Science.gov

Sample records for calb2 promoter acts

  1. Act To Promote Adult Education.

    ERIC Educational Resources Information Center

    1970

    An act of the German Lower Saxony Parliament to promote adult education is presented. It has 24 general provisions relating to the following: purpose of adult education, principle for promotion, conditions for promotions of establishments, independence of adult education, prerequisites and form of acknowledgement of entitlement to promotion,…

  2. Identification of cis- and trans-acting elements regulating calretinin expression in mesothelioma cells

    PubMed Central

    Kresoja-Rakic, Jelena; Kapaklikaya, Esra; Ziltener, Gabriela; Dalcher, Damian; Santoro, Raffaella; Christensen, Brock C.; Johnson, Kevin C.; Schwaller, Beat; Weder, Walter; Stahel, Rolf A.; Felley-Bosco, Emanuela

    2016-01-01

    Calretinin (CALB2) is a diagnostic marker for epithelioid mesothelioma. It is also a prognostic marker since patients with tumors expressing high calretinin levels have better overall survival. Silencing of calretinin decreases viability of epithelioid mesothelioma cells. Our aim was to elucidate mechanisms regulating calretinin expression in mesothelioma. Analysis of calretinin transcript and protein suggested a control at the mRNA level. Treatment with 5-aza-2′-deoxycytidine and analysis of TCGA data indicated that promoter methylation is not likely to be involved. Therefore, we investigated CALB2 promoter by analyzing ~1kb of genomic sequence surrounding the transcription start site (TSS) + 1 using promoter reporter assay. Deletion analysis of CALB2 proximal promoter showed that sequence spanning the −161/+80bp region sustained transcriptional activity. Site-directed analysis identified important cis-regulatory elements within this −161/+80bp CALB2 promoter. EMSA and ChIP assays confirmed binding of NRF-1 and E2F2 to the CALB2 promoter and siRNA knockdown of NRF-1 led to decreased expression of calretinin. Cell synchronization experiment showed that calretinin expression was cell cycle regulated with a peak of expression at G1/S phase. This study provides the first insight in the regulation of CALB2 expression in mesothelioma cells. PMID:26848772

  3. Spenito and Split ends act redundantly to promote Wingless signaling.

    PubMed

    Chang, Jinhee L; Lin, Hua V; Blauwkamp, Timothy A; Cadigan, Ken M

    2008-02-01

    Wingless (Wg)/Wnt signaling directs a variety of cellular processes during animal development by promoting the association of Armadillo/beta-catenin with TCFs on Wg-regulated enhancers (WREs). Split ends (Spen), a nuclear protein containing RNA recognition motifs (RRMs) and a SPOC domain, is required for optimal Wg signaling in several fly tissues. In this report, we demonstrate that Spenito (Nito), the only other fly protein containing RRMs and a SPOC domain, acts together with Spen to positively regulate Wg signaling. The partial defect in Wg signaling observed with spen RNAi was enhanced by simultaneous knockdown of nito while it was rescued by expression of nito in wing imaginal discs. In cell culture, depletion of both factors causes a greater defect in the activation of several Wg targets than RNAi of either spen or nito alone. These nuclear proteins are not required for Armadillo stabilization or the recruitment of TCF and Armadillo to a WRE. Loss of Wg target gene activation in cells depleted for spen and nito was not dependent on the transcriptional repressor Yan or Suppressor of Hairless, two previously identified targets of Spen. We propose that Spen and Nito act redundantly downstream of TCF/Armadillo to activate many Wg transcriptional targets.

  4. The Race Relations (Amendment) Act 2000: A Renewed Opportunity To Promote Race Equality in Schools.

    ERIC Educational Resources Information Center

    Garg, Samidha

    2002-01-01

    Discusses the potential of Great Britain's Race Relations Act 2000 to promote equality in education, noting how schools can make the best use of the act to improve their policies and practice (e.g., eliminate unlawful racial discrimination, promote equal opportunities, promote good relations between diverse persons, and assess and monitor the…

  5. Promoting Prevention Through the Affordable Care Act: Workplace Wellness

    PubMed Central

    Roffenbender, Jason S.; Goetzel, Ron Z.; Millard, Francois; Wildenhaus, Kevin; DeSantis, Charles; Novelli, William

    2012-01-01

    Public health in the United States can be improved by building workplace “cultures of health” that support healthy lifestyles. The Affordable Care Act (ACA), which includes the Prevention and Public Health Fund, will support a new focus on prevention and wellness, offering opportunities to strengthen the public’s health through workplace wellness initiatives. This article describes the opportunity the ACA provides to improve worker wellness. PMID:23237245

  6. STAT1 acts as a tumor promoter for leukemia development.

    PubMed

    Kovacic, Boris; Stoiber, Dagmar; Moriggl, Richard; Weisz, Eva; Ott, René G; Kreibich, Rita; Levy, David E; Beug, Hartmut; Freissmuth, Michael; Sexl, Veronika

    2006-07-01

    The tumor suppressor STAT1 is considered a key regulator of the surveillance of developing tumors. Here, we describe an unexpected tumor-promoting role for STAT1 in leukemia. STAT1(-/-) mice are partially protected from leukemia development, and STAT1(-/-) tumor cells induce leukemia in RAG2(-/-) and immunocompetent mice with increased latency. The low MHC class I protein levels of STAT1(-/-) tumor cells enable efficient NK cell lysis and account for the enhanced tumor clearance. Strikingly, STAT1(-/-) tumor cells acquire increased MHC class I expression upon leukemia progression. These findings define STAT1 as a tumor promoter in leukemia development. Furthermore, we describe the upregulation of MHC class I expression as a general mechanism that allows for the escape of hematopoietic malignancies from immune surveillance.

  7. PAK promotes morphological changes by acting upstream of Rac.

    PubMed Central

    Obermeier, A; Ahmed, S; Manser, E; Yen, S C; Hall, C; Lim, L

    1998-01-01

    The serine/threonine kinase p21-activated kinase (PAK) has been implicated as a downstream effector of the small GTPases Rac and Cdc42. While these GTPases evidently induce a variety of morphological changes, the role(s) of PAK remains elusive. Here we report that overexpression of betaPAK in PC12 cells induces a Rac phenotype, including cell spreading/membrane ruffling, and increased lamellipodia formation at growth cones and shafts of nerve growth factor-induced neurites. These effects are still observed in cells expressing kinase-negative or Rac/Cdc42 binding-deficient PAK mutants, indicating that kinase- and p21-binding domains are not involved. Furthermore, lamellipodia formation in all cell lines, including those expressing Rac binding-deficient PAK, is inhibited significantly by dominant-negative RacN17. Equal inhibition is achieved by blocking PAK interaction with the guanine nucleotide exchange factor PIX using a specific N-terminal PAK fragment. We conclude that PAK, via its N-terminal non-catalytic domain, acts upstream of Rac mediating lamellipodia formation through interaction with PIX. PMID:9687501

  8. ActA Promotes Listeria monocytogenes Aggregation, Intestinal Colonization and Carriage

    PubMed Central

    Travier, Laetitia; Guadagnini, Stéphanie; Gouin, Edith; Dufour, Alexandre; Chenal-Francisque, Viviane; Cossart, Pascale; Olivo-Marin, Jean-Christophe; Ghigo, Jean-Marc; Disson, Olivier; Lecuit, Marc

    2013-01-01

    Listeria monocytogenes (Lm) is a ubiquitous bacterium able to survive and thrive within the environment and readily colonizes a wide range of substrates, often as a biofilm. It is also a facultative intracellular pathogen, which actively invades diverse hosts and induces listeriosis. So far, these two complementary facets of Lm biology have been studied independently. Here we demonstrate that the major Lm virulence determinant ActA, a PrfA-regulated gene product enabling actin polymerization and thereby promoting its intracellular motility and cell-to-cell spread, is critical for bacterial aggregation and biofilm formation. We show that ActA mediates Lm aggregation via direct ActA-ActA interactions and that the ActA C-terminal region, which is not involved in actin polymerization, is essential for aggregation in vitro. In mice permissive to orally-acquired listeriosis, ActA-mediated Lm aggregation is not observed in infected tissues but occurs in the gut lumen. Strikingly, ActA-dependent aggregating bacteria exhibit an increased ability to persist within the cecum and colon lumen of mice, and are shed in the feces three order of magnitude more efficiently and for twice as long than bacteria unable to aggregate. In conclusion, this study identifies a novel function for ActA and illustrates that in addition to contributing to its dissemination within the host, ActA plays a key role in Lm persistence within the host and in transmission from the host back to the environment. PMID:23382675

  9. Characterization of cis-acting elements residing in the chitinase promoter of Bacillus pumilus SG2.

    PubMed

    Heravi, K Morabbi; Shali, A; Naghibzadeh, N; Ahmadian, G

    2014-05-01

    Bacillus pumilus SG2 is a chitinolytic bacterium that produces two chitinases, namely ChiS and ChiL. The chiS and chiL genes are consecutively expressed under a common promoter. Regulation of the chiS and chiL genes is under the control of carbon catabolite repression (CCR) in B. pumilus. This study aimed to investigate the cis-acting elements of the chitinase promoter. For this purpose, we transferred the chiS gene along with its specific promoter to Bacillus subtilis as a host. Primer extension analysis revealed two transcription start sites located 287 and 65 bp upstream of the chiS start codon. The distal promoter was highly compatible with the consensus sequence of the σ(A)-type promoters in B. subtilis, whereas the proximal promoter sequence showed less similarity to the σ(A)-type consensus sequence. A catabolite responsive element (cre), which is required for CCR in Bacillus species, was found to be 136 to 123 bp upstream of the chiS start codon. Interestingly, this cre site was located upstream of the -35 of the proximal promoter and downstream of the distal promoter. Deletion of this cre site sequence rendered the chiS expression constitutive.

  10. Implementing the Affordable Care Act: Promoting Competition in the Individual Marketplaces.

    PubMed

    Cusano, David; Lucia, Kevin

    2016-02-01

    A main goal of the Affordable Care Act is to provide Americans with access to affordable coverage in the individual market, achieved in part by pro­moting competition among insurers on premium price and value. One primary mechanism for meeting that goal is the establishment of new individual health insurance marketplaces where consumers can shop for, compare, and purchase plans, with subsidies if they are eligible. In this issue brief, we explore how the Affordable Care Act is influencing competition in the individual marketplaces in four states--Kansas, Nevada, Rhode Island, and Washington. Strategies include: educating consumers and providing coverage information in one place to ease decision-making; promoting competition among insurers; and ensuring a level playing field for premium rate development through the rate review process.

  11. The Pain Relief Promotion Act of 1999: a serious threat to palliative care.

    PubMed

    Orentlicher, D; Caplan, A

    2000-01-12

    Recent educational efforts in the US medical community have begun to address the critical issue of palliative care for terminally ill patients. However, a newly introduced bill in Congress, the Pain Relief Promotion Act of 1999 (PRPA), could dramatically hinder these efforts if enacted. The act criminally punishes the use of controlled substances to cause-or assist in causing-a patient's death. The primary purposes of PRPA are to override the physician-assisted suicide law currently in effect in Oregon and prohibit other states from enacting similar laws. The act also includes valuable provisions for better research and education in palliative care, but the benefits of those provisions are outweighed by the punitive sections of the act. Under PRPA, the quality of palliative care in the United States could be compromised when physicians, fearing criminal prosecution, err on the side of caution rather than risk their patients' deaths by using highly aggressive pain treatments. Furthermore, PRPA would put Drug Enforcement Administration officials, who have no medical expertise, in the position of regulating medical decisions. The act also would interfere with individual states' long-standing authority over medical practice. Finally, PRPA would discourage physicians from engaging in experimentation and innovation in palliative care, again out of concern for crossing the line between relief of suffering and physician-assisted suicide. Other bills have been introduced that go much further than PRPA to encourage palliative care, without its problematic provisions. Regardless of the controversy surrounding physician-assisted suicide in the United States, the need for quality end-of-life care will be far better served if Congress enacts one of these bills rather than PRPA.

  12. Leptin and insulin act on POMC neurons to promote the browning of white fat

    PubMed Central

    Dodd, Garron; Descherf, Stephanie; Loh, Kim; Simonds, Stephanie E.; Wiede, Florian; Balland, Eglantine; Merry, Troy L.; Münzberg, Heike; Zhang, Zhong-Yin; Kahn, Barbara B.; Neel, Benjamin G.; Bence, Kendra K.; Andrews, Zane B.; Cowley, Michael A.; Tiganis, Tony

    2015-01-01

    SUMMARY The primary task of white adipose tissue (WAT) is the storage of lipids. However, ‘beige’ adipocytes also exist in WAT. Beige adipocytes burn fat and dissipate the energy as heat, but their abundance is diminished in obesity. Stimulating beige adipocyte development, or WAT browning, increases energy expenditure and holds potential for combating metabolic disease and obesity. Here we report that insulin and leptin act together on hypothalamic neurons to promote WAT browning and weight loss. Deletion of the phosphatases PTP1B and TCPTP enhanced insulin and leptin signaling in proopiomelanocortin neurons and prevented diet-induced obesity by increasing WAT browning and energy expenditure. The co-infusion of insulin plus leptin into the CNS or the activation of proopiomelanocortin neurons also increased WAT browning and decreased adiposity. Our findings identify a homeostatic mechanism for coordinating the status of energy stores, as relayed by insulin and leptin, with the central control of WAT browning. PMID:25594176

  13. Leptin and insulin act on POMC neurons to promote the browning of white fat.

    PubMed

    Dodd, Garron T; Decherf, Stephanie; Loh, Kim; Simonds, Stephanie E; Wiede, Florian; Balland, Eglantine; Merry, Troy L; Münzberg, Heike; Zhang, Zhong-Yin; Kahn, Barbara B; Neel, Benjamin G; Bence, Kendra K; Andrews, Zane B; Cowley, Michael A; Tiganis, Tony

    2015-01-15

    The primary task of white adipose tissue (WAT) is the storage of lipids. However, "beige" adipocytes also exist in WAT. Beige adipocytes burn fat and dissipate the energy as heat, but their abundance is diminished in obesity. Stimulating beige adipocyte development, or WAT browning, increases energy expenditure and holds potential for combating metabolic disease and obesity. Here, we report that insulin and leptin act together on hypothalamic neurons to promote WAT browning and weight loss. Deletion of the phosphatases PTP1B and TCPTP enhanced insulin and leptin signaling in proopiomelanocortin neurons and prevented diet-induced obesity by increasing WAT browning and energy expenditure. The coinfusion of insulin plus leptin into the CNS or the activation of proopiomelanocortin neurons also increased WAT browning and decreased adiposity. Our findings identify a homeostatic mechanism for coordinating the status of energy stores, as relayed by insulin and leptin, with the central control of WAT browning. Copyright © 2015 Elsevier Inc. All rights reserved.

  14. Perfluorooctanoic acid (PFOA) acts as a tumor promoter on Syrian hamster embryo (SHE) cells.

    PubMed

    Jacquet, N; Maire, M A; Rast, C; Bonnard, M; Vasseur, P

    2011-08-01

    Perfluorooctane sulfonate (PFOS) (C(8)F(17)SO(3)) and perfluorooctanoic acid (PFOA) (C(8)HF(15)O(2)) are synthetic chemicals widely used in industrial applications for their hydrophobic and oleophobic properties. They are persistent, bioaccumulative, and toxic to mammalian species. Their widespread distribution on earth and contamination of human serum raised concerns about long-term side effects. They are suspected to be carcinogenic through a nongenotoxic mode of action, a mechanism supported by recent findings that PFOS induced cell transformation but no genotoxicity in Syrian hamster embryo (SHE) cells. In the present study, we evaluated carcinogenic potential of PFOA using the cell transformation assay on SHE cells. The chemical was applied alone or in combination with a nontransformant concentration of benzo[a]pyrene (BaP, 0.4 μM) in order to detect PFOA ability to act as tumor initiator or tumor promoter. The results showed that PFOA tested alone in the range 3.7 × 10(-5) to 300 μM did not induce SHE cell transformation frequency in a 7-day treatment. On the other side, the combination BaP/PFOA induced cell transformation at all PFOA concentrations tested, which revealed synergistic effects. No genotoxicity of PFOA on SHE cells was detected using the comet assay after 5 and 24 h of exposure. No significant increase in DNA breakage was found in BaP-initiated cells exposed to PFOA in a 7-day treatment. The whole results showed that PFOA acts as a tumor promoter and a nongenotoxic carcinogen. Cell transformation in initiated cells was observed at concentrations equivalent to the ones found in human serum of nonoccupationally and occupationally exposed populations. An involvement of PFOA in increased incidence of cancer recorded in occupationally exposed population cannot be ruled out.

  15. Promoting Health through Part H: Promoting the Health of Infants and Toddlers with Disabilities through Part H of the Individuals with Disabilities Education Act.

    ERIC Educational Resources Information Center

    Fenichel, Emily

    This issue paper is based on recommendations of a February, 1991 meeting on promoting child health through Part H of the Individuals with Disabilities Education Act (IDEA). Part H emphasizes family-centered care; service coordination; comprehensive services; collaboration among service providers and funding sources; outreach to traditionally…

  16. Characterization of hsp70 gene promoter for cis- acting elements in Indian zebu cattle of Hariana breed.

    PubMed

    Behl, Rahul; Behl, Jyotsna; Sadana, D K; Vijh, R K; Tantia, M S; Joshi, B K

    2014-01-01

    The promoter region of hsp70 gene was characterized for cis-acting elements in zebu cattle of Hariana breed. The basal regulatory domain of CAAT box identified as CAAT/enhancer binding protein (C/EBP) and CAAT binding transcription factor (CTF) binding sites, as well as GC box identified as sp1 binding site, were localized in at least two regions in the hsp70 gene promoter. A highly conserved heat shock element was found between position -108 to -95, which exactly matched at all eight positions with the consensus sequence. These cis-acting elements were found to be conserved between Holstein-Friesian and studied zebu breed.

  17. Health promotion research and practice require sound policy analysis models: the case of Quebec's Tobacco Act.

    PubMed

    Breton, Eric; Richard, Lucie; Gagnon, France; Jacques, Marie; Bergeron, Pierre

    2008-12-01

    In this paper we illustrate how policy analysis models can deepen our understanding of the challenges facing health promoters advocating for policy change. Specifically we describe the factors underpinning the adoption of Québec's Tobacco Act (1998) and the role played by actors from governmental public health agencies (GPHAs). Data were collected through interviews (n=39), newspapers articles (n=569) and documents (n > 200) from GPHAs, NGOs, the Québec National Assembly, and opponents to the legislative measures. Data collection and analysis were based on Sabatier and Jenkins-Smith's Advocacy Coalition Framework (1999) and Lemieux's theorization of coalition structuring (1998). We explain the adoption of the Act by: (1) the broad recognition within the policy elite of the main parameters of tobacco use (i.e. lethality, addictive properties, and legitimacy of governmental intervention), (2) the impacts of a series of events (e.g. cigarette contraband crisis) that enabled tobacco control advocates to influence public debates, and the governmental agenda, (3) the critical contribution of a coalition of GPHAs pooling resources to address both the sanitary and economic aspects of the legislation while countering the opposition's strategy, and (4) the failure of the opponents to present an unified voice on the definition of the tobacco policy. This study illustrates the merits of applying a policy-change model to grasp the complexity of the process. Our findings call for the development of permanent policy analysis capabilities within public health agencies and for a broader scrutiny of the non-health-related dimensions of policy debates.

  18. SNM1A Acts Downstream of ATM to Promote the G1 Cell Cycle Checkpoint

    PubMed Central

    Akhter, Shamima; Legerski, Randy J.

    2008-01-01

    We have shown previously that SNM1A co-localizes with 53BP1 at sites of double-strand breaks (DSBs) induced by IR, and that these proteins interact with or without DNA damage. However, the role of SNM1A in the DNA damage response has not been elucidated. Here, we show that SNM1A is required for an efficient G1 checkpoint arrest after IR exposure. Interestingly, the localization of SNM1A to sites of DSBs does not require either 53BP1 or H2AX, nor does the localization of 53BP1 require SNM1A. However, the localization of SNM1A does require ATM. Furthermore, SNM1A is shown to be a phosphorylation substrate of ATM in vitro, and to interact with ATM in vivo particularly after exposure of cells to IR. In addition, in the absence of SNM1A the activation of the downstream ATM target p53 is reduced. These findings suggest that SNM1A acts with ATM to promote the G1 cell cycle checkpoint. PMID:18848520

  19. Acidobacteria strains from subdivision 1 act as plant growth-promoting bacteria.

    PubMed

    Kielak, Anna M; Cipriano, Matheus A P; Kuramae, Eiko E

    2016-12-01

    Acidobacteria is one of the most abundant phyla in soils and has been detected in rhizosphere mainly based on cultivation-independent approaches such as 16S rRNA gene survey. Although putative interaction of Acidobacteria with plants was suggested, so far no plant-bacterial interactions were shown. Therefore, we performed several in vitro tests to evaluate Acidobacteria-plant interactions and the possible mechanisms involved in such interaction. We observed that Arabidopsis thaliana inoculated with three strains belonging to Acidobacteria subdivision 1 showed increase in biomass of roots and shoots as well as morphological changes in root system. Our results indicate that the plant hormone indole-3-acetic acid production and iron acquisition are plausibly involved in the plant and Acidobacteria interactions. Here, we confirm for the first time that Acidobacteria can actively interact with plants and act as plant growth-promoting bacteria. In addition, we show that Acidobacteria strains produce exopolysaccharide which supports the adhesion of bacteria to the root surfaces.

  20. AFR1 acts in conjunction with the alpha-factor receptor to promote morphogenesis and adaptation.

    PubMed Central

    Konopka, J B

    1993-01-01

    Mating pheromone receptors activate a G-protein signaling pathway that induces changes in transcription, cell division, and morphogenesis needed for the conjunction of Saccharomyces cerevisiae. The C terminus of the alpha-factor pheromone receptor functions in two complex processes, adaptation and morphogenesis. Adaptation to alpha-factor may occur through receptor desensitization, and alpha-factor-induced morphogenesis forms the conjugation bridge between mating cells. A plasmid overexpression strategy was used to isolate a new gene, AFR1, which acts together with the receptor C terminus to promote adaptation. The expression of AFR1 was highly induced by alpha-factor. Unexpectedly, cells lacking AFR1 showed a defect in alpha-factor-stimulated morphogenesis that was similar to the morphogenesis defect observed in cells producing C-terminally truncated alpha-factor receptors. In contrast, AFR1 overexpression resulted in longer projections of morphogenesis, which suggests that this gene may directly stimulate morphogenesis. These results indicate that AFR1 encodes a developmentally regulated function that coordinates both the regulation of receptor signaling and the induction of morphogenesis during conjugation. Images PMID:8413281

  1. Identification of cis-acting promoter elements in cold- and dehydration-induced transcriptional pathways in Arabidopsis, rice, and soybean.

    PubMed

    Maruyama, Kyonoshin; Todaka, Daisuke; Mizoi, Junya; Yoshida, Takuya; Kidokoro, Satoshi; Matsukura, Satoko; Takasaki, Hironori; Sakurai, Tetsuya; Yamamoto, Yoshiharu Y; Yoshiwara, Kyouko; Kojima, Mikiko; Sakakibara, Hitoshi; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko

    2012-01-01

    The genomes of three plants, Arabidopsis (Arabidopsis thaliana), rice (Oryza sativa), and soybean (Glycine max), have been sequenced, and their many genes and promoters have been predicted. In Arabidopsis, cis-acting promoter elements involved in cold- and dehydration-responsive gene expression have been extensively analysed; however, the characteristics of such cis-acting promoter sequences in cold- and dehydration-inducible genes of rice and soybean remain to be clarified. In this study, we performed microarray analyses using the three species, and compared characteristics of identified cold- and dehydration-inducible genes. Transcription profiles of the cold- and dehydration-responsive genes were similar among these three species, showing representative upregulated (dehydrin/LEA) and downregulated (photosynthesis-related) genes. All (4(6) = 4096) hexamer sequences in the promoters of the three species were investigated, revealing the frequency of conserved sequences in cold- and dehydration-inducible promoters. A core sequence of the abscisic acid-responsive element (ABRE) was the most conserved in dehydration-inducible promoters of all three species, suggesting that transcriptional regulation for dehydration-inducible genes is similar among these three species, with the ABRE-dependent transcriptional pathway. In contrast, for cold-inducible promoters, the conserved hexamer sequences were diversified among these three species, suggesting the existence of diverse transcriptional regulatory pathways for cold-inducible genes among the species.

  2. How to Preserve and Promote School Psychological Services through the American Recovery and Reinvestment Act (ARRA)

    ERIC Educational Resources Information Center

    Doescher, Heather

    2009-01-01

    The American Recovery and Reinvestment Act (ARRA), also known as the "Stimulus Act" and "Economic Recovery Act," was signed into law by President Obama on February 17, 2009. As a response to the economic downturn that Americans are all experiencing, the ARRA is an effort to jumpstart the economy, create or save millions of jobs, and make long-term…

  3. How to Preserve and Promote School Psychological Services through the American Recovery and Reinvestment Act (ARRA)

    ERIC Educational Resources Information Center

    Doescher, Heather

    2009-01-01

    The American Recovery and Reinvestment Act (ARRA), also known as the "Stimulus Act" and "Economic Recovery Act," was signed into law by President Obama on February 17, 2009. As a response to the economic downturn that Americans are all experiencing, the ARRA is an effort to jumpstart the economy, create or save millions of jobs, and make long-term…

  4. A dominantly acting murine allele of Mcm4 causes chromosomal abnormalities and promotes tumorigenesis.

    PubMed

    Bagley, Bruce N; Keane, Thomas M; Maklakova, Vilena I; Marshall, Jonathon G; Lester, Rachael A; Cancel, Michelle M; Paulsen, Alex R; Bendzick, Laura E; Been, Raha A; Kogan, Scott C; Cormier, Robert T; Kendziorski, Christina; Adams, David J; Collier, Lara S

    2012-01-01

    Here we report the isolation of a murine model for heritable T cell lymphoblastic leukemia/lymphoma (T-ALL) called Spontaneous dominant leukemia (Sdl). Sdl heterozygous mice develop disease with a short latency and high penetrance, while mice homozygous for the mutation die early during embryonic development. Sdl mice exhibit an increase in the frequency of micronucleated reticulocytes, and T-ALLs from Sdl mice harbor small amplifications and deletions, including activating deletions at the Notch1 locus. Using exome sequencing it was determined that Sdl mice harbor a spontaneously acquired mutation in Mcm4 (Mcm4(D573H)). MCM4 is part of the heterohexameric complex of MCM2-7 that is important for licensing of DNA origins prior to S phase and also serves as the core of the replicative helicase that unwinds DNA at replication forks. Previous studies in murine models have discovered that genetic reductions of MCM complex levels promote tumor formation by causing genomic instability. However, Sdl mice possess normal levels of Mcms, and there is no evidence for loss-of-heterozygosity at the Mcm4 locus in Sdl leukemias. Studies in Saccharomyces cerevisiae indicate that the Sdl mutation produces a biologically inactive helicase. Together, these data support a model in which chromosomal abnormalities in Sdl mice result from the ability of MCM4(D573H) to incorporate into MCM complexes and render them inactive. Our studies indicate that dominantly acting alleles of MCMs can be compatible with viability but have dramatic oncogenic consequences by causing chromosomal abnormalities.

  5. A Dominantly Acting Murine Allele of Mcm4 Causes Chromosomal Abnormalities and Promotes Tumorigenesis

    PubMed Central

    Bagley, Bruce N.; Keane, Thomas M.; Maklakova, Vilena I.; Marshall, Jonathon G.; Lester, Rachael A.; Cancel, Michelle M.; Paulsen, Alex R.; Bendzick, Laura E.; Been, Raha A.; Kogan, Scott C.; Cormier, Robert T.; Kendziorski, Christina; Adams, David J.; Collier, Lara S.

    2012-01-01

    Here we report the isolation of a murine model for heritable T cell lymphoblastic leukemia/lymphoma (T-ALL) called Spontaneous dominant leukemia (Sdl). Sdl heterozygous mice develop disease with a short latency and high penetrance, while mice homozygous for the mutation die early during embryonic development. Sdl mice exhibit an increase in the frequency of micronucleated reticulocytes, and T-ALLs from Sdl mice harbor small amplifications and deletions, including activating deletions at the Notch1 locus. Using exome sequencing it was determined that Sdl mice harbor a spontaneously acquired mutation in Mcm4 (Mcm4D573H). MCM4 is part of the heterohexameric complex of MCM2–7 that is important for licensing of DNA origins prior to S phase and also serves as the core of the replicative helicase that unwinds DNA at replication forks. Previous studies in murine models have discovered that genetic reductions of MCM complex levels promote tumor formation by causing genomic instability. However, Sdl mice possess normal levels of Mcms, and there is no evidence for loss-of-heterozygosity at the Mcm4 locus in Sdl leukemias. Studies in Saccharomyces cerevisiae indicate that the Sdl mutation produces a biologically inactive helicase. Together, these data support a model in which chromosomal abnormalities in Sdl mice result from the ability of MCM4D573H to incorporate into MCM complexes and render them inactive. Our studies indicate that dominantly acting alleles of MCMs can be compatible with viability but have dramatic oncogenic consequences by causing chromosomal abnormalities. PMID:23133403

  6. Arabidopsis ACT11 modifies actin turnover to promote pollen germination and maintain the normal rate of tube growth.

    PubMed

    Chang, Ming; Huang, Shanjin

    2015-08-01

    Actin is an ancient conserved protein that is encoded by multiple isovariants in multicellular organisms. There are eight functional actin genes in the Arabidopsis genome, and the precise function and mechanism of action of each isovariant remain poorly understood. Here, we report the characterization of ACT11, a reproductive actin isovariant. Our studies reveal that loss of function of ACT11 causes a delay in pollen germination, but enhances pollen tube growth. Cytological analysis revealed that the amount of filamentous actin decreased, and the rate of actin turnover increased in act11 pollen. Convergence of actin filaments upon the germination aperture was impaired in act11 pollen, consistent with the observed delay of germination. Reduction of actin dynamics with jasplakinolide suppressed the germination and tube growth phenotypes in act11 pollen, suggesting that the underlying mechanisms involve an increase in actin dynamics. Thus, we demonstrate that ACT11 is required to maintain the rate of actin turnover in order to promote pollen germination and maintain the normal rate of pollen tube growth.

  7. Hospital and Health Plan Partnerships: The Affordable Care Act's Impact on Promoting Health and Wellness

    PubMed Central

    Vu, Michelle; White, Annesha; Kelley, Virginia P.; Hopper, Jennifer Kuca; Liu, Cathy

    2016-01-01

    Background The Affordable Care Act (ACA) healthcare reforms, centered on achieving the Centers for Medicare & Medicaid Services (CMS) Triple Aim goals of improving patient care quality and satisfaction, improving population health, and reducing costs, have led to increasing partnerships between hospitals and insurance companies and the implementation of employee wellness programs. Hospitals and insurance companies have opted to partner to distribute the risk and resources and increase coordination of care. Objective To examine the ACA's impact on the health and wellness programs that have resulted from the joint ventures of hospitals and health plans based on the published literature. Method We conducted a review of the literature to identify successful mergers and best practices of health and wellness programs. Articles published between January 2007 and January 2015 were compiled from various search engines, using the search terms “corporate,” “health and wellness program,” “health plan,” “insurance plan,” “hospital,” “joint venture,” and “vertical merger.” Publications that described consolidations or wellness programs not tied to health insurance plans were excluded. Noteworthy characteristics of these programs were summarized and tabulated. Results A total of 44 eligible articles were included in the analysis. The findings showed that despite rising healthcare costs, joint ventures prevent hospitals from trading-off quality and services for cost reductions. Administrators believed that partnering would allow the companies to meet ACA standards for improving clinical outcomes at reduced costs. Before the implementation of the ACA, some employers had wellness programs, but these were not standardized and did not need to produce measurable results. The ACA encouraged improvement of employee wellness programs by providing funding for expanded health services and by mandating quality care. Successful workplace health and wellness

  8. [The Act of Promotion of Personal Autonomy and Long-Term Care. Reflections and recommendations for better development].

    PubMed

    López Casasnovas, Guillem

    2011-12-01

    The present article provides a critical analysis of the state of affairs of the care of dependent individuals and proposals for reform of social protection systems for dependency - especially the Act of Promotion of Personal Autonomy and Long-Term Care. The existing form of public coverage is linked to the theory of public finance. Against this background, a series of recommendations are made to achieve the goals of this important component of the welfare state.

  9. Implementing a Mentally Healthy Schools Framework Based on the Population Wide Act-Belong-Commit Mental Health Promotion Campaign: A Process Evaluation

    ERIC Educational Resources Information Center

    Anwar-McHenry, Julia; Donovan, Robert John; Nicholas, Amberlee; Kerrigan, Simone; Francas, Stephanie; Phan, Tina

    2016-01-01

    Purpose: Mentally Healthy WA developed and implemented the Mentally Healthy Schools Framework in 2010 in response to demand from schools wanting to promote the community-based Act-Belong-Commit mental health promotion message within a school setting. Schools are an important setting for mental health promotion, therefore, the Framework encourages…

  10. Implementing a Mentally Healthy Schools Framework Based on the Population Wide Act-Belong-Commit Mental Health Promotion Campaign: A Process Evaluation

    ERIC Educational Resources Information Center

    Anwar-McHenry, Julia; Donovan, Robert John; Nicholas, Amberlee; Kerrigan, Simone; Francas, Stephanie; Phan, Tina

    2016-01-01

    Purpose: Mentally Healthy WA developed and implemented the Mentally Healthy Schools Framework in 2010 in response to demand from schools wanting to promote the community-based Act-Belong-Commit mental health promotion message within a school setting. Schools are an important setting for mental health promotion, therefore, the Framework encourages…

  11. Reward Excellence and Promote Innovation. Reauthorizing the Elementary and Secondary Education Act

    ERIC Educational Resources Information Center

    US Department of Education, 2010

    2010-01-01

    To achieve President Obama's stated goal of providing a world-class education to every child in America, the administration has designed a blueprint for a reenvisioned federal role in education through the reauthorization of the "Elementary and Secondary Education Act" ("ESEA"). The new "ESEA" will raise the bar for…

  12. Derepression of a mouse alpha-fetoprotein expression vector in COS-1 cells by amplification of specific cis-acting sequences of the AFP promoter.

    PubMed Central

    Rabek, J P; Hoyt, P R; Zhang, D E; Izban, M G; Papaconstantinou, J

    1990-01-01

    The existence of trans-acting regulatory factors has been demonstrated by in vivo competition with cis-acting sequences from both viral and eukaryotic genomes. Plasmids containing a functional SV40 origin of replication when transfected into permissive SV40 T-antigen producing COS-1 cells will amplify to high copy numbers (5,000 to 10,000) without inflicting toxic effects upon the host cell. This amplification vector (pSVori) has been used to amplify cis-acting regulatory elements which can act as competitors for positive and negative trans-acting factors in vivo. Using this amplification system we conducted experiments to determine whether amplification of alpha-fetoprotein (AFP) and albumin cis-acting promoter sequences could activate a corresponding co-transfected AFP-promoter-CAT or Alb-promoter-CAT expression vector in COS-1 cells. We used pMoMLV(-1009)AFPcat, or p(-308)Albcat-MoMLV as reporter genes and pSVori to amplify specific promoter sequences of the AFP or albumin promoter. Our experiments indicated that amplification of a region from -53 to -202 of the AFP promoter resulted in the activation of the pMoMLV(-1009)AFPcat and p(-308)Albcat-MoMLV expression vectors in COS-1 cells. Surprisingly, amplification of the albumin promoter sequences failed to activate either the pMoMLV(-1009)AFPcat or p(-308)Albcat-MoMLV plasmids. Images PMID:1701243

  13. "Act Healthy": Promoting Health Behaviors and Self-Efficacy in the Workplace

    ERIC Educational Resources Information Center

    Schopp, Laura H.; Bike, Denise H.; Clark, Mary J.; Minor, Marian A.

    2015-01-01

    Chronic health conditions and multiple health risk factors afflict Americans and burden employers, but effective, affordable, workplace-based health promotion interventions have not been widely implemented. This is the first study to adapt the empirically validated Chronic Disease Self-Management Program for a general employee population in a…

  14. "Act Healthy": Promoting Health Behaviors and Self-Efficacy in the Workplace

    ERIC Educational Resources Information Center

    Schopp, Laura H.; Bike, Denise H.; Clark, Mary J.; Minor, Marian A.

    2015-01-01

    Chronic health conditions and multiple health risk factors afflict Americans and burden employers, but effective, affordable, workplace-based health promotion interventions have not been widely implemented. This is the first study to adapt the empirically validated Chronic Disease Self-Management Program for a general employee population in a…

  15. Identification of a fungal cutinase promoter that is inducible by a plant signal via a phosphorylated trans-acting factor.

    PubMed Central

    Bajar, A; Podila, G K; Kolattukudy, P E

    1991-01-01

    Plant cutin monomers trigger, and glucose suppresses, the expression of the cutinase gene of pathogenic fungi. To identify the cutinase promoter region responsible for induction by the unique plant components, a promoter analysis was done with transformants. Plasmids were constructed that contained (i) the 5' flanking region of the cutinase gene or its deletion mutants from Fusarium solani pisi fused with a chloramphenicol acetyltransferase (CAT) reporter gene and (ii) a constitutive promoter fused with a hygromycin phosphotransferase gene. Hygromycin-resistant transformants of F. solani pisi generated by electroporation were assayed for CAT activity inducible by cutin hydrolysate and for glucose repression of this induction. CAT was induced in a glucose-repressible manner when fused with a 360-base-pair (bp), or longer, segment of the 5' flanking region of the cutinase gene, and deletion of the next 135 bp abolished this induction. Gel retardation assays showed that a protein(s) in nuclear extract from the fungus bound to the 5' flanking region of cutinase gene, and this binding was also abolished when the same 135-bp segment was deleted. These results show that the -225 to -360 segment of the cutinase gene contains a cis-acting regulatory element that binds trans-acting factor(s) in the nuclei. Treatment of the nuclear extract with immobilized phosphatase abolished binding to the promoter, suggesting that binding required a phosphorylated form of the protein. With isolated nuclei, phosphorylation of a protein occurred only in the presence of both cutin monomer and the fungal protein factor. The presence of protein kinase inhibitor H7 during the preincubation of nuclei with the monomer and protein factor inhibited cutinase gene transcription. These results suggest that cutin monomer causes phosphorylation of a transcription factor that binds to the -225 to -360 segment of the cutinase gene and enhances transcription of this gene. Images PMID:1896470

  16. Hedgehog Signaling Acts with the Temporal Cascade to Promote Neuroblast Cell Cycle Exit

    PubMed Central

    Chai, Phing Chian; Liu, Zhong; Chia, William; Cai, Yu

    2013-01-01

    In Drosophila postembryonic neuroblasts, transition in gene expression programs of a cascade of transcription factors (also known as the temporal series) acts together with the asymmetric division machinery to generate diverse neurons with distinct identities and regulate the end of neuroblast proliferation. However, the underlying mechanism of how this “temporal series” acts during development remains unclear. Here, we show that Hh signaling in the postembryonic brain is temporally regulated; excess (earlier onset of) Hh signaling causes premature neuroblast cell cycle exit and under-proliferation, whereas loss of Hh signaling causes delayed cell cycle exit and excess proliferation. Moreover, the Hh pathway functions downstream of Castor but upstream of Grainyhead, two components of the temporal series, to schedule neuroblast cell cycle exit. Interestingly, hh is likely a target of Castor. Hence, Hh signaling provides a link between the temporal series and the asymmetric division machinery in scheduling the end of neurogenesis. PMID:23468593

  17. AP-1 family members act with Sox9 to promote chondrocyte hypertrophy.

    PubMed

    He, Xinjun; Ohba, Shinsuke; Hojo, Hironori; McMahon, Andrew P

    2016-08-15

    An analysis of Sox9 binding profiles in developing chondrocytes identified marked enrichment of an AP-1-like motif. Here, we have explored the functional interplay between Sox9 and AP-1 in mammalian chondrocyte development. Among AP-1 family members, Jun and Fosl2 were highly expressed within prehypertrophic and early hypertrophic chondrocytes. Chromatin immunoprecipitation followed by DNA sequencing (ChIP-seq) showed a striking overlap in Jun- and Sox9-bound regions throughout the chondrocyte genome, reflecting direct binding of each factor to the same enhancers and a potential for protein-protein interactions within AP-1- and Sox9-containing complexes. In vitro reporter analysis indicated that direct co-binding of Sox9 and AP-1 at target motifs promoted gene activity. By contrast, where only one factor can engage its DNA target, the presence of the other factor suppresses target activation consistent with protein-protein interactions attenuating transcription. Analysis of prehypertrophic chondrocyte removal of Sox9 confirmed the requirement of Sox9 for hypertrophic chondrocyte development, and in vitro and ex vivo analyses showed that AP-1 promotes chondrocyte hypertrophy. Sox9 and Jun co-bound and co-activated a Col10a1 enhancer in Sox9 and AP-1 motif-dependent manners consistent with their combined action promoting hypertrophic gene expression. Together, the data support a model in which AP-1 family members contribute to Sox9 action in the transition of chondrocytes to the hypertrophic program.

  18. Act Healthy: promoting health behaviors and self-efficacy in the workplace.

    PubMed

    Schopp, Laura H; Bike, Denise H; Clark, Mary J; Minor, Marian A

    2015-08-01

    Chronic health conditions and multiple health risk factors afflict Americans and burden employers, but effective, affordable, workplace-based health promotion interventions have not been widely implemented. This is the first study to adapt the empirically validated Chronic Disease Self-Management Program for a general employee population in a workplace setting with an emphasis on disease prevention and health promotion. A quasi-experimental, wellness standard of care comparison, prospective cohort design was used among employee participants at a large University employer. Ninety-one individuals participated in the program. Participants reported significantly increased health behavior frequency and self-efficacy after the intervention, compared with their pre-intervention scores, and improvements were sustained at 3-month follow-up [self-rated abilities for health practices scale (SRA): F = 30.89, P < 0.001; health promoting lifestyle profile-II (HPLP-II): F = 36.30 P < 0.001]. Individuals in the intervention group reported improved self-efficacy and health behaviors compared with the wellness standard of care comparison group at post intervention (SRA: F = 12.45, P < 0.001; HPLP-II: F = 25.28, P < 0.001). Adapting lay-facilitated self-management for the workplace offers promise as a replicable, scalable, affordable model for culture change in organizations.

  19. Promotion

    PubMed Central

    Alam, Hasan B.

    2013-01-01

    This article gives an overview of the promotion process in an academic medical center. A description of different promotional tracks, tenure and endowed chairs, and the process of submitting an application is provided. Finally, some practical advice about developing skills and attributes that can help with academic growth and promotion is dispensed. PMID:24436683

  20. Effect of the act on promotion of personal autonomy and care for dependent persons on their family caregivers

    PubMed Central

    2012-01-01

    Background The need of home care services is becoming an increasingly common scenario. These cares are mainly provided by the dependents’ relatives specifically, by the women part of the family. This situation might take years, decreasing the physical and psychological health of the caregiver. In Spain, the Act of Promotion of Personal Autonomy and Care for dependent persons, guarantees those dependent persons and their caregivers to have access to social services or to financial grants. The aim of this study is to Know the possible effects of the benefits provided by this Act in regards to the mental health, the quality of life and use of health services by the family caregivers assisting their relatives in situation of dependency. Methods and design A longitudinal descriptive study following-up a cohort of patients and caregivers. The study shall be carried out in Andalusia. It shall include the baseline assessment of the variables in those caregivers free from the exposure factor (reception of assistance pursuant to the Act). Following, once the benefits have been received, this cohort shall be followed-up. The study shall take three years, and the starting date for its development as well as its funding is January 2011. Discussion The longitudinal assessment of the rate of change of the variables studied shall allow us to know the implications which might be potentially generated as well as the natural evolution of those. PMID:23244337

  1. Effect of the Act on Promotion of Personal Autonomy and Care for dependent persons on their family caregivers.

    PubMed

    Cuevas Fernández-Gallego, Magdalena; Morales Asencio, José Miguel; Martín Santos, Francisco Javier; Cruz Arándiga, Rafaela; Contreras Fernández, Eugenio; Batres Sicilia, Juan Pedro; Navarro Moya, Francisco Javier; Lorenci Abajo, Isabel; Celdrán Mañas, Miriam; Bonill de Las Nieves, Candela

    2012-12-17

    The need of home care services is becoming an increasingly common scenario. These cares are mainly provided by the dependents' relatives specifically, by the women part of the family. This situation might take years, decreasing the physical and psychological health of the caregiver. In Spain, the Act of Promotion of Personal Autonomy and Care for dependent persons, guarantees those dependent persons and their caregivers to have access to social services or to financial grants. The aim of this study is to Know the possible effects of the benefits provided by this Act in regards to the mental health, the quality of life and use of health services by the family caregivers assisting their relatives in situation of dependency. A longitudinal descriptive study following-up a cohort of patients and caregivers. The study shall be carried out in Andalusia. It shall include the baseline assessment of the variables in those caregivers free from the exposure factor (reception of assistance pursuant to the Act). Following, once the benefits have been received, this cohort shall be followed-up.The study shall take three years, and the starting date for its development as well as its funding is January 2011. The longitudinal assessment of the rate of change of the variables studied shall allow us to know the implications which might be potentially generated as well as the natural evolution of those.

  2. SDN-1/Syndecan Acts in Parallel to the Transmembrane Molecule MIG-13 to Promote Anterior Neuroblast Migration

    PubMed Central

    Sundararajan, Lakshmi; Norris, Megan L.; Lundquist, Erik A.

