01-01

    The Adaptive Compliant Trailing Edge (ACTE) project modified a Gulfstream III (GIII) aircraft with a new flexible flap that creates a seamless transition between the flap and the wing. As with any new modification, it is crucial to ensure that the aircraft will not become overstressed in flight. To test this, Star CCM a computational fluid dynamics (CFD) software program was used to calculate aerodynamic data for the aircraft at given flight conditions.

  2. The ACTS multibeam antenna

    NASA Technical Reports Server (NTRS)

    Regier, Frank A.

    1992-01-01

    The Advanced Communications Technology Satellite (ACTS) to be launched in 1993 introduces several new technologies including a multibeam antenna (MBA) operating at Ka-band. The satellite is introduced briefly, and then the MBA, consisting of electrically similar 30 GHz received and 20 GHz transmit offset Cassegrain systems utilizing orthogonal linear polarizations, is described. Dual polarization is achieved by using one feed assembly for each polarization in conjunction with nested front and back subreflectors, the gridded front subreflector acting as a window for one polarization and a reflector for the other. The antennas produce spot beams with approximately 0.3 deg beamwidth and gains of approximately 50 dbi. High surface accuracy and high edge taper produce low sidelobe levels and high cross-polarization isolation. A brief description is given of several Ka-band components fabricated for ACTS. These include multiflare antenna feedhorns, beam-forming networks utilizing latching ferrite waveguide switches, a 30 GHz high mobility electron transmitter (HEMT) low-noise amplifier and a 20 GHz TWT power amplifier.

  3. The ACTS multibeam antenna

    NASA Astrophysics Data System (ADS)

    Regier, Frank A.

    1992-04-01

    The Advanced Communications Technology Satellite (ACTS) to be launched in 1993 introduces several new technologies including a multibeam antenna (MBA) operating at Ka-band. The satellite is introduced briefly, and then the MBA, consisting of electrically similar 30 GHz received and 20 GHz transmit offset Cassegrain systems utilizing orthogonal linear polarizations, is described. Dual polarization is achieved by using one feed assembly for each polarization in conjunction with nested front and back subreflectors, the gridded front subreflector acting as a window for one polarization and a reflector for the other. The antennas produce spot beams with approximately 0.3 deg beamwidth and gains of approximately 50 dbi. High surface accuracy and high edge taper produce low sidelobe levels and high cross-polarization isolation. A brief description is given of several Ka-band components fabricated for ACTS. These include multiflare antenna feedhorns, beam-forming networks utilizing latching ferrite waveguide switches, a 30 GHz high mobility electron transmitter (HEMT) low-noise amplifier and a 20 GHz TWT power amplifier.

  4. 75 FR 68728 - Establishment of a U.S. Honey Producer Research, Promotion, and Consumer Information Order...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-11-09

    ... Establishment of a U.S. Honey Producer Research, Promotion, and Consumer Information Order; Withdrawal of a... 12, 2010, that proposed a new U.S. honey producer funded research and promotion program under the Commodity Promotion, Research, and Information Act of 1996 (1996 Act). The proposed U.S. Honey...

  5. 76 FR 31573 - Cotton Research and Promotion Program: Request for Comments To Be Used in a Review of 1990...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-06-01

    ... Agricultural Marketing Service Cotton Research and Promotion Program: Request for Comments To Be Used in a Review of 1990 Amendments to the Cotton Research and Promotion Act AGENCY: Agricultural Marketing Service, USDA. ACTION: Notice. SUMMARY: As provided for by the Cotton Research and Promotion Act Amendments...

  6. 78 FR 28121 - Lamb Promotion, Research, and Information Order; Amendment to the Order To Raise the Assessment Rate

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-05-14

    ... Agricultural Marketing Service 7 CFR Part 1280 Lamb Promotion, Research, and Information Order; Amendment to... rule. SUMMARY: This final rule amends the Lamb Promotion, Research, and Information Order (Order) to... authorized by the Commodity Promotion, Research, and Information Act of 1996 (Act) (7 U.S.C. 7411-7425)....

  7. Consumer protection act for digital products

    NASA Astrophysics Data System (ADS)

    Hampel, Viktor E.

    1996-03-01

    This report proposes a `Consumer Protection Act for Digital Products' to support electronic commerce and to control the increasing abuse and lack of security on the national information highways. Patterned after the `Food and Drug Act of 1906 (21 USC)' and subsequent legislation, a new agency similar to that of the FDA would have the authority `to develop administrative policy with regard to the safety, effectiveness, and labeling of digital products and their communications for human use, and to review and evaluate new applications of such products.' Specifically, it is proposed that standards, originally developed by the defense industry for the labeling, enveloping, and authentication of digital products delivered to the Government, be extended to promote global electronic commerce by protecting the intellectual property rights of producers, establishing their liability for the end-use of digital products, and give consumers means for informed decision making and purchase.

  8. 28 CFR 115.117 - Hiring and promotion decisions.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 28 Judicial Administration 2 2014-07-01 2014-07-01 false Hiring and promotion decisions. 115.117 Section 115.117 Judicial Administration DEPARTMENT OF JUSTICE (CONTINUED) PRISON RAPE ELIMINATION ACT NATIONAL STANDARDS Standards for Lockups Prevention Planning § 115.117 Hiring and promotion decisions....

  9. 28 CFR 115.117 - Hiring and promotion decisions.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 28 Judicial Administration 2 2012-07-01 2012-07-01 false Hiring and promotion decisions. 115.117 Section 115.117 Judicial Administration DEPARTMENT OF JUSTICE (CONTINUED) PRISON RAPE ELIMINATION ACT NATIONAL STANDARDS Standards for Lockups Prevention Planning § 115.117 Hiring and promotion decisions....

  10. 28 CFR 115.117 - Hiring and promotion decisions.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 28 Judicial Administration 2 2013-07-01 2013-07-01 false Hiring and promotion decisions. 115.117 Section 115.117 Judicial Administration DEPARTMENT OF JUSTICE (CONTINUED) PRISON RAPE ELIMINATION ACT NATIONAL STANDARDS Standards for Lockups Prevention Planning § 115.117 Hiring and promotion decisions....

  11. ACTS broadband aeronautical experiment

    NASA Technical Reports Server (NTRS)

    Abbe, Brian S.; Jedrey, Thomas C.; Estabrook, Polly; Agan, Martin J.

    1993-01-01

    In the last decade, the demand for reliable data, voice, and video satellite communication links between aircraft and ground to improve air traffic control, airline management, and to meet the growing demand for passenger communications has increased significantly. It is expected that in the near future, the spectrum required for aeronautical communication services will grow significantly beyond that currently available at L-band. In anticipation of this, JPL is developing an experimental broadband aeronautical satellite communications system that will utilize NASA's Advanced Communications Technology Satellite (ACTS) as a satellite of opportunity and the technology developed under JPL's ACTS Mobile Terminal (AMT) Task to evaluate the feasibility of using K/Ka-band for these applications. The application of K/Ka-band for aeronautical satellite communications at cruise altitudes is particularly promising for several reasons: (1) the minimal amount of signal attenuation due to rain; (2) the reduced drag due to the smaller K/Ka-band antennas (as compared to the current L-band systems); and (3) the large amount of available bandwidth. The increased bandwidth available at these frequencies is expected to lead to significantly improved passenger communications - including full-duplex compressed video and multiple channel voice. A description of the proposed broadband experimental system will be presented including: (1) applications of K/Ka-band aeronautical satellite technology to U.S. industry; (2) the experiment objectives; (3) the experiment set-up; (4) experimental equipment description; and (5) industrial participation in the experiment and the benefits.

  12. Vaccination: An Act of Love

    MedlinePlus

    ... dreams. Remember too: Vaccination is an Act of Love. Dr. Mirta Roses Periago Director, Pan American Health ... MICROSCOPE ? KNOW WHY VACCINATION IS AN ACT OF LOVE? IT PROTECTS AGAINST MANY TYPES OF DISEASE! AND ...

  13. The Nurse Reinvestment Act revisited.

    PubMed

    Luther, Ann P

    2007-01-01

    The United States is in the midst of a widely recognized critical nursing shortage. In 2002 the "Nurse Reinvestment Act" was passed with overwhelming bipartisan support in an effort to address this serious public health threat. The Act is due for reauthorization of funding in 2007. This paper provides a brief overview of the programs contained within the Act and describes practical ways in which members of the nursing community can take action to insure renewed support for the Act.

  14. FCC and the Sunshine Act.

    ERIC Educational Resources Information Center

    Weiss, Kenneth

    The Sunshine Act, designed to encourage open meetings to increase public understanding of the governmental decision-making process, went into effect in March 1977. A total of 50 agencies, including the Federal Communications Commission (FCC), are subject to the provisions of the Sunshine Act. The act lists 10 exemptions, any of which can result in…

  15. 76 FR 32212 - Agency Forms Undergoing Paperwork Reduction Act Review

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-06-03

    ... HUMAN SERVICES Centers for Disease Control and Prevention Agency Forms Undergoing Paperwork Reduction Act Review The Centers for Disease Control and Prevention (CDC) publishes a list of information... Prevention and Health Promotion (NCDDPHP), Centers for Disease Control and Prevention (CDC). Background...

  16. 75 FR 18503 - Agency Forms Undergoing Paperwork Reduction Act Review

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-04-12

    ... HUMAN SERVICES Centers for Disease Control and Prevention Agency Forms Undergoing Paperwork Reduction Act Review The Centers for Disease Control and Prevention (CDC) publishes a list of information... Community Health, National Center for Chronic Disease Prevention and Health Promotion (NCCDPHP), Centers...

  17. 78 FR 17409 - Agency Forms Undergoing Paperwork Reduction Act Review

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-03-21

    ... HUMAN SERVICES Centers for Disease Control and Prevention Agency Forms Undergoing Paperwork Reduction Act Review The Centers for Disease Control and Prevention (CDC) publishes a list of information... Center for Chronic Disease Prevention and Health Promotion (NCCDPHP), Centers for Disease Control...

  18. 76 FR 5378 - Agency Forms Undergoing Paperwork Reduction Act Review

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-01-31

    ... HUMAN SERVICES Centers for Disease Control and Prevention Agency Forms Undergoing Paperwork Reduction Act Review The Centers for Disease Control and Prevention (CDC) publishes a list of information... Native Communities--New--National Center for Chronic Disease Prevention and Health Promotion...

  19. FAST ACTING CURRENT SWITCH

    DOEpatents

    Batzer, T.H.; Cummings, D.B.; Ryan, J.F.

    1962-05-22

    A high-current, fast-acting switch is designed for utilization as a crowbar switch in a high-current circuit such as used to generate the magnetic confinement field of a plasma-confining and heat device, e.g., Pyrotron. The device particularly comprises a cylindrical housing containing two stationary, cylindrical contacts between which a movable contact is bridged to close the switch. The movable contact is actuated by a differential-pressure, airdriven piston assembly also within the housing. To absorb the acceleration (and the shock imparted to the device by the rapidly driven, movable contact), an adjustable air buffer assembly is provided, integrally connected to the movable contact and piston assembly. Various safety locks and circuit-synchronizing means are also provided to permit proper cooperation of the invention and the high-current circuit in which it is installed. (AEC)

  20. ACTS mobile propagation campaign

    NASA Technical Reports Server (NTRS)

    Goldhirsh, Julius; Vogel, Wolfhard J.; Torrence, Geoffrey W.

    1994-01-01

    Preliminary results are presented for three propagation measurement campaigns involving a mobile receiving laboratory and 20 GHz transmissions from the Advanced Communications Technology Satellite (ACTS). Four 1994 campaigns were executed during weekly periods in and around Austin, Texas in February and May, in Central Maryland during March, and in Fairbanks, Alaska and environs in June. Measurements tested the following effects at 20 GHz: (1) attenuation due to roadside trees with and without foliage, (2) multipath effects for scenarios in which line-of-sight paths were unshadowed, (3) fades due to terrain and roadside obstacles, (4) fades due to structures in urban environs, (5) single tree attenuation, and (6) effects of fading at low elevation angles (8 deg in Fairbanks, Alaska) and high elevation angles (55 deg in Austin, Texas). Results presented here cover sampled measurements in Austin, Texas for foliage and non-foliage cases and in Central Maryland for non-foliage runs.

  1. Federal Employees' Compensation Act.

    PubMed

    Ladou, Joseph

    2009-01-01

    The Federal Employees' Compensation Act (FECA) program provides wage loss compensation and payments for medical treatment to federal civilian employees. Administered by the Department of Labor (DOL), FECA covers over 2.7 million federal employees in more than 70 different agencies. FECA costs rose from $1.4 billion in 1990 to $2.6 in 2006, while the federal workforce remained essentially unchanged. While federal civilian employees represent only 2.1% of all workers eligible for workers' compensation benefits, federal programs account for 6% of the benefits paid. Disability benefits under FECA are far greater than those in the state workers' compensation programs. The benefit payments often exceed the former salary of the injured employee. The last congressional hearings on the FECA program were held over thirty years ago. It is unlikely that Congressional review will occur any time soon, as the entrenched bureaucracy that benefits from the FECA program defines and protects its future.

  2. Triple acting radial seal

    SciTech Connect

    Ebert, Todd A; Carella, John A

    2012-03-13

    A triple acting radial seal used as an interstage seal assembly in a gas turbine engine, where the seal assembly includes an interstage seal support extending from a stationary inner shroud of a vane ring, the interstage seal support includes a larger annular radial inward facing groove in which an outer annular floating seal assembly is secured for radial displacement, and the outer annular floating seal assembly includes a smaller annular radial inward facing groove in which an inner annular floating seal assembly is secured also for radial displacement. A compliant seal is secured to the inner annular floating seal assembly. The outer annular floating seal assembly encapsulates the inner annular floating seal assembly which is made from a very low alpha material in order to reduce thermal stress.

  3. Developing a Promotional Video

    ERIC Educational Resources Information Center

    Epley, Hannah K.

    2014-01-01

    There is a need for Extension professionals to show clientele the benefits of their program. This article shares how promotional videos are one way of reaching audiences online. An example is given on how a promotional video has been used and developed using iMovie software. Tips are offered for how professionals can create a promotional video and…

  4. 22-Oxocholestanes as plant growth promoters.

    PubMed

    Zeferino-Diaz, Reyna; Hilario-Martinez, J Ciciolil; Rodriguez-Acosta, Maricela; Sandoval-Ramirez, Jesus; Fernandez-Herrera, Maria A

    2015-06-01

    The spirostanic steroidal side-chain of diosgenin and hecogenin was modified to produce 22-oxocholestane derivatives. This type of side-chain was obtained in good yields through a straightforward four-step pathway. These compounds show potent brassinosteroid-like growth promoting activity evaluated via the rice lamina joint inclination bioassay. This is the first report of steroidal skeletons bearing the 22-oxocholestane side-chain and preserving the basic structure (A-D rings) from their corresponding parent compounds acting as plant growth promoters.

  5. Database construction for PromoterCAD: synthetic promoter design for mammals and plants.

    PubMed

    Nishikata, Koro; Cox, Robert Sidney; Shimoyama, Sayoko; Yoshida, Yuko; Matsui, Minami; Makita, Yuko; Toyoda, Tetsuro

    2014-03-21

    Synthetic promoters can control a gene's timing, location, and expression level. The PromoterCAD web server ( http://promotercad.org ) allows the design of synthetic promoters to control plant gene expression, by novel arrangement of cis-regulatory elements. Recently, we have expanded PromoterCAD's scope with additional plant and animal data: (1) PLACE (Plant Cis-acting Regulatory DNA Elements), including various sized sequence motifs; (2) PEDB (Mammalian Promoter/Enhancer Database), including gene expression data for mammalian tissues. The plant PromoterCAD data now contains 22 000 Arabidopsis thaliana genes, 2 200 000 microarray measurements in 20 growth conditions and 79 tissue organs and developmental stages, while the new mammalian PromoterCAD data contains 679 Mus musculus genes and 65 000 microarray measurements in 96 tissue organs and cell types ( http://promotercad.org/mammal/ ). This work presents step-by-step instructions for adding both regulatory motif and gene expression data to PromoterCAD, to illustrate how users can expand PromoterCAD functionality for their own applications and organisms.

