Reranking candidate gene models with cross-species comparison for improved gene prediction

PubMed Central

Liu, Qian; Crammer, Koby; Pereira, Fernando CN; Roos, David S

2008-01-01

Background Most gene finders score candidate gene models with state-based methods, typically HMMs, by combining local properties (coding potential, splice donor and acceptor patterns, etc). Competing models with similar state-based scores may be distinguishable with additional information. In particular, functional and comparative genomics datasets may help to select among competing models of comparable probability by exploiting features likely to be associated with the correct gene models, such as conserved exon/intron structure or protein sequence features. Results We have investigated the utility of a simple post-processing step for selecting among a set of alternative gene models, using global scoring rules to rerank competing models for more accurate prediction. For each gene locus, we first generate the K best candidate gene models using the gene finder Evigan, and then rerank these models using comparisons with putative orthologous genes from closely-related species. Candidate gene models with lower scores in the original gene finder may be selected if they exhibit strong similarity to probable orthologs in coding sequence, splice site location, or signal peptide occurrence. Experiments on Drosophila melanogaster demonstrate that reranking based on cross-species comparison outperforms the best gene models identified by Evigan alone, and also outperforms the comparative gene finders GeneWise and Augustus+. Conclusion Reranking gene models with cross-species comparison improves gene prediction accuracy. This straightforward method can be readily adapted to incorporate additional lines of evidence, as it requires only a ranked source of candidate gene models. PMID:18854050

IFRD1 Is a Candidate Gene for SMNA on Chromosome 7q22-q23

PubMed Central

Brkanac, Zoran; Spencer, David; Shendure, Jay; Robertson, Peggy D.; Matsushita, Mark; Vu, Tiffany; Bird, Thomas D.; Olson, Maynard V.; Raskind, Wendy H.

2009-01-01

We have established strong linkage evidence that supports mapping autosomal-dominant sensory/motor neuropathy with ataxia (SMNA) to chromosome 7q22-q32. SMNA is a rare neurological disorder whose phenotype encompasses both the central and the peripheral nervous system. In order to identify a gene responsible for SMNA, we have undertaken a comprehensive genomic evaluation of the region of linkage, including evaluation for repeat expansion and small deletions or duplications, capillary sequencing of candidate genes, and massively parallel sequencing of all coding exons. We excluded repeat expansion and small deletions or duplications as causative, and through microarray-based hybrid capture and massively parallel short-read sequencing, we identified a nonsynonymous variant in the human interferon-related developmental regulator gene 1 (IFRD1) as a disease-causing candidate. Sequence conservation, animal models, and protein structure evaluation support the involvement of IFRD1 in SMNA. Mutation analysis of IFRD1 in additional patients with similar phenotypes is needed for demonstration of causality and further evaluation of its importance in neurological diseases. PMID:19409521

Walking the interactome for candidate prioritization in exome sequencing studies of Mendelian diseases

DOE PAGES

Smedley, Damian; Kohler, Sebastian; Czeschik, Johanna Christina; ...

2014-07-30

Here, whole-exome sequencing (WES) has opened up previously unheard of possibilities for identifying novel disease genes in Mendelian disorders, only about half of which have been elucidated to date. However, interpretation of WES data remains challenging. As a result, we analyze protein–protein association (PPA) networks to identify candidate genes in the vicinity of genes previously implicated in a disease. The analysis, using a random-walk with restart (RWR) method, is adapted to the setting of WES by developing a composite variant-gene relevance score based on the rarity, location and predicted pathogenicity of variants and the RWR evaluation of genes harboring themore » variants. Benchmarking using known disease variants from 88 disease-gene families reveals that the correct gene is ranked among the top 10 candidates in ≥50% of cases, a figure which we confirmed using a prospective study of disease genes identified in 2012 and PPA data produced before that date. In conclusion, we implement our method in a freely available Web server, ExomeWalker, that displays a ranked list of candidates together with information on PPAs, frequency and predicted pathogenicity of the variants to allow quick and effective searches for candidates that are likely to reward closer investigation.« less

Walking the interactome for candidate prioritization in exome sequencing studies of Mendelian diseases

DOE Office of Scientific and Technical Information (OSTI.GOV)

Smedley, Damian; Kohler, Sebastian; Czeschik, Johanna Christina

Here, whole-exome sequencing (WES) has opened up previously unheard of possibilities for identifying novel disease genes in Mendelian disorders, only about half of which have been elucidated to date. However, interpretation of WES data remains challenging. As a result, we analyze protein–protein association (PPA) networks to identify candidate genes in the vicinity of genes previously implicated in a disease. The analysis, using a random-walk with restart (RWR) method, is adapted to the setting of WES by developing a composite variant-gene relevance score based on the rarity, location and predicted pathogenicity of variants and the RWR evaluation of genes harboring themore » variants. Benchmarking using known disease variants from 88 disease-gene families reveals that the correct gene is ranked among the top 10 candidates in ≥50% of cases, a figure which we confirmed using a prospective study of disease genes identified in 2012 and PPA data produced before that date. In conclusion, we implement our method in a freely available Web server, ExomeWalker, that displays a ranked list of candidates together with information on PPAs, frequency and predicted pathogenicity of the variants to allow quick and effective searches for candidates that are likely to reward closer investigation.« less

Signature of genetic associations in oral cancer.

PubMed

Sharma, Vishwas; Nandan, Amrita; Sharma, Amitesh Kumar; Singh, Harpreet; Bharadwaj, Mausumi; Sinha, Dhirendra Narain; Mehrotra, Ravi

2017-10-01

Oral cancer etiology is complex and controlled by multi-factorial events including genetic events. Candidate gene studies, genome-wide association studies, and next-generation sequencing identified various chromosomal loci to be associated with oral cancer. There is no available review that could give us the comprehensive picture of genetic loci identified to be associated with oral cancer by candidate gene studies-based, genome-wide association studies-based, and next-generation sequencing-based approaches. A systematic literature search was performed in the PubMed database to identify the loci associated with oral cancer by exclusive candidate gene studies-based, genome-wide association studies-based, and next-generation sequencing-based study approaches. The information of loci associated with oral cancer is made online through the resource "ORNATE." Next, screening of the loci validated by candidate gene studies and next-generation sequencing approach or by two independent studies within candidate gene studies or next-generation sequencing approaches were performed. A total of 264 loci were identified to be associated with oral cancer by candidate gene studies, genome-wide association studies, and next-generation sequencing approaches. In total, 28 loci, that is, 14q32.33 (AKT1), 5q22.2 (APC), 11q22.3 (ATM), 2q33.1 (CASP8), 11q13.3 (CCND1), 16q22.1 (CDH1), 9p21.3 (CDKN2A), 1q31.1 (COX-2), 7p11.2 (EGFR), 22q13.2 (EP300), 4q35.2 (FAT1), 4q31.3 (FBXW7), 4p16.3 (FGFR3), 1p13.3 (GSTM1-GSTT1), 11q13.2 (GSTP1), 11p15.5 (H-RAS), 3p25.3 (hOGG1), 1q32.1 (IL-10), 4q13.3 (IL-8), 12p12.1 (KRAS), 12q15 (MDM2), 12q13.12 (MLL2), 9q34.3 (NOTCH1), 17p13.1 (p53), 3q26.32 (PIK3CA), 10q23.31 (PTEN), 13q14.2 (RB1), and 5q14.2 (XRCC4), were validated to be associated with oral cancer. "ORNATE" gives a snapshot of genetic loci associated with oral cancer. All 28 loci were validated to be linked to oral cancer for which further fine-mapping followed by gene-by-gene and gene-environment interaction studies is needed to confirm their involvement in modifying oral cancer.

A de novo transcriptome and valid reference genes for quantitative real-time PCR in Colaphellus bowringi.

PubMed

Tan, Qian-Qian; Zhu, Li; Li, Yi; Liu, Wen; Ma, Wei-Hua; Lei, Chao-Liang; Wang, Xiao-Ping

2015-01-01

The cabbage beetle Colaphellus bowringi Baly is a serious insect pest of crucifers and undergoes reproductive diapause in soil. An understanding of the molecular mechanisms of diapause regulation, insecticide resistance, and other physiological processes is helpful for developing new management strategies for this beetle. However, the lack of genomic information and valid reference genes limits knowledge on the molecular bases of these physiological processes in this species. Using Illumina sequencing, we obtained more than 57 million sequence reads derived from C. bowringi, which were assembled into 39,390 unique sequences. A Clusters of Orthologous Groups classification was obtained for 9,048 of these sequences, covering 25 categories, and 16,951 were assigned to 255 Kyoto Encyclopedia of Genes and Genomes pathways. Eleven candidate reference gene sequences from the transcriptome were then identified through reverse transcriptase polymerase chain reaction. Among these candidate genes, EF1α, ACT1, and RPL19 proved to be the most stable reference genes for different reverse transcriptase quantitative polymerase chain reaction experiments in C. bowringi. Conversely, aTUB and GAPDH were the least stable reference genes. The abundant putative C. bowringi transcript sequences reported enrich the genomic resources of this beetle. Importantly, the larger number of gene sequences and valid reference genes provide a valuable platform for future gene expression studies, especially with regard to exploring the molecular mechanisms of different physiological processes in this species.

Fine mapping and identification of a candidate gene for the barley Un8 true loose smut resistance gene.

PubMed

Zang, Wen; Eckstein, Peter E; Colin, Mark; Voth, Doug; Himmelbach, Axel; Beier, Sebastian; Stein, Nils; Scoles, Graham J; Beattie, Aaron D

2015-07-01

The candidate gene for the barley Un8 true loose smut resistance gene encodes a deduced protein containing two tandem protein kinase domains. In North America, durable resistance against all known isolates of barley true loose smut, caused by the basidiomycete pathogen Ustilago nuda (Jens.) Rostr. (U. nuda), is under the control of the Un8 resistance gene. Previous genetic studies mapped Un8 to the long arm of chromosome 5 (1HL). Here, a population of 4625 lines segregating for Un8 was used to delimit the Un8 gene to a 0.108 cM interval on chromosome arm 1HL, and assign it to fingerprinted contig 546 of the barley physical map. The minimal tilling path was identified for the Un8 locus using two flanking markers and consisted of two overlapping bacterial artificial chromosomes. One gene located close to a marker co-segregating with Un8 showed high sequence identity to a disease resistance gene containing two kinase domains. Sequence of the candidate gene from the parents of the segregating population, and in an additional 19 barley lines representing a broader spectrum of diversity, showed there was no intron in alleles present in either resistant or susceptible lines, and fifteen amino acid variations unique to the deduced protein sequence in resistant lines differentiated it from the deduced protein sequences in susceptible lines. Some of these variations were present within putative functional domains which may cause a loss of function in the deduced protein sequences within susceptible lines.

Genomic approaches for the elucidation of genes and gene networks underlying cardiovascular traits.

PubMed

Adriaens, M E; Bezzina, C R

2018-06-22

Genome-wide association studies have shed light on the association between natural genetic variation and cardiovascular traits. However, linking a cardiovascular trait associated locus to a candidate gene or set of candidate genes for prioritization for follow-up mechanistic studies is all but straightforward. Genomic technologies based on next-generation sequencing technology nowadays offer multiple opportunities to dissect gene regulatory networks underlying genetic cardiovascular trait associations, thereby aiding in the identification of candidate genes at unprecedented scale. RNA sequencing in particular becomes a powerful tool when combined with genotyping to identify loci that modulate transcript abundance, known as expression quantitative trait loci (eQTL), or loci modulating transcript splicing known as splicing quantitative trait loci (sQTL). Additionally, the allele-specific resolution of RNA-sequencing technology enables estimation of allelic imbalance, a state where the two alleles of a gene are expressed at a ratio differing from the expected 1:1 ratio. When multiple high-throughput approaches are combined with deep phenotyping in a single study, a comprehensive elucidation of the relationship between genotype and phenotype comes into view, an approach known as systems genetics. In this review, we cover key applications of systems genetics in the broad cardiovascular field.

The genome sequence of the most widely cultivated cacao type and its use to identify candidate genes regulating pod color.

PubMed

Motamayor, Juan C; Mockaitis, Keithanne; Schmutz, Jeremy; Haiminen, Niina; Livingstone, Donald; Cornejo, Omar; Findley, Seth D; Zheng, Ping; Utro, Filippo; Royaert, Stefan; Saski, Christopher; Jenkins, Jerry; Podicheti, Ram; Zhao, Meixia; Scheffler, Brian E; Stack, Joseph C; Feltus, Frank A; Mustiga, Guiliana M; Amores, Freddy; Phillips, Wilbert; Marelli, Jean Philippe; May, Gregory D; Shapiro, Howard; Ma, Jianxin; Bustamante, Carlos D; Schnell, Raymond J; Main, Dorrie; Gilbert, Don; Parida, Laxmi; Kuhn, David N

2013-06-03

Theobroma cacao L. cultivar Matina 1-6 belongs to the most cultivated cacao type. The availability of its genome sequence and methods for identifying genes responsible for important cacao traits will aid cacao researchers and breeders. We describe the sequencing and assembly of the genome of Theobroma cacao L. cultivar Matina 1-6. The genome of the Matina 1-6 cultivar is 445 Mbp, which is significantly larger than a sequenced Criollo cultivar, and more typical of other cultivars. The chromosome-scale assembly, version 1.1, contains 711 scaffolds covering 346.0 Mbp, with a contig N50 of 84.4 kbp, a scaffold N50 of 34.4 Mbp, and an evidence-based gene set of 29,408 loci. Version 1.1 has 10x the scaffold N50 and 4x the contig N50 as Criollo, and includes 111 Mb more anchored sequence. The version 1.1 assembly has 4.4% gap sequence, while Criollo has 10.9%. Through a combination of haplotype, association mapping and gene expression analyses, we leverage this robust reference genome to identify a promising candidate gene responsible for pod color variation. We demonstrate that green/red pod color in cacao is likely regulated by the R2R3 MYB transcription factor TcMYB113, homologs of which determine pigmentation in Rosaceae, Solanaceae, and Brassicaceae. One SNP within the target site for a highly conserved trans-acting siRNA in dicots, found within TcMYB113, seems to affect transcript levels of this gene and therefore pod color variation. We report a high-quality sequence and annotation of Theobroma cacao L. and demonstrate its utility in identifying candidate genes regulating traits.

The genome sequence of the most widely cultivated cacao type and its use to identify candidate genes regulating pod color

PubMed Central

2013-01-01

Background Theobroma cacao L. cultivar Matina 1-6 belongs to the most cultivated cacao type. The availability of its genome sequence and methods for identifying genes responsible for important cacao traits will aid cacao researchers and breeders. Results We describe the sequencing and assembly of the genome of Theobroma cacao L. cultivar Matina 1-6. The genome of the Matina 1-6 cultivar is 445 Mbp, which is significantly larger than a sequenced Criollo cultivar, and more typical of other cultivars. The chromosome-scale assembly, version 1.1, contains 711 scaffolds covering 346.0 Mbp, with a contig N50 of 84.4 kbp, a scaffold N50 of 34.4 Mbp, and an evidence-based gene set of 29,408 loci. Version 1.1 has 10x the scaffold N50 and 4x the contig N50 as Criollo, and includes 111 Mb more anchored sequence. The version 1.1 assembly has 4.4% gap sequence, while Criollo has 10.9%. Through a combination of haplotype, association mapping and gene expression analyses, we leverage this robust reference genome to identify a promising candidate gene responsible for pod color variation. We demonstrate that green/red pod color in cacao is likely regulated by the R2R3 MYB transcription factor TcMYB113, homologs of which determine pigmentation in Rosaceae, Solanaceae, and Brassicaceae. One SNP within the target site for a highly conserved trans-acting siRNA in dicots, found within TcMYB113, seems to affect transcript levels of this gene and therefore pod color variation. Conclusions We report a high-quality sequence and annotation of Theobroma cacao L. and demonstrate its utility in identifying candidate genes regulating traits. PMID:23731509

EXONSAMPLER: a computer program for genome-wide and candidate gene exon sampling for targeted next-generation sequencing.

PubMed

Cosart, Ted; Beja-Pereira, Albano; Luikart, Gordon

2014-11-01

The computer program EXONSAMPLER automates the sampling of thousands of exon sequences from publicly available reference genome sequences and gene annotation databases. It was designed to provide exon sequences for the efficient, next-generation gene sequencing method called exon capture. The exon sequences can be sampled by a list of gene name abbreviations (e.g. IFNG, TLR1), or by sampling exons from genes spaced evenly across chromosomes. It provides a list of genomic coordinates (a bed file), as well as a set of sequences in fasta format. User-adjustable parameters for collecting exon sequences include a minimum and maximum acceptable exon length, maximum number of exonic base pairs (bp) to sample per gene, and maximum total bp for the entire collection. It allows for partial sampling of very large exons. It can preferentially sample upstream (5 prime) exons, downstream (3 prime) exons, both external exons, or all internal exons. It is written in the Python programming language using its free libraries. We describe the use of EXONSAMPLER to collect exon sequences from the domestic cow (Bos taurus) genome for the design of an exon-capture microarray to sequence exons from related species, including the zebu cow and wild bison. We collected ~10% of the exome (~3 million bp), including 155 candidate genes, and ~16,000 exons evenly spaced genomewide. We prioritized the collection of 5 prime exons to facilitate discovery and genotyping of SNPs near upstream gene regulatory DNA sequences, which control gene expression and are often under natural selection. © 2014 John Wiley & Sons Ltd.

Development of New Candidate Gene and EST-Based Molecular Markers for Gossypium Species

PubMed Central

Buyyarapu, Ramesh; Kantety, Ramesh V.; Yu, John Z.; Saha, Sukumar; Sharma, Govind C.

2011-01-01

New source of molecular markers accelerate the efforts in improving cotton fiber traits and aid in developing high-density integrated genetic maps. We developed new markers based on candidate genes and G. arboreum EST sequences that were used for polymorphism detection followed by genetic and physical mapping. Nineteen gene-based markers were surveyed for polymorphism detection in 26 Gossypium species. Cluster analysis generated a phylogenetic tree with four major sub-clusters for 23 species while three species branched out individually. CAP method enhanced the rate of polymorphism of candidate gene-based markers between G. hirsutum and G. barbadense. Two hundred A-genome based SSR markers were designed after datamining of G. arboreum EST sequences (Mississippi Gossypium arboreum   EST-SSR: MGAES). Over 70% of MGAES markers successfully produced amplicons while 65 of them demonstrated polymorphism between the parents of G. hirsutum and G. barbadense RIL population and formed 14 linkage groups. Chromosomal localization of both candidate gene-based and MGAES markers was assisted by euploid and hypoaneuploid CS-B analysis. Gene-based and MGAES markers were highly informative as they were designed from candidate genes and fiber transcriptome with a potential to be integrated into the existing cotton genetic and physical maps. PMID:22315588

Exome-wide DNA capture and next generation sequencing in domestic and wild species.

PubMed

Cosart, Ted; Beja-Pereira, Albano; Chen, Shanyuan; Ng, Sarah B; Shendure, Jay; Luikart, Gordon

2011-07-05

Gene-targeted and genome-wide markers are crucial to advance evolutionary biology, agriculture, and biodiversity conservation by improving our understanding of genetic processes underlying adaptation and speciation. Unfortunately, for eukaryotic species with large genomes it remains costly to obtain genome sequences and to develop genome resources such as genome-wide SNPs. A method is needed to allow gene-targeted, next-generation sequencing that is flexible enough to include any gene or number of genes, unlike transcriptome sequencing. Such a method would allow sequencing of many individuals, avoiding ascertainment bias in subsequent population genetic analyses.We demonstrate the usefulness of a recent technology, exon capture, for genome-wide, gene-targeted marker discovery in species with no genome resources. We use coding gene sequences from the domestic cow genome sequence (Bos taurus) to capture (enrich for), and subsequently sequence, thousands of exons of B. taurus, B. indicus, and Bison bison (wild bison). Our capture array has probes for 16,131 exons in 2,570 genes, including 203 candidate genes with known function and of interest for their association with disease and other fitness traits. We successfully sequenced and mapped exon sequences from across the 29 autosomes and X chromosome in the B. taurus genome sequence. Exon capture and high-throughput sequencing identified thousands of putative SNPs spread evenly across all reference chromosomes, in all three individuals, including hundreds of SNPs in our targeted candidate genes. This study shows exon capture can be customized for SNP discovery in many individuals and for non-model species without genomic resources. Our captured exome subset was small enough for affordable next-generation sequencing, and successfully captured exons from a divergent wild species using the domestic cow genome as reference.

Candidate gene association mapping of Sclerotinia stalk rot resistance in sunflower (Helianthus annuus L.) uncovers the importance of COI1 homologs.

PubMed

Talukder, Zahirul I; Hulke, Brent S; Qi, Lili; Scheffler, Brian E; Pegadaraju, Venkatramana; McPhee, Kevin; Gulya, Thomas J

2014-01-01

Functional markers for Sclerotinia basal stalk rot resistance in sunflower were obtained using gene-level information from the model species Arabidopsis thaliana. Sclerotinia stalk rot, caused by Sclerotinia sclerotiorum, is one of the most destructive diseases of sunflower (Helianthus annuus L.) worldwide. Markers for genes controlling resistance to S. sclerotiorum will enable efficient marker-assisted selection (MAS). We sequenced eight candidate genes homologous to Arabidopsis thaliana defense genes known to be associated with Sclerotinia disease resistance in a sunflower association mapping population evaluated for Sclerotinia stalk rot resistance. The total candidate gene sequence regions covered a concatenated length of 3,791 bp per individual. A total of 187 polymorphic sites were detected for all candidate gene sequences, 149 of which were single nucleotide polymorphisms (SNPs) and 38 were insertions/deletions. Eight SNPs in the coding regions led to changes in amino acid codons. Linkage disequilibrium decay throughout the candidate gene regions declined on average to an r (2) = 0.2 for genetic intervals of 120 bp, but extended up to 350 bp with r (2) = 0.1. A general linear model with modification to account for population structure was found the best fitting model for this population and was used for association mapping. Both HaCOI1-1 and HaCOI1-2 were found to be strongly associated with Sclerotinia stalk rot resistance and explained 7.4 % of phenotypic variation in this population. These SNP markers associated with Sclerotinia stalk rot resistance can potentially be applied to the selection of favorable genotypes, which will significantly improve the efficiency of MAS during the development of stalk rot resistant cultivars.

Screening of the Filamin C Gene in a Large Cohort of Hypertrophic Cardiomyopathy Patients.

PubMed

Gómez, Juan; Lorca, Rebeca; Reguero, Julian R; Morís, César; Martín, María; Tranche, Salvador; Alonso, Belén; Iglesias, Sara; Alvarez, Victoria; Díaz-Molina, Beatriz; Avanzas, Pablo; Coto, Eliecer

2017-04-01

Recent exome sequencing studies identified filamin C ( FLNC ) as a candidate gene for hypertrophic cardiomyopathy (HCM). Our aim was to determine the rate of FLNC candidate variants in a large cohort of HCM patients who were also sequenced for the main sarcomere genes. A total of 448 HCM patients were next generation-sequenced (semiconductor chip technology) for the MYH7, MYBPC3 , TNNT2 , TNNI3 , ACTC1 , TNNC1 , MYL2 , MYL3 , TPM1 , and FLNC genes. We also sequenced 450 healthy controls from the same population. Based on the reported population frequencies, bioinformatic criteria, and familial segregation, we identified 20 FLNC candidate variants (13 new; 1 nonsense; and 19 missense) in 22 patients. Compared with the patients, only 1 of the control's missense variants was nonreported ( P =0.007; Fisher exact probability test). Based on the familial segregation and the reported functional studies, 6 of the candidate variants (in 7 patients) were finally classified as likely pathogenic, 10 as variants of uncertain significance, and 4 as likely benign. We provide a compelling evidence of the involvement of FLNC in the development of HCM. Most of the FLNC variants were associated with mild forms of HCM and a reduced penetrance, with few affected in the families to confirm the segregation. Our work, together with others who found FLNC variants among patients with dilated and restrictive cardiomyopathies, pointed to this gene as an important cause of structural cardiomyopathies. © 2017 American Heart Association, Inc.

Evolutionary Distance of Amino Acid Sequence Orthologs across Macaque Subspecies: Identifying Candidate Genes for SIV Resistance in Chinese Rhesus Macaques

PubMed Central

Ross, Cody T.; Roodgar, Morteza; Smith, David Glenn

2015-01-01

We use the Reciprocal Smallest Distance (RSD) algorithm to identify amino acid sequence orthologs in the Chinese and Indian rhesus macaque draft sequences and estimate the evolutionary distance between such orthologs. We then use GOanna to map gene function annotations and human gene identifiers to the rhesus macaque amino acid sequences. We conclude methodologically by cross-tabulating a list of amino acid orthologs with large divergence scores with a list of genes known to be involved in SIV or HIV pathogenesis. We find that many of the amino acid sequences with large evolutionary divergence scores, as calculated by the RSD algorithm, have been shown to be related to HIV pathogenesis in previous laboratory studies. Four of the strongest candidate genes for SIVmac resistance in Chinese rhesus macaques identified in this study are CDK9, CXCL12, TRIM21, and TRIM32. Additionally, ANKRD30A, CTSZ, GORASP2, GTF2H1, IL13RA1, MUC16, NMDAR1, Notch1, NT5M, PDCD5, RAD50, and TM9SF2 were identified as possible candidates, among others. We failed to find many laboratory experiments contrasting the effects of Indian and Chinese orthologs at these sites on SIVmac pathogenesis, but future comparative studies might hold fertile ground for research into the biological mechanisms underlying innate resistance to SIVmac in Chinese rhesus macaques. PMID:25884674

A taxonomic framework for cable bacteria and proposal of the candidate genera Electrothrix and Electronema.

PubMed

Trojan, Daniela; Schreiber, Lars; Bjerg, Jesper T; Bøggild, Andreas; Yang, Tingting; Kjeldsen, Kasper U; Schramm, Andreas

2016-07-01

Cable bacteria are long, multicellular filaments that can conduct electric currents over centimeter-scale distances. All cable bacteria identified to date belong to the deltaproteobacterial family Desulfobulbaceae and have not been isolated in pure culture yet. Their taxonomic delineation and exact phylogeny is uncertain, as most studies so far have reported only short partial 16S rRNA sequences or have relied on identification by a combination of filament morphology and 16S rRNA-targeted fluorescence in situ hybridization with a Desulfobulbaceae-specific probe. In this study, nearly full-length 16S rRNA gene sequences of 16 individual cable bacteria filaments from freshwater, salt marsh, and marine sites of four geographic locations are presented. These sequences formed a distinct, monophyletic sister clade to the genus Desulfobulbus and could be divided into six coherent, species-level clusters, arranged as two genus-level groups. The same grouping was retrieved by phylogenetic analysis of full or partial dsrAB genes encoding the dissimilatory sulfite reductase. Based on these results, it is proposed to accommodate cable bacteria within two novel candidate genera: the mostly marine "Candidatus Electrothrix", with four candidate species, and the mostly freshwater "Candidatus Electronema", with two candidate species. This taxonomic framework can be used to assign environmental sequences confidently to the cable bacteria clade, even without morphological information. Database searches revealed 185 16S rRNA gene sequences that affiliated within the clade formed by the proposed cable bacteria genera, of which 120 sequences could be assigned to one of the six candidate species, while the remaining 65 sequences indicated the existence of up to five additional species. Copyright © 2016 The Author(s). Published by Elsevier GmbH.. All rights reserved.