    2015-01-01

    The Q neuroblasts in Caenorhabditis elegans display left-right asymmetry in their migration, with QR and descendants on the right migrating anteriorly, and QL and descendants on the left migrating posteriorly. Initial QR and QL migration is controlled by the transmembrane receptors UNC-40/DCC, PTP-3/LAR, and the Fat-like cadherin CDH-4. After initial migration, QL responds to an EGL-20/Wnt signal that drives continued posterior migration by activating MAB-5/Hox activity in QL but not QR. QR expresses the transmembrane protein MIG-13, which is repressed by MAB-5 in QL and which drives anterior migration of QR descendants. A screen for new Q descendant AQR and PQR migration mutations identified mig-13 as well as hse-5, the gene encoding the glucuronyl C5-epimerase enzyme, which catalyzes epimerization of glucuronic acid to iduronic acid in the heparan sulfate side chains of heparan sulfate proteoglycans (HSPGs). Of five C. elegans HSPGs, we found that only SDN-1/Syndecan affected Q migrations. sdn-1 mutants showed QR descendant AQR anterior migration defects, and weaker QL descendant PQR migration defects. hse-5 affected initial Q migration, whereas sdn-1 did not. sdn-1 and hse-5 acted redundantly in AQR and PQR migration, but not initial Q migration, suggesting the involvement of other HSPGs in Q migration. Cell-specific expression studies indicated that SDN-1 can act in QR to promote anterior migration. Genetic interactions between sdn-1, mig-13, and mab-5 suggest that MIG-13 and SDN-1 act in parallel to promote anterior AQR migration and that SDN-1 also controls posterior migration. Together, our results indicate previously unappreciated complexity in the role of multiple signaling pathways and inherent left-right asymmetry in the control of Q neuroblast descendant migration. PMID:26022293

  3. SDN-1/Syndecan Acts in Parallel to the Transmembrane Molecule MIG-13 to Promote Anterior Neuroblast Migration.

    PubMed

    Sundararajan, Lakshmi; Norris, Megan L; Lundquist, Erik A

    2015-05-28

    The Q neuroblasts in Caenorhabditis elegans display left-right asymmetry in their migration, with QR and descendants on the right migrating anteriorly, and QL and descendants on the left migrating posteriorly. Initial QR and QL migration is controlled by the transmembrane receptors UNC-40/DCC, PTP-3/LAR, and the Fat-like cadherin CDH-4. After initial migration, QL responds to an EGL-20/Wnt signal that drives continued posterior migration by activating MAB-5/Hox activity in QL but not QR. QR expresses the transmembrane protein MIG-13, which is repressed by MAB-5 in QL and which drives anterior migration of QR descendants. A screen for new Q descendant AQR and PQR migration mutations identified mig-13 as well as hse-5, the gene encoding the glucuronyl C5-epimerase enzyme, which catalyzes epimerization of glucuronic acid to iduronic acid in the heparan sulfate side chains of heparan sulfate proteoglycans (HSPGs). Of five C. elegans HSPGs, we found that only SDN-1/Syndecan affected Q migrations. sdn-1 mutants showed QR descendant AQR anterior migration defects, and weaker QL descendant PQR migration defects. hse-5 affected initial Q migration, whereas sdn-1 did not. sdn-1 and hse-5 acted redundantly in AQR and PQR migration, but not initial Q migration, suggesting the involvement of other HSPGs in Q migration. Cell-specific expression studies indicated that SDN-1 can act in QR to promote anterior migration. Genetic interactions between sdn-1, mig-13, and mab-5 suggest that MIG-13 and SDN-1 act in parallel to promote anterior AQR migration and that SDN-1 also controls posterior migration. Together, our results indicate previously unappreciated complexity in the role of multiple signaling pathways and inherent left-right asymmetry in the control of Q neuroblast descendant migration. Copyright © 2015 Sundararajan et al.

  4. Bicycle Helmet Promotion Act. Report of the Senate Committee on Commerce, Science, and Transportation on S. 3096. 102d Congress, 2d Session.

    ERIC Educational Resources Information Center

    Congress of the U.S., Washington, DC. Senate Committee on Commerce, Science, and Transportation.

    Senate Bill 3096 (S. 3096), the Bicycle Helmet Promotion Act, provides incentive grants to state and local governments that seek to promote the use of bicycle helmets by children under the age of 16. Between 1984 and 1988, a total of 4,815 Americans died and 2,830,475 suffered injuries requiring hospitalization as a result of accidents that…

  5. cis-acting elements involved in photoregulation of an oat phytochrome promoter in rice.

    PubMed Central

    Bruce, W B; Quail, P H

    1990-01-01

    Phytochrome negatively regulates the transcription of its own phyA genes. High levels of Pfr, the active, far-red-light absorbing form of phytochrome, repress phyA transcription; low Pfr levels result in derepression. We have utilized microprojectile-mediated gene transfer to identify regions of an oat phyA3 gene involved in this autoregulation. Chimeric constructs containing various deletion and sequence substitution mutants of the oat phyA3 gene fused to a chloramphenicol acetyltransferase reporter (phyA3/CAT) have been introduced into etiolated rice seedlings by particle bombardment. Low Pfr concentrations induce high phyA3/CAT expression, whereas high Pfr represses activity to near basal levels. Removal of phyA3 sequences 3' to the transcription start site reduces expression about fivefold, suggesting that intron 1 of the phyA3 gene may be required for high activity. The degree of high-Pfr-imposed repression is unaffected by any of a series of deletions or sequence substitutions in the phyA3 promoter, thus providing no evidence of any Pfr-activated negative elements. In contrast, 5' and internal deletions identify a minimum of three major positive promoter elements, designated PE1 [-381 base pairs (bp) to -348 bp], PE2 (-635 bp to -489 bp), and PE3 (-110 bp to -76 bp) that are necessary for high-level expression in low-Pfr cells. The data indicate that PE1 and PE2 are functionally redundant, but that PE3 is required in conjunction with either PE1 or PE2 for activity. PE3 contains a sequence element that is highly conserved between monocot phyA promoters, indicative of a critical role in phyA expression. PMID:2152109

  6. Cbx8 Acts Non-canonically with Wdr5 to Promote Mammary Tumorigenesis.

    PubMed

    Chung, Chi-Yeh; Sun, Zhen; Mullokandov, Gavriel; Bosch, Almudena; Qadeer, Zulekha A; Cihan, Esma; Rapp, Zachary; Parsons, Ramon; Aguirre-Ghiso, Julio A; Farias, Eduardo F; Brown, Brian D; Gaspar-Maia, Alexandre; Bernstein, Emily

    2016-07-12

    Chromatin-mediated processes influence the development and progression of breast cancer. Using murine mammary carcinoma-derived tumorspheres as a functional readout for an aggressive breast cancer phenotype, we performed a loss-of-function screen targeting 60 epigenetic regulators. We identified the Polycomb protein Cbx8 as a key regulator of mammary carcinoma both in vitro and in vivo. Accordingly, Cbx8 is overexpressed in human breast cancer and correlates with poor survival. Our genomic analyses revealed that Cbx8 positively regulates Notch signaling by maintaining H3K4me3 levels on Notch-network gene promoters. Ectopic expression of Notch1 partially rescues tumorsphere formation in Cbx8-depleted cells. We find that Cbx8 associates with non-PRC1 complexes containing the H3K4 methyltransferase complex component WDR5, which together regulate Notch gene expression. Thus, our study implicates a key non-canonical role for Cbx8 in promoting breast tumorigenesis.

  7. FAN1 acts with FANCI-FANCD2 to promote DNA interstrand cross-link repair.

    PubMed

    Liu, Ting; Ghosal, Gargi; Yuan, Jingsong; Chen, Junjie; Huang, Jun

    2010-08-06

    Fanconi anemia (FA) is caused by mutations in 13 Fanc genes and renders cells hypersensitive to DNA interstrand cross-linking (ICL) agents. A central event in the FA pathway is mono-ubiquitylation of the FANCI-FANCD2 (ID) protein complex. Here, we characterize a previously unrecognized nuclease, Fanconi anemia-associated nuclease 1 (FAN1), that promotes ICL repair in a manner strictly dependent on its ability to accumulate at or near sites of DNA damage and that relies on mono-ubiquitylation of the ID complex. Thus, the mono-ubiquitylated ID complex recruits the downstream repair protein FAN1 and facilitates the repair of DNA interstrand cross-links.

  8. Motivational Interviewing to Promote Long-Acting Reversible Contraception in Postpartum Teenagers.

    PubMed

    Tomlin, Kristl; Bambulas, Tammalynn; Sutton, Maureen; Pazdernik, Vanessa; Coonrod, Dean V

    2017-06-01

    To determine if teenage patients receiving prenatal care in an adolescent-focused clinic, emphasizing long-acting reversible contraception (LARC) using motivational interviewing techniques, had higher rates of uptake of postpartum LARC than a control group. Retrospective cohort study comparing young women who received prenatal care in an adolescent-focused setting with those enrolled in standard prenatal care. Adolescents between the ages of 13 and 17 years receiving prenatal care within the Maricopa Integrated Health safety-net system between 2007 and 2014. Motivational interviewing within the context of adolescent-focused prenatal care. Rates of uptake of LARC within 13 postpartum weeks. The adjusted rate of LARC for adolescent-focused prenatal care participants by 13 weeks postpartum was 38% (95% confidence interval [CI], 29%-47%) compared with 18% (95% CI, 11%-28%) for standard care participants, with an adjusted odds ratio of LARC use of 2.8 (95% CI, 1.5-5.2). Among patients who received adolescent-focused prenatal care, most (27% vs 12.7%) were using an intrauterine device as opposed to an implantable contraceptive device. Participation in an adolescent-focused antepartum setting using motivational interviewing to emphasize postpartum LARC resulted in nearly 3 times higher rates of uptake compared with standard prenatal care. Copyright © 2016 North American Society for Pediatric and Adolescent Gynecology. Published by Elsevier Inc. All rights reserved.

  9. Selfish third parties act as peacemakers by transforming conflicts and promoting cooperation

    PubMed Central

    Halevy, Nir; Halali, Eliran

    2015-01-01

    The tremendous costs of conflict have made humans resourceful not only at warfare but also at peacemaking. Although third parties have acted as peacemakers since the dawn of history, little is known about voluntary, informal third-party intervention in conflict. Here we introduce the Peacemaker Game, a novel experimental paradigm, to model and study the interdependence between disputants and third parties in conflict. In the game, two disputants choose whether to cooperate or compete and a third party chooses whether or not to intervene in the conflict. Intervention introduces side payments that transform the game disputants are playing; it also introduces risk for the third party by making it vulnerable to disputants’ choices. Six experiments revealed three robust effects: (i) The mere possibility of third-party intervention significantly increases cooperation in interpersonal and intergroup conflicts; (ii) reducing the risk to third parties dramatically increases intervention rates, to everyone’s benefit; and (iii) disputants’ cooperation rates are consistently higher than third parties’ intervention rates. These findings explain why, how, and when self-interested third parties facilitate peaceful conflict resolution. PMID:26038546

  10. Selfish third parties act as peacemakers by transforming conflicts and promoting cooperation.

    PubMed

    Halevy, Nir; Halali, Eliran

    2015-06-02

    The tremendous costs of conflict have made humans resourceful not only at warfare but also at peacemaking. Although third parties have acted as peacemakers since the dawn of history, little is known about voluntary, informal third-party intervention in conflict. Here we introduce the Peacemaker Game, a novel experimental paradigm, to model and study the interdependence between disputants and third parties in conflict. In the game, two disputants choose whether to cooperate or compete and a third party chooses whether or not to intervene in the conflict. Intervention introduces side payments that transform the game disputants are playing; it also introduces risk for the third party by making it vulnerable to disputants' choices. Six experiments revealed three robust effects: (i) The mere possibility of third-party intervention significantly increases cooperation in interpersonal and intergroup conflicts; (ii) reducing the risk to third parties dramatically increases intervention rates, to everyone's benefit; and (iii) disputants' cooperation rates are consistently higher than third parties' intervention rates. These findings explain why, how, and when self-interested third parties facilitate peaceful conflict resolution.

  11. Provider Bias in Long-Acting Reversible Contraception (LARC) Promotion and Removal: Perceptions of Young Adult Women.

    PubMed

    Higgins, Jenny A; Kramer, Renee D; Ryder, Kristin M

    2016-11-01

    Long-acting reversible contraception (LARC) is effective and acceptable. However, concern exists about potential provider bias in LARC promotion. No study has documented contraceptive users' attitudes toward or experiences with provider influence and bias regarding LARC. We collected qualitative data in 2014 to address this gap. Participants were 50 young adult women with any history of contraceptive use (including LARC) in Dane County, Wisconsin. Women often described providers as a trusted source of contraceptive information. However, several women reported that their preferences regarding contraceptive selection or removal were not honored. Furthermore, many participants believed that providers recommend LARC disproportionately to socially marginalized women. We encourage contraceptive counseling and removal protocols that directly address historical reproductive injustices and that honor patients' wishes.

  12. Provider Bias in Long-Acting Reversible Contraception (LARC) Promotion and Removal: Perceptions of Young Adult Women

    PubMed Central

    Kramer, Renee D.; Ryder, Kristin M.

    2016-01-01

    Long-acting reversible contraception (LARC) is effective and acceptable. However, concern exists about potential provider bias in LARC promotion. No study has documented contraceptive users’ attitudes toward or experiences with provider influence and bias regarding LARC. We collected qualitative data in 2014 to address this gap. Participants were 50 young adult women with any history of contraceptive use (including LARC) in Dane County, Wisconsin. Women often described providers as a trusted source of contraceptive information. However, several women reported that their preferences regarding contraceptive selection or removal were not honored. Furthermore, many participants believed that providers recommend LARC disproportionately to socially marginalized women. We encourage contraceptive counseling and removal protocols that directly address historical reproductive injustices and that honor patients’ wishes. PMID:27631741

  13. The GABA(A) receptor RDL acts in peptidergic PDF neurons to promote sleep in Drosophila.

    PubMed

    Chung, Brian Y; Kilman, Valerie L; Keath, J Russel; Pitman, Jena L; Allada, Ravi

    2009-03-10

    Sleep is regulated by a circadian clock that times sleep and wake to specific times of day and a homeostat that drives sleep as a function of prior wakefulness. To analyze the role of the circadian clock, we have used the fruit fly Drosophila. Flies display the core behavioral features of sleep, including relative immobility, elevated arousal thresholds, and homeostatic regulation. We assessed sleep-wake modulation by a core set of circadian pacemaker neurons that express the neuropeptide PDF. We find that disruption of PDF function increases sleep during the late night in light:dark and the first subjective day of constant darkness. Flies deploy genetic and neurotransmitter pathways to regulate sleep that are similar to those of their mammalian counterparts, including GABA. We find that RNA interference-mediated knockdown of the GABA(A) receptor gene, Resistant to dieldrin (Rdl), in PDF neurons reduces sleep, consistent with a role for GABA in inhibiting PDF neuron function. Patch-clamp electrophysiology reveals GABA-activated picrotoxin-sensitive chloride currents on PDF+ neurons. In addition, RDL is detectable most strongly on the large subset of PDF+ pacemaker neurons. These results suggest that GABAergic inhibition of arousal-promoting PDF neurons is an important mode of sleep-wake regulation in vivo.

  14. Shootin1 acts in concert with KIF20B to promote polarization of migrating neurons.

    PubMed

    Sapir, Tamar; Levy, Talia; Sakakibara, Akira; Rabinkov, Aharon; Miyata, Takaki; Reiner, Orly

    2013-07-17

    Shootin1 has been ascribed a role in regulating polarization of primary hippocampal neurons. To better understand the possible role of Shootin1 in the developing brain, we identified a member of the kinesin superfamily, KIF20B, as a novel Shootin1 interacting protein and a potential mediator of Shootin1 interaction with microtubules. KIF20B/Shootin1 binding was mapped to a 57 aa KIF20B sequence, which was used as a dominant-negative fragment. Direct interaction between that peptide (MBD) and Shootin1 was confirmed by surface plasmon resonance-based technology and the affinity was determined in the 10⁻⁷ m range. The proteins are expressed in the developing brain and formed a complex in vivo based on coimmunoprecipitation experiments and coimmunostaining in primary neurons. In primary hippocampal neurons Kif20b knockdown reduced Shootin1 mobilization to the developing axon, as evidenced by immunostaining and fluorescence recovery after photobleaching analysis, suggesting that Shootin1 is a novel KIF20B cargo. shRNA targeting of Shootin1 reduced PIP3 accumulation in the growth cone, as did Kif20b shRNA. In the developing mouse brain, Kif20b knockdown or expression of the KIF20B minimal binding domain inhibited neuronal migration, and in vivo migration assays suggested that Shootin1/Kif20b acts in the same genetic pathway. Time-lapse imaging of multipolar cells in the subventricular zone revealed that downregulating levels of either Shootin1 or Kif20b hindered the transition from multipolar to bipolar cells. Collectively, our data demonstrate the importance of the Shootin1/KIF20B interaction to the dynamic process of pyramidal neuronal polarization and migration.

  15. Galectin-3 released in response to traumatic brain injury acts as an alarmin orchestrating brain immune response and promoting neurodegeneration

    PubMed Central

    Yip, Ping Kei; Carrillo-Jimenez, Alejandro; King, Paul; Vilalta, Anna; Nomura, Koji; Chau, Chi Cheng; Egerton, Alexander Michael Scott; Liu, Zhuo-Hao; Shetty, Ashray Jayaram; Tremoleda, Jordi L.; Davies, Meirion; Deierborg, Tomas; Priestley, John V.; Brown, Guy Charles; Michael-Titus, Adina Teodora; Venero, Jose Luis; Burguillos, Miguel Angel

    2017-01-01

    Traumatic brain injury (TBI) is currently a major cause of morbidity and poor quality of life in Western society, with an estimate of 2.5 million people affected per year in Europe, indicating the need for advances in TBI treatment. Within the first 24 h after TBI, several inflammatory response factors become upregulated, including the lectin galectin-3. In this study, using a controlled cortical impact (CCI) model of head injury, we show a large increase in the expression of galectin-3 in microglia and also an increase in the released form of galectin-3 in the cerebrospinal fluid (CSF) 24 h after head injury. We report that galectin-3 can bind to TLR-4, and that administration of a neutralizing antibody against galectin-3 decreases the expression of IL-1β, IL-6, TNFα and NOS2 and promotes neuroprotection in the cortical and hippocampal cell populations after head injury. Long-term analysis demonstrated a significant neuroprotection in the cortical region in the galectin-3 knockout animals in response to TBI. These results suggest that following head trauma, released galectin-3 may act as an alarmin, binding, among other proteins, to TLR-4 and promoting inflammation and neuronal loss. Taking all together, galectin-3 emerges as a clinically relevant target for TBI therapy. PMID:28128358

  16. TMF and glycitin act synergistically on keratinocytes and fibroblasts to promote wound healing and anti-scarring activity

    PubMed Central

    Seo, Ga Young; Lim, Yoongho; Koh, Dongsoo; Huh, Jung Sik; Hyun, Changlim; Kim, Young Mee; Cho, Moonjae

    2017-01-01

    Keratinocyte-fibroblast interactions are critical for skin repair after injury. During the proliferative phase of wound healing, proliferation, migration and differentiation of these cells are the major mechanisms leading to tissue remodeling. We have previously reported that glycitin, a major soy isoflavone, stimulates dermal fibroblast proliferation; and the phytochemical, 4′,6,7-trimethoxyisoflavone (TMF), induces migration of HaCaT keratinocyte cells. We therefore investigated whether these compounds display synergistic effects on skin cells during wound healing in vitro and in vivo. Co-treatment with TMF and glycitin synergistically promotes the proliferation and migration of both keratinocytes and dermal fibroblasts, with a 1:1 ratio of these compounds showing the greatest efficacy in our co-culture system. This keratinocyte-fibroblast interaction occurred via the secretion of TGF-β, and the induction of differentiation and proliferation was confirmed in both indirect and direct co-culture assays. In an excisional and burn wound animal model, mice treated with a 1:1 ratio of TMF and glycitin showed faster wound closure, regeneration and scar reduction than even the positive control drug. These data indicate that two isoflavones, TMF and glycitin, act synergistically to promote wound healing and anti-scarring and could potentially be developed together as a bioactive therapeutic for wound treatment. PMID:28303029

  17. Acetylcholine acts through M3 muscarinic receptor to activate the EGFR signaling and promotes gastric cancer cell proliferation

    PubMed Central

    Yu, Huangfei; Xia, Hongwei; Tang, Qiulin; Xu, Huanji; Wei, Guoqing; Chen, Ying; Dai, Xinyu; Gong, Qiyong; Bi, Feng

    2017-01-01

    Acetylcholine (ACh), known as a neurotransmitter, regulates the functions of numerous fundamental central and peripheral nervous system. Recently, emerging evidences indicate that ACh also plays an important role in tumorigenesis. However, little is known about the role of ACh in gastric cancer. Here, we reported that ACh could be auto-synthesized and released from MKN45 and BGC823 gastric cancer cells. Exogenous ACh promoted cell proliferation in a does-dependent manner. The M3R antagonist 4-DAMP, but not M1R antagonist trihexyphenidyl and M2/4 R antagonist AFDX-116, could reverse the ACh-induced cell proliferation. Moreover, ACh, via M3R, activated the EGFR signaling to induce the phosphorylation of ERK1/2 and AKT, and blocking EGFR pathway by specific inhibitor AG1478 suppressed the ACh induced cell proliferation. Furthermore, the M3R antagonist 4-DAMP and darifenacin could markedly inhibit gastric tumor formation in vivo. 4-DAMP could also significantly enhance the cytotoxic activity of 5-Fu against the MKN45 and BGC823 cells, and induce the expression of apoptosis-related proteins such as Bax and Caspase-3. Together, these findings indicated that the autocrine ACh could act through M3R and the EGFR signaling to promote gastric cancer cells proliferation, targeting M3R or EGFR may provide us a potential therapeutic strategy for gastric cancer treatment. PMID:28102288

  18. Galectin-3 released in response to traumatic brain injury acts as an alarmin orchestrating brain immune response and promoting neurodegeneration.

    PubMed

    Yip, Ping Kei; Carrillo-Jimenez, Alejandro; King, Paul; Vilalta, Anna; Nomura, Koji; Chau, Chi Cheng; Egerton, Alexander Michael Scott; Liu, Zhuo-Hao; Shetty, Ashray Jayaram; Tremoleda, Jordi L; Davies, Meirion; Deierborg, Tomas; Priestley, John V; Brown, Guy Charles; Michael-Titus, Adina Teodora; Venero, Jose Luis; Burguillos, Miguel Angel

    2017-01-27

    Traumatic brain injury (TBI) is currently a major cause of morbidity and poor quality of life in Western society, with an estimate of 2.5 million people affected per year in Europe, indicating the need for advances in TBI treatment. Within the first 24 h after TBI, several inflammatory response factors become upregulated, including the lectin galectin-3. In this study, using a controlled cortical impact (CCI) model of head injury, we show a large increase in the expression of galectin-3 in microglia and also an increase in the released form of galectin-3 in the cerebrospinal fluid (CSF) 24 h after head injury. We report that galectin-3 can bind to TLR-4, and that administration of a neutralizing antibody against galectin-3 decreases the expression of IL-1β, IL-6, TNFα and NOS2 and promotes neuroprotection in the cortical and hippocampal cell populations after head injury. Long-term analysis demonstrated a significant neuroprotection in the cortical region in the galectin-3 knockout animals in response to TBI. These results suggest that following head trauma, released galectin-3 may act as an alarmin, binding, among other proteins, to TLR-4 and promoting inflammation and neuronal loss. Taking all together, galectin-3 emerges as a clinically relevant target for TBI therapy.

  19. HDGF-related protein-2 (HRP-2) acts as an oncogene to promote cell growth in hepatocellular carcinoma.

    PubMed

    Gao, Kun; Xu, Chen; Jin, Xiaofeng; Wumaier, Reziya; Ma, Jian; Peng, Jingtao; Wang, Yuqi; Tang, Yan; Yu, Long; Zhang, Pingzhao

    2015-03-20

    HDGFRP2 (HRP-2) belongs to the Hepatoma-derived growth factor (HDGF)-related proteins (HRPs) family, which are characterized by a conserved HATH/PWWP domain at a well-conserved region of the N-terminus. However, the cellular function of HRP-2 remains unknown. In this study, we showed for the first time that HRP-2 is frequently overexpressed in human HCC tissues at mRNA and protein levels. We further showed that HRP-2 can promote HCC cells growth in vitro and xenograft tumors in vivo. Using protein affinity purification methods, we searched for functional partners of HRP-2, and found that HRP-2 interacts with various proteins known to be involved in transcription elongation and processing. Furthermore, we demonstrate HRP-2 interacts and co-localizes with RNA processing regulator IWS1, and positively regulated the mRNA level of Cyclin D1. Together, our study suggests HRP-2 may act as an mRNA processing co-factor to promote cells growth by regulating the mRNA of key oncogenes, which can be explored further for cancer treatment.

  20. "America COMPETES Reauthorization Act of 2010" or the "America Creating Opportunities to Meaningfully Promote Excellence in Technology, Education, and Science Reauthorization Act of 2010." House of Representatives, One Hundred Eleventh Congress, Second Session. H.R. 5116

    ERIC Educational Resources Information Center

    US House of Representatives, 2010

    2010-01-01

    The America COMPETES (Creating Opportunities to Meaningfully Promote Excellence in Technology, Education, and Science) Reauthorization Act of 2010 documented here is divided into the following titles: (1) Office of Science and Technology Policy (Coordination of Federal STEM [science, technology, engineering, and mathematics] education;…

  1. State, District, and School Implementation of Reforms Promoted under the Recovery Act: 2009-10 through 2011-12. The Final Report from Charting the Progress of Education Reform: An Evaluation of the Recovery Act's Role. NCEE 2015-4016

    ERIC Educational Resources Information Center

    Troppe, Patricia; Milanowski, Anthony; Garrison-Mogren, Roberta; Webber, Ann; Gutmann, Babette; Reisner, Elizabeth; Goertz, Margaret

    2015-01-01

    This report, based on surveys completed by all 50 State Education Agencies (SEAs) and the District of Columbia (DC) and nationally representative samples of districts and schools during spring 2011 and 2012, examines implementation of the key education reform strategies promoted by the Recovery Act in 2011-12, the extent to which implementation…

  2. Export Promotion Reform Act

    THOMAS, 112th Congress

    Rep. Berman, Howard L. [D-CA-28

    2012-02-15

    Senate - 06/04/2012 Received in the Senate and Read twice and referred to the Committee on Banking, Housing, and Urban Affairs. (All Actions) Tracker: This bill has the status Passed HouseHere are the steps for Status of Legislation:

  3. Promoting Startup Innovation Act

    THOMAS, 113th Congress

    Rep. Chabot, Steve [R-OH-1

    2013-06-04

    House - 07/15/2013 Referred to the Subcommittee on Courts, Intellectual Property, and the Internet. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  4. Promoting New Manufacturing Act

    THOMAS, 113th Congress

    Rep. Scalise, Steve [R-LA-1

    2014-05-30

    12/01/2014 Received in the Senate and Read twice and referred to the Committee on Environment and Public Works. (All Actions) Tracker: This bill has the status Passed HouseHere are the steps for Status of Legislation:

  5. Promoting Mortgage Responsibility Act

    THOMAS, 111th Congress

    Sen. Merkley, Jeff [D-OR

    2009-04-28

    Senate - 04/28/2009 Read twice and referred to the Committee on Banking, Housing, and Urban Affairs. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  6. American Savings Promotion Act

    THOMAS, 113th Congress

    Sen. Moran, Jerry [R-KS

    2013-10-29

    Senate - 10/29/2013 Read twice and referred to the Committee on Banking, Housing, and Urban Affairs. (All Actions) Notes: For further action, see H.R.3374, which became Public Law 113-251 on 12/18/2014. Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  7. Business Incubator Promotion Act

    THOMAS, 111th Congress

    Rep. Ryan, Tim [D-OH-17

    2010-04-21

    04/22/2010 Referred to the Subcommittee on Economic Development, Public Buildings and Emergency Management. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  8. Export Promotion Reform Act

    THOMAS, 112th Congress

    Rep. Berman, Howard L. [D-CA-28

    2012-02-15

    06/04/2012 Received in the Senate and Read twice and referred to the Committee on Banking, Housing, and Urban Affairs. (All Actions) Tracker: This bill has the status Passed HouseHere are the steps for Status of Legislation:

  9. Business Incubator Promotion Act

    THOMAS, 111th Congress

    Rep. Ryan, Tim [D-OH-17

    2010-04-21

    04/22/2010 Referred to the Subcommittee on Economic Development, Public Buildings and Emergency Management. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  10. Business Incubator Promotion Act

    THOMAS, 111th Congress

    Rep. Ryan, Tim [D-OH-17

    2010-04-21

    House - 04/22/2010 Referred to the Subcommittee on Economic Development, Public Buildings and Emergency Management. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  11. Promoting New Manufacturing Act

    THOMAS, 113th Congress

    Rep. Scalise, Steve [R-LA-1

    2014-05-30

    Senate - 12/01/2014 Received in the Senate and Read twice and referred to the Committee on Environment and Public Works. (All Actions) Tracker: This bill has the status Passed HouseHere are the steps for Status of Legislation:

  12. American Savings Promotion Act

    THOMAS, 113th Congress

    Sen. Moran, Jerry [R-KS

    2013-10-29

    10/29/2013 Read twice and referred to the Committee on Banking, Housing, and Urban Affairs. (All Actions) Notes: For further action, see H.R.3374, which became Public Law 113-251 on 12/18/2014. Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  13. American Savings Promotion Act

    THOMAS, 113th Congress

    Sen. Moran, Jerry [R-KS

    2013-10-29

    10/29/2013 Read twice and referred to the Committee on Banking, Housing, and Urban Affairs. (All Actions) Notes: For further action, see H.R.3374, which became Public Law 113-251 on 12/18/2014. Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  14. Promoting New Manufacturing Act

    THOMAS, 113th Congress

    Rep. Scalise, Steve [R-LA-1

    2014-05-30

    12/01/2014 Received in the Senate and Read twice and referred to the Committee on Environment and Public Works. (All Actions) Tracker: This bill has the status Passed HouseHere are the steps for Status of Legislation:

  15. Tie-dyed1 and Sucrose export defective1 act independently to promote carbohydrate export from maize leaves

    PubMed Central

    Ma, Yi; Baker, R. Frank; Magallanes-Lundback, Maria; DellaPenna, Dean

    2007-01-01

    tie-dyed1 (tdy1) and sucrose export defective1 (sxd1) are recessive maize (Zea mays) mutants with nonclonal chlorotic leaf sectors that hyperaccumulate starch and soluble sugars. In addition, both mutants display similar growth-related defects such as reduced plant height and inflorescence development due to the retention of carbohydrates in leaves. As tdy1 and sxd1 are the only variegated leaf mutants known to accumulate carbohydrates in any plant, we investigated whether Tdy1 and Sxd1 function in the same pathway. Using aniline blue staining for callose and transmission electron microscopy to inspect plasmodesmatal ultrastructure, we determined that tdy1 does not have any physical blockage or alteration along the symplastic transport pathway as found in sxd1 mutants. To test whether the two genes function in the same genetic pathway, we constructed F2 families segregating both mutations. Double mutant plants showed an additive interaction for growth related phenotypes and soluble sugar accumulation, and expressed the leaf variegation pattern of both single mutants indicating that Tdy1 and Sxd1 act in separate genetic pathways. Although sxd1 mutants lack tocopherols, we determined that tdy1 mutants have wild-type tocopherol levels, indicating that Tdy1 does not function in the same biochemical pathway as Sxd1. From these and other data we conclude that Tdy1 and Sxd1 function independently to promote carbon export from leaves. Our genetic and cytological studies implicate Tdy1 functioning in veins, and a model discussing possible functions of TDY1 is presented. Electronic supplementary material The online version of this article (doi:10.1007/s00425-007-0636-6) contains supplementary material, which is available to authorized users. PMID:17924136

  16. HRS1 Acts as a Negative Regulator of Abscisic Acid Signaling to Promote Timely Germination of Arabidopsis Seeds

    PubMed Central

    Wang, Ran; Liu, Hong; Yang, Huixia; Rodriguez, Pedro L.; Qin, Huanju; Liu, Xin; Wang, Daowen

    2012-01-01

    In this work, we conducted functional analysis of Arabidopsis HRS1 gene in order to provide new insights into the mechanisms governing seed germination. Compared with wild type (WT) control, HRS1 knockout mutant (hrs1-1) exhibited significant germination delays on either normal medium or those supplemented with abscisic acid (ABA) or sodium chloride (NaCl), with the magnitude of the delay being substantially larger on the latter media. The hypersensitivity of hrs1-1 germination to ABA and NaCl required ABI3, ABI4 and ABI5, and was aggravated in the double mutant hrs1-1abi1-2 and triple mutant hrs1-1hab1-1abi1-2, indicating that HRS1 acts as a negative regulator of ABA signaling during seed germination. Consistent with this notion, HRS1 expression was found in the embryo axis, and was regulated both temporally and spatially, during seed germination. Further analysis showed that the delay of hrs1-1 germination under normal conditions was associated with reduction in the elongation of the cells located in the lower hypocotyl (LH) and transition zone (TZ) of embryo axis. Interestingly, the germination rate of hrs1-1 was more severely reduced by the inhibitor of cell elongation, and more significantly decreased by the suppressors of plasmalemma H+-ATPase activity, than that of WT control. The plasmalemma H+-ATPase activity in the germinating seeds of hrs1-1 was substantially lower than that exhibited by WT control, and fusicoccin, an activator of this pump, corrected the transient germination delay of hrs1-1. Together, our data suggest that HRS1 may be needed for suppressing ABA signaling in germinating embryo axis, which promotes the timely germination of Arabidopsis seeds probably by facilitating the proper function of plasmalemma H+-ATPase and the efficient elongation of LH and TZ cells. PMID:22545134

  17. [Health promotion in a workplace in The United Kingdom of Great Britain and Northern Ireland by taking into consideration acts prohibited tobacco smoking].

    PubMed

    Kurzepa-Hasan, Edyta; Adamek, Renata; Hasan, Kawa

    2008-01-01

    This study presents health promotion strategies in a workplace in The United Kingdom of Great Britain and Northern Ireland. A workplace is a very important area for health promotion activities because of almost unlimited access to target group--adult group, especially good opportunity to access to men, who rather seldom going to a doctor. In 2004 Committee on Tobacco and Heath (SCOTH) classified environmental tobacco smoking (ETS) for category: "serious hazards for public health" after conducted study of harmful effects of ETS. In 2007 England becomes "free" from ETS, because of acts prohibited tobacco smoking in public places and in workplaces. In 26th of March 2006 Health Act in Scotland and in the second of April 2007 in Wales also prohibited smoking in public places. The aim of a new act was to protect health and prevention illness caused by exposition to ETS. So, there is prohibition for everyone: employees, clients, employers and guests in a whole company, in closed area and fundamental closed areas (according act). The act is also about previous areas intended for tobacco smoking. In 30th of April in 2007 Northern Ireland also prohibited smoking in public places. There are many profits for everyone, for example: protection people's health exposed to ETS, much slower development some serious illness, reduction of medical care cost and improvement of environment for community. If smokers decide to quit smoking or even reduce the number of smoking cigarettes per day, a population would be healthier.

  18. Cell-specific activity of cis-acting regulatory elements in the promoter of the mouse multidrug resistance gene mdr1.

    PubMed

    Raymond, M; Gros, P

    1990-11-01

    To define cis-acting elements implicated in transcriptional regulation of the mouse multidrug resistance gene mdr1, we have cloned and characterized the 5' end of the gene. Nucleotide sequence analysis identified TATA, GGGCGG, and CCAAT consensus sequence elements at positions -27, -47, and -83, respectively. The transcriptional activities of 5' deletion fragments from the promoter linked to a reporter gene were tested in mouse cell lines of different tissue origins shown to express different levels of endogenous mdr1 RNA. Sequences located between nucleotides -93 and +84 were able to confer basal promoter activity and cell specificity to the reporter gene. The addition to the basal promoter of sequences upstream of position -141 was found to up or down regulate the basal level of expression of the reporter gene in a cell-specific manner.

  19. cis-Acting Elements within the Candida albicans ERG11 Promoter Mediate the Azole Response through Transcription Factor Upc2p▿

    PubMed Central

    Oliver, Brian G.; Song, Jia L.; Choiniere, Jake H.; White, Theodore C.

    2007-01-01

    The azole antifungal drugs are used to treat infections caused by Candida albicans and other fungi. These drugs interfere with the biosynthesis of ergosterol, the major sterol in fungal cells, by inhibiting an ergosterol biosynthetic enzyme, lanosterol 14 α-demethylase, encoded by the ERG11 gene. In vitro, these drugs as well as other ergosterol biosynthesis inhibitors increase ERG11 mRNA expression by activation of the ERG11 promoter. The signal for this activation most likely is the depletion of ergosterol, the end product of the pathway. To identify cis-acting regulatory elements that mediate this activation, ERG11 promoter fragments have been fused to the luciferase reporter gene from Renilla reniformis. Promoter deletions and linker scan mutations localized the region important for azole induction to a segment from bp −224 to −251 upstream of the start codon, specifically two 7-bp sequences separated by 13 bp. These sequences form an imperfect inverted repeat. The region is recognized by the transcription factor Upc2p and functions as an enhancer of transcription, as it can be placed upstream of a heterologous promoter in either direction, resulting in the azole induction of that promoter. The promoter constructs are not azole inducible in the upc2/upc2 homozygous deletion, demonstrating that Upc2p controls the azole induction of ERG11. These results identify an azole-responsive enhancer element (ARE) in the ERG11 promoter that is controlled by the Upc2p transcription factor. No other ARE is present in the promoter. Thus, this ARE and Upc2p are necessary and sufficient for azole induction of ERG11. PMID:17951521

  20. Pineal expression-promoting element (PIPE), a cis-acting element, directs pineal-specific gene expression in zebrafish

    PubMed Central

    Asaoka, Yoichi; Mano, Hiroaki; Kojima, Daisuke; Fukada, Yoshitaka

    2002-01-01

    The pineal gland, sharing morphological and biochemical similarities with the retina, plays a unique and central role in the photoneuroendocrine system. The unique development of the pineal gland is directed by a specific combination of the expressed genes, but little is known about the regulatory mechanism underlying the pineal-specific gene expression. We isolated a 1.1-kbp fragment upstream of the zebrafish exo-rhodopsin (exorh) gene, which is expressed specifically in the pineal gland. Transgenic analysis using an enhanced green fluorescent protein reporter gene demonstrated that the proximal 147-bp region of the exorh promoter is sufficient to direct pineal-specific expression. This region contains three copies of a putative cone rod homeobox (Crx)/Otx-binding site, which is known to be required for expression of both retina- and pineal-specific genes. Deletion and mutational analyses of the exorh promoter revealed that a previously uncharacterized sequence TGACCCCAATCT termed pineal expression-promoting element (PIPE) is required for pineal-specific promoter activity in addition to the Crx/Otx-binding sites. By using the zebrafish rhodopsin (rh) promoter that drives retina-specific expression, we created a reporter construct having ectopic PIPE in the rh promoter at a position equivalent to that in the exorh promoter by introducing five nucleotide changes. Such a slight modification in the rh promoter induced ectopic enhanced green fluorescent protein expression in the pineal gland without affecting its retinal expression. These results identify PIPE as a critical cis-element contributing to the pineal-specific gene expression, in combination with the Crx/Otx-binding site(s). PMID:12438694

  1. The nuclear orphan receptors COUP-TFII and Ear-2 act as silencers of the human oxytocin gene promoter.

    PubMed

    Chu, K; Zingg, H H

    1997-10-01

    We have previously shown that COUP-TFII and Ear-2, two members of the nuclear orphan receptor family, are able to repress oestrogen-stimulated transcriptional activity of the human oxytocin (OT) gene promoter by binding to a site that overlaps with the oestrogen response element (ERE) present in the 5' flanking region of the gene. Although most nuclear receptor-mediated transcriptional repression conforms with the paradigm of passive repression and involves competitive binding to an activator site, active repression, i.e. silencing of basal promoter activity, has been observed in a limited number of cases. Here we show by co-transfection experiments using COUP-TFII and Ear-2 expression vectors and reporter constructs containing OT gene promoter fragments linked to the chloramphenicol acetyltransferase gene that both COUP-TFII and Ear-2 are capable of silencing basal OT gene promoter activity by 54 and 75% respectively. 5' Deletion and footprint analyses revealed two areas of functionally important interaction sites: (1) a direct TGACC(T/C) repeat overlapping the ERE and (2) a more promoter-proximal area centred at - 90 containing three imperfect direct repeats (R1-R3) spaced by four nucleotides each. Mutagenesis of reporter constructs as well as electrophoretic mobility-shift assays demonstrated that each of the three proximal repeats R1-R3 contributed to orphan receptor binding and the silencing effect. Inasmuch as the orphan receptor-binding sites are not involved in mediating basal transcriptional activity of the OT gene promoter, the observed effects are best interpreted as active repression or promoter silencing. Moreover, since COUP-TFII and Ear-2 are both co-expressed in OT-expressing uterine epithelial cells, the novel transcriptional effects described here are likely to be of functional importance in the fine-tuning of uterine OT gene expression in vivo.

  2. Identification of a cis-acting element in the class I major histocompatibility complex gene promoter responsive to activation by retroviral sequences.

    PubMed Central

    Choi, S Y; van de Mark, K; Faller, D V

    1997-01-01

    The infection of cells with Moloney murine leukemia virus (M-MuLV) causes an increase in specific cellular gene products, including the major histocompatibility complex (MHC) class I antigens. This upregulation occurs through a transactivation process mediated by the long terminal repeat (LTR) of M-MuLV, and we show here that the gene activation response to the LTR requires at least one specific cis element within the MHC proximal promoter region. Nested deletions of MHC class I H-2Kb gene promoter sequence were subcloned into a chloramphenicol acetyltransferase (CAT) reporter vector and then transiently introduced into BALB/c-3T3 cells expressing M-MuLV or cotransfected into BALB/c-3T3 cells with a vector containing subgenomic portions of the virus, including the LTR. CAT activity assays demonstrated that a minimal H-2Kb gene promoter (-64 to +12) contained elements sufficient for this transactivation. DNase I footprinting assays located a protein-binding site in the region of -64 to -34 bp from the transcriptional start site, and point mutation analysis confirmed the location of this cis-acting element, designated the let response element (LRE), and defined a binding motif. This LRE is distinct from binding sites for currently known transcription factors in the class I MHC gene promoter and is conserved in the promoters of human and murine MHC class I genes. Mutation of the LRE resulted in dramatic reduction in both DNA-protein binding activity in electrophoretic mobility shift assay and in the ability of the mutated promoter to respond to retroviral transactivation. Addition of the LRE to a heterologous promoter conferred the ability to respond to retroviral transactivation. PMID:8995614

  3. Identification of cis-acting regulatory elements in the promoter region of the rat brain creatine kinase gene.

    PubMed Central

    Hobson, G M; Molloy, G R; Benfield, P A

    1990-01-01

    The functional organization of the rat brain creatine kinase (ckb) promoter was analyzed by deletion, linker scanning, and substitution mutagenesis. Mutations were introduced into the ckb promoter of hybrid ckb/neo (neomycin resistance gene) genes, and the mutant genes were expressed transiently in HeLa cells. Expression was assayed by primer extension analysis of neo RNA, which allowed the transcription start sites and the amount of transcription to be determined. Transfections and primer extension reactions were internally controlled by simultaneous analysis of transcription from the adenovirus VA gene located on the same plasmid as the hybrid ckb/neo gene. We demonstrate that 195 bp of the ckb promoter is sufficient for efficient in vivo expression in HeLa cells. A nonconsensus TTAA element at -28 bp appears to provide the TATA box function for the ckb promoter in vivo. Two CCAAT elements, one at -84 bp and the other at -54 bp, and a TATAAA TA element (a consensus TATA box sequence) at -66 bp are required for efficient transcription from the TTAA element. In addition, we present evidence that the consensus beta-globin TATA box responds to the TATAAATA element in the same way as the ckb nonconsensus TTAA element. Images PMID:2247071

  4. Transcriptional activation of the herpes simplex virus type 1 UL38 promoter conferred by the cis-acting downstream activation sequence is mediated by a cellular transcription factor.

    PubMed

    Guzowski, J F; Singh, J; Wagner, E K

    1994-12-01

    The herpes simplex virus (HSV) type 1 strict late (gamma) UL38 promoter contains three cis-acting transcriptional elements: a TATA box, a specific initiator element, and the downstream activation sequence (DAS). DAS is located between positions +20 and +33 within the 5' untranslated leader region and strongly influences transcript levels during productive infection. In this communication, we further characterize DAS and investigate its mechanism of action. DAS function has a strict spacing requirement, and DAS contains an essential 6-bp core element. A similarly positioned element from the gamma gC gene (UL44) has partial DAS function within the UL38 promoter context, and the promoter controlling expression of the gamma US11 transcript contains an identically located element with functional and sequence similarity to UL38 DAS. These data suggest that downstream elements are a common feature of many HSV gamma promoters. Results with recombinant viruses containing modifications of the TATA box or initiator element of the UL38 promoter suggest that DAS functions to increase transcription initiation and not the efficiency of transcription elongation. In vitro transcription assays using uninfected HeLa nuclear extracts show that, as in productive infection with recombinant viruses, the deletion of DAS from the UL38 promoter dramatically decreases RNA expression. Finally, electrophoretic mobility shift assays and UV cross-linking experiments show that DAS DNA forms a specific, stable complex with a cellular protein (the DAS-binding factor) of approximately 35 kDa. These data strongly suggest that the interaction of cellular DAS-binding factor with DAS is required for efficient expression of UL38 and other HSV late genes.

  5. Interaction of trans-acting factors with the proximal promoter of the mouse alpha-fetoprotein gene.

    PubMed

    Ferrer, N; Portugal, J; Franco, R

    1992-12-01

    1. The alpha-Fetoprotein (AFP) gene is expressed during fetal life, but not in adult cells. Also, the AFP gene is expressed in most hepatomas. 2. Using gel retardation (band-shift) assays under very stringent conditions we have compared the binding of trans-acting factors to the proximal enhancer (-202, +34) region of the AFP gene. 3. We have detected the presence of two retarded bands in experiments performed with adult rat hepatocytes and the Fa32 cell line (which does not produce AFP) but only one band is observed with the HepG2 cell line (which produces AFP) and fetal liver. 4. We relate the two retarded bands to a glucocorticoid response element and, tentatively, to the C/EBP trans-acting fractor.