  6. 77 FR 28387 - Federal Advisory Committee Act; Communications Security, Reliability, and Interoperability Council

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-05-14

    ... COMMISSION Federal Advisory Committee Act; Communications Security, Reliability, and Interoperability Council... Communications Commission's (FCC) Communications Security, Reliability, and Interoperability Council (CSRIC) will... emergency alerting systems such as promoting E9-1-1 reliability and alerting platforms--Emergency...

  7. Republic Act No. 6725, 12 May 1989.

    PubMed

    1989-01-01

    This Philippines Act is designed to strengthen the prohibition on discrimination against women with respect to the terms and conditions of employment. It amends Article 135 of the Labor Code to read as follows: "Art. 135. Discrimination prohibited. It shall be unlawful for any employer to discriminate against any woman employee with respect to terms and conditions of employment solely on the grounds of sex. The following are acts of discrimination: (a) Payment of a lesser compensation, including wage, salary or other form of remuneration and fringe benefits, to a female employee as against a male employee, for work of equal value; and (b) Favoring a male employee over a female employee with respect to promotion, training opportunities, study and scholarship grants solely on account of their sexes. Criminal liability for the willful commission of any unlawful act as provided in this article or any violation of the rules and regulations issued pursuant to Section 2 hereof shall be penalized as provided in Articles 288 and 289 of this Code: provided, that the institution of any criminal action under this provision shall not bar the aggrieved employee from filing an entirely separate and distinct action for money claims, which may include claims for damages and other affirmative reliefs. The actions hereby authorized shall proceed independently of each other. SEC. 2. The Secretary of Labor and Employment is hereby authorized to promulgate the necessary guidelines to implement this Article in accordance with the generally accepted practices and standards here and abroad."

  8. Fast-Acting Valve

    NASA Technical Reports Server (NTRS)

    Wojciechowski, Bogdan V. (Inventor); Pegg, Robert J. (Inventor)

    2003-01-01

    A fast-acting valve includes an annular valve seat that defines an annular valve orifice between the edges of the annular valve seat, an annular valve plug sized to cover the valve orifice when the valve is closed, and a valve-plug holder for moving the annular valve plug on and off the annular valve seat. The use of an annular orifice reduces the characteristic distance between the edges of the valve seat. Rather than this distance being equal to the diameter of the orifice, as it is for a conventional circular orifice, the characteristic distance equals the distance between the inner and outer radii (for a circular annulus). The reduced characteristic distance greatly reduces the gap required between the annular valve plug and the annular valve seat for the valve to be fully open, thereby greatly reducing the required stroke and corresponding speed and acceleration of the annular valve plug. The use of a valve-plug holder that is under independent control to move the annular valve plug between its open and closed positions is important for achieving controllable fast operation of the valve.

  9. Double acting bit holder

    DOEpatents

    Morrell, Roger J.; Larson, David A.; Ruzzi, Peter L.

    1994-01-01

    A double acting bit holder that permits bits held in it to be resharpened during cutting action to increase energy efficiency by reducing the amount of small chips produced. The holder consist of: a stationary base portion capable of being fixed to a cutter head of an excavation machine and having an integral extension therefrom with a bore hole therethrough to accommodate a pin shaft; a movable portion coextensive with the base having a pin shaft integrally extending therefrom that is insertable in the bore hole of the base member to permit the moveable portion to rotate about the axis of the pin shaft; a recess in the movable portion of the holder to accommodate a shank of a bit; and a biased spring disposed in adjoining openings in the base and moveable portions of the holder to permit the moveable portion to pivot around the pin shaft during cutting action of a bit fixed in a turret to allow front, mid and back positions of the bit during cutting to lessen creation of small chip amounts and resharpen the bit during excavation use.

  10. Long-acting progestogens.

    PubMed

    Affandi, Biran

    2002-04-01

    Steroids can be administered in at least five different ways: injectables; hormone-releasing intra-uterine devices (IUDs); implants; vaginal rings; and pills. Progestogens which are synthetic steroids, are used as the main bioactive substances. Different progestogens are effective for different periods of time. Progestins in daily oral pills are effective for 24 hours. The effectiveness of a progestogen can be prolonged by incorporating it in a sustained-release system that gradually releases the hormone; therefore they can be effective up to 5 years or more. Two progestogen-only injectables are widely available in the family planning programmes, (DMPA and NET-EN) and two combined injectables, Cyclofem (DMPA + EC), and Mesigyna (NET-EN + EV). The ring is placed by the woman in her vagina, where it gradually releases hormone. Implantable contraceptives are placed just under the skin on the inside of the woman's arm. Implant capsules release the progestogen at a slow, steady rate. There are three implantables available in the market: Implanon; Norplant; and Jadelle. They are effective for 1-5 years, but then must be replaced. Natural and synthetic progestogens were first added to IUDs in the early 1970s. The main problem of long-acting progestogens is the disruption of the menstrual cycle.

  11. Acting to gain information

    NASA Technical Reports Server (NTRS)

    Rosenchein, Stanley J.; Burns, J. Brian; Chapman, David; Kaelbling, Leslie P.; Kahn, Philip; Nishihara, H. Keith; Turk, Matthew

    1993-01-01

    This report is concerned with agents that act to gain information. In previous work, we developed agent models combining qualitative modeling with real-time control. That work, however, focused primarily on actions that affect physical states of the environment. The current study extends that work by explicitly considering problems of active information-gathering and by exploring specialized aspects of information-gathering in computational perception, learning, and language. In our theoretical investigations, we analyzed agents into their perceptual and action components and identified these with elements of a state-machine model of control. The mathematical properties of each was developed in isolation and interactions were then studied. We considered the complexity dimension and the uncertainty dimension and related these to intelligent-agent design issues. We also explored active information gathering in visual processing. Working within the active vision paradigm, we developed a concept of 'minimal meaningful measurements' suitable for demand-driven vision. We then developed and tested an architecture for ongoing recognition and interpretation of visual information. In the area of information gathering through learning, we explored techniques for coping with combinatorial complexity. We also explored information gathering through explicit linguistic action by considering the nature of conversational rules, coordination, and situated communication behavior.

  12. 75 FR 68529 - Proposed Christmas Tree Promotion, Research, and Information Order; Referendum Procedures

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-11-08

    ... Agricultural Marketing Service 7 CFR Part 1214 RIN 0581-AD00 Proposed Christmas Tree Promotion, Research, and... determine whether the issuance or continuation of the proposed Christmas Promotion, Research, and... proposed program would be implemented under the Commodity Promotion, Research, and Information Act of...

  13. 76 FR 23537 - Hass Avocado Promotion, Research, and Information Order; Importer Associations and Assessment...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-04-27

    ... Agricultural Marketing Service Hass Avocado Promotion, Research, and Information Order; Importer Associations... Promotion, Research, and Information Order (Order)(7 CFR part 1219). The Order is authorized under the Hass Avocado Promotion, Research, and Information Act of 2000 (7 U.S.C. 7801-7813). The Order covers...

  14. 75 FR 12707 - Blueberry Promotion, Research, and Information Order; Increase Membership

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-03-17

    ... Agricultural Marketing Service 7 CFR Part 1218 Blueberry Promotion, Research, and Information Order; Increase... proposed by the Council in accordance with the provisions of the Blueberry Promotion, Research, and Information Order (Order) which is authorized by the Commodity Promotion, Research, and Information Act...

  15. 75 FR 18396 - U.S. Honey Producer Research, Promotion, and Consumer Information Order; Referendum Procedures

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-04-12

    ... Agricultural Marketing Service 7 CFR Part 1245 RIN 0581-AC78 U.S. Honey Producer Research, Promotion, and... proposed U.S. Honey Producer Research, Promotion, and Consumer Information Order (Proposed U.S. Producer... program is being implemented under the Commodity Promotion, Research, and Information Act of 1996...

  16. 78 FR 20092 - Proposed Information Collection; Comment Request; Fish and Seafood Promotion

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-04-03

    ... Seafood Promotion AGENCY: National Oceanic and Atmospheric Administration (NOAA), Commerce. ACTION: Notice... collection. Under the authority of the Fish and Seafood Promotion Act of 1986, information collected under... organization applying for consideration to form a seafood promotion council, and (2) the information...

  17. 75 FR 6089 - Processed Raspberry Promotion, Research, and Information Order; Referendum Procedures

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-02-08

    ... Service 7 CFR Part 1208 RIN 0581-AC79 Processed Raspberry Promotion, Research, and Information Order... Promotion, Research, and Information Order (Proposed Order) is favored by producers of raspberries for.... This proposed program is implemented under the Commodity Promotion, Research, and Information Act...

  18. [Euthanasia and medical act].

    PubMed

    2011-05-01

    Right to life -as the prohibition of intentionally and arbitrarily taking life, even with authorization of the concerned one- is an internationally recognized right. In many countries, debate regarding euthanasia is more centered in its convenience, social acceptability and how it is regulated, than in its substantial legitimacy. Some argue that euthanasia should be included as part of clinical practice of health professionals, grounded on individual's autonomy claims-everyone having the liberty to choose how to live and how to die. Against this, others sustain that life has a higher value than autonomy, exercising autonomy without respecting the right to life would become a serious moral and social problem. Likewise, euthanasia supporters some-times claim a 'right to live with dignity', which must be understood as a personal obligation, referred more to the ethical than to the strictly legal sphere. In countries where it is already legalized, euthanasia practice has extended to cases where it is not the patient who requests this but the family or some healthcare professional, or even the legal system-when they think that the patient is living in a condition which is not worthy to live. Generalization of euthanasia possibly will end in affecting those who need more care, such as elder, chronically ill or dying people, damaging severely personal basic rights. Nature, purpose and tradition of medicine rule out the practice of euthanasia, which ought not be considered a medical act or legitimately compulsory for physicians. Today's medicine counts with effective treatments for pain and suffering, such as palliative care, including sedative therapy, which best preserves persons dignity and keeps safe the ethos of the medical profession.

  19. Higher Education Counts: Accountability Measures for the New Millennium. Public Act 99-285 Progress Report.

    ERIC Educational Resources Information Center

    Connecticut State Dept. of Higher Education, Hartford.

    Connecticut's Public Act 99-285 clarifies the major goals and expectations that Connecticut citizens have for their public system of higher education. In this Act, the state legislature has codified its desires by identifying six priority level goals for higher education: (1) enhance student learning and promote academic excellence; (2) join with…

  20. 75 FR 32306 - Perishable Agricultural Commodities Act: Impact of Post-Default Agreements on Trust Protection...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-06-08

    ...; ] DEPARTMENT OF AGRICULTURE Agricultural Marketing Service 7 CFR Part 46 Perishable Agricultural Commodities Act: Impact of Post-Default Agreements on Trust Protection Eligibility AGENCY: Agricultural Marketing... Commodities Act (PACA) was enacted in 1930 to promote fair trading in the marketing of fresh and frozen...

  1. Health promotion in Brazil.

    PubMed

    Buss, Paulo Marchiori; de Carvalho, Antonio Ivo

    2007-01-01

    The evolution of health promotion within the Brazilian health system is examined, including an assessment of the intersectoral and development policies that have influenced the process. Particular attention is paid to the legal characteristics of the Unified Health System. Human resources formation and research initiatives in health promotion are outlined, with a summary of the obstacles that need to be overcome in order to ensure the effective implementation of health promotion in the future. Up to the end of the 20th Century health promotion was not used as a term in the Brazilian public heath context. Health promoting activities were concentrated in the area of health education, although targeting the social determinants of health and the principle of intersectoral action were part of the rhetoric. The situation has changed during the last decade, with the publication of a national policy of health promotion, issued by the Ministry of Health and jointly implemented with the States and Municipals Health Secretaries. More recently there has been a re-emergence of the discourse on the social determinants of health and the formation of intersectoral public policies as the basis of a comprehensive health promotion. Health promotion infrastructure, particularly around human resources and financing, requires strengthening in order to ensure capacity and sustainability in health promotion practice.

  2. 7 CFR 1170.2 - Act.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... Orders; Milk), DEPARTMENT OF AGRICULTURE DAIRY PRODUCT MANDATORY REPORTING § 1170.2 Act. Act means the Agricultural Marketing Act of 1946, 7 U.S.C. 1621 et seq., as amended by the Dairy Market Enhancement Act...

  3. 76 FR 59073 - Privacy Act

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-09-23

    ...: Consistent with the Privacy Act (PA), the Central Intelligence Agency (CIA) has undertaken and completed a... clearly reflect the current CIA organizational structure and policies and practices, and to eliminate... Act (PA), the CIA has undertaken and completed a review of its public PA regulations. As a result...

  4. Implementing the Amended FOI Act.

    ERIC Educational Resources Information Center

    McClain, Wallis

    The Freedom of Information Act amendments, which became effective in February 1975, have so far yielded mixed results. This report provides an account of how different federal agencies are implementing this amended statute. Among the topics discussed are modifications of the original 1966 Freedom of Information Act, which were made in the attempt…

  5. Online Challenge versus Offline ACT

    ERIC Educational Resources Information Center

    Peckham, Irvin

    2010-01-01

    This article compares essays written in response to the ACT Essay prompt and a locally developed prompt used for placement. The two writing situations differ by time and genre: the ACT Essay is timed and argumentative; the locally developed is untimed and explanatory. The article analyzes the differences in student performance and predictive…

  6. Education Leaders Applaud ATTAIN Act

    ERIC Educational Resources Information Center

    Curriculum Review, 2007

    2007-01-01

    This article talks about Achievement Through Technology and Innovation (ATTAIN) Act, a bill introduced by Senators Bingaman (D-NM), Burr (R-NC), and Murray (D-WA) and applauded by a coalition of education and industry groups. The proposed ATTAIN Act is similar to its companion in the House (HR 2449), and builds upon the Enhancing Education Through…

  7. Clean Air Act 1990 Amendments

    SciTech Connect

    Stensvaag, J.M.

    1991-01-01

    This book is an analysis of the 1990 Amendments to the Clean Air Act that includes compliance requirements, the new operating permit system, the enhanced enforcement provisions and criminal penalties, potential for citizen enforcement, and the increased reporting requirements. Also analyzed are the new defenses such as permit compliance and protection of employees acting within the direction of employers.

  8. Biomass Program Recovery Act Factsheet

    SciTech Connect

    2010-03-01

    The Biomass Program has awarded about $718 million in American Recovery and Reinvestment Act (Recovery Act) funds. The projects the Program is supporting are intended to: Accelerate advanced biofuels research, development, and demonstration; Speed the deployment and commercialization of advanced biofuels and bioproducts; Further the U.S. bioindustry through market transformation and creating or saving a range of jobs.

  9. Nurse Reinvestment Act. Public Law.

    ERIC Educational Resources Information Center

    Congress of the U.S., Washington, DC.

    This document contains the text of the Nurse Reinvestment Act, which amends the Public Health Service Act to address the increasing shortage of registered nurses by instituting a series of policies to improve nurse recruitment and nurse retention. Title I details two initiatives to boost recruitment of nurses. The first initiative includes the…

  10. 76 FR 14439 - No FEAR Act Notice

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-03-16

    ... TRANSPARENCY BOARD No FEAR Act Notice AGENCY: Recovery Accountability and Transparency Board. ACTION: Notice... and Retaliation Act (No FEAR Act or Act), as implemented by Office of Personnel Management (OPM... No FEAR Act. See Public Law 107-174, codified at 5 U.S.C. 2301 note. One purpose of the Act is...

  11. High expression Zymomonas promoters

    DOEpatents

    Viitanen, Paul V.; Tao, Luan; Zhang, Yuying; Caimi, Perry G.; McCole, Laura : Zhang, Min; Chou, Yat-Chen; McCutchen, Carol M.; Franden, Mary Ann

    2011-08-02

    Identified are mutants of the promoter of the Z. mobilis glyceraldehyde-3-phosphate dehydrogenase gene, which direct improved expression levels of operably linked heterologous nucleic acids. These are high expression promoters useful for expression of chimeric genes in Zymomonas, Zymobacter, and other related bacteria.

