Sample records for calculated binding constants

  1. Nuclear binding energy using semi empirical mass formula

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ankita,, E-mail: ankitagoyal@gmail.com; Suthar, B.

    2016-05-06

    In the present communication, semi empirical mass formula using the liquid drop model has been presented. Nuclear binding energies are calculated using semi empirical mass formula with various constants given by different researchers. We also compare these calculated values with experimental data and comparative study for finding suitable constants is added using the error plot. The study is extended to find the more suitable constant to reduce the error.

  2. Rate constants for proteins binding to substrates with multiple binding sites using a generalized forward flux sampling expression

    NASA Astrophysics Data System (ADS)

    Vijaykumar, Adithya; ten Wolde, Pieter Rein; Bolhuis, Peter G.

    2018-03-01

    To predict the response of a biochemical system, knowledge of the intrinsic and effective rate constants of proteins is crucial. The experimentally accessible effective rate constant for association can be decomposed in a diffusion-limited rate at which proteins come into contact and an intrinsic association rate at which the proteins in contact truly bind. Reversely, when dissociating, bound proteins first separate into a contact pair with an intrinsic dissociation rate, before moving away by diffusion. While microscopic expressions exist that enable the calculation of the intrinsic and effective rate constants by conducting a single rare event simulation of the protein dissociation reaction, these expressions are only valid when the substrate has just one binding site. If the substrate has multiple binding sites, a bound enzyme can, besides dissociating into the bulk, also hop to another binding site. Calculating transition rate constants between multiple states with forward flux sampling requires a generalized rate expression. We present this expression here and use it to derive explicit expressions for all intrinsic and effective rate constants involving binding to multiple states, including rebinding. We illustrate our approach by computing the intrinsic and effective association, dissociation, and hopping rate constants for a system in which a patchy particle model enzyme binds to a substrate with two binding sites. We find that these rate constants increase as a function of the rotational diffusion constant of the particles. The hopping rate constant decreases as a function of the distance between the binding sites. Finally, we find that blocking one of the binding sites enhances both association and dissociation rate constants. Our approach and results are important for understanding and modeling association reactions in enzyme-substrate systems and other patchy particle systems and open the way for large multiscale simulations of such systems.

  3. New mixed ligand palladium(II) complexes based on the antiepileptic drug sodium valproate and bioactive nitrogen-donor ligands: Synthesis, structural characterization, binding interactions with DNA and BSA, in vitro cytotoxicity studies and DFT calculations

    NASA Astrophysics Data System (ADS)

    Tabrizi, Leila; Chiniforoshan, Hossein; Tavakol, Hossein

    2015-04-01

    The complexes [Pd(valp)2(imidazole)2] (1), [Pd(valp)2(pyrazine)2] (2) (valp is sodium valproate) have been synthesized and characterized using IR, 1H NMR, 13C{1H} NMR and UV-Vis spectrometry. The interaction of complexes with CT-DNA has been investigated using spectroscopic tools and viscosity measurement. In each case, the association constant (Kb) was deduced from the absorption spectral study and the number of binding sites (n) and the binding constant (K) were calculated from relevant fluorescence quenching data. As a result, a non-covalent interaction between the metal complex and DNA was suggested, which could be assigned to an intercalative binding. In addition, the interaction of 1 and 2 was ventured with bovine serum albumin (BSA) with the help of absorption and fluorescence spectroscopy measurements. Through these techniques, the apparent association constant (Kapp) and the binding constant (K) could be calculated for each complex. Evaluation of cytotoxic activity of the complexes against four different cancer cell lines proved that the complexes exhibited cytotoxic specificity and significant cancer cell inhibitory rate. Moreover, density functional theory (DFT) calculations were employed to provide more evidence about the observed data. The majority of trans isomers were supported not only by energies, but also by the similarity of its calculated IR frequencies, UV adsorptions and NMR chemical shifts to the experimental values.

  4. Study of fluorescence quenching of Barley α-amylase

    NASA Astrophysics Data System (ADS)

    Bakkialakshmi, S.; Shanthi, B.; Bhuvanapriya, T.

    2012-05-01

    The fluorescence quenching of Barley α-amylase by acrylamide and succinimide has been studied in water using steady-state and time-resolved fluorescence techniques. The steady-state fluorescence quenching technique has been performed in three different pHs (i.e., 6, 7 and 8) of water. Ground state and excited state binding constants (Kg &Ke) have been calculated. From the calculated binding constants (Kg &Ke) the free energy changes for the ground (ΔGg) and excited (ΔGe) states have been calculated and are presented in tables. UV and FTIR spectra have also been recorded to prove the binding of Barley α-amylase with acrylamide and succinimide.

  5. Influence of sulfhydryl sites on metal binding by bacteria

    NASA Astrophysics Data System (ADS)

    Nell, Ryan M.; Fein, Jeremy B.

    2017-02-01

    The role of sulfhydryl sites within bacterial cell envelopes is still unknown, but the sites may control the fate and bioavailability of metals. Organic sulfhydryl compounds are important complexing ligands in aqueous systems and they can influence metal speciation in natural waters. Though representing only approximately 5-10% of the total available binding sites on bacterial surfaces, sulfhydryl sites exhibit high binding affinities for some metals. Due to the potential importance of bacterial sulfhydryl sites in natural systems, metal-bacterial sulfhydryl site binding constants must be determined in order to construct accurate models of the fate and distribution of metals in these systems. To date, only Cd-sulfhydryl binding has been quantified. In this study, the thermodynamic stabilities of Mn-, Co-, Ni-, Zn-, Sr- and Pb-sulfhydryl bacterial cell envelope complexes were determined for the bacterial species Shewanella oneidensis MR-1. Metal adsorption experiments were conducted as a function of both pH, ranging from 5.0 to 7.0, and metal loading, from 0.5 to 40.0 μmol/g (wet weight) bacteria, in batch experiments in order to determine if metal-sulfhydryl binding occurs. Initially, the data were used to calculate the value of the stability constants for the important metal-sulfhydryl bacterial complexes for each metal-loading condition studied, assuming a single binding reaction for the dominant metal-binding site type under the pH conditions of the experiments. For most of the metals that we studied, these calculated stability constant values increased significantly with decreasing metal loading, strongly suggesting that our initial assumption was not valid and that more than one type of binding occurs at the assumed binding site. We then modeled each dataset with two distinct site types with identical acidity constants: one site with a high metal-site stability constant value, which we take to represent metal-sulfhydryl binding and which dominates under low metal loading conditions, and another more abundant site that we term non-sulfhydryl sites that becomes important at high metal loadings. The resulting calculated stability constants do not vary significantly as a function of metal loading and yield reasonable fits to the observed adsorption behaviors as a function of both pH and metal loading. We use the results to calculate the speciation of metals bound by the bacterial envelope in realistic bacteria-bearing, heavy metal contaminated systems in order to demonstrate the potential importance of metal-sulfhydryl binding in the budget of bacterially-adsorbed metals under low metal-loading conditions.

  6. Fulvic acid-sulfide ion competition for mercury ion binding in the Florida everglades

    USGS Publications Warehouse

    Reddy, M.M.; Aiken, G.R.

    2001-01-01

    Negatively charged functional groups of fulvic acid compete with inorganic sulfide ion for mercury ion binding. This competition is evaluated here by using a discrete site-electrostatic model to calculate mercury solution speciation in the presence of fulvic acid. Model calculated species distributions are used to estimate a mercury-fulvic acid apparent binding constant to quantify fulvic acid and sulfide ion competition for dissolved inorganic mercury (Hg(II)) ion binding. Speciation calculations done with PHREEQC, modified to use the estimated mercury-fulvic acid apparent binding constant, suggest that mercury-fulvic acid and mercury-sulfide complex concentrations are equivalent for very low sulfide ion concentrations (about 10-11 M) in Everglades' surface water. Where measurable total sulfide concentration (about 10-7 M or greater) is present in Everglades' surface water, mercury-sulfide complexes should dominate dissolved inorganic mercury solution speciation. In the absence of sulfide ion (for example, in oxygenated Everglades' surface water), fulvic acid binding should dominate Everglades' dissolved inorganic mercury speciation.

  7. Spectroscopic analyses on interaction of o-Vanillin- D-Phenylalanine, o-Vanillin- L-Tyrosine and o-Vanillin- L-Levodopa Schiff Bases with bovine serum albumin (BSA)

    NASA Astrophysics Data System (ADS)

    Gao, Jingqun; Guo, Yuwei; Wang, Jun; Wang, Zhiqiu; Jin, Xudong; Cheng, Chunping; Li, Ying; Li, Kai

    2011-04-01

    In this work, three o-Vanillin Schiff Bases (o-VSB: o-Vanillin- D-Phenylalanine (o-VDP), o-Vanillin- L-Tyrosine (o-VLT) and o-Vanillin- L-Levodopa (o-VLL)) with alanine constituent were synthesized by direct reflux method in ethanol solution, and then were used to study the interaction to bovine serum albumin (BSA) molecules by fluorescence spectroscopy. Based on the fluorescence quenching calculation, the bimolecular quenching constant ( Kq), apparent quenching constant ( Ksv), effective binding constant ( KA) and corresponding dissociation constant ( KD) as well as binding site number ( n) were obtained. In addition, the binding distance ( r) was also calculated according to Foster's non-radioactive energy transfer theory. The results show that these three o-VSB can efficiently bind to BSA molecules, but the binding array order is o-VDP-BSA > o-VLT-BSA > o-VLL-BSA. Synchronous fluorescence spectroscopy indicates that the o-VDP is more accessibility to tryptophan (Trp) residues of BSA molecules than to tyrosine (Tyr) residues. Nevertheless, the o-VLT and o-VLL are more accessibility to Tyr residues than to Trp residues.

  8. Spectroscopic analyses on interaction of o-Vanillin-D-Phenylalanine, o-Vanillin-L-Tyrosine and o-Vanillin-L-Levodopa Schiff Bases with bovine serum albumin (BSA).

    PubMed

    Gao, Jingqun; Guo, Yuwei; Wang, Jun; Wang, Zhiqiu; Jin, Xudong; Cheng, Chunping; Li, Ying; Li, Kai

    2011-04-01

    In this work, three o-Vanillin Schiff Bases (o-VSB: o-Vanillin-D-Phenylalanine (o-VDP), o-Vanillin-L-Tyrosine (o-VLT) and o-Vanillin-L-Levodopa (o-VLL)) with alanine constituent were synthesized by direct reflux method in ethanol solution, and then were used to study the interaction to bovine serum albumin (BSA) molecules by fluorescence spectroscopy. Based on the fluorescence quenching calculation, the bimolecular quenching constant (K(q)), apparent quenching constant (K(sv)), effective binding constant (K(A)) and corresponding dissociation constant (K(D)) as well as binding site number (n) were obtained. In addition, the binding distance (r) was also calculated according to Foster's non-radioactive energy transfer theory. The results show that these three o-VSB can efficiently bind to BSA molecules, but the binding array order is o-VDP-BSA>o-VLT-BSA>o-VLL-BSA. Synchronous fluorescence spectroscopy indicates that the o-VDP is more accessibility to tryptophan (Trp) residues of BSA molecules than to tyrosine (Tyr) residues. Nevertheless, the o-VLT and o-VLL are more accessibility to Tyr residues than to Trp residues. Copyright © 2010 Elsevier B.V. All rights reserved.

  9. Characterization of complexes between phenethylamine enantiomers and β-cyclodextrin derivatives by capillary electrophoresis-Determination of binding constants and complex mobilities.

    PubMed

    Wahl, Joachim; Furuishi, Takayuki; Yonemochi, Etsuo; Meinel, Lorenz; Holzgrabe, Ulrike

    2017-04-01

    To optimize chiral separation conditions and to improve the knowledge of enantioseparation, it is important to know the binding constants K between analytes and cyclodextrins and the electrophoretic mobilities of the temporarily formed analyte-cyclodextrin-complexes. K values for complexes between eight phenethylamine enantiomers, namely ephedrine, pseudoephedrine, methylephedrine and norephedrine, and four different β-cyclodextrin derivatives were determined by affinity capillary electrophoresis. The binding constants were calculated from the electrophoretic mobility values of the phenethylamine enantiomers at increasing concentrations of cyclodextrins in running buffer. Three different linear plotting methods (x-reciprocal, y-reciprocal, double reciprocal) and nonlinear regression were used for the determination of binding constants with β-cyclodextrin, (2-hydroxypropyl)-β-cyclodextrin, methyl-β-cyclodextrin and 6-O-α-maltosyl-β-cyclodextrin. The cyclodextrin concentration in a 50 mM phosphate buffer pH 3.0 was varied from 0 to 12 mM. To investigate the influence of the binding constant values on the enantioseparation the observed electrophoretic selectivities were compared with the obtained K values and the calculated enantiomer-cyclodextrin-complex mobilities. The different electrophoretic mobilities of the temporarily formed complexes were crucial factors for the migration order and enantioseparation of ephedrine derivatives. To verify the apparent binding constants determined by capillary electrophoresis, a titration process using ephedrine enantiomers and β-cyclodextrin was carried out. Furthermore, the isothermal titration calorimetry measurements gave information about the thermal properties of the complexes. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Determination of the molecular complexation constant between alprostadil and alpha-cyclodextrin by conductometry: implications for a freeze-dried formulation.

    PubMed

    Sheehy, Philip M; Ramstad, Tore

    2005-10-04

    The binding constant between alprostadil (PGE1) and alpha-cyclodextrin (alpha-CD) was determined at four temperatures using conductance measurements. Alpha-cyclodextrin is an excipient material in Caverject dual chamber syringe (DCS) that was added to enhance stability. The binding constant was used to calculate the amount of PGE1 free upon reconstitution and injection, since only the free drug is clinically active. The conductivity measurement is based on a decrease in specific conductance as alprostadil is titrated with alpha-CD. The change in conductivity was plotted versus free ligand concentration (alpha-CD) to generate a binding curve. As the value of the binding constant proved to be dependent on substrate concentration, it is really a pseudo binding constant. A value of 742+/-60 M(-1) was obtained for a 0.5 mM solution of alprostadil at 27 degrees C and a value of 550+/-52 M(-1) at 37 degrees C. These results compare favorably to values previously obtained by NMR and capillary electrophoresis. Calculation of the fraction PGE1 free upon reconstitution and injection show it to approach the desired outcome of one. Hence, the amount of drug delivered by Caverject DCS is nominally equivalent to that delivered by Caverject S. Po., a predecessor product that contains no alpha-cyclodextrin.

  11. A spectroscopic study on the interaction between gold nanoparticles and hemoglobin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Garabagiu, Sorina, E-mail: sgarabagiu@itim-cj.ro

    2011-12-15

    Highlights: Black-Right-Pointing-Pointer The interaction was studied using UV-vis and fluorescence spectroscopy. Black-Right-Pointing-Pointer Gold nanoparticles quench the fluorescence emission of hemoglobin solution. Black-Right-Pointing-Pointer The binding and thermodynamic constants were calculated. Black-Right-Pointing-Pointer Major impact: electrochemical applications of the complex onto a substrate. -- Abstract: The interaction between horse hemoglobin and gold nanoparticles was studied using optical spectroscopy. UV-vis and fluorescence spectra show that a spontaneous binding process occurred between hemoglobin and gold nanoparticles. The Soret band of hemoglobin in the presence of gold nanoparticles does not show significant changes, which proves that the protein retained its biological function. A shift to longermore » wavelengths appears in the plasmonic band of gold nanoparticles upon the attachment of hemoglobin molecules. Gold nanoparticles quench the fluorescence emission of tryptophan residues in the structure of hemoglobin. The Stern-Volmer quenching constant, the binding constant and the number of binding sites were also calculated. Thermodynamic parameters indicate that the binding was mainly due to hydrophobic interactions.« less

  12. Modeling the Concentrations and Efficiencies for the Interacting Species of Pyropheophorbide Methyl Ester-Copper Association

    NASA Astrophysics Data System (ADS)

    Al-Omari, S.

    2013-07-01

    The interaction between pyropheophorbide methyl ester (PPME) and Cu2+ was investigated using UV-vis and fluorescence spectrscopy. Study of the binding interaction between PPME and Cu2+ could contribute to understanding of its pharmacokinetics and pharmacodynamics. Parameters of the static and dynamic fluorescence quenching of PPME-Cu2+ association were calculated at different temperatures. For binding site of 1:1 at 299 K, the static binding constant (kS), the static isosbestic concentration (CS{ iso}), the dynamic binding constant (kD), and the dynamic isosbestic concentration (CD{ iso }) are, respectively, 61 M-1, 0.0164 M, 75 M-1, and 0.0133 M. The concentrations and efficiencies of the intermediates species were modeled. Satisfactory correspondence between the experimental and calculated results was found.

  13. Computational scheme for pH-dependent binding free energy calculation with explicit solvent.

    PubMed

    Lee, Juyong; Miller, Benjamin T; Brooks, Bernard R

    2016-01-01

    We present a computational scheme to compute the pH-dependence of binding free energy with explicit solvent. Despite the importance of pH, the effect of pH has been generally neglected in binding free energy calculations because of a lack of accurate methods to model it. To address this limitation, we use a constant-pH methodology to obtain a true ensemble of multiple protonation states of a titratable system at a given pH and analyze the ensemble using the Bennett acceptance ratio (BAR) method. The constant pH method is based on the combination of enveloping distribution sampling (EDS) with the Hamiltonian replica exchange method (HREM), which yields an accurate semi-grand canonical ensemble of a titratable system. By considering the free energy change of constraining multiple protonation states to a single state or releasing a single protonation state to multiple states, the pH dependent binding free energy profile can be obtained. We perform benchmark simulations of a host-guest system: cucurbit[7]uril (CB[7]) and benzimidazole (BZ). BZ experiences a large pKa shift upon complex formation. The pH-dependent binding free energy profiles of the benchmark system are obtained with three different long-range interaction calculation schemes: a cutoff, the particle mesh Ewald (PME), and the isotropic periodic sum (IPS) method. Our scheme captures the pH-dependent behavior of binding free energy successfully. Absolute binding free energy values obtained with the PME and IPS methods are consistent, while cutoff method results are off by 2 kcal mol(-1) . We also discuss the characteristics of three long-range interaction calculation methods for constant-pH simulations. © 2015 The Protein Society.

  14. Spectroscopic analyses and studies on respective interaction of cyanuric acid and uric acid with bovine serum albumin and melamine

    NASA Astrophysics Data System (ADS)

    Chen, Dandan; Wu, Qiong; Wang, Jun; Wang, Qi; Qiao, Heng

    2015-01-01

    In this work, the fluorescence quenching was used to study the interaction of cyanuric acid (CYA) and uric acid (UA) with bovine serum albumin (BSA) at two different temperatures (283 K and 310 K). The bimolecular quenching constant (Kq), apparent quenching constant (Ksv), effective binding constant (KA) and corresponding dissociation constant (KD), binding site number (n) and binding distance (r) were calculated by adopting Stern-Volmer, Lineweaver-Burk, Double logarithm and overlap integral equations. The results show that CYA and UA are both able to obviously bind to BSA, but the binding strength order is BSA + CYA < BSA + UA. And then, the interactions of CYA and UA with melamine (MEL) under the same conditions were also studied by using similar methods. The results indicates that both CYA and UA can bind together closely with melamine (MEL). It is wished that these research results would facilitate the understanding the formation of kidney stones and gout in the body after ingesting excess MEL.

  15. Circular dichroism spectroscopic investigation of double-decker phthalocyanine with G-Quadruplex as promising telomerase inhibitor

    NASA Astrophysics Data System (ADS)

    Baǧda, Efkan; Baǧda, Esra; Yabaş, Ebru

    2017-01-01

    In the present study, interaction of a double-decker phthalocyanine with two G-quadruplex DNA, Tel 21 and cMYC, was investigated. To the best of our knowledge, this is the first study about G-quadruplex-double decker phthalocyanine interaction. The spectrophotometric titration method was used for binding constant calculations. From the binding constants, it can be said that double-decker phthalocyanine more likely to bind Tel 21 rather than cMYC. The conformational changes upon binding were monitored via circular dichroism spectroscopy. The ethidium bromide replacement assay was investigated spectrofluorometrically.

  16. Kinetic rate constant prediction supports the conformational selection mechanism of protein binding.

    PubMed

    Moal, Iain H; Bates, Paul A

    2012-01-01

    The prediction of protein-protein kinetic rate constants provides a fundamental test of our understanding of molecular recognition, and will play an important role in the modeling of complex biological systems. In this paper, a feature selection and regression algorithm is applied to mine a large set of molecular descriptors and construct simple models for association and dissociation rate constants using empirical data. Using separate test data for validation, the predicted rate constants can be combined to calculate binding affinity with accuracy matching that of state of the art empirical free energy functions. The models show that the rate of association is linearly related to the proportion of unbound proteins in the bound conformational ensemble relative to the unbound conformational ensemble, indicating that the binding partners must adopt a geometry near to that of the bound prior to binding. Mirroring the conformational selection and population shift mechanism of protein binding, the models provide a strong separate line of evidence for the preponderance of this mechanism in protein-protein binding, complementing structural and theoretical studies.

  17. Assessing the performance of the MM/PBSA and MM/GBSA methods. 1. The accuracy of binding free energy calculations based on molecular dynamics simulations.

    PubMed

    Hou, Tingjun; Wang, Junmei; Li, Youyong; Wang, Wei

    2011-01-24

    The Molecular Mechanics/Poisson-Boltzmann Surface Area (MM/PBSA) and the Molecular Mechanics/Generalized Born Surface Area (MM/GBSA) methods calculate binding free energies for macromolecules by combining molecular mechanics calculations and continuum solvation models. To systematically evaluate the performance of these methods, we report here an extensive study of 59 ligands interacting with six different proteins. First, we explored the effects of the length of the molecular dynamics (MD) simulation, ranging from 400 to 4800 ps, and the solute dielectric constant (1, 2, or 4) on the binding free energies predicted by MM/PBSA. The following three important conclusions could be observed: (1) MD simulation length has an obvious impact on the predictions, and longer MD simulation is not always necessary to achieve better predictions. (2) The predictions are quite sensitive to the solute dielectric constant, and this parameter should be carefully determined according to the characteristics of the protein/ligand binding interface. (3) Conformational entropy often show large fluctuations in MD trajectories, and a large number of snapshots are necessary to achieve stable predictions. Next, we evaluated the accuracy of the binding free energies calculated by three Generalized Born (GB) models. We found that the GB model developed by Onufriev and Case was the most successful model in ranking the binding affinities of the studied inhibitors. Finally, we evaluated the performance of MM/GBSA and MM/PBSA in predicting binding free energies. Our results showed that MM/PBSA performed better in calculating absolute, but not necessarily relative, binding free energies than MM/GBSA. Considering its computational efficiency, MM/GBSA can serve as a powerful tool in drug design, where correct ranking of inhibitors is often emphasized.

  18. Binding site and affinity prediction of general anesthetics to protein targets using docking.

    PubMed

    Liu, Renyu; Perez-Aguilar, Jose Manuel; Liang, David; Saven, Jeffery G

    2012-05-01

    The protein targets for general anesthetics remain unclear. A tool to predict anesthetic binding for potential binding targets is needed. In this study, we explored whether a computational method, AutoDock, could serve as such a tool. High-resolution crystal data of water-soluble proteins (cytochrome C, apoferritin, and human serum albumin), and a membrane protein (a pentameric ligand-gated ion channel from Gloeobacter violaceus [GLIC]) were used. Isothermal titration calorimetry (ITC) experiments were performed to determine anesthetic affinity in solution conditions for apoferritin. Docking calculations were performed using DockingServer with the Lamarckian genetic algorithm and the Solis and Wets local search method (http://www.dockingserver.com/web). Twenty general anesthetics were docked into apoferritin. The predicted binding constants were compared with those obtained from ITC experiments for potential correlations. In the case of apoferritin, details of the binding site and their interactions were compared with recent cocrystallization data. Docking calculations for 6 general anesthetics currently used in clinical settings (isoflurane, sevoflurane, desflurane, halothane, propofol, and etomidate) with known 50% effective concentration (EC(50)) values were also performed in all tested proteins. The binding constants derived from docking experiments were compared with known EC(50) values and octanol/water partition coefficients for the 6 general anesthetics. All 20 general anesthetics docked unambiguously into the anesthetic binding site identified in the crystal structure of apoferritin. The binding constants for 20 anesthetics obtained from the docking calculations correlate significantly with those obtained from ITC experiments (P = 0.04). In the case of GLIC, the identified anesthetic binding sites in the crystal structure are among the docking predicted binding sites, but not the top ranked site. Docking calculations suggest a most probable binding site located in the extracellular domain of GLIC. The predicted affinities correlated significantly with the known EC(50) values for the 6 frequently used anesthetics in GLIC for the site identified in the experimental crystal data (P = 0.006). However, predicted affinities in apoferritin, human serum albumin, and cytochrome C did not correlate with these 6 anesthetics' known experimental EC(50) values. A weak correlation between the predicted affinities and the octanol/water partition coefficients was observed for the sites in GLIC. We demonstrated that anesthetic binding sites and relative affinities can be predicted using docking calculations in an automatic docking server (AutoDock) for both water-soluble and membrane proteins. Correlation of predicted affinity and EC(50) for 6 frequently used general anesthetics was only observed in GLIC, a member of a protein family relevant to anesthetic mechanism.

  19. Binding Site and Affinity Prediction of General Anesthetics to Protein Targets Using Docking

    PubMed Central

    Liu, Renyu; Perez-Aguilar, Jose Manuel; Liang, David; Saven, Jeffery G.

    2012-01-01

    Background The protein targets for general anesthetics remain unclear. A tool to predict anesthetic binding for potential binding targets is needed. In this study, we explore whether a computational method, AutoDock, could serve as such a tool. Methods High-resolution crystal data of water soluble proteins (cytochrome C, apoferritin and human serum albumin), and a membrane protein (a pentameric ligand-gated ion channel from Gloeobacter violaceus, GLIC) were used. Isothermal titration calorimetry (ITC) experiments were performed to determine anesthetic affinity in solution conditions for apoferritin. Docking calculations were performed using DockingServer with the Lamarckian genetic algorithm and the Solis and Wets local search method (https://www.dockingserver.com/web). Twenty general anesthetics were docked into apoferritin. The predicted binding constants are compared with those obtained from ITC experiments for potential correlations. In the case of apoferritin, details of the binding site and their interactions were compared with recent co-crystallization data. Docking calculations for six general anesthetics currently used in clinical settings (isoflurane, sevoflurane, desflurane, halothane, propofol, and etomidate) with known EC50 were also performed in all tested proteins. The binding constants derived from docking experiments were compared with known EC50s and octanol/water partition coefficients for the six general anesthetics. Results All 20 general anesthetics docked unambiguously into the anesthetic binding site identified in the crystal structure of apoferritin. The binding constants for 20 anesthetics obtained from the docking calculations correlate significantly with those obtained from ITC experiments (p=0.04). In the case of GLIC, the identified anesthetic binding sites in the crystal structure are among the docking predicted binding sites, but not the top ranked site. Docking calculations suggest a most probable binding site located in the extracellular domain of GLIC. The predicted affinities correlated significantly with the known EC50s for the six commonly used anesthetics in GLIC for the site identified in the experimental crystal data (p=0.006). However, predicted affinities in apoferritin, human serum albumin, and cytochrome C did not correlate with these six anesthetics’ known experimental EC50s. A weak correlation between the predicted affinities and the octanol/water partition coefficients was observed for the sites in GLIC. Conclusion We demonstrated that anesthetic binding sites and relative affinities can be predicted using docking calculations in an automatic docking server (Autodock) for both water soluble and membrane proteins. Correlation of predicted affinity and EC50 for six commonly used general anesthetics was only observed in GLIC, a member of a protein family relevant to anesthetic mechanism. PMID:22392968

  20. Calcium ion binding to a soil fulvic acid using a donnan potential model

    USGS Publications Warehouse

    Marinsky, J.A.; Mathuthu, A.; Ephraim, J.H.; Reddy, M.M.

    1999-01-01

    Calcium ion binding to a soil fulvic acid (Armadale Bh Horizon) was evaluated over a range of calcium ion concentrations, from pH 3.8 to 7.3, using potentiometric titrations and calcium ion electrode measurements. Fulvic acid concentration was constant (100 milligrams per liter) and calcium ion concentration varied up to 8 X 10-4 moles per liter. Experiments discussed here included: (1) titrations of fulvic acid-calcium ion containing solutions with sodium hydroxide; and (2) titrations of fully neutralized fulvic acid with calcium chloride solutions. Apparent binding constants (expressed as the logarithm of the value, log ??app) vary with solution pH, calcium ion concentration, degree of acid dissociation, and ionic strength (from log ??app = 2.5 to 3.9) and are similar to those reported by others. Fulvic acid charge, and the associated Donnan Potential, influences calcium ion-fulvic acid ion pair formation. A Donnan Potential corrrection term allowed calculation of intrinsic calcium ion-fulvic acid binding constants. Intrinsic binding constants vary from 1.2 to 2.5 (the average value is about log??= 1.6) and are similar to, but somewhat higher than, stability constants for calcium ion-carboxylic acid monodentate complexes. ?? by Oldenbourg Wissenschaftsverlag, Mu??nchen.

  1. Temperature-Dependent Estimation of Gibbs Energies Using an Updated Group-Contribution Method.

    PubMed

    Du, Bin; Zhang, Zhen; Grubner, Sharon; Yurkovich, James T; Palsson, Bernhard O; Zielinski, Daniel C

    2018-06-05

    Reaction-equilibrium constants determine the metabolite concentrations necessary to drive flux through metabolic pathways. Group-contribution methods offer a way to estimate reaction-equilibrium constants at wide coverage across the metabolic network. Here, we present an updated group-contribution method with 1) additional curated thermodynamic data used in fitting and 2) capabilities to calculate equilibrium constants as a function of temperature. We first collected and curated aqueous thermodynamic data, including reaction-equilibrium constants, enthalpies of reaction, Gibbs free energies of formation, enthalpies of formation, entropy changes of formation of compounds, and proton- and metal-ion-binding constants. Next, we formulated the calculation of equilibrium constants as a function of temperature and calculated the standard entropy change of formation (Δ f S ∘ ) using a model based on molecular properties. The median absolute error in estimating Δ f S ∘ was 0.013 kJ/K/mol. We also estimated magnesium binding constants for 618 compounds using a linear regression model validated against measured data. We demonstrate the improved performance of the current method (8.17 kJ/mol in median absolute residual) over the current state-of-the-art method (11.47 kJ/mol) in estimating the 185 new reactions added in this work. The efforts here fill in gaps for thermodynamic calculations under various conditions, specifically different temperatures and metal-ion concentrations. These, to our knowledge, new capabilities empower the study of thermodynamic driving forces underlying the metabolic function of organisms living under diverse conditions. Copyright © 2018 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  2. Synthesis and characterization of a new zinc(II) complex with tetradentate azo-thioether ligand: X-ray structure, DNA binding study and DFT calculation

    NASA Astrophysics Data System (ADS)

    Mondal, Apurba Sau; Pramanik, Ajoy Kumar; Patra, Lakshman; Manna, Chandan Kumar; Mondal, Tapan Kumar

    2017-10-01

    A new zinc(II) complex, [Zn(L)(H2O)](ClO4) (1) with azo-thioether containing NSNO donor ligand, 3-(2-(2-((pyridin-2-ylmethyl)thio)phenyl)hydrazono)pentane-2,4-dione (HL) is synthesized and characterized by several spectroscopic techniques. The distorted square based pyramidal (DSBP) geometry is confirmed by single crystal X-ray structure. The ability of the complex to bind with CT DNA is investigated by UV-vis method and the binding constant is found to be 4.16 × 104 M-1. Competitive binding study with ethidium bromide (EB) by fluorescence method suggests that the zinc(II) complex efficiently displaces EB from EB-DNA. The Stern-Volmer dynamic quenching constant, Ksv is found to be 1.2 × 104 M-1. Theoretical calculations by DFT and TDDFT/CPCM methods are used to interpret the electronic structure and UV-vis spectrum of the complex.

  3. Microwave emulations and tight-binding calculations of transport in polyacetylene

    NASA Astrophysics Data System (ADS)

    Stegmann, Thomas; Franco-Villafañe, John A.; Ortiz, Yenni P.; Kuhl, Ulrich; Mortessagne, Fabrice; Seligman, Thomas H.

    2017-01-01

    A novel approach to investigate the electron transport of cis- and trans-polyacetylene chains in the single-electron approximation is presented by using microwave emulation measurements and tight-binding calculations. In the emulation we take into account the different electronic couplings due to the double bonds leading to coupled dimer chains. The relative coupling constants are adjusted by DFT calculations. For sufficiently long chains a transport band gap is observed if the double bonds are present, whereas for identical couplings no band gap opens. The band gap can be observed also in relatively short chains, if additional edge atoms are absent, which cause strong resonance peaks within the band gap. The experimental results are in agreement with our tight-binding calculations using the nonequilibrium Green's function method. The tight-binding calculations show that it is crucial to include third nearest neighbor couplings to obtain the gap in the cis-polyacetylene.

  4. Interaction of Antiinflammatory Drugs with EPC Liposomes: Calorimetric Study in a Broad Concentration Range

    PubMed Central

    Matos, Carla; Lima, José L. C.; Reis, Salette; Lopes, António; Bastos, Margarida

    2004-01-01

    Isothermal titration calorimetry was used to characterize and quantify the partition of indomethacin and acemetacin between the bulk aqueous phase and the membrane of egg phosphatidylcholine vesicles. Significant electrostatic effects were observed due to binding of the charged drugs to the membrane, which implied the use of the Gouy-Chapman theory to calculate the interfacial concentrations. The binding/partition phenomenon was quantified in terms of the partition coefficient (Kp), and/or the equilibrium constant (Kb). Mathematical expressions were developed, either to encompass the electrostatic effects in the partition model, or to numerically relate partition coefficients and binding constants. Calorimetric titrations conducted under a lipid/drug ratio >100:1 lead to a constant heat release and were used to directly calculate the enthalpy of the process, ΔH, and indirectly, ΔG and ΔS. As the lipid/drug ratio decreased, the constancy of reaction enthalpy was tested in the fitting process. Under low lipid/drug ratio conditions simple partition was no longer valid and the interaction phenomenon was interpreted in terms of binding isotherms. A mathematical expression was deduced for quantification of the binding constants and the number of lipid molecules associated with one drug molecule. The broad range of concentrations used stressed the biphasic nature of the interaction under study. As the lipid/drug ratio was varied, the results showed that the interaction of both drugs does not present a unique behavior in all studied regimes: the extent of the interaction, as well as the binding stoichiometry, is affected by the lipid/drug ratio. The change in these parameters reflects the biphasic behavior of the interaction—possibly the consequence of a modification of the membrane's physical properties as it becomes saturated with the drug. PMID:14747330

  5. In vitro DNA binding studies of Aspartame, an artificial sweetener.

    PubMed

    Kashanian, Soheila; Khodaei, Mohammad Mehdi; Kheirdoosh, Fahimeh

    2013-03-05

    A number of small molecules bind directly and selectively to DNA, by inhibiting replication, transcription or topoisomerase activity. In this work the interaction of native calf thymus DNA (CT-DNA) with Aspartame (APM), an artificial sweeteners was studied at physiological pH. DNA binding study of APM is useful to understand APM-DNA interaction mechanism and to provide guidance for the application and design of new and safer artificial sweeteners. The interaction was investigated using spectrophotometric, spectrofluorometric competition experiment and circular dichroism (CD). Hypochromism and red shift are shown in UV absorption band of APM. A strong fluorescence quenching reaction of DNA to APM was observed and the binding constants (Kf) of DNA with APM and corresponding number of binding sites (n) were calculated at different temperatures. Thermodynamic parameters, enthalpy changes (ΔH) and entropy changes (ΔS) were calculated to be +181kJmol(-1) and +681Jmol(-1)K(-1) according to Van't Hoff equation, which indicated that reaction is predominantly entropically driven. Moreover, spectrofluorometric competition experiment and circular dichroism (CD) results are indicative of non-intercalative DNA binding nature of APM. We suggest that APM interacts with calf thymus DNA via groove binding mode with an intrinsic binding constant of 5×10(+4)M(-1). Copyright © 2013 Elsevier B.V. All rights reserved.

  6. Theoretical study of metal noble-gas positive ions

    NASA Technical Reports Server (NTRS)

    Bauschlicher, Charles W., Jr.; Partridge, Harry; Langhoff, Stephen R.

    1989-01-01

    Theoretical calculations have been performed to determine the spectroscopic constant for the ground and selected low-lying electronic states of the transition-metal noble-gas ions Var(+), FeAr(+), CoAr(+), CuHe(+), CuAr(+), and CuKr(+). Analogous calculations have been performed for the ground states of the alkali noble-gas ions LiAr(+), LiKr(+), NaAr(+), and KAr(+) and the alkaline-earth noble-gas ion MgAr(+) to contrast the difference in binding energies between the simple and transition-metal noble-gas ions. The binding energies increase with increasing polarizability of the noble-gas ions, as expected for a charge-induced dipole bonding mechanism. It is found that the spectroscopic constants of the X 1Sigma(+) states of the alkali noble-gas ions are well described at the self-consistent field level. In contrast, the binding energies of the transition-metal noble-gas ions are substantially increased by electron correlation.

  7. Investigations on the Interactions of 5-Fluorouracil with Herring Sperm DNA: Steady State/Time Resolved and Molecular Modeling Studies

    NASA Astrophysics Data System (ADS)

    Chinnathambi, Shanmugavel; Karthikeyan, Subramani; Velmurugan, Devadasan; Hanagata, Nobutaka; Aruna, Prakasarao; Ganesan, Singaravelu

    2015-04-01

    In the present study, the interaction of 5-Fluorouracil with herring sperm DNA is reported using spectroscopic and molecular modeling techniques. This binding study of 5-FU with hs-DNA is of paramount importance in understanding chemico-biological interactions for drug design, pharmacy and biochemistry without altering the original structure. The challenge of the study was to find the exact binding mode of the drug 5-Fluorouracil with hs-DNA. From the absorption studies, a hyperchromic effect was observed for the herring sperm DNA in the presence of 5-Fluorouracil and a binding constant of 6.153 × 103 M-1 for 5-Fluorouracil reveals the existence of weak interaction between the 5-Fluorouracil and herring sperm DNA. Ethidium bromide loaded herring sperm DNA showed a quenching in the fluorescence intensity after the addition of 5-Fluorouracil. The binding constants for 5-Fluorouracil stranded DNA and competitive bindings of 5-FU interacting with DNA-EB systems were examined by fluorescence spectra. The Stern-Volmer plots and fluorescence lifetime results confirm the static quenching nature of the drug-DNA complex. The binding constant Kb was 2.5 × 104 L mol-1 and the number of binding sites are 1.17. The 5-FU on DNA system was calculated using double logarithmic plot. From the Forster nonradiative energy transfer study it has been found that the distance of 5-FU from DNA was 4.24 nm. In addition to the spectroscopic results, the molecular modeling studies also revealed the major groove binding as well as the partial intercalation mode of binding between the 5-Fluorouracil and herring sperm DNA. The binding energy and major groove binding as -6.04 kcal mol-1 and -6.31 kcal mol-1 were calculated from the modeling studies. All the testimonies manifested that binding modes between 5-Fluorouracil and DNA were evidenced to be groove binding and in partial intercalative mode.

  8. Copper complexes containing thiosemicarbazones derived from 6-nitropiperonal: Antimicrobial and biophysical properties

    NASA Astrophysics Data System (ADS)

    Beckford, Floyd A.; Webb, Kelsey R.

    2017-08-01

    A series of four thiosemicarbazones from 6-nitropiperonal along with the corresponding copper complexes were synthesized. The biophysical characteristics of the complexes were investigated by the binding to DNA and human serum albumin. The binding to DNA is moderate; the binding constants run from (0.49-7.50) × 104 M- 1. In relation to HSA, the complexes interact strongly with binding constants on the order of 105 M- 1. The complexes also display antioxidant behavior as determined by the ability to scavenge diphenylpicrylhydrazyl (dpph) and nitric oxide radicals. The antimicrobial profiles of the compounds, tested against a panel of microbes including five of the ESKAPE pathogens (Staphylococcus aureus, MRSA, Escherichia coli, Klebsiella pneumoniae, MDR, Acinetobacter baumannii, Pseudomonas aeruginosa) and two yeasts (Candida albicans and Cryptococcus neoformans var. grubii), are also described. The compounds contain a core moiety that is similar to oxolinic acid, a quinolone antibiotic that targets DNA gyrase and topoisomerase (IV). The binding interaction between the complexes and these important antibacterial targets were studied by computational methods, chiefly docking studies. The calculated dissociation constants for the interaction with DNA gyrase B (from Staphylococcus aureus) range from 4.32 to 24.65 μM; the binding was much stronger to topoisomerase IV, with dissociation constants ranging from 0.37 to 1.27 μM.

  9. Structure and equilibria of Ca 2+-complexes of glucose and sorbitol from multinuclear ( 1H, 13C and 43Ca) NMR measurements supplemented with molecular modelling calculations

    NASA Astrophysics Data System (ADS)

    Pallagi, A.; Dudás, Cs.; Csendes, Z.; Forgó, P.; Pálinkó, I.; Sipos, P.

    2011-05-01

    Ca 2+-complexation of D-glucose and D-sorbitol have been investigated with the aid of multinuclear ( 1H, 13C and 43Ca) NMR spectroscopy and ab initio quantum chemical calculations. Formation constants of the forming 1:1 complexes have been estimated from one-dimensional 13C NMR spectra obtained at constant ionic strength (1 M NaCl). Binding sites were identified from 2D 1H- 43Ca NMR spectra. 2D NMR measurements and ab initio calculations indicated that Ca 2+ ions were bound in a tridentate manner via the glycosidic OH, the ethereal oxygen in the ring and the OH on the terminal carbon for the α- and β-anomers of glucose and for sorbitol simultaneous binding of four hydroxide moieties (C1, C2, C4 and C6) was suggested.

  10. Mechanism of host-guest complexation by cucurbituril.

    PubMed

    Márquez, César; Hudgins, Robert R; Nau, Werner M

    2004-05-12

    The factors affecting host-guest complexation between the molecular container compound cucurbit[6]uril (CB6) and various guests in aqueous solution are studied, and a detailed complexation mechanism in the presence of cations is derived. The formation of the supramolecular complex is studied in detail for cyclohexylmethylammonium ion as guest. The kinetics and thermodynamics of complexation is monitored by NMR as a function of temperature, salt concentration, and cation size. The binding constants and the ingression rate constants decrease with increasing salt concentration and cation-binding constant, in agreement with a competitive binding of the ammonium site of the guest and the metal cation with the ureido carbonyl portals of CB6. Studies as a function of guest size indicate that the effective container volume of the CB6 cavity is approximately 105 A(3). It is suggested that larger guests are excluded for two reasons: a high activation barrier for ingression imposed by the tight CB6 portals and a destabilization of the complex due to steric repulsion inside. For example, in the case of the nearly spherical azoalkane homologues 2,3-diazabicyclo[2.2.1]hept-2-ene (DBH, volume ca. 96 A(3)) and 2,3-diazabicyclo[2.2.2]oct-2-ene (DBO, volume ca. 110 A(3)), the former forms the CB6 complex promptly with a sizable binding constant (1300 M(-1)), while the latter does not form a complex even after several months at optimized complexation conditions. Molecular mechanics calculations are performed for several CB6/guest complexes. A qualitative agreement is found between experimental and calculated activation energies for ingression as a function of both guest size and state of protonation. The potential role of constrictive binding by CB6 is discussed.

  11. Studies on the interactions of 3,6-diaminoacridine derivatives with human serum albumin by fluorescence spectroscopy.

    PubMed

    Gökoğlu, Elmas; Kıpçak, Fulya; Seferoğlu, Zeynel

    2014-11-01

    This study reports the preparation and investigation of the modes of binding of the two symmetric 3,6-diaminoacridine derivatives obtained from proflavine, which are 3,6-diphenoxycarbonyl aminoacridine and 3,6-diethoxycarbonyl aminoacridine to human serum albumin (HSA). The interaction of HSA with the derivatives was investigated using fluorescence quenching and ultraviolet-visible absorption spectra at pH 7.2 and different temperatures. The results suggest that the derivatives used can interact strongly with HSA and are the formation of HSA-derivative complexes and hydrophobic interactions as the predominant intermolecular forces in stabilizing for each complex. The Stern-Volmer quenching constants, binding constants, binding sites and corresponding thermodynamic parameters ΔH, ΔS and ΔG were calculated at different temperatures. The binding distance (r) ~ 3 nm between the donor (HSA) and acceptors (3,6-diethoxycarbonyl aminoacridine, 3,6-diphenoxycarbonyl aminoacridine and proflavine) was obtained according to Förster's non-radiative energy transfer theory. Moreover, the limit of detection and limit of quantification of derivatives were calculated in the presence of albumin. Copyright © 2014 John Wiley & Sons, Ltd.

  12. Biophysical influence of coumarin 35 on bovine serum albumin: Spectroscopic study

    NASA Astrophysics Data System (ADS)

    Bayraktutan, Tuğba; Onganer, Yavuz

    2017-01-01

    The binding mechanism and protein-fluorescence probe interactions between bovine serum albumin (BSA) and coumarin 35 (C35) was investigated by using UV-Vis absorption and fluorescence spectroscopies since they remain major research topics in biophysics. The spectroscopic data indicated that a fluorescence quenching process for BSA-C35 system was occurred. The fluorescence quenching processes were analyzed using Stern-Volmer method. In this regard, Stern-Volmer quenching constants (KSV) and binding constants were calculated at different temperatures. The distance r between BSA (donor) and C35 (acceptor) was determined by exploiting fluorescence resonance energy transfer (FRET) method. Synchronous fluorescence spectra were also studied to observe information about conformational changes. Moreover, thermodynamics parameters were calculated for better understanding of interactions and conformational changes of the system.

  13. Simultaneous effects of temperature and pressure on the donor binding energy in a V-groove quantum wire

    NASA Astrophysics Data System (ADS)

    Khordad, R.

    2010-03-01

    The influence of temperature and pressure, simultaneously, on the binding energy of a hydrogenic donor impurity in a ridge GaAs/Ga 1- xAl xAs quantum wire is studied using a variational procedure within the effective mass approximation. The subband energy and the binding energy of the donor impurity in its ground state as a function of the wire bend width and impurity location at different temperatures and pressures are calculated. The results show that, when the temperature increases, the donor binding energy decreases for a constant applied pressure for all wire bend widths. Also, the binding energy increases by increasing the pressure for a constant temperature for all wire bend widths. In addition, when the temperature and pressure are applied simultaneously the binding energy decreases as the quantum wire bend width increases. On the whole, it is deduced that the temperature and pressure have important effects on the donor binding energy in a V-groove quantum wire.

  14. Kinetic analysis of cooperative interactions induced by Mn2+ binding to the chloroplast H(+)-ATPase.

    PubMed

    Hiller, R; Carmeli, C

    1990-07-03

    The kinetics of Mn2+ binding to three cooperatively interacting sites in chloroplast H(+)-ATPase (CF1) were measured by EPR following rapid mixing of the enzyme with MnCl2 with a time resolution of 8 ms. Mixing of the enzyme-bound Mn2+ with MgCl2 gave a measure of the rate of exchange. The data could be best fitted to a kinetic model assuming three sequential, positively cooperative binding sites. (1) In the latent CF1, the binding to all three sites had a similar on-rate constants of (1.1 +/- 0.04) X 10(4) M-1s-1. (2) Site segregation was found in the release of ions with off-rate constants of 0.69 +/- 0.04 s-1 for the first two and 0.055 +/- 0.003 s-1 for the third. (3) Addition of one ADP per CF1 caused a decrease in the off-rate constants to 0.31 +/- 0.02 and 0.033 +/- 0.008 s-1 for the first two and the third sites, respectively. (4) Heat activation of CF1 increased the on-rate constant to (4.2 +/- 0.92) X 10(4) M-1s-1 and the off-rate constants of the first two and the third site to 1.34 +/- 0.08 and 0.16 +/- 0.07 s-1, respectively. (5) The calculated thermodynamic dissociation constants were similar to those previously obtained from equilibrium binding studies. These findings were correlated to the rate constants obtained from studies of the catalysis and regulation of the H(+)-ATPase. The data support the suggestion that regulation induces sequential progress of catalysis through the three active sites of the enzyme.

  15. Spectroscopic studies on the interaction of a water-soluble cationic porphyrin with proteins

    NASA Astrophysics Data System (ADS)

    Ma, Hong-Min; Chen, Xin; Zhang, Nuo; Han, Yan-Yan; Wu, Dan; Du, Bin; Wei, Qin

    2009-04-01

    The interaction of a water-soluble cationic porphyrin, meso-tetrakis (4- N, N, N-trimethylanilinium) porphyrin (TMAP), with two proteins, bovine serum albumin (BSA) and human serum albumin (HSA), was studied by UV-vis absorption spectroscopy, fluorescence spectroscopy, fluorescence anisotropy and synchronous fluorescence spectroscopy at neutral aqueous solutions. Free base TMAP bound to proteins as monomers and no aggregation was observed. The binding of TMAP quenched the fluorescence of the protein. On the contrary, the fluorescence of TMAP was enhanced and the fluorescence anisotropy increased due to the binding. The direct static binding mechanism could account for the quenching by TMAP and the binding constants were calculated. TMAP showed a higher quenching efficiency and binding constant of HSA than BSA. The binding of TMAP had no obvious effect on the molecular conformation of the protein. There was only one binding site for TMAP and it was located on the surface of the protein molecule. Electrostatic force played an important role in the binding due to the opposite charges on porphyrin and the proteins.

  16. Spectroscopic studies on the interaction of a water-soluble cationic porphyrin with proteins.

    PubMed

    Ma, Hong-Min; Chen, Xin; Zhang, Nuo; Han, Yan-Yan; Wu, Dan; Du, Bin; Wei, Qin

    2009-04-01

    The interaction of a water-soluble cationic porphyrin, meso-tetrakis (4-N,N,N-trimethylanilinium) porphyrin (TMAP), with two proteins, bovine serum albumin (BSA) and human serum albumin (HSA), was studied by UV-vis absorption spectroscopy, fluorescence spectroscopy, fluorescence anisotropy and synchronous fluorescence spectroscopy at neutral aqueous solutions. Free base TMAP bound to proteins as monomers and no aggregation was observed. The binding of TMAP quenched the fluorescence of the protein. On the contrary, the fluorescence of TMAP was enhanced and the fluorescence anisotropy increased due to the binding. The direct static binding mechanism could account for the quenching by TMAP and the binding constants were calculated. TMAP showed a higher quenching efficiency and binding constant of HSA than BSA. The binding of TMAP had no obvious effect on the molecular conformation of the protein. There was only one binding site for TMAP and it was located on the surface of the protein molecule. Electrostatic force played an important role in the binding due to the opposite charges on porphyrin and the proteins.

  17. All human Na(+)-K(+)-ATPase alpha-subunit isoforms have a similar affinity for cardiac glycosides.

    PubMed

    Wang, J; Velotta, J B; McDonough, A A; Farley, R A

    2001-10-01

    Three alpha-subunit isoforms of the sodium pump, which is the receptor for cardiac glycosides, are expressed in human heart. The aim of this study was to determine whether these isoforms have distinct affinities for the cardiac glycoside ouabain. Equilibrium ouabain binding to membranes from a panel of different human tissues and cell lines derived from human tissues was compared by an F statistic to determine whether a single population of binding sites or two populations of sites with different affinities would better fit the data. For all tissues, the single-site model fit the data as well as the two-site model. The mean equilibrium dissociation constant (K(d)) for all samples calculated using the single-site model was 18 +/- 6 nM (mean +/- SD). No difference in K(d) was found between nonfailing and failing human heart samples, although the maximum number of binding sites in failing heart was only approximately 50% of the number of sites in nonfailing heart. Measurement of association rate constants and dissociation rate constants confirmed that the binding affinities of the different human alpha-isoforms are similar to each other, although calculated K(d) values were lower than those determined by equilibrium binding. These results indicate both that the affinity of all human alpha-subunit isoforms for ouabain is similar and that the increased sensitivity of failing human heart to cardiac glycosides is probably due to a reduction in the number of pumps in the heart rather than to a selective inhibition of a subset of pumps with different affinities for the drugs.

  18. The investigation of the interaction between piracetam and bovine serum albumin by spectroscopic methods

    NASA Astrophysics Data System (ADS)

    Guo, Xingjia; Han, Xiaowei; Tong, Jian; Guo, Chuang; Yang, Wenfeng; Zhu, Jifen; Fu, Bing

    2010-03-01

    The interaction between piracetam (OPA) with bovine serum albumin (BSA) has been thoroughly studied by fluorescence quenching technique in combination with UV-vis absorption, Fourier transform infrared (FT-IR), and circular dichroism (CD) spectroscopies under the simulative physiological conditions. The quenching of BSA fluorescence by OPA was found to be a static quenching process. The binding constants ( K a) are 3.014, 2.926, and 2.503 × 10 3 M -1 at 292, 298, and 309 K, respectively. According to the van't Hoff equation, the thermodynamic functions standard enthalpy (Δ H) and standard entropy (Δ S) for the reaction were calculated to be -74.560 kJ mol -1 and -159.380 J mol -1 K -1, which indicated that OPA binds to BSA mainly by hydrogen bonds and van der Waals interactions. The binding distance between BSA and OPA was calculated to be 4.10 nm according to the theory of FÖrster's non-radiation energy transfer. The displacement experiments confirmed that OPA could bind to the site I of BSA. Furthermore, the effects of pH and some common ions on the binding constant were also examined. And the alterations of protein secondary structure in the presence of OPA were observed by the CD and FT-IR spectra.

  19. Characterization of the binding of metoprolol tartrate and guaifenesin drugs to human serum albumin and human hemoglobin proteins by fluorescence and circular dichroism spectroscopy.

    PubMed

    Duman, Osman; Tunç, Sibel; Kancı Bozoğlan, Bahar

    2013-07-01

    The interactions of metoprolol tartrate (MPT) and guaifenesin (GF) drugs with human serum albumin (HSA) and human hemoglobin (HMG) proteins at pH 7.4 were studied by fluorescence and circular dichroism (CD) spectroscopy. Drugs quenched the fluorescence spectra of HSA and HMG proteins through a static quenching mechanism. For each protein-drug system, the values of Stern-Volmer quenching constant, bimolecular quenching constant, binding constant and number of binding site on the protein molecules were determined at 288.15, 298.15, 310.15 and 318.15 K. It was found that the binding constants of HSA-MPT and HSA-GF systems were smaller than those of HMG-MPT and HMG-GF systems. For both drugs, the affinity of HMG was much higher than that of HSA. An increase in temperature caused a negative effect on the binding reactions. The number of binding site on blood proteins for MPT and GF drugs was approximately one. Thermodynamic parameters showed that MPT interacted with HSA through electrostatic attraction forces. However, hydrogen bonds and van der Waals forces were the main interaction forces in the formation of HSA-GF, HMG-MPT and HMG-GF complexes. The binding processes between protein and drug molecules were exothermic and spontaneous owing to negative ∆H and ∆G values, respectively. The values of binding distance between protein and drug molecules were calculated from Förster resonance energy transfer theory. It was found from CD analysis that the bindings of MPT and GF drugs to HSA and HMG proteins altered the secondary structure of HSA and HMG proteins.

  20. Mobility-based correction for accurate determination of binding constants by capillary electrophoresis-frontal analysis.

    PubMed

    Qian, Cheng; Kovalchik, Kevin A; MacLennan, Matthew S; Huang, Xiaohua; Chen, David D Y

    2017-06-01

    Capillary electrophoresis frontal analysis (CE-FA) can be used to determine binding affinity of molecular interactions. However, its current data processing method mandate specific requirement on the mobilities of the binding pair in order to obtain accurate binding constants. This work shows that significant errors are resulted when the mobilities of the interacting species do not meet these requirements. Therefore, the applicability of CE-FA in many real word applications becomes questionable. An electrophoretic mobility-based correction method is developed in this work based on the flux of each species. A simulation program and a pair of model compounds are used to verify the new equations and evaluate the effectiveness of this method. Ibuprofen and hydroxypropyl-β-cyclodextrinare used to demonstrate the differences in the obtained binding constant by CE-FA when different calculation methods are used, and the results are compared with those obtained by affinity capillary electrophoresis (ACE). The results suggest that CE-FA, with the mobility-based correction method, can be a generally applicable method for a much wider range of applications. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Evidence of bovine serum albumin-viologen herbicide binding interaction and associated structural modifications

    NASA Astrophysics Data System (ADS)

    Roy, Swarup; Saxena, Shailendra K.; Mishra, Suryakant; Yogi, Priyanka; Sagdeo, P. R.; Kumar, Rajesh

    2017-07-01

    The binding ability of viologen herbicide with bovine serum albumin (BSA) has been investigated to understand viologen associated hazards by investigating ethyl viologen's (EV) binding using various spectroscopies and in-silico molecular docking approaches. Apparent association constant (1.3 × 104 L/mol), calculated using UV-Vis spectra indicating a moderate complex formation between BSA and EV. A static mode of fluorescence quenching has been observed as evident from inverse temperature dependence of Stern-Volmer quenching constant which also confirms an EV-BSA complex formation. Emission and time resolved fluorescence studies reveal that the emission quenching of BSA with EV is initiated by static quenching mechanism. A moderately strong binding affinity between EV and BSA has been observed (binding constant value of 7.58 × 104 L/Mol) using fluorescence quenching titration, obtained at 298 K. Quantitative measurements of thermodynamic parameters like enthalpy and entropy changes clearly indicates hydrophobic force responsible for EV-BSA complex formation. The binding distance between EV and BSA was found to be 4.48 nm are involved in non-radiative energy transfer process. Furthermore, from the circular dichroism spectra it was observed that addition of EV is also found to change the secondary structure of BSA which leads to decrease in α-helix. Above mentioned results are found to be in consonance with molecular docking simulations and supports the EV-BSA binding.

  2. Estimation of Hammett sigma constants of substituted benzenes through accurate density-functional calculation of core-electron binding energy shifts

    NASA Astrophysics Data System (ADS)

    Takahata, Yuji; Chong, Delano P.

    For substituted benzenes such as (p-F-C6H4-Z), Linderberg et al. 1 demonstrated the validity of an equation similar to: ΔCEBE ≈ κσ, where ΔCEBE is the difference in core-electron binding energies (CEBEs) of the fluorinated carbon in p-F-C6H4-Z and that in FC6H5, the parameter κ is a function of the type of reaction, and σ is the Hammett substituent (σ) constant. In this work, CEBEs of ring carbon atoms for a series of para disubstituted molecules p-F-C6H4-Z were first calculated using Density Functional Theory (DFT) with the scheme ΔEKS (PW86-PW91)/TZP+Crel//HF/6-31G*. An average absolute deviation of 0.13 eV from experiment was obtained for the CEBEs. Then we performed a linear regression analysis in the form of Y = A+B*X for a plot of Hammett σp constants against calculated shifts ΔCEBEs (in eV) for the fluorinated carbon. The results were: A = -0.08 and B = 1.01, with correlation coefficient R = 0.973, standard deviation = 0.12, and P < 0.0001. The intercept A of the fitted line, close to zero, shows that the Hammett σp constant is proportional to the calculated ΔCEBEs. On the other hand, the slope B of the straight line gives an estimate of the parameter κ. Similar statistical correlations were obtained for the carbon atoms ortho and meta to the substituent Z.

  3. Interaction between Pin1 and its natural product inhibitor epigallocatechin-3-gallate by spectroscopy and molecular dynamics simulations

    NASA Astrophysics Data System (ADS)

    Xi, Lei; Wang, Yu; He, Qing; Zhang, Qingyan; Du, Linfang

    2016-12-01

    The binding of epigallocatechin-3-gallate (EGCG) to wild type Pin1 in solution was studied by spectroscopic methods and molecular dynamics simulations in this research to explore the binding mode and inhibition mechanism. The binding constants and number of binding sites per Pin1 for EGCG were calculated through the Stern-Volmer equation. The values of binding free energy and thermodynamic parameters were calculated and indicated that hydrogen bonds, electrostatic interaction and Van der Waals interaction played the major role in the binding process. The alterations of Pin1 secondary structure in the presence of EGCG were confirmed by far-UV circular dichroism spectra. The binding model at atomic-level revealed that EGCG was bound to the Glu12, Lys13, Arg14, Met15 and Arg17 in WW domain. Furthermore, EGCG could also interact with Arg69, Asp112, Cys113 and Ser114 in PPIase domain.

  4. Trace Metal-Humic Complexes in Natural Waters: Insights From Speciation Experiments

    NASA Astrophysics Data System (ADS)

    Stern, J. C.; Salters, V.; Sonke, J.

    2006-12-01

    The DOM cycle is intimately linked to the cycling and bioavailability of trace metals in aqueous environments. The presence or absence of DOM in the water column can determined whether trace elements will be present in limited quantities as a nutrient, or in surplus quantities as a toxicant. Humic substances (HS), which represent the refractory products of DOM degradation, strongly affect the speciation of trace metals in natural waters. To simulate metal-HS interactions in nature, experiments must be carried out using trace metal concentrations. Sensitive detection systems such as ICP-MS make working with small (nanomolar) concentrations possible. Capillary electrophoresis coupled with ICP-MS (CE-ICP-MS) has recently been identified as a rapid and accurate method to separate metal species and calculate conditional binding constants (log K_c) of metal-humic complexes. CE-ICP-MS was used to measure partitioning of metals between humic substances and a competing ligand (EDTA) and calculate binding constants of rare earth element (REE) and Th, Hf, and Zr-humic complexes at pH 3.5-8 and ionic strength of 0.1. Equilibrium dialysis ligand exchange (EDLE) experiments to validate the CE-ICP-MS method were performed to separate the metal-HS and metal-EDTA species by partitioning due to size exclusion via diffusion through a 1000 Da membrane. CE-ICP-MS experiments were also conducted to compare binding constants of REE with humic substances of various origin, including soil, peat, and aquatic DOM. Results of our experiments show an increase in log K_c with decrease in ionic radius for REE-humic complexes (the lanthanide contraction effect). Conditional binding constants of tetravalent metal-humic complexes were found to be several orders of magnitude higher than REE-humic complexes, indicating that tetravalent metals have a very strong affinity for humic substances. Because thorium is often used as a proxy for the tetravalent actinides, Th-HS binding constants can allow us to assess the importance of tetravalent actinide-humic complexes in groundwater transport from nuclear repositories. Our results suggest that tetravalent actinide-humic complexes couild be more important to account for in predictive speciation models than previously thought.

  5. Mussel-inspired histidine-based transient network metal coordination hydrogels

    PubMed Central

    Fullenkamp, Dominic E.; He, Lihong; Barrett, Devin G.; Burghardt, Wesley R.; Messersmith, Phillip B.

    2013-01-01

    Transient network hydrogels cross-linked through histidine-divalent cation coordination bonds were studied by conventional rheologic methods using histidine-modified star poly(ethylene glycol) (PEG) polymers. These materials were inspired by the mussel, which is thought to use histidine-metal coordination bonds to impart self-healing properties in the mussel byssal thread. Hydrogel viscoelastic mechanical properties were studied as a function of metal, pH, concentration, and ionic strength. The equilibrium metal-binding constants were determined by dilute solution potentiometric titration of monofunctional histidine-modified methoxy-PEG and were found to be consistent with binding constants of small molecule analogs previously studied. pH-dependent speciation curves were then calculated using the equilibrium constants determined by potentiometric titration, providing insight into the pH dependence of histidine-metal ion coordination and guiding the design of metal coordination hydrogels. Gel relaxation dynamics were found to be uncorrelated with the equilibrium constants measured, but were correlated to the expected coordination bond dissociation rate constants. PMID:23441102

  6. Determination of the parameters of binding between lipopolysaccharide and chitosan and its N-acetylated derivative using a gravimetric piezoquartz biosensor.

    PubMed

    Naberezhnykh, G A; Gorbach, V I; Kalmykova, E N; Solov'eva, T F

    2015-03-01

    The interaction of endotoxin (lipopolysaccharide - LPS) with low molecular weight chitosan (5.5 kDa), its N-acylated derivative and chitoliposomes was studied using a gravimetric piezoelectric quartz crystal microbalance biosensor. The optimal conditions for the formation of a biolayer based on immobilized LPS on the resonator surface and its regeneration were elaborated. The association and dissociation rate constants for LPS binding to chitosans were determined and the affinity constants (Kaf) were calculated based on the data on changes in the oscillation frequency of the quartz crystal resonator. The Kaf values correlated with the ones obtained using other methods. The affinity of N-acylated chitosan binding to LPS was higher than that of the parent chitosan binding to LPS. Based on the results obtained, we suggest that water-soluble N-acylated derivatives of chitosan with low degree of substitution of amino groups could be useful compounds for endotoxin binding and neutralization. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. Interaction of new kinase inhibitors cabozantinib and tofacitinib with human serum alpha-1 acid glycoprotein. A comprehensive spectroscopic and molecular Docking approach

    NASA Astrophysics Data System (ADS)

    Ajmal, Mohammad Rehan; Abdelhameed, Ali Saber; Alam, Parvez; Khan, Rizwan Hasan

    2016-04-01

    In the current study we have investigated the interaction of newly approved kinase inhibitors namely Cabozantinib (CBZ) and Tofacitinib (TFB) with human Alpha-1 acid glycoprotein (AAG) under simulated physiological conditions using fluorescence quenching measurements, circular dichroism, dynamic light scattering and molecular docking methods. CBZ and TFB binds to AAG with significant affinity and the calculated binding constant for the drugs lie in the order of 104. With the increase in temperature the binding constant values decreased for both CBZ and TFB. The fluorescence resonance energy transfer (FRET) from AAG to CBZ and TFB suggested the fluorescence intensity of AAG was quenched by the two studied drugs via the formation of a non-fluorescent complex in the static manner. The molecular distance r value calculated from FRET is around 2 nm for both drugs, fluorescence spectroscopy data was employed for the study of thermodynamic parameters, standard Gibbs free energy change at 300K was calculated as - 5.234 kcal mol- 1 for CBZ-AAG interaction and - 6.237 kcal mol- 1 for TFB-AAG interaction, standard enthalpy change and standard entropy change for CBZ-AAG interaction are - 9.553 kcal mol- 1 and - 14.618 cal mol- 1K- 1 respectively while for AAG-TFB interaction, standard enthalpy and standard entropy change was calculated as 4.019 kcal mol- 1 and 7.206 cal mol- 1K- 1 respectively. Protein binding of the two drugs caused the tertiary structure alterations. Dynamic light scattering measurements demonstrated the reduction in the hydrodynamic radii of the protein. Furthermore molecular docking results suggested the Hydrophobic interaction and hydrogen bonding were the interactive forces in the binding process of CBZ to AAG while in case of TFB only hydrophobic interactions were found to be involved, overlap of the binding site for two studied drugs on the AAG molecule was revealed by docking results.

  8. Ionised concentrations in calcium and magnesium buffers: Standards and precise measurement are mandatory.

    PubMed

    McGuigan, John A S; Kay, James W; Elder, Hugh Y

    2016-09-01

    In Ca(2+) and Mg(2+) buffer solutions the ionised concentrations ([X(2+)]) are either calculated or measured. Calculated values vary by up to a factor of seven due to the following four problems: 1) There is no agreement amongst the tabulated constants in the literature. These constants have usually to be corrected for ionic strength and temperature. 2) The ionic strength correction entails the calculation of the single ion activity coefficient, which involves non-thermodynamic assumptions; the data for temperature correction is not always available. 3) Measured pH is in terms of activity i.e. pHa. pHa measurements are complicated by the change in the liquid junction potentials at the reference electrode making an accurate conversion from H(+) activity to H(+) concentration uncertain. 4) Ligands such as EGTA bind water and are not 100% pure. Ligand purity has to be measured, even when the [X(2+)] are calculated. The calculated [X(2+)] in buffers are so inconsistent that calculation is not an option. Until standards are available, the [X(2+)] in the buffers must be measured. The Ligand Optimisation Method is an accurate and independently verified method of doing this (McGuigan & Stumpff, Anal. Biochem. 436, 29, 2013). Lack of standards means it is not possible to compare the published [Ca(2+)] in the nmolar range, and the apparent constant (K(/)) values for Ca(2+) and Mg(2+) binding to intracellular ligands amongst different laboratories. Standardisation of Ca(2+)/Mg(2+) buffers is now essential. The parameters to achieve this are proposed. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. BDflex: A method for efficient treatment of molecular flexibility in calculating protein-ligand binding rate constants from Brownian dynamics simulations

    PubMed Central

    Greives, Nicholas; Zhou, Huan-Xiang

    2012-01-01

    A method developed by Northrup [J. Chem. Phys. 80, 1517 (1984)]10.1063/1.446900 for calculating protein-ligand binding rate constants (ka) from Brownian dynamics (BD) simulations has been widely used for rigid molecules. Application to flexible molecules is limited by the formidable computational cost to treat conformational fluctuations during the long BD simulations necessary for ka calculation. Here, we propose a new method called BDflex for ka calculation that circumvents this problem. The basic idea is to separate the whole space into an outer region and an inner region, and formulate ka as the product of kE and \\documentclass[12pt]{minimal} \\usepackage{amsmath} \\usepackage{wasysym} \\usepackage{amsfonts} \\usepackage{amssymb} \\usepackage{amsbsy} \\usepackage{upgreek} \\usepackage{mathrsfs} \\setlength{\\oddsidemargin}{-69pt} \\begin{document} \\begin{equation*}\\bar \\eta _{\\rm d}\\end{equation*} \\end{document}η¯d, which are obtained by separately solving exterior and interior problems. kE is the diffusion-controlled rate constant for the ligand in the outer region to reach the dividing surface between the outer and inner regions; in this exterior problem conformational fluctuations can be neglected. \\documentclass[12pt]{minimal} \\usepackage{amsmath} \\usepackage{wasysym} \\usepackage{amsfonts} \\usepackage{amssymb} \\usepackage{amsbsy} \\usepackage{upgreek} \\usepackage{mathrsfs} \\setlength{\\oddsidemargin}{-69pt} \\begin{document} \\begin{equation*}\\bar \\eta _{\\rm d}\\end{equation*} \\end{document}η¯d is the probability that the ligand, starting from the dividing surface, will react at the binding site rather than escape to infinity. The crucial step in reducing the determination of \\documentclass[12pt]{minimal} \\usepackage{amsmath} \\usepackage{wasysym} \\usepackage{amsfonts} \\usepackage{amssymb} \\usepackage{amsbsy} \\usepackage{upgreek} \\usepackage{mathrsfs} \\setlength{\\oddsidemargin}{-69pt} \\begin{document} \\begin{equation*}\\bar \\eta _{\\rm d}\\end{equation*} \\end{document}η¯d to a problem confined to the inner region is a radiation boundary condition imposed on the dividing surface; the reactivity on this boundary is proportional to kE. By confining the ligand to the inner region and imposing the radiation boundary condition, we avoid multiple-crossing of the dividing surface before reaction at the binding site and hence dramatically cut down the total simulation time, making the treatment of conformational fluctuations affordable. BDflex is expected to have wide applications in problems where conformational fluctuations of the molecules are crucial for productive ligand binding, such as in cases where transient widening of a bottleneck allows the ligand to access the binding pocket, or the binding site is properly formed only after ligand entrance induces the closure of a lid. PMID:23039617

  10. Evaluation of DNA, BSA binding, and antimicrobial activity of new synthesized neodymium complex containing 29-dimethyl 110-phenanthroline.

    PubMed

    Moradi, Zohreh; Khorasani-Motlagh, Mozhgan; Rezvani, Ali Reza; Noroozifar, Meissam

    2018-02-01

    In order to evaluate biological potential of a novel synthesized complex [Nd(dmp) 2 Cl 3 .OH 2 ] where dmp is 29-dimethyl 110-phenanthroline, the DNA-binding, cleavage, BSA binding, and antimicrobial activity properties of the complex are investigated by multispectroscopic techniques study in physiological buffer (pH 7.2).The intrinsic binding constant (K b ) for interaction of Nd(III) complex and FS-DNA is calculated by UV-Vis (K b  = 2.7 ± 0.07 × 10 5 ) and fluorescence spectroscopy (K b  = 1.13 ± 0.03 × 10 5 ). The Stern-Volmer constant (K SV ), thermodynamic parameters including free energy change (ΔG°), enthalpy change (∆H°), and entropy change (∆S°), are calculated by fluorescent data and Vant' Hoff equation. The experimental results show that the complex can bind to FS-DNA and the major binding mode is groove binding. Meanwhile, the interaction of Nd(III) complex with protein, bovine serum albumin (BSA), has also been studied by using absorption and emission spectroscopic tools. The experimental results show that the complex exhibits good binding propensity to BSA. The positive ΔH° and ∆S° values indicate that the hydrophobic interaction is main force in the binding of the Nd(III) complex to BSA, and the complex can quench the intrinsic fluorescence of BSA remarkably through a static quenching process. Also, DNA cleavage was investigated by agarose gel electrophoresis that according to the results cleavage of DNA increased with increasing of concentration of the complex. Antimicrobial screening test gives good results in the presence of Nd(III) complex system.

  11. Binding behaviors of greenly synthesized silver nanoparticles - Lysozyme interaction: Spectroscopic approach

    NASA Astrophysics Data System (ADS)

    Roy, Swarup

    2018-02-01

    Interaction of greenly synthesized silver nanoparticles (SNP) and lysozyme (Lys) has been studied using spectroscopy. From UV-Vis study it is observed that a moderate association constant (Kapp) of 5.36 × 104 L/mol giving an indication of interaction. Fluorescence emission and time resolved study, confirm static mode of quenching phenomena and the binding constant (Kb) was 25.12, 3.98 and 1.99 × 103 L/mol at 298, 305 and 312 K respectively and the number of binding sites (n) was found to be ∼1. Using temperature dependent fluorimetric data, thermodynamic parameters calculated (Enthalpy change, ΔH = -143.95 kJ/mol, Entropy change, ΔS = -400.32 J/mol/K, Gibbs free energy change, ΔG = -24.66 kJ/mol at 298 K) and resulting insight indicative of weak force (van der Walls interaction & H-bonding) as key feature for the Lys-SNP interaction. By following Förster's non-radiative energy transfer (FRET) theory, average binding distance (r = 3.05 nm) was calculated and observed that nonradiative type energy transfer between SNP and Lys. What is more, circular dichroism (CD) spectra indicates presence of SNP does not display substantial alteration in the secondary structure of Lys. Hence, this results may be very useful for the well thought of essential aspects of binding between the Lys and SNP.

  12. Quantifying Na(I)-insulin and K(I)-insulin non-covalent complexes by ESI-MS method and calculation of their equilibrium constants.

    PubMed

    Gülfen, Mustafa; Özdemir, Abdil; Lin, Jung-Lee; Chen, Chung-Hsuan

    2017-10-01

    In this study, the dissociation and formation equilibrium constants of Na(I)-insulin and K(I)-insulin complexes have been calculated after the quantifying them on ESI mass spectrometer. The ESI-MS spectra of the complexes were measured by using the solvents as 50% MeOH in water and 100% water. The effect of pH on the Na(I)-insulin and K(I)-insulin complex formation were examined. Serial binding of Na(I) and K(I) ions to the insulin molecule were observed in the ESI-MS measurements. The first formation equilibrium constants were calculated as K f1 : 5.48×10 3 1/M for Na(I)-insulin complex and K f1 : 4.87×10 3 1/M for K(I)-insulin in water. The binding capability of Na(I) ions to insulin molecule is higher than the capability of K(I) ions. In case of a comparison together with Ca(II)-insulin and Mg(II)-insulin, the formation equilibrium constants (K f1 ) are in order of Ca(II)-insulin>Mg(II)-insulin>Na(I)-insulin>K(I)-insulin in water. The results showed that Na(I) and K(I) ions are involved in the formation of the non-covalent complexes with insulin molecule, since high extracellular and intracellular concentrations of them in the body. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Characterization of the Interaction between Gallic Acid and Lysozyme by Molecular Dynamics Simulation and Optical Spectroscopy

    PubMed Central

    Zhan, Minzhong; Guo, Ming; Jiang, Yanke; Wang, Xiaomeng

    2015-01-01

    The binding interaction between gallic acid (GA) and lysozyme (LYS) was investigated and compared by molecular dynamics (MD) simulation and spectral techniques. The results from spectroscopy indicate that GA binds to LYS to generate a static complex. The binding constants and thermodynamic parameters were calculated. MD simulation revealed that the main driving forces for GA binding to LYS are hydrogen bonding and hydrophobic interactions. The root-mean-square deviation verified that GA and LYS bind to form a stable complex, while the root-mean-square fluctuation results showed that the stability of the GA-LYS complex at 298 K was higher than that at 310 K. The calculated free binding energies from the molecular mechanics/Poisson-Boltzmann surface area method showed that van der Waals forces and electrostatic interactions are the predominant intermolecular forces. The MD simulation was consistent with the spectral experiments. This study provides a reference for future study of the pharmacological mechanism of GA. PMID:26140374

  14. Characterization of the Interaction between Gallic Acid and Lysozyme by Molecular Dynamics Simulation and Optical Spectroscopy.

    PubMed

    Zhan, Minzhong; Guo, Ming; Jiang, Yanke; Wang, Xiaomeng

    2015-07-01

    The binding interaction between gallic acid (GA) and lysozyme (LYS) was investigated and compared by molecular dynamics (MD) simulation and spectral techniques. The results from spectroscopy indicate that GA binds to LYS to generate a static complex. The binding constants and thermodynamic parameters were calculated. MD simulation revealed that the main driving forces for GA binding to LYS are hydrogen bonding and hydrophobic interactions. The root-mean-square deviation verified that GA and LYS bind to form a stable complex, while the root-mean-square fluctuation results showed that the stability of the GA-LYS complex at 298 K was higher than that at 310 K. The calculated free binding energies from the molecular mechanics/Poisson-Boltzmann surface area method showed that van der Waals forces and electrostatic interactions are the predominant intermolecular forces. The MD simulation was consistent with the spectral experiments. This study provides a reference for future study of the pharmacological mechanism of GA.

  15. Spectrophotometric and molecular modelling studies on in vitro interaction of tyrosine kinase inhibitor linifanib with bovine serum albumin.

    PubMed

    Wani, Tanveer A; Bakheit, Ahmed H; Zargar, Seema; Hamidaddin, Mohammed A; Darwish, Ibrahim A

    2017-01-01

    Linifanib (LNF) possess antitumor activity and acts by inhibiting receptor tyrosine kinase VEGF and PDGF. The interaction of BSA with the drug can provide valuable information regarding the pharmacokinetic and pharmacodynamics behavior of drug. In our study the spectrophotometric methods and molecular docking studies were executed to understand the interaction behavior of BSA and LNF. BSA has an intrinsic fluorescence and that fluorescence was quenched by LNF. This quenching process was studied at three different temperatures of 288, 300and 308 K. The interaction between LNF and BSA was due to static quenching because the Ksv (Stern-Volmer constant) at 288 K was higher than at 300 and 308 K. Kq (quenching rate constant) behaved in a similar fashion as the Ksv. Several other parameters like binding constants, number of binding sites and binding energy in addition to molecular docking studies were also used to evaluate the interaction process. A decrease in the binding constants was observed with increasing temperatures and the binding site number approximated unity. The decreasing binding constant indicates LNF-BSA complex stability. The site mark competition experiment confirmed the binding site for LNF was located on site II of BSA. UV-visible studies along with synchronous fluorescence confirm a small change in the conformation of BSA upon interaction with LNF. The thermodynamic analysis provided the values for free energy ΔG0, ΔH0 and ΔS0. The ΔG0 at the 288, 300 and 308 K ranged in between -21.5 to -23.3 kJ mol-1, whereas the calculated values of ΔH (-55.91 kJ mol-1) and ΔS0 (-111.74 J mol-1·K-1). The experimental and molecular docking results suggest that the interaction between LNF and BSA was spontaneous and they exhibited hydrogen bonding and van der Waals force between them.

  16. Protocols Utilizing Constant pH Molecular Dynamics to Compute pH-Dependent Binding Free Energies

    PubMed Central

    2015-01-01

    In protein–ligand binding, the electrostatic environments of the two binding partners may vary significantly in bound and unbound states, which may lead to protonation changes upon binding. In cases where ligand binding results in a net uptake or release of protons, the free energy of binding is pH-dependent. Nevertheless, conventional free energy calculations and molecular docking protocols typically do not rigorously account for changes in protonation that may occur upon ligand binding. To address these shortcomings, we present a simple methodology based on Wyman’s binding polynomial formalism to account for the pH dependence of binding free energies and demonstrate its use on cucurbit[7]uril (CB[7]) host–guest systems. Using constant pH molecular dynamics and a reference binding free energy that is taken either from experiment or from thermodynamic integration computations, the pH-dependent binding free energy is determined. This computational protocol accurately captures the large pKa shifts observed experimentally upon CB[7]:guest association and reproduces experimental binding free energies at different levels of pH. We show that incorrect assignment of fixed protonation states in free energy computations can give errors of >2 kcal/mol in these host–guest systems. Use of the methods presented here avoids such errors, thus suggesting their utility in computing proton-linked binding free energies for protein–ligand complexes. PMID:25134690

  17. Exploring interaction of TNF and orthopoxviral CrmB protein by surface plasmon resonance and free energy calculation.

    PubMed

    Ivanisenko, Nikita V; Tregubchak, Tatiana V; Saik, Olga V; Ivanisenko, Vladimir A; Shchelkunov, Sergei N

    2014-01-01

    Inhibition of the activity of the tumor necrosis factor (TNF) has become the main strategy for treating inflammatory diseases. The orthopoxvirus TNF-binding proteins can bind and efficiently neutralize TNF. To analyze the mechanisms of the interaction between human (hTNF) or mouse (mTNF) TNF and the cowpox virus N-terminal binding domain (TNFBD-CPXV), also the variola virus N-terminal binding domain (TNFBD-VARV) and to define the amino acids most importantly involved in the formation of complexes, computer models, derived from the X-ray structure of a homologous hTNF/TNFRII complex, were used together with experiments. The hTNF/TNFBD-CPXV, hTNF/TNFBD-VARV, mTNF/TNFBD-CPXV, and mTNF/TNFBD-VARV complexes were used in the molecular dynamics (MD) simulations and MM/GBSA free energy calculations. The complexes were ordered as hTNF/TNFBD-CPXV, hTNF/TNFBD-VARV, mTNF/TNFBD-CPXV and mTNF/TNFBD-VARV according to increase in the binding affinity. The calculations were in agreement with surface plasmon resonance (SPR) measurements of the binding constants. Key residues involved in complex formation were identified.

  18. Critical evaluation of methods to incorporate entropy loss upon binding in high-throughput docking.

    PubMed

    Salaniwal, Sumeet; Manas, Eric S; Alvarez, Juan C; Unwalla, Rayomand J

    2007-02-01

    Proper accounting of the positional/orientational/conformational entropy loss associated with protein-ligand binding is important to obtain reliable predictions of binding affinity. Herein, we critically examine two simplified statistical mechanics-based approaches, namely a constant penalty per rotor method, and a more rigorous method, referred to here as the partition function-based scoring (PFS) method, to account for such entropy losses in high-throughput docking calculations. Our results on the estrogen receptor beta and dihydrofolate reductase proteins demonstrate that, while the constant penalty method over-penalizes molecules for their conformational flexibility, the PFS method behaves in a more "DeltaG-like" manner by penalizing different rotors differently depending on their residual entropy in the bound state. Furthermore, in contrast to no entropic penalty or the constant penalty approximation, the PFS method does not exhibit any bias towards either rigid or flexible molecules in the hit list. Preliminary enrichment studies using a lead-like random molecular database suggest that an accurate representation of the "true" energy landscape of the protein-ligand complex is critical for reliable predictions of relative binding affinities by the PFS method. Copyright 2006 Wiley-Liss, Inc.

  19. Synthesis of a zinc(II) complex with hexadentate N4S2 donor thioether ligand: X-ray structure, DNA binding study and DFT computation

    NASA Astrophysics Data System (ADS)

    Mondal, Apurba Sau; Jana, Mahendra Sekhar; Manna, Chandan Kumar; Naskar, Rahul; Mondal, Tapan Kumar

    2018-07-01

    A new zinc(II) complex, [Zn(L)](ClO4) with hexadentate N4S2 donor azo-thioether ligand (HL) was synthesized and characterized by several spectroscopic techniques. The structure was confirmed by single crystal X-ray analysis. The interaction of the complex with CT DNA was investigated by UV-vis method and binding constant is found to be 6.6 × 104 M-1. Competitive binding titration with ethidium bromide (EB) by fluorescence titration method reveals that the complex efficiently displaces EB from EB-DNA system and the Stern-Volmer dynamic quenching constant, Ksv is found to be 2.6 × 104 M-1. DFT and TDDFT calculations were carried out to interpret the electronic structure and electronic spectra of the complex.

  20. Pressure-induced increase of exciton-LO-phonon coupling in a ZnCdSe/ZnSe quantum well

    NASA Astrophysics Data System (ADS)

    Guo, Z. Z.; Liang, X. X.; Ban, S. L.

    2003-07-01

    The possibility of pressure-induced increase of exciton-LO-phonon coupling in ZnCdSe/ZnSe quantum wells is studied. The ground state binding energies of the heavy hole excitons are calculated using a variational method with consideration of the electron-phonon interaction and the pressure dependence of the parameters. The results show that for quantum wells with intermediate well width, the exciton binding energy and the LO-phonon energy may coincide in the course of pressure increasing, resulting in the increase of exciton-LO-phonon coupling. It is also found that among the pressure-dependent parameters, the influence of the lattice constant is the most important one. The changes of both the effective masses and the dielectric constants have obvious effects on the exciton binding energy, but their influences are counterbalanced.

  1. Photochemical and DFT studies on DNA-binding ability and antibacterial activity of lanthanum(III)-phenanthroline complex

    NASA Astrophysics Data System (ADS)

    Niroomand, Sona; Khorasani-Motlagh, Mozhgan; Noroozifar, Meissam; Jahani, Shohreh; Moodi, Asieh

    2017-02-01

    The binding of the lanthanum(III) complex containing 1,10-phenanthroline (phen), [La(phen)3Cl3·OH2], to DNA is investigated by absorption and emission methods. This complex shows absorption decreasing in a charge transfer band, and fluorescence decrement when it binds to DNA. Electronic absorption spectroscopy (UV-Vis), fluorescence spectra, iodide quenching experiments, salt effect and viscosity measurements, ethidium bromide (EB) competition test, circular dichroism (CD) spectra as well as variable temperature experiments indicate that the La(III) complex binds to fish salmon (FS) DNA, presumably via groove binding mode. The binding constants (Kb) of the La(III) complex with DNA is (2.55 ± 0.02) × 106 M-1. Furthermore, the binding site size, n, the Stern-Volmer constant KSV and thermodynamic parameters; enthalpy change (ΔH0) and entropy change (ΔS0) and Gibb's free energy (ΔG0), are calculated according to relevant fluorescent data and the Van't Hoff equation. The La(III) complex has been screened for its antibacterial activities by the disc diffusion method. Also, in order to supplement the experimental findings, DFT computation and NBO analysis are carried out.

  2. Thermodynamic linkage between the binding of protons and inhibitors to HIV-1 protease.

    PubMed Central

    Trylska, J.; Antosiewicz, J.; Geller, M.; Hodge, C. N.; Klabe, R. M.; Head, M. S.; Gilson, M. K.