  6. 7 CFR 1205.302 - Act.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.302 Act. Act means the Cotton Research and Promotion Act...

  7. 7 CFR 1205.302 - Act.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.302 Act. Act means the Cotton Research and Promotion Act...

  8. miR-574-3p acts as a tumor promoter in osteosarcoma by targeting SMAD4 signaling pathway

    PubMed Central

    Xu, Haidong; Liu, Xiaozhou; Zhou, Juan; Chen, Xiaoyun; Zhao, Jianning

    2016-01-01

    Human osteosarcoma is the most common primary bone malignancy sarcoma that affects primarily children and people <20 years old. In the present study, it was demonstrated that miR-574-3p was downregulated in human osteosarcoma U2OS, SAOS and MG63 cells lines as well as in osteosarcoma tissue compared with the normal tissues. Downregulation of miR-574-3p by antisense miR-574-3p, inhibited cell growth and induced cell apoptosis. Overexpression of miR-574-3p by transfection with miR-574-3p mimics promoted the growth of U2OS cells. The present study then identified mothers against decapentaplegic homolog 4 (SMAD4) as a target of miR-574-3p and SMAD4 was suppressed in miR-574-3p transfected cells. Overexpression of SMAD4 could rescue the promoting effects of miR-574-3p on cancer cell growth. In conclusion, miR-574-3p exerts tumor-promoting roles by targeting the tumor-suppressing gene SMAD4 and its downstream signaling in human osteosarcoma, which provides a novel target for the treatment. PMID:28105233

  9. cis-acting DNA regulatory elements, including the retinoic acid response element, are required for tissue specific laminin B1 promoter/lacZ expression in transgenic mice.

    PubMed

    Sharif, K A; Li, C; Gudas, L J

    2001-05-01

    The LAMB1 gene encodes the laminin beta1 subunit of laminin, an extracellular matrix protein. Using several transgenic mouse lines containing various lengths of the LAMB1 promoter driving lacZ reporter gene expression, regions of LAMB1 promoter that contain cis-acting DNA regulatory element(s) have been identified. The 3.9LAMB1betagal transgene is expressed in various tissues during development. LAMB1 transgene expression is observed in a selective set of nephrons of the neonatal and adult kidneys. The cis-acting DNA regulatory elements responsible for LAMB1 transgene expression in ovaries and in juvenile kidneys are present between -'1.4 and -0.7 kb relative to the transcription start site, while those of adult kidneys are located between -2.5 and -1.4 kb. The LAMB1 transgene is also expressed in the epididymis of 1 week old transgenic mice. Mutation of the retinoic acid response element (RARE) in the context of the 3.9LAMB1betagal transgene results in loss of LAMB1 transgene expression in all tissues. Thus, sequences between -2.5 and -0.7 kb plus the RARE are required for appropriate expression of the LAMB1 transgene in mice.

  10. Recent trends in population-based cancer registries in Japan: the Act on Promotion of Cancer Registries and drastic changes in the historical registry.

    PubMed

    Matsuda, Tomohiro; Sobue, Tomotaka

    2015-02-01

    Cancer registration in Japan has a long history spanning over 60 years; the first population-based cancer registry was established in Miyagi prefecture in 1951. The progress made in the regional population-based cancer registries in terms of standardization and quality improvement during the 10 years of the third comprehensive strategy for cancer control was highlighted in the history of cancer registration in Japan. However, there were still weak points regarding local government-oriented cancer registries that remained, e.g., the reporting of cancer cases to the population-based cancer registries was not a mandatory task for medical institutions. After the Cancer Control Act in 2006, the Act on Promotion of Cancer Registries was finally enacted in Japan on December 6, 2013. According to that Act, hospital managers must report information on any primary cancer that was first diagnosed in their institutions from January 1, 2016 to the prefectural governors. Given the increasing number of cases and amount of information recorded, it would have been almost impossible to maintain our cancer registries using the same system, and changes were required to obtain reliable cancer statistics. This was particularly important in Japan, because the country is facing a hyper-aging society, with two to three million cancer patients requiring entry of detailed information. We appreciate the long history of the Japanese cancer registry, but it is necessary to make dramatic changes to bring the registry up to date and to be able to track the increasing amount of information.

  11. The value of advocacy in promoting social change: implementing the new Domestic Violence Act in South Africa.

    PubMed

    Usdin, S; Christofides, N; Malepe, L; Maker, A

    2000-11-01

    South Africa's first democratic government passed the Domestic Violence Act (DVA) into law in 1998 as part of local and international commitments to protecting the human rights of women. Although the Act was welcomed as groundbreaking legislation, delays in implementing it led to increasing frustration. This paper describes an advocacy campaign conducted by the Soul City Institute for Health and Development Communication in partnership with the National Network on Violence against Women, to ensure the effective implementation of the DVA. Lessons from the campaign stress the importance of coalition building to draw on diverse strengths, and the use of a combination of advocacy tools, including lobbying, media advocacy and social mobilisation to achieve campaign goals. Given the critical role NGOs dealing with victims/survivors of domestic violence and the justice system played in lobbying for change and drafting the new law, their exclusion from the implementation process was ironic. While many advocacy efforts focus on the development of policy and legislation, ongoing efforts are needed to ensure effective implementation, the commitment of adequate resources and monitoring to identify gaps and propose new solutions. Our experience highlights the important role of policy advocates in connecting the multiple streams at play in the policy and legislative arena.

  12. 7 CFR 1206.1 - Act.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE MANGO PROMOTION, RESEARCH, AND INFORMATION Mango Promotion, Research, and Information Order Definitions § 1206.1 Act. Act means the...

  13. 7 CFR 1206.1 - Act.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE MANGO PROMOTION, RESEARCH, AND INFORMATION Mango Promotion, Research, and Information Order Definitions § 1206.1 Act. Act means the...

  14. 7 CFR 1206.1 - Act.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE MANGO PROMOTION, RESEARCH, AND INFORMATION Mango Promotion, Research, and Information Order Definitions § 1206.1 Act. Act means the...

  15. 7 CFR 1206.1 - Act.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE MANGO PROMOTION, RESEARCH, AND INFORMATION Mango Promotion, Research, and Information Order Definitions § 1206.1 Act. Act means the...

  16. 7 CFR 1206.1 - Act.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE MANGO PROMOTION, RESEARCH, AND INFORMATION Mango Promotion, Research, and Information Order Definitions § 1206.1 Act. Act means the...

  17. 7 CFR 1210.302 - Act.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE WATERMELON RESEARCH AND PROMOTION PLAN Watermelon Research and Promotion Plan Definitions § 1210.302 Act. Act means the Watermelon...

  18. 7 CFR 1210.302 - Act.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE WATERMELON RESEARCH AND PROMOTION PLAN Watermelon Research and Promotion Plan Definitions § 1210.302 Act. Act means the Watermelon...

  19. 7 CFR 1210.302 - Act.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE WATERMELON RESEARCH AND PROMOTION PLAN Watermelon Research and Promotion Plan Definitions § 1210.302 Act. Act means the Watermelon...

  20. 7 CFR 1218.1 - Act.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE BLUEBERRY PROMOTION, RESEARCH, AND INFORMATION ORDER Blueberry Promotion, Research, and Information Order Definitions § 1218.1 Act. Act means...

  1. 7 CFR 1218.1 - Act.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE BLUEBERRY PROMOTION, RESEARCH, AND INFORMATION ORDER Blueberry Promotion, Research, and Information Order Definitions § 1218.1 Act. Act means...

  2. 7 CFR 1218.1 - Act.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE BLUEBERRY PROMOTION, RESEARCH, AND INFORMATION ORDER Blueberry Promotion, Research, and Information Order Definitions § 1218.1 Act. Act means...

  3. 7 CFR 1218.1 - Act.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE BLUEBERRY PROMOTION, RESEARCH, AND INFORMATION ORDER Blueberry Promotion, Research, and Information Order Definitions § 1218.1 Act. Act means...

  4. 7 CFR 1218.1 - Act.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE BLUEBERRY PROMOTION, RESEARCH, AND INFORMATION ORDER Blueberry Promotion, Research, and Information Order Definitions § 1218.1 Act. Act means...

  5. 7 CFR 1214.1 - Act.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE CHRISTMAS TREE PROMOTION, RESEARCH, AND INFORMATION ORDER Christmas Tree Promotion, Research, and Information Order Definitions § 1214.1 Act. Act...

  6. 7 CFR 1214.1 - Act.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE CHRISTMAS TREE PROMOTION, RESEARCH, AND INFORMATION ORDER Christmas Tree Promotion, Research, and Information Order Definitions § 1214.1 Act. Act...

  7. 7 CFR 1214.1 - Act.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE CHRISTMAS TREE PROMOTION, RESEARCH, AND INFORMATION ORDER Christmas Tree Promotion, Research, and Information Order Definitions § 1214.1 Act. Act...

  8. 7 CFR 1216.1 - Act.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE PEANUT PROMOTION, RESEARCH, AND INFORMATION ORDER Peanut Promotion, Research, and Information Order Definitions § 1216.1 Act. Act means the...

  9. 7 CFR 1216.1 - Act.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE PEANUT PROMOTION, RESEARCH, AND INFORMATION ORDER Peanut Promotion, Research, and Information Order Definitions § 1216.1 Act. Act means the...

  10. 7 CFR 1216.1 - Act.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE PEANUT PROMOTION, RESEARCH, AND INFORMATION ORDER Peanut Promotion, Research, and Information Order Definitions § 1216.1 Act. Act means the...

  11. 7 CFR 1216.1 - Act.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE PEANUT PROMOTION, RESEARCH, AND INFORMATION ORDER Peanut Promotion, Research, and Information Order Definitions § 1216.1 Act. Act means the...

  12. 7 CFR 1216.1 - Act.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE PEANUT PROMOTION, RESEARCH, AND INFORMATION ORDER Peanut Promotion, Research, and Information Order Definitions § 1216.1 Act. Act means the...

  13. 7 CFR 1221.1 - Act.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE SORGHUM PROMOTION, RESEARCH, AND INFORMATION ORDER Sorghum Promotion, Research, and Information Order Definitions § 1221.1 Act. Act means...

  14. 7 CFR 1221.1 - Act.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE SORGHUM PROMOTION, RESEARCH, AND INFORMATION ORDER Sorghum Promotion, Research, and Information Order Definitions § 1221.1 Act. Act means...

  15. 7 CFR 1221.1 - Act.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE SORGHUM PROMOTION, RESEARCH, AND INFORMATION ORDER Sorghum Promotion, Research, and Information Order Definitions § 1221.1 Act. Act means...

  16. 7 CFR 1221.1 - Act.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE SORGHUM PROMOTION, RESEARCH, AND INFORMATION ORDER Sorghum Promotion, Research, and Information Order Definitions § 1221.1 Act. Act means...

  17. 7 CFR 1221.1 - Act.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE SORGHUM PROMOTION, RESEARCH, AND INFORMATION ORDER Sorghum Promotion, Research, and Information Order Definitions § 1221.1 Act. Act means...

  18. 7 CFR 1280.101 - Act.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE LAMB PROMOTION, RESEARCH, AND INFORMATION ORDER Lamb Promotion, Research, and Information Order Definitions § 1280.101 Act. Act means...

  19. Promoting Mentalizing in Pupils by Acting on Teachers: Preliminary Italian Evidence of the "Thought in Mind" Project.

    PubMed

    Valle, Annalisa; Massaro, Davide; Castelli, Ilaria; Sangiuliano Intra, Francesca; Lombardi, Elisabetta; Bracaglia, Edoardo; Marchetti, Antonella

    2016-01-01

    Mentalization research focuses on different aspects of this topic, highlighting individual differences in mentalizing and proposing programs of intervention for children and adults to increase this ability. The "Thought in Mind Project" (TiM Project) provides training targeted to adults-teachers or parents-to increase their mentalization and, consequently, to obtain mentalization improvement in children. The present research aimed to explore for the first time ever the potential of training for teachers based on the TiM Project, regarding the enhancement of mentalizing of an adult who would have interacted as a teacher with children. For this reason, two teachers - similar for meta-cognitive and meta-emotional skills - and their classes (N = 46) were randomly assigned to the training or control condition. In the first case, the teacher participated in training on the implementation of promotion of mentalizing in everyday school teaching strategies; in the second case the teacher participated in a control activity, similar to training for scheduling and methods, but without promoting the implementation of mentalization (in both conditions two meetings lasting about 3 h at the beginning of the school year and two supervisions during the school year were conducted). The children were tested by tasks assessing several aspects of mentalization (second and third-order false belief understanding, Strange Stories, Reading the mind in the Eyes, Mentalizing Task) both before and after the teacher participate in the TiM or control training (i.e., at the beginning and at the end of the school year). The results showed that, although some measured components of mentalization progressed over time, only the TiM Project training group significantly improved in third order false belief understanding and changed - in a greater way compared to the control group - in two of the three components of the Mentalizing Task. These evidences are promising about the idea that the creation of

  20. Promoting Mentalizing in Pupils by Acting on Teachers: Preliminary Italian Evidence of the “Thought in Mind” Project

    PubMed Central

    Valle, Annalisa; Massaro, Davide; Castelli, Ilaria; Sangiuliano Intra, Francesca; Lombardi, Elisabetta; Bracaglia, Edoardo; Marchetti, Antonella

    2016-01-01

    Mentalization research focuses on different aspects of this topic, highlighting individual differences in mentalizing and proposing programs of intervention for children and adults to increase this ability. The “Thought in Mind Project” (TiM Project) provides training targeted to adults—teachers or parents—to increase their mentalization and, consequently, to obtain mentalization improvement in children. The present research aimed to explore for the first time ever the potential of training for teachers based on the TiM Project, regarding the enhancement of mentalizing of an adult who would have interacted as a teacher with children. For this reason, two teachers – similar for meta-cognitive and meta-emotional skills - and their classes (N = 46) were randomly assigned to the training or control condition. In the first case, the teacher participated in training on the implementation of promotion of mentalizing in everyday school teaching strategies; in the second case the teacher participated in a control activity, similar to training for scheduling and methods, but without promoting the implementation of mentalization (in both conditions two meetings lasting about 3 h at the beginning of the school year and two supervisions during the school year were conducted). The children were tested by tasks assessing several aspects of mentalization (second and third-order false belief understanding, Strange Stories, Reading the mind in the Eyes, Mentalizing Task) both before and after the teacher participate in the TiM or control training (i.e., at the beginning and at the end of the school year). The results showed that, although some measured components of mentalization progressed over time, only the TiM Project training group significantly improved in third order false belief understanding and changed - in a greater way compared to the control group – in two of the three components of the Mentalizing Task. These evidences are promising about the idea that the

  1. Practices related to tobacco sale, promotion and protection from tobacco smoke exposure in restaurants and bars in Kampala before implementation of the Uganda tobacco control Act 2015.

    PubMed

    Kabwama, Steven Ndugwa; Kadobera, Daniel; Ndyanabangi, Sheila; Nyamurungi, Kellen Namusisi; Gravely, Shannon; Robertson, Lindsay; Guwatudde, David

    2017-01-01

    The Word Health Organization's Framework Convention on Tobacco Control calls on parties to implement evidenced-based tobacco control policies, which includes Article 8 (protect the public from exposure to tobacco smoke), and Article 13 (tobacco advertising, promotion and sponsorship (TAPS)). In 2015, Uganda passed the Tobacco Control Act 2015 which includes a comprehensive ban on smoking in all public places and on all forms of TAPS. Prior to implementation, we sought to assess practices related to protection of the public from tobacco smoke exposure, limiting access to tobacco products and TAPS in restaurants and bars in Kampala City to inform implementation of the new law. This was a cross-sectional study that used an observational checklist to guide observations. Assessments were: whether an establishment allows for tobacco products to be smoked on premises, offer of tobacco products for sale, observation of tobacco products for sale, tobacco advertising posters, illuminated tobacco advertisements, tobacco promotional items, presence of designated smoking zones, no-smoking signs and posters, and observation of indoor smoking. Managers of establishments were also asked whether they conducted tobacco product sales promotions within establishments. Data were collected in May 2016, immediately prior to implementation of the smoke-free and TAPS laws. Of the 218 establishments in the study, 17% (n = 37) had no-smoking signs, 50% (n = 108) allowed for tobacco products to be smoked on premises of which, 63% (n = 68) had designated smoking zones. Among the respondents in the study, 33.3% (n = 72) reported having tobacco products available for sale of which 73.6% (n = 53) had manufactured cigarettes as the available tobacco products. Eleven percent (n = 24) of respondents said they conducted tobacco promotion within their establishment while 7.9% (n = 17) had promotional items given to them by tobacco companies. Hospitality establishments in

  2. Kaposi's Sarcoma-Associated Herpesvirus-Encoded LANA Down-Regulates IL-22R1 Expression through a Cis-Acting Element within the Promoter Region

    PubMed Central

    Su, Ling; Liao, Qingjiao; Wu, Yang; Chen, Xulin

    2011-01-01

    Kaposi's sarcoma-associated herpesvirus (KSHV) is considered to be a necessary, but not sufficient, causal agent of Kaposi's sarcoma (KS). All forms of KS are characterized by the proliferation of spindle-shaped cells, and most (>90%) spindle cells from KS lesions are latently infected with KSHV. During KSHV latency, only a few viral genes are expressed. Among those latent genes, the ORF 73 gene encodes the latency-associated nuclear antigen (LANA), which is critical for the establishment and maintenance of the latent KSHV infection. Much evidence suggests that many cytokines can increase the frequency and aggressiveness of KS. In this study, a microarray analysis of KS and normal tissues revealed that multiple cytokines and cytokine receptors are regulated by KSHV latent infection. Of special interest, IL-22R1 transcript level was found to be down-regulated in the KS tissue. To study the possible regulation of IL-22R1 by LANA, the IL-22R1 promoter was constructed and found to contain a LANA-binding site (LBS). LANA was demonstrated to down-regulate IL-22R1 expression via direct binding to the LBS located within the IL-22R1 promoter region. Furthermore, KSHV latently infected cells showed an impaired response to IL-22 stimulation. These results suggest that LANA can regulate host factor expression by directly binding to a cis-acting element within the factor's promoter to benefit latent viral infection and suppression of the antiviral immune response. PMID:21544244

  3. The ribonucleotidyl transferase USIP-1 acts with SART3 to promote U6 snRNA recycling

    PubMed Central

    Rüegger, Stefan; Miki, Takashi S.; Hess, Daniel; Großhans, Helge

    2015-01-01

    The spliceosome is a large molecular machine that serves to remove the intervening sequences that are present in most eukaryotic pre-mRNAs. At its core are five small nuclear ribonucleoprotein complexes, the U1, U2, U4, U5 and U6 snRNPs, which undergo dynamic rearrangements during splicing. Their reutilization for subsequent rounds of splicing requires reversion to their original configurations, but little is known about this process. Here, we show that ZK863.4/USIP-1 (U Six snRNA-Interacting Protein-1) is a ribonucleotidyl transferase that promotes accumulation of the Caenorhabditis elegans U6 snRNA. Endogenous USIP-1–U6 snRNA complexes lack the Lsm proteins that constitute the protein core of the U6 snRNP, but contain the U6 snRNP recycling factor SART3/B0035.12. Furthermore, co-immunoprecipitation experiments suggest that SART3 but not USIP-1 occurs also in a separate complex containing both the U4 and U6 snRNPs. Based on this evidence, genetic interaction between usip-1 and sart-3, and the apparent dissociation of Lsm proteins from the U6 snRNA during spliceosome activation, we propose that USIP-1 functions upstream of SART3 to promote U6 snRNA recycling. PMID:25753661

  4. Polymorphic tandem repeats within gene promoters act as modifiers of gene expression and DNA methylation in humans.

    PubMed

    Quilez, Javier; Guilmatre, Audrey; Garg, Paras; Highnam, Gareth; Gymrek, Melissa; Erlich, Yaniv; Joshi, Ricky S; Mittelman, David; Sharp, Andrew J

    2016-05-05

    Despite representing an important source of genetic variation, tandem repeats (TRs) remain poorly studied due to technical difficulties. We hypothesized that TRs can operate as expression (eQTLs) and methylation (mQTLs) quantitative trait loci. To test this we analyzed the effect of variation at 4849 promoter-associated TRs, genotyped in 120 individuals, on neighboring gene expression and DNA methylation. Polymorphic promoter TRs were associated with increased variance in local gene expression and DNA methylation, suggesting functional consequences related to TR variation. We identified >100 TRs associated with expression/methylation levels of adjacent genes. These potential eQTL/mQTL TRs were enriched for overlaps with transcription factor binding and DNaseI hypersensitivity sites, providing a rationale for their effects. Moreover, we showed that most TR variants are poorly tagged by nearby single nucleotide polymorphisms (SNPs) markers, indicating that many functional TR variants are not effectively assayed by SNP-based approaches. Our study assigns biological significance to TR variations in the human genome, and suggests that a significant fraction of TR variations exert functional effects via alterations of local gene expression or epigenetics. We conclude that targeted studies that focus on genotyping TR variants are required to fully ascertain functional variation in the genome. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. Synthetic promoters consisting of defined cis-acting elements link multiple signaling pathways to probenazole-inducible system.

    PubMed

    Zhu, Zheng; Gao, Jiong; Yang, Jin-xiao; Wang, Xiao-yan; Ren, Guo-dong; Ding, Yu-long; Kuai, Ben-ke

    2015-04-01

    Probenazole (3-allyloxy-1,2-benzisothiazole-1,1-dioxide, PBZ), the active component of Oryzemate, could induce systemic acquired resistance (SAR) in plants through the induction of salicylic acid (SA) biosynthesis. As a widely used chemical inducer, PBZ is a good prospect for establishing a new chemical-inducible system. We first designed artificially synthetic promoters with tandem copies of a single type of cis-element (SARE, JERE, GCC, GST1, HSRE, and W-box) that could mediate the expression of the β-glucuronidase (GUS) reporter gene in plants upon PBZ treatment. Then we combined different types of elements in order to improve inducibility in the PBZ-inducible system. On the other hand, we were surprised to find that the cis-elements, which are responsive to jasmonic acid (JA) and ethylene, also responded to PBZ, implying that SA, JA, and ethylene pathways also would play important roles in PBZ's action. Further analysis demonstrated that PBZ also induced early events of innate immunity via a signaling pathway in which Ca(2+) influx and mitogen-activated protein kinase (MAPK) activity were involved. We constructed synthesized artificial promoters to establish a PBZ chemical-inducible system, and preliminarily explored SA, JA, ethylene, calcium, and MAPK signaling pathways via PBZ-inducible system, which could provide an insight for in-depth study.

  6. Evidence that TSC2 acts as a transcription factor and binds to and represses the promoter of Epiregulin.

    PubMed

    Pradhan, Shalmali Avinash; Rather, Mohammad Iqbal; Tiwari, Ankana; Bhat, Vishwanath Kumble; Kumar, Arun

    2014-06-01

    The TSC2 gene, mutated in patients with tuberous sclerosis complex (TSC), encodes a 200 kDa protein TSC2 (tuberin). The importance of TSC2 in the regulation of cell growth and proliferation is irrefutable. TSC2 in complex with TSC1 negatively regulates the mTOR complex 1 (mTORC1) via RHEB in the PI3K-AKT-mTOR pathway and in turn regulates cell proliferation. It shows nuclear as well as cytoplasmic localization. However, its nuclear function remains elusive. In order to identify the nuclear function of TSC2, a whole-genome expression profiling of TSC2 overexpressing cells was performed, and the results showed differential regulation of 266 genes. Interestingly, transcription was found to be the most populated functional category. EREG (Epiregulin), a member of the epidermal growth factor family, was found to be the most downregulated gene in the microarray analysis. Previous reports have documented elevated levels of EREG in TSC lesions, making its regulatory aspects intriguing. Using the luciferase reporter, ChIP and EMSA techniques, we show that TSC2 binds to the EREG promoter between -352 bp and -303 bp and negatively regulates its expression. This is the first evidence for the role of TSC2 as a transcription factor and of TSC2 binding to the promoter of any gene.

  7. Evidence that TSC2 acts as a transcription factor and binds to and represses the promoter of Epiregulin

    PubMed Central

    Pradhan, Shalmali Avinash; Rather, Mohammad Iqbal; Tiwari, Ankana; Bhat, Vishwanath Kumble; Kumar, Arun

    2014-01-01

    The TSC2 gene, mutated in patients with tuberous sclerosis complex (TSC), encodes a 200 kDa protein TSC2 (tuberin). The importance of TSC2 in the regulation of cell growth and proliferation is irrefutable. TSC2 in complex with TSC1 negatively regulates the mTOR complex 1 (mTORC1) via RHEB in the PI3K-AKT-mTOR pathway and in turn regulates cell proliferation. It shows nuclear as well as cytoplasmic localization. However, its nuclear function remains elusive. In order to identify the nuclear function of TSC2, a whole-genome expression profiling of TSC2 overexpressing cells was performed, and the results showed differential regulation of 266 genes. Interestingly, transcription was found to be the most populated functional category. EREG (Epiregulin), a member of the epidermal growth factor family, was found to be the most downregulated gene in the microarray analysis. Previous reports have documented elevated levels of EREG in TSC lesions, making its regulatory aspects intriguing. Using the luciferase reporter, ChIP and EMSA techniques, we show that TSC2 binds to the EREG promoter between −352 bp and −303 bp and negatively regulates its expression. This is the first evidence for the role of TSC2 as a transcription factor and of TSC2 binding to the promoter of any gene. PMID:24748662

  8. C1q acts in the tumour microenvironment as a cancer-promoting factor independently of complement activation.

    PubMed

    Bulla, Roberta; Tripodo, Claudio; Rami, Damiano; Ling, Guang Sheng; Agostinis, Chiara; Guarnotta, Carla; Zorzet, Sonia; Durigutto, Paolo; Botto, Marina; Tedesco, Francesco

    2016-02-01

    Complement C1q is the activator of the classical pathway. However, it is now recognized that C1q can exert functions unrelated to complement activation. Here we show that C1q, but not C4, is expressed in the stroma and vascular endothelium of several human malignant tumours. Compared with wild-type (WT) or C3- or C5-deficient mice, C1q-deficient (C1qa(-/-)) mice bearing a syngeneic B16 melanoma exhibit a slower tumour growth and prolonged survival. This effect is not attributable to differences in the tumour-infiltrating immune cells. Tumours developing in WT mice display early deposition of C1q, higher vascular density and an increase in the number of lung metastases compared with C1qa(-/-) mice. Bone marrow (BM) chimeras between C1qa(-/-) and WT mice identify non-BM-derived cells as the main local source of C1q that can promote cancer cell adhesion, migration and proliferation. Together these findings support a role for locally synthesized C1q in promoting tumour growth.

  9. Synthetic promoters consisting of defined cis-acting elements link multiple signaling pathways to probenazole-inducible system * #

    PubMed Central

    Zhu, Zheng; Gao, Jiong; Yang, Jin-xiao; Wang, Xiao-yan; Ren, Guo-dong; Ding, Yu-long; Kuai, Ben-ke

    2015-01-01

    Probenazole (3-allyloxy-1,2-benzisothiazole-1,1-dioxide, PBZ), the active component of Oryzemate, could induce systemic acquired resistance (SAR) in plants through the induction of salicylic acid (SA) biosynthesis. As a widely used chemical inducer, PBZ is a good prospect for establishing a new chemical-inducible system. We first designed artificially synthetic promoters with tandem copies of a single type of cis-element (SARE, JERE, GCC, GST1, HSRE, and W-box) that could mediate the expression of the β-glucuronidase (GUS) reporter gene in plants upon PBZ treatment. Then we combined different types of elements in order to improve inducibility in the PBZ-inducible system. On the other hand, we were surprised to find that the cis-elements, which are responsive to jasmonic acid (JA) and ethylene, also responded to PBZ, implying that SA, JA, and ethylene pathways also would play important roles in PBZ’s action. Further analysis demonstrated that PBZ also induced early events of innate immunity via a signaling pathway in which Ca2+ influx and mitogen-activated protein kinase (MAPK) activity were involved. We constructed synthesized artificial promoters to establish a PBZ chemical-inducible system, and preliminarily explored SA, JA, ethylene, calcium, and MAPK signaling pathways via PBZ-inducible system, which could provide an insight for in-depth study. PMID:25845359

  10. Long noncoding RNA CCAT1 acts as an oncogene and promotes chemoresistance in docetaxel-resistant lung adenocarcinoma cells

    PubMed Central

    Wang, Rui; Chu, Xiaoyuan; Chen, Longbang

    2016-01-01

    Chemoresistance remains one of the major obstacles in clinical treatment of lung adenocarcinoma (LAD). Indeed, docetaxel-resistant LAD cells present chemoresistance and epithelial-to-mesenchymal transition phenotypes. Long non-coding RNAs (lncRNAs) are known to promote tumorigenesis in many cancer types. Here, we showed that the lncRNA colon cancer-associated transcript-1 (CCAT1) was upregulated in docetaxel-resistant LAD cells. Furthermore, downregulation of CCAT1 decreased chemoresistance, inhibited proliferation, enhanced apoptosis and reversed the epithelial-to-mesenchymal transition phenotype of docetaxel-resistant LAD cells. We also found that the oncogenic function of CCAT1 in docetaxel-resistant LAD cells depended on the sponging of let-7c. In turn, the sponging of let-7c by CCAT1 released Bcl-xl (a let-7c target), thereby promoting the acquisition of chemoresistance and epithelial-to-mesenchymal transition phenotypes in docetaxel-resistant LAD cells. Our data reveal a novel pathway underlying chemoresistance and the epithelial-to-mesenchymal transition in docetaxel-resistant LAD cells. PMID:27566568

  11. Clobetasol and Halcinonide Act as Smoothened Agonists to Promote Myelin Gene Expression and RxRγ Receptor Activation.

    PubMed

    Porcu, Giampiero; Serone, Eliseo; De Nardis, Velia; Di Giandomenico, Daniele; Lucisano, Giuseppe; Scardapane, Marco; Poma, Anna; Ragnini-Wilson, Antonella

    2015-01-01

    One of the causes of permanent disability in chronic multiple sclerosis patients is the inability of oligodendrocyte progenitor cells (OPCs) to terminate their maturation program at lesions. To identify key regulators of myelin gene expression acting at the last stages of OPC maturation we developed a drug repositioning strategy based on the mouse immortalized oligodendrocyte (OL) cell line Oli-neu brought to the premyelination stage by stably expressing a key factor regulating the last stages of OL maturation. The Prestwick Chemical Library of 1,200 FDA-approved compound(s) was repositioned at three dosages based on the induction of Myelin Basic Protein (MBP) expression. Drug hits were further validated using dosage-dependent reproducibility tests and biochemical assays. The glucocorticoid class of compounds was the most highly represented and we found that they can be divided in three groups according to their efficacy on MBP up-regulation. Since target identification is crucial before bringing compounds to the clinic, we searched for common targets of the primary screen hits based on their known chemical-target interactomes, and the pathways predicted by top ranking compounds were validated using specific inhibitors. Two of the top ranking compounds, Halcinonide and Clobetasol, act as Smoothened (Smo) agonists to up-regulate myelin gene expression in the Oli-neuM cell line. Further, RxRγ activation is required for MBP expression upon Halcinonide and Clobetasol treatment. These data indicate Clobetasol and Halcinonide as potential promyelinating drugs and also provide a mechanistic understanding of their mode of action in the pathway leading to myelination in OPCs. Furthermore, our classification of glucocorticoids with respect to MBP expression provides important novel insights into their effects in the CNS and a rational criteria for their choice in combinatorial therapies in de-myelinating diseases.

  12. Clobetasol and Halcinonide Act as Smoothened Agonists to Promote Myelin Gene Expression and RxRγ Receptor Activation

    PubMed Central

    De Nardis, Velia; Di Giandomenico, Daniele; Lucisano, Giuseppe; Scardapane, Marco; Poma, Anna; Ragnini-Wilson, Antonella

    2015-01-01

    One of the causes of permanent disability in chronic multiple sclerosis patients is the inability of oligodendrocyte progenitor cells (OPCs) to terminate their maturation program at lesions. To identify key regulators of myelin gene expression acting at the last stages of OPC maturation we developed a drug repositioning strategy based on the mouse immortalized oligodendrocyte (OL) cell line Oli-neu brought to the premyelination stage by stably expressing a key factor regulating the last stages of OL maturation. The Prestwick Chemical Library® of 1,200 FDA-approved compound(s) was repositioned at three dosages based on the induction of Myelin Basic Protein (MBP) expression. Drug hits were further validated using dosage-dependent reproducibility tests and biochemical assays. The glucocorticoid class of compounds was the most highly represented and we found that they can be divided in three groups according to their efficacy on MBP up-regulation. Since target identification is crucial before bringing compounds to the clinic, we searched for common targets of the primary screen hits based on their known chemical-target interactomes, and the pathways predicted by top ranking compounds were validated using specific inhibitors. Two of the top ranking compounds, Halcinonide and Clobetasol, act as Smoothened (Smo) agonists to up-regulate myelin gene expression in the Oli-neuM cell line. Further, RxRγ activation is required for MBP expression upon Halcinonide and Clobetasol treatment. These data indicate Clobetasol and Halcinonide as potential promyelinating drugs and also provide a mechanistic understanding of their mode of action in the pathway leading to myelination in OPCs. Furthermore, our classification of glucocorticoids with respect to MBP expression provides important novel insights into their effects in the CNS and a rational criteria for their choice in combinatorial therapies in de-myelinating diseases. PMID:26658258

  13. Id4, a New Candidate Gene for Senile Osteoporosis, Acts as a Molecular Switch Promoting Osteoblast Differentiation

    PubMed Central

    Yamashita, Yzumi; Nakachi, Yutaka; Nikaido, Itoshi; Bono, Hidemasa; Ninomiya, Yuichi; Kanesaki-Yatsuka, Yukiko; Akita, Masumi; Motegi, Hiromi; Wakana, Shigeharu; Noda, Tetsuo; Sablitzky, Fred; Arai, Shigeki; Kurokawa, Riki; Fukuda, Toru; Katagiri, Takenobu; Schönbach, Christian; Suda, Tatsuo; Mizuno, Yosuke; Okazaki, Yasushi

    2010-01-01

    Excessive accumulation of bone marrow adipocytes observed in senile osteoporosis or age-related osteopenia is caused by the unbalanced differentiation of MSCs into bone marrow adipocytes or osteoblasts. Several transcription factors are known to regulate the balance between adipocyte and osteoblast differentiation. However, the molecular mechanisms that regulate the balance between adipocyte and osteoblast differentiation in the bone marrow have yet to be elucidated. To identify candidate genes associated with senile osteoporosis, we performed genome-wide expression analyses of differentiating osteoblasts and adipocytes. Among transcription factors that were enriched in the early phase of differentiation, Id4 was identified as a key molecule affecting the differentiation of both cell types. Experiments using bone marrow-derived stromal cell line ST2 and Id4-deficient mice showed that lack of Id4 drastically reduces osteoblast differentiation and drives differentiation toward adipocytes. On the other hand knockdown of Id4 in adipogenic-induced ST2 cells increased the expression of Pparγ2, a master regulator of adipocyte differentiation. Similar results were observed in bone marrow cells of femur and tibia of Id4-deficient mice. However the effect of Id4 on Pparγ2 and adipocyte differentiation is unlikely to be of direct nature. The mechanism of Id4 promoting osteoblast differentiation is associated with the Id4-mediated release of Hes1 from Hes1-Hey2 complexes. Hes1 increases the stability and transcriptional activity of Runx2, a key molecule of osteoblast differentiation, which results in an enhanced osteoblast-specific gene expression. The new role of Id4 in promoting osteoblast differentiation renders it a target for preventing the onset of senile osteoporosis. PMID:20628571

  14. Reg proteins promote acinar-to-ductal metaplasia and act as novel diagnostic and prognostic markers in pancreatic ductal adenocarcinoma

    PubMed Central

    Zogopoulos, George; Shao, Qin; Dong, Kun; Lv, Fudong; Nwilati, Karam; Gui, Xian-yong; Cuggia, Adeline; Liu, Jun-Li; Gao, Zu-hua

    2016-01-01

    Pancreatic ductal adenocarcinoma (PDAC) is a highly aggressive malignant tumor. Acinar-to-ductal metaplasia (ADM) and pancreatic intraepithelial neoplasia (PanIN) are both precursor lesions that lead to the development of PDAC. Reg family proteins (Reg1A, 1B, 3A/G, 4) are a group of calcium-dependent lectins that promote islet growth in response to inflammation and/or injuries. The aim of this study was to establish a role for Reg proteins in the development of PDAC and their clinical value as biomarkers. We found that Reg1A and Reg3A/G were highly expressed in the ADM tissues by immunohistochemistry. In the 3-dimensional culture of mouse acinar cells, Reg3A promoted ADM formation with concurrent activation of mitogen-acitvated protein kinase. Upregulation of Reg1A and Reg1B levels was observed as benign ductal epithelium progresses from PanIN to invasive PDAC. Patients with PDAC showed significantly higher serum levels of Reg1A and Reg1B than matching healthy subjects. These results were further validated by the quantification of Reg 1A and 1B mRNA levels in the microdissected tissues (22- and 6-fold increases vs. non-tumor tissues). Interestingly, patients with higher levels of Reg1A and 1B exhibited improved survival rate than those with lower levels. Furthermore, tissue expressions of Reg1A, Reg1B, and Reg4 could differentiate metastatic PDAC in the liver from intrahepatic cholangiocarcinoma with 92% sensitivity and 95% specificity. Overall, our results demonstrate the upregulation of Reg proteins during PDAC development. If validated in larger scale, Reg1A and Reg1B could become clinical markers for detecting early stages of PDAC, monitoring therapeutic response, and/or predicting patient's prognosis. PMID:27788482

  15. DNA-binding protein phosphatase AtDBP1 acts as a promoter of flowering in Arabidopsis.

    PubMed

    Zhai, Hong; Ning, Wenfeng; Wu, Hongyan; Zhang, Xingzheng; Lü, Shixiang; Xia, Zhengjun

    2016-03-01

    We provide evidence that AtDBP1 promotes flowering by regulating the transcript levels of several important integrators and floral meristem identity genes, including FLC, CO, SOC1, LFY, FT and FD. DNA-binding protein phosphatases (DBP) which exhibit both sequence specific DNA-binding and protein phosphatase 2C activities are important regulators that are involved in both the transcriptional and post-translational regulations. DBP factors are known to mediate susceptibility to potyviruses; however, whether they are involved in other processes is still unclear. In this study, under both long day (LD) and short day conditions, AtDBP1 overexpressing plants displayed early flowering, while the knock out mutants, atdbp1, exhibited a delay in flowering relative to the wild-type plants; both the overexpressing lines and atdbp1 mutants remained photoperiodic sensitive, indicating that AtDBP1 was involved in the autonomous pathway. AtDBP1 does not respond to vernalization at transcript level, and both AtDBP1 overexpressing plants and atdbp1 mutants remain responsive to vernalization, indicating that AtDBP1 may not be directly involved in vernalization. Real-time PCR analysis showed that AtDBP1 can suppress FLOWERING LOCUC C (FLC) expression, a key integrator of the autonomous and vernalization pathways, and enhance the expression levels of CONSTANS and FLOWERING LOCUC T, key regulators of the LD pathway. Furthermore, expression of floral meristem identity genes including SUPPRESSOR OF OVEREXPRESSION OF CO 1, LEAFY and FD was also promoted in AtDBP1 overexpressing plants. AtDBP1 transcription can be detected in root, leaf, stem, flower and silique. AtDBP1-GFP and YFP-AtDBP1 fusion protein were localized in the cytosol and nucleus. Our results provide the evidence demonstrating the effective role of AtDBP1 for flowering time regulation and report a novel function of DBP factors in planta besides in plant defense.

  16. [Does the lack of evidence of effectiveness among international studies on interventions in prevention and health promotion have an impact on a German Act of Prevention?].

    PubMed

    Lüngen, Markus; Schröer-Günther, Milly-Anna; Passon, Anna Marie; Gerber, Andreas; Lauterbach, Karl W

    2009-02-15

    Efforts have been undertaken to devise and pass an Act of Prevention in Germany. To date, no consensus could be reached with changing political majorities in parliament. Hence, the authors ask the question whether the lack of evidence in prevention and health promotion could also be contributing to this delay. After a systematic search of the literature on prevention and health promotion in nutrition, exercise, depression, and smoking, all retrieved studies were evaluated in terms of their effect as well as the quality of study design like prior power calculation and intervention like documentation of process or participation of intended group. For inclusion, studies had to be undertaken in one of 13 countries that have a socioeconomic standard of living comparable to Germany. The authors of this article exemplarily included studies from the following focus areas into the systematic review: prevention of depression among children and adolescents, exercise in the work environment, nutrition for children and adolescents, and smoking cessation programs among pregnant women, all from 1990 to 2006. The authors retrieved 18 studies on prevention of depression among children and adolescents, 26 on exercise in the work environment, 23 on nutrition for children and adolescents, and 34 on smoking cessation programs among pregnant women. Six out of 26 on exercise had a positive effect (23.1%), one out of 18 on depression (5.6%), seven out of 23 in the field of nutrition (30.4%), and nine out of 34 smoking cessation programs (26.5%). If one takes into account the quality of study design and intervention as a marker for the reliability and validity of results, one intervention on exercise, two on nutrition, three on smoking and none on depression would remain with a positive effect. In four exemplarily selected fields only six out of a total of 101 international studies (5.9%) had an effect, if one also ties in quality of study design and intervention. With regard to this

  17. Sea Changes - ACT : Artists and Scientists collaborating to promote ocean activism and conservation. (www.seachanges.org)

    NASA Astrophysics Data System (ADS)

    Lueker, T.

    2012-12-01

    We are a group of ocean scientists, artists, and educators working to publicize the urgent environmental problems facing our ocean environs, including overfishing, climate change and ocean acidification, and environmental degradation due to plastic and other forms of pollution. Our team leader, Kira Carrillo Corser, is an artist and educator known nationally for affecting policy and social change. Our collaboration results from the DNA of Creativity Project - the brainchild of Patricia Frischer, co-ordinator for the San Diego Visual Arts Network (http://dnaofc.weebly.com). The DNA of Creativity funded teams composed of artists and scientists with the goal of fusing the creative energies of both into projects that will enhance the public's perception of creativity, and make the complexities of art and science collaborations accessible to a new and larger audience. Sea Changes - ACT was funded initially by the DNA of Creativity Project. Our project goals are : 1) To entice people to participate in the joys of discovery of art AND science and 2) To motivate the public to work for real, committed and innovative change to protect our oceans. Part of our strategy for achieving our goals is to create a traveling art installation to illustrate the beauty of the oceans and to instill in our viewers the joys of discovery and creativity that we as scientists and artists pursue. And following this, to make the destructive changes occurring in the ocean and the future consequences more visible and understandable. We will develop lesson plans to integrate our ideas into the educational system and we are documenting our collaborative and creative process to inform future art-science collaborations. Finally, after emotionally connecting with our viewers to provide a means to ACT to make real and positive CHANGES for the future. Our project aims to build commitment and action for environmental conservation and stewardship as we combine scientific research with ways to take action

  18. NER and HR pathways act sequentially to promote UV-C-induced germ cell apoptosis in Caenorhabditis elegans

    PubMed Central

    Stergiou, L; Eberhard, R; Doukoumetzidis, K; Hengartner, M O

    2011-01-01

    Ultraviolet (UV) radiation-induced DNA damage evokes a complex network of molecular responses, which culminate in DNA repair, cell cycle arrest and apoptosis. Here, we provide an in-depth characterization of the molecular pathway that mediates UV-C-induced apoptosis of meiotic germ cells in the nematode Caenorhabditis elegans. We show that UV-C-induced DNA lesions are not directly pro-apoptotic. Rather, they must first be recognized and processed by the nucleotide excision repair (NER) pathway. Our data suggest that NER pathway activity transforms some of these lesions into other types of DNA damage, which in turn are recognized and acted upon by the homologous recombination (HR) pathway. HR pathway activity is in turn required for the recruitment of the C. elegans homolog of the yeast Rad9-Hus1-Rad1 (9-1-1) complex and activation of downstream checkpoint kinases. Blocking either the NER or HR pathway abrogates checkpoint pathway activation and UV-C-induced apoptosis. Our results show that, following UV-C, multiple DNA repair pathways can cooperate to signal to the apoptotic machinery to eliminate potentially hazardous cells. PMID:21151025

  19. The Clean Air Act Amendments of 1990: Opportunities for Promoting Renewable Energy; Final Report: December 11, 2000

    SciTech Connect

    Wooley, D.R.; Morss, E.M.

    2001-01-08

    This report explores key aspects of the intersection between the nation's clean air and energy goals and proposes alternatives for encouraging renewable energy in the context of the federal Clean Air Act (CAA). As with most environmental statutes enacted in the early 1970s, the 1970 CAA embraced a somewhat rigid ''command-and-control'' approach to achieving its clean air goals. Although effective, this approach has been criticized for discouraging creative and cost-effective solutions to reducing air emissions. In response to this concern, Congress included the first significant market-based program to address an environmental problem-in this case, acid rain caused by sulfur dioxide (SO2) emissions from power plants-in the 1990 CAA Amendments. This program prompted the federal government and various state governments to pursue other market-based programs to address air pollution problems. Ten years have elapsed since the passage of the 1990 CAA Amendments, so the time is ripe to consider expanding opportunities for renewable energy development in the reform of clean air policies. A significant potential for renewables exists in conjunction with international efforts to reduce emissions of greenhouse gases (GHG), including CO2. Unfortunately, Congressional opposition to international GHG reduction agreements makes it difficult to develop GHG emission-reduction programs, including a cap-and-trade alternative, that would enable the renewables industry to harness this potential. The renewable industry can, however, track developments both nationally and internationally to ensure that the programs developed adequately address renewables.