  12. Health Promotion Program.

    ERIC Educational Resources Information Center

    McClary, Cheryl

    The Health Promotion Program began with establishment of a one-credit course in health promotion and wellness and the training of family practice residents at the Mountain Area Health Education Center to serve as lab leaders in the course. The course later became part of the university's general education requirements. In addition, a health…

  13. Promoting Resilience in Children.

    ERIC Educational Resources Information Center

    Rolfe, Sharne A.

    2002-01-01

    This booklet invites reflection on ways in which childhood resilience can be promoted, thereby helping children to adapt effectively in the face of adversity. The attributes of resilient children are described, as is the importance of protective factors in building or promoting resilience. The booklet discusses the complex interplay between risk…

  14. ACTS and OLYMPUS propagation experiments

    NASA Technical Reports Server (NTRS)

    Bostian, Charles W.; Baker, Kenneth R.

    1988-01-01

    The OLYMPUS and ACTS satellites both provide opportunities for 10 to 30 GHz propagation measurements. The spacecraft are sufficiently alike that OLYMPUS can be used to test some prototype ACTS equipment and experiments. Data are particularly needed on short term signal behavior and in support of uplink power control and adaptive forward error correction (FEC) techniques. The Virginia Tech Satellite Communications Group has proposed a set of OLYMPUS experiments including attenuation and fade rate measurements, data communications, uplink power control, rain scatter interference, and small-scale site diversity operation. A digital signal processing receiver for the OLYMPUS and ACTS beacon signals is being developed.

  15. Assessment & Commitment Tracking System (ACTS)

    SciTech Connect

    Bryant, Robert A.; Childs, Teresa A.; Miller, Michael A.; Sellars, Kevin J.

    2004-12-20

    The ACTS computer code provides a centralized tool for planning and scheduling assessments, tracking and managing actions associated with assessments or that result from an event or condition, and "mining" data for reporting and analyzing information for improving performance. The ACTS application is designed to work with the MS SQL database management system. All database interfaces are written in SQL. The following software is used to develop and support the ACTS application: Cold Fusion HTML JavaScript Quest TOAD Microsoft Visual Source Safe (VSS) HTML Mailer for sending email Microsoft SQL Microsoft Internet Information Server

  16. Overview of tumor promotion in animals

    PubMed Central

    Slaga, T. J.

    1983-01-01

    Our present understanding of two-stage carcinogenesis encompasses almost four decades of research. Evidence for chemical promotion or cocarcinogenesis was first provided by Berenblum, who reported that a regimen of croton oil (weak or noncarcinogenic) applied alternately with small doses of benzo(a)pyrene (BP) to mouse skin induced a larger number of tumors than BP alone. Subsequently, Moltram found that a single subcarcinogenic dose of BP followed by multiple applications of croton oil could induce a large number of skin tumors. These investigations as well as a number of others, such as Boutwell, Van Duuren and Hecker, were responsible in defining many important aspects of the initiation and promotion of two-stage carcinogenesis. The initiation stage in mouse skin requires only a single application of either a direct-acting carcinogen or a procarcinogen and is essentially an irreversible step which as data suggests probably involves a somatic cell mutation. The promotion stage in mouse skin can be accomplished by a wide variety of weak or noncarcinogenic agents and is initially reversible later becoming irreversible. Current information suggests that skin tumor promoters are not mutagenic but bring about a number of important epigenetic changes, such as epidermal hyperplasia, and an increase in polyamines, prostaglandins and dark basal keratinocytes as well as other embryonic conditions. Recently, tumor promotion in mouse skin was shown to consist of at least two stages, in which each stage can be accomplished by either a known promoter or a weak or nonpromoting agent. Some of the important characteristics of the first stage of promotion are: (1) only one application of a first-stage promoter, such as phorbol ester tumor promoters, calcium ionophore A23187, hydrogen peroxide and wounding is needed; (2) the action is partially irreversible; (3) an increase in dark basal keratinocytes and prostaglandins is important; and (4) such an increase can be inhibited by

  17. 77 FR 47820 - Invention Promoters/Promotion Firms Complaints

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-08-10

    ... United States Patent and Trademark Office Invention Promoters/Promotion Firms Complaints ACTION: Proposed... participate in any legal proceedings against invention promoters or promotion firms. Complaints submitted to... promotion firm, explain the basis for the complaint, and include the signature of the complainant....

  18. Monitoring EERE's Recovery Act Portfolio

    SciTech Connect

    2011-01-01

    Performance monitoring of Recovery Act projects within EERE has been an ongoing effort. Project recipients have been reporting technical and financial progress to project officers on a quarterly basis.

  19. Summary of the Privacy Act

    EPA Pesticide Factsheets

    The purpose of the Privacy Act is to balance the government's need to maintain information about individuals with the rights of individuals to be protected against unwarranted invasions of their privacy.

  20. Prelinguistic Vocalizations Distinguish Pointing Acts

    ERIC Educational Resources Information Center

    Grunloh, Thomas; Liszkowski, Ulf

    2015-01-01

    The current study investigated whether point-accompanying characteristics, like vocalizations and hand shape, differentiate infants' underlying motives of prelinguistic pointing. We elicited imperative (requestive) and declarative (expressive and informative) pointing acts in experimentally controlled situations, and analyzed accompanying…

  1. Criminal Acts Against Civil Aviation

    DTIC Science & Technology

    1991-01-01

    28 Soviet Union ...34 Feature Articles Civil Aviation in the Soviet Union ................................................................. 39 Attacks on Airline...relief transport aircraft or hijackings; none were related to the Gulf war. Likewise, in Asia, there were few criminal acts against civil aviation

  2. Clean Water Act Analytical Methods

    EPA Pesticide Factsheets

    EPA publishes laboratory analytical methods (test procedures) that are used by industries and municipalities to analyze the chemical, physical and biological components of wastewater and other environmental samples required by the Clean Water Act.

  3. Novelty and Promotional Items

    EPA Pesticide Factsheets

    Small novelty or promotional products, primarily used for outreach and educational purposes, must effectively convey a message, and their purchase will only be allowed if the item will contribute to the accomplishment of the Agency's mission.

  4. Promoting "Global" Attitudes.

    ERIC Educational Resources Information Center

    Case, Roland

    1996-01-01

    Discusses and illustrates three ways to promote prosocial attitudes towards global issues among students. Includes classroom environments that reinforce desired attitudes; facilitating direct "emotional" experiences that influence attitudes; and engaging students in thoughtful deliberation about global issues. Offers illustrative…

  5. Structure and Regulation of the Versican Promoter

    PubMed Central

    Domenzain-Reyna, Clelia; Hernández, Daniel; Miquel-Serra, Laia; Docampo, María José; Badenas, Celia; Fabra, Angels; Bassols, Anna

    2009-01-01

    Versican is a large chondroitin sulfate proteoglycan of the extracellular matrix that is involved in a variety of cellular processes. We showed previously that versican, which is overexpressed in cutaneous melanomas as well as in premalignant lesions, contributes to melanoma progression, favoring the detachment of cells and the metastatic dissemination. Here, we investigated the transcriptional regulation of the versican promoter in melanoma cell lines with different levels of biological aggressiveness and stages of differentiation. We show that versican promoter up-regulation accounts for the differential expression levels of mRNA and protein detected in the invasive SK-mel-131 human melanoma cells. The activity of the versican promoter increased 5-fold in these cells in comparison with that measured in non-invasive MeWo melanoma cells. Several transcriptional regulatory elements were identified in the proximal promoter, including AP-1, Sp1, AP-2, and two TCF-4 sites. We show that promoter activation is mediated by the ERK/MAPK and JNK signaling pathways acting on the AP-1 site, suggesting that BRAF mutation present in SK-mel-131 cells impinge upon the up-regulation of the versican gene through signaling elicited by the ERK/MAPK pathway. This is the first time the AP-1 transcription factor family has been shown to be related to the regulation of versican expression. Furthermore, deletion of the TCF-4 binding sites caused a 60% decrease in the promoter activity in SK-mel-131 cells. These results showing that AP-1 and TCF-4 binding sites are the main regulatory regions directing versican production provide new insights into versican promoter regulation during melanoma progression. PMID:19269971

  6. Nicotine administration in the wake-promoting basal forebrain attenuates sleep-promoting effects of alcohol.

    PubMed

    Sharma, Rishi; Lodhi, Shafi; Sahota, Pradeep; Thakkar, Mahesh M

    2015-10-01

    Nicotine and alcohol co-abuse is highly prevalent, although the underlying causes are unclear. It has been suggested that nicotine enhances pleasurable effects of alcohol while reducing aversive effects. Recently, we reported that nicotine acts via the basal forebrain (BF) to activate nucleus accumbens and increase alcohol consumption. Does nicotine suppress alcohol-induced aversive effects via the BF? We hypothesized that nicotine may act via the BF to suppress sleep-promoting effects of alcohol. To test this hypothesis, adult male Sprague-Dawley rats were implanted with sleep-recording electrodes and bilateral guides targeted toward the BF. Nicotine (75 pmol/500 nL/side) or artificial cerebrospinal fluid (ACSF; 500 nL/side) was microinjected into the BF followed by intragastric alcohol (ACSF + EtOH and NiC + EtOH groups; 3 g/kg) or water (NiC + W and ACSF + W groups; 10 mL/kg) administration. On completion, rats were killed and processed to localize injection sites in the BF. The statistical analysis revealed a significant effect of treatment on sleep-wakefulness. While rats exposed to alcohol (ACSF + EtOH) displayed strong sleep promotion, nicotine pre-treatment in the BF (NiC + EtOH) attenuated alcohol-induced sleep and normalized sleep-wakefulness. These results suggest that nicotine acts via the BF to suppress the aversive, sleep-promoting effects of alcohol, further supporting the role of BF in alcohol-nicotine co-use.

  7. Powerplant and Industrial Fuel Use Act annual report

    SciTech Connect

    1981-03-01

    This annual report was prepared for the Congress by the Secretary of the Department of Energy (DOE) in conjunction with the Acting Administrator of the Environmental Protection Agency (EPA) as required by Section 806 of the Powerplant and Industrial Fuel Use Act of 1978 (FUA), Public Law 95-620, enacted November 9, 1978. This annual report describes actions taken under the legislation, which was enacted to promote national energy self-sufficiency and encourage the use of the alternate energy resources in electric powerplants and major industrial fuel-burning installations (MFBI's) in the utility, industrial and Federal governmental sectors. Annual FUA implementation activities are discussed and legislative requirements are satisfied that the annual report discuss: actions taken under FUA and under Section 2 of the Energy Supply and Environmental Coordination Act of 1974 (ESECA) Public Law 93-319 during the preceding calendar year; and the effectiveness of the provisions of both laws in achieving their purposes.

  8. EPA and the Federal Technology Transfer Act: Opportunity knocks

    SciTech Connect

    Gatchett, A.M.; Fradkin, L.; Moore, M.; Gorman, T.; Ehrlich, A.

    1990-12-31

    In 1986, the Federal Technology Transfer Act (FTTA) was established to promote a closer, collaborative relationship between federal government agencies and the private sector. With the increasing need for new cost-effective technologies to prevent and control pollution, both the US Environmental Protection Agency (EPA) and private industry are encouraged to facilitate the transfer of knowledge and technology under this Act. The FTTA removed several of the legal and institutional barriers to cooperative research that existed before the Act`s passage. Through the FTTA, the government strives to promote the movement of its products, processes, skills, and knowledge into the private sector for further development and commercialization by encouraging the exchange of technical personnel and the sharing of facilities and other resources. Collaborative efforts between industry, federal agencies, and academia are made possible through cooperative research and development agreements (CRADAs). Forty-two CRADAs and five licensing agreements have been initiated with EPA under this program. This paper provides an overview of this new and innovative program within the EPA. 1 fig., 2 tabs.

  9. 78 FR 17403 - No FEAR Act Notice

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-03-21

    ... AGENCY No FEAR Act Notice AGENCY: Federal Housing Finance Agency. ACTION: Notice. SUMMARY: The Federal... and Federal Employee Antidiscrimination and Retaliation Act of 2002, which is now known as the No FEAR Act (No FEAR Act), (Pub. L. 107-174). One purpose of the No FEAR Act is to require that...

  10. 7 CFR 1170.2 - Act.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... Orders; Milk), DEPARTMENT OF AGRICULTURE DAIRY PRODUCT MANDATORY REPORTING § 1170.2 Act. Act means the Agricultural Marketing Act of 1946, 7 U.S.C. 1621 et seq., as amended by the Dairy Market Enhancement Act of 2000, Public Law 106-532, 114 Stat. 2541, and the Farm Security and Rural Investment Act of...

  11. 7 CFR 1170.2 - Act.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... ORDERS; MILK), DEPARTMENT OF AGRICULTURE DAIRY PRODUCT MANDATORY REPORTING § 1170.2 Act. Act means the Agricultural Marketing Act of 1946, 7 U.S.C. 1621 et seq., as amended by the Dairy Market Enhancement Act of 2000, Pub. L. 106-532, 114 Stat. 2541; the Farm Security and Rural Investment Act of 2002, Pub. L....

  12. 7 CFR 1170.2 - Act.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... ORDERS; MILK), DEPARTMENT OF AGRICULTURE DAIRY PRODUCT MANDATORY REPORTING § 1170.2 Act. Act means the Agricultural Marketing Act of 1946, 7 U.S.C. 1621 et seq., as amended by the Dairy Market Enhancement Act of 2000, Pub. L. 106-532, 114 Stat. 2541; the Farm Security and Rural Investment Act of 2002, Pub. L....

  13. 7 CFR 1170.2 - Act.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... Orders; Milk), DEPARTMENT OF AGRICULTURE DAIRY PRODUCT MANDATORY REPORTING § 1170.2 Act. Act means the Agricultural Marketing Act of 1946, 7 U.S.C. 1621 et seq., as amended by the Dairy Market Enhancement Act of 2000, Public Law 106-532, 114 Stat. 2541, and the Farm Security and Rural Investment Act of...

  14. In vivo interactions of the Drosophila Hairy and Runt transcriptional repressors with target promoters.

    PubMed

    Jiménez, G; Pinchin, S M; Ish-Horowicz, D

    1996-12-16

    The Hairy and Runt pair-rule proteins regulate Drosophila segmentation by repressing transcription. To explore the ability of these proteins to function as promoter-bound regulators in vivo, we examined the effects of Hairy and Runt derivatives containing heterologous transcriptional activation domains (HairyAct and RunAct). Using this approach, we find that Hairy and Runt efficiently target such activation domains to specific segmentation gene promoters, leading to rapid induction of transcription. Our results strongly suggest that Hairy normally acts as a promoter-bound repressor of fushi tarazu, runt and odd-skipped, and that Runt directly represses even-skipped. We also show that expressing HairyAct in early blastoderm embryos causes ectopic Sex-lethal expression and male-specific lethality, implying that the Hairy-related denominator element Deadpan represses Sex-lethal during sex determination by directly recognizing the early Sex-lethal promoter.

  15. 7 CFR 65.100 - Act.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) REGULATIONS AND STANDARDS UNDER THE AGRICULTURAL..., AND GINSENG General Provisions Definitions § 65.100 Act. Act means the Agricultural Marketing Act...

  16. [Municipal Health Promotion in Germany: Duties, Rights and Potential].

    PubMed

    Walter, U; Volkenand, K

    2016-10-18

    Municipalities have an overarching structure in health promotion. Due to the right to self-government, municipalities are in charge of both voluntary and obligatory tasks. Some of the original and fundamental tasks can be summarized as "services to the public". Current common definitions do not include the term "health promotion". In the present study, a sub-target of a joint project, legal acts, requirements and recommendations were researched and analyzed. The results show substantive cornerstones of health promotion in various regulations of different disciplines. Based on these findings, health promotion can be interpreted as being part of services to the public. Currently the regulations for education, social tasks, environmental and consumer protection constitute the legal framework for community health promotion, but also include constitutions. They range from public international law to municipal resolutions. Quality management and also quality development are already an integral part in some communal departments. The management of structures, processes and results arises from commitments or measurable targets. In contrast, quality management for health promotion is not based on binding requirements. Specifications of other neighboring sectors (e. g. education, social sector) demonstrate the potential and effectiveness of legal policy guidelines, seen as a frame. A transparent communication about the current regulations is indispensable for formulating future guidelines. The German National Prevention Act opens opportunities for municipalities. However, its interpretation and local engagement will still guide the practice of communal health promotion.