Using whole-exome sequencing to identify variants inherited from mosaic parents

PubMed Central

Rios, Jonathan J; Delgado, Mauricio R

2015-01-01

Whole-exome sequencing (WES) has allowed the discovery of genes and variants causing rare human disease. This is often achieved by comparing nonsynonymous variants between unrelated patients, and particularly for sporadic or recessive disease, often identifies a single or few candidate genes for further consideration. However, despite the potential for this approach to elucidate the genetic cause of rare human disease, a majority of patients fail to realize a genetic diagnosis using standard exome analysis methods. Although genetic heterogeneity contributes to the difficulty of exome sequence analysis between patients, it remains plausible that rare human disease is not caused by de novo or recessive variants. Multiple human disorders have been described for which the variant was inherited from a phenotypically normal mosaic parent. Here we highlight the potential for exome sequencing to identify a reasonable number of candidate genes when dominant disease variants are inherited from a mosaic parent. We show the power of WES to identify a limited number of candidate genes using this disease model and how sequence coverage affects identification of mosaic variants by WES. We propose this analysis as an alternative to discover genetic causes of rare human disorders for which typical WES approaches fail to identify likely pathogenic variants. PMID:24986828

A public platform for the verification of the phenotypic effect of candidate genes for resistance to aflatoxin accumulation and Aspergillus flavus infection in maize

USDA-ARS?s Scientific Manuscript database

A public candidate gene testing pipeline for resistance to aflatoxin accumulation or Aspergillus flavus infection in maize is presented here. The pipeline consists of steps for identifying, testing, and verifying the association of any maize gene sequence with resistance under field conditions. Reso...

Transcript map of the Ovum mutant (Om) locus: isolation by exon trapping of new candidate genes for the DDK syndrome.

PubMed

Le Bras, Stéphanie; Cohen-Tannoudji, Michel; Guyot, Valérie; Vandormael-Pournin, Sandrine; Coumailleau, Franck; Babinet, Charles; Baldacci, Patricia

2002-08-21

The DDK syndrome is defined as the embryonic lethality of F1 mouse embryos from crosses between DDK females and males from other strains (named hereafter as non-DDK strains). Genetically controlled by the Ovum mutant (Om) locus, it is due to a deleterious interaction between a maternal factor present in DDK oocytes and the non-DDK paternal pronucleus. Therefore, the DDK syndrome constitutes a unique genetic tool to study the crucial interactions that take place between the parental genomes and the egg cytoplasm during mammalian development. In this paper, we present an extensive analysis performed by exon trapping on the Om region. Twenty-seven trapped sequences were from genes in the databases: beta-adaptin, CCT zeta2, DNA LigaseIII, Notchless, Rad51l3 and Scya1. Twenty-eight other sequences presented similarities with expressed sequence tags and genomic sequences whereas 57 did not. The pattern of expression of 37 of these markers was established. Importantly, five of them are expressed in DDK oocytes and are candidate genes for the maternal factor, and 20 are candidate genes for the paternal factor since they are expressed in testis. This data is an important step towards identifying the genes responsible for the DDK syndrome.

Exome Sequence Analysis of 14 Families With High Myopia.

PubMed

Kloss, Bethany A; Tompson, Stuart W; Whisenhunt, Kristina N; Quow, Krystina L; Huang, Samuel J; Pavelec, Derek M; Rosenberg, Thomas; Young, Terri L

2017-04-01

To identify causal gene mutations in 14 families with autosomal dominant (AD) high myopia using exome sequencing. Select individuals from 14 large Caucasian families with high myopia were exome sequenced. Gene variants were filtered to identify potential pathogenic changes. Sanger sequencing was used to confirm variants in original DNA, and to test for disease cosegregation in additional family members. Candidate genes and chromosomal loci previously associated with myopic refractive error and its endophenotypes were comprehensively screened. In 14 high myopia families, we identified 73 rare and 31 novel gene variants as candidates for pathogenicity. In seven of these families, two of the novel and eight of the rare variants were within known myopia loci. A total of 104 heterozygous nonsynonymous rare variants in 104 genes were identified in 10 out of 14 probands. Each variant cosegregated with affection status. No rare variants were identified in genes known to cause myopia or in genes closest to published genome-wide association study association signals for refractive error or its endophenotypes. Whole exome sequencing was performed to determine gene variants implicated in the pathogenesis of AD high myopia. This study provides new genes for consideration in the pathogenesis of high myopia, and may aid in the development of genetic profiling of those at greatest risk for attendant ocular morbidities of this disorder.

Digital transcriptome analysis of putative sex-determination genes in papaya (Carica papaya).

PubMed

Urasaki, Naoya; Tarora, Kazuhiko; Shudo, Ayano; Ueno, Hiroki; Tamaki, Moritoshi; Miyagi, Norimichi; Adaniya, Shinichi; Matsumura, Hideo

2012-01-01

Papaya (Carica papaya) is a trioecious plant species that has male, female and hermaphrodite flowers on different plants. The primitive sex chromosomes genetically determine the sex of the papaya. Although draft sequences of the papaya genome are already available, the genes for sex determination have not been identified, likely due to the complicated structure of its sex-chromosome sequences. To identify the candidate genes for sex determination, we conducted a transcriptome analysis of flower samples from male, female and hermaphrodite plants using high-throughput SuperSAGE for digital gene expression analysis. Among the short sequence tags obtained from the transcripts, 312 unique tags were specifically mapped to the primitive sex chromosome (X or Y(h)) sequences. An annotation analysis revealed that retroelements are the most abundant sequences observed in the genes corresponding to these tags. The majority of tags on the sex chromosomes were located on the X chromosome, and only 30 tags were commonly mapped to both the X and Y(h) chromosome, implying a loss of many genes on the Y(h) chromosome. Nevertheless, candidate Y(h) chromosome-specific female determination genes, including a MADS-box gene, were identified. Information on these sex chromosome-specific expressed genes will help elucidating sex determination in the papaya.

Digital Transcriptome Analysis of Putative Sex-Determination Genes in Papaya (Carica papaya)

PubMed Central

Urasaki, Naoya; Tarora, Kazuhiko; Shudo, Ayano; Ueno, Hiroki; Tamaki, Moritoshi; Miyagi, Norimichi; Adaniya, Shinichi; Matsumura, Hideo

2012-01-01

Papaya (Carica papaya) is a trioecious plant species that has male, female and hermaphrodite flowers on different plants. The primitive sex chromosomes genetically determine the sex of the papaya. Although draft sequences of the papaya genome are already available, the genes for sex determination have not been identified, likely due to the complicated structure of its sex-chromosome sequences. To identify the candidate genes for sex determination, we conducted a transcriptome analysis of flower samples from male, female and hermaphrodite plants using high-throughput SuperSAGE for digital gene expression analysis. Among the short sequence tags obtained from the transcripts, 312 unique tags were specifically mapped to the primitive sex chromosome (X or Yh) sequences. An annotation analysis revealed that retroelements are the most abundant sequences observed in the genes corresponding to these tags. The majority of tags on the sex chromosomes were located on the X chromosome, and only 30 tags were commonly mapped to both the X and Yh chromosome, implying a loss of many genes on the Yh chromosome. Nevertheless, candidate Yh chromosome-specific female determination genes, including a MADS-box gene, were identified. Information on these sex chromosome-specific expressed genes will help elucidating sex determination in the papaya. PMID:22815863

Genomic analysis of Meckel–Gruber syndrome in Arabs reveals marked genetic heterogeneity and novel candidate genes

PubMed Central

Shaheen, Ranad; Faqeih, Eissa; Alshammari, Muneera J; Swaid, Abdulrahman; Al-Gazali, Lihadh; Mardawi, Elham; Ansari, Shinu; Sogaty, Sameera; Seidahmed, Mohammed Z; AlMotairi, Muhammed I; Farra, Chantal; Kurdi, Wesam; Al-Rasheed, Shatha; Alkuraya, Fowzan S

2013-01-01

Meckel–Gruber syndrome (MKS, OMIM #249000) is a multiple congenital malformation syndrome that represents the severe end of the ciliopathy phenotypic spectrum. Despite the relatively common occurrence of this syndrome among Arabs, little is known about its genetic architecture in this population. This is a series of 18 Arab families with MKS, who were evaluated clinically and studied using autozygome-guided mutation analysis and exome sequencing. We show that autozygome-guided candidate gene analysis identified the underlying mutation in the majority (n=12, 71%). Exome sequencing revealed a likely pathogenic mutation in three novel candidate MKS disease genes. These include C5orf42, Ellis–van-Creveld disease gene EVC2 and SEC8 (also known as EXOC4), which encodes an exocyst protein with an established role in ciliogenesis. This is the largest and most comprehensive genomic study on MKS in Arabs and the results, in addition to revealing genetic and allelic heterogeneity, suggest that previously reported disease genes and the novel candidates uncovered by this study account for the overwhelming majority of MKS patients in our population. PMID:23169490

De novo transcriptome sequencing of axolotl blastema for identification of differentially expressed genes during limb regeneration

PubMed Central

2013-01-01

Background Salamanders are unique among vertebrates in their ability to completely regenerate amputated limbs through the mediation of blastema cells located at the stump ends. This regeneration is nerve-dependent because blastema formation and regeneration does not occur after limb denervation. To obtain the genomic information of blastema tissues, de novo transcriptomes from both blastema tissues and denervated stump ends of Ambystoma mexicanum (axolotls) 14 days post-amputation were sequenced and compared using Solexa DNA sequencing. Results The sequencing done for this study produced 40,688,892 reads that were assembled into 307,345 transcribed sequences. The N50 of transcribed sequence length was 562 bases. A similarity search with known proteins identified 39,200 different genes to be expressed during limb regeneration with a cut-off E-value exceeding 10-5. We annotated assembled sequences by using gene descriptions, gene ontology, and clusters of orthologous group terms. Targeted searches using these annotations showed that the majority of the genes were in the categories of essential metabolic pathways, transcription factors and conserved signaling pathways, and novel candidate genes for regenerative processes. We discovered and confirmed numerous sequences of the candidate genes by using quantitative polymerase chain reaction and in situ hybridization. Conclusion The results of this study demonstrate that de novo transcriptome sequencing allows gene expression analysis in a species lacking genome information and provides the most comprehensive mRNA sequence resources for axolotls. The characterization of the axolotl transcriptome can help elucidate the molecular mechanisms underlying blastema formation during limb regeneration. PMID:23815514

Clinical germline diagnostic exome sequencing for hereditary cancer: Findings within novel candidate genes are prevalent.

PubMed

Powis, Zöe; Espenschied, Carin R; LaDuca, Holly; Hagman, Kelly D; Paudyal, Tripti; Li, Shuwei; Inaba, Hiroto; Mauer, Ann; Nathanson, Katherine L; Knost, James; Chao, Elizabeth C; Tang, Sha

2018-08-01

Clinical diagnostic exome sequencing (DES) has been effective in diagnosing individuals with suspected genetic conditions; nevertheless little has been described regarding its clinical utility in individuals with a personal and family history of cancer. This study aimed to assess diagnostic yield and clinical characteristics of pediatric and adult patients undergoing germline DES for hereditary cancer. We retrospectively reviewed 2171 patients referred for DES; cases with a personal and/or family history of cancer were further studied. Of 39 cancer patients, relevant alterations were found in eight individuals (21%), including one (3%) positive pathogenic alteration within a characterized gene, two (5%) uncertain findings in characterized genes, and five (13%) alterations in novel candidate genes. Two of the 5 pediatric patients, undergoing testing, (40%) had findings in novel candidate genes, with the remainder being negative. We include brief case studies to illustrate the variety of challenging issues related to these patients. Our observations demonstrate utility of family-based exome sequencing in patients for suspected hereditary cancer, including familial co-segregation analysis, and comprehensive medical review. DES may be particularly useful when traditional approaches do not result in a diagnosis or in families with unique phenotypes. This work also highlights the importance and complexity of analysis of uncharacterized genes in exome sequencing for hereditary cancer. Copyright © 2018 Elsevier Inc. All rights reserved.

GraphTeams: a method for discovering spatial gene clusters in Hi-C sequencing data.

PubMed

Schulz, Tizian; Stoye, Jens; Doerr, Daniel

2018-05-08

Hi-C sequencing offers novel, cost-effective means to study the spatial conformation of chromosomes. We use data obtained from Hi-C experiments to provide new evidence for the existence of spatial gene clusters. These are sets of genes with associated functionality that exhibit close proximity to each other in the spatial conformation of chromosomes across several related species. We present the first gene cluster model capable of handling spatial data. Our model generalizes a popular computational model for gene cluster prediction, called δ-teams, from sequences to graphs. Following previous lines of research, we subsequently extend our model to allow for several vertices being associated with the same label. The model, called δ-teams with families, is particular suitable for our application as it enables handling of gene duplicates. We develop algorithmic solutions for both models. We implemented the algorithm for discovering δ-teams with families and integrated it into a fully automated workflow for discovering gene clusters in Hi-C data, called GraphTeams. We applied it to human and mouse data to find intra- and interchromosomal gene cluster candidates. The results include intrachromosomal clusters that seem to exhibit a closer proximity in space than on their chromosomal DNA sequence. We further discovered interchromosomal gene clusters that contain genes from different chromosomes within the human genome, but are located on a single chromosome in mouse. By identifying δ-teams with families, we provide a flexible model to discover gene cluster candidates in Hi-C data. Our analysis of Hi-C data from human and mouse reveals several known gene clusters (thus validating our approach), but also few sparsely studied or possibly unknown gene cluster candidates that could be the source of further experimental investigations.

High-throughput, pooled sequencing identifies mutations in NUBPL and FOXRED1 in human complex I deficiency

PubMed Central

Calvo, Sarah E; Tucker, Elena J; Compton, Alison G; Kirby, Denise M; Crawford, Gabriel; Burtt, Noel P; Rivas, Manuel A; Guiducci, Candace; Bruno, Damien L; Goldberger, Olga A; Redman, Michelle C; Wiltshire, Esko; Wilson, Callum J; Altshuler, David; Gabriel, Stacey B; Daly, Mark J; Thorburn, David R; Mootha, Vamsi K

2010-01-01

Discovering the molecular basis of mitochondrial respiratory chain disease is challenging given the large number of both mitochondrial and nuclear genes involved. We report a strategy of focused candidate gene prediction, high-throughput sequencing, and experimental validation to uncover the molecular basis of mitochondrial complex I (CI) disorders. We created five pools of DNA from a cohort of 103 patients and then performed deep sequencing of 103 candidate genes to spotlight 151 rare variants predicted to impact protein function. We used confirmatory experiments to establish genetic diagnoses in 22% of previously unsolved cases, and discovered that defects in NUBPL and FOXRED1 can cause CI deficiency. Our study illustrates how large-scale sequencing, coupled with functional prediction and experimental validation, can reveal novel disease-causing mutations in individual patients. PMID:20818383

Identification of Immunity Related Genes to Study the Physalis peruviana – Fusarium oxysporum Pathosystem

PubMed Central

Enciso-Rodríguez, Felix E.; González, Carolina; Rodríguez, Edwin A.; López, Camilo E.; Landsman, David; Barrero, Luz Stella; Mariño-Ramírez, Leonardo

2013-01-01

The Cape gooseberry ( Physalis peruviana L) is an Andean exotic fruit with high nutritional value and appealing medicinal properties. However, its cultivation faces important phytosanitary problems mainly due to pathogens like Fusarium oxysporum, Cercosporaphysalidis and Alternaria spp. Here we used the Cape gooseberry foliar transcriptome to search for proteins that encode conserved domains related to plant immunity including: NBS (Nucleotide Binding Site), CC (Coiled-Coil), TIR (Toll/Interleukin-1 Receptor). We identified 74 immunity related gene candidates in P . peruviana which have the typical resistance gene (R-gene) architecture, 17 Receptor like kinase (RLKs) candidates related to PAMP-Triggered Immunity (PTI), eight (TIR-NBS-LRR, or TNL) and nine (CC–NBS-LRR, or CNL) candidates related to Effector-Triggered Immunity (ETI) genes among others. These candidate genes were categorized by molecular function (98%), biological process (85%) and cellular component (79%) using gene ontology. Some of the most interesting predicted roles were those associated with binding and transferase activity. We designed 94 primers pairs from the 74 immunity-related genes (IRGs) to amplify the corresponding genomic regions on six genotypes that included resistant and susceptible materials. From these, we selected 17 single band amplicons and sequenced them in 14 F. oxysporum resistant and susceptible genotypes. Sequence polymorphisms were analyzed through preliminary candidate gene association, which allowed the detection of one SNP at the PpIRG-63 marker revealing a nonsynonymous mutation in the predicted LRR domain suggesting functional roles for resistance. PMID:23844210

Identification of immunity related genes to study the Physalis peruviana--Fusarium oxysporum pathosystem.

PubMed

Enciso-Rodríguez, Felix E; González, Carolina; Rodríguez, Edwin A; López, Camilo E; Landsman, David; Barrero, Luz Stella; Mariño-Ramírez, Leonardo

2013-01-01

The Cape gooseberry (Physalisperuviana L) is an Andean exotic fruit with high nutritional value and appealing medicinal properties. However, its cultivation faces important phytosanitary problems mainly due to pathogens like Fusarium oxysporum, Cercosporaphysalidis and Alternaria spp. Here we used the Cape gooseberry foliar transcriptome to search for proteins that encode conserved domains related to plant immunity including: NBS (Nucleotide Binding Site), CC (Coiled-Coil), TIR (Toll/Interleukin-1 Receptor). We identified 74 immunity related gene candidates in P. peruviana which have the typical resistance gene (R-gene) architecture, 17 Receptor like kinase (RLKs) candidates related to PAMP-Triggered Immunity (PTI), eight (TIR-NBS-LRR, or TNL) and nine (CC-NBS-LRR, or CNL) candidates related to Effector-Triggered Immunity (ETI) genes among others. These candidate genes were categorized by molecular function (98%), biological process (85%) and cellular component (79%) using gene ontology. Some of the most interesting predicted roles were those associated with binding and transferase activity. We designed 94 primers pairs from the 74 immunity-related genes (IRGs) to amplify the corresponding genomic regions on six genotypes that included resistant and susceptible materials. From these, we selected 17 single band amplicons and sequenced them in 14 F. oxysporum resistant and susceptible genotypes. Sequence polymorphisms were analyzed through preliminary candidate gene association, which allowed the detection of one SNP at the PpIRG-63 marker revealing a nonsynonymous mutation in the predicted LRR domain suggesting functional roles for resistance.

Mining new crystal protein genes from Bacillus thuringiensis on the basis of mixed plasmid-enriched genome sequencing and a computational pipeline.

PubMed

Ye, Weixing; Zhu, Lei; Liu, Yingying; Crickmore, Neil; Peng, Donghai; Ruan, Lifang; Sun, Ming

2012-07-01

We have designed a high-throughput system for the identification of novel crystal protein genes (cry) from Bacillus thuringiensis strains. The system was developed with two goals: (i) to acquire the mixed plasmid-enriched genomic sequence of B. thuringiensis using next-generation sequencing biotechnology, and (ii) to identify cry genes with a computational pipeline (using BtToxin_scanner). In our pipeline method, we employed three different kinds of well-developed prediction methods, BLAST, hidden Markov model (HMM), and support vector machine (SVM), to predict the presence of Cry toxin genes. The pipeline proved to be fast (average speed, 1.02 Mb/min for proteins and open reading frames [ORFs] and 1.80 Mb/min for nucleotide sequences), sensitive (it detected 40% more protein toxin genes than a keyword extraction method using genomic sequences downloaded from GenBank), and highly specific. Twenty-one strains from our laboratory's collection were selected based on their plasmid pattern and/or crystal morphology. The plasmid-enriched genomic DNA was extracted from these strains and mixed for Illumina sequencing. The sequencing data were de novo assembled, and a total of 113 candidate cry sequences were identified using the computational pipeline. Twenty-seven candidate sequences were selected on the basis of their low level of sequence identity to known cry genes, and eight full-length genes were obtained with PCR. Finally, three new cry-type genes (primary ranks) and five cry holotypes, which were designated cry8Ac1, cry7Ha1, cry21Ca1, cry32Fa1, and cry21Da1 by the B. thuringiensis Toxin Nomenclature Committee, were identified. The system described here is both efficient and cost-effective and can greatly accelerate the discovery of novel cry genes.

Identification and fine mapping of a stay-green gene (Brnye1) in pakchoi (Brassica campestris L. ssp. chinensis).

PubMed

Wang, Nan; Liu, Zhiyong; Zhang, Yun; Li, Chengyu; Feng, Hui

2018-03-01

Using bulked segregant analysis combined with next-generation sequencing, we delimited the Brnye1 gene responsible for the stay-green trait of nye in pakchoi. Sequence analysis identified Bra019346 as the candidate gene. "Stay-green" refers to a plant trait whereby leaves remain green during senescence. This trait is useful in the cultivation of pakchoi (Brassica campestris L. ssp. chinensis), which is marketed as a green leaf product. This study aimed to identify the gene responsible for the stay-green trait in pakchoi. We identified a stay-green mutant in pakchoi, which we termed "nye". Genetic analysis revealed that the stay-green trait is controlled by a single recessive gene, Brnye1. Using the BSA-seq method, a 3.0-Mb candidate region was mapped on chromosome A03, which helped us localize Brnye1 to an 81.01-kb interval between SSR markers SSRWN27 and SSRWN30 via linkage analysis in an F 2 population. We identified 12 genes in this region, 11 of which were annotated based on the Brassica rapa annotation database, and one was a functionally unknown gene. An orthologous gene of the Arabidopsis gene AtNYE1, Bra019346, was identified as the potential candidate for Brnye1. Sequence analysis revealed a 40-bp insertion in the second exon of Bra019346 in nye, which generated the TAA stop codon. A candidate gene-specific Indel marker in 1561 F 2 individuals showed perfect cosegregation with Brnye1 in the nye mutant. These results provide a foundation for uncovering the molecular mechanism of the stay-green trait in pakchoi.

Candidate genes for obesity-susceptibility show enriched association within a large genome-wide association study for BMI.

PubMed

Vimaleswaran, Karani S; Tachmazidou, Ioanna; Zhao, Jing Hua; Hirschhorn, Joel N; Dudbridge, Frank; Loos, Ruth J F

2012-10-15

Before the advent of genome-wide association studies (GWASs), hundreds of candidate genes for obesity-susceptibility had been identified through a variety of approaches. We examined whether those obesity candidate genes are enriched for associations with body mass index (BMI) compared with non-candidate genes by using data from a large-scale GWAS. A thorough literature search identified 547 candidate genes for obesity-susceptibility based on evidence from animal studies, Mendelian syndromes, linkage studies, genetic association studies and expression studies. Genomic regions were defined to include the genes ±10 kb of flanking sequence around candidate and non-candidate genes. We used summary statistics publicly available from the discovery stage of the genome-wide meta-analysis for BMI performed by the genetic investigation of anthropometric traits consortium in 123 564 individuals. Hypergeometric, rank tail-strength and gene-set enrichment analysis tests were used to test for the enrichment of association in candidate compared with non-candidate genes. The hypergeometric test of enrichment was not significant at the 5% P-value quantile (P = 0.35), but was nominally significant at the 25% quantile (P = 0.015). The rank tail-strength and gene-set enrichment tests were nominally significant for the full set of genes and borderline significant for the subset without SNPs at P < 10(-7). Taken together, the observed evidence for enrichment suggests that the candidate gene approach retains some value. However, the degree of enrichment is small despite the extensive number of candidate genes and the large sample size. Studies that focus on candidate genes have only slightly increased chances of detecting associations, and are likely to miss many true effects in non-candidate genes, at least for obesity-related traits.

The genome sequence of the most widely cultivated cacao type and its use to identify candidate genes regulating pod color

USDA-ARS?s Scientific Manuscript database

Background: Theobroma cacao L. cultivar Matina 1-6 belongs to the most cultivated cacao type. The availability of its genome sequence and methods for identifying genes responsible for important cacao traits will aid cacao researchers and breeders. Results: We describe the sequencing and assembly of...

Mutational Landscape of Candidate Genes in Familial Prostate Cancer

PubMed Central

Johnson, Anna M.; Zuhlke, Kimberly A.; Plotts, Chris; McDonnell, Shannon K.; Middha, Sumit; Riska, Shaun M.; Thibodeau, Stephen N.; Douglas, Julie A.; Cooney, Kathleen A.

2014-01-01

Background Family history is a major risk factor for prostate cancer (PCa), suggesting a genetic component to the disease. However, traditional linkage and association studies have failed to fully elucidate the underlying genetic basis of familial PCa. Methods Here we use a candidate gene approach to identify potential PCa susceptibility variants in whole exome sequencing data from familial PCa cases. Six hundred ninety-seven candidate genes were identified based on function, location near a known chromosome 17 linkage signal, and/or previous association with prostate or other cancers. Single nucleotide variants (SNVs) in these candidate genes were identified in whole exome sequence data from 33 PCa cases from 11 multiplex PCa families (3 cases/family). Results Overall, 4856 candidate gene SNVs were identified, including 1052 missense and 10 nonsense variants. Twenty missense variants were shared by all 3 family members in each family in which they were observed. Additionally, 15 missense variants were shared by 2 of 3 family members and predicted to be deleterious by 5 different algorithms. Four missense variants, BLM Gln123Arg, PARP2 Arg283Gln, LRCC46 Ala295Thr and KIF2B Pro91Leu, and 1 nonsense variant, CYP3A43 Arg441Ter, showed complete co-segregation with PCa status. Twelve additional variants displayed partial co-segregation with PCa. Conclusions Forty-three nonsense and shared, missense variants were identified in our candidate genes. Further research is needed to determine the contribution of these variants to PCa susceptibility. PMID:25111073

Pediatric Glioblastoma Therapies Based on Patient-Derived Stem Cell Resources

DTIC Science & Technology

2014-11-01

genomic DNA and then subjected to Illumina high-throughput sequencing . In this analysis, shRNAs lost in the GSC population represent candidate gene...and genomic DNA and then subjected to Illumina high-throughput sequencing . In this analysis, shRNAs lost in the GSC population represent candidate...PRISM 7900 Sequence Detection System ( Genomics Resource, FHCRC). Relative transcript abundance was analyzed using the 2−ΔΔCt method. TRIzol (Invitrogen

Sleeping Beauty transposon mutagenesis identifies genes that cooperate with mutant Smad4 in gastric cancer development

PubMed Central

Takeda, Haruna; Rust, Alistair G.; Ward, Jerrold M.; Yew, Christopher Chin Kuan; Jenkins, Nancy A.; Copeland, Neal G.