    1999-01-01

    The aspartyl dyad of free HIV-1 protease has apparent pK(a)s of approximately 3 and approximately 6, but recent NMR studies indicate that the aspartyl dyad is fixed in the doubly protonated form over a wide pH range when cyclic urea inhibitors are bound, and in the monoprotonated form when the inhibitor KNI-272 is bound. We present computations and measurements related to these changes in protonation and to the thermodynamic linkage between protonation and inhibition. The Poisson-Boltzmann model of electrostatics is used to compute the apparent pK(a)s of the aspartyl dyad in the free enzyme and in complexes with four different inhibitors. The calculations are done with two parameter sets. One assigns epsilon = 4 to the solute interior and uses a detailed model of ionization; the other uses epsilon = 20 for the solute interior and a simplified representation of ionization. For the free enzyme, both parameter sets agree well with previously measured apparent pK(a)s of approximately 3 and approximately 6. However, the calculations with an internal dielectric constant of 4 reproduce the large pKa shifts upon binding of inhibitors, but the calculations with an internal dielectric constant of 20 do not. This observation has implications for the accurate calculation of pK(a)s in complex protein environments. Because binding of a cyclic urea inhibitor shifts the pK(a)s of the aspartyl dyad, changing the pH is expected to change its apparent binding affinity. However, we find experimentally that the affinity is independent of pH from 5.5 to 7.0. Possible explanations for this discrepancy are discussed. PMID:10210196

  3. Evaluation of the binding interaction between bovine serum albumin and dimethyl fumarate, an anti-inflammatory drug by multispectroscopic methods

    NASA Astrophysics Data System (ADS)

    Jattinagoudar, Laxmi; Meti, Manjunath; Nandibewoor, Sharanappa; Chimatadar, Shivamurti

    2016-03-01

    The information of the quenching reaction of bovine serum albumin with dimethyl fumarate is obtained by multi-spectroscopic methods. The number of binding sites, n and binding constants, KA were determined at different temperatures. The effect of increasing temperature on Stern-Volmer quenching constants (KD) indicates that a dynamic quenching mechanism is involved in the interaction. The analysis of thermodynamic quantities namely, ∆H° and ∆S° suggested hydrophobic forces playing a major role in the interaction between dimethyl fumarate and bovine serum albumin. The binding site of dimethyl fumarate on bovine serum albumin was determined by displacement studies, using the site probes viz., warfarin, ibuprofen and digitoxin. The determination of magnitude of the distance of approach for molecular interactions between dimethyl fumarate and bovine serum albumin is calculated according to the theory of Förster energy transfer. The CD, 3D fluorescence spectra, synchronous fluorescence measurements and FT-IR spectral results were indicative of the change in secondary structure of the protein. The influence of some of the metal ions on the binding interaction was also studied.

  4. Theory of long binding events in single-molecule–controlled rotation experiments on F1-ATPase

    PubMed Central

    Volkán-Kacsó, Sándor; Marcus, Rudolph A.

    2017-01-01

    The theory of elastic group transfer for the binding and release rate constants for nucleotides in F1-ATPase as a function of the rotor angle is further extended in several respects. (i) A method is described for predicting the experimentally observed lifetime distribution of long binding events in the controlled rotation experiments by taking into account the hydrolysis and synthesis reactions occurring during these events. (ii) A method is also given for treating the long binding events in the experiments and obtaining the rate constants for the hydrolysis and synthesis reactions occurring during these events. (iii) The theory in the previous paper is given in a symmetric form, an extension that simplifies the application of the theory to experiments. It also includes a theory-based correction of the reported “on” and “off” rates by calculating the missed events. A near symmetry of the data about the angle of −40° and a “turnover” in the binding rate data vs. rotor angle for angles greater than ∼40° is also discussed. PMID:28652332

  5. Modified high-affinity binding of Ni2+, Ca2+ and Zn2+ to natural mutants of human serum albumin and proalbumin.

    PubMed

    Kragh-Hansen, U; Brennan, S O; Minchiotti, L; Galliano, M

    1994-07-01

    High-affinity binding of radioactive Ni2+, Ca2+ and Zn2+ to six genetic albumin variants and to normal albumin isolated from the same heterozygote carriers was studied by equilibrium dialysis at pH 7.4. The three cations bind differently to albumin. Ni2+ binds to a site in the N-terminal region of the protein which is partially blocked by the presence of a propeptide as in proalbumin (proAlb) Varese (Arg-2-->His), proAlb Christchurch (Arg-1-->Gln) and proAlb Blenheim (Asp1-->Val) and by the presence of only an extra Arg residue (Arg-1) as in Arg-Alb and albumin (Alb) Redhill. The association constants are decreased by more than one order of magnitude in these cases, suggesting biological consequences for the ligand. The additional structural changes in Alb Redhill have no effect on Ni2+ binding. Finally, the modification of Alb Blenheim (Asp1-->Val) reduces the binding constant to 50%. Ca2+ binding is decreased to about 60-80% by the presence of a propeptide and the mutation Asp1-->Val. Arg-1 alone does not affect binding, whereas Alb Redhill binds Ca2+ more strongly than the normal protein (125%). In contrast with binding of Ni2+ and Ca2+, albumin shows heterogeneity with regard to binding of Zn2+, i.e. the number of high-affinity sites was calculated to be, on average, 0.43. The binding constant for Zn2+ is increased to 125% in the case of proAlb Varese, decreased to 50-60% for proAlb Christchurch and Alb Redhill but is normal for proAlb Blenheim, Alb Blenheim and Arg-Alb. The effects of the mutations on binding of Ca2+ and Zn2+ indicate that primary binding, when operative, is to as yet unidentified sites in domain I of the albumin molecule.

  6. The investigation of the interaction between NCP-EDA and bovine serum albumin by spectroscopic approaches

    NASA Astrophysics Data System (ADS)

    Yu, Xianyong; Lu, Shiyu; Yang, Ying; Li, Xiaofang; Yi, Pinggui

    2011-12-01

    The fluorescence and ultraviolet spectroscopies were explored to study the interaction between N-confused porphyrins-edaravone diad (NCP-EDA) and bovine serum albumin (BSA) under simulative physiological condition at different temperatures. The experimental results show that the fluorescence quenching mechanism between NCP-EDA and BSA is a combined quenching (dynamic and static quenching). The binding constants, binding sites and the corresponding thermodynamic parameters (Δ G, Δ H, and Δ S) of the interaction system were calculated at different temperatures. According to Förster non-radiation energy transfer theory, the binding distance between NCP-EDA and BSA was calculated to be 3.63 nm. In addition, the effect of NCP-EDA on the conformation of BSA was analyzed using synchronous fluorescence spectroscopy.

  7. Peroxidative oxidation of halides catalysed by myeloperoxidase. Effect of fluoride on halide oxidation.

    PubMed

    Zgliczyński, J M; Stelmaszyńska, T; Olszowska, E; Krawczyk, A; Kwasnowska, E; Wróbel, J T

    1983-01-01

    It was found that all halides can compete with cyanide for binding with myeloperoxidase. The lower is the pH, the higher is the affinity of halides. The apparent dissociation constants (Kd) of myeloperoxidase-cyanide complex were determined in the presence of F-, Cl-, Br- and I- in the pH range of 4 to 7. In slightly acidic pH (4 - 6) fluoride and chloride exhibit a higher affinity towards the enzyme than bromide and iodide. Taking into account competition between cyanide and halides for binding with myeloperoxidase the dissociation constants of halide-myeloperoxidase complexes were calculated. All halides except fluoride can be oxidized by H2O2 in the presence of myeloperoxidase. However, since fluoride can bind with myeloperoxidase, it can competitively inhibit the oxidation of other halides. Fluoride was a competitive inhibitor with respect to other halides as well as to H2O2. Inhibition constants (Ki) for fluoride as a competitive inhibitor with respect to H2O2 increased from iodide oxidation through bromide to chloride oxidation.

  8. Interaction between a cationic porphyrin and ctDNA investigated by SPR, CV and UV-vis spectroscopy.

    PubMed

    Xu, Zi-Qiang; Zhou, Bo; Jiang, Feng-Lei; Dai, Jie; Liu, Yi

    2013-10-01

    The interaction between ctDNA and a cationic porphyrin was studied in this work. The binding process was monitored by surface plasmon resonance (SPR) spectroscopy in detail. The association, dissociation rate constants and the binding constants calculated by global analysis were 2.4×10(2)±26.4M(-1)s(-1), 0.011±0.0000056s(-1) and 2.18×10(4)M(-1), respectively. And the results were confirmed by cyclic voltammetry and UV-vis absorption spectroscopy. The binding constants obtained from cyclic voltammetry and UV-vis absorption spectroscopy were 8.28×10(4)M(-1) and 6.73×10(4)M(-1) at 298K, respectively. The covalent immobilization methodology of ctDNA onto gold surface modified with three different compounds was also investigated by SPR. These compounds all contain sulfydryl but with different terminated functional groups. The results indicated that the 11-MUA (HS(CH2)10COOH)-modified gold film is more suitable for studying the DNA-drug interaction. Copyright © 2013 Elsevier B.V. All rights reserved.

  9. Rationalizing 5000-Fold Differences in Receptor-Binding Rate Constants of Four Cytokines

    PubMed Central

    Pang, Xiaodong; Qin, Sanbo; Zhou, Huan-Xiang

    2011-01-01

    The four cytokines erythropoietin (EPO), interleukin-4 (IL4), human growth hormone (hGH), and prolactin (PRL) all form four-helix bundles and bind to type I cytokine receptors. However, their receptor-binding rate constants span a 5000-fold range. Here, we quantitatively rationalize these vast differences in rate constants by our transient-complex theory for protein-protein association. In the transient complex, the two proteins have near-native separation and relative orientation, but have yet to form the short-range specific interactions of the native complex. The theory predicts the association rate constant as ka=ka0exp(−ΔGel∗/kBT) where ka0 is the basal rate constant for reaching the transient complex by random diffusion, and the Boltzmann factor captures the rate enhancement due to electrostatic attraction. We found that the vast differences in receptor-binding rate constants of the four cytokines arise mostly from the differences in charge complementarity among the four cytokine-receptor complexes. The basal rate constants (ka0) of EPO, IL4, hGH, and PRL were similar (5.2 × 105 M−1s−1, 2.4 × 105 M−1s−1, 1.7 × 105 M−1s−1, and 1.7 × 105 M−1s−1, respectively). However, the average electrostatic free energies (ΔGe1∗) were very different (−4.2 kcal/mol, −2.4 kcal/mol, −0.1 kcal/mol, and −0.5 kcal/mol, respectively, at ionic strength = 160 mM). The receptor-binding rate constants predicted without adjusting any parameters, 6.2 × 108 M−1s−1, 1.3 × 107 M−1s−1, 2.0 × 105 M−1s−1, and 7.6 × 104 M−1s−1, respectively, for EPO, IL4, hGH, and PRL agree well with experimental results. We uncover that these diverse rate constants are anticorrelated with the circulation concentrations of the cytokines, with the resulting cytokine-receptor binding rates very close to the limits set by the half-lives of the receptors, suggesting that these binding rates are functionally relevant and perhaps evolutionarily tuned. Our calculations also reproduced well-observed effects of mutations and ionic strength on the rate constants and produced a set of mutations on the complex of hGH with its receptor that putatively enhances the rate constant by nearly 100-fold through increasing charge complementarity. To quantify charge complementarity, we propose a simple index based on the charge distribution within the binding interface, which shows good correlation with ΔGe1∗. Together these results suggest that protein charges can be manipulated to tune ka and control biological function. PMID:21889455

  10. Spectrophotometric study on binding of 2-thioxanthone acetic acid with ct-DNA.

    PubMed

    Ataci, Nese; Ozcelik, Elif; Arsu, Nergis

    2018-06-02

    Thioxanthone and its derivatives are the most remarkable molecules due to their vast variety of application such as radiation curing that is, until using them as a therapeutic drug. Therefore, in this study it was intended to use 2-Thioxanthone acetic acid with and without NaCl in Tris HCl buffer solution (pH:7.0) to represent the interaction with ct-DNA. The UV-vis absorption spectra of TXCH 2 COOH in the presence of ct-DNA showed hypochromism and the intrinstic binding constant (K b ) was determined as 6 × 10 3  L mol -1 . The fluoresence intensity of TXCH 2 COOH with ct-DNA clearly increased up to 101% which indicated that the fluorescence intensity was very sensitive to ct-DNA concentration. The binding constant (K) and the values of number of binding sites (n) and were calculated as 1.8 × 10 3  L mol -1 and 0.69, respectively. When the quenching constants (K sv ) of free TXCH 2 COOH and TXCH 2 COOH, which were bonded with ct-DNA were compared, slightly changed values of Ksv were seen. Moreover, displacement assay with Hoechst 33,258 and viscosity measurements in the presence and absence of NaCl salt also confirmed the binding mode which noted the electrostatic interaction following groove binding between TXCH 2 COOH and ct-DNA. Last but not least, the salt effect was examined on ct-DNA binding with TXCH 2 COOH. The results of the experiments indicated that the groove binding was strengthened by NaCl whereas in the high NaCl concentration, the binding ability of TXCH 2 COOH to ct-DNA was inversely affected. Copyright © 2018 Elsevier B.V. All rights reserved.

  11. New Parameters for Higher Accuracy in the Computation of Binding Free Energy Differences upon Alanine Scanning Mutagenesis on Protein-Protein Interfaces.

    PubMed

    Simões, Inês C M; Costa, Inês P D; Coimbra, João T S; Ramos, Maria J; Fernandes, Pedro A

    2017-01-23

    Knowing how proteins make stable complexes enables the development of inhibitors to preclude protein-protein (P:P) binding. The identification of the specific interfacial residues that mostly contribute to protein binding, denominated as hot spots, is thus critical. Here, we refine an in silico alanine scanning mutagenesis protocol, based on a residue-dependent dielectric constant version of the Molecular Mechanics/Poisson-Boltzmann Surface Area method. We have used a large data set of structurally diverse P:P complexes to redefine the residue-dependent dielectric constants used in the determination of binding free energies. The accuracy of the method was validated through comparison with experimental data, considering the per-residue P:P binding free energy (ΔΔG binding ) differences upon alanine mutation. Different protocols were tested, i.e., a geometry optimization protocol and three molecular dynamics (MD) protocols: (1) one using explicit water molecules, (2) another with an implicit solvation model, and (3) a third where we have carried out an accelerated MD with explicit water molecules. Using a set of protein dielectric constants (within the range from 1 to 20) we showed that the dielectric constants of 7 for nonpolar and polar residues and 11 for charged residues (and histidine) provide optimal ΔΔG binding predictions. An overall mean unsigned error (MUE) of 1.4 kcal mol -1 relative to the experiment was achieved in 210 mutations only with geometry optimization, which was further reduced with MD simulations (MUE of 1.1 kcal mol -1 for the MD employing explicit solvent). This recalibrated method allows for a better computational identification of hot spots, avoiding expensive and time-consuming experiments or thermodynamic integration/ free energy perturbation/ uBAR calculations, and will hopefully help new drug discovery campaigns in their quest of searching spots of interest for binding small drug-like molecules at P:P interfaces.

  12. Interaction of a copper (II) complex containing an artificial sweetener (aspartame) with calf thymus DNA.

    PubMed

    Shahabadi, Nahid; Khodaei, Mohammad Mehdi; Kashanian, Soheila; Kheirdoosh, Fahimeh

    2014-01-01

    A copper (II) complex containing aspartame (APM) as ligand, Cu(APM)2Cl2⋅2H2O, was synthesized and characterized. In vitro binding interaction of this complex with native calf thymus DNA (CT-DNA) was studied at physiological pH. The interaction was studied using different methods: spectrophotometric, spectrofluorometric, competition experiment, circular dichroism (CD) and viscosimetric techniques. Hyperchromicity was observed in UV absorption band of Cu(APM)2Cl2⋅2H2O. A strong fluorescence quenching reaction of DNA to Cu(APM)2Cl2⋅2H2O was observed and the binding constants (Kf) and corresponding numbers of binding sites (n) were calculated at different temperatures. Thermodynamic parameters, enthalpy change (ΔH) and entropy change (ΔS) were calculated to be+89.3 kJ mol(-1) and+379.3 J mol(-1) K(-1) according to Van't Hoff equation which indicated that reaction is predominantly entropically driven. Experimental results from spectroscopic methods were comparable and further supported by viscosity measurements. We suggest that Cu(APM)2Cl2⋅2H2O interacts with calf thymus DNA via a groove interaction mode with an intrinsic binding constant of 8×10+4 M(-1). Binding of this copper complex to DNA was found to be stronger compared to aspartame which was studied recently. Copyright © 2013 Elsevier B.V. All rights reserved.

  13. Proton and metal ion binding to natural organic polyelectrolytes-I. Studies with synthetic model compounds

    USGS Publications Warehouse

    Marinsky, J.A.; Reddy, M.M.

    1984-01-01

    A unified physico-chemical model, based on a modified Henderson-Hasselbalch equation, for the analysis of ion complexation reactions involving charged polymeric systems is presented and verified. In this model pH = pKa+p(??Ka) + log(??/1 - ??) where Ka is the intrinsic acid dissociation constant of the ionizable functional groups on the polymer, ??Ka is the deviation of the intrinsic constant due to electrostatic interaction between the hydrogen ion and the polyanion, and alpha (??) is the polyacid degree of ionization. Using this approach pKa values for repeating acidic units of polyacrylic (PAA) and polymethacrylic (PMA) acids were found to be 4.25 ?? 0.03 and 4.8 ?? 0.1, respectively. The polyion electrostatic deviation term derived from the potentiometric titration data (i.e. p(??Ka)) is used to calculate metal ion concentration at the complexation site on the surface of the polyanion. Intrinsic cobalt-polycarboxylate binding constants (7.5 for PAA and 5.6 for PMA), obtained using this procedure, are consistent with the range of published binding constants for cobalt-monomer carboxylate complexes. In two phase systems incorporation of a Donnan membrane potential term allows determination of the intrinsic pKa of a cross-linked PMA gel, pKa = 4.83, in excellent agreement with the value obtained for the linear polyelectrolyte and the monomer. Similarly, the intrinsic stability constant for cobalt ion binding to a PMA-gel (??CoPMA+ = 11) was found to be in agreement with the linear polyelectrolyte analogue and the published data for cobalt-carboxylate monodentate complexes. ?? 1984.

  14. [Derivative spectrophotometric and NMR spectroscopic study in pharmaceutical science].

    PubMed

    Kitamura, Keisuke

    2007-10-01

    This review starts with an introduction of derivative spectrophotometry followed by a description on the construction of a personal computer-assisted derivative spectrophotometric (DS) system. An acquisition system for inputting digitalized absorption spectra into personal computers and a BASIC program for calculating derivative spectra were developed. Then, applications of the system to drug analyses that are difficult with traditional absorption methods are described. Following this, studies on the interactions of drugs with biological macromolecules by the DS and NMR methods were discussed. An (1)H NMR study elucidated that the small unilamellar vesicle (SUV) has a single membrane made of a phosphatidylcholine bilayer, and that chlorpromazine interacts with both the outer and inner layers. (13)C NMR revealed a reduction of the dissociation constants of phenothiazine drugs due to their interaction with SUV. The partition coefficients of phenothiazine, benzodiazepine and steroid drugs in an SUV-water system and the effects of cholesterol or amino lipids content on these partition coefficients were examined by the DS method. The binding constants of phenothiazine drugs to bovine serum albumin (BSA) and the influence of Na(+), K(+), Cl(-), Br(-), and I(-) on these binding constants were determined by DS. It was found that I(-), Br(-), Cl(-) reduce the binding constants in this order, and that Na(+) and K(+) have no effect. A (19)F NMR study revealed that triflupromazine binds to BSA and human serum albumin in two regions including Site II with different populations, and that a nonsteroidal anti-inflammatory drug, niflumic acid, binds Sites Ia and Ib.

  15. Interaction of the dietary pigment curcumin with hemoglobin: energetics of the complexation.

    PubMed

    Basu, Anirban; Kumar, Gopinatha Suresh

    2014-08-01

    Thermodynamics of the interaction of the chemotherapeutic and chemopreventive dietary pigment, curcumin, with hemoglobin was studied by isothermal titration calorimetry. The binding was characterized to be exothermic. At 293.15 K, the equilibrium constant for curcumin-Hb complexation was found to be (4.88 ± 0.06) × 10(5) M(-1). The binding stoichiometry was calculated to be 1.08 ± 0.05, confirming a 1:1 complexation. The binding was driven by a large negative standard molar enthalpy change (ΔH(0) = -118.45 ± 0.05 kJ mol(-1)) and an unfavorable standard molar entropy change (TΔS(0) = -86.53 ± 0.01 kJ mol(-1)) at 293.15 K. Increasing the temperature favoured the binding, and the magnitude of the negative standard molar heat capacity change suggested the involvement of significant hydrophobic forces in the binding process. With increasing salt concentration, the magnitude of the equilibrium constant decreased slightly; and the complexation mostly involved non-polyelectrolytic forces contributing about 92-94% of the standard molar Gibbs energy change. DSC studies revealed that curcumin binding caused a partial unfolding of the protein.

  16. Binding analysis for interaction of diacetylcurcumin with β-casein nanoparticles by using fluorescence spectroscopy and molecular docking calculations

    NASA Astrophysics Data System (ADS)

    Mehranfar, Fahimeh; Bordbar, Abdol-Khalegh; Fani, Najme; Keyhanfar, Mehrnaz

    2013-11-01

    The interaction of diacetylcurcumin (DAC), as a novel synthetic derivative of curcumin, with bovine β-casein (an abundant milk protein that is highly amphiphilic and self assembles into stable micellar nanoparticles in aqueous solution) was investigated using fluorescence quenching experiments, Forster energy transfer measurements and molecular docking calculations. The fluorescence quenching measurements revealed the presence of a single binding site on β-casein for DAC with the binding constant value equals to (4.40 ± 0.03) × 104 M-1. Forster energy transfer measurements suggested that the distance between bound DAC and Trp143 residue is higher than the respective critical distance, hence, the static quenching is more likely responsible for fluorescence quenching other than the mechanism of non-radiative energy transfer. Our results from molecular docking calculations indicated that binding of DAC to β-casein predominantly occurred through hydrophobic contacts in the hydrophobic core of protein. Additionally, in vitro investigation of the cytotoxicity of free DAC and DAC-β-casein complex in human breast cancer cell line MCF7 revealed the higher cytotoxic effect of DAC-β-casein complex.

  17. Comparison of calculation and experiment implicates significant electrostatic contributions to the binding stability of barnase and barstar.

    PubMed

    Dong, Feng; Vijayakumar, M; Zhou, Huan-Xiang

    2003-07-01

    The contributions of electrostatic interactions to the binding stability of barnase and barstar were studied by the Poisson-Boltzmann model with three different protocols: a), the dielectric boundary specified as the van der Waals (vdW) surface of the protein along with a protein dielectric constant (epsilon (p)) of 4; b), the dielectric boundary specified as the molecular (i.e., solvent-exclusion (SE)) surface along with epsilon (p) = 4; and c), "SE + epsilon (p) = 20." The "vdW + epsilon (p) = 4" and "SE + epsilon (p) = 20" protocols predicted an overall electrostatic stabilization whereas the "SE + epsilon (p) = 4" protocol predicted an overall electrostatic destabilization. The "vdW + epsilon (p) = 4" protocol was most consistent with experiment. It quantitatively reproduced the observed effects of 17 mutations neutralizing charged residues lining the binding interface and the measured coupling energies of six charge pairs across the interface and reasonably rationalized the experimental ionic strength and pH dependences of the binding constant. In contrast, the "SE + epsilon (p) = 4" protocol predicted significantly larger coupling energies of charge pairs whereas the "SE + epsilon (p) = 20" protocol did not predict any pH dependence. This study calls for further scrutiny of the different Poisson-Boltzmann protocols and demonstrates potential danger in drawing conclusions on electrostatic contributions based on a particular calculation protocol.

  18. Analysis of the difference in color development in the dye-binding method due to the kind of buffer solution.

    PubMed

    Suzuki, Yuji

    2006-06-01

    In a dye-binding method using a pH indicator, color development has reportedly been affected by the kind of buffer solution used in the color reagent. This phenomenon was analyzed by using a calculation based on the assumption that the anion of the buffer solution also reacts with protein. Color development decreases with increases in the anion concentration of the buffer solution and in the equilibrium constant of the reaction between the anion and protein. The differences in color development due to the kind of buffer solution can be attributed to differences in the equilibrium constant of the reaction forming the anion-protein complex and to the concentration of the anion between the buffer solutions.

  19. Study of iridium silicide monolayers using density functional theory

    NASA Astrophysics Data System (ADS)

    Popis, Minh D.; Popis, Sylvester V.; Oncel, Nuri; Hoffmann, Mark R.; ćakır, Deniz

    2018-02-01

    In this study, we investigated physical and electronic properties of possible two-dimensional structures formed by Si (silicon) and Ir (iridium). To this end, different plausible structures were modeled by using density functional theory and the cohesive energies calculated for the geometry of optimized structures, with the lowest equilibrium lattice constants. Among several candidate structures, we identified three mechanically (via elastic constants and Young's modulus), dynamically (via phonon calculations), and thermodynamically stable iridium silicide monolayer structures. The lowest energy structure has a chemical formula of Ir2Si4 (called r-IrSi2), with a rectangular lattice (Pmmn space group). Its cohesive energy was calculated to be -0.248 eV (per IrSi2 unit) with respect to bulk Ir and bulk Si. The band structure indicates that the Ir2Si4 monolayer exhibits metallic properties. Other stable structures have hexagonal (P-3m1) and tetragonal (P4/nmm) cell structures with 0.12 and 0.20 eV/f.u. higher cohesive energies, respectively. Our calculations showed that Ir-Si monolayers are reactive. Although O2 molecules exothermically dissociate on the surface of the free-standing iridium silicide monolayers with large binding energies, H2O molecules bind to the monolayers with a rather weak interaction.

  20. Binding constants of membrane-anchored receptors and ligands depend strongly on the nanoscale roughness of membranes.

    PubMed

    Hu, Jinglei; Lipowsky, Reinhard; Weikl, Thomas R

    2013-09-17

    Cell adhesion and the adhesion of vesicles to the membranes of cells or organelles are pivotal for immune responses, tissue formation, and cell signaling. The adhesion processes depend sensitively on the binding constant of the membrane-anchored receptor and ligand proteins that mediate adhesion, but this constant is difficult to measure in experiments. We have investigated the binding of membrane-anchored receptor and ligand proteins with molecular dynamics simulations. We find that the binding constant of the anchored proteins strongly decreases with the membrane roughness caused by thermally excited membrane shape fluctuations on nanoscales. We present a theory that explains the roughness dependence of the binding constant for the anchored proteins from membrane confinement and that relates this constant to the binding constant of soluble proteins without membrane anchors. Because the binding constant of soluble proteins is readily accessible in experiments, our results provide a useful route to compute the binding constant of membrane-anchored receptor and ligand proteins.

  1. DNA binding of a proflavine derivative bearing a platinum hanging residue.

    PubMed

    Biagini, Silvia; Bianchi, Antonio; Biver, Tarita; Boggioni, Alessia; Nikolayenko, Igor V; Secco, Fernando; Venturini, Marcella

    2011-04-01

    New platinum(II) complex of 3,6-diamine-9-[6,6-bis(2-aminohethyl)-1,6-diaminohexyl]acridine, AzaPt, has been synthesised and characterised. Behaviour of AzaPt in solution (protonation and possible self-aggregation phenomena) has been investigated by spectral methods (absorbance and fluorescence) at I=0.1M and 25°C, and the equilibrium parameters of binding to calf thymus DNA have been established. Two different modes of DNA binding by the complex were detected, which depend on the polymer to dye molar ratio (P/D). At relatively low P/D values the mode was interpreted as binding by the polyamine residue external to the base pairs, while at high P/D values the binding corresponds to intercalation of the proflavine residue. Such interpretation is supported by the observed salt effect on binding and the temperature variation of the binding constants, which allowed estimating the ΔH and ΔS values contributions. Spectrophotometric analysis of the long time range binding revealed that AzaPt is involved in a slow reaction, interpreted as an attack by the platinum ion on the nucleobases. The time constant for such interaction was calculated and found to be the same order of magnitude as for processes responsible for the action of anti-tumour drugs that do covalently bind to polynucleotides. Copyright © 2010 Elsevier Inc. All rights reserved.

  2. A rigorous multiple independent binding site model for determining cell-based equilibrium dissociation constants.

    PubMed

    Drake, Andrew W; Klakamp, Scott L

    2007-01-10

    A new 4-parameter nonlinear equation based on the standard multiple independent binding site model (MIBS) is presented for fitting cell-based ligand titration data in order to calculate the ligand/cell receptor equilibrium dissociation constant and the number of receptors/cell. The most commonly used linear (Scatchard Plot) or nonlinear 2-parameter model (a single binding site model found in commercial programs like Prism(R)) used for analysis of ligand/receptor binding data assumes only the K(D) influences the shape of the titration curve. We demonstrate using simulated data sets that, depending upon the cell surface receptor expression level, the number of cells titrated, and the magnitude of the K(D) being measured, this assumption of always being under K(D)-controlled conditions can be erroneous and can lead to unreliable estimates for the binding parameters. We also compare and contrast the fitting of simulated data sets to the commonly used cell-based binding equation versus our more rigorous 4-parameter nonlinear MIBS model. It is shown through these simulations that the new 4-parameter MIBS model, when used for cell-based titrations under optimal conditions, yields highly accurate estimates of all binding parameters and hence should be the preferred model to fit cell-based experimental nonlinear titration data.

  3. Universal binding energy relations in metallic adhesion

    NASA Technical Reports Server (NTRS)

    Ferrante, J.; Smith, J. R.; Rose, J. H.

    1981-01-01

    Scaling relations which map metallic adhesive binding energy onto a single universal binding energy curve are discussed in relation to adhesion, friction, and wear in metals. The scaling involved normalizing the energy to the maximum binding energy and normalizing distances by a suitable combination of Thomas-Fermi screening lengths. The universal curve was found to be accurately represented by E*(A*)= -(1+beta A) exp (-Beta A*) where E* is the normalized binding energy, A* is the normalized separation, and beta is the normalized decay constant. The calculated cohesive energies of potassium, barium, copper, molybdenum, and samarium were also found to scale by similar relations, suggesting that the universal relation may be more general than for the simple free electron metals.

  4. Rate Constants and Mechanisms of Protein–Ligand Binding

    PubMed Central

    Pang, Xiaodong; Zhou, Huan-Xiang

    2017-01-01

    Whereas protein–ligand binding affinities have long-established prominence, binding rate constants and binding mechanisms have gained increasing attention in recent years. Both new computational methods and new experimental techniques have been developed to characterize the latter properties. It is now realized that binding mechanisms, like binding rate constants, can and should be quantitatively determined. In this review, we summarize studies and synthesize ideas on several topics in the hope of providing a coherent picture of and physical insight into binding kinetics. The topics include microscopic formulation of the kinetic problem and its reduction to simple rate equations; computation of binding rate constants; quantitative determination of binding mechanisms; and elucidation of physical factors that control binding rate constants and mechanisms. PMID:28375732

  5. Kinetics of phloretin binding to phosphatidylcholine vesicle membranes

    PubMed Central

    1980-01-01

    The submillisecond kinetics for phloretin binding to unilamellar phosphatidylcholine (PC) vesicles was investigated using the temperature-jump technique. Spectrophotometric studies of the equilibrium binding performed at 328 nm demonstrated that phloretin binds to a single set of independent, equivalent sites on the vesicle with a dissociation constant of 8.0 microM and a lipid/site ratio of 4.0. The temperature of the phloretin-vesicle solution was jumped by 4 degrees C within 4 microseconds producing a monoexponential, concentration-dependent relaxation process with time constants in the 30--200-microseconds time range. An analysis of the concentration dependence of relaxation time constants at pH 7.30 and 24 degrees C yielded a binding rate constant of 2.7 X 10(8) M-1 s-1 and an unbinding constant of 2,900 s-1; approximately 66 percent of total binding sites are exposed at the outer vesicle surface. The value of the binding rate constant and three additional observations suggest that the binding kinetics are diffusion limited. The phloretin analogue, naringenin, which has a diffusion coefficient similar to phloretin yet a dissociation constant equal to 24 microM, bound to PC vesicle with the same rate constant as phloretin did. In addition, the phloretin-PC system was studied in buffers made one to six times more viscous than water by addition of sucrose or glycerol to the differ. The equilibrium affinity for phloretin binding to PC vesicles is independent of viscosity, yet the binding rate constant decreases with the expected dependence (kappa binding alpha 1/viscosity) for diffusion-limited processes. Thus, the binding rate constant is not altered by differences in binding affinity, yet depends upon the diffusion coefficient in buffer. Finally, studies of the pH dependence of the binding rate constant showed a dependence (kappa binding alpha [1 + 10pH-pK]) consistent with the diffusion-limited binding of a weak acid. PMID:7391812

  6. A comparative study on the binding of single and double chain surfactant-cobalt(III) complexes with bovine serum albumin

    NASA Astrophysics Data System (ADS)

    Vignesh, G.; Sugumar, K.; Arunachalam, S.; Vignesh, S.; Arthur James, R.

    2013-09-01

    The comparative binding effect of single and double aliphatic chain containing surfactant-cobalt(III) complexes cis-[Co(bpy)2(DA)2](ClO4)3ṡ2H2O (1), cis-[Co(bpy)2(DA)Cl](ClO4)2ṡ2H2O (2), cis-[Co(phen)2(CA)2](ClO4)3ṡ2H2O (3), and cis-[Co(phen)2(CA)Cl](ClO4)2ṡ2H2O (4) with bovine serum albumin (BSA) under physiological condition was analyzed by steady state, time resolved fluorescence, synchronous, three-dimensional fluorescence, UV-Visible absorption and circular dichroism spectroscopic techniques. The results show that these complexes cause the fluorescence quenching of BSA through a static mechanism. The binding constants (Kb) and the number of binding sites were calculated and binding constant values are found in the range of 104-105 M-1. The results indicate that compared to single chain complex, double chain surfactant-cobalt(III) complex interacts strongly with BSA. Also the sign of thermodynamic parameters (ΔG°, ΔH°, and ΔS°) indicate that all the complexes interact with BSA through hydrophobic force. The binding distance (r) between complexes and BSA was calculated using Förster non-radiation energy transfer theory and found to be less than 7 nm. The results of synchronous, three dimensional fluorescence and circular dichroism spectroscopic methods indicate that the double chain surfactant-cobalt(III) complexes changed the conformation of the protein considerably than the respective single chain surfactant-cobalt(III) complexes. Antimicrobial studies of the complexes showed good activities against pathogenic microorganisms.

  7. Constants for mercury binding by organic matter isolates from the Florida Everglades

    USGS Publications Warehouse

    Benoit, J.M.; Mason, R.P.; Gilmour, C.C.; Aiken, G.R.

    2001-01-01

    Dissolved organic matter (DOM) has been implicated as an important complexing agent for Hg that can affect its mobility and bioavailability in aquatic ecosystems. However, binding constants for natural Hg-DOM complexes are not well known. We employed a competitive ligand approach to estimate conditional stability constants for Hg complexes with DOM isolates collected from Florida Everglades surface waters. The isolates examined were the hydrophobic fraction of DOM from a eutrophic, sulfidic site (F1-HPoA) and the hydrophilic fraction from an oligotrophic, low-sulfide site (2BS-HPiA). Our experimental determinations utilized overall octanol-water partitioning coefficients (Dow) for 203Hg at 0.01 M chloride and across pH and DOM concentration gradients. Use of this radioisotope allowed rapid determinations of Hg concentrations in both water and octanol phases without problems of matrix interference. Conditional stability constants (1 = 0.06, 23??C) were log K??? = 11.8 for F1-HPoA and log K' = 10.6 for 2BS-HPiA. These are similar to previously published stability constants for Hg binding to low-molecular-weight thiols. Further, F1-HPoA showed a pH-dependent decline in Dow that was consistent with models of Hg complexation with thiol groups as the dominant Hg binding sites in DOM. These experiments demonstrate that the DOM isolates are stronger ligands for Hg than chloride ion or ethylenediamine-tetraacetic acid. Speciation calculations indicate that at the DOM concentrations frequently measured in Everglades, 20 to 40 ??M, significant complexation of Hg by DOM would be expected in aerobic (sulfide-free) surface waters. Copyright ?? 2001 Elsevier Science Ltd.

  8. Magnetic properties and core electron binding energies of liquid water

    NASA Astrophysics Data System (ADS)

    Galamba, N.; Cabral, Benedito J. C.

    2018-01-01

    The magnetic properties and the core and inner valence electron binding energies of liquid water are investigated. The adopted methodology relies on the combination of molecular dynamics and electronic structure calculations. Born-Oppenheimer molecular dynamics with the Becke and Lee-Yang-Parr functionals for exchange and correlation, respectively, and includes an empirical correction (BLYP-D3) functional and classical molecular dynamics with the TIP4P/2005-F model were carried out. The Keal-Tozer functional was applied for predicting magnetic shielding and spin-spin coupling constants. Core and inner valence electron binding energies in liquid water were calculated with symmetry adapted cluster-configuration interaction. The relationship between the magnetic shielding constant σ(17O), the role played by the oxygen atom as a proton acceptor and donor, and the tetrahedral organisation of liquid water are investigated. The results indicate that the deshielding of the oxygen atom in water is very dependent on the order parameter (q) describing the tetrahedral organisation of the hydrogen bond network. The strong sensitivity of magnetic properties on changes of the electronic density in the nuclei environment is illustrated by a correlation between σ(17O) and the energy gap between the 1a1[O1s] (core) and the 2a1 (inner valence) orbitals of water. Although several studies discussed the eventual connection between magnetic properties and core electron binding energies, such a correlation could not be clearly established. Here, we demonstrate that for liquid water this correlation exists although involving the gap between electron binding energies of core and inner valence orbitals.

  9. Using resonance light scattering and UV/vis absorption spectroscopy to study the interaction between gliclazide and bovine serum albumin.

    PubMed

    Zhang, Qiu-Ju; Liu, Bao-Sheng; Li, Gai-Xia; Han, Rong

    2016-08-01

    At different temperatures (298, 310 and 318 K), the interaction between gliclazide and bovine serum albumin (BSA) was investigated using fluorescence quenching spectroscopy, resonance light scattering spectroscopy and UV/vis absorption spectroscopy. The first method studied changes in the fluorescence of BSA on addition of gliclazide, and the latter two methods studied the spectral change in gliclazide while BSA was being added. The results indicated that the quenching mechanism between BSA and gliclazide was static. The binding constant (Ka ), number of binding sites (n), thermodynamic parameters, binding forces and Hill's coefficient were calculated at three temperatures. Values for the binding constant obtained using resonance light scattering and UV/vis absorption spectroscopy were much greater than those obtained from fluorescence quenching spectroscopy, indicating that methods monitoring gliclazide were more accurate and reasonable. In addition, the results suggest that other residues are involved in the reaction and the mode 'point to surface' existed in the interaction between BSA and gliclazide. Copyright © 2015 John Wiley & Sons, Ltd. Copyright © 2015 John Wiley & Sons, Ltd.

  10. Electrostatic contribution to the binding stability of protein-protein complexes.

    PubMed

    Dong, Feng; Zhou, Huan-Xiang

    2006-10-01

    To investigate roles of electrostatic interactions in protein binding stability, electrostatic calculations were carried out on a set of 64 mutations over six protein-protein complexes. These mutations alter polar interactions across the interface and were selected for putative dominance of electrostatic contributions to the binding stability. Three protocols of implementing the Poisson-Boltzmann model were tested. In vdW4 the dielectric boundary between the protein low dielectric and the solvent high dielectric is defined as the protein van der Waals surface and the protein dielectric constant is set to 4. In SE4 and SE20, the dielectric boundary is defined as the surface of the protein interior inaccessible to a 1.4-A solvent probe, and the protein dielectric constant is set to 4 and 20, respectively. In line with earlier studies on the barnase-barstar complex, the vdW4 results on the large set of mutations showed the closest agreement with experimental data. The agreement between vdW4 and experiment supports the contention of dominant electrostatic contributions for the mutations, but their differences also suggest van der Waals and hydrophobic contributions. The results presented here will serve as a guide for future refinement in electrostatic calculation and inclusion of nonelectrostatic effects. Proteins 2006. (c) 2006 Wiley-Liss, Inc.

  11. Kinetic modeling of benzodiazepine receptor binding with PET and high specific activity [(11)C]Iomazenil in healthy human subjects.

    PubMed

    Bremner, J D; Horti, A; Staib, L H; Zea-Ponce, Y; Soufer, R; Charney, D S; Baldwin, R

    2000-01-01

    Quantitation of the PET benzodiazepine receptor antagonist, [(11)C]Iomazenil, using low specific activity radioligand was recently described. The purpose of this study was to quantitate benzodiazepine receptor binding in human subjects using PET and high specific activity [(11)C]Iomazenil. Six healthy human subjects underwent PET imaging following a bolus injection of high specific activity (>100 Ci/mmol) [(11)C]iomazenil. Arterial samples were collected at multiple time points after injection for measurement of unmetabolized total and nonprotein-bound parent compound in plasma. Time activity curves of radioligand concentration in brain and plasma were analyzed using two and three compartment model. Kinetic rate constants of transfer of radioligand between plasma, nonspecifically bound brain tissue, and specifically bound brain tissue compartments were fitted to the model. Values for fitted kinetic rate constants were used in the calculation of measures of benzodiazepine receptor binding, including binding potential (the ratio of receptor density to affinity), and product of BP and the fraction of free nonprotein-bound parent compound (V(3)'). Use of the three compartment model improved the goodness of fit in comparison to the two compartment model. Values for kinetic rate constants and measures of benzodiazepine receptor binding, including BP and V(3)', were similar to results obtained with the SPECT radioligand [(123)I]iomazenil, and a prior report with low specific activity [(11)C]Iomazenil. Kinetic modeling using the three compartment model with PET and high specific activity [(11)C]Iomazenil provides a reliable measure of benzodiazepine receptor binding. Synapse 35:68-77, 2000. Published 2000 Wiley-Liss, Inc.

  12. Comparative evaluation of in vitro efficacy of colesevelam hydrochloride tablets.

    PubMed

    Krishnaiah, Yellela S R; Yang, Yongsheng; Bykadi, Srikant; Sayeed, Vilayat A; Khan, Mansoor A

    2014-09-01

    Colesevelam hydrochloride is used as an adjunct to diet and exercise to reduce elevated low-density lipoprotein (LDL) cholesterol in patients with primary hyperlipidemia as well as to improve glycemic control in patients with type 2 diabetes. This is likely to result in submission of abbreviated new drug applications (ANDA). This study was conducted to compare the efficacy of two tablet products of colesevelam hydrochloride based on the in vitro binding of bile acid sodium salts of glycocholic acid (GC), glycochenodeoxycholic acid (GCDA) and taurodeoxycholic acid (TDCA). Kinetic binding study was carried out with constant initial bile salt concentrations as a function of time. Equilibrium binding studies were conducted under conditions of constant incubation time and varying initial concentrations of bile acid sodium salts. The unbound concentration of bile salts was determined in the samples of these studies. Langmuir equation was utilized to calculate the binding constants k1 and k2. The amount of the three bile salts bound to both the products reached equilibrium at 3 h. The similarity factor (f2) was 99.5 based on the binding profile of total bile salts to the test and reference colesevelam tablets as a function of time. The 90% confidence interval for the test to reference ratio of k2 values were 96.06-112.07 which is within the acceptance criteria of 80-120%. It is concluded from the results that the test and reference tablets of colesevelam hydrochloride showed a similar in vitro binding profile and capacity to bile salts.

  13. Material Science Smart Coatings

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rubinstein, A. I.; Sabirianov, R. F.; Namavar, Fereydoon

    2014-07-01

    The contribution of electrostatic interactions to the free energy of binding between model protein and a ceramic implant surface in the aqueous solvent, considered in the framework of the nonlocal electrostatic model, is calculated as a function of the implant low-frequency dielectric constant. We show that the existence of a dynamically ordered (low-dielectric) interfacial solvent layer at the protein-solvent and ceramic-solvent interface markedly increases charging energy of the protein and ceramic implant, and consequently makes the electrostatic contribution to the protein-ceramic binding energy more favorable (attractive). Our analysis shows that the corresponding electrostatic energy between protein and oxide ceramics dependsmore » nonmonotonically on the dielectric constant of ceramic, ε C. Obtained results indicate that protein can attract electrostatically to the surface if ceramic material has a moderate ε C below or about 35 (in particularly ZrO 2 or Ta 2O 5). This is in contrast to classical (local) consideration of the solvent, which demonstrates an unfavorable electrostatic interaction of protein with typical metal oxide ceramic materials (ε C>10). Thus, a solid implant coated by combining oxide ceramic with a reduced dielectric constant can be beneficial to strengthen the electrostatic binding of the protein-implant complex.« less

  14. Analysis of binding ability of two tetramethylpyridylporphyrins to albumin and its complex with bilirubin

    NASA Astrophysics Data System (ADS)

    Solomonov, Alexey V.; Shipitsyna, Maria K.; Vashurin, Arthur S.; Rumyantsev, Evgeniy V.; Timin, Alexander S.; Ivanov, Sergey P.

    2016-11-01

    An interaction between 5,10,15,20-tetrakis-(N-methyl-x-pyridyl)porphyrins, x = 2; 4 (TMPyPs) with bovine serum albumin (BSA) and its bilirubin (BR) complex was investigated by UV-Viz and fluorescence spectroscopy under imitated physiological conditions involving molecular docking studies. The parameters of forming intermolecular complexes (binding constants, quenching rate constants, quenching sphere radius etc.) were determined. It was showed that the interaction between proteins and TMPyPs occurs via static quenching of protein fluorescence and has predominantly hydrophobic and electrostatic character. It was revealed that obtained complexes are relatively stable, but in the case of TMPyP4 binding with proteins occurs better than TMPyP2. Nevertheless, both TMPyPs have better binding ability with free protein compared to BRBSA at the same time. The influence of TMPyPs on the conformational changes in protein molecules was studied using synchronous fluorescence spectroscopy. It was found that there is no competition of BR with TMPyPs for binging sites on protein molecule and BR displacement does not occur. Molecular docking calculations have showed that TMPyPs can bind with albumin via tryptophan residue in the hydrophilic binding site of protein molecule but it is not one possible interaction way.

  15. Organic additives stabilize RNA aptamer binding of malachite green.

    PubMed

    Zhou, Yubin; Chi, Hong; Wu, Yuanyuan; Marks, Robert S; Steele, Terry W J

    2016-11-01

    Aptamer-ligand binding has been utilized for biological applications due to its specific binding and synthetic nature. However, the applications will be limited if the binding or the ligand is unstable. Malachite green aptamer (MGA) and its labile ligand malachite green (MG) were found to have increasing apparent dissociation constants (Kd) as determined through the first order rate loss of emission intensity of the MGA-MG fluorescent complex. The fluorescent intensity loss was hypothesized to be from the hydrolysis of MG into malachite green carbinol base (MGOH). Random screening organic additives were found to reduce or retain the fluorescence emission and the calculated apparent Kd of MGA-MG binding. The protective effect became more apparent as the percentage of organic additives increased up to 10% v/v. The mechanism behind the organic additive protective effects was primarily from a ~5X increase in first order rate kinetics of MGOH→MG (kMGOH→MG), which significantly changed the equilibrium constant (Keq), favoring the generation of MG, versus MGOH without organic additives. A simple way has been developed to stabilize the apparent Kd of MGA-MG binding over 24h, which may be beneficial in stabilizing other triphenylmethane or carbocation ligand-aptamer interactions that are susceptible to SN1 hydrolysis. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Formation of the prebiotic molecule NH2CHO on astronomical amorphous solid water surfaces: accurate tunneling rate calculations.

    PubMed

    Song, Lei; Kästner, Johannes

    2016-10-26

    Investigating how formamide forms in the interstellar medium is a hot topic in astrochemistry, which can contribute to our understanding of the origin of life on Earth. We have constructed a QM/MM model to simulate the hydrogenation of isocyanic acid on amorphous solid water surfaces to form formamide. The binding energy of HNCO on the ASW surface varies significantly between different binding sites, we found values between ∼0 and 100 kJ mol -1 . The barrier for the hydrogenation reaction is almost independent of the binding energy, though. We calculated tunneling rate constants of H + HNCO → NH 2 CO at temperatures down to 103 K combining QM/MM with instanton theory. Tunneling dominates the reaction at such low temperatures. The tunneling reaction is hardly accelerated by the amorphous solid water surface compared to the gas phase for this system, even though the activation energy of the surface reaction is lower than the one of the gas-phase reaction. Both the height and width of the barrier affect the tunneling rate in practice. Strong kinetic isotope effects were observed by comparing to rate constants of D + HNCO → NHDCO. At 103 K we found a KIE of 231 on the surface and 146 in the gas phase. Furthermore, we investigated the gas-phase reaction NH 2 + H 2 CO → NH 2 CHO + H and found it unlikely to occur at cryogenic temperatures. The data of our tunneling rate constants are expected to significantly influence astrochemical models.

  17. Experimental and computational studies on the effects of valganciclovir as an antiviral drug on calf thymus DNA.

    PubMed

    Shahabadi, Nahid; Pourfoulad, Mehdi; Moghadam, Neda Hosseinpour

    2017-01-02

    DNA-binding properties of an antiviral drug, valganciclovir (valcyte) was studied by using emission, absorption, circular dichroism, viscosity, differential pulse voltammetry, fluorescence techniques, and computational studies. The drug bound to calf thymus DNA (ct-DNA) in a groove-binding mode. The calculated binding constant of UV-vis, K a , is comparable to groove-binding drugs. Competitive fluorimetric studies with Hoechst 33258 showed that valcyte could displace the DNA-bound Hoechst 33258. The drug could not displace intercalated methylene blue from DNA double helix. Furthermore, the induced detectable changes in the CD spectrum of ct-DNA as well as changes in its viscosity confirm the groove-binding mode. In addition, an integrated molecular docking was employed to further investigate the binding interactions between valcyte and calf thymus DNA.

  18. A Receptor-targeted Fluorescent Radiopharmaceutical for Multireporter Sentinel Lymph Node Imaging

    PubMed Central

    Emerson, Derek K.; Limmer, Karl K.; Hall, David J.; Han, Sung-Ho; Eckelman, William C.; Kane, Christopher J.; Wallace, Anne M.

    2012-01-01

    Purpose: To determine the imaging and receptor-binding properties of a multireporter probe designed for sentinel lymph node (SLN) mapping via nuclear and fluorescence detection. Materials and Methods: The animal experiments were approved by the institutional animal care and use committee. A multireporter probe was synthesized by covalently attaching cyanine 7 (Cy7), a near-infrared cyanine dye, to tilmanocept, a radiopharmaceutical that binds to a receptor specific to recticuloendothelial cells. In vitro binding assays of technetium 99m (99mTc) -labeled Cy7 tilmanocept were conducted at 4°C by using receptor-bearing macrophages. Optical SLN imaging after foot pad administration was performed by using two molar doses of Cy7 tilmanocept. Six mice were injected with 0.11 nmol of 99mTc-labeled Cy7 tilmanocept (low-dose group); an additional six mice were injected with 31 nmol of 99mTc-labeled Cy7 tilmanocept (high-dose group) to saturate the receptor sites within the SLN. After 2.5 hours of imaging, the mice were euthanized, and the sentinel and distal lymph nodes were excised and assayed for radioactivity for calculation of SLN percentage of injected dose and extraction. Four mice were used as controls for autofluorescence. Standard optical imaging software was used to plot integrated fluorescence intensity against time for calculation of the SLN uptake rate constant and scaled peak intensity. Significance was calculated by using the Student t test. Results: In vitro binding assays showed subnanomolar affinity (mean dissociation constant, 0.25 nmol/L ± 0.10 [standard deviation]). Fluorescence imaging showed a detection sensitivity of 1.6 × 103 counts · sec−1 · μW−1 per picomole of Cy7. All four imaging metrics (percentage of injected dose, SLN extraction, SLN uptake rate constant, and expected peak fluorescence intensity) exhibited higher values (P = .005 to P = .042) in the low-dose group than in the high-dose group; this finding was consistent with receptor-mediated image formation. Conclusion: The multireporter probe 99mTc-labeled Cy7 tilmanocept exhibits in vitro and in vivo receptor-binding properties for successful receptor-targeted SLN mapping with nuclear and optical imaging. © RSNA, 2012 Supplemental material: http://radiology.rsna.org/lookup/suppl/doi:10.1148/radiol.12120638/-/DC1 PMID:22753678

  19. Comparison of Calculation and Experiment Implicates Significant Electrostatic Contributions to the Binding Stability of Barnase and Barstar

    PubMed Central

    Dong, Feng; Vijayakumar, M.; Zhou, Huan-Xiang

    2003-01-01

    The contributions of electrostatic interactions to the binding stability of barnase and barstar were studied by the Poisson-Boltzmann model with three different protocols: a), the dielectric boundary specified as the van der Waals (vdW) surface of the protein along with a protein dielectric constant (ɛp) of 4; b), the dielectric boundary specified as the molecular (i.e., solvent-exclusion (SE)) surface along with ɛp = 4; and c), “SE + ɛp = 20.” The “vdW + ɛp = 4” and “SE + ɛp = 20” protocols predicted an overall electrostatic stabilization whereas the “SE + ɛp = 4” protocol predicted an overall electrostatic destabilization. The “vdW + ɛp = 4” protocol was most consistent with experiment. It quantitatively reproduced the observed effects of 17 mutations neutralizing charged residues lining the binding interface and the measured coupling energies of six charge pairs across the interface and reasonably rationalized the experimental ionic strength and pH dependences of the binding constant. In contrast, the “SE + ɛp = 4” protocol predicted significantly larger coupling energies of charge pairs whereas the “SE + ɛp = 20” protocol did not predict any pH dependence. This study calls for further scrutiny of the different Poisson-Boltzmann protocols and demonstrates potential danger in drawing conclusions on electrostatic contributions based on a particular calculation protocol. PMID:12829463

  20. Protein sequences bound to mineral surfaces persist into deep time

    PubMed Central

    Demarchi, Beatrice; Hall, Shaun; Roncal-Herrero, Teresa; Freeman, Colin L; Woolley, Jos; Crisp, Molly K; Wilson, Julie; Fotakis, Anna; Fischer, Roman; Kessler, Benedikt M; Rakownikow Jersie-Christensen, Rosa; Olsen, Jesper V; Haile, James; Thomas, Jessica; Marean, Curtis W; Parkington, John; Presslee, Samantha; Lee-Thorp, Julia; Ditchfield, Peter; Hamilton, Jacqueline F; Ward, Martyn W; Wang, Chunting Michelle; Shaw, Marvin D; Harrison, Terry; Domínguez-Rodrigo, Manuel; MacPhee, Ross DE; Kwekason, Amandus; Ecker, Michaela; Kolska Horwitz, Liora; Chazan, Michael; Kröger, Roland; Thomas-Oates, Jane; Harding, John H; Cappellini, Enrico; Penkman, Kirsty; Collins, Matthew J

    2016-01-01

    Proteins persist longer in the fossil record than DNA, but the longevity, survival mechanisms and substrates remain contested. Here, we demonstrate the role of mineral binding in preserving the protein sequence in ostrich (Struthionidae) eggshell, including from the palaeontological sites of Laetoli (3.8 Ma) and Olduvai Gorge (1.3 Ma) in Tanzania. By tracking protein diagenesis back in time we find consistent patterns of preservation, demonstrating authenticity of the surviving sequences. Molecular dynamics simulations of struthiocalcin-1 and -2, the dominant proteins within the eggshell, reveal that distinct domains bind to the mineral surface. It is the domain with the strongest calculated binding energy to the calcite surface that is selectively preserved. Thermal age calculations demonstrate that the Laetoli and Olduvai peptides are 50 times older than any previously authenticated sequence (equivalent to ~16 Ma at a constant 10°C). DOI: http://dx.doi.org/10.7554/eLife.17092.001 PMID:27668515

  1. Comparison of the bonding between ML(+) and ML2(+) (M = metal, L = noble gas)

    NASA Technical Reports Server (NTRS)

    Bauschlicher, Charles W., Jr.; Partridge, Harry; Langhoff, Stephen R.

    1990-01-01

    Ab initio calculations are reported of the spectroscopic constants for the low-lying states of the molecular ions ML2(+), where M = Li, Na, Mg, V, Fe, Co, Ni and Cu, and where L is usually Ar. Comparison with existing analogous calculations on the ML(+) ions shows how the bonding and binding energy change with the addition of a second noble gas atom. The second binding energy is predicted to be essentially the same as the first for the Li, Na, Mg, and V ions, but larger for the Fe, Co, Ni and Cu ions. The binding energies of the transition metal noble gas ions are not accurately predicted at the SCF level, because correlation is required to describe their M(0)Ln(+) character. All trends can be explained in terms of promotion and hybridization on the metal ion.

  2. Metal binding characterization and conformational studies using Raman microscopy of resin-bound poly(aspartic acid).

    PubMed

    Stair, Jacqueline L; Holcombe, James A

    2007-03-01

    The metal binding capacities, conditional stability constants, and secondary structure of immobilized polyaspartic acid (PLAsp) (n = 6, 20, and 30) on TentaGel resin were determined when binding Mg2+, Co2+, Cd2+, and Ni2+. Metal binding to the synthesized peptides was evaluated using breakthrough curves from a packed microcolumn and flame atomic absorption spectrophotometry (FAAS) detection. The metal capacities reached values of 590, 2160, and 3710 mumol of metal/g of resin for the 6-mer, 20-mer, and 30-mer, respectively, and this resulted in 2-3 residues per metal for all peptides and metals tested. Surprisingly, the concentrated environment of the resin along with the spatial distribution of attachment groups allowed for most residues to participate in metal binding regardless of the peptide length. Conditional stability constants calculated using single metal binding isotherms indicated that binding strength decreased as the chain length increased on the resin. Raman microscopy on single beads was used to determine PLAsp secondary structure, and all peptides were of a mixed conformation (i.e., beta-sheets, alpha-helices, random chain, etc.) during neutral conditioning and metal binding. Uniquely, the longer 20-mer and 30-mer peptides showed a distinct change from a mixed conformation to beta-sheets and alpha-helices during metal release with acid. This study confirms that metal release by longer immobilized peptides is often assisted by a conformational change, which easily spoils the binding cavity, while shorter peptides may release metal primarily by H+ displacement.

  3. Theoretical studies of alkyl radicals in the NaY and HY zeolites.

    PubMed

    Ghandi, Khashayar; Zahariev, Federico E; Wang, Yan Alexander

    2005-08-18

    Interplay of quantum mechanical calculations and experimental data on hyperfine coupling constants of ethyl radical in zeolites at several temperatures was engaged to study the geometries and binding energies and to predict the temperature dependence of hyperfine splitting of a series of alkyl radicals in zeolites for the first time. The main focus is on the hyperfine interaction of alkyl radicals in the NaY and HY zeolites. The hyperfine splitting for neutral free radicals and free radical cations is predicted for different zeolite environments. This information can be used to establish the nature of the muoniated alkyl radicals in the NaY and HY zeolites via muSR experiments. The muon hyperfine coupling constants of the ethane radical cation in these zeolites are very large with relatively little dependence on temperature. It was found that the intramolecular dynamics of alkyl free radicals are only weakly affected by their strong binding to zeolites. In contrast, the substrate binding has a significant effect on their intermolecular dynamics.

  4. Photoinduced interaction studies on N-(2-methylthiophenyl)-2-hydroxy-1-naphthadiamine with TiO2 nanoparticles: a combined experimental and theoretical (DFT and spectroscopic) approach.

    PubMed

    Pushpam, S; Gayathri, S; Ramakrishnan, V

    2014-12-10

    Schiff base derivative synthesized by the reaction of 2-(methylthio) aniline and 2-hydroxy-1-naphthaldehyde exhibits keto-amine tautomerism in methanol solvent. The fluorescence quenching of N-(2-methyl thiophenyl)-2-hydroxy-1-naphthadiamine (NMTHN) by TiO2 nanoparticles in methanol has been studied. The excitation and emission peaks have been observed at 439 and 509nm respectively. The apparent association constant has been deduced from the absorption spectral changes of NMTHN-TiO2 nanoparticles using Bensi-Hildebrand equation. The number of binding sites and the binding constant have been calculated from the relevant fluorescence data. Quenching of fluorescence of NMTHN by TiO2 could be due to a dynamic mode. Density Functional Theory (DFT) calculations also have been performed to study the charge distribution of NMTHN-TiO2 both in ground and excited states. The HOMO-LUMO analysis of NMTHN-TiO2 in the ground state has been made. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. Synthesis, DNA Binding, and Antiproliferative Activity of Novel Acridine-Thiosemicarbazone Derivatives

    PubMed Central

    de Almeida, Sinara Mônica Vitalino; Lafayette, Elizabeth Almeida; Gomes da Silva, Lúcia Patrícia Bezerra; Amorim, Cézar Augusto da Cruz; de Oliveira, Tiago Bento; Gois Ruiz, Ana Lucia Tasca; de Carvalho, João Ernesto; de Moura, Ricardo Olímpio; Beltrão, Eduardo Isidoro Carneiro; de Lima, Maria do Carmo Alves; de Carvalho Júnior, Luiz Bezerra

    2015-01-01

    In this work, the acridine nucleus was used as a lead-compound for structural modification by adding different substituted thiosemicarbazide moieties. Eight new (Z)-2-(acridin-9-ylmethylene)-N-phenylhydrazinecarbothioamide derivatives (3a–h) were synthesized, their antiproliferative activities were evaluated, and DNA binding properties were performed with calf thymus DNA (ctDNA) by electronic absorption and fluorescence spectroscopies. Both hyperchromic and hypochromic effects, as well as red or blue shifts were demonstrated by addition of ctDNA to the derivatives. The calculated binding constants ranged from 1.74 × 104 to 1.0 × 106 M−1 and quenching constants from −0.2 × 104 to 2.18 × 104 M−1 indicating high affinity to ctDNA base pairs. The most efficient compound in binding to ctDNA in vitro was (Z)-2-(acridin-9-ylmethylene)-N-(4-chlorophenyl) hydrazinecarbothioamide (3f), while the most active compound in antiproliferative assay was (Z)-2-(acridin-9-ylmethylene)-N-phenylhydrazinecarbothioamide (3a). There was no correlation between DNA-binding and in vitro antiproliferative activity, but the results suggest that DNA binding can be involved in the biological activity mechanism. This study may guide the choice of the size and shape of the intercalating part of the ligand and the strategic selection of substituents that increase DNA-binding or antiproliferative properties. PMID:26068233

  6. Characterization of Protein-Carbohydrate Interactions by NMR Spectroscopy.

    PubMed

    Grondin, Julie M; Langelaan, David N; Smith, Steven P

    2017-01-01

    Solution-state nuclear magnetic resonance (NMR) spectroscopy can be used to monitor protein-carbohydrate interactions. Two-dimensional 1 H- 15 N heteronuclear single quantum coherence (HSQC)-based techniques described in this chapter can be used quickly and effectively to screen a set of possible carbohydrate binding partners, to quantify the dissociation constant (K d ) of any identified interactions, and to map the carbohydrate binding site on the structure of the protein. Here, we describe the titration of a family 32 carbohydrate binding module from Clostridium perfringens (CpCBM32) with the monosaccharide N-acetylgalactosamine (GalNAc), in which we calculate the apparent dissociation of the interaction, and map the GalNAc binding site onto the structure of CpCBM32.

  7. In vitro study on binding interaction of quinapril with bovine serum albumin (BSA) using multi-spectroscopic and molecular docking methods.

    PubMed

    Shi, Jie-Hua; Pan, Dong-Qi; Jiang, Min; Liu, Ting-Ting; Wang, Qi

    2017-08-01

    The binding interaction between quinapril (QNPL) and bovine serum albumin (BSA) in vitro has been investigated using UV absorption spectroscopy, steady-state fluorescence spectroscopic, synchronous fluorescence spectroscopy, 3D fluorescence spectroscopy, Fourier transform infrared spectroscopy, circular dichroism, and molecular docking methods for obtaining the binding information of QNPL with BSA. The experimental results confirm that the quenching mechanism of the intrinsic fluorescence of BSA induced by QNPL is static quenching based on the decrease in the quenching constants of BSA in the presence of QNPL with the increase in temperature and the quenching rates of BSA larger than 10 10  L mol -1  s -1 , indicating forming QNPL-BSA complex through the intermolecular binding interaction. The binding constant for the QNPL-BSA complex is in the order of 10 5  M -1 , indicating there is stronger binding interaction of QNPL with BSA. The analysis of thermodynamic parameters together with molecular docking study reveal that the main binding forces in the binding process of QNPL with BSA are van der Waal's forces and hydrogen bonding interaction. And, the binding interaction of BSA with QNPL is an enthalpy-driven process. Based on Förster resonance energy transfer, the binding distance between QNPL and BSA is calculated to be 2.76 nm. The results of the competitive binding experiments and molecular docking confirm that QNPL binds to sub-domain IIA (site I) of BSA. It is confirmed there is a slight change in the conformation of BSA after binding QNPL, but BSA still retains its secondary structure α-helicity.

  8. Calculations of binding affinity between C8-substituted GTP analogs and the bacterial cell-division protein FtsZ

    PubMed Central

    Hritz, Jozef; Läppchen, Tilman

    2010-01-01

    The FtsZ protein is a self-polymerizing GTPase that plays a central role in bacterial cell division. Several C8-substituted GTP analogs are known to inhibit the polymerization of FtsZ by competing for the same binding site as its endogenous activating ligand GTP. Free energy calculations of the relative binding affinities to FtsZ for a set of five C8-substituted GTP analogs were performed. The calculated values agree well with the available experimental data, and the main contribution to the free energy differences is determined to be the conformational restriction of the ligands. The dihedral angle distributions around the glycosidic bond of these compounds in water are known to vary considerably depending on the physicochemical properties of the substituent at C8. However, within the FtsZ protein, this substitution has a negligible influence on the dihedral angle distributions, which fall within the narrow range of −140° to −90° for all investigated compounds. The corresponding ensemble average of the coupling constants 3J(C4,H1′) is calculated to be 2.95 ± 0.1 Hz. The contribution of the conformational selection of the GTP analogs upon binding was quantified from the corresponding populations. The obtained restraining free energy values follow the same trend as the relative binding affinities to FtsZ, indicating their dominant contribution. PMID:20559630

  9. [Binding interaction of harpagoside and bovine serum albumin: spectroscopic methodologies and molecular docking].

    PubMed

    Cao, Tuan-Wu; Huang, Wen-Bing; Shi, Jian-Wei; He, Wei

    2018-03-01

    Scrophularia ningpoensis has exhibited a variety of biological activities and been used as a pharmaceutical product for the treatment of inflammatory ailment, rheumatoid arthritis, osteoarthritis and so on. Harpagoside (HAR) is considerer as a main bioactive compound in this plant. Serum albumin has important physiological roles in transportation, distribution and metabolism of many endogenous and exogenous substances in body. It is of great significance to study the interaction mechanism between HAR and bovine serum albumin (BSA). The mechanism of interaction between HAR and BSA was investigated using 2D and 3D fluorescence, synchronous florescence, ultraviolet spectroscopy and molecular docking. According to the analysis of fluorescence spectra, HAR could strongly quench the fluorescence of BSA, and the static quenching process indicated that the decrease in the quenching constant was observed with the increase in temperature. The magnitude of binding constants (KA) was more than 1×10⁵ L·mol⁻¹, and the number of binding sites(n) was approximate to 1. The thermodynamic parameters were calculated through analysis of fluorescence data with Stern-Volmer and Van't Hoff equation. The calculated enthalpy change (ΔH) and entropy change (ΔS) implied that the main interaction forces of HAR with BSA were the bonding interaction between van der Waals forces and hydrogen. The negative values of energy (ΔG) demonstrated that the binding of HAR with BSA was a spontaneous and exothermic process. The binding distance(r) between HAR and BSA was calculated to be about 2.80 nm based on the theory of Frster's non-radiation energy transfer, which indicated that energy is likely to be transfer from BSA to HAR. Both synchronous and 3D florescence spectroscopy clearly revealed that the microenvironment and conformation of BSA changed during the binding interaction between HAR and BSA. The molecular docking analysis revealed HAR is more inclined to BSA and human serum albumin (HSA) in subdomain ⅡA (Sudlow's site I). This study will provide valuable information for understanding the action mechanism of HAR. Copyright© by the Chinese Pharmaceutical Association.

  10. Study on the interactions between toxic nitroanilines and lysozyme by spectroscopic approaches and molecular modeling.

    PubMed

    Gu, Yunlan; Wang, Yanqing; Zhang, Hongmei

    2018-05-05

    Being exogenous environmental pollutants, nitroanilines (NAs) are highly toxic and have mutagenic and carcinogenic activity. Being lack of studies on interactions between NAs and lysozyme at molecular level, the binding interactions of lysozyme with o-nitroaniline (oNA), m-nitroaniline (mNA) and p-nitroaniline (pNA) were investigated by means of steady-state fluorescence, synchronous fluorescence, UV-vis absorption spectroscopy, as well as molecular modeling. The experimental results revealed that the fluorescence of lysozyme is quenched by oNA and mNA through a static quenching, while the fluorescence quenching triggered by pNA is a combined dynamic and static quenching. The number of binding sites (n) and the binding constant (K b ) corresponding thermodynamic parameters ΔH ⊖ , ΔS ⊖ , ΔG ⊖ at different temperatures were calculated. The reactions between NAs and lysozyme were spontaneous and entropy driven and the binding of NAs to lysozyme induced conformation changes of lysozyme. The difference of the position of -NO 2 group affected the binding and the binding constants K b decreased in the following pattern: K b (pNA) >K b (mNA) >K b (oNA). Molecular docking studies were performed to reveal the most favorable binding sites of NAs on lysozyme. Our recently results could offer mechanistic insights into the nature of the binding interactions between NAs and lysozyme and provide information about the toxicity risk of NAs to human health. Copyright © 2018 Elsevier B.V. All rights reserved.

  11. Studies on binding mechanism between carotenoids from sea buckthorn and thermally treated α-lactalbumin

    NASA Astrophysics Data System (ADS)

    Dumitraşcu, Loredana; Ursache, Florentina Mihaela; Stănciuc, Nicoleta; Aprodu, Iuliana

    2016-12-01

    Sea buckthorn is a natural food ingredient rich in bioactive compounds such as carotenoids, tocopherols, sterols, flavonoids, lipids, vitamins, tannins and minerals. Herein, fluorescence and UV-vis techniques were used to study the interaction of heat treated α-lactalbumin (α-LA) with carotenoids from sea buckthorn berries extract (CSB) and β-carotene. Further atomic level details on the interaction between α-LA and β-carotene were obtained by means of molecular modelling techniques. The quenching rate constants, binding constants, and number of binding sites were calculated in the presence of CSB. The emission spectral studies revealed that, CSB have the ability to bind α-LA and form a ground state complex via static quenching process. Maximum degree of quenching was reached at 100 °C, where β-carotene and CSB quenched the Trp fluorescence of α-LA by 56% and 47%, respectively. In order to reveal the interaction between CSB and α-LA, the thermodynamic parameters were determined from the van't Hoff plot based on the temperature dependence of the binding constant. In agreement with the in silico observations, the thermodynamic parameters enabled us to consider that the association between α-LA and β-carotene is a spontaneous process driven by enthalpy, dominated mainly by the van der Waals interaction, but hydrophobic interactions might also be considered. The interaction between CSB and α-LA was further confirmed by UV-vis absorption spectra, where a blue shift of position was noticed at higher temperature suggesting the complex formation. The results provided here supply a better understanding of the binding of CSB to α-LA, which can be further exploited in designing new healthy food applications.

  12. Binding of warfarin influences the acid-base equilibrium of H242 in sudlow site I of human serum albumin.

    PubMed

    Perry, Jennifer L; Goldsmith, Michael R; Williams, T Richard; Radack, Kyle P; Christensen, Trine; Gorham, Justin; Pasquinelli, Melissa A; Toone, Eric J; Beratan, David N; Simon, John D

    2006-01-01

    Sudlow Site I of human serum albumin (HSA) is located in subdomain IIA of the protein and serves as a binding cavity for a variety of ligands. In this study, the binding of warfarin (W) is examined using computational techniques and isothermal titration calorimetry (ITC). The structure of the docked warfarin anion (W-) to Site I is similar to that revealed by X-ray crystallography, with a calculated binding constant of 5.8 x 10(5) M(-1). ITC experiments (pH 7.13 and I = 0.1) carried out in three different buffers (MOPs, phosphate and Tris) reveal binding of W- is accompanied by uptake of 0.30+/-0.02 protons from the solvent. This measurement suggests that the binding of W- is stabilized by an ion-pair interaction between protonated H242 and the phenoxide group of W-.

  13. Interaction studies of resistomycin from Streptomyces aurantiacus AAA5 with calf thymus DNA and bovine serum albumin

    NASA Astrophysics Data System (ADS)

    Vijayabharathi, R.; Sathyadevi, P.; Krishnamoorthy, P.; Senthilraja, D.; Brunthadevi, P.; Sathyabama, S.; Priyadarisini, V. Brindha

    2012-04-01

    Resistomycin, a secondary metabolite produced by Streptomyces aurantiacus AAA5. The binding interaction of resistomycin with calf thymus DNA (CT DNA) and bovine serum albumin (BSA) was investigated by spectrophotometry, spectrofluorimetry, circular dichroism (CD) and synchronous fluorescence techniques under physiological conditions in vitro. Absorption spectral studies along with the fluorescence competition with ethidium bromide measurements and circular dichroism clearly suggest that the resistomycin bind with CT DNA relatively strong via groove binding. BSA interaction results revealed that the drug was found to quench the fluorescence intensity of the protein through a static quenching mechanism. The number of binding sites 'n' and apparent binding constant 'K' calculated according to the Scatchard equation exhibit a good binding property to bovine serum albumin protein. In addition, the results observed from synchronous fluorescence measurements clearly demonstrate the occurrence of conformational changes of BSA upon addition of the test compound.

  14. The effect of Cu 2+ or Fe 3+ on the noncovalent binding of rutin with bovine serum albumin by spectroscopic analysis

    NASA Astrophysics Data System (ADS)

    Li, Daojin; Zhu, Mei; Xu, Chen; Chen, Jianjun; Ji, Baoming

    2011-01-01

    The interaction of rutin to bovine serum albumin (BSA) in aqueous solution was investigated by fluorescence spectra and ultraviolet-visible (UV-vis) spectra at pH 7.40. There are also some metal ions present in blood plasma, thus the research about the effect of metal ions on the interaction of drugs with proteins is crucial. Therefore, we have studied the effect of Cu 2+ or Fe 3+ on the interaction between rutin and BSA by using spectroscopic technique at pH 7.40, for the first time. The results of fluorescence titration indicated that rutin could quench the intrinsic fluorescence of BSA in a static quenching way. The binding sites number ( n), the binding constant ( K) and the spatial-distance ( r) of rutin with BSA without or with Cu 2+ or Fe 3+ at 310 K were calculated. The result showed that the presence of Cu 2+ or Fe 3+ increased the binding constant and changed the binding distance between the acceptor and the donor, which possibly results from the formation of metal ions-BSA complex. The effect of rutin on the conformation of BSA was also analyzed using UV under experimental conditions. Furthermore, the fluorescence displacement experiments indicated that rutin is situated within subdomain IIA of BSA.

  15. Signatures of van der Waals binding: A coupling-constant scaling analysis

    NASA Astrophysics Data System (ADS)

    Jiao, Yang; Schröder, Elsebeth; Hyldgaard, Per

    2018-02-01

    The van der Waals (vdW) density functional (vdW-DF) method [Rep. Prog. Phys. 78, 066501 (2015), 10.1088/0034-4885/78/6/066501] describes dispersion or vdW binding by tracking the effects of an electrodynamic coupling among pairs of electrons and their associated exchange-correlation holes. This is done in a nonlocal-correlation energy term Ecnl, which permits density functional theory calculation in the Kohn-Sham scheme. However, to map the nature of vdW forces in a fully interacting materials system, it is necessary to also account for associated kinetic-correlation energy effects. Here, we present a coupling-constant scaling analysis, which permits us to compute the kinetic-correlation energy Tcnl that is specific to the vdW-DF account of nonlocal correlations. We thus provide a more complete spatially resolved analysis of the electrodynamical-coupling nature of nonlocal-correlation binding, including vdW attraction, in both covalently and noncovalently bonded systems. We find that kinetic-correlation energy effects play a significant role in the account of vdW or dispersion interactions among molecules. Furthermore, our mapping shows that the total nonlocal-correlation binding is concentrated to pockets in the sparse electron distribution located between the material fragments.

  16. Anticancer drug-DNA interactions measured using a photoinduced electron-transfer mechanism based on luminescent quantum dots.

    PubMed

    Yuan, Jipei; Guo, Weiwei; Yang, Xiurong; Wang, Erkang

    2009-01-01

    A sensing system based on the photoinduced electron transfer of quantum dots (QDs) was designed to measure the interaction of anticancer drug and DNA, taking mitoxantrone (MTX) as a model drug. MTX adsorbed on the surface of QDs can quench the photoluminescence (PL) of QDs through the photoinduced electron-transfer process; and then the addition of DNA will bring the restoration of QDs PL intensity, as DNA can bind with MTX and remove it from QDs. Sensitive detection of MTX with the detection limit of 10 nmol L(-1) and a linear detection range from 10 nmol L(-1) to 4.5 micromol L(-1) was achieved. The dependence of PL intensity on DNA amount was successfully utilized to investigate the interactions between MTX and DNA. Both the binding constants and the sizes of binding site of MTX-DNA interactions were calculated based on the equations deduced for the PL recovery process. The binding constant obtained in our experiment was generally consistent with previous reports. The sensitive and speedy detection of MTX as well as the avoidance of modification or immobilization process made this system suitable and promising in the drug-DNA interaction studies.

  17. Effect of van der Waals interactions on the structural and binding properties of GaSe

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sarkisov, Sergey Y., E-mail: sarkisov@mail.tsu.ru; Kosobutsky, Alexey V., E-mail: kosobutsky@kemsu.ru; Kemerovo State University, Krasnaya 6, 650043 Kemerovo

    The influence of van der Waals interactions on the lattice parameters, band structure, elastic moduli and binding energy of layered GaSe compound has been studied using projector-augmented wave method within density functional theory. We employed the conventional local/semilocal exchange-correlation functionals and recently developed van der Waals functionals which are able to describe dispersion forces. It is found that application of van der Waals density functionals allows to substantially increase the accuracy of calculations of the lattice constants a and c and interlayer distance in GaSe at ambient conditions and under hydrostatic pressure. The pressure dependences of the a-parameter, Ga–Ga, Ga–Semore » bond lengths and Ga–Ga–Se bond angle are characterized by a relatively low curvature, while c(p) has a distinct downward bowing due to nonlinear shrinking of the interlayer spacing. From the calculated binding energy curves we deduce the interlayer binding energy of GaSe, which is found to be in the range 0.172–0.197 eV/layer (14.2–16.2 meV/Å{sup 2}). - Highlights: • Effects of van der Waals interactions are analyzed using advanced density functionals. • Calculations with vdW-corrected functionals closely agree with experiment. • Interlayer binding energy of GaSe is estimated to be 14.2–16.2 meV/Å{sup 2}.« less

  18. Determination of human serum albumin using an intramolecular charge transfer fluorescence probe: 4'-dimethylamino-2,5-dihydroxychalcone.

    PubMed

    Xu, Zhicheng; Yang, Weibing; Dong, Chuan

    2005-09-15

    A new intramolecular charge transfer fluorescence probe, namely, 4'-dimethylamino-2,5-dihydroxychalcone (DMADHC), exhibited dramatic enhancement of fluorescence intensity with an accompanying blue shift of the emission maximum when the concentration of human serum albumin (HSA) was increased. Binding to HSA also caused a progressive shift in the absorption spectrum of DMADHC, and a clear isosbestic point appeared. The binding site number and binding constant were calculated. Thermodynamic parameters were given and possible binding site was speculated. The optimum conditions for the determination of HSA were also investigated. A new, fast, and simple spectrofluorimetric method for the determination of HSA was developed. In the detection of HSA in samples of human plasma, this method gave values close to that of the Erythrosin B method.

  19. A highly selective colorimetric and fluorescent chemosensor for Al(III) based-on simple naphthol in aqueous solution

    NASA Astrophysics Data System (ADS)

    Liu, Zhaodi; Xu, Huajie; Sheng, Liangquan; Chen, Shuisheng; Huang, Deqian; Liu, Jie

    2016-03-01

    A colorimetric and fluorescent chemosensor (L) for Al(III) was synthesized and fully characterized. L could be both used as a colorimetric and fluorescent chemosensor for the detection of Al3 + ions with low detection limit (8.87 × 10- 7 M) in CH3CN-H2O (1:1, v/v) solution. The binding ratio of L-Al3 + was determined from the Job plot (absorption and fluorescence spectra) and MALDI-TOF MS data to be 1:1. The binding constant (Ka) of Al3 + binding to L was calculated to be 4.8 × 105 M- 1 from a Benesi-Hildebrand plot. Moreover, the binding site of L with Al3 + was determined by 1H NMR titration experiment.

  20. Packaging of single DNA molecules by the yeast mitochondrial protein Abf2p: reinterpretation of recent single molecule experiments.

    PubMed

    Stigter, Dirk

    2004-07-01

    Brewer et al. (Biophys. J. 85 (2003) 2519-2524) have studied the compaction of dsDNA in a double flow cell by observing the extension of stained DNA tethered in buffer solutions with or without Abf2p. They use a Langmuir adsorption model in which one Abf2p molecule adsorbs on one site on the DNA, and the binding constant, K, is given as the ratio of the experimental rates of adsorption and desorption. This paper presents an improved interpretation. Instead of Langmuir adsorption we use the more appropriate McGhee-von Hippel (J. Mol. Biol. 86 (1974) 469-489) theory for the adsorption of large ligands to a one-dimensional lattice. We assume that each adsorbed molecule shortens the effective contour length of DNA by the foot print of Abf2p of 27 base pairs. When Abf2p adsorbs to DNA stretched in the flowing buffer solution, we account for a tension effect that decreases the adsorption rate and the binding constant by a factor of 2 to 4. The data suggest that the accessibility to Abf2p decreases significantly with increasing compaction of DNA, resulting in a lower adsorption rate and a lower binding constant. The kinetics reported by Brewer et al. (Biophys. J. 85 (2003) 2519-2524) lead to a binding constant K=3.6 x 10(6) M(-1) at the beginning, and to K=5 x 10(5) M(-1) near the end of a compaction run, more than an order of magnitude lower than the value K=2.57 x 10(7) M(-1) calculated by Brewer et al. (Biophys. J. 85 (2003) 2519-2524).

  1. Evaluation of anthocyanins in Aronia melanocarpa/BSA binding by spectroscopic studies.

    PubMed

    Wei, Jie; Xu, Dexin; Zhang, Xiao; Yang, Jing; Wang, Qiuyu

    2018-05-02

    The interaction between Anthocyanins in Aronia melanocarpa (AMA) and bovine serum albumin (BSA) were studied in this paper by multispectral technology, such as fluorescence quenching titration, circular dichroism (CD) spectroscopy and Fourier transform infrared spectroscopy (FTIR). The results of the fluorescence titration revealed that AMA could strongly quench the intrinsic fluorescence of BSA by static quenching. The apparent binding constants K SV and number of binding sites n of AMA with BSA were obtained by fluorescence quenching method. The thermodynamic parameters, enthalpy change (ΔH) and entropy change (ΔS), were calculated to be 18.45 kJ mol -1  > 0 and 149.72 J mol -1  K -1  > 0, respectively, which indicated that the interaction of AMA with BSA was driven mainly by hydrophobic forces. The binding process was a spontaneous process of Gibbs free energy change. Based on Förster's non-radiative energy transfer theory, the distance r between the donor (BSA) and the receptor (AMA) was calculated to be 3.88 nm. Their conformations were analyzed using infrared spectroscopy and CD. The results of multispectral technology showed that the binding of AMA to BSA induced the conformational change of BSA.

  2. Virtual screening using molecular simulations.

    PubMed

    Yang, Tianyi; Wu, Johnny C; Yan, Chunli; Wang, Yuanfeng; Luo, Ray; Gonzales, Michael B; Dalby, Kevin N; Ren, Pengyu

    2011-06-01

    Effective virtual screening relies on our ability to make accurate prediction of protein-ligand binding, which remains a great challenge. In this work, utilizing the molecular-mechanics Poisson-Boltzmann (or Generalized Born) surface area approach, we have evaluated the binding affinity of a set of 156 ligands to seven families of proteins, trypsin β, thrombin α, cyclin-dependent kinase (CDK), cAMP-dependent kinase (PKA), urokinase-type plasminogen activator, β-glucosidase A, and coagulation factor Xa. The effect of protein dielectric constant in the implicit-solvent model on the binding free energy calculation is shown to be important. The statistical correlations between the binding energy calculated from the implicit-solvent approach and experimental free energy are in the range of 0.56-0.79 across all the families. This performance is better than that of typical docking programs especially given that the latter is directly trained using known binding data whereas the molecular mechanics is based on general physical parameters. Estimation of entropic contribution remains the barrier to accurate free energy calculation. We show that the traditional rigid rotor harmonic oscillator approximation is unable to improve the binding free energy prediction. Inclusion of conformational restriction seems to be promising but requires further investigation. On the other hand, our preliminary study suggests that implicit-solvent based alchemical perturbation, which offers explicit sampling of configuration entropy, can be a viable approach to significantly improve the prediction of binding free energy. Overall, the molecular mechanics approach has the potential for medium to high-throughput computational drug discovery. Copyright © 2011 Wiley-Liss, Inc.

  3. Cell wall reactivity of acidophilic and alkaliphilic bacteria determined by potentiometric titrations and Cd adsorption experiments.

    PubMed

    Kenney, Janice P L; Fein, Jeremy B

    2011-05-15

    In this study, we used potentiometric titrations and Cd adsorption experiments to determine the binding capacities of two acidophilic (A. cryptum and A. acidophilum) and two alkaliphilic (B. pseudofirmus and B. circulans) bacterial species in order to determine if any consistent trends could be observed relating bacterial growth environment to proton and Cd binding properties and to compare those binding behaviors to those of neutrophilic bacteria. All of the bacterial species studied exhibited significant proton buffering over the pH range in this study, with the alkaliphiles exhibiting significantly higher acidity constants than the acidophiles as well as the neutrophilic bacterial consortia. The calculated average site concentrations for each of the bacteria in this study are within 2σ experimental error of each other, with the exception of A. cryptum, which has a significantly higher Site 2 concentration than the other species. Despite differing acidity constants between the acidophiles and alkaliphiles, all bacteria except A. cryptum exhibited remarkably similar Cd adsorption behavior to each other, and the observed extent of adsorption was also similar to that predicted from a generalized model derived using neutrophilic bacterial consortia. This study demonstrates that bacteria that grow under extreme conditions exhibit similar proton and metal adsorption behavior to that of previously studied neutrophilic species and that a single set of proton and metal binding constants can be used to model the behavior of bacterial adsorption under a wide range of environmental conditions.

  4. First-Principles Study on the Gilbert Damping Constants of Transition Metal Alloys, Fe--Ni and Fe--Pt Systems

    NASA Astrophysics Data System (ADS)

    Sakuma, Akimasa

    2012-08-01

    We adapt the tight-binding linear muffin-tin orbital (TB-LMTO) method to the torque-correlation model for the Gilbert damping constant α and perform the first-principles calculation for disordered transition metal alloys, Fe--Ni and Fe--Pt systems, within the framework of the CPA. Quantitatively, the calculated α values are about one-half of the experimental values, whereas the variations in the Fermi level dependence of α are much larger than these discrepancies. As expected, we confirm in the (Fe--Ni)1-XPtX and FePt systems that Pt atoms certainly enhance α owing to their large spin--orbit coupling. For the disordered alloys, we find that α decreases with increasing chemical degree of order in a wide range.