  17. Promoting Disability Equality and Inclusive Learning in Planning Education

    ERIC Educational Resources Information Center

    Peel, Deborah; Posas, Paula J.

    2009-01-01

    In the UK, the Disability Discrimination Act 2005 created a positive duty on the public sector to promote disability equality. This duty extends to higher education and local planning authorities. Based on Zuber-Skerrit's CRASP model for professional development, this paper examines an initiative to enact the duty. It details a completed action…

  18. 28 CFR 115.17 - Hiring and promotion decisions.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 28 Judicial Administration 2 2012-07-01 2012-07-01 false Hiring and promotion decisions. 115.17 Section 115.17 Judicial Administration DEPARTMENT OF JUSTICE (CONTINUED) PRISON RAPE ELIMINATION ACT NATIONAL STANDARDS Standards for Adult Prisons and Jails Prevention Planning § 115.17 Hiring and...

  19. 28 CFR 115.17 - Hiring and promotion decisions.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 28 Judicial Administration 2 2013-07-01 2013-07-01 false Hiring and promotion decisions. 115.17 Section 115.17 Judicial Administration DEPARTMENT OF JUSTICE (CONTINUED) PRISON RAPE ELIMINATION ACT NATIONAL STANDARDS Standards for Adult Prisons and Jails Prevention Planning § 115.17 Hiring and...

  20. 28 CFR 115.317 - Hiring and promotion decisions.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 28 Judicial Administration 2 2014-07-01 2014-07-01 false Hiring and promotion decisions. 115.317 Section 115.317 Judicial Administration DEPARTMENT OF JUSTICE (CONTINUED) PRISON RAPE ELIMINATION ACT NATIONAL STANDARDS Standards for Juvenile Facilities Prevention Planning § 115.317 Hiring and...

  1. 28 CFR 115.317 - Hiring and promotion decisions.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 28 Judicial Administration 2 2013-07-01 2013-07-01 false Hiring and promotion decisions. 115.317 Section 115.317 Judicial Administration DEPARTMENT OF JUSTICE (CONTINUED) PRISON RAPE ELIMINATION ACT NATIONAL STANDARDS Standards for Juvenile Facilities Prevention Planning § 115.317 Hiring and...

  2. 28 CFR 115.317 - Hiring and promotion decisions.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 28 Judicial Administration 2 2012-07-01 2012-07-01 false Hiring and promotion decisions. 115.317 Section 115.317 Judicial Administration DEPARTMENT OF JUSTICE (CONTINUED) PRISON RAPE ELIMINATION ACT NATIONAL STANDARDS Standards for Juvenile Facilities Prevention Planning § 115.317 Hiring and...

  3. 28 CFR 115.17 - Hiring and promotion decisions.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 28 Judicial Administration 2 2014-07-01 2014-07-01 false Hiring and promotion decisions. 115.17 Section 115.17 Judicial Administration DEPARTMENT OF JUSTICE (CONTINUED) PRISON RAPE ELIMINATION ACT NATIONAL STANDARDS Standards for Adult Prisons and Jails Prevention Planning § 115.17 Hiring and...

  4. 75 FR 34516 - Determination Under Subsection 402(d)(1) of the Trade Act of 1974, as Amended; Continuation of...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-06-17

    ... for Belarus Pursuant to the authority vested in the President under the Trade Act of 1974, as amended... determine that continuation of the waiver applicable to Belarus will substantially promote the objectives...

  5. Caspase 3 promotes genetic instability and carcinogenesis

    PubMed Central

    Liu, Xinjian; He, Yujun; Li, Fang; Huang, Qian; Kato, Takamitsu A.; Hall, Russell P; Li, Chuan-Yuan

    2015-01-01

    Summary Apoptosis is typically considered an anti-oncogenic process since caspase activation can promote the elimination of genetically unstable or damaged cells. We report that a central effector of apoptosis, caspase 3, facilitates, rather than suppresses, chemical and radiation-induced genetic instability and carcinogenesis. We found that a significant fraction of mammalian cells treated with ionizing radiation can survive, despite caspase 3 activation. Moreover, this sublethal activation of caspase 3 promoted persistent DNA damage and oncogenic transformation. In addition, chemically-induced skin carcinogenesis was significantly reduced in mice genetically deficient in caspase 3. Furthermore, attenuation of Endo G activity significantly reduced radiation-induced DNA damage and oncogenic transformation, identifying Endo G as a downstream effector of caspase 3 in this pathway. Our findings suggest that rather than acting as a broad inhibitor of carcinogenesis, caspase 3 activation may contribute to genome instability and play a pivotal role in tumor formation following damage. PMID:25866249

  6. Self-acting shaft seals

    NASA Technical Reports Server (NTRS)

    Ludwig, L. P.

    1978-01-01

    Self-acting seals are described in detail. The mathematical models for obtaining a seal force balance and the equilibrium operating film thickness are outlined. Particular attention is given to primary ring response (seal vibration) to rotating seat face runout. This response analysis reveals three different vibration models with secondary seal friction being an important parameter. Leakage flow inlet pressure drop and affects of axisymmetric sealing face deformations are discussed. Experimental data on self-acting face seals operating under simulated gas turbine conditions are given. Also a spiral groove seal design operated to 244 m/sec (800 ft/sec) is described.

  7. Long-acting reversible contraception.

    PubMed

    Peck, Susan A

    2013-10-01

    Although short-acting reversible hormonal contraceptives, such as oral contraceptives and the contraceptive patch and vaginal ring, remain the most commonly used contraceptive methods in the United States, they are also associated with the highest failure rates. Long-acting reversible contraception (LARC) methods, such as intrauterine devices and contraceptive implants, offer high continuation rates and very low failure rates, and are safe for use in most women. The provision of LARC methods to adolescent, young adult and nulliparous women is a relatively new concept that offers an innovative option for these populations.

  8. Advanced Communications Technology Satellite (ACTS)

    NASA Technical Reports Server (NTRS)

    Gedney, Richard T.; Schertler, Ronald J.

    1989-01-01

    The NASA Advanced Communications Technology Satellite (ACTS) was conceived to help maintain U.S. leadership in the world's communications-satellite market. This experimental satellite is expected to be launched by NASA in 1992 and to furnish the technology necessary for establishing very small aperture terminal digital networks which provide on-demand full-mesh connectivity, and 1.544-MBPS services with only a single hop. Utilizing on-board switching and processing, each individual voice or data circuit can be separately routed to any location in the network. This paper provides an overview of the ACTS and discusses the value of the technology for future communications systems.

  9. 7 CFR 65.100 - Act.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... MARKETING ACT OF 1946 AND THE EGG PRODUCTS INSPECTION ACT (CONTINUED) COUNTRY OF ORIGIN LABELING OF BEEF, PORK, LAMB, CHICKEN, GOAT MEAT, PERISHABLE AGRICULTURAL COMMODITIES, MACADAMIA NUTS, PECANS,...

  10. 7 CFR 65.100 - Act.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... MARKETING ACT OF 1946 AND THE EGG PRODUCTS INSPECTION ACT (CONTINUED) COUNTRY OF ORIGIN LABELING OF BEEF, PORK, LAMB, CHICKEN, GOAT MEAT, PERISHABLE AGRICULTURAL COMMODITIES, MACADAMIA NUTS, PECANS,...

  11. 7 CFR 65.100 - Act.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... MARKETING ACT OF 1946 AND THE EGG PRODUCTS INSPECTION ACT (CONTINUED) COUNTRY OF ORIGIN LABELING OF BEEF, PORK, LAMB, CHICKEN, GOAT MEAT, PERISHABLE AGRICULTURAL COMMODITIES, MACADAMIA NUTS, PECANS,...

  12. 7 CFR 65.100 - Act.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... MARKETING ACT OF 1946 AND THE EGG PRODUCTS INSPECTION ACT (CONTINUED) COUNTRY OF ORIGIN LABELING OF BEEF, PORK, LAMB, CHICKEN, GOAT MEAT, PERISHABLE AGRICULTURAL COMMODITIES, MACADAMIA NUTS, PECANS,...

  13. The Indian National Food Security Act, 2013: a commentary.

    PubMed

    Varadharajan, Kiruba Sankar; Thomas, Tinku; Kurpad, Anura

    2014-06-01

    The National Food Security Act (NFSA) 2013, passed recently by the Indian Parliament, aims to ensure food security in India, chiefly by providing cereals at subsidized prices through the Targeted Public Distribution System (TPDS) for about two-thirds of households. The predominant line of criticism of the NFSA has been the costs of such an ambitious rights-based approach in the context of decelerating economic growth and growing fiscal deficits. We argue that the food subsidy has been increasing through the last few decades and is set to climb even higher with this act but that the incremental costs, at about 0.2% of gross domestic product, are not as high as claimed. Further, recent evidence of increasing utilization of the TPDS and decreasing corruption add credence to the act's premise that significant income transfers to poor households can be achieved, thereby promoting food security as well as dietary diversity. Several concerns remain to be addressed in the design and implementation of the act, including its proposed coverage, a cereal-centric approach, the identification of beneficiaries, and its adaptability at the state level. If these are resolved effectively, the act can prove to be a significant step forward in India's long-drawn-out battle against undernutrition and food insecurity. Finally, the NFSA also provides a fresh opportunity to reform and strengthen the TPDS, which has been an integral component of India's strategy to achieve food security at the national level.

  14. Pertussis toxin promoter sequences involved in modulation.

    PubMed Central

    Gross, R; Rappuoli, R

    1989-01-01

    Previous analysis of the pertussis toxin (PT) promoter has shown that expression of PT requires a trans-activating factor encoded by the vir locus and a 170-base-pair DNA sequence upstream from the transcription start site containing a 21-base-pair direct repeat sequence crucial trans-activation (R. Gross and R. Rappuoli, Proc. Natl. Acad. Sci. USA 85:3913-3917, 1988). In this paper we extend the analysis to the modulative response to environmental stimuli. We show that modulation acts at the transcriptional level and occurs only in phase I bacteria. Modulation also requires a functional vir locus and the same promoter region of 170 base pairs. We show that, in addition to the previously identified direct repeat, even the sequences downstream from position -117 are required for trans-activation and modulation and that the deletion of four cytosine residues at position -31 causes the inactivation of the promoter. The kinetics of the change in transcription show that the PT promoter can be shut off very rapidly by adding 50 mM MgSO4 to the medium, whereas resumption of transcription after removal of the modulative agents from the medium is slow. Images PMID:2544567

  15. 13 CFR 107.115 - 1940 Act and 1980 Act Companies.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false 1940 Act and 1980 Act Companies... INVESTMENT COMPANIES Qualifying for an SBIC License Organizing An Sbic § 107.115 1940 Act and 1980 Act Companies. A 1940 Act or 1980 Act Company is eligible to apply for an SBIC license, and an existing...

  16. 13 CFR 107.115 - 1940 Act and 1980 Act Companies.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 13 Business Credit and Assistance 1 2011-01-01 2011-01-01 false 1940 Act and 1980 Act Companies... INVESTMENT COMPANIES Qualifying for an SBIC License Organizing An Sbic § 107.115 1940 Act and 1980 Act Companies. A 1940 Act or 1980 Act Company is eligible to apply for an SBIC license, and an existing...

  17. 13 CFR 107.115 - 1940 Act and 1980 Act Companies.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 13 Business Credit and Assistance 1 2012-01-01 2012-01-01 false 1940 Act and 1980 Act Companies... INVESTMENT COMPANIES Qualifying for an SBIC License Organizing An Sbic § 107.115 1940 Act and 1980 Act Companies. A 1940 Act or 1980 Act Company is eligible to apply for an SBIC license, and an existing...

  18. Isolation of Persicaria minor sesquiterpene synthase promoter and its deletions for transgenic Arabidopsis thaliana

    NASA Astrophysics Data System (ADS)

    Omar, Aimi Farehah; Ismail, Ismanizan

    2016-11-01

    Sesquiterpene synthase (SS) catalyzes the formation of sesquiterpenes from farnesyl diphosphate (FDP) via carbocation intermediates. In this study, the promoter region of sesquiterpene synthase was isolated from Persicaria minor to identify possible cis-acting elements in the promoter. The full-length PmSS promoter of P. minor is 1824-bp sequences. The sequence was analyzed and several putative cis-acting regulatory elements were identified. Three cis-acting regulatory elements were selected for deletion analysis which are cis-acting element involved in wound responsiveness (WUN), cis - acting element involved in defense and stress responsiveness (TC) and cis-acting element involved in ABA responsiveness (ABRE). Series of deletions were conducted to assess the promoter activity producing three truncated fragments promoter; Prom 2 1606-bp, Prom 3 1144- bp, and Prom 4 921-bp. The full-length promoter and its deletion series were cloned into the pBGWFS7 vector which contain β-glucuronidase (GUS) gene and green fluorescent protein (GFP) as the reporter gene. All constructs were successfully transformed into Arabidopsis thaliana based on PCR of positive BASTA resistance plants.

  19. Methylation of an intragenic alternative promoter regulates transcription of GARP.

    PubMed

    Haupt, Sonja; Söntgerath, Viktoria Sophie Apollonia; Leipe, Jan; Schulze-Koops, Hendrik; Skapenko, Alla

    2016-02-01

    Alternative promoter usage has been proposed as a mechanism regulating transcriptional and translational diversity in highly elaborated systems like the immune system in humans. Here, we report that transcription of human glycoprotein A repetitions predominant (GARP) in regulatory CD4 T cells (Tregs) is tightly regulated by two alternative promoters. An intragenic promoter contains several CpGs and acts as a weak promoter that is demethylated and initiates transcription Treg-specifically. The strong up-stream promoter containing a CpG-island is, in contrast, fully demethylated throughout tissues. Transcriptional activity of the strong promoter was surprisingly down-regulated upon demethylation of the weak promoter. This demethylation-induced transcriptional attenuation regulated the magnitude of GARP expression and correlated with disease activity in rheumatoid arthritis. Treg-specific GARP transcription was initiated by synergistic interaction of forkhead box protein 3 (Foxp3) with nuclear factor of activated T cells (NFAT) and was underpinned by permissive chromatin remodeling caused by release of the H3K4 demethylase, PLU-1. Our findings describe a novel function of alternative promoters in regulating the extent of transcription. Moreover, since GARP functions as a transporter of transforming growth factor β (TGFβ), a cytokine with broad pleiotropic traits, GARP transcriptional attenuation by alternative promoters might provide a mechanism regulating peripheral TGFβ to avoid unwanted harmful effects.

  20. Studies on the mechanism of skin tumor promotion: Evidence for several stages in promotion

    PubMed Central

    Slaga, T. J.; Fischer, S. M.; Nelson, K.; Gleason, G. L.