2016-01-01

Mutations in SMAD4 predispose to the development of gastrointestinal cancer, which is the third leading cause of cancer-related deaths. To identify genes driving gastric cancer (GC) development, we performed a Sleeping Beauty (SB) transposon mutagenesis screen in the stomach of Smad4+/− mutant mice. This screen identified 59 candidate GC trunk drivers and a much larger number of candidate GC progression genes. Strikingly, 22 SB-identified trunk drivers are known or candidate cancer genes, whereas four SB-identified trunk drivers, including PTEN, SMAD4, RNF43, and NF1, are known human GC trunk drivers. Similar to human GC, pathway analyses identified WNT, TGF-β, and PI3K-PTEN signaling, ubiquitin-mediated proteolysis, adherens junctions, and RNA degradation in addition to genes involved in chromatin modification and organization as highly deregulated pathways in GC. Comparative oncogenomic filtering of the complete list of SB-identified genes showed that they are highly enriched for genes mutated in human GC and identified many candidate human GC genes. Finally, by comparing our complete list of SB-identified genes against the list of mutated genes identified in five large-scale human GC sequencing studies, we identified LDL receptor-related protein 1B (LRP1B) as a previously unidentified human candidate GC tumor suppressor gene. In LRP1B, 129 mutations were found in 462 human GC samples sequenced, and LRP1B is one of the top 10 most deleted genes identified in a panel of 3,312 human cancers. SB mutagenesis has, thus, helped to catalog the cooperative molecular mechanisms driving SMAD4-induced GC growth and discover genes with potential clinical importance in human GC. PMID:27006499

Sleeping Beauty transposon mutagenesis identifies genes that cooperate with mutant Smad4 in gastric cancer development.

PubMed

Takeda, Haruna; Rust, Alistair G; Ward, Jerrold M; Yew, Christopher Chin Kuan; Jenkins, Nancy A; Copeland, Neal G

2016-04-05

Mutations in SMAD4 predispose to the development of gastrointestinal cancer, which is the third leading cause of cancer-related deaths. To identify genes driving gastric cancer (GC) development, we performed a Sleeping Beauty (SB) transposon mutagenesis screen in the stomach of Smad4(+/-) mutant mice. This screen identified 59 candidate GC trunk drivers and a much larger number of candidate GC progression genes. Strikingly, 22 SB-identified trunk drivers are known or candidate cancer genes, whereas four SB-identified trunk drivers, including PTEN, SMAD4, RNF43, and NF1, are known human GC trunk drivers. Similar to human GC, pathway analyses identified WNT, TGF-β, and PI3K-PTEN signaling, ubiquitin-mediated proteolysis, adherens junctions, and RNA degradation in addition to genes involved in chromatin modification and organization as highly deregulated pathways in GC. Comparative oncogenomic filtering of the complete list of SB-identified genes showed that they are highly enriched for genes mutated in human GC and identified many candidate human GC genes. Finally, by comparing our complete list of SB-identified genes against the list of mutated genes identified in five large-scale human GC sequencing studies, we identified LDL receptor-related protein 1B (LRP1B) as a previously unidentified human candidate GC tumor suppressor gene. In LRP1B, 129 mutations were found in 462 human GC samples sequenced, and LRP1B is one of the top 10 most deleted genes identified in a panel of 3,312 human cancers. SB mutagenesis has, thus, helped to catalog the cooperative molecular mechanisms driving SMAD4-induced GC growth and discover genes with potential clinical importance in human GC.

Resistance gene candidates identified by PCR with degenerate oligonucleotide primers map to clusters of resistance genes in lettuce.

PubMed

Shen, K A; Meyers, B C; Islam-Faridi, M N; Chin, D B; Stelly, D M; Michelmore, R W

1998-08-01

The recent cloning of genes for resistance against diverse pathogens from a variety of plants has revealed that many share conserved sequence motifs. This provides the possibility of isolating numerous additional resistance genes by polymerase chain reaction (PCR) with degenerate oligonucleotide primers. We amplified resistance gene candidates (RGCs) from lettuce with multiple combinations of primers with low degeneracy designed from motifs in the nucleotide binding sites (NBSs) of RPS2 of Arabidopsis thaliana and N of tobacco. Genomic DNA, cDNA, and bacterial artificial chromosome (BAC) clones were successfully used as templates. Four families of sequences were identified that had the same similarity to each other as to resistance genes from other species. The relationship of the amplified products to resistance genes was evaluated by several sequence and genetic criteria. The amplified products contained open reading frames with additional sequences characteristic of NBSs. Hybridization of RGCs to genomic DNA and to BAC clones revealed large numbers of related sequences. Genetic analysis demonstrated the existence of clustered multigene families for each of the four RGC sequences. This parallels classical genetic data on clustering of disease resistance genes. Two of the four families mapped to known clusters of resistance genes; these two families were therefore studied in greater detail. Additional evidence that these RGCs could be resistance genes was gained by the identification of leucine-rich repeat (LRR) regions in sequences adjoining the NBS similar to those in RPM1 and RPS2 of A. thaliana. Fluorescent in situ hybridization confirmed the clustered genomic distribution of these sequences. The use of PCR with degenerate oligonucleotide primers is therefore an efficient method to identify numerous RGCs in plants.

Phytoplasma phylogenetics based on analysis of secA and 23S rRNA gene sequences for improved resolution of candidate species of 'Candidatus Phytoplasma'.

PubMed

Hodgetts, Jennifer; Boonham, Neil; Mumford, Rick; Harrison, Nigel; Dickinson, Matthew

2008-08-01

Phytoplasma phylogenetics has focused primarily on sequences of the non-coding 16S rRNA gene and the 16S-23S rRNA intergenic spacer region (16-23S ISR), and primers that enable amplification of these regions from all phytoplasmas by PCR are well established. In this study, primers based on the secA gene have been developed into a semi-nested PCR assay that results in a sequence of the expected size (about 480 bp) from all 34 phytoplasmas examined, including strains representative of 12 16Sr groups. Phylogenetic analysis of secA gene sequences showed similar clustering of phytoplasmas when compared with clusters resolved by similar sequence analyses of a 16-23S ISR-23S rRNA gene contig or of the 16S rRNA gene alone. The main differences between trees were in the branch lengths, which were elongated in the 16-23S ISR-23S rRNA gene tree when compared with the 16S rRNA gene tree and elongated still further in the secA gene tree, despite this being a shorter sequence. The improved resolution in the secA gene-derived phylogenetic tree resulted in the 16SrII group splitting into two distinct clusters, while phytoplasmas associated with coconut lethal yellowing-type diseases split into three distinct groups, thereby supporting past proposals that they represent different candidate species within 'Candidatus Phytoplasma'. The ability to differentiate 16Sr groups and subgroups by virtual RFLP analysis of secA gene sequences suggests that this gene may provide an informative alternative molecular marker for pathogen identification and diagnosis of phytoplasma diseases.

Anchoring genome sequence to chromosomes of the central bearded dragon (Pogona vitticeps) enables reconstruction of ancestral squamate macrochromosomes and identifies sequence content of the Z chromosome.

PubMed

Deakin, Janine E; Edwards, Melanie J; Patel, Hardip; O'Meally, Denis; Lian, Jinmin; Stenhouse, Rachael; Ryan, Sam; Livernois, Alexandra M; Azad, Bhumika; Holleley, Clare E; Li, Qiye; Georges, Arthur

2016-06-10

Squamates (lizards and snakes) are a speciose lineage of reptiles displaying considerable karyotypic diversity, particularly among lizards. Understanding the evolution of this diversity requires comparison of genome organisation between species. Although the genomes of several squamate species have now been sequenced, only the green anole lizard has any sequence anchored to chromosomes. There is only limited gene mapping data available for five other squamates. This makes it difficult to reconstruct the events that have led to extant squamate karyotypic diversity. The purpose of this study was to anchor the recently sequenced central bearded dragon (Pogona vitticeps) genome to chromosomes to trace the evolution of squamate chromosomes. Assigning sequence to sex chromosomes was of particular interest for identifying candidate sex determining genes. By using two different approaches to map conserved blocks of genes, we were able to anchor approximately 42 % of the dragon genome sequence to chromosomes. We constructed detailed comparative maps between dragon, anole and chicken genomes, and where possible, made broader comparisons across Squamata using cytogenetic mapping information for five other species. We show that squamate macrochromosomes are relatively well conserved between species, supporting findings from previous molecular cytogenetic studies. Macrochromosome diversity between members of the Toxicofera clade has been generated by intrachromosomal, and a small number of interchromosomal, rearrangements. We reconstructed the ancestral squamate macrochromosomes by drawing upon comparative cytogenetic mapping data from seven squamate species and propose the events leading to the arrangements observed in representative species. In addition, we assigned over 8 Mbp of sequence containing 219 genes to the Z chromosome, providing a list of genes to begin testing as candidate sex determining genes. Anchoring of the dragon genome has provided substantial insight into the evolution of squamate genomes, enabling us to reconstruct ancestral macrochromosome arrangements at key positions in the squamate phylogeny, demonstrating that fusions between macrochromosomes or fusions of macrochromosomes and microchromosomes, have played an important role during the evolution of squamate genomes. Assigning sequence to the sex chromosomes has identified NR5A1 as a promising candidate sex determining gene in the dragon.

Fine mapping of the genic male-sterile ms 1 gene in Capsicum annuum L.

PubMed

Jeong, Kyumi; Choi, Doil; Lee, Jundae

2018-01-01

The genomic region cosegregating with the genic male-sterile ms 1 gene of Capsicum annuum L. was delimited to a region of 869.9 kb on chromosome 5 through fine mapping analysis. A strong candidate gene, CA05g06780, a homolog of the Arabidopsis MALE STERILITY 1 gene that controls pollen development, was identified in this region. Genic male sterility caused by the ms 1 gene has been used for the economically efficient production of massive hybrid seeds in paprika (Capsicum annuum L.), a colored bell-type sweet pepper. Previously, a CAPS marker, PmsM1-CAPS, located about 2-3 cM from the ms 1 locus, was reported. In this study, we constructed a fine map near the ms 1 locus using high-resolution melting (HRM) markers in an F 2 population consisting of 1118 individual plants, which segregated into 867 male-fertile and 251 male-sterile plants. A total of 12 HRM markers linked to the ms 1 locus were developed from 53 primer sets targeting intraspecific SNPs derived by comparing genome-wide sequences obtained by next-generation resequencing analysis. Using this approach, we narrowed down the region cosegregating with the ms 1 gene to 869.9 kb of sequence. Gene prediction analysis revealed 11 open reading frames in this region. A strong candidate gene, CA05g06780, was identified; this gene is a homolog of the Arabidopsis MALE STERILITY 1 (MS1) gene, which encodes a PHD-type transcription factor that regulates pollen and tapetum development. Sequence comparison analysis suggested that the CA05g06780 gene is the strongest candidate for the ms 1 gene of paprika. To summarize, we developed a cosegregated marker, 32187928-HRM, for marker-assisted selection and identified a strong candidate for the ms 1 gene.

A family with X-linked anophthalmia: exclusion of SOX3 as a candidate gene.

PubMed

Slavotinek, Anne; Lee, Stephen S; Hamilton, Steven P

2005-10-01

We report on a four-generation family with X-linked anophthalmia in four affected males and show that this family has LOD scores consistent with linkage to Xq27, the third family reported to be linked to the ANOP1 locus. We sequenced the SOX3 gene at Xq27 as a candidate gene for the X-linked anophthalmia based on the high homology of this gene to SOX2, a gene previously mutated in bilateral anophthlamia. However, no amino acid sequence alterations were identified in SOX3. We have improved the definition of the phenotype in males with anophthalmia linked to the ANOP1 locus, as microcephaly, ocular colobomas, and severe renal malformations have not been described in families linked to ANOP1. (c) 2005 Wiley-Liss, Inc.

A priori and a posteriori approaches for finding genes of evolutionary interest in non-model species: osmoregulatory genes in the kidney transcriptome of the desert rodent Dipodomys spectabilis (banner-tailed kangaroo rat).

PubMed

Marra, Nicholas J; Eo, Soo Hyung; Hale, Matthew C; Waser, Peter M; DeWoody, J Andrew

2012-12-01

One common goal in evolutionary biology is the identification of genes underlying adaptive traits of evolutionary interest. Recently next-generation sequencing techniques have greatly facilitated such evolutionary studies in species otherwise depauperate of genomic resources. Kangaroo rats (Dipodomys sp.) serve as exemplars of adaptation in that they inhabit extremely arid environments, yet require no drinking water because of ultra-efficient kidney function and osmoregulation. As a basis for identifying water conservation genes in kangaroo rats, we conducted a priori bioinformatics searches in model rodents (Mus musculus and Rattus norvegicus) to identify candidate genes with known or suspected osmoregulatory function. We then obtained 446,758 reads via 454 pyrosequencing to characterize genes expressed in the kidney of banner-tailed kangaroo rats (Dipodomys spectabilis). We also determined candidates a posteriori by identifying genes that were overexpressed in the kidney. The kangaroo rat sequences revealed nine different a priori candidate genes predicted from our Mus and Rattus searches, as well as 32 a posteriori candidate genes that were overexpressed in kidney. Mutations in two of these genes, Slc12a1 and Slc12a3, cause human renal diseases that result in the inability to concentrate urine. These genes are likely key determinants of physiological water conservation in desert rodents. Copyright © 2012 Elsevier Inc. All rights reserved.

Exome sequencing of a large family identifies potential candidate genes contributing risk to bipolar disorder.

PubMed

Zhang, Tianxiao; Hou, Liping; Chen, David T; McMahon, Francis J; Wang, Jen-Chyong; Rice, John P

2018-03-01

Bipolar disorder is a mental illness with lifetime prevalence of about 1%. Previous genetic studies have identified multiple chromosomal linkage regions and candidate genes that might be associated with bipolar disorder. The present study aimed to identify potential susceptibility variants for bipolar disorder using 6 related case samples from a four-generation family. A combination of exome sequencing and linkage analysis was performed to identify potential susceptibility variants for bipolar disorder. Our study identified a list of five potential candidate genes for bipolar disorder. Among these five genes, GRID1(Glutamate Receptor Delta-1 Subunit), which was previously reported to be associated with several psychiatric disorders and brain related traits, is particularly interesting. Variants with functional significance in this gene were identified from two cousins in our bipolar disorder pedigree. Our findings suggest a potential role for these genes and the related rare variants in the onset and development of bipolar disorder in this one family. Additional research is needed to replicate these findings and evaluate their patho-biological significance. Copyright © 2017 Elsevier B.V. All rights reserved.

Mapping by sequencing in cotton (Gossypium hirsutum) line MD52ne identified candidate genes for fiber strength and its related quality attributes.

PubMed

Islam, Md S; Zeng, Linghe; Thyssen, Gregory N; Delhom, Christopher D; Kim, Hee Jin; Li, Ping; Fang, David D

2016-06-01

Three QTL regions controlling three fiber quality traits were validated and further fine-mapped with 27 new single nucleotide polymorphism (SNP) markers. Transcriptome analysis suggests that receptor-like kinases found within the validated QTLs are potential candidate genes responsible for superior fiber strength in cotton line MD52ne. Fiber strength, length, maturity and fineness determine the market value of cotton fibers and the quality of spun yarn. Cotton fiber strength has been recognized as a critical quality attribute in the modern textile industry. Fine mapping along with quantitative trait loci (QTL) validation and candidate gene prediction can uncover the genetic and molecular basis of fiber quality traits. Four previously-identified QTLs (qFBS-c3, qSFI-c14, qUHML-c14 and qUHML-c24) related to fiber bundle strength, short fiber index and fiber length, respectively, were validated using an F3 population that originated from a cross of MD90ne × MD52ne. A group of 27 new SNP markers generated from mapping-by-sequencing (MBS) were placed in QTL regions to improve and validate earlier maps. Our refined QTL regions spanned 4.4, 1.8 and 3.7 Mb of physical distance in the Gossypium raimondii reference genome. We performed RNA sequencing (RNA-seq) of 15 and 20 days post-anthesis fiber cells from MD52ne and MD90ne and aligned reads to the G. raimondii genome. The QTL regions contained 21 significantly differentially expressed genes (DEGs) between the two near-isogenic parental lines. SNPs that result in non-synonymous substitutions to amino acid sequences of annotated genes were identified within these DEGs, and mapped. Taken together, transcriptome and amino acid mutation analysis indicate that receptor-like kinase pathway genes are likely candidates for superior fiber strength and length in MD52ne. MBS along with RNA-seq demonstrated a powerful strategy to elucidate candidate genes for the QTLs that control complex traits in a complex genome like tetraploid upland cotton.

Transcriptome Sequencing of Codonopsis pilosula and Identification of Candidate Genes Involved in Polysaccharide Biosynthesis

PubMed Central

Gao, Jian Ping; Wang, Dong; Cao, Ling Ya; Sun, Hai Feng

2015-01-01

Background Codonopsis pilosula (Franch.) Nannf. is one of the most widely used medicinal plants. Although chemical and pharmacological studies have shown that codonopsis polysaccharides (CPPs) are bioactive compounds and that their composition is variable, their biosynthetic pathways remain largely unknown. Next-generation sequencing is an efficient and high-throughput technique that allows the identification of candidate genes involved in secondary metabolism. Principal Findings To identify the components involved in CPP biosynthesis, a transcriptome library, prepared using root and other tissues, was assembled with the help of Illumina sequencing. A total of 9.2 Gb of clean nucleotides was obtained comprising 91,175,044 clean reads, 102,125 contigs, and 45,511 unigenes. After aligning the sequences to the public protein databases, 76.1% of the unigenes were annotated. Among these annotated unigenes, 26,189 were assigned to Gene Ontology categories, 11,415 to Clusters of Orthologous Groups, and 18,848 to Kyoto Encyclopedia of Genes and Genomes pathways. Analysis of abundance of transcripts in the library showed that genes, including those encoding metallothionein, aquaporin, and cysteine protease that are related to stress responses, were in the top list. Among genes involved in the biosynthesis of CPP, those responsible for the synthesis of UDP-L-arabinose and UDP-xylose were highly expressed. Significance To our knowledge, this is the first study to provide a public transcriptome dataset prepared from C. pilosula and an outline of the biosynthetic pathway of polysaccharides in a medicinal plant. Identified candidate genes involved in CPP biosynthesis provide understanding of the biosynthesis and regulation of CPP at the molecular level. PMID:25719364

DISSECTING THE GENETICS OF HUMAN HIGH MYOPIA: A MOLECULAR BIOLOGIC APPROACH

PubMed Central

Young, Terri L

2004-01-01

ABSTRACT Purpose Despite the plethora of experimental myopia animal studies that demonstrate biochemical factor changes in various eye tissues, and limited human studies utilizing pharmacologic agents to thwart axial elongation, we have little knowledge of the basic physiology that drives myopic development. Identifying the implicated genes for myopia susceptibility will provide a fundamental molecular understanding of how myopia occurs and may lead to directed physiologic (ie, pharmacologic, gene therapy) interventions. The purpose of this proposal is to describe the results of positional candidate gene screening of selected genes within the autosomal dominant high-grade myopia-2 locus (MYP2) on chromosome 18p11.31. Methods A physical map of a contracted MYP2 interval was compiled, and gene expression studies in ocular tissues using complementary DNA library screens, microarray matches, and reverse-transcription techniques aided in prioritizing gene selection for screening. The TGIF, EMLIN-2, MLCB, and CLUL1 genes were screened in DNA samples from unrelated controls and in high-myopia affected and unaffected family members from the original seven MYP2 pedigrees. All candidate genes were screened by direct base pair sequence analysis. Results Consistent segregation of a gene sequence alteration (polymorphism) with myopia was not demonstrated in any of the seven families. Novel single nucleotide polymorphisms were found. Conclusion The positional candidate genes TGIF, EMLIN-2, MLCB, and CLUL1 are not associated with MYP2-linked high-grade myopia. Base change polymorphisms discovered with base sequence screening of these genes were submitted to an Internet database. Other genes that also map within the interval are currently undergoing mutation screening. PMID:15747770

High-throughput discovery of mutations in tef semi-dwarfing genes by next-generation sequencing analysis.

PubMed

Zhu, Qihui; Smith, Shavannor M; Ayele, Mulu; Yang, Lixing; Jogi, Ansuya; Chaluvadi, Srinivasa R; Bennetzen, Jeffrey L

2012-11-01

Tef (Eragrostis tef) is a major cereal crop in Ethiopia. Lodging is the primary constraint to increasing productivity in this allotetraploid species, accounting for losses of ∼15-45% in yield each year. As a first step toward identifying semi-dwarf varieties that might have improved lodging resistance, an ∼6× fosmid library was constructed and used to identify both homeologues of the dw3 semi-dwarfing gene of Sorghum bicolor. An EMS mutagenized population, consisting of ∼21,210 tef plants, was planted and leaf materials were collected into 23 superpools. Two dwarfing candidate genes, homeologues of dw3 of sorghum and rht1 of wheat, were sequenced directly from each superpool with 454 technology, and 120 candidate mutations were identified. Out of 10 candidates tested, six independent mutations were validated by Sanger sequencing, including two predicted detrimental mutations in both dw3 homeologues with a potential to improve lodging resistance in tef through further breeding. This study demonstrates that high-throughput sequencing can identify potentially valuable mutations in under-studied plant species like tef and has provided mutant lines that can now be combined and tested in breeding programs for improved lodging resistance.

Human Chromosome 7: DNA Sequence and Biology

PubMed Central

Scherer, Stephen W.; Cheung, Joseph; MacDonald, Jeffrey R.; Osborne, Lucy R.; Nakabayashi, Kazuhiko; Herbrick, Jo-Anne; Carson, Andrew R.; Parker-Katiraee, Layla; Skaug, Jennifer; Khaja, Razi; Zhang, Junjun; Hudek, Alexander K.; Li, Martin; Haddad, May; Duggan, Gavin E.; Fernandez, Bridget A.; Kanematsu, Emiko; Gentles, Simone; Christopoulos, Constantine C.; Choufani, Sanaa; Kwasnicka, Dorota; Zheng, Xiangqun H.; Lai, Zhongwu; Nusskern, Deborah; Zhang, Qing; Gu, Zhiping; Lu, Fu; Zeesman, Susan; Nowaczyk, Malgorzata J.; Teshima, Ikuko; Chitayat, David; Shuman, Cheryl; Weksberg, Rosanna; Zackai, Elaine H.; Grebe, Theresa A.; Cox, Sarah R.; Kirkpatrick, Susan J.; Rahman, Nazneen; Friedman, Jan M.; Heng, Henry H. Q.; Pelicci, Pier Giuseppe; Lo-Coco, Francesco; Belloni, Elena; Shaffer, Lisa G.; Pober, Barbara; Morton, Cynthia C.; Gusella, James F.; Bruns, Gail A. P.; Korf, Bruce R.; Quade, Bradley J.; Ligon, Azra H.; Ferguson, Heather; Higgins, Anne W.; Leach, Natalia T.; Herrick, Steven R.; Lemyre, Emmanuelle; Farra, Chantal G.; Kim, Hyung-Goo; Summers, Anne M.; Gripp, Karen W.; Roberts, Wendy; Szatmari, Peter; Winsor, Elizabeth J. T.; Grzeschik, Karl-Heinz; Teebi, Ahmed; Minassian, Berge A.; Kere, Juha; Armengol, Lluis; Pujana, Miguel Angel; Estivill, Xavier; Wilson, Michael D.; Koop, Ben F.; Tosi, Sabrina; Moore, Gudrun E.; Boright, Andrew P.; Zlotorynski, Eitan; Kerem, Batsheva; Kroisel, Peter M.; Petek, Erwin; Oscier, David G.; Mould, Sarah J.; Döhner, Hartmut; Döhner, Konstanze; Rommens, Johanna M.; Vincent, John B.; Venter, J. Craig; Li, Peter W.; Mural, Richard J.; Adams, Mark D.; Tsui, Lap-Chee

2010-01-01

DNA sequence and annotation of the entire human chromosome 7, encompassing nearly 158 million nucleotides of DNA and 1917 gene structures, are presented. To generate a higher order description, additional structural features such as imprinted genes, fragile sites, and segmental duplications were integrated at the level of the DNA sequence with medical genetic data, including 440 chromosome rearrangement breakpoints associated with disease. This approach enabled the discovery of candidate genes for developmental diseases including autism. PMID:12690205

Interspecific and intraspecific gene variability in a 1-Mb region containing the highest density of NBS-LRR genes found in the melon genome.

PubMed

González, Víctor M; Aventín, Núria; Centeno, Emilio; Puigdomènech, Pere

2014-12-17

Plant NBS-LRR -resistance genes tend to be found in clusters, which have been shown to be hot spots of genome variability. In melon, half of the 81 predicted NBS-LRR genes group in nine clusters, and a 1 Mb region on linkage group V contains the highest density of R-genes and presence/absence gene polymorphisms found in the melon genome. This region is known to contain the locus of Vat, an agronomically important gene that confers resistance to aphids. However, the presence of duplications makes the sequencing and annotation of R-gene clusters difficult, usually resulting in multi-gapped sequences with higher than average errors. A 1-Mb sequence that contains the largest NBS-LRR gene cluster found in melon was improved using a strategy that combines Illumina paired-end mapping and PCR-based gap closing. Unknown sequence was decreased by 70% while about 3,000 SNPs and small indels were corrected. As a result, the annotations of 18 of a total of 23 NBS-LRR genes found in this region were modified, including additional coding sequences, amino acid changes, correction of splicing boundaries, or fussion of ORFs in common transcription units. A phylogeny analysis of the R-genes and their comparison with syntenic sequences in other cucurbits point to a pattern of local gene amplifications since the diversification of cucurbits from other families, and through speciation within the family. A candidate Vat gene is proposed based on the sequence similarity between a reported Vat gene from a Korean melon cultivar and a sequence fragment previously absent in the unrefined sequence. A sequence refinement strategy allowed substantial improvement of a 1 Mb fragment of the melon genome and the re-annotation of the largest cluster of NBS-LRR gene homologues found in melon. Analysis of the cluster revealed that resistance genes have been produced by sequence duplication in adjacent genome locations since the divergence of cucurbits from other close families, and through the process of speciation within the family a candidate Vat gene was also identified using sequence previously unavailable, which demonstrates the advantages of genome assembly refinements when analyzing complex regions such as those containing clusters of highly similar genes.

Mutation analysis of the chromosome 14q24.3 dihydrolipoyl succinyltransferase (DLST) gene in patients with early-onset Alzheimer disease.