  5. Fluorescence studies on binding of pyrene and its derivatives to humic acid

    NASA Astrophysics Data System (ADS)

    Nakashima, K.; Maki, M.; Ishikawa, F.; Yoshikawa, T.; Gong, Y.-K.; Miyajima, T.

    2007-07-01

    Binding of pyrene (PyH) and its derivatives to humic acid (HA) has been studied by fluorescence spectroscopy. The nature of the interaction between HA and pyrene derivatives are extensively investigated by employing three derivatives ranging from anionic to cationic compounds: 1-pyrenebutylic acid (PyA), 1-pyrenemethanol (PyM), and 1-pyrenebutyltrimethylammonium bromide (PyB). Binding constants between HA and PyX (X = H, A, M, B) are obtained by steady-state fluorescence quenching techniques, and it is found that PyB has a markedly large binding constant among the pyrene family. This is attributed to a strong electrostatic interaction between cationic PyB and anionic HA. The result suggests that an electrostatic interaction plays a dominant role in binding of pyrenes to humic acid. The importance of electrostatic interaction was also confirmed by a salt effect on the binding constant. Influence of collisional quenching on the binding constant, which causes overestimation of the binding constant, was examined by time-resolved fluorescence spectroscopy as well as temperature effect in steady-state fluorescence measurements. It is elucidated that collisional quenching does not much bring overestimation into the binding constants.

  6. Inner reorganization limiting electron transfer controlled hydrogen bonding: intra- vs. intermolecular effects.

    PubMed

    Martínez-González, Eduardo; Frontana, Carlos

    2014-05-07

    In this work, experimental evidence of the influence of the electron transfer kinetics during electron transfer controlled hydrogen bonding between anion radicals of metronidazole and ornidazole, derivatives of 5-nitro-imidazole, and 1,3-diethylurea as the hydrogen bond donor, is presented. Analysis of the variations of voltammetric EpIcvs. log KB[DH], where KB is the binding constant, allowed us to determine the values of the binding constant and also the electron transfer rate k, confirmed by experiments obtained at different scan rates. Electronic structure calculations at the BHandHLYP/6-311++G(2d,2p) level for metronidazole, including the solvent effect by the Cramer/Truhlar model, suggested that the minimum energy conformer is stabilized by intramolecular hydrogen bonding. In this structure, the inner reorganization energy, λi,j, contributes significantly (0.5 eV) to the total reorganization energy of electron transfer, thus leading to a diminishment of the experimental k.

  7. Spectroscopic and molecular modeling studies of the interaction between cytidine and human serum albumin and its analytical application.

    PubMed

    Cui, Fengling; Wang, Junli; Yao, Xiaojun; Wang, Li; Zhang, Qiangzhai; Qu, Guirong

    In this study, the interaction between cytidine and human serum albumin (HSA) was investigated for the first time by fluorescence spectroscopy in combination with UV absorption spectrum and molecular modeling under simulative physiological conditions. Experimental results indicated that cytidine had a strong ability to quench the intrinsic fluorescence of human serum albumin. The binding constants (K) at different temperatures, thermodynamic parameter enthalpy changes (DeltaH) and entropy changes (DeltaS) of HSA-cytidine had been calculated according to the relevant fluorescence data, which indicated that the hydrophobic and electrostatic interactions played a major role, which was in agreement with the results of molecular modeling study. In addition, the effects of other ions on the binding constants were also studied. Furthermore, synchronous fluorescence technology was successfully applied to the determination of human serum albumin added into the cytidine solution.

  8. A Comparative Study on the Photophysics and Photochemistry of Xanthene Dyes in the Presence of Polyamidoamine (PAMAM) Dendrimers.

    PubMed

    Arbeloa, Ernesto Maximiliano; Previtali, Carlos Mario; Bertolotti, Sonia Graciela

    2018-04-17

    The photophysical and photochemical properties of the xanthene dyes Eosin Y, Erythrosin B, and Rose Bengal are evaluated in the presence of amino-terminated polyamidoamine (PAMAM) dendrimers of relatively high generation (G3-G5) in alkaline aqueous solution. UV/Vis absorption and fluorescence spectra of the dyes show bathochromic shifts, which correlate with the size of the dendrimer. Binding constants (K bind ) are calculated from absorption data. The resulting high K bind values indicate strong interactions between both molecules. Triplet-triplet absorption spectra of the dyes are recorded by laser flash photolysis, and a decrease in the triplet lifetimes is observed in the presence of dendrimers. At the same time, an increase in the absorption of the semireduced form of the dyes is observed. Rate constants for triplet quenching ( 3 k q ) and radical quantum yields (Φ R ) are obtained. The results are explained by a very efficient electron-transfer process from PAMAM to xanthene dyes for all of the dye/dendrimer couples that are evaluated. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Investigation of glucose binding sites on insulin.

    PubMed

    Zoete, Vincent; Meuwly, Markus; Karplus, Martin

    2004-05-15

    Possible insulin binding sites for D-glucose have been investigated theoretically by docking and molecular dynamics (MD) simulations. Two different docking programs for small molecules were used; Multiple Copy Simultaneous Search (MCSS) and Solvation Energy for Exhaustive Docking (SEED) programs. The configurations resulting from the MCSS search were evaluated with a scoring function developed to estimate the binding free energy. SEED calculations were performed using various values for the dielectric constant of the solute. It is found that scores emphasizing non-polar interactions gave a preferential binding site in agreement with that inferred from recent fluorescence and NMR NOESY experiments. The calculated binding affinity of -1.4 to -3.5 kcal/mol is within the measured range of -2.0 +/- 0.5 kcal/mol. The validity of the binding site is suggested by the dynamical stability of the bound glucose when examined with MD simulations with explicit solvent. Alternative binding sites were found in the simulations and their relative stabilities were estimated. The motions of the bound glucose during molecular dynamics simulations are correlated with the motions of the insulin side chains that are in contact with it and with larger scale insulin motions. These results raise the question of whether glucose binding to insulin could play a role in its activity. The results establish the complementarity of molecular dynamics simulations and normal mode analyses with the search for binding sites proposed with small molecule docking programs. Copyright 2004 Wiley-Liss, Inc.

  10. Evidence that Chemical Chaperone 4-Phenylbutyric Acid Binds to Human Serum Albumin at Fatty Acid Binding Sites

    PubMed Central

    James, Joel; Shihabudeen, Mohamed Sham; Kulshrestha, Shweta; Goel, Varun; Thirumurugan, Kavitha

    2015-01-01

    Endoplasmic reticulum stress elicits unfolded protein response to counteract the accumulating unfolded protein load inside a cell. The chemical chaperone, 4-Phenylbutyric acid (4-PBA) is a FDA approved drug that alleviates endoplasmic reticulum stress by assisting protein folding. It is found efficacious to augment pathological conditions like type 2 diabetes, obesity and neurodegeneration. This study explores the binding nature of 4-PBA with human serum albumin (HSA) through spectroscopic and molecular dynamics approaches, and the results show that 4-PBA has high binding specificity to Sudlow Site II (Fatty acid binding site 3, subdomain IIIA). Ligand displacement studies, RMSD stabilization profiles and MM-PBSA binding free energy calculation confirm the same. The binding constant as calculated from fluorescence spectroscopic studies was found to be kPBA = 2.69 x 105 M-1. Like long chain fatty acids, 4-PBA induces conformational changes on HSA as shown by circular dichroism, and it elicits stable binding at Sudlow Site II (fatty acid binding site 3) by forming strong hydrogen bonding and a salt bridge between domain II and III of HSA. This minimizes the fluctuation of HSA backbone as shown by limited conformational space occupancy in the principal component analysis. The overall hydrophobicity of W214 pocket (located at subdomain IIA), increases upon occupancy of 4-PBA at any FA site. Descriptors of this pocket formed by residues from other subdomains largely play a role in compensating the dynamic movement of W214. PMID:26181488

  11. Free enthalpies of replacing water molecules in protein binding pockets.

    PubMed

    Riniker, Sereina; Barandun, Luzi J; Diederich, François; Krämer, Oliver; Steffen, Andreas; van Gunsteren, Wilfred F

    2012-12-01

    Water molecules in the binding pocket of a protein and their role in ligand binding have increasingly raised interest in recent years. Displacement of such water molecules by ligand atoms can be either favourable or unfavourable for ligand binding depending on the change in free enthalpy. In this study, we investigate the displacement of water molecules by an apolar probe in the binding pocket of two proteins, cyclin-dependent kinase 2 and tRNA-guanine transglycosylase, using the method of enveloping distribution sampling (EDS) to obtain free enthalpy differences. In both cases, a ligand core is placed inside the respective pocket and the remaining water molecules are converted to apolar probes, both individually and in pairs. The free enthalpy difference between a water molecule and a CH(3) group at the same location in the pocket in comparison to their presence in bulk solution calculated from EDS molecular dynamics simulations corresponds to the binding free enthalpy of CH(3) at this location. From the free enthalpy difference and the enthalpy difference, the entropic contribution of the displacement can be obtained too. The overlay of the resulting occupancy volumes of the water molecules with crystal structures of analogous ligands shows qualitative correlation between experimentally measured inhibition constants and the calculated free enthalpy differences. Thus, such an EDS analysis of the water molecules in the binding pocket may give valuable insight for potency optimization in drug design.

  12. Free enthalpies of replacing water molecules in protein binding pockets

    NASA Astrophysics Data System (ADS)

    Riniker, Sereina; Barandun, Luzi J.; Diederich, François; Krämer, Oliver; Steffen, Andreas; van Gunsteren, Wilfred F.

    2012-12-01

    Water molecules in the binding pocket of a protein and their role in ligand binding have increasingly raised interest in recent years. Displacement of such water molecules by ligand atoms can be either favourable or unfavourable for ligand binding depending on the change in free enthalpy. In this study, we investigate the displacement of water molecules by an apolar probe in the binding pocket of two proteins, cyclin-dependent kinase 2 and tRNA-guanine transglycosylase, using the method of enveloping distribution sampling (EDS) to obtain free enthalpy differences. In both cases, a ligand core is placed inside the respective pocket and the remaining water molecules are converted to apolar probes, both individually and in pairs. The free enthalpy difference between a water molecule and a CH3 group at the same location in the pocket in comparison to their presence in bulk solution calculated from EDS molecular dynamics simulations corresponds to the binding free enthalpy of CH3 at this location. From the free enthalpy difference and the enthalpy difference, the entropic contribution of the displacement can be obtained too. The overlay of the resulting occupancy volumes of the water molecules with crystal structures of analogous ligands shows qualitative correlation between experimentally measured inhibition constants and the calculated free enthalpy differences. Thus, such an EDS analysis of the water molecules in the binding pocket may give valuable insight for potency optimization in drug design.

  13. Like-Charge Guanidinium Pairing between Ligand and Receptor: An Unusual Interaction for Drug Discovery and Design?

    PubMed

    Yang, Yang; Xu, Zhijian; Zhang, Zhengyan; Yang, Zhuo; Liu, Yingtao; Wang, Jinan; Cai, Tingting; Li, Shujin; Chen, Kaixian; Shi, Jiye; Zhu, Weiliang

    2015-09-10

    A database survey in this study revealed for the first time that there are 227 counterintuitive like-charge guanidinium pairings (Gdm(+)-Arg pairings) between ligands and receptors in the Protein Data Bank, implying the potential guanidinium-arginine binding between guanidine-containing drugs and their target proteins. Furthermore, there are 145 guanidine-containing molecules in the DrugBank, showing the prevalence of guanidinium groups in drugs. It has also been reported that the introduction of a guanidinium group forming Gdm(+)-Arg pairing improved the potency of the drug by more than 8-fold in a typical case. On the basis of the survey, six ligand-protein complexes with typical Gdm(+)-Arg pairings were chosen for QM/MM calculations. The calculations at the B97-D/6-311++g(d,p) level revealed that the interaction could be as strong as -1.0 to -2.5 kcal/mol in DMSO and water, comparable to common intermolecular interactions. The calculations also unveiled that the Gdm(+)-Arg pairing interactions change from repulsive to attractive with the increase of dielectric constant, suggesting that the dielectric constant has a general stabilization effect on the Gdm(+)-Arg pairing. This study suggested that the like-charge guanidinium pairing interaction could be used not only for tuning the physical and chemical properties of drug leads but also for improving ligand binding affinity.

  14. Nonadiabatic effects on the charge transfer rate constant: A numerical study of a simple model system

    NASA Astrophysics Data System (ADS)

    Shin, Seokmin; Metiu, Horia

    1995-06-01

    We use a minimal model to study the effects of the upper electronic states on the rate of a charge transfer reaction. The model consists of three ions and an electron, all strung on a line. The two ions at the ends of the structure are held fixed, but the middle ion and the electron are allowed to move in one dimension, along the line joining them. The system has two bound states, one in which the electron ties the movable ion to the fixed ion at the left, and the other in which the binding takes place to the fixed ion at the right. The transition between these bound states is a charge transfer reaction. We use the flux-flux correlation function theory to perform two calculations of the rate constant for this reaction. In one we obtain numerically the exact rate constant. In the other we calculate the exact rate constant for the case when the reaction proceeds exclusively on the ground adiabatic state. The difference between these calculations gives the magnitude of the nonadiabatic effects. We find that the nonadiabatic effects are fairly large even when the gap between the ground and the excited adiabatic state substantially exceeds the thermal energy. The rate in the nonadiabatic theory is always smaller than that of the adiabatic one. Both rate constants satisfy the Arrhenius formula. Their activation energies are very close but the nonadiabatic one is always higher. The nonadiabatic preexponential is smaller, due to the fact that the upper electronic state causes an early recrossing of the reactive flux. The description of this reaction in terms of two diabatic states, one for reactants and one for products, is not always adequate. In the limit when nonadiabaticity is small, we need to use a third diabatic state, in which the electron binds to the moving ion as the latter passes through the transition state; this is an atom transfer process. The reaction changes from an atom transfer to an electron transfer, as nonadiabaticity is increased.

  15. Electrochemical, spectroscopic, and theoretical studies on the interaction between azathioprine and DNA.

    PubMed

    Jalali, Fahimeh; Rasaee, Gelareh

    2015-11-01

    Possible interaction between immunosuppressive drug, azathioprine, and calf thymus DNA was explored by cyclic voltammetry, spectrophotometry, competitive spectrofluorimetry, circular dichroism spectroscopy (CD), and viscosity measurements. Cyclic voltammetry showed negative shift in the reduction peak of azathioprine in the presence of DNA, and large decrease in peak current, referring to the predominance of electrostatic forces. The binding constant was calculated to be 1.22×10(3)M(-1). Absorption hyperchromism without shift in wavelength was observed when DNA was added to azathioprine solution. Competitive fluorescence experiments were conducted by using Hoechst 33258 and methylene blue as probes for minor groove and intercalation binding modes, respectively. The studies showed that azathioprine could release Hoechst 33258, while negligible effect was detected in the case of methylene blue. Stern-Volmer quenching constant (KSV) and complex formation constant (Kf) were obtained from the fluorescence measurements to be 7.6×10(3)M(-1) and 7.76×10(4)M(-1), respectively, at 298K. Enthalpy and entropy changes during the interaction between azathioprine and DNA were calculated from Van't Hoff plot (ΔH=-20.2kJmol(-1); ΔS=26.11Jmol(-1)K(-1) at 298K) which showed an exothermic spontaneous reaction, and involvement of electrostatic forces in the complex formation with DNA. Moreover, circular dichroism studies revealed that azathioprine induced detectable changes in the negative band of DNA spectrum. Viscosity of DNA solution decreased in the presence of azathioprine, showed a non-intercalative mode of interaction. Finally, molecular docking calculations showed that in the lowest energy level of drug-DNA complex, azathioprine approaches the minor grooves of DNA. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. Binding investigation on the interaction between Methylene Blue (MB)/TiO2 nanocomposites and bovine serum albumin by resonance light-scattering (RLS) technique and fluorescence spectroscopy.

    PubMed

    Li, Yuesheng; Zhang, Yue; Sun, Shaofa; Zhang, Aiqing; Liu, Yi

    2013-11-05

    The interaction between Methylene Blue (MB)/TiO2 nanocomposites and bovine serum albumin (BSA) was investigated by resonance light scattering (RLS), fluorescence, three-dimension spectra and UV-vis absorbance spectroscopy. Several factors which may influence the RLS intensity were also investigated before characterizing MB/TiO2-BSA complex. It was proved that the mechanism of MB/TiO2 nanocomposites binding to BSA was mainly a result of the formation of MB/TiO2-BSA complex. The binding constant of MB/TiO2-BSA is 0.762 × 10(-5) L mol(-1) at 298K. By calculating the binding constant at different temperature, the thermodynamic parameters ΔH, ΔG, and ΔS can be observed and deduced that the hydrophobic interactions played an important role to stabilize the complex. The distance r (3.73 nm) between donor (BSA) and acceptor (MB/TiO2) was obtained according to fluorescence resonance energy transfer (FRET). The binding site for MB/TiO2 on BSA was mainly located in sub-domain IIA. The UV-vis absorbance, circular dichroism and three dimension fluorescence have also been used to investigate the effect of MB/TiO2 on the conformation of BSA. Copyright © 2013 Elsevier B.V. All rights reserved.

  17. Mixed bilayer containing dipalmitoylphosphatidylcholine and dipalmitoylphosphatidylserine: lipid complexation, ion binding, and electrostatics.

    PubMed

    Pandit, Sagar A; Bostick, David; Berkowitz, Max L

    2003-11-01

    Two mixed bilayers containing dipalmitoylphosphatidylcholine and dipalmitoylphosphatidylserine at a ratio of 5:1 are simulated in NaCl electrolyte solutions of different concentration using the molecular dynamics technique. Direct NH.O and CH.O hydrogen bonding between lipids was observed to serve as the basis of interlipid complexation. It is deduced from our results and previous studies that dipalmitoylphosphatidylcholine alone is less likely to form interlipid complexes than in the presence of bound ions or other bilayer "impurities" such as dipalmitoylphosphatidylserine. The binding of counterions is observed and quantitated. Based upon the calculated ion binding constants, the Gouy-Chapman surface potential (theta) is calculated. In addition we calculated the electrostatic potential profile (Phi) by twice integrating the system charge distribution. A large discrepancy between and the value of Phi at the membrane surface is observed. However, at "larger" distance from the bilayer surface, a qualitative similarity in the z-profiles of Phi and psi(GC) is seen. The discrepancy between the two potential profiles near the bilayer surface is attributed to the discrete and nonbulk-like nature of water in the interfacial region and to the complex geometry of this region.

  18. Interaction of an antiepileptic drug, lamotrigine with human serum albumin (HSA): Application of spectroscopic techniques and molecular modeling methods.

    PubMed

    Poureshghi, Fatemeh; Ghandforoushan, Parisa; Safarnejad, Azam; Soltani, Somaieh

    2017-01-01

    Lamotrigine (an epileptic drug) interaction with human serum albumin (HSA) was investigated by fluorescence, UV-Vis, FTIR, CD spectroscopic techniques, and molecular modeling methods. Binding constant (K b ) of 5.74×10 3 and number of binding site of 0.97 showed that there is a slight interaction between lamotrigine and HSA. Thermodynamic studies was constructed using the flourimetric titrations in three different temperatures and the resulted data used to calculate the parameters using Vant Hoff equation. Decreased Stern Volmer quenching constant by enhanced temperature revealed the static quenching mechanism. Negative standard enthalpy (ΔH) and standard entropy (ΔS) changes indicated that van der Waals interactions and hydrogen bonds were dominant forces which facilitate the binding of Lamotrigine to HSA, the results were confirmed by molecular docking studies which showed no hydrogen binding. The FRET studies showed that there is a possibility of energy transfer between Trp214 and lamotrigine. Also the binding of lamotrigine to HSA in the studied concentrations was not as much as many other drugs, but the secondary structure of the HSA was significantly changed following the interaction in a way that α-helix percentage was reduced from 67% to 57% after the addition of lamotrigine in the molar ratio of 4:1 to HSA. According to the docking studies, lamotrigine binds to IB site preferably. Copyright © 2016. Published by Elsevier B.V.

  19. Characterization of the interaction between furosemide and bovine serum albumin

    NASA Astrophysics Data System (ADS)

    Zhou, Neng; Liang, Yi-Zeng; Wang, Ping

    2008-01-01

    The interaction of furosemide (FU), one kind of potent diuretic, with bovine serum albumin (BSA) has been investigated at physiological acidity (pH 7.40) by fluorescent technique. Displacement experiment with site markers and Synchronous fluorescence clearly reveal that there are non-specific binding sites of FU with BSA. This conclusion was supported by the binding studies in the presence of the hydrophobic probe 1-anilinonaphthalene-8-sulfonic acid (ANS) and in different ionic strength. The binding sites number n and binding constant K were measured. The thermodynamic parameters Δ H°, Δ G°, Δ S° at different temperatures were calculated. The effects of other four diuretics, some common metal ions and bioactive components from herbal medicine on the binding are also considered. The results show only bumetanide has strong effect on FU's binding. Moreover, several data processing methods presently used were evaluated with Data of the same set. Quite different results were obtained from these methods suggesting more attention should be paid to the data processing methods.

  20. Biochemical investigation of yttrium(III) complex containing 1,10-phenanthroline: DNA binding and antibacterial activity.

    PubMed

    Khorasani-Motlagh, Mozhgan; Noroozifar, Meissam; Moodi, Asieh; Niroomand, Sona

    2013-03-05

    Characterization of the interaction between yttrium(III) complex containing 1,10-phenanthroline as ligand, [Y(phen)2Cl(OH2)3]Cl2⋅H2O, and DNA has been carried out by UV absorption, fluorescence spectra and viscosity measurements in order to investigate binding mode. The experimental results indicate that the yttrium(III) complex binds to DNA and absorption is decreasing in charge transfer band with the increase in amount of DNA. The binding constant (Kb) at different temperatures as well as thermodynamic parameters, enthalpy change (ΔH°) and entropy change (ΔS°), were calculated according to relevant fluorescent data and Vant' Hoff equation. The results of interaction mechanism studies, suggested that groove binding plays a major role in the binding of the complex and DNA. The activity of yttrium(III) complex against some bacteria was tested and antimicrobial screening tests shown growth inhibitory activity in the presence of yttrium(III) complex. Copyright © 2013 Elsevier B.V. All rights reserved.

  1. Dynamics, magnetic properties, and electron binding energies of H2O2 in water.

    PubMed

    C Cabral, Benedito J

    2017-06-21

    Results for the magnetic properties and electron binding energies of H 2 O 2 in liquid water are presented. The adopted methodology relies on the combination of Born-Oppenheimer molecular dynamics and electronic structure calculations. The Keal-Tozer functional was applied for predicting magnetic shieldings and H 2 O 2 intramolecular spin-spin coupling constants. Electron binding energies were calculated with electron propagator theory. In water, H 2 O 2 is a better proton donor than proton acceptor, and the present results indicate that this feature is important for understanding magnetic properties in solution. In comparison with the gas-phase, H 2 O 2 atoms are deshielded in water. For oxygen atoms, the deshielding is mainly determined by structural/conformational changes. Hydrogen-bond interactions explain the deshielding of protons in water. The predicted chemical shift for the H 2 O 2 protons in water (δ∼11.8 ppm) is in good agreement with experimental information (δ=11.2 ppm). The two lowest electron binding energies of H 2 O 2 in water (10.7±0.5 and 11.2±0.5 eV) are in reasonable agreement with experiment. In keeping with data from photoelectron spectroscopy, an ∼1.6 eV red-shift of the two first ionisation energies relative to the gas-phase is observed in water. The strong dependence of magnetic properties on changes of the electronic density in the nuclei environment is illustrated by a correlation between the σ( 17 O) magnetic shielding constant and the energy gap between the [2a] lowest valence and [1a] core orbitals of H 2 O 2 .

  2. Second-order Kinetics of DTPA and Plutonium in Rat Plasma

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Miller, Guthrie; Poudel, Deepesh; Klumpp, John Allan

    We report that in 2008, Serandour et al. reported on their in vitro experiment involving rat plasma samples obtained after an intravenous intake of plutonium citrate. Different amounts of DTPA were added to the plasma samples and the percentage of low-molecular-weight plutonium measured. Only when the DTPA dosage was three orders of magnitude greater than the recommended 30 μmol/kg was 100% of the plutonium apparently in the form of chelate. These data were modeled assuming three competing chemical reactions with other molecules that bind with plutonium. Here, time-dependent second-order kinetics of these reactions are calculated, intended eventually to become partmore » of a complete biokinetic model of DTPA action on actinides in laboratory animals or humans. The probability distribution of the ratio of stability constants for the reactants was calculated using Markov Chain Monte Carlo. In conclusion, these calculations substantiate that the inclusion of more reactions is needed in order to be in agreement with known stability constants.« less

  3. Second-order Kinetics of DTPA and Plutonium in Rat Plasma

    DOE PAGES

    Miller, Guthrie; Poudel, Deepesh; Klumpp, John Allan; ...

    2017-11-15

    We report that in 2008, Serandour et al. reported on their in vitro experiment involving rat plasma samples obtained after an intravenous intake of plutonium citrate. Different amounts of DTPA were added to the plasma samples and the percentage of low-molecular-weight plutonium measured. Only when the DTPA dosage was three orders of magnitude greater than the recommended 30 μmol/kg was 100% of the plutonium apparently in the form of chelate. These data were modeled assuming three competing chemical reactions with other molecules that bind with plutonium. Here, time-dependent second-order kinetics of these reactions are calculated, intended eventually to become partmore » of a complete biokinetic model of DTPA action on actinides in laboratory animals or humans. The probability distribution of the ratio of stability constants for the reactants was calculated using Markov Chain Monte Carlo. In conclusion, these calculations substantiate that the inclusion of more reactions is needed in order to be in agreement with known stability constants.« less

  4. Internal twisting motion dependent conductance of an aperiodic DNA molecule

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wiliyanti, Vandan, E-mail: vandan.wiliyanti@ui.ac.id; Yudiarsah, Efta

    The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from amore » base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.« less

  5. Caffeine and sulfadiazine interact differently with human serum albumin: A combined fluorescence and molecular docking study

    NASA Astrophysics Data System (ADS)

    Islam, Mullah Muhaiminul; Sonu, Vikash K.; Gashnga, Pynsakhiat Miki; Moyon, N. Shaemningwar; Mitra, Sivaprasad

    2016-01-01

    The interaction and binding behavior of the well-known drug sulfadiazine (SDZ) and psychoactive stimulant caffeine (CAF) with human serum albumin (HSA) was monitored by in vitro fluorescence titration and molecular docking calculations under physiological condition. The quenching of protein fluorescence on addition of CAF is due to the formation of protein-drug complex in the ground state; whereas in case of SDZ, the experimental results were explained on the basis of sphere of action model. Although both these compounds bind preferentially in Sudlow's site 1 of the protein, the association constant is approximately two fold higher in case of SDZ (∼4.0 × 104 M-1) in comparison with CAF (∼9.3 × 102 M-1) and correlates well with physico-chemical properties like pKa and lipophilicity of the drugs. Temperature dependent fluorescence study reveals that both SDZ and CAF bind spontaneously with HSA. However, the binding of SDZ with the protein is mainly governed by the hydrophobic forces in contrast with that of CAF; where, the interaction is best explained in terms of electrostatic mechanism. Molecular docking calculation predicts the binding of these drugs in different location of sub-domain IIA in the protein structure.

  6. Investigation of the interaction between naringin and human serum albumin

    NASA Astrophysics Data System (ADS)

    Zhang, Yaheng; Li, Ying; Dong, Lijun; Li, Jiazhong; He, Wenying; Chen, Xingguo; Hu, Zhide

    2008-03-01

    The interaction between naringin and human serum albumin (HSA) has been thoroughly studied by fluorescence quenching technique in combination with UV absorption spectroscopy, Fourier transform infrared (FT-IR) spectroscopy, circular dichroism (CD) spectroscopy and molecular modeling method. Under the simulative physiological conditions, fluorescence data revealed the presence of the binding site on HSA and its binding constants ( K) are 1.62 × 10 4, 1.68 × 10 4, 1.72 × 10 4, and 1.79 × 10 4 M -1 at 289, 296, 303, and 310 K, respectively. The alterations of protein secondary structure in the presence of naringin aqueous solution were qualitative and quantitative calculated by the evidence from CD and FT-IR spectroscopes. In addition, according to the Van't Hoff equation, the thermodynamic functions standard enthalpy (Δ H0) and standard entropy (Δ S0) for the reaction were calculated to be 3.45 kJ mol -1 and 92.52 J mol -1 K -1. These results indicated that naringin binds to HSA mainly by a hydrophobic interaction. Furthermore, the displacement experiments confirmed that naringin could bind to the site I of HSA, which was also in agreement with the result of the molecular modeling study.

  7. Towards understanding the E. coli PNP binding mechanism and FRET absence between E. coli PNP and formycin A.

    PubMed

    Prokopowicz, Małgorzata; Greń, Bartosz; Cieśla, Joanna; Kierdaszuk, Borys

    2017-11-01

    The aim of this study is threefold: (1) augmentation of the knowledge of the E. coli PNP binding mechanism; (2) explanation of the previously observed 'lack of FRET' phenomenon and (3) an introduction of the correction (modified method) for FRET efficiency calculation in the PNP-FA complexes. We present fluorescence studies of the two E. coli PNP mutants (F159Y and F159A) with formycin A (FA), that indicate that the aromatic amino acid is indispensable in the nucleotide binding, additional hydroxyl group at position 159 probably enhances the strength of binding and that the amino acids pair 159-160 has a great impact on the spectroscopic properties of the enzyme. The experiments were carried out in hepes and phosphate buffers, at pH7 and 8.3. Two methods, a conventional and a modified one, that utilizes the dissociation constant, for calculations of the energy transfer efficiency (E) and the acceptor-to-donor distance (r) between FA and the Tyr (energy donor) were employed. Total difference spectra were calculated for emission spectra (λ ex 280nm, 295nm, 305nm and 313nm) for all studied systems. Time-resolved techniques allowed to conclude the existence of a specific structure formed by amino acids at positions 159 and 160. The results showed an unexpected pattern change of FRET in the mutants, when compared to the wild type enzyme and a probable presence of a structure created between 159 and 160 residue, that might influence the binding efficiency. Additionally, we confirmed the indispensable role of the modification of the FRET efficiency (E) calculation on the fraction of enzyme saturation in PNP-FA systems. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Alpha-amylase inhibitor, CS-1036 binds to serum amylase in a concentration-dependent and saturable manner.

    PubMed

    Honda, Tomohiro; Kaneno-Urasaki, Yoko; Ito, Takashi; Kimura, Takako; Matsushima, Nobuko; Okabe, Hiromi; Yamasaki, Atsushi; Izumi, Takashi

    2014-03-01

    (2R,3R,4R)-4-hydroxy-2-(hydroxymethyl)pyrrolidin-3-yl 4-O-(6-deoxy-β-D-glucopyranosyl)-α-D-glucopyranoside (CS-1036), which is an α-amylase inhibitor, exhibited biphasic and sustained elimination with a long t1/2 (18.4-30.0 hours) in rats and monkeys, but exhibited a short t1/2 (3.7-7.9 hours) in humans. To clarify the species differences in the t1/2, the plasma protein binding of CS-1036 was evaluated by ultrafiltration. A concentration-dependent and saturable plasma protein binding of CS-1036 was observed in rats and monkeys with the dissociation rate constant (KD) of 8.95 and 27.2 nM, and maximal binding capacity (Bmax) of 52.8 and 22.1 nM, respectively. By the assessments of the recombinant amylase and immunoprecipitation, the major binding protein of CS-1036 in rats was identified as salivary amylase (KD 5.64 nM). CS-1036 also showed concentration-dependent and saturable binding to human salivary and pancreatic amylase, with similar binding affinity in rats. However, the protein binding of CS-1036 was constant in human plasma (≤10.2%) due to the lower serum amylase level compared with rats and monkeys. From the calculation of the unbound fraction (fu) in plasma based on in vitro KD and Bmax, the dose-dependent increase in fu after oral administration is speculated to lead to a dose-dependent increase in total body clearance and a high area under the curve/dose at lower doses, such as 0.3 mg/kg in rats.

  9. Electronic structure and exchange interactions in diluted semimagnetic semiconductors (Zn,Co)Se and (Zn,Mn)Se

    NASA Astrophysics Data System (ADS)

    Mašek, J.

    1991-05-01

    A comparative study of the electronic structure of (Zn,Co)Se and (Zn,Mn)Se is done by using a tight-binding version of the coherent potential approximation. The densities of states, relevant for a photoemission experiment, are calculated for a magnetically disordered phase. The exchange constant Jpd is obtained from the splitting of the valence band top in the ferromagnetic phase of the mixed crystal; Jdd is estimated from the energy of a spin reversal. We explain the large exchange constant in the Co-based systems as a result of efficient hybridization of the d-states with the valence band.

  10. Improving the treatment of coarse-grain electrostatics: CVCEL.

    PubMed

    Ceres, N; Lavery, R

    2015-12-28

    We propose an analytic approach for calculating the electrostatic energy of proteins or protein complexes in aqueous solution. This method, termed CVCEL (Circular Variance Continuum ELectrostatics), is fitted to Poisson calculations and is able to reproduce the corresponding energies for different choices of solute dielectric constant. CVCEL thus treats both solute charge interactions and charge self-energies, and it can also deal with salt solutions. Electrostatic damping notably depends on the degree of solvent exposure of the charges, quantified here in terms of circular variance, a measure that reflects the vectorial distribution of the neighbors around a given center. CVCEL energies can be calculated rapidly and have simple analytical derivatives. This approach avoids the need for calculating effective atomic volumes or Born radii. After describing how the method was developed, we present test results for coarse-grain proteins of different shapes and sizes, using different internal dielectric constants and different salt concentrations and also compare the results with those from simple distance-dependent models. We also show that the CVCEL approach can be used successfully to calculate the changes in electrostatic energy associated with changes in protein conformation or with protein-protein binding.

  11. Spectroscopic studies on the interactions between 3,4-dihydropyrimidin-2(1H)-ones and bovine serum albumin.

    PubMed

    Yu, Xianyong; Liu, Ronghua; Ji, Danhong; Xie, Jian; Yang, Fengxian; Li, Xiaofang; Huang, Haowen; Yi, Pinggui

    2010-09-15

    The interactions between 3,4-dihydropyrimidin-2(1H)-ones (DHPM) and bovine serum albumin (BSA) were investigated by fluorescence and ultraviolet spectroscopy under imitated physiological conditions. The experimental results showed that all DHPM could form complexes with BSA. Static quenching and non-radiation energy transfer are the main reasons leading to the fluorescence quenching. The binding constants (K(A)) and the number of binding sites (n) were calculated. According to Förster theory of non-radiation energy transfer, the binding distances (r) between BSA and DHPM are less than 7 nm. The relationship between different aryl groups in pyrimidine ring and the binding ability of DHPM with BSA is preliminarily discussed. Moreover, the synchronous fluorescence spectra indicated that the conformation of BSA has not been changed. Copyright 2010 Elsevier B.V. All rights reserved.

  12. Corrigendum to "Onset of η-nuclear binding in a pionless EFT approach" [Phys. Lett. B 771 (2017) 297-302

    NASA Astrophysics Data System (ADS)

    Barnea, N.; Bazak, B.; Friedman, E.; Gal, A.

    2017-12-01

    A three-body force acting between the η-meson and two nucleons was overlooked inadvertently in the model description and discussion in the published version of our paper "Onset of η-nuclear binding in a pionless EFT approach" [Phys. Lett. B 771 (2017) 297-302] while present in the actual numerical calculations. The stated conclusion that a stabilizing ηNN contact term was not needed is therefore incorrect. Such a three-body force, associated with a new low energy constant dηNNΛ, must be introduced at leading order to stabilize η-nucleus systems.

  13. Spectroscopic characterization of effective components anthraquinones in Chinese medicinal herbs binding with serum albumins

    NASA Astrophysics Data System (ADS)

    Bi, Shuyun; Song, Daqian; Kan, Yuhe; Xu, Dong; Tian, Yuan; Zhou, Xin; Zhang, Hanqi

    2005-11-01

    The interactions of serum albumins such as human serum albumin (HSA) and bovine serum albumin (BSA) with emodin, rhein, aloe-emodin and aloin were assessed employing fluorescence quenching and absorption spectroscopic techniques. The results obtained revealed that there are relatively strong binding affinity for the four anthraquinones with HSA and BSA and the binding constants for the interactions of anthraquinones with HSA or BSA at 20 °C were obtained. Anthraquinone-albumin interactions were studied at different temperatures and in the presence of some metal ions. And the competition binding of anthraquinones with serum albumins was also discussed. The Stern-Volmer curves suggested that the quenching occurring in the reactions was the static quenching process. The binding distances and transfer efficiencies for each binding reactions were calculated according to the Föster theory of non-radiation energy transfer. Using thermodynamic equations, the main action forces of these reactions were also obtained. The reasons of the different binding affinities for different anthraquinone-albumin reactions were probed from the point of view of molecular structures.

  14. Probing the binding reaction of cytarabine to human serum albumin using multispectroscopic techniques with the aid of molecular docking.

    PubMed

    Xu, Liang; Hu, Yan-Xi; Li, Jin; Liu, Yu-Feng; Zhang, Li; Ai, Hai-Xin; Liu, Hong-Sheng

    2017-08-01

    Cytarabine is a kind of chemotherapy medication. In the present study, the molecular interaction between cytarabine and human serum albumin (HSA) was investigated via fluorescence, UV-vis absorption, circular dichroism (CD) spectroscopy and molecular docking method under simulative physiological conditions. It was found that cytarabine could effectively quench the intrinsic fluorescence of HSA through a static quenching process. The apparent binding constants between drug and HSA at 288, 293 and 298K were estimated to be in the order of 10 3 L·mol -1 . The thermodynamic parameters ΔH°, ΔG°and ΔS° were calculated, in which the negative ΔG°suggested that the binding of cytarabine to HSA was spontaneous, moreover the negative ΔS°and negative ΔH°revealed that van der Waals force and hydrogen bonds were the major forces to stabilize the protein-cytarabine (1:1) complex. The competitive binding experiments showed that the primary binding site of cytarabine was located in the site I (subdomain IIA) of HSA. In addition, the binding distance was calculated to be 3.4nm according to the Förster no-radiation energy transfer theory. The analysis of CD and three-dimensional (3D) fluorescence spectra demonstrated that the binding of drug to HSA induced some conformational changes in HSA. The molecular docking study also led to the same conclusion obtained from the spectral results. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Alkoxy bridged binuclear rhenium (I) complexes as a potential sensor for β-amyloid aggregation.

    PubMed

    Sathish, Veerasamy; Babu, Eththilu; Ramdass, Arumugam; Lu, Zong-Zhan; Velayudham, Murugesan; Thanasekaran, Pounraj; Lu, Kuang-Lieh; Rajagopal, Seenivasan

    2014-12-01

    Alkoxy bridged binuclear rhenium(I) complexes are used as a probe for the selective and sensitive detection of aggregation of β-amyloid fibrils that are consorted with Alzheimer's disease (AD). The strong binding of the complexes is affirmed by the fluorescence enhancement and calculated binding constant value in the order of 10(5)M(-1) is obtained from the Scatchard plots. The binding of β-amyloid can be attributed to π-π stacking interaction of naphthalene moiety present in rhenium(I) complexes, and it is supported by docking studies. The selectivity is quite high towards other proteins and the formation of fibrils can be observed in the range of 30-40 nm through the AFM and TEM techniques. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. Analysis of the binding interaction in uric acid - Human hemoglobin system by spectroscopic techniques

    NASA Astrophysics Data System (ADS)

    Makarska-Bialokoz, Magdalena

    2017-05-01

    The binding interaction between human hemoglobin and uric acid has been studied for the first time, by UV-vis absorption and steady-state, synchronous and three-dimensional fluorescence techniques. Characteristic effects observed for human hemoglobin intrinsic fluorescence during interaction with uric acid at neutral pH point at the formation of stacking non-covalent and non-fluorescent complexes. All the calculated parameters, the binding, fluorescence quenching and bimolecular quenching rate constants, as well as Förster resonance energy transfer parameters confirm the existence of static quenching. The results of synchronous fluorescence measurements indicate that the fluorescence quenching of human hemoglobin originates both from Trp and Tyr residues and that the addition of uric acid could significantly hinder the physiological functions of human hemoglobin.

  17. The Role of Binding Site on the Mechanical Unfolding Mechanism of Ubiquitin

    NASA Astrophysics Data System (ADS)

    Cao, Penghui; Yoon, Gwonchan; Tao, Weiwei; Eom, Kilho; Park, Harold S.

    2015-03-01

    We apply novel atomistic simulations based on potential energy surface exploration to investigate the constant force-induced unfolding of ubiquitin. At the experimentally-studied force clamping level of 100 pN, we find a new unfolding mechanism starting with the detachment between β5 and β3 involving the binding site of ubiquitin, the Ile44 residue. This new unfolding pathway leads to the discovery of new intermediate configurations, which correspond to the end-to-end extensions previously seen experimentally. More importantly, it demonstrates the novel finding that the binding site of ubiquitin can be responsible not only for its biological functions, but also its unfolding dynamics. We also report in contrast to previous single molecule constant force experiments that when the clamping force becomes smaller than about 300 pN, the number of intermediate configurations increases dramatically, where almost all unfolding events at 100 pN involve an intermediate configuration. By directly calculating the life times of the intermediate configurations from the height of the barriers that were crossed on the potential energy surface, we demonstrate that these intermediate states were likely not observed experimentally due to their lifetimes typically being about two orders of magnitude smaller than the experimental temporal resolution.

  18. Quantification of transcription factor-DNA binding affinity in a living cell

    PubMed Central

    Belikov, Sergey; Berg, Otto G.; Wrange, Örjan

    2016-01-01

    The apparent dissociation constant (Kd) for specific binding of glucocorticoid receptor (GR) and androgen receptor (AR) to DNA was determined in vivo in Xenopus oocytes. The total nuclear receptor concentration was quantified as specifically retained [3H]-hormone in manually isolated oocyte nuclei. DNA was introduced by nuclear microinjection of single stranded phagemid DNA, chromatin is then formed during second strand synthesis. The fraction of DNA sites occupied by the expressed receptor was determined by dimethylsulphate in vivo footprinting and used for calculation of the receptor-DNA binding affinity. The forkhead transcription factor FoxA1 enhanced the DNA binding by GR with an apparent Kd of ∼1 μM and dramatically stimulated DNA binding by AR with an apparent Kd of ∼0.13 μM at a composite androgen responsive DNA element containing one FoxA1 binding site and one palindromic hormone receptor binding site known to bind one receptor homodimer. FoxA1 exerted a weak constitutive- and strongly cooperative DNA binding together with AR but had a less prominent effect with GR, the difference reflecting the licensing function of FoxA1 at this androgen responsive DNA element. PMID:26657626

  19. Equivalence of two approaches for modeling ion permeation through a transmembrane channel with an internal binding site

    NASA Astrophysics Data System (ADS)

    Zhou, Huan-Xiang

    2011-04-01

    Ion permeation through transmembrane channels has traditionally been modeled using two different approaches. In one approach, the translocation of the permeant ion through the channel pore is modeled as continuous diffusion and the rate of ion transport is obtained from solving the steady-state diffusion equation. In the other approach, the translocation of the permeant ion through the pore is modeled as hopping along a discrete set of internal binding sites and the rate of ion transport is obtained from solving a set of steady-state rate equations. In a recent work [Zhou, J. Phys. Chem. Lett. 1, 1973 (2010)], the rate constants for binding to an internal site were further calculated by modeling binding as diffusion-influenced reactions. That work provided the foundation for bridging the two approaches. Here we show that, by representing a binding site as an energy well, the two approaches indeed give the same result for the rate of ion transport.

  20. Binding energy of the donor impurities in GaAs-Ga 1- x Al x As quantum well wires with Morse potential in the presence of electric and magnetic fields

    NASA Astrophysics Data System (ADS)

    Aciksoz, Esra; Bayrak, Orhan; Soylu, Asim

    2016-10-01

    The behavior of a donor in the GaAs-Ga1-x Al x As quantum well wire represented by the Morse potential is examined within the framework of the effective-mass approximation. The donor binding energies are numerically calculated for with and without the electric and magnetic fields in order to show their influence on the binding energies. Moreover, how the donor binding energies change for the constant potential parameters (D e, r e, and a) as well as with the different values of the electric and magnetic field strengths is determined. It is found that the donor binding energy is highly dependent on the external electric and magnetic fields as well as parameters of the Morse potential. Project supported by the Turkish Science Research Council (TÜBİTAK) and the Financial Supports from Akdeniz and Nigde Universities.

  1. Binding of (-)-epigallocatechin-3-gallate with thermally-induced bovine serum albumin/ι-carrageenan particles.

    PubMed

    Li, Jinbing; Wang, Xiaoyong

    2015-02-01

    Novel thermally-induced BSA/ι-carrageenan particles are used as a protective carrier for (-)-epigallocatechin-3-gallate (EGCG). The addition of EGCG to BSA/ι-carrageenan particles can highly quench the intrinsic fluorescence of BSA, which is explained in terms of the binding of EGCG to the hydrophobic pockets of BSA mainly through the hydrophobic force. According to the double logarithm equation, the binding constant is determined as 1.1×10(8)M(-1) for the binding of EGCG with BSA/ι-carrageenan particles. The high binding affinity is ascribed to both the molecular structure of EGCG and the partial unfolding state of BSA in BSA/ι-carrageenan particles. The circular dichroism spectra and calculated α-helix of BSA suggest that the bound EGCG leads to a more random secondary structure of BSA. Furthermore, BSA/ι-carrageenan particles are found to be superior to native BSA and pure BSA particles for improving the stability and radical scavenging activity of EGCG. Copyright © 2014 Elsevier Ltd. All rights reserved.

  2. Genistein Binding to Copper(II)-Solvent Dependence and Effects on Radical Scavenging.

    PubMed

    Yang, Jing; Xu, Yi; Liu, Hao-Yu; Han, Rui-Min; Zhang, Jian-Ping; Skibsted, Leif H

    2017-10-18

    Genistein, but not daidzein, binds to copper(II) with a 1:2 stoichiometry in ethanol and with a 1:1 stoichiometry in methanol, indicating chelation by the 5-phenol and the 4-keto group of the isoflavonoid as demonstrated by the Jobs method and UV-visible absorption spectroscopy. In ethanol, the stability constants had the value 1.12 × 10 11 L²∙mol -2 for the 1:2 complex and in methanol 6.0 × 10⁵ L∙mol -1 for the 1:1 complex at 25 °C. Binding was not detected in water, as confirmed by an upper limit for the 1:1 stability constant of K = 5 mol -1 L as calculated from the difference in solvation free energy of copper(II) between methanol and the more polar water. Solvent molecules compete with genistein as demonstrated in methanol where binding stoichiometry changes from 1:2 to 1:1 compared to ethanol and methanol/chloroform (7/3, v / v ). Genistein binding to copper(II) increases the scavenging rate of the stable, neutral 2,2-diphenyl-1-picrylhydrazyl radical by more than a factor of four, while only small effects were seen for the short-lived but more oxidizing β -carotene radical cation using laser flash photolysis. The increased efficiency of coordinated genistein is concluded to depend on kinetic rather than on thermodynamic factors, as confirmed by the small change in reduction potential of -0.016 V detected by cyclic voltammetry upon binding of genistein to copper(II) in methanol/chloroform solutions.

  3. Towards accurate free energy calculations in ligand protein-binding studies.

    PubMed

    Steinbrecher, Thomas; Labahn, Andreas

    2010-01-01

    Cells contain a multitude of different chemical reaction paths running simultaneously and quite independently next to each other. This amazing feat is enabled by molecular recognition, the ability of biomolecules to form stable and specific complexes with each other and with their substrates. A better understanding of this process, i.e. of the kinetics, structures and thermodynamic properties of biomolecule binding, would be invaluable in the study of biological systems. In addition, as the mode of action of many pharmaceuticals is based upon their inhibition or activation of biomolecule targets, predictive models of small molecule receptor binding are very helpful tools in rational drug design. Since the goal here is normally to design a new compound with a high inhibition strength, one of the most important thermodynamic properties is the binding free energy DeltaG(0). The prediction of binding constants has always been one of the major goals in the field of computational chemistry, because the ability to reliably assess a hypothetical compound's binding properties without having to synthesize it first would save a tremendous amount of work. The different approaches to this question range from fast and simple empirical descriptor methods to elaborate simulation protocols aimed at putting the computation of free energies onto a solid foundation of statistical thermodynamics. While the later methods are still not suited for the screenings of thousands of compounds that are routinely performed in computational drug design studies, they are increasingly put to use for the detailed study of protein ligand interactions. This review will focus on molecular mechanics force field based free energy calculations and their application to the study of protein ligand interactions. After a brief overview of other popular methods for the calculation of free energies, we will describe recent advances in methodology and a variety of exemplary studies of molecular dynamics simulation based free energy calculations.

  4. Using two-dimensional correlation size exclusion chromatography (2D-CoSEC) to explore the size-dependent heterogeneity of humic substances for copper binding.

    PubMed

    Lee, Yun-Kyung; Hur, Jin

    2017-08-01

    Knowledge of the heterogeneous distribution of humic substances (HS) reactivities along a continuum of molecular weight (MW) is crucial for the systems where the HS MW is subject to change. In this study, two dimensional correlation spectroscopy combined with size exclusion chromatography (2D-CoSEC) was first utilized to obtain a continuous and heterogeneous presence of copper binding characteristics within bulk HS with respect to MW. HS solutions with varying copper concentrations were directly injected into a size exclusion chromatography (SEC) system with Tris-HCl buffer as a mobile phase. Several validation tests confirmed neither structural disruption of HS nor competition effect of the mobile phase used. Similar to batch systems, fluorescence quenching was observed in the chromatograms over a wide range of HS MW. 2D-CoSEC maps of a soil-derived HS (Elliot soil humic acid) showed the greater fluorescence quenching degrees with respect to the apparent MW on the order of 12500 Da > 10600 Da > 7000 Da > 15800 Da. The binding constants calculated based on modified Stern-Volmer equation were consistent with the 2D-CoSEC results. More heterogeneity of copper binding affinities within bulk HS was found for the soil-derived HS versus an aquatic HS. The traditional fluorescence quenching titration method using ultrafiltered HS size fractions failed to delineate detailed distribution of the copper binding characteristics, exhibiting a much shorter range of the binding constants than those obtained from the 2D-CoSEC. Our proposed technique demonstrated a great potential to describe metal binding characteristics of HS at high MW resolution, providing a clear picture of the size-dependent metal-HS interactions. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. The mechanism of tubulin-colchicine recognition--a kinetic study of the binding of a bicyclic colchicine analogue with a minor modification of the A ring.

    PubMed

    Dumortier, C; Potenziano, J L; Bane, S; Engelborghs, Y

    1997-10-01

    2-Methoxy-5-(2',3',4'-trimethoxy)-2,4,6-cycloheptatrien-1-one (MTC) is a colchicine analogue that lacks the B ring. 2-Methoxy-5-(2',4'-dimethoxyphenyl)-2,4,6-cycloheptatrien-1-one (MD) is an A-ring analogue of MTC, in which one methoxy group is replaced by a hydrogen atom. This paper describes the kinetic features of MDC binding to tubulin, and compares its behaviour with MTC to analyse the effect of the A-ring modification on the recognition process by tubulin. Binding is accompanied by a strong enhancement of MDC fluorescence and quenching of protein fluorescence. The kinetic and thermodynamic parameters were obtained from fluorescence stopped-flow measurements. The kinetics are described by a single exponential, indicating that this drug does not discriminate between the different tubulin isotypes. The observed pseudo-first-order rate constant of the fluorescence increase upon binding increases in a non-linear way, indicating that this ligand binds with a similar overall mechanism as colchicine and MTC, consisting of a fast initial binding of low affinity followed by a slower isomerisation step leading to full affinity. The K1 and k2 values for MDC at 25 degrees C were 540 +/- 65 M(-1) and 70 +/- 6 s(-1) respectively. From the temperature dependence, a reaction enthalpy change (deltaH(o)1) of the initial binding of 49 +/- 11 kJ/mol(-1) and an activation energy for the second step of 28 +/- 9 kJ/mol(-1) were calculated. Displacement experiments of bound MDC by MTC allowed the determination of a rate constant of reverse isomerisation of 0.60 +/- 0.07 s(-1) at 25 degrees C and the activation energy of 81 +/- 6 kJ/mol(-1). The overall binding constant was (6.3 +/- 0.2) x 10(4) M(-1) at 25 degrees C. Combination of these results with the kinetic parameters for association gives a full characterisation of the enthalpy pathway for the binding of MDC. The pathway of MDC is shown to differ considerably from that of MTC binding. Since its structural difference is located in ring A, this result indicates the use of ring A in the first step. The kinetics of the binding of MDC in the presence of some A-ring colchicine analogues (podophyllotoxin, 3',4',5'-trimethoxyacetophenone and N-acetylmescaline) and a C-ring analogue (tropolone methyl ether) suggest that the A and C rings are involved in the binding of MDC.

  6. New cobalt(II) and nickel(II) complexes of benzyl carbazate Schiff bases: Syntheses, crystal structures, in vitro DNA and HSA binding studies.

    PubMed

    Nithya, Palanivelu; Helena, Sannasi; Simpson, Jim; Ilanchelian, Malaichamy; Muthusankar, Aathi; Govindarajan, Subbiah

    2016-12-01

    In the present study, new Schiff base complexes with the composition [M(NCS) 2 (L1) 2 ]·nH 2 O, where M=Co (n=0) (1) and Ni (n=2) (2); [M(NCS) 2 (L2) 2 ], M=Co (3) and Ni (4) as well as [M(NCS) 2 (L3) 2 ], M=Co (5) and Ni (6); (L1=benzyl 2-(propan-2-ylidene)hydrazinecarboxylate, L2=benzyl 2-(butan-2-ylidene)hydrazinecarboxylate and L3=benzyl 2-(pentan-3-ylidene)hydrazinecarboxylate) have been synthesized by a template method. The complexes were characterised by analytical methods, spectroscopic studies, thermal and X-ray diffraction techniques. The structures of all the complexes explore that the metal(II) cation has a trans-planar coordination environment, the monomeric units containing a six-coordinated metal center in octahedral geometry with N-bound isothiocyanate anions coordinated as terminal ligands. Furthermore, the binding of the two Schiff base ligands to the metal centers involves the azomethine nitrogen and the carbonyl oxygen in mutually trans configuration. The binding interactions of all the complexes with Calf thymus-deoxyribonucleic acid (CT-DNA) and human serum albumin (HSA) have been investigated using absorption and emission spectral techniques. The CT-DNA binding properties of these complexes reveal that they bind to CT-DNA through a partial intercalation mode and the binding constant values were calculated using the absorption and emission spectral data. The binding constant values (~10×10 6 moldm -3 ) indicate strong binding of metal complexes with CT-DNA. HSA binding interaction studies showed that the cobalt and nickel complexes can quench the intrinsic fluorescence of HSA through static quenching process. Also, molecular docking studies were supported out to apprehend the binding interactions of these complexes with DNA and HSA which offer new understandings into the experimental model observations. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Direct Measurement of Equilibrium Constants for High-Affinity Hemoglobins

    PubMed Central

    Kundu, Suman; Premer, Scott A.; Hoy, Julie A.; Trent, James T.; Hargrove, Mark S.

    2003-01-01

    The biological functions of heme proteins are linked to their rate and affinity constants for ligand binding. Kinetic experiments are commonly used to measure equilibrium constants for traditional hemoglobins comprised of pentacoordinate ligand binding sites and simple bimolecular reaction schemes. However, kinetic methods do not always yield reliable equilibrium constants with more complex hemoglobins for which reaction mechanisms are not clearly understood. Furthermore, even where reaction mechanisms are clearly understood, it is very difficult to directly measure equilibrium constants for oxygen and carbon monoxide binding to high-affinity (KD ≪ 1 μM) hemoglobins. This work presents a method for direct measurement of equilibrium constants for high-affinity hemoglobins that utilizes a competition for ligands between the "target" protein and an array of "scavenger" hemoglobins with known affinities. This method is described for oxygen and carbon monoxide binding to two hexacoordinate hemoglobins: rice nonsymbiotic hemoglobin and Synechocystis hemoglobin. Our results demonstrate that although these proteins have different mechanisms for ligand binding, their affinities for oxygen and carbon monoxide are similar. Their large affinity constants for oxygen, 285 and ∼100 μM−1 respectively, indicate that they are not capable of facilitating oxygen transport. PMID:12770899

  8. New phthalimide-appended Schiff bases: Studies of DNA binding, molecular docking and antioxidant activities.

    PubMed

    Nayab, Pattan Sirajuddin; Akrema; Ansari, Istikhar A; Shahid, Mohammad; Rahisuddin

    2017-08-01

    Herein, we investigated new phthalimide-based Schiff base molecules as promising DNA-binding and free radical scavenging agents. Physicochemical properties of these molecules were demonstrated on the basis of elemental analysis, ultraviolet-visible (UV-Vis), infra-red (IR), 1 H and 13 C nuclear magnetic resonance (NMR) spectroscopy. All spectral data are agreed well with the proposed Schiff base framework. The DNA-binding potential of synthesized compounds were investigated by means of UV-visible, fluorescence, iodide quenching, circular dichroism, viscosity and thermal denaturation studies. The intrinsic binding constants (K b ) were calculated from absorption studies were found to be 1.1 × 10 4 and 1.0 × 10 4  M -1 for compounds 2a and 2b suggesting that compound 2a binding abilities with DNA were stronger than the compound 2b. Our studies showed that the presented compounds interact with DNA through groove binding. Molecular docking studies were carried out to predict the binding between Ct-DNA and test compounds. Interestingly, in silico predictions were corroborated with in vitro DNA-binding conclusions. Furthermore, the title compounds displayed remarkable antioxidant activity compared with reference standard. Copyright © 2016 John Wiley & Sons, Ltd.

  9. Study on interaction between curcumin and pepsin by spectroscopic and docking methods.

    PubMed

    Ying, Ming; Huang, Fengwen; Ye, Haidong; Xu, Hong; Shen, Liangliang; Huan, Tianwen; Huang, Shitong; Xie, Jiangfeng; Tian, Shengli; Hu, Zhangli; He, Zhendan; Lu, Jun; Zhou, Kai

    2015-08-01

    The interaction between curcumin and pepsin was investigated by fluorescence, synchronous fluorescence, UV-vis absorption, circular dichroism (CD), and molecular docking. Under physiological pH value in stomach, the fluorescence of pepsin can be quenched effectively by curcumin via a combined quenching process. Binding constant (Ka) and binding site number (n) of curcumin to pepsin were obtained. According to the theory of Förster's non-radiation energy transfer, the distance r between pepsin and curcumin was found to be 2.45 nm within the curcumin-pepsin complex, which implies that the energy transfer occurs between curcumin and pepsin, leading to the quenching of pepsin fluorescence. Fluorescence experiments also suggest that curcumin is located more closely to tryptophan residues than tyrosine residues. CD spectra together with UV-vis absorbance studies show that binding of curcumin to pepsin results in the extension of peptide strands of pepsin with loss of some β-sheet structures. Thermodynamic parameters calculated from the binding constants at different temperatures reveal that hydrophobic force plays a major role in stabilizing the curcumin-pepsin complex. In addition, docking results support the above experimental findings and suggest the possible hydrogen bonds of curcumin with Thr-77, Thr-218, and Glu-287 of pepsin, which help further stabilize the curcumin-pepsin complex. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. Predicting Binding Free Energy Change Caused by Point Mutations with Knowledge-Modified MM/PBSA Method.

    PubMed

    Petukh, Marharyta; Li, Minghui; Alexov, Emil

    2015-07-01

    A new methodology termed Single Amino Acid Mutation based change in Binding free Energy (SAAMBE) was developed to predict the changes of the binding free energy caused by mutations. The method utilizes 3D structures of the corresponding protein-protein complexes and takes advantage of both approaches: sequence- and structure-based methods. The method has two components: a MM/PBSA-based component, and an additional set of statistical terms delivered from statistical investigation of physico-chemical properties of protein complexes. While the approach is rigid body approach and does not explicitly consider plausible conformational changes caused by the binding, the effect of conformational changes, including changes away from binding interface, on electrostatics are mimicked with amino acid specific dielectric constants. This provides significant improvement of SAAMBE predictions as indicated by better match against experimentally determined binding free energy changes over 1300 mutations in 43 proteins. The final benchmarking resulted in a very good agreement with experimental data (correlation coefficient 0.624) while the algorithm being fast enough to allow for large-scale calculations (the average time is less than a minute per mutation).

  11. The constant region affects antigen binding of antibodies to DNA by altering secondary structure.

    PubMed

    Xia, Yumin; Janda, Alena; Eryilmaz, Ertan; Casadevall, Arturo; Putterman, Chaim

    2013-11-01

    We previously demonstrated an important role of the constant region in the pathogenicity of anti-DNA antibodies. To determine the mechanisms by which the constant region affects autoantibody binding, a panel of isotype-switch variants (IgG1, IgG2a, IgG2b) was generated from the murine PL9-11 IgG3 autoantibody. The affinity of the PL9-11 antibody panel for histone was measured by surface plasmon resonance (SPR). Tryptophan fluorescence was used to determine wavelength shifts of the antibody panel upon binding to DNA and histone. Finally, circular dichroism spectroscopy was used to measure changes in secondary structure. SPR analysis revealed significant differences in histone binding affinity between members of the PL9-11 panel. The wavelength shifts of tryptophan fluorescence emission were found to be dependent on the antibody isotype, while circular dichroism analysis determined that changes in antibody secondary structure content differed between isotypes upon antigen binding. Thus, the antigen binding affinity is dependent on the particular constant region expressed. Moreover, the effects of antibody binding to antigen were also constant region dependent. Alteration of secondary structures influenced by constant regions may explain differences in fine specificity of anti-DNA antibodies between antibodies with similar variable regions, as well as cross-reactivity of anti-DNA antibodies with non-DNA antigens. Copyright © 2013 Elsevier Ltd. All rights reserved.

  12. On the binding of calcium by micelles composed of carboxy-modified pluronics measured by means of differential potentiometric titration and modeled with a self-consistent-field theory.

    PubMed

    Lauw, Y; Leermakers, F A M; Cohen Stuart, M A; Pinheiro, J P; Custers, J P A; van den Broeke, L J P; Keurentjes, J T F

    2006-12-19

    We perform differential potentiometric titration measurements for the binding of Ca2+ ions to micelles composed of the carboxylic acid end-standing Pluronic P85 block copolymer (i.e., CAE-85 (COOH-(EO)26-(PO)39-(EO)26-COOH)). Two different ion-selective electrodes (ISEs) are used to detect the free calcium concentration; the first ISE is an indicator electrode, and the second is a reference electrode. The titration is done by adding the block copolymers to a known solution of Ca2+ at neutral pH and high enough temperature (above the critical micellization temperature CMT) and various amount of added monovalent salt. By measuring the difference in the electromotive force between the two ISEs, the amount of Ca2+ that is bound by the micelles is calculated. This is then used to determine the binding constant of Ca2+ with the micelles, which is a missing parameter needed to perform molecular realistic self-consistent-field (SCF) calculations. It turns out that the micelles from block copolymer CAE-85 bind Ca2+ ions both electrostatically and specifically. The specific binding between Ca2+ and carboxylic groups in the corona of the micelles is modeled through the reaction equilibrium -COOCa+ <==> -COO- + Ca2+ with pKCa = 1.7 +/- 0.06.

  13. pH-selective mutagenesis of protein-protein interfaces: in silico design of therapeutic antibodies with prolonged half-life.

    PubMed

    Spassov, Velin Z; Yan, Lisa

    2013-04-01

    Understanding the effects of mutation on pH-dependent protein binding affinity is important in protein design, especially in the area of protein therapeutics. We propose a novel method for fast in silico mutagenesis of protein-protein complexes to calculate the effect of mutation as a function of pH. The free energy differences between the wild type and mutants are evaluated from a molecular mechanics model, combined with calculations of the equilibria of proton binding. The predicted pH-dependent energy profiles demonstrate excellent agreement with experimentally measured pH-dependency of the effect of mutations on the dissociation constants for the complex of turkey ovomucoid third domain (OMTKY3) and proteinase B. The virtual scanning mutagenesis identifies all hotspots responsible for pH-dependent binding of immunoglobulin G (IgG) to neonatal Fc receptor (FcRn) and the results support the current understanding of the salvage mechanism of the antibody by FcRn based on pH-selective binding. The method can be used to select mutations that change the pH-dependent binding profiles of proteins and guide the time consuming and expensive protein engineering experiments. As an application of this method, we propose a computational strategy to search for mutations that can alter the pH-dependent binding behavior of IgG to FcRn with the aim of improving the half-life of therapeutic antibodies in the target organism. Copyright © 2013 Wiley Periodicals, Inc.

  14. Substituent Effects on Thermal Decolorization Rates of Bisbenzospiropyrans

    PubMed Central

    Lu, Nina T.; Nguyen, Vi N.; Kumar, Satish; McCurdy, Alison

    2009-01-01

    A novel application of photochromic molecules is to mimic physiological oscillatory calcium signals by reversibly binding and releasing calcium ions in response to light. Substituent changes on the largely unexplored photochromic bisbenzospiropyran scaffold led to significant changes in thermal fading rates in several organic solvents. Excellent correlations have been found between fading rates and empirical Hammett constants as well as calculated ground-state energies. These correlations can be used to improve scaffold design. PMID:16238356

  15. The Binding Constant of Estradiol to Bovine Serum Albumin: An Upper-Level Experiment Utilizing Tritium-Labeled Estradiol and Liquid Scintillation Counting

    ERIC Educational Resources Information Center

    Peihong Liang; Adhyaru, Bhavin; Pearson, Wright L.; Williams, Kathryn R.

    2006-01-01

    The experiment used [to the third power]H-labeled estradiol to determine the binding constant of estradiol to bovine serum albumin. Estradiol must complex with serum proteins for the transport in the blood stream because of its low solubility in aqueous systems and estradiol-protein binding constant, where K[subscript B] is important to understand…

  16. Characterization of binding site heterogeneity for copper within dissolved organic matter fractions using two-dimensional correlation fluorescence spectroscopy.

    PubMed

    Hur, Jin; Lee, Bo-Mi

    2011-06-01

    The heterogeneity of copper binding characteristics for dissolved organic matter (DOM) fractions was investigated based on the fluorescence quenching of the synchronous fluorescence spectra upon the addition of copper and two-dimensional correlation spectroscopy (2D-COS). Hydrophobic acid (HoA) and hydrophilic (Hi) fractions of two different DOM (algal and leaf litter DOM) were used for this study. For both DOM, fluorescence quenching occurred at a wider range of wavelengths for the HoA fractions compared to the Hi fractions. The combined information of the synchronous and asynchronous maps derived from 2D-COS provided a clear picture of the heterogeneous distribution of the copper binding sites within each DOM fraction, which was not readily recognized by a simple comparison of the changes in the synchronous fluorescence spectra upon the addition of copper. For the algal DOM, higher stability constants were exhibited for the HoA versus the Hi fractions. The logarithms of the stability constants ranged from 4.8 to 6.1 and from 4.5 to 5.0 for the HoA and the Hi fractions of the algal DOM, respectively, depending on the associated wavelength and the fitted models. In contrast, no distinctive difference in the binding characteristics was found between the two fractions of the leaf litter DOM. This suggests that influences of the structural and chemical properties of DOM on copper binding may differ for DOM from different sources. The relative difference of the calculated stability constants within the DOM fractions were consistent with the sequential orders interpreted from the asynchronous 2D-COS. It is expected that 2D-COS will be widely applied to other DOM studies requiring detailed information on the heterogeneous nature and subsequent effects under a range of environmental conditions. Copyright © 2011 Elsevier Ltd. All rights reserved.

  17. Redox-dependent interactions between reduced/oxidized cytochrome c and cytochrome c oxidase evaluated by in-situ electrochemical surface plasmon resonance.

    PubMed

    Hou, Yuting; An, Jianhong; Deng, Chunyan; Chen, Shu; Xiang, Juan

    2016-07-01

    The interactions between the redox couple of cytochrome c (Cyt c) and cytochrome c oxidase (COX) were investigated at a mimic redox-modulated interface by using an electrochemical surface plasmon resonance (EC-SPR) system. Although early studies of the binding between COX and Cyt c have been conducted using several techniques in homogeneous solutions, a problem still inherent is that ferro-cytochrome c (Cyt c red), the reduced form of Cyt c, can be easily oxidized into ferri-cytochrome c (Cyt c ox) and adversely impact the accuracy and reproducibility of the binding measurements. In order to realize reliable redox-dependent binding tests, here the Cyt c red is quantitatively electro-generated from Cyt c ox by in situ cathodic polarization in a flow cell. Then the kinetic and dissociation constants of the bindings between COX and Cyt c red/Cyt c ox can be evaluated accurately. In this study, the values of association/dissociation rate constants (k a, k d) for both COX/Cyt c red and COX/Cyt c ox were obtained. The dissociation constants, K D, were finally calculated as 3.33 × 10(-8) mol · L(-1) for COX/Cyt c red and 4.25 × 10(-5) mol · L(-1) for COX/Cyt c ox, respectively. In-situ EC-SPR is promising for better mimicking the in vivo condition that COX is embedded in the inner mitochondrial membrane and Cyt c acts as an electron shuttle in the mobile phase. It is an effective method for the investigation of redox-dependent biomolecular interactions. Graphical Abstract Schematic representation of the experimental designs using EC-SPR system. (a) the Au-Cys-COX SPR chip with SAM layers. (b) redox-modulated Cyt c and its binding onto pre-immobilized COX.

  18. Heterodimer Autorepression Loop: A Robust and Flexible Pulse-Generating Genetic Module

    NASA Astrophysics Data System (ADS)

    Lannoo, B.; Carlon, E.; Lefranc, M.

    2016-07-01

    We investigate the dynamics of the heterodimer autorepression loop (HAL), a small genetic module in which a protein A acts as an autorepressor and binds to a second protein B to form an A B dimer. For suitable values of the rate constants, the HAL produces pulses of A alternating with pulses of B . By means of analytical and numerical calculations, we show that the duration of A pulses is extremely robust against variation of the rate constants while the duration of the B pulses can be flexibly adjusted. The HAL is thus a minimal genetic module generating robust pulses with a tunable duration, an interesting property for cellular signaling.

  19. Rational redesign of inhibitors of furin/kexin processing proteases by electrostatic mutations.

    PubMed

    Cai, Xiao-hui; Zhang, Qing; Ding, Da-fu

    2004-12-01

    To model the three-dimensional structure and investigate the interaction mechanism of the proprotein convertase furin/kexin and their inhibitors (eglin c mutants). The three-dimensional complex structures of furin/kexin with its inhibitors, eglin c mutants, were generated by modeller program using the newly published X-ray crystallographical structures of mouse furin and yeast kexin as templates. The electrostatic interaction energy of each complex was calculated and the results were compared with the experimentally determined inhibition constants to find the correlation between them. High quality models of furin/kexin-eglin c mutants were obtained and used for calculation of the electrostatic interaction energies between the proteases and their inhibitors. The calculated electrostatic energies of interaction showed a linear correlation to the experimental inhibition constants. The modeled structures give good explanations of the specificity of eglin c mutants to furin/kexin. The electrostatic interactions play important roles in inhibitory activity of eglin c mutants to furin/kexin. The results presented here provided quantitative structural and functional information concerning the role of the charge-charge interactions in the binding of furin/kexin and their inhibitors.

  20. Number of independent parameters in the potentiometric titration of humic substances.

    PubMed

    Lenoir, Thomas; Manceau, Alain

    2010-03-16

    With the advent of high-precision automatic titrators operating in pH stat mode, measuring the mass balance of protons in solid-solution mixtures against the pH of natural and synthetic polyelectrolytes is now routine. However, titration curves of complex molecules typically lack obvious inflection points, which complicates their analysis despite the high-precision measurements. The calculation of site densities and median proton affinity constants (pK) from such data can lead to considerable covariance between fit parameters. Knowing the number of independent parameters that can be freely varied during the least-squares minimization of a model fit to titration data is necessary to improve the model's applicability. This number was calculated for natural organic matter by applying principal component analysis (PCA) to a reference data set of 47 independent titration curves from fulvic and humic acids measured at I = 0.1 M. The complete data set was reconstructed statistically from pH 3.5 to 9.8 with only six parameters, compared to seven or eight generally adjusted with common semi-empirical speciation models for organic matter, and explains correlations that occur with the higher number of parameters. Existing proton-binding models are not necessarily overparametrized, but instead titration data lack the sensitivity needed to quantify the full set of binding properties of humic materials. Model-independent conditional pK values can be obtained directly from the derivative of titration data, and this approach is the most conservative. The apparent proton-binding constants of the 23 fulvic acids (FA) and 24 humic acids (HA) derived from a high-quality polynomial parametrization of the data set are pK(H,COOH)(FA) = 4.18 +/- 0.21, pK(H,Ph-OH)(FA) = 9.29 +/- 0.33, pK(H,COOH)(HA) = 4.49 +/- 0.18, and pK(H,Ph-OH)(HA) = 9.29 +/- 0.38. Their values at other ionic strengths are more reliably calculated with the empirical Davies equation than any existing model fit.

  1. Synthesis, characterization and biological application of four novel metal-Schiff base complexes derived from allylamine and their interactions with human serum albumin: Experimental, molecular docking and ONIOM computational study.

    PubMed

    Kazemi, Zahra; Rudbari, Hadi Amiri; Sahihi, Mehdi; Mirkhani, Valiollah; Moghadam, Majid; Tangestaninejad, Shahram; Mohammadpoor-Baltork, Iraj; Gharaghani, Sajjad

    2016-09-01

    Novel metal-based drug candidate including VOL2, NiL2, CuL2 and PdL2 have been synthesized from 2-hydroxy-1-allyliminomethyl-naphthalen ligand and have been characterized by means of elemental analysis (CHN), FT-IR and UV-vis spectroscopies. In addition, (1)H and (13)C NMR techniques were employed for characterization of the PdL2 complex. Single-crystal X-ray diffraction technique was utilized to characterise the structure of the complexes. The Cu(II), Ni(II) and Pd(II) complexes show a square planar trans-coordination geometry, while in the VOL2, the vanadium center has a distorted tetragonal pyramidal N2O3 coordination sphere. The HSA-binding was also determined, using fluorescence quenching, UV-vis spectroscopy, and circular dichroism (CD) titration method. The obtained results revealed that the HSA affinity for binding the synthesized compounds follows as PdL2>CuL2>VOL2>NiL2, indicating the effect of metal ion on binding constant. The distance between these compounds and HSA was obtained based on the Förster's theory of non-radiative energy transfer. Furthermore, computational methods including molecular docking and our Own N-layered Integrated molecular Orbital and molecular Mechanics (ONIOM) were carried out to investigate the HSA-binding of the compounds. Molecular docking calculation indicated the existence of hydrogen bond between amino acid residues of HSA and all synthesized compounds. The formation of the hydrogen bond in the HSA-compound systems leads to their stabilization. The ONIOM method was utilized in order to investigate HSA binding of compounds more precisely in which molecular mechanics method (UFF) and semi empirical method (PM6) were selected for the low layer and the high layer, respectively. The results show that the structural parameters of the compounds changed along with binding to HSA, indicating the strong interaction between the compounds and HSA. The value of binding constant depends on the extent of the resultant changes. This should be mentioned that both theoretical methods calculated the Kb values in the same sequence and are in a good agreement with the experimental data. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Characterization of Receptor Binding Profiles of Influenza A Viruses Using An Ellipsometry-Based Label-Free Glycan Microarray Assay Platform

    PubMed Central

    Fei, Yiyan; Sun, Yung-Shin; Li, Yanhong; Yu, Hai; Lau, Kam; Landry, James P.; Luo, Zeng; Baumgarth, Nicole; Chen, Xi; Zhu, Xiangdong

    2015-01-01

    A key step leading to influenza viral infection is the highly specific binding of a viral spike protein, hemagglutinin (HA), with an extracellular glycan receptor of a host cell. Detailed and timely characterization of virus-receptor binding profiles may be used to evaluate and track the pandemic potential of an influenza virus strain. We demonstrate a label-free glycan microarray assay platform for acquiring influenza virus binding profiles against a wide variety of glycan receptors. By immobilizing biotinylated receptors on a streptavidin-functionalized solid surface, we measured binding curves of five influenza A virus strains with 24 glycans of diverse structures and used the apparent equilibrium dissociation constants (avidity constants, 10–100 pM) as characterizing parameters of viral receptor profiles. Furthermore by measuring binding kinetic constants of solution-phase glycans to immobilized viruses, we confirmed that the glycan-HA affinity constant is in the range of 10 mM and the reaction is enthalpy-driven. PMID:26193329

  3. Characterization of Receptor Binding Profiles of Influenza A Viruses Using An Ellipsometry-Based Label-Free Glycan Microarray Assay Platform.

    PubMed

    Fei, Yiyan; Sun, Yung-Shin; Li, Yanhong; Yu, Hai; Lau, Kam; Landry, James P; Luo, Zeng; Baumgarth, Nicole; Chen, Xi; Zhu, Xiangdong

    2015-07-16

    A key step leading to influenza viral infection is the highly specific binding of a viral spike protein, hemagglutinin (HA), with an extracellular glycan receptor of a host cell. Detailed and timely characterization of virus-receptor binding profiles may be used to evaluate and track the pandemic potential of an influenza virus strain. We demonstrate a label-free glycan microarray assay platform for acquiring influenza virus binding profiles against a wide variety of glycan receptors. By immobilizing biotinylated receptors on a streptavidin-functionalized solid surface, we measured binding curves of five influenza A virus strains with 24 glycans of diverse structures and used the apparent equilibrium dissociation constants (avidity constants, 10-100 pM) as characterizing parameters of viral receptor profiles. Furthermore by measuring binding kinetic constants of solution-phase glycans to immobilized viruses, we confirmed that the glycan-HA affinity constant is in the range of 10 mM and the reaction is enthalpy-driven.

  4. The interaction of flavonoid-lysozyme and the relationship between molecular structure of flavonoids and their binding activity to lysozyme.

    PubMed

    Yang, Ran; Yu, Lanlan; Zeng, Huajin; Liang, Ruiling; Chen, Xiaolan; Qu, Lingbo

    2012-11-01

    In this work, the interactions of twelve structurally different flavonoids with Lysozyme (Lys) were studied by fluorescence quenching method. The interaction mechanism and binding properties were investigated. It was found that the binding capacities of flavonoids to Lys were highly depend on the number and position of hydrogen, the kind and position of glycosyl. To explore the selectivity of the bindings of flavonoids with Lys, the structure descriptors of the flavonoids were calculated under QSAR software package of Cerius2, the quantitative relationship between the structures of flavonoids and their binding activities to Lys (QSAR) was performed through genetic function approximation (GFA) regression analysis. The QSAR regression equation was K(A) = 37850.460 + 1630.01Dipole +3038.330HD-171.795MR. (r = 0.858, r(CV)(2) = 0.444, F((11,3)) = 7.48), where K(A) is binding constants, Dipole, HD and MR was dipole moment, number of hydrogen-bond donor and molecular refractivity, respectively. The obtained results make us understand better how the molecular structures influencing their binding to protein which may open up new avenues for the design of the most suitable flavonoids derivatives with structure variants.

  5. Comparison and analysis on the serum-binding characteristics of aspirin-zinc complex and aspirin.

    PubMed

    Zhang, Hua-Xin; Zhang, Qun; Wang, Hong-Lin; Li, Li-Wei

    2017-09-01

    This study was designed to compare the protein-binding characteristics of aspirin-zinc complex (AZN) with those of aspirin itself. AZN was synthesized and interacted with a model transport protein, human serum albumin (HSA). Three-dimensional fluorescence, ultraviolet-visible and circular dichroism (CD) spectra were used to characterize the interaction of AZN with HSA under physiological conditions. The interaction mechanism was explored using a fluorescence quenching method and thermodynamic calculation. The binding site and binding locality of AZN on HSA were demonstrated using a fluorescence probe technique and Förster non-radiation energy transfer theory. Synchronous fluorescence and CD spectra were employed to reveal the effect of AZN on the native conformation of the protein. The HSA-binding results for AZN were compared with those for aspirin under consistent experimental conditions, and indicated that aspirin acts as a guide in AZN when binding to Sudlow's site I, in subdomain IIA of the HSA molecule. Moreover, compared with aspirin, AZN showed greater observed binding constants with, but smaller changes in the α-helicity of, HSA, which proved that AZN might be easier to transport and have less toxicity in vivo. Copyright © 2017 John Wiley & Sons, Ltd.

  6. Comparison of solute-binding properties of plastic materials used as pharmaceutical product containers.

    PubMed

    Jenke, Dennis; Couch, Tom; Gillum, Amy

    2010-01-01

    Material/water equilibrium binding constants (E(b)) were determined for 11 organic solutes and 2 plastic materials commonly used in pharmaceutical product containers (plasticized polyvinyl chloride and polyolefin). In general, solute binding by the plasticized polyvinyl chloride material was greater, by nearly an order of magnitude, than the binding by the polyolefin (on an equal weight basis). The utilization of the binding constants to facilitate container compatibility assessments (e.g., drug loss by container binding) for drug-containing products is discussed.

  7. A novel methodological approach for the analysis of host-ligand interactions.

    PubMed

    Strat, Daniela; Missailidis, Sotiris; Drake, Alex F

    2007-02-02

    Traditional analysis of drug-binding data relies upon the Scatchard formalism. These methods rely upon the fitting of a linear equation providing intercept and gradient data that relate to physical properties, such as the binding constant, cooperativity coefficients and number of binding sites. However, the existence of different binding modes with different binding constants makes the implementation of these models difficult. This article describes a novel approach to the binding model of host-ligand interactions by using a derived analytical function describing the observed signal. The benefit of this method is that physically significant parameters, that is, binding constants and number of binding sites, are automatically derived by the use of a minimisation routine. This methodology was utilised to analyse the interactions between a novel antitumour agent and DNA. An optical spectroscopy study confirms that the pentacyclic acridine derivative (DH208) binds to nucleic acids. Two binding modes can be identified: a stronger one that involves intercalation and a weaker one that involves oriented outer-sphere binding. In both cases the plane of the bound acridine ring is parallel to the nucleic acid bases, orthogonal to the phosphate backbone. Ultraviolet (UV) and circular dichroism (CD) data were fitted using the proposed model. The binding constants and the number of binding sites derived from the model remained consistent across the different techniques used. The different wavelengths at which the measurements were made maintained the coherence of the results.

  8. Synthesis, spectroscopic studies, DFT calculations, electrochemical evaluation, BSA binding and molecular docking of an aroylhydrazone -based cis-dioxido Mo(VI) complex

    NASA Astrophysics Data System (ADS)

    Mohamadi, Maryam; Faghih-Mirzaei, Ehsan; Ebrahimipour, S. Yousef; Sheikhshoaie, Iran; Haase, Wolfgang; Foro, Sabine

    2017-07-01

    A cis-dioxido Mo(VI) complex, [MoO2(L)(MeOH)], [L2-: (3-methoxy-2-oxidobenzylidene) benzohydrazonate], has been synthesized and characterized using physicochemical and spectroscopic techniques including elemental analysis, FT-IR, 1HNMR, UV-Vis spectroscopy, molar conductivity and single crystal X-ray diffraction. DFT calculations in the ground state of the complex were carried out using hybrid functional B3LYP with DGDZVP as basis set. Non-linear optical properties including electric dipole moment (μ), polarizability (α) and molecular first hyperpolarizability (β) of the compound were also computed. The values of linear polarizability and first hyperpolarizability obtained for the studied molecule indicated that the compound could be a good candidate of nonlinear optical materials. TD-DFT calculation and molecular electrostatic potential (MEP) were also performed. The thermodynamic properties (heat capacity, entropy, and enthalpy) of the complex at different temperatures have been calculated. The interaction of a synthesized complex, with bovine serum albumin was also thoroughly investigated using experimental and theoretical studies. UV-Vis absorption and fluorescence quenching techniques were used to determine the binding parameters as well as the mechanism of the interaction. The values of binding constants were in the range of 104-105 M-1 demonstrating a moderate interaction between the synthesized complex and BSA making the protein suitable for transportation and delivery of the compound. Thermodynamic parameters were also indicating a binding through van der Waals force or hydrogen bond of [MoO2(L)(MeOH)] to BSA. The results obtained from docking studies were consistent to those obtained from experimental studies.

  9. Interaction of cinnamic acid derivatives with serum albumins: A fluorescence spectroscopic study

    NASA Astrophysics Data System (ADS)

    Singh, T. Sanjoy; Mitra, Sivaprasad

    2011-03-01

    Cinnamic acid (CA) derivatives are known to possess broad therapeutic applications including anti-tumor activity. The present study was designed to determine the underlying mechanism and thermodynamic parameters for the binding of two CA based intramolecular charge transfer (ICT) fluorescent probes, namely, 4-(dimethylamino) cinnamic acid (DMACA) and trans-ethyl p-(dimethylamino) cinnamate (EDAC), with albumins by fluorescence spectroscopy. Stern-Volmer analysis of the tryptophan fluorescence quenching data in presence of the added ligand reveals fluorescence quenching constant ( κq), Stern-Volmer constant ( KSV) and also the ligand-protein association constant ( Ka). The thermodynamic parameters like enthalpy (Δ H) and entropy (Δ S) change corresponding to the ligand binding process were also estimated. The results show that the ligands bind into the sub-domain IIA of the proteins in 1:1 stoichiometry with an apparent binding constant value in the range of 10 4 dm 3 mol -1. In both the cases, the spontaneous ligand binding to the proteins occur through entropy driven mechanism, although the interaction of DMACA is relatively stronger in comparison with EDAC. The temperature dependence of the binding constant indicates the induced change in protein secondary structure.

  10. Comparative studies on the human serum albumin binding of the clinically approved EGFR inhibitors gefitinib, erlotinib, afatinib, osimertinib and the investigational inhibitor KP2187.

    PubMed

    Dömötör, Orsolya; Pelivan, Karla; Borics, Attila; Keppler, Bernhard K; Kowol, Christian R; Enyedy, Éva A

    2018-05-30

    Binding interactions between human serum albumin (HSA) and four approved epidermal growth factor receptor (EGFR) inhibitors gefitinib (GEF), erlotinib (ERL), afatinib (AFA), osimertinib (OSI), as well as the experimental drug KP2187, were investigated by means of spectrofluorometric and molecular modelling methods. Steady-state and time resolved spectrofluorometric techniques were carried out, including direct quenching of protein fluorescence and site marker displacement measurements. Proton dissociation processes and solvent dependent fluorescence properties were investigated as well. The EGFR inhibitors were predominantly presented in their single protonated form (HL + ) at physiological pH except ERL, which is charge-neutral. Significant solvent dependent fluorescence properties were found for GEF, ERL and KP2187, namely their emission spectra show strong dependence on the polarity and the hydrogen bonding ability of the solvents. The inhibitors proved to be bound at site I of HSA (in subdomain IIA) in a weak-to-moderate fashion (logK' 3.9-4.9) using spectrofluorometry. OSI (logK' 4.3) and KP2187 can additionally bind in site II (in subdomain IIIA), while GEF, ERL and AFA clearly show no interaction here. Docking methods qualitatively confirmed binding site preferences of compounds GEF and KP2187, and indicated that they probably bind to HSA in their neutral forms. Binding constants calculated on the basis of the various experimental data indicate a weak-to-moderate binding on HSA, only OSI exhibits somewhat higher affinity towards this protein. However, model calculations performed at physiological blood concentrations of HSA resulted in high (ca. 90%) bound fractions for the inhibitors, highlighting the importance of plasma protein binding. Copyright © 2018 Elsevier B.V. All rights reserved.