    1980-01-01

    The effects of nonpromoting and weakly promoting diterpenes on skin tumor promotion by 12-O-tetradecanoylphorbol 13-acetate (TPA) were investigated. When phorbol and phorbol 12,13-diacetate (both nonpromoting) were given simultaneously with TPA after 7,12-dimethylbenz[a]-anthracene (DMBA) initiation in female mice, they had no effect on TPA promotion. However, the nonpromoter 4-O-methyl-TPA and the weak promoter mezerein were found to inhibit TPA promotion in a dose-dependent manner when given simultaneously with TPA. Because mezerein was found to be an effective inhibitor of TPA promotion when given simultaneously and because it induces many biological responses similar to those to TPA, the capacity of mezerein to act as an incomplete promoter in a two-stage promotion protocol was also investigated. Twice-weekly applications of 1,2, or 5 μg of TPA for 2 weeks after DMBA initiation produced 0, 0, and 0.5 papilloma per mouse, respectively, at 20 weeks. When the twice-weekly applications of TPA for 2 weeks were followed by twice-weekly treatments with 2 μg of mezerein for 18 weeks, the number of papillomas per mouse was 2.2, 3.5, and 9.0, respectively. Twice-weekly applications of 2 μg of TPA for 2 weeks followed by twice-weekly treatments with 1, 2, or 4 μg of mezerein for 18 weeks produced 2.1, 3.5, and 6.8 papillomas per mouse, respectively, in DMBA-treated mice. Twice-weekly doses as high as 40 μg of 4-O-methyl-TPA were not effective in producing tumors when given after a limited treatment with TPA; however, 4-O-methyl-TPA had weak activity as a first-stage promoter. The results suggest that although mezerein by itself is a weak promoter and mimics TPA in many biochemical and morphological effects it is a potent second-stage promoter in a two-stage promotion regimen. PMID:6774342

  1. Legislative Branch Appropriations Act, 2010

    THOMAS, 111th Congress

    Rep. Wasserman Schultz, Debbie [D-FL-20

    2009-06-17

    10/01/2009 Became Public Law No: 111-68. (PDF) (All Actions) Notes: Division A is the Legislative Branch Appropriations Act, 2010. Division B is the Continuing Appropriations Resolution, 2010. Tracker: This bill has the status Became LawHere are the steps for Status of Legislation:

  2. FDA Food Safety Modernization Act

    THOMAS, 111th Congress

    Rep. Sutton, Betty [D-OH-13

    2009-06-08

    01/04/2011 Became Public Law No: 111-353. (PDF) (All Actions) Notes: H.R.2751 was introduced and first passed the House as the Consumer Assistance to Recycle and Save Act. Tracker: This bill has the status Became LawHere are the steps for Status of Legislation:

  3. The Federal Employees' Compensation Act.

    ERIC Educational Resources Information Center

    Nordlund, Willis J.

    1991-01-01

    The 1916 Federal Employees' Compensation Act is still the focal point around which the federal workers compensation program works today. The program has gone through many changes on its way to becoming a modern means of compensating workers for job-related injury, disease, and death. (Author)

  4. The Indian Child Welfare Act.

    ERIC Educational Resources Information Center

    Steward, Katy Jo

    The Indian Child Welfare Act of 1978 (I.C.W.A.) is federal legislation which preempts state law whenever Indian children may be removed from their families. The I.C.W.A. permits Indian tribal courts to decide the future of Indian children, establishes minimum federal standards for removal of Indian children from their families, requires that…

  5. The Indian Mineral Development Act.

    ERIC Educational Resources Information Center

    Houle, Antoinette

    1986-01-01

    Discusses the objectives of the Indian Mineral Development Act of 1982 (IMDA) and the possible effects it may have on Indian mineral development. Explains how the provisions of IMDA work to provide Indian tribes with greater flexibility for the development and sale of their mineral resources. (ML)

  6. Legislative Branch Appropriations Act, 2010

    THOMAS, 111th Congress

    Rep. Wasserman Schultz, Debbie [D-FL-20

    2009-06-17

    10/01/2009 Became Public Law No: 111-68. (TXT | PDF) (All Actions) Notes: Division A is the Legislative Branch Appropriations Act, 2010. Division B is the Continuing Appropriations Resolution, 2010. Tracker: This bill has the status Became LawHere are the steps for Status of Legislation:

  7. The altruistic act of asking.

    PubMed

    Kirklin, D

    2003-06-01

    There are a number of obstacles to increasing the supply of cadaveric organs for transplantation. These include reluctance on the part of relatives to agree to the so called harvesting of organs from their deceased relative, and the unwillingness of some doctors to approach grieving families and ask consent for this harvesting to take place. In this paper I will focus on the altruistic act of asking that the latter entails, and will argue that failure to acknowledge the personal cost of this act to physicians is having an adverse impact on the supply of organs. I will draw analogies with the almost equally neglected altruistic act of undertaking anatomy dissection and all of the related breaking of societal taboos. I will examine the language used in discussions about increasing organ supply and conclude that the terms cadaveric and harvest are unhelpful in gaining public confidence. A process and vocabulary that openly acknowledges and validates the altruistic acts demanded of all the human beings involved--donors, recipients, their respective relatives, and the health professionals who mediate between them--is needed if the supply of organs is to be increased.

  8. ACT and General Cognitive Ability

    ERIC Educational Resources Information Center

    Koenig, Katherine A.; Frey, Meredith C.; Detterman, Douglas K.

    2008-01-01

    Research on the SAT has shown a substantial correlation with measures of "g" such as the Armed Services Vocational Aptitude Battery (ASVAB). Another widely administered test for college admission is the American College Test (ACT). Using the National Longitudinal Survey of Youth 1979, measures of "g" were derived from the ASVAB and correlated with…

  9. 78 FR 46256 - Privacy Act

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-07-31

    ... From the Federal Register Online via the Government Publishing Office FEDERAL ELECTION COMMISSION 11 CFR Part 1 Privacy Act CFR Correction In Title 11 of the Code of Federal Regulations, revised as of January 1, 2012, on page 5, in Sec. 1.2, the words ``95 and 96 of the Internal Revenue Code...

  10. Community Environmental Response Facilitation Act

    EPA Pesticide Factsheets

    To amend the Comprehensive Environmental Response, Compensation, and Liability Act of 1980 to require the Federal Government, before termination of Federal activities on any real property owned by the Government, to identify real property where no hazardous substance was stored, released, or disposed of.

  11. FDA Food Safety Modernization Act

    THOMAS, 111th Congress

    Rep. Sutton, Betty [D-OH-13

    2009-06-08

    01/04/2011 Became Public Law No: 111-353. (TXT | PDF) (All Actions) Notes: H.R.2751 was introduced and first passed the House as the Consumer Assistance to Recycle and Save Act. Tracker: This bill has the status Became LawHere are the steps for Status of Legislation:

  12. Clery Act: Road to Compliance

    ERIC Educational Resources Information Center

    McNeal, Laura R.

    2007-01-01

    The purpose of this study was to explore what factors served as impediments to institutional efforts to comply with Clery Act guidelines through the perceptions of campus law administrators. Statistical analyses were performed on data collected from an online survey, which was distributed to members of the International Association of Campus Law…

  13. Promoting La Cultura Hispana

    ERIC Educational Resources Information Center

    Pluviose, David

    2007-01-01

    Launched in 1985 at Arizona State University, the Hispanic Research Center's (HRC) efforts to promote Latino and Chicano art and issues have flourished in recent years. In 2004, the HRC hosted the Arizona International Latina/o Arts Festival in collaboration with the Mesa Southwest Museum. The HRC has also founded a mentoring institute for…

  14. The Ideal Promotion Effort.

    ERIC Educational Resources Information Center

    Morris, Edward L.

    The ideal promotional effort for an educational television (ETV) station is dependent on a professional approach to the problem. This means that each ETV station should employ a public relations manager and should keep him informed about all major station decisions. The Public Broadcasting Service (PBS) has a campaign of its own to bring attention…

  15. Health Promotion Interventions.

    ERIC Educational Resources Information Center

    Jason, Leonard A.; Curie, Carrie J.; Townsend, Stephanie M.; Pokorny, Steven B.; Katz, Richard B.; Sherk, Joseph L.

    2002-01-01

    Reviews four areas from the prevention science field, including: promoting healthy behavior; preventing substance abuse; preventing high-risk sexual behaviors; and preventing child abuse and sexual abuse. Recommendations are made regarding strategies for implementing empirically validated programs, supplementing school programs with ecological…

  16. Does Paid Promotion Pay?

    ERIC Educational Resources Information Center

    Scherer, Chris

    1980-01-01

    A study to determine the cost effectiveness of newspaper display advertising for cooperative extension programs showed such publicity to be more effective in large metropolitan areas. Though not a technique for increasing enrollment, this method provided long-range benefits in the overall promotion of extension educational services. (SK)

  17. Promoting Healthy Dietary Behaviors.

    ERIC Educational Resources Information Center

    Perry, Cheryl L.; Story, Mary; Lytle, Leslie A.

    This chapter reviews the research on promoting healthy dietary behaviors in all youth, not just those who exhibit problems such as obesity or eating disorders. The first section of this chapter presents a rationale for addressing healthy dietary behavior with children and adolescents, on the basis of the impact of these behaviors on short- and…

  18. Partners: Promoting Accessible Recreation.

    ERIC Educational Resources Information Center

    Sable, Janet; Gravink, Jill

    1995-01-01

    The Promoting Accessible Recreation through Networking, Education, Resources and Services (PARTNERS) Project, a partnership between Northeast Passage, the University of New Hampshire, and Granite State Independent Living Foundation, helps create barrier-free recreation for individuals with physical disabilities. The paper describes PARTNERS and…

  19. Promoting Continuing Education Programs.

    ERIC Educational Resources Information Center

    Hendrickson, Gayle A.

    This handbook is intended for use by institutions in marketing their continuing education programs. A section on "Devising Your Strategy" looks at identifying a target audience, determining the marketing approach, and developing a marketing plan and promotional techniques. A discussion of media options looks at the advantages and…

  20. 50 Practical Promotion Ideas.

    ERIC Educational Resources Information Center

    Madeyski, Tom

    1997-01-01

    Includes 50 cost-effective ideas for promoting camp in the areas of recruiting new campers, encouraging returning campers, advertising strategies, printing brochures and other written materials, using photographs, targeting groups for camp facility rental, and effectively using the media. (LP)

  1. 17 CFR 229.404 - (Item 404) Transactions with related persons, promoters and certain control persons.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... presented in a registration statement filed pursuant to the Securities Act or the Exchange Act, information... 17 Commodity and Securities Exchanges 2 2013-04-01 2013-04-01 false (Item 404) Transactions with related persons, promoters and certain control persons. 229.404 Section 229.404 Commodity and...

  2. Elementary Teachers' Knowledge and Use of Interventions and Barriers to Promoting Student Self-Determination

    ERIC Educational Resources Information Center

    Cho, Hyun-Jeong; Wehmeyer, Michael; Kingston, Neal

    2011-01-01

    The No Child Left Behind Act (2001) and the Individuals with Disabilities Education Improvement Act (2004) emphasize accountability to improve student academic achievement. Promoting self-determination has been proposed as a means to achieving this outcome. Elementary teachers in 30 states were surveyed to measure (a) their perceived importance of…

  3. A Strong Step for Students: House Higher Education Bill Promotes Innovation and Student Success

    ERIC Educational Resources Information Center

    Duke, Amy-Ellen

    2008-01-01

    Last Thursday, the House of Representatives passed the College Opportunity and Affordability Act in a vote of 354-58. This legislation, H.R. 4137, moves Congress one step closer to the long-awaited reauthorization of the Higher Education Act of 1965, which governs federal student financial aid and other programs that promote access for low-income…

  4. Advocating for School Psychologists in Response to the APA's Proposed "Model Act for State Licensure of Psychologists"

    ERIC Educational Resources Information Center

    Skalski, Anastasia Kalamaros

    2009-01-01

    On March 6, 2009, the APA Model Licensure Act Task Force released its second draft of the policy document known as the proposed "Model Act for State Licensure of Psychologists". This policy document serves as guidance to state legislatures for how they should set up their psychology licensing laws. The general expectations promoted in the model…

  5. The Civil Rights Act and the Equal Employment Opportunity Commission. The Constitution Community: Contemporary United States (1968 to the Present).

    ERIC Educational Resources Information Center

    Simmons, Linda

    In 1964, Congress passed Public Law 82-352. This civil rights act forbade hiring, promoting, and firing discrimination based on sex or race. Title VII of the act created the Equal Employment Opportunity Commission (EEOC) to implement the law. Subsequent legislation expanded the role of the EEOC. Today, the EEOC enforces laws that prohibit…

  6. Equal Employment in Postsecondary HPERD. Administrative Guidelines for Compliance with Title VII and the Equal Pay Act.

    ERIC Educational Resources Information Center

    Nursall, John G.

    1989-01-01

    Outlined are key provisions, relevant to education, of Title VII of the Civil Rights Act of 1964 and the Equal Pay Act of 1963. Administrative guidelines to insure compliance are presented, as well as preventive measures that reduce vulnerability to charges of discrimination in hiring, promotion, and compensation. (IAH)

  7. 3 CFR - Presidential Determination Under Section 402 (c)(2)(A) of the Trade Act of 1974-Republic of Belarus

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ...)(A) of the Trade Act of 1974-Republic of Belarus Presidential Documents Other Presidential Documents...) of the Trade Act of 1974—Republic of Belarus Memorandum for the Secretary of State Pursuant to... with respect to Belarus will substantially promote the objectives of section 402. You are...

  8. 40 CFR 1508.2 - Act.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 32 2010-07-01 2010-07-01 false Act. 1508.2 Section 1508.2 Protection of Environment COUNCIL ON ENVIRONMENTAL QUALITY TERMINOLOGY AND INDEX § 1508.2 Act. Act means the National Environmental Policy Act, as amended (42 U.S.C. 4321, et seq.) which is also referred to as “NEPA.”...

  9. 77 FR 52066 - Sunshine Act Meeting

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-08-28

    ... to the Board on the appropriations request for FY 2014 (Resolution 2012-XXX) 4. Consider and act on... 2012-XXX) 6. Consider and act on whether to authorize an executive session of the Board Closed Session... 2012-XXX) 9. Public comment 10. Consider and act on other business 11. Consider and act on motion...

  10. 7 CFR 948.2 - Act.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... Regulating Handling Definitions § 948.2 Act. Act means Public Act No. 10 73d Congress, as amended and as reenacted and amended by the Agricultural Marketing Agreement Act of 1937, as amended (sections 1-19, 48 Stat. 31, as amended; 7 U.S.C. 601-674)....

  11. 7 CFR 959.2 - Act.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... Handling Definitions § 959.2 Act. Act means Public Act No. 10, 73d Congress, as amended and as reenacted and amended by the Agricultural Marketing Agreement Act of 1937, as amended (sections 1-19, 48 Stat. 31, as amended; 7 U.S.C. 601-674)....

  12. Michigan Minimum Wage: Act 154, Public Act of 1964, As Amended and Act 390, Public Act of 1978. Legal Modules for Vocational Cooperative Education.

    ERIC Educational Resources Information Center

    Western Michigan Univ., Kalamazoo.

    Intended for use by cooperative education program coordinators, this module deals with the rights of cooperative education program enrollees as they are specified by Michigan minimum wage legislation. Specifically, the module deals with two Michigan laws--Act 154 of Public Act of 1964, as amended and Act 390 of Public Act of 1978. Designed to be a…

  13. 76 FR 25665 - No Fear Act

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-05-05

    ... COMMISSION No Fear Act AGENCY: American Battle Monuments Commission. ACTION: Notice. SUMMARY: The American... FEAR Act), as implemented by the Office of Personnel Management (OPM) regulations at 5 CFR part 724... Retaliation Act of 2002,'' which is now known as the No FEAR Act. See Public Law 107-174, codified at 5...

  14. Acting Out; Theoretical and Clinical Aspects.

    ERIC Educational Resources Information Center

    Abt, Lawrence Edwin, Ed.; Weissman, Stuart L.

    The beneficial and harmful effects of acting out are studied in a series of short essays by numerous authors. Included are four articles on the theoretical and dynamic considerations of acting out, along with five clinical manifestations of acting out involving suicide and criminality in adolescents and adults. Special forms of harmful acting out…

  15. 7 CFR 953.2 - Act.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements and... Order Regulating Handling Definitions § 953.2 Act. Act means Public Act No. 10, 73d Congress, as amended and as re-enacted and amended by the Agricultural Marketing Agreement Act of 1937, as amended (7...

  16. 7 CFR 993.2 - Act.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements and... Regulating Handling Definitions § 993.2 Act. Act means Public Act No. 10, 73d Congress, as amended and reenacted and amended by the Agricultural Marketing Agreement Act of 1937, as amended (7 U.S.C. 601 et seq.)....