PubMed

Cruts, M; Backhovens, H; Van Gassen, G; Theuns, J; Wang, S Y; Wehnert, A; van Duijn, C M; Karlsson, T; Hofman, A; Adolfsson, R

1995-10-13

Linkage analysis studies have indicated that the chromosome band 14q24.3 harbours a major gene for familial early-onset Alzheimer's disease (AD). Recently we localized the chromosome 14 AD gene (AD3) in the 6.4 cM interval between the markers D14S289 and D14S61. We mapped the gene encoding dihydrolipoyl succinyltransferase (DLST), the E2k component of human alpha-ketoglutarate dehydrogenase complex (KGDHC), in the AD3 candidate region using yeast artificial chromosomes (YACs). The DLST gene is a candidate for the AD3 gene since deficiencies in KGDHC activity have been observed in brain tissue and fibroblasts of AD patients. The 15 exons and the promoter region of the DLST gene were analysed for mutations in chromosome 14 linked AD cases and in two series of unrelated early-onset AD cases (onset age < 55 years). Sequence variations in intronic sequences (introns 3, 5 and 10) or silent mutations in exonic sequences (exons 8 and 14) were identified. However, no AD related mutations were observed, suggesting that the DLST gene is not the chromosome 14 AD3 gene.

Identification of an miRNA candidate reflects the possible significance of transcribed microsatellites in the hairpin precursors of black pepper.

PubMed

Joy, Nisha; Soniya, Eppurathu Vasudevan

2012-06-01

Plant miRNAs (18-24nt) are generated by the RNase III-type Dicer endonuclease from the endogenous hairpin precursors ('pre-miRNAs') with significant regulatory functions. The transcribed regions display a higher frequency of microsatellites, when compared to other regions of the genomic DNA. Simple sequence repeats (SSRs) resulting from replication slippage occurring in transcripts affect the expression of genes. The available experimental evidence for the incidence of SSRs in the miRNA precursors is limited. Considering the potential significance of SSRs in the miRNA genes, we carried out a preliminary analysis to verify the presence of SSRs in the pri-miRNAs of black pepper (Piper nigrum L.). We isolated a (CT) dinucleotide SSR bearing transcript using SMART strategy. The transcript was predicted to be a 'pri-miRNA candidate' with Dicer sites based on miRNA prediction tools and MFOLD structural predictions. The presence of this 'miRNA candidate' was confirmed by real-time TaqMan assays. The upstream sequence of the 'miRNA candidate' by genome walking when subjected to PlantCARE showed the presence of certain promoter elements, and the deduced amino acid showed significant similarity with NAP1 gene, which affects the transcription of many genes. Moreover the hairpin-like precursor overlapped the neighbouring NAP1 gene. In silico analysis revealed distinct putative functions for the 'miRNA candidate', of which majority were related to growth. Hence, we assume that this 'miRNA candidate' may get activated during transcription of NAP gene, thereby regulating the expression of many genes involved in developmental processes.

Using RNA-Seq for gene identification, polymorphism detection and transcript profiling in two alfalfa genotypes with divergent cell wall composition in stems

PubMed Central

2011-01-01

Background Alfalfa, [Medicago sativa (L.) sativa], a widely-grown perennial forage has potential for development as a cellulosic ethanol feedstock. However, the genomics of alfalfa, a non-model species, is still in its infancy. The recent advent of RNA-Seq, a massively parallel sequencing method for transcriptome analysis, provides an opportunity to expand the identification of alfalfa genes and polymorphisms, and conduct in-depth transcript profiling. Results Cell walls in stems of alfalfa genotype 708 have higher cellulose and lower lignin concentrations compared to cell walls in stems of genotype 773. Using the Illumina GA-II platform, a total of 198,861,304 expression sequence tags (ESTs, 76 bp in length) were generated from cDNA libraries derived from elongating stem (ES) and post-elongation stem (PES) internodes of 708 and 773. In addition, 341,984 ESTs were generated from ES and PES internodes of genotype 773 using the GS FLX Titanium platform. The first alfalfa (Medicago sativa) gene index (MSGI 1.0) was assembled using the Sanger ESTs available from GenBank, the GS FLX Titanium EST sequences, and the de novo assembled Illumina sequences. MSGI 1.0 contains 124,025 unique sequences including 22,729 tentative consensus sequences (TCs), 22,315 singletons and 78,981 pseudo-singletons. We identified a total of 1,294 simple sequence repeats (SSR) among the sequences in MSGI 1.0. In addition, a total of 10,826 single nucleotide polymorphisms (SNPs) were predicted between the two genotypes. Out of 55 SNPs randomly selected for experimental validation, 47 (85%) were polymorphic between the two genotypes. We also identified numerous allelic variations within each genotype. Digital gene expression analysis identified numerous candidate genes that may play a role in stem development as well as candidate genes that may contribute to the differences in cell wall composition in stems of the two genotypes. Conclusions Our results demonstrate that RNA-Seq can be successfully used for gene identification, polymorphism detection and transcript profiling in alfalfa, a non-model, allogamous, autotetraploid species. The alfalfa gene index assembled in this study, and the SNPs, SSRs and candidate genes identified can be used to improve alfalfa as a forage crop and cellulosic feedstock. PMID:21504589

Pea Marker Database (PMD) - A new online database combining known pea (Pisum sativum L.) gene-based markers.

PubMed

Kulaeva, Olga A; Zhernakov, Aleksandr I; Afonin, Alexey M; Boikov, Sergei S; Sulima, Anton S; Tikhonovich, Igor A; Zhukov, Vladimir A

2017-01-01

Pea (Pisum sativum L.) is the oldest model object of plant genetics and one of the most agriculturally important legumes in the world. Since the pea genome has not been sequenced yet, identification of genes responsible for mutant phenotypes or desirable agricultural traits is usually performed via genetic mapping followed by candidate gene search. Such mapping is best carried out using gene-based molecular markers, as it opens the possibility for exploiting genome synteny between pea and its close relative Medicago truncatula Gaertn., possessing sequenced and annotated genome. In the last 5 years, a large number of pea gene-based molecular markers have been designed and mapped owing to the rapid evolution of "next-generation sequencing" technologies. However, the access to the complete set of markers designed worldwide is limited because the data are not uniformed and therefore hard to use. The Pea Marker Database was designed to combine the information about pea markers in a form of user-friendly and practical online tool. Version 1 (PMD1) comprises information about 2484 genic markers, including their locations in linkage groups, the sequences of corresponding pea transcripts and the names of related genes in M. truncatula. Version 2 (PMD2) is an updated version comprising 15944 pea markers in the same format with several advanced features. To test the performance of the PMD, fine mapping of pea symbiotic genes Sym13 and Sym27 in linkage groups VII and V, respectively, was carried out. The results of mapping allowed us to propose the Sen1 gene (a homologue of SEN1 gene of Lotus japonicus (Regel) K. Larsen) as the best candidate gene for Sym13, and to narrow the list of possible candidate genes for Sym27 to ten, thus proving PMD to be useful for pea gene mapping and cloning. All information contained in PMD1 and PMD2 is available at www.peamarker.arriam.ru.

Mapping of Mcs30, a new mammary carcinoma susceptibility quantitative trait locus (QTL30) on rat chromosome 12: identification of fry as a candidate Mcs gene.

PubMed

Ren, Xuefeng; Graham, Jessica C; Jing, Lichen; Mikheev, Andrei M; Gao, Yuan; Lew, Jenny Pan; Xie, Hong; Kim, Andrea S; Shang, Xiuling; Friedman, Cynthia; Vail, Graham; Fang, Ming Zhu; Bromberg, Yana; Zarbl, Helmut

2013-01-01

Rat strains differ dramatically in their susceptibility to mammary carcinogenesis. On the assumption that susceptibility genes are conserved across mammalian species and hence inform human carcinogenesis, numerous investigators have used genetic linkage studies in rats to identify genes responsible for differential susceptibility to carcinogenesis. Using a genetic backcross between the resistant Copenhagen (Cop) and susceptible Fischer 344 (F344) strains, we mapped a novel mammary carcinoma susceptibility (Mcs30) locus to the centromeric region on chromosome 12 (LOD score of ∼8.6 at the D12Rat59 marker). The Mcs30 locus comprises approximately 12 Mbp on the long arm of rat RNO12 whose synteny is conserved on human chromosome 13q12 to 13q13. After analyzing numerous genes comprising this locus, we identified Fry, the rat ortholog of the furry gene of Drosophila melanogaster, as a candidate Mcs gene. We cloned and determined the complete nucleotide sequence of the 13 kbp Fry mRNA. Sequence analysis indicated that the Fry gene was highly conserved across evolution, with 90% similarity of the predicted amino acid sequence among eutherian mammals. Comparison of the Fry sequence in the Cop and F344 strains identified two non-synonymous single nucleotide polymorphisms (SNPs), one of which creates a putative, de novo phosphorylation site. Further analysis showed that the expression of the Fry gene is reduced in a majority of rat mammary tumors. Our results also suggested that FRY activity was reduced in human breast carcinoma cell lines as a result of reduced levels or mutation. This study is the first to identify the Fry gene as a candidate Mcs gene. Our data suggest that the SNPs within the Fry gene contribute to the genetic susceptibility of the F344 rat strain to mammary carcinogenesis. These results provide the foundation for analyzing the role of the human FRY gene in cancer susceptibility and progression.

A high-resolution genetic, physical, and comparative gene map of the doublefoot (Dbf) region of mouse chromosome 1 and the region of conserved synteny on human chromosome 2q35.

PubMed

Hayes, C; Rump, A; Cadman, M R; Harrison, M; Evans, E P; Lyon, M F; Morriss-Kay, G M; Rosenthal, A; Brown, S D

2001-12-01

The mouse doublefoot (Dbf) mutant exhibits preaxial polydactyly in association with craniofacial defects. This mutation has previously been mapped to mouse chromosome 1. We have used a positional cloning strategy, coupled with a comparative sequencing approach using available human draft sequence, to identify putative candidates for the Dbf gene in the mouse and in homologous human region. We have constructed a high-resolution genetic map of the region, localizing the mutation to a 0.4-cM (+/-0.0061) interval on mouse chromosome 1. Furthermore, we have constructed contiguous BAC/PAC clone maps across the mouse and human Dbf region. Using existing markers and additional sequence tagged sites, which we have generated, we have anchored the physical map to the genetic map. Through the comparative sequencing of these clones we have identified 35 genes within this interval, indicating that the region is gene-rich. From this we have identified several genes that are known to be differentially expressed in the developing mid-gestation mouse embryo, some in the developing embryonic limb buds. These genes include those encoding known developmental signaling molecules such as WNT proteins and IHH, and we provide evidence that these genes are candidates for the Dbf mutation.

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Methylation analysis of plasma cell-free DNA for breast cancer early detection using bisulfite next-generation sequencing.

PubMed

Li, Zibo; Guo, Xinwu; Tang, Lili; Peng, Limin; Chen, Ming; Luo, Xipeng; Wang, Shouman; Xiao, Zhi; Deng, Zhongping; Dai, Lizhong; Xia, Kun; Wang, Jun

2016-10-01

Circulating cell-free DNA (cfDNA) has been considered as a potential biomarker for non-invasive cancer detection. To evaluate the methylation levels of six candidate genes (EGFR, GREM1, PDGFRB, PPM1E, SOX17, and WRN) in plasma cfDNA as biomarkers for breast cancer early detection, quantitative analysis of the promoter methylation of these genes from 86 breast cancer patients and 67 healthy controls was performed by using microfluidic-PCR-based target enrichment and next-generation bisulfite sequencing technology. The predictive performance of different logistic models based on methylation status of candidate genes was investigated by means of the area under the ROC curve (AUC) and odds ratio (OR) analysis. Results revealed that EGFR, PPM1E, and 8 gene-specific CpG sites showed significantly hypermethylation in cancer patients' plasma and significantly associated with breast cancer (OR ranging from 2.51 to 9.88). The AUC values for these biomarkers were ranging from 0.66 to 0.75. Combinations of multiple hypermethylated genes or CpG sites substantially improved the predictive performance for breast cancer detection. Our study demonstrated the feasibility of quantitative measurement of candidate gene methylation in cfDNA by using microfluidic-PCR-based target enrichment and bisulfite next-generation sequencing, which is worthy of further validation and potentially benefits a broad range of applications in clinical oncology practice. Quantitative analysis of methylation pattern of plasma cfDNA by next-generation sequencing might be a valuable non-invasive tool for early detection of breast cancer.

Secretome Characterization and Correlation Analysis Reveal Putative Pathogenicity Mechanisms and Identify Candidate Avirulence Genes in the Wheat Stripe Rust Fungus Puccinia striiformis f. sp. tritici.

PubMed

Xia, Chongjing; Wang, Meinan; Cornejo, Omar E; Jiwan, Derick A; See, Deven R; Chen, Xianming

2017-01-01

Stripe (yellow) rust, caused by Puccinia striiformis f. sp. tritici ( Pst ), is one of the most destructive diseases of wheat worldwide. Planting resistant cultivars is an effective way to control this disease, but race-specific resistance can be overcome quickly due to the rapid evolving Pst population. Studying the pathogenicity mechanisms is critical for understanding how Pst virulence changes and how to develop wheat cultivars with durable resistance to stripe rust. We re-sequenced 7 Pst isolates and included additional 7 previously sequenced isolates to represent balanced virulence/avirulence profiles for several avirulence loci in seretome analyses. We observed an uneven distribution of heterozygosity among the isolates. Secretome comparison of Pst with other rust fungi identified a large portion of species-specific secreted proteins, suggesting that they may have specific roles when interacting with the wheat host. Thirty-two effectors of Pst were identified from its secretome. We identified candidates for Avr genes corresponding to six Yr genes by correlating polymorphisms for effector genes to the virulence/avirulence profiles of the 14 Pst isolates. The putative AvYr76 was present in the avirulent isolates, but absent in the virulent isolates, suggesting that deleting the coding region of the candidate avirulence gene has produced races virulent to resistance gene Yr76 . We conclude that incorporating avirulence/virulence phenotypes into correlation analysis with variations in genomic structure and secretome, particularly presence/absence polymorphisms of effectors, is an efficient way to identify candidate Avr genes in Pst . The candidate effector genes provide a rich resource for further studies to determine the evolutionary history of Pst populations and the co-evolutionary arms race between Pst and wheat. The Avr candidates identified in this study will lead to cloning avirulence genes in Pst , which will enable us to understand molecular mechanisms underlying Pst -wheat interactions, to determine the effectiveness of resistance genes and further to develop durable resistance to stripe rust.

Targeted next-generation sequencing identification of mutations in disease resistance gene anologs (RGAs) in wild and cultivated beets

USDA-ARS?s Scientific Manuscript database

Resistance gene analogs (RGAs) were searched bioinformatically in the sugar beet (Beta vulgaris L.) genome as potential candidates for improving resistance against different diseases. In the present study, Ion Torrent sequencing technology was used to identify mutations in 21 RGAs. The DNA samples o...

Identification of a Novel De Novo Heterozygous Deletion in the SOX10 Gene in Waardenburg Syndrome Type II Using Next-Generation Sequencing.

PubMed

Li, Haonan; Jin, Peng; Hao, Qian; Zhu, Wei; Chen, Xia; Wang, Ping

2017-11-01

Waardenburg syndrome (WS) is a rare autosomal dominant disorder associated with pigmentation abnormalities and sensorineural hearing loss. In this study, we investigated the genetic cause of WSII in a patient and evaluated the reliability of the targeted next-generation exome sequencing method for the genetic diagnosis of WS. Clinical evaluations were conducted on the patient and targeted next-generation sequencing (NGS) was used to identify the candidate genes responsible for WSII. Multiplex ligation-dependent probe amplification (MLPA) and real-time quantitative polymerase chain reaction (qPCR) were performed to confirm the targeted NGS results. Targeted NGS detected the entire deletion of the coding sequence (CDS) of the SOX10 gene in the WSII patient. MLPA results indicated that all exons of the SOX10 heterozygous deletion were detected; no aberrant copy number in the PAX3 and microphthalmia-associated transcription factor (MITF) genes was found. Real-time qPCR results identified the mutation as a de novo heterozygous deletion. This is the first report of using a targeted NGS method for WS candidate gene sequencing; its accuracy was verified by using the MLPA and qPCR methods. Our research provides a valuable method for the genetic diagnosis of WS.

Global Transcriptome Changes Underlying Colony Growth in the Opportunistic Human Pathogen Aspergillus fumigatus

PubMed Central

Gibbons, John G.; Beauvais, Anne; Beau, Remi; McGary, Kriston L.

2012-01-01

Aspergillus fumigatus is the most common and deadly pulmonary fungal infection worldwide. In the lung, the fungus usually forms a dense colony of filaments embedded in a polymeric extracellular matrix. To identify candidate genes involved in this biofilm (BF) growth, we used RNA-Seq to compare the transcriptomes of BF and liquid plankton (PL) growth. Sequencing and mapping of tens of millions sequence reads against the A. fumigatus transcriptome identified 3,728 differentially regulated genes in the two conditions. Although many of these genes, including the ones coding for transcription factors, stress response, the ribosome, and the translation machinery, likely reflect the different growth demands in the two conditions, our experiment also identified hundreds of candidate genes for the observed differences in morphology and pathobiology between BF and PL. We found an overrepresentation of upregulated genes in transport, secondary metabolism, and cell wall and surface functions. Furthermore, upregulated genes showed significant spatial structure across the A. fumigatus genome; they were more likely to occur in subtelomeric regions and colocalized in 27 genomic neighborhoods, many of which overlapped with known or candidate secondary metabolism gene clusters. We also identified 1,164 genes that were downregulated. This gene set was not spatially structured across the genome and was overrepresented in genes participating in primary metabolic functions, including carbon and amino acid metabolism. These results add valuable insight into the genetics of biofilm formation in A. fumigatus and other filamentous fungi and identify many relevant, in the context of biofilm biology, candidate genes for downstream functional experiments. PMID:21724936

Using microarrays to identify positional candidate genes for QTL: the case study of ACTH response in pigs.

PubMed

Jouffe, Vincent; Rowe, Suzanne; Liaubet, Laurence; Buitenhuis, Bart; Hornshøj, Henrik; SanCristobal, Magali; Mormède, Pierre; de Koning, D J

2009-07-16

Microarray studies can supplement QTL studies by suggesting potential candidate genes in the QTL regions, which by themselves are too large to provide a limited selection of candidate genes. Here we provide a case study where we explore ways to integrate QTL data and microarray data for the pig, which has only a partial genome sequence. We outline various procedures to localize differentially expressed genes on the pig genome and link this with information on published QTL. The starting point is a set of 237 differentially expressed cDNA clones in adrenal tissue from two pig breeds, before and after treatment with adrenocorticotropic hormone (ACTH). Different approaches to localize the differentially expressed (DE) genes to the pig genome showed different levels of success and a clear lack of concordance for some genes between the various approaches. For a focused analysis on 12 genes, overlapping QTL from the public domain were presented. Also, differentially expressed genes underlying QTL for ACTH response were described. Using the latest version of the draft sequence, the differentially expressed genes were mapped to the pig genome. This enabled co-location of DE genes and previously studied QTL regions, but the draft genome sequence is still incomplete and will contain many errors. A further step to explore links between DE genes and QTL at the pathway level was largely unsuccessful due to the lack of annotation of the pig genome. This could be improved by further comparative mapping analyses but this would be time consuming. This paper provides a case study for the integration of QTL data and microarray data for a species with limited genome sequence information and annotation. The results illustrate the challenges that must be addressed but also provide a roadmap for future work that is applicable to other non-model species.

[BIOINFORMATIC SEARCH AND PHYLOGENETIC ANALYSIS OF THE CELLULOSE SYNTHASE GENES OF FLAX (LINUM USITATISSIMUM)].

PubMed

Pydiura, N A; Bayer, G Ya; Galinousky, D V; Yemets, A I; Pirko, Ya V; Podvitski, T A; Anisimova, N V; Khotyleva, L V; Kilchevsky, A V; Blume, Ya B

2015-01-01

A bioinformatic search of sequences encoding cellulose synthase genes in the flax genome, and their comparison to dicots orthologs was carried out. The analysis revealed 32 cellulose synthase gene candidates, 16 of which are highly likely to encode cellulose synthases, and the remaining 16--cellulose synthase-like proteins (Csl). Phylogenetic analysis of gene products of cellulose synthase genes allowed distinguishing 6 groups of cellulose synthase genes of different classes: CesA1/10, CesA3, CesA4, CesA5/6/2/9, CesA7 and CesA8. Paralogous sequences within classes CesA1/10 and CesA5/6/2/9 which are associated with the primary cell wall formation are characterized by a greater similarity within these classes than orthologous sequences. Whereas the genes controlling the biosynthesis of secondary cell wall cellulose form distinct clades: CesA4, CesA7, and CesA8. The analysis of 16 identified flax cellulose synthase gene candidates shows the presence of at least 12 different cellulose synthase gene variants in flax genome which are represented in all six clades of cellulose synthase genes. Thus, at this point genes of all ten known cellulose synthase classes are identify in flax genome, but their correct classification requires additional research.

Next-Generation Sequence Analysis of the Genome of RFHVMn, the Macaque Homolog of Kaposi's Sarcoma (KS)-Associated Herpesvirus, from a KS-Like Tumor of a Pig-Tailed Macaque

PubMed Central

Bruce, A. Gregory; Ryan, Jonathan T.; Thomas, Mathew J.; Peng, Xinxia; Grundhoff, Adam; Tsai, Che-Chung

2013-01-01

The complete sequence of retroperitoneal fibromatosis-associated herpesvirus Macaca nemestrina (RFHVMn), the pig-tailed macaque homolog of Kaposi's sarcoma-associated herpesvirus (KSHV), was determined by next-generation sequence analysis of a Kaposi's sarcoma (KS)-like macaque tumor. Colinearity of genes was observed with the KSHV genome, and the core herpesvirus genes had strong sequence homology to the corresponding KSHV genes. RFHVMn lacked homologs of open reading frame 11 (ORF11) and KSHV ORFs K5 and K6, which appear to have been generated by duplication of ORFs K3 and K4 after the divergence of KSHV and RFHV. RFHVMn contained positional homologs of all other unique KSHV genes, although some showed limited sequence similarity. RFHVMn contained a number of candidate microRNA genes. Although there was little sequence similarity with KSHV microRNAs, one candidate contained the same seed sequence as the positional homolog, kshv-miR-K12-10a, suggesting functional overlap. RNA transcript splicing was highly conserved between RFHVMn and KSHV, and strong sequence conservation was noted in specific promoters and putative origins of replication, predicting important functional similarities. Sequence comparisons indicated that RFHVMn and KSHV developed in long-term synchrony with the evolution of their hosts, and both viruses phylogenetically group within the RV1 lineage of Old World primate rhadinoviruses. RFHVMn is the closest homolog of KSHV to be completely sequenced and the first sequenced RV1 rhadinovirus homolog of KSHV from a nonhuman Old World primate. The strong genetic and sequence similarity between RFHVMn and KSHV, coupled with similarities in biology and pathology, demonstrate that RFHVMn infection in macaques offers an important and relevant model for the study of KSHV in humans. PMID:24109218

Transcriptomic analysis of Siberian ginseng (Eleutherococcus senticosus) to discover genes involved in saponin biosynthesis.

PubMed

Hwang, Hwan-Su; Lee, Hyoshin; Choi, Yong Eui

2015-03-14

Eleutherococcus senticosus, Siberian ginseng, is a highly valued woody medicinal plant belonging to the family Araliaceae. E. senticosus produces a rich variety of saponins such as oleanane-type, noroleanane-type, 29-hydroxyoleanan-type, and lupane-type saponins. Genomic or transcriptomic approaches have not been used to investigate the saponin biosynthetic pathway in this plant. In this study, de novo sequencing was performed to select candidate genes involved in the saponin biosynthetic pathway. A half-plate 454 pyrosequencing run produced 627,923 high-quality reads with an average sequence length of 422 bases. De novo assembly generated 72,811 unique sequences, including 15,217 contigs and 57,594 singletons. Approximately 48,300 (66.3%) unique sequences were annotated using BLAST similarity searches. All of the mevalonate pathway genes for saponin biosynthesis starting from acetyl-CoA were isolated. Moreover, 206 reads of cytochrome P450 (CYP) and 145 reads of uridine diphosphate glycosyltransferase (UGT) sequences were isolated. Based on methyl jasmonate (MeJA) treatment and real-time PCR (qPCR) analysis, 3 CYPs and 3 UGTs were finally selected as candidate genes involved in the saponin biosynthetic pathway. The identified sequences associated with saponin biosynthesis will facilitate the study of the functional genomics of saponin biosynthesis and genetic engineering of E. senticosus.

Identification of positional candidates for bovine placental genes responsible for early embryonic death during cloning-attempted pregnancy.

PubMed

Yamada, Takahisa; Muramatsu, Youji; Taniguchi, Yukio; Sasaki, Yoshiyuki

Our previous study detected 291 and 77 genes showing early embryonic death-associated elevation and reduction of expression, respectively, in the fetal placenta of the cow carrying somatic nuclear transfer-derived cloned embryo. In this study, we mapped the 10 genes showing the elevation and the 10 genes doing the reduction most significantly, using somatic cell hybrid and bovine draft genome sequence. We then compared the mapped positions for these genes with the genomic locations of bovine quantitative trait loci for still-birth and/or abortion. Among the mapped genes, peptidylglycine alpha-amidating monooxygenase (PAM), spectrin, beta, nonerythrocytic 1 (SPTBNI), and an unknown novel gene containing AU277832 expressed sequence tag were intriguing, in that the mapped positions were consistent with the genomic locations of bovine still-birth and/or abortion quantitative trait loci, and thus identified as positional candidates for bovine placental genes responsible for the early embryonic death during the pregnancy attempted by somatic nuclear transfer-derived cloning.

Molecular cloning of the potato Gro1-4 gene conferring resistance to pathotype Ro1 of the root cyst nematode Globodera rostochiensis, based on a candidate gene approach.

PubMed

Paal, Jürgen; Henselewski, Heike; Muth, Jost; Meksem, Khalid; Menéndez, Cristina M; Salamini, Francesco; Ballvora, Agim; Gebhardt, Christiane

2004-04-01

The endoparasitic root cyst nematode Globodera rostochiensis causes considerable damage in potato cultivation. In the past, major genes for nematode resistance have been introgressed from related potato species into cultivars. Elucidating the molecular basis of resistance will contribute to the understanding of nematode-plant interactions and assist in breeding nematode-resistant cultivars. The Gro1 resistance locus to G. rostochiensis on potato chromosome VII co-localized with a resistance-gene-like (RGL) DNA marker. This marker was used to isolate from genomic libraries 15 members of a closely related candidate gene family. Analysis of inheritance, linkage mapping, and sequencing reduced the number of candidate genes to three. Complementation analysis by stable potato transformation showed that the gene Gro1-4 conferred resistance to G. rostochiensis pathotype Ro1. Gro1-4 encodes a protein of 1136 amino acids that contains Toll-interleukin 1 receptor (TIR), nucleotide-binding (NB), leucine-rich repeat (LRR) homology domains and a C-terminal domain with unknown function. The deduced Gro1-4 protein differed by 29 amino acid changes from susceptible members of the Gro1 gene family. Sequence characterization of 13 members of the Gro1 gene family revealed putative regulatory elements and a variable microsatellite in the promoter region, insertion of a retrotransposon-like element in the first intron, and a stop codon in the NB coding region of some genes. Sequence analysis of RT-PCR products showed that Gro1-4 is expressed, among other members of the family including putative pseudogenes, in non-infected roots of nematode-resistant plants. RT-PCR also demonstrated that members of the Gro1 gene family are expressed in most potato tissues.