  11. Synthesis, crystal structure, DFT calculation and DNA binding studies of new water-soluble derivatives of dppz

    NASA Astrophysics Data System (ADS)

    Aminzadeh, Mohammad; Eslami, Abbas; Kia, Reza; Aleeshah, Roghayeh

    2017-10-01

    Diquaternarization of dipyrido-[2,3-a:2‧,3‧-c]-phenazine,(dppz) and its analogous dipyrido-[2,3-a:2‧,3‧-c]-dimethylphenazine,(dppx) using 1,3-dibromopropane afford new water-soluble derivatives of phenazine, propylene-bipyridyldiylium-phenazine (1) and propylene-bipyridyldiylium-dimethylphenazine (2). The compounds have been characterized by means of FT-IR, NMR, elemental analysis and conductometric measurements and their structure were determined by X-ray crystallography. The experimental studies on the compounds have been accompanied computationally by Density Functional Theory (DFT) calculations. The DNA binding properties of both compounds to calf thymus DNA (ctDNA) were investigated by UV-Vis absorption and emission methods. The expanded UV-Vis spectral data matrix was analyzed by multivariate curve resolution-alternating least squares (MCR-ALS) technique to obtain the concentration profile and pure spectra of all reaction species which existed in the interaction procedure. Multivariate curve resolution may help us to give a better understanding of the 1(Cl)2-ctDNA and 2(Cl)2-ctDNA interaction mechanism. The results suggest that both compounds bind tightly to DNA through intercalation mechanism and the DNA binding affinity of 2 is slightly lower than that of 1 due to steric hindrance of the methyl group. Also, thermal denaturation studies reveal that these compounds show strong affinity for binding with calf thymus DNA. The thermodynamic parameters of the DNA binding process were obtained from the temperature dependence of the binding constants and the results showed that binding of both compounds to DNA is an enthalpically driven process that is in agreement with proposed DNA intercalation capability of these compounds.

  12. The Use of Hammett Constants to Understand the Non-Covalent Binding of Aromatics

    PubMed Central

    Lewis, Michael; Bagwill, Christina; Hardebeck, Laura K. E.; Wireduaah, Selina

    2012-01-01

    Non-covalent interactions of aromatics are important in a wide range of chemical and biological applications. The past two decades have seen numerous reports of arene-arene binding being understood in terms Hammett substituent constants, and similar analyses have recently been extended to cation-arene and anion-arene binding. It is not immediately clear why electrostatic Hammett parameters should work so well in predicting the binding for all three interactions, given that different intermolecular forces dominate each interaction. This review explores such anomalies, and summarizes how Hammett substituent constants have been employed to understand the non-covalent binding in arene-arene, cation-arene and anion-arene interactions. PMID:24688634

  13. A stepwise mechanism for the permeation of phloretin through a lipid bilayer

    PubMed Central

    1982-01-01

    The thermodynamics of interactions between phloretin and a phosphatidylcholine (PC) vesicle membrane are characterized using equilibrium spectrophotometric titration, stopped-flow, and temperature- jump techniques. Binding of phloretin to a PC vesicle membrane is diffusion limited, with an association rate constant greater than 10(8) M-1s-1, and an interfacial activation free energy of less than 2 kcal/mol. Equilibrium binding of phloretin to a vesicle membrane is characterized by a single class of high-affinity (8 micro M), noninteracting sites. Binding is enthalpy driven (delta H = -4.9 kcal/mol) at 23 degrees C. Analysis of amplitudes of kinetic processes shows that 66 +/- 3% of total phloretin binding sites are exposed at the external vesicle surface. The rate of phloretin movement between binding sites located near the external and internal interfaces is proportional to the concentration of un-ionized phloretin, with a rate constant of 5.7 X 10(4) M-1s-1 at 23 degrees C. The rate of this process is limited by a large enthalpic (9 kcal/mol) and entropic (-31 entropy units) barrier. An analysis of the concentration dependence of the rate of transmembrane movement suggests the presence of multiple intramembrane potential barriers. Permeation of phloretin through a lipid bilayer is modeled quantitatively in terms of discrete steps: binding to a membrane surface, translocation across a series of intramembrane barriers, and dissociation from the opposite membrane surface. The permeability coefficient for phloretin is calculated as 1.9 X 10(-3) cm/s on the basis of the model presented. Structure- function relationships are examined for a number of phloretin analogues. PMID:7142954

  14. Cyanide binding to ferrous and ferric microperoxidase-11.

    PubMed

    Ascenzi, Paolo; Sbardella, Diego; Santucci, Roberto; Coletta, Massimo

    2016-07-01

    Microperoxidase-11 (MP11) is an undecapeptide derived from horse heart cytochrome c (cytc). MP11 is characterized by a covalently linked solvent-exposed heme group, the heme-Fe atom being axially coordinated by a histidyl residue. Here, the reactions of ferrous and ferric MP11 (MP11-Fe(II) and MP11-Fe(III), respectively) with cyanide have been investigated from the kinetic and thermodynamic viewpoints, at pH 7.0 and 20.0 °C. Values of the second-order rate constant for cyanide binding to MP11-Fe(II) and MP11-Fe(III) are 4.5 M(-1) s(-1) and 8.9 × 10(3) M(-1) s(-1), respectively. Values of the first-order rate constant for cyanide dissociation from ligated MP11-Fe(II) and MP11-Fe(III) are 1.8 × 10(-1) s(-1) and 1.5 × 10(-3) s(-1), respectively. Values of the dissociation equilibrium constant for cyanide binding to MP11-Fe(II) and MP11-Fe(III) are 3.7 × 10(-2) and 1.7 × 10(-7) M, respectively, matching very well with those calculated from kinetic parameters so that no intermediate species seem to be involved in the ligand-binding process. The pH-dependence of cyanide binding to MP11-Fe(III) indicates that CN(-) is the only binding species. Present results have been analyzed in parallel with those of several heme-proteins, suggesting that (1) the ligand accessibility to the metal center and cyanide ionization may modulate the formation of heme-Fe-cyanide complexes, and (2) the general polarity of the heme pocket and/or hydrogen bonding of the heme-bound ligand may affect cyanide exit from the protein matrix. Microperoxidase-11 (MP11) is an undecapeptide derived from horse heart cytochrome c. Penta-coordinated MP11 displays a very high reactivity towards cyanide, whereas the reactivity of hexa-coordinated horse heart cytochrome c is very low.

  15. Dual-emitting biosensors for glucose and glutamine from genertically engineered E. coli binding proteins

    NASA Astrophysics Data System (ADS)

    Tolosa, Leah; Ge, Xudong; Kostov, Yordan; Lakowicz, Joseph R.; Rao, Govind

    2003-07-01

    Glucose is the major source of carbon, and glutamine is the major source of nitrogen in cell culture media. Thus, glucose and glutamine monitoring are important in maintaining optimal conditions in industrial bioprocesses. Here we report reagentless glucose and glutamine sensors using the E. coli glucose binding protein (GBP) and the glutamine binding protein (GlnBP). Both of these proteins are derived from the permease system of the gram-negative bacteria. The Q26C variant of GBP was labeled at the 26-position with anilino-naphthalene sulfonate (ANS), while the S179C variant of GlnBP was labeled at the 179-position with acrylodan. The ANS and acrylodan emissions are quenched in the presence of glucose and glutamine, respectively. The acrylodan-labeled GlnBP was labeled at the N-terminal with ruthenium bis-(2,2"-bipyridyl)-1,10-phenanthroline-9-isothiocyanate. The ruthenium acts as a non-responsive long-lived reference. The apparent binding constant, Kd", of 8.0 μM glucose was obtained from the decrease in intensity of ANS in GBP. The reliability of the method in monitoring glucose during yeast fermentation was determined by comparison with the YSI Biochemistry Analyzer. The apparent binding constant, Kd", of 0.72 μM glutamine was calculated from the ratio of emission intensities of acrylodan and ruthenium (I515/I610) in GlnBP. The presence of the long-lived ruthenium allowed for modulation sensing at lower frequencies (1-10 MHz) approaching an accuracy of +/- 0.02 μM. The conversion of the GBP into a similar ratiometric sensor was described.

  16. Lamb Shift of n = 1 and n = 2 States of Hydrogen-like Atoms, 1 ≤ Z ≤ 110

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yerokhin, V. A.; Shabaev, V. M.

    2015-09-15

    Theoretical energy levels of the n = 1 and n = 2 states of hydrogen-like atoms with the nuclear charge numbers 1 ≤ Z ≤ 110 are tabulated. The tabulation is based on ab initio quantum electrodynamics calculations performed to all orders in the nuclear binding strength parameter Zα, where α is the fine structure constant. Theoretical errors due to various effects are critically examined and estimated.

  17. Diffusion coefficients in systems with inclusion compounds. 1. alpha. -Cyclodextrin-L-phenylalanine-water at 25 degree C

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Paduano, L.; Sartorio, R.; Vitagliano, V.

    Diffusion coefficients in the ternary system {alpha}-cyclodextrin (at one concentration)-L-phenylalanine (at four concentrations)-water have been measured by using the Gouy interferometric technique. The effect of the inclusion equilibrium on the cross-term diffusion coefficients was observed. The measured diffusion coefficients in the ternary systems were used to calculate values of the binding constants. These values are in good agreement with the value obtained from calorimetric studies.

  18. Magnetic Levitation as a Platform for Competitive Protein-Ligand Binding Assays

    PubMed Central

    Shapiro, Nathan D.; Soh, Siowling; Mirica, Katherine A.; Whitesides, George M.

    2012-01-01

    This paper describes a method based on magnetic levitation (MagLev) that is capable of indirectly measuring the binding of unlabeled ligands to unlabeled protein. We demonstrate this method by measuring the affinity of unlabeled bovine carbonic anhydrase (BCA) for a variety of ligands (most of which are benzene sulfonamide derivatives). This method utilizes porous gel beads that are functionalized with a common aryl sulfonamide ligand. The beads are incubated with BCA and allowed to reach an equilibrium state in which the majority of the immobilized ligands are bound to BCA. Since the beads are less dense than the protein, protein binding to the bead increases the overall density of the bead. This change in density can be monitored using MagLev. Transferring the beads to a solution containing no protein creates a situation where net protein efflux from the bead is thermodynamically favorable. The rate at which protein leaves the bead for the solution can be calculated from the rate at which the levitation height of the bead changes. If another small molecule ligand of BCA is dissolved in the solution, the rate of protein efflux is accelerated significantly. This paper develops a reaction-diffusion (RD) model to explain both this observation, and the physical-organic chemistry that underlies it. Using this model, we calculate the dissociation constants of several unlabeled ligands from BCA, using plots of levitation height versus time. Notably, although this method requires no electricity, and only a single piece of inexpensive equipment, it can measure accurately the binding of unlabeled proteins to small molecules over a wide range of dissociation constants (Kd’s within the range of ~ 10 nM to 100 µM are measured easily). Assays performed using this method generally can be completed within a relatively short time period (20 minutes – 2 hours). A deficiency of this system is that it is not, in its present form, applicable to proteins with molecular weight greater than approximately 65 kDa. PMID:22686324

  19. Magnetic levitation as a platform for competitive protein-ligand binding assays.

    PubMed

    Shapiro, Nathan D; Soh, Siowling; Mirica, Katherine A; Whitesides, George M

    2012-07-17

    This paper describes a method based on magnetic levitation (MagLev) that is capable of indirectly measuring the binding of unlabeled ligands to unlabeled protein. We demonstrate this method by measuring the affinity of unlabeled bovine carbonic anhydrase (BCA) for a variety of ligands (most of which are benzene sulfonamide derivatives). This method utilizes porous gel beads that are functionalized with a common aryl sulfonamide ligand. The beads are incubated with BCA and allowed to reach an equilibrium state in which the majority of the immobilized ligands are bound to BCA. Since the beads are less dense than the protein, protein binding to the bead increases the overall density of the bead. This change in density can be monitored using MagLev. Transferring the beads to a solution containing no protein creates a situation where net protein efflux from the bead is thermodynamically favorable. The rate at which protein leaves the bead for the solution can be calculated from the rate at which the levitation height of the bead changes. If another small molecule ligand of BCA is dissolved in the solution, the rate of protein efflux is accelerated significantly. This paper develops a reaction-diffusion (RD) model to explain both this observation, and the physical-organic chemistry that underlies it. Using this model, we calculate the dissociation constants of several unlabeled ligands from BCA, using plots of levitation height versus time. Notably, although this method requires no electricity, and only a single piece of inexpensive equipment, it can measure accurately the binding of unlabeled proteins to small molecules over a wide range of dissociation constants (K(d) values within the range from ~10 nM to 100 μM are measured easily). Assays performed using this method generally can be completed within a relatively short time period (20 min-2 h). A deficiency of this system is that it is not, in its present form, applicable to proteins with molecular weight greater than approximately 65 kDa.

  20. Interaction of phenolic acids and their derivatives with human serum albumin: Structure-affinity relationships and effects on antioxidant activity.

    PubMed

    Zhang, Yunyue; Wu, Simin; Qin, Yinghui; Liu, Jiaxin; Liu, Jingwen; Wang, Qingyu; Ren, Fazheng; Zhang, Hao

    2018-02-01

    In this study, 111 phenolic acids and their derivatives were chosen to investigate their structure-affinity relationships when binding to human serum albumin (HSA), and effects on their antioxidant activity. A comprehensive mathematical model was employed to calculate the binding constants, using a fluorescence quenching method, and this was corrected for the inner-filter effect to improve accuracy. We found that a hydroxy group at the 2-position of the benzene ring exerted a positive effect on the affinities, while a 4-hydroxy substituent had a negative influence. Both methylation of the hydroxy groups and replacing the hydroxy groups with methyl groups at the 3- and 4-positions of the benzene ring enhanced the binding affinities. Hydrophobic force and hydrogen bonding were binding forces for the phenolic acids, and their methyl esters, respectively. The antioxidant activity of the HSA-phenolic acid interaction compounds was higher than that of the phenolic acids alone. Copyright © 2017. Published by Elsevier Ltd.

  1. Distinct mechanisms of a phosphotyrosyl peptide binding to two SH2 domains.

    PubMed

    Pang, Xiaodong; Zhou, Huan-Xiang

    2014-05-01

    Protein phosphorylation is very common post-translational modification, catalyzed by kinases, for signaling and regulation. Phosphotyrosines frequently target SH2 domains. The spleen tyrosine kinase (Syk) is critical for tyrosine phosphorylation of multiple proteins and for regulation of important pathways. Phosphorylation of both Y342 and Y346 in Syk linker B is required for optimal signaling. The SH2 domains of Vav1 and PLC-γ both bind this doubly phosphorylated motif. Here we used a recently developed method to calculate the effects of Y342 and Y346 phosphorylation on the rate constants of a peptide from Syk linker B binding to the SH2 domains of Vav1 and PLC-γ. The predicted effects agree well with experimental observations. Moreover, we found that the same doubly phosphorylated peptide binds the two SH2 domains via distinct mechanisms, with apparent rigid docking for Vav1 SH2 and dock-and-coalesce for PLC-γ SH2.

  2. Good use of fruit wastes: eco-friendly synthesis of silver nanoparticles, characterization, BSA protein binding studies.

    PubMed

    Sreekanth, T V M; Ravikumar, Sambandam; Lee, Yong Rok

    2016-06-01

    A simple and eco-friendly methodology for the green synthesis of silver nanoparticles (AgNPs) using a mango seed extract was evaluated. The AgNPs were characterized by ultraviolet-visible spectrophotometry, Fourier transform infrared spectroscopy, transmission electron microscopy, energy dispersive X-ray spectroscopy, and X-ray diffraction. The interaction between the green synthesized AgNPs and bovine serum albumin (BSA) in an aqueous solution at physiological pH was examined by fluorescence spectroscopy. The results confirmed that the AgNPs quenched the fluorophore of BSA by forming a ground state complex in aqueous solution. This fluorescence quenching data were also used to determine the binding sites and binding constants at different temperatures. The calculated thermodynamic parameters (ΔG°, ΔH° and ΔS°) suggest that the binding process occurs spontaneously through the involvement of electrostatic interactions. The synchronous fluorescence spectra showed a blue shift, indicating increasing hydrophobicity. Copyright © 2015 John Wiley & Sons, Ltd. Copyright © 2015 John Wiley & Sons, Ltd.

  3. Long-term bioconcentration kinetics of hydrophobic chemicals in Selenastrum capricornutum and Microcystis aeruginosa

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Koelmans, A.A.; Woude, H. van der; Hattink, J.

    1999-06-01

    The bioconcentration of two chlorobenzenes (CBs) and of seven polychlorobiphenyls (PCBs) to Selenastrum capricornutum and Microcystis aeruginosa was studied with accumulation experiments followed by gas purge elimination experiments. Henry's law constants at 10 C were needed to interpret the gas purge results and were measured in control experiments. For the M. aerogunisa culture, steady-state uptake was reached within days, whereas uptake by S. capricornutum took several weeks. The relationships between the log bioconcentration factors (BCF) and log octanol-water partition coefficients (K[sub OW]) were nonlinear, with relatively low values for the more hydrophobic PCBs. Rate constants for the elimination of CBsmore » and PCBs from the algal cells were shown to be larger than 1 per day when calculated with a one-compartment model. With such large rate constants, it is unlikely that the curvature observed for these species is caused by slow kinetics or that algal growth affects BCF by dilution of CB or PCB concentrations. The log BCF-log K[sub OW] relationships could be described by a simple three-phase model that accounted for the binding of CBs and PCBs to dissolved organic carbon (DOC). Modeling bioconcentration of hydrophobic chemicals in phytoplankton should account for the binding to DOC.« less

  4. Spectroscopic and electrochemical studies of the interaction between oleuropein, the major bio-phenol in olives, and salmon sperm DNA

    NASA Astrophysics Data System (ADS)

    Mohamadi, Maryam; Afzali, Daryoush; Esmaeili-Mahani, Saeed; Mostafavi, Ali; Torkzadeh-Mahani, Masoud

    2015-09-01

    Interaction of oleuropein, the major bio-phenol in olive leaf and fruit, with salmon sperm double-stranded DNA was investigated by employing electronic absorption titrations, fluorescence quenching spectroscopy, competitive fluorescence spectroscopy, thermal denaturation and voltammetric studies. Titration of oleuropein with the DNA caused a hypochromism accompanied with a red shift indicating an intercalative mode of interaction. Binding constant of 1.4 × 104 M-1 was obtained for this interaction. From the curves of fluorescence titration of oleuropein with the DNA, binding constant and binding sites were calculated to be 8.61 × 103 M-1 and 1.05, respectively. Competitive studies with ethidium bromide (a well-known DNA intercalator) showed that the bio-phenol could take the place of ethidium bromide in the DNA intercalation sites. The interaction of oleuropein with DNA was also studied electrochemically. In the presence of the DNA, the anodic and cathodic peak currents of oleuropein decreased accompanied with increases in peak-to-peak potential separation and formal potential, indicating the intercalation of oleuropein into the DNA double helix. Moreover, melting temperature of the DNA was found to increase in the presence of oleuropein, indicating the stabilization of the DNA double helix due to an intercalative interaction.

  5. Energetics and kinetics of cooperative cofilin-actin filament interactions.

    PubMed

    Cao, Wenxiang; Goodarzi, Jim P; De La Cruz, Enrique M

    2006-08-11

    We have evaluated the thermodynamic parameters associated with cooperative cofilin binding to actin filaments, accounting for contributions of ion-linked equilibria, and determined the kinetic basis of cooperative cofilin binding. Ions weaken non-contiguous (isolated, non-cooperative) cofilin binding to an actin filament without affecting cooperative filament interactions. Non-contiguous cofilin binding is coupled to the dissociation of approximately 1.7 thermodynamically bound counterions. Counterion dissociation contributes approximately 40% of the total cofilin binding free energy (in the presence of 50 mM KCl). The non-contiguous and cooperative binding free energies are driven entirely by large, positive entropy changes, consistent with a cofilin-mediated increase in actin filament structural dynamics. The rate constant for cofilin binding to an isolated site on an actin filament is slow and likely to be limited by filament breathing. Cooperative cofilin binding arises from an approximately tenfold more rapid association rate constant and an approximately twofold slower dissociation rate constant. The more rapid association rate constant is presumably a consequence of cofilin-dependent changes in the average orientation of subdomain 2, subunit angular disorder and filament twist, which increase the accessibility of a neighboring cofilin-binding site on an actin filament. Cooperative association is more rapid than binding to an isolated site, but still slow for a second-order reaction, suggesting that cooperative binding is limited also by binding site accessibility. We suggest that the dissociation of actin-associated ions weakens intersubunit interactions in the actin filament lattice that enhance cofilin-binding site accessibility, favor cooperative binding and promote filament severing.

  6. Spectroscopic and molecular modeling study on the separate and simultaneous bindings of alprazolam and fluoxetine hydrochloride to human serum albumin (HSA): With the aim of the drug interactions probing

    NASA Astrophysics Data System (ADS)

    Dangkoob, Faeze; Housaindokht, Mohmmad Reza; Asoodeh, Ahmad; Rajabi, Omid; Rouhbakhsh Zaeri, Zeinab; Verdian Doghaei, Asma

    2015-02-01

    The objective of the present research is to study the interaction of separate and simultaneous of alprazolam (ALP) and fluoxetine hydrochloride (FLX) with human serum albumin (HSA) in phosphate buffer (pH 7.4) using different kinds of spectroscopic, cyclic voltammetry and molecular modeling techniques. The absorbance spectra of protein, drugs and protein-drug showed complex formation between the drugs and HSA. Fluorescence analysis demonstrated that ALP and FLX could quench the fluorescence spectrum of HSA and demonstrated the conformational change of HSA in the presence of both drugs. Also, fluorescence quenching mechanism of HSA-drug complexes both separately and simultaneously was suggested as static quenching. The analysis of UV absorption data and the fluorescence quenching of HSA in the binary and ternary systems showed that FLX decreased the binding affinity between ALP and HSA. On the contrary, ALP increased the binding affinity of FLX and HSA. The results of synchronous fluorescence and three-dimensional fluorescence spectra indicated that the binding of drugs to HSA would modify the microenvironment around the Trp and Tyr residues and the conformation of HSA. The distances between Trp residue and the binding sites of the drugs were estimated according to the Förster theory, and it was demonstrated that non-radiative energy transfer from HSA to the drugs occurred with a high probability. Moreover, according to CV measurements, the decrease of peak current in the cyclic voltammogram of the both drugs in the presence of HSA revealed that they interacted with albumin and binding constants were calculated for binary systems which were in agreement with the binding constants obtained from UV absorption and fluorescence spectroscopy. The prediction of the best binding sites of ALP and FLX in binary and ternary systems in molecular modeling approach was done using of Gibbs free energy.

  7. Spectroscopic and molecular modeling study on the separate and simultaneous bindings of alprazolam and fluoxetine hydrochloride to human serum albumin (HSA): with the aim of the drug interactions probing.

    PubMed

    Dangkoob, Faeze; Housaindokht, Mohmmad Reza; Asoodeh, Ahmad; Rajabi, Omid; Rouhbakhsh Zaeri, Zeinab; Verdian Doghaei, Asma

    2015-02-25

    The objective of the present research is to study the interaction of separate and simultaneous of alprazolam (ALP) and fluoxetine hydrochloride (FLX) with human serum albumin (HSA) in phosphate buffer (pH 7.4) using different kinds of spectroscopic, cyclic voltammetry and molecular modeling techniques. The absorbance spectra of protein, drugs and protein-drug showed complex formation between the drugs and HSA. Fluorescence analysis demonstrated that ALP and FLX could quench the fluorescence spectrum of HSA and demonstrated the conformational change of HSA in the presence of both drugs. Also, fluorescence quenching mechanism of HSA-drug complexes both separately and simultaneously was suggested as static quenching. The analysis of UV absorption data and the fluorescence quenching of HSA in the binary and ternary systems showed that FLX decreased the binding affinity between ALP and HSA. On the contrary, ALP increased the binding affinity of FLX and HSA. The results of synchronous fluorescence and three-dimensional fluorescence spectra indicated that the binding of drugs to HSA would modify the microenvironment around the Trp and Tyr residues and the conformation of HSA. The distances between Trp residue and the binding sites of the drugs were estimated according to the Förster theory, and it was demonstrated that non-radiative energy transfer from HSA to the drugs occurred with a high probability. Moreover, according to CV measurements, the decrease of peak current in the cyclic voltammogram of the both drugs in the presence of HSA revealed that they interacted with albumin and binding constants were calculated for binary systems which were in agreement with the binding constants obtained from UV absorption and fluorescence spectroscopy. The prediction of the best binding sites of ALP and FLX in binary and ternary systems in molecular modeling approach was done using of Gibbs free energy. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. Binding of DNA-binding alkaloids berberine and palmatine to tRNA and comparison to ethidium: Spectroscopic and molecular modeling studies

    NASA Astrophysics Data System (ADS)

    Islam, Md. Maidul; Pandya, Prateek; Chowdhury, Sebanti Roy; Kumar, Surat; Kumar, Gopinatha Suresh

    2008-11-01

    The interaction of two natural protoberberine plant alkaloids berberine and palmatine with tRNA phe was studied using various biophysical techniques and molecular modeling and the data were compared with the binding of the classical DNA intercalator, ethidium. Circular dichroic studies revealed that the tRNA conformation was moderately perturbed on binding of the alkaloids. The cooperative binding of both the alkaloids and ethidium to tRNA was revealed from absorbance and fluorescence studies. Fluorescence quenching studies advanced a conclusion that while berberine and palmatine are partially intercalated, ethidium is fully intercalated on the tRNA molecule. The binding of the alkaloids as well as ethidium stabilized the tRNA melting, and the binding constant evaluated from the averaged optical melting temperature data was in agreement with fluorescence spectral-binding data. Differential scanning calorimetry revealed that the tRNA melting showed three close transitions that were affected on binding of these small molecules. Molecular docking calculations performed showed the preferred regions of binding of these small molecules on the tRNA. Taken together, the results suggest that the binding of the alkaloids berberine and palmatine on the tRNA structure appears to be mostly by partial intercalation while ethidium intercalates fully on the tRNA. These results further advance our knowledge on the molecular aspects on the interaction of these alkaloids to tRNA.

  9. Paracetamol and cytarabine binding competition in high affinity binding sites of transporting protein

    NASA Astrophysics Data System (ADS)

    Sułkowska, A.; Bojko, B.; Równicka, J.; Sułkowski, W. W.

    2006-07-01

    Paracetamol (acetaminophen, AA) the most popular analgesic drug is commonly used in the treatment of pain in patients suffering from cancer. In our studies, we evaluated the competition in binding with serum albumin between paracetamol (AA) and cytarabine, antyleukemic drug (araC). The presence of one drug can alter the binding affinity of albumin towards the second one. Such interaction can result in changing of the free fraction of the one of these drugs in blood. Two spectroscopic methods were used to determine high affinity binding sites and the competition of the drugs. Basing on the change of the serum albumin fluorescence in the presence of either of the drugs the quenching ( KQ) constants for the araC-BSA and AA-BSA systems were calculated. Analysis of UV difference spectra allowed us to describe the changes in drug-protein complexes (araC-albumin and AA-albumin) induced by the presence of the second drug (AA and araC, respectively). The mechanism of competition between araC and AA has been proposed.

  10. Multispectroscopic and bioimaging approach for the interaction of rhodamine 6G capped gold nanoparticles with bovine serum albumin.

    PubMed

    Manjubaashini, N; Kesavan, Mookkandi Palsamy; Rajesh, Jegathalaprathaban; Daniel Thangadurai, T

    2018-06-01

    Binding interaction of Bovine Serum Albumin (BSA) with newly prepared rhodamine 6G-capped gold nanoparticles (Rh6G-Au NPs) under physiological conditions (pH 7.2) was investigated by a wide range of photophysical techniques. Rh6G-Au NPs caused the static quenching of the intrinsic fluorescence of BSA that resulted from the formation of ground-state complex between BSA and Rh6G-Au NPs. The binding constant from fluorescence quenching method (K a  = 1.04 × 10 4  L mol -1 ; LoD = 14.0 μM) is in accordance with apparent association constant (K app  = 1.14 × 10 1  M -1 ), which is obtained from absorption spectral studies. Förster resonance energy transfer (FRET) efficiency between the tryptophan (Trp) residue of BSA and fluorophore of Rh6G-Au NPs during the interaction was calculated to be 90%. The free energy change (ΔG = -23.07 kJ/mol) of BSA-Rh6G-Au NPs complex was calculated based on modified Stern-Volmer Plot. The time-resolved fluorescence analysis confirmed that quenching of BSA follows static mechanism through the formation of ground state complex. Furthermore, synchronous and three-dimensional fluorescence measurement, Raman spectral analysis and Circular Dichroism spectrum results corroborate the strong binding between Rh6G-Au NPs and BSA, which causes the conformational changes on BSA molecule. In addition, fluorescence imaging experiments of BSA in living human breast cancer (HeLa) cells was successfully demonstrated, which articulated the value of Rh6G-Au NPs practical applications in biological systems. Copyright © 2018. Published by Elsevier B.V.

  11. Synthesis of β-arabinofuranoside glycolipids, studies of their binding to surfactant protein-A and effect on sliding motilities of M. smegmatis.

    PubMed

    Naresh, Kottari; Avaji, Prakash Gouda; Maiti, Krishnagopal; Bharati, Binod K; Syal, Kirtimaan; Chatterji, Dipankar; Jayaraman, Narayanaswamy

    2012-04-01

    Surfactant protein A (SP-A), which is a lung innate immune system component, is known to bind glycolipids present at the cell surface of a mycobacterial pathogen. Lipoarabinomannan (LAM), a component of mycobacterial thick, waxy cell wall, is one of the glycolipid ligands for SP-A. In order to assess binding of synthetic glycolipids with SP-A and the glycosidic linkage preferences for the interaction, β-arabinofuranoside trisaccharide glycolipids constituted with β-(1→2), β-(1→3) and β-(1→2), β-(1→5) linkages relevant to LAM were synthesized through chemical glycosylations. The efficacies of synthetic glycolipids to interact with SP-A were assessed by using the surface plasmon resonance (SPR) technique, from which association-dissociation rate constants and equilibrium binding constants were derived. The equilibrium binding constants of the interaction of two constitutionally varying β-arabinofuranoside glycolipids with SP-A were found to be in the millimolar range. A comparison of the results with few α-anomeric arabinofuranoside glycolipids showed that glycolipids with β-anomeric linkages were having relatively lower equilibrium binding constants than those with α-anomeric linkages in binding to the protein, whereas oligosaccharides alone, without lipidic chains, exhibited higher equilibrium binding constants. Further, the synthetic compounds inhibited the growth of mycobacteria and affected sliding motilities of the bacteria, although to an extent relatively lesser than that of synthetic compounds constituted with α-anomeric linkages.

  12. Assessment of the binding performance of histamine-imprinted microspheres by frontal analysis capillary electrophoresis.

    PubMed

    Romano, Edwin F; Quirino, Joselito P; Holdsworth, John L; So, Regina C; Holdsworth, Clovia I

    2017-05-01

    Frontal analysis capillary electrophoresis was used to evaluate the binding performance of molecularly imprinted microspheres (MIM) toward its template histamine and analogs at pH 7, and compared to the high performance liquid chromatographic method. In both methods, batch binding was employed and the binding parameters were calculated from the measured concentration of unbound amine analytes and afforded comparable histamine equilibrium dissociation constants (K d ∼ 0.4 mM). FACE was easily carried out at shorter binding equilibration time (i.e. 30 min) and without the need to separate the microspheres, circumventing laborious and, in the case of the system under study, inefficient sample filtration. It also allowed for competitive binding studies by virtue of its ability to distinctly separate intact microspheres and all tested amines which could not be resolved in HPLC. K d 's for nonimprinted (control) microspheres (NIM) from FACE and HPLC were also comparable (∼ 0.6 mM) but at higher histamine concentrations, HPLC gave lower histamine binding. This discrepancy was attributed to inefficient filtration of the batch binding samples prior to HPLC analysis resulting in an over-estimation of the concentration of free histamine brought about by the presence of unfiltered histamine-bound microspheres. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Interaction of glucocorticoids and progesterone derivatives with human serum albumin.

    PubMed

    Abboud, Rola; Akil, Mohammad; Charcosset, Catherine; Greige-Gerges, Hélène

    2017-10-01

    Glucocorticoids (GCs) and progesterone derivatives (PGDs) are steroid hormones with well-known biological activities. Their interaction with human serum albumin (HSA) may control their distribution. Their binding to albumin is poorly studied in literature. This paper deals with the interaction of a series of GCs (cortisol, cortisone, prednisolone, prednisone, 6-methylprednisolone and 9-fluorocortisol acetate) and PGDs (progesterone, hydroxylated PGDs, methylated PGDs and dydrogesterone) with HSA solution (pH 7.4) at molar ratios steroid to HSA varying from 0 to 10. Similar titrations were conducted using Trp aqueous solution. Fluorescence titration method and Fourier transform infrared spectroscopy (FTIR) are used. PGDs (except dydrogesterone), cortisone and 9-fluorocortisol acetate affected weakly the fluorescence of Trp in buffer solution while they decreased in a dose-dependent manner that of HSA. Their binding constants to HSA were then calculated. Moreover, displacement experiment was performed using bilirubin as a site marker. The binding constant of bilirubin to albumin was determined in the absence and presence of a steroid at a molar ratio steroid to HSA of 1. The results indicate that the steroids bind to HSA at site I in a pocket different from that of bilirubin. Furthermore, the peak positions of amide I and amide II bands of HSA were shifted in the presence of progesterone, dydrogesterone and GCs. Also a variation was observed in amide I region indicating the formation of hydrogen bonding between albumin and steroids. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Moiré-pattern interlayer potentials in van der Waals materials in the random-phase approximation

    NASA Astrophysics Data System (ADS)

    Leconte, Nicolas; Jung, Jeil; Lebègue, Sébastien; Gould, Tim

    2017-11-01

    Stacking-dependent interlayer interactions are important for understanding the structural and electronic properties in incommensurable two-dimensional material assemblies where long-range moiré patterns arise due to small lattice constant mismatch or twist angles. Here we study the stacking-dependent interlayer coupling energies between graphene (G) and hexagonal boron nitride (BN) homo- and heterostructures using high-level random-phase approximation (RPA) ab initio calculations. Our results show that although total binding energies within LDA and RPA differ substantially by a factor of 200%-400%, the energy differences as a function of stacking configuration yield nearly constant values with variations smaller than 20%, meaning that LDA estimates are quite reliable. We produce phenomenological fits to these energy differences, which allows us to calculate various properties of interest including interlayer spacing, sliding energetics, pressure gradients, and elastic coefficients to high accuracy. The importance of long-range interactions (captured by RPA but not LDA) on various properties is also discussed. Parametrizations for all fits are provided.

  15. Study on the interaction of a copper(II) complex containing the artificial sweetener aspartame with human serum albumin.

    PubMed

    Shahabadi, Nahid; Khodaei, Mohammad Mehdi; Kashanian, Soheila; Kheirdoosh, Fahimeh; Filli, Soraya Moradi

    2014-05-01

    A copper(II) complex containing aspartame (APM) as ligand, Cu(APM)2Cl2·2H2O, was synthesized and characterized. In vitro binding interaction of this complex with human serum albumin (HSA) was studied at physiological pH. Binding studies of this complex with HSA are useful for understanding the Cu(APM)2Cl2·2H2O-HSA interaction mechanism and providing guidance for the application and design of new and more efficient artificial sweeteners drive. The interaction was investigated by spectrophotometric, spectrofluorometric, competition experiment and circular dichroism. Hyperchromicity observed in UV absorption band of Cu(APM)2Cl2·2H2O. A strong fluorescence quenching reaction of HSA to Cu(APM)2Cl2·2H2O was observed and the binding constant (Kf) and corresponding numbers of binding sites (n) were calculated at different temperatures. Thermodynamic parameters, enthalpy change (∆H) and entropy change (∆S) were calculated to be -458.67 kJ mol(-1) and -1,339 J mol(-1 )K(-1) respectively. According to the van't Hoff equation, the reaction is predominantly enthalpically driven. In conformity with experimental results, we suggest that Cu(APM)2Cl2·2H2O interacts with HSA. In comparison with previous study, it is found that the Cu(II) complex binds stronger than aspartame.

  16. Cd and proton adsorption onto bacterial consortia grown from industrial wastes and contaminated geologic settings.

    PubMed

    Borrok, David M; Fein, Jeremy B; Kulpa, Charles F

    2004-11-01

    To model the effects of bacterial metal adsorption in contaminated environments, results from metal adsorption experiments involving individual pure stains of bacteria must be extrapolated to systems in which potentially dozens of bacterial species are present. This extrapolation may be made easier because bacterial consortia from natural environments appear to exhibit similar metal binding properties. However, bacteria that thrive in highly perturbed contaminated environments may exhibit significantly different adsorptive behavior. Here we measure proton and Cd adsorption onto a range of bacterial consortia grown from heavily contaminated industrial wastes, groundwater, and soils. We model the results using a discrete site surface complexation approach to determine binding constants and site densities for each consortium. The results demonstrate that bacterial consortia from different contaminated environments exhibit a range of total site densities (approximately a 3-fold difference) and Cd-binding constants (approximately a 10-fold difference). These ranges for Cd binding constants may be small enough to suggest that bacteria-metal adsorption in contaminated environments can be described using relatively few "averaged" bacteria-metal binding constants (in conjunction with the necessary binding constants for competing surfaces and ligands). However, if additional precision is necessary, modeling parameters must be developed separately for each contaminated environment of interest.

  17. Bidentate urea derivatives of p-tert-butyldihomooxacalix[4]arene: neutral receptors for anion complexation.

    PubMed

    Marcos, Paula M; Teixeira, Filipa A; Segurado, Manuel A P; Ascenso, José R; Bernardino, Raul J; Michel, Sylvia; Hubscher-Bruder, Véronique

    2014-01-17

    Three new bidentate ureidodihomooxacalix[4]arene derivatives (phenyl 5a, n-propyl 5b, and tert-butyl 5c) were synthesized in four steps from the parent compound p-tert-butyldihomooxacalix[4]arene and obtained in the cone conformation, as shown by NMR studies. The binding ability of these neutral receptors toward spherical, linear, trigonal planar, and tetrahedrical anions was assessed by (1)H NMR and UV-vis titrations. The structures and complexation energies of some complexes were also studied by DFT methods. The data showed that the association constants are strongly dependent on the nature of the substituent (aryl/alkyl) at the urea moiety. In general, for all the receptors, the association constants decrease with decrease of anion basicity. Ph-urea 5a is the best anion receptor, showing the strongest complexation for F(-) (log K(assoc) = 3.10 in CDCl3) and also high binding affinity for the carboxylates AcO(-) and BzO(-). Similar results were obtained by UV-vis studies and were also corroborated by DFT calculations.

  18. Sensitivity of polarization fluctuations to the nature of protein-water interactions: Study of biological water in four different protein-water systems

    NASA Astrophysics Data System (ADS)

    Ghosh, Rikhia; Banerjee, Saikat; Hazra, Milan; Roy, Susmita; Bagchi, Biman

    2014-12-01

    Since the time of Kirkwood, observed deviations in magnitude of the dielectric constant of aqueous protein solution from that of neat water (˜80) and slower decay of polarization have been subjects of enormous interest, controversy, and debate. Most of the common proteins have large permanent dipole moments (often more than 100 D) that can influence structure and dynamics of even distant water molecules, thereby affecting collective polarization fluctuation of the solution, which in turn can significantly alter solution's dielectric constant. Therefore, distance dependence of polarization fluctuation can provide important insight into the nature of biological water. We explore these aspects by studying aqueous solutions of four different proteins of different characteristics and varying sizes, chicken villin headpiece subdomain (HP-36), immunoglobulin binding domain protein G (GB1), hen-egg white lysozyme (LYS), and Myoglobin (MYO). We simulate fairly large systems consisting of single protein molecule and 20000-30000 water molecules (varied according to the protein size), providing a concentration in the range of ˜2-3 mM. We find that the calculated dielectric constant of the system shows a noticeable increment in all the cases compared to that of neat water. Total dipole moment auto time correlation function of water ⟨δMW(0)δMW(t)⟩ is found to be sensitive to the nature of the protein. Surprisingly, dipole moment of the protein and total dipole moment of the water molecules are found to be only weakly coupled. Shellwise decomposition of water molecules around protein reveals higher density of first layer compared to the succeeding ones. We also calculate heuristic effective dielectric constant of successive layers and find that the layer adjacent to protein has much lower value (˜50). However, progressive layers exhibit successive increment of dielectric constant, finally reaching a value close to that of bulk 4-5 layers away. We also calculate shellwise orientational correlation function and tetrahedral order parameter to understand the local dynamics and structural re-arrangement of water. Theoretical analysis providing simple method for calculation of shellwise local dielectric constant and implication of these findings are elaborately discussed in the present work.

  19. Spectroscopic and microcalorimetric studies on the molecular binding of food colorant acid red 27 with deoxyribonucleic acid.

    PubMed

    Basu, Anirban; Kumar, Gopinatha Suresh

    2016-08-01

    Interaction of the food colorant acid red 27 with double stranded DNA was investigated using spectroscopic and calorimetric methods. Absorbance and fluorescence studies suggested an intimate binding interaction between the dye and DNA. The quantum efficiency value testified an effective energy transfer from the DNA base pairs to the dye molecules. Minor groove displacement assay with Hoechst 33258 revealed that the binding occurs in the minor groove of DNA. Circular dichroism studies revealed that acid red 27 induces moderate conformational perturbations in DNA. Results of calorimetric studies suggested that the complexation process was driven largely by positive entropic contribution with a smaller favorable enthalpy contribution. The equilibrium constant of the binding was calculated to be (3.04 ± 0.09) × 10(4)  M(-1) at 298.15 K. Negative heat capacity value along with the enthalpy-entropy compensation phenomenon established the involvement of dominant hydrophobic forces in the binding process. Differential scanning calorimetry studies presented evidence for an increased thermal stability of DNA on binding of acid red 27. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  20. Small Molecule Regulation of Protein Conformation by Binding in the Flap of HIV Protease

    PubMed Central

    Tiefenbrunn, Theresa; Forli, Stefano; Baksh, Michael M.; Chang, Max W.; Happer, Meaghan; Lin, Ying-Chuan; Perryman, Alexander L.; Rhee, Jin-Kyu; Torbett, Bruce E.; Olson, Arthur J.; Elder, John H.; Finn, M. G.; Stout, C. David

    2013-01-01

    The fragment indole-6-carboxylic acid (1F1), previously identified as a flap site binder in a fragment-based screen against HIV protease (PR), has been co-crystallized with pepstatin-inhibited PR and with apo-PR. Another fragment, 3-indolepropionic acid (1F1-N), predicted by AutoDock calculations and confirmed in a novel ‘inhibition of nucleation’ crystallization assay, exploits the same interactions in the flap site in two crystal structures. Both 1F1 and 1F1-N bind to the closed form of apo-PR and to pepstatin:PR. In solution, 1F1 and 1F1-N raise the Tm of apo-PR by 3.5–5 °C as assayed by differential scanning fluorimetry (DSF), and show equivalent low-micromolar binding constants to both apo-PR and pepstatin:PR, assayed by backscattering interferometry (BSI). The observed signal intensities in BSI are greater for each fragment upon binding to apo-PR than to pepstatin-bound PR, consistent with greater conformational change in the former binding event. Together, these data indicate that fragment binding in the flap site favors a closed conformation of HIV PR. PMID:23540839

  1. Alteration of methotrexate binding to human serum albumin induced by oxidative stress. Spectroscopic comparative study

    NASA Astrophysics Data System (ADS)

    Maciążek-Jurczyk, M.; Sułkowska, A.; Równicka-Zubik, J.

    2016-01-01

    Changes of oxidative modified albumin conformation by comparison of non-modified (HSA) and modified (oHSA) human serum albumin absorption spectra, Red Edge Excitation Shift (REES) effect and fluorescence synchronous spectra were investigated. Studies of absorption spectra indicated that changes in the value of absorbance associated with spectral changes in the region from 200 to 250 nm involve structural alterations related to variations in peptide backbone conformation. Analysis of the REES effect allowed for the observation of changes caused by oxidation in the region of the hydrophobic pocket containing the tryptophanyl residue. Synchronous fluorescence spectroscopy confirmed changes of the position of the tryptophanyl and tyrosil residues fluorescent band. Effect of oxidative stress on binding of methotrexate (MTX) was investigated by spectrofluorescence, UV-VIS and 1HNMR spectroscopy. MTX caused the fluorescence quenching of non-modified (HSA) and modified (oHSA) human serum albumin molecule. The values of binding constants, Hill's coefficients and a number of binding sites in the protein molecule in the high affinity binding site were calculated for the binary MTX-HSA and MTX-oHSA systems. For these systems, qualitative analysis in the low affinity binding sites was performed with the use of the 1HNMR technique.

  2. A Role for Weak Electrostatic Interactions in Peripheral Membrane Protein Binding

    PubMed Central

    Khan, Hanif M.; He, Tao; Fuglebakk, Edvin; Grauffel, Cédric; Yang, Boqian; Roberts, Mary F.; Gershenson, Anne; Reuter, Nathalie

    2016-01-01

    Bacillus thuringiensis phosphatidylinositol-specific phospholipase C (BtPI-PLC) is a secreted virulence factor that binds specifically to phosphatidylcholine (PC) bilayers containing negatively charged phospholipids. BtPI-PLC carries a negative net charge and its interfacial binding site has no obvious cluster of basic residues. Continuum electrostatic calculations show that, as expected, nonspecific electrostatic interactions between BtPI-PLC and membranes vary as a function of the fraction of anionic lipids present in the bilayers. Yet they are strikingly weak, with a calculated ΔGel below 1 kcal/mol, largely due to a single lysine (K44). When K44 is mutated to alanine, the equilibrium dissociation constant for small unilamellar vesicles increases more than 50 times (∼2.4 kcal/mol), suggesting that interactions between K44 and lipids are not merely electrostatic. Comparisons of molecular-dynamics simulations performed using different lipid compositions reveal that the bilayer composition does not affect either hydrogen bonds or hydrophobic contacts between the protein interfacial binding site and bilayers. However, the occupancies of cation-π interactions between PC choline headgroups and protein tyrosines vary as a function of PC content. The overall contribution of basic residues to binding affinity is also context dependent and cannot be approximated by a rule-of-thumb value because these residues can contribute to both nonspecific electrostatic and short-range protein-lipid interactions. Additionally, statistics on the distribution of basic amino acids in a data set of membrane-binding domains reveal that weak electrostatics, as observed for BtPI-PLC, might be a less unusual mechanism for peripheral membrane binding than is generally thought. PMID:27028646

  3. Semi-empirical proton binding constants for natural organic matter

    NASA Astrophysics Data System (ADS)

    Matynia, Anthony; Lenoir, Thomas; Causse, Benjamin; Spadini, Lorenzo; Jacquet, Thierry; Manceau, Alain

    2010-03-01

    Average proton binding constants ( KH,i) for structure models of humic (HA) and fulvic (FA) acids were estimated semi-empirically by breaking down the macromolecules into reactive structural units (RSUs), and calculating KH,i values of the RSUs using linear free energy relationships (LFER) of Hammett. Predicted log KH,COOH and log KH,Ph-OH are 3.73 ± 0.13 and 9.83 ± 0.23 for HA, and 3.80 ± 0.20 and 9.87 ± 0.31 for FA. The predicted constants for phenolic-type sites (Ph-OH) are generally higher than those derived from potentiometric titrations, but the difference may not be significant in view of the considerable uncertainty of the acidity constants determined from acid-base measurements at high pH. The predicted constants for carboxylic-type sites agree well with titration data analyzed with Model VI (4.10 ± 0.16 for HA, 3.20 ± 0.13 for FA; Tipping, 1998), the Impermeable Sphere model (3.50-4.50 for HA; Avena et al., 1999), and the Stockholm Humic Model (4.10 ± 0.20 for HA, 3.50 ± 0.40 for FA; Gustafsson, 2001), but differ by about one log unit from those obtained by Milne et al. (2001) with the NICA-Donnan model (3.09 ± 0.51 for HA, 2.65 ± 0.43 for FA), and used to derive recommended generic values. To clarify this ambiguity, 10 high-quality titration data from Milne et al. (2001) were re-analyzed with the new predicted equilibrium constants. The data are described equally well with the previous and new sets of values ( R2 ⩾ 0.98), not necessarily because the NICA-Donnan model is overparametrized, but because titration lacks the sensitivity needed to quantify the full binding properties of humic substances. Correlations between NICA-Donnan parameters are discussed, but general progress is impeded by the unknown number of independent parameters that can be varied during regression of a model fit to titration data. The high consistency between predicted and experimental KH,COOH values, excluding those of Milne et al. (2001), gives faith in the proposed semi-empirical structural approach, and its usefulness to assess the plausibility of proton stability constants derived from simulations of titration data.

  4. Investigation of flavonoids bearing different substituents on ring C and their cu2+ complex binding with bovine serum albumin: structure-affinity relationship aspects.

    PubMed

    Shi, Shuyun; Zhang, Yuping; Chen, Xiaoqin; Peng, Mijun

    2011-10-12

    The effects of 1:1 flavonoid-Cu(2+) complexes of four flavonoids with different C-ring substituents, quercetin (QU), luteolin (LU), taxifolin (TA), and (+)-catechin (CA), on bovine serum albumin (BSA) were investigated and compared with corresponding free flavonoids by spectroscopic analysis in an attempt to characterize the chemical association taking place. The results indicated that all of the quenching mechanisms were based on static quenching combined with nonradiative energy transfer. Cu(2+) chelation changed the binding constants for BSA depending on the structures of flavonoids and the detected concentrations. The reduced hydroxyl groups, increased steric hindrance, and hydrophilicity of Cu(2+) chelation may be the main reasons for the reduced binding constants, whereas the formation of stable flavonoid-Cu(2+) complexes and synergistic action could increase the binding constants. The changed trends of critical energy transfer distance (R(0)) for Cu(2+) chelation were contrary to those of binding constants.

  5. Proton and metal ion binding to natural organic polyelectrolytes-II. Preliminary investigation with a peat and a humic acid

    USGS Publications Warehouse

    Marinsky, J.A.; Reddy, M.M.

    1984-01-01

    We summarize here experimental studies of proton and metal ion binding to a peat and a humic acid. Data analysis is based on a unified physico-chemical model for reaction of simple ions with polyelectrolytes employing a modified Henderson-Hasselbalch equation. Peat exhibited an apparent intrinsic acid dissociation constant of 10-4.05, and an apparent intrinsic metal ion binding constant of: 400 for cadmium ion; 600 for zinc ion; 4000 for copper ion; 20000 for lead ion. A humic acid was found to have an apparent intrinsic proton binding constant of 10-2.6. Copper ion binding to this humic acid sample occurred at two types of sites. The first site exhibited reaction characteristics which were independent of solution pH and required the interaction of two ligands on the humic acid matrix to simultaneously complex with each copper ion. The second complex species is assumed to be a simple monodentate copper ion-carboxylate species with a stability constant of 18. ?? 1984.

  6. Novel cholinesterase modulators and their ability to interact with DNA

    NASA Astrophysics Data System (ADS)

    Janockova, Jana; Gulasova, Zuzana; Musilek, Kamil; Kuca, Kamil; Kozurkova, Maria

    2013-11-01

    In the present work, an interaction of four cholinesterase modulators (1-4) with calf thymus DNA was studied via spectroscopic techniques (UV-Vis, fluorescent spectroscopy and circular dichroism). From UV-Vis spectroscopic analysis, the binding constants for DNA-pyridinium oximes complexes were calculated (K = 3.5 × 104 to 1.4 × 105 M-1). All these measurements indicated that the compounds behave as effective DNA-interacting agents. Electrophoretic techniques proved that ligand 2 inhibited topoisomerase I at a concentration 5 μM.

  7. Clay catalysis of oligonucleotide formation: kinetics of the reaction of the 5'-phosphorimidazolides of nucleotides with the non-basic heterocycles uracil and hypoxanthine

    NASA Technical Reports Server (NTRS)

    Kawamura, K.; Ferris, J. P.

    1999-01-01

    The montmorillonite clay catalyzed condensation of activated monocleotides to oligomers of RNA is a possible first step in the formation of the proposed RNA world. The rate constants for the condensation of the phosphorimidazolide of adenosine were measured previously and these studies have been extended to the phosphorimidazolides of inosine and uridine in the present work to determine of substitution of neutral heterocycles for the basic adenine ring changes the reaction rate or regioselectivity. The oligomerization reactions of the 5'-phosphoromidazolides of uridine (ImpU) and inosine (ImpI) on montmorillonite yield oligo(U)s and oligo(I)s as long as heptamers. The rate constants for oligonucleotide formation were determined by measuring the rates of formation of the oligomers by HPLC. Both the apparent rate constants in the reaction mixture and the rate constants on the clay surface were calculated using the partition coefficients of the oligomers between the aqueous and clay phases. The rate constants for trimer formation are much greater than those dimer synthesis but there was little difference in the rate constants for the formation of trimers and higher oligomers. The overall rates of oligomerization of the phosphorimidazolides of purine and pyrimidine nucleosides in the presence of montmorillonite clay are the same suggesting that RNA formed on the primitive Earth could have contained a variety of heterocyclic bases. The rate constants for oligomerization of pyrimidine nucleotides on the clay surface are significantly higher than those of purine nucleotides since the pyrimidine nucleotides bind less strongly to the clay than do the purine nucleotides. The differences in the binding is probably due to Van der Waals interactions between the purine bases and the clay surface. Differences in the basicity of the heterocyclic ring in the nucleotide have little effect on the oligomerization process.

  8. Experimental, computational and chemometrics studies of BSA-vitamin B6 interaction by UV-Vis, FT-IR, fluorescence spectroscopy, molecular dynamics simulation and hard-soft modeling methods.

    PubMed

    Manouchehri, Firouzeh; Izadmanesh, Yahya; Aghaee, Elham; Ghasemi, Jahan B

    2016-10-01

    The interaction of pyridoxine (Vitamin B6) with bovine serum albumin (BSA) is investigated under pseudo-physiological conditions by UV-Vis, fluorescence and FTIR spectroscopy. The intrinsic fluorescence of BSA was quenched by VB6, which was rationalized in terms of the static quenching mechanism. According to fluorescence quenching calculations, the bimolecular quenching constant (kq), dynamic quenching (KSV) and static quenching (KLB) at 310K were obtained. The efficiency of energy transfer and the distance between the donor (BSA) and the acceptor (VB6) were calculated by Foster's non-radiative energy transfer theory and were equal to 41.1% and 2.11nm. The collected UV-Vis and fluorescence spectra were combined into a row-and column-wise augmented matrix and resolved by multivariate curve resolution-alternating least squares (MCR-ALS). MCR-ALS helped to estimate the stoichiometry of interactions, concentration profiles and pure spectra for three species (BSA, VB6 and VB6-BSA complex) existed in the interaction procedure. Based on the MCR-ALS results, using mass balance equations, a model was developed and binding constant of complex was calculated using non-linear least squares curve fitting. FT-IR spectra showed that the conformation of proteins was altered in presence of VB6. Finally, the combined docking and molecular dynamics (MD) simulations were used to estimate the binding affinity of VB6 to BSA. Five-nanosecond MD simulations were performed on bovine serum albumin (BSA) to study the conformational features of its ligand binding site. From MD results, eleven BSA snapshots were extracted, at every 0.5ns, to explore the binding affinity (GOLD score) of VB6 using a docking procedure. MD simulations indicated that there is a considerable flexibility in the structure of protein that affected ligand recognition. Structural analyses and docking simulations indicated that VB6 binds to site I and GOLD score values depend on the conformations of both BSA and ligand. Molecular modeling results showed that VB6-BSA complex formed not only on the basis of electrostatic forces, but also on the basis of π-π staking and hydrogen bond. There was an excellent agreement between the experimental and computational results. The results presented in this paper, will offer a reference for detailed and systematic studies on the biological effects and action mechanism of small molecules with proteins. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Pressure-volume relations and bulk modulus under pressure of tetrahedral compounds

    NASA Astrophysics Data System (ADS)

    Soma, T.; Takahashi, Y.; Kagaya, H.-M.

    1985-03-01

    The pressure-volume relation and the compression effect on the bulk modulus of tetrahedral compounds such as GaP, InP, ZnS, ZnSe, ZnTe and CdTe are investigated from the electronic theory of solids by using a recently presented binding force, which includes mainly covalent interactions in the pseudopotential formalism and partially ionic interactions. The calculated results of the pressure-volume relations involving the pressure-induced phase transition are useful when comparing with the experimental data under high pressure. The calculated bulk modulus of these compounds increases as the crystal volume decreases. Further, the pressure derivative of bulk modulus is not constant and decreases with the reduction of the crystal volume.

  10. Rate constants of agonist binding to muscarinic receptors in rat brain medulla. Evaluation by competition kinetics

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schreiber, G.; Henis, Y.I.; Sokolovsky, M.

    The method of competition kinetics, which measures the binding kinetics of an unlabeled ligand through its effect on the binding kinetics of a labeled ligand, was employed to investigate the kinetics of muscarinic agonist binding to rat brain medulla pons homogenates. The agonists studied were acetylcholine, carbamylcholine, and oxotremorine, with N-methyl-4-(TH)piperidyl benzilate employed as the radiolabeled ligand. Our results suggested that the binding of muscarinic agonists to the high affinity sites is characterized by dissociation rate constants higher by 2 orders of magnitude than those of antagonists, with rather similar association rate constants. Our findings also suggest that isomerization ofmore » the muscarinic receptors following ligand binding is significant in the case of antagonists, but not of agonists. Moreover, it is demonstrated that in the medulla pons preparation, agonist-induced interconversion between high and low affinity bindings sites does not occur to an appreciable extent.« less

  11. Pathogenesis of Shigella diarrhea: rabbit intestinal cell microvillus membrane binding site for Shigella toxin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fuchs, G.; Mobassaleh, M.; Donohue-Rolfe, A.

    This study examined the binding of purified /sup 125/I-labeled shigella toxin to rabbit jejunal microvillus membranes (MVMs). Toxin binding was concentration dependent, saturable, reversible, and specifically inhibited by unlabeled toxin. The calculated number of toxin molecules bound at 4/sup 0/C was 7.9 X 10(10) (3 X 10(10) to 2 X 10(11))/micrograms of MVM protein or 1.2 X 10(6) per enterocyte. Scatchard analysis showed the binding site to be of a single class with an equilibrium association constant, K, of 4.7 X 10(9) M-1 at 4/sup 0/C. Binding was inversely related to the temperature of incubation. A total of 80% ofmore » the labeled toxin binding at 4/sup 0/C dissociated from MVM when the temperature was raised to 37/sup 0/C, but reassociated when the temperature was again brought to 4/sup 0/C. There was no structural or functional change of MVM due to toxin as monitored by electron microscopy or assay of MVM sucrase activity. These studies demonstrate a specific binding site for shigella toxin on rabbit MVMs. The physiological relevance of this receptor remains to be determined.« less

  12. The effect of interferon on the receptor sites to rabies virus on mouse neuroblastoma cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Briggs, D.J.

    1989-01-01

    The binding of rabies virus to mouse neuroblastoma cells (MNA) primed with alpha interferon (IFN-{alpha}), beta interferon (IFN-{beta}), or alpha bungarotoxin (BTX) was examined. A saturable number of receptor sites to rabies virus was calculated by increasing the amount of {sup 3}H-CVS added to a constant number of untreated MNA cells. MNA cells were then exposed to 20 I.U. of IFN-{alpha}, IFN-{beta}, or 1 {mu}g of BTX and assayed to determine if these treatments had an effect on the number of receptor sites to rabies virus. Total amount of {sup 3}H-CVS bound to MNA cells was determined during a threemore » hour incubation period. Cold competition assays using 1,000 fold excess unlabeled CVS were used to determine non-specific binding for each treatment. Specific binding was then calculated by subtracting non-specific binding from the total amount of CVS bound to MNA cells. A similar amount of total viral protein bound to untreated and IFN-{beta}, and BTX treated cells after 180 minutes of incubation. The bound protein varied by only 0.07 {mu}g. However, the amount of specific and non-specific binding varied a great deal between treatments. BTX caused an increase in non-specific and a decrease in specific binding of rabies virus. IFN-{beta} produced variable results in non-specific and specific binding while IFN-{alpha} caused mainly specific binding to occur. The most significant change brought about by IFN-{alpha} was an increase in the rate of viral attachment. At 30 minutes post-infection, IFN-{alpha} treated cells had bound 90% of the total amount of virus bound to untreated cells after 180 minutes. The increased binding rate did not cause a productive infection of rabies virus. No viral production was evident after an incubation period of 48 hours in either IFN-{alpha} or IFN-{beta} treated cells.« less

  13. The effect of Cu(2+) chelation on the direct photolysis of oxytetracycline: A study assisted by spectroscopy analysis and DFT calculation.

    PubMed

    Jin, Xin; Qiu, Shanshan; Wu, Ke; Jia, Mingyun; Wang, Fang; Gu, Chenggang; Zhang, Aiqian; Jiang, Xin

    2016-07-01

    The extensive usage of OTC and Cu(2+) in livestock and poultry industry caused high residues in natural environment. Co-contamination of OTC and Cu(2+) was a considerable environmental problem in surface waters. In this study, Cu(2+) mediated direct photolysis of OTC was studied. Cu(2+) chelating with OTC was found to greatly inhibit OTC photodegradation. To reveal the chelation mechanism of OTC-Cu complexes, multiple methods including UV-Vis absorption spectra, Infrared (IR) spectra, mass spectroscopy, and density functional theoretical (DFT) modeling were performed. Four OTC-Cu complexes were proposed. Cu(2+) preferably bond to O11O12 site with the binding constants logK = 8.19 and 7.86 for CuHL+ and CuL±, respectively. The second chelating site was suggested to be O2O3 with the binding constants of logK = 4.41 and 4.62 for Cu2HL3+ and Cu2L2+, respectively. The suppressed quantum yield of OTC by Cu2+ chelation was accused for their intra-/inter-molecular electron transfer, by which the energy in activated states was distributed. The occurrence of electron transfer between BCD ring and A ring also from BCD ring to Cu was evidenced by the TD-DFT result only for the OTC-Cu complexes. Besides, the cyclic voltammetry measurement also suggested one OTC-Cu(II)/OTC-Cu(I) redox couple. These results suggested that the persistence of OTC in environmental surface waters will probably be underestimated for neglecting the chelating effect of Cu2+. The photolysis quantum yield of OTC-Cu complexes, as well as the specific molar absorption constants, the equilibrium binding constants of Cu2+ with OTC could contribute to more accurate kinetic models of OTC. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. Catalytic oxidation of o-aminophenols and aromatic amines by mushroom tyrosinase.

    PubMed

    Muñoz-Muñoz, Jose Luis; Garcia-Molina, Francisco; Garcia-Ruiz, Pedro Antonio; Varon, Ramon; Tudela, Jose; Rodriguez-Lopez, Jose N; Garcia-Canovas, Francisco

    2011-12-01

    The kinetics of tyrosinase acting on o-aminophenols and aromatic amines as substrates was studied. The catalytic constants of aromatic monoamines and o-diamines were both low, these results are consistent with our previous mechanism in which the slow step is the transfer of a proton by a hydroxyl to the peroxide in oxy-tyrosinase (Fenoll et al., Biochem. J. 380 (2004) 643-650). In the case of o-aminophenols, the hydroxyl group indirectly cooperates in the transfer of the proton and consequently the catalytic constants in the action of tyrosinase on these compounds are higher. In the case of aromatic monoamines, the Michaelis constants are of the same order of magnitude than for monophenols, which suggests that the monophenols bind better (higher binding constant) to the enzyme to facilitate the π-π interactions between the aromatic ring and a possible histidine of the active site. In the case of aromatic o-diamines, both the catalytic and Michaelis constants are low, the values of the catalytic constants being lower than those of the corresponding o-diphenols. The values of the Michaelis constants of the aromatic o-diamines are slightly lower than those of their corresponding o-diphenols, confirming that the aromatic o-diamines bind less well (lower binding constant) to the enzyme. Copyright © 2011 Elsevier B.V. All rights reserved.

  15. Binding constant of cell adhesion receptors and substrate-immobilized ligands depends on the distribution of ligands

    NASA Astrophysics Data System (ADS)

    Li, Long; Hu, Jinglei; Xu, Guangkui; Song, Fan

    2018-01-01

    Cell-cell adhesion and the adhesion of cells to tissues and extracellular matrix, which are pivotal for immune response, tissue development, and cell locomotion, depend sensitively on the binding constant of receptor and ligand molecules anchored on the apposing surfaces. An important question remains of whether the immobilization of ligands affects the affinity of binding with cell adhesion receptors. We have investigated the adhesion of multicomponent membranes to a flat substrate coated with immobile ligands using Monte Carlo simulations of a statistical mesoscopic model with biologically relevant parameters. We find that the binding of the adhesion receptors to ligands immobilized on the substrate is strongly affected by the ligand distribution. In the case of ligand clusters, the receptor-ligand binding constant can be significantly enhanced due to the less translational entropy loss of lipid-raft domains in the model cell membranes upon the formation of additional complexes. For ligands randomly or uniformly immobilized on the substrate, the binding constant is rather decreased since the receptors localized in lipid-raft domains have to pay an energetic penalty in order to bind ligands. Our findings help to understand why cell-substrate adhesion experiments for measuring the impact of lipid rafts on the receptor-ligand interactions led to contradictory results.

  16. Transcription factor target site search and gene regulation in a background of unspecific binding sites.

    PubMed

    Hettich, J; Gebhardt, J C M

    2018-06-02

    Response time and transcription level are vital parameters of gene regulation. They depend on how fast transcription factors (TFs) find and how efficient they occupy their specific target sites. It is well known that target site search is accelerated by TF binding to and sliding along unspecific DNA and that unspecific associations alter the occupation frequency of a gene. However, whether target site search time and occupation frequency can be optimized simultaneously is mostly unclear. We developed a transparent and intuitively accessible state-based formalism to calculate search times to target sites on and occupation frequencies of promoters of arbitrary state structure. Our formalism is based on dissociation rate constants experimentally accessible in live cell experiments. To demonstrate our approach, we consider promoters activated by a single TF, by two coactivators or in the presence of a competitive inhibitor. We find that target site search time and promoter occupancy differentially vary with the unspecific dissociation rate constant. Both parameters can be harmonized by adjusting the specific dissociation rate constant of the TF. However, while measured DNA residence times of various eukaryotic TFs correspond to a fast search time, the occupation frequencies of target sites are generally low. Cells might tolerate low target site occupancies as they enable timely gene regulation in response to a changing environment. Copyright © 2018 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  17. Binding Interactions of Dopamine and Apomorphine in D2High and D2Low States of Human Dopamine D2 Receptor Using Computational and Experimental Techniques.

    PubMed

    Durdagi, Serdar; Salmas, Ramin Ekhteiari; Stein, Matthias; Yurtsever, Mine; Seeman, Philip

    2016-02-17

    We have recently reported G-protein coupled receptor (GPCR) model structures for the active and inactive states of the human dopamine D2 receptor (D2R) using adrenergic crystal structures as templates. Since the therapeutic concentrations of dopamine agonists that suppress the release of prolactin are the same as those that act at the high-affinity state of the D2 receptor (D2High), D2High in the anterior pituitary gland is considered to be the functional state of the receptor. In addition, the therapeutic concentrations of anti-Parkinson drugs are also related to the dissociation constants in the D2High form of the receptor. The discrimination between the high- and low-affinity (D2Low) components of the D2R is not obvious and requires advanced computer-assisted structural biology investigations. Therefore, in this work, the derived D2High and D2Low receptor models (GPCR monomer and dimer three-dimensional structures) are used as drug-binding targets to investigate binding interactions of dopamine and apomorphine. The study reveals a match between the experimental dissociation constants of dopamine and apomorphine at their high- and low-affinity sites of the D2 receptor in monomer and dimer and their calculated dissociation constants. The allosteric receptor-receptor interaction for dopamine D2R dimer is associated with the accessibility of adjacent residues of transmembrane region 4. The measured negative cooperativity between agonist ligand at dopamine D2 receptor is also correctly predicted using the D2R homodimerization model.

  18. A combined spectroscopic, molecular docking and molecular dynamic simulation study on the interaction of quercetin with β-casein nanoparticles.

    PubMed

    Mehranfar, Fahimeh; Bordbar, Abdol-Khalegh; Parastar, Hadi

    2013-10-05

    The interaction of quercetin with β-casein nanoparticle micelle was studied at various temperatures in order to do a complete thermodynamic and molecular analysis on the binding process. The results of fluorescence studies showed the possibility of fluorescence energy transfer between excited tryptophan and quercetin. The determined values of critical transfers distance and the mean distance of ligand from Trp-143 residues in β-casein micelle represents a non-radiative energy transfer mechanism for quenching and the existence of a significant interaction between this flavonoid and β-casein nanoparticle. The equilibrium binding of quercetin with β-casein micelle at different temperatures was studied by using UV-Vis absorption spectroscopy. The chemometric analysis (principal component analysis (PCA) and multivariate curve resolution-alternating least squares (MCR-ALS) methods) on spectrophotometric data revealed the existence of two components in solution (quercetin and β-casein-quercetin complex) and resolved their pure concentration and spectral profiles. This information let us to calculate the equilibrium binding constant at various temperatures and the relevant thermodynamic parameters of interaction (enthalpy, entropy and Gibbs free energy) with low uncertainty. The negative values of entropy and enthalpy changes represent the predominate role of hydrogen binding and van der Waals interactions in the binding process. Docking calculations showed the probable binding site of quercetin is located in the hydrophobic core of β-casein where the quercetin molecule is lined by hydrophobic residues and make five hydrogen bonds and several van der Waals contacts with them. Moreover, molecular dynamic (MD) simulation results suggested that this flavonoid can interact with β-casein, without affecting the secondary structure of β-casein. Simulations, molecular docking and experimental data reciprocally supported each other. Copyright © 2013 Elsevier B.V. All rights reserved.

  19. Synthesis, crystal structure and investigation of mononuclear copper(II) and zinc(II) complexes of a new carboxylate rich tripodal ligand and their interaction with carbohydrates in alkaline aqueous solution

    PubMed Central

    Stewart, Christopher D.; Pedraza, Mayra; Arman, Hadi; Fan, Hua-Jun; Schilling, Eduardo Luiz; Szpoganicz, Bruno; Musie, Ghezai T.

    2016-01-01

    A new carboxylate rich asymmetric tripodal ligand, N-[2-carboxybenzomethyl]-N-[carboxymethyl]-β-alanine (H3camb), and its di-copper(II), (NH4)2[1]2, and di-zinc(II), ((CH3)4 N)2[2]2, complexes have been synthesized as carbohydrate binding models in aqueous solutions. The ligand and complexes have been fully characterized using several techniques, including single crystal X-ray diffraction. The interactions of (NH4)2[1]2 and ((CH3)4 N)2[2]2 with D-glucose, D-mannose, D-xylose and xylitol in aqueous alkaline media were investigated using UV–Vis and 13C-NMR spectroscopic techniques, respectively. The molar conductance, NMR and ESI–MS studies indicate that the complexes dissociate in solution to produce the respective complex anions, 1− and 2−. Complexes 1− and 2− showed chelating ability towards the naturally abundant and biologically relevant sugars, D-glucose, D-mannose, D-xylose, and xylitol. The complex ions bind to one molar equivalent of the sugars, even in the presence of stoichiometric excess of the substrates, in solution. Experimentally obtained spectroscopic data and computational results suggest that the substrates bind to the metal center in a bidentate fashion. Apparent binding constant values, pKapp, between the complexes and the substrates were determined and a specific mode of substrate binding is proposed. The pKapp and relativistic density functional theory (DFT) calculated Gibbs free energy values indicate that D-mannose displayed the strongest interaction with the complexes. Syntheses, characterizations, detailed substrate binding studies using spectroscopic techniques, single crystal X-ray diffraction and geometry optimizations of the complex-substrates with DFT calculations are also reported. PMID:25969174

  20. Synthesis, characterization, and binding assessment with human serum albumin of three bipyridine lanthanide(III) complexes.

    PubMed

    Aramesh-Boroujeni, Zahra; Bordbar, Abdol-Khalegh; Khorasani-Motlagh, Mozhgan; Sattarinezhad, Elham; Fani, Najme; Noroozifar, Meissam

    2018-05-18

    In this work, the terbium(III), dysprosium(III), and ytterbium(III) complexes containing 2, 2'-bipyridine (bpy) ligand have been synthesized and characterized using CHN elemental analysis, FT-IR, UV-Vis and 1 H-NMR techniques and their binding behavior with human serum albumin (HSA) was studied by UV-Vis, fluorescence and molecular docking examinations. The experimental data indicated that all three lanthanide complexes have high binding affinity to HSA with effective quenching of HSA fluorescence via static mechanism. The binding parameters, the type of interaction, the value of resonance energy transfer, and the binding distance between complexes and HSA were estimated from the analysis of fluorescence measurements and Förster theory. The thermodynamic parameters suggested that van der Waals interactions and hydrogen bonds play an important role in the binding mechanism. While, the energy transfer from HSA molecules to all these complexes occurs with high probability, the order of binding constants (BpyTb > BpyDy > BpyYb) represents the importance of radius of Ln 3+ ion in the complex-HSA interaction. The results of molecular docking calculation and competitive experiments assessed site 3 of HSA, located in subdomain IB, as the most probable binding site for these ligands and also indicated the microenvironment residues around the bound mentioned complexes. The computational results kept in good agreement with experimental data.

  1. Quantum chemical calculations and molecular docking studies of 5-(4-chlorobenzylidene)thiazolidine-2,4-dione(CTD) and its mannich product 5-(4-chlorobenzylidene)-3-(morpholinomethyl)thiazolidine-2,4-dione (CMTD)

    NASA Astrophysics Data System (ADS)

    Fatma, Shaheen; Bishnoi, Abha; Verma, Anil Kumar; Singh, Vineeta; Srivastava, Krishna

    2018-04-01

    This work presents the synthesis of 5-(4-chlorobenzylidene)thiazolidine-2,4-dione (CTD) by Claisen condensation of thiazolidine-2,4-dione and mannich product of CTD, 5-(4-chlorobenzylidene)-3-(morpholinomethyl)thiazolidine-2,4-dione (CMTD). The static first hyperpolarizability values for thiazolidine-2,4-dione derivatives have been calculated as 10.28 × 10-30 esu for CTD and 19.42 × 10-30 esu for CMTD. The gradual increase in hyperpolarizability values of synthesized thiazolidine-2,4-dione derivatives from CTD to CMTD is due to the blockage of sbnd NH group on CTD by mannich reaction. The structures of these compounds have been derived by spectroscopic(IR, UV, Mass, 1H and 13C NMR) analysis as well as with the help of theoretical studies. The high values of first static hyperpolarizability indicate that the synthesized derivatives are suitable as non-linear optical (NLO) material. CTD with MIC value of 12.5 μg/mL can be developed as an alternative drug for the treatment of enteric fever. Calculated frontier orbital gap values suggest that the CMTD is a soft molecule with high chemical reactivity and is more polarizable as compared to the CTD. Molecular electrostatic potential is calculated for the optimized geometry of the molecules to estimate their chemical reactivity. The inhibitor CTD forms a stable complex with 3-dehydroquinase enzyme of Salmonella typhi. It is evident from the ligand receptor interactions and a binding affinity value of -5.88 kcal/mol and an inhibition constant of 49.22 μM. This is further confirmed by the experimental biological data. The molecular docking studies are supportive of the antibacterial activity of CTD exhibiting high inhibition constant and binding energy.

  2. EPR Studies of the Binding Properties, Guest Dynamics, and Inner-Space Dimensions of a Water-Soluble Resorcinarene Capsule.

    PubMed

    Ayhan, Mehmet Menaf; Casano, Gilles; Karoui, Hakim; Rockenbauer, Antal; Monnier, Valérie; Hardy, Micaël; Tordo, Paul; Bardelang, David; Ouari, Olivier

    2015-11-09

    Nitroxide free radicals have been used to study the inner space of one of Rebek's water-soluble capsules. EPR and (1) H NMR spectroscopy, ESI-MS, and DFT calculations showed a preference for the formation of 1:2 complexes. EPR titrations allowed us to determine binding constants (Ka ) in the order of 10(7)  M(-2) . EPR spectral-shape analysis provided information on the guest rotational dynamics within the capsule. The interplay between optimum hydrogen bonding upon capsule formation and steric strain for guest accommodation highlights some degree of flexibility for guest inclusion, particularly at the center of the capsule where the hydrogen bond seam can be barely distorted or slightly disturbed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Spectroscopic investigation of interaction between mangiferin and bovine serum albumin

    NASA Astrophysics Data System (ADS)

    Lin, Hui; Lan, Jingfeng; Guan, Min; Sheng, Fenling; Zhang, Haixia

    2009-09-01

    The mechanism of interaction between mangiferin (MA) and bovine serum albumin (BSA) in aqueous solution was investigated by fluorescence spectra, synchronous fluorescence spectra, absorbance spectra and Fourier transform infrared (FT-IR) spectroscopy. The binding constants and binding sites of MA to BSA at different reaction times were calculated. And the distance between MA and BSA was estimated to be 5.20 nm based on Föster's theory. In addition, synchronous fluorescence and FT-IR measurements revealed that the secondary structures of the protein changed after the interaction of MA with BSA. As a conclusion, the interaction between the anti-diabetes Chinese medicine MA and BSA may provide some significant information for the mechanism of the traditional chinese medicine MA on the protein level to cure diabetes or other diseases.

  4. Study on interaction of mangiferin to insulin and glucagon in ternary system

    NASA Astrophysics Data System (ADS)

    Lin, Hui; Chen, Rui; Liu, Xiaoyan; Sheng, Fenling; Zhang, Haixia

    2010-05-01

    The binding of mangiferin to insulin and glucagon was investigated in the presence and absence of another Peptide by optical spectroscopy. Fluorescence titration experiments revealed that mangiferin quenched the intrinsic fluorescence of insulin and glucagon by static quenching. The ratios of binding constants of glucagon-mangiferin to insulin-mangiferin at different temperatures were calculated in "pure" and ternary system, respectively. The results indicated that the Peptides were competitive with each other to act on mangiferin. Values of the thermodynamic parameters and the experiments of pH effect proved that the key interacting forces between mangiferin and the Peptides were hydrophobic interaction. In addition, UV-vis absorption, synchronous fluorescence and Fourier transform infrared measurements showed that the conformation of insulin and glucagon were changed after adding mangiferin.

  5. Structure-affinity relationship of the interaction between phenolic acids and their derivatives and β-lactoglobulin and effect on antioxidant activity.

    PubMed

    Wu, Simin; Zhang, Yunyue; Ren, Fazheng; Qin, Yinghui; Liu, Jiaxin; Liu, Jingwen; Wang, Qingyu; Zhang, Hao

    2018-04-15

    In this study, 71 phenolic acids and their derivatives were used to investigate the structure-affinity relationship of β-lactoglobulin binding, and the effect of this interaction on antioxidant activity. Based on a fluorescence quenching method, an improved mathematical model was adopted to calculate the binding constants, with a correction for the inner-filter effect. Hydroxylation at the 3-position increased the affinity of the phenolic acids for β-lactoglobulin, while hydroxylation at the 2- or 4-positions had a negative effect. Complete methylation of all hydroxy groups, except at the 3-position, enhanced the binding affinity. Replacing the hydroxy groups with methyl groups at the 2-position also had a positive effect. Hydrogen bonding was one of the binding forces for the interaction. The antioxidant activity of phenolic acid-β-lactoglobulin complexes was higher than that of phenolic acids alone. These findings provide an understanding of the structure-activity relationship of the interaction between β-lactoglobulin and phenolic acids. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Investigation on potential enzyme toxicity of clenbuterol to trypsin

    NASA Astrophysics Data System (ADS)

    Chai, Jun; Xu, Qifei; Dai, Jinping; Liu, Rutao

    2013-03-01

    Clenbuterol (CLB) is a kind of β2-adrenergic agonists which was illegally used as feed additives nowadays. The toxic interaction of CLB with trypsin, an important digestive enzyme, was studied in vitro using multi-spectroscopic methods and molecular modeling methods. CLB was proved to bind with trypsin in S1 pocket, forming a complex driven by the dominant force of H-bond. The binding constant was calculated to be 1.79887 × 105 L mol-1 at 289 K and 0.32584 × 105 L mol-1 at 310 K, respectively. The skeleton of trypsin became loosened and unfolded with the amino residues microenvironment changed. The secondary and tertiary structure of trypsin also varied. Molecular modeling studies illustrated specific display of the binding information and explained most of the experiment phenomena. The binding site of CLB induced the fluorescence quenching as well as inhibition of enzyme activity of trypsin. The study confirmed that CLB had potential toxicity on both the structure and function of trypsin and the effects enhanced with the increasing concentration of CLB.

  7. Spectroscopic studies on the interaction of bovine serum albumin with surfactants and apigenin

    NASA Astrophysics Data System (ADS)

    Zhao, Xu-Na; Liu, Yi; Niu, Li-Yuan; Zhao, Chen-Ping

    The binding of apigenin (Ap) to bovine serum albumin (BSA) has been studied using the methods of fluorescence spectroscopy and UV-vis absorption spectroscopy. The spectroscopic analysis of the quenching mechanism indicates that the quenching constants are inversely correlated with the temperatures and the quenching process could result from a static interaction. The type of interaction force was discussed and the binding site of Ap was in site I (subdomain IIA) of BSA. The thermodynamic parameters ΔH and ΔS are -42.02 kJ mol-1 and -48.31 J mol-1 K-1, respectively and the negative ΔG implying that the binding interaction was spontaneous. The distance r between BSA and Ap was calculated according to Förster's theory and the value is 3.44 nm. The synchronous and three-dimensional fluorescence spectra show that the binding of Ap to BSA could lead to the changes in the conformation and microenvironment of BSA. At the same time, the effects of ionic surfactants on the interaction of Ap and BSA have also been investigated.

  8. Studies on interaction of norbixin with DNA: Multispectroscopic and in silico analysis

    NASA Astrophysics Data System (ADS)

    Anantharaman, Amrita; Priya, Rajendra Rao; Hemachandran, Hridya; Sivaramakrishna, Akella; Babu, Subramanian; Siva, Ramamoorthy

    2015-06-01

    The interaction of food colorant norbixin with calf thymus DNA (CTDNA) was investigated through UV-Visible spectroscopy, Fourier Transform Infrared (FTIR), Circular Dichroism (CD), Nuclear Magnetic Resonance (NMR), DNA melting studies, electrophoretic analysis, histological staining technique and molecular docking studies. The results indicated that norbixin interacted with CTDNA by partial intercalation mode. The binding constant (K) of norbixin with CTDNA was calculated to be 5.08 × 105 Mol-1 L. FTIR and CD studies were coupled with 1H NMR spectra revealed that norbixin intercalates partially and binds to the groove's, phosphate group, deoxyribose sugar of DNA and also induces conformational transition of B-form to A-form DNA. Agarose gel electrophoretic and histological staining technique results further prove that, norbixin specifically binds to the DNA in the cell. Moreover, molecular docking studies on the specific binding of norbixin with CTDNA have exhibited lowest conformation energy score of -3.2. Therefore, this food colorant has the ability to interact with DNA and it could emerge as a promising class of natural DNA targeted therapeutic.

  9. The role of side chain conformational flexibility in surface recognition by Tenebrio molitor antifreeze protein

    PubMed Central

    Daley, Margaret E.; Sykes, Brian D.

    2003-01-01

    Two-dimensional nuclear magnetic resonance spectroscopy was used to investigate the flexibility of the threonine side chains in the β-helical Tenebrio molitor antifreeze protein (TmAFP) at low temperatures. From measurement of the 3Jαβ 1H-1H scalar coupling constants, the χ1 angles and preferred rotamer populations can be calculated. It was determined that the threonines on the ice-binding face of the protein adopt a preferred rotameric conformation at near freezing temperatures, whereas the threonines not on the ice-binding face sample many rotameric states. This suggests that TmAFP maintains a preformed ice-binding conformation in solution, wherein the rigid array of threonines that form the AFP-ice interface matches the ice crystal lattice. A key factor in binding to the ice surface and inhibition of ice crystal growth appears to be the close surface-to-surface complementarity between the AFP and crystalline ice, and the lack of an entropic penalty associated with freezing out motions in a flexible ligand. PMID:12824479

  10. Binding and Inhibitory Effect of the Dyes Amaranth and Tartrazine on Amyloid Fibrillation in Lysozyme.

    PubMed

    Basu, Anirban; Suresh Kumar, Gopinatha

    2017-02-16

    Interaction of two food colorant dyes, amaranth and tartrazine, with lysozyme was studied employing multiple biophysical techniques. The dyes exhibited hypochromic changes in the presence of lysozyme. The intrinsic fluorescence of lysozyme was quenched by both dyes; amaranth was a more efficient quencher than tartrazine. The equilibrium constant of amaranth was higher than that of tartarzine. From FRET analysis, the binding distances for amaranth and tartrazine were calculated to be 4.51 and 3.93 nm, respectively. The binding was found to be dominated by non-polyelectrolytic forces. Both dyes induced alterations in the microenvironment surrounding the tryptophan and tyrosine residues of the protein, with the alterations being comparatively higher for the tryptophans than the tyrosines. The interaction caused significant loss in the helicity of lysozyme, the change being higher with amaranth. The binding of both dyes was exothermic. The binding of amaranth was enthalpy driven, while that of tartrazine was predominantly entropy driven. Amaranth delayed lysozyme fibrillation at 25 μM, while tartrazine had no effect even at 100 μM. Nevertheless, both dyes had a significant inhibitory effect on fibrillogenesis. The present study explores the potential antiamyloidogenic property of these azo dyes used as food colorants.

  11. Testing the Underlying Chemical Principles of the Biotic Ligand Model (BLM) to Marine Copper Systems: Measuring Copper Speciation Using Fluorescence Quenching.

    PubMed

    Tait, Tara N; McGeer, James C; Smith, D Scott

    2018-01-01

    Speciation of copper in marine systems strongly influences the ability of copper to cause toxicity. Natural organic matter (NOM) contains many binding sites which provides a protective effect on copper toxicity. The purpose of this study was to characterize copper binding with NOM using fluorescence quenching techniques. Fluorescence quenching of NOM with copper was performed on nine sea water samples. The resulting stability constants and binding capacities were consistent with literature values of marine NOM, showing strong binding with [Formula: see text] values from 7.64 to 10.2 and binding capacities ranging from 15 to 3110 nmol mg [Formula: see text] Free copper concentrations estimated at total dissolved copper concentrations corresponding to previously published rotifer effect concentrations, in the same nine samples, were statistically the same as the range of free copper calculated for the effect concentration in NOM-free artificial seawater. These data confirms the applicability of fluorescence spectroscopy techniques for NOM and copper speciation characterization in sea water and demonstrates that such measured speciation is consistent with the chemical principles underlying the biotic ligand model approach for bioavailability-based metals risk assessment.