  20. The Nuclear DNA Sensor IFI16 Acts as a Restriction Factor for Human Papillomavirus Replication through Epigenetic Modifications of the Viral Promoters

    PubMed Central

    Lo Cigno, Irene; De Andrea, Marco; Borgogna, Cinzia; Albertini, Silvia; Landini, Manuela M.; Peretti, Alberto; Johnson, Karen E.; Chandran, Bala; Landolfo, Santo

    2015-01-01

    ABSTRACT The human interferon-inducible IFI16 protein, an innate immune sensor of intracellular DNA, was recently demonstrated to act as a restriction factor for human cytomegalovirus (HCMV) and herpes simplex virus 1 (HSV-1) infection by inhibiting both viral-DNA replication and transcription. Through the use of two distinct cellular models, this study provides strong evidence in support of the notion that IFI16 can also restrict human papillomavirus 18 (HPV18) replication. In the first model, an immortalized keratinocyte cell line (NIKS) was used, in which the IFI16 protein was knocked down through the use of small interfering RNA (siRNA) technology and overexpressed following transduction with the adenovirus IFI16 (AdVIFI16) vector. The second model consisted of U2OS cells transfected by electroporation with HPV18 minicircles. In differentiated IFI16-silenced NIKS-HPV18 cells, viral-load values were significantly increased compared with differentiated control cells. Consistent with this, IFI16 overexpression severely impaired HPV18 replication in both NIKS and U2OS cells, thus confirming its antiviral restriction activity. In addition to the inhibition of viral replication, IFI16 was also able to reduce viral transcription, as demonstrated by viral-gene expression analysis in U2OS cells carrying episomal HPV18 minicircles and HeLa cells. We also provide evidence that IFI16 promotes the addition of heterochromatin marks and the reduction of euchromatin marks on viral chromatin at both early and late promoters, thus reducing both viral replication and transcription. Altogether, these results argue that IFI16 restricts chromatinized HPV DNA through epigenetic modifications and plays a broad surveillance role against viral DNA in the nucleus that is not restricted to herpesviruses. IMPORTANCE Intrinsic immunity is mediated by cellular restriction factors that are constitutively expressed and active even before a pathogen enters the cell. The host nuclear factor IFI

  1. Peer counselling for the promotion of long-acting, reversible contraception among teens: a randomised, controlled trial.

    PubMed

    Wilson, Susan F; Degaiffier, Nathalie; Ratcliffe, Sarah J; Schreiber, Courtney A

    2016-10-01

    To evaluate the impact peer counselling has on same-day desire for long-acting, reversible contraception (LARC) among adolescents attending a family planning clinic. A randomised, controlled trial of 110 adolescent females attending an outpatient clinic for contraception in 2013. Adolescents received either brief peer counselling about LARC with routine contraceptive counselling, or routine counselling alone. Bivariate analyses and multivariable logistic regression assessed the primary outcome of same-day desire for LARC and secondary outcomes of change in knowledge and attitudes regarding LARC. Peer counselling was well received and 70% reported that it was helpful in contraceptive decision-making. Peer counselling did not affect same-day desire for LARC, however, adolescents who received the intervention were more likely to report increased knowledge and positive change in attitudes towards LARC (adjusted odds ratios: 6.6 (95% confidence interval: 2.0-22.0 and 6.4 (1.6-26.8), respectively). Factors positively associated with same-day LARC desire included greater reported peer contraceptive influence, peer use of LARC and social support. Twenty of the 36 adolescents who desired LARC at the end of their clinic visit did not receive one most commonly due to a need to schedule a specific appointment for the procedure and the need to return during a menstrual period for intrauterine device placement. While brief, point-of-care peer counselling is well received, and can increase adolescent knowledge and positive attitude about our most effective contraceptive methods, barriers to same-day LARC placement limit immediate use.

  2. Grape seed proanthocyanidins and metformin act by different mechanisms to promote insulin signaling in rats fed high calorie diet.

    PubMed

    Yogalakshmi, Baskaran; Bhuvaneswari, Saravanan; Sreeja, S; Anuradha, Carani Venkatraman

    2014-03-01

    Key pathways like insulin signaling, AMP activated kinase (AMPK) activation and inflammatory signaling are involved in the complex pathological network of hepatic insulin resistance. Our aim is to investigate whether grape seed proanthocyanidins (GSP) and metformin (MET) target any of these pathways in insulin resistant rat liver. Albino Wistar rats were rendered insulin resistant by feeding a high fat-fructose diet (HFFD). Either GSP (100 mg/kg b.w), MET(50 mg/kg b.w) or both were administered to insulin resistant rats as therapeutic options. HFFD-feeding caused hyperglycemia, hyperinsulinemia, increased gluconeogenesis, decreased tyrosine phosphorylation of insulin receptor-β(IR-β) and insulin receptor substrate-1 (IRS-1) and increased serine phosphorylation of IRS-1. The association of p85α subunit of phosphotidyl inositol 3 kinase(PI3K) with IRS-1 and subsequent Akt phosphorylation were reduced while the expression of mitogen activated protein kinases (MAPK) were increased in HFFD rats. Both MET and GSP reduced hyperglycemia and hyperinsulinemia and improved glycolysis, tyrosine phosphorylation of IR-β and IRS-1, IRS-1-PI3K association and Akt activation. However, activation of tumor necrosis factor-α, interleukin-6, leptin and suppressor of cytokine signaling-3 and reduction in adiponectin caused by chronic HFFD feeding were reversed by GSP better than by MET. Activation of AMPK by GSP was much less compared to that by MET. These findings suggest that GSP might activate PI3K pathway and promote insulin action by reducing serine kinase activation and cytokine signaling and MET by targeting AMPK. The beneficial effects were enhanced during combination therapy. Thus, combination therapy with MET and GSP may be considered for the management of metabolic syndrome.

  3. Identification of fungus-responsive cis-acting element in the promoter of Brassica juncea chitinase gene, BjCHI1.

    PubMed

    Gao, Ying; Zan, Xin-Li; Wu, Xue-Feng; Yao, Lei; Chen, Yu-Ling; Jia, Shuang-Wei; Zhao, Kai-Jun

    2014-02-01

    Chitinases are a group of pathogenesis-related proteins. The Brassica juncea chitinase gene BjCHI1 is highly inducible by pathogenic fungal infection, suggesting that the promoter of BjCHI1 might contain specific cis-acting element responsive to fungal attack. To identify the fungus-responsive element in BjCHI1 promoter (BjC-P), a series of binary plant transformation vectors were constructed by fusing the BjC-P or its deletion-derivatives to β-glucuronidase (GUS) reporter gene. Expression of the GUS reporter gene was systematically assayed by a transient gene expression system in Nicotiana benthamiana leaves treated with fungal elicitor Hexa-N-Acetyl-Chitohexaose, as well as in transgenic Arabidopsis plants inoculated with fungus Botrytis cinerea. The histochemical and quantitative GUS assays showed that the W-box-like element (GTAGTGACTCAT) in the region (-668 to -657) was necessary for the fungus-response, although there were another five W-box-like elements in BjC-P. In addition, gain-of-function analysis demonstrated that the fragment (-409 to -337) coupled to the W-box-like element was needed for full magnitude of the fungal induction. These results revealed the existence of a novel regulation mechanism of W-box-like element involved in plant pathogenic resistance, and will benefit the potential application of BjC-P in engineering crops.

  4. Novel lentiviral vectors displaying "early-acting cytokines" selectively promote survival and transduction of NOD/SCID repopulating human hematopoietic stem cells.

    PubMed

    Verhoeyen, Els; Wiznerowicz, Maciej; Olivier, Delphine; Izac, Brigitte; Trono, Didier; Dubart-Kupperschmitt, Anne; Cosset, François-Loïc

    2005-11-15

    A major limitation of current lentiviral vectors (LVs) is their inability to govern efficient gene transfer into quiescent cells, such as human CD34(+) cells, that reside in the G(0) phase of the cell cycle and that are highly enriched in hematopoietic stem cells. This hampers their application for gene therapy of hematopoietic cells. Here, we designed novel LVs that overcome this restriction by displaying "early-acting cytokines" on their surface. Display of thrombopoietin, stem cell factor, or both cytokines on the LV surface allowed efficient gene delivery into quiescent cord blood CD34(+) cells. Moreover, these surface-engineered LVs preferentially transduced and promoted survival of resting CD34(+) cells rather than cycling cells. Finally, and most importantly, these novel LVs allowed superior gene transfer in the most immature CD34(+) cells as compared to conventional LVs, even when the latter vectors were used to transduce cells in the presence of recombinant cytokines. This was demonstrated by their capacity to promote selective transduction of CD34(+) cell in in vitro derived long-term culture-initiating cell (LTC-IC) colonies and of long-term NOD/SCID repopulating cells (SRCs) in vivo.

  5. A Conserved GEF for Rho-Family GTPases Acts in an EGF Signaling Pathway to Promote Sleep-like Quiescence in Caenorhabditis elegans

    PubMed Central

    Fry, Amanda L.; Laboy, Jocelyn T.; Huang, Huiyan; Hart, Anne C.; Norman, Kenneth R.

    2016-01-01

    Sleep is evolutionarily conserved and required for organism homeostasis and survival. Despite this importance, the molecular and cellular mechanisms underlying sleep are not well understood. Caenorhabditis elegans exhibits sleep-like behavioral quiescence and thus provides a valuable, simple model system for the study of cellular and molecular regulators of this process. In C. elegans, epidermal growth factor receptor (EGFR) signaling is required in the neurosecretory neuron ALA to promote sleep-like behavioral quiescence after cellular stress. We describe a novel role for VAV-1, a conserved guanine nucleotide exchange factor (GEF) for Rho-family GTPases, in regulation of sleep-like behavioral quiescence. VAV-1, in a GEF-dependent manner, acts in ALA to suppress locomotion and feeding during sleep-like behavioral quiescence in response to cellular stress. Additionally, VAV-1 activity is required for EGF-induced sleep-like quiescence and normal levels of EGFR and secretory dense core vesicles in ALA. Importantly, the role of VAV-1 in promoting cellular stress–induced behavioral quiescence is vital for organism health because VAV-1 is required for normal survival after cellular stress. PMID:26801183

  6. Polo-like kinase 2 acting as a promoter in human tumor cells with an abundance of TAp73

    PubMed Central

    Hu, ZhengBo; Xu, ZunYing; Liao, XiaoHong; Yang, Xiao; Dong, Cao; Luk, KuaDi; Jin, AnMin; Lu, Hai

    2015-01-01

    suppresses TAp73 functions. PLK2 promotes the survival of human tumor cells, a novel insight into the workings of malignant tumors characterized by TAp73 overexpression, and one that could speed the development of therapies. PMID:26640387

  7. DLX1 acts as a crucial target of FOXM1 to promote ovarian cancer aggressiveness by enhancing TGF-β/SMAD4 signaling

    PubMed Central

    Chan, D W; Hui, W W Y; Wang, J J; Yung, M M H; Hui, L M N; Qin, Y; Liang, R R; Leung, T H Y; Xu, D; Chan, K K L; Yao, K-M; Tsang, B K; Ngan, H Y S

    2017-01-01

    Recent evidence from a comprehensive genome analysis and functional studies have revealed that FOXM1 is a crucial metastatic regulator that drives cancer progression. However, the regulatory mechanism by which FOXM1 exerts its metastatic functions in cancer cells remains obscure. Here, we report that DLX1 acts as a FOXM1 downstream target, exerting pro-metastatic function in ovarian cancers. Both FOXM1 isoforms (FOXM1B or FOXM1C) could transcriptionally upregulate DLX1 through two conserved binding sites, located at +61 to +69bp downstream (TFBS1) and −675 to −667bp upstream (TFBS2) of the DLX1 promoter, respectively. This regulation was further accentuated by the significant correlation between the nuclear expression of FOXM1 and DLX1 in high-grade serous ovarian cancers. Functionally, the ectopic expression of DLX1 promoted ovarian cancer cell growth, cell migration/invasion and intraperitoneal dissemination of ovarian cancer in mice, whereas small interfering RNA-mediated DLX1 knockdown in FOXM1-overexpressing ovarian cancer cells abrogated these oncogenic capacities. In contrast, depletion of FOXM1 by shRNAi only partially attenuated tumor growth and exerted almost no effect on cell migration/invasion and the intraperitoneal dissemination of DLX1-overexpressing ovarian cancer cells. Furthermore, the mechanistic studies showed that DLX1 positively modulates transforming growth factor-β (TGF-β) signaling by upregulating PAI-1 and JUNB through direct interaction with SMAD4 in the nucleus upon TGF-β1 induction. Taken together, these data strongly suggest that DLX1 has a pivotal role in FOXM1 signaling to promote cancer aggressiveness through intensifying TGF-β/SMAD4 signaling in high-grade serous ovarian cancer cells. PMID:27593933

  8. Nitrogen transporter and assimilation genes exhibit developmental stage-selective expression in maize (Zea mays L.) associated with distinct cis-acting promoter motifs.

    PubMed

    Liseron-Monfils, Christophe; Bi, Yong-Mei; Downs, Gregory S; Wu, Wenqing; Signorelli, Tara; Lu, Guangwen; Chen, Xi; Bondo, Eddie; Zhu, Tong; Lukens, Lewis N; Colasanti, Joseph; Rothstein, Steven J; Raizada, Manish N

    2013-10-01

    Nitrogen is considered the most limiting nutrient for maize (Zea mays L.), but there is limited understanding of the regulation of nitrogen-related genes during maize development. An Affymetrix 82K maize array was used to analyze the expression of ≤ 46 unique nitrogen uptake and assimilation probes in 50 maize tissues from seedling emergence to 31 d after pollination. Four nitrogen-related expression clusters were identified in roots and shoots corresponding to, or overlapping, juvenile, adult, and reproductive phases of development. Quantitative real time PCR data was consistent with the existence of these distinct expression clusters. Promoters corresponding to each cluster were screened for over-represented cis-acting elements. The 8-bp distal motif of the Arabidopsis 43-bp nitrogen response element (NRE) was over-represented in nitrogen-related maize gene promoters. This conserved motif, referred to here as NRE43-d8, was previously shown to be critical for nitrate-activated transcription of nitrate reductase (NIA1) and nitrite reductase (NIR1) by the NIN-LIKE PROTEIN 6 (NLP6) in Arabidopsis. Here, NRE43-d8 was over-represented in the promoters of maize nitrate and ammonium transporter genes, specifically those that showed peak expression during early-stage vegetative development. This result predicts an expansion of the NRE-NLP6 regulon and suggests that it may have a developmental component in maize. We also report leaf expression of putative orthologs of nitrite transporters (NiTR1), a transporter not previously reported in maize. We conclude by discussing how each of the four transcriptional modules may be responsible for the different nitrogen uptake and assimilation requirements of leaves and roots at different stages of maize development.

  9. 7 CFR 1150.101 - Act.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... Orders; Milk), DEPARTMENT OF AGRICULTURE DAIRY PROMOTION PROGRAM Dairy Promotion and Research Order Definitions § 1150.101 Act. Act means Title I, Subtitle B, of the Dairy and Tobacco Adjustment Act of...

  10. 7 CFR 1150.101 - Act.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... Orders; Milk), DEPARTMENT OF AGRICULTURE DAIRY PROMOTION PROGRAM Dairy Promotion and Research Order Definitions § 1150.101 Act. Act means Title I, Subtitle B, of the Dairy and Tobacco Adjustment Act of 1983...

  11. 7 CFR 1150.101 - Act.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... ORDERS; MILK), DEPARTMENT OF AGRICULTURE DAIRY PROMOTION PROGRAM Dairy Promotion and Research Order Definitions § 1150.101 Act. Act means Title I, Subtitle B, of the Dairy and Tobacco Adjustment Act of 1983...

  12. 7 CFR 1150.101 - Act.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... ORDERS; MILK), DEPARTMENT OF AGRICULTURE DAIRY PROMOTION PROGRAM Dairy Promotion and Research Order Definitions § 1150.101 Act. Act means Title I, Subtitle B, of the Dairy and Tobacco Adjustment Act of 1983...

  13. LeMYC2 acts as a negative regulator of blue light mediated photomorphogenic growth, and promotes the growth of adult tomato plants

    PubMed Central

    2014-01-01

    Background Arabidopsis ZBF1/MYC2bHLH transcription factor is a repressor of photomorphogenesis, and acts as a point of cross talk in light, abscisic acid (ABA) and jasmonic acid (JA) signaling pathways. MYC2 also functions as a positive regulator of lateral root development and flowering time under long day conditions. However, the function of MYC2 in growth and development remains unknown in crop plants. Results Here, we report the functional analyses of LeMYC2 in tomato (Lycopersicon esculentum). The amino acid sequence of LeMYC2 showed extensive homology with Arabidopsis MYC2, containing the conserved bHLH domain. To study the function of LeMYC2 in tomato, overexpression and RNA interference (RNAi) LeMYC2 tomato transgenic plants were generated. Examination of seedling morphology, physiological responses and light regulated gene expression has revealed that LeMYC2 works as a negative regulator of blue light mediated photomorphogenesis. Furthermore, LeMYC2 specifically binds to the G-box of LeRBCS-3A promoter. Overexpression of LeMYC2 has led to increased root length with more number of lateral roots. The tomato plants overexpressing LeMYC2 have reduced internode distance with more branches, and display the opposite morphology to RNAi transgenic lines. Furthermore, this study shows that LeMYC2 promotes ABA and JA responsiveness. Conclusions Collectively, this study highlights that working in light, ABA and JA signaling pathways LeMYC2 works as an important regulator for growth and development in tomato plants. PMID:24483714

  14. A Snapshot of Urban Adolescent Women's Contraceptive Knowledge at the Onset of a Community Long-Acting Reversible Contraceptive Promotion Initiative.

    PubMed

    Greenberg, Katherine Blumoff; Jenks, Sara Catherine; Piazza, Nina; Malibiran, Beatriz Ramos; Aligne, C Andrew

    2017-08-01

    To contextualize young women's knowledge and attitudes regarding contraception at the outset of an intervention promoting long-acting reversible contraceptive (LARC) use for teen pregnancy prevention. Our intervention was on the basis of diffusion of innovation theory, and at the outset we were interested in likely early adopters' existing knowledge and attitudes toward contraception. This mixed methods study consisted of focus groups within positive youth development programs in Rochester, New York; we discussed young women's knowledge and sources of information for all US Food and Drug Administration-approved contraceptive methods. Seven focus groups and 24 female adolescent participants aged 15-19 years. Quantitative ranking of all contraceptive methods; qualitative themes from focus group discussions. Our findings showed a high level of knowledge about a select group of methods, which included LARC methods, and that participants received contraceptive information from peers and family. Participants had more concerns than positive impressions regarding the effectiveness, safety, practicality, and partner reception of the contraceptive methods, with the exception of the condom. Quantitatively, the condom received the highest average rating. The importance of personal anecdotes in our findings supports the use of outreach and information campaigns; providing medically accurate information and spreading positive personal anecdotes will be key to improving young women's impressions of the safety and acceptability of LARC use. This snapshot of contraceptive knowledge indicates that young women can be mature, informed consumers of sexual and reproductive health care, and through diffusion of innovation could be key players in promoting the most effective means of pregnancy prevention. Copyright © 2017 North American Society for Pediatric and Adolescent Gynecology. Published by Elsevier Inc. All rights reserved.

  15. Collinsville Renewable Energy Promotion Act

    THOMAS, 112th Congress

    Sen. Lieberman, Joseph I. [ID-CT

    2011-04-04

    06/23/2011 Committee on Energy and Natural Resources Subcommittee on Water and Power. Hearings held. With printed Hearing: S.Hrg. 112-129. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  16. Collinsville Renewable Energy Promotion Act

    THOMAS, 111th Congress

    Rep. Murphy, Christopher S. [D-CT-5

    2010-01-13

    06/17/2010 Received in the Senate and Read twice and referred to the Committee on Energy and Natural Resources. (All Actions) Tracker: This bill has the status Passed HouseHere are the steps for Status of Legislation:

  17. Travel Promotion Act of 2009

    THOMAS, 111th Congress

    Rep. Delahunt, William D. [D-MA-10

    2009-06-18

    07/23/2009 Referred to the Subcommittee on Immigration, Citizenship, Refugees, Border Security, and International Law. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  18. Collinsville Renewable Energy Promotion Act

    THOMAS, 112th Congress

    Rep. Murphy, Christopher S. [D-CT-5

    2012-05-08

    06/27/2012 Received in the Senate and Read twice and referred to the Committee on Energy and Natural Resources. (All Actions) Tracker: This bill has the status Passed HouseHere are the steps for Status of Legislation:

  19. Collinsville Renewable Energy Promotion Act

    THOMAS, 112th Congress

    Sen. Lieberman, Joseph I. [ID-CT

    2011-04-04

    Senate - 06/23/2011 Committee on Energy and Natural Resources Subcommittee on Water and Power. Hearings held. With printed Hearing: S.Hrg. 112-129. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  20. Collinsville Renewable Energy Promotion Act

    THOMAS, 111th Congress

    Rep. Murphy, Christopher [D-CT-5

    2010-01-13

    Senate - 06/17/2010 Received in the Senate and Read twice and referred to the Committee on Energy and Natural Resources. (All Actions) Tracker: This bill has the status Passed HouseHere are the steps for Status of Legislation:

  1. Promote Nanotechnology in Schools Act

    THOMAS, 111th Congress

    Sen. Wyden, Ron [D-OR

    2010-03-15

    Senate - 03/15/2010 Read twice and referred to the Committee on Health, Education, Labor, and Pensions. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  2. Travel Promotion Act of 2009

    THOMAS, 111th Congress

    Sen. Dorgan, Byron L. [D-ND

    2009-05-12

    Senate - 09/23/2010 Message received in the Senate: Returned to the Senate pursuant to the provisions of H.Res. 1653. (All Actions) Notes: For further action, see H.R.1299, which became Public Law 111-145 on 3/4/2010. Tracker: This bill has the status Passed SenateHere are the steps for Status of Legislation:

  3. Collinsville Renewable Energy Promotion Act

    THOMAS, 112th Congress

    Rep. Murphy, Christopher S. [D-CT-5

    2012-05-08

    06/27/2012 Received in the Senate and Read twice and referred to the Committee on Energy and Natural Resources. (All Actions) Tracker: This bill has the status Passed HouseHere are the steps for Status of Legislation:

  4. Export Promotion Act of 2012

    THOMAS, 112th Congress

    Sen. Pryor, Mark L. [D-AR

    2012-03-07

    Senate - 03/07/2012 Read twice and referred to the Committee on Banking, Housing, and Urban Affairs. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  5. Breastfeeding Promotion Act of 2011

    THOMAS, 112th Congress

    Sen. Merkley, Jeff [D-OR

    2011-08-01

    Senate - 08/01/2011 Read twice and referred to the Committee on Health, Education, Labor, and Pensions. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  6. Collinsville Renewable Energy Promotion Act

    THOMAS, 112th Congress

    Sen. Lieberman, Joseph I. [ID-CT

    2011-04-04

    06/23/2011 Committee on Energy and Natural Resources Subcommittee on Water and Power. Hearings held. With printed Hearing: S.Hrg. 112-129. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  7. Collinsville Renewable Energy Promotion Act

    THOMAS, 111th Congress

    Rep. Murphy, Christopher S. [D-CT-5

    2010-01-13

    06/17/2010 Received in the Senate and Read twice and referred to the Committee on Energy and Natural Resources. (All Actions) Tracker: This bill has the status Passed HouseHere are the steps for Status of Legislation:

  8. Travel Promotion Act of 2009

    THOMAS, 111th Congress

    Sen. Dorgan, Byron L. [D-ND

    2009-05-12

    09/23/2010 Message received in the Senate: Returned to the Senate pursuant to the provisions of H.Res. 1653. (All Actions) Notes: For further action, see H.R.1299, which became Public Law 111-145 on 3/4/2010. Tracker: This bill has the status Passed SenateHere are the steps for Status of Legislation:

  9. Travel Promotion Act of 2009

    THOMAS, 111th Congress

    Rep. Delahunt, Bill [D-MA-10

    2009-06-18

    07/23/2009 Referred to the Subcommittee on Immigration, Citizenship, Refugees, Border Security, and International Law. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  10. Stop Tenant Organizing Promotion Act

    THOMAS, 112th Congress

    Rep. Black, Diane [R-TN-6

    2012-08-02

    House - 10/01/2012 Referred to the Subcommittee on Insurance, Housing and Community Opportunity. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  11. Travel Promotion Act of 2009

    THOMAS, 111th Congress

    Sen. Dorgan, Byron L. [D-ND

    2009-05-12

    09/23/2010 Message received in the Senate: Returned to the Senate pursuant to the provisions of H.Res. 1653. (All Actions) Notes: For further action, see H.R.1299, which became Public Law 111-145 on 3/4/2010. Tracker: This bill has the status Passed SenateHere are the steps for Status of Legislation:

  12. Travel Promotion Act of 2009

    THOMAS, 111th Congress

    Rep. Delahunt, Bill [D-MA-10

    2009-06-18

    House - 07/23/2009 Referred to the Subcommittee on Immigration, Citizenship, Refugees, Border Security, and International Law. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  13. Export Promotion Act of 2010

    THOMAS, 111th Congress

    Sen. Klobuchar, Amy [D-MN

    2010-03-05

    Senate - 09/13/2010 Placed on Senate Legislative Calendar under General Orders. Calendar No. 560. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  14. Methanol-Independent Protein Expression by AOX1 Promoter with trans-Acting Elements Engineering and Glucose-Glycerol-Shift Induction in Pichia pastoris

    PubMed Central

    Wang, Jinjia; Wang, Xiaolong; Shi, Lei; Qi, Fei; Zhang, Ping; Zhang, Yuanxing; Zhou, Xiangshan; Song, Zhiwei; Cai, Menghao

    2017-01-01

    The alcohol oxidase 1 promoter (PAOX1) of Pichia pastoris is commonly used for high level expression of recombinant proteins. While the safety risk of methanol and tough process control for methanol induction usually cause problems especially in large-scale fermentation. By testing the functions of trans-acting elements of PAOX1 and combinatorially engineering of them, we successfully constructed a methanol-free PAOX1 start-up strain, in which, three transcription repressors were identified and deleted and, one transcription activator were overexpressed. The strain expressed 77% GFP levels in glycerol compared to the wide-type in methanol. Then, insulin precursor (IP) was expressed, taking which as a model, we developed a novel glucose-glycerol-shift induced PAOX1 start-up for this methanol-free strain. A batch phase with glucose of 40 g/L followed by controlling residual glucose not lower than 20 g/L was compatible for supporting cell growth and suppressing PAOX1. Then, glycerol induction was started after glucose used up. Accordingly, an optimal bioprocess was further determined, generating a high IP production of 2.46 g/L in a 5-L bioreactor with dramatical decrease of oxygen consumption and heat evolution comparing with the wild-type in methanol. This mutant and bioprocess represent a safe and efficient alternative to the traditional glycerol-repressed/methanol-induced PAOX1 system. PMID:28150747

  15. Identification of two novel Rhizoctonia solani-inducible cis-acting elements in the promoter of the maize gene, GRMZM2G315431

    PubMed Central

    Li, Ning; Chen, Jing; Yang, Fangfang; Wei, Shutong; Kong, Lingguang; Ding, Xinhua; Chu, Zhaohui

    2017-01-01

    Plants are continuously exposed to myriad pathogen stresses. However, the molecular mechanisms by which these stress signals are perceived and transduced are poorly understood. In this study, the maize gene GRMZM2G315431 was identified to be highly inducible by Rhizoctonia solani infection, suggesting that the promoter of GRMZM2G315431 (pGRMZM2G315431) might contain a specific cis-acting element responsive to R. solani attack. To identify the R. solani-responsive element in pGRMZM2G315431, a series of binary plant transformation vectors were constructed by fusing pGRMZM2G315431 or its deletion-derivatives with the reporter genes. In the transient gene expression system of Nicotiana benthamiana leaves inoculated with R. solani, GUS quantification suggested that the DNA fragment contains the unknown pathogen-inducible cis-elements in the −1323 to −1212 region. Furthermore, detailed quantitative assays showed that two novel cis-elements, GTTGA in the −1243 to −1239 region and TATTT in the −1232 to −1228 region, were responsible for the R. solani-inducible activity. These two cis-elements were also identified to have R. solani-specific-inducible activity in stable transgenic rice plants, suggesting the existence of a novel regulation mechanism involved in the interaction between R. solani and Zea mays. PMID:28163300

  16. U-box E3 ubiquitin ligase PUB17 acts in the nucleus to promote specific immune pathways triggered by Phytophthora infestans.

    PubMed

    He, Qin; McLellan, Hazel; Boevink, Petra C; Sadanandom, Ari; Xie, Conghua; Birch, Paul R J; Tian, Zhendong

    2015-06-01

    Ubiquitination regulates many processes in plants, including immunity. The E3 ubiquitin ligase PUB17 is a positive regulator of programmed cell death (PCD) triggered by resistance proteins CF4/9 in tomato. Its role in immunity to the potato late blight pathogen, Phytophthora infestans, was investigated here. Silencing StPUB17 in potato by RNAi and NbPUB17 in Nicotiana benthamiana by virus-induced gene silencing (VIGS) each enhanced P. infestans leaf colonization. PAMP-triggered immunity (PTI) transcriptional responses activated by flg22, and CF4/Avr4-mediated PCD were attenuated by silencing PUB17. However, silencing PUB17 did not compromise PCD triggered by P. infestans PAMP INF1, or co-expression of R3a/AVR3a, demonstrating that not all PTI- and PCD-associated responses require PUB17. PUB17 localizes to the plant nucleus and especially in the nucleolus. Transient over-expression of a dominant-negative StPUB17(V314I,V316I) mutant, which retained nucleolar localization, suppressed CF4-mediated cell death and enhanced P. infestans colonization. Exclusion of the StPUB17(V314I,V316I) mutant from the nucleus abolished its dominant-negative activity, demonstrating that StPUB17 functions in the nucleus. PUB17 is a positive regulator of immunity to late blight that acts in the nucleus to promote specific PTI and PCD pathways.

  17. Methanol-Independent Protein Expression by AOX1 Promoter with trans-Acting Elements Engineering and Glucose-Glycerol-Shift Induction in Pichia pastoris.

    PubMed

    Wang, Jinjia; Wang, Xiaolong; Shi, Lei; Qi, Fei; Zhang, Ping; Zhang, Yuanxing; Zhou, Xiangshan; Song, Zhiwei; Cai, Menghao

    2017-02-02

    The alcohol oxidase 1 promoter (PAOX1) of Pichia pastoris is commonly used for high level expression of recombinant proteins. While the safety risk of methanol and tough process control for methanol induction usually cause problems especially in large-scale fermentation. By testing the functions of trans-acting elements of PAOX1 and combinatorially engineering of them, we successfully constructed a methanol-free PAOX1 start-up strain, in which, three transcription repressors were identified and deleted and, one transcription activator were overexpressed. The strain expressed 77% GFP levels in glycerol compared to the wide-type in methanol. Then, insulin precursor (IP) was expressed, taking which as a model, we developed a novel glucose-glycerol-shift induced PAOX1 start-up for this methanol-free strain. A batch phase with glucose of 40 g/L followed by controlling residual glucose not lower than 20 g/L was compatible for supporting cell growth and suppressing PAOX1. Then, glycerol induction was started after glucose used up. Accordingly, an optimal bioprocess was further determined, generating a high IP production of 2.46 g/L in a 5-L bioreactor with dramatical decrease of oxygen consumption and heat evolution comparing with the wild-type in methanol. This mutant and bioprocess represent a safe and efficient alternative to the traditional glycerol-repressed/methanol-induced PAOX1 system.

  18. LncRNA-RMRP promotes carcinogenesis by acting as a miR-206 sponge and is used as a novel biomarker for gastric cancer.

    PubMed

    Shao, Yongfu; Ye, Meng; Li, Qier; Sun, Weiliang; Ye, Guoliang; Zhang, Xinjun; Yang, Yunben; Xiao, Bingxiu; Guo, Junming

    2016-06-21

    Long noncoding RNAs (lncRNAs) play crucial roles in tumorigenesis. However, the mechanisms of most lncRNAs in cancers are largely unknown. Because the RNA component of mitochondrial RNA processing endoribonuclease (RMRP) is one of the dysregulated lncRNAs in gastric cancer, this study explored its molecular mechanisms in carcinogenesis. RMRP levels in 792 tissues, plasma and gastric juices from patients with various stages of gastric tumorigenesis were analyzed by quantitative reverse transcription-polymerase chain reaction. Overexpression and RNA interference were used to manipulate RMRP expression by RMRP expression vector and small interfering RNAs, respectively. Its mechanisms were evaluated by flow cytometry, real-time cell analysis, plate colony formation assays, and xenograft models. RMRP levels in tissue, plasma and gastric juices from patients with gastric cancer were significantly different from those from controls. Its levels were significantly associated with Borrmann type and metastasis. Plasma and gastric juice RMRP had higher sensitivity and specificity than commonly used markers (such as carcinoembryonic antigen and carbohydrate antigen 19-9). Knockdown of RMRP significantly inhibited cell proliferation in vitro and in vivo, whereas overexpression of RMRP promoted cell growth. Acting as a miR-206 sponge, RMRP modulated cell cycle by regulating Cyclin D2 expression. RMRP plays a crucial role in gastric cancer occurrence and can be used as a novel biomarker for gastric cancer.

  19. TGFβ and FGF promote tendon progenitor fate and act downstream of muscle contraction to regulate tendon differentiation during chick limb development.

    PubMed

    Havis, Emmanuelle; Bonnin, Marie-Ange; Esteves de Lima, Joana; Charvet, Benjamin; Milet, Cécile; Duprez, Delphine

    2016-10-15

    The molecular programme underlying tendon development has not been fully identified. Interactions with components of the musculoskeletal system are important for limb tendon formation. Limb tendons initiate their development independently of muscles; however, muscles are required for further tendon differentiation. We show that both FGF/ERK MAPK and TGFβ/SMAD2/3 signalling pathways are required and sufficient for SCX expression in chick undifferentiated limb cells, whereas the FGF/ERK MAPK pathway inhibits Scx expression in mouse undifferentiated limb mesodermal cells. During differentiation, muscle contraction is required to maintain SCX, TNMD and THBS2 expression in chick limbs. The activities of FGF/ERK MAPK and TGFβ/SMAD2/3 signalling pathways are decreased in tendons under immobilisation conditions. Application of FGF4 or TGFβ2 ligands prevents SCX downregulation in immobilised limbs. TGFβ2 but not FGF4 prevent TNMD and THBS2 downregulation under immobilisation conditions. We did not identify any intracellular crosstalk between both signalling pathways in their positive effect on SCX expression. Independently of each other, both FGF and TGFβ promote tendon commitment of limb mesodermal cells and act downstream of mechanical forces to regulate tendon differentiation during chick limb development. © 2016. Published by The Company of Biologists Ltd.

  20. Long non-coding RNA MALAT1 acts as a competing endogenous RNA to promote malignant melanoma growth and metastasis by sponging miR-22

    PubMed Central

    Bu, Xuefeng; Xia, Yun; Wang, Jinlong; Djangmah, Henry Siaw; Liu, Xiaohui; You, Yongping; Xu, Bin

    2016-01-01

    Long non-coding RNAs (lncRNAs) are involved in tumorigenesis. Metastasis-associated lung adenocarcinoma transcript 1 (MALAT1), an lncRNAs, is associated with the growth and metastasis of many human tumors, but its biological roles in malignant melanoma remain unclear. In this study, the aberrant up-regulation of MALAT1 was detected in melanoma. We determined that MALAT1 promotes melanoma cells proliferation, invasion and migration by sponging miR-22. MiR-22 was decreased and acted as a tumor suppressor in melanoma, and MMP14 and Snail were the functional targets of miR-22. Furthermore, MALAT1 could modulate MMP14 and Snail by operating as a competing endogenous RNA (ceRNA) for miR-22. The effects of MALAT1 in malignant melanoma is verified using a xenograft model. This finding elucidates a new mechanism for MALAT1 in melanoma development and provides a potential target for melanoma therapeutic intervention. PMID:27564100

  1. Verification of the in vivo activity of three distinct cis-acting elements within the Gata1 gene promoter-proximal enhancer in mice.

    PubMed

    Shimizu, Ritsuko; Hasegawa, Atsushi; Ottolenghi, Sergio; Ronchi, Antonella; Yamamoto, Masayuki

    2013-11-01

    The transcription factor GATA1 is essential for erythroid and megakaryocytic cell differentiation. Gata1 hematopoietic regulatory domain (G1HRD) has been shown to recapitulate endogenous Gata1 gene expression in transgenic mouse assays in vivo. G1HRD contains a promoter-proximal enhancer composed of a GATA-palindrome motif, four CP2-binding sites and two CACCC boxes. We prepared transgenic reporter mouse lines in which green fluorescent protein and β-galactosidase expression are driven by wild-type G1HRD (as a positive control) and the G1HRD harboring mutations within these cis-acting elements (as the experimental conditions), respectively. Exploiting this transgenic dual reporter (TDR) assay, we show here that in definitive erythropoiesis, G1HRD activity was markedly affected by individual mutations in the GATA-palindrome motif and the CACCC boxes. Mutation of CP2-binding sites also moderately decreased G1HRD activity. The combined mutation of the CP2-binding sites and the GATA-palindrome motif resulted in complete loss of G1HRD activity. In contrast, in primitive erythroid cells, individual mutations of each element did not affect G1HRD activity; G1HRD activity was abolished only when these three mutations were combined. These results thus show that all three elements independently and cooperatively contribute to G1HRD activity in vivo in definitive erythropoiesis, although these are contributing redundantly to primitive erythropoiesis.

  2. The Indian Health Promotion and Disease Prevention Act of 1985. Hearing before the Select Committee on Indian Affairs. United States Senate, Ninety-Ninth Congress, First Session on S. 400. (Gallup, NM, June 1, 1985).

    ERIC Educational Resources Information Center

    Congress of the U.S., Washington, DC. Senate Select Committee on Indian Affairs.

    The document contains transcripts of a Congressional hearing on providing health promotion and disease prevention services to American Indians. The bill under consideration would add the following programs to the Indian Health Care Improvement Act (25, U.S.C. 1603): reduction of drug, alcohol, and tobacco use; improvement of nutrition and physical…

  3. Treatment of diet-induced lipodystrophic C57BL/6J mice with long-acting PASylated leptin normalises insulin sensitivity and hepatic steatosis by promoting lipid utilisation.

    PubMed

    Bolze, Florian; Bast, Andrea; Mocek, Sabine; Morath, Volker; Yuan, Detian; Rink, Nadine; Schlapschy, Martin; Zimmermann, Anika; Heikenwalder, Mathias; Skerra, Arne; Klingenspor, Martin

    2016-09-01

    Recombinant leptin offers a viable treatment for lipodystrophy (LD) syndromes. However, due to its short plasma half-life, leptin replacement therapy requires at least daily subcutaneous (s.c.) injections. Here, we optimised this treatment strategy in LD mice by using a novel leptin version with extended plasma half-life using PASylation technology. A long-acting leptin version was prepared by genetic fusion with a 600 residue polypeptide made of Pro, Ala and Ser (PASylation), which enlarges the hydrodynamic volume and, thus, retards renal filtration, allowing less frequent injection. LD was induced in C57BL/6J mice by feeding a diet supplemented with conjugated linoleic acid (CLA). Chronic and acute effects of leptin treatment were assessed by evaluating plasma insulin levels, insulin tolerance, histological liver sections, energy expenditure, energy intake and body composition. In a cohort of female mice, 4 nmol PAS-leptin (applied via four s.c. injections every 3 days) successfully alleviated the CLA-induced LD phenotype, which was characterised by hyperinsulinaemia, insulin intolerance and hepatosteatosis. The same injection regimen had no measurable effect when unmodified recombinant leptin was administered at an equivalent dose. In a cohort of LD males, a single s.c. injection of PAS-leptin did not affect energy expenditure but inhibited food intake and promoted a shift in fuel selection towards preferential fat oxidation, which mechanistically substantiates the metabolic improvements. The excellent pharmacological properties render PASylated leptin an agent of choice for refining both animal studies and therapeutic strategies in the context of LD syndromes and beyond.

  4. Validation of trans-acting elements that promote exon 7 skipping of SMN2 in SMN2-GFP stable cell line.

    PubMed

    Cho, Sunghee; Moon, Heegyum; Yang, Xiaoming; Zhou, Jianhua; Kim, Hye-Ran; Shin, Myung-Geun; Loh, Tiing Jen; Zheng, Xuexiu; Shen, Haihong

    2012-07-06

    Spinal muscular atrophy is a genetic disease in which the SMN1 gene is deleted. The SMN2 gene exists in all of the patients. Alternative splicing of these two genes are different. More than 90% of exon 7 included form is produced from SMN1 pre-mRNA, whereas only ∼20% of exon 7 included form is produced from SMN2 pre-mRNA. Only exon 7 inclusion form produces functional protein. Exon 7 skipped SMN isoform is unstable. Here we constructed a GFP reporter system that recapitulates the alternative splicing of SMN1 and SMN2 pre-mRNA. We designed a system in which GFP protein is expressed only when exon 7 of is included in alternative splicing. The stable cell that expresses SMN1-GFP produces ∼4 times more GFP protein than the stable cell line that expresses SMN2-GFP; as demonstrated by microscopy, FACS analysis and immunoblotting. In addition the ratio of exon 7 inclusion and skipping of SMN1-GFP and SMN2-GFP pre-mRNA was similar to endogenous SMN1 and SMN2 pre-mRNA as shown in RT-PCR. Furthermore the knockdown with hnRNP A1 shRNA, a known protein which promotes exon 7 skipping of SMN2, induces exon 7 inclusion of exon 7 in SMN2-GFP pre-mRNA in SMN2-GFP cell line. We conclude that we have established the stable cell lines that recapitulate alternative splicing of the SMN1 and SMN2 genes. The stable cell line can be used to identify the trans-acting elements with siRNA.

  5. Growth-associated protein GAP-43 and L1 act synergistically to promote regenerative growth of Purkinje cell axons in vivo.

    PubMed

    Zhang, Yi; Bo, Xuenong; Schoepfer, Ralf; Holtmaat, Anthony J D G; Verhaagen, Joost; Emson, Piers C; Lieberman, A Robert; Anderson, Patrick N

    2005-10-11

    Neuronal expression of growth-associated protein 43 (GAP-43) and the cell adhesion molecule L1 has been correlated with CNS axonal growth and regeneration, but it is not known whether expression of these molecules is necessary for axonal regeneration to occur. We have taken advantage of the fact that Purkinje cells do not express GAP-43 or L1 in adult mammals or regenerate axons into peripheral nerve grafts to test the importance of these molecules for axonal regeneration in vivo. Transgenic mice were generated in which Purkinje cells constitutively express L1 or both L1 and GAP-43 under the Purkinje cell-specific L7 promoter, and regeneration of Purkinje cell axons into peripheral nerve grafts implanted into the cerebellum was examined. Purkinje cells expressing GAP-43 or L1 showed minor enhancement of axonal sprouting. Purkinje cells expressing both GAP-43 and L1 showed more extensive axonal sprouting and axonal growth into the proximal portion of the graft. When a predegenerated nerve graft was implanted into double-transgenic mice, penetration of the graft by Purkinje cell axonal sprouts was strongly enhanced, and some axons grew along the entire intracerebral length of the graft (2.5-3.0 mm) and persisted for several months. The results demonstrate that GAP-43 and L1 coexpressed in Purkinje cells can act synergistically to switch these regeneration-incompetent CNS neurons into a regeneration-competent phenotype and show that coexpression of these molecules is a key regulator of the regenerative ability of intrinsic CNS neurons in vivo.

  6. State Implementation of Reforms Promoted under the Recovery Act. A Report from Charting the Progress of Education Reform: An Evaluation of the Recovery Act's Role. NCEE 2014-4011

    ERIC Educational Resources Information Center

    Webber, Ann; Troppe, Patricia; Milanowski, Anthony; Gutmann, Babette; Reisner, Elizabeth; Goertz, Margaret

    2014-01-01

    The American Recovery and Reinvestment Act (ARRA or the Recovery Act) of 2009 provided an unprecedented level of funding for K-12 education. The program created a "historic opportunity to save hundreds of thousands of jobs, support states and school districts, and advance reforms and improvements that will create long-lasting results for our…

  7. 7 CFR 1260.128 - Act.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 10 2011-01-01 2011-01-01 false Act. 1260.128 Section 1260.128 Agriculture... Promotion and Research Order Definitions § 1260.128 Act. Act means the Beef Promotion and Research Act of 1985, Title XVI, Subtitle A of the Food Security Act of 1985, Pub. L. 99-198 and any amendments thereto. ...

  8. 7 CFR 1260.128 - Act.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Act. 1260.128 Section 1260.128 Agriculture... Promotion and Research Order Definitions § 1260.128 Act. Act means the Beef Promotion and Research Act of 1985, Title XVI, Subtitle A of the Food Security Act of 1985, Pub. L. 99-198 and any amendments thereto. ...

  9. 7 CFR 1260.128 - Act.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 10 2013-01-01 2013-01-01 false Act. 1260.128 Section 1260.128 Agriculture... Promotion and Research Order Definitions § 1260.128 Act. Act means the Beef Promotion and Research Act of 1985, Title XVI, Subtitle A of the Food Security Act of 1985, Pub. L. 99-198 and any amendments thereto. ...

  10. 7 CFR 1260.128 - Act.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 10 2014-01-01 2014-01-01 false Act. 1260.128 Section 1260.128 Agriculture... Promotion and Research Order Definitions § 1260.128 Act. Act means the Beef Promotion and Research Act of 1985, Title XVI, Subtitle A of the Food Security Act of 1985, Pub. L. 99-198 and any amendments thereto. ...