Genome-Wide Identification of Differentially Expressed Genes Associated with the High Yielding of Oleoresin in Secondary Xylem of Masson Pine (Pinus massoniana Lamb) by Transcriptomic Analysis

PubMed Central

Liu, Qinghua; Zhou, Zhichun; Wei, Yongcheng; Shen, Danyu; Feng, Zhongping; Hong, Shanping

2015-01-01

Masson pine is an important timber and resource for oleoresin in South China. Increasing yield of oleoresin in stems can raise economic benefits and enhance the resistance to bark beetles. However, the genetic mechanisms for regulating the yield of oleoresin were still unknown. Here, high-throughput sequencing technology was used to investigate the transcriptome and compare the gene expression profiles of high and low oleoresin-yielding genotypes. A total of 40,690,540 reads were obtained and assembled into 137,499 transcripts from the secondary xylem tissues. We identified 84,842 candidate unigenes based on sequence annotation using various databases and 96 unigenes were candidates for terpenoid backbone biosynthesis in pine. By comparing the expression profiles of high and low oleoresin-yielding genotypes, 649 differentially expressed genes (DEGs) were identified. GO enrichment analysis of DEGs revealed that multiple pathways were related to high yield of oleoresin. Nine candidate genes were validated by QPCR analysis. Among them, the candidate genes encoding geranylgeranyl diphosphate synthase (GGPS) and (-)-alpha/beta-pinene synthase were up-regulated in the high oleoresin-yielding genotype, while tricyclene synthase revealed lower expression level, which was in good agreement with the GC/MS result. In addition, DEG encoding ABC transporters, pathogenesis-related proteins (PR5 and PR9), phosphomethylpyrimidine synthase, non-specific lipid-transfer protein-like protein and ethylene responsive transcription factors (ERFs) were also confirmed to be critical for the biosynthesis of oleoresin. The next-generation sequencing strategy used in this study has proven to be a powerful means for analyzing transcriptome variation related to the yield of oleoresin in masson pine. The candidate genes encoding GGPS, (-)-alpha/beta-pinene, tricyclene synthase, ABC transporters, non-specific lipid-transfer protein-like protein, phosphomethylpyrimidine synthase, ERFs and pathogen responses may play important roles in regulating the yield of oleoresin. These DEGs are worthy of special attention in future studies. PMID:26167875

Comparative molecular analyses of select pH- and osmoregulatory genes in three freshwater crayfish Cherax quadricarinatus, C. destructor and C. cainii.

PubMed

Ali, Muhammad Y; Pavasovic, Ana; Dammannagoda, Lalith K; Mather, Peter B; Prentis, Peter J

2017-01-01

Systemic acid-base balance and osmotic/ionic regulation in decapod crustaceans are in part maintained by a set of transport-related enzymes such as carbonic anhydrase (CA), Na + /K + -ATPase (NKA), H + -ATPase (HAT), Na + /K + /2Cl - cotransporter (NKCC), Na + /Cl - /HCO[Formula: see text] cotransporter (NBC), Na + /H + exchanger (NHE), Arginine kinase (AK), Sarcoplasmic Ca +2 -ATPase (SERCA) and Calreticulin (CRT). We carried out a comparative molecular analysis of these genes in three commercially important yet eco-physiologically distinct freshwater crayfish , Cherax quadricarinatus, C. destructor and C. cainii , with the aim to identify mutations in these genes and determine if observed patterns of mutations were consistent with the action of natural selection. We also conducted a tissue-specific expression analysis of these genes across seven different organs, including gills, hepatopancreas, heart, kidney, liver, nerve and testes using NGS transcriptome data. The molecular analysis of the candidate genes revealed a high level of sequence conservation across the three Cherax sp. Hyphy analysis revealed that all candidate genes showed patterns of molecular variation consistent with neutral evolution. The tissue-specific expression analysis showed that 46% of candidate genes were expressed in all tissue types examined, while approximately 10% of candidate genes were only expressed in a single tissue type. The largest number of genes was observed in nerve (84%) and gills (78%) and the lowest in testes (66%). The tissue-specific expression analysis also revealed that most of the master genes regulating pH and osmoregulation (CA, NKA, HAT, NKCC, NBC, NHE) were expressed in all tissue types indicating an important physiological role for these genes outside of osmoregulation in other tissue types. The high level of sequence conservation observed in the candidate genes may be explained by the important role of these genes as well as potentially having a number of other basic physiological functions in different tissue types.

Photoreceptor dysplasia (pd) in miniature schnauzer dogs: evaluation of candidate genes by molecular genetic analysis.

PubMed

Zhang, Q; Baldwin, V J; Acland, G M; Parshall, C J; Haskel, J; Aguirre, G D; Ray, K

1999-01-01

Photoreceptor dysplasia (pd) is one of a group of at least six distinct autosomal and one X-linked retinal disorders identified in dogs which are collectively known as progressive retinal atrophy (PRA). It is an early onset retinal disease identified in miniature schnauzer dogs, and pedigree analysis and breeding studies have established autosomal recessive inheritance of the disease. Using a gene-based approach, a number of retina-expressed genes, including some members of the phototransduction pathway, have been causally implicated in retinal diseases of humans and other animals. Here we examined seven such potential candidate genes (opsin, RDS/peripherin, ROM1, rod cGMP-gated cation channel alpha-subunit, and three subunits of transducin) for their causal association with the pd locus by testing segregation of intragenic markers with the disease locus, or, in the absence of informative polymorphisms, sequencing of the coding regions of the genes. Based on these results, we have conclusively excluded four photoreceptor-specific genes as candidates for pd by linkage analysis. For three other photoreceptor-specific genes, we did not find any mutation in the coding sequences of the genes and have excluded them provisionally. Formal exclusion would require investigation of the levels of expression of the candidate genes in pd-affected dogs relative to age-matched controls. At present we are building suitable informative pedigrees for the disease locus with a sufficient number of meiosis to be useful for genomewide screening. This should identify markers linked to the disease locus and eventually permit progress toward the identification of the photoreceptor dysplasia gene and the disease-causing mutation.

Finding functional features in Saccharomyces genomes by phylogenetic footprinting.

PubMed

Cliften, Paul; Sudarsanam, Priya; Desikan, Ashwin; Fulton, Lucinda; Fulton, Bob; Majors, John; Waterston, Robert; Cohen, Barak A; Johnston, Mark

2003-07-04

The sifting and winnowing of DNA sequence that occur during evolution cause nonfunctional sequences to diverge, leaving phylogenetic footprints of functional sequence elements in comparisons of genome sequences. We searched for such footprints among the genome sequences of six Saccharomyces species and identified potentially functional sequences. Comparison of these sequences allowed us to revise the catalog of yeast genes and identify sequence motifs that may be targets of transcriptional regulatory proteins. Some of these conserved sequence motifs reside upstream of genes with similar functional annotations or similar expression patterns or those bound by the same transcription factor and are thus good candidates for functional regulatory sequences.

High-resolution phylogenetic microbial community profiling

DOE Office of Scientific and Technical Information (OSTI.GOV)

Singer, Esther; Coleman-Derr, Devin; Bowman, Brett

2014-03-17

The representation of bacterial and archaeal genome sequences is strongly biased towards cultivated organisms, which belong to merely four phylogenetic groups. Functional information and inter-phylum level relationships are still largely underexplored for candidate phyla, which are often referred to as microbial dark matter. Furthermore, a large portion of the 16S rRNA gene records in the GenBank database are labeled as environmental samples and unclassified, which is in part due to low read accuracy, potential chimeric sequences produced during PCR amplifications and the low resolution of short amplicons. In order to improve the phylogenetic classification of novel species and advance ourmore » knowledge of the ecosystem function of uncultivated microorganisms, high-throughput full length 16S rRNA gene sequencing methodologies with reduced biases are needed. We evaluated the performance of PacBio single-molecule real-time (SMRT) sequencing in high-resolution phylogenetic microbial community profiling. For this purpose, we compared PacBio and Illumina metagenomic shotgun and 16S rRNA gene sequencing of a mock community as well as of an environmental sample from Sakinaw Lake, British Columbia. Sakinaw Lake is known to contain a large age of microbial species from candidate phyla. Sequencing results show that community structure based on PacBio shotgun and 16S rRNA gene sequences is highly similar in both the mock and the environmental communities. Resolution power and community representation accuracy from SMRT sequencing data appeared to be independent of GC content of microbial genomes and was higher when compared to Illumina-based metagenome shotgun and 16S rRNA gene (iTag) sequences, e.g. full-length sequencing resolved all 23 OTUs in the mock community, while iTags did not resolve closely related species. SMRT sequencing hence offers various potential benefits when characterizing uncharted microbial communities.« less

Exome Sequencing in Suspected Monogenic Dyslipidemias

PubMed Central

Stitziel, Nathan O.; Peloso, Gina M.; Abifadel, Marianne; Cefalu, Angelo B.; Fouchier, Sigrid; Motazacker, M. Mahdi; Tada, Hayato; Larach, Daniel B.; Awan, Zuhier; Haller, Jorge F.; Pullinger, Clive R.; Varret, Mathilde; Rabès, Jean-Pierre; Noto, Davide; Tarugi, Patrizia; Kawashiri, Masa-aki; Nohara, Atsushi; Yamagishi, Masakazu; Risman, Marjorie; Deo, Rahul; Ruel, Isabelle; Shendure, Jay; Nickerson, Deborah A.; Wilson, James G.; Rich, Stephen S.; Gupta, Namrata; Farlow, Deborah N.; Neale, Benjamin M.; Daly, Mark J.; Kane, John P.; Freeman, Mason W.; Genest, Jacques; Rader, Daniel J.; Mabuchi, Hiroshi; Kastelein, John J.P.; Hovingh, G. Kees; Averna, Maurizio R.; Gabriel, Stacey; Boileau, Catherine; Kathiresan, Sekar

2015-01-01

Background Exome sequencing is a promising tool for gene mapping in Mendelian disorders. We utilized this technique in an attempt to identify novel genes underlying monogenic dyslipidemias. Methods and Results We performed exome sequencing on 213 selected family members from 41 kindreds with suspected Mendelian inheritance of extreme levels of low-density lipoprotein (LDL) cholesterol (after candidate gene sequencing excluded known genetic causes for high LDL cholesterol families) or high-density lipoprotein (HDL) cholesterol. We used standard analytic approaches to identify candidate variants and also assigned a polygenic score to each individual in order to account for their burden of common genetic variants known to influence lipid levels. In nine families, we identified likely pathogenic variants in known lipid genes (ABCA1, APOB, APOE, LDLR, LIPA, and PCSK9); however, we were unable to identify obvious genetic etiologies in the remaining 32 families despite follow-up analyses. We identified three factors that limited novel gene discovery: (1) imperfect sequencing coverage across the exome hid potentially causal variants; (2) large numbers of shared rare alleles within families obfuscated causal variant identification; and (3) individuals from 15% of families carried a significant burden of common lipid-related alleles, suggesting complex inheritance can masquerade as monogenic disease. Conclusions We identified the genetic basis of disease in nine of 41 families; however, none of these represented novel gene discoveries. Our results highlight the promise and limitations of exome sequencing as a discovery technique in suspected monogenic dyslipidemias. Considering the confounders identified may inform the design of future exome sequencing studies. PMID:25632026

Extensive sequence analysis of CFTR, SCNN1A, SCNN1B, SCNN1G and SERPINA1 suggests an oligogenic basis for cystic fibrosis-like phenotypes.

PubMed

Ramos, M D; Trujillano, D; Olivar, R; Sotillo, F; Ossowski, S; Manzanares, J; Costa, J; Gartner, S; Oliva, C; Quintana, E; Gonzalez, M I; Vazquez, C; Estivill, X; Casals, T

2014-07-01

The term cystic fibrosis (CF)-like disease is used to describe patients with a borderline sweat test and suggestive CF clinical features but without two CFTR(cystic fibrosis transmembrane conductance regulator) mutations. We have performed the extensive molecular analysis of four candidate genes (SCNN1A, SCNN1B, SCNN1G and SERPINA1) in a cohort of 10 uncharacterized patients with CF and CF-like disease. We have used whole-exome sequencing to characterize mutations in the CFTR gene and these four candidate genes. CFTR molecular analysis allowed a complete characterization of three of four CF patients. Candidate variants in SCNN1A, SCNN1B, SCNN1G and SERPINA1 in six patients with CF-like phenotypes were confirmed by Sanger sequencing and were further supported by in silico predictive analysis, pedigree studies, sweat test in other family members, and analysis in CF patients and healthy subjects. Our results suggest that CF-like disease probably results from complex genotypes in several genes in an oligogenic form, with rare variants interacting with environmental factors. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Prediction of Human Disease Genes by Human-Mouse Conserved Coexpression Analysis

PubMed Central

Grassi, Elena; Damasco, Christian; Silengo, Lorenzo; Oti, Martin; Provero, Paolo; Di Cunto, Ferdinando

2008-01-01

Background Even in the post-genomic era, the identification of candidate genes within loci associated with human genetic diseases is a very demanding task, because the critical region may typically contain hundreds of positional candidates. Since genes implicated in similar phenotypes tend to share very similar expression profiles, high throughput gene expression data may represent a very important resource to identify the best candidates for sequencing. However, so far, gene coexpression has not been used very successfully to prioritize positional candidates. Methodology/Principal Findings We show that it is possible to reliably identify disease-relevant relationships among genes from massive microarray datasets by concentrating only on genes sharing similar expression profiles in both human and mouse. Moreover, we show systematically that the integration of human-mouse conserved coexpression with a phenotype similarity map allows the efficient identification of disease genes in large genomic regions. Finally, using this approach on 850 OMIM loci characterized by an unknown molecular basis, we propose high-probability candidates for 81 genetic diseases. Conclusion Our results demonstrate that conserved coexpression, even at the human-mouse phylogenetic distance, represents a very strong criterion to predict disease-relevant relationships among human genes. PMID:18369433

Association of candidate genes with drought tolerance traits in diverse perennial ryegrass accessions

PubMed Central

Jiang, Yiwei

2013-01-01

Drought is a major environmental stress limiting growth of perennial grasses in temperate regions. Plant drought tolerance is a complex trait that is controlled by multiple genes. Candidate gene association mapping provides a powerful tool for dissection of complex traits. Candidate gene association mapping of drought tolerance traits was conducted in 192 diverse perennial ryegrass (Lolium perenne L.) accessions from 43 countries. The panel showed significant variations in leaf wilting, leaf water content, canopy and air temperature difference, and chlorophyll fluorescence under well-watered and drought conditions across six environments. Analysis of 109 simple sequence repeat markers revealed five population structures in the mapping panel. A total of 2520 expression-based sequence readings were obtained for a set of candidate genes involved in antioxidant metabolism, dehydration, water movement across membranes, and signal transduction, from which 346 single nucleotide polymorphisms were identified. Significant associations were identified between a putative LpLEA3 encoding late embryogenesis abundant group 3 protein and a putative LpFeSOD encoding iron superoxide dismutase and leaf water content, as well as between a putative LpCyt Cu-ZnSOD encoding cytosolic copper-zinc superoxide dismutase and chlorophyll fluorescence under drought conditions. Four of these identified significantly associated single nucleotide polymorphisms from these three genes were also translated to amino acid substitutions in different genotypes. These results indicate that allelic variation in these genes may affect whole-plant response to drought stress in perennial ryegrass. PMID:23386684

The American cranberry: first insights into the whole genome of a species adapted to bog habitat.

PubMed

Polashock, James; Zelzion, Ehud; Fajardo, Diego; Zalapa, Juan; Georgi, Laura; Bhattacharya, Debashish; Vorsa, Nicholi

2014-06-13

The American cranberry (Vaccinium macrocarpon Ait.) is one of only three widely-cultivated fruit crops native to North America- the other two are blueberry (Vaccinium spp.) and native grape (Vitis spp.). In terms of taxonomy, cranberries are in the core Ericales, an order for which genome sequence data are currently lacking. In addition, cranberries produce a host of important polyphenolic secondary compounds, some of which are beneficial to human health. Whereas next-generation sequencing technology is allowing the advancement of whole-genome sequencing, one major obstacle to the successful assembly from short-read sequence data of complex diploid (and higher ploidy) organisms is heterozygosity. Cranberry has the advantage of being diploid (2n = 2x = 24) and self-fertile. To minimize the issue of heterozygosity, we sequenced the genome of a fifth-generation inbred genotype (F ≥ 0.97) derived from five generations of selfing originating from the cultivar Ben Lear. The genome size of V. macrocarpon has been estimated to be about 470 Mb. Genomic sequences were assembled into 229,745 scaffolds representing 420 Mbp (N50 = 4,237 bp) with 20X average coverage. The number of predicted genes was 36,364 and represents 17.7% of the assembled genome. Of the predicted genes, 30,090 were assigned to candidate genes based on homology. Genes supported by transcriptome data totaled 13,170 (36%). Shotgun sequencing of the cranberry genome, with an average sequencing coverage of 20X, allowed efficient assembly and gene calling. The candidate genes identified represent a useful collection to further study important biochemical pathways and cellular processes and to use for marker development for breeding and the study of horticultural characteristics, such as disease resistance.

The American cranberry: first insights into the whole genome of a species adapted to bog habitat

PubMed Central

2014-01-01

Background The American cranberry (Vaccinium macrocarpon Ait.) is one of only three widely-cultivated fruit crops native to North America- the other two are blueberry (Vaccinium spp.) and native grape (Vitis spp.). In terms of taxonomy, cranberries are in the core Ericales, an order for which genome sequence data are currently lacking. In addition, cranberries produce a host of important polyphenolic secondary compounds, some of which are beneficial to human health. Whereas next-generation sequencing technology is allowing the advancement of whole-genome sequencing, one major obstacle to the successful assembly from short-read sequence data of complex diploid (and higher ploidy) organisms is heterozygosity. Cranberry has the advantage of being diploid (2n = 2x = 24) and self-fertile. To minimize the issue of heterozygosity, we sequenced the genome of a fifth-generation inbred genotype (F ≥ 0.97) derived from five generations of selfing originating from the cultivar Ben Lear. Results The genome size of V. macrocarpon has been estimated to be about 470 Mb. Genomic sequences were assembled into 229,745 scaffolds representing 420 Mbp (N50 = 4,237 bp) with 20X average coverage. The number of predicted genes was 36,364 and represents 17.7% of the assembled genome. Of the predicted genes, 30,090 were assigned to candidate genes based on homology. Genes supported by transcriptome data totaled 13,170 (36%). Conclusions Shotgun sequencing of the cranberry genome, with an average sequencing coverage of 20X, allowed efficient assembly and gene calling. The candidate genes identified represent a useful collection to further study important biochemical pathways and cellular processes and to use for marker development for breeding and the study of horticultural characteristics, such as disease resistance. PMID:24927653

An Efficient Approach for the Development of Locus Specific Primers in Bread Wheat (Triticum aestivum L.) and Its Application to Re-Sequencing of Genes Involved in Frost Tolerance

PubMed Central

Babben, Steve; Perovic, Dragan; Koch, Michael; Ordon, Frank

2015-01-01

Recent declines in costs accelerated sequencing of many species with large genomes, including hexaploid wheat (Triticum aestivum L.). Although the draft sequence of bread wheat is known, it is still one of the major challenges to developlocus specific primers suitable to be used in marker assisted selection procedures, due to the high homology of the three genomes. In this study we describe an efficient approach for the development of locus specific primers comprising four steps, i.e. (i) identification of genomic and coding sequences (CDS) of candidate genes, (ii) intron- and exon-structure reconstruction, (iii) identification of wheat A, B and D sub-genome sequences and primer development based on sequence differences between the three sub-genomes, and (iv); testing of primers for functionality, correct size and localisation. This approach was applied to single, low and high copy genes involved in frost tolerance in wheat. In summary for 27 of these genes for which sequences were derived from Triticum aestivum, Triticum monococcum and Hordeum vulgare, a set of 119 primer pairs was developed and after testing on Nulli-tetrasomic (NT) lines, a set of 65 primer pairs (54.6%), corresponding to 19 candidate genes, turned out to be specific. Out of these a set of 35 fragments was selected for validation via Sanger's amplicon re-sequencing. All fragments, with the exception of one, could be assigned to the original reference sequence. The approach presented here showed a much higher specificity in primer development in comparison to techniques used so far in bread wheat and can be applied to other polyploid species with a known draft sequence. PMID:26565976

Sequence Evolution and Expression Regulation of Stress-Responsive Genes in Natural Populations of Wild Tomato

PubMed Central

Fischer, Iris; Steige, Kim A.; Stephan, Wolfgang; Mboup, Mamadou

2013-01-01

The wild tomato species Solanum chilense and S. peruvianum are a valuable non-model system for studying plant adaptation since they grow in diverse environments facing many abiotic constraints. Here we investigate the sequence evolution of regulatory regions of drought and cold responsive genes and their expression regulation. The coding regions of these genes were previously shown to exhibit signatures of positive selection. Expression profiles and sequence evolution of regulatory regions of members of the Asr (ABA/water stress/ripening induced) gene family and the dehydrin gene pLC30-15 were analyzed in wild tomato populations from contrasting environments. For S. chilense, we found that Asr4 and pLC30-15 appear to respond much faster to drought conditions in accessions from very dry environments than accessions from more mesic locations. Sequence analysis suggests that the promoter of Asr2 and the downstream region of pLC30-15 are under positive selection in some local populations of S. chilense. By investigating gene expression differences at the population level we provide further support of our previous conclusions that Asr2, Asr4, and pLC30-15 are promising candidates for functional studies of adaptation. Our analysis also demonstrates the power of the candidate gene approach in evolutionary biology research and highlights the importance of wild Solanum species as a genetic resource for their cultivated relatives. PMID:24205149

Identification of downy mildew resistance gene candidates by positional cloning in maize (Zea mays subsp. mays; Poaceae)1

PubMed Central

Kim, Jae Yoon; Moon, Jun-Cheol; Kim, Hyo Chul; Shin, Seungho; Song, Kitae; Kim, Kyung-Hee; Lee, Byung-Moo

2017-01-01

Premise of the study: Positional cloning in combination with phenotyping is a general approach to identify disease-resistance gene candidates in plants; however, it requires several time-consuming steps including population or fine mapping. Therefore, in the present study, we suggest a new combined strategy to improve the identification of disease-resistance gene candidates. Methods and Results: Downy mildew (DM)–resistant maize was selected from five cultivars using a spreader row technique. Positional cloning and bioinformatics tools were used to identify the DM-resistance quantitative trait locus marker (bnlg1702) and 47 protein-coding gene annotations. Eventually, five DM-resistance gene candidates, including bZIP34, Bak1, and Ppr, were identified by quantitative reverse-transcription PCR (RT-PCR) without fine mapping of the bnlg1702 locus. Conclusions: The combined protocol with the spreader row technique, quantitative trait locus positional cloning, and quantitative RT-PCR was effective for identifying DM-resistance candidate genes. This cloning approach may be applied to other whole-genome-sequenced crops or resistance to other diseases. PMID:28224059

RNA-Seq analysis and annotation of a draft blueberry genome assembly identifies candidate genes involved in fruit ripening, biosynthesis of bioactive compounds, and stage-specific alternative splicing.

PubMed

Gupta, Vikas; Estrada, April D; Blakley, Ivory; Reid, Rob; Patel, Ketan; Meyer, Mason D; Andersen, Stig Uggerhøj; Brown, Allan F; Lila, Mary Ann; Loraine, Ann E

2015-01-01

Blueberries are a rich source of antioxidants and other beneficial compounds that can protect against disease. Identifying genes involved in synthesis of bioactive compounds could enable the breeding of berry varieties with enhanced health benefits. Toward this end, we annotated a previously sequenced draft blueberry genome assembly using RNA-Seq data from five stages of berry fruit development and ripening. Genome-guided assembly of RNA-Seq read alignments combined with output from ab initio gene finders produced around 60,000 gene models, of which more than half were similar to proteins from other species, typically the grape Vitis vinifera. Comparison of gene models to the PlantCyc database of metabolic pathway enzymes identified candidate genes involved in synthesis of bioactive compounds, including bixin, an apocarotenoid with potential disease-fighting properties, and defense-related cyanogenic glycosides, which are toxic. Cyanogenic glycoside (CG) biosynthetic enzymes were highly expressed in green fruit, and a candidate CG detoxification enzyme was up-regulated during fruit ripening. Candidate genes for ethylene, anthocyanin, and 400 other biosynthetic pathways were also identified. Homology-based annotation using Blast2GO and InterPro assigned Gene Ontology terms to around 15,000 genes. RNA-Seq expression profiling showed that blueberry growth, maturation, and ripening involve dynamic gene expression changes, including coordinated up- and down-regulation of metabolic pathway enzymes and transcriptional regulators. Analysis of RNA-seq alignments identified developmentally regulated alternative splicing, promoter use, and 3' end formation. We report genome sequence, gene models, functional annotations, and RNA-Seq expression data that provide an important new resource enabling high throughput studies in blueberry.

A novel homozygous mutation in G6PC3 presenting as cyclic neutropenia and severe congenital neutropenia in the same family.

PubMed

Alangari, Abdullah A; Alsultan, Abdulrahman; Osman, Mohamed Elfaki; Anazi, Shamsa; Alkuraya, Fowzan S

2013-11-01

Patients with autosomal recessive cyclic neutropenia have no known causative genetic defect yet. Autozygosity mapping on two branches of an extended multiplex consanguineous family presenting with cyclic neutropenia or severe congenital neutropenia to look for candidate gene, followed by candidate gene selection and sequencing. A single autozygous interval on Chr17:33,901,938-45,675,414 that is exclusively shared by the affected members was identified. This interval spans 11.8 Mb and contains 30 genes. Review of these genes highlighted G6PC3 as the most likely candidate given its known role in neutrophil biology. Direct sequencing revealed a novel homozygous mutation (NM_138387.3, c.974T > G, p.Leu325Arg). Two of our patients had associated congenital defects that are known to occur in patients with G6PC3 mutations, including congenital heart disease and intermittent thrombocytopenia. Biallelic G6PC3 defects should be considered in patients with autosomal recessive cyclic neutropenia, especially those with typical associated congenital defects.

Identification of SLC20A1 and SLC15A4 among other genes as potential risk factors for combined pituitary hormone deficiency.