  17. 40 CFR 791.105 - Prohibited acts.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 31 2010-07-01 2010-07-01 true Prohibited acts. 791.105 Section 791.105 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) TOXIC SUBSTANCES CONTROL ACT (CONTINUED) DATA REIMBURSEMENT Prohibited Acts § 791.105 Prohibited acts. Failure to provide...

  18. Bicycle Safety: A Balancing Act.

    ERIC Educational Resources Information Center

    Cinque, Chris

    1989-01-01

    In an effort to reduce deaths and serious injuries among bicyclists, physicians and bicycling organizations are promoting safety skill classes. Children are at especially high risk of accidents and need proper training and education. Helmets and other protective gear are considered crucial equipment, and common sense and alertness are important.…

  19. 21 CFR 812.7 - Prohibition of promotion and other practices.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Prohibition of promotion and other practices. 812.7 Section 812.7 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES... promotion and other practices. A sponsor, investigator, or any person acting for or on behalf of a...

  20. 21 CFR 812.7 - Prohibition of promotion and other practices.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Prohibition of promotion and other practices. 812.7 Section 812.7 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES... promotion and other practices. A sponsor, investigator, or any person acting for or on behalf of a...

  1. 21 CFR 812.7 - Prohibition of promotion and other practices.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Prohibition of promotion and other practices. 812.7 Section 812.7 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES... promotion and other practices. A sponsor, investigator, or any person acting for or on behalf of a...

  2. 21 CFR 812.7 - Prohibition of promotion and other practices.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Prohibition of promotion and other practices. 812.7 Section 812.7 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES... promotion and other practices. A sponsor, investigator, or any person acting for or on behalf of a...

  3. Construction of gene expression system in hop (Humulus lupulus) lupulin gland using valerophenone synthase promoter.

    PubMed

    Okada, Yukio; Saeki, Kazuo; Inaba, Akira; Suda, Narushi; Kaneko, Takafumi; Ito, Kazutoshi

    2003-09-01

    The promoter region of the valerophenone synthase (VPS) gene was isolated from hop (Humulus lupulus). VPS, a member of the chalcone synthase (CHS) super-family, catalyzes the biosynthesis reaction of the hop resin that significantly accumulates in the cone's secretory gland called the "lupulin gland". The typical H-box and G-box sequences, which exist in many plants' CHS promoters and act as cis-elements for tissue specificity, UV-light induction, etc., were not found in the isolated VPS promoter, although the H-box-like sequence (CCTTACC, CCTAACC) and the core sequence (ACGT) of the G-box were observed. The transformation experiment using the VPS promoter-UIDA gene fusion revealed that the promoter acts not only in the lupulin gland but also in the glands of leaf and stem. On the other hand, the VPS promoter activity was not induced by UV-irradiation.

  4. Promoting health by addressing living conditions in Norwegian municipalities.

    PubMed

    Hagen, Susanne; Torp, Steffen; Helgesen, Marit; Fosse, Elisabeth

    2016-07-10

    Worldwide, inequalities in health are increasing, even in well-developed welfare states such as Norway, which in 2012, saw a new public health act take effect that enshrined equity in health as national policy and devolved to municipalities' responsibility to act on the social determinants of health. The act deems governance structures and "Health in All Policies" approaches as important steering mechanisms for local health promotion. The aim of this study is to investigate whether Norway's municipalities address living conditions - economic circumstances, housing, employment and educational factors - in local health promotion, and what factors are associated with doing so. All Norway's municipalities (n= 428) were included in this cross-sectional study, and both register and survey data were used and were subjected to descriptive and bi- and multivariate regression analyses. Eighty-two percent of the municipalities reported that they were capable of reducing inequalities in health. Forty percent of the municipalities defined living conditions as a main challenge in their local public health promotion, while 48% cited it as a main health promotion priority. Our study shows that defining living conditions as a main challenge is positively associated with size of municipality, and also its assessment of its own capability in reducing inequalities in health. The latter factor was also associated with actually prioritizing living conditions in health promotion, as was having established cross-sectorial working groups or inter-municipal collaboration related to local health promotion. This study underlines the importance of inter-sectoral collaboration to promote health and well-being.

  5. False memories for aggressive acts.

    PubMed

    Laney, Cara; Takarangi, Melanie K T

    2013-06-01

    Can people develop false memories for committing aggressive acts? How does this process compare to developing false memories for victimhood? In the current research we used a simple false feedback procedure to implant false memories for committing aggressive acts (causing a black eye or spreading malicious gossip) or for victimhood (receiving a black eye). We then compared these false memories to other subjects' true memories for equivalent events. False aggressive memories were all too easy to implant, particularly in the minds of individuals with a proclivity towards aggression. Once implanted, the false memories were indistinguishable from true memories for the same events, on several dimensions, including emotional content. Implications for aggression-related memory more generally as well as false confessions are discussed.

  6. Long-Acting Beta Agonists Enhance Allergic Airway Disease

    PubMed Central

    Knight, John M.; Mak, Garbo; Shaw, Joanne; Porter, Paul; McDermott, Catherine; Roberts, Luz; You, Ran; Yuan, Xiaoyi; Millien, Valentine O.; Qian, Yuping; Song, Li-Zhen; Frazier, Vincent; Kim, Choel; Kim, Jeong Joo; Bond, Richard A.; Milner, Joshua D.; Zhang, Yuan; Mandal, Pijus K.; Luong, Amber; Kheradmand, Farrah

    2015-01-01

    Asthma is one of the most common of medical illnesses and is treated in part by drugs that activate the beta-2-adrenoceptor (β2-AR) to dilate obstructed airways. Such drugs include long acting beta agonists (LABAs) that are paradoxically linked to excess asthma-related mortality. Here we show that LABAs such as salmeterol and structurally related β2-AR drugs such as formoterol and carvedilol, but not short-acting agonists (SABAs) such as albuterol, promote exaggerated asthma-like allergic airway disease and enhanced airway constriction in mice. We demonstrate that salmeterol aberrantly promotes activation of the allergic disease-related transcription factor signal transducer and activator of transcription 6 (STAT6) in multiple mouse and human cells. A novel inhibitor of STAT6, PM-242H, inhibited initiation of allergic disease induced by airway fungal challenge, reversed established allergic airway disease in mice, and blocked salmeterol-dependent enhanced allergic airway disease. Thus, structurally related β2-AR ligands aberrantly activate STAT6 and promote allergic airway disease. This untoward pharmacological property likely explains adverse outcomes observed with LABAs, which may be overcome by agents that antagonize STAT6. PMID:26605551

  7. Long-Acting Beta Agonists Enhance Allergic Airway Disease.

    PubMed

    Knight, John M; Mak, Garbo; Shaw, Joanne; Porter, Paul; McDermott, Catherine; Roberts, Luz; You, Ran; Yuan, Xiaoyi; Millien, Valentine O; Qian, Yuping; Song, Li-Zhen; Frazier, Vincent; Kim, Choel; Kim, Jeong Joo; Bond, Richard A; Milner, Joshua D; Zhang, Yuan; Mandal, Pijus K; Luong, Amber; Kheradmand, Farrah; McMurray, John S; Corry, David B

    2015-01-01

    Asthma is one of the most common of medical illnesses and is treated in part by drugs that activate the beta-2-adrenoceptor (β2-AR) to dilate obstructed airways. Such drugs include long acting beta agonists (LABAs) that are paradoxically linked to excess asthma-related mortality. Here we show that LABAs such as salmeterol and structurally related β2-AR drugs such as formoterol and carvedilol, but not short-acting agonists (SABAs) such as albuterol, promote exaggerated asthma-like allergic airway disease and enhanced airway constriction in mice. We demonstrate that salmeterol aberrantly promotes activation of the allergic disease-related transcription factor signal transducer and activator of transcription 6 (STAT6) in multiple mouse and human cells. A novel inhibitor of STAT6, PM-242H, inhibited initiation of allergic disease induced by airway fungal challenge, reversed established allergic airway disease in mice, and blocked salmeterol-dependent enhanced allergic airway disease. Thus, structurally related β2-AR ligands aberrantly activate STAT6 and promote allergic airway disease. This untoward pharmacological property likely explains adverse outcomes observed with LABAs, which may be overcome by agents that antagonize STAT6.

  8. The new Clean Air Act

    SciTech Connect

    Padmanabha, A.P. ); Olem, H. )

    1991-05-01

    This article is a title by title review of the new Clean Air Act and how it affects water quality and wastewater treatment. The bill provides for restoring and protecting lakes and rivers by reducing acid-rain-causing emissions and toxics from nonpoint-source runoff. Topics covered include urban smog, mobile sources, air toxics, acid rain, permits, ozone-depleting chemicals, enforcement, and the law's socio-economic impacts.

  9. Clean Air Act. Revision 5

    SciTech Connect

    Not Available

    1994-02-15

    This Reference Book contains a current copy of the Clean Air Act, as amended, and those regulations that implement the statute and appear to be most relevant to DOE activities. The document is provided to DOE and contractor staff for informational purposes only and should not be interpreted as legal guidance. This Reference Book has been completely revised and is current through February 15, 1994.

  10. SCADA Application for ACTS Technology

    NASA Technical Reports Server (NTRS)

    Fairbanks, Barry

    1992-01-01

    The results of a system level study done by Hughes Network Systems for NASA are presented. For the supervisory control and data acquisition (SCADA) application, use of Ka-band spot beam satellite technology associated with NASA's Advanced Communication Technology Satellite (ACTS) offers a reduction in Earth station antenna size and transmitter power that may translate into lower system costs. The approaches taken to determine commercial potential of the system are described.

  11. A Preview of Act 1.

    DTIC Science & Technology

    1981-05-01

    parallel processors. Our group is proposing to construct such a machine, called the Apiary [10 Implementation of Act I on an Apiary will require solving...load balancing and garbage collection. A preliminary simulation of the Apiary has been constructed by Jeff Schiller, using several Lisp Machines...Computation, MIT Lab for Computer Science report TR-197 [101 Carl Hewitt and Jeff Schiller, The Design of Apiary -0, 1980 Lisp Conference, Stanford

  12. The promotion of breastfeeding.

    PubMed

    Tuluhungwa, R R; Yung, W

    1979-01-01

    To reverse the current trend of a significant decline worldwide in breast feeding means reeducation of medical and health personnel as well as the general public. Programs to promote breast feeding require the commitment of governments, with support from various ministries including health, education, labor, community development and judiciary. Examples of what 3 developing countries--Jamaica, Colombia and Thailand--are doing to promote breast feeding are reported. A large scale breast feeding campaign was launched in Jamaica in October 1977. The 3 phases of the campaign were: 1) preliminary surveys and research and motivation of professional, voluntary and extension groups through training seminars, panel discussions, and meetings; 2) promotion of breast feeding via mass media and motivation of target groups by trained personnel; and 3) evaluation of the campaign. A survey undertaken in 1978 showed that the breast feeding messages had achieved the desired effect--more mothers practiced breast feeding. In Colombia the breast feeding campaign emphasized non-formal education through the use of games and pictures. A game is used which is usually initiated by a health worker in the waiting room of a health center and involves the mothers, the general public, and sometimes the professional personnel. Through reading and interpreting rhymed breast feeding messages, the participants exchange opinions and experiences. Before starting a campaign to encourage low-income urban and semi-urban mothers to breast feed, the National Food and Nutrition Committee of Thailand pretested slogans and posters designed for the promotion of breast feeding. Posters develpoed in accordance with the suggestions made by the women were tested among 126 pregnant and lactating women. The Committee decided which picture to print for low-income and rural audiences and which to print for middle-class audiences.

  13. Democracy Promotion in Oman

    DTIC Science & Technology

    2013-01-01

    succession process . The “Ruling Family Council” will meet to designate a successor within 3 days of Qaboos’s death. If it fails to select someone, it will...the Gulf is to increase democracy promotion programs designed to encourage timely and peaceful transitions to more representative forms of govern...stronger efforts toward reform supported by the United States could foster a more peaceful political transformation. This process should begin with the

  14. Publishing and academic promotion.

    PubMed

    Dixon, A K

    2009-09-01

    Clearly, academic endeavour has to be the single most important criterion for appointment to an academic position and for subsequent promotion. It is rare for excellence either in teaching or clinical practice to offset a poor publication record. However, the pressure to publish and gain related grant income can lead to problems in the normal academic pursuits of a department or institution. These and other related issues will be explored in this editorial.

  15. Overview of the ACT program

    NASA Technical Reports Server (NTRS)

    Davis, John G., Jr.

    1992-01-01

    NASA's Advanced Composites Program (ACT) was initiated in 1988. A National Research Announcement was issued to solicit innovative ideas that could significantly contribute to development and demonstration of an integrated technology data base and confidence level that permits cost-effective use of composite primary structures in transport aircraft. Fifteen contracts were awarded by the Spring of 1989 and the participants include commercial and military airframe manufacturers, materials developers and suppliers, universities, and government laboratories. The program approach is to develop materials, structural mechanics methodology, design concepts, and fabrication procedures that offer the potential to make composite structures cost-effective compared to aluminum structure. Goals for the ACT program included 30-50 percent weight reduction, 20-25 percent acquisition cost reduction, and provided the scientific basis for predicting materials and structures performance. This paper provides an overview of the ACT program status, plans, and selected technical accomplishments. Sixteen additional papers, which provide more detailed information on the research and development accomplishments, are contained in this publication.

  16. Bicycle Promotion Plan

    SciTech Connect

    Simone, G. A.

    1981-03-09

    The objective of this Bicycle Promotion Plan is to outline a set of recommendations and supporting strategies for implementation by the US DOE toward increased use of the bicycle for energy conservation. The recommendations are designed in such a way as to function in concert with: (1) bicycle programs administered by other Federal government agencies; and (2) related programs and activities already sponsored by DOE. The approach to preparation of the Plan involved a review of all current and planned bicycle promotion programs at the Federal level as well as a review of the array of lierature on the subject. The UniWorld project staff also interacted with several DOE program offices, in order to determine the extent to which they might appropriately contribute to the implementation of bicycle promotional efforts. A synthesis of all the information gathered was published in January of 1981 as a part of the project (The Bicycle Program Review). Based upon this information and an examination of the barriers to bicycle use identified by bicycle transportation specialists in the field, UniWorld developed a series of the most potentially effective recommendations and program strategies for implementation by DOE. The recommendations address activities that could be undertaken in conjunction with existing DOE programs, new developments that might be considered to fulfill critical needs in the field, and interagency efforts that DOE could play a role in.

  17. The dynamics of mobile promoters: Enhanced stability in promoter regions.

    PubMed

    Rabbani, Mahnaz; Wahl, Lindi M

    2016-10-21

    Mobile promoters are emerging as a new class of mobile genetic elements, first identified by examining prokaryote genome sequences, and more recently confirmed by experimental observations in bacteria. Recent datasets have identified over 40,000 putative mobile promoters in sequenced prokaryote genomes, however only one-third of these are in regions of the genome directly upstream from coding sequences, that is, in promoter regions. The presence of many promoter sequences in non-promoter regions is unexplained. Here we develop a general mathematical model for the dynamics of mobile promoters, extending previous work to capture the dynamics both within and outside promoter regions. From this general model, we apply rigorous model selection techniques to identify which parameters are statistically justified in describing the available mobile promoter data, and find best-fit values of these parameters. Our results suggest that high rates of horizontal gene transfer maintain the population of mobile promoters in promoter regions, and that once established at these sites, mobile promoters are rarely lost, but are commonly copied to other genomic regions. In contrast, mobile promoter copies in non-promoter regions are more numerous and more volatile, experiencing substantially higher rates of duplication, loss and diversification.