  12. Synthesis, characterization, crystal structure, DNA/BSA binding ability and antibacterial activity of asymmetric europium complex based on 1,10- phenanthroline

    NASA Astrophysics Data System (ADS)

    Alfi, Nafiseh; Khorasani-Motlagh, Mozhgan; Rezvani, Ali Reza; Noroozifar, Meissam; Molčanov, Krešimir

    2017-06-01

    A heteroleptic europium coordination compound formulated as [Eu(phen)2(OH2)2(Cl)2](Cl)(H2O) (phen = 1,10-phenanthroline), has been synthesized and characterized by elemental analysis, FT-IR spectroscopy, and single-crystal X-ray diffractometer. Crystal structure analysis reveals the complex is crystallized in orthorhombic system with Pca21 space group. Electronic absorption and various emission methods for investigation of the binding system of europium(III) complex to Fish Salmon deoxyribonucleic acid (FS-DNA) and Bovamin Serum Albumin (BSA) have been explored. Furthermore, the binding constants, binding sites and the corresponding thermodynamic parameters of the interaction system based on the van't Hoff equation for FS-DNA and BSA were calculated. The thermodynamic parameters reflect the exothermic nature of emission process (ΔH°<0 and ΔS°<0). The experimental results seem to indicate that the [Eu(phen)2(OH2)2(Cl)2](Cl)(H2O) bound to FS-DNA by non-intercalative mode which the groove binding is preferable mode. Also, the complex exhibits a brilliant antimicrobial activity in vitro against standard bacterial strains.

  13. Quantification of metabotropic glutamate subtype 5 receptors in the brain by an equilibrium method using 18F-SP203.

    PubMed

    Kimura, Yasuyuki; Siméon, Fabrice G; Zoghbi, Sami S; Zhang, Yi; Hatazawa, Jun; Pike, Victor W; Innis, Robert B; Fujita, Masahiro

    2012-02-01

    A new PET ligand, 3-fluoro-5-(2-(2-(18)F-(fluoromethyl)-thiazol-4-yl)ethynyl)benzonitrile (18F-SP203) can quantify metabotropic glutamate subtype 5 receptors (mGluR5) in human brain by a bolus injection and kinetic modeling. As an alternative approach to a bolus injection, binding can simply be measured as a ratio of tissue to metabolite-corrected plasma at a single time point under equilibrium conditions achieved by administering the radioligand with a bolus injection followed by a constant infusion. The purpose of this study was to validate the equilibrium method as an alternative to the standard kinetic method for measuring 18F-SP203 binding in the brain. Nine healthy subjects were injected with 18F-SP203 using a bolus plus constant infusion for 300 min. A single ratio of bolus-to-constant infusion (the activity of bolus equaled to that of infusion over 219 min) was applied to all subjects to achieve equilibrium in approximately 120 min. As a measure of ligand binding, we compared total distribution volume (VT) calculated by the equilibrium and kinetic methods in each scan. The equilibrium method calculated VT by the ratio of radioactivity in the brain to the concentration of 18F-SP203 in arterial plasma at 120 min, and the kinetic method calculated VT by a two-tissue compartment model using brain and plasma dynamic data from 0 to 120 min. VT obtained via the equilibrium method was highly correlated with VT obtained via kinetic modeling. Inter-subject variability of VT obtained via the equilibrium method was slightly smaller than VT obtained via the kinetic method. VT obtained via the equilibrium method was ~10% higher than VT obtained via the kinetic method, indicating a small difference between the measurements. Taken together, the results of this study show that using the equilibrium method is an acceptable alternative to the standard kinetic method when using 18F-SP203 to measure mGluR5. Although small differences in the measurements obtained via the equilibrium and kinetic methods exist, both methods consistently measured mGluR5 as indicated by the highly correlated VT values; the equilibrium method was slightly more precise, as indirectly measured by the smaller coefficient of variability across subjects. In addition, when using 18F-SP203, the equilibrium method is more efficient because it requires much less data. Copyright © 2011. Published by Elsevier Inc.

  14. Synthesis and characterization of new unsymmetrical Schiff base Zn (II) and Co (II) complexes and study of their interactions with bovin serum albumin and DNA by spectroscopic techniques.

    PubMed

    Sedighipoor, Maryam; Kianfar, Ali Hossein; Sabzalian, Mohammad R; Abyar, Fatemeh

    2018-06-05

    Two novel tetra-coordinated Cobalt(II) and Zinc (II) chelate series with the general formula of [Co (L)·2H 2 O] (1) and [Zn (L)] (2) [L=N-2-hydroxyacetophenon-N'-2-hydroxynaphthaldehyde-1,2 phenylenediimine)] with biologically active Schiff base ligands were synthesized and recognized by elemental analysis and multi-nuclear spectroscopy (IR and 1 H and 13 C NMR); then, their biological activities including DNA and protein interactions were studied. The interaction of the synthesized compounds with bovine serum albumin (BSA) was investigated via fluorescence spectroscopy, showing the affinity of the complexes for these proteins with relatively high binding constant values and the changed secondary BSA structure in the presence of the complexes. The interaction of these compounds with CT-DNA was considered by UV-Vis technique, emission titration, viscosity measurements, helix melting methods, and circular dichroism (CD) spectroscopy, confirming that the complexes were bound to CT-DNA by the intercalation binding mode. Furthermore, the complexes had the capability to displace the DNA-bound MB, as shown by the competitive studies of these complexes with methylene blue (MB), thereby suggesting the intercalation mode for the competition. Finally, the theoretical studies carried out by the docking method were performed to calculate the binding constants and recognize the binding site of the BSA and DNA by the complexes. In addition, in vitro and in silico studies showed that the compounds were degradable by bacterial and fungal biodegradation activities. Copyright © 2018 Elsevier B.V. All rights reserved.

  15. Synthesis and characterization of new unsymmetrical Schiff base Zn (II) and Co (II) complexes and study of their interactions with bovin serum albumin and DNA by spectroscopic techniques

    NASA Astrophysics Data System (ADS)

    Sedighipoor, Maryam; Kianfar, Ali Hossein; Sabzalian, Mohammad R.; Abyar, Fatemeh

    2018-06-01

    Two novel tetra-coordinated Cobalt(II) and Zinc (II) chelate series with the general formula of [Co (L)·2H2O] (1) and [Zn (L)] (2) [L = N-2-hydroxyacetophenon-N‧-2-hydroxynaphthaldehyde-1,2 phenylenediimine)] with biologically active Schiff base ligands were synthesized and recognized by elemental analysis and multi-nuclear spectroscopy (IR and 1H and 13C NMR); then, their biological activities including DNA and protein interactions were studied. The interaction of the synthesized compounds with bovine serum albumin (BSA) was investigated via fluorescence spectroscopy, showing the affinity of the complexes for these proteins with relatively high binding constant values and the changed secondary BSA structure in the presence of the complexes. The interaction of these compounds with CT-DNA was considered by UV-Vis technique, emission titration, viscosity measurements, helix melting methods, and circular dichroism (CD) spectroscopy, confirming that the complexes were bound to CT-DNA by the intercalation binding mode. Furthermore, the complexes had the capability to displace the DNA-bound MB, as shown by the competitive studies of these complexes with methylene blue (MB), thereby suggesting the intercalation mode for the competition. Finally, the theoretical studies carried out by the docking method were performed to calculate the binding constants and recognize the binding site of the BSA and DNA by the complexes. In addition, in vitro and in silico studies showed that the compounds were degradable by bacterial and fungal biodegradation activities.

  16. ESI-MS measurements for the equilibrium constants of copper(II)-insulin complexes.

    PubMed

    Gülfen, Mustafa; Özdemir, Abdil; Lin, Jung-Lee; Chen, Chung-Hsuan

    2018-06-01

    Trace elements regulate many biological reactions in the body. Copper(II) is known as one of trace elements and capable of binding to proteins. Insulin is a blood glucose-lowering peptide hormone and it is secreted by the pancreatic β-cells. In this study, Cu(II)-insulin complexes were investigated by using ESI-MS method. Insulin molecule gives ESI-MS peaks at +4, +5, +6 and +7 charged states. Cu(II)-insulin complexes can be monitored and quantified on the ESI-MS spectra as the shifted peaks according to insulin peaks. The solutions of Cu(II)-insulin complexes at different pHs and mole ratios of Cu(II) ions to insulin molecule were measured on the ESI-MS. The highest complex formation ratio for Cu(II)-insulin were found at pH 7. The multiple bindings of Cu(II) ions to insulin molecule was observed. The formation equilibrium constants of Cu(II)-insulin complexes were calculated as Kf 1 : 3.34 × 10 4 , Kf 2 : 2.99 × 10 4 , Kf 3 : 7.00 × 10 3 and Kf 4 :2.86 × 10 3 . The specific binding property of Cu(II) ions was controlled by using different spray ion sources including electrospray and nano-electrospray. The binding property of Cu(II) also investigated by MS/MS fragmentation. It was concluded from the ESI-MS measurements that Cu(II) ion has a high affinity to insulin molecules to form stable complexes. Copyright © 2018 Elsevier B.V. All rights reserved.

  17. Effect of temperature on the methotrexate BSA interaction: Spectroscopic study

    NASA Astrophysics Data System (ADS)

    Sułkowska, A.; Maciążek, M.; Równicka, J.; Bojko, B.; Pentak, D.; Sułkowski, W. W.

    2007-05-01

    Rheumatoid arthritis (RA) is an autoimmune and chronic inflammatory illness which affects about one percent of the world's population. Methotrexate (4-amino-10-methylfolic acid) (MTX) also known as amethopterin is commonly used to treat rheumatoid arthritis (RA). It is transported in the circulary system as a complex with serum albumin. The aim of this study was to investigate the interactions of MTX with transporting protein with the use of spectroscopic methods. The binding of MTX to bovine serum albumin (BSA) was studied by monitoring the changes in the emission fluorescence spectra of protein in the presence of MTX at excitation wavelength of 280 nm and 295 nm. The quenching of protein fluorescence at temperature range from 298 K to 316 K was observed. Energy transfer between methotrexate and fluorophores contained in the serum albumin structure was found at the molar ratio MTX:BSA 7.5:1. The relative fluorescence intensity of BSA decreases with increase of temperature. Similar results were observed for BSA excited with 280 nm and 295 nm at the same temperature range. The presence of MTX seems to prevent these changes. Temperature dependence of the binding constant has been presented. The binding and quenching constants for equilibrium complex were calculated using Scatchard and Stern-Volmer method, respectively. The results show that MTX forms π-π complex with aromatic amino acid residues of BSA. The binding site for MTX on BSA was found to be situated in the hydrophobic IIA or IB subdomain where the Trps were located. The spontaneity of MTX-BSA complex formation in the temperature range 298-316 K was ascertained.

  18. A universal surface complexation framework for modeling proton binding onto bacterial surfaces in geologic settings

    USGS Publications Warehouse

    Borrok, D.; Turner, B.F.; Fein, J.B.

    2005-01-01

    Adsorption onto bacterial cell walls can significantly affect the speciation and mobility of aqueous metal cations in many geologic settings. However, a unified thermodynamic framework for describing bacterial adsorption reactions does not exist. This problem originates from the numerous approaches that have been chosen for modeling bacterial surface protonation reactions. In this study, we compile all currently available potentiometric titration datasets for individual bacterial species, bacterial consortia, and bacterial cell wall components. Using a consistent, four discrete site, non-electrostatic surface complexation model, we determine total functional group site densities for all suitable datasets, and present an averaged set of 'universal' thermodynamic proton binding and site density parameters for modeling bacterial adsorption reactions in geologic systems. Modeling results demonstrate that the total concentrations of proton-active functional group sites for the 36 bacterial species and consortia tested are remarkably similar, averaging 3.2 ?? 1.0 (1??) ?? 10-4 moles/wet gram. Examination of the uncertainties involved in the development of proton-binding modeling parameters suggests that ignoring factors such as bacterial species, ionic strength, temperature, and growth conditions introduces relatively small error compared to the unavoidable uncertainty associated with the determination of cell abundances in realistic geologic systems. Hence, we propose that reasonable estimates of the extent of bacterial cell wall deprotonation can be made using averaged thermodynamic modeling parameters from all of the experiments that are considered in this study, regardless of bacterial species used, ionic strength, temperature, or growth condition of the experiment. The average site densities for the four discrete sites are 1.1 ?? 0.7 ?? 10-4, 9.1 ?? 3.8 ?? 10-5, 5.3 ?? 2.1 ?? 10-5, and 6.6 ?? 3.0 ?? 10-5 moles/wet gram bacteria for the sites with pKa values of 3.1, 4.7, 6.6, and 9.0, respectively. It is our hope that this thermodynamic framework for modeling bacteria-proton binding reactions will also provide the basis for the development of an internally consistent set of bacteria-metal binding constants. 'Universal' constants for bacteria-metal binding reactions can then be used in conjunction with equilibrium constants for other important metal adsorption and complexation reactions to calculate the overall distribution of metals in realistic geologic systems.

  19. Computational Equilibrium Thermodynamic and Kinetic Analysis of K-Ras Dimerization through an Effector Binding Surface Suggests Limited Functional Role.

    PubMed

    Sayyed-Ahmad, Abdallah; Cho, Kwang-Jin; Hancock, John F; Gorfe, Alemayehu A

    2016-08-25

    Dimer formation is believed to have a substantial impact on regulating K-Ras function. However, the evidence for dimerization and the molecular details of the process are scant. In this study, we characterize a K-Ras pseudo-C2-symmetric dimerization interface involving the effector interacting β2-strand. We used structure matching and all-atom molecular dynamics (MD) simulations to predict, refine, and investigate the stability of this interface. Our MD simulation suggested that the β2-dimer is potentially stable and remains relatively close to its initial conformation due to the presence of a number of hydrogen bonds, ionic salt bridges, and other favorable interactions. We carried out potential of mean force calculations to determine the relative binding strength of the interface. The results of these calculations indicated that the β2 dimerization interface provides a weak binding free energy in solution and a dissociation constant that is close to 1 mM. Analyses of Brownian dynamics simulations suggested an association rate kon ≈ 10(5)-10(6) M(-1) s(-1). Combining these observations with available literature data, we propose that formation of auto-inhibited β2 K-Ras dimers is possible but its fraction in cells is likely very small under normal physiologic conditions.

  20. An auxiliary-field quantum Monte Carlo study of the chromium dimer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Purwanto, Wirawan, E-mail: wirawan0@gmail.com; Zhang, Shiwei; Krakauer, Henry

    2015-02-14

    The chromium dimer (Cr{sub 2}) presents an outstanding challenge for many-body electronic structure methods. Its complicated nature of binding, with a formal sextuple bond and an unusual potential energy curve (PEC), is emblematic of the competing tendencies and delicate balance found in many strongly correlated materials. We present an accurate calculation of the PEC and ground state properties of Cr{sub 2}, using the auxiliary-field quantum Monte Carlo (AFQMC) method. Unconstrained, exact AFQMC calculations are first carried out for a medium-sized but realistic basis set. Elimination of the remaining finite-basis errors and extrapolation to the complete basis set limit are thenmore » achieved with a combination of phaseless and exact AFQMC calculations. Final results for the PEC and spectroscopic constants are in excellent agreement with experiment.« less

  1. Calorimetric and spectroscopic studies of the interaction between zidovudine and human serum albumin

    NASA Astrophysics Data System (ADS)

    Pîrnău, Adrian; Mic, Mihaela; Neamţu, Silvia; Floare, Călin G.; Bogdan, Mircea

    2018-02-01

    A quantitative analysis of the interaction between zidovudine (AZT) and human serum albumin (HSA) was achieved using Isothermal titration calorimetry (ITC) in combination with fluorescence and 1H NMR spectroscopy. ITC directly measure the heat during a biomolecular binding event and gave us thermodynamic parameters and the characteristic association constant. By fluorescence quenching, the binding parameters of AZT-HSA interaction was determined and location to binding site I of HSA was confirmed. Via T1 NMR selective relaxation time measurements the drug-protein binding extent was evaluated as dissociation constants Kd and the involvement of azido moiety of zidovudine in molecular complex formation was put in evidence. All three methods indicated a very weak binding interaction. The association constant determined by ITC (3.58 × 102 M- 1) is supported by fluorescence quenching data (2.74 × 102 M- 1). The thermodynamic signature indicates that at least hydrophobic and electrostatic type interactions played a main role in the binding process.

  2. Revised Model of Calcium and Magnesium Binding to the Bacterial Cell Wall

    PubMed Central

    Thomas, Kieth J.; Rice, Charles V.

    2014-01-01

    Metals bind to the bacterial cell wall yet the binding mechanisms and affinity constants are not fully understood. The cell wall of gram positive bacteria is characterized by a thick layer of peptidoglycan and anionic teichoic acids anchored in the cytoplasmic membrane (lipoteichoic acid) or covalently bound to the cell wall (wall teichoic acid). The polyphosphate groups of teichoic acid provide one-half of the metal binding sites for calcium and magnesium, contradicting previous reports that calcium binding is 100% dependent on teichoic acid. The remaining binding sites are formed with the carboxyl units of peptidoglycan. In this work we report equilibrium association constants and total metal binding capacities for the interaction of calcium and magnesium ions with the bacterial cell wall. Metal binding is much stronger and previously reported. Curvature of Scatchard plots from the binding data and the resulting two regions of binding affinity suggest the presence of negative cooperative binding, meaning that the binding affinity decreases as more ions become bound to the sample. For Ca2+, Region I has a KA = (1.0 ± 0.2) × 106 M−1 and Region II has a KA = (0.075 ± 0.058) × 106 M−1. For Mg2+, KA1 = (1.5 ± 0.1) × 106 and KA2 = (0.17 ± 0.10) × 106. A binding capacity (η) is reported for both regions. However, since binding is still occurring in Region II, the total binding capacity is denoted by η2, which are 0.70 ± 0.04 µmol/mg and 0.67 ± 0.03 µmol/mg for Ca2+ and Mg2+ respectively. These data contradict the current paradigm of there being a single metal affinity value that is constant over a range of concentrations. We also find that measurement of equilibrium binding constants is highly sample dependent, suggesting a role for diffusion of metals through heterogeneous cell wall fragments. As a result, we are able to reconcile many contradictory theories that describe binding affinity and the binding mode of divalent metal cations. PMID:25315444

  3. Binding of resveratrol with sodium caseinate in aqueous solutions.

    PubMed

    Acharya, Durga P; Sanguansri, Luz; Augustin, Mary Ann

    2013-11-15

    The interaction between resveratrol (Res) and sodium caseinate (Na-Cas) has been studied by measuring fluorescence quenching of the protein by resveratrol. Quenching constants were determined using Stern-Volmer equation, which suggests that both dynamic and static quenching occur between Na-Cas and Res. Binding constants for the complexation between Na-Cas and Res were determined at different temperatures. The large binding constants (3.7-5.1×10(5)M(-1)) suggest that Res has strong affinity for Na-Cas. This affinity decreases as the temperature is raised from 25 to 37°C. The binding involves both hydrogen bonding and hydrophobic interaction, as suggested by negative enthalpy change and positive entropy change for the binding reaction. The present study indicates that Na-Cas, a common food protein, may be used as a carrier of Res, a bioactive polyphenol which is insoluble in both water and oils. Copyright © 2013 Elsevier Ltd. All rights reserved.

  4. Electrochemical and spectroscopic studies of the interaction of proflavine with DNA.

    PubMed

    Aslanoglu, Mehmet

    2006-03-01

    The interaction of proflavine with herring sperm DNA has been investigated by cyclic voltammetry and UV-Vis spectroscopy as well as viscosity measurements. Shifts in the peak potentials in cyclic voltammetry, spectral changes in UV absorption titration, an increase in viscosity of DNA and the results of the effect of ionic strength on the binding constant strongly support the intercalation of proflavine into the DNA double helix. The binding constant for the interaction between proflavine and DNA was K = 2.32 (+/- 0.41) x 10(4) M(-1) and the binding site size was 2.07 (+/- 0.1) base pairs, estimated in voltammetric measurements. The value of the binding site size was determined to be closer to that expected for a planar intercalating agent. The standard Gibbs free-energy change is ca. -24.90 kJ/mol at 25 degrees C, indicating the spontaneity of the binding interaction. The binding constant determined by UV absorption measurements was K = 2.20 (+/- 0.48) x 10(4) M(-1), which is very close to the value determined by cyclic voltammetry assuming that the binding equilibrium is static.

  5. Copper(II) binding by dissolved organic matter: Importance of the copper-to-dissolved organic matter ratio and implications for the Biotic Ligand Model

    USGS Publications Warehouse

    Craven, Alison M.; Aiken, George R.; Ryan, Joseph N.

    2012-01-01

    The ratio of copper to dissolved organic matter (DOM) is known to affect the strength of copper binding by DOM, but previous methods to determine the Cu2+–DOM binding strength have generally not measured binding constants over the same Cu:DOM ratios. In this study, we used a competitive ligand exchange–solid-phase extraction (CLE-SPE) method to determine conditional stability constants for Cu2+–DOM binding at pH 6.6 and 0.01 M ionic strength over a range of Cu:DOM ratios that bridge the detection windows of copper-ion-selective electrode and voltammetry measurements. As the Cu:DOM ratio increased from 0.0005 to 0.1 mg of Cu/mg of DOM, the measured conditional binding constant (cKCuDOM) decreased from 1011.5 to 105.6 M–1. A comparison of the binding constants measured by CLE-SPE with those measured by copper-ion-selective electrode and voltammetry demonstrates that the Cu:DOM ratio is an important factor controlling Cu2+–DOM binding strength even for DOM isolates of different types and different sources and for whole water samples. The results were modeled with Visual MINTEQ and compared to results from the biotic ligand model (BLM). The BLM was found to over-estimate Cu2+ at low total copper concentrations and under-estimate Cu2+ at high total copper concentrations.

  6. Titration ELISA as a Method to Determine the Dissociation Constant of Receptor Ligand Interaction.

    PubMed

    Eble, Johannes A

    2018-02-15

    The dissociation constant describes the interaction between two partners in the binding equilibrium and is a measure of their affinity. It is a crucial parameter to compare different ligands, e.g., competitive inhibitors, protein isoforms and mutants, for their binding strength to a binding partner. Dissociation constants are determined by plotting concentrations of bound versus free ligand as binding curves. In contrast, titration curves, in which a signal that is proportional to the concentration of bound ligand is plotted against the total concentration of added ligand, are much easier to record. The signal can be detected spectroscopically and by enzyme-linked immunosorbent assay (ELISA). This is exemplified in a protocol for a titration ELISA that measures the binding of the snake venom-derived rhodocetin to its immobilized target domain of α2β1 integrin. Titration ELISAs are versatile and widely used. Any pair of interacting proteins can be used as immobilized receptor and soluble ligand, provided that both proteins are pure, and their concentrations are known. The difficulty so far has been to determine the dissociation constant from a titration curve. In this study, a mathematical function underlying titration curves is introduced. Without any error-prone graphical estimation of a saturation yield, this algorithm allows processing of the raw data (signal intensities at different concentrations of added ligand) directly by mathematical evaluation via non-linear regression. Thus, several titration curves can be recorded simultaneously and transformed into a set of characteristic parameters, among them the dissociation constant and the concentration of binding-active receptor, and they can be evaluated statistically. When combined with this algorithm, titration ELISAs gain the advantage of directly presenting the dissociation constant. Therefore, they may be used more efficiently in the future.

  7. Rational design of biaryl pharmacophore inserted noscapine derivatives as potent tubulin binding anticancer agents.

    PubMed

    Santoshi, Seneha; Manchukonda, Naresh Kumar; Suri, Charu; Sharma, Manya; Sridhar, Balasubramanian; Joseph, Silja; Lopus, Manu; Kantevari, Srinivas; Baitharu, Iswar; Naik, Pradeep Kumar

    2015-03-01

    We have strategically designed a series of noscapine derivatives by inserting biaryl pharmacophore (a major structural constituent of many of the microtubule-targeting natural anticancer compounds) onto the scaffold structure of noscapine. Molecular interaction of these derivatives with α,β-tubulin heterodimer was investigated by molecular docking, molecular dynamics simulation, and binding free energy calculation. The predictive binding affinity indicates that the newly designed noscapinoids bind to tubulin with a greater affinity. The predictive binding free energy (ΔG(bind, pred)) of these derivatives (ranging from -5.568 to -5.970 kcal/mol) based on linear interaction energy (LIE) method with a surface generalized Born (SGB) continuum solvation model showed improved binding affinity with tubulin compared to the lead compound, natural α-noscapine (-5.505 kcal/mol). Guided by the computational findings, these new biaryl type α-noscapine congeners were synthesized from 9-bromo-α-noscapine using optimized Suzuki reaction conditions for further experimental evaluation. The derivatives showed improved inhibition of the proliferation of human breast cancer cells (MCF-7), human cervical cancer cells (HeLa) and human lung adenocarcinoma cells (A549), compared to natural noscapine. The cell cycle analysis in MCF-7 further revealed that these compounds alter the cell cycle profile and cause mitotic arrest at G2/M phase more strongly than noscapine. Tubulin binding assay revealed higher binding affinity to tubulin, as suggested by dissociation constant (Kd) of 126 ± 5.0 µM for 5a, 107 ± 5.0 µM for 5c, 70 ± 4.0 µM for 5d, and 68 ± 6.0 µM for 5e compared to noscapine (Kd of 152 ± 1.0 µM). In fact, the experimentally determined value of ΔG(bind, expt) (calculated from the Kd value) are consistent with the predicted value of ΔG(bind, pred) calculated based on LIE-SGB. Based on these results, one of the derivative 5e of this series was used for further toxicological evaluation. Treatment of mice with a daily dose of 300 mg/kg and a single dose of 600 mg/kg indicates that the compound does not induce detectable pathological abnormalities in normal tissues. Also there were no significant differences in hematological parameters between the treated and untreated groups. Hence, the newly designed noscapinoid, 5e is an orally bioavailable, safe and effective anticancer agent with a potential for the treatment of cancer and might be a candidate for clinical evaluation.

  8. Gas sorption and barrier properties of polymeric membranes from molecular dynamics and Monte Carlo simulations.

    PubMed

    Cozmuta, Ioana; Blanco, Mario; Goddard, William A

    2007-03-29

    It is important for many industrial processes to design new materials with improved selective permeability properties. Besides diffusion, the molecule's solubility contributes largely to the overall permeation process. This study presents a method to calculate solubility coefficients of gases such as O2, H2O (vapor), N2, and CO2 in polymeric matrices from simulation methods (Molecular Dynamics and Monte Carlo) using first principle predictions. The generation and equilibration (annealing) of five polymer models (polypropylene, polyvinyl alcohol, polyvinyl dichloride, polyvinyl chloride-trifluoroethylene, and polyethylene terephtalate) are extensively described. For each polymer, the average density and Hansen solubilities over a set of ten samples compare well with experimental data. For polyethylene terephtalate, the average properties between a small (n = 10) and a large (n = 100) set are compared. Boltzmann averages and probability density distributions of binding and strain energies indicate that the smaller set is biased in sampling configurations with higher energies. However, the sample with the lowest cohesive energy density from the smaller set is representative of the average of the larger set. Density-wise, low molecular weight polymers tend to have on average lower densities. Infinite molecular weight samples do however provide a very good representation of the experimental density. Solubility constants calculated with two ensembles (grand canonical and Henry's constant) are equivalent within 20%. For each polymer sample, the solubility constant is then calculated using the faster (10x) Henry's constant ensemble (HCE) from 150 ps of NPT dynamics of the polymer matrix. The influence of various factors (bad contact fraction, number of iterations) on the accuracy of Henry's constant is discussed. To validate the calculations against experimental results, the solubilities of nitrogen and carbon dioxide in polypropylene are examined over a range of temperatures between 250 and 650 K. The magnitudes of the calculated solubilities agree well with experimental results, and the trends with temperature are predicted correctly. The HCE method is used to predict the solubility constants at 298 K of water vapor and oxygen. The water vapor solubilities follow more closely the experimental trend of permeabilities, both ranging over 4 orders of magnitude. For oxygen, the calculated values do not follow entirely the experimental trend of permeabilities, most probably because at this temperature some of the polymers are in the glassy regime and thus are diffusion dominated. Our study also concludes large confidence limits are associated with the calculated Henry's constants. By investigating several factors (terminal ends of the polymer chains, void distribution, etc.), we conclude that the large confidence limits are intimately related to the polymer's conformational changes caused by thermal fluctuations and have to be regarded--at least at microscale--as a characteristic of each polymer and the nature of its interaction with the solute. Reducing the mobility of the polymer matrix as well as controlling the distribution of the free (occupiable) volume would act as mechanisms toward lowering both the gas solubility and the diffusion coefficients.

  9. Comparative study of substrate and product binding to the human ABO(H) blood group glycosyltransferases.

    PubMed

    Soya, Naoto; Shoemaker, Glen K; Palcic, Monica M; Klassen, John S

    2009-11-01

    The first comparative thermodynamic study of the human blood group glycosyltransferases, alpha-(1-->3)-N-acetylgalactosaminyltransferase (GTA) and alpha-(1-->3)-galactosyltransferase (GTB), interacting with donor substrates, donor and acceptor analogs, and trisaccharide products in vitro is reported. The binding constants, measured at 24 degrees C with the direct electrospray ionization mass spectrometry (ES-MS) assay, provide new insights into these model GTs and their interactions with substrate and product. Notably, the recombinant forms of GTA and GTB used in this study are shown to exist as homodimers, stabilized by noncovalent interactions at neutral pH. In the absence of divalent metal ion, neither GTA nor GTB exhibits any appreciable affinity for its native donors (UDP-GalNAc, UDP-Gal). Upon introduction of Mn(2+), both donors undergo enzyme-catalyzed hydrolysis in the presence of either GTA or GTB. Hydrolysis of UDP-GalNAc in the presence of GTA proceeds very rapidly under the solution conditions investigated and a binding constant could not be directly measured. In contrast, the rate of hydrolysis of UDP-Gal in the presence of GTB is significantly slower and, utilizing a modified approach to analyze the ES-MS data, a binding constant of 2 x 10(4) M(-1) was established. GTA and GTB bind the donor analogs UDP-GlcNAc, UDP-Glc with affinities similar to those measured for UDP-Gal and UDP-GalNAc (GTB only), suggesting that the native donors and donor analogs bind to the GTA and GTB through similar interactions. The binding constant determined for GTA and UDP-GlcNAc (approximately 1 x 10(4) M(-1)), therefore, provides an estimate for the binding constant for GTA and UDP-GalNAc. Binding of GTA and GTB with the A and B trisaccharide products was also investigated for the first time. In the absence of UDP and Mn(2+), both GTA and GTB recognize their respective trisaccharide products but with a low affinity approximately 10(3) M(-1); the presence of UDP and Mn(2+) has no effect on A trisaccharide binding but precludes B-trisaccharide binding.

  10. Predicting Stability Constants for Uranyl Complexes Using Density Functional Theory

    DOE PAGES

    Vukovic, Sinisa; Hay, Benjamin P.; Bryantsev, Vyacheslav S.

    2015-04-02

    The ability to predict the equilibrium constants for the formation of 1:1 uranyl:ligand complexes (log K 1 values) provides the essential foundation for the rational design of ligands with enhanced uranyl affinity and selectivity. We also use density functional theory (B3LYP) and the IEFPCM continuum solvation model to compute aqueous stability constants for UO 2 2+ complexes with 18 donor ligands. Theoretical calculations permit reasonably good estimates of relative binding strengths, while the absolute log K 1 values are significantly overestimated. Accurate predictions of the absolute log K 1 values (root mean square deviation from experiment < 1.0 for logmore » K 1 values ranging from 0 to 16.8) can be obtained by fitting the experimental data for two groups of mono and divalent negative oxygen donor ligands. The utility of correlations is demonstrated for amidoxime and imide dioxime ligands, providing a useful means of screening for new ligands with strong chelate capability to uranyl.« less

  11. An integrated catch-and-hold mechanism activates nicotinic acetylcholine receptors.

    PubMed

    Jadey, Snehal; Auerbach, Anthony

    2012-07-01

    In neuromuscular acetylcholine (ACh) receptor channels (AChRs), agonist molecules bind with a low affinity (LA) to two sites that can switch to high affinity (HA) and increase the probability of channel opening. We measured (by using single-channel kinetic analysis) the rate and equilibrium constants for LA binding and channel gating for several different agonists of adult-type mouse AChRs. Almost all of the variation in the equilibrium constants for LA binding was from differences in the association rate constants. These were consistently below the limit set by diffusion and were substantially different even though the agonists had similar sizes and the same charge. This suggests that binding to resting receptors is not by diffusion alone and, hence, that each binding site can undergo two conformational changes ("catch" and "hold") that connect three different structures (apo-, LA-bound, and HA-bound). Analyses of ACh-binding protein structures suggest that this binding site, too, may adopt three discrete structures having different degrees of loop C displacement ("capping"). For the agonists we tested, the logarithms of the equilibrium constants for LA binding and LA↔HA gating were correlated. Although agonist binding and channel gating have long been considered to be separate processes in the activation of ligand-gated ion channels, this correlation implies that the catch-and-hold conformational changes are energetically linked and together comprise an integrated process having a common structural basis. We propose that loop C capping mainly reflects agonist binding, with its two stages corresponding to the formation of the LA and HA complexes. The catch-and-hold reaction coordinate is discussed in terms of preopening states and thermodynamic cycles of activation.

  12. An integrated catch-and-hold mechanism activates nicotinic acetylcholine receptors

    PubMed Central

    Jadey, Snehal

    2012-01-01

    In neuromuscular acetylcholine (ACh) receptor channels (AChRs), agonist molecules bind with a low affinity (LA) to two sites that can switch to high affinity (HA) and increase the probability of channel opening. We measured (by using single-channel kinetic analysis) the rate and equilibrium constants for LA binding and channel gating for several different agonists of adult-type mouse AChRs. Almost all of the variation in the equilibrium constants for LA binding was from differences in the association rate constants. These were consistently below the limit set by diffusion and were substantially different even though the agonists had similar sizes and the same charge. This suggests that binding to resting receptors is not by diffusion alone and, hence, that each binding site can undergo two conformational changes (“catch” and “hold”) that connect three different structures (apo-, LA-bound, and HA-bound). Analyses of ACh-binding protein structures suggest that this binding site, too, may adopt three discrete structures having different degrees of loop C displacement (“capping”). For the agonists we tested, the logarithms of the equilibrium constants for LA binding and LA↔HA gating were correlated. Although agonist binding and channel gating have long been considered to be separate processes in the activation of ligand-gated ion channels, this correlation implies that the catch-and-hold conformational changes are energetically linked and together comprise an integrated process having a common structural basis. We propose that loop C capping mainly reflects agonist binding, with its two stages corresponding to the formation of the LA and HA complexes. The catch-and-hold reaction coordinate is discussed in terms of preopening states and thermodynamic cycles of activation. PMID:22732309

  13. A dye-binding assay for measurement of the binding of Cu(II) to proteins.

    PubMed

    Wilkinson-White, Lorna E; Easterbrook-Smith, Simon B

    2008-10-01

    We analysed the theory of the coupled equilibria between a metal ion, a metal ion-binding dye and a metal ion-binding protein in order to develop a procedure for estimating the apparent affinity constant of a metal ion:protein complex. This can be done by analysing from measurements of the change in the concentration of the metal ion:dye complex with variation in the concentration of either the metal ion or the protein. Using experimentally determined values for the affinity constant of Cu(II) for the dye, 2-(5-bromo-2-pyridylaxo)-5-(N-propyl-N-sulfopropylamino) aniline (5-Br-PSAA), this procedure was used to estimate the apparent affinity constants for formation of Cu(II):transthyretin, yielding values which were in agreement with literature values. An apparent affinity constant for Cu(II) binding to alpha-synuclein of approximately 1 x 10(9)M(-1) was obtained from measurements of tyrosine fluorescence quenching by Cu(II). This value was in good agreement with that obtained using 5-Br-PSAA. Our analysis and data therefore show that measurement of changes in the equilibria between Cu(II) and 5-Br-PSAA by Cu(II)-binding proteins provides a general procedure for estimating the affinities of proteins for Cu(II).

  14. Evaluation of the rate constants of sugar transport through maltoporin (LamB) of Escherichia coli from the sugar-induced current noise

    PubMed Central

    1995-01-01

    LamB (maltoporin) of Escherichia coli outer membrane was reconstituted into artificial lipid bilayer membranes. The channel contains a binding site for sugars and is blocked for ions when the site is occupied by a sugar. The on and off reactions of sugar binding cause an increase of the noise of the current through the channel. The sugar-induced current noise of maltoporin was used for the evaluation of the sugar-binding kinetics for different sugars of the maltooligosaccharide series and for sucrose. The on rate constant for sugar binding was between 10(6) and 10(7) M-1.s-1 for the maltooligosaccharides and corresponds to the movement of the sugars from the aqueous phase to the central binding site. The off rate (corresponding to the release of the sugars from the channel) decreased with increasing number of glucose residues in the maltooligosaccharides from approximately 2,000 s-1 for maltotriose to 180 s-1 for maltoheptaose. The kinetics for sucrose movement was considerably slower. The activation energies of the stability constant and of the rate constants for sugar binding were evaluated from noise experiments at different temperatures. The role of LamB in the transport of maltooligosaccharides across the outer membrane is discussed. PMID:7539481

  15. Polariton biexciton transitions in a ZnSe-based microcavity

    NASA Astrophysics Data System (ADS)

    Neukirch, U.; Bolton, S. R.; Fromer, N. A.; Sham, L. J.; Chemla, D. S.

    2000-06-01

    The optical third-order nonlinearity of a ZnSe-based microcavity is investigated by the pump-and-probe method. In the specially designed non-monolithic sample the biexciton binding energy exceeds all damping constants and the normal-mode splitting between exciton and cavity photon. For counter-circular polarized beams the nonlinear response exhibits strong oscillatory structures in the spectral vicinity of the polariton-biexciton transition. Comparison to model calculations shows that in this case the coherent nonlinearity is completely dominated by biexciton-exciton interactions beyond the Hartree-Fock approximation.

  16. A highly selective and sensitive fluorescent chemosensor and its application for rapid on-site detection of Al3 +

    NASA Astrophysics Data System (ADS)

    Yue, Xiao-li; Wang, Zhao-qing; Li, Chao-rui; Yang, Zheng-yin

    2018-03-01

    In this paper, a simple naphthalene-based derivative (HL) has been designed and synthesized as a Al3 +-selective fluorescent chemosensor based on the PET mechanism. HL exhibited high selectivity and sensitivity towards Al3 + over other commonly coexisting metal ions in ethanol with a detection limit of 2.72 nM. The 1:1 binding stoichiometry of the complex (HL-Al3 +) was determined from the Job's plot based on fluorescence titrations and the ESI-MS spectrum data. Moreover, the binding site of HL with Al3 + was assured by the 1H NMR titration experiment. The binding constant (Ka) of the complex (HL-Al3 +) was calculated to be 5.06 × 104 M- 1 according to the Benesi-Hildebrand equation. In addition, the recognizing process of HL towards Al3 + was chemically reversible by adding Na2EDTA. Importantly, HL could directly and rapidly detect aluminum ion through the filter paper without resorting to additional instrumental analysis.

  17. Thiophene-based rhodamine as selectivef luorescence probe for Fe(III) and Al(III) in living cells.

    PubMed

    Wang, Kun-Peng; Chen, Ju-Peng; Zhang, Si-Jie; Lei, Yang; Zhong, Hua; Chen, Shaojin; Zhou, Xin-Hong; Hu, Zhi-Qiang

    2017-09-01

    The thiophene-modified rhodamine 6G (GYJ) has been synthesized as a novel chemosensor. The sensor has sufficiently high selectivity and sensitivity for the detection of Fe 3+ and Al 3+ ions (M 3+ ) by fluorescence and ultraviolet spectroscopy with a strong ability for anti-interference performance. The binding ratio of M 3+ -GYJ complex was determined to be 2:1 according to the Job's plot. The binding constants for Fe 3+ and Al 3+ were calculated to be 3.91 × 10 8 and 5.26 × 10 8  M -2 , respectively. All these unique features made it particularly favorable for cellular imaging applications. The obvious fluorescence microscopy experiments demonstrated that the probes could contribute to the detection of Fe 3+ and Al 3+ in related cells and biological organs with satisfying resolution. Graphical abstract GYJ has high selectivity and sensitivity for the detection of Fe(III) and Al(III) with the binding ratio of 2:1.

  18. Interaction of Lysozyme with Rhodamine B: A combined analysis of spectroscopic & molecular docking.

    PubMed

    Millan, Sabera; Satish, Lakkoji; Kesh, Sandeep; Chaudhary, Yatendra S; Sahoo, Harekrushna

    2016-09-01

    The interaction of Rhodamine B (RB) with Lysozyme (Lys) was investigated by different optical spectroscopic techniques such as absorption, fluorescence, and circular-dichroism (CD), along with molecular docking studies. The fluorescence results (including steady-state and time-resolved mode) revealed that the addition of RB effectively causes strong quenching of intrinsic fluorescence in Lysozyme and mostly, by the static quenching mechanism. Different binding and thermodynamic parameters were calculated at different temperatures and the binding constant value was found to be 2963.54Lmol(-1) at 25°C. The average distance (r0) was found to be 3.31nm according to Förster's theory of non-radiative energy transfer between Lysozyme and RB. The conformational change in Lysozyme during interaction with RB was confirmed from absorbance, synchronous fluorescence, and circular dichroism measurements. Finally, molecular docking studies were done to confirm that the dye binds with Lysozyme. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Structure-based prediction of free energy changes of binding of PTP1B inhibitors

    NASA Astrophysics Data System (ADS)

    Wang, Jing; Ling Chan, Shek; Ramnarayan, Kal

    2003-08-01

    The goals were (1) to understand the driving forces in the binding of small molecule inhibitors to the active site of PTP1B and (2) to develop a molecular mechanics-based empirical free energy function for compound potency prediction. A set of compounds with known activities was docked onto the active site. The related energy components and molecular surface areas were calculated. The bridging water molecules were identified and their contributions were considered. Linear relationships were explored between the above terms and the binding free energies of compounds derived based on experimental inhibition constants. We found that minimally three terms are required to give rise to a good correlation (0.86) with predictive power in five-group cross-validation test (q2 = 0.70). The dominant terms are the electrostatic energy and non-electrostatic energy stemming from the intra- and intermolecular interactions of solutes and from those of bridging water molecules in complexes.

  20. Analysis of the interaction of calcitriol with the disulfide isomerase ERp57

    NASA Astrophysics Data System (ADS)

    Gaucci, Elisa; Raimondo, Domenico; Grillo, Caterina; Cervoni, Laura; Altieri, Fabio; Nittari, Giulio; Eufemi, Margherita; Chichiarelli, Silvia

    2016-11-01

    Calcitriol, the active form of vitamin D3, can regulate the gene expression through the binding to the nuclear receptor VDR, but it can also display nongenomic actions, acting through a membrane-associated receptor, which has been discovered as the disulfide isomerase ERp57. The aim of our research is to identify the binding sites for calcitriol in ERp57 and to analyze their interaction. We first studied the interaction through bioinformatics and fluorimetric analyses. Subsequently, we focused on two protein mutants containing the predicted interaction domains with calcitriol: abb’-ERp57, containing the first three domains, and a’-ERp57, the fourth domain only. To consolidate the achievements we used the calorimetric approach to the whole protein and its mutants. Our results allow us to hypothesize that the interaction with the a’ domain contributes to a greater extent than the other potential binding sites to the dissociation constant, calculated as a Kd of about 10-9 M.

  1. Synthesis and binding studies of Alzheimer ligands on solid support.

    PubMed

    Rzepecki, Petra; Geib, Nina; Peifer, Manuel; Biesemeier, Frank; Schrader, Thomas

    2007-05-11

    Aminopyrazole derivatives constitute the first class of nonpeptidic rationally designed beta-sheet ligands. Here we describe a double solid-phase protocol for both synthesis and affinity testing. The presented solid-phase synthesis of four types of hybrid compounds relies on the Fmoc strategy and circumvents subsequent HPLC purification by precipitating the final product from organic solution in pure form. Hexa- and octapeptide pendants with internal di- and tetrapeptide bridges are now amenable in high yields to combinatorial synthesis of compound libraries for high-throughput screening purposes. Solid-phase peptide synthesis (SPPS) on an acid-resistant PAM allows us, after PMB deprotection, to subject the free aminopyrazole binding sites in an immobilized state to on-bead assays with fluorescence-labeled peptides. From the fluorescence emission intensity decrease, individual binding constants can be calculated via reference curves by simple application of the law of mass action. Gratifyingly, host/guest complexation can be monitored quantitatively even for those ligands, which are almost insoluble in water.

  2. Binding and Diffusion of Lithium in Graphite: Quantum Monte Carlo Benchmarks and Validation of van der Waals Density Functional Methods

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ganesh, P.; Kim, Jeongnim; Park, Changwon

    2014-11-03

    In highly accurate diffusion quantum Monte Carlo (QMC) studies of the adsorption and diffusion of atomic lithium in AA-stacked graphite are compared with van der Waals-including density functional theory (DFT) calculations. Predicted QMC lattice constants for pure AA graphite agree with experiment. Pure AA-stacked graphite is shown to challenge many van der Waals methods even when they are accurate for conventional AB graphite. Moreover, the highest overall DFT accuracy, considering pure AA-stacked graphite as well as lithium binding and diffusion, is obtained by the self-consistent van der Waals functional vdW-DF2, although errors in binding energies remain. Empirical approaches based onmore » point charges such as DFT-D are inaccurate unless the local charge transfer is assessed. Our results demonstrate that the lithium carbon system requires a simultaneous highly accurate description of both charge transfer and van der Waals interactions, favoring self-consistent approaches.« less

  3. Spectroscopic analysis on the resveratrol-DNA binding interactions at physiological pH

    NASA Astrophysics Data System (ADS)

    Zhang, Shufang; Sun, Xuejun; Jing, Zhihong; Qu, Fengli

    2011-11-01

    The interaction of resveratrol with calf thymus deoxyribonucleic acid (ctDNA) under physiological conditions (Tris-HCl buffer solutions, pH 7.4) was studied by spectroscopy, fluorescence spectroscopy and viscosity measurement method, respectively. Results indicated that a complex of resveratrol with ctDNA was formed with a binding constant of K17 °C = 5.49 × 10 3 L mol -1 and K37 °C = 1.90 × 10 4 L mol -1. The fluorescence quenching mechanism of acridine orange (AO)-ctDNA by resveratrol was shown to be a static quenching type. The thermodynamic parameters of the complex were calculated by a double reciprocal method: ΔHms=4.64×10 J mol, ΔSms=231.8 J K mol and ΔGms=-2.54×10 J mol (37 °C). Spectroscopic techniques together with viscosity determination provided evidences of intercalation mode of binding for the interaction between resveratrol and ctDNA.

  4. Investigation on the protein-binding properties of icotinib by spectroscopic and molecular modeling method

    NASA Astrophysics Data System (ADS)

    Zhang, Hua-xin; Xiong, Hang-xing; Li, Li-wei

    2016-05-01

    Icotinib is a highly-selective epidermal growth factor receptor tyrosine kinase inhibitor with preclinical and clinical activity in non-small cell lung cancer, which has been developed as a new targeted anti-tumor drug in China. In this work, the interaction of icotinib and human serum albumin (HSA) were studied by three-dimensional fluorescence spectra, ultraviolet spectra, circular dichroism (CD) spectra, molecular probe and molecular modeling methods. The results showed that icotinib binds to Sudlow's site I in subdomain IIA of HSA molecule, resulting in icotinib-HSA complexes formed at ground state. The number of binding sites, equilibrium constants, and thermodynamic parameters of the reaction were calculated at different temperatures. The negative enthalpy change (ΔHθ) and entropy change (ΔSθ) indicated that the structure of new complexes was stabilized by hydrogen bonds and van der Waals power. The distance between donor and acceptor was calculated according to Förster's non-radiation resonance energy transfer theory. The structural changes of HSA caused by icotinib binding were detected by synchronous spectra and circular dichroism (CD) spectra. Molecular modeling method was employed to unfold full details of the interaction at molecular level, most of which could be supported by experimental results. The study analyzed the probability that serum albumins act as carriers for this new anticarcinogen and provided fundamental information on the process of delivering icotinib to its target tissues, which might be helpful in understanding the mechanism of icotinib in cancer therapy.

  5. Effect of charging on silicene with alkali metal atom adsorption

    NASA Astrophysics Data System (ADS)

    Li, Manman; Li, Zhongyao; Gong, Shi-Jing

    2018-02-01

    Based on first-principles calculations, we studied the effects of charging on the structure, binding energy and electronic properties of silicene with alkali metal (AM) atom (Li, Na or K) adsorption. In AMSi2, electron doping enlarges the lattice constant of silicene, while the influence of hole doping is non-monotonic. In AMSi8, the lattice constant increases/decreases almost linearly with the increase in electron/hole doping. In addition, the AM-Si vertical distance can be greatly enlarged by excessive hole doping in both AMSi2 and AMSi8 systems. When the hole doping is as large as  +e per unit cell, both AMSi2 and AMSi8 can be transformed from metal to semiconductor. However, the binding energy would be negative in the AM+ Si2 semiconductor. It suggests AM+ Si2 is unstable in this case. In addition, the electron doping and the AM-Si vertical distance would greatly influence the band gap of silicene in LiSi8 and NaSi8, while the band gap in KSi8 is relatively stable. Therefore, KSi8 may be a more practicable material in nanotechnology.

  6. Kinetic Characterisation of a Single Chain Antibody against the Hormone Abscisic Acid: Comparison with Its Parental Monoclonal

    PubMed Central

    Badescu, George O.; Marsh, Andrew; Smith, Timothy R.; Thompson, Andrew J.; Napier, Richard M.

    2016-01-01

    A single-chain Fv fragment antibody (scFv) specific for the plant hormone abscisic acid (ABA) has been expressed in the bacterium Escherichia coli as a fusion protein. The kinetics of ABA binding have been measured using surface plasmon resonance spectrometry (BIAcore 2000) using surface and solution assays. Care was taken to calculate the concentration of active protein in each sample using initial rate measurements under conditions of partial mass transport limitation. The fusion product, parental monoclonal antibody and the free scFv all have low nanomolar affinity constants, but there is a lower dissociation rate constant for the parental monoclonal resulting in a three-fold greater affinity. Analogue specificity was tested and structure-activity binding preferences measured. The biologically-active (+)-ABA enantiomer is recognised with an affinity three orders of magnitude higher than the inactive (-)-ABA. Metabolites of ABA including phaseic acid, dihydrophaseic acid and deoxy-ABA have affinities over 100-fold lower than that for (+)-ABA. These properties of the scFv make it suitable as a sensor domain in bioreporters specific for the naturally occurring form of ABA. PMID:27023768

  7. Evaluation of interactions between RAW264.7 macrophages and small molecules by capillary electrophoresis.

    PubMed

    Wang, Feng-Qin; Li, Qiao-Qiao; Zhang, Qian; Wang, Yin-Zhen; Hu, Yuan-Jia; Li, Peng; Wan, Jian-Bo; Yang, Feng-Qing; Xia, Zhi-Ning

    2017-03-01

    In this study, the affinity interactions between RAW 264.7 macrophages and three small molecules including naringin, oleuropein and paeoniflorin were evaluated by affinity capillary electrophoresis (ACE), partial filling affinity capillary electrophoresis (PFACE) and frontal analysis capillary electrophoresis (FACE), respectively. The result indicated that ACE (varying concentrations of cell suspension were filled in the capillary as receptor) may not be suitable for the evaluation of interactions between cell and small molecules due to the high viscosity of cell suspension; PFACE can qualitatively evaluate the interaction, but the difference in viscosity between RAW264.7 suspension and buffer effects on the liner relationship between filling length and injection time, which makes the calculation of binding constant difficult. Furthermore, based on the PFACE results, naringin showed stronger interaction with macrophages than the other two molecules; taking advantage of the aggregation phenomenon of cell induced by electric field, FACE was successfully used to determine the stoichiometry (n = 5×10 9 ) and binding constant (K b = 1×10 4 L/mol) of the interaction between RAW264.7 and naringin. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Influence of pH for the determination of serum albumin by a dye-binding method in the presence of a detergent.

    PubMed

    Suzuki, Yuji

    2008-08-01

    In the dye-binding method, the absorbance increase caused by a protein error of a pH indicator is observed only in a restricted pH range. However, this pH range in the presence of a detergent has not yet been examined. Thus, the author investigated the pH (pH(UL)) where the absorbance increase becomes zero by a calculation based on the chemical equilibrium of a protein error of a pH indicator, and by experiments using four sulfonephthalein dyes. The pH(UL) value changed only with the detergent concentration, but did not change at all due to the dye, buffer solution or protein concentrations. Although the pH(UL) value was different according to the kind of dye used, it correlated well with the pK(D) values (dissociation constant) of BPB, BCG, BCP and BTB. The characteristics of pH(UL) in the reactions of the four dyes indicated good agreement with that obtained by a calculation.

  9. A simple model for metal cation-phosphate interactions in nucleic acids in the gas phase: alkali metal cations and trimethyl phosphate.

    PubMed

    Ruan, Chunhai; Huang, Hai; Rodgers, M T

    2008-02-01

    Threshold collision-induced dissociation techniques are employed to determine the bond dissociation energies (BDEs) of complexes of alkali metal cations to trimethyl phosphate, TMP. Endothermic loss of the intact TMP ligand is the only dissociation pathway observed for all complexes. Theoretical calculations at the B3LYP/6-31G* level of theory are used to determine the structures, vibrational frequencies, and rotational constants of neutral TMP and the M+(TMP) complexes. Theoretical BDEs are determined from single point energy calculations at the B3LYP/6-311+G(2d,2p) level using the B3LYP/6-31G* optimized geometries. The agreement between theory and experiment is reasonably good for all complexes except Li+(TMP). The absolute M+-(TMP) BDEs are found to decrease monotonically as the size of the alkali metal cation increases. No activated dissociation was observed for alkali metal cation binding to TMP. The binding of alkali metal cations to TMP is compared with that to acetone and methanol.

  10. Photo-isomerization and oxidation of bilirubin in mammals is dependent on albumin binding.

    PubMed

    Goncharova, Iryna; Jašprová, Jana; Vítek, Libor; Urbanová, Marie

    2015-12-01

    The bilirubin (BR) photo-conversion in the human body is a protein-dependent process; an effective photo-isomerization of the potentially neurotoxic Z,Z-BR as well as its oxidation to biliverdin in the antioxidant redox cycle is possible only when BR is bound on serum albumin. We present a novel analytical concept in the study of linear tetrapyrroles metabolic processes based on an in-depth mapping of binding sites in the structure of human serum albumin (HSA). A combination of fluorescence spectroscopy, circular dichroism (CD) spectroscopy, and molecular modeling methods was used for recognition of the binding site for BR, its derivatives (mesobilirubin and bilirubin ditaurate), and the products of the photo-isomerization and oxidation (lumirubin, biliverdin, and xanthobilirubic acid) on HSA. The CD spectra and fluorescent quenching of the Trp-HSA were used to calculate the binding constants. The results of the CD displacement experiments performed with hemin were interpreted together with the findings of molecular docking performed on the pigment-HSA complexes. We estimated that Z,Z-BR and its metabolic products bind on two independent binding sites. Our findings support the existence of a reversible antioxidant redox cycle for BR and explain an additional pathway of the photo-isomerization process (increase of HSA binding capacity; the excess free [unbound] BR can be converted and also bound to HSA). Copyright © 2015 Elsevier Inc. All rights reserved.

  11. Spectroscopic analysis of the interaction between thiazolo[2,3-b]pyrimidine analogues and bovine serum albumin.

    PubMed

    Yu, Xianyong; Yang, Ying; Yao, Qing; Tao, Hongwen; Lu, Shiyu; Xie, Jian; Zhou, Hu; Yi, Pinggui

    2012-10-01

    The interaction between thiazolo[2,3-b]pyrimidine (TZPM) analogues and bovine serum albumin (BSA) was investigated by fluorescence spectroscopy and UV-Vis spectroscopy at two different temperatures (299 and 307K) under imitated physiological conditions. The results indicate that both static quenching and dynamic quenching contribute to the fluorescence quenching of BSA by TZPM. The binding constant (K(a)) and binding sites (n) were calculated from the obtained spectra. Based on the Förster non-radiation energy transfer theory, the average binding distance between BSA and TZPM was estimated. The synchronous fluorescence spectra indicate that the conformation of BSA has been changed. The comparison of binding potency of TZPM and BSA suggests that the substituents on the benzene ring enhance the binding affinity of TZPM and BSA. We investigated the possible sub-domains on BSA that bind TZPM by displacement experiments. Furthermore, to explore the effect of molecular structure on the binding, a study on quantitative structure-property relationship (QSPR) was performed, the quantitative relationship equation of R(0), r and K(a) were obtained. We observed that R(0), r and K(a) between BSA and TZPM is connected with the margin of the highest and the lowest occupied orbital energy (ΔE), dipole moment (μ), Molar Volume (V(m)), Mole Mass (M). Copyright © 2012 Elsevier B.V. All rights reserved.

  12. Fatty acid modulated human serum albumin binding of the β-carboline alkaloids norharmane and harmane.

    PubMed

    Domonkos, Celesztina; Fitos, Ilona; Visy, Júlia; Zsila, Ferenc

    2013-12-02

    Harmane and norharmane are representative members of the large group of natural β-carboline alkaloids featured with diverse pharmacological activities. In blood, these agents are transported by human serum albumin (HSA) which has a profound impact on the pharmacokinetic and pharmacodynamic properties of many therapeutic drugs and xenobiotics. By combination of various spectroscopic methods, the present contribution is aimed to elucidate how nonesterified fatty acids (FAs), the primary endogenous ligands of HSA, affect the binding properties of harmane and norharmane. Analysis of induced circular dichroism (CD) and fluorescence spectroscopic data indicates the inclusion of the neutral form of both molecules into the binding pocket of subdomain IIIA, which hosts two FA binding sites, too. The induced CD and UV absorption spectra of harmane and norharmane exhibit peculiar changes upon addition of FAs, suggesting the formation of ternary complexes in which the lipid ligands significantly alter the binding mode of the alkaloids via cooperative allosteric mechanism. To our knowledge, it is the first instance of the demonstration of drug-FA cobinding at site IIIA. In line with these results, molecular docking calculations showed two distinct binding positions of norharmane within subdomain IIIA. The profound increase in the affinity constants of β-carbolines estimated in the presence of FAs predicts that the unbound, pharmacologically active serum fraction of these compounds strongly depends on the actual lipid binding profile of HSA.

  13. Analysis of cholera toxin-ganglioside interactions by flow cytometry.

    PubMed

    Lauer, Sabine; Goldstein, Byron; Nolan, Rhiannon L; Nolan, John P

    2002-02-12

    Cholera toxin entry into mammalian cells is mediated by binding of the pentameric B subunit (CTB) to ganglioside GM(1) in the cell membrane. We used flow cytometry to quantitatively measure in real time the interactions of fluorescently labeled pentameric cholera toxin B-subunit (FITC-CTB) with its ganglioside receptor on microsphere-supported phospholipid membranes. A model that describes the multiple steps of this mode of recognition was developed to guide our flow cytometric experiments and extract relevant equilibrium and kinetic rate constants. In contrast to previous studies, our approach takes into account receptor cross-linking, an important feature for multivalent interactions. From equilibrium measurements, we determined an equilibrium binding constant for a single subunit of FITC-CTB binding monovalently to GM(1) presented in bilayers of approximately 8 x 10(7) M(-1) while that for binding to soluble GM(1)-pentasaccharide was found to be approximately 4 x 10(6) M(-1). From kinetic measurements, we determined the rate constant for dissociation of a single site of FITC-CTB from microsphere-supported bilayers to be (3.21 +/- 0.03) x 10(-3) s(-1), and the rate of association of a site on FITC-CTB in solution to a GM(1) in the bilayer to be (2.8 +/- 0.4) x 10(4) M(-1) s(-1). These values yield a lower estimate for the equilibrium binding constant of approximately 1 x 10(7) M(-1). We determined the equilibrium surface cross-linking constant [(1.1 +/- 0.1) x 10(-12) cm(2)] and from this value and the value for the rate constant for dissociation derived a value of approximately 3.5 x 10(-15) cm(2) s(-1) for the forward rate constant for cross-linking. We also compared the interaction of the receptor binding B-subunit with that of the whole toxin (A- and B-subunits). Our results show that the whole toxin binds with approximately 100-fold higher avidity than the pentameric B-subunit alone which is most likely due to the additional interaction of the A(2)-subunit with the membrane surface. Interaction of cholera toxin B-subunit and whole cholera toxin with gangliosides other than GM(1) revealed specific binding only to GD1(b) and asialo-GM(1). These interactions, however, are marked by low avidity and require high receptor concentrations to be observed.

  14. The structure of binding curves and practical identifiability of equilibrium ligand-binding parameters

    PubMed Central

    Middendorf, Thomas R.

    2017-01-01

    A critical but often overlooked question in the study of ligands binding to proteins is whether the parameters obtained from analyzing binding data are practically identifiable (PI), i.e., whether the estimates obtained from fitting models to noisy data are accurate and unique. Here we report a general approach to assess and understand binding parameter identifiability, which provides a toolkit to assist experimentalists in the design of binding studies and in the analysis of binding data. The partial fraction (PF) expansion technique is used to decompose binding curves for proteins with n ligand-binding sites exactly and uniquely into n components, each of which has the form of a one-site binding curve. The association constants of the PF component curves, being the roots of an n-th order polynomial, may be real or complex. We demonstrate a fundamental connection between binding parameter identifiability and the nature of these one-site association constants: all binding parameters are identifiable if the constants are all real and distinct; otherwise, at least some of the parameters are not identifiable. The theory is used to construct identifiability maps from which the practical identifiability of binding parameters for any two-, three-, or four-site binding curve can be assessed. Instructions for extending the method to generate identifiability maps for proteins with more than four binding sites are also given. Further analysis of the identifiability maps leads to the simple rule that the maximum number of structurally identifiable binding parameters (shown in the previous paper to be equal to n) will also be PI only if the binding curve line shape contains n resolved components. PMID:27993951

  15. CONSTANTS FOR MERCURY BINDING BY DISSOLVED ORGANIC MATTER ISOLATES FROM THE FLORIDA EVERGLADES. (R827653)

    EPA Science Inventory

    Dissolved organic matter (DOM) has been implicated as an important complexing agent for Hg that can affect its mobility and bioavailability in aquatic ecosystems. However, binding constants for natural Hg-DOM complexes are not well known. We employed a competitive ligand appro...

  16. Interaction of Antitumor Agent Mitoxantrone with Double Helical Synthetic Polyribonucleotides Poly(G)ṡPoly(C) and Poly(I)ṡPoly(C)

    NASA Astrophysics Data System (ADS)

    Babayan, Yuri S.; Hakobyan, Sergey N.; Ghazaryan, Rusanna S.; Shahinyan, Mariam A.

    The interaction of antitumor drug mitoxantrone (MTX) with double-stranded synthetic RNA homopolymers has been studied by means of spectroscopic (UV-Visible absorption, circular dichroism) techniques. The results show a base specificity in this interaction: the association constant with poly(G)ṡpoly(C) is higher than with poly(I)ṡpoly(C). Values of changes of the system enthalpy and entropy due to complex-formation were determined through the temperature dependence of the binding constant. Calculations show that due to the intercalation interaction of MTX, the values of changes of the system entropy and enthalpy differ from those obtained at ehtidium bromide interaction with synthetic polyribonucleotides, which shows that the intercalation interaction of MTX with double-stranded RNA significantly differs from that of ethidium bromide with RNA.

  17. Blockade of Neuronal α7-nAChR by α-Conotoxin ImI Explained by Computational Scanning and Energy Calculations

    PubMed Central

    Yu, Rilei; Craik, David J.; Kaas, Quentin

    2011-01-01

    α-Conotoxins potently inhibit isoforms of nicotinic acetylcholine receptors (nAChRs), which are essential for neuronal and neuromuscular transmission. They are also used as neurochemical tools to study nAChR physiology and are being evaluated as drug leads to treat various neuronal disorders. A number of experimental studies have been performed to investigate the structure-activity relationships of conotoxin/nAChR complexes. However, the structural determinants of their binding interactions are still ambiguous in the absence of experimental structures of conotoxin-receptor complexes. In this study, the binding modes of α-conotoxin ImI to the α7-nAChR, currently the best-studied system experimentally, were investigated using comparative modeling and molecular dynamics simulations. The structures of more than 30 single point mutants of either the conotoxin or the receptor were modeled and analyzed. The models were used to explain qualitatively the change of affinities measured experimentally, including some nAChR positions located outside the binding site. Mutational energies were calculated using different methods that combine a conformational refinement procedure (minimization with a distance dependent dielectric constant or explicit water, or molecular dynamics using five restraint strategies) and a binding energy function (MM-GB/SA or MM-PB/SA). The protocol using explicit water energy minimization and MM-GB/SA gave the best correlations with experimental binding affinities, with an R2 value of 0.74. The van der Waals and non-polar desolvation components were found to be the main driving force for binding of the conotoxin to the nAChR. The electrostatic component was responsible for the selectivity of the various ImI mutants. Overall, this study provides novel insights into the binding mechanism of α-conotoxins to nAChRs and the methodological developments reported here open avenues for computational scanning studies of a rapidly expanding range of wild-type and chemically modified α-conotoxins. PMID:21390272

  18. Tunneling Rate Constants for H2CO+H on Amorphous Solid Water Surfaces

    NASA Astrophysics Data System (ADS)

    Song, Lei; Kästner, Johannes

    2017-12-01

    Formaldehyde (H2CO) is one of the most abundant molecules observed in the icy mantle covering interstellar grains. Studying its evolution can contribute to our understanding of the formation of complex organic molecules in various interstellar environments. In this work, we investigated the hydrogenation reactions of H2CO yielding CH3O, CH2OH, and the hydrogen abstraction resulting in H2+HCO on an amorphous solid water (ASW) surface using a quantum mechanics/molecular mechanics (QM/MM) model. The binding energies of H2CO on the ASW surface vary broadly, from 1000 to 9370 K. No correlation was found between binding energies and activation energies of hydrogenation reactions. Combining instanton theory with QM/MM modeling, we calculated rate constants for the Langmuir-Hinshelwood and the Eley-Rideal mechanisms for the three product channels of H+H2CO surface reactions down to 59 K. We found that the channel producing CH2OH can be ignored, owing to its high activation barrier leading to significantly lower rates than the other two channels. The ASW surface influences the reactivity in favor of formation of CH3O (branching ratio ˜80%) and hinders the H2CO dissociation into H2+HCO. In addition, kinetic isotope effects are strong in all reaction channels and vary strongly between the channels. Finally, we provide fits of the rate constants to be used in astrochemical models.

  19. Binding equilibrium and kinetics of membrane-anchored receptors and ligands in cell adhesion: Insights from computational model systems and theory.

    PubMed

    Weikl, Thomas R; Hu, Jinglei; Xu, Guang-Kui; Lipowsky, Reinhard

    2016-09-02

    The adhesion of cell membranes is mediated by the binding of membrane-anchored receptor and ligand proteins. In this article, we review recent results from simulations and theory that lead to novel insights on how the binding equilibrium and kinetics of these proteins is affected by the membranes and by the membrane anchoring and molecular properties of the proteins. Simulations and theory both indicate that the binding equilibrium constant [Formula: see text] and the on- and off-rate constants of anchored receptors and ligands in their 2-dimensional (2D) membrane environment strongly depend on the membrane roughness from thermally excited shape fluctuations on nanoscales. Recent theory corroborated by simulations provides a general relation between [Formula: see text] and the binding constant [Formula: see text] of soluble variants of the receptors and ligands that lack the membrane anchors and are free to diffuse in 3 dimensions (3D).

  20. Binding equilibrium and kinetics of membrane-anchored receptors and ligands in cell adhesion: Insights from computational model systems and theory

    PubMed Central

    Weikl, Thomas R.; Hu, Jinglei; Xu, Guang-Kui; Lipowsky, Reinhard

    2016-01-01

    ABSTRACT The adhesion of cell membranes is mediated by the binding of membrane-anchored receptor and ligand proteins. In this article, we review recent results from simulations and theory that lead to novel insights on how the binding equilibrium and kinetics of these proteins is affected by the membranes and by the membrane anchoring and molecular properties of the proteins. Simulations and theory both indicate that the binding equilibrium constant K2D and the on- and off-rate constants of anchored receptors and ligands in their 2-dimensional (2D) membrane environment strongly depend on the membrane roughness from thermally excited shape fluctuations on nanoscales. Recent theory corroborated by simulations provides a general relation between K2D and the binding constant K3D of soluble variants of the receptors and ligands that lack the membrane anchors and are free to diffuse in 3 dimensions (3D). PMID:27294442

  1. Kinetics and equilibria of cyanide binding to prostaglandin H synthase.

    PubMed

    MacDonald, I D; Dunford, H B

    1989-09-01

    Cyanide binding to prostaglandin H (PGH) synthase results in a spectral shift in the Soret region. This shift was exploited to determine equilibrium and kinetic parameters of the cyanide binding process. At pH 8.0, ionic strength 0.22 M, 4 degrees C, the cyanide dissociation constant, determined from equilibrium experiments, is (65 +/- 10) microM. The binding rate constant is (2.8 +/- 0.2) x 10(3) M-1 s-1, and the dissociation rate constant is zero within experimental error. Through a kinetic study of the binding process as a function of pH, from pH 3.96 to 8.00, it was possible to determine the pKa of a heme-linked acid group on the enzyme of 4.15 +/- 0.10 with citrate buffer. An apparent pKa of 4.75 +/- 0.03 was determined with acetate buffer; this different value is attributed to complexation of the enzyme with one of the components of the acetate buffer.

  2. Size and molecular flexibility affect the binding of ellagitannins to bovine serum albumin.

    PubMed

    Dobreva, Marina A; Green, Rebecca J; Mueller-Harvey, Irene; Salminen, Juha-Pekka; Howlin, Brendan J; Frazier, Richard A

    2014-09-17

    Binding to bovine serum albumin of monomeric (vescalagin and pedunculagin) and dimeric ellagitannins (roburin A, oenothein B, and gemin A) was investigated by isothermal titration calorimetry and fluorescence spectroscopy, which indicated two types of binding sites. Stronger and more specific sites exhibited affinity constants, K1, of 10(4)-10(6) M(-1) and stoichiometries, n1, of 2-13 and dominated at low tannin concentrations. Weaker and less-specific binding sites had K2 constants of 10(3)-10(5) M(-1) and stoichiometries, n2, of 16-30 and dominated at higher tannin concentrations. Binding to stronger sites appeared to be dependent on tannin flexibility and the presence of free galloyl groups. Positive entropies for all but gemin A indicated that hydrophobic interactions dominated during complexation. This was supported by an exponential relationship between the affinity, K1, and the modeled hydrophobic accessible surface area and by a linear relationship between K1 and the Stern-Volmer quenching constant, K(SV).

  3. Probing the mechanism of interaction of metoprolol succinate with human serum albumin by spectroscopic and molecular docking analysis.

    PubMed

    Pawar, Suma K; Jaldappagari, Seetharamappa

    2017-09-01

    In the present work, the mechanism of the interaction between a β1 receptor blocker, metoprolol succinate (MS) and human serum albumin (HSA) under physiological conditions was investigated by spectroscopic techniques, namely fluorescence, Fourier transform infra-red spectroscopy (FT-IR), fluorescence lifetime decay and circular dichroism (CD) as well as molecular docking and cyclic voltammetric methods. The fluorescence and lifetime decay results indicated that MS quenched the intrinsic intensity of HSA through a static quenching mechanism. The Stern-Volmer quenching constants and binding constants for the MS-HSA system at 293, 298 and 303 K were obtained from the Stern-Volmer plot. Thermodynamic parameters for the interaction of MS with HSA were evaluated; negative values of entropy change (ΔG°) indicated the spontaneity of the MS and HSA interaction. Thermodynamic parameters such as negative ΔH° and positive ΔS° values revealed that hydrogen bonding and hydrophobic forces played a major role in MS-HSA interaction and stabilized the complex. The binding site for MS in HSA was identified by competitive site probe experiments and molecular docking studies. These results indicated that MS was bound to HSA at Sudlow's site I. The efficiency of energy transfer and the distance between the donor (HSA) and acceptor (MS) was calculated based on the theory of Fosters' resonance energy transfer (FRET). Three-dimensional fluorescence spectra and CD results revealed that the binding of MS to HSA resulted in an obvious change in the conformation of HSA. Cyclic voltammograms of the MS-HSA system also confirmed the interaction between MS and HSA. Furthermore, the effects of metal ions on the binding of MS to HSA were also studied. Copyright © 2017 John Wiley & Sons, Ltd.

  4. Measurement of monomolecular binding constants of neutral phenols into the beta-cyclodextrin by continuous frontal analysis in capillary and microchip electrophoresis via a competitive assay.

    PubMed

    Le Saux, Thomas; Hisamoto, Hideaki; Terabe, Shigeru

    2006-02-03

    Measurement of binding constant by chip electrophoresis is a very promising technique for the high throughput screening of non-covalent interactions. Among the different electrophoretic methods available that yield the binding parameters, continuous frontal analysis is the most appropriate for a transposition from capillary electrophoresis (CE) to microchip electrophoresis. Implementation of this methodology in microchip was exemplified by the measurement of inclusion constants of 2-naphtalenesulfonate and neutral phenols (phenol, 4-chlorophenol and 4-nitrophenol) into beta-cyclodextrin by competitive assays. The issue of competitor choice is discussed in relation to its appropriateness for proper monitoring of the interaction.

  5. Heavy metals binding properties of esterified lemon.

    PubMed

    Arslanoglu, Hasan; Altundogan, Hamdi Soner; Tumen, Fikret

    2009-05-30

    Sorption of Cd(2+), Cr(3+), Cu(2+), Ni(2+), Pb(2+) and Zn(2+) onto a carboxyl groups-rich material prepared from lemon was investigated in batch systems. The results revealed that the sorption is highly pH dependent. Sorption kinetic data indicated that the equilibrium was achieved in the range of 30-240 min for different metal ions and sorption kinetics followed the pseudo-second-order model for all metals studied. Relative sorption rate of various metal cations was found to be in the general order of Ni(2+)>Cd(2+)>Cu(2+)>Pb(2+)>Zn(2+)>Cr(3+). The binding characteristics of the sorbent for heavy metal ions were analyzed under various conditions and isotherm data was accurately fitted to the Langmuir equation. The metal binding capacity order calculated from Langmuir isotherm was Pb(2+)>Cu(2+)>Ni(2+)>Cd(2+)>Zn(2+)>Cr(3+). The mean free energy of metal sorption process calculated from Dubinin-Radushkevich parameter and the Polanyi potential was found to be in the range of 8-11 kJ mol(-1) for the metals studied showing that the main mechanism governing the sorption process seems to be ion exchange. The basic thermodynamic parameters of metals ion sorption process were calculated by using the Langmuir constants obtained from equilibration study. The DeltaG degrees and DeltaH degrees values for metals ion sorption on the lemon sorbent showed the process to be spontaneous and exothermic in nature. Relatively low DeltaH degrees values revealed that physical adsorption significantly contributed to the mechanism.

  6. The effect of glycation on bovine serum albumin conformation and ligand binding properties with regard to gliclazide

    NASA Astrophysics Data System (ADS)

    Żurawska-Płaksej, Ewa; Rorbach-Dolata, Anna; Wiglusz, Katarzyna; Piwowar, Agnieszka

    2018-01-01

    Albumin, the major serum protein, plays a variety of functions, including binding and transporting endogenous and exogenous ligands. Its molecular structure is sensitive to different environmental modifiers, among which glucose is one of the most significant. In vivo albumin glycation occurs under physiological conditions, but it is increased in diabetes. Since bovine serum albumin (BSA) may serve as a model protein in in vitro experiments, we aimed to investigate the impact of glucose-mediated BSA glycation on the binding capacity towards gliclazide, as well as the ability of this drug to prevent glycation of the BSA molecule. To reflect normo- and hyperglycemia, the conditions of the glycation process were established. Structural changes of albumin after interaction with gliclazide (0-14 μM) were determined using fluorescence quenching and circular dichroism spectroscopy. Moreover, thermodynamic parameters as well as energy transfer parameters were determined. Calculated Stern-Volmer quenching constants, as well as binding constants for the BSA-gliclazide complex, were lower for the glycated form of albumin than for the unmodified protein. The largest, over 2-fold, decrease in values of binding parameters was observed for the sample with 30 mM of glucose, reflecting the poorly controlled diabetic state, which indicates that the degree of glycation had a critical influence on binding with gliclazide. In contrast to significant changes in the tertiary structure of BSA upon binding with gliclazide, only slight changes in the secondary structure were observed, which was reflected by about a 3% decrease of the α-helix content of glycated BSA (regardless of glucose concentration) in comparison to unmodified BSA. The presence of gliclazide during glycation did not affect its progress. The results of this study indicate that glycation significantly changed the binding ability of BSA towards gliclazide and the scale of these changes depended on glucose concentration. It may have a direct impact on the free drug fraction and its pharmacokinetic behavior, including the risk of hypoglycemic episodes or unexpected interactions with other ligands. The use of BSA in examining binding effects upon glycation seems to be good model for preliminary research and may be used to identify a potential drug response in a diabetic state.

  7. Kinetic studies of amino acid-based surfactant binding to DNA.

    PubMed

    Santhiya, Deenan; Dias, Rita S; Dutta, Sounak; Das, Prasanta Kumar; Miguel, Maria G; Lindman, Björn; Maiti, Souvik

    2012-05-24

    In this work, the binding kinetics of amino acid-based surfactants, presenting different linkers and head groups, with calf thymus (CT)-DNA was studied using stopped-flow fluorescence spectroscopy. The kinetic studies were carried out as a function of Na(+) concentration and surfactant-to-DNA charge ratio. The surfactant binding on DNA took place in two consecutive steps, for which the corresponding first and second relative rate constants (k(1) and k(2)) were determined. The fast step was attributed to the surfactant binding to DNA and micelle formation in its vicinity, the slower step to DNA condensation and possible rearrangement of the surfactant aggregates. In general, both relative rate constants increase with surfactant concentration and decrease with the ionic strength of the medium. The architecture of the surfactant was found to have a significant impact on the kinetics of the DNA-surfactant complexation. Surfactants with amide linkers showed larger relative rate constants than those with ester linkers. The variation of the relative rate constants with the head groups of the surfactants, alanine and proline, was found to be less obvious, being partially dependent on the surfactant concentration.

  8. Self-consistent field theory of polymer-ionic molecule complexation.

    PubMed

    Nakamura, Issei; Shi, An-Chang

    2010-05-21

    A self-consistent field theory is developed for polymers that are capable of binding small ionic molecules (adsorbates). The polymer-ionic molecule association is described by Ising-like binding variables, C(i) ((a))(kDelta)(=0 or 1), whose average determines the number of adsorbed molecules, n(BI). Polymer gelation can occur through polymer-ionic molecule complexation in our model. For polymer-polymer cross-links through the ionic molecules, three types of solutions for n(BI) are obtained, depending on the equilibrium constant of single-ion binding. Spinodal lines calculated from the mean-field free energy exhibit closed-loop regions where the homogeneous phase becomes unstable. This phase instability is driven by the excluded-volume interaction due to the single occupancy of ion-binding sites on the polymers. Moreover, sol-gel transitions are examined using a critical degree of conversion. A gel phase is induced when the concentration of adsorbates is increased. At a higher concentration of the adsorbates, however, a re-entrance from a gel phase into a sol phase arises from the correlation between unoccupied and occupied ion-binding sites. The theory is applied to a model system, poly(vinyl alcohol) and borate ion in aqueous solution with sodium chloride. Good agreement between theory and experiment is obtained.

  9. High-affinity binding of laurate to naturally occurring mutants of human serum albumin and proalbumin.

    PubMed

    Kragh-Hansen, U; Pedersen, A O; Galliano, M; Minchiotti, L; Brennan, S O; Tárnoky, A L; Franco, M H; Salzano, F M

    1996-12-15

    Binding of laurate (n-dodecanoate) to genetic variants of albumin or its proprotein and to normal albumin isolated from the same heterozygous carriers was studied by a kinetic dialysis technique at physiological pH. The first stoichiometric association constant for binding to proalbumin Lille (Arg-2-->His) and albumin (Alb) Roma (Glu321-->Lys) was increased to 126% and 136% respectively compared with that for binding to normal albumin, whereas the constant for Alb Maku (Lys541-->Glu) was decreased to 80%. In contrast, normal laurate-binding properties were found for as many as nine other albumin variants with single amino acid substitutions. Because the net charges of all these mutants were different from that of normal albumin, the results suggest that the examples of modified laurate binding are not caused by long-range electrostatic effects. Rather, the three positions mentioned are located close to different binding sites for the fatty acid anion. The most pronounced effect was observed for the glycosylated Alb Casebrook, the binding constant of which was decreased to 20%. Binding to the glycosylated Alb Redhill was also decreased, but to a smaller extent (68%). These decreases in binding are caused by partial or total blocking of the high-affinity site by the oligosaccharides, by the negative charges of the oligosaccharides, and/or by conformational changes induced by these bulky moieties. Laurate binding to two chain-termination mutants (Alb Catania and Alb Venezia) was normal, indicating that the C-terminus of albumin is not important for binding. By using different preparations of normal albumin as controls in the binding experiments, it was also possible to compare the effect of various methods for isolation and defatting on laurate binding.

  10. mRNA stability in mammalian cells.

    PubMed Central

    Ross, J

    1995-01-01

    This review concerns how cytoplasmic mRNA half-lives are regulated and how mRNA decay rates influence gene expression. mRNA stability influences gene expression in virtually all organisms, from bacteria to mammals, and the abundance of a particular mRNA can fluctuate manyfold following a change in the mRNA half-life, without any change in transcription. The processes that regulate mRNA half-lives can, in turn, affect how cells grow, differentiate, and respond to their environment. Three major questions are addressed. Which sequences in mRNAs determine their half-lives? Which enzymes degrade mRNAs? Which (trans-acting) factors regulate mRNA stability, and how do they function? The following specific topics are discussed: techniques for measuring eukaryotic mRNA stability and for calculating decay constants, mRNA decay pathways, mRNases, proteins that bind to sequences shared among many mRNAs [like poly(A)- and AU-rich-binding proteins] and proteins that bind to specific mRNAs (like the c-myc coding-region determinant-binding protein), how environmental factors like hormones and growth factors affect mRNA stability, and how translation and mRNA stability are linked. Some perspectives and predictions for future research directions are summarized at the end. PMID:7565413

  11. Investigation on interaction between Ligupurpuroside A and pepsin by spectroscopic and docking methods.

    PubMed

    Shen, Liangliang; Xu, Hong; Huang, Fengwen; Li, Yi; Xiao, Huafeng; Yang, Zhen; Hu, Zhangli; He, Zhendan; Zeng, Zheling; Li, Yinong

    2015-01-25

    Ligupurpuroside A is one of the major glycoside in Ku-Din-Cha, a type of Chinese functional tea. In order to better understand its digestion and metabolism in humans, the interaction between Ligupurpuroside A and pepsin has been investigated by fluorescence spectra, UV-vis absorption spectra and synchronous fluorescence spectra along with molecular docking method. The fluorescence experiments indicate that Ligupurpuroside A can effectively quench the intrinsic fluorescence of pepsin through a combined quenching way at the low concentration of Ligupurpuroside A, and a static quenching procedure at the high concentration. The binding constant, binding sites of Ligupurpuroside A with pepsin have been calculated. The thermodynamic analysis suggests that non-covalent reactions, including electrostatic force, hydrophobic interaction and hydrogen bond are the main forces stabilizing the complex. According to the Förster's non-radiation energy transfer theory, the binding distance between pepsin and Ligupurpuroside A was calculated to be 3.15 nm, which implies that energy transfer occurs between pepsin and Ligupurpuroside A. Conformation change of pepsin was observed from UV-vis absorption spectra and synchronous fluorescence spectra under experimental conditions. In addition, all these experimental results have been validated by the protein-ligand docking studies which show that Ligupurpuroside A is located in the cleft between the domains of pepsin. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Bioinformatic Analysis of the Contribution of Primer Sequences to Aptamer Structures

    PubMed Central

    Ellington, Andrew D.

    2009-01-01

    Aptamers are nucleic acid molecules selected in vitro to bind a particular ligand. While numerous experimental studies have examined the sequences, structures, and functions of individual aptamers, considerably fewer studies have applied bioinformatics approaches to try to infer more general principles from these individual studies. We have used a large Aptamer Database to parse the contributions of both random and constant regions to the secondary structures of more than 2000 aptamers. We find that the constant, primer-binding regions do not, in general, contribute significantly to aptamer structures. These results suggest that (a) binding function is not contributed to nor constrained by constant regions; (b) in consequence, the landscape of functional binding sequences is sparse but robust, favoring scenarios for short, functional nucleic acid sequences near origins; and (c) many pool designs for the selection of aptamers are likely to prove robust. PMID:18594898

  13. Spectrophotometric analysis of flavonoid-DNA binding interactions at physiological conditions

    NASA Astrophysics Data System (ADS)

    Janjua, Naveed Kausar; Siddiqa, Asima; Yaqub, Azra; Sabahat, Sana; Qureshi, Rumana; Haque, Sayed ul

    2009-12-01

    Mode of interactions of three flavonoids [morin (M), quercetin (Q), and rutin (R)] with chicken blood ds.DNA (ck.DNA) has been investigated spectrophotometrically at different temperatures including body temperature (310 K) and at two physiological pH values, i.e. 7.4 (human blood pH) and 4.7 (stomach pH). The binding constants, Kf, evaluated using Benesi-Hildebrand equation showed that the flavonoids bind effectively through intercalation at both pH values and body temperature. Quercetin, somehow, showed greater binding capabilities with DNA. The free energies of flavonoid-DNA complexes indicated the spontaneity of their binding. The order of binding constants of three flavonoids at both pH values were found to be Kf(Q) > Kf(R) > Kf(M) and at 310 K.

  14. Cobalt porphyrin-mediated oxygen transport in a polymer membrane. Effect of the cobalt porphyrin structure on the oxygen-binding reaction, oxygen-diffusion constants, and oxygen-transport efficiency

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nishide, Hiroyuki; Suzuki, Takayuki; Kawakami, Hiroyoshi

    1994-05-12

    New derivatives of (meso-[alpha],[alpha],[alpha],[alpha]-tetrakis(o-pivalamidophenyl)porphinato)cobalt (CoPs) were characterized by oxygen-binding equilibrium and rate constants of the cobalt centered in the porphyrins. They depended on the structure of the porphyrin; for example, the rate constants of oxygen binding and dissociation (k[sub on] and k[sub off]) for [alpha][sup 3][beta]-CoP[sub 4]P were 3 and 20 times as large as those for [alpha][sup 4]-CoB[sub 4]P, respectively. Oxygen transport through the polymer membranes containing CoPs as the fixed oxygen carriers was facilitated and was affected by the oxygen-binding character or the structure of CoPs. The logarithmically linear correlation of the oxygen-dissociation rate constant of CoPs (k[submore » off] = (3-66) x 10[sup 3] S[sup [minus]1]) with the diffusion constant of oxygen via CoPs fixed in the membranes (D[sub cc] = (3-140) x 10[sup [minus]9] cm[sup 2] s[sup [minus]1]) was given for those six CoP derivatives. 26 refs., 5 figs., 2 tabs.« less

  15. Measuring Positive Cooperativity Using the Direct ESI-MS Assay. Cholera Toxin B Subunit Homopentamer Binding to GM1 Pentasaccharide

    NASA Astrophysics Data System (ADS)

    Lin, Hong; Kitova, Elena N.; Klassen, John S.