  11. 7 CFR 1260.128 - Act.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Act. 1260.128 Section 1260.128 Agriculture... Promotion and Research Order Definitions § 1260.128 Act. Act means the Beef Promotion and Research Act of 1985, Title XVI, Subtitle A of the Food Security Act of 1985, Pub. L. 99-198 and any amendments thereto. ...

  12. Biochar and flyash inoculated with plant growth promoting rhizobacteria act as potential biofertilizer for luxuriant growth and yield of tomato plant.

    PubMed

    Tripti; Kumar, Adarsh; Usmani, Zeba; Kumar, Vipin; Anshumali

    2017-04-01

    Overuse of agrochemical fertilizers alarmingly causes deterioration in soil health and soil-flora. Persistence of these agrochemicals exerts detrimental effects on environment, potentially inducing toxic effects on human health, thus pronouncing an urgent need for a safer substitute. The present study investigates the potential use of agricultural and industrial wastes as carrier materials, viz. biochar and flyash, respectively, for preparation of bioformulations (or biofertilizers) using two plant growth promoting rhizobacteria, Bacillus sp. strain A30 and Burkholderia sp. strain L2, and its effect on growth of Lycopersicon esculentum Mill. (tomato). The viability of strains was determined based on colony forming units (cfu) count of each bioformulation at an interval of 60 days for a period of 240 days. Seeds were coated with different carrier based bioformulations and pot experiment(s) were carried out to access its effects on plant growth parameters. Biochar based bioformulations showed higher cfu count and maximum viability for strain L2 (10(7) cfu g(-1)) at 240 days of storage. Maximum percentage of seed germination was also observed in biochar inoculated with strain L2. Significant (p < 0.05) increase in plant growth parameters (dry and fresh biomass, length, number of flowers) were ascertained from the pot experiment and amongst all bioformulations, biochar inoculated with strain L2 performed consistently thriving results for tomato yield. Furthermore, post-harvest study of this bioformulation treated soil improved physico-chemical properties and dehydrogenase activity as compared to pre-plantation soil status. Overall, we show that prepared biochar based bioformulation using Burkholderia sp. L2 as inoculum can tremendously enhance the productivity of tomato, soil fertility, and can also act as a sustainable substitute for chemical fertilizers. In addition, mixture of biochar and flyash inoculated with strain L2 also showed noteworthy results for the

  13. 7 CFR 1207.302 - Act.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE POTATO RESEARCH AND PROMOTION PLAN Potato Research and Promotion Plan Definitions § 1207.302 Act. Act means the Potato Research and...

  14. 7 CFR 1207.302 - Act.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE POTATO RESEARCH AND PROMOTION PLAN Potato Research and Promotion Plan Definitions § 1207.302 Act. Act means the Potato Research and...

  15. 7 CFR 1207.302 - Act.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE POTATO RESEARCH AND PROMOTION PLAN Potato Research and Promotion Plan Definitions § 1207.302 Act. Act means the Potato Research and...

  16. 7 CFR 1207.302 - Act.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE POTATO RESEARCH AND PROMOTION PLAN Potato Research and Promotion Plan Definitions § 1207.302 Act. Act means the Potato Research and...

  17. 7 CFR 1207.302 - Act.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE POTATO RESEARCH AND PROMOTION PLAN Potato Research and Promotion Plan Definitions § 1207.302 Act. Act means the Potato Research and...

  18. 7 CFR 1260.630 - Paperwork Reduction Act assigned number.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... BEEF PROMOTION AND RESEARCH Beef Promotion and Research: Certification and Nomination Procedures for the Cattlemen's Beef Promotion and Research Board § 1260.630 Paperwork Reduction Act assigned...

  19. 7 CFR 1219.1 - Act.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE HASS AVOCADO PROMOTION, RESEARCH, AND INFORMATION Hass Avocado Promotion, Research, and Information Order Definitions § 1219.1 Act. Act means the Hass Avocado Promotion, Research, and Information Act of 2000, Public Law 106-387, 7 U.S.C....

  20. 7 CFR 1219.1 - Act.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE HASS AVOCADO PROMOTION, RESEARCH, AND INFORMATION Hass Avocado Promotion, Research, and Information Order Definitions § 1219.1 Act. Act means the Hass Avocado Promotion, Research, and Information Act of 2000, Public Law 106-387, 7 U.S.C....

  1. 7 CFR 1219.1 - Act.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE HASS AVOCADO PROMOTION, RESEARCH, AND INFORMATION Hass Avocado Promotion, Research, and Information Order Definitions § 1219.1 Act. Act means the Hass Avocado Promotion, Research, and Information Act of 2000, Public Law 106-387, 7 U.S.C....

  2. 7 CFR 1219.1 - Act.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE HASS AVOCADO PROMOTION, RESEARCH, AND INFORMATION Hass Avocado Promotion, Research, and Information Order Definitions § 1219.1 Act. Act means the Hass Avocado Promotion, Research, and Information Act of 2000, Public Law 106-387, 7 U.S.C....

  3. 7 CFR 1219.1 - Act.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE HASS AVOCADO PROMOTION, RESEARCH, AND INFORMATION Hass Avocado Promotion, Research, and Information Order Definitions § 1219.1 Act. Act means the Hass Avocado Promotion, Research, and Information Act of 2000, Public Law 106-387, 7 U.S.C....

  4. 7 CFR 1209.1 - Act.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE MUSHROOM PROMOTION, RESEARCH, AND CONSUMER INFORMATION ORDER Mushroom Promotion, Research, and Consumer Information Order Definitions § 1209.1 Act. Act means the Mushroom Promotion, Research, and Consumer Information Act of 1990, subtitle B of title XIX of...

  5. 7 CFR 1209.1 - Act.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE MUSHROOM PROMOTION, RESEARCH, AND CONSUMER INFORMATION ORDER Mushroom Promotion, Research, and Consumer Information Order Definitions § 1209.1 Act. Act means the Mushroom Promotion, Research, and Consumer Information Act of 1990, subtitle B of title XIX of...

  6. 7 CFR 1209.1 - Act.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE MUSHROOM PROMOTION, RESEARCH, AND CONSUMER INFORMATION ORDER Mushroom Promotion, Research, and Consumer Information Order Definitions § 1209.1 Act. Act means the Mushroom Promotion, Research, and Consumer Information Act of 1990, subtitle B of title XIX of...

  7. 7 CFR 1209.1 - Act.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE MUSHROOM PROMOTION, RESEARCH, AND CONSUMER INFORMATION ORDER Mushroom Promotion, Research, and Consumer Information Order Definitions § 1209.1 Act. Act means the Mushroom Promotion, Research, and Consumer Information Act of 1990, subtitle B of title XIX...

  8. 7 CFR 1209.1 - Act.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE MUSHROOM PROMOTION, RESEARCH, AND CONSUMER INFORMATION ORDER Mushroom Promotion, Research, and Consumer Information Order Definitions § 1209.1 Act. Act means the Mushroom Promotion, Research, and Consumer Information Act of 1990, subtitle B of title XIX...

  9. 7 CFR 1215.1 - Act.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE POPCORN PROMOTION, RESEARCH, AND CONSUMER INFORMATION Popcorn Promotion, Research, and Consumer Information Order Definitions § 1215.1 Act. Act means the Popcorn Promotion, Research, and Consumer Information Act of 1995, Subtitle E of Title V of the...

  10. 7 CFR 1215.1 - Act.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE POPCORN PROMOTION, RESEARCH, AND CONSUMER INFORMATION Popcorn Promotion, Research, and Consumer Information Order Definitions § 1215.1 Act. Act means the Popcorn Promotion, Research, and Consumer Information Act of 1995, Subtitle E of Title V of the...

  11. 7 CFR 1215.1 - Act.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE POPCORN PROMOTION, RESEARCH, AND CONSUMER INFORMATION Popcorn Promotion, Research, and Consumer Information Order Definitions § 1215.1 Act. Act means the Popcorn Promotion, Research, and Consumer Information Act of 1995, Subtitle E of Title V of the...

  12. 7 CFR 1215.1 - Act.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE POPCORN PROMOTION, RESEARCH, AND CONSUMER INFORMATION Popcorn Promotion, Research, and Consumer Information Order Definitions § 1215.1 Act. Act means the Popcorn Promotion, Research, and Consumer Information Act of 1995, Subtitle E of Title V of the...

  13. 7 CFR 1215.1 - Act.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE POPCORN PROMOTION, RESEARCH, AND CONSUMER INFORMATION Popcorn Promotion, Research, and Consumer Information Order Definitions § 1215.1 Act. Act means the Popcorn Promotion, Research, and Consumer Information Act of 1995, Subtitle E of Title V of the...

  14. Construction of a promoter-probe vector for Bacillus thuringiensis: the identification of cis-acting elements of the chiA locus.

    PubMed

    Xie, Chi-Chu; Luo, Yang; Chen, Yue-Hua; Cai, Jun

    2012-05-01

    The expression and application of Bacillus thuringiensis (Bt) chitinase genes have been extensively investigated. However, little information is available regarding the regulation of chitinase gene expression in Bt. In this study, a shuttle promoter-probe vector was constructed incorporating the thermostable β-galactosidase gene bgaB of B. stearothermophilus as the reporter for the study of Bt promoters. Using this plasmid, the activity of the chiA gene promoter in Bt was investigated. Deletion analysis of the putative chiA promoter region revealed that the sequence located ~75 bp DNA from positions -116 to -42, with respect to the translation start site, is the core promoter of chiA gene. Furthermore, a site for chitin induction was identified near position -36. This site for negative regulation was indicated downstream of the RNA polymerase binding sites of the promoter of chiA. The expression of chiA started in cell grown for about 6 h and reached the maximum after 60 h of incubation. Induction of chiA expression by chitin was demonstrated by an increase in β-galactosidase activity of ~2.5-fold.

  15. 7 CFR 1220.101 - Act.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Act. 1220.101 Section 1220.101 Agriculture... CONSUMER INFORMATION Soybean Promotion and Research Order Definitions § 1220.101 Act. The term Act means the Soybean Promotion, Research, and Consumer Information Act, subtitle E of title XIX, of the Food...

  16. 7 CFR 1280.101 - Act.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 10 2011-01-01 2011-01-01 false Act. 1280.101 Section 1280.101 Agriculture... INFORMATION ORDER Lamb Promotion, Research, and Information Order Definitions § 1280.101 Act. Act means the Commodity Promotion, Research, and Information Act of 1996 (7 U.S.C. 7411-7425; Pub. L. 104-127; 110 Stat...

  17. 7 CFR 1230.1 - Act.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Act. 1230.1 Section 1230.1 Agriculture Regulations of... INFORMATION Pork Promotion, Research, and Consumer Information Order Definitions § 1230.1 Act. Act means the Pork Promotion, Research, and Consumer Information Act of 1985 (7 U.S.C. 4801-4819) and any amendments...

  18. 7 CFR 1220.101 - Act.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 10 2013-01-01 2013-01-01 false Act. 1220.101 Section 1220.101 Agriculture... CONSUMER INFORMATION Soybean Promotion and Research Order Definitions § 1220.101 Act. The term Act means the Soybean Promotion, Research, and Consumer Information Act, subtitle E of title XIX, of the Food...

  19. 7 CFR 1230.1 - Act.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 10 2014-01-01 2014-01-01 false Act. 1230.1 Section 1230.1 Agriculture Regulations of... INFORMATION Pork Promotion, Research, and Consumer Information Order Definitions § 1230.1 Act. Act means the Pork Promotion, Research, and Consumer Information Act of 1985 (7 U.S.C. 4801-4819) and any amendments...

  20. 7 CFR 1205.302 - Act.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 10 2014-01-01 2014-01-01 false Act. 1205.302 Section 1205.302 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS... Research and Promotion Order Definitions § 1205.302 Act. Act means the Cotton Research and Promotion Act...

  1. 7 CFR 1205.302 - Act.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 10 2013-01-01 2013-01-01 false Act. 1205.302 Section 1205.302 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS... Research and Promotion Order Definitions § 1205.302 Act. Act means the Cotton Research and Promotion Act...

  2. 7 CFR 1230.1 - Act.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 10 2013-01-01 2013-01-01 false Act. 1230.1 Section 1230.1 Agriculture Regulations of... INFORMATION Pork Promotion, Research, and Consumer Information Order Definitions § 1230.1 Act. Act means the Pork Promotion, Research, and Consumer Information Act of 1985 (7 U.S.C. 4801-4819) and any amendments...

  3. 7 CFR 1230.1 - Act.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Act. 1230.1 Section 1230.1 Agriculture Regulations of... INFORMATION Pork Promotion, Research, and Consumer Information Order Definitions § 1230.1 Act. Act means the Pork Promotion, Research, and Consumer Information Act of 1985 (7 U.S.C. 4801-4819) and any amendments...

  4. 7 CFR 1230.1 - Act.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 10 2011-01-01 2011-01-01 false Act. 1230.1 Section 1230.1 Agriculture Regulations of... INFORMATION Pork Promotion, Research, and Consumer Information Order Definitions § 1230.1 Act. Act means the Pork Promotion, Research, and Consumer Information Act of 1985 (7 U.S.C. 4801-4819) and any amendments...

  5. 7 CFR 1280.101 - Act.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Act. 1280.101 Section 1280.101 Agriculture... INFORMATION ORDER Lamb Promotion, Research, and Information Order Definitions § 1280.101 Act. Act means the Commodity Promotion, Research, and Information Act of 1996 (7 U.S.C. 7411-7425; Pub. L. 104-127; 110 Stat...

  6. 7 CFR 1220.101 - Act.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 10 2014-01-01 2014-01-01 false Act. 1220.101 Section 1220.101 Agriculture... CONSUMER INFORMATION Soybean Promotion and Research Order Definitions § 1220.101 Act. The term Act means the Soybean Promotion, Research, and Consumer Information Act, subtitle E of title XIX, of the Food...

  7. 7 CFR 1280.101 - Act.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 10 2014-01-01 2014-01-01 false Act. 1280.101 Section 1280.101 Agriculture... INFORMATION ORDER Lamb Promotion, Research, and Information Order Definitions § 1280.101 Act. Act means the Commodity Promotion, Research, and Information Act of 1996 (7 U.S.C. 7411-7425; Pub. L. 104-127; 110 Stat...

  8. 7 CFR 1220.101 - Act.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 10 2011-01-01 2011-01-01 false Act. 1220.101 Section 1220.101 Agriculture... CONSUMER INFORMATION Soybean Promotion and Research Order Definitions § 1220.101 Act. The term Act means the Soybean Promotion, Research, and Consumer Information Act, subtitle E of title XIX, of the Food...

  9. 7 CFR 1205.302 - Act.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Act. 1205.302 Section 1205.302 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS... Research and Promotion Order Definitions § 1205.302 Act. Act means the Cotton Research and Promotion Act...

  10. 7 CFR 1220.101 - Act.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Act. 1220.101 Section 1220.101 Agriculture... CONSUMER INFORMATION Soybean Promotion and Research Order Definitions § 1220.101 Act. The term Act means the Soybean Promotion, Research, and Consumer Information Act, subtitle E of title XIX, of the Food...

  11. 7 CFR 1280.101 - Act.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 10 2013-01-01 2013-01-01 false Act. 1280.101 Section 1280.101 Agriculture... INFORMATION ORDER Lamb Promotion, Research, and Information Order Definitions § 1280.101 Act. Act means the Commodity Promotion, Research, and Information Act of 1996 (7 U.S.C. 7411-7425; Pub. L. 104-127; 110 Stat...

  12. The avian cardiac alpha-actin promoter is regulated through a pair of complex elements composed of E boxes and serum response elements that bind both positive- and negative-acting factors.

    PubMed

    Moss, J B; McQuinn, T C; Schwartz, R J

    1994-04-29

    The chicken alpha-cardiac actin is one of the earliest contractile protein genes selectively expressed during embryonic skeletal and cardiac muscle differentiation. Cardiac actin promoter elements were examined in these two sarcomeric cell types. A portion of the alpha-cardiac actin promoter responsible for striated muscle specificity has been delineated (1, 2) and shown to contain four serum response elements (SRE). Previously, SRE3 was shown to be part of a complex element in conjunction with a functional E box (2), and we now show that SRE4 is also part of an upstream SRE.E box cis-element complex. The SREs function similarly, but the E boxes have dissimilar properties within and between striated muscle types. The SRE3.E1 box binds myogenic basic helix-loop-helix factors and is required for cardiac actin trans-activation in primary muscle cell cultures but functions as a negative regulatory element in cardiac muscle cells. The SRE4.E2 box, on the other hand, fails to bind basic helix-loop-helix (bHLH) factors, is negative acting in skeletal muscle cells, and is positive acting in cardiac myocytes. A DNA binding factor similar to HF1a (3) was identified that interacts specifically with the SRE4.E2 box. This study shows that the avian cardiac actin promoter elements are differentially used between skeletal and cardiac striated muscle cell lineages.

  13. The heptanucleotide motif GAGACGC is a key component of a cis-acting promoter element that is critical for SnSAG1 expression in Sarcocystis neurona.

    PubMed

    Gaji, Rajshekhar Y; Howe, Daniel K

    2009-07-01

    The apicomplexan parasite Sarcocystis neurona undergoes a complex process of intracellular development, during which many genes are temporally regulated. The described study was undertaken to begin identifying the basic promoter elements that control gene expression in S. neurona. Sequence analysis of the 5'-flanking region of five S. neurona genes revealed a conserved heptanucleotide motif GAGACGC that is similar to the WGAGACG motif described upstream of multiple genes in Toxoplasma gondii. The promoter region for the major surface antigen gene SnSAG1, which contains three heptanucleotide motifs within 135 bases of the transcription start site, was dissected by functional analysis using a dual luciferase reporter assay. These analyses revealed that a minimal promoter fragment containing all three motifs was sufficient to drive reporter molecule expression, with the presence and orientation of the 5'-most heptanucleotide motif being absolutely critical for promoter function. Further studies should help to identify additional sequence elements important for promoter function and for controlling gene expression during intracellular development by this apicomplexan pathogen.

  14. Human cytomegalovirus contains a tegument protein that enhances transcription from promoters with upstream ATF and AP-1 cis-acting elements.

    PubMed Central

    Liu, B; Stinski, M F

    1992-01-01

    The tegument proteins of human cytomegalovirus are introduced into cells as components of infectious virus. The tegument proteins may affect viral and cellular transcription prior to the synthesis of the immediate-early viral regulatory proteins. The phosphorylated tegument protein of 71 kDa (pp71) is reported to be encoded by the UL82 gene. The UL82 gene products transactivated promoters containing upstream ATF or AP-1 binding sites. In contrast, the phosphorylated tegument protein of 65 kDa (pp65), encoded by the UL83 gene, had no detectable effect on these promoters. Enhancement by UL82 of downstream transcription was directly proportional to the number of upstream ATF sites. Response to UL82 transactivation was abolished by mutation of the ATF site. Mutation in the carboxy-terminal region of UL82 also eliminated transactivation. Even though the major immediate-early promoter of human cytomegalovirus is a strong enhancer-containing promoter, UL82 further enhanced its transcription as much as 20-fold. The mechanism of UL82 enhancement of transcription from viral or cellular promoters is not known, but the enhancement may be mediated by triggering one of the protein kinase signaling pathways, increasing the affinity of ATF or AP-1 for the target sequence, or stabilizing the complex between the eucaryotic transcription factor and the target sequence. Images PMID:1318413

  15. Activation of the major immediate early gene of human cytomegalovirus by cis-acting elements in the promoter-regulatory sequence and by virus-specific trans-acting components.

    PubMed Central

    Stinski, M F; Roehr, T J

    1985-01-01

    Upstream of the major immediate early gene of human cytomegalovirus (Towne) is a strong promoter-regulatory region that promotes the synthesis of 1.95-kilobase mRNA (D. R. Thomsen, R. M. Stenberg, W. F. Goins, and M. F. Stinski, Proc. Natl. Acad. Sci. U.S.A. 81:659-663, 1984; M. F. Stinski, D. R. Thomsen, R. M. Stenberg, and L. C. Goldstein, J. Virol. 46:1-14, 1983). The wild-type promoter-regulatory region as well as deletions within this region were ligated upstream of the thymidine kinase, chloramphenicol acetyltransferase, or ovalbumin genes. These gene chimeras were constructed to investigate the role of the regulatory sequences in enhancing downstream expression. The regulatory region extends to approximately 465 nucleotides upstream of the cap site for the initiation of transcription. The extent and type of regulatory sequences upstream of the promoter influences the level of in vitro transcription as well as the amount of in vivo expression of the downstream gene. The regulatory elements for cis-activation appear to be repeated several times within the regulatory region. A direct correlation was established between the distribution of the 19 (5' CCCCAGTTGACGTCAATGGG 3')- and 18 (5' CACTAACGGGACTTTCCAA 3')-nucleotide repeats and the level of downstream expression. In contrast, the 16 (5' CTTGGCAGTACATCAA 3')-nucleotide repeat is not necessary for the enhancement of downstream expression. In a domain associated with the 19- or 18-nucleotide repeats are elements that can be activated in trans by a human cytomegalovirus-specified component but not a herpes simplex virus-specified component. Therefore, the regulatory sequences of the major immediate early gene of human cytomegalovirus have an important role in interacting with cellular and virus-specific factors of the transcription complex to enhance downstream expression of this critical viral gene. Images PMID:2991567

  16. A short, highly repetitive element in intron -1 of the human c-Ha-ras gene acts as a block to transcriptional readthrough by a viral promoter.

    PubMed Central

    Lowndes, N F; Bushel, P; Mendelsohn, L; Wu, J; Yen, M Y; Allan, M

    1990-01-01

    We have identified a short, highly repetitive element within intron -1 of the human c-Ha-ras gene. This element was found to be transcribed in both orientations and to be homologous to heterogeneous nonpolyadenylated transcripts. The repetitive element blocked transcriptional readthrough from a strong upstream viral promoter but allowed unimpaired readthrough from the c-Has-ras promoter. We suggest that it may serve to prevent excessive transcription into the coding region of the gene under such circumstances as viral insertion. Images PMID:2201911

  17. American Recovery and Reinvestment Act-Modernization of Third Floor Utilities-Center for Health Promotion and Preventative Medicine, Aberdeen Proving Ground, Maryland

    DTIC Science & Technology

    2010-11-22

    Program DPW Directorate of Public Works MEDCOM U. S. Army Medical Command OMB Office of Management and Budget TMA TRICARE Management Activity USACE U.S...whether the efforts of TRICARE Management Activity ( TMA ) and U. S. Army Medical Command (MEDCOM) personnel complied with the Recovery Act’s requirements...February 18, 2009, and subsequent related guidance. What We Found TMA personnel distributed Recovery Act funds in a timely manner and consistent with

  18. 7 CFR 33.1 - Act.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... AUTHORITY OF THE EXPORT APPLE ACT Definitions § 33.1 Act. Act and Export Apple Act are synonymous and mean “An act to promote the foreign trade of the United States in apples to protect the reputation of American-grown apples in foreign markets, to prevent deception or misrepresentation as to the quality of...

  19. 7 CFR 33.1 - Act.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... AUTHORITY OF THE EXPORT APPLE ACT Definitions § 33.1 Act. Act and Export Apple Act are synonymous and mean “An act to promote the foreign trade of the United States in apples to protect the reputation of American-grown apples in foreign markets, to prevent deception or misrepresentation as to the quality of...

  20. 7 CFR 33.1 - Act.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... AUTHORITY OF THE EXPORT APPLE ACT Definitions § 33.1 Act. Act and Export Apple Act are synonymous and mean “An act to promote the foreign trade of the United States in apples to protect the reputation of American-grown apples in foreign markets, to prevent deception or misrepresentation as to the quality of...

  1. 7 CFR 33.1 - Act.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... AUTHORITY OF THE EXPORT APPLE ACT Definitions § 33.1 Act. Act and Export Apple Act are synonymous and mean “An act to promote the foreign trade of the United States in apples to protect the reputation of American-grown apples in foreign markets, to prevent deception or misrepresentation as to the quality of...

  2. 7 CFR 33.1 - Act.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... AUTHORITY OF THE EXPORT APPLE ACT Definitions § 33.1 Act. Act and Export Apple Act are synonymous and mean “An act to promote the foreign trade of the United States in apples to protect the reputation of American-grown apples in foreign markets, to prevent deception or misrepresentation as to the quality of...

  3. Endoglin expression in the endothelium is regulated by Fli-1, Erg, and Elf-1 acting on the promoter and a -8-kb enhancer.

    PubMed

    Pimanda, John E; Chan, W Y Iris; Donaldson, Ian J; Bowen, Mark; Green, Anthony R; Göttgens, Berthold

    2006-06-15

    Angiogenesis is critical to the growth and regeneration of tissue but is also a key component of tumor growth and chronic inflammatory disorders. Endoglin plays a key role in angiogenesis by modulating cellular responses to transforming growth factor-beta (TGF-beta) signaling and is upregulated in proliferating endothelial cells. To gain insights into the transcriptional hierarchies that govern endoglin expression, we used a combination of comparative genomic, biochemical, and transgenic approaches. Both the promoter and a region 8 kb upstream of exon 1 were active in transfection assays in endothelial cells. In transgenic mice, the promoter directed low-level expression to a subset of endothelial cells. By contrast, inclusion of the -8 enhancer resulted in robust endothelial activity with additional staining in developing ear mesenchyme. Subsequent molecular analysis demonstrated that both the -8 enhancer and the promoter depend on conserved Ets sites, which were bound in endothelial cells in vivo by Fli-1, Erg, and Elf-1. This study therefore establishes the transcriptional framework within which endoglin functions during angiogenesis.

  4. A cis-acting element in the promoter of human ether à go-go 1 potassium channel gene mediates repression by calcitriol in human cervical cancer cells.

    PubMed

    Cázares-Ordoñez, V; González-Duarte, R J; Díaz, L; Ishizawa, M; Uno, S; Ortíz, V; Ordoñez-Sánchez, M L; Makishima, M; Larrea, F; Avila, E

    2015-02-01

    The human ether à go-go 1 potassium channel (hEAG1) is required for cell cycle progression and proliferation of cancer cells. Inhibitors of hEAG1 activity and expression represent potential therapeutic drugs in cancer. Previously, we have shown that hEAG1 expression is downregulated by calcitriol in a variety of cancer cells. Herein, we provided evidence on the regulatory mechanism involved in such repressive effect in cells derived from human cervical cancer. Our results indicate that repression by calcitriol occurs at the transcriptional level and involves a functional negative vitamin D response element (nVDRE) E-box type in the hEAG1 promoter. The described mechanism in this work implies that a protein complex formed by the vitamin D receptor-interacting repressor, the vitamin D receptor, the retinoid X receptor, and the Williams syndrome transcription factor interact with the nVDRE in the hEAG1 promoter in the absence of ligand. Interestingly, all of these transcription factors except the vitamin D receptor-interacting repressor are displaced from hEAG1 promoter in the presence of calcitriol. Our results provide novel mechanistic insights into calcitriol mode of action in repressing hEAG1 gene expression.

  5. DPL-1 DP, LIN-35 Rb and EFL-1 E2F act with the MCD-1 zinc-finger protein to promote programmed cell death in Caenorhabditis elegans.

    PubMed

    Reddien, Peter W; Andersen, Erik C; Huang, Michael C; Horvitz, H Robert

    2007-04-01

    The genes egl-1, ced-9, ced-4, and ced-3 play major roles in programmed cell death in Caenorhabditis elegans. To identify genes that have more subtle activities, we sought mutations that confer strong cell-death defects in a genetically sensitized mutant background. Specifically, we screened for mutations that enhance the cell-death defects caused by a partial loss-of-function allele of the ced-3 caspase gene. We identified mutations in two genes not previously known to affect cell death, dpl-1 and mcd-1 (modifier of cell death). dpl-1 encodes the C. elegans homolog of DP, the human E2F-heterodimerization partner. By testing genes known to interact with dpl-1, we identified roles in cell death for four additional genes: efl-1 E2F, lin-35 Rb, lin-37 Mip40, and lin-52 dLin52. mcd-1 encodes a novel protein that contains one zinc finger and that is synthetically required with lin-35 Rb for animal viability. dpl-1 and mcd-1 act with efl-1 E2F and lin-35 Rb to promote programmed cell death and do so by regulating the killing process rather than by affecting the decision between survival and death. We propose that the DPL-1 DP, MCD-1 zinc finger, EFL-1 E2F, LIN-35 Rb, LIN-37 Mip40, and LIN-52 dLin52 proteins act together in transcriptional regulation to promote programmed cell death.

  6. Privacy Act

    EPA Pesticide Factsheets

    Learn about the Privacy Act of 1974, the Electronic Government Act of 2002, the Federal Information Security Management Act, and other information about the Environmental Protection Agency maintains its records.

  7. The gibberellin biosynthetic genes AtGA20ox1 and AtGA20ox2 act, partially redundantly, to promote growth and development throughout the Arabidopsis life cycle.

    PubMed

    Rieu, Ivo; Ruiz-Rivero, Omar; Fernandez-Garcia, Nieves; Griffiths, Jayne; Powers, Stephen J; Gong, Fan; Linhartova, Terezie; Eriksson, Sven; Nilsson, Ove; Thomas, Stephen G; Phillips, Andrew L; Hedden, Peter

    2008-02-01

    The activity of the gibberellin (GA) biosynthetic enzymes GA 20-oxidases (GA20ox) is of particular importance in determining GA concentration in many plant species. In Arabidopsis these enzymes are encoded by a family of five genes: AtGA20ox1-AtGA20ox5. Transcript analysis indicated that they have different expression patterns and may thus participate differentially in GA-regulated developmental processes. We have used reverse genetics to determine the physiological roles of AtGA20ox1 and AtGA20ox2, the most highly expressed GA20ox genes during vegetative and early reproductive development. AtGA20ox1 and AtGA20ox2 act redundantly to promote hypocotyl and internode elongation, flowering time, elongation of anther filaments, the number of seeds that develop per silique and elongation of siliques, with AtGA20ox1 making the greater contribution to internode and filament elongation, and AtGA20ox2 making the greater contribution to flowering time and silique length. Pollination of the double mutant with wild-type pollen indicated that the GA promoting silique elongation is of maternal origin. The ga20ox2 phenotype revealed that GA promotes the number of stem internodes that elongate upon bolting, and does so independently of its effect on internode elongation. Comparison of the phenotype of the double mutant with that of the highly GA-deficient ga1-3 mutant indicates that other GA20ox genes contribute to all the developmental processes examined, and, in some cases such as root growth and leaf expansion, make major contributions, as these processes were unaffected in the double mutant. In addition, the effects of the mutations are mitigated by the homeostatic mechanism that acts on expression of other GA dioxygenase and GID1 receptor genes.

  8. Inhibitor of differentiation 4 (ID4) acts as an inhibitor of ID-1, -2 and -3 and promotes basic helix loop helix (bHLH) E47 DNA binding and transcriptional activity.

    PubMed

    Sharma, Pankaj; Chinaranagari, Swathi; Chaudhary, Jaideep

    2015-05-01

    The four known ID proteins (ID1-4, Inhibitor of Differentiation) share a homologous helix loop helix (HLH) domain and act as dominant negative regulators of basic-HLH transcription factors. ID proteins also interact with many non-bHLH proteins in complex networks. The expression of ID proteins is increasingly observed in many cancers. Whereas ID-1, ID-2 and ID-3, are generally considered as tumor promoters, ID4 on the contrary has emerged as a tumor suppressor. In this study we demonstrate that ID4 heterodimerizes with ID-1, -2 and -3 and promote bHLH DNA binding, essentially acting as an inhibitor of inhibitors of differentiation proteins. Interaction of ID4 was observed with ID1, ID2 and ID3 that was dependent on intact HLH domain of ID4. Interaction with bHLH protein E47 required almost 3 fold higher concentration of ID4 as compared to ID1. Furthermore, inhibition of E47 DNA binding by ID1 was restored by ID4 in an EMSA binding assay. ID4 and ID1 were also colocalized in prostate cancer cell line LNCaP. The alpha helix forming alanine stretch N-terminal, unique to HLH ID4 domain was required for optimum interaction. Ectopic expression of ID4 in DU145 prostate cancer line promoted E47 dependent expression of CDKNI p21. Thus counteracting the biological activities of ID-1, -2 and -3 by forming inactive heterodimers appears to be a novel mechanism of action of ID4. These results could have far reaching consequences in developing strategies to target ID proteins for cancer therapy and understanding biologically relevant ID-interactions.

  9. The Werner Protein Acts as a Coactivator of Nuclear Factor κB (NF-κB) on HIV-1 and Interleukin-8 (IL-8) Promoters.

    PubMed

    Mizutani, Taketoshi; Ishizaka, Aya; Furuichi, Yasuhiro

    2015-07-24

    The Werner syndrome helicase (WRN) plays a role in maintaining genomic stability. The lack of WRN results in Werner syndrome, a rare autosomal recessive genetic disorder, which causes premature aging accompanied by many complications such as rare forms of cancer and type 2 diabetes. However, the underlying mechanisms of these complications, arising due to the loss of WRN, are poorly understood. In this study, we demonstrated the function of WRN in transcriptional regulation of NF-κB targets. WRN physically interacts via its RecQ C-terminal (RQC) domain with the Rel homology domain of both the RelA (p65) and the p50 subunits of NF-κB. In the steady state, WRN is recruited to HIV-1 long terminal repeat (LTR), a typical NF-κB-responsive promoter, as well as the p50/p50 homodimer, in an NF-κB site-dependent manner. The amount of WRN on LTR increased along with the transactivating RelA/p50 heterodimer in response to TNF-α stimulation. Further, a knockdown of WRN reduced the transactivation of LTR in exogenous RelA/p50-introduced or TNF-α-stimulated cells. Additionally, knockdown of WRN reduced TNF-α stimulation-induced activation of the endogenous promoter of IL-8, an NF-κB-responsive gene, and WRN increased its association with the IL-8 promoter region together with RelA/p50 after TNF-α stimulation. In conjunction with studies that have shown NF-κB to be a key regulator of aging and inflammation, our results indicate a novel role of WRN in transcriptional regulation. Along with NF-κB, the loss of WRN is expected to result in incorrect regulation of downstream targets and leads to immune abnormalities and homeostatic disruption.

  10. The Werner Protein Acts as a Coactivator of Nuclear Factor κB (NF-κB) on HIV-1 and Interleukin-8 (IL-8) Promoters*

    PubMed Central

    Mizutani, Taketoshi; Ishizaka, Aya; Furuichi, Yasuhiro

    2015-01-01

    The Werner syndrome helicase (WRN) plays a role in maintaining genomic stability. The lack of WRN results in Werner syndrome, a rare autosomal recessive genetic disorder, which causes premature aging accompanied by many complications such as rare forms of cancer and type 2 diabetes. However, the underlying mechanisms of these complications, arising due to the loss of WRN, are poorly understood. In this study, we demonstrated the function of WRN in transcriptional regulation of NF-κB targets. WRN physically interacts via its RecQ C-terminal (RQC) domain with the Rel homology domain of both the RelA (p65) and the p50 subunits of NF-κB. In the steady state, WRN is recruited to HIV-1 long terminal repeat (LTR), a typical NF-κB-responsive promoter, as well as the p50/p50 homodimer, in an NF-κB site-dependent manner. The amount of WRN on LTR increased along with the transactivating RelA/p50 heterodimer in response to TNF-α stimulation. Further, a knockdown of WRN reduced the transactivation of LTR in exogenous RelA/p50-introduced or TNF-α-stimulated cells. Additionally, knockdown of WRN reduced TNF-α stimulation-induced activation of the endogenous promoter of IL-8, an NF-κB-responsive gene, and WRN increased its association with the IL-8 promoter region together with RelA/p50 after TNF-α stimulation. In conjunction with studies that have shown NF-κB to be a key regulator of aging and inflammation, our results indicate a novel role of WRN in transcriptional regulation. Along with NF-κB, the loss of WRN is expected to result in incorrect regulation of downstream targets and leads to immune abnormalities and homeostatic disruption. PMID:26037922

  11. Collagen triple helix repeat containing 1 (CTHRC1) acts via ERK-dependent induction of MMP9 to promote invasion of colorectal cancer cells.

    PubMed

    Kim, Hee Cheol; Kim, Yong Sung; Oh, Hyun-Woo; Kim, Kwoneel; Oh, Sang-Seok; Kim, Jong-Tae; Kim, Bo Yeon; Lee, Seon-Jin; Choe, Yong-Kyung; Kim, Dong Hyeok; Kim, Seok-Hyung; Chae, Seoung Wan; Kim, Kwang Dong; Lee, Hee Gu

    2014-01-30

    Collagen triple helix repeat-containing 1 (CTHRC1) is known to be aberrantly upregulated in most human solid tumors, although the functional roles of CTHRC1 in colorectal cancer remain unclear. In this study, we investigated the occurrence of CTHRC1 upregulation and its role in vivo and in vitro. The expression profile and clinical importance of CTHRC1 were examined by reverse transcription-polymerase chain reaction and immunohistochemical analyses in normal and tumor patient samples. CTHRC1 was detectable in normal tissues, but also was highly expressed in tumor specimens. CTHRC1 upregulation was significantly associated with demethylation of the CTHRC1 promoter in colon cancer cell lines and tumor tissues. Clinicopathologic analyses showed that nodal status and expression of CTHRC1 (95% CI 0.999-3.984, p=0.05) were significant prognostic factors for disease-free survival. Promoter CpG methylation and hypermethylation status were measured by bisulfite sequencing and pyrosequencing analysis. Furthermore, we showed that overexpression of CTHRC1 in the SW480 and HT-29 cell lines increased invasiveness, an effect mediated by extracellular signal-regulated kinase (ERK)-dependent upregulation of matrix metalloproteinase 9 (MMP9). Consistent with this, we found that knockdown of CTHRC1 attenuated ERK activation and cancer cell invasivity. These results demonstrate that CTHRC1 expression is elevated in human colon cancer cell lines and clinical specimens, and promotes cancer cell invasivity through ERK-dependent induction of MMP9 expression. Our results further suggest that high levels of CTHRC1 expression are associated with poor clinical outcomes.

  12. Vascular Endothelial Cell Growth Factor A Acts via Platelet-Derived Growth Factor Receptor α To Promote Viability of Cells Enduring Hypoxia

    PubMed Central

    Pennock, Steven; Kim, Leo A.

    2016-01-01

    Vascular endothelial cell growth factor A (VEGF) is a biologically and therapeutically important growth factor because it promotes angiogenesis in response to hypoxia, which underlies a wide variety of both physiological and pathological settings. We report here that both VEGF receptor 2 (VEGFR2)-positive and -negative cells depended on VEGF to endure hypoxia. VEGF enhanced the viability of platelet-derived growth factor receptor α (PDGFRα)-positive and VEGFR2-negative cells by enabling indirect activation of PDGFRα, thereby reducing the level of p53. We conclude that the breadth of VEGF's influence extends beyond VEGFR-positive cells and propose a plausible mechanistic explanation of this phenomenon. PMID:27325673

  13. Dpr Acts as a molecular switch, inhibiting Wnt signaling when unphosphorylated, but promoting Wnt signaling when phosphorylated by casein kinase Idelta/epsilon.

    PubMed

    Teran, Evelyn; Branscomb, Aron D; Seeling, Joni M

    2009-01-01

    The Wnt pathway is a key regulator of development and tumorigenesis. Dpr (Dact/Frodo) influences Wnt signaling in part through the interaction of its PDZ-B domain with Dsh's PDZ domain. Studies have shown that XDpr1a and its close relative, Frodo, are involved in multiple steps of the Wnt pathway in either inhibitory or activating roles. We found that XDpr1a is phosphorylated by casein kinase Idelta/epsilon (CKIdelta/epsilon), an activator of Wnt signaling, in the presence of XDsh. Abrogating XDpr1a's ability to bind XDsh through mutation of XDpr1a's PDZ-B domain blocks CK1delta/epsilon's phosphorylation of XDpr1a. Conversely, XDsh possessing a mutation in its PDZ domain that is unable to bind XDpr1a does not promote XDpr1a phosphorylation. Phosphorylation of XDpr1a and XDsh by CKIdelta/epsilon decreases their interaction. Moreover, the phosphorylation of XDpr1a by CKIdelta/epsilon not only abrogates XDpr1a's promotion of beta-catenin degradation but blocks beta-catenin degradation. Our data suggest that XDpr1a phosphorylation by CKIdelta/epsilon is dependent on the interaction of XDpr1a's PDZ-B domain with XDsh's PDZ domain, and that the phosphorylation state of XDpr1a determines whether it inhibits or activates Wnt signaling.

  14. Dpr Acts as a Molecular Switch, Inhibiting Wnt Signaling when Unphosphorylated, but Promoting Wnt Signaling when Phosphorylated by Casein Kinase Iδ/ε

    PubMed Central

    Teran, Evelyn; Branscomb, Aron D.; Seeling, Joni M.

    2009-01-01

    The Wnt pathway is a key regulator of development and tumorigenesis. Dpr (Dact/Frodo) influences Wnt signaling in part through the interaction of its PDZ-B domain with Dsh's PDZ domain. Studies have shown that XDpr1a and its close relative, Frodo, are involved in multiple steps of the Wnt pathway in either inhibitory or activating roles. We found that XDpr1a is phosphorylated by casein kinase Iδ/ε (CKIδ/ε), an activator of Wnt signaling, in the presence of XDsh. Abrogating XDpr1a's ability to bind XDsh through mutation of XDpr1a's PDZ-B domain blocks CK1δ/ε's phosphorylation of XDpr1a. Conversely, XDsh possessing a mutation in its PDZ domain that is unable to bind XDpr1a does not promote XDpr1a phosphorylation. Phosphorylation of XDpr1a and XDsh by CKIδ/ε decreases their interaction. Moreover, the phosphorylation of XDpr1a by CKIδ/ε not only abrogates XDpr1a's promotion of β-catenin degradation but blocks β-catenin degradation. Our data suggest that XDpr1a phosphorylation by CKIδ/ε is dependent on the interaction of XDpr1a's PDZ-B domain with XDsh's PDZ domain, and that the phosphorylation state of XDpr1a determines whether it inhibits or activates Wnt signaling. PMID:19440376

  15. p11 is up-regulated in the forebrain of stressed rats by glucocorticoid acting via two specific glucocorticoid response elements in the p11 promoter.

    PubMed

    Zhang, L; Li, H; Su, T P; Barker, J L; Maric, D; Fullerton, C S; Webster, M J; Hough, C J; Li, X X; Ursano, R

    2008-06-02

    Posttraumatic stress disorder (PTSD) is one of the most common psychiatric disorders. Despite the extensive study of the neurobiological correlates of this disorder, the underlying mechanisms of PTSD are still poorly understood. Recently, a study demonstrated that dexamethasone (Dex), a synthetic glucocorticoid, can up-regulate p11, known as S100A10-protein which is down-regulated in patients with depression, (Yao et al., 1999; Huang et al., 2003) a common comorbid disorder in PTSD. These observations led to our hypothesis that traumatic stress may alter expression of p11 mediated through a glucocorticoid receptor. Here, we demonstrate that inescapable tail shock increased both prefrontal cortical p11 mRNA levels and plasma corticosterone levels in rats. We also found that Dex up-regulated p11 expression in SH-SY5Y cells through glucocorticoid response elements (GREs) within the p11 promoter. This response was attenuated by either RU486, a glucocorticoid receptor (GR) antagonist or mutating two of three glucocorticoid response elements (GRE2 and GRE3) in the p11 promoter. Finally, we showed that p11 mRNA levels were increased in postmortem prefrontal cortical tissue (area 46) of patients with PTSD. The data obtained from our work in a rat model of inescapable tail shock, a p11-transfected cell line and postmortem brain tissue from PTSD patients outline a possible mechanism by which p11 is regulated by glucocorticoids elevated by traumatic stress.

  16. Ectopic activation of the transcription promoter for the testis-specific mouse Pgk-2 gene on elimination of a cis-acting upstream DNA region.

    PubMed

    Ando, H; Haruna, Y; Suzuki, M; Yamada, S; Okabe, M; Nakanishi, Y

    2000-08-01

    Transgenic mice carrying the coding sequence of beta-galactosidase, for which expression was driven by various upstream regions including the transcription promoter of the testis-specific mouse Pgk-2 gene, were generated. Expression of beta-galactosidase mRNA driven by the region between nucleotide positions -1404 and +61, with respect to the transcription initiation site numbered +1, was examined by reverse transcription-mediated polymerase chain reaction, blot hybridization and in situ hybridization, and compared with that of endogenous Pgk-2 mRNA. The results revealed that the 1.4kb DNA region is sufficient for determining the organ-specific, developmental stage-specific and spermatogenic stage-specific transcription of the mouse Pgk-2 gene. When the region between -684 and +61 was used to generate transgenic mice, beta-galactosidase mRNA was detectable not only in the testis, but also in other organs such as brain and lung. However, the timing and cell-type specificity of testicular expression of beta-galactosidase mRNA were retained in these mice. Because the region between -1404 and -685 repressed the Pgk-2 promoter in somatic cell-derived cell lines, it is suggested that the organ specificity of Pgk-2 transcription is achieved at least partly by negative regulation.

  17. MiR-371-373 cluster acts as a tumor-suppressor-miR and promotes cell cycle arrest in unrestricted somatic stem cells.

    PubMed

    Langroudi, Lida; Jamshidi-Adegani, Fatemeh; Shafiee, Abbas; Rad, Seyed Mohammad Ali Hosseini; Keramati, Farid; Azadmanesh, Kayhan; Arefian, Ehsan; Soleimani, Masoud

    2015-09-01

    Recent advances in small RNA research have implicated microRNAs (miRNAs) as important regulators of proliferation and development. The miR-371-373 cluster is prominently expressed in human embryonic stem cells (ESCs) and rapidly decreases after cell differentiation. MiR-371-373 cluster was investigated as one of the key factors of stem cell maintenance and pluripotency in unrestricted somatic stem cells (USSCs) using a lentivirus system. Gene expression showed a dual effect on proliferation, which revealed a transient cell cycle progression and consequent repression in pluripotency factors and cell cycle genes. Cell proliferation analysis with CFU, MTT, and DNA content assays further confirmed the dual effect of cluster after prolonged exposure. Analyzing the course of action, it seems that miR-371-373 cluster acts as an onco/tumor suppressor-miR. MiR371-373 cluster acts by modulating the function of these factors and limiting the excessive cell cycle propagation upon oncogenic stimuli to protect cells from replicative stress, but also activate CDK inhibitors and transcriptional repressors of the retinoblastoma family to cause cell cycle arrest. In contrast to the previous studies, we believe that miR-371-373 cluster functions as a self-renewal miRNA to induce and maintain the pluripotent state but also to potentially inhibit dysregulated proliferation through cell cycle arrest. It seems that miR-371-373 cluster presents with a dual effect in this cellular context which may possess different actions in various cells. This not only expands the basic knowledge of the cluster but may offer a great chance for therapeutic interventions.