PubMed

Simm, Franziska; Griesbeck, Anne; Choukair, Daniela; Weiß, Birgit; Paramasivam, Nagarajan; Klammt, Jürgen; Schlesner, Matthias; Wiemann, Stefan; Martinez, Cristina; Hoffmann, Georg F; Pfäffle, Roland W; Bettendorf, Markus; Rappold, Gudrun A

2017-10-26

PurposeCombined pituitary hormone deficiency (CPHD) is characterized by a malformed or underdeveloped pituitary gland resulting in an impaired pituitary hormone secretion. Several transcription factors have been described in its etiology, but defects in known genes account for only a small proportion of cases.MethodsTo identify novel genetic causes for congenital hypopituitarism, we performed exome-sequencing studies on 10 patients with CPHD and their unaffected parents. Two candidate genes were sequenced in further 200 patients. Genotype data of known hypopituitary genes are reviewed.ResultsWe discovered 51 likely damaging variants in 38 genes; 12 of the 51 variants represent de novo events (24%); 11 of the 38 genes (29%) were present in the E12.5/E14.5 pituitary transcriptome. Targeted sequencing of two candidate genes, SLC20A1 and SLC15A4, of the solute carrier membrane transport protein family in 200 additional patients demonstrated two further variants predicted as damaging. We also found combinations of de novo (SLC20A1/SLC15A4) and transmitted variants (GLI2/LHX3) in the same individuals, leading to the full-blown CPHD phenotype.ConclusionThese data expand the pituitary target genes repertoire for diagnostics and further functional studies. Exome sequencing has identified a combination of rare variants in different genes that might explain incomplete penetrance in CPHD.Genetics in Medicine advance online publication, 26 October 2017; doi:10.1038/gim.2017.165.

De novo characterization of the Chinese fir (Cunninghamia lanceolata) transcriptome and analysis of candidate genes involved in cellulose and lignin biosynthesis

PubMed Central

2012-01-01

Background Chinese fir (Cunninghamia lanceolata) is an important timber species that accounts for 20–30% of the total commercial timber production in China. However, the available genomic information of Chinese fir is limited, and this severely encumbers functional genomic analysis and molecular breeding in Chinese fir. Recently, major advances in transcriptome sequencing have provided fast and cost-effective approaches to generate large expression datasets that have proven to be powerful tools to profile the transcriptomes of non-model organisms with undetermined genomes. Results In this study, the transcriptomes of nine tissues from Chinese fir were analyzed using the Illumina HiSeq™ 2000 sequencing platform. Approximately 40 million paired-end reads were obtained, generating 3.62 gigabase pairs of sequencing data. These reads were assembled into 83,248 unique sequences (i.e. Unigenes) with an average length of 449 bp, amounting to 37.40 Mb. A total of 73,779 Unigenes were supported by more than 5 reads, 42,663 (57.83%) had homologs in the NCBI non-redundant and Swiss-Prot protein databases, corresponding to 27,224 unique protein entries. Of these Unigenes, 16,750 were assigned to Gene Ontology classes, and 14,877 were clustered into orthologous groups. A total of 21,689 (29.40%) were mapped to 119 pathways by BLAST comparison against the Kyoto Encyclopedia of Genes and Genomes (KEGG) database. The majority of the genes encoding the enzymes in the biosynthetic pathways of cellulose and lignin were identified in the Unigene dataset by targeted searches of their annotations. And a number of candidate Chinese fir genes in the two metabolic pathways were discovered firstly. Eighteen genes related to cellulose and lignin biosynthesis were cloned for experimental validating of transcriptome data. Overall 49 Unigenes, covering different regions of these selected genes, were found by alignment. Their expression patterns in different tissues were analyzed by qRT-PCR to explore their putative functions. Conclusions A substantial fraction of transcript sequences was obtained from the deep sequencing of Chinese fir. The assembled Unigene dataset was used to discover candidate genes of cellulose and lignin biosynthesis. This transcriptome dataset will provide a comprehensive sequence resource for molecular genetics research of C. lanceolata. PMID:23171398

Detecting novel genes with sparse arrays

PubMed Central

Haiminen, Niina; Smit, Bart; Rautio, Jari; Vitikainen, Marika; Wiebe, Marilyn; Martinez, Diego; Chee, Christine; Kunkel, Joe; Sanchez, Charles; Nelson, Mary Anne; Pakula, Tiina; Saloheimo, Markku; Penttilä, Merja; Kivioja, Teemu

2014-01-01

Species-specific genes play an important role in defining the phenotype of an organism. However, current gene prediction methods can only efficiently find genes that share features such as sequence similarity or general sequence characteristics with previously known genes. Novel sequencing methods and tiling arrays can be used to find genes without prior information and they have demonstrated that novel genes can still be found from extensively studied model organisms. Unfortunately, these methods are expensive and thus are not easily applicable, e.g., to finding genes that are expressed only in very specific conditions. We demonstrate a method for finding novel genes with sparse arrays, applying it on the 33.9 Mb genome of the filamentous fungus Trichoderma reesei. Our computational method does not require normalisations between arrays and it takes into account the multiple-testing problem typical for analysis of microarray data. In contrast to tiling arrays, that use overlapping probes, only one 25mer microarray oligonucleotide probe was used for every 100 b. Thus, only relatively little space on a microarray slide was required to cover the intergenic regions of a genome. The analysis was done as a by-product of a conventional microarray experiment with no additional costs. We found at least 23 good candidates for novel transcripts that could code for proteins and all of which were expressed at high levels. Candidate genes were found to neighbour ire1 and cre1 and many other regulatory genes. Our simple, low-cost method can easily be applied to finding novel species-specific genes without prior knowledge of their sequence properties. PMID:20691772

Exome sequencing of Pakistani consanguineous families identifies 30 novel candidate genes for recessive intellectual disability

PubMed Central

Riazuddin, S; Hussain, M; Razzaq, A; Iqbal, Z; Shahzad, M; Polla, D L; Song, Y; van Beusekom, E; Khan, A A; Tomas-Roca, L; Rashid, M; Zahoor, M Y; Wissink-Lindhout, W M; Basra, M A R; Ansar, M; Agha, Z; van Heeswijk, K; Rasheed, F; Van de Vorst, M; Veltman, J A; Gilissen, C; Akram, J; Kleefstra, T; Assir, M Z; Grozeva, D; Carss, K; Raymond, F L; O'Connor, T D; Riazuddin, S A; Khan, S N; Ahmed, Z M; de Brouwer, A P M; van Bokhoven, H; Riazuddin, S

2017-01-01

Intellectual disability (ID) is a clinically and genetically heterogeneous disorder, affecting 1–3% of the general population. Although research into the genetic causes of ID has recently gained momentum, identification of pathogenic mutations that cause autosomal recessive ID (ARID) has lagged behind, predominantly due to non-availability of sizeable families. Here we present the results of exome sequencing in 121 large consanguineous Pakistani ID families. In 60 families, we identified homozygous or compound heterozygous DNA variants in a single gene, 30 affecting reported ID genes and 30 affecting novel candidate ID genes. Potential pathogenicity of these alleles was supported by co-segregation with the phenotype, low frequency in control populations and the application of stringent bioinformatics analyses. In another eight families segregation of multiple pathogenic variants was observed, affecting 19 genes that were either known or are novel candidates for ID. Transcriptome profiles of normal human brain tissues showed that the novel candidate ID genes formed a network significantly enriched for transcriptional co-expression (P<0.0001) in the frontal cortex during fetal development and in the temporal–parietal and sub-cortex during infancy through adulthood. In addition, proteins encoded by 12 novel ID genes directly interact with previously reported ID proteins in six known pathways essential for cognitive function (P<0.0001). These results suggest that disruptions of temporal parietal and sub-cortical neurogenesis during infancy are critical to the pathophysiology of ID. These findings further expand the existing repertoire of genes involved in ARID, and provide new insights into the molecular mechanisms and the transcriptome map of ID. PMID:27457812

Exome sequencing of Pakistani consanguineous families identifies 30 novel candidate genes for recessive intellectual disability.

PubMed

Riazuddin, S; Hussain, M; Razzaq, A; Iqbal, Z; Shahzad, M; Polla, D L; Song, Y; van Beusekom, E; Khan, A A; Tomas-Roca, L; Rashid, M; Zahoor, M Y; Wissink-Lindhout, W M; Basra, M A R; Ansar, M; Agha, Z; van Heeswijk, K; Rasheed, F; Van de Vorst, M; Veltman, J A; Gilissen, C; Akram, J; Kleefstra, T; Assir, M Z; Grozeva, D; Carss, K; Raymond, F L; O'Connor, T D; Riazuddin, S A; Khan, S N; Ahmed, Z M; de Brouwer, A P M; van Bokhoven, H; Riazuddin, S

2017-11-01

Intellectual disability (ID) is a clinically and genetically heterogeneous disorder, affecting 1-3% of the general population. Although research into the genetic causes of ID has recently gained momentum, identification of pathogenic mutations that cause autosomal recessive ID (ARID) has lagged behind, predominantly due to non-availability of sizeable families. Here we present the results of exome sequencing in 121 large consanguineous Pakistani ID families. In 60 families, we identified homozygous or compound heterozygous DNA variants in a single gene, 30 affecting reported ID genes and 30 affecting novel candidate ID genes. Potential pathogenicity of these alleles was supported by co-segregation with the phenotype, low frequency in control populations and the application of stringent bioinformatics analyses. In another eight families segregation of multiple pathogenic variants was observed, affecting 19 genes that were either known or are novel candidates for ID. Transcriptome profiles of normal human brain tissues showed that the novel candidate ID genes formed a network significantly enriched for transcriptional co-expression (P<0.0001) in the frontal cortex during fetal development and in the temporal-parietal and sub-cortex during infancy through adulthood. In addition, proteins encoded by 12 novel ID genes directly interact with previously reported ID proteins in six known pathways essential for cognitive function (P<0.0001). These results suggest that disruptions of temporal parietal and sub-cortical neurogenesis during infancy are critical to the pathophysiology of ID. These findings further expand the existing repertoire of genes involved in ARID, and provide new insights into the molecular mechanisms and the transcriptome map of ID.

HLA genotyping by next-generation sequencing of complementary DNA.

PubMed

Segawa, Hidenobu; Kukita, Yoji; Kato, Kikuya

2017-11-28

Genotyping of the human leucocyte antigen (HLA) is indispensable for various medical treatments. However, unambiguous genotyping is technically challenging due to high polymorphism of the corresponding genomic region. Next-generation sequencing is changing the landscape of genotyping. In addition to high throughput of data, its additional advantage is that DNA templates are derived from single molecules, which is a strong merit for the phasing problem. Although most currently developed technologies use genomic DNA, use of cDNA could enable genotyping with reduced costs in data production and analysis. We thus developed an HLA genotyping system based on next-generation sequencing of cDNA. Each HLA gene was divided into 3 or 4 target regions subjected to PCR amplification and subsequent sequencing with Ion Torrent PGM. The sequence data were then subjected to an automated analysis. The principle of the analysis was to construct candidate sequences generated from all possible combinations of variable bases and arrange them in decreasing order of the number of reads. Upon collecting candidate sequences from all target regions, 2 haplotypes were usually assigned. Cases not assigned 2 haplotypes were forwarded to 4 additional processes: selection of candidate sequences applying more stringent criteria, removal of artificial haplotypes, selection of candidate sequences with a relaxed threshold for sequence matching, and countermeasure for incomplete sequences in the HLA database. The genotyping system was evaluated using 30 samples; the overall accuracy was 97.0% at the field 3 level and 98.3% at the G group level. With one sample, genotyping of DPB1 was not completed due to short read size. We then developed a method for complete sequencing of individual molecules of the DPB1 gene, using the molecular barcode technology. The performance of the automatic genotyping system was comparable to that of systems developed in previous studies. Thus, next-generation sequencing of cDNA is a viable option for HLA genotyping.

Application of whole genome re-sequencing data in the development of diagnostic DNA markers tightly linked to a disease-resistance locus for marker-assisted selection in lupin (Lupinus angustifolius).

PubMed

Yang, Huaan; Jian, Jianbo; Li, Xuan; Renshaw, Daniel; Clements, Jonathan; Sweetingham, Mark W; Tan, Cong; Li, Chengdao

2015-09-02

Molecular marker-assisted breeding provides an efficient tool to develop improved crop varieties. A major challenge for the broad application of markers in marker-assisted selection is that the marker phenotypes must match plant phenotypes in a wide range of breeding germplasm. In this study, we used the legume crop species Lupinus angustifolius (lupin) to demonstrate the utility of whole genome sequencing and re-sequencing on the development of diagnostic markers for molecular plant breeding. Nine lupin cultivars released in Australia from 1973 to 2007 were subjected to whole genome re-sequencing. The re-sequencing data together with the reference genome sequence data were used in marker development, which revealed 180,596 to 795,735 SNP markers from pairwise comparisons among the cultivars. A total of 207,887 markers were anchored on the lupin genetic linkage map. Marker mining obtained an average of 387 SNP markers and 87 InDel markers for each of the 24 genome sequence assembly scaffolds bearing markers linked to 11 genes of agronomic interest. Using the R gene PhtjR conferring resistance to phomopsis stem blight disease as a test case, we discovered 17 candidate diagnostic markers by genotyping and selecting markers on a genetic linkage map. A further 243 candidate diagnostic markers were discovered by marker mining on a scaffold bearing non-diagnostic markers linked to the PhtjR gene. Nine out from the ten tested candidate diagnostic markers were confirmed as truly diagnostic on a broad range of commercial cultivars. Markers developed using these strategies meet the requirements for broad application in molecular plant breeding. We demonstrated that low-cost genome sequencing and re-sequencing data were sufficient and very effective in the development of diagnostic markers for marker-assisted selection. The strategies used in this study may be applied to any trait or plant species. Whole genome sequencing and re-sequencing provides a powerful tool to overcome current limitations in molecular plant breeding, which will enable plant breeders to precisely pyramid favourable genes to develop super crop varieties to meet future food demands.

Utilizing Gene Tree Variation to Identify Candidate Effector Genes in Zymoseptoria tritici

PubMed Central

McDonald, Megan C.; McGinness, Lachlan; Hane, James K.; Williams, Angela H.; Milgate, Andrew; Solomon, Peter S.

2016-01-01

Zymoseptoria tritici is a host-specific, necrotrophic pathogen of wheat. Infection by Z. tritici is characterized by its extended latent period, which typically lasts 2 wks, and is followed by extensive host cell death, and rapid proliferation of fungal biomass. This work characterizes the level of genomic variation in 13 isolates, for which we have measured virulence on 11 wheat cultivars with differential resistance genes. Between the reference isolate, IPO323, and the 13 Australian isolates we identified over 800,000 single nucleotide polymorphisms, of which ∼10% had an effect on the coding regions of the genome. Furthermore, we identified over 1700 probable presence/absence polymorphisms in genes across the Australian isolates using de novo assembly. Finally, we developed a gene tree sorting method that quickly identifies groups of isolates within a single gene alignment whose sequence haplotypes correspond with virulence scores on a single wheat cultivar. Using this method, we have identified < 100 candidate effector genes whose gene sequence correlates with virulence toward a wheat cultivar carrying a major resistance gene. PMID:26837952

Prediction and identification of sequences coding for orphan enzymes using genomic and metagenomic neighbours

PubMed Central

Yamada, Takuji; Waller, Alison S; Raes, Jeroen; Zelezniak, Aleksej; Perchat, Nadia; Perret, Alain; Salanoubat, Marcel; Patil, Kiran R; Weissenbach, Jean; Bork, Peer

2012-01-01

Despite the current wealth of sequencing data, one-third of all biochemically characterized metabolic enzymes lack a corresponding gene or protein sequence, and as such can be considered orphan enzymes. They represent a major gap between our molecular and biochemical knowledge, and consequently are not amenable to modern systemic analyses. As 555 of these orphan enzymes have metabolic pathway neighbours, we developed a global framework that utilizes the pathway and (meta)genomic neighbour information to assign candidate sequences to orphan enzymes. For 131 orphan enzymes (37% of those for which (meta)genomic neighbours are available), we associate sequences to them using scoring parameters with an estimated accuracy of 70%, implying functional annotation of 16 345 gene sequences in numerous (meta)genomes. As a case in point, two of these candidate sequences were experimentally validated to encode the predicted activity. In addition, we augmented the currently available genome-scale metabolic models with these new sequence–function associations and were able to expand the models by on average 8%, with a considerable change in the flux connectivity patterns and improved essentiality prediction. PMID:22569339

Database of cattle candidate genes and genetic markers for milk production and mastitis

PubMed Central

Ogorevc, J; Kunej, T; Razpet, A; Dovc, P

2009-01-01

A cattle database of candidate genes and genetic markers for milk production and mastitis has been developed to provide an integrated research tool incorporating different types of information supporting a genomic approach to study lactation, udder development and health. The database contains 943 genes and genetic markers involved in mammary gland development and function, representing candidates for further functional studies. The candidate loci were drawn on a genetic map to reveal positional overlaps. For identification of candidate loci, data from seven different research approaches were exploited: (i) gene knockouts or transgenes in mice that result in specific phenotypes associated with mammary gland (143 loci); (ii) cattle QTL for milk production (344) and mastitis related traits (71); (iii) loci with sequence variations that show specific allele-phenotype interactions associated with milk production (24) or mastitis (10) in cattle; (iv) genes with expression profiles associated with milk production (207) or mastitis (107) in cattle or mouse; (v) cattle milk protein genes that exist in different genetic variants (9); (vi) miRNAs expressed in bovine mammary gland (32) and (vii) epigenetically regulated cattle genes associated with mammary gland function (1). Fourty-four genes found by multiple independent analyses were suggested as the most promising candidates and were further in silico analysed for expression levels in lactating mammary gland, genetic variability and top biological functions in functional networks. A miRNA target search for mammary gland expressed miRNAs identified 359 putative binding sites in 3′UTRs of candidate genes. PMID:19508288

Mutation analysis in 129 genes associated with other forms of retinal dystrophy in 157 families with retinitis pigmentosa based on exome sequencing.

PubMed

Xu, Yan; Guan, Liping; Xiao, Xueshan; Zhang, Jianguo; Li, Shiqiang; Jiang, Hui; Jia, Xiaoyun; Yang, Jianhua; Guo, Xiangming; Yin, Ye; Wang, Jun; Zhang, Qingjiong

2015-01-01

Mutations in 60 known genes were previously identified by exome sequencing in 79 of 157 families with retinitis pigmentosa (RP). This study analyzed variants in 129 genes associated with other forms of hereditary retinal dystrophy in the same cohort. Apart from the 73 genes previously analyzed, a further 129 genes responsible for other forms of hereditary retinal dystrophy were selected based on RetNet. Variants in the 129 genes determined by whole exome sequencing were selected and filtered by bioinformatics analysis. Candidate variants were confirmed by Sanger sequencing and validated by analysis of available family members and controls. A total of 90 candidate variants were present in the 129 genes. Sanger sequencing confirmed 83 of the 90 variants. Analysis of family members and controls excluded 76 of these 83 variants. The remaining seven variants were considered to be potential pathogenic mutations; these were c.899A>G, c.1814C>G, and c.2107C>T in BBS2; c.1073C>T and c.1669C>T in INPP5E; and c.3582C>G and c.5704-5C>G in CACNA1F. Six of these seven mutations were novel. The mutations were detected in five unrelated patients without a family history, including three patients with homozygous or compound heterozygous mutations in BBS2 and INPP5E, and two patients with hemizygous mutations in CACNA1F. None of the patients had mutations in the genes associated with autosome dominant retinal dystrophy. Only a small portion of patients with RP, about 3% (5/157), had causative mutations in the 129 genes associated with other forms of hereditary retinal dystrophy.

Pool-based genome-wide association study identified novel candidate regions on BTA9 and 14 for oleic acid percentage in Japanese Black cattle.

PubMed

Kawaguchi, Fuki; Kigoshi, Hiroto; Nakajima, Ayaka; Matsumoto, Yuta; Uemoto, Yoshinobu; Fukushima, Moriyuki; Yoshida, Emi; Iwamoto, Eiji; Akiyama, Takayuki; Kohama, Namiko; Kobayashi, Eiji; Honda, Takeshi; Oyama, Kenji; Mannen, Hideyuki; Sasazaki, Shinji

2018-05-17

Fatty acid composition is an important indicator of beef quality. The objective of this study was to search the potential candidate region for fatty acid composition. We performed pool-based genome-wide association studies (GWAS) for oleic acid percentage (C18:1) in a Japanese Black cattle population from the Hyogo prefecture. GWAS analysis revealed two novel candidate regions on BTA9 and BTA14. The most significant single nucleotide polymorphisms (SNPs) in each region were genotyped in a population (n = 899) to verify their effect on C18:1. Statistical analysis revealed that both SNPs were significantly associated with C18:1 (p = .0080 and .0003), validating the quantitative trait loci (QTLs) detected in GWAS. We subsequently selected VNN1 and LYPLA1 genes as candidate genes from each region on BTA9 and BTA14, respectively. We sequenced full-length coding sequence (CDS) of these genes in eight individuals and identified a nonsynonymous SNP T66M on VNN1 gene as a putative candidate polymorphism. The polymorphism was also significantly associated with C18:1, but the p value (p = .0162) was higher than the most significant SNP on BTA9, suggesting that it would not be responsible for the QTL. Although further investigation will be needed to determine the responsible gene and polymorphism, our findings would contribute to development of selective markers for fatty acid composition in the Japanese Black cattle of Hyogo. © 2018 Japanese Society of Animal Science.

The WRKY Transcription Factor Family in Citrus: Valuable and Useful Candidate Genes for Citrus Breeding.

PubMed

Ayadi, M; Hanana, M; Kharrat, N; Merchaoui, H; Marzoug, R Ben; Lauvergeat, V; Rebaï, A; Mzid, R

2016-10-01

WRKY transcription factors belong to a large family of plant transcriptional regulators whose members have been reported to be involved in a wide range of biological roles including plant development, adaptation to environmental constraints and response to several diseases. However, little or poor information is available about WRKY's in Citrus. The recent release of completely assembled genomes sequences of Citrus sinensis and Citrus clementina and the availability of ESTs sequences from other citrus species allowed us to perform a genome survey for Citrus WRKY proteins. In the present study, we identified 100 WRKY members from C. sinensis (51), C. clementina (48) and Citrus unshiu (1), and analyzed their chromosomal distribution, gene structure, gene duplication, syntenic relation and phylogenetic analysis. A phylogenetic tree of 100 Citrus WRKY sequences with their orthologs from Arabidopsis has distinguished seven groups. The CsWRKY genes were distributed across all ten sweet orange chromosomes. A comprehensive approach and an integrative analysis of Citrus WRKY gene expression revealed variable profiles of expression within tissues and stress conditions indicating functional diversification. Thus, candidate Citrus WRKY genes have been proposed as potentially involved in fruit acidification, essential oil biosynthesis and abiotic/biotic stress tolerance. Our results provided essential prerequisites for further WRKY genes cloning and functional analysis with an aim of citrus crop improvement.

Development and application of microsatellites in candidate genes related to wood properties in the Chinese white poplar (Populus tomentosa Carr.).

PubMed

Du, Qingzhang; Gong, Chenrui; Pan, Wei; Zhang, Deqiang

2013-02-01

Gene-derived simple sequence repeats (genic SSRs), also known as functional markers, are often preferred over random genomic markers because they represent variation in gene coding and/or regulatory regions. We characterized 544 genic SSR loci derived from 138 candidate genes involved in wood formation, distributed throughout the genome of Populus tomentosa, a key ecological and cultivated wood production species. Of these SSRs, three-quarters were located in the promoter or intron regions, and dinucleotide (59.7%) and trinucleotide repeat motifs (26.5%) predominated. By screening 15 wild P. tomentosa ecotypes, we identified 188 polymorphic genic SSRs with 861 alleles, 2-7 alleles for each marker. Transferability analysis of 30 random genic SSRs, testing whether these SSRs work in 26 genotypes of five genus Populus sections (outgroup, Salix matsudana), showed that 72% of the SSRs could be amplified in Turanga and 100% could be amplified in Leuce. Based on genotyping of these 26 genotypes, a neighbour-joining analysis showed the expected six phylogenetic groupings. In silico analysis of SSR variation in 220 sequences that are homologous between P. tomentosa and Populus trichocarpa suggested that genic SSR variations between relatives were predominantly affected by repeat motif variations or flanking sequence mutations. Inheritance tests and single-marker associations demonstrated the power of genic SSRs in family-based linkage mapping and candidate gene-based association studies, as well as marker-assisted selection and comparative genomic studies of P. tomentosa and related species.

Integrated systems analysis reveals a molecular network underlying autism spectrum disorders

PubMed Central

Li, Jingjing; Shi, Minyi; Ma, Zhihai; Zhao, Shuchun; Euskirchen, Ghia; Ziskin, Jennifer; Urban, Alexander; Hallmayer, Joachim; Snyder, Michael

2014-01-01

Autism is a complex disease whose etiology remains elusive. We integrated previously and newly generated data and developed a systems framework involving the interactome, gene expression and genome sequencing to identify a protein interaction module with members strongly enriched for autism candidate genes. Sequencing of 25 patients confirmed the involvement of this module in autism, which was subsequently validated using an independent cohort of over 500 patients. Expression of this module was dichotomized with a ubiquitously expressed subcomponent and another subcomponent preferentially expressed in the corpus callosum, which was significantly affected by our identified mutations in the network center. RNA-sequencing of the corpus callosum from patients with autism exhibited extensive gene mis-expression in this module, and our immunochemical analysis showed that the human corpus callosum is predominantly populated by oligodendrocyte cells. Analysis of functional genomic data further revealed a significant involvement of this module in the development of oligodendrocyte cells in mouse brain. Our analysis delineates a natural network involved in autism, helps uncover novel candidate genes for this disease and improves our understanding of its molecular pathology. PMID:25549968

snoSeeker: an advanced computational package for screening of guide and orphan snoRNA genes in the human genome.

PubMed

Yang, Jian-Hua; Zhang, Xiao-Chen; Huang, Zhan-Peng; Zhou, Hui; Huang, Mian-Bo; Zhang, Shu; Chen, Yue-Qin; Qu, Liang-Hu

2006-01-01

Small nucleolar RNAs (snoRNAs) represent an abundant group of non-coding RNAs in eukaryotes. They can be divided into guide and orphan snoRNAs according to the presence or absence of antisense sequence to rRNAs or snRNAs. Current snoRNA-searching programs, which are essentially based on sequence complementarity to rRNAs or snRNAs, exist only for the screening of guide snoRNAs. In this study, we have developed an advanced computational package, snoSeeker, which includes CDseeker and ACAseeker programs, for the highly efficient and specific screening of both guide and orphan snoRNA genes in mammalian genomes. By using these programs, we have systematically scanned four human-mammal whole-genome alignment (WGA) sequences and identified 54 novel candidates including 26 orphan candidates as well as 266 known snoRNA genes. Eighteen novel snoRNAs were further experimentally confirmed with four snoRNAs exhibiting a tissue-specific or restricted expression pattern. The results of this study provide the most comprehensive listing of two families of snoRNA genes in the human genome till date.