    2014-01-01

    Direct electrospray ionization mass spectrometry (ESI-MS) assay was used to investigate the stepwise binding of the GM1 pentasaccharide β- D-Gal p-(1→3)-β-D-Gal pNAc-(1→4)[α-D-Neu5Ac-(2→3)]-β- D-Gal p-(1→4)-β-D-Glc p (GM1os) to the cholera toxin B subunit homopentamer (CTB5) and to establish conclusively whether GM1os binding is cooperative. Apparent association constants were measured for the stepwise addition of one to five GM1os to CTB5 at pH 6.9 and 22 °C. The intrinsic association constant, which was established from the apparent association constant for the addition of a single GM1os to CTB5, was found to be (3.2 ± 0.2) × 106 M-1. This is in reasonable agreement with the reported value of (6.4 ± 0.3) × 106 M-1, which was measured at pH 7.4 and 25 °C using isothermal titration calorimetry (ITC). Analysis of the apparent association constants provides direct and unambiguous evidence that GM1os binding exhibits small positive cooperativity. Binding was found to be sensitive to the number of ligand-bound nearest neighbor subunits, with the affinities enhanced by a factor of 1.7 and 2.9 when binding occurs next to one or two ligand-bound subunits, respectively. These findings, which provide quantitative support for the binding model proposed by Homans and coworkers [14], highlight the unique strengths of the direct ESI-MS assay for measuring cooperative ligand binding.

  16. Determination of the side-reaction coefficient of the trihydroxamate siderophore desferrioxamine B in metal-free seawater

    NASA Astrophysics Data System (ADS)

    Schijf, J.; Burns, S. M.

    2016-02-01

    Desferrioxamines are a class of trihydroxamate siderophores, members of which occur in surface seawater at low-picomolar concentrations. The total synthesis of desferrioxamine B (DFOB), achieved in the late 1980s and prompted by its use in the treatment of human iron-overload disorders, has ensured a steady commercial supply enabling extensive laboratory studies of its properties. While highly specific for Fe3+, DFOB binds many di-, tri-, and tetravalent metals with substantial affinity and has consequently been employed as a model for strong organic ligands that ostensibly dominate the speciation of several bio-essential metals in the ocean, yet remain largely unidentified. Such comparisons are only meaningful if we know the side-reaction coefficient of DFOB in seawater, which accounts for its binding with the divalent cations Mg2+ and Ca2+. Although quite weak, this has a potentially important effect on the availability of the free ligand, due to the great abundance of these sea salt constituents. We have performed potentiometric titrations to measure the sequential binding of Mg and Ca to the three hydroxamate groups of DFOB, quantified by stability constants β1, β2, and β3. Values of β1 are reported for the first time, however no evidence was found for binding with the terminal amine of DFOB and the corresponding stability constant β4 was thus omitted from the regression model constructed to fit the titration curves. We also examined Mg and Ca binding to methanesulfonate (MSA), a common DFOB counter-ion, by measuring the stability of their complexes with acetohydroxamate in the presence and absence of MSA. Whereas stabilities of metal-MSA complexes have not been published, their similarity to sulfate complexes suggests that MSA may compete with DFOB for Mg and Ca in the titrations. Our calculated side-reaction coefficient is consistent with a previous estimate, but should properly be expressed in terms of protonated forms of DFOB, resulting in a much lower value.

  17. The Bilirubin Binding Panel: A Henderson-Hasselbalch Approach to Neonatal Hyperbilirubinemia.

    PubMed

    Ahlfors, Charles E

    2016-10-01

    Poor plasma bilirubin binding increases the risk of bilirubin neurotoxicity in newborns with hyperbilirubinemia. New laboratory tests may soon make it possible to obtain a complete bilirubin binding panel when evaluating these babies. The 3 measured components of the panel are the plasma total bilirubin concentration (B Total ), which is currently used to guide clinical care; the bilirubin binding capacity (BBC); and the concentration of non-albumin bound or free bilirubin (B Free ). The fourth component is the bilirubin-albumin equilibrium dissociation constant, K D , which is calculated from B Total , BBC, and B Free The bilirubin binding panel is comparable to the panel of components used in the Henderson-Hasselbalch approach to acid-base assessment. Bilirubin binding population parameters (not prospective studies to determine whether the new bilirubin binding panel components are better predictors of bilirubin neurotoxicity than B Total ) are needed to expedite the clinical use of bilirubin binding. At any B Total , the B Free and the relative risk of bilirubin neurotoxicity increase as the K D /BBC ratio increases (ie, bilirubin binding worsens). Comparing the K D /BBC ratio of newborns with B Total of concern with that typical for the population helps determine whether the risk of bilirubin neurotoxicity varies significantly from the inherent risk at that B Total Furthermore, the bilirubin binding panel individualizes care because it helps to determine how aggressive intervention should be at any B Total , irrespective of whether it is above or below established B Total guidelines. The bilirubin binding panel may reduce anxiety, costs, unnecessary treatment, and the likelihood of undetected bilirubin neurotoxicity. Copyright © 2016 by the American Academy of Pediatrics.

  18. Interaction of the recently approved anticancer drug nintedanib with human acute phase reactant α 1-acid glycoprotein

    NASA Astrophysics Data System (ADS)

    Abdelhameed, Ali Saber; Ajmal, Mohammad Rehan; Ponnusamy, Kalaiarasan; Subbarao, Naidu; Khan, Rizwan Hasan

    2016-07-01

    A comprehensive study of the interaction of the newly approved tyrosine kinase inhibitor, Nintedanib (NTB) and Alpha-1 Acid Glycoprotein (AAG) has been carried out by utilizing UV-Vis spectroscopy, fluorescence spectroscopy, circular dichroism, dynamic light scattering and molecular docking techniques. The obtained results showed enhancement of the UV-Vis peak of the protein upon binding to NTB with the fluorescence intensity of AAG is being quenched by NTB via the formation of ground state complex (i.e. Static quenching). Forster distance (Ro) obtained from fluorescence resonance energy transfer (FRET) is found to be 2.3 nm. The calculated binding parameters from the modified Stern-Volmer equation showed that NTB binds to AAG with a binding constant in the order of 103. Conformational alteration of the protein upon its binding to NTB was confirmed by the circular dichroism. Dynamic light scattering results showed that the binding interaction of NTB leads to the reduction in hydrodynamic radii of AAG. Dynamic molecular docking results showed that the NTB fits into the central binding cavity in AAG and hydrophobic interaction played the key role in the binding process also the docking studies were performed with methotrexate and clofarabine drugs to look into the common binding regions of these drugs on AAG molecule, it was found that five amino acid residues namely Phe 113, Arg 89, Tyr 126, Phe 48 and Glu 63 were common among the binding regions of three studied drugs this phenomenon of overlapping binding regions may influence the drug transport by the carrier molecule in turn affecting the metabolism of the drug and treatment outcome.

  19. Investigation on the protein-binding properties of icotinib by spectroscopic and molecular modeling method.

    PubMed

    Zhang, Hua-xin; Xiong, Hang-xing; Li, Li-wei

    2016-05-15

    Icotinib is a highly-selective epidermal growth factor receptor tyrosine kinase inhibitor with preclinical and clinical activity in non-small cell lung cancer, which has been developed as a new targeted anti-tumor drug in China. In this work, the interaction of icotinib and human serum albumin (HSA) were studied by three-dimensional fluorescence spectra, ultraviolet spectra, circular dichroism (CD) spectra, molecular probe and molecular modeling methods. The results showed that icotinib binds to Sudlow's site I in subdomain IIA of HSA molecule, resulting in icotinib-HSA complexes formed at ground state. The number of binding sites, equilibrium constants, and thermodynamic parameters of the reaction were calculated at different temperatures. The negative enthalpy change (ΔH(θ)) and entropy change (ΔS(θ)) indicated that the structure of new complexes was stabilized by hydrogen bonds and van der Waals power. The distance between donor and acceptor was calculated according to Förster's non-radiation resonance energy transfer theory. The structural changes of HSA caused by icotinib binding were detected by synchronous spectra and circular dichroism (CD) spectra. Molecular modeling method was employed to unfold full details of the interaction at molecular level, most of which could be supported by experimental results. The study analyzed the probability that serum albumins act as carriers for this new anticarcinogen and provided fundamental information on the process of delivering icotinib to its target tissues, which might be helpful in understanding the mechanism of icotinib in cancer therapy. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Enantioselective complexation of chiral propylene oxide by an enantiopure water-soluble cryptophane.

    PubMed

    Bouchet, Aude; Brotin, Thierry; Linares, Mathieu; Ågren, Hans; Cavagnat, Dominique; Buffeteau, Thierry

    2011-05-20

    ECD and NMR experiments show that the complexation of propylene oxide (PrO) within the cavity of an enantiopure water-soluble cryptophane 1 in NaOH solution is enantioselective and that the (R)-PrO@PP-1 diastereomer is more stable than the (S)-PrO@PP-1 diastereomer with a free energy difference of 1.7 kJ/mol. This result has been confirmed by molecular dynamics (MD) and ab initio calculations. The enantioselectivity is preserved in LiOH and KOH solutions even though the binding constants decrease, whereas PrO is not complexed in CsOH solution.

  1. Modeling direct interband tunneling. II. Lower-dimensional structures

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pan, Andrew, E-mail: pandrew@ucla.edu; Chui, Chi On; California NanoSystems Institute, University of California, Los Angeles, Los Angeles, California 90095

    We investigate the applicability of the two-band Hamiltonian and the widely used Kane analytical formula to interband tunneling along unconfined directions in nanostructures. Through comparisons with k·p and tight-binding calculations and quantum transport simulations, we find that the primary correction is the change in effective band gap. For both constant fields and realistic tunnel field-effect transistors, dimensionally consistent band gap scaling of the Kane formula allows analytical and numerical device simulations to approximate non-equilibrium Green's function current characteristics without arbitrary fitting. This allows efficient first-order calibration of semiclassical models for interband tunneling in nanodevices.

  2. A possible molecular mechanism of the action of digitalis: ouabain action on calcium binding to sites associated with a purified sodium-potassium-activated adenosine triphosphatase from kidney.

    PubMed

    Gervais, A; Lane, L K; Anner, B M; Lindenmayer, G E; Schwartz, A

    1977-01-01

    Calcium binding at 0 degrees C to a purified sheep kidney Na+,K+-ATPase was described by linear Scatchard plots. Binding at saturating free calcium was 65-80 nmol/mg of protein, or 30-40 mol of calcium/mol of enzyme. Aqueous emulsions of lipids extracted from Na+,K+-ATPase yielded dissociation constants and maximum calcium-binding values that were similar to those for native Na+,K+-ATPase. Phospholipase A treatment markedly reduced calcium binding. Pretreatment of native Na+,K+-ATPase with ouabain increased the dissociation constant for calcium binding from 131 +/- 7 to 192 +/- 7 muM without altering maximum calcium binding. Ouabain pretreatment did not affect calcium binding to extracted phospholipids, ouabain-insensitive ATPases, or heat denatured Na+,K+-ATPase, Na+ and K+ (5-20 mM) increased the dissociation constants for calcium, which suggests competition between the monovalent cations and calcium for the binding sites. At higher concentrations of monovalent cations, ouabain increased the apparent affinity of binding sites for calcium. Extrapolation to physiological cation concentrations revealed that the ouabain-induced increase in apparent affinity for calcium may be as much as 2- to 3-fold. These results suggest: (1) calcium binds to phospholipids associated with Na+,K+-ATPase; (2) ouabain interaction with Na+,K+-ATPase induces a perturbation that is transmitted to adjacent phospholipids, altering their affinity for calcium; and (3) at physiological concentrations of Na+ or K+, or both, ouabain interaction with Na+,K+-ATPase may lead to an increased pool of membrane-bound calcium.

  3. Binding of volatile anesthetics to serum albumin: measurements of enthalpy and solvent contributions.

    PubMed

    Sawas, Abdul H; Pentyala, Srinivas N; Rebecchi, Mario J

    2004-10-05

    This study directly examines the enthalpic contributions to binding in aqueous solution of closely related anesthetic haloethers (desflurane, isoflurane, enflurane, and sevoflurane), a haloalkane (halothane), and an intravenous anesthetic (propofol) to bovine and human serum albumin (BSA and HSA) using isothermal titration calorimetry. Binding to serum albumin is exothermic, yielding enthalpies (DeltaH(obs)) of -3 to -6 kcal/mol for BSA with a rank order of apparent equilibrium association constants (K(a) values): desflurane > isoflurane approximately enflurane > halothane >or= sevoflurane, with the differences being largely ascribed to entropic contributions. Competition experiments indicate that volatile anesthetics, at low concentrations, share the same sites in albumin previously identified in crystallographic and photo-cross-linking studies. The magnitude of the observed DeltaH increased linearly with increased reaction temperature, reflecting negative changes in heat capacities (DeltaC(p)). These -DeltaC(p) values significantly exceed those calculated for burial of each anesthetic in a hydrophobic pocket. The enhanced stabilities of the albumin/anesthetic complexes and -DeltaC(p) are consistent with favorable solvent rearrangements that promote binding. This idea is supported by substitution of D(2)O for H(2)O that significantly reduces the favorable binding enthalpy observed for desflurane and isoflurane, with an opposing increase of DeltaS(obs). From these results, we infer that solvent restructuring, resulting from release of water weakly bound to anesthetic and anesthetic-binding sites, is a dominant and favorable contributor to the enthalpy and entropy of binding to proteins.

  4. Spectroscopic study of binding of chlorogenic acid with the surface of ZnO nanoparticles

    NASA Astrophysics Data System (ADS)

    Belay, Abebe; Kim, Hyung Kook; Hwang, Yoon-Hwae

    2017-09-01

    Understanding the interaction properties of biological materials with ZnO NPs is fundamental interest in the field of biotechnological applications as well as in the formation of optoelectronic devices. In this research, the binding of ZnO NPs and chlorogenic acid (CGA) were investigated using fluorescence quenching, UV-Vis absorption spectroscopy, Fourier transform infrared (FTIR), Raman spectroscopy, scanning electron microscopy (TEM), and dynamic light scattering (DLS) techniques. The study results indicated the fluorescence quenching between ZnO NPs and CGA rationalized in terms of static quenching mechanism or the formation of nonfluorescent CGA-ZnO. From fluorescence quenching spectral analysis the binding constant ( K a ), number of binding sites ( n), and thermodynamic properties, were determined. The quenching constants ( K sv) and binding constant ( K a ), decrease with increasing the temperature and their binding sites n are 2. The thermodynamic parameters determined using Van't Hoff equation indicated binding occurs spontaneously involving the hydrogen bond and van der Walls forces played the major role in the reaction of ZnO NPs with CGA. The Raman, SEM, DLS, and Zeta potential measurements were also indicated the differences in the structure, morphology and sizes of CGA, ZnO NPs, and their corresponding CGA-ZnO due to adsorption of CGA on the surface of ZnO NPs

  5. Locating the Binding Sites of Pb(II) Ion with Human and Bovine Serum Albumins

    PubMed Central

    Belatik, Ahmed; Hotchandani, Surat; Carpentier, Robert; Tajmir-Riahi, Heidar-Ali

    2012-01-01

    Lead is a potent environmental toxin that has accumulated above its natural level as a result of human activity. Pb cation shows major affinity towards protein complexation and it has been used as modulator of protein-membrane interactions. We located the binding sites of Pb(II) with human serum (HSA) and bovine serum albumins (BSA) at physiological conditions, using constant protein concentration and various Pb contents. FTIR, UV-visible, CD, fluorescence and X-ray photoelectron spectroscopic (XPS) methods were used to analyse Pb binding sites, the binding constant and the effect of metal ion complexation on HSA and BSA stability and conformations. Structural analysis showed that Pb binds strongly to HSA and BSA via hydrophilic contacts with overall binding constants of KPb-HSA = 8.2 (±0.8)×104 M−1 and KPb-BSA = 7.5 (±0.7)×104 M−1. The number of bound Pb cation per protein is 0.7 per HSA and BSA complexes. XPS located the binding sites of Pb cation with protein N and O atoms. Pb complexation alters protein conformation by a major reduction of α-helix from 57% (free HSA) to 48% (metal-complex) and 63% (free BSA) to 52% (metal-complex) inducing a partial protein destabilization. PMID:22574219

  6. Influences of urea, pH and metal ions on the interaction between cepharanthine and lysozyme by steady state fluorescence spectroscopy

    NASA Astrophysics Data System (ADS)

    Yang, Yumin; Li, Daojin; Xu, Chen

    2015-03-01

    The study on the binding mode of drug with protein is important to understand the pharmacokinetics and toxicity of the drug as well as the relationship of structure and function of the protein. In the study, the interaction between cepharanthine and lysozyme (Lys) in aqueous solution was first investigated by fluorescence spectroscopic techniques at pH 7.4. The obtained quenching rate constant and binding constant indicated the static quenching mechanism and medium binding force. The effect of cepharanthine on the conformation of Lys was analyzed using synchronous fluorescence and three-dimensional (3D) fluorescence. In addition, the effect of urea on the interaction of cepharanthine with Lys was studied and the binding capacity of cepharanthine to the denatured Lys deceases dramatically, as compared with that of cepharanthine to native Lys. Moreover, influence of pH on the interaction of cepharanthine with Lys was investigated. As compared with that at pH 7.4, the binding abilities of the drug to Lys under other pH conditions (pH 9.0, 5.5, 3.5, and 1.9) deceased. Furthermore, the effect of metal ions on the binding constant of cepharanthine with Lys was investigated.

  7. The identification of hydrophobic sites on the surface of proteins using absorption difference spectroscopy of bromophenol blue.

    PubMed

    Bertsch, M; Mayburd, A L; Kassner, R J

    2003-02-15

    Hydrophobic sites on the surface of protein molecules are thought to have important functional roles. The identification of such sites can provide information about the function and mode of interaction with other cellular components. While the fluorescence enhancement of polarity-sensitive dyes has been useful in identifying hydrophobic sites on a number of targets, strong intrinsic quenching of Nile red and ANSA dye fluorescence is observed on binding to a cytochrome c('). Fluorescence quenching is also observed to take place in the presence of a variety of other biologically important molecules which can compromise the quantitative determination of binding constants. Absorption difference spectroscopy is shown not to be sensitive to the presence of fluorescence quenchers but sensitive enough to measure binding constants. The dye BPB is shown to bind to the same hydrophobic sites on proteins as polarity-sensitive fluorescence probes. The absorption spectrum of BPB is also observed to be polarity sensitive. A binding constant of 3x10(6)M(-1) for BPB to BSA has been measured by absorption difference spectroscopy. An empirical correlation is observed between the shape of the absorption difference spectrum of BPB and the polarity of the environment. The results indicate that absorption difference spectroscopy of BPB provides a valuable supplement to fluorescence for determining the presence of hydrophobic sites on the surface of proteins as well as a method for measuring binding constants.

  8. Millimeter Wave Spectrum of the Weakly Bound Complex CH2═CHCN·H2O: Structure, Dynamics, and Implications for Astronomical Search.

    PubMed

    Calabrese, Camilla; Vigorito, Annalisa; Maris, Assimo; Mariotti, Sergio; Fathi, Pantea; Geppert, Wolf D; Melandri, Sonia

    2015-12-03

    The weakly bound 1:1 complex between acrylonitrile (CH2═CHCN) and water has been characterized spectroscopically in the millimeter wave range (59.6-74.4 GHz) using a Free Jet Absorption Millimeter Wave spectrometer. Precise values of the rotational and quartic centrifugal distortion constants have been obtained from the measured frequencies of the normal and isotopically substituted water moiety (DOH, DOD, H(18)OH). Structural parameters have been estimated from the rotational constants and their differences among isotopologues: the complex has a planar structure with the two subunits held together by a O-H···N (2.331(3) Å) and a C-H···O (2.508(4) Å) interaction. The ab initio intermolecular binding energy, obtained at the counterpoise corrected MP2/aug-cc-pVTZ level of calculation, is De = 24.4 kJ mol(-1).

  9. Motion of kinesin in a viscoelastic medium

    NASA Astrophysics Data System (ADS)

    Knoops, Gert; Vanderzande, Carlo

    2018-05-01

    Kinesin is a molecular motor that transports cargo along microtubules. The results of many in vitro experiments on kinesin-1 are described by kinetic models in which one transition corresponds to the forward motion and subsequent binding of the tethered motor head. We argue that in a viscoelastic medium like the cytosol of a cell this step is not Markov and has to be described by a nonexponential waiting time distribution. We introduce a semi-Markov kinetic model for kinesin that takes this effect into account. We calculate, for arbitrary waiting time distributions, the moment generating function of the number of steps made, and determine from this the average velocity and the diffusion constant of the motor. We illustrate our results for the case of a waiting time distribution that is Weibull. We find that for realistic parameter values, viscoelasticity decreases the velocity and the diffusion constant, but increases the randomness (or Fano factor).

  10. Hydrogen molecules and chains in a superstrong magnetic field

    NASA Technical Reports Server (NTRS)

    Lai, Dong; Salpeter, Edwin E.; Shapiro, Stuart L.

    1992-01-01

    The electronic structures of hydrogen polymolecules H(n) (n = 2,3,4,...) is studied in a superstrong magnetic field (B greater than about 10 exp 12 G) typically found on the surface of a neutron star. Simple analytical scaling relations for several limiting cases (e.g., large n, high B field) are derived. The binding energies of H(n) molecules are numerically calculated for various magnetic-field strengths. For a given magnetic-field strength, the binding energy per atom in the H(n) molecules is found to approach a constant value as n increases. For typical field strengths of interest, energy saturation is essentially achieved once n exceeds 3 to 4. Also considered is the structure of negative H ions in a high magnetic field. For B about 10 exp 12 G, the dissociation energy of an atom in a hydrogen chain and the ionization potential of H(-) are smaller than the ionization potential of neutral atomic hydrogen.

  11. Subsite mapping of enzymes. Depolymerase computer modelling.

    PubMed Central

    Allen, J D; Thoma, J A

    1976-01-01

    We have developed a depolymerase computer model that uses a minimization routine. The model is designed so that, given experimental bond-cleavage frequencies for oligomeric substrates and experimental Michaelis parameters as a function of substrate chain length, the optimum subsite map is generated. The minimized sum of the weighted-squared residuals of the experimental and calculated data is used as a criterion of the goodness-of-fit for the optimized subsite map. The application of the minimization procedure to subsite mapping is explored through the use of simulated data. A procedure is developed whereby the minimization model can be used to determine the number of subsites in the enzymic binding region and to locate the position of the catalytic amino acids among these subsites. The degree of propagation of experimental variance into the subsite-binding energies is estimated. The question of whether hydrolytic rate coefficients are constant or a function of the number of filled subsites is examined. PMID:999629

  12. Cooperativity and tunable excited state deactivation: modular self-assembly of depsipeptide dendrons on a Hamilton receptor modified porphyrin platform.

    PubMed

    Gnichwitz, Jan-Frederik; Wielopolski, Mateusz; Hartnagel, Kristine; Hartnagel, Uwe; Guldi, Dirk M; Hirsch, Andreas

    2008-07-02

    A series of novel supramolecular architectures were built around a tin tetraphenyl porphyrin platform 6--functionalized by a 2-fold 1-ethyl-3-3-(3-dimethylaminopropyl)carbodiimide (EDC) promoted condensation reaction--and chiral depsipeptide dendrons of different generations 1-4. Here, implementation of a Hamilton receptor provided the necessary means to keep the constituents together via strong hydrogen bonding. Characterization of all architectures has been performed, including 4 which is the fourth generation, on the basis of NMR and photophysical methods. In particular, several titration experiments were conducted suggesting positive cooperativity, an assessment that is based on association constants that tend to be higher for the second binding step than for the first step. Importantly, molecular modeling calculations reveal a significant deaggregation of the intermolecular network of 6 during the course of the first binding step. As a consequence, an improved accessibility of the second Hamilton receptor unit in 6 emerges and, in turn, facilitates the higher association constants. The features of the equilibrium, that is, the dynamic exchange of depsipeptide dendrons 1-4 with fullerene 5, was tested in photophysical reference experiments. These steady-state and time-resolved measurements showed the tunable excited-state deactivations of these complexes upon photoexcitation.

  13. Saturation behavior: a general relationship described by a simple second-order differential equation.

    PubMed

    Kepner, Gordon R

    2010-04-13

    The numerous natural phenomena that exhibit saturation behavior, e.g., ligand binding and enzyme kinetics, have been approached, to date, via empirical and particular analyses. This paper presents a mechanism-free, and assumption-free, second-order differential equation, designed only to describe a typical relationship between the variables governing these phenomena. It develops a mathematical model for this relation, based solely on the analysis of the typical experimental data plot and its saturation characteristics. Its utility complements the traditional empirical approaches. For the general saturation curve, described in terms of its independent (x) and dependent (y) variables, a second-order differential equation is obtained that applies to any saturation phenomena. It shows that the driving factor for the basic saturation behavior is the probability of the interactive site being free, which is described quantitatively. Solving the equation relates the variables in terms of the two empirical constants common to all these phenomena, the initial slope of the data plot and the limiting value at saturation. A first-order differential equation for the slope emerged that led to the concept of the effective binding rate at the active site and its dependence on the calculable probability the interactive site is free. These results are illustrated using specific cases, including ligand binding and enzyme kinetics. This leads to a revised understanding of how to interpret the empirical constants, in terms of the variables pertinent to the phenomenon under study. The second-order differential equation revealed the basic underlying relations that describe these saturation phenomena, and the basic mathematical properties of the standard experimental data plot. It was shown how to integrate this differential equation, and define the common basic properties of these phenomena. The results regarding the importance of the slope and the new perspectives on the empirical constants governing the behavior of these phenomena led to an alternative perspective on saturation behavior kinetics. Their essential commonality was revealed by this analysis, based on the second-order differential equation.

  14. Probing the electrostatics and pharmacologic modulation of sequence-specific binding by the DNA-binding domain of the ETS-family transcription factor PU.1: a binding affinity and kinetics investigation

    PubMed Central

    Munde, Manoj; Poon, Gregory M. K.; Wilson, W. David

    2013-01-01

    Members of the ETS family of transcription factors regulate a functionally diverse array of genes. All ETS proteins share a structurally-conserved but sequence-divergent DNA-binding domain, known as the ETS domain. Although the structure and thermodynamics of the ETS-DNA complexes are well known, little is known about the kinetics of sequence recognition, a facet that offers potential insight into its molecular mechanism. We have characterized DNA binding by the ETS domain of PU.1 by biosensor-surface plasmon resonance (SPR). SPR analysis revealed a striking kinetic profile for DNA binding by the PU.1 ETS domain. At low salt concentrations, it binds high-affinity cognate DNA with a very slow association rate constant (≤105 M−1 s−1), compensated by a correspondingly small dissociation rate constant. The kinetics are strongly salt-dependent but mutually balance to produce a relatively weak dependence in the equilibrium constant. This profile contrasts sharply with reported data for other ETS domains (e.g., Ets-1, TEL) for which high-affinity binding is driven by rapid association (>107 M−1 s−1). We interpret this difference in terms of the hydration properties of ETS-DNA binding and propose that at least two mechanisms of sequence recognition are employed by this family of DNA-binding domain. Additionally, we use SPR to demonstrate the potential for pharmacological inhibition of sequence-specific ETS-DNA binding, using the minor groove-binding distamycin as a model compound. Our work establishes SPR as a valuable technique for extending our understanding of the molecular mechanisms of ETS-DNA interactions as well as developing potential small-molecule agents for biotechnological and therapeutic purposes. PMID:23416556

  15. Determination of the affinity of drugs toward serum albumin by measurement of the quenching of the intrinsic tryptophan fluorescence of the protein.

    PubMed

    Epps, D E; Raub, T J; Caiolfa, V; Chiari, A; Zamai, M

    1999-01-01

    Binding of new chemical entities to serum proteins is an issue confronting pharmaceutical companies during development of potential therapeutic agents. Most drugs bind to the most abundant plasma protein, human serum albumin (HSA), at two major binding sites. Excepting fluorescence spectroscopy, existing methods for assaying drug binding to serum albumin are insensitive to higher-affinity compounds and can be labour-intensive, time-consuming, and usually require compound-specific assays. This led us to examine alternative ways to measure drug-albumin interaction. One method described here uses fluorescence quenching of the single tryptophan (Trp) residue in HSA excited at 295 nm to measure drug-binding affinity. Unfortunately, many compounds absorb, fluoresce, or both, in this UV wavelength region of the spectrum. Several types of binding phenomenon and spectral interference were identified by use of six structurally unrelated compounds and the equations necessary to make corrections mathematically were derived and applied to calculate binding constants accurately. The general cases were: direct quenching of Trp fluorescence by optically transparent ligands with low or high affinities; binding of optically transparent, non-fluorescent ligands to two specific sites where both sites or only one site result in Trp fluorescence quenching; and chromophores whose absorption either overlaps the Trp emission and quenches by energy transfer or absorbs light at the Trp fluorescence excitation wavelength producing absorptive screening as well as fluorescence quenching. Unless identification of the site specificity of drug binding to serum albumin is desired, quenching of the Trp fluorescence of albumin by titration with ligand is a rapid and facile method for determining the binding affinities of drugs for serum albumin.

  16. Measurement of free glucocorticoids: quantifying corticosteroid-binding globulin binding affinity and its variation within and among mammalian species.

    PubMed

    Delehanty, Brendan; Hossain, Sabrina; Jen, Chao Ching; Crawshaw, Graham J; Boonstra, Rudy

    2015-01-01

    Plasma glucocorticoids (GCs) are commonly used as measures of stress in wildlife. A great deal of evidence indicates that only free GC (GC not bound by the specific binding protein, corticosteroid-binding globulin, CBG) leaves the circulation and exerts biological effects on GC-sensitive tissues. Free hormone concentrations are difficult to measure directly, so researchers estimate free GC using two measures: the binding affinity and the binding capacity in plasma. We provide an inexpensive saturation binding method for calculating the binding affinity (equilibrium dissociation constant, K d) of CBG that can be run without specialized laboratory equipment. Given that other plasma proteins, such as albumin, also bind GCs, the method compensates for this non-specific binding. Separation of bound GC from free GC was achieved with dextran-coated charcoal. The method provides repeatable estimates (12% coefficient of variation in the red squirrel, Tamiasciurus hudsonicus), and there is little evidence of inter-individual variation in K d (range 2.0-7.3 nM for 16 Richardson's ground squirrels, Urocitellus richardsonii). The K d values of 28 mammalian species we assessed were mostly clustered around a median of 4 nM, but five species had values between 13 and 61 nM. This pattern may be distinct from birds, for which published values are more tightly distributed (1.5-5.1 nM). The charcoal separation method provides a reliable and robust method for measuring the K d in a wide range of species. It uses basic laboratory equipment to provide rapid results at very low cost. Given the importance of CBG in regulating the biological activity of GCs, this method is a useful tool for physiological ecologists.

  17. Fluorescent bovine serum albumin interacting with the antitussive quencher dextromethorphan: a spectroscopic insight.

    PubMed

    Durgannavar, Amar K; Patgar, Manjanath B; Nandibewoor, Sharanappa T; Chimatadar, Shivamurti A

    2016-05-01

    The interaction of dextromethorphan hydrobromide (DXM) with bovine serum albumin (BSA) is studied by using fluorescence spectra, UV-vis absorption, synchronous fluorescence spectra (SFS), 3D fluorescence spectra, Fourier transform infrared (FTIR) spectroscopy and circular dichroism under simulated physiological conditions. DXM effectively quenched the intrinsic fluorescence of BSA. Values of the binding constant, K(A), are 7.159 × 10(3), 9.398 × 10(3) and 16.101 × 10(3)  L/mol; the number of binding sites, n, and the corresponding thermodynamic parameters ΔG°, ΔH° and ΔS° between DXM and BSA were calculated at different temperatures. The interaction between DXM and BSA occurs through dynamic quenching and the effect of DXM on the conformation of BSA was analyzed using SFS. The average binding distance, r, between the donor (BSA) and acceptor (DXM) was determined based on Förster's theory. The results of fluorescence spectra, UV-vis absorption spectra and SFS show that the secondary structure of the protein has been changed in the presence of DXM. Copyright © 2015 John Wiley & Sons, Ltd.

  18. Study on the interaction of triadimenol with calf thymus DNA by multispectroscopic methods and molecular modeling

    NASA Astrophysics Data System (ADS)

    Zhang, Yepeng; Zhang, Guowen; Fu, Peng; Ma, Yadi; Zhou, Jia

    2012-10-01

    The binding mechanism of triadimenol (NOL) to calf thymus DNA (ctDNA) in physiological buffer (pH 7.4) was investigated by multispectroscopic methods including UV-vis absorption, fluorescence, circular dichroism (CD), Fourier transform infrared (FT-IR), and nuclear magnetic resonance (1H NMR) spectroscopy, coupled with viscosity measurements and atomic force microscopy (AFM) technique. The results suggested that NOL interacted with ctDNA by intercalation mode. CD and AFM assays showed that NOL can damage the base stacking of ctDNA and result in regional cleavage of the two DNA strands. FT-IR and 1H NMR spectra coupled with molecular docking revealed that a specific binding mainly exists between NOL and G-C base pairs of the ctDNA where two hydrogen bonds form. Moreover, the association constants of NOL with DNA at three different temperatures were determined to be in the 103 L mol-1 range. The calculated thermodynamic parameters suggested that the binding of NOL to ctDNA was driven mainly by hydrogen bond and van der Waals.

  19. Sorption of lead onto two gram-negative marine bacteria in seawater

    USGS Publications Warehouse

    Harvey, Ronald W.; Leckie, James O.

    1985-01-01

    Laboratory adsorption experiments performed at environmentally significant lead (Pb) and cell concentrations indicate that the marine bacteria examined have significant binding capacities for Pb. However, the behavior governing Pb sorption onto gram-negative bacteria in seawater may be quite complex. The sorption kinetics appear to involve two distinct phases, i.e., a rapid removal of Pb from solution within the first few minutes, followed by a slow but nearly constant removal over many hours. Also, the average binding coefficient, calculated for Pb sorption onto bacteria and a measure of binding intensity, increases with decreasing sorption density (amounts of bacteria-associated Pb per unit bacterial surface) at low cell concentrations (105 cells ml−1), but decreases with decreasing sorption density at higher cell concentrations (107 cells ml−1). The latter effect is apparently due to the production of significant amounts of extra-cellular organics at high cell concentrations that compete directly with bacterial surfaces for available lead. Lead toxicity and active uptake by marine bacteria did not appear significant at the Pb concentrations used.

  20. Energetics of codon-anticodon recognition on the small ribosomal subunit.

    PubMed

    Almlöf, Martin; Andér, Martin; Aqvist, Johan

    2007-01-09

    Recent crystal structures of the small ribosomal subunit have made it possible to examine the detailed energetics of codon recognition on the ribosome by computational methods. The binding of cognate and near-cognate anticodon stem loops to the ribosome decoding center, with mRNA containing the Phe UUU and UUC codons, are analyzed here using explicit solvent molecular dynamics simulations together with the linear interaction energy (LIE) method. The calculated binding free energies are in excellent agreement with experimental binding constants and reproduce the relative effects of mismatches in the first and second codon position versus a mismatch at the wobble position. The simulations further predict that the Leu2 anticodon stem loop is about 10 times more stable than the Ser stem loop in complex with the Phe UUU codon. It is also found that the ribosome significantly enhances the intrinsic stability differences of codon-anticodon complexes in aqueous solution. Structural analysis of the simulations confirms the previously suggested importance of the universally conserved nucleotides A1492, A1493, and G530 in the decoding process.

  1. In silico strategies for the selection of chelating compounds with potential application in metal-promoted neurodegenerative diseases

    NASA Astrophysics Data System (ADS)

    Rodríguez-Rodríguez, Cristina; Rimola, Albert; Alí-Torres, Jorge; Sodupe, Mariona; González-Duarte, Pilar

    2011-01-01

    The development of new strategies to find commercial molecules with promising biochemical features is a main target in the field of biomedicine chemistry. In this work we present an in silico-based protocol that allows identifying commercial compounds with suitable metal coordinating and pharmacokinetic properties to act as metal-ion chelators in metal-promoted neurodegenerative diseases (MpND). Selection of the chelating ligands is done by combining quantum chemical calculations with the search of commercial compounds on different databases via virtual screening. Starting from different designed molecular frameworks, which mainly constitute the binding site, the virtual screening on databases facilitates the identification of different commercial molecules that enclose such scaffolds and, by imposing a set of chemical and pharmacokinetic filters, obey some drug-like requirements mandatory to deal with MpND. The quantum mechanical calculations are useful to gauge the chelating properties of the selected candidate molecules by determining the structure of metal complexes and evaluating their stability constants. With the proposed strategy, commercial compounds containing N and S donor atoms in the binding sites and capable to cross the BBB have been identified and their chelating properties analyzed.

  2. Modeling of the solution interaction properties of plastic materials used in pharmaceutical product container systems.

    PubMed

    Jenke, Dennis; Couch, Tom; Gillum, Amy; Sadain, Salma

    2009-01-01

    Material/water equilibrium binding constants (Eb) were determined for 14 organic solutes and 17 plastic raw materials that could be used in pharmaceutical product container systems. Correlations between the measured binding constants and the organic solute's octanol/water and hexane/water partition coefficients were obtained. In general, while the materials examined exhibited a wide range of binding characteristics, the tested materials by and large fell within two broad classes: (1) those that were octanol-like in their binding characteristics, and (2) those that were hexane-like. Materials of the same class (e.g., polypropylenes) generally had binding models that were very similar. Rank ordering of the materials in terms of their magnitude of drug binding (least binding to most binding) was as follows: polypropylene < polyethylene < polyamide < styrene-ethylene-butylene-styrene < copolyester ether elastomer approximately equal to amine-terminated poly fatty acid amide polymer. The utilization of the developed models to estimate drug loss via sorption by the container is discussed.

  3. The 5-HT1A Receptor PET Radioligand 11C-CUMI-101 Has Significant Binding to α1-Adrenoceptors in Human Cerebellum, Limiting Its Use as a Reference Region.

    PubMed

    Shrestha, Stal S; Liow, Jeih-San; Jenko, Kimberly; Ikawa, Masamichi; Zoghbi, Sami S; Innis, Robert B

    2016-12-01

    Prazosin, a potent and selective α 1 -adrenoceptor antagonist, displaces 25% of 11 C-CUMI-101 ([O-methyl- 11 C]2-(4-(4-(2-methoxyphenyl)piperazin-1-yl)butyl)-4-methyl-1,2,4-triazine-3,5(2H,4H)dione) binding in monkey cerebellum. We sought to estimate the percentage contamination of 11 C-CUMI-101 binding to α 1 -adrenoceptors in human cerebellum under in vivo conditions. In vitro receptor-binding techniques were used to measure α 1 -adrenoceptor density and the affinity of CUMI-101 for these receptors in human, monkey, and rat cerebellum. Binding potential (maximum number of binding sites × affinity [(1/dissociation constant]) was determined using in vitro homogenate binding assays in human, monkey, and rat cerebellum. 3 H-prazosin was used to determine the maximum number of binding sites, as well as the dissociation constant of 3 H-prazosin and the inhibition constant of CUMI-101. α 1 -adrenoceptor density and the affinity of CUMI-101 for these receptors were similar across species. Cerebellar binding potentials were 3.7 for humans, 2.3 for monkeys, and 3.4 for rats. Reasoning by analogy, 25% of 11 C-CUMI-101 uptake in human cerebellum reflects binding to α 1 -adrenoceptors, suggesting that the cerebellum is of limited usefulness as a reference tissue for quantification in human studies. © 2016 by the Society of Nuclear Medicine and Molecular Imaging, Inc.

  4. The Universal Statistical Distributions of the Affinity, Equilibrium Constants, Kinetics and Specificity in Biomolecular Recognition

    PubMed Central

    Zheng, Xiliang; Wang, Jin

    2015-01-01

    We uncovered the universal statistical laws for the biomolecular recognition/binding process. We quantified the statistical energy landscapes for binding, from which we can characterize the distributions of the binding free energy (affinity), the equilibrium constants, the kinetics and the specificity by exploring the different ligands binding with a particular receptor. The results of the analytical studies are confirmed by the microscopic flexible docking simulations. The distribution of binding affinity is Gaussian around the mean and becomes exponential near the tail. The equilibrium constants of the binding follow a log-normal distribution around the mean and a power law distribution in the tail. The intrinsic specificity for biomolecular recognition measures the degree of discrimination of native versus non-native binding and the optimization of which becomes the maximization of the ratio of the free energy gap between the native state and the average of non-native states versus the roughness measured by the variance of the free energy landscape around its mean. The intrinsic specificity obeys a Gaussian distribution near the mean and an exponential distribution near the tail. Furthermore, the kinetics of binding follows a log-normal distribution near the mean and a power law distribution at the tail. Our study provides new insights into the statistical nature of thermodynamics, kinetics and function from different ligands binding with a specific receptor or equivalently specific ligand binding with different receptors. The elucidation of distributions of the kinetics and free energy has guiding roles in studying biomolecular recognition and function through small-molecule evolution and chemical genetics. PMID:25885453

  5. Rational design of biaryl pharmacophore inserted noscapine derivatives as potent tubulin binding anticancer agents

    NASA Astrophysics Data System (ADS)

    Santoshi, Seneha; Manchukonda, Naresh Kumar; Suri, Charu; Sharma, Manya; Sridhar, Balasubramanian; Joseph, Silja; Lopus, Manu; Kantevari, Srinivas; Baitharu, Iswar; Naik, Pradeep Kumar

    2015-03-01

    We have strategically designed a series of noscapine derivatives by inserting biaryl pharmacophore (a major structural constituent of many of the microtubule-targeting natural anticancer compounds) onto the scaffold structure of noscapine. Molecular interaction of these derivatives with α,β-tubulin heterodimer was investigated by molecular docking, molecular dynamics simulation, and binding free energy calculation. The predictive binding affinity indicates that the newly designed noscapinoids bind to tubulin with a greater affinity. The predictive binding free energy (ΔGbind, pred) of these derivatives (ranging from -5.568 to -5.970 kcal/mol) based on linear interaction energy (LIE) method with a surface generalized Born (SGB) continuum solvation model showed improved binding affinity with tubulin compared to the lead compound, natural α-noscapine (-5.505 kcal/mol). Guided by the computational findings, these new biaryl type α-noscapine congeners were synthesized from 9-bromo-α-noscapine using optimized Suzuki reaction conditions for further experimental evaluation. The derivatives showed improved inhibition of the proliferation of human breast cancer cells (MCF-7), human cervical cancer cells (HeLa) and human lung adenocarcinoma cells (A549), compared to natural noscapine. The cell cycle analysis in MCF-7 further revealed that these compounds alter the cell cycle profile and cause mitotic arrest at G2/M phase more strongly than noscapine. Tubulin binding assay revealed higher binding affinity to tubulin, as suggested by dissociation constant (Kd) of 126 ± 5.0 µM for 5a, 107 ± 5.0 µM for 5c, 70 ± 4.0 µM for 5d, and 68 ± 6.0 µM for 5e compared to noscapine (Kd of 152 ± 1.0 µM). In fact, the experimentally determined value of ΔGbind, expt (calculated from the Kd value) are consistent with the predicted value of ΔGbind, pred calculated based on LIE-SGB. Based on these results, one of the derivative 5e of this series was used for further toxicological evaluation. Treatment of mice with a daily dose of 300 mg/kg and a single dose of 600 mg/kg indicates that the compound does not induce detectable pathological abnormalities in normal tissues. Also there were no significant differences in hematological parameters between the treated and untreated groups. Hence, the newly designed noscapinoid, 5e is an orally bioavailable, safe and effective anticancer agent with a potential for the treatment of cancer and might be a candidate for clinical evaluation.

  6. Vanadyl (IV) and vanadate (V) binding to selected endogenous phosphate, carboxyl, and amino ligands; calculations of cellular vanadium species distribution.

    PubMed

    Nechay, B R; Nanninga, L B; Nechay, P S

    1986-11-15

    Vanadium enters cells as vanadate (V) where it is reduced to vanadyl (IV), VO2+. Vanadate species at plasma pH, H2VO4-, and HVO4(2-) are referred to as VO3-. To gain an insight into the subcellular vanadium distribution we measured the binding of VO3- and VO2+ to extra- and intracellular ligands, and calculated free and bound fractions of these ions for expected in vivo conditions. The association constants (K) were determined by the pH shift caused by an addition of VOSO4 or NaVO3 to individual ligand solutions at 20 degrees C and a pH equal to the pK of the reactive groups. The pk's for binding of VO2+ were ATP, 5.9; ADP, 5.5; AMP, 5.1; Pi 4.3; creatine phosphate (CP), 3.6; glutamic acid, 3.4; aspartic acid, 3.1; human serum albumin, 3.1; glutathione, 2.7; ascorbic acid, 3.3; citric acid, 4.0. The pk of VO3- and human serum albumin was 3.3 and of that VO3- and glutathione was 4.2. VO3- did not bind to ATP, even via Mg2+ or Ca2+ bridges. We calculated that in cells approximately 1% of total VO2+ is unbound, which is 10(-10)-10(-9) M since published values for total vanadium (mainly VO2+) concentrations in tissues are on the order of 10(-8)-10(-7) M. Free VO2+ may be even less because of binding to additional ligands not considered and due to spontaneous hydrolysis to VOOH+ and VO(OH)2(2+) at intracellular pH. The binding of VO2+ to each ligand was corrected for presence of multiple ligands and competition by H+, K+, and Mg2+. In cells with no CP, up to 70% of VO2+ is bound to phosphates and up to 29% to proteins; in cells with 30 mM CP (as in muscle), approximately 95% is bound to phosphates (CP binds up to 61% of total VO2+) and approximately 4% to proteins; in cells with 2 mM ascorbic acid (as in brain), the vitamin binds approximately 3% of total VO2+. These binding values apply for the total VO2+ concentration range of 10(-8)-10(-5) M. The intracellular binding and a reducing environment protect the freshly reduced VO2+ from oxidation to VO3- that would otherwise occur at neutral pH. This strong affinity of VO2+ primarily for phosphates also explains the mechanism for the intracellular accumulation of vanadium which is a factor in previously observed transport of VO3- into cells.(ABSTRACT TRUNCATED AT 400 WORDS)

  7. Determination of binding constants of cyclodextrin inclusion complexes with amino acids and dipeptides by potentiometric titration.

    PubMed

    Kahle, Claudia; Holzgrabe, Ulrike

    2004-10-01

    Cyclodextrins are well known for their ability to separate enantiomers of drugs, natural products, and other chiral substances using HPLC, GC, or CE. The resolution of the enantiomers is due to the formation of diastereomeric complexes between the cyclodextrin and the pairs of enantiomers. The aim of this study was to determine the binding constants of the complexes between alpha- and beta-cyclodextrin and the enantiomers of a series of aliphatic and aromatic amino acids, and dipeptides, using a potentiometric titration method. The results of this method are compared to other methods, and correlated to findings in cyclodextrin-modified capillary electrophoresis and possible complex structures. Potentiometric titration was found to be an appropriate tool to determine the binding constants of cyclodextrin inclusion complexes.

  8. Low-Lying Electronic States of AlZn Calculated by MRCI+Q Method

    NASA Astrophysics Data System (ADS)

    Zhang, Shudong; Wang, Mingxu; Wang, Zifan; Hu, Kun; Dong, Jingping

    2017-07-01

    Some low-lying electronic states of AlZn have been studied by the ab initio calculation method of multireference configuration interaction (MRCI). The complete potential energy curves (PECs) of the three lowest doublet states (X2Π, A2Σ+, and B2Π) and the two lowest quartet states (a4Σ- and b4Π) are computed in the range of R = 0.1-0.9 nm and these states are correlated to three dissociation limits, X2Π and A2Σ+ to Zn(4s2,1S) + Al(3s23p1,2P), a4Σ- and b4Π to Zn(4s2,1S) + Al(3s13p2,4P), and B2Π to Zn(4s14p1,3P) + Al(3s23p1,2P). The calculated PECs indicate that the A2Σ+ state has a very shallow potential well and the other states show significant binding-state characteristics. The equilibrium internuclear distances Re, dissociation energies De, and term energies Te for the electronic excited states were obtained. All the possible vibrational levels, rotational constants, and spectral constants for the four bound states were computed by solving the radial Schrödinger equation of nuclear motion with the Level8.0 program provided by Le Roy.

  9. Highly Preorganized Ligand 1,10-Phenanthroline-2,9-dicarboxylic Acid for the Selective Recovery of Uranium from Seawater in the Presence of Competing Vanadium Species

    DOE PAGES

    Lashley, Mark A.; Ivanov, Alexander S.; Bryantsev, Vyacheslav S.; ...

    2016-09-30

    Studies of the complexation of new promising ligands with uranyl (UO 2 2+) and other seawater cations can aid the development of more efficient, selective, and robust sorbents for the recovery of uranium from seawater. Here, we propose that the ligand design principles based on structural preorganization can be successfully applied to obtain a dramatic enhancement in UO 2 2+ ion binding affinity and selectivity. This concept is exemplified through the investigation of the com-plexes of UO 2 2+, VO 2+, and VO 2+ with the highly preorganized ligand PDA (1,10-phenanthroline-2,9-dicarboxylic acid) using a combination of fluores-cence and absorbance techniques,more » along with den-sity functional theory (DFT) calculations. Moreover, the measured stability constant value, log K1, of 16.5 for the UO 2 2+/PDA complex is very high compared to uranyl complexes with other dicarboxylic ligands. Moreover, PDA exhibits strong selectivity for uranyl over vanadium ions, since the determined sta-bility constant values of the PDA complexes of the vanadium ions are quite low (V(IV) log K1 = 7.4, V(V) = 7.3). Finally, the structures of the corresponding UO 2 2+, VO 2+, and VO 2+ complexes with PDA were identified by systematic DFT calculations, and helped to interpret the stronger binding affinity for uranium over the vanadium ions. Due to its high chemical stability, selectivity, and structural preor-ganization for UO 2 2+ complexation, PDA is a very promising candidate that can be potentially used in the development of novel adsorbent materials for the selective extraction of uranium from sea-water.« less

  10. Highly Preorganized Ligand 1,10-Phenanthroline-2,9-dicarboxylic Acid for the Selective Recovery of Uranium from Seawater in the Presence of Competing Vanadium Species

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lashley, Mark A.; Ivanov, Alexander S.; Bryantsev, Vyacheslav S.

    Studies of the complexation of new promising ligands with uranyl (UO 2 2+) and other seawater cations can aid the development of more efficient, selective, and robust sorbents for the recovery of uranium from seawater. Here, we propose that the ligand design principles based on structural preorganization can be successfully applied to obtain a dramatic enhancement in UO 2 2+ ion binding affinity and selectivity. This concept is exemplified through the investigation of the com-plexes of UO 2 2+, VO 2+, and VO 2+ with the highly preorganized ligand PDA (1,10-phenanthroline-2,9-dicarboxylic acid) using a combination of fluores-cence and absorbance techniques,more » along with den-sity functional theory (DFT) calculations. Moreover, the measured stability constant value, log K1, of 16.5 for the UO 2 2+/PDA complex is very high compared to uranyl complexes with other dicarboxylic ligands. Moreover, PDA exhibits strong selectivity for uranyl over vanadium ions, since the determined sta-bility constant values of the PDA complexes of the vanadium ions are quite low (V(IV) log K1 = 7.4, V(V) = 7.3). Finally, the structures of the corresponding UO 2 2+, VO 2+, and VO 2+ complexes with PDA were identified by systematic DFT calculations, and helped to interpret the stronger binding affinity for uranium over the vanadium ions. Due to its high chemical stability, selectivity, and structural preor-ganization for UO 2 2+ complexation, PDA is a very promising candidate that can be potentially used in the development of novel adsorbent materials for the selective extraction of uranium from sea-water.« less

  11. Protein-ion binding process on finite macromolecular concentration. A Poisson-Boltzmann and Monte Carlo study.

    PubMed

    de Carvalho, Sidney Jurado; Fenley, Márcia O; da Silva, Fernando Luís Barroso

    2008-12-25

    Electrostatic interactions are one of the key driving forces for protein-ligands complexation. Different levels for the theoretical modeling of such processes are available on the literature. Most of the studies on the Molecular Biology field are performed within numerical solutions of the Poisson-Boltzmann Equation and the dielectric continuum models framework. In such dielectric continuum models, there are two pivotal questions: (a) how the protein dielectric medium should be modeled, and (b) what protocol should be used when solving this effective Hamiltonian. By means of Monte Carlo (MC) and Poisson-Boltzmann (PB) calculations, we define the applicability of the PB approach with linear and nonlinear responses for macromolecular electrostatic interactions in electrolyte solution, revealing some physical mechanisms and limitations behind it especially due the raise of both macromolecular charge and concentration out of the strong coupling regime. A discrepancy between PB and MC for binding constant shifts is shown and explained in terms of the manner PB approximates the excess chemical potentials of the ligand, and not as a consequence of the nonlinear thermal treatment and/or explicit ion-ion interactions as it could be argued. Our findings also show that the nonlinear PB predictions with a low dielectric response well reproduce the pK shifts calculations carried out with an uniform dielectric model. This confirms and completes previous results obtained by both MC and linear PB calculations.

  12. Enzymology below 200 K: The kinetics and thermodynamics of the photochemistry catalyzed by protochlorophyllide oxidoreductase

    PubMed Central

    Heyes, Derren J.; Ruban, Alexander V.; Wilks, Helen M.; Hunter, C. Neil

    2002-01-01

    The chlorophyll biosynthesis enzyme protochlorophyllide reductase (POR) catalyzes the light-dependent reduction of protochlorophyllide (Pchlide) into chlorophyllide in the presence of NADPH. As POR is light-dependent, catalysis can be initiated by illumination of the enzyme-substrate complex at low temperatures, making it an attractive model for studying aspects of biological proton and hydride transfers. The early stages in the photoreduction, involving Pchlide binding and an initial photochemical reaction, have been studied in vitro by using low-temperature fluorescence and absorbance measurements. Formation of the ternary POR-NADPH-Pchlide complex produces red shifts in the fluorescence and absorbance maxima of Pchlide, allowing the dissociation constant for Pchlide binding to be measured. We demonstrate that the product of an initial photochemical reaction, which can occur below 200 K, is a nonfluorescent intermediate with a broad absorbance band at 696 nm (A696) that is suggested to represent an ion radical complex. The temperature dependence of the rate of A696 formation has allowed the activation energy for the photochemical step to be calculated and has shown that POR catalysis can proceed at much lower temperatures than previously thought. Calculations of differences in free energy between various reaction intermediates have been calculated; these, together with the quantum efficiency for Pchlide conversion, suggest a quantitative model for the thermodynamics of the light-driven step of Pchlide reduction. PMID:12177453

  13. Surface Plasmon Resonance Biosensor Method for Palytoxin Detection Based on Na+,K+-ATPase Affinity

    PubMed Central

    Alfonso, Amparo; Pazos, María-José; Fernández-Araujo, Andrea; Tobio, Araceli; Alfonso, Carmen; Vieytes, Mercedes R.; Botana, Luis M.

    2013-01-01

    Palytoxin (PLTX), produced by dinoflagellates from the genus Ostreopsis was first discovered, isolated, and purified from zoanthids belonging to the genus Palythoa. The detection of this toxin in contaminated shellfish is essential for human health preservation. A broad range of studies indicate that mammalian Na+,K+-ATPase is a high affinity cellular receptor for PLTX. The toxin converts the pump into an open channel that stimulates sodium influx and potassium efflux. In this work we develop a detection method for PLTX based on its binding to the Na+,K+-ATPase. The method was developed by using the phenomenon of surface plasmon resonance (SPR) to monitor biomolecular reactions. This technique does not require any labeling of components. The interaction of PLTX over immobilized Na+,K+-ATPase is quantified by injecting different concentrations of toxin in the biosensor and checking the binding rate constant (kobs). From the representation of kobs versus PLTX concentration, the kinetic equilibrium dissociation constant (KD) for the PLTX-Na+,K+-ATPase association can be calculated. The value of this constant is KD = 6.38 × 10−7 ± 6.67 × 10−8 M PLTX. In this way the PLTX-Na+,K+-ATPase association was used as a suitable method for determination of the toxin concentration in a sample. This method represents a new and useful approach to easily detect the presence of PLTX-like compounds in marine products using the mechanism of action of these toxins and in this way reduce the use of other more expensive and animal based methods. PMID:24379088

  14. Surface plasmon resonance biosensor method for palytoxin detection based on Na+,K+-ATPase affinity.

    PubMed

    Alfonso, Amparo; Pazos, María-José; Fernández-Araujo, Andrea; Tobio, Araceli; Alfonso, Carmen; Vieytes, Mercedes R; Botana, Luis M

    2013-12-27

    Palytoxin (PLTX), produced by dinoflagellates from the genus Ostreopsis was first discovered, isolated, and purified from zoanthids belonging to the genus Palythoa. The detection of this toxin in contaminated shellfish is essential for human health preservation. A broad range of studies indicate that mammalian Na+,K+-ATPase is a high affinity cellular receptor for PLTX. The toxin converts the pump into an open channel that stimulates sodium influx and potassium efflux. In this work we develop a detection method for PLTX based on its binding to the Na+,K+-ATPase. The method was developed by using the phenomenon of surface plasmon resonance (SPR) to monitor biomolecular reactions. This technique does not require any labeling of components. The interaction of PLTX over immobilized Na+,K+-ATPase is quantified by injecting different concentrations of toxin in the biosensor and checking the binding rate constant (Kobs). From the representation of Kobs versus PLTX concentration, the kinetic equilibrium dissociation constant (K(D)) for the PLTX-Na+,K+-ATPase association can be calculated. The value of this constant is K(D) = 6.38 × 10-7 ± 6.67 × 10-8 M PLTX. In this way the PLTX-Na+,K+-ATPase association was used as a suitable method for determination of the toxin concentration in a sample. This method represents a new and useful approach to easily detect the presence of PLTX-like compounds in marine products using the mechanism of action of these toxins and in this way reduce the use of other more expensive and animal based methods.

  15. Mechanism of Sulfide Binding by Ferric Hemeproteins.

    PubMed

    Boubeta, Fernando M; Bieza, Silvina A; Bringas, Mauro; Estrin, Darío A; Boechi, Leonardo; Bari, Sara E

    2018-06-19

    The reaction of hydrogen sulfide (H 2 S) with hemeproteins is a key physiological reaction; still, its mechanism and implications are not completely understood. In this work, we propose a combination of experimental and theoretical tools to shed light on the reaction in model system microperoxidase 11 (MP11-Fe III ) and myoglobin (Mb-Fe III ), from the estimation of the intrinsic binding constants of the species H 2 S and hydrosulfide (HS - ), and the computational description of the overall binding process. Our results show that H 2 S and HS - are the main reactive species in Mb-Fe III and MP11-Fe III , respectively, and that the magnitude of their intrinsic binding constants are similar to most of the binding constants reported so far for hemeproteins systems and model compounds. However, while the binding of HS - to Mb-Fe III was negligible, the binding of H 2 S to MP11-Fe III was significant, providing a frame for a discriminated analysis of both species and revealing differential mechanistic aspects. A joint inspection of the kinetic data and the free energy profiles of the binding processes suggests that a dissociative mechanism with the release of a coordinated water molecule as rate limiting step is operative in the binding of H 2 S to Mb-Fe III and that the binding of HS - is prevented in the access to the protein matrix. For the MP11-Fe III case, where no access restrictions for the ligands are present, an associative component in the mechanism seems to be operative. Overall, the results suggest that if accessing the active site then both H 2 S and HS - are capable of binding a ferric heme moiety.

  16. Ap4A is not an efficient Zn(II) binding agent. A concerted potentiometric, calorimetric and NMR study.

    PubMed

    Wszelaka-Rylik, Małgorzata; Witkiewicz-Kucharczyk, Aleksandra; Wójcik, Jacek; Bal, Wojciech

    2007-05-01

    Diadenosine 5',5''-P(1)P(4) tetraphosphate (Ap(4)A) has been considered as an intracellular partner for Zn(II). We applied potentiometry, ITC and NMR to study protonation equilibria of Ap(4)A and Zn(II) complexation by this dinucleotide. The values of binding constants obtained by these three techniques under various experimental conditions coherently demonstrated that Ap(4)A binds Zn(II) weakly, with an apparent binding constant of ca. 10(4) at neutral pH. Such a low stability of Zn(II) complexes with Ap(4)A excludes a possibility for interactions between these two agents in vivo.

  17. Interaction of Sulforaphane with DNA and RNA

    PubMed Central

    Abassi Joozdani, Farzaneh; Yari, Faramarz; Abassi Joozdani, Parvaneh; Nafisi, Shohreh

    2015-01-01

    Sulforaphane (SFN) is an isothiocyanate found in cruciferous vegetables with anti-inflammatory, anti-oxidant and anti-cancer activities. However, the antioxidant and anticancer mechanism of sulforaphane is not well understood. In the present research, we reported binding modes, binding constants and stability of SFN–DNA and -RNA complexes by Fourier transform infrared (FTIR) and UV–Visible spectroscopic methods. Spectroscopic evidence showed DNA intercalation with some degree of groove binding. SFN binds minor and major grooves of DNA and backbone phosphate (PO2), while RNA binding is through G, U, A bases with some degree of SFN–phosphate (PO2) interaction. Overall binding constants were estimated to be K(SFN–DNA)=3.01 (± 0.035)×104 M-1 and K(SFN–RNA)= 6.63 (±0.042)×103 M-1. At high SFN concentration (SFN/RNA = 1/1), DNA conformation changed from B to A occurred, while RNA remained in A-family structure. PMID:26030290

  18. Rates and equilibrium constants of the ligand-induced conformational transition of an HCN ion channel protein domain determined by DEER spectroscopy.

    PubMed

    Collauto, Alberto; DeBerg, Hannah A; Kaufmann, Royi; Zagotta, William N; Stoll, Stefan; Goldfarb, Daniella

    2017-06-14

    Ligand binding can induce significant conformational changes in proteins. The mechanism of this process couples equilibria associated with the ligand binding event and the conformational change. Here we show that by combining the application of W-band double electron-electron resonance (DEER) spectroscopy with microfluidic rapid freeze quench (μRFQ) it is possible to resolve these processes and obtain both equilibrium constants and reaction rates. We studied the conformational transition of the nitroxide labeled, isolated carboxy-terminal cyclic-nucleotide binding domain (CNBD) of the HCN2 ion channel upon binding of the ligand 3',5'-cyclic adenosine monophosphate (cAMP). Using model-based global analysis, the time-resolved data of the μRFQ DEER experiments directly provide fractional populations of the open and closed conformations as a function of time. We modeled the ligand-induced conformational change in the protein using a four-state model: apo/open (AO), apo/closed (AC), bound/open (BO), bound/closed (BC). These species interconvert according to AC + L ⇌ AO + L ⇌ BO ⇌ BC. By analyzing the concentration dependence of the relative contributions of the closed and open conformations at equilibrium, we estimated the equilibrium constants for the two conformational equilibria and the open-state ligand dissociation constant. Analysis of the time-resolved μRFQ DEER data gave estimates for the intrinsic rates of ligand binding and unbinding as well as the rates of the conformational change. This demonstrates that DEER can quantitatively resolve both the thermodynamics and the kinetics of ligand binding and the associated conformational change.

  19. Binding of vitamin A with milk α- and β-caseins.

    PubMed

    Bourassa, P; N'soukpoé-Kossi, C N; Tajmir-Riahi, H A

    2013-05-01

    The binding sites of retinol and retinoic acid with milk α- and β-caseins were determined, using constant protein concentration and various retinoid contents. FTIR, UV-visible and fluorescence spectroscopic methods as well as molecular modelling were used to analyse retinol and retinoic acid binding sites, the binding constant and the effect of retinoid complexation on the stability and conformation of caseins. Structural analysis showed that retinoids bind caseins via both hydrophilic and hydrophobic contacts with overall binding constants of K(retinol-)(α)(-caseins)=1.21 (±0.4)×10(5) M(-1) and K(retinol-)(β)(-caseins)=1.11 (±0.5)×10(5) M(-1) and K(retinoic acid-)(α)(-caseins)=6.2 (±0.6)×10(4) M(-1) and K(retinoic acid-)(β)(-caseins)=6.3 (±0.6)×10(4) M(-1). The number of bound retinol molecules per protein (n) was 1.5 (±0.1) for α-casein and 1.0 (±0.1) for β-casein, while 1 molecule of retinoic acid was bound in the α- and β-casein complexes. Molecular modelling showed different binding sites for retinol and retinoic acid on α- and β-caseins with more stable complexes formed with α-casein. Retinoid-casein complexation induced minor alterations of protein conformation. Caseins might act as carriers for transportation of retinoids to target molecules. Copyright © 2012 Elsevier Ltd. All rights reserved.

  20. Spectroscopic and molecular docking studies on the charge transfer complex of bovine serum albumin with quinone in aqueous medium and its influence on the ligand binding property of the protein.

    PubMed

    Satheshkumar, Angupillai; Elango, Kuppanagounder P

    2014-09-15

    The spectral techniques such as UV-Vis, (1)H NMR and fluorescence and electrochemical experiments have been employed to investigate the interaction between 2-methoxy-3,5,6-trichloro-1,4-benzoquinone (MQ; a water soluble quinone) and bovine serum albumin (BSA) in aqueous medium. The fluorescence of BSA was quenched by MQ via formation of a 1:1 BSA-MQ charge transfer adduct with a formation constant of 3.3×10(8) L mol(-1). Based on the Forster's theory the binding distance between them is calculated as 2.65 nm indicating high probability of binding. For the first time, influence of quinone on the binding property of various types of ligands such as aspirin, ascorbic acid, nicotinimide and sodium stearate has also been investigated. The results indicated that the strong and spontaneous binding existing between BSA and MQ, decreased the intensity of binding of these ligands with BSA. Since Tryptophan (Trp) is the basic residue present in BSA, a comparison between binding property of Trp-MQ adduct with that of BSA-MQ with these ligands has also been attempted. 1H NMR titration study indicated that the Trp forms a charge transfer complex with MQ, which reduces the interaction of Trp with the ligands. Molecular docking study supported the fact that the quinone interacts with the Trp212 unit of the BSA and the free energy change of binding (ΔG) for the BSA-MQ complex was found to be -46 kJ mol(-1), which is comparable to our experimental free energy of binding (-49 kJ mol(-1)) obtained from fluorescence study. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. Spectroscopic and molecular docking studies on the charge transfer complex of bovine serum albumin with quinone in aqueous medium and its influence on the ligand binding property of the protein

    NASA Astrophysics Data System (ADS)

    Satheshkumar, Angupillai; Elango, Kuppanagounder P.

    2014-09-01

    The spectral techniques such as UV-Vis, 1H NMR and fluorescence and electrochemical experiments have been employed to investigate the interaction between 2-methoxy-3,5,6-trichloro-1,4-benzoquinone (MQ; a water soluble quinone) and bovine serum albumin (BSA) in aqueous medium. The fluorescence of BSA was quenched by MQ via formation of a 1:1 BSA-MQ charge transfer adduct with a formation constant of 3.3 × 108 L mol-1. Based on the Forster’s theory the binding distance between them is calculated as 2.65 nm indicating high probability of binding. For the first time, influence of quinone on the binding property of various types of ligands such as aspirin, ascorbic acid, nicotinimide and sodium stearate has also been investigated. The results indicated that the strong and spontaneous binding existing between BSA and MQ, decreased the intensity of binding of these ligands with BSA. Since Tryptophan (Trp) is the basic residue present in BSA, a comparison between binding property of Trp-MQ adduct with that of BSA-MQ with these ligands has also been attempted. 1H NMR titration study indicated that the Trp forms a charge transfer complex with MQ, which reduces the interaction of Trp with the ligands. Molecular docking study supported the fact that the quinone interacts with the Trp212 unit of the BSA and the free energy change of binding (ΔG) for the BSA-MQ complex was found to be -46 kJ mol-1, which is comparable to our experimental free energy of binding (-49 kJ mol-1) obtained from fluorescence study.

  2. Locating the binding sites of folic acid with milk α- and β-caseins.

    PubMed

    Bourassa, P; Tajmir-Riahi, H A

    2012-01-12

    We located the binding sites of folic acid with milk α- and β-caseins at physiological conditions, using constant protein concentration and various folic acid contents. FTIR, UV-visible, and fluorescence spectroscopic methods as well as molecular modeling were used to analyze folic acid binding sites, the binding constant, and the effect of folic acid interaction on the stability and conformation of caseins. Structural analysis showed that folic acid binds caseins via both hydrophilic and hydrophobic contacts with overall binding constants of K(folic acid-α-caseins) = 4.8 (±0.6) × 10(4) M(-1) and K(folic acid-β-caseins) = 7.0 (±0.9) × 10(4) M(-1). The number of bound acid molecules per protein was 1.5 (±0.4) for α-casein and 1.4 (±0.3) for β-casein complexes. Molecular modeling showed different binding sites for folic acid on α- and β-caseins. The participation of several amino acids in folic acid-protein complexes was observed, which was stabilized by hydrogen bonding network and the free binding energy of -7.7 kcal/mol (acid-α-casein) and -8.1 kcal/mol (acid-β-casein). Folic acid complexation altered protein secondary structure by the reduction of α-helix from 35% (free α-casein) to 33% (acid-complex) and 32% (free β-casein) to 26% (acid-complex) indicating a partial protein destabilization. Caseins might act as carriers for transportation of folic acid to target molecules.

  3. Interactions and diffusion in fine-stranded β-lactoglobulin gels determined via FRAP and binding.

    PubMed

    Schuster, Erich; Hermansson, Anne-Marie; Ohgren, Camilla; Rudemo, Mats; Lorén, Niklas

    2014-01-07

    The effects of electrostatic interactions and obstruction by the microstructure on probe diffusion were determined in positively charged hydrogels. Probe diffusion in fine-stranded gels and solutions of β-lactoglobulin at pH 3.5 was determined using fluorescence recovery after photobleaching (FRAP) and binding, which is widely used in biophysics. The microstructures of the β-lactoglobulin gels were characterized using transmission electron microscopy. The effects of probe size and charge (negatively charged Na2-fluorescein (376Da) and weakly anionic 70kDa FITC-dextran), probe concentration (50 to 200 ppm), and β-lactoglobulin concentration (9% to 12% w/w) on the diffusion properties and the electrostatic interaction between the negatively charged probes and the positively charged gels or solutions were evaluated. The results show that the diffusion of negatively charged Na2-fluorescein is strongly influenced by electrostatic interactions in the positively charged β-lactoglobulin systems. A linear relationship between the pseudo-on binding rate constant and the β-lactoglobulin concentration for three different probe concentrations was found. This validates an important assumption of existing biophysical FRAP and binding models, namely that the pseudo-on binding rate constant equals the product of the molecular binding rate constant and the concentration of the free binding sites. Indicators were established to clarify whether FRAP data should be analyzed using a binding-diffusion model or an obstruction-diffusion model. Copyright © 2014 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  4. Measurement of Nanomolar Dissociation Constants by Titration Calorimetry and Thermal Shift Assay – Radicicol Binding to Hsp90 and Ethoxzolamide Binding to CAII

    PubMed Central

    Zubrienė, Asta; Matulienė, Jurgita; Baranauskienė, Lina; Jachno, Jelena; Torresan, Jolanta; Michailovienė, Vilma; Cimmperman, Piotras; Matulis, Daumantas

    2009-01-01

    The analysis of tight protein-ligand binding reactions by isothermal titration calorimetry (ITC) and thermal shift assay (TSA) is presented. The binding of radicicol to the N-terminal domain of human heat shock protein 90 (Hsp90αN) and the binding of ethoxzolamide to human carbonic anhydrase (hCAII) were too strong to be measured accurately by direct ITC titration and therefore were measured by displacement ITC and by observing the temperature-denaturation transitions of ligand-free and ligand-bound protein. Stabilization of both proteins by their ligands was profound, increasing the melting temperature by more than 10 ºC, depending on ligand concentration. Analysis of the melting temperature dependence on the protein and ligand concentrations yielded dissociation constants equal to 1 nM and 2 nM for Hsp90αN-radicicol and hCAII-ethoxzolamide, respectively. The ligand-free and ligand-bound protein fractions melt separately, and two melting transitions are observed. This phenomenon is especially pronounced when the ligand concentration is equal to about half the protein concentration. The analysis compares ITC and TSA data, accounts for two transitions and yields the ligand binding constant and the parameters of protein stability, including the Gibbs free energy and the enthalpy of unfolding. PMID:19582223

  5. Contacts between the factor TUF and RPG sequences.

    PubMed

    Vignais, M L; Huet, J; Buhler, J M; Sentenac, A

    1990-08-25

    The yeast TUF factor binds specifically to RPG-like sequences involved in multiple functions at enhancers, silencers, and telomeres. We have characterized the interaction of TUF with its optimal binding sequence, rpg-1 (1-ACACCCATACATTT-14), using a gel DNA-binding assay in combination with methylation protection and mutagenesis experiments. As many as 10 base pairs appear to be engaged in factor binding. Analysis of a collection of 30 different RPG mutants demonstrated the importance of 8 base pairs at position 2, 3, 4, 5, 6, 7, 10, and 12 and the critical role of the central GC pair at position 5. Methylation protection data on four different natural sites confirmed a close contact at positions 4, 5, 6, and 10 and suggested additional contacts at base pairs 8, 12, and 13. The derived consensus sequence was RCAAYCCRYNCAYY. A quantitative band shift analysis was used to determine the equilibrium dissociation constant for the complex of TUF and its optimal binding site rpg-1. The specific dissociation constant (K8) was found to be 1.3 x 10(-11) M. The comparison of the K8 value with the dissociation constant obtained for nonspecific DNA sites (Kn8 = 8.7 x 10(-6) M) shows the high binding selectivity of TUF for its specific RPG target.

  6. Studies on the synthesis, characterization, human serum albumin binding and biological activity of single chain surfactant-cobalt(III) complexes.

    PubMed

    Vignesh, G; Sugumar, K; Arunachalam, S; Vignesh, S; Arthur James, R; Arun, R; Premkumar, K

    2016-03-01

    The interaction of surfactant-cobalt(III) complexes [Co(bpy)(dien)TA](ClO4)3 · 3H2O (1) and [Co(dien)(phen)TA](ClO4)3 · 4H2O (2), where bpy = 2,2'-bipyridine, dien = diethylenetriamine, phen = 1,10-phenanthroline and TA = tetradecylamine with human serum albumin (HSA) under physiological conditions was analyzed using steady state, synchronous, 3D fluorescence, UV/visabsorption and circular dichroism spectroscopic techniques. The results show that these complexes cause the fluorescence quenching of HSA through a static mechanism. The binding constant (Kb ) and number of binding-sites (n) were obtained at different temperatures. The corresponding thermodynamic parameters (∆G°, ∆H° and ∆S°) and Ea were also obtained. According to Förster's non-radiation energy transfer theory, the binding distance (r) between the complexes and HSA were calculated. The results of synchronous and 3D fluorescence spectroscopy indicate that the binding process has changed considerably the polarity around the fluorophores, along with changes in the conformation of the protein. The antimicrobial and anticancer activities of the complexes were tested and the results show that the complexes have good activities against pathogenic microorganisms and cancer cells. Copyright © 2015 John Wiley & Sons, Ltd.

  7. NMR and molecular modeling of wine tannins binding to saliva proteins: revisiting astringency from molecular and colloidal prospects.

    PubMed

    Cala, Olivier; Pinaud, Noël; Simon, Cécile; Fouquet, Eric; Laguerre, Michel; Dufourc, Erick J; Pianet, Isabelle

    2010-11-01

    In organoleptic science, the association of tannins to saliva proteins leads to the poorly understood phenomenon of astringency. To decipher this interaction at molecular and colloidal levels, the binding of 4 procyanidin dimers (B1-4) and 1 trimer (C2) to a human saliva proline-rich peptide, IB7(14), was studied. Interactions have been characterized by measuring dissociation constants, sizes of complexes, number, and nature of binding sites using NMR (chemical shift variations, diffusion-ordered spectroscopy, and saturation transfer diffusion). The binding sites were identified using molecular mechanics, and the hydrophilic/hydrophobic nature of the interactions was resolved by calculating the molecular lipophilicity potential within the complexes. The following comprehensive scheme can be proposed: 1) below the tannin critical micelle concentration (CMC), interaction is specific, and the procyanidin anchorage always occurs on the same three IB7(14) sites. The tannin 3-dimensional structure plays a key role in the binding force and in the tannin's ability to act as a bidentate ligand: tannins adopting an extended conformation exhibit higher affinity toward protein and initiate the formation of a network. 2) Above the CMC, after the first specific hydrophilic interaction has taken place, a random hydrophobic stacking occurs between tannins and proteins. The whole process is discussed in the general frame of wine tannins eliciting astringency.

  8. Study binding of Al-curcumin complex to ds-DNA, monitoring by multispectroscopic and voltammetric techniques

    NASA Astrophysics Data System (ADS)

    Ahmadi, F.; Alizadeh, A. A.; Shahabadi, N.; Rahimi-Nasrabadi, M.

    2011-09-01

    In this work a complex of Al 3+ with curcumin ([Al(curcumin) (EtOH) 2](NO 3) 2) was synthesized and characterized by UV-vis, FT-IR, elemental analysis and spectrophotometric titration techniques. The mole ratio plot revealed a 1:1 complex between Al 3+ and curcumin in solution. For binding studies of this complex to calf thymus-DNA various methods such as: UV-vis, fluorescence, circular dichroism (CD), FT-IR spectroscopy and cyclic voltammetry were used. The intrinsic binding constant of ACC with DNA at 25 °C was calculated by UV-vis and cyclic voltammetry as 2.1 × 10 4 and 2.6 × 10 4, respectively. The thermodynamic studies showed that the reaction is enthalpy and entropy favored. The CD results showed that only the Δ-ACC interacts with DNA and the Δ-ACC form has not any tendency to interact with DNA, also the pure curcumin has not any stereoselective interaction with CT-DNA. Fluorimetric studies showed that fluorescence enhancement was initiated by a static process in the ground state. The cyclic voltammetry showed that ACC interact with DNA with a binding site size of 2. From the FT-IR we concluded that the Δ-ACC interacts with DNA via partial electrostatic and minor groove binding. In comparison with previous works it was concluded that curcumin significantly reduced the affinity of Al 3+ to the DNA.

  9. Insights from spectroscopic and in-silico techniques for the exploitation of biomolecular interactions between Human serum albumin and Paromomycin.

    PubMed

    Raza, Muslim; Jiang, Yang; Wei, Yun; Ahmad, Aftab; Khan, Ajmal; Qipeng, Yuan

    2017-09-01

    The study of molecular interactions of drug-protein are extremely important from the biological aspect in all living organisms, and therefore such type of investigation hold a tremendous significance in rational drug design and discovery. In the present study, the molecular interactions between paromomycin (PAR) and human serum albumin (HSA) have been studied by different biophysical techniques and validated by in-silico approaches. The results obtained from Ultraviolet-visible spectroscopy (UV) and Fourier transform infrared spectroscopy (FT-IR) demonstrated a remarkable change upon the complexation of PAR with HSA. Circular Dichroism (CD), Dynamic Light Scattering (DLS) and Resonance Rayleigh scattering (RRS) results revealed a significant secondary structure alteration and reduction of hydrodynamic radii upon the conjugation of PAR with HSA. The fluorescence spectroscopy results also apparently revealed the static quenching mechanism. The number of binding sites, binding constants, and Gibbs free energy values were calculated to illustrate the nature of intermolecular interactions. Similarly, the in-silico docking and molecular dynamics simulation clearly explain the theoretical basis of the binding mechanism of PAR with HSA. The experimental and docking approaches suggested that PAR binds to the hydrophobic cavity site I of HSA. The finding of present investigation will provide binding insight of PAR and associated alterations in the stability and conformation of HSA. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Milk caseins as useful vehicle for delivery of dipyridamole drug.

    PubMed

    Dezhampanah, Hamid; Esmaili, Masoomeh; Hasani, Leila

    2018-05-01

    The interaction of bovine milk α- and β-caseins as an efficient drug carrier system with Dipyridamole (DIP) was investigated using spectroscopy and molecular docking studies at different temperatures (20-37 °C). FTIR, CD, and fluorescence spectroscopy methods demonstrated that α- and β-caseins interact with DIP molecule mainly via hydrophobic and hydrophilic interactions and change in secondary structure of α- and β-caseins. DIP showed a higher quenching efficiency and binding constant of α-casein than β-casein. There was only one binding site for DIP and it was located on the surface of the protein molecule. The thermodynamic parameters of calculation showed that the binding process occurs spontaneously and demonstrated that α- and β-caseins provide very good binding and entrapment to DIP via hydrogen bonds, Van der Waals forces, and hydrophobic interactions. Fluorescence resonance energy transfer, synchronous fluorescence spectroscopy, and docking study showed that DIP binds to the Trp residues of α- and β-casein molecules with short distances. Docking study showed that DIP molecule made several hydrogen bonds and van der Waals interactions with α- and β-caseins. The study of cell culture and micellar solubility of DIP demonstrated α- and β-caseins relatively the same helping in delivery of DIP. Milk α- and β-caseins are considered as a useful vehicle for the solublization and stabilization of DIP in aqueous solution at natural pH.

  11. Application of headspace solid phase microextraction for study of noncovalent interaction of borneol with human serum albumin

    PubMed Central

    Hu, Liang; Chen, Dong-ying

    2009-01-01

    Aim: To investigate noncovalent interactions between borneol and human serum albumin (HSA) under near-physiological conditions. Methods: A 65-μm polydimethylsiloxane (PDMS) fiber was selected for sampling. The extraction temperature was kept at 37 °C, and the extraction time was optimized at 10 min. Borneol solutions of different concentrations were equilibrated in 600 μmol/L HSA and 67 mmol/L phosphate buffer solution (pH 7.4, 37 °C) for 24 h prior to solid phase microextraction (SPME) using headspace mode. The binding properties were obtained based on the calculation of extracted borneol amount using gas chromatography (GC) determination. Results: The headspace SPME extraction method avoided disturbance from the HSA binding matrix. The recovery showed good linearity for the borneol concentrations over the range of 0.4–16.3 μmol/L with a regression coefficient (R2) of 0.9998. The limit of detection and lower limit of quantitation were determined to be 0.01 μmol/L and 0.4 μmol/L, respectively. The binding constant and the percentage binding rate were estimated to be 2.4×103(mol/L)-1 and 59.5%, respectively. Conclusion: Headspace SPME coupled to GC is a simple, sensitive and rapid method for the study of borneol binding to HSA. The method may be applied in the determination of other protein binding properties in human plasma. PMID:19890364

  12. Monitoring binding affinity between drug and α1-acid glycoprotein in real time by Venturi easy ambient sonic-spray ionization mass spectrometry.

    PubMed

    Liu, Ning; Lu, Xin; Yang, YuHan; Yao, Chen Xi; Ning, BaoMing; He, Dacheng; He, Lan; Ouyang, Jin

    2015-10-01

    A new approach for monitoring the binding affinity between drugs and alpha 1-acid glycoprotein in real time was developed based on a combination of drug-protein reaction followed by Venturi easy ambient sonic-spray ionization mass spectrometry determination of the free drug concentrations. A known basic drug, propranolol was used to validate the new built method. Binding constant values calculated by venturi easy ambient sonic-spray ionization mass spectrometry was in good accordance with a traditional ultrafiltration combined with high performance liquid chromatography method. Then six types of basic drugs were used as the samples to conduct the real time analysis. Upon injection of alpha 1-acid glycoprotein to the drug mixture, the ion chromatograms were extracted to show the changes in the free drug concentrations in real time. By observing the drop-out of six types of drugs during the whole binding reaction, the binding affinities of different drugs were distinguished. A volume shift validating experiment and an injection delay correcting experiment were also performed to eliminate extraneous factors and verify the reliability of our experiment. Therefore, the features of Venturi easy ambient sonic-spray ionization mass spectrometry (V-EASI-MS) and the experimental results indicate that our technique is likely to become a powerful tool for monitoring drug-AGP binding affinity in real time. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. A spectroscopic and molecular docking approach on the binding of tinzaparin sodium with human serum albumin

    NASA Astrophysics Data System (ADS)

    Abdullah, Saleh M. S.; Fatma, Sana; Rabbani, Gulam; Ashraf, Jalaluddin M.

    2017-01-01

    Protein bound toxins are poorly removed by conventional extracorporeal therapies. Venous thromboembolism (VTE) is a major cause of morbidity and mortality in patients with cancer. The interaction between tinzaparin, an inhibitor of angiotensin converting enzyme and human serum albumin, a principal plasma protein in the liver has been investigated in vitro under a simulated physiological condition by UV-vis spectrophotometry and fluorescence spectrometry. The intrinsic fluorescence intensity of human serum albumin was strongly quenched by tinzaparin (TP). The binding constants and binding stoichiometry can be calculated from the data obtained from fluorescence quenching experiments. The negative value of ΔG° reveals that the binding process is a spontaneous process. Thermodynamic analysis shows that the HSA-TP complex formation occurs via hydrogen bonds, hydrophobic interactions and undergoes slight structural changes as evident by far-UV CD. It indicated that the hydrophobic interactions play a main role in the binding of TP to human serum albumin. In addition, the distance between TP (acceptor) and tryptophan residues of human serum albumin (donor) was estimated to be 2.21 nm according to the Förster's resonance energy transfer theory. For the deeper understanding of the interaction, thermodynamic, and molecular docking studies were performed as well. Our docking results suggest that TP forms stable complex with HSA (Kb ∼ 104) and its primary binding site is located in subdomain IIA (Sudlow Site I). The results obtained herein will be of biological significance in pharmacology and clinical medicine.

  14. Assessing the performance of MM/PBSA and MM/GBSA methods. 8. Predicting binding free energies and poses of protein-RNA complexes.

    PubMed

    Chen, Fu; Sun, Huiyong; Wang, Junmei; Zhu, Feng; Liu, Hui; Wang, Zhe; Lei, Tailong; Li, Youyong; Hou, Tingjun

    2018-06-21

    Molecular docking provides a computationally efficient way to predict the atomic structural details of protein-RNA interactions (PRI), but accurate prediction of the three-dimensional structures and binding affinities for PRI is still notoriously difficult, partly due to the unreliability of the existing scoring functions for PRI. MM/PBSA and MM/GBSA are more theoretically rigorous than most scoring functions for protein-RNA docking, but their prediction performance for protein-RNA systems remains unclear. Here, we systemically evaluated the capability of MM/PBSA and MM/GBSA to predict the binding affinities and recognize the near-native binding structures for protein-RNA systems with different solvent models and interior dielectric constants (ϵ in ). For predicting the binding affinities, the predictions given by MM/GBSA based on the minimized structures in explicit solvent and the GBGBn1 model with ϵ in = 2 yielded the highest correlation with the experimental data. Moreover, the MM/GBSA calculations based on the minimized structures in implicit solvent and the GBGBn1 model distinguished the near-native binding structures within the top 10 decoys for 118 out of the 149 protein-RNA systems (79.2%). This performance is better than all docking scoring functions studied here. Therefore, the MM/GBSA rescoring is an efficient way to improve the prediction capability of scoring functions for protein-RNA systems. Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  15. Force and Stress along Simulated Dissociation Pathways of Cucurbituril-Guest Systems.