  18. TNF{alpha} acting on TNFR1 promotes breast cancer growth via p42/P44 MAPK, JNK, Akt and NF-{kappa}B-dependent pathways

    SciTech Connect

    Rivas, Martin A.; Carnevale, Romina P.; Proietti, Cecilia J.; Rosemblit, Cinthia; Beguelin, Wendy; Salatino, Mariana; Charreau, Eduardo H.; Frahm, Isabel; Sapia, Sandra; Brouckaert, Peter; Elizalde, Patricia V.; Schillaci, Roxana

    2008-02-01

    Tumor necrosis factor {alpha} (TNF{alpha}) enhances proliferation of chemically-induced mammary tumors and of T47D human cell line through not fully understood pathways. Here, we explored the intracellular signaling pathways triggered by TNF{alpha}, the participation of TNF{alpha} receptor (TNFR) 1 and TNFR2 and the molecular mechanism leading to breast cancer growth. We demonstrate that TNF{alpha} induced proliferation of C4HD murine mammary tumor cells and of T47D cells through the activation of p42/p44 MAPK, JNK, PI3-K/Akt pathways and nuclear factor-kappaB (NF-{kappa}B) transcriptional activation. A TNF{alpha}-specific mutein selectively binding to TNFR1 induced p42/p44 MAPK, JNK, Akt activation, NF-{kappa}B transcriptional activation and cell proliferation, just like wild-type TNF{alpha}, while a mutein selective for TNFR2 induced only p42/p44 MAPK activation. Interestingly, blockage of TNFR1 or TNFR2 with specific antibodies was enough to impair TNF{alpha} signaling and biological effect. Moreover, in vivo TNF{alpha} administration supported C4HD tumor growth. We also demonstrated, for the first time, that injection of a selective inhibitor of NF-{kappa}B activity, Bay 11-7082, resulted in regression of TNF{alpha}-promoted tumor. Bay 11-7082 blocked TNF{alpha} capacity to induce cell proliferation and up-regulation of cyclin D1 and of Bcl-x{sub L}in vivo and in vitro. Our results reveal evidence for TNF{alpha} as a breast tumor promoter, and provide novel data for a future therapeutic approach using TNF{alpha} antagonists and NF-{kappa}B pharmacological inhibitors in established breast cancer treatment.

  19. BubR1 Acts as a Promoter in Cellular Motility of Human Oral Squamous Cancer Cells through Regulating MMP-2 and MMP-9.

    PubMed

    Chou, Chou-Kit; Wu, Chang-Yi; Chen, Jeff Yi-Fu; Ng, Ming-Chong; Wang, Hui-Min David; Chen, Jen-Hao; Yuan, Shyng-Shiou F; Tsai, Eing-Mei; Chang, Jan-Gowth; Chiu, Chien-Chih

    2015-07-03

    BubR1 is a critical component of spindle assembly checkpoint, ensuring proper chromatin segregation during mitosis. Recent studies showed that BubR1 was overexpressed in many cancer cells, including oral squamous cell carcinomas (OSCC). However, the effect of BubR1 on metastasis of OSCC remains unclear. This study aimed to unravel the role of BubR1 in the progression of OSCC and confirm the expression of BubR1 in a panel of malignant OSCC cell lines with different invasive abilities. The results of quantitative real-time PCR showed that the mRNA level of BubR1 was markedly increased in four OSCC cell lines, Ca9-22, HSC3, SCC9 and Cal-27 cells, compared to two normal cells, normal human oral keratinocytes (HOK) and human gingival fibroblasts (HGF). Moreover, the expression of BubR1 in these four OSCC cell lines was positively correlated with their motility. Immunofluorescence revealed that BubR1 was mostly localized in the cytosol of human gingival carcinoma Ca9-22 cells. BubR1 knockdown significantly decreased cellular invasion but slightly affect cellular proliferation on both Ca9-22 and Cal-27 cells. Consistently, the activities of metastasis-associated metalloproteinases MMP-2 and MMP-9 were attenuated in BubR1 knockdown Ca9-22 cells, suggesting the role of BubR1 in promotion of OSCC migration. Our present study defines an alternative pathway in promoting metastasis of OSCC cells, and the expression of BubR1 could be a prognostic index in OSCC patients.

  20. H2O2-Sensitive Isoforms of Drosophila melanogaster TRPA1 Act in Bitter-Sensing Gustatory Neurons to Promote Avoidance of UV During Egg-Laying.

    PubMed

    Guntur, Ananya R; Gou, Bin; Gu, Pengyu; He, Ruo; Stern, Ulrich; Xiang, Yang; Yang, Chung-Hui

    2017-02-01

    The evolutionarily conserved TRPA1 channel can sense various stimuli including temperatures and chemical irritants. Recent results have suggested that specific isoforms of Drosophila TRPA1 (dTRPA1) are UV-sensitive and that their UV sensitivity is due to H2O2 sensitivity. However, whether such UV sensitivity served any physiological purposes in animal behavior was unclear. Here, we demonstrate that H2O2-sensitive dTRPA1 isoforms promote avoidance of UV when adult Drosophila females are selecting sites for egg-laying. First, we show that blind/visionless females are still capable of sensing and avoiding UV during egg-laying when intensity of UV is high yet within the range of natural sunlight. Second, we show that such vision-independent UV avoidance is mediated by a group of bitter-sensing neurons on the proboscis that express H2O2-sensitive dTRPA1 isoforms. We show that these bitter-sensing neurons exhibit dTRPA1-dependent UV sensitivity. Importantly, inhibiting activities of these bitter-sensing neurons, reducing their dTRPA1 expression, or reducing their H2O2-sensitivity all significantly reduced blind females' UV avoidance, whereas selectively restoring a H2O2-sensitive isoform of dTRPA1 in these neurons restored UV avoidance. Lastly, we show that specifically expressing the red-shifted channelrhodopsin CsChrimson in these bitter-sensing neurons promotes egg-laying avoidance of red light, an otherwise neutral cue for egg-laying females. Together, these results demonstrate a physiological role of the UV-sensitive dTRPA1 isoforms, reveal that adult Drosophila possess at least two sensory systems for detecting UV, and uncover an unexpected role of bitter-sensing taste neurons in UV sensing.

  1. BubR1 Acts as a Promoter in Cellular Motility of Human Oral Squamous Cancer Cells through Regulating MMP-2 and MMP-9

    PubMed Central

    Chou, Chou-Kit; Wu, Chang-Yi; Chen, Jeff Yi-Fu; Ng, Ming-Chong; Wang, Hui-Min David; Chen, Jen-Hao; Yuan, Shyng-Shiou F.; Tsai, Eing-Mei; Chang, Jan-Gowth; Chiu, Chien-Chih

    2015-01-01

    BubR1 is a critical component of spindle assembly checkpoint, ensuring proper chromatin segregation during mitosis. Recent studies showed that BubR1 was overexpressed in many cancer cells, including oral squamous cell carcinomas (OSCC). However, the effect of BubR1 on metastasis of OSCC remains unclear. This study aimed to unravel the role of BubR1 in the progression of OSCC and confirm the expression of BubR1 in a panel of malignant OSCC cell lines with different invasive abilities. The results of quantitative real-time PCR showed that the mRNA level of BubR1 was markedly increased in four OSCC cell lines, Ca9-22, HSC3, SCC9 and Cal-27 cells, compared to two normal cells, normal human oral keratinocytes (HOK) and human gingival fibroblasts (HGF). Moreover, the expression of BubR1 in these four OSCC cell lines was positively correlated with their motility. Immunofluorescence revealed that BubR1 was mostly localized in the cytosol of human gingival carcinoma Ca9-22 cells. BubR1 knockdown significantly decreased cellular invasion but slightly affect cellular proliferation on both Ca9-22 and Cal-27 cells. Consistently, the activities of metastasis-associated metalloproteinases MMP-2 and MMP-9 were attenuated in BubR1 knockdown Ca9-22 cells, suggesting the role of BubR1 in promotion of OSCC migration. Our present study defines an alternative pathway in promoting metastasis of OSCC cells, and the expression of BubR1 could be a prognostic index in OSCC patients. PMID:26151845

  2. ttm-1 Encodes CDF Transporters That Excrete Zinc from Intestinal Cells of C. elegans and Act in a Parallel Negative Feedback Circuit That Promotes Homeostasis

    PubMed Central

    Roh, Hyun Cheol; Collier, Sara; Deshmukh, Krupa; Guthrie, James; Robertson, J. David; Kornfeld, Kerry

    2013-01-01

    Zinc is an essential metal involved in a wide range of biological processes, and aberrant zinc metabolism is implicated in human diseases. The gastrointestinal tract of animals is a critical site of zinc metabolism that is responsible for dietary zinc uptake and distribution to the body. However, the role of the gastrointestinal tract in zinc excretion remains unclear. Zinc transporters are key regulators of zinc metabolism that mediate the movement of zinc ions across membranes. Here, we identified a comprehensive list of 14 predicted Cation Diffusion Facilitator (CDF) family zinc transporters in Caenorhabditis elegans and demonstrated that zinc is excreted from intestinal cells by one of these CDF proteins, TTM-1B. The ttm-1 locus encodes two transcripts, ttm-1a and ttm-1b, that use different transcription start sites. ttm-1b expression was induced by high levels of zinc specifically in intestinal cells, whereas ttm-1a was not induced by zinc. TTM-1B was localized to the apical plasma membrane of intestinal cells, and analyses of loss-of-function mutant animals indicated that TTM-1B promotes zinc excretion into the intestinal lumen. Zinc excretion mediated by TTM-1B contributes to zinc detoxification. These observations indicate that ttm-1 is a component of a negative feedback circuit, since high levels of cytoplasmic zinc increase ttm-1b transcript levels and TTM-1B protein functions to reduce the level of cytoplasmic zinc. We showed that TTM-1 isoforms function in tandem with CDF-2, which is also induced by high levels of cytoplasmic zinc and reduces cytoplasmic zinc levels by sequestering zinc in lysosome-related organelles. These findings define a parallel negative feedback circuit that promotes zinc homeostasis and advance the understanding of the physiological roles of the gastrointestinal tract in zinc metabolism in animals. PMID:23717214

  3. ttm-1 encodes CDF transporters that excrete zinc from intestinal cells of C. elegans and act in a parallel negative feedback circuit that promotes homeostasis.

    PubMed

    Roh, Hyun Cheol; Collier, Sara; Deshmukh, Krupa; Guthrie, James; Robertson, J David; Kornfeld, Kerry

    2013-05-01

    Zinc is an essential metal involved in a wide range of biological processes, and aberrant zinc metabolism is implicated in human diseases. The gastrointestinal tract of animals is a critical site of zinc metabolism that is responsible for dietary zinc uptake and distribution to the body. However, the role of the gastrointestinal tract in zinc excretion remains unclear. Zinc transporters are key regulators of zinc metabolism that mediate the movement of zinc ions across membranes. Here, we identified a comprehensive list of 14 predicted Cation Diffusion Facilitator (CDF) family zinc transporters in Caenorhabditis elegans and demonstrated that zinc is excreted from intestinal cells by one of these CDF proteins, TTM-1B. The ttm-1 locus encodes two transcripts, ttm-1a and ttm-1b, that use different transcription start sites. ttm-1b expression was induced by high levels of zinc specifically in intestinal cells, whereas ttm-1a was not induced by zinc. TTM-1B was localized to the apical plasma membrane of intestinal cells, and analyses of loss-of-function mutant animals indicated that TTM-1B promotes zinc excretion into the intestinal lumen. Zinc excretion mediated by TTM-1B contributes to zinc detoxification. These observations indicate that ttm-1 is a component of a negative feedback circuit, since high levels of cytoplasmic zinc increase ttm-1b transcript levels and TTM-1B protein functions to reduce the level of cytoplasmic zinc. We showed that TTM-1 isoforms function in tandem with CDF-2, which is also induced by high levels of cytoplasmic zinc and reduces cytoplasmic zinc levels by sequestering zinc in lysosome-related organelles. These findings define a parallel negative feedback circuit that promotes zinc homeostasis and advance the understanding of the physiological roles of the gastrointestinal tract in zinc metabolism in animals.

  4. Insulin-like growth factors act synergistically with basic fibroblast growth factor and nerve growth factor to promote chromaffin cell proliferation.

    PubMed Central

    Frödin, M; Gammeltoft, S

    1994-01-01

    We have investigated the effects of insulin-like growth factors (IGFs), basic fibroblast growth factor (bFGF), and nerve growth factor (NGF) on DNA synthesis in cultured chromaffin cells from fetal, neonatal, and adult rats by using 5-bromo-2'-deoxyuridine (BrdUrd) pulse labeling for 24 or 48 h and immunocytochemical staining of cell nuclei. After 6 days in culture in the absence of growth factors, nuclear BrdUrd incorporation was detected in 30% of fetal chromaffin cells, 1.5% of neonatal cells, and 0.1% of adult cells. Addition of 10 nM IGF-I or IGF-II increased the fraction of BrdUrd-labeled nuclei to 50% of fetal, 20% of neonatal, and 2% of adult chromaffin cells. The ED50 value of IGF-I- and IGF-II-stimulated BrdUrd labeling in neonatal chromaffin cells was 0.3 nM and 0.8 nM, respectively. In neonatal and adult chromaffin cells, addition of 1 nM bFGF or 2 nM NGF stimulated nuclear BrdUrd incorporation to approximately the same level as 10 nM IGF-I or IGF-II. However, the response to bFGF or NGF in combination with either IGF-I or IGF-II was more than additive, indicating that the combined effect of the IGFs and bFGF or NGF is synergistic. The degree of synergism was 2- to 4-fold in neonatal chromaffin cells and 10- to 20-fold in adult chromaffin cells compared with the effect of each growth factor alone. In contrast, the action of bFGF and NGF added together in the absence of IGFs was not synergistic or additive. IGF-II acted also as a survival factor on neonatal chromaffin cells and the cell survival was further improved when bFGF or NGF was added together with IGF-II. In conclusion, we propose that IGF-I and IGF-II act in synergy with bFGF and NGF to stimulate proliferation and survival of chromaffin cells during neonatal growth and adult maintenance of the adrenal medulla. Our findings may have implications for improving the survival of chromaffin cell implants in diseased human brain. PMID:8127879

  5. USP7 Acts as a Molecular Rheostat to Promote WASH-Dependent Endosomal Protein Recycling and Is Mutated in a Human Neurodevelopmental Disorder.

    PubMed

    Hao, Yi-Heng; Fountain, Michael D; Fon Tacer, Klementina; Xia, Fan; Bi, Weimin; Kang, Sung-Hae L; Patel, Ankita; Rosenfeld, Jill A; Le Caignec, Cédric; Isidor, Bertrand; Krantz, Ian D; Noon, Sarah E; Pfotenhauer, Jean P; Morgan, Thomas M; Moran, Rocio; Pedersen, Robert C; Saenz, Margarita S; Schaaf, Christian P; Potts, Patrick Ryan

    2015-09-17

    Endosomal protein recycling is a fundamental cellular process important for cellular homeostasis, signaling, and fate determination that is implicated in several diseases. WASH is an actin-nucleating protein essential for this process, and its activity is controlled through K63-linked ubiquitination by the MAGE-L2-TRIM27 ubiquitin ligase. Here, we show that the USP7 deubiquitinating enzyme is an integral component of the MAGE-L2-TRIM27 ligase and is essential for WASH-mediated endosomal actin assembly and protein recycling. Mechanistically, USP7 acts as a molecular rheostat to precisely fine-tune endosomal F-actin levels by counteracting TRIM27 auto-ubiquitination/degradation and preventing overactivation of WASH through directly deubiquitinating it. Importantly, we identify de novo heterozygous loss-of-function mutations of USP7 in individuals with a neurodevelopmental disorder, featuring intellectual disability and autism spectrum disorder. These results provide unanticipated insights into endosomal trafficking, illuminate the cooperativity between an ubiquitin ligase and a deubiquitinating enzyme, and establish a role for USP7 in human neurodevelopmental disease. Copyright © 2015 Elsevier Inc. All rights reserved.

  6. USP7 acts as a molecular rheostat to promote WASH-dependent endosomal protein recycling and is mutated in a human neurodevelopmental disorder

    PubMed Central

    Hao, Yi-Heng; Fountain, Michael D.; Tacer, Klementina Fon; Xia, Fan; Bi, Weimin; Kang, Sung-Hae L.; Patel, Ankita; Rosenfeld, Jill A.; Caignec, Cédric Le; Isidor, Bertrand; Krantz, Ian D.; Noon, Sarah E.; Pfotenhauer, Jean P.; Morgan, Thomas M.; Moran, Rocio; Pedersen, Robert C.; Saenz, Margarita S.; Schaaf, Christian P.; Potts, Patrick Ryan

    2015-01-01

    SUMMARY Endosomal protein recycling is a fundamental cellular process important for cellular homeostasis, signaling, and fate determination that is implicated in several diseases. WASH is an actin nucleating protein essential for this process and its activity is controlled through K63-linked ubiquitination by the MAGE-L2-TRIM27 ubiquitin ligase. Here, we show that the USP7 deubiquitinating enzyme is an integral component of the MAGE-L2-TRIM27 ligase and is essential for WASH-mediated endosomal actin assembly and protein recycling. Mechanistically, USP7 acts as a molecular rheostat to precisely fine-tune endosomal F-actin levels by counteracting TRIM27 auto-ubiquitination/degradation and preventing overactivation of WASH through directly deubiquitinating it. Importantly, we identify de novo heterozygous loss-of-function mutations of USP7 in individuals with a neurodevelopmental disorder, featuring intellectual disability and autism spectrum disorder. These results provide unanticipated insights into endosomal trafficking, illuminate the cooperativity between a ubiquitin ligase and a deubiquitinating enzyme, and establish a role for USP7 in human neurodevelopmental disease. PMID:26365382

  7. The CCR4 deadenylase acts with Nanos and Pumilio in the fine-tuning of Mei-P26 expression to promote germline stem cell self-renewal.

    PubMed

    Joly, Willy; Chartier, Aymeric; Rojas-Rios, Patricia; Busseau, Isabelle; Simonelig, Martine

    2013-01-01

    Translational regulation plays an essential role in Drosophila ovarian germline stem cell (GSC) biology. GSC self-renewal requires two translational repressors, Nanos (Nos) and Pumilio (Pum), which repress the expression of differentiation factors in the stem cells. The molecular mechanisms underlying this translational repression remain unknown. Here, we show that the CCR4 deadenylase is required for GSC self-renewal and that Nos and Pum act through its recruitment onto specific mRNAs. We identify mei-P26 mRNA as a direct and major target of Nos/Pum/CCR4 translational repression in the GSCs. mei-P26 encodes a protein of the Trim-NHL tumor suppressor family that has conserved functions in stem cell lineages. We show that fine-tuning Mei-P26 expression by CCR4 plays a key role in GSC self-renewal. These results identify the molecular mechanism of Nos/Pum function in GSC self-renewal and reveal the role of CCR4-NOT-mediated deadenylation in regulating the balance between GSC self-renewal and differentiation.

  8. CCR4 promotes metastasis via ERK/NF-κB/MMP13 pathway and acts downstream of TNF-α in colorectal cancer

    PubMed Central

    Feng, Hao; Wangpu, Xiongzhi; Zhu, Congcong; Zong, Yaping; Ma, Junjun; Sun, Jing; Shen, Xiaohui; Zheng, Minhua; Lu, Aiguo

    2016-01-01

    Chemokines and chemokine receptors are causally involved in the metastasis of human malignancies. As a crucial chemokine receptor for mediating immune homeostasis, however, the role of CCR4 in colorectal cancer (CRC) remains unknown. In this study, we found that high expression of CCR4 in CRC tissues was correlated with shorter overall survival and disease free survival. In vitro and in vivo experiments revealed that silencing CCR4 attenuated the invasion and metastasis of CRC cells, whereas ectopic overexpression of CCR4 contributed to the forced metastasis of these cells. We further demonstrated that matrix metalloproteinase 13 (MMP13) played an important role in CCR4-mediated cancer cell invasion, which is up-regulated by ERK/NF-κB signaling. Positive correlation between CCR4 and MMP13 expression was also observed in CRC tissues. Moreover, our investigations showed that the level of CCR4 could be induced by TNF-α dependent of NF-κB activation in CRC cells. CCR4 might be implicated in TNF-α-regulated cancer cells metastasis. Combination of CCR4 and TNF-α is a more powerful prognostic marker for CRC patients. These findings suggest that CCR4 facilitates metastasis through ERK/NF-κB/MMP13 signaling and acts as a downstream target of TNF-α. CCR4 inhibition may be a promising therapeutic option for suppressing CRC metastasis. PMID:27356745

  9. HSPRO acts via SnRK1-mediated signaling in the regulation of Nicotiana attenuata seedling growth promoted by Piriformospora indica

    PubMed Central

    Schuck, Stefan; Baldwin, Ian T.; Bonaventure, Gustavo

    2013-01-01

    Nicotiana attenuata HSPRO (NaHSPRO) is a negative regulator of seedling growth promoted by the fungus Piriformospora indica. Homologs of NaHSPRO in Arabidopsis thaliana (i.e., AtHSPRO1 and AtHSPRO2) are known to physically interact with the AKINβγ subunit of the SnRK1 complex.2 To investigate whether NaHSPRO is associated with SnRK1 function during the stimulation of seedling growth by P. indica, we studied N. attenuata plants silenced in the expression of NaGAL83 (as-gal83 plants)—a gene that encodes for the regulatory β-subunit of SnRK1—and plants silenced in the expression of both NaHSPRO and NaGAL83 (ir-hspro/as-gal83 plants). The results showed that P. indica differentially stimulated the growth of both as-gal83 and ir-hspro/as-gal83 seedlings compared with control seedlings, with a magnitude similar to that observed in ir-hspro seedlings. Thus, we showed that, similar to NaHSPRO, NaGAL83 is a negative regulator of seedling growth stimulated by P. indica. We propose that the effect of NaHSPRO on seedling growth is associated with SnRK1 signaling. PMID:23333980

  10. PKBalpha/Akt1 acts downstream of DNA-PK in the DNA double-strand break response and promotes survival.

    PubMed

    Bozulic, Lana; Surucu, Banu; Hynx, Debby; Hemmings, Brian A

    2008-04-25

    Protein kinase B (PKB/Akt) is a well-established regulator of several essential cellular processes. Here, we report a route by which activated PKB promotes survival in response to DNA insults in vivo. PKB activation following DNA damage requires 3-phosphoinositide-dependent kinase 1 (PDK1) and DNA-dependent protein kinase (DNA-PK). Active PKB localizes in the nucleus of gamma-irradiated cells adjacent to DNA double-strand breaks, where it colocalizes and interacts with DNA-PK. Levels of active PKB inversely correlate with DNA damage-induced apoptosis. A significant portion of p53- and DNA damage-regulated genes are misregulated in cells lacking PKBalpha. PKBalpha knockout mice show impaired DNA damage-dependent induction of p21 and increased tissue apoptosis after single-dose whole-body irradiation. Our findings place PKB downstream of DNA-PK in the DNA damage response signaling cascade, where it provides a prosurvival signal, in particular by affecting transcriptional p21 regulation. Furthermore, this function is apparently restricted to the PKBalpha isoform.

  11. Acidosis Acts through HSP90 in a PHD/VHL-Independent Manner to Promote HIF Function and Stem Cell Maintenance in Glioma.

    PubMed

    Filatova, Alina; Seidel, Sascha; Böğürcü, Nuray; Gräf, Sabine; Garvalov, Boyan K; Acker, Till

    2016-10-01

    Hypoxia is a common feature of solid tumors, which controls multiple aspects of cancer progression. One important function of hypoxia and the hypoxia-inducible factors (HIF) is the maintenance of cancer stem-like cells (CSC), a population of tumor cells that possess stem cell-like properties and drives tumor growth. Among the changes promoted by hypoxia is a metabolic shift resulting in acidification of the tumor microenvironment. Here, we show that glioma hypoxia and acidosis functionally cooperate in inducing HIF transcription factors and CSC maintenance. We found that these effects did not involve the classical PHD/VHL pathway for HIF upregulation, but instead involved the stress-induced chaperone protein HSP90. Genetic or pharmacologic inactivation of HSP90 inhibited the increase in HIF levels and abolished the self-renewal and tumorigenic properties of CSCs induced by acidosis. In clinical specimens of glioma, HSP90 was upregulated in the hypoxic niche and was correlated with a CSC phenotype. Our findings highlight the role of tumor acidification within the hypoxic niche in the regulation of HIF and CSC function through HSP90, with implications for therapeutic strategies to target CSC in gliomas and other hypoxic tumors. Cancer Res; 76(19); 5845-56. ©2016 AACR.

  12. Free Sialic Acid Acts as a Signal That Promotes Streptococcus pneumoniae Invasion of Nasal Tissue and Nonhematogenous Invasion of the Central Nervous System

    PubMed Central

    Hatcher, Brandon L.; Hale, Joanetha Y.

    2016-01-01

    Streptococcus pneumoniae (pneumococcus) is a leading cause of bacterial meningitis and neurological sequelae in children worldwide. Acute bacterial meningitis is widely considered to result from bacteremia that leads to blood-brain barrier breakdown and bacterial dissemination throughout the central nervous system (CNS). Previously, we showed that pneumococci can gain access to the CNS through a nonhematogenous route without peripheral blood infection. This access is thought to occur when the pneumococci in the upper sinus follow the olfactory nerves and enter the CNS through the olfactory bulbs. In this study, we determined whether the addition of exogenous sialic acid postcolonization promotes nonhematogenous invasion of the CNS. Previously, others showed that treatment with exogenous sialic acid post-pneumococcal infection increased the numbers of CFU recovered from an intranasal mouse model of infection. Using a pneumococcal colonization model, an in vivo imaging system, and a multiplex assay for cytokine expression, we demonstrated that sialic acid can increase the number of pneumococci recovered from the olfactory bulbs and brains of infected animals. We also show that pneumococci primarily localize to the olfactory bulb, leading to increased expression levels of proinflammatory cytokines and chemokines. These findings provide evidence that sialic acid can enhance the ability of pneumococci to disseminate into the CNS and provide details about the environment needed to establish nonhematogenous pneumococcal meningitis. PMID:27354445

  13. Bet v 1 from birch pollen is a lipocalin-like protein acting as allergen only when devoid of iron by promoting Th2 lymphocytes.

    PubMed

    Roth-Walter, Franziska; Gomez-Casado, Cristina; Pacios, Luis F; Mothes-Luksch, Nadine; Roth, Georg A; Singer, Josef; Diaz-Perales, Araceli; Jensen-Jarolim, Erika

    2014-06-20

    It is hypothesized that allergens are at the borderline of self and non-self and, through as yet elusive circumstances, mount a Th2 response for allergic sensitization. The major birch pollen allergen Bet v 1 is considered the prototype for the PR-10 protein family causing respiratory allergy. Here, we give structural evidence that Bet v 1 is a lipocalin-like protein with a striking structural resemblance to human lipocalin 2. Lipocalin 2 is highly expressed in the lung where it exerts immunoregulatory functions dependent on being loaded with siderophore-bound iron (holo-form) or not (apo-form). We demonstrate that similar to lipocalin 2, Bet v 1 is capable of binding iron via catechol-based siderophores. Thereby, calculated Kd values of 66 nm surpassed affinities to known ligands nearly by a power of 10. Moreover, we give functional evidence of the immunomodulatory capacity of Bet v 1 being dependent on its iron-loaded state. When incubated to human immune cells, only the apo-form of Bet v 1, but not the holo-form, was able to promote Th2 cells secreting IL13. These results provide for the first time a functional understanding on the allergenicity of Bet v 1 and a basis for future allergen immunotherapies counteracting Th2 immune responses on a molecular basis. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  14. The haploinsufficient tumor suppressor, CUX1, acts as an analog transcriptional regulator that controls target genes through distal enhancers that loop to target promoters.

    PubMed

    Arthur, Robert K; An, Ningfei; Khan, Saira; McNerney, Megan E

    2017-06-20

    One third of tumor suppressors are haploinsufficient transcriptional regulators, yet it remains unknown how a 50% reduction of a transcription factor is translated at the cis-regulatory level into a malignant transcriptional program. We studied CUX1, a haploinsufficient transcription factor that is recurrently mutated in hematopoietic and solid tumors. We determined CUX1 DNA-binding and target gene regulation in the wildtype and haploinsufficient states. CUX1 binds with transcriptional activators and cohesin at distal enhancers across three different human cell types. Haploinsufficiency of CUX1 altered the expression of a large number of genes, including cell cycle regulators, with concomitant increased cellular proliferation. Surprisingly, CUX1 occupancy decreased genome-wide in the haploinsufficient state, and binding site affinity did not correlate with differential gene expression. Instead, differentially expressed genes had multiple, low-affinity CUX1 binding sites, features of analog gene regulation. A machine-learning algorithm determined that chromatin accessibility, enhancer activity, and distance to the transcription start site are features of dose-sensitive CUX1 transcriptional regulation. Moreover, CUX1 is enriched at sites of DNA looping, as determined by Hi-C analysis, and these loops connect CUX1 to the promoters of regulated genes. We propose an analog model for haploinsufficient transcriptional deregulation mediated by higher order genome architecture. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  15. Ubiquitin E3 ligase Nedd4-1 acts as a downstream target of PI3K/PTEN-mTORC1 signaling to promote neurite growth

    PubMed Central

    Hsia, Hung-En; Kumar, Rohit; Luca, Rossella; Takeda, Michiko; Courchet, Julien; Nakashima, Jonathan; Wu, Shumin; Goebbels, Sandra; An, Wenlin; Eickholt, Britta J.; Polleux, Franck; Rotin, Daniela; Wu, Hong; Rossner, Moritz J.; Bagni, Claudia; Rhee, Jeong-Seop; Brose, Nils; Kawabe, Hiroshi

    2014-01-01

    Protein ubiquitination is a core regulatory determinant of neural development. Previous studies have indicated that the Nedd4-family E3 ubiquitin ligases Nedd4-1 and Nedd4-2 may ubiquitinate phosphatase and tensin homolog (PTEN) and thereby regulate axonal growth in neurons. Using conditional knockout mice, we show here that Nedd4-1 and Nedd4-2 are indeed required for axonal growth in murine central nervous system neurons. However, in contrast to previously published data, we demonstrate that PTEN is not a substrate of Nedd4-1 and Nedd4-2, and that aberrant PTEN ubiquitination is not involved in the impaired axon growth upon deletion of Nedd4-1 and Nedd4-2. Rather, PTEN limits Nedd4-1 protein levels by modulating the activity of mTORC1, a protein complex that controls protein synthesis and cell growth. Our data demonstrate that Nedd4-family E3 ligases promote axonal growth and branching in the developing mammalian brain, where PTEN is not a relevant substrate. Instead, PTEN controls neurite growth by regulating Nedd4-1 expression. PMID:25157163

  16. FANC Pathway Promotes UV-Induced Stalled Replication Forks Recovery by Acting Both Upstream and Downstream Polη and Rev1

    PubMed Central

    Renaud, Emilie; Rosselli, Filippo

    2013-01-01

    To cope with ultraviolet C (UVC)-stalled replication forks and restart DNA synthesis, cells either undergo DNA translesion synthesis (TLS) by specialised DNA polymerases or tolerate the lesions using homologous recombination (HR)-based mechanisms. To gain insight into how cells manage UVC-induced stalled replication forks, we analysed the molecular crosstalk between the TLS DNA polymerases Polη and Rev1, the double-strand break repair (DSB)-associated protein MDC1 and the FANC pathway. We describe three novel functional interactions that occur in response to UVC-induced DNA lesions. First, Polη and Rev1, whose optimal expression and/or relocalisation depend on the FANC core complex, act upstream of FANCD2 and are required for the proper relocalisation of monoubiquitinylated FANCD2 (Ub-FANCD2) to subnuclear foci. Second, during S-phase, Ub-FANCD2 and MDC1 relocalise to UVC-damaged nuclear areas or foci simultaneously but independently of each other. Third, Ub-FANCD2 and MDC1 are independently required for optimal BRCA1 relocalisation. While RPA32 phosphorylation (p-RPA32) and RPA foci formation were reduced in parallel with increasing levels of H2AX phosphorylation and MDC1 foci in UVC-irradiated FANC pathway-depleted cells, MDC1 depletion was associated with increased UVC-induced Ub-FANCD2 and FANCD2 foci as well as p-RPA32 levels and p-RPA32 foci. On the basis of the previous observations, we propose that the FANC pathway participates in the rescue of UVC-stalled replication forks in association with TLS by maintaining the integrity of ssDNA regions and by preserving genome stability and preventing the formation of DSBs, the resolution of which would require the intervention of MDC1. PMID:23365640

  17. How safe is our "place of safety"? Clinical guidance promoting safer medical care of patients detained under section 136 of the Mental Health Act.

    PubMed

    Mouko, Josie; Goddard, Aurielle; Nimmo-Smith, Victoria

    2015-01-01

    A new four-bed unit was opened in Bristol, UK, in 2014, for people detained under section 136 of the Mental Health Act. Police bring individuals posing a risk to themselves or others to a Place of Safety (PoS) in order to receive a mental health assessment. Individuals may be held for up to 72 hours, but cannot receive treatment against their will, unless assessed as lacking the capacity to refuse treatment. Issues requiring medical input arose in more than a third of patients, yet there was little guidance for trainees around the PoS. We conducted a survey which confirmed that robust clinical guidance was needed for junior doctors around medical assistance in this unique environment. We identified specific concerns around patient safety in relation to alcohol withdrawal, uncertainties around legislation and lack of clarity of who to call out of hours. Trainees felt they were working outside of their expertise. We collaborated with a variety of professionals to produce clinical guidance in line with best evidence, and made this easily accessible. We also gained a consensus that more experienced core trainees (SHOs) in Psychiatry should be the first point of contact. We then conducted a survey in June 2015, and found that doctors covering the PoS now felt there was sufficient guidance on most clinical scenarios, 100% consensus on who to contact and improved confidence in their ability to manage issues arising. In August 2015 we held an informal training session for the new intake of trainees on the rota. A subsequent survey revealed similarly positive results. Through this project, we were able to identify defects in a system, provide needed guidance to enable safer and more equitable care to a vulnerable group, and foster closer collaboration between junior doctors and managers in the design and use of services.

  18. Thrombospondin 1 acts as a strong promoter of transforming growth factor β effects via two distinct mechanisms in hepatic stellate cells

    PubMed Central

    Breitkopf, K; Sawitza, I; Westhoff, J H; Wickert, L; Dooley, S; Gressner, A M

    2005-01-01

    Background and aims: Thrombospondin 1 (TSP-1) is an important activator of latent transforming growth factor β (TGF-β) but little is known of the expression patterns and functions of TSP-1 in liver cells. We therefore analysed if and how TSP-1 acts on TGF-β during fibrogenesis. Methods and results: Using reverse transcription-polymerase chain reaction, we demonstrated that hepatocytes from normal liver expressed no TSP-1 mRNA whereas Kupffer cells and sinusoidal endothelial cells did. TSP-1 mRNA and protein were detected in quiescent and activated cultured hepatic stellate cells (HSC) and TSP-1 expression was highly inducible by platelet derived growth factor BB (PDGF-BB) and, to a lesser extent, by tumour necrosis factor α in activated HSC. Furthermore, addition of PDGF-BB directly led to enhanced TGF-β mRNA expression and a TSP-1 dependent increase in TGF-β/Smad signalling. Using either a peptide specifically blocking the interaction of TSP-1 with latent TGF-β or antibodies against TSP-1 not only abrogated activation of latent TGF-β but also reduced the effects of the active dimer itself. Conclusions: Our data suggest that TSP-1 expression is important for TGF-β effects and that it is regulated by the profibrogenic mediator PDGF-BB in HSC. Furthermore, the presence of TSP-1 seems to be a prerequisite for effective signal transduction by active TGF-β not only in rat HSC but also in other cell types such as human dermal fibroblasts. PMID:15831915

  19. Long-Acting PASylated Leptin Ameliorates Obesity by Promoting Satiety and Preventing Hypometabolism in Leptin-Deficient Lep(ob/ob) Mice.

    PubMed

    Bolze, Florian; Morath, Volker; Bast, Andrea; Rink, Nadine; Schlapschy, Martin; Mocek, Sabine; Skerra, Arne; Klingenspor, Martin

    2016-01-01

    Body weight loss of Lep(ob/ob) mice in response to leptin is larger than expected from the reduction in energy intake alone, suggesting a thermogenic action of unknown magnitude. We exploited the superior pharmacological properties of a novel long-acting leptin prepared via PASylation to study the contribution of its anorexigenic and thermogenic effects. PASylation, the genetic fusion of leptin with a conformationally disordered polypeptide comprising 600 Pro/Ala/Ser (PAS) residues, provides a superior way to increase the hydrodynamic volume of the fusion protein, thus retarding kidney filtration and extending plasma half-life. Here a single PAS(600)-leptin injection (300 pmol/g) resulted in a maximal weight reduction of 21% 6 days after application. The negative energy balance of 300 kJ/(4 d) was driven by a decrease in energy intake, whereas energy expenditure remained stable. Mice that were food restricted to the same extent showed an energy deficit of only 220 kJ/(4 d) owing to recurring torpor bouts. Therefore, the anorexigenic effect of PAS(600)-leptin contributes 75% to weight loss, whereas the thermogenic action accounts for 25% by preventing hypometabolism. In a second experiment, just four injections of PAS(600)-leptin (100 pmol/g) administered in 5- to 6-day intervals rectified the Lep(ob/ob) phenotype. In total, 16 nmol of PAS(600)-leptin per mouse triggered a weight loss of 43% within 20 days and normalized hypothermia and glucose homeostasis as well as hepatic steatosis. The beneficial properties of PAS(600)-leptin are substantiated by a comparison with previous studies in which approximately 400 nmol (∼25-fold) unmodified leptin was mandatory to achieve similar improvements.

  20. The C. elegans anaphase promoting complex and MBK-2/DYRK kinase act redundantly with CUL-3/MEL-26 ubiquitin ligase to degrade MEI-1 microtubule-severing activity after meiosis.

    PubMed

    Lu, Chenggang; Mains, Paul E

    2007-02-15

    The C. elegans embryo supports both meiotic and mitotic spindles, requiring careful regulation of components specific to each spindle type. The MEI-1/katanin microtubule-severing complex is required for meiosis but must be inactivated prior to mitosis. Downregulation of MEI-1 depends on MEL-26, which binds MEI-1, targeting it for degradation by the CUL-3 E3 ubiquitin ligase complex. Here we report that other protein degradation pathways, involving the anaphase promoting complex (APC) and the MBK-2/DYRK kinase, act in parallel to MEL-26 to inactivate MEI-1. At 25 degrees all mel-26(null) embryos die due to persistence of MEI-1 into mitosis, but at 15 degrees a significant portion of embryos hatch due to lower levels of ectopic MEI-1, suggesting that a redundant pathway also regulates MEI-1 degradation at 15 degrees. Previously the MBK-2/DYRK kinase was suggested to trigger MEL-26 mediated MEI-1 degradation. However, mbk-2 enhances the incomplete lethality of mel-26(null) at 15 degrees, arguing that MEL-26 acts in parallel to MBK-2. APC mutants behave similarly. In mel-26 embryos, ectopic MEI-1 remains until the onset of gastrulation, but in mbk-2; apc embryos, MEI-1 only persists through the first mitosis. We propose that mbk-2 and apc couple the initial phase of MEI-1 degradation to meiotic exit, after which MEL-26 completes MEI-1 degradation.

  1. Sam68 promotes Schwann cell proliferation by enhancing the PI3K/Akt pathway and acts on regeneration after sciatic nerve crush

    SciTech Connect

    Wu, Weijie Liu, Yuxi Wang, Youhua

    2016-05-13

    Sam68 (Src-associated in mitosis of 68 kD), a KH domain RNA-binding protein, is not only important in signaling transduction cascades, but crucial in a variety of cellular processes. Sam68 is reported to be involved in the phospoinositide3-kinase (PI3K) and nuclear factor-kappa B (NF-κB) signaling pathways, and it is closely associated with cell proliferation, RNA metabolism, and tumor progression. However, we know little about the role of Sam68 during peripheral nervous system injury and regeneration. In this study, we investigated the expression of Sam68 and its biological significances in sciatic nerve crush. Interestingly, we found Sam68 had a co-localization with S100 (Schwann cell marker). Moreover, after crush, Sam68 had a spatiotemporal protein expression, which was in parallel with proliferation cell nuclear antigen (PCNA). In vitro, we also observed increased expression of Sam68 during the process of TNF-α-induced Schwann cell proliferation model. Besides, flow cytometry analyses, CCK-8, and EDU were all performed with the purpose of investigating the role of Sam68 in the regulation of Schwann cell proliferation. Even more importantly, we discovered that Sam68 could enhance the phosphorylation of Akt while LY294002 (a PI3K inhibitor) obviously reversed Sam68-induced cell proliferation. Finally, we detected the variance during regeneration progress through the rat walk footprint test. In summary, all these evidences demonstrated that Sam68 might participate in Schwann cell proliferation partially via PI3K/Akt pathway and also regulate regeneration after sciatic nerve crush. -- Highlights: •The dynamic changes and location of Sam68 after sciatic nerve crush. •Sam68 promoted Schwann cell proliferation via PI3K/Akt pathway. •Sam68 modulated functional recovery after sciatic nerve crush.

  2. 7 CFR 1217.1 - Act.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 10 2014-01-01 2014-01-01 false Act. 1217.1 Section 1217.1 Agriculture Regulations of..., and Industry Information Order Definitions § 1217.1 Act. Act means the Commodity Promotion, Research, and Information Act of 1996 (7 U.S.C. 7411-7425), and any amendments thereto. ...

  3. 7 CFR 1250.302 - Act.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 10 2011-01-01 2011-01-01 false Act. 1250.302 Section 1250.302 Agriculture... Research and Promotion Order Definitions § 1250.302 Act. Act means the Egg Research and Consumer Information Act and as it may be amended (Pub. L. 93-428). ...

  4. 7 CFR 1217.1 - Act.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 10 2013-01-01 2013-01-01 false Act. 1217.1 Section 1217.1 Agriculture Regulations of..., and Industry Information Order Definitions § 1217.1 Act. Act means the Commodity Promotion, Research, and Information Act of 1996 (7 U.S.C. 7411-7425), and any amendments thereto. ...

  5. 7 CFR 1205.10 - Act.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 10 2014-01-01 2014-01-01 false Act. 1205.10 Section 1205.10 Agriculture Regulations... for Conduct of Sign-up Period Definitions § 1205.10 Act. The term Act means the Cotton Research and Promotion Act, as amended . ...

  6. 7 CFR 1230.601 - Act.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 10 2014-01-01 2014-01-01 false Act. 1230.601 Section 1230.601 Agriculture... CONSUMER INFORMATION Procedures for the Conduct of Referendum Definitions § 1230.601 Act. The term Act means the Pork Promotion, Research, and Consumer Information Act of 1985 (7 U.S.C. 4801-4819) and any...

  7. 7 CFR 1205.10 - Act.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Act. 1205.10 Section 1205.10 Agriculture Regulations... for Conduct of Sign-up Period Definitions § 1205.10 Act. The term Act means the Cotton Research and Promotion Act, as amended . ...

  8. 7 CFR 1230.601 - Act.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Act. 1230.601 Section 1230.601 Agriculture... CONSUMER INFORMATION Procedures for the Conduct of Referendum Definitions § 1230.601 Act. The term Act means the Pork Promotion, Research, and Consumer Information Act of 1985 (7 U.S.C. 4801-4819) and any...

  9. 7 CFR 1250.302 - Act.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Act. 1250.302 Section 1250.302 Agriculture... Research and Promotion Order Definitions § 1250.302 Act. Act means the Egg Research and Consumer Information Act and as it may be amended (Pub. L. 93-428). ...

  10. 7 CFR 1220.600 - Act.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 10 2013-01-01 2013-01-01 false Act. 1220.600 Section 1220.600 Agriculture... CONSUMER INFORMATION Procedures To Request a Referendum Definitions § 1220.600 Act. Act means the Soybean, Promotion, Research, and Consumer Information Act set forth in title XIX, subtitle E, of the Food...

  11. 7 CFR 1250.302 - Act.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 10 2013-01-01 2013-01-01 false Act. 1250.302 Section 1250.302 Agriculture... Research and Promotion Order Definitions § 1250.302 Act. Act means the Egg Research and Consumer Information Act and as it may be amended (Pub. L. 93-428). ...

  12. 7 CFR 1220.600 - Act.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 10 2014-01-01 2014-01-01 false Act. 1220.600 Section 1220.600 Agriculture... CONSUMER INFORMATION Procedures To Request a Referendum Definitions § 1220.600 Act. Act means the Soybean, Promotion, Research, and Consumer Information Act set forth in title XIX, subtitle E, of the Food...

  13. 7 CFR 1250.302 - Act.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Act. 1250.302 Section 1250.302 Agriculture... Research and Promotion Order Definitions § 1250.302 Act. Act means the Egg Research and Consumer Information Act and as it may be amended (Pub. L. 93-428). ...

  14. 7 CFR 1230.601 - Act.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 10 2013-01-01 2013-01-01 false Act. 1230.601 Section 1230.601 Agriculture... CONSUMER INFORMATION Procedures for the Conduct of Referendum Definitions § 1230.601 Act. The term Act means the Pork Promotion, Research, and Consumer Information Act of 1985 (7 U.S.C. 4801-4819) and any...