Screening for microsatellite instability target genes in colorectal cancers

PubMed Central

Vilkki, S; Launonen, V; Karhu, A; Sistonen, P; Vastrik, I; Aaltonen, L

2002-01-01

Background: Defects in the DNA repair system lead to genetic instability because replication errors are not corrected. This type of genetic instability is a key event in the malignant progression of HNPCC and a subset of sporadic colon cancers and mutation rates are particularly high at short repetitive sequences. Somatic deletions of coding mononucleotide repeats have been detected, for example, in the TGFßRII and BAX genes, and recently many novel target genes for microsatellite instability (MSI) have been proposed. Novel target genes are likely to be discovered in the future. More data should be created on background mutation rates in MSI tumours to evaluate mutation rates observed in the candidate target genes. Methods: Mutation rates in 14 neutral intronic repeats were evaluated in MSI tumours. Bioinformatic searches combined with keywords related to cancer and tumour suppressor or CRC related gene homology were used to find new candidate MSI target genes. By comparison of mutation frequencies observed in intronic mononucleotide repeats versus exonic coding repeats of potential MSI target genes, the significance of the exonic mutations was estimated. Results: As expected, the length of an intronic mononucleotide repeat correlated positively with the number of slippages for both G/C and A/T repeats (p=0.0020 and p=0.0012, respectively). BRCA1, CtBP1, and Rb1 associated CtIP and other candidates were found in a bioinformatic search combined with keywords related to cancer. Sequencing showed a significantly increased mutation rate in the exonic A9 repeat of CtIP (25/109=22.9%) as compared with similar intronic repeats (p≤0.001). Conclusions: We propose a new candidate MSI target gene CtIP to be evaluated in further studies. PMID:12414815

Loci and candidate genes conferring resistance to soybean cyst nematode HG type 2.5.7.

PubMed

Zhao, Xue; Teng, Weili; Li, Yinghui; Liu, Dongyuan; Cao, Guanglu; Li, Dongmei; Qiu, Lijuan; Zheng, Hongkun; Han, Yingpeng; Li, Wenbin

2017-06-14

Soybean (Glycine max L. Merr.) cyst nematode (SCN, Heterodera glycines I,) is a major pest of soybean worldwide. The most effective strategy to control this pest involves the use of resistant cultivars. The aim of the present study was to investigate the genome-wide genetic architecture of resistance to SCN HG Type 2.5.7 (race 1) in landrace and elite cultivated soybeans. A total of 200 diverse soybean accessions were screened for resistance to SCN HG Type 2.5.7 and genotyped through sequencing using the Specific Locus Amplified Fragment Sequencing (SLAF-seq) approach with a 6.14-fold average sequencing depth. A total of 33,194 SNPs were identified with minor allele frequencies (MAF) over 4%, covering 97% of all the genotypes. Genome-wide association mapping (GWAS) revealed thirteen SNPs associated with resistance to SCN HG Type 2.5.7. These SNPs were distributed on five chromosomes (Chr), including Chr7, 8, 14, 15 and 18. Four SNPs were novel resistance loci and nine SNPs were located near known QTL. A total of 30 genes were identified as candidate genes underlying SCN resistance. A total of sixteen novel soybean accessions were identified with significant resistance to HG Type 2.5.7. The beneficial alleles and candidate genes identified by GWAS might be valuable for improving marker-assisted breeding efficiency and exploring the molecular mechanisms underlying SCN resistance.

Selection of a DNA barcode for Nectriaceae from fungal whole-genomes.

PubMed

Zeng, Zhaoqing; Zhao, Peng; Luo, Jing; Zhuang, Wenying; Yu, Zhihe

2012-01-01

A DNA barcode is a short segment of sequence that is able to distinguish species. A barcode must ideally contain enough variation to distinguish every individual species and be easily obtained. Fungi of Nectriaceae are economically important and show high species diversity. To establish a standard DNA barcode for this group of fungi, the genomes of Neurospora crassa and 30 other filamentous fungi were compared. The expect value was treated as a criterion to recognize homologous sequences. Four candidate markers, Hsp90, AAC, CDC48, and EF3, were tested for their feasibility as barcodes in the identification of 34 well-established species belonging to 13 genera of Nectriaceae. Two hundred and fifteen sequences were analyzed. Intra- and inter-specific variations and the success rate of PCR amplification and sequencing were considered as important criteria for estimation of the candidate markers. Ultimately, the partial EF3 gene met the requirements for a good DNA barcode: No overlap was found between the intra- and inter-specific pairwise distances. The smallest inter-specific distance of EF3 gene was 3.19%, while the largest intra-specific distance was 1.79%. In addition, there was a high success rate in PCR and sequencing for this gene (96.3%). CDC48 showed sufficiently high sequence variation among species, but the PCR and sequencing success rate was 84% using a single pair of primers. Although the Hsp90 and AAC genes had higher PCR and sequencing success rates (96.3% and 97.5%, respectively), overlapping occurred between the intra- and inter-specific variations, which could lead to misidentification. Therefore, we propose the EF3 gene as a possible DNA barcode for the nectriaceous fungi.

Complete Genome Sequence of Sporisorium scitamineum and Biotrophic Interaction Transcriptome with Sugarcane

PubMed Central

Benevenuto, Juliana; Peters, Leila P.; Carvalho, Giselle; Palhares, Alessandra; Quecine, Maria C.; Nunes, Filipe R. S.; Kmit, Maria C. P.; Wai, Alvan; Hausner, Georg; Aitken, Karen S.; Berkman, Paul J.; Fraser, James A.; Moolhuijzen, Paula M.; Coutinho, Luiz L.; Creste, Silvana; Vieira, Maria L. C.; Kitajima, João P.; Monteiro-Vitorello, Claudia B.

2015-01-01

Sporisorium scitamineum is a biotrophic fungus responsible for the sugarcane smut, a worldwide spread disease. This study provides the complete sequence of individual chromosomes of S. scitamineum from telomere to telomere achieved by a combination of PacBio long reads and Illumina short reads sequence data, as well as a draft sequence of a second fungal strain. Comparative analysis to previous available sequences of another strain detected few polymorphisms among the three genomes. The novel complete sequence described herein allowed us to identify and annotate extended subtelomeric regions, repetitive elements and the mitochondrial DNA sequence. The genome comprises 19,979,571 bases, 6,677 genes encoding proteins, 111 tRNAs and 3 assembled copies of rDNA, out of our estimated number of copies as 130. Chromosomal reorganizations were detected when comparing to sequences of S. reilianum, the closest smut relative, potentially influenced by repeats of transposable elements. Repetitive elements may have also directed the linkage of the two mating-type loci. The fungal transcriptome profiling from in vitro and from interaction with sugarcane at two time points (early infection and whip emergence) revealed that 13.5% of the genes were differentially expressed in planta and particular to each developmental stage. Among them are plant cell wall degrading enzymes, proteases, lipases, chitin modification and lignin degradation enzymes, sugar transporters and transcriptional factors. The fungus also modulates transcription of genes related to surviving against reactive oxygen species and other toxic metabolites produced by the plant. Previously described effectors in smut/plant interactions were detected but some new candidates are proposed. Ten genomic islands harboring some of the candidate genes unique to S. scitamineum were expressed only in planta. RNAseq data was also used to reassure gene predictions. PMID:26065709

Characterization and Amplification of Gene-Based Simple Sequence Repeat (SSR) Markers in Date Palm.

PubMed

Zhao, Yongli; Keremane, Manjunath; Prakash, Channapatna S; He, Guohao

2017-01-01

The paucity of molecular markers limits the application of genetic and genomic research in date palm (Phoenix dactylifera L.). Availability of expressed sequence tag (EST) sequences in date palm may provide a good resource for developing gene-based markers. This study characterizes a substantial fraction of transcriptome sequences containing simple sequence repeats (SSRs) from the EST sequences in date palm. The EST sequences studied are mainly homologous to those of Elaeis guineensis and Musa acuminata. A total of 911 gene-based SSR markers, characterized with functional annotations, have provided a useful basis not only for discovering candidate genes and understanding genetic basis of traits of interest but also for developing genetic and genomic tools for molecular research in date palm, such as diversity study, quantitative trait locus (QTL) mapping, and molecular breeding. The procedures of DNA extraction, polymerase chain reaction (PCR) amplification of these gene-based SSR markers, and gel electrophoresis of PCR products are described in this chapter.

Identifying metabolic enzymes with multiple types of association evidence

PubMed Central

Kharchenko, Peter; Chen, Lifeng; Freund, Yoav; Vitkup, Dennis; Church, George M

2006-01-01

Background Existing large-scale metabolic models of sequenced organisms commonly include enzymatic functions which can not be attributed to any gene in that organism. Existing computational strategies for identifying such missing genes rely primarily on sequence homology to known enzyme-encoding genes. Results We present a novel method for identifying genes encoding for a specific metabolic function based on a local structure of metabolic network and multiple types of functional association evidence, including clustering of genes on the chromosome, similarity of phylogenetic profiles, gene expression, protein fusion events and others. Using E. coli and S. cerevisiae metabolic networks, we illustrate predictive ability of each individual type of association evidence and show that significantly better predictions can be obtained based on the combination of all data. In this way our method is able to predict 60% of enzyme-encoding genes of E. coli metabolism within the top 10 (out of 3551) candidates for their enzymatic function, and as a top candidate within 43% of the cases. Conclusion We illustrate that a combination of genome context and other functional association evidence is effective in predicting genes encoding metabolic enzymes. Our approach does not rely on direct sequence homology to known enzyme-encoding genes, and can be used in conjunction with traditional homology-based metabolic reconstruction methods. The method can also be used to target orphan metabolic activities. PMID:16571130

Genome-Wide Association Study Identifying Candidate Genes Influencing Important Agronomic Traits of Flax (Linum usitatissimum L.) Using SLAF-seq

PubMed Central

Xie, Dongwei; Dai, Zhigang; Yang, Zemao; Sun, Jian; Zhao, Debao; Yang, Xue; Zhang, Liguo; Tang, Qing; Su, Jianguang

2018-01-01

Flax (Linum usitatissimum L.) is an important cash crop, and its agronomic traits directly affect yield and quality. Molecular studies on flax remain inadequate because relatively few flax genes have been associated with agronomic traits or have been identified as having potential applications. To identify markers and candidate genes that can potentially be used for genetic improvement of crucial agronomic traits, we examined 224 specimens of core flax germplasm; specifically, phenotypic data for key traits, including plant height, technical length, number of branches, number of fruits, and 1000-grain weight were investigated under three environmental conditions before specific-locus amplified fragment sequencing (SLAF-seq) was employed to perform a genome-wide association study (GWAS) for these five agronomic traits. Subsequently, the results were used to screen single nucleotide polymorphism (SNP) loci and candidate genes that exhibited a significant correlation with the important agronomic traits. Our analyses identified a total of 42 SNP loci that showed significant correlations with the five important agronomic flax traits. Next, candidate genes were screened in the 10 kb zone of each of the 42 SNP loci. These SNP loci were then analyzed by a more stringent screening via co-identification using both a general linear model (GLM) and a mixed linear model (MLM) as well as co-occurrences in at least two of the three environments, whereby 15 final candidate genes were obtained. Based on these results, we determined that UGT and PL are candidate genes for plant height, GRAS and XTH are candidate genes for the number of branches, Contig1437 and LU0019C12 are candidate genes for the number of fruits, and PHO1 is a candidate gene for the 1000-seed weight. We propose that the identified SNP loci and corresponding candidate genes might serve as a biological basis for improving crucial agronomic flax traits. PMID:29375606

Genome-Wide Association Study Identifying Candidate Genes Influencing Important Agronomic Traits of Flax (Linum usitatissimum L.) Using SLAF-seq.

PubMed

Xie, Dongwei; Dai, Zhigang; Yang, Zemao; Sun, Jian; Zhao, Debao; Yang, Xue; Zhang, Liguo; Tang, Qing; Su, Jianguang

2017-01-01

Flax ( Linum usitatissimum L.) is an important cash crop, and its agronomic traits directly affect yield and quality. Molecular studies on flax remain inadequate because relatively few flax genes have been associated with agronomic traits or have been identified as having potential applications. To identify markers and candidate genes that can potentially be used for genetic improvement of crucial agronomic traits, we examined 224 specimens of core flax germplasm; specifically, phenotypic data for key traits, including plant height, technical length, number of branches, number of fruits, and 1000-grain weight were investigated under three environmental conditions before specific-locus amplified fragment sequencing (SLAF-seq) was employed to perform a genome-wide association study (GWAS) for these five agronomic traits. Subsequently, the results were used to screen single nucleotide polymorphism (SNP) loci and candidate genes that exhibited a significant correlation with the important agronomic traits. Our analyses identified a total of 42 SNP loci that showed significant correlations with the five important agronomic flax traits. Next, candidate genes were screened in the 10 kb zone of each of the 42 SNP loci. These SNP loci were then analyzed by a more stringent screening via co-identification using both a general linear model (GLM) and a mixed linear model (MLM) as well as co-occurrences in at least two of the three environments, whereby 15 final candidate genes were obtained. Based on these results, we determined that UGT and PL are candidate genes for plant height, GRAS and XTH are candidate genes for the number of branches, Contig1437 and LU0019C12 are candidate genes for the number of fruits, and PHO1 is a candidate gene for the 1000-seed weight. We propose that the identified SNP loci and corresponding candidate genes might serve as a biological basis for improving crucial agronomic flax traits.

Comparative molecular analyses of select pH- and osmoregulatory genes in three freshwater crayfish Cherax quadricarinatus, C. destructor and C. cainii

PubMed Central

Pavasovic, Ana; Dammannagoda, Lalith K.; Mather, Peter B.; Prentis, Peter J.

2017-01-01

Systemic acid-base balance and osmotic/ionic regulation in decapod crustaceans are in part maintained by a set of transport-related enzymes such as carbonic anhydrase (CA), Na+/K+-ATPase (NKA), H+-ATPase (HAT), Na+/K+/2Cl− cotransporter (NKCC), Na+/Cl−/HCO\\documentclass[12pt]{minimal} \\usepackage{amsmath} \\usepackage{wasysym} \\usepackage{amsfonts} \\usepackage{amssymb} \\usepackage{amsbsy} \\usepackage{upgreek} \\usepackage{mathrsfs} \\setlength{\\oddsidemargin}{-69pt} \\begin{document} }{}${}_{3}^{-}$\\end{document}3− cotransporter (NBC), Na+/H+ exchanger (NHE), Arginine kinase (AK), Sarcoplasmic Ca+2-ATPase (SERCA) and Calreticulin (CRT). We carried out a comparative molecular analysis of these genes in three commercially important yet eco-physiologically distinct freshwater crayfish, Cherax quadricarinatus, C. destructor and C. cainii, with the aim to identify mutations in these genes and determine if observed patterns of mutations were consistent with the action of natural selection. We also conducted a tissue-specific expression analysis of these genes across seven different organs, including gills, hepatopancreas, heart, kidney, liver, nerve and testes using NGS transcriptome data. The molecular analysis of the candidate genes revealed a high level of sequence conservation across the three Cherax sp. Hyphy analysis revealed that all candidate genes showed patterns of molecular variation consistent with neutral evolution. The tissue-specific expression analysis showed that 46% of candidate genes were expressed in all tissue types examined, while approximately 10% of candidate genes were only expressed in a single tissue type. The largest number of genes was observed in nerve (84%) and gills (78%) and the lowest in testes (66%). The tissue-specific expression analysis also revealed that most of the master genes regulating pH and osmoregulation (CA, NKA, HAT, NKCC, NBC, NHE) were expressed in all tissue types indicating an important physiological role for these genes outside of osmoregulation in other tissue types. The high level of sequence conservation observed in the candidate genes may be explained by the important role of these genes as well as potentially having a number of other basic physiological functions in different tissue types. PMID:28852583

Transcriptional sequencing and analysis of major genes involved in the adventitious root formation of mango cotyledon segments.

PubMed

Li, Yun-He; Zhang, Hong-Na; Wu, Qing-Song; Muday, Gloria K

2017-06-01

A total of 74,745 unigenes were generated and 1975 DEGs were identified. Candidate genes that may be involved in the adventitious root formation of mango cotyledon segment were revealed. Adventitious root formation is a crucial step in plant vegetative propagation, but the molecular mechanism of adventitious root formation remains unclear. Adventitious roots formed only at the proximal cut surface (PCS) of mango cotyledon segments, whereas no roots were formed on the opposite, distal cut surface (DCS). To identify the transcript abundance changes linked to adventitious root development, RNA was isolated from PCS and DCS at 0, 4 and 7 days after culture, respectively. Illumina sequencing of libraries generated from these samples yielded 62.36 Gb high-quality reads that were assembled into 74,745 unigenes with an average sequence length of 807 base pairs, and 33,252 of the assembled unigenes at least had homologs in one of the public databases. Comparative analysis of these transcriptome databases revealed that between the different time points at PCS there were 1966 differentially expressed genes (DEGs), while there were only 51 DEGs for the PCS vs. DCS when time-matched samples were compared. Of these DEGs, 1636 were assigned to gene ontology (GO) classes, the majority of that was involved in cellular processes, metabolic processes and single-organism processes. Candidate genes that may be involved in the adventitious root formation of mango cotyledon segment are predicted to encode polar auxin transport carriers, auxin-regulated proteins, cell wall remodeling enzymes and ethylene-related proteins. In order to validate RNA-sequencing results, we further analyzed the expression profiles of 20 genes by quantitative real-time PCR. This study expands the transcriptome information for Mangifera indica and identifies candidate genes involved in adventitious root formation in cotyledon segments of mango.

Integrating De Novo Transcriptome Assembly and Cloning to Obtain Chicken Ovocleidin-17 Full-Length cDNA

PubMed Central

Ning, ZhongHua; Hincke, Maxwell T.; Yang, Ning; Hou, ZhuoCheng

2014-01-01

Efficiently obtaining full-length cDNA for a target gene is the key step for functional studies and probing genetic variations. However, almost all sequenced domestic animal genomes are not ‘finished’. Many functionally important genes are located in these gapped regions. It can be difficult to obtain full-length cDNA for which only partial amino acid/EST sequences exist. In this study we report a general pipeline to obtain full-length cDNA, and illustrate this approach for one important gene (Ovocleidin-17, OC-17) that is associated with chicken eggshell biomineralization. Chicken OC-17 is one of the best candidates to control and regulate the deposition of calcium carbonate in the calcified eggshell layer. OC-17 protein has been purified, sequenced, and has had its three-dimensional structure solved. However, researchers still cannot conduct OC-17 mRNA related studies because the mRNA sequence is unknown and the gene is absent from the current chicken genome. We used RNA-Seq to obtain the entire transcriptome of the adult hen uterus, and then conducted de novo transcriptome assembling with bioinformatics analysis to obtain candidate OC-17 transcripts. Based on this sequence, we used RACE and PCR cloning methods to successfully obtain the full-length OC-17 cDNA. Temporal and spatial OC-17 mRNA expression analyses were also performed to demonstrate that OC-17 is predominantly expressed in the adult hen uterus during the laying cycle and barely at immature developmental stages. Differential uterine expression of OC-17 was observed in hens laying eggs with weak versus strong eggshell, confirming its important role in the regulation of eggshell mineralization and providing a new tool for genetic selection for eggshell quality parameters. This study is the first one to report the full-length OC-17 cDNA sequence, and builds a foundation for OC-17 mRNA related studies. We provide a general method for biologists experiencing difficulty in obtaining candidate gene full-length cDNA sequences. PMID:24676480

Integrating de novo transcriptome assembly and cloning to obtain chicken Ovocleidin-17 full-length cDNA.

PubMed

Zhang, Quan; Liu, Long; Zhu, Feng; Ning, ZhongHua; Hincke, Maxwell T; Yang, Ning; Hou, ZhuoCheng

2014-01-01

Efficiently obtaining full-length cDNA for a target gene is the key step for functional studies and probing genetic variations. However, almost all sequenced domestic animal genomes are not 'finished'. Many functionally important genes are located in these gapped regions. It can be difficult to obtain full-length cDNA for which only partial amino acid/EST sequences exist. In this study we report a general pipeline to obtain full-length cDNA, and illustrate this approach for one important gene (Ovocleidin-17, OC-17) that is associated with chicken eggshell biomineralization. Chicken OC-17 is one of the best candidates to control and regulate the deposition of calcium carbonate in the calcified eggshell layer. OC-17 protein has been purified, sequenced, and has had its three-dimensional structure solved. However, researchers still cannot conduct OC-17 mRNA related studies because the mRNA sequence is unknown and the gene is absent from the current chicken genome. We used RNA-Seq to obtain the entire transcriptome of the adult hen uterus, and then conducted de novo transcriptome assembling with bioinformatics analysis to obtain candidate OC-17 transcripts. Based on this sequence, we used RACE and PCR cloning methods to successfully obtain the full-length OC-17 cDNA. Temporal and spatial OC-17 mRNA expression analyses were also performed to demonstrate that OC-17 is predominantly expressed in the adult hen uterus during the laying cycle and barely at immature developmental stages. Differential uterine expression of OC-17 was observed in hens laying eggs with weak versus strong eggshell, confirming its important role in the regulation of eggshell mineralization and providing a new tool for genetic selection for eggshell quality parameters. This study is the first one to report the full-length OC-17 cDNA sequence, and builds a foundation for OC-17 mRNA related studies. We provide a general method for biologists experiencing difficulty in obtaining candidate gene full-length cDNA sequences.

Gene Prioritization of Resistant Rice Gene against Xanthomas oryzae pv. oryzae by Using Text Mining Technologies

PubMed Central

Xia, Jingbo; Zhang, Xing; Yuan, Daojun; Chen, Lingling; Webster, Jonathan; Fang, Alex Chengyu

2013-01-01

To effectively assess the possibility of the unknown rice protein resistant to Xanthomonas oryzae pv. oryzae, a hybrid strategy is proposed to enhance gene prioritization by combining text mining technologies with a sequence-based approach. The text mining technique of term frequency inverse document frequency is used to measure the importance of distinguished terms which reflect biomedical activity in rice before candidate genes are screened and vital terms are produced. Afterwards, a built-in classifier under the chaos games representation algorithm is used to sieve the best possible candidate gene. Our experiment results show that the combination of these two methods achieves enhanced gene prioritization. PMID:24371834

Gene prioritization of resistant rice gene against Xanthomas oryzae pv. oryzae by using text mining technologies.

PubMed

Xia, Jingbo; Zhang, Xing; Yuan, Daojun; Chen, Lingling; Webster, Jonathan; Fang, Alex Chengyu

2013-01-01

To effectively assess the possibility of the unknown rice protein resistant to Xanthomonas oryzae pv. oryzae, a hybrid strategy is proposed to enhance gene prioritization by combining text mining technologies with a sequence-based approach. The text mining technique of term frequency inverse document frequency is used to measure the importance of distinguished terms which reflect biomedical activity in rice before candidate genes are screened and vital terms are produced. Afterwards, a built-in classifier under the chaos games representation algorithm is used to sieve the best possible candidate gene. Our experiment results show that the combination of these two methods achieves enhanced gene prioritization.

In Silico Identification of Candidate Genes for Fertility Restoration in Cytoplasmic Male Sterile Perennial Ryegrass (Lolium perenne L.)

PubMed Central

Sykes, Timothy; Yates, Steven; Nagy, Istvan; Asp, Torben; Small, Ian

2017-01-01

Perennial ryegrass (Lolium perenne L.) is widely used for forage production in both permanent and temporary grassland systems. To increase yields in perennial ryegrass, recent breeding efforts have been focused on strategies to more efficiently exploit heterosis by hybrid breeding. Cytoplasmic male sterility (CMS) is a widely applied mechanism to control pollination for commercial hybrid seed production and although CMS systems have been identified in perennial ryegrass, they are yet to be fully characterized. Here, we present a bioinformatics pipeline for efficient identification of candidate restorer of fertility (Rf) genes for CMS. From a high-quality draft of the perennial ryegrass genome, 373 pentatricopeptide repeat (PPR) genes were identified and classified, further identifying 25 restorer of fertility-like PPR (RFL) genes through a combination of DNA sequence clustering and comparison to known Rf genes. This extensive gene family was targeted as the majority of Rf genes in higher plants are RFL genes. These RFL genes were further investigated by phylogenetic analyses, identifying three groups of perennial ryegrass RFLs. These three groups likely represent genomic regions of active RFL generation and identify the probable location of perennial ryegrass PPR-Rf genes. This pipeline allows for the identification of candidate PPR-Rf genes from genomic sequence data and can be used in any plant species. Functional markers for PPR-Rf genes will facilitate map-based cloning of Rf genes and enable the use of CMS as an efficient tool to control pollination for hybrid crop production. PMID:26951780

Breeding maize for silage and biofuel production, an illustration of a step forward with the genome sequence.

PubMed

Barrière, Yves; Courtial, Audrey; Chateigner-Boutin, Anne-Laure; Denoue, Dominique; Grima-Pettenati, Jacqueline

2016-01-01

The knowledge of the gene families mostly impacting cell wall digestibility variations would significantly increase the efficiency of marker-assisted selection when breeding maize and grass varieties with improved silage feeding value and/or with better straw fermentability into alcohol or methane. The maize genome sequence of the B73 inbred line was released at the end of 2009, opening up new avenues to identify the genetic determinants of quantitative traits. Colocalizations between a large set of candidate genes putatively involved in secondary cell wall assembly and QTLs for cell wall digestibility (IVNDFD) were then investigated, considering physical positions of both genes and QTLs. Based on available data from six RIL progenies, 59 QTLs corresponding to 38 non-overlapping positions were matched up with a list of 442 genes distributed all over the genome. Altogether, 176 genes colocalized with IVNDFD QTLs and most often, several candidate genes colocalized at each QTL position. Frequent QTL colocalizations were found firstly with genes encoding ZmMYB and ZmNAC transcription factors, and secondly with genes encoding zinc finger, bHLH, and xylogen regulation factors. In contrast, close colocalizations were less frequent with genes involved in monolignol biosynthesis, and found only with the C4H2, CCoAOMT5, and CCR1 genes. Close colocalizations were also infrequent with genes involved in cell wall feruloylation and cross-linkages. Altogether, investigated colocalizations between candidate genes and cell wall digestibility QTLs suggested a prevalent role of regulation factors over constitutive cell wall genes on digestibility variations. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

An assessment of heavy ion irradiation mutagenesis for reverse genetics in wheat (Triticum aestivum L.).