  18. Human Promoters Are Intrinsically Directional

    PubMed Central

    Duttke, Sascha H.C.; Lacadie, Scott A.; Ibrahim, Mahmoud M.; Glass, Christopher K.; Corcoran, David L.; Benner, Christopher; Heinz, Sven; Kadonaga, James T.; Ohler, Uwe

    2015-01-01

    Divergent transcription, in which reverse-oriented transcripts occur upstream of eukaryotic promoters in regions devoid of annotated genes, has been suggested to be a general property of active promoters. Here we show that the human basal RNA polymerase II transcriptional machinery and core promoter are inherently unidirectional, and that reverse-oriented transcripts originate from their own cognate reverse-directed core promoters. In vitro transcription analysis and mapping of nascent transcripts in cells revealed that sequences at reverse start sites are similar to those of their forward counterparts. The use of DNase I accessibility to define proximal promoter borders revealed that up to half of promoters are unidirectional and that unidirectional promoters are depleted at their upstream edges of reverse core promoter sequences and their associated chromatin features. Divergent transcription is thus not an inherent property of the transcription process, but rather the consequence of the presence of both forward- and reverse-directed core promoters. PMID:25639469

  19. The Americans with Disabilities Act: the impact on radiologic technologists and managers.

    PubMed

    Wedel, C S

    1993-01-01

    On July 26, 1990, President Bush signed the Americans With Disabilities Act (ADA) which prohibits discrimination on the basis of disability. The act is being cited as one of the most extensive changes in personnel law since the Civil Rights Act of 1964. The law will impact hiring, promotion, and retention practices in the U.S. work force. Popular press reports have focused on the hiring of disabled workers, but the author argues that retaining healthy workers who become disabled will be the major impact for radiology managers. This article discusses the ADA with a specific emphasis on the retention of disabled radiologic technologists.

  20. Eucalyptus growth promotion by endophytic Bacillus spp.

    PubMed

    Paz, I C P; Santin, R C M; Guimarães, A M; Rosa, O P P; Dias, A C F; Quecine, M C; Azevedo, J L; Matsumura, A T S

    2012-10-11

    Clonal eucalyptus plantings have increased in recent years; however, some clones with high production characteristics have vegetative propagation problems because of weak root and aerial development. Endophytic microorganisms live inside healthy plants without causing any damage to their hosts and can be beneficial, acting as plant growth promoters. We isolated endophytic bacteria from eucalyptus plants and evaluated their potential in plant growth promotion of clonal plantlets of Eucalyptus urophylla x E. grandis, known as the hybrid, E. urograndis. Eighteen isolates of E. urograndis, clone 4622, were tested for plant growth promotion using the same clone. These isolates were also evaluated for indole acetic acid production and their potential for nitrogen fixation and phosphate solubilization. The isolates were identified by partial sequencing of 16S rRNA. Bacillus subtilis was the most prevalent species. Several Bacillus species, including B. licheniformis and B. subtilis, were found for the first time as endophytes of eucalyptus. Bacillus sp strain EUCB 10 significantly increased the growth of the root and aerial parts of eucalyptus plantlets under greenhouse conditions, during the summer and winter seasons.

  1. The way forward: experiences of health promotion development in Thailand.

    PubMed

    Buasai, Supakorn; Kanchanachitra, Churnrurtai; Siwaraksa, Parichart

    2007-01-01

    A landmark in health promotion in Thailand came in 2001 with the launching of the Universal Health Coverage Scheme at the cost of approximately USD 2 billion a year. Another important event was the establishment of the Thai Health Promotion Foundation (ThaiHealth) as a health promotion funding mechanism that draws upon a 2 percent surcharge levied on alcohol and tobacco excise tax, approximately USD 50-60 million a year. The most significant institutional development is the promulgation of the National Health Act in 2007. The Act embraces the principle of human rights and key principles of the Ottawa Charter in 2005. It is a result of five years of extensive public dialogues on important health issues that enhanced public awareness and nation wide networking on health promotion. ThaiHealth regards itself as a catalyst for health promotion. The organisation collaborates with all sectors of the society, from the national to the grassroots level, and is the most notable organisation for health promotion in Thailand. ThaiHealth funds programs on health risks/issues such as alcohol, tobacco, accidents, exercise, as well as area or setting based programs, for example, school, work place, community, and programs that target specific population groups such as the youth, the elderly, Muslim community. The open grants program invites proposals from all kinds of organizations/groups interested in launching health promotion initiatives. The endeavour has started to bear fruit. Smoking and alcohol consumption rates have dropped and more people have become health conscious and do more exercise. However, much remains to be done as some population groups especially the youth have become susceptible to various kinds of health risks. This remarkable start must be sustained and reinforced by the continuation and expansion of knowledge generation and dissemination, relentless policy advocacy and creative public campaign, with a strong health promotion network as the most critical

  2. PROMOTIONS: PROper MOTION Software

    NASA Astrophysics Data System (ADS)

    Caleb Wherry, John; Sahai, R.

    2009-05-01

    We report on the development of a software tool (PROMOTIONS) to streamline the process of measuring proper motions of material in expanding nebulae. Our tool makes use of IDL's widget programming capabilities to design a unique GUI that is used to compare images of the objects from two epochs. The software allows us to first orient and register the images to a common frame of reference and pixel scale, using field stars in each of the images. We then cross-correlate specific morphological features in order to determine their proper motions, which consist of the proper motion of the nebula as a whole (PM-neb), and expansion motions of the features relative to the center. If the central star is not visible (quite common in bipolar nebulae with dense dusty waists), point-symmetric expansion is assumed and we use the average motion of high-quality symmetric pairs of features on opposite sides of the nebular center to compute PM-neb. This is then subtracted out to determine the individual movements of these and additional features relative to the nebular center. PROMOTIONS should find wide applicability in measuring proper motions in astrophysical objects such as the expanding outflows/jets commonly seen around young and dying stars. We present first results from using PROMOTIONS to successfully measure proper motions in several pre-planetary nebulae (transition objects between the red giant and planetary nebula phases), using images taken 7-10 years apart with the WFPC2 and ACS instruments on board HST. The authors are grateful to NASA's Undergradute Scholars Research Program (USRP) for supporting this research.

  3. Promoting healthy sleep.

    PubMed

    Price, Bob

    2016-03-09

    Nurses are accustomed to helping others with their sleep problems and dealing with issues such as pain that may delay or interrupt sleep. However, they may be less familiar with what constitutes a healthy night's sleep. This article examines what is known about the process and purpose of sleep, and examines the ways in which factors that promote wakefulness and sleep combine to help establish a normal circadian rhythm. Theories relating to the function of sleep are discussed and research is considered that suggests that sleep deficit may lead to metabolic risks, including heart disease, obesity, type 2 diabetes mellitus and several types of cancer.

  4. Fast-acting valve actuator

    DOEpatents

    Cho, Nakwon

    1980-01-01

    A fast-acting valve actuator utilizes a spring driven pneumatically loaded piston to drive a valve gate. Rapid exhaust of pressurized gas from the pneumatically loaded side of the piston facilitates an extremely rapid piston stroke. A flexible selector diaphragm opens and closes an exhaust port in response to pressure differentials created by energizing and de-energizing a solenoid which controls the pneumatic input to the actuator as well as selectively providing a venting action to one side of the selector diaphragm.

  5. 75 FR 29 - Privacy Act, Government in the Sunshine Act, Freedom of Information Act (“FOIA”), and Federal...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-01-04

    ... Information Act (``FOIA''), and Federal Election Campaign Act (``FECA'') Rules; Corrections AGENCY: Federal..., 5 U.S.C. 552, and the Federal Election Campaign Act (``FECA'') of 1971, as amended, 2 U.S.C. 431, et... requirements. 11 CFR Part 104 Campaign funds, Political committees and parties, Reporting and...

  6. [The basic plan to promote cancer control in Japan].

    PubMed

    Monden, Morito

    2013-05-01

    Cancer has been the leading cause of death in Japan since 1981. The Japanese government implemented the Comprehensive 10-year Strategy for Cancer Control in 1984, following which the Second- and Third-term Comprehensive 10-year Strategy for Cancer Control have been implemented every 10years to promote cancer research and disseminate high-quality cancer medical services. The Cancer Control Act was approved in June 2006, and the law has been implemented since April 2007. Based on this law, the Basic Plan to Promote Cancer Control program was discussed by the Cancer Control Promotion Council and approved by the Cabinet of Japan in June 2007. This plan was launched in June 2007, and covered 5 fiscal years from 2007 to 2011. It also provides a model for developing the Prefectural Plan to Promote Cancer Control. The Basic Plan needs to be updated at least every 5 years under the Cancer Control Act; therefore, the Phase Two Basic Plan was approved by the Japanese Cabinet in June 2012. Although the first plan was limited to medicine or medical care, the second plan was broadened to include social undertakings such as patient support in terms of job acquisition or student education for an indepth understanding of cancer. This paper includes the history of cancer control promotion in Japan and viewpoints on the basic plan for cancer control.

  7. Students Promoted Despite Test Failure

    ERIC Educational Resources Information Center

    Wakefield, Dara V.

    2012-01-01

    "No Child Left Behind" (NCLB) dictates students in Grades 3, 5, and 8 pass state tests to be promoted. Accordingly, most state education codes require students to pass reading and math exams for promotion. The majority of those who fail, however, appear to be promoted anyway. This article addresses core questions concerning the paradigm…

  8. TWEAK Promotes Peritoneal Inflammation

    PubMed Central

    Sanz, Ana Belen; Aroeira, Luiz Stark; Bellon, Teresa; del Peso, Gloria; Jimenez-Heffernan, Jose; Santamaria, Beatriz; Sanchez-Niño, Maria Dolores; Blanco-Colio, Luis Miguel; Lopez-Cabrera, Manuel; Ruiz-Ortega, Marta; Egido, Jesus; Selgas, Rafael; Ortiz, Alberto

    2014-01-01

    Peritoneal dialysis (PD) is complicated by peritonitis episodes that cause loss of mesothelium and eventually sclerosing peritonitis. An improved understanding of the molecular contributors to peritoneal injury and defense may increase the therapeutic armamentarium to optimize peritoneal defenses while minimizing peritoneal injury. There is no information on the expression and function of the cytokine TWEAK and its receptor Fn14 during peritoneal injury. Fn14 expression and soluble TWEAK levels were measured in human PD peritoneal effluent cells or fluids with or without peritonitis. Fn14 expression was also analyzed in peritoneal biopsies from PD patients. Actions of intraperitoneal TWEAK were studied in mice in vivo. sTWEAK levels were increased in peritoneal effluent in PD peritonitis. Effluent sTWEAK levels correlated with the number of peritoneal macrophages (r = 0.491, p = 0.002). Potential TWEAK targets that express the receptor Fn14 include mesothelial cells and macrophages, as demonstrated by flow cytometry of peritoneal effluents and by analysis of peritoneal biopsies. Peritoneal biopsy Fn14 correlated with mesothelial injury, fibrosis and inflammation, suggesting a potential deleterious effect of TWEAK/Fn14. In this regard, intraperitoneal TWEAK administration to mice promoted peritoneal inflammation characterized by increased peritoneal effluent MCP-1, Fn14 and Gr1+ macrophages, increased mesothelial Fn14, MCP-1 and CCL21 expression and submesothelial tissue macrophage recruitment. Taken together these data suggest that the TWEAK/Fn14 system may promote inflammation and tissue injury during peritonitis and PD. PMID:24599047

  9. ACTS Satellite Telemammography Network Experiments

    NASA Technical Reports Server (NTRS)

    Kachmar, Brian A.; Kerczewski, Robert J.

    2000-01-01

    The Satellite Networks and Architectures Branch of NASA's Glenn Research Center has developed and demonstrated several advanced satellite communications technologies through the Advanced Communications Technology Satellite (ACTS) program. One of these technologies is the implementation of a Satellite Telemammography Network (STN) encompassing NASA Glenn, the Cleveland Clinic Foundation. the University of Virginia, and the Ashtabula County Medical Center. This paper will present a look at the STN from its beginnings to the impact it may have on future telemedicine applications. Results obtained using the experimental ACTS satellite demonstrate the feasibility of Satellite Telemammography. These results have improved teleradiology processes and mammography image manipulation, and enabled advances in remote screening methodologies. Future implementation of satellite telemammography using next generation commercial satellite networks will be explored. In addition, the technical aspects of the project will be discussed, in particular how the project has evolved from using NASA developed hardware and software to commercial off the shelf (COTS) products. Development of asymmetrical link technologies was an outcome of this work. Improvements in the display of digital mammographic images, better understanding of end-to-end system requirements, and advances in radiological image compression were achieved as a result of the research. Finally, rigorous clinical medical studies are required for new technologies such as digital satellite telemammography to gain acceptance in the medical establishment. These experiments produced data that were useful in two key medical studies that addressed the diagnostic accuracy of compressed satellite transmitted digital mammography images. The results of these studies will also be discussed.

  10. Uproar over Milk Substitutes Act.

    PubMed

    1993-11-15

    Health policy activists lobbied 7 years for the Infant Milk Substitutes, Feeding Bottles and Infant Food Bill. Proponents of the bill say that it basically curtails unethical marketing practices, not the sales of baby foods, and argue that it was conceived to reduce the trend of mothers over-diluting commercial milk in order to reduce household expenses as well as stem the potential erosion of knowledge on locally available weaning foods. Even though the bill will become an Act only after its rules and regulations have been finalized, the government has already banned baby food advertisements on television and in other electronic media under its control. Women's groups now argue that the bill tends to focus almost exclusively upon the welfare of children and compromises the position of women who can not lactate adequately. Moreover, they hold that the bill may be used to compel wives to stay out of the formal workforce so that they may feed their babies. The intention of the bill may be meaningless without complementary legislation addressing the problems of working mothers. Specifically, amendments to the Maternity Benefits Act of 1961 would extend maternity leave to 4 months after delivery and lengthen the duration of nursing breaks. It is, however, feared that these changes may reduce employment prospects for women.

  11. 76 FR 14668 - Sunshine Act Meeting

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-03-17

    ..., on motion of Director Thomas J. Curry (Appointive), seconded by Director John G. Walsh (Acting Comptroller of the Currency), concurred in by Director John E. Bowman (Acting Director, Office of...

  12. 76 FR 27643 - Sunshine Act Meeting

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-05-12

    ... motion of Director John E. Bowman (Acting Director, Office of Thrift Supervision), seconded by Director Thomas J. Curry (Appointive), concurred in by Director John G. Walsh (Acting Comptroller of the...

  13. 76 FR 20986 - Sunshine Act Meeting

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-04-14

    ..., on motion of Director John E. Bowman (Acting Director, Office of Thrift Supervision), seconded by Director John G. Walsh (Acting Comptroller of the Currency), concurred in by Vice Chairman Martin...

  14. 75 FR 69444 - Sunshine Act Meeting

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-11-12

    ..., on motion of Director John E. Bowman (Acting Director, Office of Thrift Supervision), seconded by Director John G. Walsh (Acting Comptroller of the Currency), concurred in by Vice Chairman Martin...

  15. 7 CFR 926.2 - Act.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements and Orders; Fruits, Vegetables, Nuts), DEPARTMENT OF AGRICULTURE DATA COLLECTION, REPORTING AND RECORDKEEPING REQUIREMENTS APPLICABLE TO CRANBERRIES NOT SUBJECT TO THE CRANBERRY MARKETING ORDER § 926.2 Act. Act...

  16. 75 FR 62613 - Sunshine Act Meeting

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-10-12

    ... securities (ABS) to perform a review of the assets underlying the ABS and disclose information relating to... 15E(s)(4)(A) of the Exchange Act as added by Section 932 of the Act, which requires an ABS issuer...

  17. The Penal Code (Amendment) Act 1989 (Act A727), 1989.

    PubMed

    1989-01-01

    In 1989, Malaysia amended its penal code to provide that inducing an abortion is not an offense if the procedure is performed by a registered medical practitioner who has determined that continuation of the pregnancy would risk the life of the woman or damage her mental or physical health. Additional amendments include a legal description of the conditions which constitute the act of rape. Among these conditions is intercourse with or without consent with a woman under the age of 16. Malaysia fails to recognize rape within a marriage unless the woman is protected from her husband by judicial decree or is living separately from her husband according to Muslim custom. Rape is punishable by imprisonment for a term of 5-20 years and by whipping.

  18. 29 CFR 4.103 - The Act.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 29 Labor 1 2010-07-01 2010-07-01 true The Act. 4.103 Section 4.103 Labor Office of the Secretary of Labor LABOR STANDARDS FOR FEDERAL SERVICE CONTRACTS Application of the McNamara-O'Hara Service Contract Act Introductory § 4.103 The Act. The McNamara-O'Hara Service Contract Act of 1965 (Pub. L....