    PubMed

    Velez-Vega, Camilo; Gilson, Michael K

    2012-03-13

    The field of host-guest chemistry provides computationally tractable yet informative model systems for biomolecular recognition. We applied molecular dynamics simulations to study the forces and mechanical stresses associated with forced dissociation of aqueous cucurbituril-guest complexes with high binding affinities. First, the unbinding transitions were modeled with constant velocity pulling (steered dynamics) and a soft spring constant, to model atomic force microscopy (AFM) experiments. The computed length-force profiles yield rupture forces in good agreement with available measurements. We also used steered dynamics with high spring constants to generate paths characterized by a tight control over the specified pulling distance; these paths were then equilibrated via umbrella sampling simulations and used to compute time-averaged mechanical stresses along the dissociation pathways. The stress calculations proved to be informative regarding the key interactions determining the length-force profiles and rupture forces. In particular, the unbinding transition of one complex is found to be a stepwise process, which is initially dominated by electrostatic interactions between the guest's ammoniums and the host's carbonyl groups, and subsequently limited by the extraction of the guest's bulky bicyclooctane moiety; the latter step requires some bond stretching at the cucurbituril's extraction portal. Conversely, the dissociation of a second complex with a more slender guest is mainly driven by successive electrostatic interactions between the different guest's ammoniums and the host's carbonyl groups. The calculations also provide information on the origins of thermodynamic irreversibilities in these forced dissociation processes.

  16. Tc-99m galactosyl-neoglycoalbumin: in vitro characterization of receptor-mediated binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vera, D.R.; Krohn, K.A.; Stadalnik, R.C.

    1984-07-01

    Hepatic binding protein (HBP) is a membrane receptor that binds and transports plasma glycoproteins from hepatic blood to hepatocellular lysosomes. A characterization is made of the in vitro binding of Tc-99m galactosyl-neoglycoalbumin (Tc-NGA), a synthetic HBP ligand, to liver membrane. Structural modifications of NGA resulted in the alteration of the equilibrium constant, KA, and the forward-binding rate constant, kb. Binding was second-order; the relative amount of membrane-bound NGA depended on the initial concentrations of ligand and membrane. Membrane displacement studies, using carrier ligands in contrast to previously bound Tc-NGA or I-NGA, correlated with the binding characteristics of a native HBPmore » ligand, asialo-orosomucoid. Computer simulation was used to study the detectability of the changes in HBP concentration at different values of kb. The simulations indicated that radiopharmacokinetic sensitivity to alterations in (HBP) should be possible using a neoglycoalbumin preparation with a carbohydrate density within the range of 15 to 25 galactose units per albumin molecule.« less

  17. Hydration Differences Explain the Large Variations in the Complexation Thermodynamics of Modified γ-Cyclodextrins with Bile Salts.

    PubMed

    Køhler, Jonatan; Schönbeck, Christian; Westh, Peter; Holm, René

    2016-01-28

    The structure and thermodynamics of inclusion complexes of seven different γ-cyclodextrins (γCDs) and three biologically relevant bile salts (BS) were investigated in the present study. Natural γCD and six modified γCDs [two methyl-γCDs, one sulfobutyl ether-γCD (SBEγCD), and three 2-hydroxypropyl-γCDs (HPγCD)] and their complexes with BS were investigated by isothermal titration calorimetry, NMR, and molecular dynamics simulations. With the exception of the fully methylated γCD, which did not bind the BSs investigated, all of the γCDs formed 1:1 complexes with the BS, and the structures were similar to those with natural γCD; i.e., the modifications of the γCD had limited structural impact on the formation of complexes. Isothermal titration calorimetry was carried out over in the temperature interval 5-55 °C to enable the calculation of the stability constant (K) and the thermodynamic parameters enthalpy (ΔH°), entropy (ΔS°), and heat capacity (ΔCp°). The stability constants decreased with an increased degree of substitution (DS), with methyl substituents having a lower effect on the stability constant than the sulfobutyl ether and hydroxypropyl substituents on the stability constants. Enthalpy-entropy compensation was observed, since both enthalpy and entropy increased with the degree of substitution, which may reflect dehydration of the hydrophobic surface on both CD and BS. Calculations based on ΔCp° data suggested that each of the substituents dehydrated 10-20 (hydroxypropyl), 22-33 (sulfobutyl ether), and 10-15 Å(2) (methyl) of the BS surface area, in reasonable agreement with estimates from the molecular dynamics simulations. Combined with earlier investigations on modified βCDs, these results indicate general trends of the substituents on the thermodynamics of complex formation.

  18. Effects of pH on the association between the inhibitor cystatin and the proteinase chymopapain.

    PubMed

    Reyes-Espinosa, Francisco; Arroyo-Reyna, Alfonso; Garcia-Gutierrez, Ponciano; Serratos, Iris N; Zubillaga, Rafael A

    2014-01-01

    Cysteine proteinases are involved in many aspects of physiological regulation. In humans, some cathepsins have shown another function in addition to their role as lysosomal proteases in intracellular protein degradation; they have been implicated in the pathogenesis of several heart and blood vessel diseases and in cancer development. In this work, we present a fluorometric and computational study of the binding of one representative plant cysteine proteinase, chymopapain, to one of the most studied inhibitors of these proteinases: chicken cystatin. The binding equilibrium constant, Kb, was determined in the pH range between 3.5 and 10.0, revealing a maximum in the affinity at pH 9.0. We constructed an atomic model for the chymopapain-cystatin dimer by docking the individual 3D protein structures; subsequently, the model was refined using a 100 ns NPT molecular dynamics simulation in explicit water. Upon scrutiny of this model, we identified 14 ionizing residues at the interface of the complex using a cutoff distance of 5.0 Å. Using the pKa values predicted with PROPKA and a modified proton-linkage model, we performed a regression analysis on our data to obtain the composite pKavalues for three isoacidic residues. We also calculated the electrostatic component of the binding energy (ΔGb,elec) at different pH values using an implicit solvent model and APBS software. The pH profile of this calculated energy compares well with the experimentally obtained binding energy, ΔGb. We propose that the residues that form an interchain ionic pair, Lys139A from chymopapain and Glu19B from cystatin, as well as Tyr61A and Tyr67A from chymopapain are the main residues responsible for the observed pH dependence in the chymopapain- cystatin affinity.

  19. Design of graphene nanoparticle undergoing axial compression: quantum study

    NASA Astrophysics Data System (ADS)

    Glukhova, O. E.; Kirillova, I. V.; Saliy, I. N.; Kolesnikova, A. S.; Slepchenkov, M. M.

    2011-03-01

    We report the results of quantum mechanical investigations of the atomic structure and deformations of graphene nanoparticle undergoing axial compression. We applied the tight-binding (TB) method. Our transferable tightbinding potential correctly reproduced tight-binding changes in the electronic configuration as a function of the local bonding geometry around each carbon atom. The tight-binding method applied provided the consideration and calculation of the rehybridization between σ- and π-orbitals. To research nanoribbons using tight-binding potential our own program was used. We adapted TB method to be able to run the algorithm on a parallel computing machine (computer cluster). To simulate axial compression of graphene nanoparticles the atoms on the ends were fixed on the plates. The plates were moved towards each other to decrease the length at some percent. Plane atomic network undergoing axial compression became wave-like. The amplitude of wave and its period were not constant and changed along axis. This is a phase transition. The strain energy collapse occurs at the value of axial compression 0.03-0.04. The strain energy increased up to the quantity compression 0.03, then collapsed sharply and decreased. So according to our theoretical investigation, the elasticity of graphene nanoparticles is more than the elasticity of nanotubes the same width and length. The curvature of the atomic network because of compression will decrease the reactivity of graphene nanoparticles. We have calculated the atomic structure and electronic structure of the compression graphene nanopaticle at each step of strain of axial compression. We have come to the conclusion that the wave-like graphenes adsorbing protein and nucleic acid are the effective nanosensors and bionanosensors.

  20. A global reaction route mapping-based kinetic Monte Carlo algorithm

    NASA Astrophysics Data System (ADS)

    Mitchell, Izaac; Irle, Stephan; Page, Alister J.

    2016-07-01

    We propose a new on-the-fly kinetic Monte Carlo (KMC) method that is based on exhaustive potential energy surface searching carried out with the global reaction route mapping (GRRM) algorithm. Starting from any given equilibrium state, this GRRM-KMC algorithm performs a one-step GRRM search to identify all surrounding transition states. Intrinsic reaction coordinate pathways are then calculated to identify potential subsequent equilibrium states. Harmonic transition state theory is used to calculate rate constants for all potential pathways, before a standard KMC accept/reject selection is performed. The selected pathway is then used to propagate the system forward in time, which is calculated on the basis of 1st order kinetics. The GRRM-KMC algorithm is validated here in two challenging contexts: intramolecular proton transfer in malonaldehyde and surface carbon diffusion on an iron nanoparticle. We demonstrate that in both cases the GRRM-KMC method is capable of reproducing the 1st order kinetics observed during independent quantum chemical molecular dynamics simulations using the density-functional tight-binding potential.

  1. Theoretical and Experimental Study of Inclusion Complexes of β-Cyclodextrins with Chalcone and 2',4'-Dihydroxychalcone.

    PubMed

    Sancho, Matias I; Andujar, Sebastian; Porasso, Rodolfo D; Enriz, Ricardo D

    2016-03-31

    The inclusion complexes formed by chalcone and 2',4'-dihydroxychalcone with β-cyclodextrin have been studied combining experimental (phase solubility diagrams, Fourier transform infrared spectroscopy) and molecular modeling (molecular dynamics, quantum mechanics/molecular mechanics calculations) techniques. The formation constants of the complexes were determined at different temperatures, and the thermodynamic parameters of the process were obtained. The inclusion of chalcone in β-cyclodextrin is an exothermic process, while the inclusion of 2',4'-dihydroxychalcone is endothermic. Free energy profiles, derived from umbrella sampling using molecular dynamics simulations, were constructed to analyze the binding affinity and the complexation reaction at a molecular level. Hybrid QM/MM calculations were also employed to obtain a better description of the energetic and structural aspects of the complexes. The intermolecular interactions that stabilize both inclusion complexes were characterized by means of quantum atoms in molecules theory and reduce density gradient method. The calculated interactions were experimentally observed using FTIR.

  2. A global reaction route mapping-based kinetic Monte Carlo algorithm.

    PubMed

    Mitchell, Izaac; Irle, Stephan; Page, Alister J

    2016-07-14

    We propose a new on-the-fly kinetic Monte Carlo (KMC) method that is based on exhaustive potential energy surface searching carried out with the global reaction route mapping (GRRM) algorithm. Starting from any given equilibrium state, this GRRM-KMC algorithm performs a one-step GRRM search to identify all surrounding transition states. Intrinsic reaction coordinate pathways are then calculated to identify potential subsequent equilibrium states. Harmonic transition state theory is used to calculate rate constants for all potential pathways, before a standard KMC accept/reject selection is performed. The selected pathway is then used to propagate the system forward in time, which is calculated on the basis of 1st order kinetics. The GRRM-KMC algorithm is validated here in two challenging contexts: intramolecular proton transfer in malonaldehyde and surface carbon diffusion on an iron nanoparticle. We demonstrate that in both cases the GRRM-KMC method is capable of reproducing the 1st order kinetics observed during independent quantum chemical molecular dynamics simulations using the density-functional tight-binding potential.

  3. Kinetics of protein–ligand unbinding: Predicting pathways, rates, and rate-limiting steps

    PubMed Central

    Tiwary, Pratyush; Limongelli, Vittorio; Salvalaglio, Matteo; Parrinello, Michele

    2015-01-01

    The ability to predict the mechanisms and the associated rate constants of protein–ligand unbinding is of great practical importance in drug design. In this work we demonstrate how a recently introduced metadynamics-based approach allows exploration of the unbinding pathways, estimation of the rates, and determination of the rate-limiting steps in the paradigmatic case of the trypsin–benzamidine system. Protein, ligand, and solvent are described with full atomic resolution. Using metadynamics, multiple unbinding trajectories that start with the ligand in the crystallographic binding pose and end with the ligand in the fully solvated state are generated. The unbinding rate koff is computed from the mean residence time of the ligand. Using our previously computed binding affinity we also obtain the binding rate kon. Both rates are in agreement with reported experimental values. We uncover the complex pathways of unbinding trajectories and describe the critical rate-limiting steps with unprecedented detail. Our findings illuminate the role played by the coupling between subtle protein backbone fluctuations and the solvation by water molecules that enter the binding pocket and assist in the breaking of the shielded hydrogen bonds. We expect our approach to be useful in calculating rates for general protein–ligand systems and a valid support for drug design. PMID:25605901

  4. Determining the binding affinities of phenolic compounds to proteins by quenching of the intrinsic tryptophan fluorescence.

    PubMed

    Rawel, Harshadrai M; Frey, Simone K; Meidtner, Karina; Kroll, Jürgen; Schweigert, Florian J

    2006-08-01

    The noncovalent binding of selected phenolic compounds (chlorogenic-, ferulic-, gallic acid, quercetin, rutin, and isoquercetin) to proteins (HSA, BSA, soy glycinin, and lysozyme) was studied by an indirect method applying the quenching of intrinsic tryptophan fluorescence. From the data obtained, the binding constants were calculated by nonlinear regression (one site binding; y = Bx/k + x). It has been reported that tannins inhibit human salivary amylase and that these complexes may reduce the development of cariogenic plaques. Further, amylase contains two tryptophan residues in its active site. Therefore, in a second part of the study involving 31 human subjects, evidence was sought for noncovalent interactions between the phenols of green tea and saliva proteins as measured by the fluorescence intensity. Amylase activity was determined before and after the addition of green tea to saliva of 31 subjects. Forty percent of the subjects showed an increase in amylase activity contrary to studies reporting only a decrease in activity. The interactions of tannin with amylase result in a decrease of its activity. It still remains to be elucidated why amylase does not react uniformly under conditions of applying green tea to saliva. Further, in terms of using phenols as caries inhibitors this finding should be of importance.

  5. Effect of halo-substituted aromatic salts on counterion binding constants obtained from cationic nanoparticle catalyzed reactions of piperidine and phenyl salicylate

    NASA Astrophysics Data System (ADS)

    Fagge, Ibrahim I.; Yusof, Nor Saadah M.; Zain, Sharifuddin Md; Khan, M. Niyaz

    2017-12-01

    Halo-substitutions at 3-position of benzene ring of the salts of aromatic carboxylate, MX, revealed the effect of two different halide ions (Br- and Cl-) on the counterion binding constants obtained from cationic nanoparticle catalyzed piperidinolysis of ionized phenyl salicylate (PhS-). The values of observed rate constant, kobs, determined at a constant total concentration of cetyltrimethylammonium bromide, [CTABr]T, piperidine, ([P]T), [PhS-]T, NaOH, and various concentration of MX (MX = 3-BrC6H4CO2Na and 3-ClC6H4CO2Na), were determined using UV-visible X spectrophotometric technique at 35 °C and 370 nm. The average value of nanoparticle binding constant, KXBr, for X- = 3-BrC6H4CO2- (RXBr = 57) was found to be about 2-fold larger than that for X- = 3-ClC6H4CO2- (RXBr = 30). These XX values were dependent of substituents 3-Br and 3-Cl, and independent of [CTABr]T. Both are related to the presence of different extent of viscoelastic worm-like nanoparticles formation in the [CTABr]T of 6 and 10 mM.

  6. Label-Free Determination of Protein Binding in Aqueous Solution using Overlayer Enhanced Attenuated Total Reflectance Fourier Transform Infrared Spectroscopy (OE-ATR-FTIR)

    NASA Astrophysics Data System (ADS)

    Ruthenburg, Travis; Aweda, Tolulope; Park, Simon; Meares, Claude; Land, Donald

    2009-03-01

    Protein binding/affinity studies are often performed using Surface Plasmon Resonance techniques that don't produce much spectral information. Measurement of protein binding affinity using FTIR is traditionally performed using high protein concentration or deuterated solvent. By immobilizing a protein near the surface of a gold-coated germanium internal reflection element interactions can be measured between an immobilized protein and free proteins or small molecules in aqueous solution. By monitoring the on and off rates of these interactions, the dissociation constant for the system can be determined. The dissociation constant for the molecule Yttrium-DOTA binding to the antibody 2D12.5 system was determined to be 100nM. Results will also be presented from our measurements of Bovine Serum Albumin (BSA) binding to anti-BSA.

  7. Computational Calorimetry: High-Precision Calculation of Host–Guest Binding Thermodynamics

    PubMed Central

    2015-01-01

    We present a strategy for carrying out high-precision calculations of binding free energy and binding enthalpy values from molecular dynamics simulations with explicit solvent. The approach is used to calculate the thermodynamic profiles for binding of nine small molecule guests to either the cucurbit[7]uril (CB7) or β-cyclodextrin (βCD) host. For these systems, calculations using commodity hardware can yield binding free energy and binding enthalpy values with a precision of ∼0.5 kcal/mol (95% CI) in a matter of days. Crucially, the self-consistency of the approach is established by calculating the binding enthalpy directly, via end point potential energy calculations, and indirectly, via the temperature dependence of the binding free energy, i.e., by the van’t Hoff equation. Excellent agreement between the direct and van’t Hoff methods is demonstrated for both host–guest systems and an ion-pair model system for which particularly well-converged results are attainable. Additionally, we find that hydrogen mass repartitioning allows marked acceleration of the calculations with no discernible cost in precision or accuracy. Finally, we provide guidance for accurately assessing numerical uncertainty of the results in settings where complex correlations in the time series can pose challenges to statistical analysis. The routine nature and high precision of these binding calculations opens the possibility of including measured binding thermodynamics as target data in force field optimization so that simulations may be used to reliably interpret experimental data and guide molecular design. PMID:26523125

  8. Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR

    NASA Astrophysics Data System (ADS)

    D'Aquino, J. Alejandro; Ringe, Dagmar

    2006-08-01

    The diphtheria toxin repressor, DtxR, is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear (1 - 3). Calorimetric techniques have demonstrated that while binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 × 10-7, binding site 2 (primary) is a low affinity binding site with a binding constant of 6.3 × 10-4. These two binding sites act independently and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A,C102D), reported here and the previously reported DtxR(H79A) (4) has allowed us to propose a mechanism of metal ion activation for DtxR.

  9. Characterization of solution-phase drug-protein interactions by ultrafast affinity extraction.

    PubMed

    Beeram, Sandya R; Zheng, Xiwei; Suh, Kyungah; Hage, David S

    2018-03-03

    A number of tools based on high-performance affinity separations have been developed for studying drug-protein interactions. An example of one recent approach is ultrafast affinity extraction. This method has been employed to examine the free (or non-bound) fractions of drugs and other solutes in simple or complex samples that contain soluble binding agents. These free fractions have also been used to determine the binding constants and rate constants for the interactions of drugs with these soluble agents. This report describes the general principles of ultrafast affinity extraction and the experimental conditions under which it can be used to characterize such interactions. This method will be illustrated by utilizing data that have been obtained when using this approach to measure the binding and dissociation of various drugs with the serum transport proteins human serum albumin and alpha 1 -acid glycoprotein. A number of practical factors will be discussed that should be considered in the design and optimization of this approach for use with single-column or multi-column systems. Techniques will also be described for analyzing the resulting data for the determination of free fractions, rate constants and binding constants. In addition, the extension of this method to complex samples, such as clinical specimens, will be considered. Copyright © 2018 Elsevier Inc. All rights reserved.

  10. Metal binding stoichiometry and isotherm choice in biosorption

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schiewer, S.; Wong, M.H.

    1999-11-01

    Seaweeds that possess a high metal binding capacity may be used as biosorbents for the removal of toxic heavy metals from wastewater. The binding of Cu and Ni by three brown algae (Sargassum, Colpomenia, Petalonia) and one green alga (Ulva) was investigated at pH 4.0 and pH 3.0. The greater binding strength of Cu is reflected in a binding constant that is about 10 times as high as that of Ni. The extent of metal binding followed the order Petalonia {approximately} Sargassum > Colpomenia > Ulva. This was caused by a decreasing number of binding sites and by much lowermore » metal binding constants for Ulva as compared to the brown algae. Three different stoichiometric assumptions are compared for describing the metal binding, which assume either that each metal ion M binds to one binding site B forming a BM complex or that a divalent metal ion M binds to two monovalent sites B forming BM{sub 0.5} or B{sub 2}M complexes, respectively. Stoichiometry plots are proposed as tools to discern the relevant binding stoichiometry. The pH effect in metal binding and the change in proton binding were well predicted for the B{sub 2}M or BM{sub 0.5} stoichiometries with the former being better for Cu and the latter preferable for Ni. Overall, the BM{sub 0.5} model is recommended because it avoids iterations.« less

  11. Investigation of the binding of Salvianolic acid B to human serum albumin and the effect of metal ions on the binding

    NASA Astrophysics Data System (ADS)

    Chen, Tingting; Cao, Hui; Zhu, Shajun; Lu, Yapeng; Shang, Yanfang; Wang, Miao; Tang, Yanfeng; Zhu, Li

    2011-10-01

    The studies on the interaction between HSA and drugs have been an interesting research field in life science, chemistry and clinical medicine. There are also many metal ions present in blood plasma, thus the research about the effect of metal ions on the interaction between drugs and plasma proteins is crucial. In this study, the interaction of Salvianolic acid B (Sal B) with human serum albumin (HSA) was investigated by the steady-state, synchronous fluorescence and circular dichroism (CD) spectroscopies. The results showed that Sal B had a strong ability to quench the intrinsic fluorescence of HSA through a static quenching mechanism. Binding parameters calculated showed that Sal B was bound to HSA with the binding affinities of 10 5 L mol -1. The thermodynamic parameters studies revealed that the binding was characterized by positive enthalpy and positive entropy changes, and hydrophobic interactions were the predominant intermolecular forces to stabilize the complex. The specific binding distance r (2.93 nm) between donor (HSA) and acceptor (Sal B) was obtained according to Förster non-radiative resonance energy transfer theory. The synchronous fluorescence experiment revealed that Sal B cannot lead to the microenvironmental changes around the Tyr and Trp residues of HSA, and the binding site of Sal B on HSA is located in hydrophobic cavity of subdomain IIA. The CD spectroscopy indicated the secondary structure of HSA is not changed in the presence of Sal B. Furthermore, The effect of metal ions (e.g. Zn 2+, Cu 2+, Co 2+, Ni 2+, Fe 3+) on the binding constant of Sal B-HSA complex was also discussed.

  12. Binding of polychlorinated biphenyls to aquatic humic substances: The role of substrate and sorbate properties on partitioning

    USGS Publications Warehouse

    Uhle, M.E.; Chin, Y.-P.; Aiken, G.R.; McKnight, Diane M.

    1999-01-01

    Two ortho- (2,2',5 and 2,2',5,6') and a non-ortho- (3,3',4,4') substituted polychlorinated biphenyl (PCB) congeners were used to study the effects of sorbate structure in binding processes to two lacustrine fulvic acids. Binding constants were determined by solubility enhancement of the solutes by the fulvic acids. The binding of the ortho-trichlorobiphenyl was significantly less than the non-ortho-substituted tetrachlorobiphenyl to both fulvic acids. Surprisingly, the measured ortho-trichlorobiphenyl binding constant to both fulvic acids was approximately the same as the ortho- substituted tetrachlorobiphenyl. The effect of the chlorines in the ortho position inhibits free rotation around the 1,1' carbon bond, thereby making the molecule less able to interact effectively with the fulvic acid substrate relative to its non-ortho-substituted congeners. Finally, binding of all three PCBs to the Great Dismal Swamp fulvic acid was significantly higher than for the Pony Lake sample. This observation is attributable to the former substrate's higher degree of aromaticity and polarizability, which can potentially interact more favorably with the PCBs through an increase in van der Waals type interactions.Two ortho- (2,2???,5 and 2,2???,5,6???) and a non-ortho- (3,3???,4,4???) substituted polychlorinated biphenyl (PCB) congeners were used to study the effects of sorbate structure in binding processes to two lacustrine fulvic acids. Binding constants were determined by solubility enhancement of the solutes by the fulvic acids. The binding of the ortho-trichlorobiphenyl was significantly less than the non-ortho-substituted tetrachlorobiphenyl to both fulvic acids. Surprisingly, the measured ortho-trichlorobiphenyl binding constant to both fulvic acids was approximately the same as the ortho-substituted tetrachlorobiphenyl. The effect of the chlorines in the ortho position inhibits free rotation around the 1,1??? carbon bond, thereby making the molecule less able to interact effectively with the fulvic acid substrate relative to its non-ortho-substituted congeners. Finally, binding of all three PCBs to the Great Dismal Swamp fulvic acid was significantly higher than for the Pony Lake sample. This observation is attributable to the former substrate's higher degree of aromaticity and polarizability, which can potentially interact more favorably with the PCBs through an increase in van der Waals type interactions.

  13. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sawada, Y.; Kawai, R.; McManaway, M.

    (3H)Cyclofoxy (CF: 17-cyclopropylmethyl-3,14-dihydroxy-4,5-alpha-epoxy-6-beta-fluoromorp hinan) is an opioid antagonist with affinity to both mu and kappa subtypes that was synthesized for quantitative evaluation of opioid receptor binding in vivo. Two sets of experiments in rats were analyzed. The first involved determining the metabolite-corrected blood concentration and tissue distribution of CF in brain 1 to 60 min after i.v. bolus injection. The second involved measuring brain washout for 15 to 120 s following intracarotid artery injection of CF. A physiologically based model and a classical compartmental pharmacokinetic model were compared. The models included different assumptions for transport across the blood-brain barrier (BBB);more » estimates of nonspecific tissue binding and specific binding to a single opiate receptor site were found to be essentially the same with both models. The nonspecific binding equilibrium constant varied modestly in different brain structures (Keq = 3-9), whereas the binding potential (BP) varied over a much broader range (BP = 0.6-32). In vivo estimates of the opioid receptor dissociation constant were similar for different brain structures (KD = 2.1-5.2 nM), whereas the apparent receptor density (Bmax) varied between 1 (cerebellum) and 78 (thalamus) pmol/g of brain. The receptor dissociation rate constants in cerebrum (k4 = 0.08-0.16 min-1; koff = 0.16-0.23 min-1) and brain vascular permeability (PS = 1.3-3.4 ml/min/g) are sufficiently high to achieve equilibrium conditions within a reasonable period of time. Graphical analysis of the data is inappropriate due to the high tissue-loss rate constant for CF in brain. From these findings, CF should be a very useful opioid receptor ligand for the estimation of the receptor binding parameters in human subjects using (18F)CF and positron emission tomography.« less

  14. An in situ method to quantitatively determine dissolved free drug concentrations in vitro in the presence of polymer excipients using pulsatile microdialysis (PMD).

    PubMed

    Vejani, Charchil; Bellantone, Robert A

    2015-12-30

    In drug formulations containing polymer excipients, the effects of the polymer on the dissolved free drug concentration and resulting dissolution or release can be important, especially for poorly soluble drugs. In this study, an in vitro method based on pulsatile microdialysis (PMD) was developed to quantitatively determine dissolved free concentrations of drugs in the presence of polymers in aqueous media in situ (e.g., in place within the system being characterized). Formulations were made by dissolving various ratios of the drug griseofulvin and polymer PVP K30 in water and allowing the mix to equilibrate. A PMD probe was immersed in each mixture and the dissolved free drug concentrations were determined in the PMD samples. The experimental procedure and the equations used for data analysis are presented. To assess the consistency of data, a binding model was fit to the data obtained using PMD by calculating the dissolved free drug fraction fD for each drug-polymer ratio in solution, and obtaining the product of the binding stoichiometry and binding constant (νK per mole of polymer) from the slope of a plot of (1-fD)/fD vs. the molar polymer concentration. For comparison, equilibrium binding experiments were also performed at 23C, and the determined value of νK was similar to the value found using PMD. Experiments were performed at three temperatures, and a plot of ln (νK) vs. 1/T was linear and a binding enthalpy of -110.9±4.4J/mol of monomer was calculated from its slope. It was concluded that PMD can be used to determine the dissolved free drug concentrations in situ, which allows characterization of the drug-polymer interaction, even for low drug concentrations. This information may be important in modeling the dissolution or release of drugs from formulations containing polymers. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. A critical review of three methods used for the measurement of mercury (Hg2+)-dissolved organic matter stability constants

    USGS Publications Warehouse

    Gasper, J.D.; Aiken, G.R.; Ryan, J.N.

    2007-01-01

    Three experimental techniques - ion exchange, liquid-liquid extraction with competitive ligand exchange, and solid-phase extraction with competitive ligand exchange (CLE-SPE) - were evaluated as methods for determining conditional stability constants (K) for the binding of mercury (Hg2+) to dissolved organic matter (DOM). To determine the utility of a given method to measure stability constants at environmentally relevant experimental conditions, experimental results should meet three criteria: (1) the data must be experimentally valid, in that they were acquired under conditions that meet all the requirements of the experimental method, (2) the Hg:DOM ratio should be determined and it should fall within levels that are consistent with environmental conditions, and (3) the stability constants must fall within the detection window of the method. The ion exchange method was found to be limited by its detection window, which constrains the method to stability constants with log K values less than about 14. The liquid-liquid extraction method was found to be complicated by the ability of Hg-DOM complexes to partition into the organic phase. The CLE-SPE method was found to be the most suitable of these methods for the measurement of Hg-DOM stability constants. Stability constants for DOM isolates measured using the CLE-SPE method at environmentally relevant Hg:DOM ratios were log K = 25-30 (M-1). These values are consistent with the strong Hg2+ binding expected for reduced S-containing binding sites. ?? 2007 Elsevier Ltd. All rights reserved.

  16. Esr Spectra of Alkali-Metal Atoms on Helium Nanodroplets: a Theoretical Model for the Prediction of Helium Induced Hyperfine Structure Shifts

    NASA Astrophysics Data System (ADS)

    Hauser, Reas W.; Filatov, Michael; Ernst, Wolfgang E.

    2013-06-01

    We predict He-droplet-induced changes of the isotropic HFS constant a_{HFS} of the alkali-metal atoms M = Li, Na, K and Rb on the basis of a model description. Optically detected electron spin resonance spectroscopy has allowed high resolution measurements that show the influence of the helium droplet and its size on the unpaired electron spin density at the alkali nucleus. Our theoretical approach to describe this dependence is based on a combination of two well established techniques: Results of relativistic coupled-cluster calculations on the alkali-He dimers (energy and HFS constant as functions of the binding length) are mapped onto the doped-droplet-situation with the help of helium-density functional theory. We simulate doped droplets He_{N} with N ranging from 50 to 10000, using the diatomic alkali-He-potential energy curves as input. From the obtained density profiles we evaluate average distances between the dopant atom and its direct helium neighborhood. The distances are then set in relation to the variation of the HFS constant with binding length in the simplified alkali-He-dimer model picture. This method yields reliable relative shifts but involves a systematic absolute error. Hence, the absolute values of the shifts are tied to one experimentally determined HFS constant for ^{85}Rb-He_{N = 2000}. With this parameter choice we obtain results in good agreement with the available experimental data for Rb and K^{a,b} confirming the predicted 1/N trend of the functional dependence^{c}. M. Koch, G. Auböck, C. Callegari, and W. E. Ernst, Phys. Rev. Lett. 103, 035302-1-4 (2009) M. Koch, C. Callegari, and W. E. Ernst, Mol. Phys. 108 (7), 1005-1011 (2010) A. W. Hauser, T. Gruber, M. Filatov, and W. E. Ernst, ChemPhysChem (2013) online DOI: 10.1002/cphc.201200697

  17. Lactose-installed poly(ethylene glycol)-poly(d,l-lactide) block copolymer micelles exhibit fast-rate binding and high affinity toward a protein bed simulating a cell surface. A surface plasmon resonance study.

    PubMed

    Jule, Eduardo; Nagasaki, Yukio; Kataoka, Kazunori

    2003-01-01

    Lactose molecules were installed on the surface of poly(ethylene glycol)-poly(d,l-lactide) (PEG-PLA) block copolymer micelles in the scope of seeking specific recognition by cell surface receptors at hepatic sites. This, in turn, is expected to result in the formation of a complex displaying prolonged retention times and thus enhanced cellular internalization by receptor-mediated endocytosis. The so-obtained particles based on a block copolymer of molecular weight 9400 g/mol (4900/4500 g/mol for the PEG and PLA blocks, respectively) were found to have an average hydrodynamic diameter of 31.8 nm, as measured by dynamic light scattering. Further, the particle size distribution (micro(2)/Gamma(2)) was found to be lower than 0.08. Lactose-PEG-PLA micelles (Lac-micelles) were then injected over a gold surface containing Ricinus communis agglutinin lectins simulating the aforementioned glycoreceptors, and their interaction was studied by surface plasmon resonance. Then, a kinetic evaluation was carried out, by fitting the observed data mathematically. It appears that Lac-micelles bind in a multivalent manner to the lectin protein bed, which logically results in low dissociation constants. Micelles bearing a ligand density of 80% (Lac-micelles 80%: 80 lactose molecules per 100 copolymer chains) exhibit fast association phases (k(a1) = 3.2 x 10(4) M(-)(1) s(-)(1)), but also extremely slow dissociation phases (k(d1) = 1.3 x 10(-)(4) s(-)(1)). Recorded sensorgrams were fitted with a trivalent model, conveying a calculated equilibrium dissociation constant (K(D1) = k(d1)/k(a1)) of about 4 nM. The importance of cooperative binding was also assessed, by preparing Lac-micelles bearing different ligand densities, and by discussing the influence of the latter on kinetic constants. Interestingly enough, whereas Lac-micelles 80% bind in a trivalent manner to the protein bed, Lac-micelles 20% are still capable of forming bivalent complexes with the same protein bed (K(D1) = 1360 nM). Therefore, despite enhanced kinetic values brought about by a supplementary bond, lower ligand densities appear to be more effective on a molecular basis.

  18. Spectral and computational features of the binding between riparins and human serum albumin

    NASA Astrophysics Data System (ADS)

    Camargo, Cintia Ramos; Caruso, Ícaro Putinhon; Gutierrez, Stanley Juan Chavez; Fossey, Marcelo Andres; Filho, José Maria Barbosa; Cornélio, Marinônio Lopes

    2018-02-01

    The green Brazilian bay leaf, a spice much prized in local cuisine (Aniba riparia, Lauraceae), contains chemical compounds presenting benzoyl-derivatives named riparins, which have anti-inflammatory, antimicrobial and anxiolytic properties. However, it is unclear what kind of interaction riparins perform with any molecular target. As a profitable target, human serum albumin (HSA) is one of the principal extracellular proteins, with an exceptional capacity to interact with several molecules, and it also plays a crucial role in the transport, distribution, and metabolism of a wide variety of endogenous and exogenous ligands. To outline the HSA-riparin interaction mechanism, spectroscopy and computational methods were synergistically applied. An evaluation through fluorescence spectroscopy showed that the emission, attributed to Trp 214, at 346 nm decreased with titrations of riparins. A static quenching mechanism was observed in the binding of riparins to HSA. Fluorescence experiments performed at 298, 308 and 318 K made it possible to conduct thermodynamic analysis indicating a spontaneous reaction in the complex formation (ΔG < 0). The enthalpy-entropy balance experiment with a molecular modeling calculation revealed that hydrophobic, hydrogen bond and non-specific interactions are present for riparin I-III with HSA. The set of results from fractional fluorescence changes obtained through Schatchard was inconclusive in establishing what kind of cooperativity is present in the interaction. To shed light upon the HSA-riparins complex, Hill's approach was utilized to distinguish the index of affinity and the binding constant. A correspondence between the molecular structures of riparins, due to the presence of the hydroxyl group in the B-ring, with thermodynamic parameters and index of affinity were observed. Riparin III performs an intramolecular hydrogen bond, which affects the Hill coefficient and the binding constant. Therefore, the presence of hydroxyl groups is capable of modulating the interaction between riparins and HSA. Site marker competitive experiments indicated Site I as being the most suitable, and the molecular modeling tools reinforced the experimental results detailing the participation of residues.

  19. Interaction between phillygenin and human serum albumin based on spectroscopic and molecular docking

    NASA Astrophysics Data System (ADS)

    Song, W.; Ao, M. Z.; Shi, Y.; Yuan, L. F.; Yuan, X. X.; Yu, L. J.

    2012-01-01

    In this paper, the interaction of human serum albumin (HSA) with phillygenin was investigated by fluorescence, circular dichroism (CD), UV-vis spectroscopic and molecular docking methods under physiological conditions. The Stern-Volmer analysis indicated that the fluorescence quenching of HSA by phillygenin resulted from static mechanism, and the binding constants were 1.71 × 10 5, 1.61 × 10 5 and 1.47 × 10 4 at 300, 305 and 310 K, respectively. The results of UV-vis spectra show that the secondary structure of the protein has been changed in the presence of phillygenin. The CD spectra showed that HSA conformation was altered by phillygenin with a major reduction of α-helix and an increase in β-sheet and random coil structures, indicating a partial protein unfolding. The distance between donor (HSA) and acceptor (phillygenin) was calculated to be 3.52 nm and the results of synchronous fluorescence spectra showed that binding of phillygenin to HSA can induce conformational changes in HSA. Molecular docking experiments found that phillygenin binds with HSA at IIIA domain of hydrophobic pocket with hydrogen bond interactions. The ionic bonds were formed with the O (4), O (5) and O (6) of phillygenin with nitrogen of ASN109, ARG186 and LEU115, respectively. The hydrogen bonds are formed between O (2) of phillygenin and SER419. In the presence of copper (II), iron (III) and alcohol, the apparent association constant KA and the number of binding sites of phillygenin on HSA were both decreased in the range of 88.84-91.97% and 16.09-18.85%, respectively. In view of the evidence presented, it is expected to enrich our knowledge of the interaction dynamics of phillygenin to the important plasma protein HSA, and it is also expected to provide important information of designs of new inspired drugs.

  20. Development of Quantum Chemical Method to Calculate Half Maximal Inhibitory Concentration (IC50 ).

    PubMed

    Bag, Arijit; Ghorai, Pradip Kr

    2016-05-01

    Till date theoretical calculation of the half maximal inhibitory concentration (IC50 ) of a compound is based on different Quantitative Structure Activity Relationship (QSAR) models which are empirical methods. By using the Cheng-Prusoff equation it may be possible to compute IC50 , but this will be computationally very expensive as it requires explicit calculation of binding free energy of an inhibitor with respective protein or enzyme. In this article, for the first time we report an ab initio method to compute IC50 of a compound based only on the inhibitor itself where the effect of the protein is reflected through a proportionality constant. By using basic enzyme inhibition kinetics and thermodynamic relations, we derive an expression of IC50 in terms of hydrophobicity, electric dipole moment (μ) and reactivity descriptor (ω) of an inhibitor. We implement this theory to compute IC50 of 15 HIV-1 capsid inhibitors and compared them with experimental results and available other QASR based empirical results. Calculated values using our method are in very good agreement with the experimental values compared to the values calculated using other methods. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Calculation of individual isotope equilibrium constants for implementation in geochemical models

    USGS Publications Warehouse

    Thorstenson, Donald C.; Parkhurst, David L.

    2002-01-01

    Theory is derived from the work of Urey to calculate equilibrium constants commonly used in geochemical equilibrium and reaction-transport models for reactions of individual isotopic species. Urey showed that equilibrium constants of isotope exchange reactions for molecules that contain two or more atoms of the same element in equivalent positions are related to isotope fractionation factors by , where is n the number of atoms exchanged. This relation is extended to include species containing multiple isotopes, for example and , and to include the effects of nonideality. The equilibrium constants of the isotope exchange reactions provide a basis for calculating the individual isotope equilibrium constants for the geochemical modeling reactions. The temperature dependence of the individual isotope equilibrium constants can be calculated from the temperature dependence of the fractionation factors. Equilibrium constants are calculated for all species that can be formed from and selected species containing , in the molecules and the ion pairs with where the subscripts g, aq, l, and s refer to gas, aqueous, liquid, and solid, respectively. These equilibrium constants are used in the geochemical model PHREEQC to produce an equilibrium and reaction-transport model that includes these isotopic species. Methods are presented for calculation of the individual isotope equilibrium constants for the asymmetric bicarbonate ion. An example calculates the equilibrium of multiple isotopes among multiple species and phases.

  2. Comprehensive insight into the binding of sunitinib, a multi-targeted anticancer drug to human serum albumin

    NASA Astrophysics Data System (ADS)

    Kabir, Md. Zahirul; Tee, Wei-Ven; Mohamad, Saharuddin B.; Alias, Zazali; Tayyab, Saad

    2017-06-01

    Binding studies between a multi-targeted anticancer drug, sunitinib (SU) and human serum albumin (HSA) were made using fluorescence, UV-vis absorption, circular dichroism (CD) and molecular docking analysis. Both fluorescence quenching data and UV-vis absorption results suggested formation of SU-HSA complex. Moderate binding affinity between SU and HSA was evident from the value of the binding constant (3.04 × 104 M-1), obtained at 298 K. Involvement of hydrophobic interactions and hydrogen bonds as the leading intermolecular forces in the formation of SU-HSA complex was predicted from the thermodynamic data of the binding reaction. These results were in good agreement with the molecular docking analysis. Microenvironmental perturbations around Tyr and Trp residues as well as secondary and tertiary structural changes in HSA upon SU binding were evident from the three-dimensional fluorescence and circular dichroism results. SU binding to HSA also improved the thermal stability of the protein. Competitive displacement results and molecular docking analysis revealed the binding locus of SU to HSA in subdomain IIA (Sudlow's site I). The influence of a few common ions on the binding constant of SU-HSA complex was also noticed.

  3. Adsorption of surfactant ions and binding of their counterions at an air/water interface.

    PubMed

    Tagashira, Hiroaki; Takata, Youichi; Hyono, Atsushi; Ohshima, Hiroyuki

    2009-01-01

    An expression for the surface tension of an aqueous mixed solution of surfactants and electrolyte ions in the presence of the common ions was derived from the Helmholtz free energy of an air/water surface. By applying the equation to experimental data for the surface tension, the adsorption constant of surfactant ions onto the air/water interface, the binding constant of counterions on the surfactants, and the surface potential and surface charge density of the interface were estimated. The adsorption constant and binding constant were dependent on the species of surfactant ion and counterion, respectively. Taking account of the dependence of surface potential and surface charge density on the concentration of electrolyte, it was suggested that the addition of electrolyte to the aqueous surfactant solution brings about the decrease in the surface potential, the increase in the surface density of surfactant ions, and consequently, the decrease in the surface tension. Furthermore, it was found that the configurational entropy plays a predominant role for the surface tension, compared to the electrical work.

  4. Integrating a Smartphone and Molecular Modeling for Determining the Binding Constant and Stoichiometry Ratio of the Iron(II)-Phenanthroline Complex: An Activity for Analytical and Physical Chemistry Laboratories

    ERIC Educational Resources Information Center

    de Morais, Camilo de L. M.; Silva, Se´rgio R. B.; Vieira, Davi S.; Lima, Ka´ssio M. G.

    2016-01-01

    The binding constant and stoichiometry ratio for the formation of iron(II)-(1,10-phenanthroline) or iron(II)-o-phenanthroline complexes has been determined by a combination of a low-cost analytical method using a smartphone and a molecular modeling method as a laboratory experiment designed for analytical and physical chemistry courses. Intensity…

  5. Competitive counterion complexation allows the true host : guest binding constants from a single titration by ionic receptors.

    PubMed

    Pessêgo, Márcia; Basílio, Nuno; Muñiz, M Carmen; García-Río, Luis

    2016-07-06

    Counterion competitive complexation is a background process currently ignored by using ionic hosts. Consequently, guest binding constants are strongly affected by the design of the titration experiments in such a way that the results are dependent on the guest concentration and on the presence of added salts, usually buffers. In the present manuscript we show that these experimental difficulties can be overcome by just considering the counterion competitive complexation. Moreover a single titration allows us to obtain not only the true binding constants but also the stoichiometry of the complex showing the formation of 1 : 1 : 1 (host : guest : counterion) complexes. The detection of high stoichiometry complexes is not restricted to a single titration experiment but also to a displacement assay where both competitive and competitive-cooperative complexation models are taken into consideration.

  6. Spectroscopic investigation on the mechanism of formation of molecular complexes of albendazole and trimethoprim with 2,3-dichloro-5,6-dicyano-1,4-benzoquinone

    NASA Astrophysics Data System (ADS)

    Ganesh, K.; Balraj, C.; Satheshkumar, A.; Elango, K. P.

    2012-06-01

    UV-vis, 1H NMR, FT-IR, mass and fluorescence spectral techniques were employed to investigate the mechanism of interaction of albendazole and trimethoprim with 2,3-dichloro-5,6-dicyano-1,4-benzoquinone (DDQ) and to characterize the reaction products. The interaction of DDQ with trimethoprim (TMP) and albenadazole (ALB) were found to proceed through the formation of donor-acceptor complex, containing DDQ radical anion and its conversion to the product. Fluorescence quenching studies indicated that the interaction between the donors and the acceptor are spontaneous and the interaction of TMP-DDQ (binding constant = 2.9 × 105) is found to be stronger than that the ALB-DDQ (binding constant = 3 × 103) system. Also, the binding constant increased with an increase in polarity of the medium indicating the involvement of radical anion as intermediate.

  7. Antioxidative capacity and binding affinity of the complex of green tea catechin and beta-lactoglobulin glycated by the Maillard reaction.

    PubMed

    Perusko, Marija; Al-Hanish, Ayah; Mihailovic, Jelena; Minic, Simeon; Trifunovic, Sara; Prodic, Ivana; Cirkovic Velickovic, Tanja

    2017-10-01

    Major green tea catechin, epigallocatechin-3-gallate (EGCG), binds non-covalently to numerous dietary proteins, including beta-lactoglobulin of cow's milk. The effects of glycation of proteins via Maillard reaction on the binding capacity for polyphenols and the antiradical properties of the formed complexes have not been studied previously. Binding constant of BLG glycated by milk sugar lactose to EGCG was measured by the method of fluorophore quenching. Binding of EGCG was confirmed by CD and FTIR. The antioxidative properties of the complexes were examined by measuring ABTS radical scavenging capacity, superoxide anion scavenging capacity and total reducing power assay. Glycation of BLG does not significantly influence the binding constant of EGCG for the protein. Conformational changes were observed for both native and glycated BLG upon complexation with EGCG. Masking effect of polyphenol complexation on the antioxidative potential of the protein was of the similar degree for both glycated BLG and native BLG. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Determination of the DNA-binding characteristics of ethidium bromide, proflavine, and cisplatin by flow injection analysis: usefulness in studies on antitumor drugs.

    PubMed

    Alonso, A; Almendral, M J; Curto, Y; Criado, J J; Rodríguez, E; Manzano, J L

    2006-08-15

    Flow injection analysis was used to study the reactions occurring between DNA and certain compounds that bind to its double helix, deforming this and even breaking it, such that some of them (e.g., cisplatin) are endowed with antitumoral activity. Use of this technique in the merging zones and stopped-flow modes afforded data on the binding parameters and the kinetic characteristics of the process. The first compound studied was ethidium bromide (EtdBr), used as a fluorescent marker because its fluorescence is enhanced when it binds to DNA. The DNA-EtdBr binding parameters, the apparent intrinsic binding constant (0.31+/-0.02 microM(-1)), and the maximum number of binding sites per nucleotide (0.327+/-0.009) were determined. The modification introduced in these parameters by the presence of proflavine (Prf), a classic competitive inhibitor of the binding of EtdBr to the DNA double helix, was also studied, determining the value of the intrinsic binding constant of Prf (K(Prf) = 0.119+/-9x10(-3) microM(-1)). Finally, we determined the binding parameters between DNA and EtdBr in the presence of the antitumor agent cisplatin, a noncompetitive inhibitor of such binding. This provided information about the binding mechanism as well as the duration and activity of the binding of the compound in its pharmacological use.

  9. Binding free energies for nicotine analogs inhibiting cytochrome P450 2A6 by a combined use of molecular dynamics simulations and QM/MM-PBSA calculations.

    PubMed

    Lu, Haiting; Huang, Xiaoqin; AbdulHameed, Mohamed Diwan M; Zhan, Chang-Guo

    2014-04-01

    Molecular dynamics (MD) simulations and hybrid quantum mechanical/molecular mechanical (QM/MM) calculations have been performed to explore the dynamic behaviors of cytochrome P450 2A6 (CYP2A6) binding with nicotine analogs (that are typical inhibitors) and to calculate their binding free energies in combination with Poisson-Boltzmann surface area (PBSA) calculations. The combined MD simulations and QM/MM-PBSA calculations reveal that the most important structural parameters affecting the CYP2A6-inhibitor binding affinity are two crucial internuclear distances, that is, the distance between the heme iron atom of CYP2A6 and the coordinating atom of the inhibitor, and the hydrogen-bonding distance between the N297 side chain of CYP2A6 and the pyridine nitrogen of the inhibitor. The combined MD simulations and QM/MM-PBSA calculations have led to dynamic CYP2A6-inhibitor binding structures that are consistent with the observed dynamic behaviors and structural features of CYP2A6-inhibitor binding, and led to the binding free energies that are in good agreement with the experimentally-derived binding free energies. The agreement between the calculated binding free energies and the experimentally-derived binding free energies suggests that the combined MD and QM/MM-PBSA approach may be used as a valuable tool to accurately predict the CYP2A6-inhibitor binding affinities in future computational design of new, potent and selective CYP2A6 inhibitors. Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. Binding Rate Constants Reveal Distinct Features of Disordered Protein Domains.

    PubMed

    Dogan, Jakob; Jonasson, Josefin; Andersson, Eva; Jemth, Per

    2015-08-04

    Intrinsically disordered proteins (IDPs) are abundant in the proteome and involved in key cellular functions. However, experimental data about the binding kinetics of IDPs as a function of different environmental conditions are scarce. We have performed an extensive characterization of the ionic strength dependence of the interaction between the molten globular nuclear co-activator binding domain (NCBD) of CREB binding protein and five different protein ligands, including the intrinsically disordered activation domain of p160 transcriptional co-activators (SRC1, TIF2, ACTR), the p53 transactivation domain, and the folded pointed domain (PNT) of transcription factor ETS-2. Direct comparisons of the binding rate constants under identical conditions show that the association rate constant, kon, for interactions between NCBD and disordered protein domains is high at low salt concentrations (90-350 × 10(6) M(-1) s(-1) at 4 °C) but is reduced significantly (10-30-fold) with an increasing ionic strength and reaches a plateau around physiological ionic strength. In contrast, the kon for the interaction between NCBD and the folded PNT domain is only 7 × 10(6) M(-1) s(-1) (4 °C and low salt) and displays weak ionic strength dependence, which could reflect a distinctly different association that relies less on electrostatic interactions. Furthermore, the basal rate constant (in the absence of electrostatic interactions) is high for the NCBD interactions, exceeding those typically observed for folded proteins. One likely interpretation is that disordered proteins have a large number of possible collisions leading to a productive on-pathway encounter complex, while folded proteins are more restricted in terms of orientation. Our results highlight the importance of electrostatic interactions in binding involving IDPs and emphasize the significance of including ionic strength as a factor in studies that compare the binding properties of IDPs to those of ordered proteins.

  11. How to deal with multiple binding poses in alchemical relative protein-ligand binding free energy calculations.

    PubMed

    Kaus, Joseph W; Harder, Edward; Lin, Teng; Abel, Robert; McCammon, J Andrew; Wang, Lingle

    2015-06-09

    Recent advances in improved force fields and sampling methods have made it possible for the accurate calculation of protein–ligand binding free energies. Alchemical free energy perturbation (FEP) using an explicit solvent model is one of the most rigorous methods to calculate relative binding free energies. However, for cases where there are high energy barriers separating the relevant conformations that are important for ligand binding, the calculated free energy may depend on the initial conformation used in the simulation due to the lack of complete sampling of all the important regions in phase space. This is particularly true for ligands with multiple possible binding modes separated by high energy barriers, making it difficult to sample all relevant binding modes even with modern enhanced sampling methods. In this paper, we apply a previously developed method that provides a corrected binding free energy for ligands with multiple binding modes by combining the free energy results from multiple alchemical FEP calculations starting from all enumerated poses, and the results are compared with Glide docking and MM-GBSA calculations. From these calculations, the dominant ligand binding mode can also be predicted. We apply this method to a series of ligands that bind to c-Jun N-terminal kinase-1 (JNK1) and obtain improved free energy results. The dominant ligand binding modes predicted by this method agree with the available crystallography, while both Glide docking and MM-GBSA calculations incorrectly predict the binding modes for some ligands. The method also helps separate the force field error from the ligand sampling error, such that deviations in the predicted binding free energy from the experimental values likely indicate possible inaccuracies in the force field. An error in the force field for a subset of the ligands studied was identified using this method, and improved free energy results were obtained by correcting the partial charges assigned to the ligands. This improved the root-mean-square error (RMSE) for the predicted binding free energy from 1.9 kcal/mol with the original partial charges to 1.3 kcal/mol with the corrected partial charges.

  12. How To Deal with Multiple Binding Poses in Alchemical Relative Protein–Ligand Binding Free Energy Calculations

    PubMed Central

    2016-01-01

    Recent advances in improved force fields and sampling methods have made it possible for the accurate calculation of protein–ligand binding free energies. Alchemical free energy perturbation (FEP) using an explicit solvent model is one of the most rigorous methods to calculate relative binding free energies. However, for cases where there are high energy barriers separating the relevant conformations that are important for ligand binding, the calculated free energy may depend on the initial conformation used in the simulation due to the lack of complete sampling of all the important regions in phase space. This is particularly true for ligands with multiple possible binding modes separated by high energy barriers, making it difficult to sample all relevant binding modes even with modern enhanced sampling methods. In this paper, we apply a previously developed method that provides a corrected binding free energy for ligands with multiple binding modes by combining the free energy results from multiple alchemical FEP calculations starting from all enumerated poses, and the results are compared with Glide docking and MM-GBSA calculations. From these calculations, the dominant ligand binding mode can also be predicted. We apply this method to a series of ligands that bind to c-Jun N-terminal kinase-1 (JNK1) and obtain improved free energy results. The dominant ligand binding modes predicted by this method agree with the available crystallography, while both Glide docking and MM-GBSA calculations incorrectly predict the binding modes for some ligands. The method also helps separate the force field error from the ligand sampling error, such that deviations in the predicted binding free energy from the experimental values likely indicate possible inaccuracies in the force field. An error in the force field for a subset of the ligands studied was identified using this method, and improved free energy results were obtained by correcting the partial charges assigned to the ligands. This improved the root-mean-square error (RMSE) for the predicted binding free energy from 1.9 kcal/mol with the original partial charges to 1.3 kcal/mol with the corrected partial charges. PMID:26085821

  13. Quartz crystal microbalance for the cardiac markers/antibodies binding kinetic measurements in the plasma samples

    NASA Astrophysics Data System (ADS)

    Agafonova, L. E.; Shumyantseva, V. V.; Archakov, A. I.

    2014-06-01

    The quartz crystal microbalance (QCM) was exploited for cardiac markers detection and kinetic studies of immunochemical reaction of cardiac troponin I (cTnI) and human heart fatty acid binding protein (H-FABP) with the corresponding monoclonal antibodies in undiluted plasma (serum) and standard solutions. The QCM technique allowed to dynamically monitor the kinetic differences in specific interactions and nonspecific sorption, without multiple labeling procedures and separation steps. The affinity binding process was characterized by the association (ka) and the dissociation (kd) kinetic constants and the equilibrium association (K) constant, all of which were obtained from experimental data.

  14. Calculation of individual isotope equilibrium constants for geochemical reactions

    USGS Publications Warehouse

    Thorstenson, D.C.; Parkhurst, D.L.

    2004-01-01

    Theory is derived from the work of Urey (Urey H. C. [1947] The thermodynamic properties of isotopic substances. J. Chem. Soc. 562-581) to calculate equilibrium constants commonly used in geochemical equilibrium and reaction-transport models for reactions of individual isotopic species. Urey showed that equilibrium constants of isotope exchange reactions for molecules that contain two or more atoms of the same element in equivalent positions are related to isotope fractionation factors by ?? = (Kex)1/n, where n is the number of atoms exchanged. This relation is extended to include species containing multiple isotopes, for example 13C16O18O and 1H2H18O. The equilibrium constants of the isotope exchange reactions can be expressed as ratios of individual isotope equilibrium constants for geochemical reactions. Knowledge of the equilibrium constant for the dominant isotopic species can then be used to calculate the individual isotope equilibrium constants. Individual isotope equilibrium constants are calculated for the reaction CO2g = CO2aq for all species that can be formed from 12C, 13C, 16O, and 18O; for the reaction between 12C18 O2aq and 1H218Ol; and among the various 1H, 2H, 16O, and 18O species of H2O. This is a subset of a larger number of equilibrium constants calculated elsewhere (Thorstenson D. C. and Parkhurst D. L. [2002] Calculation of individual isotope equilibrium constants for implementation in geochemical models. Water-Resources Investigation Report 02-4172. U.S. Geological Survey). Activity coefficients, activity-concentration conventions for the isotopic variants of H2O in the solvent 1H216Ol, and salt effects on isotope fractionation have been included in the derivations. The effects of nonideality are small because of the chemical similarity of different isotopic species of the same molecule or ion. The temperature dependence of the individual isotope equilibrium constants can be calculated from the temperature dependence of the fractionation factors. The derivations can be extended to calculation of individual isotope equilibrium constants for ion pairs and equilibrium constants for isotopic species of other chemical elements. The individual isotope approach calculates the same phase isotopic compositions as existing methods, but also provides concentrations of individual species, which are needed in calculations of mass-dependent effects in transport processes. The equilibrium constants derived in this paper are used to calculate the example of gas-water equilibrium for CO2 in an acidic aqueous solution. ?? 2004 Elsevier Ltd.

  15. The structure and energetics of Cr(CO)6 and Cr(CO)5

    NASA Technical Reports Server (NTRS)

    Barnes, Leslie A.; Liu, Bowen; Lindh, Roland

    1992-01-01

    The geometric structure of Cr(CO)6 is optimized at the modified coupled pair functional (MCPF), single and double excitation coupled-cluster (CCSD) and CCSD(T) levels of theory (including a perturbational estimate for connected triple excitations), and the force constants for the totally symmetric representation are determined. The geometry of Cr(CO)5 is partially optimized at the MCPF, CCSD, and CCSD(T) levels of theory. Comparison with experimental data shows that the CCSD(T) method gives the best results for the structures and force constants, and that remaining errors are probably due to deficiencies in the one-particle basis sets used for CO. The total binding energies of Cr(CO)6 and Cr(CO)5 are also determined at the MCPF, CCSD, and CCSD(T) levels of theory. The CCSD(T) method gives a much larger total binding energy than either the MCPF or CCSD methods. An analysis of the basis set superposition error (BSSE) at the MCPF level of treatment points out limitations in the one-particle basis used. Calculations using larger basis sets reduce the BSSE, but the total binding energy of Cr(CO)6 is still significantly smaller than the experimental value, although the first CO bond dissociation energy of Cr(CO)6 is well described. An investigation of 3s3p correlation reveals only a small effect. In the largest basis set, the total CO binding energy of Cr(CO)6 is estimated to be 140 kcal/mol at the CCSD(T) level of theory, or about 86 percent of the experimental value. The remaining discrepancy between the experimental and theoretical value is probably due to limitations in the one-particle basis, rather than limitations in the correlation treatment. In particular an additional d function and an f function on each C and O are needed to obtain quantitative results. This is underscored by the fact that even using a very large primitive set (1042 primitive functions contracted to 300 basis functions), the superposition error for the total binding energy of Cr(CO)6 is 22 kcal/mol at the MCPF level of treatment.

  16. Kafirin adsorption on ion-exchange resins: isotherm and kinetic studies.

    PubMed

    Kumar, Prashant; Lau, Pei Wen; Kale, Sandeep; Johnson, Stuart; Pareek, Vishnu; Utikar, Ranjeet; Lali, Arvind

    2014-08-22

    Kafirin is a natural, hydrophobic and celiac safe prolamin protein obtained from sorghum seeds. Today kafirin is found to be useful in designing delayed delivery systems and coatings of pharmaceuticals and nutraceuticals where its purity is important and this can be obtained by adsorptive chromatography. This study is the first scientific insight into the isotherm and kinetic studies of kafirin adsorption on anion- and cation-exchange resins for practical applications in preparative scale chromatography. Adsorption isotherms of kafirin were determined for five anion- and two cation-exchange resins in batch systems. Isotherm parameters such as maximum binding capacity and dissociation constant were determined from Langmuir isotherm, and adsorptive capacity and affinity constant from Freundlich isotherm. Langmuir isotherm was found to fit the adsorption equilibrium data well. Batch uptake kinetics for kafirin adsorption on these resins was also carried out and critical parameters including the diffusion coefficient, film mass transfer coefficient, and Biot number for film-pore diffusion model were calculated. Both the isotherm and the kinetic parameters were considered for selection of appropriate resin for kafirin purification. UNOsphere Q (78.26 mg/ml) and Toyopearl SP-650M (57.4 mg/ml) were found to offer better kafirin binding capacities and interaction strength with excellent uptake kinetics under moderate operating conditions. With these adsorbents, film diffusion resistance was found to be major governing factor for adsorption (Bi<10 and δ<1). Based on designer objective function, UNOsphere Q was found be best adsorbent for binding of kafirin. The data presented is valuable for designing large scale preparative adsorptive chromatographic kafirin purification systems. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. Sequential Proton Loss Electron Transfer in Deactivation of Iron(IV) Binding Protein by Tyrosine Based Food Components.

    PubMed

    Tang, Ning; Skibsted, Leif H

    2017-08-02

    The iron(IV) binding protein ferrylmyoglobin, MbFe(IV)═O, was found to be reduced by tyrosine based food components in aqueous solution through a sequential proton loss electron transfer reaction mechanism without binding to the protein as confirmed by isothermal titration calorimetry. Dopamine and epinephrine are the most efficient food components reducing ferrylmyoglobin to oxymyoglobin, MbFe(II)O 2 , and metmyoglobin, MbFe(III), as revealed by multivariate curve resolution alternating least-squares with second order rate constants of 33.6 ± 2.3 L/mol/s (ΔH ⧧ of 19 ± 5 kJ/mol, ΔS ⧧ of -136 ± 18 J/mol K) and 228.9 ± 13.3 L/mol/s (ΔH ⧧ of 110 ± 7 kJ/mol, ΔS ⧧ of 131 ± 25 J/mol K), respectively, at pH 7.4 and 25 °C. The other tyrosine based food components were found to reduce ferrylmyoglobin to metmyoglobin with similar reduction rates at pH 7.4 and 25 °C. These reduction reactions were enhanced by protonation of ferrylmyoglobin and facilitated proton transfer at acidic conditions. Enthalpy-entropy compensation effects were observed for the activation parameters (ΔH ⧧ and ΔS ⧧ ), indicating the common reaction mechanism. Moreover, principal component analysis combined with heat map were performed to understand the relationship between density functional theory calculated molecular descriptors and kinetic data, which was further modeled by partial least squares for quantitative structure-activity relationship analysis. In addition, a three tyrosine residue containing protein, lysozyme, was also found to be able to reduce ferrylmyoglobin with a second order rate constant of 66 ± 28 L/mol/s as determined by a competitive kinetic method.

  18. Structure-activity relationships of 4-hydroxyalkenals in the conjugation catalysed by mammalian glutathione transferases.

    PubMed Central

    Danielson, U H; Esterbauer, H; Mannervik, B

    1987-01-01

    The substrate specificities of 15 cytosolic glutathione transferases from rat, mouse and man have been explored by use of a homologous series of 4-hydroxyalkenals, extending from 4-hydroxypentenal to 4-hydroxypentadecenal. Rat glutathione transferase 8-8 is exceptionally active with the whole range of 4-hydroxyalkenals, from C5 to C15. Rat transferase 1-1, although more than 10-fold less efficient than transferase 8-8, is the second most active transferase with the longest chain length substrates. Other enzyme forms showing high activities with these substrates are rat transferase 4-4 and human transferase mu. The specificity constants, kcat./Km, for the various enzymes have been determined with the 4-hydroxyalkenals. From these constants the incremental Gibbs free energy of binding to the enzyme has been calculated for the homologous substrates. The enzymes responded differently to changes in the length of the hydrocarbon side chain and could be divided into three groups. All glutathione transferases displayed increased binding energy in response to increased hydrophobicity of the substrate. For some of the enzymes, steric limitations of the active site appear to counteract the increase in binding strength afforded by increased chain length of the substrate. Comparison of the activities with 4-hydroxyalkenals and other activated alkenes provides information about the active-site properties of certain glutathione transferases. The results show that the ensemble of glutathione transferases in a given species may serve an important physiological role in the conjugation of the whole range of 4-hydroxyalkenals. In view of its high catalytic efficiency with all the homologues, rat glutathione transferase 8-8 appears to have evolved specifically to serve in the detoxication of these reactive compounds of oxidative metabolism. PMID:3426557

  19. Tumor necrosis factor interaction with gold nanoparticles

    NASA Astrophysics Data System (ADS)

    Tsai, De-Hao; Elzey, Sherrie; Delrio, Frank W.; Keene, Athena M.; Tyner, Katherine M.; Clogston, Jeffrey D.; Maccuspie, Robert I.; Guha, Suvajyoti; Zachariah, Michael R.; Hackley, Vincent A.

    2012-05-01

    We report on a systematic investigation of molecular conjugation of tumor necrosis factor-α (TNF) protein onto gold nanoparticles (AuNPs) and the subsequent binding behavior to its antibody (anti-TNF). We employ a combination of physical and spectroscopic characterization methods, including electrospray-differential mobility analysis, dynamic light scattering, polyacrylamide gel electrophoresis, attenuated total reflectance-Fourier transform infrared spectroscopy, fluorescence assay, and enzyme-linked immunosorbent assay. The native TNF used in this study exists in the active homotrimer configuration prior to conjugation. After binding to AuNPs, the maximum surface density of TNF is (0.09 +/- 0.02) nm-2 with a binding constant of 3 × 106 (mol L-1)-1. Dodecyl sulfate ions induce desorption of monomeric TNF from the AuNP surface, indicating a relatively weak intermolecular binding within the AuNP-bound TNF trimers. Anti-TNF binds to both TNF-conjugated and citrate-stabilized AuNPs, showing that non-specific binding is significant. Based on the number of anti-TNF molecules adsorbed, a substantially higher binding affinity was observed for the TNF-conjugated surface. The inclusion of thiolated polyethylene glycol (SH-PEG) on the AuNPs inhibits the binding of anti-TNF, and the amount of inhibition is related to the number ratio of surface bound SH-PEG to TNF and the way in which the ligands are introduced. This study highlights the challenges in quantitatively characterizing complex hybrid nanoscale conjugates, and provides insight on TNF-AuNP formation and activity.We report on a systematic investigation of molecular conjugation of tumor necrosis factor-α (TNF) protein onto gold nanoparticles (AuNPs) and the subsequent binding behavior to its antibody (anti-TNF). We employ a combination of physical and spectroscopic characterization methods, including electrospray-differential mobility analysis, dynamic light scattering, polyacrylamide gel electrophoresis, attenuated total reflectance-Fourier transform infrared spectroscopy, fluorescence assay, and enzyme-linked immunosorbent assay. The native TNF used in this study exists in the active homotrimer configuration prior to conjugation. After binding to AuNPs, the maximum surface density of TNF is (0.09 +/- 0.02) nm-2 with a binding constant of 3 × 106 (mol L-1)-1. Dodecyl sulfate ions induce desorption of monomeric TNF from the AuNP surface, indicating a relatively weak intermolecular binding within the AuNP-bound TNF trimers. Anti-TNF binds to both TNF-conjugated and citrate-stabilized AuNPs, showing that non-specific binding is significant. Based on the number of anti-TNF molecules adsorbed, a substantially higher binding affinity was observed for the TNF-conjugated surface. The inclusion of thiolated polyethylene glycol (SH-PEG) on the AuNPs inhibits the binding of anti-TNF, and the amount of inhibition is related to the number ratio of surface bound SH-PEG to TNF and the way in which the ligands are introduced. This study highlights the challenges in quantitatively characterizing complex hybrid nanoscale conjugates, and provides insight on TNF-AuNP formation and activity. Electronic supplementary information (ESI) available: Experimental procedures, instrumentation, materials and calculations. See DOI: 10.1039/c2nr30415e

  20. Regular square planer bis-(4,4,4-trifluoro-1-(thiophen-2-yl)butane-1,3-dione)/copper(II) complex: Trans/cis-DFT isomerization, crystal structure, thermal, solvatochromism, hirshfeld surface and DNA-binding analysis

    NASA Astrophysics Data System (ADS)

    Hema, M. K.; Karthik, C. S.; Warad, Ismail; Lokanath, N. K.; Zarrouk, Abdelkader; Kumara, Karthik; Pampa, K. J.; Mallu, P.

    2018-04-01

    Trans-[Cu(O∩O)2] complex, O∩O = 4,4,4-trifluoro-1-(thiophen-2-yl)butane-1,3-dione was reported with high potential toward CT-DNA binder. The solved XRD-structure of complex indicated a perfect regular square-planer geometry around the Cu(II) center. The trans/cis-DFT-isomerization calculation supported the XRD seen in reflecting the trans-isomer as the kinetic-favor isomer. The desired complex structure was also characterized by conductivity measurement, CHN-elemental analyses, MS, EDX, SEM, UV-Vis., FT-IR, HAS and TG/DTG. The Solvatochromism behavior of the complex was evaluated using four different polar solvents. MPE and Hirshfeld surface analysis (HSA) come to an agreement that fluoride and thiophene protons atoms are with suitable electro-potential environment to form non-classical H-bonds of type CThsbnd H⋯F. The DNA-binding properties were investigated by viscosity tests and spectrometric titrations, the results revealed the complex as strong calf-thymus DNA binder. High intrinsic-binding constants value ∼1.8 × 105 was collected.

  1. Early events in 2,4,6-trinitrotoluene (TNT) degradation by porphyrins: binding of TNT to porphyrin by hydrophobic and hydrogen bonds.

    PubMed

    Hikal, Walid M; Harmon, H James

    2008-06-15

    The interaction of meso-tri(4-sulfonatophenyl)mono(4-carboxyphenyl) porphyrin (C1TPP) with 2,4,6-trinitrotoluene (TNT) has been explored by UV-vis and fluorescence spectroscopy. The influence of temperature on the interaction has also been studied. C1TPP binds to TNT at pH 7.0 at room temperature via 1.94 kcal/mole hydrogen bonds with absorbance loss at 412-413 nm and the appearance of a new peak at 422-424 nm. The hydrogen binding of TNT to C1TPP was confirmed by the dissolution of the complex upon the addition of urea. Increasing the temperature results in the appearance of a new absorbance peak at 540 nm and absorbance loss at 515 nm with activation energy of 29.7 kcal/mole in the range of the hydrophobic bond energy. This suggests the hydrophobic bonding of TNT with the pyrrole nitrogens in the porphyrin. Increasing the concentration of the TNT in the solution quenches the fluorescence of the porphyrin following the Stern-Volmer equation. The association constants calculated from absorbance and fluorescence are expectedly similar.

  2. Studies on the interaction of apigenin with calf thymus DNA by spectroscopic methods

    NASA Astrophysics Data System (ADS)

    Zhang, Shufang; Sun, Xuejun; Kong, Rongmei; Xu, Mingming

    2015-02-01

    The interaction between apigenin and calf thymus deoxyribonucleic acid (ctDNA) in a pH 7.4 Tris-HCl buffer solution was investigated by UV-Vis spectroscopy, fluorescence spectroscopy, DNA melting techniques, and viscosity measurements. It was found that apigenin molecules could intercalate into the base pairs of DNA, forming a apigenin-DNA complex with a binding constant of K310K = 6.4 × 104 L mol-1. The thermodynamic parameters enthalpy change (ΔH), entropy change (ΔS) and Gibbs free energy (ΔG) were calculated to be 7.36 × 104 J mol-1, 329 J K-1 mol-1 and -2.84 × 104 J mol-1 at 310 K, respectively. Hydrophobic interaction was the predominant intermolecular force in stabilizing the apigenin-DNA complex. Thermal denaturation study suggested that the stabilization of the ctDNA helix was increased when the apigenin binding to ctDNA as indicated by the increase in thermal denaturation temperature of ctDNA at around 5.0 °C in the presence of apigenin. Spectroscopic techniques together with melting techniques and viscosity determination provided evidences of intercalation mode of binding for the interaction between apigenin and ctDNA.

  3. Non-covalent binding analysis of sulfamethoxazole to human serum albumin: Fluorescence spectroscopy, UV-vis, FT-IR, voltammetric and molecular modeling.

    PubMed

    Naik, Praveen N; Nandibewoor, Sharanappa T; Chimatadar, Shivamurthi A

    2015-06-01

    This study was designed to examine the interaction of sulfamethoxazole (SMZ) with human serum albumin(HSA). Spectroscopic analysis of the emission quenching at different temperatures revealed that the quenching mechanism of human serum albumin by SMZ was static mechanism. The binding constant values for the SMZ-HSA system were obtained to be 22,500 L/mol at 288 K, 15,600 L/mol at 298 K, and 8500 L/mol at 308 K. The distance r between donor and acceptor was evaluated according to the theory of Föster energy transfer. The results of spectroscopic analysis and molecular modeling techniques showed that the conformation of human serum albumin had been changed in the presence of SMZ. The thermodynamic parameters, namely enthalpy change (∆ H 0 ) -36.0 kJ/mol, entropy change (∆ S 0 ) -41.3 J/mol K and free energy change (∆ G 0 ) -23.7 kJ/mol, were calculated by using van׳t Hoff equation. The effect of common ions on the binding of SMZ to HSA was tested.

  4. Fluorescence spectroscopic study on the interaction of resveratrol with lipoxygenase

    NASA Astrophysics Data System (ADS)

    Pinto, María del Carmen; Duque, Antonio Luis; Macías, Pedro

    2010-09-01

    The interaction of lipoxygenase with (E)-resveratrol was investigated by fluorescence spectroscopy. The data obtained revealed that the quenching of intrinsic fluorescence of lipoxygenase is produced by the formation of a complex lipoxygenase-(E)-resveratrol. From the value obtained for the binding constant, according to the Stern-Volmer modified equation, was deduced the existence of static quenching mechanism and, as consequence, the existence of a strong interaction between (E)-resveratrol and lipoxygenase. The values obtained for the thermodynamic parameter Δ H (-3.58 kJ mol -1) and Δ S (87.97 J mol -1K -1) suggested the participation of hydrophobic interactions and hydrogen bonds in the stabilization of the complex ligand-protein. From the static quenching we determined that only exist one independent binding site. Based on the Förster energy transfer theory, the distance between the acceptor ((E)-resveratrol) and the donor (Trp residues of lipoxygenase) was calculated to be 3.42 nm. Finally, based on the information obtained from the evaluation of synchronous and three-dimensional fluorescence spectroscopy, we deduced that the interaction of (E)-resveratrol with lipoxygenase produces micro-environmental and conformational alterations of protein in the binding region.

  5. Solubility profiles, hydration and desolvation of curcumin complexed with γ-cyclodextrin and hydroxypropyl-γ-cyclodextrin

    NASA Astrophysics Data System (ADS)

    Shityakov, Sergey; Salmas, Ramin Ekhteiari; Durdagi, Serdar; Roewer, Norbert; Förster, Carola; Broscheit, Jens

    2017-04-01

    In this study, we investigated curcumin (CUR) solubility profiles and hydration/desolvation effects of this substance formulated with γ-cyclodextrin (γ-CD) and hydroxypropyl-γ-cyclodextrin (HP-γ-CD) excipients. The CUR/HP-γ-CD complex was found to be more stable in solution with the highest apparent stability constant for CUR/HP-γ-CD (Kc = 1.58*104 M-1) as the more soluble form in distilled water. The in silico calculations, including molecular docking, Monte Carlo (MC), and molecular dynamics (MD) simulations, indicated that water molecules play an important role in host-guest complexation mediating the CUR binding to cyclodextrins via hydrogen bond formations. The CUR hydration/desolvation effects contributed to the complex formation by elevating the CUR binding affinity to both CDs. The CUR/HP-γ-CD complex after the CUR hydration was determined with a minimal Gibbs free energy of binding (ΔGbind = -9.93 kcal*mol-1) due to the major hydrophobic (vdW) forces. Overall, the results of this study can aid a development of cyclodextrin-based drug delivery vectors, signifying the importance of water molecules during the formulation processes.

  6. Binding of KATP channel modulators in rat cardiac membranes

    PubMed Central

    Löffler-Walz, Cornelia; Quast, Ulrich

    1998-01-01

    The binding of [3H]-P1075, a potent opener of adenosine-5′-triphosphate-(ATP)-sensitive K+ channels, was studied in a crude heart membrane preparation of the rat, at 37°C.Binding required MgATP. In the presence of an ATP-regenerating system, MgATP supported [3H]-P1075 binding with an EC50 value of 100 μM and a Hill coefficient of 1.4.In saturation experiments [3H]-P1075 binding was homogeneous with a KD value of 6±1 nM and a binding capacity (Bmax) of 33±3 fmol mg−1 protein.Upon addition of an excess of unlabelled P1075, the [3H]-P1075-receptor complex dissociated in a mono-exponential manner with a dissociation rate constant of 0.13±0.01 min−1. If a bi-molecular association mechanism was assumed, the dependence of the association kinetics on label concentration gave an association rate constant of 0.030±0.003 nM−1 min−1. From the kinetic experiments the KD value was calculated as 4.7±0.6 nM.Openers of the ATP-sensitive K+ channel belonging to different structural classes inhibited specific [3H]-P1075 binding in a monophasic manner to completion; an exception was minoxidil sulphate where maximum inhibition was 68%. The potencies of the openers in this assay agree with published values obtained in rat cardiocytes and are on average 3.5 times lower than those determined in rat aorta.Sulphonylureas, such as glibenclamide and glibornuride and the sulphonylurea-related carboxylate, AZ-DF 265, inhibited [3H]-P1075 binding with biphasic inhibition curves. The high affinity component comprised about 60% of the curves with the IC50 value of glibenclamide being ≈amp;90 nM; affinities for the low affinity component were in the μM concentration range. The fluorescein derivative, phloxine B, showed a monophasic inhibition curve with an IC50 value of 6 μM, a maximum inhibition of 94% and a Hill coefficient of 1.5.It is concluded that binding studies with [3H]-P1075 are feasible in rat heart membranes in the presence of MgATP and of an ATP-regenerating system. The pharmacological profile of the [3H]-P1075 binding sites in the cardiac preparation, which probably contains sulphonylurea receptors (SURs) from cardiac myocytes (SUR2A) and vascular smooth muscle cells (SUR2B), differs from that expected for SUR2A and SUR2B. PMID:9579735

  7. Different kinetic pathways of the binding of two biphenyl analogues of colchicine to tubulin.

    PubMed

    Dumortier, C; Gorbunoff, M J; Andreu, J M; Engelborghs, Y

    1996-04-09

    The kinetics of the interaction of tubulin with two biphenyl analogues of colchicine were measured by fluorescence stopped flow. The ligands were 2,3,4-trimethoxy-4'-carbomethoxy-1,1'-biphenyl (TCB) and 2,3,4-trimethoxy-4'-acetyl-1,1'-biphenyl (TKB). The binding of both analogues is accompanied by a fluorescence increase with monophasic kinetics, which indicates that these drugs, unlike colchicine, do not discriminate between the isoforms of tubulin. The observed pseudo-first-order rate constant increases in a nonlinear way with the drug concentration, indicating that the binding of the biphenyl analogues to tubulin occurs, like colchicine, in two steps: a fast reversible equilibrium followed by an isomerization of the initial complex. Kinetic analysis shows that TCB and TKB exhibit differences in their K1 values. At 25 degrees C, these are 114,000 +/- 15,000 M(-1) for TCB and 8,300 +/- 900 M(-1) for TKB. Both molecules show a much higher affinity than colchicine for the initial binding site. Also at 25 degrees C, the k2 value is 0.66 +/- 0.04 s(-1) for TCB and 3.0 +/- 0.2 s(-1) for TKB. From the temperature dependence, a reaction enthalpy change for the initial binding (deltaH(zero)1) of 44 +/- 9 kJ x mol(-1) (TCB) and -40 +/- 14 kJ x mol(-1) (TKB) and an activation energy for the second forward step of 64 +/- 2 kJ x mol(-1) (TCB) and 101 +/- 10 kJ x mol(-1) (TKB) were calculated. The dissociation kinetics were studied by displacement experiments, in which podophyllotoxin was used as a displacing ligand. The rate constant for the second step in the off direction (k(-2)) is 0.25 +/- 0.05 s(-1) for TCB and 0.093 +/- 0.009 s(-1) for TKB at 25 degrees C. The activation energies for the backward isomerization of the complexes were found to be 86 +/- 20 kJ x mol(-1) (TCB) and 79 +/- 5 kJ x mol(-1) (TKB). Combination of these results with the kinetic parameters for association gives a full characterization of the enthalpy pathway for the binding of TCB and TKB. The pathway of TCB binding is shown to differ considerably from that of TKB binding. Since their structural difference is located in ring C', this result points to their use of the ring C' in the first binding step. The competitiveness of the binding of TCB and TKB with those of podophyllotoxin, MTC, and MDL 27048 indicates that the two biphenyls interact as well with the trimethoxyphenyl-specific subsite.

  8. Characterization of flavonoid-protein interactions using fluorescence spectroscopy: Binding of pelargonidin to dairy proteins.

    PubMed

    Arroyo-Maya, Izlia J; Campos-Terán, José; Hernández-Arana, Andrés; McClements, David Julian

    2016-12-15

    In this study, the interaction between the flavonoid pelargonidin and dairy proteins: β-lactoglobulin (β-LG), whey protein (WPI), and caseinate (CAS) was investigated. Fluorescence experiments demonstrated that pelargonidin quenched milk proteins fluorescence strongly. However, the protein secondary structure was not significantly affected by pelargonidin, as judged from far-UV circular dichroism. Analysis of fluorescence data indicated that pelargonidin-induced quenching does not arise from a dynamical mechanism, but instead is due to protein-ligand binding. Therefore, quenching data were analyzed using the model of independent binding sites. Both β-LG and CAS, but not WPI, showed hyperbolic binding isotherms indicating that these proteins firmly bound pelargonidin at both pH 7.0 and 3.0 (binding constants ca. 1.0×10(5) at 25.0°C). To investigate the underlying thermodynamics, binding constants were determined at 25.0, 35.0, and 45.0°C. These results pointed to binding processes that depend on the structural conformation of the milk proteins. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. A hierarchical approach to cooperativity in macromolecular and self-assembling binding systems.

    PubMed

    Garcés, Josep Lluís; Acerenza, Luis; Mizraji, Eduardo; Mas, Francesc

    2008-04-01

    The study of complex macromolecular binding systems reveals that a high number of states and processes are involved in their mechanism of action, as has become more apparent with the sophistication of the experimental techniques used. The resulting information is often difficult to interpret because of the complexity of the scheme (large size and profuse interactions, including cooperative and self-assembling interactions) and the lack of transparency that this complexity introduces into the interpretation of the indexes traditionally used to describe the binding properties. In particular, cooperative behaviour can be attributed to very different causes, such as direct chemical modification of the binding sites, conformational changes in the whole structure of the macromolecule, aggregation processes between different subunits, etc. In this paper, we propose a novel approach for the analysis of the binding properties of complex macromolecular and self-assembling systems. To quantify the binding behaviour, we use the global association quotient defined as K(c) = [occupied sites]/([free sites] L), L being the free ligand concentration. K(c) can be easily related to other measures of cooperativity (such as the Hill number or the Scatchard plot) and to the free energies involved in the binding processes at each ligand concentration. In a previous work, it was shown that K(c) could be decomposed as an average of equilibrium constants in two ways: intrinsic constants for Adair binding systems and elementary constants for the general case. In this study, we show that these two decompositions are particular cases of a more general expression, where the average is over partial association quotients, associated with subsystems from which the system is composed. We also show that if the system is split into different subsystems according to a binding hierarchy that starts from the lower, microscopic level and ends at the higher, aggregation level, the global association quotient can be decomposed following the hierarchical levels of macromolecular organisation. In this process, the partial association quotients of one level are expressed, in a recursive way, as a function of the partial quotients of the level that is immediately below, until the microscopic level is reached. As a result, the binding properties of very complex macromolecular systems can be analysed in detail, making the mechanistic explanation of their behaviour transparent. In addition, our approach provides a model-independent interpretation of the intrinsic equilibrium constants in terms of the elementary ones.

  10. Theory of single-molecule controlled rotation experiments, predictions, tests, and comparison with stalling experiments in F1-ATPase.

    PubMed

    Volkán-Kacsó, Sándor; Marcus, Rudolph A

    2016-10-25

    A recently proposed chemomechanical group transfer theory of rotary biomolecular motors is applied to treat single-molecule controlled rotation experiments. In these experiments, single-molecule fluorescence is used to measure the binding and release rate constants of nucleotides by monitoring the occupancy of binding sites. It is shown how missed events of nucleotide binding and release in these experiments can be corrected using theory, with F 1 -ATP synthase as an example. The missed events are significant when the reverse rate is very fast. Using the theory the actual rate constants in the controlled rotation experiments and the corrections are predicted from independent data, including other single-molecule rotation and ensemble biochemical experiments. The effective torsional elastic constant is found to depend on the binding/releasing nucleotide, and it is smaller for ADP than for ATP. There is a good agreement, with no adjustable parameters, between the theoretical and experimental results of controlled rotation experiments and stalling experiments, for the range of angles where the data overlap. This agreement is perhaps all the more surprising because it occurs even though the binding and release of fluorescent nucleotides is monitored at single-site occupancy concentrations, whereas the stalling and free rotation experiments have multiple-site occupancy.

  11. Effect of flavonols on wine astringency and their interaction with human saliva.

    PubMed

    Ferrer-Gallego, Raúl; Brás, Natércia F; García-Estévez, Ignacio; Mateus, Nuno; Rivas-Gonzalo, Julián C; de Freitas, Victor; Escribano-Bailón, M Teresa

    2016-10-15

    The addition of external phenolic compounds to wines in order to improve their sensory quality is an established winemaking practice. This study was aimed at evaluating the effect of the addition of quercetin 3-O-glucoside on the astringency and bitterness of wines. Sensory results showed that the addition of this flavonol to wines results in an increase in astringency and bitterness. Additionally, flavonol-human salivary protein interactions were studied using fluorescence spectroscopy, dynamic light scattering and molecular dynamic simulations (MD). The apparent Stern-Volmer (KsvApp) and the apparent bimolecular quenching constants (kqApp) were calculated from fluorescence spectra. The KsvApp was 12620±390M(-1), and the apparent biomolecular constant was 3.94×10(12)M(-1)s(-1), which suggests that a complex was formed between the human salivary proteins and quercetin 3-O-glucoside. MD simulations showed that the quercetin 3-O-glucoside molecules have the ability to bind to the IB937 model peptide. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. Compound Selectivity and Target Residence Time of Kinase Inhibitors Studied with Surface Plasmon Resonance.

    PubMed

    Willemsen-Seegers, Nicole; Uitdehaag, Joost C M; Prinsen, Martine B W; de Vetter, Judith R F; de Man, Jos; Sawa, Masaaki; Kawase, Yusuke; Buijsman, Rogier C; Zaman, Guido J R

    2017-02-17

    Target residence time (τ) has been suggested to be a better predictor of the biological activity of kinase inhibitors than inhibitory potency (IC 50 ) in enzyme assays. Surface plasmon resonance binding assays for 46 human protein and lipid kinases were developed. The association and dissociation constants of 80 kinase inhibitor interactions were determined. τ and equilibrium affinity constants (K D ) were calculated to determine kinetic selectivity. Comparison of τ and K D or IC 50 values revealed a strikingly different view on the selectivity of several kinase inhibitors, including the multi-kinase inhibitor ponatinib, which was tested on 10 different kinases. In addition, known pan-Aurora inhibitors resided much longer on Aurora B than on Aurora A, despite having comparable affinity for Aurora A and B. Furthermore, the γ/δ-selective PI3K inhibitor duvelisib and the δ-selective drug idelalisib had similar 20-fold selectivity for δ- over γ-isoform but duvelisib resided much longer on both targets. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. pyr RNA binding to the Bacillus caldolyticus PyrR attenuation protein. Characterization and regulation by uridine and guanosine nucleotides

    PubMed Central

    Jørgensen, Casper Møller; Fields, Christopher J.; Chander, Preethi; Watt, Desmond; Burgner, John W.; Smith, Janet L.; Switzer, Robert L.