  15. 7 CFR 1217.1 - Act.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Act. 1217.1 Section 1217.1 Agriculture Regulations of..., and Industry Information Order Definitions § 1217.1 Act. Act means the Commodity Promotion, Research, and Information Act of 1996 (7 U.S.C. 7411-7425), and any amendments thereto. ...

  16. 7 CFR 1220.600 - Act.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Act. 1220.600 Section 1220.600 Agriculture... CONSUMER INFORMATION Procedures To Request a Referendum Definitions § 1220.600 Act. Act means the Soybean, Promotion, Research, and Consumer Information Act set forth in title XIX, subtitle E, of the Food...

  17. 7 CFR 1230.601 - Act.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 10 2011-01-01 2011-01-01 false Act. 1230.601 Section 1230.601 Agriculture... CONSUMER INFORMATION Procedures for the Conduct of Referendum Definitions § 1230.601 Act. The term Act means the Pork Promotion, Research, and Consumer Information Act of 1985 (7 U.S.C. 4801-4819) and any...

  18. 7 CFR 1205.10 - Act.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Act. 1205.10 Section 1205.10 Agriculture Regulations... for Conduct of Sign-up Period Definitions § 1205.10 Act. The term Act means the Cotton Research and Promotion Act, as amended . ...

  19. 7 CFR 1230.601 - Act.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Act. 1230.601 Section 1230.601 Agriculture... CONSUMER INFORMATION Procedures for the Conduct of Referendum Definitions § 1230.601 Act. The term Act means the Pork Promotion, Research, and Consumer Information Act of 1985 (7 U.S.C. 4801-4819) and any...

  20. 7 CFR 1205.10 - Act.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 10 2013-01-01 2013-01-01 false Act. 1205.10 Section 1205.10 Agriculture Regulations... for Conduct of Sign-up Period Definitions § 1205.10 Act. The term Act means the Cotton Research and Promotion Act, as amended . ...

  1. 7 CFR 1220.600 - Act.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 10 2011-01-01 2011-01-01 false Act. 1220.600 Section 1220.600 Agriculture... CONSUMER INFORMATION Procedures To Request a Referendum Definitions § 1220.600 Act. Act means the Soybean, Promotion, Research, and Consumer Information Act set forth in title XIX, subtitle E, of the Food...

  2. 7 CFR 1205.10 - Act.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 10 2011-01-01 2011-01-01 false Act. 1205.10 Section 1205.10 Agriculture Regulations... for Conduct of Sign-up Period Definitions § 1205.10 Act. The term Act means the Cotton Research and Promotion Act, as amended . ...

  3. 7 CFR 1250.302 - Act.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 10 2014-01-01 2014-01-01 false Act. 1250.302 Section 1250.302 Agriculture... Research and Promotion Order Definitions § 1250.302 Act. Act means the Egg Research and Consumer Information Act and as it may be amended (Pub. L. 93-428). ...

  4. 7 CFR 1220.600 - Act.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Act. 1220.600 Section 1220.600 Agriculture... CONSUMER INFORMATION Procedures To Request a Referendum Definitions § 1220.600 Act. Act means the Soybean, Promotion, Research, and Consumer Information Act set forth in title XIX, subtitle E, of the Food...

  5. 7 CFR 35.1 - Act.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ...), DEPARTMENT OF AGRICULTURE COMMODITY STANDARDS AND STANDARD CONTAINER REGULATIONS EXPORT GRAPES AND PLUMS Definitions § 35.1 Act. Act or Export Grape and Plum Act means “An Act to promote the foreign trade of the United States in grapes and plums, to protect the reputation of American-grown grapes and plums in...

  6. 7 CFR 35.1 - Act.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ...), DEPARTMENT OF AGRICULTURE COMMODITY STANDARDS AND STANDARD CONTAINER REGULATIONS EXPORT GRAPES AND PLUMS Definitions § 35.1 Act. Act or Export Grape and Plum Act means “An Act to promote the foreign trade of the United States in grapes and plums, to protect the reputation of American-grown grapes and plums in...

  7. 7 CFR 35.1 - Act.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ...), DEPARTMENT OF AGRICULTURE COMMODITY STANDARDS AND STANDARD CONTAINER REGULATIONS EXPORT GRAPES AND PLUMS Definitions § 35.1 Act. Act or Export Grape and Plum Act means “An Act to promote the foreign trade of the United States in grapes and plums, to protect the reputation of American-grown grapes and plums in...

  8. 7 CFR 35.1 - Act.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ...), DEPARTMENT OF AGRICULTURE COMMODITY STANDARDS AND STANDARD CONTAINER REGULATIONS EXPORT GRAPES AND PLUMS Definitions § 35.1 Act. Act or Export Grape and Plum Act means “An Act to promote the foreign trade of the United States in grapes and plums, to protect the reputation of American-grown grapes and plums in...

  9. 7 CFR 35.1 - Act.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ...), DEPARTMENT OF AGRICULTURE COMMODITY STANDARDS AND STANDARD CONTAINER REGULATIONS EXPORT GRAPES AND PLUMS Definitions § 35.1 Act. Act or Export Grape and Plum Act means “An Act to promote the foreign trade of the United States in grapes and plums, to protect the reputation of American-grown grapes and plums in...

  10. Clean Water Act Section 404 and Agriculture

    EPA Pesticide Factsheets

    The U.S. Department of Agriculture (USDA) and EPA have longstanding programs to promote water quality and broader environmental goals identified in both the Agriculture Act of 2014 and the Clean Water Act.

  11. 75 FR 62889 - Sunshine Act Meetings

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-10-13

    ... Legal Services Committee (``Promotion & Provision Committee''). 2. Governance & Performance Review... solely of staff briefings does not fall within the Sunshine Act's definition of the term ``meeting'' and... other business. 7. Consider and act on adjournment of meeting. Governance and Performance...

  12. 7 CFR 1160.101 - Act.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 9 2012-01-01 2012-01-01 false Act. 1160.101 Section 1160.101 Agriculture Regulations... Definitions § 1160.101 Act. Act means the Fluid Milk Promotion Act of 1990, Subtitle H of Title XIX of the Food, Agriculture, Conservation, and Trade Act of 1990, Public Law 101-624, 7 U.S.C. 6401-6417, and any...

  13. 7 CFR 1160.101 - Act.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 9 2014-01-01 2013-01-01 true Act. 1160.101 Section 1160.101 Agriculture Regulations... Definitions § 1160.101 Act. Act means the Fluid Milk Promotion Act of 1990, Subtitle H of Title XIX of the Food, Agriculture, Conservation, and Trade Act of 1990, Public Law 101-624, 7 U.S.C. 6401-6417, and any...

  14. 7 CFR 1160.101 - Act.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 9 2011-01-01 2011-01-01 false Act. 1160.101 Section 1160.101 Agriculture Regulations... Definitions § 1160.101 Act. Act means the Fluid Milk Promotion Act of 1990, Subtitle H of Title XIX of the Food, Agriculture, Conservation, and Trade Act of 1990, Public Law 101-624, 7 U.S.C. 6401-6417, and any...

  15. 7 CFR 1160.101 - Act.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 9 2010-01-01 2009-01-01 true Act. 1160.101 Section 1160.101 Agriculture Regulations... Definitions § 1160.101 Act. Act means the Fluid Milk Promotion Act of 1990, Subtitle H of Title XIX of the Food, Agriculture, Conservation, and Trade Act of 1990, Public Law 101-624, 7 U.S.C. 6401-6417, and any...

  16. 7 CFR 1160.101 - Act.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 9 2013-01-01 2013-01-01 false Act. 1160.101 Section 1160.101 Agriculture Regulations... Definitions § 1160.101 Act. Act means the Fluid Milk Promotion Act of 1990, Subtitle H of Title XIX of the Food, Agriculture, Conservation, and Trade Act of 1990, Public Law 101-624, 7 U.S.C. 6401-6417, and any...

  17. Promoting Jobs for Veterans Act of 2009

    THOMAS, 111th Congress

    Rep. Buyer, Steve [R-IN-4

    2009-12-08

    House - 01/04/2010 Referred to the Subcommittee on Higher Education, Lifelong Learning, and Competitiveness. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  18. Promoting Small House Nursing Homes Act

    THOMAS, 111th Congress

    Sen. Casey, Robert P., Jr. [D-PA

    2009-04-01

    Senate - 04/01/2009 Read twice and referred to the Committee on Banking, Housing, and Urban Affairs. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  19. Promoting Partnerships to Transform Opportunities Act

    THOMAS, 113th Congress

    Sen. Udall, Tom [D-NM

    2014-04-29

    Senate - 04/29/2014 Read twice and referred to the Committee on Health, Education, Labor, and Pensions. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  20. Renewable Electricity Promotion Act of 2010

    THOMAS, 111th Congress

    Sen. Bingaman, Jeff [D-NM

    2010-09-21

    09/22/2010 Read the second time. Placed on Senate Legislative Calendar under General Orders. Calendar No. 576. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  1. Promoting Electric Vehicles Act of 2011

    THOMAS, 112th Congress

    Sen. Merkley, Jeff [D-OR

    2011-05-11

    05/19/2011 Committee on Energy and Natural Resources. Hearings held. Hearings printed: S.Hrg. 112-38. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  2. Artificial Reef Promotion Act of 2013

    THOMAS, 113th Congress

    Sen. Vitter, David [R-LA

    2013-05-23

    Senate - 05/23/2013 Read twice and referred to the Committee on Commerce, Science, and Transportation. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  3. Promoting Physical Activity for Americans Act

    THOMAS, 113th Congress

    Sen. Harkin, Tom [D-IA

    2013-03-12

    Senate - 07/23/2014 Placed on Senate Legislative Calendar under General Orders. Calendar No. 479. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  4. American Export Promotion Act of 2013

    THOMAS, 113th Congress

    Sen. Schatz, Brian [D-HI

    2013-11-20

    Senate - 11/20/2013 Read twice and referred to the Committee on Banking, Housing, and Urban Affairs. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  5. Community-Supported Agriculture Promotion Act

    THOMAS, 112th Congress

    Sen. Sanders, Bernard [I-VT

    2011-07-26

    Senate - 07/26/2011 Read twice and referred to the Committee on Agriculture, Nutrition, and Forestry. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  6. Prescription Drug Labeling Promotion Act of 2012

    THOMAS, 112th Congress

    Rep. Markey, Edward J. [D-MA-7

    2012-02-24

    02/24/2012 Referred to the House Committee on Energy and Commerce. (All Actions) Notes: For further action, see S.3187, which became Public Law 112-144 on 7/9/2012. Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  7. Promoting Electric Vehicles Act of 2010

    THOMAS, 111th Congress

    Sen. Dorgan, Byron L. [D-ND

    2010-06-15

    Senate - 09/28/2010 Placed on Senate Legislative Calendar under General Orders. Calendar No. 623. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  8. Promoting Electric Vehicles Act of 2011

    THOMAS, 112th Congress

    Sen. Merkley, Jeff [D-OR

    2011-05-11

    Senate - 05/19/2011 Committee on Energy and Natural Resources. Hearings held. Hearings printed: S.Hrg. 112-38. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  9. Veterans' Health Promotion Act of 2013

    THOMAS, 113th Congress

    Sen. Sanders, Bernard [I-VT

    2013-04-25

    Senate - 05/09/2013 Committee on Veterans' Affairs. Hearings held. Hearings printed: S.Hrg. 113-203. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  10. Promoting Jobs for Veterans Act of 2009

    THOMAS, 111th Congress

    Rep. Buyer, Steve [R-IN-4

    2009-12-08

    01/04/2010 Referred to the Subcommittee on Higher Education, Lifelong Learning, and Competitiveness. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  11. Climate Change Health Protection and Promotion Act

    THOMAS, 113th Congress

    Sen. Markey, Edward J. [D-MA

    2014-09-18

    Senate - 09/18/2014 Read twice and referred to the Committee on Health, Education, Labor, and Pensions. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  12. Prescription Drug Labeling Promotion Act of 2012

    THOMAS, 112th Congress

    Rep. Markey, Edward J. [D-MA-7

    2012-02-24

    House - 02/24/2012 Referred to the House Committee on Energy and Commerce. (All Actions) Notes: For further action, see S.3187, which became Public Law 112-144 on 7/9/2012. Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  13. Promoting Jobs for Veterans Act of 2009

    THOMAS, 111th Congress

    Rep. Buyer, Steve [R-IN-4

    2009-12-08

    01/04/2010 Referred to the Subcommittee on Higher Education, Lifelong Learning, and Competitiveness. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  14. Renewable Electricity Promotion Act of 2010

    THOMAS, 111th Congress

    Sen. Bingaman, Jeff [D-NM

    2010-09-21

    09/22/2010 Read the second time. Placed on Senate Legislative Calendar under General Orders. Calendar No. 576. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  15. Promoting Electric Vehicles Act of 2011

    THOMAS, 112th Congress

    Sen. Merkley, Jeff [D-OR

    2011-05-11

    05/19/2011 Committee on Energy and Natural Resources. Hearings held. Hearings printed: S.Hrg. 112-38. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  16. Renewable Electricity Promotion Act of 2010

    THOMAS, 111th Congress

    Sen. Bingaman, Jeff [D-NM

    2010-09-21

    Senate - 09/22/2010 Read the second time. Placed on Senate Legislative Calendar under General Orders. Calendar No. 576. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  17. Promoting Health Care Purchasing Cooperatives Act

    THOMAS, 111th Congress

    Sen. Feingold, Russell D. [D-WI

    2009-06-02

    06/02/2009 Read twice and referred to the Committee on Health, Education, Labor, and Pensions. (text of measure as introduced: CR S5949-5950) (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  18. Regenerative Medicine Promotion Act of 2014

    THOMAS, 113th Congress

    Sen. Boxer, Barbara [D-CA

    2014-03-13

    Senate - 03/13/2014 Read twice and referred to the Committee on Health, Education, Labor, and Pensions. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  19. n-Alkane and clofibrate, a peroxisome proliferator, activate transcription of ALK2 gene encoding cytochrome P450alk2 through distinct cis-acting promoter elements in Candida maltosa

    SciTech Connect

    Kogure, Takahisa; Takagi, Masamichi; Ohta, Akinori . E-mail: aaohta@mail.ecc.u-tokyo.ac.jp

    2005-04-01

    The ALK2 gene, encoding one of the n-alkane-hydroxylating cytochromes P450 in Candida maltosa, is induced by n-alkanes and a peroxisome proliferator, clofibrate. Deletion analysis of this gene's promoter revealed two cis-acting elements-an n-alkane-responsive element (ARE2) and a clofibrate-responsive element (CRE2)-that partly overlap in sequence but have distinct functions. ARE2-mediated activation responded to n-alkanes but not to clofibrate and was repressed by glucose. CRE2-mediated activation responded to polyunsaturated fatty acids and steroid hormones as well as to peroxisome proliferators but not to n-alkanes, and it was not repressed by glucose. Both elements mediated activation by oleic acid. Mutational analysis demonstrated that three CCG sequences in CRE2 were critical to the activation by clofibrate as well as to the in vitro binding of a specific protein to this element. These findings suggest that ALK2 is induced by peroxisome proliferators and steroid hormones through a specific CRE2-mediated regulatory mechanism.

  20. News Competition: School team launches a rocket Conference: Norway focuses on physics teaching Science on Stage: Canadian science acts take to the stage Particle Physics: Teachers get a surprise at CERN Teaching: Exploring how students learn physics University: Oxford opens doors to science teachers Lasers: Lasers shine light on meeting Science Fair: Malawi promotes science education

    NASA Astrophysics Data System (ADS)

    2010-11-01

    Competition: School team launches a rocket Conference: Norway focuses on physics teaching Science on Stage: Canadian science acts take to the stage Particle Physics: Teachers get a surprise at CERN Teaching: Exploring how students learn physics University: Oxford opens doors to science teachers Lasers: Lasers shine light on meeting Science Fair: Malawi promotes science education

  1. Freedom of Information Act

    USGS Publications Warehouse

    Newman, D.J.

    2012-01-01

    The Freedom of Information Act( FOIA), 5 U.S.C.§ 552, as amended, generally provides that any person has a right to request access to Federal agency records. The USGS proactively promotes information disclosure as inherent to its mission of providing objective science to inform decisionmakers and the general public. USGS scientists disseminate up-to-date and historical scientific data that are critical to addressing national and global priorities.

  2. Acting Atoms.

    ERIC Educational Resources Information Center

    Farin, Susan Archie

    1997-01-01

    Describes a fun game in which students act as electrons, protons, and neutrons. This activity is designed to help students develop a concrete understanding of the abstract concept of atomic structure. (DKM)

  3. Acting Atoms.

    ERIC Educational Resources Information Center

    Farin, Susan Archie

    1997-01-01

    Describes a fun game in which students act as electrons, protons, and neutrons. This activity is designed to help students develop a concrete understanding of the abstract concept of atomic structure. (DKM)

  4. 7 CFR 1210.302 - Act.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Act. 1210.302 Section 1210.302 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS... PLAN Watermelon Research and Promotion Plan Definitions § 1210.302 Act. Act means the Watermelon...

  5. 78 FR 78325 - National Research, Promotion, and Consumer Information Programs; Request for Extension and...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-12-26

    ... watermelons. The enabling legislation includes the Beef Promotion and Research Act of 1985 ; the Cotton..., Research, and consumer Information Act [7 U.S.C. 6301-63111; the Watermelon Research and Promotion Act [7...

  6. Balancing Act

    ERIC Educational Resources Information Center

    Kennedy, Mike

    2007-01-01

    For some administrators and planners, designing and building education facilities may sometimes seem like a circus act--trying to project a persona of competence and confidence while juggling dozens of issues. Meanwhile, the audience--students, staff members and taxpayers--watch and wait with anticipation in hopes of getting what they paid for and…

  7. Balancing Act

    ERIC Educational Resources Information Center

    Kennedy, Mike

    2007-01-01

    For some administrators and planners, designing and building education facilities may sometimes seem like a circus act--trying to project a persona of competence and confidence while juggling dozens of issues. Meanwhile, the audience--students, staff members and taxpayers--watch and wait with anticipation in hopes of getting what they paid for and…

  8. 7 CFR 1210.312 - Promotion.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE WATERMELON RESEARCH AND PROMOTION PLAN Watermelon Research and Promotion Plan Definitions § 1210.312 Promotion. Promotion means any action taken by the Board, pursuant to the Act, to present a favorable image for watermelons to the...

  9. 7 CFR 1210.312 - Promotion.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE WATERMELON RESEARCH AND PROMOTION PLAN Watermelon Research and Promotion Plan Definitions § 1210.312 Promotion. Promotion means any action taken by the Board, pursuant to the Act, to present a favorable image for watermelons to the...

  10. 7 CFR 1210.312 - Promotion.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE WATERMELON RESEARCH AND PROMOTION PLAN Watermelon Research and Promotion Plan Definitions § 1210.312 Promotion. Promotion means any action taken by the Board, pursuant to the Act, to present a favorable image for watermelons to the...

  11. 7 CFR 1210.312 - Promotion.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE WATERMELON RESEARCH AND PROMOTION PLAN Watermelon Research and Promotion Plan Definitions § 1210.312 Promotion. Promotion means any action taken by the Board, pursuant to the Act, to present a favorable image for watermelons to...

  12. 7 CFR 1210.312 - Promotion.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE WATERMELON RESEARCH AND PROMOTION PLAN Watermelon Research and Promotion Plan Definitions § 1210.312 Promotion. Promotion means any action taken by the Board, pursuant to the Act, to present a favorable image for watermelons to...

  13. Implications of the Americans with Disabilities Act.

    ERIC Educational Resources Information Center

    Meservey, Lynne

    1993-01-01

    The Americans with Disabilities Act of 1990 (ADA) makes it unlawful to discriminate in all employee practices such as recruitment, hiring, promotion, training, benefits, pay, firing, job assignment, leave, lay-off, and all other employment-related activities. (PAM)

  14. 7 CFR 1150.187 - Paperwork Reduction Act assigned number.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... MARKETING SERVICE (MARKETING AGREEMENTS AND ORDERS; MILK), DEPARTMENT OF AGRICULTURE DAIRY PROMOTION PROGRAM Dairy Promotion and Research Order Miscellaneous § 1150.187 Paperwork Reduction Act assigned number. The...

  15. Why the act?

    PubMed

    Kumta, N B

    1995-07-01

    All of the 4000 infants who die daily in India have been bottle fed. Most of these infants die from infections which are typically caused by bottle feeding. Considerable research has shown that human breast milk ideally suits babies' needs. Human breast milk protects infants from several infections and allergies, such that the breastfed infant is 25 times less likely than the bottle fed infant to die due to diarrhea and pneumonia. Comparative studies have even found breastfed babies to have higher IQs than bottle fed ones. Detrimental maternity home practices, adverse social factors, and the unethical and aggressive marketing strategy adopted by the manufacturers of infant milk substitutes and feeding bottles are the major factors responsible for the erosion of the practice of breastfeeding. These factors are discussed. The Infant Milk Substitutes, Feeding Bottles, and Infant Foods Act prohibits the advertisement and promotion of feeding bottles and infant milk substitutes by unethical marketing strategies. Violations of the act are punishable by imprisonment and a heavy fine. The act and the need for its passage are discussed.

  16. Exopolyphosphatase of Pseudomonas aeruginosa is essential for the production of virulence factors, and its expression is controlled by NtrC and PhoB acting at two interspaced promoters.

    PubMed

    Gallarato, Lucas A; Sánchez, Diego G; Olvera, Leticia; Primo, Emiliano D; Garrido, Mónica N; Beassoni, Paola R; Morett, Enrique; Lisa, Angela T

    2014-02-01

    The exopolyphosphatase (Ppx) of Pseudomonas aeruginosa is encoded by the PA5241 gene (ppx). Ppx catalyses the hydrolysis of inorganic polyphosphates to orthophosphate (Pi). In the present work, we identified and characterized the promoter region of ppx and its regulation under environmental stress conditions. The role of Ppx in the production of several virulence factors was demonstrated through studies performed on a ppx null mutant. We found that ppx is under the control of two interspaced promoters, dually regulated by nitrogen and phosphate limitation. Under nitrogen-limiting conditions, its expression was controlled from a σ(54)-dependent promoter activated by the response regulator NtrC. However, under Pi limitation, the expression was controlled from a σ(70) promoter, activated by PhoB. Results obtained from the ppx null mutant demonstrated that Ppx is involved in the production of virulence factors associated with both acute infection (e.g. motility-promoting factors, blue/green pigment production, C6-C12 quorum-sensing homoserine lactones) and chronic infection (e.g. rhamnolipids, biofilm formation). Molecular and physiological approaches used in this study indicated that P. aeruginosa maintains consistently proper levels of Ppx regardless of environmental conditions. The precise control of ppx expression appeared to be essential for the survival of P. aeruginosa and the occurrence of either acute or chronic infection in the host.

  17. 7 CFR 1212.1 - Act.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS AND..., PROMOTION, CONSUMER EDUCATION AND INDUSTRY INFORMATION ORDER Honey Packers and Importers Research, Promotion, Consumer Education, and Industry Information Order Definitions § 1212.1 Act. “Act” means the...

  18. Act resilient.

    PubMed

    Joseph, Genie; Bice-Stephens, Wynona

    2014-01-01

    Attendees have reported changing from being fearful to serene, from listless to energized, from disengaged to connected, and becoming markedly less anxious in a few weeks. Anecdotally, self-reported stress levels have been reduced by over 50% after just one class. Attendees learn not to be afraid of their feelings by working with emotions in a playful manner. When a person can act angry, but separate himself from his personal story, the emotional energy exists in a separate form that is not attached to specific events, and can be more easily dealt with and neutralized. Attendees are taught to "take out the emotional trash" through expressive comedy. They become less intimated by their own emotional intensity and triggers as they learn how even metaphorical buckets of anger, shame, guilt and hurt can be emotionally emptied. The added benefit is that this is accomplished without the disclosure of personal information of the requirement to reexperience past pain which can trigger its own cascade of stress.

  19. 77 FR 26911 - Processed Raspberry Promotion, Research, and Information Order

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-05-08

    ... Service 7 CFR Part 1208 RIN 0581-AC79 Processed Raspberry Promotion, Research, and Information Order... Processed Raspberry Promotion, Research, and Information Order (Order). The program will be implemented under the Commodity Promotion, Research, and Information Act of 1996 (1996 Act). Under the...

  20. Health Promotion

    PubMed Central

    Wilson, Ron

    1992-01-01

    How physicians address issues of disease prevention and health promotion is discussed and current standards of screening for disease and counseling practices are reviewed. Collaboration among all health professionals is necessary if preventive medicine is to be effective. PMID:21221259

  1. 78 FR 32228 - Cotton Research and Promotion Program: Determination of Whether To Conduct a Referendum Regarding...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-05-29

    ... Agricultural Marketing Service Cotton Research and Promotion Program: Determination of Whether To Conduct a Referendum Regarding 1990 Amendments to the Cotton Research and Promotion Act AGENCY: Agricultural Marketing... Promotion Act (Act). The 1990 amendments require the Secretary of Agriculture, once every 5 years,...

  2. Using Data to Promote Equity

    ERIC Educational Resources Information Center

    Shum, Brenda

    2016-01-01

    Data plays a starring role in promoting educational equity, and data-driven decision making begins with good state policies. With the recent passage of the Every Student Succeeds Act (ESSA) and a proposed federal rule to address racial disproportionality in special education, states will shoulder increased responsibility for eliminating…

  3. Using Data to Promote Equity

    ERIC Educational Resources Information Center

    Shum, Brenda

    2016-01-01

    Data plays a starring role in promoting educational equity, and data-driven decision making begins with good state policies. With the recent passage of the Every Student Succeeds Act (ESSA) and a proposed federal rule to address racial disproportionality in special education, states will shoulder increased responsibility for eliminating…

  4. Co-inoculation of Glomus intraradices and Trichoderma atroviride acts as a biostimulant to promote growth, yield and nutrient uptake of vegetable crops.

    PubMed

    Colla, Giuseppe; Rouphael, Youssef; Di Mattia, Elena; El-Nakhel, Christophe; Cardarelli, Mariateresa

    2015-06-01

    The application of beneficial microorganisms at transplanting can promote rapid transplant establishment (starter effect) for achieving early and high yields. The aim of this study was to evaluate the biostimulant effects of Glomus intraradices BEG72 (G) and Trichoderma atroviride MUCL 45632 (T) alone or in combination on plant growth parameters, yield, chlorophyll index (SPAD), chlorophyll fluorescence and mineral composition of several vegetable crops. The T. atroviride strain was capable of producing siderophores and auxin-like compounds under a wide range of substrate pH conditions (5.5-8.0). The highest shoot, root dry weight, SPAD and chlorophyll fluorescence in lettuce, tomato and zucchini was observed in the G + T combination, followed by a single inoculation of G or T, whereas the lowest values were recorded in the uninoculated plants. Under greenhouse conditions, the shoot dry weight was significantly increased by 167%, 56%, 115%, 68% and 58% in lettuce, melon, pepper, tomato and zucchini, respectively, when supplied with both beneficial microorganisms in comparison with the control. This increase in root and shoot weight was associated with an increased level of nutrient uptake (e.g. P, Mg, Fe, Zn and B). Under open field conditions, the lettuce shoot and root dry weight increased by 61% and 57%, respectively, with biostimulant microorganism application in field conditions. For zucchini, early and total yields were significantly increased by 59% and 15%, respectively, when plants were inoculated with both microorganisms. The application of the biostimulant tablet containing both G and T can promote transplant establishment and vegetable crop productivity in a sustainable way. © 2014 Society of Chemical Industry.

  5. The catecholestrogen, 2-hydroxyestradiol-17beta, acts as a G protein-coupled estrogen receptor 1 (GPER/GPR30) antagonist to promote the resumption of meiosis in zebrafish oocytes.

    PubMed

    Chourasia, Tapan K; Pang, Yefei; Thomas, Peter

    2015-03-01

    Estradiol-17beta (E2) maintains high cAMP levels and meiotic arrest in zebrafish oocytes through activation of G protein-coupled estrogen receptor (GPER). The catecholestrogen 2-hydroxyestradiol-17beta (2-OHE2) has an opposite effect to that of E2 on oocyte maturation (OM) and cAMP levels in Indian catfish oocytes. We tested the hypothesis that 2-OHE2 is produced in zebrafish ovaries and promotes the resumption of oocyte meiosis through its action as a GPER antagonist. Ovarian 2-OHE2 production by estrogen-2-hydroxylase (EH) was up-regulated by gonadotropin treatment at the onset of OM, consistent with a physiological role for 2-OHE2 in regulating OM. The increases in EH activity and OM were blocked by treatment with CYP1A1 and CYP1B1 inhibitors. Expression of cyp1a, cyp1b1, and cyp1c mRNAs was increased by gonadotropin treatment, further implicating these Cyp1s in 2-OHE2 synthesis prior to OM. Conversely, aromatase activity and cyp19a1 mRNA expression declined during gonadotropin induction of OM. 2-OHE2 treatment significantly increased spontaneous OM in defolliculated zebrafish oocytes and reversed the inhibition of OM by E2 and the GPER agonist G-1. 2-OHE2 was an effective competitor of [(3)H]-E2 binding to recombinant zebrafish GPER expressed in HEK-293 cells. 2-OHE2 also antagonized estrogen actions through GPER on cAMP production in zebrafish oocytes, resulting in a reduction in cAMP levels. Stimulation of OM by 2-OHE2 was blocked by pretreatment of defolliculated oocytes with the GPER antibody. Collectively, the results suggest that 2-OHE2 functions as a GPER antagonist and promotes OM in zebrafish through blocking GPER-dependent E2 inhibition of the resumption of OM. © 2015 by the Society for the Study of Reproduction, Inc.

  6. Promoting Models

    NASA Astrophysics Data System (ADS)

    Li, Qin; Zhao, Yongxin; Wu, Xiaofeng; Liu, Si

    There can be multitudinous models specifying aspects of the same system. Each model has a bias towards one aspect. These models often override in specific aspects though they have different expressions. A specification written in one model can be refined by introducing additional information from other models. The paper proposes a concept of promoting models which is a methodology to obtain refinements with support from cooperating models. It refines a primary model by integrating the information from a secondary model. The promotion principle is not merely an academic point, but also a reliable and robust engineering technique which can be used to develop software and hardware systems. It can also check the consistency between two specifications from different models. A case of modeling a simple online shopping system with the cooperation of the guarded design model and CSP model illustrates the practicability of the promotion principle.

  7. Interleukin-5 receptor alpha subunit gene regulation in human eosinophil development: identification of a unique cis-element that acts lie an enhancer in regulating activity of the IL-5R alpha promoter.

    PubMed

    Sun, Z; Yergeau, D A; Wong, I C; Tuypens, T; Tavernier, J; Paul, C C; Baumann, M A; Auron, P E; Tenen, D G; Ackerman, S J

    1996-01-01

    Further functional and biochemical characterization of the nuclear factor(s) which interacts with the EOS1 enhancer-like element in the IL-5R alpha promoter is currently in progress. Since different transcription factors recognize and interact with DNA in distinct fashions and with distinct structural motifs, we have modeled potential binding of the EOS1 factor to its cis-element based upon its methylation interference pattern (Fig. 2), using a cylindrical DNA helical projection (Fig. 6). Over a length of two helical turns, all nuclear protein contacts indicated by methylation interference map to one side of the DNA helix, suggesting that EOS1 binds in the major groove, across the minor groove, and on only one side of the helix. Further review of the model also reveals a potential diad symmetry for the binding site, suggestive of binding by a homodimer and consistent with the formation of the two DNA-protein complexes in our electrophoretic mobility shift experiments that could represent interactions with monomer versus dimer. Comparison of the EOS1 binding motif to similar models for the binding of other transcription factor families for which structural crystallographic and/or binding data is available suggests a similarity of the EOS1 complex to that of the bacterial helix-turn-helix phage lambda and 434 repressor-operator complexes, and the Cys4 zinc finger glucocorticoid response element (GRE) DNA-binding motifs, all of which show similar diad symmetry and binding in the major groove on one side of the DNA. The possibility that EOS1 functions as a GRE is being investigated, especially since there is a consensus AP-1 site at bp -440 to -432 of the IL-5R alpha promoter, immediately adjacent to the EOS1 binding site (see Fig. 5 in reference [36]) and AP-1/GRE interactions have been identified for composite response elements in the regulation of a number of different genes. The identification or cloning of EOS1, a potentially novel and eosinophil lineage

  8. Health Promotion

    PubMed Central

    Karmali-Rawji, Shameela; Kassim-Lakha, Shaheen; Taylor, Karmel

    1992-01-01

    Perceived lack or loss of control, stress, a rapidly again population and rising costs of health care necessitate effective health promotion and disease prevention in the elderly. In a collaborative health promotion effort, the private sector, public sector, and community partners have joined to increase the South Asian elders' sense of control over the decisions and circumstances that affect their everyday lives. The project was designed to help elders come to terms with the fragmentation of their extended families, cultural alienation, decreased autonomy, need for information, and greater risk of cardiovascular disease. Imagesp622-a

  9. The viral oncogene Np9 acts as a critical molecular switch for co-activating β-catenin, ERK, Akt and Notch1 and promoting the growth of human leukemia stem/progenitor cells.

    PubMed

    Chen, T; Meng, Z; Gan, Y; Wang, X; Xu, F; Gu, Y; Xu, X; Tang, J; Zhou, H; Zhang, X; Gan, X; Van Ness, C; Xu, G; Huang, L; Zhang, X; Fang, Y; Wu, J; Zheng, S; Jin, J; Huang, W; Xu, R

    2013-07-01

    HERV-K (human endogenous retrovirus type K) type 1-encoded Np9 is a tumor-specific biomarker, but its oncogenic role and targets in human leukemia remain elusive. We first identified Np9 as a potent viral oncogene in human leukemia. Silencing of Np9 inhibited the growth of myeloid and lymphoblastic leukemic cells, whereas expression of Np9 significantly promoted the growth of leukemia cells in vitro and in vivo. Np9 not only activated ERK, AKT and Notch1 pathways but also upregulated β-catenin essential for survival of leukemia stem cells. In human leukemia, Np9 protein level in leukemia patients was substantially higher than that in normal donors (56% vs 4.5%). Moreover, Np9 protein level was correlated with the number of leukemia stem/progenitor cells but not detected in normal CD34(+) hematopoietic stem cells. In addition, Np9-positive samples highly expressed leukemia-specific pol-env polyprotein, env and transmembrane proteins as well as viral particles. Thus, the viral oncogene Np9 is a critical molecular switch of multiple signaling pathways regulating the growth of leukemia stem/progenitor cells. These findings open a new perspective to understand the etiology of human common leukemia and provide a novel target for treating leukemia.

  10. 27 CFR 6.96 - Consumer promotions.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Consumer promotions. 6.96 Section 6.96 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS âTIED-HOUSEâ Exceptions § 6.96 Consumer promotions. (a) Coupons. The act...

  11. 27 CFR 6.96 - Consumer promotions.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2011-04-01 2011-04-01 false Consumer promotions. 6.96... OF THE TREASURY LIQUORS âTIED-HOUSEâ Exceptions § 6.96 Consumer promotions. (a) Coupons. The act by an industry member of furnishing to consumers coupons which are redeemable at a retail...

  12. 27 CFR 6.96 - Consumer promotions.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2014-04-01 2014-04-01 false Consumer promotions. 6.96... OF THE TREASURY ALCOHOL âTIED-HOUSEâ Exceptions § 6.96 Consumer promotions. (a) Coupons. The act by an industry member of furnishing to consumers coupons which are redeemable at a retail establishment...

  13. 27 CFR 6.96 - Consumer promotions.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2013-04-01 2013-04-01 false Consumer promotions. 6.96... OF THE TREASURY ALCOHOL âTIED-HOUSEâ Exceptions § 6.96 Consumer promotions. (a) Coupons. The act by an industry member of furnishing to consumers coupons which are redeemable at a retail establishment...

  14. 27 CFR 6.96 - Consumer promotions.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2012-04-01 2012-04-01 false Consumer promotions. 6.96... OF THE TREASURY LIQUORS âTIED-HOUSEâ Exceptions § 6.96 Consumer promotions. (a) Coupons. The act by an industry member of furnishing to consumers coupons which are redeemable at a retail establishment...

  15. Identifying Opinion Leaders to Promote Behavior Change

    ERIC Educational Resources Information Center

    Valente, Thomas W.; Pumpuang, Patchareeya

    2007-01-01

    This article reviews 10 techniques used to identify opinion leaders to promote behavior change. Opinion leaders can act as gatekeepers for interventions, help change social norms, and accelerate behavior change. Few studies document the manner in which opinion leaders are identified, recruited, and trained to promote health. The authors categorize…

  16. Promoting Health.

    ERIC Educational Resources Information Center

    Mechanic, David

    1990-01-01

    Argues that culture change or modification of the social structure is necessary for effective health promotion because health behavior is closely tied to basic group structures and processes. Examines the health attitudes of Mormons, low income and minority groups, and developing Islamic nations, emphasizing attitudes towards education and women.…

  17. A multicenter, randomized, double-blind, placebo-controlled, dose-finding trial of a long-acting formulation of octreotide in promoting weight loss in obese adults with insulin hypersecretion

    PubMed Central

    Lustig, RH; Greenway, F; Velasquez-Mieyer, P; Heimburger, D; Schumacher, D; Smith, D; Smith, W; Soler, N; Warsi, G; Berg, W; Maloney, J; Benedetto, J; Zhu, W; Hohneker, J

    2006-01-01

    Objective To compare changes in weight in obese patients who received long-acting octreotide (octreotide LAR) at one of three dose levels (20, 40, or 60 mg) or placebo over 6 months and to identify the lowest dose of octreotide LAR that safely achieved optimal weight loss. Design Randomized, double-blind, placebo-controlled trial of octreotide LAR at three dose levels. Patients A total of 172 adults (28 men and 144 women) with at least moderate obesity (body mass index (BMI) range 30–65 kg/m2) and evidence of insulin hypersecretion were enrolled. Patients were predominantly either Caucasian (50.0%) or African American (45.3%). The mean age (38±11 year), weight (110.7±23 kg), and BMI (39.8±6.5 kg/m2) were similar across the four treatment groups. Measurements Efficacy measures included weight, BMI, fasting serum glucose; triglycerides; percentage of total body fat and abdominal fat as measured by dual-energy X-ray absorptiometry; skin fold thickness; waist-to-hip circumference; leptin; percentage of carbohydrates, fat, and protein ingested; nutritional evaluation (including dietary analysis – 3-day food record); quality of life (QoL; using the Impact of Weight on Quality of Life-Lite™); Beck Depression Inventory; and Carbohydrate Craving Questionnaire. Safety measures included medical history, vital signs, physical examinations, hematology, blood chemistries, thyroid function tests, hemoglobin A1c, gallbladder ultrasound, electrocardiograms, and adverse events. Results After 6 months of treatment, patients receiving 40 or 60 mg of octreotide LAR experienced statistically significant weight loss compared to baseline, with mean differences from placebo in percent weight change of −1.98 and −1.87%, respectively. This finding was accompanied by statistically significant mean decreases in BMI compared to baseline, that is, a mean decrease of 0.73 and 0.79 kg/m2 for the 40 and 60 mg treatment arms, respectively. The observed weight loss was progressive during

  18. Health Promotion

    DTIC Science & Technology

    1986-03-11

    Dependents Schools and Section 6 schools. (4) Information on the health consequences of smoking shall be incorporated with the information on alcohol...departments. 2. A Health Promotion Coordinating Committee shall be established to enhance communication among the Military Services, recommend joint policy...about the patient’s tobacco use, including use of smokeless tobacco products; to advise him or her of the risks associated with use, the health bcnefits

  19. Energy Independence and Security Act of 2007

    SciTech Connect

    2011-12-30

    An Act passed in 2007 to move the United States toward greater energy independence and security, to increase the production of clean renewable fuels, to protect consumers, to increase the efficiency of products, buildings, and vehicles, to promote research on and deploy greenhouse gas capture and storage options, and to improve the energy performance of the Federal Government, and for other purposes.

  20. 75 FR 39593 - Sunshine Act Meeting

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-07-09

    ... Sunshine Act, Public Law 94-409, that the Securities and Exchange Commission will hold an Open Meeting on... a concept release to solicit public comment as to whether the Commission should consider revisions to its rules to promote greater efficiency and transparency in the U.S. proxy system and enhance the...

  1. The Clean Air Act and bonus allowances

    SciTech Connect

    Markey, E.J.; Moorhead, C.J.

    1991-05-15

    This article discusses how utility companies can benefit in the form of bonus sulfur dioxide allowances from the Environmental Protection Agency by investing in renewable energy sources such as wind and promoting conservation. Topics discussed include the Clean Air Act Amendments, acid rain, energy conservation, renewable energy sources, and the procedure for gaining bonus allowances.

  2. ACTS data center

    NASA Technical Reports Server (NTRS)

    Syed, Ali; Vogel, Wolfhard J.

    1993-01-01

    Viewgraphs on ACTS Data Center status report are included. Topics covered include: ACTS Data Center Functions; data flow overview; PPD flow; RAW data flow; data compression; PPD distribution; RAW Data Archival; PPD Audit; and data analysis.

  3. Privacy Act Statement

    EPA Pesticide Factsheets

    Any information you provide to the Environmental Protection Agency’s (EPA) Suspension and Debarment Program will be governed by the Privacy Act and will be included in the EPA Debarment and Suspension Files, a Privacy Act system of records.

  4. Recovery Act Milestones

    SciTech Connect

    Rogers, Matt

    2009-01-01

    Every 100 days, the Department of Energy is held accountable for a progress report on the American Recovery and Reinvestment Act. Update at 200 days, hosted by Matt Rogers, Senior Advisor to Secretary Steven Chu for Recovery Act Implementation.

  5. Recovery Act Milestones

    ScienceCinema

    Rogers, Matt

    2016-07-12

    Every 100 days, the Department of Energy is held accountable for a progress report on the American Recovery and Reinvestment Act. Update at 200 days, hosted by Matt Rogers, Senior Advisor to Secretary Steven Chu for Recovery Act Implementation.

  6. ACTS Aeronautical Experiments

    NASA Technical Reports Server (NTRS)

    Agan, Martin J.; Nakamura, Daniel I.; Campbell, Alan D.; Sternowski, Robert H.; Whiting, Wendy A.; Shameson, Leon

    1996-01-01

    This paper discusses a series of aeronautical experiments that utilize the advanced communication technology satellite (ACTS). As part of the ongoing effort to investigate commercial applications of ACTS technologies, NASA's Jet Propulsion Laboratory and various industry/government partners have developed a series of experiments that utilize the ACTS mobile terminal (AMT) and the broadband aeronautical terminal to investigate aeronautical uses of the ACTS. This paper discusses these experiments including the experiment configurations, technologies, results and future implications.

  7. ACTS Aeronautical Experiments

    NASA Technical Reports Server (NTRS)

    Agan, Martin J.; Nakamura, Daniel I.; Campbell, Alan D.; Sternowski, Robert H.; Whiting, Wendy A.; Shameson, Leon

    1996-01-01

    This paper discusses a series of aeronautical experiments that utilize the advanced communication technology satellite (ACTS). As part of the ongoing effort to investigate commercial applications of ACTS technologies, NASA's Jet Propulsion Laboratory and various industry/government partners have developed a series of experiments that utilize the ACTS mobile terminal (AMT) and the broadband aeronautical terminal to investigate aeronautical uses of the ACTS. This paper discusses these experiments including the experiment configurations, technologies, results and future implications.

  8. The dermatology acting internship.

    PubMed

    Stephens, John B; Raimer, Sharon S; Wagner, Richard F

    2011-07-15

    Acting internships are an important component of modern day medical school curriculum. Several specialties outside of internal medicine now offer acting internship experiences to fourth year medical students. We have found that a dermatology acting internship is a valuable experience for fourth year medical students who are interested in pursuing a residency in dermatology. Our experience with the dermatology acting internship over the 2010-2011 academic year is described.

  9. The Indian Child Welfare Act in the Face of Extinction.

    ERIC Educational Resources Information Center

    Philips, Sloan

    1997-01-01

    Discusses the history, purposes, and provisions of the Indian Child Welfare Act (ICWA); recent high-profile transracial adoption cases; the debate over whether ICWA purposes have been realized; the proposed Adoption Promotion and Stability Act, which would severely limit application of ICWA to adoption cases; and proposed compromise amendments to…

  10. The US Bayh-Dole Act and Revisionism Redux

    ERIC Educational Resources Information Center

    Bremer, Howard; Allen, Joseph; Latker, Norman J.

    2009-01-01

    In the past several years various published papers have questioned whether the Bayh-Dole Act of 1980 (The University and Small Business Patent Procedures Act) has in reality been a determining factor in promoting the transfer of technology from US universities, as has been credited to it. This paper responds to that criticism, presenting facts and…

  11. The US Bayh-Dole Act and Revisionism Redux

    ERIC Educational Resources Information Center

    Bremer, Howard; Allen, Joseph; Latker, Norman J.

    2009-01-01

    In the past several years various published papers have questioned whether the Bayh-Dole Act of 1980 (The University and Small Business Patent Procedures Act) has in reality been a determining factor in promoting the transfer of technology from US universities, as has been credited to it. This paper responds to that criticism, presenting facts and…

  12. Indian Child Welfare Act of 1978: Questions and Answers.

    ERIC Educational Resources Information Center

    Administration for Native Americans (DHEW/OHDS), Washington, DC.

    The question and answer booklet highlights the provisions of the Indian Child Welfare Act of 1978 which was designed to protect the best interests of Indian children and to promote the stability and security of Indian tribes and families. The booklet attempts to answer 28 important questions concerning title I of the Act. Examples of questions…

  13. ACTS Experiments Program

    NASA Technical Reports Server (NTRS)

    Schertler, R. J.