  19. 29 CFR 4.103 - The Act.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 29 Labor 1 2014-07-01 2013-07-01 true The Act. 4.103 Section 4.103 Labor Office of the Secretary of Labor LABOR STANDARDS FOR FEDERAL SERVICE CONTRACTS Application of the McNamara-O'Hara Service Contract Act Introductory § 4.103 The Act. The McNamara-O'Hara Service Contract Act of 1965 (Pub. L....

  20. 12 CFR 619.9000 - The Act.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 12 Banks and Banking 6 2010-01-01 2010-01-01 false The Act. 619.9000 Section 619.9000 Banks and Banking FARM CREDIT ADMINISTRATION FARM CREDIT SYSTEM DEFINITIONS § 619.9000 The Act. The Farm Credit Act of 1971; Pub. L. 92-181 and amendments....

  1. 7 CFR 29.13 - The act.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false The act. 29.13 Section 29.13 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing... INSPECTION Regulations Definitions § 29.13 The act. The Tobacco Inspection Act, approved August 23, 1935....

  2. 75 FR 41908 - Sunshine Act Meeting

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-07-19

    ... and rule and form amendments under the Investment Company Act of 1940, the Securities Act of 1933, and the Securities Exchange Act of 1934, to reform the regulation of distribution fees paid by registered open-end management investment companies (``funds''). The recommended proposal would provide a...

  3. 43 CFR 4770.1 - Prohibited acts.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... HORSES AND BURROS Prohibited Acts, Administrative Remedies, and Penalties § 4770.1 Prohibited acts. The following acts are prohibited: (a) Maliciously or negligently injuring or harassing a wild horse or burro; (b) Removing or attempting to remove a wild horse or burro from the public lands...

  4. 16 CFR 305.4 - Prohibited acts.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... UNDER THE ENERGY POLICY AND CONSERVATION ACT (âAPPLIANCE LABELING RULEâ) General § 305.4 Prohibited acts... part with a marking, label, hang tag, or energy fact sheet which conforms to the provisions of the Act... or render illegible any marking or label required to be provided with such product by this part....

  5. 77 FR 42513 - Sunshine Act Meetings Notice

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-07-19

    ... business. 6. Public comment. 7. Consider and act on motion to adjourn meeting. Audit Committee 1. Approval... Corporation. 8. Consider and act on motion to adjourn the meeting. Finance Committee 1. Approval of agenda. 2... other business. 6. Consider and act on motion to adjourn the meeting. Operations & Regulations...

  6. 78 FR 13472 - Freedom of Information Act

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-02-28

    ... CFR Part 4 Freedom of Information Act AGENCY: Federal Trade Commission (FTC). ACTION: Final rule... information for the filing of initial Freedom of Information Act (``FOIA'') requests; clarifying agency..., Freedom of Information Act. For the reasons set forth in the preamble, the Federal Trade Commission...

  7. ACT National Curriculum Survey[R], 2009

    ERIC Educational Resources Information Center

    ACT, Inc., 2009

    2009-01-01

    The ACT National Curriculum Survey is a one-of-a-kind nationwide survey of educational practices and expectations conducted by ACT every 3 to 5 years. ACT surveys thousands of middle school/junior high school, secondary, and postsecondary teachers in English/writing, reading (including English language arts and social studies teachers),…

  8. 75 FR 57330 - Community Reinvestment Act

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-09-20

    ... Office of Thrift Supervision Community Reinvestment Act AGENCY: Office of Thrift Supervision (OTS... collection. Title of Proposal: Community Reinvestment Act. OMB Number: 1550-0012. Form Number: N/A. Description: The Community Reinvestment Act regulation requires the OTS, as well as the Office of...

  9. 75 FR 44852 - Community Reinvestment Act Sunshine

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-07-29

    ... Office of Thrift Supervision Community Reinvestment Act Sunshine AGENCY: Office of Thrift Supervision... collection. Title of Proposal: Community Reinvestment Act Sunshine. OMB Number: 1550-0105. Form Number: N/A... agreements that are in fulfillment of the Community Reinvestment Act of 1977 to be disclosed to the...

  10. Academic Development Is a Creative Act

    ERIC Educational Resources Information Center

    Budge, Kylie; Clarke, Angela

    2012-01-01

    This paper argues that academic development is a creative act. Creative acts have potential to inspire, critique, inform and in many cases to change. The creativity literature identifies a number of core features of creative acts that assist in developing independent creative practitioners. Those features are observing, attending to relationships,…

  11. 12 CFR 268.203 - Rehabilitation Act.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Rehabilitation Act. 268.203 Section 268.203... Rehabilitation Act. (a) Model employer. The Board shall be a model employer of individuals with disabilities. The... Rehabilitation Act of 1973, as amended (29 U.S.C. 791), has been violated in a complaint alleging...

  12. 29 CFR 1614.203 - Rehabilitation Act.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 29 Labor 4 2010-07-01 2010-07-01 false Rehabilitation Act. 1614.203 Section 1614.203 Labor... EMPLOYMENT OPPORTUNITY Provisions Applicable to Particular Complaints § 1614.203 Rehabilitation Act. (a... Rehabilitation Act of 1973, as amended (29 U.S.C. 791), has been violated in a complaint alleging...

  13. 75 FR 7312 - No FEAR Act Notice

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-02-18

    ... No FEAR Act Notice Summary: 5 CFR part 724.202 requires that each Federal agency provide notice to... notice in the Federal Register. No FEAR Act Notice On May 15, 2002, Congress enacted the Notification and Federal Employee Antidiscrimination and Retaliation Act of 2002, which is now known as the No FEAR...

  14. 77 FR 27532 - No FEAR Act Notice

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-05-10

    ... FOR AFGHANISTAN RECONSTRUCTION No FEAR Act Notice AGENCY: Special Inspector General for Afghanistan... Reconstruction's (SIGAR) ``No FEAR Act Notice'' Federal Register publication obligations, as required by the... FEAR) Act and by the Office of Personnel Management implementing regulations at 5 CFR 724.202, to...

  15. 78 FR 17471 - Privacy Act of 1974

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-03-21

    ... Internal Revenue Service Privacy Act of 1974 AGENCY: Internal Revenue Service, Treasury. ACTION: IRS notice...) and the Congressional committees responsible for oversight of the Privacy Act in accordance with the Privacy Act of 1974, OMB Guidelines on the Conduct of Matching Programs (54 FR 25818, June 19, 1989),...

  16. 31 CFR 0.216 - Privacy Act.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 31 Money and Finance: Treasury 1 2013-07-01 2013-07-01 false Privacy Act. 0.216 Section 0.216... RULES OF CONDUCT Rules of Conduct § 0.216 Privacy Act. Employees involved in the design, development, operation, or maintenance of any system of records or in maintaining records subject to the Privacy Act...

  17. 75 FR 61994 - Privacy Act; Implementation

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-10-07

    ... Office of the Secretary 31 CFR Part 1 RIN 1505-AC25 Privacy Act; Implementation AGENCY: Office of Foreign... requirements of the Privacy Act of 1974, as amended, the Department of the Treasury is amending its regulations... records by revising the number and title of the Privacy Act system of records for which an exemption...

  18. 76 FR 71293 - Privacy Act; Implementation

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-11-17

    ... Office of the Secretary 31 CFR Part 1 RIN 1505-AC37 Privacy Act; Implementation AGENCY: Office of the Secretary, Treasury. ACTION: Proposed rule. SUMMARY: In accordance with the requirements of the Privacy Act... Identification Number Records'' from certain provisions of the Privacy Act. DATES: Comments must be received...

  19. 31 CFR 0.216 - Privacy Act.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 31 Money and Finance: Treasury 1 2012-07-01 2012-07-01 false Privacy Act. 0.216 Section 0.216... RULES OF CONDUCT Rules of Conduct § 0.216 Privacy Act. Employees involved in the design, development, operation, or maintenance of any system of records or in maintaining records subject to the Privacy Act...

  20. 31 CFR 0.216 - Privacy Act.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 31 Money and Finance: Treasury 1 2010-07-01 2010-07-01 false Privacy Act. 0.216 Section 0.216... RULES OF CONDUCT Rules of Conduct § 0.216 Privacy Act. Employees involved in the design, development, operation, or maintenance of any system of records or in maintaining records subject to the Privacy Act...

  1. 77 FR 57015 - Privacy Act; Implementation

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-09-17

    ... of the Secretary 32 CFR Part 319 Privacy Act; Implementation AGENCY: Defense Intelligence Agency, DoD... that have been previously claimed for the records in another Privacy Act system of records. DIA is updating the DIA Privacy Act Program by adding the (k)(2) and (k)(5) exemptions to accurately describe...

  2. 31 CFR 0.216 - Privacy Act.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 31 Money and Finance: Treasury 1 2011-07-01 2011-07-01 false Privacy Act. 0.216 Section 0.216... RULES OF CONDUCT Rules of Conduct § 0.216 Privacy Act. Employees involved in the design, development, operation, or maintenance of any system of records or in maintaining records subject to the Privacy Act...

  3. 75 FR 65229 - Privacy Act; Implementation

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-10-22

    ... Office of the Secretary 31 CFR Part 1 RIN 1505-AC26 Privacy Act; Implementation AGENCY: Departmental... of the Privacy Act of 1974, as amended, the Department of the Treasury is revising the title of an... FURTHER INFORMATION CONTACT: Dale Underwood, Privacy Act officer, Department of the Treasury,...

  4. 31 CFR 0.216 - Privacy Act.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 31 Money and Finance: Treasury 1 2014-07-01 2014-07-01 false Privacy Act. 0.216 Section 0.216... RULES OF CONDUCT Rules of Conduct § 0.216 Privacy Act. Employees involved in the design, development, operation, or maintenance of any system of records or in maintaining records subject to the Privacy Act...

  5. 78 FR 63528 - Sunshine Act Meeting

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-10-24

    ... COMMISSION Sunshine Act Meeting Notice is hereby given, pursuant to the provisions of the Government in the Sunshine Act, Public Law 94-409, that the Securities and Exchange Commission will hold an Open Meeting on... sale of securities through crowdfunding pursuant to Section 4(a)(6) of the Securities Act of 1933,...

  6. 45 CFR 670.4 - Prohibited acts.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... ANTARCTIC ANIMALS AND PLANTS Prohibited Acts, Exceptions § 670.4 Prohibited acts. Unless a permit has been... taken in violation of the Act. (e) Introduction of non-indigenous animals and plants into Antarctica. It is unlawful for any person to introduce into Antarctica any animal or plant which is not...

  7. 45 CFR 670.4 - Prohibited acts.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... ANTARCTIC ANIMALS AND PLANTS Prohibited Acts, Exceptions § 670.4 Prohibited acts. Unless a permit has been... taken in violation of the Act. (e) Introduction of non-indigenous animals and plants into Antarctica. It is unlawful for any person to introduce into Antarctica any animal or plant which is not...

  8. 45 CFR 670.4 - Prohibited acts.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... ANTARCTIC ANIMALS AND PLANTS Prohibited Acts, Exceptions § 670.4 Prohibited acts. Unless a permit has been... taken in violation of the Act. (e) Introduction of non-indigenous animals and plants into Antarctica. It is unlawful for any person to introduce into Antarctica any animal or plant which is not...

  9. 45 CFR 670.4 - Prohibited acts.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... ANTARCTIC ANIMALS AND PLANTS Prohibited Acts, Exceptions § 670.4 Prohibited acts. Unless a permit has been... taken in violation of the Act. (e) Introduction of non-indigenous animals and plants into Antarctica. It is unlawful for any person to introduce into Antarctica any animal or plant which is not...

  10. 45 CFR 670.4 - Prohibited acts.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... ANTARCTIC ANIMALS AND PLANTS Prohibited Acts, Exceptions § 670.4 Prohibited acts. Unless a permit has been... taken in violation of the Act. (e) Introduction of non-indigenous animals and plants into Antarctica. It is unlawful for any person to introduce into Antarctica any animal or plant which is not...

  11. 3 CFR - The Endangered Species Act

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 3 The President 1 2010-01-01 2010-01-01 false The Endangered Species Act Presidential Documents Other Presidential Documents Memorandum of March 3, 2009 The Endangered Species Act Memorandum for the Heads of Executive Departments and Agencies The Endangered Species Act (ESA), 16 U.S.C. 1531 et...

  12. 77 FR 25168 - Sunshine Act Meeting

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-04-27

    ... Arrest and Conviction Records in Employment Decisions under Title VII of the Civil Rights Act of 1964... COMMISSION Sunshine Act Meeting AGENCY HOLDING THE MEETING: Equal Employment Opportunity Commission. FEDERAL... with Disabilities Act, as amended has been removed from the Agenda. CONTACT PERSON FOR MORE...

  13. 76 FR 35866 - Sunshine Act Meeting Notice

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-06-20

    ... Doc No: 2011-15326] U.S. ELECTION ASSISTANCE COMMISSION Sunshine Act Meeting Notice AGENCY: U.S.... SUPPLEMENTARY INFORMATION: Pursuant to the Federal Advisory Committee Act, 5 U.S.C. App., notice is hereby given... available at http://vote.nist.gov . The TGDC was established pursuant to 42 U.S.C. 15361, to act in...

  14. 75 FR 61035 - Community Reinvestment Act Regulations

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-10-04

    ... Education loan program; or (2) any private education loan as defined in the Truth in Lending Act, including... expenses,'' each of which is defined in the HEOA in the context of the Truth in Lending Act (TILA). Section... the Truth in Lending Act, as added by section 1011 of the HEOA. In turn, the HEOA defines a...

  15. 12 CFR 619.9000 - The Act.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 12 Banks and Banking 6 2011-01-01 2011-01-01 false The Act. 619.9000 Section 619.9000 Banks and Banking FARM CREDIT ADMINISTRATION FARM CREDIT SYSTEM DEFINITIONS § 619.9000 The Act. The Farm Credit Act of 1971; Pub. L. 92-181 and amendments....

  16. 7 CFR 29.13 - The act.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false The act. 29.13 Section 29.13 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing... INSPECTION Regulations Definitions § 29.13 The act. The Tobacco Inspection Act, approved August 23, 1935....

  17. 12 CFR 619.9000 - The Act.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 12 Banks and Banking 7 2014-01-01 2014-01-01 false The Act. 619.9000 Section 619.9000 Banks and Banking FARM CREDIT ADMINISTRATION FARM CREDIT SYSTEM DEFINITIONS § 619.9000 The Act. The Farm Credit Act of 1971; Pub. L. 92-181 and amendments....

  18. 29 CFR 401.17 - Act.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 29 Labor 2 2010-07-01 2010-07-01 false Act. 401.17 Section 401.17 Labor Regulations Relating to Labor OFFICE OF LABOR-MANAGEMENT STANDARDS, DEPARTMENT OF LABOR LABOR-MANAGEMENT STANDARDS MEANING OF TERMS USED IN THIS SUBCHAPTER § 401.17 Act. Act means the Labor-Management Reporting and Disclosure...

  19. The 1944 Education Act and Outdoor Education: From Policy to Practice.

    ERIC Educational Resources Information Center

    Cook, Lynn

    1999-01-01

    Examines the aspects of the 1944 Education Act that promoted outdoor education and the changes as the Bill passed through parliament. Reviews the practice of outdoor education and how Local Education Authorities (LEA) responded to the legislation. Demonstrates how the outdoors was incorporated into children's education as a response to social and…

  20. The Impact of the Native American Languages Act on Public School Curriculum: A Different View.

    ERIC Educational Resources Information Center

    Littlejohn, Jim

    2000-01-01

    Responds to Scott Ferrin's argument (EJ 583 598) and, as the former policy director for the U.S. Office for Civil Rights (OCR), decries both Ferrin and OCR for their relentless and, in his view, unwarranted promotion of bilingual education. Contends that no civil-rights laws, including the Native American Languages Act (NALA), support or allow…