    2011-01-01

    Summary The PyrR protein regulates expression of pyrimidine biosynthetic (pyr) genes in many bacteria. PyrR binds to specific sites in the 5’ leader RNA of target operons and favors attenuation of transcription. Filter binding and gel mobility assays were used to characterize the binding of PyrR from Bacillus caldolyticus to RNA sequences (binding loops) from the three attenuation regions of the B. caldolyticus pyr operon. Binding of PyrR to the three binding loops and modulation of RNA binding by nucleotides was similar for all three RNAs. Apparent dissociation constants at 0° C ranged from 0.13 to 0.87 nM in the absence of effectors; dissociation constants were decreased by 3 to 12 fold by uridine nucleotides and increased by 40 to 200 fold by guanosine nucleotides. The binding data suggest that pyr operon expression is regulated by the ratio of intracellular uridine nucleotides to guanosine nucleotides; the effects of nucleoside addition to the growth medium on aspartate transcarbamylase (pyrB) levels in B. subtilis cells in vivo supported this conclusion. Analytical ultracentrifugation established that RNA binds to dimeric PyrR, even though the tetrameric form of unbound PyrR predominates in solution at the concentrations studied. PMID:18190533

  14. Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    D'Aquino,J.; Tetenbaum-Novatt, J.; White, A.

    2005-01-01

    The diphtheria toxin repressor (DtxR) is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear. Calorimetric techniques have demonstrated that although binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 x 10{sup -7}, binding site 2 (primary) is a low-affinity binding site with amore » binding constant of 6.3 x 10{sup -4}. These two binding sites act in an independent fashion, and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A, C102D), reported here, and the previously reported DtxR(H79A) have allowed us to propose a mechanism of metal activation for DtxR.« less

  15. A method of chemiluminescence coupled with ultrafiltration for investigating the interaction between ibuprofen and human serum albumin.

    PubMed

    Xiong, Xunyu; Zhang, Qunzheng; Nan, Yefei; Gu, Xuefan

    2013-01-01

    In acidic media, ibuprofen substantially enhanced the weak chemiluminescence (CL) produced by sodium sulfite and potassium permanganate. The increased signals were linearly correlated with ibuprofen concentrations ranging from 1.2 × 10(-3) to 4.8 μM, with a detection limit of 4.8 × 10(-4) μM. Two ultrafiltration (UF) membranes were used to construct a unit for trapping 0.15 and 0.75 μM human serum albumin (HSA) and coupled online with the CL system. At low HSA concentrations, the numbers of bound molecules per binding site were calculated to be 0.9 for Sudlow site I and 6.2 for Sudlow site II. The association constants on these binding sites were 5.9 × 10(5) and 3.4 × 10(4) M(-1), respectively. Our CL-UF protocol presents a rapid and sensitive method for studies on drug-protein interaction. Copyright © 2012 John Wiley & Sons, Ltd.

  16. Synthetic water soluble di-/tritopic molecular receptors exhibiting Ca2+/Mg2+ exchange.

    PubMed

    Lavie-Cambot, Aurélie; Tron, Arnaud; Ducrot, Aurélien; Castet, Frédéric; Kauffmann, Brice; Beauté, Louis; Allouchi, Hassan; Pozzo, Jean-Luc; Bonnet, Célia S; McClenaghan, Nathan D

    2017-05-23

    Structural integration of two synthetic water soluble receptors for Ca 2+ and Mg 2+ , namely 1,2-bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid (BAPTA) and o-aminophenol-N,N,O-triacetic acid (APTRA), respectively, gave novel di- and tritopic ionophores (1 and 2). As Mg 2+ and Ca 2+ cannot be simultaneously complexed by the receptors, allosteric control of complexation results. Potentiometric measurements established stepwise protonation constants and showed high affinity for Ca 2+ (log K = 6.08 and 8.70 for 1 and 2, respectively) and an excellent selectivity over Mg 2+ (log K = 3.70 and 5.60 for 1 and 2, respectively), which is compatible with magnesium-calcium ion exchange. While ion-exchange of a single Mg 2+ for a single Ca 2+ is possible in both 1 and 2, the simultaneous binding of two Mg 2+ by 2 appears prohibitive for replacement of these two ions by a single Ca 2+ . Ion-binding and exchange was further rationalized by DFT calculations.

  17. Employment of electrodonating capacity as an index of reactive modulation by substituent effects: application for electron-transfer-controlled hydrogen bonding.

    PubMed

    Martínez-González, Eduardo; Frontana, Carlos

    2014-02-07

    Evaluation of the substituent effect in reaction series is an issue of interest, as it is fundamental for controlling chemical reactivity in molecules. Within the framework of density functional theory, employment of the chemical potential, μ, and the chemical hardness, η, leads to the calculation of properties of common use, such as the electrodonating (ω(-)) and electroaccepting (ω(+)) powers, in many chemical systems. In order to examine the predictive character of the substituent effect by these indexes, a comparison between these and experimental binding constants (Kb) for binding of a series of radical anions from para- and ortho-substituted nitrobenzenes with 1,3-diethylurea in acetonitrile was performed, and fair correlations were obtained; furthermore, this strategy was suitable for all of the studied compounds, even those for which empirical approximations, such as Hammett's model, are not valid. Visual representations of substituent effects are presented by considering the local electrodonating power ω(-)(r).

  18. A study of the interaction between malachite green and lysozyme by steady-state fluorescence.

    PubMed

    Ding, Fei; Liu, Wei; Liu, Feng; Li, Zhi-Yuan; Sun, Ying

    2009-09-01

    The interaction of a N-methylated diaminotriphenylmethane dye, malachite green, with lysozyme was investigated by fluorescence spectroscopic techniques under physiological conditions. The binding parameters have been evaluated by fluorescence quenching methods. The results revealed that malachite green caused the fluorescence quenching of lysozyme through a static quenching procedure. The thermodynamic parameters like DeltaH and DeltaS were calculated to be -15.33 kJ mol(-1) and 19.47 J mol(-1) K(-1) according to van't Hoff equation, respectively, which proves main interaction between malachite green and lysozyme is hydrophobic forces and hydrogen bond contact. The distance r between donor (lysozyme) and acceptor (malachite green) was obtained to be 3.82 nm according to Frster's theory. The results of synchronous fluorescence, UV/vis and three-dimensional fluorescence spectra showed that binding of malachite green with lysozyme can induce conformational changes in lysozyme. In addition, the effects of common ions on the constants of lysozyme-malachite green complex were also discussed.

  19. Very Strong Binding for a Neutral Calix[4]pyrrole Receptor Displaying Positive Allosteric Binding.

    PubMed

    Duedal, Troels; Nielsen, Kent A; Olsen, Gunnar; Rasmussen, Charlotte B G; Kongsted, Jacob; Levillain, Eric; Breton, Tony; Miyazaki, Eigo; Takimiya, Kazuo; Bähring, Steffen; Jeppesen, Jan O

    2017-02-17

    The dual-analyte responsive behavior of tetraTTF-calix[4]pyrrole receptor 1 has been shown to complex electron-deficient planar guests in a 2:1 fashion by adopting a so-called 1,3-alternate conformation. However, stronger 1:1 complexes have been demonstrated with tetraalkylammonium halide salts that defer receptor 1 to its cone conformation. Herein, we report the complexation of an electron-deficient planar guest, 1,4,5,8-naphthalenetetracarboxylic dianhydride (NTCDA, 2) that champions the complexation with 1, resulting in a high association constant K a = 3 × 10 10 M -2 . The tetrathiafulvalene (TTF) subunits in the tetraTTF-calix[4]pyrrole receptor 1 present a near perfect shape and electronic complementarity to the NTCDA guest, which was confirmed by X-ray crystal structure analysis, DFT calculations, and electron density surface mapping. Moreover, the complexation of these species results in the formation of a charge transfer complex (2 2 ⊂1) as visualized by a readily apparent color change from yellow to brown.

  20. Hydrogen atom addition to the surface of graphene nanoflakes: A density functional theory study

    NASA Astrophysics Data System (ADS)

    Tachikawa, Hiroto

    2017-02-01

    Polycyclic aromatic hydrocarbons (PAHs) provide a 2-dimensional (2D) reaction surface in 3-dimensional (3D) interstellar space and have been utilized as a model of graphene surfaces. In the present study, the reaction of PAHs with atomic hydrogen was investigated by means of density functional theory (DFT) to systematically elucidate the binding nature of atomic hydrogen to graphene nanoflakes. PAHs with n = 4-37 were chosen, where n indicates the number of benzene rings. Activation energies of hydrogen addition to the graphene surface were calculated to be 5.2-7.0 kcal/mol at the CAM-B3LYP/6-311G(d,p) level, which is almost constant for all PAHs. The binding energies of hydrogen atom were slightly dependent on the size (n): 14.8-28.5 kcal/mol. The absorption spectra showed that a long tail is generated at the low-energy region after hydrogen addition to the graphene surface. The electronic states of hydrogenated graphenes were discussed on the basis of theoretical results.

  1. Chloroperoxidase-catalyzed oxidation of 4,6-dimethyldibenzothiophene as dimer complexes: evidence for kinetic cooperativity.

    PubMed

    Torres, Eduardo; Aburto, Jorge

    2005-05-15

    A sigmoidal kinetic behavior of chloroperoxidase for the oxidation of 4,6-dimethyldibenzothiophene (4,6-DMDBT) in water-miscible organic solvent is for the first time reported. Kinetics of 4,6-DMDBT oxidation showed a cooperative profile probably due to the capacity of chloroperoxidase to recognize a substrate dimer (pi-pi dimer) in its active site. Experimental evidence is given for dimer formation and its presence in the active site of chloroperoxidase. The kinetic data were adjusted for a binding site able to interact with either monomer or dimer substrates, producing a cooperative model describing a one-site binding of two related species. Determination of kinetics constants by iterative calculations of possible oxidation paths of 4,6-DMDBT suggests that kinetics oxidation of dimer substrate is preferred when compared to monomer oxidation. Steady-state fluorometry of substrate in the absence and presence of chloroperoxidase, described by the spectral center of mass, supports this last conclusion.

  2. Novel coumarins and related copper complexes with biological activity: DNA binding, molecular docking and in vitro antiproliferative activity.

    PubMed

    Pivetta, Tiziana; Valletta, Elisa; Ferino, Giulio; Isaia, Francesco; Pani, Alessandra; Vascellari, Sarah; Castellano, Carlo; Demartin, Francesco; Cabiddu, Maria Grazia; Cadoni, Enzo

    2017-12-01

    Coumarins show biological activity and are widely exploited for their therapeutic effects. Although a great number of coumarins substituted by heterocyclic moieties have been prepared, few studies have been carried out on coumarins containing pyridine heterocycle, which is known to modulate their physiological activities. We prepared and characterized three novel 3-(pyridin-2-yl)coumarins and their corresponding copper(II) complexes. We extended our investigations also to three known similar coumarins, since no data about their biochemical activity was previously been reported. The antiproliferative activity of the studied compounds was tested against human derived tumor cell lines and one human normal cell line. The DNA binding constants were determined and docking studies with DNA carried out. Selected Quantitative Structure-Activity Relationship (QSAR) descriptors were calculated in order to relate a set of structural and topological descriptors of the studied compounds to their DNA interaction and cytotoxic activity. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Effective optical constants of anisotropic materials

    NASA Technical Reports Server (NTRS)

    Aronson, J. R.; Emslie, A. G.

    1980-01-01

    The applicability of a technique for determining the optical constants of soil or aerosol components on the basis of measurements of the reflectance or transmittance of inhomogeneous samples of component material is investigated. Optical constants for a sample of very pure quartzite were obtained by a specular reflection technique and line parameters were calculated by classical dispersion theory. Predictions of the reflectance of powdered quartz were then derived from optical constants measured for the anisotropic quartz and for pure quartz crystals, and compared with experimental measurements. The calculated spectra are found to resemble each other moderately well in shape, however the reflectance level calculated from the psuedo-optical constants (quartzite) is consistently below that calculated from quartz values. The spectrum calculated from the quartz optical constants is also shown to represent the experimental nonrestrahlen features more accurately. It is thus concluded that although optical constants derived from inhomogeneous materials may represent the spectral features of a powdered sample qualitatively a quantitative fit to observed data is not likely.

  4. Binding interaction of ramipril with bovine serum albumin (BSA): Insights from multi-spectroscopy and molecular docking methods.

    PubMed

    Shi, Jie-Hua; Pan, Dong-Qi; Jiang, Min; Liu, Ting-Ting; Wang, Qi

    2016-11-01

    The binding interaction between a typical angiotensin-converting enzyme inhibitor (ACEI), ramipril, and a transport protein, bovine serum albumin (BSA), was studied in vitro using UV-vis absorption spectroscopy, steady-state fluorescence spectroscopic titration, synchronous fluorescence spectroscopy, three dimensional fluorescence spectroscopy, circular dichroism and molecular docking under the imitated physiological conditions (pH=7.4). The experimental results suggested that the intrinsic fluorescence of BSA was quenched by ramipril thought a static quenching mechanism, indicating that the stable ramipril-BSA complex was formed by the intermolecular interaction. The number of binding sites (n) and binding constant of ramipril-BSA complex were about 1 and 3.50×10 4 M -1 at 298K, respectively, suggesting that there was stronger binding interaction of ramipril with BSA. The thermodynamic parameters together with molecular docking study revealed that both van der Waal's forces and hydrogen bonding interaction dominated the formation of the ramipril-BSA complex and the binding interaction of BSA with ramipril is enthalpy-driven processes due to |ΔH°|>|TΔS°| and ΔG°<0. The spatial distance between ramipril and BSA was calculated to be 3.56nm based on Förster's non-radiative energy transfer theory. The results of the competitive displacement experiments and molecular docking confirmed that ramipril inserted into the subdomain IIA (site I) of BSA, resulting in a slight change in the conformation of BSA but BSA still retained its secondary structure α-helicity. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Equilibrium isotope effects on noncovalent interactions in a supramolecular host-guest system.

    PubMed

    Mugridge, Jeffrey S; Bergman, Robert G; Raymond, Kenneth N

    2012-02-01

    The self-assembled supramolecular complex [Ga(4)L(6)](12-) (1; L = 1,5-bis[2,3-dihydroxybenzamido]naphthalene) can act as a molecular host in aqueous solution and bind cationic guest molecules to its highly charged exterior surface or within its hydrophobic interior cavity. The distinct internal cavity of host 1 modifies the physical properties and reactivity of bound guest molecules and can be used to catalyze a variety of chemical transformations. Noncovalent host-guest interactions in large part control guest binding, molecular recognition and the chemical reactivity of bound guests. Herein we examine equilibrium isotope effects (EIEs) on both exterior and interior guest binding to host 1 and use these effects to probe the details of noncovalent host-guest interactions. For both interior and exterior binding of a benzylphosphonium guest in aqueous solution, protiated guests are found to bind more strongly to host 1 (K(H)/K(D) > 1) and the preferred association of protiated guests is driven by enthalpy and opposed by entropy. Deuteration of guest methyl and benzyl C-H bonds results in a larger EIE than deuteration of guest aromatic C-H bonds. The observed EIEs can be well explained by considering changes in guest vibrational force constants and zero-point energies. DFT calculations further confirm the origins of these EIEs and suggest that changes in low-frequency guest C-H/D vibrational motions (bends, wags, etc.) are primarily responsible for the observed EIEs. © 2011 American Chemical Society

  6. Assessment of amsacrine binding with DNA using UV-visible, circular dichroism and Raman spectroscopic techniques.

    PubMed

    Jangir, Deepak Kumar; Dey, Sanjay Kumar; Kundu, Suman; Mehrotra, Ranjana

    2012-09-03

    Proper understanding of the mechanism of binding of drugs to their targets in cell is a fundamental requirement to develop new drug therapy regimen. Amsacrine is a rationally designed anticancer drug, used to treat leukemia and lymphoma. Binding with cellular DNA is a crucial step in its mechanism of cytotoxicity. Despite numerous studies, DNA binding properties of amsacrine are poorly understood. Its reversible binding with DNA does not permit X-ray crystallography or NMR spectroscopic evaluation of amsacrine-DNA complexes. In the present work, interaction of amsacrine with calf thymus DNA is investigated at physiological conditions. UV-visible, FT-Raman and circular dichroism spectroscopic techniques were employed to determine the binding mode, binding constant, sequence specificity and conformational effects of amsacrine binding to native calf thymus DNA. Our results illustrate that amsacrine interacts with DNA by and large through intercalation between base pairs. Binding constant of the amsacrine-DNA complex was found to be K=1.2±0.1×10(4) M(-1) which is indicative of moderate type of binding of amsacrine to DNA. Raman spectroscopic results suggest that amsacrine has a binding preference of intercalation between AT base pairs of DNA. Minor groove binding is also observed in amsacrine-DNA complexes. These results are in good agreement with in silico investigation of amsacrine binding to DNA and thus provide detailed insight into DNA binding properties of amsacrine, which could ultimately, renders its cytotoxic efficacy. Copyright © 2012 Elsevier B.V. All rights reserved.

  7. Mercury(II) sorption to two Florida Everglades peat--Evidence for strong and weak binding and competition by dissolved organic matter released from the peat

    USGS Publications Warehouse

    Drexel, R. Todd; Haitzer, Markus; Ryan, Joseph N.; Aiken, George R.; Nagy, Kathryn L.

    2002-01-01

    The binding of mercury(II) to two peats from Florida Everglades sites with different rates of mercury methylation was measured at pH 6.0 and 0.01 M ionic strength. The mercury(II) sorption isotherms, measured over a total mercury(II) range of 10-7.4 to 10-3.7 M, showed the competition for mercury(II) between the peat and dissolved organic matter released from the peat and the existence of strong and weak binding sites for mercury(II). Binding was portrayed by a model accounting for strong and weak sites on both the peat and the released DOM. The conditional binding constants (for which the ligand concentration was set as the concentration of reduced sulfur in the organic matter as measured by X-ray absorption near-edge structure spectroscopy) determined for the strong sites on the two peats were similar (Kpeat,s = 1021.8±0.1and 1022.0±0.1 M-1), but less than those determined for the DOM strong sites (Kdom,s = 1022.8±0.1and 1023.2±0.1 M-1), resulting in mercury(II) binding by the DOM at low mercury(II) concentrations. The magnitude of the strong site binding constant is indicative of mercury(II) interaction with organic thiol functional groups. The conditional binding constants determined for the weak peat sites (Kpeat,w = 1011.5±0.1 and 1011.8±0.1 M-1) and weak DOM sites (Kdom,w = 108.7±3.0 and 107.3±4.5 M-1) were indicative of mercury(II) interaction with carboxyl and phenol functional groups.

  8. Prediction of binding constants of protein ligands: A fast method for the prioritization of hits obtained from de novo design or 3D database search programs

    NASA Astrophysics Data System (ADS)

    Böhm, Hans-Joachim

    1998-07-01

    A dataset of 82 protein-ligand complexes of known 3D structure and binding constant Ki was analysed to elucidate the important factors that determine the strength of protein-ligand interactions. The following parameters were investigated: the number and geometry of hydrogen bonds and ionic interactions between the protein and the ligand, the size of the lipophilic contact surface, the flexibility of the ligand, the electrostatic potential in the binding site, water molecules in the binding site, cavities along the protein-ligand interface and specific interactions between aromatic rings. Based on these parameters, a new empirical scoring function is presented that estimates the free energy of binding for a protein-ligand complex of known 3D structure. The function distinguishes between buried and solvent accessible hydrogen bonds. It tolerates deviations in the hydrogen bond geometry of up to 0.25 Å in the length and up to 30 °Cs in the hydrogen bond angle without penalizing the score. The new energy function reproduces the binding constants (ranging from 3.7 × 10-2 M to 1 × 10-14 M, corresponding to binding energies between -8 and -80 kJ/mol) of the dataset with a standard deviation of 7.3 kJ/mol corresponding to 1.3 orders of magnitude in binding affinity. The function can be evaluated very fast and is therefore also suitable for the application in a 3D database search or de novo ligand design program such as LUDI. The physical significance of the individual contributions is discussed.

  9. GROUND WATER ISSUE - CALCULATION AND USE OF FIRST-ORDER RATE CONSTANTS FOR MONITORED NATURAL ATTENUATION STUDIES

    EPA Science Inventory

    This issue paper explains when and how to apply first-order attenuation rate constant calculations in monitored natural attenuation (MNA) studies. First-order attenuation rate constant calculations can be an important tool for evaluating natural attenuation processes at ground-wa...

  10. Solvent Effects on the Conductance of 1,4-benzenediamine

    NASA Astrophysics Data System (ADS)

    Fatemi, Valla; Kamenetska, Maria; Neaton, Jeffrey; Venkataraman, Latha

    2010-03-01

    We measured the conductance of 1,4-benzenediamine (BDA) by mechanically forming and breaking Au point contacts with a modified STM in a solution of molecules in ambient conditions, using a variety of solvents. Here, we present reliable experimental results which show that the conductance of BDA can be increased by over 50% when dissolved in aromatic organic solvents solely by varying halogen groups on the solvent molecule. The trends in conductance do not correlate with the solvent dielectric constant, dipole moment, or direct solvent-BDA interactions. First-principles density functional theory calculations of solvent molecule binding to gold surfaces are used to discuss mechanisms behind the conductance shift of the BDA molecule.

  11. Interaction study of some macrocyclic inorganic schiff base complexes with calf thymus DNA using spectroscopic and voltammetric methods

    NASA Astrophysics Data System (ADS)

    Bordbar, Maryam; Tavoosi, Fariba; Yeganeh-Faal, Ali; Zebarjadian, Mohammad Hasan

    2018-01-01

    The interaction of Cd(II), Zn(II) and Mn(II)-L (4,8-bis(2-pyridylmethyl)-4,8-diazaundecane-1,11-diamine) transition metal complexes with calf thymus DNA (CT-DNA) has been investigated using electronic, fluorescence and circular dichroism (CD) spectroscopy, thermal denaturation and cyclic voltammetry (CV). Based on the UV-Vis study, binding constants of the complexes with CT-DNA were calculated. Changes in the band of the CD spectrum, DNA melting temperature and in the ipa and ipc of the complexes in the presenceCT-DNA, overall, showed that the studied complex exhibited good DNA interaction ability with partial intercalation mode.

  12. Quantum mechanism of nonlocal Gilbert damping in magnetic trilayers

    NASA Astrophysics Data System (ADS)

    Barati, Ehsan; Cinal, Marek

    2015-06-01

    A fully quantum-mechanical calculation of the Gilbert damping constant α in magnetic trilayers is done by employing the torque-correlation formula within a realistic tight-binding model. A remarkable enhancement of α in Co/NM1/NM2 trilayers is obtained due to adding the caps NM2=Pd, Pt, and it decays with the thickness of the spacers NM1=Cu, Ag, Au in agreement with experiment. Nonlocal origin of the Gilbert damping is visualized with its atomic layer contributions. It is shown that magnetization in Co is damped remotely by strong spin-orbit coupling in NM2 via quantum states with large amplitude in both Co and NM2.

  13. Communication: Local energetic analysis of the interfacial and surface energies of graphene from the single layer to graphite

    NASA Astrophysics Data System (ADS)

    Kocherlakota, Lakshmi S.; Krajina, Brad A.; Overney, René M.

    2015-12-01

    Recent advances in scanning probe methods that provide direct access to the surface free energy of inorganic layered materials in terms of the Hamaker constant yield energetic values for monolayer graphene that differ substantially, by a factor of around 0.4, from bulk graphite. The onset of bulk deviating energy values was observed at a multilayer slab thickness of ˜3 nm, corresponding to a layer number of 10. The findings, complemented with extractions from water contact angle measurements and calculated interlayer binding energies, find short-range ordinary van der Waals interactions to be most prominently affected by dimensional constraints and many-body interactions.

  14. Communication: Local energetic analysis of the interfacial and surface energies of graphene from the single layer to graphite.

    PubMed

    Kocherlakota, Lakshmi S; Krajina, Brad A; Overney, René M

    2015-12-28

    Recent advances in scanning probe methods that provide direct access to the surface free energy of inorganic layered materials in terms of the Hamaker constant yield energetic values for monolayer graphene that differ substantially, by a factor of around 0.4, from bulk graphite. The onset of bulk deviating energy values was observed at a multilayer slab thickness of ∼3 nm, corresponding to a layer number of 10. The findings, complemented with extractions from water contact angle measurements and calculated interlayer binding energies, find short-range ordinary van der Waals interactions to be most prominently affected by dimensional constraints and many-body interactions.

  15. Measuring Binding Affinity of Protein-Ligand Interaction Using Spectrophotometry: Binding of Neutral Red to Riboflavin-Binding Protein

    ERIC Educational Resources Information Center

    Chenprakhon, Pirom; Sucharitakul, Jeerus; Panijpan, Bhinyo; Chaiyen, Pimchai

    2010-01-01

    The dissociation constant, K[subscript d], of the binding of riboflavin-binding protein (RP) with neutral red (NR) can be determined by titrating RP to a fixed concentration of NR. Upon adding RP to the NR solution, the maximum absorption peak of NR shifts to 545 nm from 450 nm for the free NR. The change of the absorption can be used to determine…

  16. Anion binding by bambus[6]uril probed in the gas phase and in solution.

    PubMed

    Révész, Agnes; Schröder, Detlef; Svec, Jan; Wimmerová, Michaela; Sindelar, Vladimir

    2011-10-20

    Electrospray ionization mass spectrometry (ESI-MS) is used to probe the binding of small anions to the macrocycle of bambus[6]uril. For the halide ions, the experimental patterns suggest F(-) < Cl(-) < Br(-) < I(-), which is consistent with the order of anion binding found in the condensed phase. Parallel equilibrium studies in the condensed phase establish the association constants of halide anions and bambus[6]uril in mixed solvents. A detailed analysis of the mass spectrometric data is used to shed light on the correlations between the binding constants in the condensed phase and the ion abundances observed using ESI-MS. From the analysis it becomes apparent that ESI-MS can indeed represent the situation in solution to some extent, but the sampling in the gas-phase experiment is not 1:1 compared to that in solution.

  17. Interaction of milk whey protein with common phenolic acids

    NASA Astrophysics Data System (ADS)

    Zhang, Hao; Yu, Dandan; Sun, Jing; Guo, Huiyuan; Ding, Qingbo; Liu, Ruihai; Ren, Fazheng

    2014-01-01

    Phenolics-rich foods such as fruit juices and coffee are often consumed with milk. In this study, the interactions of α-lactalbumin and β-lactoglobulin with the phenolic acids (chlorogenic acid, caffeic acid, ferulic acid, and coumalic acid) were examined. Fluorescence, CD, and FTIR spectroscopies were used to analyze the binding modes, binding constants, and the effects of complexation on the conformation of whey protein. The results showed that binding constants of each whey protein-phenolic acid interaction ranged from 4 × 105 to 7 × 106 M-n and the number of binding sites n ranged from 1.28 ± 0.13 to 1.54 ± 0.34. Because of these interactions, the conformation of whey protein was altered, with a significant reduction in the amount of α-helix and an increase in the amounts of β-sheet and turn structures.

  18. Complexes of polyadenylic acid and the methyl esters of amino acids

    NASA Technical Reports Server (NTRS)

    Khaled, M. A.; Mulins, D. W., Jr.; Swindle, M.; Lacey, J. C., Jr.

    1983-01-01

    A study of amino acid methyl esters binding to polyadenylic acid supports the theory that the genetic code originated through weak but selective affinities between amino acids and nucleotides. NMR, insoluble complex analysis, and ultraviolet spectroscopy are used to illustrate a correlation between the hydrophybicities of A amino acids and their binding constants, which, beginning with the largest, are in the order of Phe (having nominally a hydrophobic AAA anticodon), Ile, Leu, Val and Gly (having a hydrophilic anticodon with no A). In general, the binding constants are twice the values by Reuben and Polk (1980) for monomeric AMP, which suggests that polymer amino acids are interacting with only one base. No real differences are found betwen poly A binding for free Phe, Phe methyl ester or Phe amide, except that the amide value is slightly lower.

  19. Method bacterial endospore quantification using lanthanide dipicolinate luminescence

    NASA Technical Reports Server (NTRS)

    Venkateswaran, Kasthuri J. (Inventor); Kirby, James Patrick (Inventor); Ponce, Adrian (Inventor)

    2007-01-01

    A lanthanide is combined with a medium to be tested for endospores. The dipicolinic acid released from the endospores binds the lanthanides, which have distinctive emission (i.e., luminescence) spectra, and are detected using photoluminescence. The concentration of spores is determined by preparing a calibration curve generated from photoluminescence spectra of lanthanide complex mixed with spores of a known concentration. A lanthanide complex is used as the analysis reagent, and is comprised of lanthanide ions bound to multidentate ligands that increase the dipicolinic acid binding constant through a cooperative binding effect with respect to lanthanide chloride. The resulting combined effect of increasing the binding constant and eliminating coordinated water and multiple equilibria increase the sensitivity of the endospore assay by an estimated three to four orders of magnitude over prior art of endospore detection based on lanthanide luminescence.

  20. Interactions of poly(amidoamine) dendrimers with human serum albumin: binding constants and mechanisms.

    PubMed

    Giri, Jyotsnendu; Diallo, Mamadou S; Simpson, André J; Liu, Yi; Goddard, William A; Kumar, Rajeev; Woods, Gwen C

    2011-05-24

    The interactions of nanomaterials with plasma proteins have a significant impact on their in vivo transport and fate in biological fluids. This article discusses the binding of human serum albumin (HSA) to poly(amidoamine) [PAMAM] dendrimers. We use protein-coated silica particles to measure the HSA binding constants (K(b)) of a homologous series of 19 PAMAM dendrimers in aqueous solutions at physiological pH (7.4) as a function of dendrimer generation, terminal group, and core chemistry. To gain insight into the mechanisms of HSA binding to PAMAM dendrimers, we combined (1)H NMR, saturation transfer difference (STD) NMR, and NMR diffusion ordered spectroscopy (DOSY) of dendrimer-HSA complexes with atomistic molecular dynamics (MD) simulations of dendrimer conformation in aqueous solutions. The binding measurements show that the HSA binding constants (K(b)) of PAMAM dendrimers depend on dendrimer size and terminal group chemistry. The NMR (1)H and DOSY experiments indicate that the interactions between HSA and PAMAM dendrimers are relatively weak. The (1)H NMR STD experiments and MD simulations suggest that the inner shell protons of the dendrimers groups interact more strongly with HSA proteins. These interactions, which are consistently observed for different dendrimer generations (G0-NH(2)vs G4-NH(2)) and terminal groups (G4-NH(2)vs G4-OH with amidoethanol groups), suggest that PAMAM dendrimers adopt backfolded configurations as they form weak complexes with HSA proteins in aqueous solutions at physiological pH (7.4).

  1. Interaction of flavonols with human serum albumin: a biophysical study showing structure-activity relationship and enhancement when coated on silver nanoparticles.

    PubMed

    Das, Pratyusa; Chaudhari, Sunil Kumar; Das, Asmita; Kundu, Somashree; Saha, Chabita

    2018-04-24

    Binding affinities of flavonols namely quercetin, myricetin, and kaempferol to human serum albumin (HSA) were determined fluorimetrically and the order was observed to be myricetin > quercetin > kaempferol demonstrating structure-activity relationship. Quercetin-coated silver nanoparticles (AgNPs) show higher binding affinity to HSA compared to free quercetin with binding constants 6.04 × 10 7  M -1 and 4.2 × 10 6  M -1 , respectively. Using site-specific markers it is concluded that free quercetin and that coated on AgNPs bind at different sites. Significant structural changes in circular dichroism (CD) spectra of HSA were recorded with quercetin-coated AgNPs compared to free quercetin. These results were further substantiated by time-resolved fluorescence spectroscopy where fluorescence life time of the tryptophan residue in HSA-quercetin-coated AgNPs complex decreased to 3.63 ns from 4.22 ns in HSA-quercetin complex. Isothermal calorimetric studies reveal two binding modes for quercetin-coated AgNPs and also higher binding constants compared to free quercetin. These higher binding affinities are attributed to altered properties of quercetin when coated on AgNPs enabling it to reach the binding sites other than site II where free quercetin mainly binds.

  2. Synthesis, crystal structure and interaction of L-valine Schiff base divanadium(V) complex containing a V2O3 core with DNA and BSA.

    PubMed

    Guo, Qiong; Li, Lianzhi; Dong, Jianfang; Liu, Hongyan; Xu, Tao; Li, Jinghong

    2013-04-01

    A divanadium(V) complex, [V2O3(o-van-val)2] (o-van-val=Schiff base derived from o-vanillin and L-valine), has been synthesized and structurally characterized. The crystal structure shows that both of the vanadium centers in the complex have a distorted octahedral coordination environment composed of tridentate Schiff base ligand. A V2O3 core in molecular structure adopts intermediate between cis and trans configuration with the O1V1⋯V1AO1A torsion angle 115.22 (28)° and the V1⋯V1A distance 3.455Å. The binding properties of the complex with calf thymus DNA (CT-DNA) have been investigated by UV-vis absorption, fluorescence, CD spectra and viscosity measurement. The results indicate that the complex binds to CT-DNA in non-classical intercalative mode. Meanwhile, the interaction of the complex with bovine serum albumin (BSA) has been studied by UV-vis absorption, fluorescence and CD spectra. Results indicated that the complex can markedly quench the intrinsic fluorescence of BSA via a static quenching process, and cause its conformational change. The calculated apparent binding constant Kb was 1.05×10(6)M(-1) and the binding site number n was 1.18. Copyright © 2013 Elsevier B.V. All rights reserved.

  3. Analysis of the interactions between human serum albumin/amphiphilic penicillin in different aqueous media: an isothermal titration calorimetry and dynamic light scattering study

    NASA Astrophysics Data System (ADS)

    Barbosa, Silvia; Taboada, Pablo; Mosquera, Victor

    2005-04-01

    The complexation process of the amphiphilic penicillins sodium cloxacillin and sodium dicloxacillin with the protein human serum albumin (HSA) in aqueous buffered solutions of pH 4.5 and 7.4 at 25 °C was investigated through isothermal titration calorimetry (ITC) and dynamic light scattering. ITC experiments were carried out in the very dilute regime and showed that although hydrophobic interactions are the leading forces for complexation, electrostatic interactions also play an important role. The possibility of the formation of hydrogen bonds is also deduced from experimental data. The thermodynamic quantities of the binding mechanism, i.e, the enthalpy, ΔHITCi, entropy, ΔSITCi, Gibbs energy, ΔGITCi, binding constant, KITCi and the number of binding sites, ni, were obtained. The binding was saturable and is characterised by Langmuir adsorption isotherms. From ITC data and following a theoretical model, the number of bound and free penicillin molecules was calculated. From Scatchard plots, KITCi and ni were obtained and compared with those from ITC data. The interaction potential between the HSA-penicillin complexes and their stability were determined at pH 7.4 from the dependence of the diffusion coefficients on protein concentration by application of the DLVO colloidal stability theory. The results indicate decreasing stability of the colloidal dispersion of the drug-protein complexes with increase in the concentration of added drug.

  4. Interaction Entropy: A New Paradigm for Highly Efficient and Reliable Computation of Protein-Ligand Binding Free Energy.

    PubMed

    Duan, Lili; Liu, Xiao; Zhang, John Z H

    2016-05-04

    Efficient and reliable calculation of protein-ligand binding free energy is a grand challenge in computational biology and is of critical importance in drug design and many other molecular recognition problems. The main challenge lies in the calculation of entropic contribution to protein-ligand binding or interaction systems. In this report, we present a new interaction entropy method which is theoretically rigorous, computationally efficient, and numerically reliable for calculating entropic contribution to free energy in protein-ligand binding and other interaction processes. Drastically different from the widely employed but extremely expensive normal mode method for calculating entropy change in protein-ligand binding, the new method calculates the entropic component (interaction entropy or -TΔS) of the binding free energy directly from molecular dynamics simulation without any extra computational cost. Extensive study of over a dozen randomly selected protein-ligand binding systems demonstrated that this interaction entropy method is both computationally efficient and numerically reliable and is vastly superior to the standard normal mode approach. This interaction entropy paradigm introduces a novel and intuitive conceptual understanding of the entropic effect in protein-ligand binding and other general interaction systems as well as a practical method for highly efficient calculation of this effect.

  5. Absolute binding free energies between T4 lysozyme and 141 small molecules: calculations based on multiple rigid receptor configurations

    PubMed Central

    Xie, Bing; Nguyen, Trung Hai; Minh, David D. L.

    2017-01-01

    We demonstrate the feasibility of estimating protein-ligand binding free energies using multiple rigid receptor configurations. Based on T4 lysozyme snapshots extracted from six alchemical binding free energy calculations with a flexible receptor, binding free energies were estimated for a total of 141 ligands. For 24 ligands, the calculations reproduced flexible-receptor estimates with a correlation coefficient of 0.90 and a root mean square error of 1.59 kcal/mol. The accuracy of calculations based on Poisson-Boltzmann/Surface Area implicit solvent was comparable to previously reported free energy calculations. PMID:28430432

  6. Theory for rates, equilibrium constants, and Brønsted slopes in F1-ATPase single molecule imaging experiments

    PubMed Central

    Volkán-Kacsó, Sándor; Marcus, Rudolph A.

    2015-01-01

    A theoretical model of elastically coupled reactions is proposed for single molecule imaging and rotor manipulation experiments on F1-ATPase. Stalling experiments are considered in which rates of individual ligand binding, ligand release, and chemical reaction steps have an exponential dependence on rotor angle. These data are treated in terms of the effect of thermodynamic driving forces on reaction rates, and lead to equations relating rate constants and free energies to the stalling angle. These relations, in turn, are modeled using a formalism originally developed to treat electron and other transfer reactions. During stalling the free energy profile of the enzymatic steps is altered by a work term due to elastic structural twisting. Using biochemical and single molecule data, the dependence of the rate constant and equilibrium constant on the stall angle, as well as the Børnsted slope are predicted and compared with experiment. Reasonable agreement is found with stalling experiments for ATP and GTP binding. The model can be applied to other torque-generating steps of reversible ligand binding, such as ADP and Pi release, when sufficient data become available. PMID:26483483

  7. Binding of polarity-sensitive hydrophobic ligands to erythroid and nonerythroid spectrin: fluorescence and molecular modeling studies.

    PubMed

    Patra, Malay; Mitra, Madhurima; Chakrabarti, Abhijit; Mukhopadhyay, Chaitali

    2014-01-01

    We have used three polarity-sensitive fluorescence probes, 6-propionyl 2-(N,N-dimethyl-amino) naphthalene (Prodan), pyrene and 8-anilino 1-naphthalene sulphonic acid, to study their binding with erythroid and nonerythroid spectrin, using fluorescence spectroscopy. We have found that both bind to prodan and pyrene with high affinities with apparent dissociation constants (Kd) of .50 and .17 μM, for prodan, and .04 and .02 μM, for pyrene, respectively. The most striking aspect of these bindings have been that the binding stoichiometry have been equal to 1 in erythroid spectrin, both in dimeric and tetrameric form, and in tetrameric nonerythroid spectrin. From an estimate of apparent dielectric constants, the polarity of the binding site in both erythroid and nonerythroid forms have been found to be extremely hydrophobic. Thermodynamic parameters associated with such binding revealed that the binding is favored by positive change in entropy. Molecular docking studies alone indicate that both prodan and pyrene bind to the four major structural domains, following the order in the strength of binding to the Ankyrin binding domain > SH3 domain > Self-association domain > N-terminal domain of α-spectrin of both forms of spectrin. The binding experiments, particularly with the tetrameric nonerythroid spectrin, however, indicate more toward the self association domain in offering the unique binding site, since the binding stoichiometry have been 1 in all forms of dimeric and tetrameric spectrin, so far studied by us. Further studies are needed to characterize the hydrophobic binding sites in both forms of spectrin.

  8. Binding of caffeine with caffeic acid and chlorogenic acid using fluorescence quenching, UV/vis and FTIR spectroscopic techniques.

    PubMed

    Belay, Abebe; Kim, Hyung Kook; Hwang, Yoon-Hwae

    2016-03-01

    The interactions of caffeine (CF) with chlorogenic acid (CGA) and caffeic acid (CFA) were investigated by fluorescence quenching, UV/vis and Fourier transform infrared (FTIR) spectroscopic techniques. The results of the study indicated that the fluorescence quenching between caffeine and hydroxycinnamic acids could be rationalized in terms of static quenching or the formation of non-fluorescent CF-CFA and CF-CGA complexes. From fluorescence quenching spectral analysis, the quenching constant (KSV), quenching rate constant (kq), number of binding sites (n), thermodynamic properties and conformational changes of the interaction were determined. The quenching constants (KSV) between CF and CGA, CFA are 1.84 × 10(4) and 1.04 × 10(4) L/mol at 298 K and their binding site n is ~ 1. Thermodynamic parameters determined using the Van't Hoff equation indicated that hydrogen bonds and van der Waal's forces have a major role in the reaction of caffeine with caffeic acid and chlorogenic acid. The 3D fluorescence, UV/vis and FTIR spectra also showed that the binding of CF with CFA and CGA induces conformational changes in CFA and CGA. Copyright © 2015 John Wiley & Sons, Ltd.

  9. Interaction of dihydrofolate reductase with methotrexate: Ensemble and single-molecule kinetics

    NASA Astrophysics Data System (ADS)

    Rajagopalan, P. T. Ravi; Zhang, Zhiquan; McCourt, Lynn; Dwyer, Mary; Benkovic, Stephen J.; Hammes, Gordon G.

    2002-10-01

    The thermodynamics and kinetics of the interaction of dihydrofolate reductase (DHFR) with methotrexate have been studied by using fluorescence, stopped-flow, and single-molecule methods. DHFR was modified to permit the covalent addition of a fluorescent molecule, Alexa 488, and a biotin at the N terminus of the molecule. The fluorescent molecule was placed on a protein loop that closes over methotrexate when binding occurs, thus causing a quenching of the fluorescence. The biotin was used to attach the enzyme in an active form to a glass surface for single-molecule studies. The equilibrium dissociation constant for the binding of methotrexate to the enzyme is 9.5 nM. The stopped-flow studies revealed that methotrexate binds to two different conformations of the enzyme, and the association and dissociation rate constants were determined. The single-molecule investigation revealed a conformational change in the enzyme-methotrexate complex that was not observed in the stopped-flow studies. The ensemble averaged rate constants for this conformation change in both directions is about 2-4 s1 and is attributed to the opening and closing of the enzyme loop over the bound methotrexate. Thus the mechanism of methotrexate binding to DHFR involves multiple steps and protein conformational changes.

  10. A Simple and Convenient Method of Multiple Linear Regression to Calculate Iodine Molecular Constants

    ERIC Educational Resources Information Center

    Cooper, Paul D.

    2010-01-01

    A new procedure using a student-friendly least-squares multiple linear-regression technique utilizing a function within Microsoft Excel is described that enables students to calculate molecular constants from the vibronic spectrum of iodine. This method is advantageous pedagogically as it calculates molecular constants for ground and excited…

  11. Investigation into the interaction of losartan with human serum albumin and glycated human serum albumin by spectroscopic and molecular dynamics simulation techniques: A comparison study.

    PubMed

    Moeinpour, Farid; Mohseni-Shahri, Fatemeh S; Malaekeh-Nikouei, Bizhan; Nassirli, Hooriyeh

    2016-09-25

    The interaction between losartan and human serum albumin (HSA), as well as its glycated form (gHSA) was studied by multiple spectroscopic techniques and molecular dynamics simulation under physiological conditions. The binding information, including the binding constants, effective quenching constant and number of binding sites showed that the binding partiality of losartan to HSA was higher than to gHSA. The findings of three-dimensional fluorescence spectra demonstrated that the binding of losartan to HSA and gHSA would alter the protein conformation. The distances between Trp residue and the binding sites of the drug were evaluated on the basis of the Förster theory, and it was indicated that non-radiative energy transfer from HSA and gHSA to the losartan happened with a high possibility. According to molecular dynamics simulation, the protein secondary and tertiary structure changes were compared in HSA and gHSA for clarifying the obtained results. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  12. Carbohydrate binding specificity of pea lectin studied by NMR spectroscopy and molecular dynamics simulations

    NASA Astrophysics Data System (ADS)

    Cheong, Youngjoo; Shim, Gyuchang; Kang, Dongil; Kim, Yangmee

    1999-02-01

    The conformational details of Man( α1,6)Man( α)OMe are investigated through NMR spectroscopy in conjunction with molecular modeling. The lowest energy structure (M1) in the adiabatic energy map calculated with a dielectric constant of 50 has glycosidic dihedral angles of φ=-60°, ψ=180° and ω=180°. The other low energy structure (M2) has glycosidic dihedral angles of φ=-60°, ψ=180° and ω=-60°. Molecular dynamics simulations and NMR experiments prove that Man( α1,6)Man( α)OMe in the free form exists with conformational averaging of M1 and M2 conformers predominantly. Molecular dynamics simulations of the pea lectin-carbohydrate complex with explicit water molecules starting from the X-ray crystallographic structure of pea lectin show that the protein-carbohydrate interaction centers mainly on the hydrogen bonds and van der Waals interactions between protein and carbohydrate. From the molecular dynamics simulation, it is found that the M1 structure can bind to pea lectin better than the M2 structure. The origin of this selectivity is the water- mediated hydrogen bond interactions between the remote mannose and the binding site of pea lectin as well as the direct hydrogen bond interaction between the terminal mannose and pea lectin. Extensive networks of interactions in the carbohydrate binding site and the metal binding site are important in maintaining the carbohydrate binding properties of pea lectin. Especially, the predominant factors of mannose binding specificity of pea lectin are the hydrogen bond interactions between the 4th hydroxyl groups of the terminal sugar ring and the side chains of Asp-81 and Asn-125 in the carbohydrate binding site, and the additional interactions between these side chains of Asp-81 and Asn-125 and the calcium ion in the metal binding site of pea lectin.

  13. Evaluation of kinetic constants of biomolecular interaction on optical surface plasmon resonance sensor with Newton Iteration Method

    NASA Astrophysics Data System (ADS)

    Zhao, Yuanyuan; Jiang, Guoliang; Hu, Jiandong; Hu, Fengjiang; Wei, Jianguang; Shi, Liang

    2010-10-01

    In the immunology, there are two important types of biomolecular interaction: antigens-antibodies and receptors-ligands. Monitoring the response rate and affinity of biomolecular interaction can help analyze the protein function, drug discover, genomics and proteomics research. Moreover the association rate constant and dissociation rate constant of receptors-ligands are the important parameters for the study of signal transmission between cells. Recent advances in bioanalyzer instruments have greatly simplified the measurement of the kinetics of molecular interactions. Non-destructive and real-time monitoring the response to evaluate the parameters between antigens and antibodies can be performed by using optical surface plasmon resonance (SPR) biosensor technology. This technology provides a quantitative analysis that is carried out rapidly with label-free high-throughput detection using the binding curves of antigens-antibodies. Consequently, the kinetic parameters of interaction between antigens and antibodies can be obtained. This article presents a low cost integrated SPR-based bioanalyzer (HPSPR-6000) designed by ourselves. This bioanalyzer is mainly composed of a biosensor TSPR1K23, a touch-screen monitor, a microprocessor PIC24F128, a microflow cell with three channels, a clamp and a photoelectric conversion device. To obtain the kinetic parameters, sensorgrams may be modeled using one of several binding models provided with BIAevaluation software 3.0, SensiQ or Autolab. This allows calculation of the association rate constant (ka) and the dissociation rate constant (kd). The ratio of ka to kd can be used to estimate the equilibrium constant. Another kind is the analysis software OriginPro, which can process the obtained data by nonlinear fitting and then get some correlative parameters, but it can't be embedded into the bioanalyzer, so the bioanalyzer don't support the use of OriginPro. This paper proposes a novel method to evaluate the kinetic parameters of biomolecular interaction by using Newton Iteration Method and Least Squares Method. First, the pseudo first order kinetic model of biomolecular interaction was established. Then the data of molecular interaction of HBsAg and HBsAb was obtained by bioanalyzer. Finally, we used the optical SPR bioanalyzer software which was written by ourselves to make nonlinear fit about the association and dissociation curves. The correlation coefficient R-squared is 0.99229 and 0.99593, respectively. Furthermore, the kinetic parameters and affinity constants were evaluated using the obtained data from the fitting results.

  14. Multiple Mechanisms of Zinc-Mediated Inhibition for the Apoptotic Caspases-3, -6, -7, and -8.

    PubMed

    Eron, Scott J; MacPherson, Derek J; Dagbay, Kevin B; Hardy, Jeanne A

    2018-05-18

    Zinc is emerging as a widely used and important biological regulatory signal. Cellular zinc levels are tightly regulated by a complex array of zinc importers and exporters to control processes such as apoptotic cell death. While caspase inhibition by zinc has been reported previously, the reported inhibition constants were too weak to suggest a critical biological role for zinc-mediated inhibition. In this work, we have adopted a method of assessing available zinc. This allowed assessment of accurate inhibition constants for apoptotic caspases, caspase-3, -6, -7, and -8. Each of these caspases are inhibited by zinc at intracellular levels but with widely differing inhibition constants and different zinc binding stoichiometries. Caspase-3, -6, and -8 appear to be constitutively inhibited by typical zinc levels, and this inhibition must be lifted to allow activation. The inhibition constant for caspase-7 (76 nM) is much weaker than for the other apoptotic caspases (2.6-6.9 nM) suggesting that caspase-7 is not inactivated by normal zinc concentrations but can be inhibited under conditions of zinc stress. Caspase-3, -7, and -8 were found to bind three, one, and two zincs, respectively. In each of these caspases, zinc was present in the active site, in contrast to caspase-6, which binds one zinc allosterically. The most notable new mechanism to emerge from this work is for zinc-mediated inhibition of caspase-8. Zinc binds caspase-8 directly at the active site and at a second site. Zinc binding inhibits formation of the caspase-8 dimer, the activated form of the enzyme. Together these findings suggest that zinc plays a critical role in regulation of apoptosis by direct inactivation of caspases, in a manner that is unique for each caspase.

  15. Quantifying Protein-Ligand Binding Constants using Electrospray Ionization Mass Spectrometry: A Systematic Binding Affinity Study of a Series of Hydrophobically Modified Trypsin Inhibitors

    NASA Astrophysics Data System (ADS)

    Cubrilovic, Dragana; Biela, Adam; Sielaff, Frank; Steinmetzer, Torsten; Klebe, Gerhard; Zenobi, Renato

    2012-10-01

    NanoESI-MS is used for determining binding strengths of trypsin in complex with two different series of five congeneric inhibitors, whose binding affinity in solution depends on the size of the P3 substituent. The ligands of the first series contain a 4-amidinobenzylamide as P1 residue, and form a tight complex with trypsin. The inhibitors of the second series have a 2-aminomethyl-5-chloro-benzylamide as P1 group, and represent a model system for weak binders. The five different inhibitors of each group are based on the same scaffold and differ only in the length of the hydrophobic side chain of their P3 residue, which modulates the interactions in the S3/4 binding pocket of trypsin. The dissociation constants (KD) for high affinity ligands investigated by nanoESI-MS ranges from 15 nM to 450 nM and decreases with larger hydrophobic P3 side chains. Collision-induced dissociation (CID) experiments of five trypsin and benzamidine-based complexes show a correlation between trends in KD and gas-phase stability. For the second inhibitor series we could show that the effect of imidazole, a small stabilizing additive, can avoid the dissociation of the complex ions and as a result increases the relative abundance of weakly bound complexes. Here the KD values ranging from 2.9 to 17.6 μM, some 1-2 orders of magnitude lower than the first series. For both ligand series, the dissociation constants (KD) measured via nanoESI-MS were compared with kinetic inhibition constants (Ki) in solution.

  16. Quantum calculations of the rate constant for the O(3P)+HCl reaction on new ab initio 3A″ and 3A' surfaces

    NASA Astrophysics Data System (ADS)

    Xie, Tiao; Bowman, Joel M.; Peterson, K. A.; Ramachandran, B.

    2003-11-01

    We report the thermal rate constant of the O(3P)+HCl→OH+Cl reaction calculated from 200 to 3200 K, using new fits to extensive ab initio calculations [B. Ramachandran and K. A. Peterson, J. Chem. Phys. 119, 9590 (2003), preceding paper]. The rate constants are obtained for both the 3A″ and 3A' surfaces using exact quantum reactive scattering calculations for selected values of the total angular momentum and the J-shifting approximation for both the 3A″ and 3A' surfaces. The results are compared with the ICVT/μOMT rate constants calculated by the POLYRATE program and all available experimental data. Other related high-energy reaction channels are also studied qualitatively for their contribution to the total thermal rate constant at high temperature.

  17. Affinity capillary electrophoresis and fluorescence spectroscopy for studying enantioselective interactions between omeprazole enantiomer and human serum albumin.

    PubMed

    Xu, Yujing; Hong, Tingting; Chen, Xueping; Ji, Yibing

    2017-05-01

    Baseline separation of omeprazole (OME) enantiomers was achieved by affinity capillary electrophoresis (ACE), using human serum albumin (HSA) as the chiral selector. The influence of several experimental variables such as HSA concentration, the type and content of organic modifiers, applied voltage and running buffer concentration on the separation was evaluated. The binding of esomeprazole (S-omeprazole, S-OME) and its R-enantiomer (R-omeprazole, R-OME) to HSA under simulated physiological conditions was studied by ACE and fluorescence spectroscopy which was considered as a reference method. ACE studies demonstrated that the binding constants of the two enantiomers and HSA were 3.18 × 10 3 M -1 and 5.36 × 10 3 M -1 , respectively. The binding properties including the fluorescence quenching mechanisms, binding constants, binding sites and the number of binding sites were obtained by fluorescence spectroscopy. Though the ACE method could not get enough data when compared with the fluorescence spectrum method, the separation and binding studies of chiral drugs could be achieved simultaneously via this method. This study is of great significance for the investigation and clinical application of chiral drugs. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Applications of isothermal titration calorimetry - the research and technical developments from 2011 to 2015.

    PubMed

    Falconer, Robert J

    2016-10-01

    Isothermal titration calorimetry is a widely used biophysical technique for studying the formation or dissociation of molecular complexes. Over the last 5 years, much work has been published on the interpretation of isothermal titration calorimetry (ITC) data for single binding and multiple binding sites. As over 80% of ITC papers are on macromolecules of biological origin, this interpretation is challenging. Some researchers have attempted to link the thermodynamics constants to events at the molecular level. This review highlights work carried out using binding sites characterized using x-ray crystallography techniques that allow speculation about individual bond formation and the displacement of individual water molecules during ligand binding and link these events to the thermodynamic constants for binding. The review also considers research conducted with synthetic binding partners where specific binding events like anion-π and π-π interactions were studied. The revival of assays that enable both thermodynamic and kinetic information to be collected from ITC data is highlighted. Lastly, published criticism of ITC research from a physical chemistry perspective is appraised and practical advice provided for researchers unfamiliar with thermodynamics and its interpretation. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  19. Ab Initio Molecular Dynamics and Lattice Dynamics-Based Force Field for Modeling Hexagonal Boron Nitride in Mechanical and Interfacial Applications.

    PubMed

    Govind Rajan, Ananth; Strano, Michael S; Blankschtein, Daniel

    2018-04-05

    Hexagonal boron nitride (hBN) is an up-and-coming two-dimensional material, with applications in electronic devices, tribology, and separation membranes. Herein, we utilize density-functional-theory-based ab initio molecular dynamics (MD) simulations and lattice dynamics calculations to develop a classical force field (FF) for modeling hBN. The FF predicts the crystal structure, elastic constants, and phonon dispersion relation of hBN with good accuracy and exhibits remarkable agreement with the interlayer binding energy predicted by random phase approximation calculations. We demonstrate the importance of including Coulombic interactions but excluding 1-4 intrasheet interactions to obtain the correct phonon dispersion relation. We find that improper dihedrals do not modify the bulk mechanical properties and the extent of thermal vibrations in hBN, although they impact its flexural rigidity. Combining the FF with the accurate TIP4P/Ice water model yields excellent agreement with interaction energies predicted by quantum Monte Carlo calculations. Our FF should enable an accurate description of hBN interfaces in classical MD simulations.

  20. Hydrophobic forces in the foam films stabilized by sodium dodecyl sulfate: effect of electrolyte.

    PubMed

    Wang, Liguang; Yoon, Roe-Hoan

    2004-12-21

    Further studies of the hydrophobic force in foam films were carried out, including the effect of added inorganic electrolyte. We used a thin film balance of Scheludko-Exerowa type to obtain the disjoining pressure isotherms of the foam films stabilized by 10(-4) M sodium dodecyl sulfate in varying concentrations of sodium chloride. The results were compared with the disjoining pressure isotherms predicted from the extended Derjaguin-Landau-Verwey-Overbeek theory, which considers contributions from hydrophobic force in addition to those from double layer and van der Waals dispersion forces. The double layer forces were calculated from the surface potentials (psi s) obtained using the Gibbs adsorption equation and corrected for the counterion binding effect, while the dispersion forces were calculated using the Hamaker constant (A232) of 3.7 x 10(-20) J. The hydrophobic forces were calculated from the equilibrium film thickness as described previously. The predicted disjoining pressure isotherms were in good agreement with the experimental ones. It was found that the hydrophobic force is dampened substantially by the added electrolyte.

  1. Role of Reversible Histidine Coordination in Hydroxylamine Reduction by Plant Hemoglobins (Phytoglobins).

    PubMed

    Athwal, Navjot Singh; Alagurajan, Jagannathan; Andreotti, Amy H; Hargrove, Mark S

    2016-10-18

    Reduction of hydroxylamine to ammonium by phytoglobin, a plant hexacoordinate hemoglobin, is much faster than that of other hexacoordinate hemoglobins or pentacoordinate hemoglobins such as myoglobin, leghemoglobin, and red blood cell hemoglobin. The reason for differences in reactivity is not known but could be intermolecular electron transfer between protein molecules in support of the required two-electron reduction, hydroxylamine binding, or active site architecture favoring the reaction. Experiments were conducted with phytoglobins from rice, tomato, and soybean along with human neuroglobin and soybean leghemoglobin that reveal hydroxylamine binding as the rate-limiting step. For hexacoordinate hemoglobins, binding is limited by the dissociation rate constant for the distal histidine, while leghemoglobin is limited by an intrinsically low affinity for hydroxylamine. When the distal histidine is removed from rice phytoglobin, a hydroxylamine-bound intermediate is formed and the reaction rate is diminished, indicating that the distal histidine imidazole side chain is critical for the reaction, albeit not for electron transfer but rather for direct interaction with the substrate. Together, these results demonstrate that phytoglobins are superior at hydroxylamine reduction because they have distal histidine coordination affinity constants near 1, and facile rate constants for binding and dissociation of the histidine side chain. Hexacoordinate hemoglobins such as neuroglobin are limited by tighter histidine coordination that blocks hydroxylamine binding, and pentacoordinate hemoglobins have intrinsically lower hydroxylamine affinities.

  2. Botulinum Neurotoxin Serotype A Recognizes Its Protein Receptor SV2 by a Different Mechanism than Botulinum Neurotoxin B Synaptotagmin

    PubMed Central

    Weisemann, Jasmin; Stern, Daniel; Mahrhold, Stefan; Dorner, Brigitte G.; Rummel, Andreas

    2016-01-01

    Botulinum neurotoxins (BoNTs) exhibit extraordinary potency due to their exquisite neurospecificity, which is achieved by dual binding to complex polysialo-gangliosides and synaptic vesicle proteins. The luminal domain 4 (LD4) of the three synaptic vesicle glycoprotein 2 isoforms, SV2A‐C, identified as protein receptors for the most relevant serotype BoNT/A, binds within the 50 kDa cell binding domain HC of BoNT/A. Here, we deciphered the BoNT/A‐SV2 interactions in more detail. In pull down assays, the binding of HCA to SV2-LD4 isoforms decreases from SV2C >> SV2A > SV2B. A binding constant of 200 nM was determined for BoNT/A to rat SV2C-LD4 in GST pull down assay. A similar binding constant was determined by surface plasmon resonance for HCA to rat SV2C and to human SV2C, the latter being slightly lower due to the substitution L563F in LD4. At pH 5, as measured in acidic synaptic vesicles, the binding constant of HCA to hSV2C is increased more than 10-fold. Circular dichroism spectroscopy reveals that the quadrilateral helix of SV2C-LD4 already exists in solution prior to BoNT/A binding. Hence, the BoNT/A‐SV2C interaction is of different nature compared to BoNT/B‐Syt-II. In particular, the preexistence of the quadrilateral β-sheet helix of SV2 and its pH-dependent binding to BoNT/A via backbone–backbone interactions constitute major differences. Knowledge of the molecular details of BoNT/A‐SV2 interactions drives the development of high affinity peptides to counteract BoNT/A intoxications or to capture functional BoNT/A variants in innovative detection systems for botulism diagnostic. PMID:27196927

  3. Determinants of the Differential Antizyme-Binding Affinity of Ornithine Decarboxylase

    PubMed Central

    Liu, Yen-Chin; Hsu, Den-Hua; Huang, Chi-Liang; Liu, Yi-Liang; Liu, Guang-Yaw; Hung, Hui-Chih

    2011-01-01

    Ornithine decarboxylase (ODC) is a ubiquitous enzyme that is conserved in all species from bacteria to humans. Mammalian ODC is degraded by the proteasome in a ubiquitin-independent manner by direct binding to the antizyme (AZ). In contrast, Trypanosoma brucei ODC has a low binding affinity toward AZ. In this study, we identified key amino acid residues that govern the differential AZ binding affinity of human and Trypanosoma brucei ODC. Multiple sequence alignments of the ODC putative AZ-binding site highlights several key amino acid residues that are different between the human and Trypanosoma brucei ODC protein sequences, including residue 119, 124,125, 129, 136, 137 and 140 (the numbers is for human ODC). We generated a septuple human ODC mutant protein where these seven bases were mutated to match the Trypanosoma brucei ODC protein sequence. The septuple mutant protein was much less sensitive to AZ inhibition compared to the WT protein, suggesting that these amino acid residues play a role in human ODC-AZ binding. Additional experiments with sextuple mutants suggest that residue 137 plays a direct role in AZ binding, and residues 119 and 140 play secondary roles in AZ binding. The dissociation constants were also calculated to quantify the affinity of the ODC-AZ binding interaction. The K d value for the wild type ODC protein-AZ heterodimer ([ODC_WT]-AZ) is approximately 0.22 μM, while the K d value for the septuple mutant-AZ heterodimer ([ODC_7M]-AZ) is approximately 12.4 μM. The greater than 50-fold increase in [ODC_7M]-AZ binding affinity shows that the ODC-7M enzyme has a much lower binding affinity toward AZ. For the mutant proteins ODC_7M(-Q119H) and ODC_7M(-V137D), the K d was 1.4 and 1.2 μM, respectively. These affinities are 6-fold higher than the WT_ODC K d, which suggests that residues 119 and 137 play a role in AZ binding. PMID:22073206

  4. Identification of a β-lactamase inhibitory protein variant that is a potent inhibitor of Staphylococcus PC1 β-lactamase

    PubMed Central

    Yuan, Ji; Chow, Dar-Chone; Huang, Wanzhi; Palzkill, Timothy

    2011-01-01

    The β-lactamase inhibitory protein (BLIP) binds and inhibits a diverse collection of class A β-lactamases. Widespread resistance to β-lactam antibiotics currently limits treatment strategies for Staphylococcus infections. The goal of this study was to determine the binding affinity of BLIP for S. aureus PC1 β-lactamase and to identify mutants that alter binding affinity. The BLIP inhibition constant (Ki) for the PC1 β-lactamase was measured at 350 nM and isothermal titration calorimetry (ITC) experiments indicated a binding constant (Kd) of 380 nM. A total of 23 residue positions in BLIP that contact β-lactamase were randomized and phage display was used to sort the libraries for tight binders to immobilized PC1 β-lactamase. The BLIP K74G mutant was the dominant clone selected and it was found to inhibit the PC1 β-lactamase with a Ki of 42 nM while calorimetry indicated a Kd of 26 nM. Molecular modeling studies suggested BLIP binds weakly to the PC1 β-lactamase due to the presence of alanine at position 104 of PC1. This position is occupied by glutamate in the TEM-1 enzyme where it forms a salt bridge with BLIP residue Lys74 that is important for the stability of the complex. This hypothesis was confirmed by showing that the A104E PC1 enzyme binds BLIP with 15-fold greater affinity than wild type PC1 β-lactamase. Kinetic measurements indicated similar association rates for all complexes with the variation in affinity due to altered dissociation rate constants suggesting changes in short-range interactions are responsible for the altered binding properties of the mutants. PMID:21238457

  5. Actinomycin D binding mode reveals the basis for its potent HIV-1 and cancer activity

    NASA Astrophysics Data System (ADS)

    Paramanathan, Thayaparan; Vladescu, Ioana D.; McCauley, Micah J.; Rouzina, Ioulia; Williams, Mark C.

    2011-03-01

    Actinomycin D (ActD) is one of the most studied antibiotics, which has been used as an anti-cancer agent and also shown to inhibit HIV reverse transcription. Initial studies with ActD established that it intercalates double stranded DNA (dsDNA). However, recent studies have shown that ActD binds with even higher affinity to single stranded DNA (ssDNA). In our studies we use optical tweezers to stretch and hold single dsDNA molecule at constant force in the presence of varying ActD concentrations until the binding reaches equilibrium. The change in dsDNA length upon ActD binding measured as a function of time yields the rate of binding in addition to the equilibrium lengthening of DNA. The results suggest extremely slow kinetics, on the order of several minutes and 0.52 +/- 0.06 μ M binding affinity. Holding DNA at constant force while stretching and relaxing suggests that ActD binds to two single strands that are close to each other rather than to pure dsDNA or ssDNA. This suggests that biological activity of ActD that contributes towards the inhibition of cellular replication is due to its ability to bind at DNA bubbles during RNA transcription, thereby stalling the transcription process.

  6. Mechanism of calmodulin recognition of the binding domain of isoform 1b of the plasma membrane Ca2+-ATPase: kinetic pathway and effects of methionine oxidation

    PubMed Central

    Slaughter, Brian D.; Bieber Urbauer, Ramona J.; Urbauer, Jeffrey L.; Johnson, Carey K.

    2008-01-01

    Calmodulin (CaM) binds to a domain near the C-terminus of the plasma-membrane Ca2+-ATPase (PMCA), causing the release of this domain and relief of its autoinhibitory function. We investigated the kinetics of dissociation and binding of Ca2+-CaM with a 28-residue peptide (C28W(1b)) corresponding to the CaM binding domain of isoform 1b of PMCA. CaM was labeled with a fluorescent probe on either the N-terminal domain at residue 34 or on the C-terminal domain at residue 110. Formation of complexes of CaM with C28W(1b) results in a decrease in the fluorescence yield of the fluorophore, allowing the kinetics of dissociation or binding to be detected. Using a maximum entropy method, we determined the minimum number and magnitudes of rate constants required to fit the data. Comparison of the fluorescence changes for CaM labeled on the C-terminal or N-terminal domain suggests sequential and ordered binding of the C-terminal and N-terminal domains of CaM with C28W(1b). For dissociation of C28W(1b) from CaM labeled on the N-terminal domain, we observed three time constants, indicating the presence of two intermediate states in the dissociation pathway. However, for CaM labeled on the C-terminal domain, we observed only two time constants, suggesting that the fluorescence label on the C-terminal domain was not sensitive to one of the kinetic steps. The results were modeled by a kinetic mechanism where an initial complex forms upon binding of the C-terminal domain of CaM to C28W(1b), followed by binding of the N-terminal domain, and then formation of a tight binding complex. Oxidation of methionine residues in CaM resulted in significant perturbations to the binding kinetics. The rate of formation of a tight binding complex was reduced, consistent with the lower effectiveness of oxidized CaM in activating the Ca2+ pump. PMID:17343368

  7. Interactions of tea tannins and condensed tannins with proteins.

    PubMed

    Frazier, Richard A; Deaville, Eddie R; Green, Rebecca J; Stringano, Elisabetta; Willoughby, Ian; Plant, John; Mueller-Harvey, Irene

    2010-01-20

    Binding parameters for the interactions of four types of tannins: tea catechins, grape seed proanthocyanidins, mimosa 5-deoxy proanthocyanidins, and sorghum procyanidins (mDP=17), with gelatin and bovine serum albumin (BSA) have been determined from isothermal titration calorimetry data. Equilibrium binding constants determined for the interaction with gelatin were in the range 10(4) to 10(6) M(-1) and in the order: sorghum procyanidins > grape seed proanthocyanidins > mimosa 5-deoxy proanthocyanidins > tea catechins. Interaction with BSA was generally weaker, with equilibrium binding constants of < or =10(3)M(-1) for grape seed proanthocyanidins, mimosa 5-deoxy proanthocyanidins and tea catechins, and 10(4)M(-1) for the sorghum procyanidins. In all cases the interactions with proteins were exothermic and involved multiple binding sites on the protein. The data are discussed in relation to the structures and the known nutritional effects of the condensed tannins.

  8. Photocaged Competitor Guests: A General Approach Toward Light-Activated Cargo Release From Cucurbiturils.

    PubMed

    Romero, Miguel A; Basílio, Nuno; Moro, Artur J; Domingues, Mara; González-Delgado, José A; Arteaga, Jesús F; Pischel, Uwe

    2017-09-21

    A general approach toward the light-induced guest release from cucurbit[7]uril by means of a photoactivatable competitor was devised. An o-nitrobenzyl-caged competitor is photolyzed to generate a competitive guest that can displace cargo from the host macrocycle solely based on considerations of chemical equilibrium. With this method the release of terpene guests from inclusion complexes with cucurbit[7]uril was demonstrated. The binding of the herein investigated terpenes, all being lead fragrant components in essential oils, has been characterized for the first time. They feature binding constants of up to 10 8  L mol -1 and a high differential binding selectivity (spanning four orders of magnitude for the binding constants for the particular set of terpenes). By fine-tuning the photoactivatable competitor guest, selective and also sequential release of the terpenes was achieved. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Computational Approaches to the Chemical Equilibrium Constant in Protein-ligand Binding.

    PubMed

    Montalvo-Acosta, Joel José; Cecchini, Marco

    2016-12-01

    The physiological role played by protein-ligand recognition has motivated the development of several computational approaches to the ligand binding affinity. Some of them, termed rigorous, have a strong theoretical foundation but involve too much computation to be generally useful. Some others alleviate the computational burden by introducing strong approximations and/or empirical calibrations, which also limit their general use. Most importantly, there is no straightforward correlation between the predictive power and the level of approximation introduced. Here, we present a general framework for the quantitative interpretation of protein-ligand binding based on statistical mechanics. Within this framework, we re-derive self-consistently the fundamental equations of some popular approaches to the binding constant and pinpoint the inherent approximations. Our analysis represents a first step towards the development of variants with optimum accuracy/efficiency ratio for each stage of the drug discovery pipeline. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Yeast hexokinase: substrate-induced association--dissociation reactions in the binding of glucose to hexokinase P-II.

    PubMed

    Hoggett, J G; Kellett, G L

    1976-06-15

    A method is described for the purification of native hexokinases P-I and P-II from yeast using preparative isoelectric focussing to separate the isozymes. The binding of glucose to hexokinase P-II, and the effect of this on the monomer--dimer association--dissociation reaction have been investigated quantitatively by a combination of titrations of intrinsic protein fluorescence and equilibrium ultracentrifugation. Association constants for the monomer-dimer reaction decreased with increasing pH, ionic strength and concentration of glucose. Saturating concentrations of glucose did not bring about complete dissociation of the enzyme showing that both sites were occupired in the dimer. At pH 8.0 and high ionic strength, where the enzyme existed as monomer, the dissociation constant of the enzyme-glucose complex was 3 X 10(-4) mol 1(-1) and was independent of the concentration of enzyme. Binding to the dimeric form at low pH and ionic strength (I=0.02 mol 1(-1), pH less than 7.5) was also independent of enzyme concentration (in the range 10-1000 mug ml-1) but was much weaker. The process could be described by a single dissociation constant, showing that the two available sites on the dimer were equivalent and non-cooperative; values of the intrinsic dissociation constant varied from 2.5 X 10(-3) mol 1(-1) at pH 7.0 to 6 X 10(-3) at pH 6.5. Under intermediate conditions (pH 7.0, ionic strength=0.15 mol 1(-1)), where monomer and dimer coexisted, the binding of glucose showed weak positive cooperatively (Hill coefficient 1.2); in addition, the binding was dependent upon the concentration of enzyme in the direction of stronger binding at lower concentrations. The results show that the phenomenon of half-sites reactivity observed in the binding of glucose to crystalline hexokinase P-II does not occur in solution; the simplest explanation of our finding the two sites to be equivalent is that the dimer results from the homologous association of two identical subunits.

  11. Density functional theory determination of structural and electronic properties of struvite.

    PubMed

    Romanowski, Zbigniew; Kempisty, Paweł; Prywer, Jolanta; Krukowski, Stanisław; Torzewska, Agnieszka

    2010-07-29

    Crystallographic structure, total energy, electronic structure, and the most important elastic properties of struvite, NH(4)MgPO(4).6H(2)O, the main component of infectious urinary stones, are presented. The calculations were performed using ab initio full-electron calculations within the density functional theory-generalized gradient approximation (DFT-GGA) framework. The obtained crystallographic symmetry and the calculated lattice parameters and also the elastic constants are in good agreement with the experimental data. The elastic properties are essential for establishing an optimal response of urinary stones during shock-wave lithotripsy. The calculated electronic charge distribution confirms the layered structure of the struvite crystals. The polar character of the crystal, well-known from crystal growth experiments, was also confirmed by the magnitude of spontaneous polarization which was obtained from direct determination of the electrical dipole density. The calculated value of spontaneous polarization is equal to -8.8 microC cm(-2). This feature may play a key role in struvite crystallization, electrically binding the charged active impurities and other active species, and consequently determining urinary stone formation. We also present the results of our own experiment of the mineralization of struvite induced to growth by Proteus bacteria which are mainly isolated from infectious urinary stones.

  12. Spin-orbit coupling effect on structural and magnetic properties of ConRh13-n (n = 0-13) clusters

    NASA Astrophysics Data System (ADS)

    Bai, Xi; Lv, Jin; Zhang, Fu-Qiang; Jia, Jian-Feng; Wu, Hai-Shun

    2018-04-01

    The effect of spin-orbit interaction on the structures and magnetism of ConRh13-n (n = 0-13) clusters have been systematically investigated by using the spin-orbit coupling (SOC) implementation of the density functional theory (DFT). The results calculated without SOC (NSOC) show that Rh13 prefers the double simple-cubic configuration, and icosahedron is the favorable structure for n = 1-9, while n ≥ 10, clusters favor the hexagonal bilayer structure. The inclusion of SOC in calculation does not change the geometries of clusters. Compared with that in NSOC calculation, although the binding energy per atom in clusters with same composition decreases in SOC calculation, the relative stability of clusters with different compositions does not change. An interesting result is that the spin moments of clusters for n = 1-9 are almost constant (21 μB). Spin-orbit interaction recovers orbital moment and its anisotropy by removing crystal-field effect in calculation. The destruction of bonding symmetry and relaxation of bonding account for high anisotropies of orbital moments in Co11Rh2 and CoRh12 clusters. With atomic composition (Co/Rh) around 4/9-5/8 and 9/4, the Co-Rh clusters exhibit high magnetic anisotropy energies.

  13. Aptamer-based surface plasmon resonance sensing of glycated human blood proteins

    NASA Astrophysics Data System (ADS)

    Reaver, Nathan G. F.; Zheng, Rui; Kim, Dong-Shik; Cameron, Brent D.

    2013-02-01

    The concentration ratio of glycated to non-glycated forms of various blood proteins can be used as a diagnostic measure in diabetes to determine a history of glycemic compliance. Depending on a protein's half-life in blood, compliance can be assessed from a few days to several months in the past, which can then be used to provide additional therapeutic guidance. Current glycated protein detection methods are limited in their ability to measure multiple proteins, and are susceptible to interference from other blood pathologies. In this study, we developed and characterized DNA aptamers for use in Surface Plasmon Resonance (SPR) sensors to assess the blood protein hemoglobin. The aptamers were developed by way of a modified Systematic Evolution of Ligands by Exponential Enrichment (SELEX) process which selects DNA sequences that have a high binding affinity to a specific protein. DNA products resulting from this process are sequenced and identified aptamers are then synthesized. The SELEX process was performed to produce aptamers for a glycated form of hemoglobin. Equilibrium dissociation constants for the binding of the identified aptamer to glycated hemoglobin, hemoglobin, and fibrinogen were calculated from fitted Langmuir isotherms obtained through SPR. These constants were determined to be 94 nM, 147 nM, and 244 nM respectively. This aptamer can potentially be used to create a SPR aptamer based biosensor for detection of glycated hemoglobin, a technology that has the potential to deliver low-cost and immediate glycemic compliance assessment in either a clinical or home setting.

  14. Nuclear shielding constants by density functional theory with gauge including atomic orbitals

    NASA Astrophysics Data System (ADS)

    Helgaker, Trygve; Wilson, Philip J.; Amos, Roger D.; Handy, Nicholas C.

    2000-08-01

    Recently, we introduced a new density-functional theory (DFT) approach for the calculation of NMR shielding constants. First, a hybrid DFT calculation (using 5% exact exchange) is performed on the molecule to determine Kohn-Sham orbitals and their energies; second, the constants are determined as in nonhybrid DFT theory, that is, the paramagnetic contribution to the constants is calculated from a noniterative, uncoupled sum-over-states expression. The initial results suggested that this semiempirical DFT approach gives shielding constants in good agreement with the best ab initio and experimental data; in this paper, we further validate this procedure, using London orbitals in the theory, having implemented DFT into the ab initio code DALTON. Calculations on a number of small and medium-sized molecules confirm that our approach produces shieldings in excellent agreement with experiment and the best ab initio results available, demonstrating its potential for the study of shielding constants of large systems.

  15. Measuring Norfloxacin Binding to Trypsin Using a Fluorescence Quenching Assay in an Upper-Division, Integrated Laboratory Course

    ERIC Educational Resources Information Center

    Hicks, Katherine A.

    2016-01-01

    Fluorescence quenching assays are often used to measure dissociation constants that quantify the binding affinity between small molecules and proteins. In an upper-division undergraduate laboratory course, where students work on projects using a guided inquiry-based approach, a binding titration experiment at physiological pH is performed to…

  16. Quantitation of benzodiazepine receptor binding with PET [11C]iomazenil and SPECT [123I]iomazenil: preliminary results of a direct comparison in healthy human subjects.

    PubMed

    Bremner, J D; Baldwin, R; Horti, A; Staib, L H; Ng, C K; Tan, P Z; Zea-Ponce, Y; Zoghbi, S; Seibyl, J P; Soufer, R; Charney, D S; Innis, R B

    1999-08-31

    Although positron emission tomography (PET) and single photon emission computed tomography (SPECT) are increasingly used for quantitation of neuroreceptor binding, almost no studies to date have involved a direct comparison of the two. One study found a high level of agreement between the two techniques, although there was a systematic 30% increase in measures of benzodiazepine receptor binding in SPECT compared with PET. The purpose of the current study was to directly compare quantitation of benzodiazepine receptor binding in the same human subjects using PET and SPECT with high specific activity [11C]iomazenil and [123I]iomazenil, respectively. All subjects were administered a single bolus of high specific activity iomazenil labeled with 11C or 123I followed by dynamic PET or SPECT imaging of the brain. Arterial blood samples were obtained for measurement of metabolite-corrected radioligand in plasma. Compartmental modeling was used to fit values for kinetic rate constants of transfer of radioligand between plasma and brain compartments. These values were used for calculation of binding potential (BP = Bmax/Kd) and product of BP and the fraction of free non-protein-bound parent compound (V3'). Mean values for V3' in PET and SPECT were as follows: temporal cortex 23+/-5 and 22+/-3 ml/g, frontal cortex23+/-6 and 22+/-3 ml/g, occipital cortex 28+/-3 and 31+/-5 ml/g, and striatum 4+/-4 and 7+/-4 ml/g. These preliminary findings indicate that PET and SPECT provide comparable results in quantitation of neuroreceptor binding in the human brain.

  17. Interactions of cephalexin with bovine serum albumin: displacement reaction and molecular docking.

    PubMed

    Hamishehkar, Hamed; Hosseini, Soheila; Naseri, Abdolhossein; Safarnejad, Azam; Rasoulzadeh, Farzaneh

    2016-01-01

    Introduction: The drug-plasma protein interaction is a fundamental issue in guessing and checking the serious drug side effects related with other drugs. The purpose of this research was to study the interaction of cephalexin with bovine serum albumin (BSA) and displacement reaction using site probes. Methods: The interaction mechanism concerning cephalexin (CPL) with BSA was investigated using various spectroscopic methods and molecular modeling method. The binding sites number, n, apparent binding constant, K, and thermodynamic parameters, ΔG 0 , ΔH 0 , and ΔS 0 were considered at different temperatures. To evaluate the experimental results, molecular docking modeling was calculated. Results: The distance, r=1.156 nm between BSA and CPL were found in accordance with the Forster theory of non-radiation energy transfer (FRET) indicating energy transfer occurs between BSA and CPL. According to the binding parameters and ΔG 0 = negative values and ΔS 0 = 28.275 j mol -1 K -1 , a static quenching process is effective in the CPL-BSA interaction spontaneously. ΔG 0 for the CPL-BSA complex obtained from the docking simulation is -28.99 kj mol -1 , which is close to experimental ΔG of binding, -21.349 kj mol -1 that indicates a good agreement between the results of docking methods and experimental data. Conclusion: The outcomes of spectroscopic methods revealed that the conformation of BSA changed during drug-BSA interaction. The results of FRET propose that CPL quenches the fluorescence of BSA by static quenching and FRET. The displacement study showed that phenylbutazon and ketoprofen displaced CPL, indicating that its binding site on albumin is site I and Gentamicin cannot be displaced from the binding site of CPL. All results of molecular docking method agreed with the results of experimental data.

  18. An interspecies comparison of mercury inhibition on muscarinic acetylcholine receptor binding in the cerebral cortex and cerebellum

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Basu, Niladri; Department of Natural Resource Sciences, McGill University, Ste.-Anne-de-Bellevue, Quebec, H9X 3V9; Stamler, Christopher J.

    2005-05-15

    Mercury (Hg) is a ubiquitous pollutant that can disrupt neurochemical signaling pathways in mammals. It is well documented that inorganic Hg (HgCl{sub 2}) and methyl Hg (MeHg) can inhibit the binding of radioligands to the muscarinic acetylcholine (mACh) receptor in rat brains. However, little is known concerning this relationship in specific anatomical regions of the brain or in other species, including humans. The purpose of this study was to explore the inhibitory effects of HgCl{sub 2} and MeHg on [{sup 3}H]-quinuclidinyl benzilate ([{sup 3}H]-QNB) binding to the mACh receptor in the cerebellum and cerebral cortex regions from human, rat, mouse,more » mink, and river otter brain tissues. Saturation binding curves were obtained from each sample to calculate receptor density (B {sub max}) and ligand affinity (K {sub d}). Subsequently, samples were exposed to HgCl{sub 2} or MeHg to derive IC50 values and inhibition constants (K {sub i}). Results demonstrate that HgCl{sub 2} is a more potent inhibitor of mACh receptor binding than MeHg, and the receptors in the cerebellum are more sensitive to Hg-mediated mACh receptor inhibition than those in the cerebral cortex. Species sensitivities, irrespective of Hg type and brain region, can be ranked from most to least sensitive: river otter > rat > mink > mouse > humans. In summary, our data demonstrate that Hg can inhibit the binding [{sup 3}H]-QNB to the mACh receptor in a range of mammalian species. This comparative study provides data on interspecies differences and a framework for interpreting results from human, murine, and wildlife studies.« less

  19. Synthesis of trimethoprim metal complexes: Spectral, electrochemical, thermal, DNA-binding and surface morphology studies.

    PubMed

    Demirezen, Nihat; Tarınç, Derya; Polat, Duygu; Ceşme, Mustafa; Gölcü, Ayşegül; Tümer, Mehmet

    2012-08-01

    Complexes of trimethoprim (TMP), with Cu(II), Zn(II), Pt(II), Ru(III) and Fe(III) have been synthesized. Then, these complexes have been characterized by spectroscopic techniques involving UV-vis, IR, mass and (1)H NMR. CHN elemental analysis, electrochemical and thermal behavior of complexes have also been investigated. The electrochemical properties of all complexes have been investigated by cyclic voltammetry (CV) using glassy carbon electrode. The biological activity of the complexes has been evaluated by examining their ability to bind to calf-thymus DNA (CT DNA) with UV spectroscopy and cyclic voltammetry. UV studies of the interaction of the complexes with DNA have shown that these compounds can bind to CT DNA. The binding constants of the complexes with CT DNA have also been calculated. The cyclic voltammograms of the complexes in the presence of CT DNA have shown that the complexes can bind to CT DNA by both the intercalative and the electrostatic binding mode. The antimicrobial activity of these complexes has been evaluated against three Gram-positive and four Gram-negative bacteria. Antifungal activity against two different fungi has been evaluated and compared with the reference drug TMP. Almost all types of complexes show excellent activity against all type of bacteria and fungi. The morphology of the CT DNA, TMP, metal ions and metal complexes has been investigated by scanning electron microscopy (SEM). To get the SEM images, the interaction of compounds with CT DNA has been studied by means of differential pulse voltammetry (DPV) at CT DNA modified pencil graphite electrode (PGE). The decrease in intensity of the guanine oxidation signals has been used as an indicator for the interaction mechanism. Copyright © 2012 Elsevier B.V. All rights reserved.

  20. Binding and Energetics of Electron Transfer between an Artificial Four-Helix Mn-Protein and Reaction Centers from Rhodobacter sphaeroides.

    PubMed

    Espiritu, Eduardo; Olson, Tien L; Williams, JoAnn C; Allen, James P

    2017-12-12

    The ability of an artificial four-helix bundle Mn-protein, P1, to bind and transfer an electron to photosynthetic reaction centers from the purple bacterium Rhodobacter sphaeroides was characterized using optical spectroscopy. Upon illumination of reaction centers, an electron is transferred from P, the bacteriochlorophyll dimer, to Q A , the primary electron acceptor. The P1 Mn-protein can bind to the reaction center and reduce the oxidized bacteriochlorophyll dimer, P + , with a dissociation constant of 1.2 μM at pH 9.4, comparable to the binding constant of c-type cytochromes. Amino acid substitutions of surface residues on the Mn-protein resulted in increases in the dissociation constant to 8.3 μM. The extent of reduction of P + by the P1 Mn-protein was dependent on the P/P + midpoint potential and the pH. Analysis of the free energy difference yielded a midpoint potential of approximately 635 mV at pH 9.4 for the Mn cofactor of the P1 Mn-protein, a value similar to those found for other Mn cofactors in proteins. The linear dependence of -56 mV/pH is consistent with one proton being released upon Mn oxidation, allowing the complex to maintain overall charge neutrality. These outcomes demonstrate the feasibility of designing four-helix bundles and other artificial metalloproteins to bind and transfer electrons to bacterial reaction centers and establish the usefulness of this system as a platform for designing sites to bind novel metal cofactors capable of performing complex oxidation-reduction reactions.

Top