    1986-01-01

    An overview of the ACTS Experiments Program is presented. ACTS is being developed and will flight test the advanced technologies associated with: a Ka-band multibeam antenna, onboard signal processing and switching as well as laser communications. A nominal 3 yr experiments program is planned. Through the experiments program, the capabilities of the ACTS system will be made available to U.S. industry, university and government experimenters to test, prove the feasibility and evaluate the key ACTS system technologies. Communication modes of operation using the baseband processor and microwave switch matrix are presented, along with the antenna coverage pattern. Potential experiment categories are also presented and briefly discussed. An overall schedule of activities associated with the experiments program is outlined. Results of the ACTS Experiments Program will provide information vital to successful industry implementation of ACTS technology in a future operational system.

  14. Promoting health at the community level: thinking globally, acting locally.

    PubMed

    Economos, Christina D; Tovar, Alison

    2012-02-01

    Prevention of childhood obesity is a societal priority. Despite our knowledge about the scope of the problem and the determinants that lead to it, we have yet to produce meaningful declines in obesity rates. Recent attention has been given to interventions that employ multiple strategies across multiple settings involving whole communities given their promising results. The next era of science calls for interdisciplinary teams who will envision a whole system approach to advance the community-based obesity prevention model. This perspective describes some of the more recent discussions of community-based methodologies such as the ANGELO (Analysis Grid for Environments Linked to Obesity) framework, best-practice principles, and a whole system intervention approach to obesity prevention. The proposed required elements to advance community-based research to address childhood obesity are: A systems perspective and approach, training of future leaders in community research methodology and social change, applying transdisciplinary strategies, funding to conduct rigorous trials to determine efficacy and effectiveness, enhanced design and analysis approaches, new and improved tools and methodologies to collect quantitative and qualitative data, enhanced community engagement models and sustainability frameworks, advancement of a bold public policy agenda, economic modeling, and acknowledgment of the approach as viable. To reverse childhood obesity, we need to embrace and integrate complex strategies at multiple levels within communities across the globe.

  15. United States-Panama Trade Promotion Agreement Implementation Act

    THOMAS, 112th Congress

    Sen. Baucus, Max [D-MT

    2011-10-03

    Senate - 09/20/2012 By Senator Baucus from Committee on Finance filed written report. Report No. 112-224. Additional views filed. (All Actions) Notes: For further action, see H.R.3079, which became Public Law 112-43 on 10/21/2011. Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  16. Concrete Masonry Products Research, Education, and Promotion Act of 2013

    THOMAS, 113th Congress

    Sen. Nelson, Bill [D-FL

    2013-02-28

    12/12/2014 By Senator Rockefeller from Committee on Commerce, Science, and Transportation filed written report. Report No. 113-319. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  17. Promoting Healthy Minds for Safer Communities Act of 2014

    THOMAS, 113th Congress

    Rep. Thompson, Mike [D-CA-5

    2014-05-30

    07/21/2014 Referred to the Subcommittee on Crime, Terrorism, Homeland Security, and Investigations. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  18. Critical Minerals and Materials Promotion Act of 2011

    THOMAS, 112th Congress

    Sen. Udall, Mark [D-CO

    2011-02-17

    06/09/2011 Committee on Energy and Natural Resources Subcommittee on Energy. Hearings held. With printed Hearing: S.Hrg. 112-117. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  19. Marine and Hydrokinetic Renewable Energy Promotion Act of 2011

    THOMAS, 112th Congress

    Rep. Inslee, Jay [D-WA-1

    2011-09-21

    09/19/2012 PERMISSION TO BE ADDED AS A COSPONSOR - Ms. Bonamici asked unanimous consent that she be added as a cosponsor of H.R. 2994 since the original sponsor is no longer a Member of Congress. Agreed to without objection. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  20. United States-Colombia Trade Promotion Agreement Implementation Act

    THOMAS, 112th Congress

    Sen. Baucus, Max [D-MT

    2011-10-03

    09/20/2012 By Senator Baucus from Committee on Finance filed written report. Report No. 112-222. Additional views filed. (All Actions) Notes: For further action, see H.R.3078, which became Public Law 112-42 on 10/21/2011. Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  1. United States-Panama Trade Promotion Agreement Implementation Act

    THOMAS, 112th Congress

    Sen. Baucus, Max [D-MT

    2011-10-03

    09/20/2012 By Senator Baucus from Committee on Finance filed written report. Report No. 112-224. Additional views filed. (All Actions) Notes: For further action, see H.R.3079, which became Public Law 112-43 on 10/21/2011. Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  2. Concrete Masonry Products Research, Education, and Promotion Act of 2013

    THOMAS, 113th Congress

    Sen. Nelson, Bill [D-FL

    2013-02-28

    12/12/2014 By Senator Rockefeller from Committee on Commerce, Science, and Transportation filed written report. Report No. 113-319. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  3. Promoting Natural Gas and Electric Vehicles Act of 2010

    THOMAS, 111th Congress

    Sen. Reid, Harry [D-NV

    2010-09-21

    11/17/2010 Cloture motion on the motion to proceed to the bill withdrawn by unanimous consent in Senate. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  4. Marine and Hydrokinetic Renewable Energy Promotion Act of 2011

    THOMAS, 112th Congress

    Rep. Inslee, Jay [D-WA-1

    2011-09-21

    09/19/2012 PERMISSION TO BE ADDED AS A COSPONSOR - Ms. Bonamici asked unanimous consent that she be added as a cosponsor of H.R. 2994 since the original sponsor is no longer a Member of Congress. Agreed to without objection. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  5. Promoting Healthy Minds for Safer Communities Act of 2014

    THOMAS, 113th Congress

    Rep. Thompson, Mike [D-CA-5

    2014-05-30

    House - 07/21/2014 Referred to the Subcommittee on Crime, Terrorism, Homeland Security, and Investigations. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  6. Promoting Health as Youth Skills In Classrooms And Life Act

    THOMAS, 112th Congress

    Sen. Udall, Tom [D-NM

    2011-02-17

    Senate - 02/17/2011 Read twice and referred to the Committee on Health, Education, Labor, and Pensions. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  7. Promoting Health as Youth Skills In Classrooms And Life Act

    THOMAS, 112th Congress

    Rep. Fudge, Marcia L. [D-OH-11

    2011-08-12

    House - 11/18/2011 Referred to the Subcommittee on Early Childhood, Elementary, and Secondary Education. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  8. Medicare, Medicaid, and MCH Tobacco Cessation Promotion Act of 2009

    THOMAS, 111th Congress

    Sen. Durbin, Richard [D-IL

    2009-04-01

    04/01/2009 Read twice and referred to the Committee on Finance. (text of measure as introduced: CR S4180-4191) (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  9. Iran Human Rights and Democracy Promotion Act of 2011

    THOMAS, 112th Congress

    Sen. Kirk, Mark Steven [R-IL

    2011-05-04

    05/04/2011 Read twice and referred to the Committee on Foreign Relations. (All Actions) Notes: For further action, see H.R.1905, which became Public Law 112-158 on 8/10/2012. Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  10. Iran Human Rights and Democracy Promotion Act of 2011

    THOMAS, 112th Congress

    Rep. Dold, Robert J. [R-IL-10

    2011-05-04

    08/02/2011 Referred to the Subcommittee on Middle East and South Asia . (All Actions) Notes: For further action, see H.R.1905, which became Public Law 112-158 on 8/10/2012. Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  11. Protecting States' Rights to Promote American Energy Security Act

    THOMAS, 113th Congress

    Rep. Flores, Bill [R-TX-17

    2013-07-18

    Senate - 12/09/2013 Read the second time. Placed on Senate Legislative Calendar under General Orders. Calendar No. 255. (All Actions) Tracker: This bill has the status Passed HouseHere are the steps for Status of Legislation:

  12. Marine and Hydrokinetic Renewable Energy Promotion Act of 2011

    THOMAS, 112th Congress

    Rep. Inslee, Jay [D-WA-1

    2011-09-21

    House - 09/19/2012 PERMISSION TO BE ADDED AS A COSPONSOR - Ms. Bonamici asked unanimous consent that she be added as a cosponsor of H.R. 2994 since the original sponsor is no longer a Member of Congress. Agreed to without objection. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  13. Promoting Innovations to 21st Century Careers Act

    THOMAS, 111th Congress

    Rep. Tierney, John F. [D-MA-6

    2009-07-29

    House - 10/22/2009 Referred to the Subcommittee on Higher Education, Lifelong Learning, and Competitiveness. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  14. Promoting Health as Youth Skills In Classrooms And Life Act

    THOMAS, 113th Congress

    Rep. Fudge, Marcia L. [D-OH-11

    2013-05-23

    07/08/2013 Referred to the Subcommittee on Early Childhood, Elementary, and Secondary Education. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  15. Critical Minerals and Materials Promotion Act of 2011

    THOMAS, 112th Congress

    Sen. Udall, Mark [D-CO

    2011-02-17

    06/09/2011 Committee on Energy and Natural Resources Subcommittee on Energy. Hearings held. With printed Hearing: S.Hrg. 112-117. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  16. Promoting Wellness for Individuals with Disabilities Act of 2009

    THOMAS, 111th Congress

    Rep. Lowey, Nita M. [D-NY-18

    2009-04-02

    05/14/2009 Referred to the Subcommittee on Higher Education, Lifelong Learning, and Competitiveness. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  17. Promoting Innovations to 21st Century Careers Act

    THOMAS, 111th Congress

    Rep. Tierney, John F. [D-MA-6

    2009-07-29

    10/22/2009 Referred to the Subcommittee on Higher Education, Lifelong Learning, and Competitiveness. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  18. Promoting Health as Youth Skills In Classrooms And Life Act

    THOMAS, 113th Congress

    Rep. Fudge, Marcia L. [D-OH-11

    2013-05-23

    House - 07/08/2013 Referred to the Subcommittee on Early Childhood, Elementary, and Secondary Education. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  19. Promoting Health as Youth Skills In Classrooms And Life Act

    THOMAS, 113th Congress

    Sen. Udall, Tom [D-NM

    2013-02-27

    Senate - 02/27/2013 Read twice and referred to the Committee on Health, Education, Labor, and Pensions. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  20. Promoting Wellness for Individuals with Disabilities Act of 2009

    THOMAS, 111th Congress

    Rep. Lowey, Nita M. [D-NY-18

    2009-04-02

    House - 05/14/2009 Referred to the Subcommittee on Higher Education, Lifelong Learning, and Competitiveness. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  1. Promoting Innovations to 21st Century Careers Act

    THOMAS, 111th Congress

    Sen. Murray, Patty [D-WA

    2009-07-29

    Senate - 07/29/2009 Read twice and referred to the Committee on Health, Education, Labor, and Pensions. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  2. United States-Colombia Trade Promotion Agreement Implementation Act

    THOMAS, 112th Congress

    Sen. Baucus, Max [D-MT

    2011-10-03

    Senate - 09/20/2012 By Senator Baucus from Committee on Finance filed written report. Report No. 112-222. Additional views filed. (All Actions) Notes: For further action, see H.R.3078, which became Public Law 112-42 on 10/21/2011. Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  3. Internet Freedom, Broadband Promotion, and Consumer Protection Act of 2011

    THOMAS, 112th Congress

    Sen. Cantwell, Maria [D-WA

    2011-01-25

    Senate - 01/25/2011 Read twice and referred to the Committee on Commerce, Science, and Transportation. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  4. Promoting Job Creation and Reducing Small Business Burdens Act

    THOMAS, 113th Congress

    Rep. Fitzpatrick, Michael G. [R-PA-8

    2014-09-08

    09/17/2014 Received in the Senate and Read twice and referred to the Committee on Banking, Housing, and Urban Affairs. (All Actions) Tracker: This bill has the status Passed HouseHere are the steps for Status of Legislation:

  5. Travel Promotion, Enhancement, and Modernization Act of 2014

    THOMAS, 113th Congress

    Rep. Bilirakis, Gus M. [R-FL-12

    2014-04-10

    Senate - 07/31/2014 Read twice. Placed on Senate Legislative Calendar under General Orders. Calendar No. 521. (All Actions) Tracker: This bill has the status Passed HouseHere are the steps for Status of Legislation:

  6. Travel Promotion, Enhancement, and Modernization Act of 2014

    THOMAS, 113th Congress

    Sen. Klobuchar, Amy [D-MN

    2014-04-10

    Senate - 07/31/2014 Placed on Senate Legislative Calendar under General Orders. Calendar No. 520. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  7. Promoting Natural Gas and Electric Vehicles Act of 2010

    THOMAS, 111th Congress

    Sen. Reid, Harry [D-NV

    2010-09-21

    Senate - 11/17/2010 Cloture motion on the motion to proceed to the bill withdrawn by unanimous consent in Senate. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  8. Algae-based Renewable Fuel Promotion Act of 2010

    THOMAS, 111th Congress

    Rep. Teague, Harry [D-NM-2

    2009-12-01

    11/15/2010 Read the second time. Placed on Senate Legislative Calendar under General Orders. Calendar No. 639. (All Actions) Tracker: This bill has the status Passed HouseHere are the steps for Status of Legislation:

  9. Algae-based Renewable Fuel Promotion Act of 2009

    THOMAS, 111th Congress

    Sen. Nelson, Bill [D-FL

    2009-06-11

    06/11/2009 Read twice and referred to the Committee on Finance. (text of measure as introduced: CR S6557) (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  10. Concrete Masonry Products Research, Education, and Promotion Act of 2012

    THOMAS, 112th Congress

    Sen. Nelson, Bill [D-FL

    2012-05-23

    Senate - 05/23/2012 Read twice and referred to the Committee on Commerce, Science, and Transportation. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  11. Concrete Masonry Products Research, Education, and Promotion Act of 2013

    THOMAS, 113th Congress

    Sen. Nelson, Bill [D-FL

    2013-02-28

    Senate - 12/12/2014 By Senator Rockefeller from Committee on Commerce, Science, and Transportation filed written report. Report No. 113-319. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  12. Promoting Transparency in Financial Reporting Act of 2009

    THOMAS, 111th Congress

    Rep. Lee, Christopher J. [R-NY-26

    2009-06-02

    09/10/2009 Received in the Senate and Read twice and referred to the Committee on Banking, Housing, and Urban Affairs. (All Actions) Tracker: This bill has the status Passed HouseHere are the steps for Status of Legislation:

  13. Promoting Transparency in Financial Reporting Act of 2009

    THOMAS, 111th Congress

    Rep. Lee, Christopher J. [R-NY-26

    2009-06-02

    09/10/2009 Received in the Senate and Read twice and referred to the Committee on Banking, Housing, and Urban Affairs. (All Actions) Tracker: This bill has the status Passed HouseHere are the steps for Status of Legislation:

  14. Critical Minerals and Materials Promotion Act of 2011

    THOMAS, 112th Congress

    Sen. Udall, Mark [D-CO

    2011-02-17

    Senate - 06/09/2011 Committee on Energy and Natural Resources Subcommittee on Energy. Hearings held. With printed Hearing: S.Hrg. 112-117. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  15. Promoting Health as Youth Skills In Classrooms And Life Act

    THOMAS, 111th Congress

    Sen. Udall, Tom [D-NM

    2010-08-02

    Senate - 08/02/2010 Read twice and referred to the Committee on Health, Education, Labor, and Pensions. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  16. Child Nutrition Promotion and School Lunch Protection Act of 2009

    THOMAS, 111th Congress

    Sen. Harkin, Tom [D-IA

    2009-04-30

    Senate - 04/30/2009 Read twice and referred to the Committee on Agriculture, Nutrition, and Forestry. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  17. Travel Promotion, Enhancement, and Modernization Act of 2014

    THOMAS, 113th Congress

    Rep. Bilirakis, Gus M. [R-FL-12

    2014-04-10

    07/31/2014 Read twice. Placed on Senate Legislative Calendar under General Orders. Calendar No. 521. (All Actions) Tracker: This bill has the status Passed HouseHere are the steps for Status of Legislation:

  18. Promoting Job Creation and Reducing Small Business Burdens Act

    THOMAS, 113th Congress

    Rep. Fitzpatrick, Michael G. [R-PA-8

    2014-09-08

    Senate - 09/17/2014 Received in the Senate and Read twice and referred to the Committee on Banking, Housing, and Urban Affairs. (All Actions) Tracker: This bill has the status Passed HouseHere are the steps for Status of Legislation:

  19. Internet Freedom, Broadband Promotion, and Consumer Protection Act of 2011

    THOMAS, 112th Congress

    Sen. Cantwell, Maria [D-WA

    2011-01-25

    01/25/2011 Read twice and referred to the Committee on Commerce, Science, and Transportation. (text of measure as introduced: CR S183-185) (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  20. Iran Human Rights and Democracy Promotion Act of 2011

    THOMAS, 112th Congress

    Rep. Dold, Robert J. [R-IL-10

    2011-05-04

    House - 08/02/2011 Referred to the Subcommittee on Middle East and South Asia . (All Actions) Notes: For further action, see H.R.1905, which became Public Law 112-158 on 8/10/2012. Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  1. Iran Human Rights and Democracy Promotion Act of 2011

    THOMAS, 112th Congress

    Sen. Kirk, Mark Steven [R-IL

    2011-05-04

    Senate - 05/04/2011 Read twice and referred to the Committee on Foreign Relations. (All Actions) Notes: For further action, see H.R.1905, which became Public Law 112-158 on 8/10/2012. Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  2. Algae-based Renewable Fuel Promotion Act of 2010

    THOMAS, 111th Congress

    Rep. Teague, Harry [D-NM-2

    2009-12-01

    Senate - 11/15/2010 Read the second time. Placed on Senate Legislative Calendar under General Orders. Calendar No. 639. (All Actions) Tracker: This bill has the status Passed HouseHere are the steps for Status of Legislation:

  3. Health Promotion Funding Integrated Research, Synthesis, and Training Act

    THOMAS, 111th Congress

    Sen. Lugar, Richard G. [R-IN

    2009-05-07

    Senate - 05/07/2009 Read twice and referred to the Committee on Health, Education, Labor, and Pensions. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  4. United States-China Market Engagement and Export Promotion Act

    THOMAS, 111th Congress

    Sen. Cantwell, Maria [D-WA

    2009-08-06

    08/06/2009 Read twice and referred to the Committee on Banking, Housing, and Urban Affairs. (text of measure as introduced: CR S9016-9017) (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  5. Algae-based Renewable Fuel Promotion Act of 2010

    THOMAS, 111th Congress

    Rep. Teague, Harry [D-NM-2

    2009-12-01

    11/15/2010 Read the second time. Placed on Senate Legislative Calendar under General Orders. Calendar No. 639. (All Actions) Tracker: This bill has the status Passed HouseHere are the steps for Status of Legislation:

  6. Promoting Wellness for Individuals with Disabilities Act of 2009

    THOMAS, 111th Congress

    Rep. Lowey, Nita M. [D-NY-18

    2009-04-02

    05/14/2009 Referred to the Subcommittee on Higher Education, Lifelong Learning, and Competitiveness. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  7. Iran Human Rights and Democracy Promotion Act of 2011

    THOMAS, 112th Congress

    Sen. Kirk, Mark Steven [R-IL

    2011-05-04

    05/04/2011 Read twice and referred to the Committee on Foreign Relations. (All Actions) Notes: For further action, see H.R.1905, which became Public Law 112-158 on 8/10/2012. Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  8. Promoting Natural Gas and Electric Vehicles Act of 2010

    THOMAS, 111th Congress

    Sen. Reid, Harry [D-NV

    2010-09-21

    11/17/2010 Cloture motion on the motion to proceed to the bill withdrawn by unanimous consent in Senate. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  9. Promoting Transparency in Financial Reporting Act of 2009

    THOMAS, 111th Congress

    Rep. Lee, Christopher J. [R-NY-26

    2009-06-02

    Senate - 09/10/2009 Received in the Senate and Read twice and referred to the Committee on Banking, Housing, and Urban Affairs. (All Actions) Tracker: This bill has the status Passed HouseHere are the steps for Status of Legislation:

  10. Promoting Innovations to 21st Century Careers Act

    THOMAS, 111th Congress

    Rep. Tierney, John F. [D-MA-6

    2009-07-29

    10/22/2009 Referred to the Subcommittee on Higher Education, Lifelong Learning, and Competitiveness. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  11. Travel Promotion, Enhancement, and Modernization Act of 2014

    THOMAS, 113th Congress

    Rep. Bilirakis, Gus M. [R-FL-12

    2014-04-10

    07/31/2014 Read twice. Placed on Senate Legislative Calendar under General Orders. Calendar No. 521. (All Actions) Tracker: This bill has the status Passed HouseHere are the steps for Status of Legislation:

  12. Promoting Innovation and Access to Life-Saving Medicine Act

    THOMAS, 111th Congress

    Sen. Schumer, Charles E. [D-NY

    2009-03-26

    Senate - 03/26/2009 Read twice and referred to the Committee on Health, Education, Labor, and Pensions. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  13. Marine and Hydrokinetic Renewable Energy Promotion Act of 2011

    THOMAS, 112th Congress

    Sen. Murkowski, Lisa [R-AK

    2011-03-17

    Senate - 07/11/2011 Placed on Senate Legislative Calendar under General Orders. Calendar No. 98. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  14. Promoting Health as Youth Skills In Classrooms And Life Act

    THOMAS, 113th Congress

    Rep. Fudge, Marcia L. [D-OH-11

    2013-05-23

    07/08/2013 Referred to the Subcommittee on Early Childhood, Elementary, and Secondary Education. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  15. Iran Human Rights and Democracy Promotion Act of 2011

    THOMAS, 112th Congress

    Rep. Dold, Robert J. [R-IL-10

    2011-05-04

    08/02/2011 Referred to the Subcommittee on Middle East and South Asia . (All Actions) Notes: For further action, see H.R.1905, which became Public Law 112-158 on 8/10/2012. Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  16. Promoting Health as Youth Skills In Classrooms And Life Act

    THOMAS, 112th Congress

    Rep. Fudge, Marcia L. [D-OH-11

    2011-08-12

    11/18/2011 Referred to the Subcommittee on Early Childhood, Elementary, and Secondary Education. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  17. United States-Panama Trade Promotion Agreement Implementation Act

    THOMAS, 112th Congress

    Sen. Baucus, Max [D-MT

    2011-10-03

    09/20/2012 By Senator Baucus from Committee on Finance filed written report. Report No. 112-224. Additional views filed. (All Actions) Notes: For further action, see H.R.3079, which became Public Law 112-43 on 10/21/2011. Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  18. United States-Colombia Trade Promotion Agreement Implementation Act

    THOMAS, 112th Congress

    Sen. Baucus, Max [D-MT

    2011-10-03

    09/20/2012 By Senator Baucus from Committee on Finance filed written report. Report No. 112-222. Additional views filed. (All Actions) Notes: For further action, see H.R.3078, which became Public Law 112-42 on 10/21/2011. Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  19. Promoting Job Creation and Reducing Small Business Burdens Act

    THOMAS, 113th Congress

    Rep. Fitzpatrick, Michael G. [R-PA-8

    2014-09-08

    09/17/2014 Received in the Senate and Read twice and referred to the Committee on Banking, Housing, and Urban Affairs. (All Actions) Tracker: This bill has the status Passed HouseHere are the steps for Status of Legislation:

  20. Bone Health Promotion and Research Act of 2011

    THOMAS, 112th Congress

    Sen. Gillibrand, Kirsten E. [D-NY

    2011-05-12

    Senate - 05/12/2011 Read twice and referred to the Committee on Health, Education, Labor, and Pensions. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  1. Protecting States' Rights to Promote American Energy Security Act

    THOMAS, 113th Congress

    Rep. Flores, Bill [R-TX-17

    2013-07-18

    12/09/2013 Read the second time. Placed on Senate Legislative Calendar under General Orders. Calendar No. 255. (All Actions) Tracker: This bill has the status Passed HouseHere are the steps for Status of Legislation:

  2. Promoting Health as Youth Skills In Classrooms And Life Act

    THOMAS, 112th Congress

    Rep. Fudge, Marcia L. [D-OH-11

    2011-08-12

    11/18/2011 Referred to the Subcommittee on Early Childhood, Elementary, and Secondary Education. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  3. Promoting Healthy Minds for Safer Communities Act of 2014

    THOMAS, 113th Congress

    Rep. Thompson, Mike [D-CA-5

    2014-05-30

    07/21/2014 Referred to the Subcommittee on Crime, Terrorism, Homeland Security, and Investigations. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  4. Promoting Innovations to 21st Century Careers Act

    THOMAS, 113th Congress

    Sen. Murray, Patty [D-WA

    2013-07-25

    Senate - 07/25/2013 Read twice and referred to the Committee on Health, Education, Labor, and Pensions. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  5. Promoting Innovations to 21st Century Careers Act

    THOMAS, 112th Congress

    Sen. Murray, Patty [D-WA

    2011-04-14

    Senate - 04/14/2011 Read twice and referred to the Committee on Health, Education, Labor, and Pensions. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  6. 75 FR 31730 - Popcorn Promotion, Research, and Consumer Information Order; Reapportionment

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-06-04

    ... Agricultural Marketing Service 7 CFR Part 1215 Popcorn Promotion, Research, and Consumer Information Order... the Popcorn Promotion, Research and Consumer Information Order (Order) which is authorized by the Popcorn Promotion, Research and Consumer Information Act (Act), the number of members on the Board may...

  7. 76 FR 28625 - Sorghum Promotion, Research, and Information Program; State Referendum Results

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-05-18

    ... Service 7 CFR 1221 Sorghum Promotion, Research, and Information Program; State Referendum Results AGENCY..., 2011, through February 28, 2011, have approved the continuation of the Sorghum Promotion, Research, and... Promotion, Research, and Information Act of 1996 (Act) (7 U.S.C. 7411-7425), the Department of...

  8. 77 FR 52597 - Beef Promotion and Research; Amendment to the Order

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-08-30

    ... Agricultural Marketing Service 7 CFR Part 1260 Beef Promotion and Research; Amendment to the Order AGENCY... authority of the Beef Promotion and Research Order (Order). The Beef Research and Information Act (Act) requires that the Beef Promotion Operating Committee (BPOC) enter into contracts with established...

  9. 75 FR 24373 - Cotton Research and Promotion Program: Designation of Cotton-Producing States

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-05-05

    ... Service 7 CFR Part 1205 RIN 0581-AC84 Cotton Research and Promotion Program: Designation of Cotton... Marketing Service (AMS) is amending the Cotton Research and Promotion Order (Cotton Order) following a... Bill) that amended the Cotton Research and Promotion Act (Cotton Act). The 2008 Farm Bill provided...

  10. 77 FR 12752 - Beef Promotion and Research; Amendment to the Order

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-03-02

    ... Agricultural Marketing Service 7 CFR Part 1260 Beef Promotion and Research; Amendment to the Order AGENCY... contracting authority as established under the Beef Promotion and Research (Order). The Beef Research and Information Act (Act) requires that the Beef Promotion Operating Committee (BPOC) enter into contracts...

  11. 25 CFR 700.33 - Act (The Act).

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 25 Indians 2 2014-04-01 2014-04-01 false Act (The Act). 700.33 Section 700.33 Indians THE OFFICE OF NAVAJO AND HOPI INDIAN RELOCATION COMMISSION OPERATIONS AND RELOCATION PROCEDURES General Policies and Instructions Definitions § 700.33 Act (The Act). (a) The Act. The Act is Pub. L. 93-531, (88 Stat...

  12. 25 CFR 700.33 - Act (The Act).

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 25 Indians 2 2012-04-01 2012-04-01 false Act (The Act). 700.33 Section 700.33 Indians THE OFFICE OF NAVAJO AND HOPI INDIAN RELOCATION COMMISSION OPERATIONS AND RELOCATION PROCEDURES General Policies and Instructions Definitions § 700.33 Act (The Act). (a) The Act. The Act is Pub. L. 93-531, (88 Stat...

  13. 25 CFR 700.33 - Act (The Act).

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 25 Indians 2 2013-04-01 2013-04-01 false Act (The Act). 700.33 Section 700.33 Indians THE OFFICE OF NAVAJO AND HOPI INDIAN RELOCATION COMMISSION OPERATIONS AND RELOCATION PROCEDURES General Policies and Instructions Definitions § 700.33 Act (The Act). (a) The Act. The Act is Pub. L. 93-531, (88 Stat...

  14. 25 CFR 700.33 - Act (The Act).

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 25 Indians 2 2011-04-01 2011-04-01 false Act (The Act). 700.33 Section 700.33 Indians THE OFFICE OF NAVAJO AND HOPI INDIAN RELOCATION COMMISSION OPERATIONS AND RELOCATION PROCEDURES General Policies and Instructions Definitions § 700.33 Act (The Act). (a) The Act. The Act is Pub. L. 93-531, (88 Stat...

  15. 25 CFR 700.33 - Act (The Act).

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 25 Indians 2 2010-04-01 2010-04-01 false Act (The Act). 700.33 Section 700.33 Indians THE OFFICE OF NAVAJO AND HOPI INDIAN RELOCATION COMMISSION OPERATIONS AND RELOCATION PROCEDURES General Policies and Instructions Definitions § 700.33 Act (The Act). (a) The Act. The Act is Pub. L. 93-531, (88 Stat...

  16. Quantum Measurement Act as a Speech Act

    NASA Astrophysics Data System (ADS)

    Schneider, Jean

    2005-10-01

    I show that the quantum measurement problem can be understood if the measurement is seen as a "speech act" in the sense of modern language theory. The reduction of the state vector is in this perspective an intersubjective -- or, better, a-subjective -- symbolic process. I then give some perspectives on applications to the "Mind-Body Problem".

  17. Act II of the Sunshine Act.

    PubMed

    Pham-Kanter, Genevieve

    2014-11-01

    To coincide with the introduction in the United States of the Sunshine Act, Genevieve Pham-Kanter discusses what we need to look for to fight hidden bias and deliberate or unconscious corruption. Please see later in the article for the Editors' Summary.

  18. Promoting Retention

    PubMed Central

    Hall, LaToya N.; Ficker, Lisa J.; Chadiha, Letha A.; Green, Carmen R.; Jackson, James S.; Lichtenberg, Peter A.

    2016-01-01

    Objectives: The objectives of this study were to evaluate the capability of a research volunteer registry to retain community-dwelling African American older adults, and to explore demographic and health factors associated with retention. Method: A logistic regression model was used to determine the influence of demographics, health factors, and registry logic model activities on retention in a sample of 1,730 older African American adults. Results: Almost 80% of participants active in the volunteer research registry between January 2012 and June 2015 were retained. Employment, being referred to research studies, a higher number of medical conditions, and more follow-up contacts were associated with an increased likelihood of retention. Older age, more months in the registry, and more mobility problems decreased the likelihood of retention. Discussion: These results suggest the Michigan Center for Urban African American Aging Research logic model promotes retention through involving older African American adults in research through study referrals and intensive follow-up. The loss of participants due to age- and mobility-related issues indicate the registry may be losing its most vulnerable participants. PMID:28138501

  19. [Acceptance and Commitment Therapy (ACT): Behaviorism, mindfulness and values].

    PubMed

    Coletti, Juan P; Teti, Germán L

    2015-01-01

    Over the last decades a series of psychological treatments labeled 'Third Generation Therapies' have been developed. Acceptance and Commitment Therapy (ACT) is a third generation therapy that essentially seeks to promote the acceptance of private events in opposition to their modification or change, with the aim of promoting cognitive flexibility. Thus, it is intended that the subject be permitted to choose their behavior consistent with personal values. The current work aims to provide overview specific to the contextual conditions that promoted the emergence of ACT, the underlying philosophy and theory, and the particularities of the intervention model.

  20. [ACCEPTANCE AND COMMITMENT THERAPY (ACT): BEHAVIORISM, MINDFULNESS AND VALUES].

    PubMed

    Coletti, Juan Pablo; Teti, Germán Leandro

    2015-01-01

    Over the last decades a series of psychological treatments labeled have been developed. Acceptance and Commitment Therapy (ACT) is a third generation therapy that essentially seeks to promote the acceptance of private events in opposition to their modification or change, with the aim of promoting cognitive flexibility. Thus, it is intended that the subject be permitted to choose their behavior consistent with personal values. The current work aims to provide overview specific to the contextual conditions that promoted the emergence of ACT, the underlying philosophy and theory, and the particularities of the intervention model.

  1. Developmental Disabilities Act.

    ERIC Educational Resources Information Center

    TEACHING Exceptional Children, 1995

    1995-01-01

    The Developmental Disabilities Act provides funds to State Developmental Disabilities Councils to formulate comprehensive systems of services, supports, and other assistance. The act also supports protection and advocacy systems to protect legal rights, university-affiliated programs to provide preservice preparation, and national initiatives to…

  2. Clean Air Act Text

    EPA Pesticide Factsheets

    The Clean Air Act is the law that defines EPA's responsibilities for protecting and improving the nation's air quality and the stratospheric ozone layer. The last major change in the law, the Clean Air Act Amendments of 1990, enacted in 1990 by Congress.

  3. ACT and College Success

    ERIC Educational Resources Information Center

    Bleyaert, Barbara

    2010-01-01

    What is the relationship between ACT scores and success in college? For decades, admissions policies in colleges and universities across the country have required applicants to submit scores from a college entrance exam, most typically the ACT (American College Testing) or SAT (Scholastic Aptitude Test). This requirement suggests that high school…

  4. Americans With Disabilities Act.

    PubMed

    Walk, E E; Ahn, H C; Lampkin, P M; Nabizadeh, S A; Edlich, R F

    1993-01-01

    The Americans with Disabilities Act gives all Americans with disabilities a chance to achieve the same quality of life that individuals without disabilities enjoy. This act prohibits discrimination on the basis of disabilities in employment, public services, privately operated public accommodations, services, and telecommunications. The Americans with Disabilities Act is divided into five titles. Title I of the act pertains to discrimination against the disabled in the workplace. Title II prevents discrimination against persons with a disability in state and local government services. Title III prohibits discrimination against persons with disabilities in places of public accommodations and commercial facilities. Title IV ensures that companies offering telephone services to the general public provide special services for individuals with hearing and speech impairments. Under the enforcement provisions of the Americans with Disabilities Act, stringent penalties will be implemented for failure to comply with its provisions.

  5. Acts of kindness and acts of novelty affect life satisfaction.

    PubMed

    Buchanan, Kathryn E; Bardi, Anat

    2010-01-01

    The present experiment was designed to establish the effects of acts of kindness and acts of novelty on life satisfaction. Participants aged 18-60 took part on a voluntary basis. They were randomly assigned to perform either acts of kindness, acts of novelty, or no acts on a daily basis for 10 days. Their life satisfaction was measured before and after the 10-day experiment. As expected, performing acts of kindness or acts of novelty resulted in an increase in life satisfaction.

  6. Learning activism, acting with phronesis

    NASA Astrophysics Data System (ADS)

    Lee, Yew-Jin

    2015-12-01

    The article "Socio-political development of private school children mobilising for disadvantaged others" by Darren Hoeg, Natalie Lemelin, and Lawrence Bencze described a language-learning curriculum that drew on elements of Socioscientific issues and Science, Technology, Society and Environment. Results showed that with a number of enabling factors acting in concert, learning about and engagement in practical action for social justice and equity are possible. An alternative but highly compatible framework is now introduced—phronetic social research—as an action-oriented, wisdom-seeking research stance for the social sciences. By so doing, it is hoped that forms of phronetic social research can gain wider currency among those that promote activism as one of many valued outcomes of an education in science.

  7. Draconian dress act repealed.

    PubMed

    Mhone, C

    1994-01-01

    The Dress Act was put into place in Malawi by the government of President Kamuzu Banda after the long period of direct colonialism. The act made it illegal for women in Malawi to be seen publicly wearing dresses which did not completely cover their knees or wearing pants; men had to wear their hair short. Police officers even scrutinized women's attire at private house parties and in homes. The autocratic political structure established by Banda, however, was voted out in a referendum June 14, 1993. Pressure by opposition forces such as the United Democratic Front forced a repeal of the act on November 16 of the same year. The repeal was vigorously attacked by female Parliament members as a move which would result in moral degradation and an increase in the level of sexual harassment against women. Other citizens and tourists have generally detested the act. The act has most certainly kept many potential visitors from vacationing in Malawi. Some expert observers think that repeals of the Dress Act, the Forfeiture Act, and legislation which allowed the government to detain opposition figures without trial were done to garner support from the Paris Club for the resumption of balance of payments support suspended due to the country's poor human rights record.

  8. Freedom of Information Act-Employee responsibilities

    USGS Publications Warehouse

    Newman, David J.

    2012-01-01

    The Freedom of Information Act( FOIA), 5 U.S.C. § 552, as amended, generally provides that any person has a right to request access to Federal agency records. The USGS proactively promotes information disclosure as inherent to its mission of providing objective science to inform decisionmakers and the general public. USGS scientists disseminate up-to-date and historical scientific data that are critical to addressing national and global priorities.

  9. Human Rights Act, 12 February 1987.

    PubMed

    1987-01-01

    This document reprints major provisions of the Yukon's (Canada) 1987 Human Rights Act. The Act furthers the public policy that every individual is free and equal in dignity and rights, seeks to discourage and eliminate discrimination, and promotes the underlying principles of Canadian and international human rights instruments. Part 1 contains a Bill of Rights that protects the right to freedom of: 1) religion and conscience, 2) expression, 3) assembly and association, and 4) to enjoyment and disposition of property. Part 2 prohibits discrimination based on ancestry (including color and race), national origin, ethnic or linguistic background or origin, age, sex (including pregnancy), and marital or family status. Discrimination is also prohibited when offering services, goods, or facilities to the public; in connection with employment; in connection with membership in trade unions or trade, occupational, or professional associations; and in negotiation or performance of public contracts. The Bill of Rights lists reasonable causes for discrimination as well as exemptions, including preferential treatment for organization or family members or employment in a private home. Special programs and affirmative action programs are specifically not considered discrimination under this Act. The Act sets forth rules for providing equal pay for work of equal value and creates a Yukon Human Rights Commission to promote human rights and assist adjudication of complaints.

  10. Disabilities Act in Action.

    ERIC Educational Resources Information Center

    Daynes, Kristine S.

    1990-01-01

    Eight true or false questions explore implications of the Americans with Disabilities Act of 1990. Topics include AIDS, drug abuse, undue hardship, reasonable accommodation, and company size affected by the law. (SK)

  11. Disabilities Act in Action.

    ERIC Educational Resources Information Center

    Daynes, Kristine S.

    1990-01-01

    Eight true or false questions explore implications of the Americans with Disabilities Act of 1990. Topics include AIDS, drug abuse, undue hardship, reasonable accommodation, and company size affected by the law. (SK)

  12. ACTS mobile SATCOM experiments

    NASA Technical Reports Server (NTRS)

    Abbe, Brian S.; Frye, Robert E.; Jedrey, Thomas C.

    1993-01-01

    Over the last decade, the demand for reliable mobile satellite communications (satcom) for voice, data, and video applications has increased dramatically. As consumer demand grows, the current spectrum allocation at L-band could become saturated. For this reason, NASA and the Jet Propulsion Laboratory are developing the Advanced Communications Technology Satellites (ACTS) mobile terminal (AMT) and are evaluating the feasibility of K/Ka-band (20/30 GHz) mobile satcom to meet these growing needs. U.S. industry and government, acting as co-partners, will evaluate K/Ka-band mobile satcom and develop new technologies by conducting a series of applications-oriented experiments. The ACTS and the AMT testbed will be used to conduct these mobile satcom experiments. The goals of the ACTS Mobile Experiments Program and the individual experiment configurations and objectives are further presented.

  13. The Pregnancy Discrimination Act of 1978 and Its Impact on Educational Institutions.

    ERIC Educational Resources Information Center

    Association of American Colleges, Washington, DC. Project on the Status and Education of Women.

    The Pregnancy Discrimination Act of 1978--which amends Title VII of the Civil Rights Act of 1964--and its impact on educational institutions are discussed. The Act prohibits discrimination against women employees because of pregnancy, childbirth, or related medical conditions. It covers hiring, promotion, firing, and seniority rights as well as…

  14. The Export Trading Company Act of 1982 and the photovoltaics industry: An assessment

    NASA Technical Reports Server (NTRS)

    Enfield, S.; Laporta, C.

    1983-01-01

    The potential advantages of recent export promotion legislation for the U.S. photovoltaics industry were assessed. The provisions of the Export Trading Company Act of 1982 were reviewed and the export trade sector was surveyed to determine what impact the Act is haviang on export company activity. The photovoltaics industry was then studied to determine whether the Act offers particular advantages for promoting its product overseas.

  15. Promoter-Based Theranostics for Prostate Cancer

    DTIC Science & Technology

    2016-06-01

    for research contains sequences from bacterial origin. These bacterial sequences and mammalian promoters often rich in unmethylated 2’- deoxyribo...sequence enables plasmid DNA act as an artificial chromosome resulting in prolonged existence of the plasmid over multiple cell divisions. It is also

  16. The punctilious RNA polymerase II core promoter.

    PubMed

    Vo Ngoc, Long; Wang, Yuan-Liang; Kassavetis, George A; Kadonaga, James T

    2017-07-01

    The signals that direct the initiation of transcription ultimately converge at the core promoter, which is the gateway to transcription. Here we provide an overview of the RNA polymerase II core promoter in bilateria (bilaterally symmetric animals). The core promoter is diverse in terms of its composition and function yet is also punctilious, as it acts with strict rules and precision. We additionally describe an expanded view of the core promoter that comprises the classical DNA sequence motifs, sequence-specific DNA-binding transcription factors, chromatin signals, and DNA structure. This model may eventually lead to a more unified conceptual understanding of the core promoter. © 2017 Vo ngoc et al.; Published by Cold Spring Harbor Laboratory Press.

  17. Plant growth-promoting bacterial endophytes.

    PubMed

    Santoyo, Gustavo; Moreno-Hagelsieb, Gabriel; Orozco-Mosqueda, Ma del Carmen; Glick, Bernard R

    2016-02-01

    Bacterial endophytes ubiquitously colonize the internal tissues of plants, being found in nearly every plant worldwide. Some endophytes are able to promote the growth of plants. For those strains the mechanisms of plant growth-promotion known to be employed by bacterial endophytes are similar to the mechanisms used by rhizospheric bacteria, e.g., the acquisition of resources needed for plant growth and modulation of plant growth and development. Similar to rhizospheric plant growth-promoting bacteria, endophytic plant growth-promoting bacteria can act to facilitate plant growth in agriculture, horticulture and silviculture as well as in strategies for environmental cleanup (i.e., phytoremediation). Genome comparisons between bacterial endophytes and the genomes of rhizospheric plant growth-promoting bacteria are starting to unveil potential genetic factors involved in an endophytic lifestyle, which should facilitate a better understanding of the functioning of bacterial endophytes.

  18. The CEO's second act.

    PubMed

    Nadler, David A

    2007-01-01

    When a CEO leaves because of performance problems, the company typically recruits someone thought to be better equipped to fix what the departing executive couldn't--or wouldn't. The board places its confidence in the new person because of the present dilemma's similarity to some previous challenge that he or she dealt with successfully. But familiar problems are inevitably succeeded by less familiar ones, for which the specially selected CEO is not quite so qualified. More often than not, the experiences, skills, and temperament that yielded triumph in Act I turn out to be unequal to Act II's difficulties. In fact, the approaches that worked so brilliantly in Act I may be the very opposite of what is needed in Act II. The CEO has four choices: refuse to change, in which case he or she will be replaced; realize that the next act requires new skills and learn them; downsize or circumscribe his or her role to compensate for deficiencies; or line up a successor who is qualified to fill a role to which the incumbent's skills and interests are no longer suited. Hewlett-Packard's Carly Fiorina exemplifies the first alternative; Merrill Lynch's Stanley O'Neal the second; Google's Sergey Brin and Larry Page the third; and Quest Diagnostics' Ken Freeman the fourth. All but the first option are reasonable responses to the challenges presented in the second acts of most CEOs' tenures. And all but the first require a power of observation, a propensity for introspection, and a strain of humility that are rare in the ranks of the very people who need those qualities most. There are four essential steps executives can take to discern that they have entered new territory and to respond accordingly: recognition that their leadership style and approach are no longer working; acceptance of others' advice on why performance is faltering; analysis and understanding of the nature of the Act II shift; and, finally, decision and action.

  19. H.R. 747, The Effective Schools Development in Education Act of 1985. Hearing before the Subcommittee on Elementary, Secondary, and Vocational Education of the Committee on Education and Labor, House of Representatives, Ninety-Ninth Congress, Second Session on H.R. 747 To Amend the Elementary and Secondary Education Act of 1965 To Establish a Program To Promote More Effective Schools and Excellence in Education, and for Other Purposes.

    ERIC Educational Resources Information Center

    Congress of the U.S., Washington, DC. House Committee on Education and Labor.

    The purpose of this hearing was to present testimony on the concept of effective schools and to discuss the Effective Schools Development in Education Act of 1985, H.R. 747. This report includes statements from: (1) Dr. Robert N. Fortenberry, superintendent of the Jackson (Mississippi) Municipal Separate School District; (2) Dr. Eric Cooper,…

  20. Plant-growth-promoting rhizobacteria.

    PubMed

    Lugtenberg, Ben; Kamilova, Faina

    2009-01-01

    Several microbes promote plant growth, and many microbial products that stimulate plant growth have been marketed. In this review we restrict ourselves to bacteria that are derived from and exert this effect on the root. Such bacteria are generally designated as PGPR (plant-growth-promoting rhizobacteria). The beneficial effects of these rhizobacteria on plant growth can be direct or indirect. This review begins with describing the conditions under which bacteria live in the rhizosphere. To exert their beneficial effects, bacteria usually must colonize the root surface efficiently. Therefore, bacterial traits required for root colonization are subsequently described. Finally, several mechanisms by which microbes can act beneficially on plant growth are described. Examples of direct plant growth promotion that are discussed include (a) biofertilization, (b) stimulation of root growth, (c) rhizoremediation, and (d) plant stress control. Mechanisms of biological control by which rhizobacteria can promote plant growth indirectly, i.e., by reducing the level of disease, include antibiosis, induction of systemic resistance, and competition for nutrients and niches.