PubMed

Fitzgerald, Timothy L; Powell, Jonathan J; Stiller, Jiri; Weese, Terri L; Abe, Tomoko; Zhao, Guangyao; Jia, Jizeng; McIntyre, C Lynne; Li, Zhongyi; Manners, John M; Kazan, Kemal

2015-01-01

Reverse genetic techniques harnessing mutational approaches are powerful tools that can provide substantial insight into gene function in plants. However, as compared to diploid species, reverse genetic analyses in polyploid plants such as bread wheat can present substantial challenges associated with high levels of sequence and functional similarity amongst homoeologous loci. We previously developed a high-throughput method to identify deletions of genes within a physically mutagenized wheat population. Here we describe our efforts to combine multiple homoeologous deletions of three candidate disease susceptibility genes (TaWRKY11, TaPFT1 and TaPLDß1). We were able to produce lines featuring homozygous deletions at two of the three homoeoloci for all genes, but this was dependent on the individual mutants used in crossing. Intriguingly, despite extensive efforts, viable lines possessing homozygous deletions at all three homoeoloci could not be produced for any of the candidate genes. To investigate deletion size as a possible reason for this phenomenon, we developed an amplicon sequencing approach based on synteny to Brachypodium distachyon to assess the size of the deletions removing one candidate gene (TaPFT1) in our mutants. These analyses revealed that genomic deletions removing the locus are relatively large, resulting in the loss of multiple additional genes. The implications of this work for the use of heavy ion mutagenesis for reverse genetic analyses in wheat are discussed.

An Assessment of Heavy Ion Irradiation Mutagenesis for Reverse Genetics in Wheat (Triticum aestivum L.)

PubMed Central

Fitzgerald, Timothy L.; Powell, Jonathan J.; Stiller, Jiri; Weese, Terri L.; Abe, Tomoko; Zhao, Guangyao; Jia, Jizeng; McIntyre, C. Lynne; Li, Zhongyi; Manners, John M.; Kazan, Kemal

2015-01-01

Reverse genetic techniques harnessing mutational approaches are powerful tools that can provide substantial insight into gene function in plants. However, as compared to diploid species, reverse genetic analyses in polyploid plants such as bread wheat can present substantial challenges associated with high levels of sequence and functional similarity amongst homoeologous loci. We previously developed a high-throughput method to identify deletions of genes within a physically mutagenized wheat population. Here we describe our efforts to combine multiple homoeologous deletions of three candidate disease susceptibility genes (TaWRKY11, TaPFT1 and TaPLDß1). We were able to produce lines featuring homozygous deletions at two of the three homoeoloci for all genes, but this was dependent on the individual mutants used in crossing. Intriguingly, despite extensive efforts, viable lines possessing homozygous deletions at all three homoeoloci could not be produced for any of the candidate genes. To investigate deletion size as a possible reason for this phenomenon, we developed an amplicon sequencing approach based on synteny to Brachypodium distachyon to assess the size of the deletions removing one candidate gene (TaPFT1) in our mutants. These analyses revealed that genomic deletions removing the locus are relatively large, resulting in the loss of multiple additional genes. The implications of this work for the use of heavy ion mutagenesis for reverse genetic analyses in wheat are discussed. PMID:25719507

Experience of targeted Usher exome sequencing as a clinical test

PubMed Central

Besnard, Thomas; García-García, Gema; Baux, David; Vaché, Christel; Faugère, Valérie; Larrieu, Lise; Léonard, Susana; Millan, Jose M; Malcolm, Sue; Claustres, Mireille; Roux, Anne-Françoise

2014-01-01

We show that massively parallel targeted sequencing of 19 genes provides a new and reliable strategy for molecular diagnosis of Usher syndrome (USH) and nonsyndromic deafness, particularly appropriate for these disorders characterized by a high clinical and genetic heterogeneity and a complex structure of several of the genes involved. A series of 71 patients including Usher patients previously screened by Sanger sequencing plus newly referred patients was studied. Ninety-eight percent of the variants previously identified by Sanger sequencing were found by next-generation sequencing (NGS). NGS proved to be efficient as it offers analysis of all relevant genes which is laborious to reach with Sanger sequencing. Among the 13 newly referred Usher patients, both mutations in the same gene were identified in 77% of cases (10 patients) and one candidate pathogenic variant in two additional patients. This work can be considered as pilot for implementing NGS for genetically heterogeneous diseases in clinical service. PMID:24498627

Fine Mapping Identifies SmFAS Encoding an Anthocyanidin Synthase as a Putative Candidate Gene for Flower Purple Color in Solanum melongena L.

PubMed Central

Chen, Mengqiang; Xu, Mengyun; Xiao, Yao; Cui, Dandan; Qin, Yongqiang; Wu, Jiaqi; Wang, Wenyi; Wang, Guoping

2018-01-01

Anthocyanins are the main pigments in flowers and fruits. These pigments are responsible for the red, red-purple, violet, and purple color in plants, and act as insect and animal attractants. In this study, phenotypic analysis of the purple flower color in eggplant indicated that the flower color is controlled by a single dominant gene, FAS. Using an F2 mapping population derived from a cross between purple-flowered ‘Blacknite’ and white-flowered ‘Small Round’, Flower Anthocyanidin Synthase (FAS) was fine mapped to an approximately 165.6-kb region between InDel marker Indel8-11 and Cleaved Amplified Polymorphic Sequences (CAPS) marker Efc8-32 on Chromosome 8. On the basis of bioinformatic analysis, 29 genes were subsequently located in the FAS target region, among which were two potential Anthocyanidin Synthase (ANS) gene candidates. Allelic sequence comparison results showed that one ANS gene (Sme2.5_01638.1_g00003.1) was conserved in promoter and coding sequences without any nucleotide change between parents, whereas four single-nucleotide polymorphisms were detected in another ANS gene (Sme2.5_01638.1_g00005.1). Crucially, a single base pair deletion at site 438 resulted in premature termination of FAS, leading to the loss of anthocyanin accumulation. In addition, FAS displayed strong expression in purple flowers compared with white flowers and other tissues. Collectively, our results indicate that Sme2.5_01638.1_g00005.1 is a good candidate gene for FAS, which controls anthocyanidin synthase in eggplant flowers. The present study provides information for further potential facilitate genetic engineering for improvement of anthocyanin levels in plants. PMID:29522465

Identification of candidate genes for drought tolerance in coffee by high-throughput sequencing in the shoot apex of different Coffea arabica cultivars.

PubMed

Mofatto, Luciana Souto; Carneiro, Fernanda de Araújo; Vieira, Natalia Gomes; Duarte, Karoline Estefani; Vidal, Ramon Oliveira; Alekcevetch, Jean Carlos; Cotta, Michelle Guitton; Verdeil, Jean-Luc; Lapeyre-Montes, Fabienne; Lartaud, Marc; Leroy, Thierry; De Bellis, Fabien; Pot, David; Rodrigues, Gustavo Costa; Carazzolle, Marcelo Falsarella; Pereira, Gonçalo Amarante Guimarães; Andrade, Alan Carvalho; Marraccini, Pierre

2016-04-19

Drought is a widespread limiting factor in coffee plants. It affects plant development, fruit production, bean development and consequently beverage quality. Genetic diversity for drought tolerance exists within the coffee genus. However, the molecular mechanisms underlying the adaptation of coffee plants to drought are largely unknown. In this study, we compared the molecular responses to drought in two commercial cultivars (IAPAR59, drought-tolerant and Rubi, drought-susceptible) of Coffea arabica grown in the field under control (irrigation) and drought conditions using the pyrosequencing of RNA extracted from shoot apices and analysing the expression of 38 candidate genes. Pyrosequencing from shoot apices generated a total of 34.7 Mbp and 535,544 reads enabling the identification of 43,087 clusters (41,512 contigs and 1,575 singletons). These data included 17,719 clusters (16,238 contigs and 1,575 singletons) exclusively from 454 sequencing reads, along with 25,368 hybrid clusters assembled with 454 sequences. The comparison of DNA libraries identified new candidate genes (n = 20) presenting differential expression between IAPAR59 and Rubi and/or drought conditions. Their expression was monitored in plagiotropic buds, together with those of other (n = 18) candidates genes. Under drought conditions, up-regulated expression was observed in IAPAR59 but not in Rubi for CaSTK1 (protein kinase), CaSAMT1 (SAM-dependent methyltransferase), CaSLP1 (plant development) and CaMAS1 (ABA biosynthesis). Interestingly, the expression of lipid-transfer protein (nsLTP) genes was also highly up-regulated under drought conditions in IAPAR59. This may have been related to the thicker cuticle observed on the abaxial leaf surface in IAPAR59 compared to Rubi. The full transcriptome assembly of C. arabica, followed by functional annotation, enabled us to identify differentially expressed genes related to drought conditions. Using these data, candidate genes were selected and their differential expression profiles were confirmed by qPCR experiments in plagiotropic buds of IAPAR59 and Rubi under drought conditions. As regards the genes up-regulated under drought conditions, specifically in the drought-tolerant IAPAR59, several corresponded to orphan genes but also to genes coding proteins involved in signal transduction pathways, as well as ABA and lipid metabolism, for example. The identification of these genes should help advance our understanding of the genetic determinism of drought tolerance in coffee.

Metagenomic gene annotation by a homology-independent approach

DOE Office of Scientific and Technical Information (OSTI.GOV)

Froula, Jeff; Zhang, Tao; Salmeen, Annette

2011-06-02

Fully understanding the genetic potential of a microbial community requires functional annotation of all the genes it encodes. The recently developed deep metagenome sequencing approach has enabled rapid identification of millions of genes from a complex microbial community without cultivation. Current homology-based gene annotation fails to detect distantly-related or structural homologs. Furthermore, homology searches with millions of genes are very computational intensive. To overcome these limitations, we developed rhModeller, a homology-independent software pipeline to efficiently annotate genes from metagenomic sequencing projects. Using cellulases and carbonic anhydrases as two independent test cases, we demonstrated that rhModeller is much faster than HMMERmore » but with comparable accuracy, at 94.5percent and 99.9percent accuracy, respectively. More importantly, rhModeller has the ability to detect novel proteins that do not share significant homology to any known protein families. As {approx}50percent of the 2 million genes derived from the cow rumen metagenome failed to be annotated based on sequence homology, we tested whether rhModeller could be used to annotate these genes. Preliminary results suggest that rhModeller is robust in the presence of missense and frameshift mutations, two common errors in metagenomic genes. Applying the pipeline to the cow rumen genes identified 4,990 novel cellulases candidates and 8,196 novel carbonic anhydrase candidates.In summary, we expect rhModeller to dramatically increase the speed and quality of metagnomic gene annotation.« less

Sequence and gene content of a large fragment of a lizard sex chromosome and evaluation of candidate sex differentiating gene R-spondin 1

PubMed Central

2013-01-01

Background Scant genomic information from non-avian reptile sex chromosomes is available, and for only a few lizards, several snakes and one turtle species, and it represents only a small fraction of the total sex chromosome sequences in these species. Results We report a 352 kb of contiguous sequence from the sex chromosome of a squamate reptile, Pogona vitticeps, with a ZZ/ZW sex microchromosome system. This contig contains five protein coding genes (oprd1, rcc1, znf91, znf131, znf180), and major families of repetitive sequences with a high number of copies of LTR and non-LTR retrotransposons, including the CR1 and Bov-B LINEs. The two genes, oprd1 and rcc1 are part of a homologous syntenic block, which is conserved among amniotes. While oprd1 and rcc1 have no known function in sex determination or differentiation in amniotes, this homologous syntenic block in mammals and chicken also contains R-spondin 1 (rspo1), the ovarian differentiating gene in mammals. In order to explore the probability that rspo1 is sex determining in dragon lizards, genomic BAC and cDNA clones were mapped using fluorescence in situ hybridisation. Their location on an autosomal microchromosome pair, not on the ZW sex microchromosomes, eliminates rspo1 as a candidate sex determining gene in P. vitticeps. Conclusion Our study has characterized the largest contiguous stretch of physically mapped sex chromosome sequence (352 kb) from a ZZ/ZW lizard species. Although this region represents only a small fraction of the sex chromosomes of P. vitticeps, it has revealed several features typically associated with sex chromosomes including the accumulation of large blocks of repetitive sequences. PMID:24344927

Allelic association of sequence variants in the herpes virus entry mediator-B gene (PVRL2) with the severity of multiple sclerosis.

PubMed

Schmidt, S; Pericak-Vance, M A; Sawcer, S; Barcellos, L F; Hart, J; Sims, J; Prokop, A M; van der Walt, J; DeLoa, C; Lincoln, R R; Oksenberg, J R; Compston, A; Hauser, S L; Haines, J L; Gregory, S G

2006-07-01

Discrepant findings have been reported regarding an association of the apolipoprotein E (APOE) gene with the clinical course of multiple sclerosis (MS). To resolve these discrepancies, we examined common sequence variation in six candidate genes residing in a 380-kb genomic region surrounding and including the APOE locus for an association with MS severity. We genotyped at least three polymorphisms in each of six candidate genes in 1,540 Caucasian MS families (729 single-case and multiple-case families from the United States, 811 single-case families from the UK). By applying the quantitative transmission/disequilibrium test to a recently proposed MS severity score, the only statistically significant (P=0.003) association with MS severity was found for an intronic variant in the Herpes Virus Entry Mediator-B Gene PVRL2. Additional genotyping extended the association to a 16.6 kb block spanning intron 1 to intron 2 of the gene. Sequencing of PVRL2 failed to identify variants with an obvious functional role. In conclusion, the analysis of a very large data set suggests that genetic polymorphisms in PVRL2 may influence MS severity and supports the possibility that viral factors may contribute to the clinical course of MS, consistent with previous reports.

Endeavour update: a web resource for gene prioritization in multiple species

PubMed Central

Tranchevent, Léon-Charles; Barriot, Roland; Yu, Shi; Van Vooren, Steven; Van Loo, Peter; Coessens, Bert; De Moor, Bart; Aerts, Stein; Moreau, Yves

2008-01-01

Endeavour (http://www.esat.kuleuven.be/endeavourweb; this web site is free and open to all users and there is no login requirement) is a web resource for the prioritization of candidate genes. Using a training set of genes known to be involved in a biological process of interest, our approach consists of (i) inferring several models (based on various genomic data sources), (ii) applying each model to the candidate genes to rank those candidates against the profile of the known genes and (iii) merging the several rankings into a global ranking of the candidate genes. In the present article, we describe the latest developments of Endeavour. First, we provide a web-based user interface, besides our Java client, to make Endeavour more universally accessible. Second, we support multiple species: in addition to Homo sapiens, we now provide gene prioritization for three major model organisms: Mus musculus, Rattus norvegicus and Caenorhabditis elegans. Third, Endeavour makes use of additional data sources and is now including numerous databases: ontologies and annotations, protein–protein interactions, cis-regulatory information, gene expression data sets, sequence information and text-mining data. We tested the novel version of Endeavour on 32 recent disease gene associations from the literature. Additionally, we describe a number of recent independent studies that made use of Endeavour to prioritize candidate genes for obesity and Type II diabetes, cleft lip and cleft palate, and pulmonary fibrosis. PMID:18508807

Identification of Putative Transmembrane Proteins Involved in Salinity Tolerance in Chenopodium quinoa by Integrating Physiological Data, RNAseq, and SNP Analyses

PubMed Central

Schmöckel, Sandra M.; Lightfoot, Damien J.; Razali, Rozaimi; Tester, Mark; Jarvis, David E.

2017-01-01

Chenopodium quinoa (quinoa) is an emerging crop that produces nutritious grains with the potential to contribute to global food security. Quinoa can also grow on marginal lands, such as soils affected by high salinity. To identify candidate salt tolerance genes in the recently sequenced quinoa genome, we used a multifaceted approach integrating RNAseq analyses with comparative genomics and topology prediction. We identified 219 candidate genes by selecting those that were differentially expressed in response to salinity, were specific to or overrepresented in quinoa relative to other Amaranthaceae species, and had more than one predicted transmembrane domain. To determine whether these genes might underlie variation in salinity tolerance in quinoa and its close relatives, we compared the response to salinity stress in a panel of 21 Chenopodium accessions (14 C. quinoa, 5 C. berlandieri, and 2 C. hircinum). We found large variation in salinity tolerance, with one C. hircinum displaying the highest salinity tolerance. Using genome re-sequencing data from these accessions, we investigated single nucleotide polymorphisms and copy number variation (CNV) in the 219 candidate genes in accessions of contrasting salinity tolerance, and identified 15 genes that could contribute to the differences in salinity tolerance of these Chenopodium accessions. PMID:28680429

Rapid-Onset Obesity with Hypothalamic Dysfunction, Hypoventilation, and Autonomic Dysregulation (ROHHAD): exome sequencing of trios, monozygotic twins and tumours.

PubMed

Barclay, Sarah F; Rand, Casey M; Borch, Lauren A; Nguyen, Lisa; Gray, Paul A; Gibson, William T; Wilson, Richard J A; Gordon, Paul M K; Aung, Zaw; Berry-Kravis, Elizabeth M; Ize-Ludlow, Diego; Weese-Mayer, Debra E; Bech-Hansen, N Torben

2015-08-25

Rapid-onset Obesity with Hypothalamic Dysfunction, Hypoventilation, and Autonomic Dysregulation (ROHHAD) is thought to be a genetic disease caused by de novo mutations, though causative mutations have yet to be identified. We searched for de novo coding mutations among a carefully-diagnosed and clinically homogeneous cohort of 35 ROHHAD patients. We sequenced the exomes of seven ROHHAD trios, plus tumours from four of these patients and the unaffected monozygotic (MZ) twin of one (discovery cohort), to identify constitutional and somatic de novo sequence variants. We further analyzed this exome data to search for candidate genes under autosomal dominant and recessive models, and to identify structural variations. Candidate genes were tested by exome or Sanger sequencing in a replication cohort of 28 ROHHAD singletons. The analysis of the trio-based exomes found 13 de novo variants. However, no two patients had de novo variants in the same gene, and additional patient exomes and mutation analysis in the replication cohort did not provide strong genetic evidence to implicate any of these sequence variants in ROHHAD. Somatic comparisons revealed no coding differences between any blood and tumour samples, or between the two discordant MZ twins. Neither autosomal dominant nor recessive analysis yielded candidate genes for ROHHAD, and we did not identify any potentially causative structural variations. Clinical exome sequencing is highly unlikely to be a useful diagnostic test in patients with true ROHHAD. As ROHHAD has a high risk for fatality if not properly managed, it remains imperative to expand the search for non-exomic genetic risk factors, as well as to investigate other possible mechanisms of disease. In so doing, we will be able to confirm objectively the ROHHAD diagnosis and to contribute to our understanding of obesity, respiratory control, hypothalamic function, and autonomic regulation.

Mapping and genomic targeting of the major leaf shape gene (L) in Upland cotton (Gossypium hirsutum L.).

PubMed

Andres, Ryan J; Bowman, Daryl T; Kaur, Baljinder; Kuraparthy, Vasu

2014-01-01

A major leaf shape locus (L) was mapped with molecular markers and genomically targeted to a small region in the D-genome of cotton. By using expression analysis and candidate gene mapping, two LMI1 -like genes are identified as possible candidates for leaf shape trait in cotton. Leaf shape in cotton is an important trait that influences yield, flowering rates, disease resistance, lint trash, and the efficacy of foliar chemical application. The leaves of okra leaf cotton display a significantly enhanced lobing pattern, as well as ectopic outgrowths along the lobe margins when compared with normal leaf cotton. These phenotypes are the hallmark characteristics of mutations in various known modifiers of leaf shape that culminate in the mis/over-expression of Class I KNOX genes. To better understand the molecular and genetic processes underlying leaf shape in cotton, a normal leaf accession (PI607650) was crossed to an okra leaf breeding line (NC05AZ21). An F2 population of 236 individuals confirmed the incompletely dominant single gene nature of the okra leaf shape trait in Gossypium hirsutum L. Molecular mapping with simple sequence repeat markers localized the leaf shape gene to 5.4 cM interval in the distal region of the short arm of chromosome 15. Orthologous mapping of the closely linked markers with the sequenced diploid D-genome (Gossypium raimondii) tentatively resolved the leaf shape locus to a small genomic region. RT-PCR-based expression analysis and candidate gene mapping indicated that the okra leaf shape gene (L (o) ) in cotton might be an upstream regulator of Class I KNOX genes. The linked molecular markers and delineated genomic region in the sequenced diploid D-genome will assist in the future high-resolution mapping and map-based cloning of the leaf shape gene in cotton.

Genetic structure of the mating-type locus of Chlamydomonas reinhardtii.

PubMed Central

Ferris, Patrick J; Armbrust, E Virginia; Goodenough, Ursula W

2002-01-01

Portions of the cloned mating-type (MT) loci (mt(+) and mt(-)) of Chlamydomonas reinhardtii, defined as the approximately 1-Mb domains of linkage group VI that are under recombinational suppression, were subjected to Northern analysis to elucidate their coding capacity. The four central rearranged segments of the loci were found to contain both housekeeping genes (expressed during several life-cycle stages) and mating-related genes, while the sequences unique to mt(+) or mt(-) carried genes expressed only in the gametic or zygotic phases of the life cycle. One of these genes, Mtd1, is a candidate participant in gametic cell fusion; two others, Mta1 and Ezy2, are candidate participants in the uniparental inheritance of chloroplast DNA. The identified housekeeping genes include Pdk, encoding pyruvate dehydrogenase kinase, and GdcH, encoding glycine decarboxylase complex subunit H. Unusual genetic configurations include three genes whose sequences overlap, one gene that has inserted into the coding region of another, several genes that have been inactivated by rearrangements in the region, and genes that have undergone tandem duplication. This report extends our original conclusion that the MT locus has incurred high levels of mutational change. PMID:11805055

Transcriptome analysis of Bupleurum chinense focusing on genes involved in the biosynthesis of saikosaponins

PubMed Central

2011-01-01

Abstract Background Bupleurum chinense DC. is a widely used traditional Chinese medicinal plant. Saikosaponins are the major bioactive constituents of B. chinense, but relatively little is known about saikosaponin biosynthesis. The 454 pyrosequencing technology provides a promising opportunity for finding novel genes that participate in plant metabolism. Consequently, this technology may help to identify the candidate genes involved in the saikosaponin biosynthetic pathway. Results One-quarter of the 454 pyrosequencing runs produced a total of 195, 088 high-quality reads, with an average read length of 356 bases (NCBI SRA accession SRA039388). A de novo assembly generated 24, 037 unique sequences (22, 748 contigs and 1, 289 singletons), 12, 649 (52.6%) of which were annotated against three public protein databases using a basic local alignment search tool (E-value ≤1e-10). All unique sequences were compared with NCBI expressed sequence tags (ESTs) (237) and encoding sequences (44) from the Bupleurum genus, and with a Sanger-sequenced EST dataset (3, 111). The 23, 173 (96.4%) unique sequences obtained in the present study represent novel Bupleurum genes. The ESTs of genes related to saikosaponin biosynthesis were found to encode known enzymes that catalyze the formation of the saikosaponin backbone; 246 cytochrome P450 (P450s) and 102 glycosyltransferases (GTs) unique sequences were also found in the 454 dataset. Full length cDNAs of 7 P450s and 7 uridine diphosphate GTs (UGTs) were verified by reverse transcriptase polymerase chain reaction or by cloning using 5' and/or 3' rapid amplification of cDNA ends. Two P450s and three UGTs were identified as the most likely candidates involved in saikosaponin biosynthesis. This finding was based on the coordinate up-regulation of their expression with β-AS in methyl jasmonate-treated adventitious roots and on their similar expression patterns with β-AS in various B. chinense tissues. Conclusions A collection of high-quality ESTs for B. chinense obtained by 454 pyrosequencing is provided here for the first time. These data should aid further research on the functional genomics of B. chinense and other Bupleurum species. The candidate genes for enzymes involved in saikosaponin biosynthesis, especially the P450s and UGTs, that were revealed provide a substantial foundation for follow-up research on the metabolism and regulation of the saikosaponins. PMID:22047182

From genomes to vaccines: Leishmania as a model.

PubMed Central

Almeida, Renata; Norrish, Alan; Levick, Mark; Vetrie, David; Freeman, Tom; Vilo, Jaak; Ivens, Alasdair; Lange, Uta; Stober, Carmel; McCann, Sharon; Blackwell, Jenefer M

2002-01-01

The 35 Mb genome of Leishmania should be sequenced by late 2002. It contains approximately 8500 genes that will probably translate into more than 10 000 proteins. In the laboratory we have been piloting strategies to try to harness the power of the genome-proteome for rapid screening of new vaccine candidate. To this end, microarray analysis of 1094 unique genes identified using an EST analysis of 2091 cDNA clones from spliced leader libraries prepared from different developmental stages of Leishmania has been employed. The plan was to identify amastigote-expressed genes that could be used in high-throughput DNA-vaccine screens to identify potential new vaccine candidates. Despite the lack of transcriptional regulation that polycistronic transcription in Leishmania dictates, the data provide evidence for a high level of post-transcriptional regulation of RNA abundance during the developmental cycle of promastigotes in culture and in lesion-derived amastigotes of Leishmania major. This has provided 147 candidates from the 1094 unique genes that are specifically upregulated in amastigotes and are being used in vaccine studies. Using DNA vaccination, it was demonstrated that pooling strategies can work to identify protective vaccines, but it was found that some potentially protective antigens are masked by other disease-exacerbatory antigens in the pool. A total of 100 new vaccine candidates are currently being tested separately and in pools to extend this analysis, and to facilitate retrospective bioinformatic analysis to develop predictive algorithms for sequences that constitute potentially protective antigens. We are also working with other members of the Leishmania Genome Network to determine whether RNA expression determined by microarray analyses parallels expression at the protein level. We believe we are making good progress in developing strategies that will allow rapid translation of the sequence of Leishmania into potential interventions for disease control in humans. PMID:11839176

Restriction site polymorphism-based candidate gene mapping for seedling drought tolerance in cowpea [Vigna unguiculata (L.) Walp.].

PubMed

Muchero, Wellington; Ehlers, Jeffrey D; Roberts, Philip A

2010-02-01

Quantitative trait loci (QTL) studies provide insight into the complexity of drought tolerance mechanisms. Molecular markers used in these studies also allow for marker-assisted selection (MAS) in breeding programs, enabling transfer of genetic factors between breeding lines without complete knowledge of their exact nature. However, potential for recombination between markers and target genes limit the utility of MAS-based strategies. Candidate gene mapping offers an alternative solution to identify trait determinants underlying QTL of interest. Here, we used restriction site polymorphisms to investigate co-location of candidate genes with QTL for seedling drought stress-induced premature senescence identified previously in cowpea. Genomic DNA isolated from 113 F(2:8) RILs of drought-tolerant IT93K503-1 and drought susceptible CB46 genotypes was digested with combinations of EcoR1 and HpaII, Mse1, or Msp1 restriction enzymes and amplified with primers designed from 13 drought-responsive cDNAs. JoinMap 3.0 and MapQTL 4.0 software were used to incorporate polymorphic markers onto the AFLP map and to analyze their association with the drought response QTL. Seven markers co-located with peaks of previously identified QTL. Isolation, sequencing, and blast analysis of these markers confirmed their significant homology with drought or other abiotic stress-induced expressed sequence tags (EST) from cowpea and other plant systems. Further, homology with coding sequences for a multidrug resistance protein 3 and a photosystem I assembly protein ycf3 was revealed in two of these candidates. These results provide a platform for the identification and characterization of genetic trait determinants underlying seedling drought tolerance in cowpea.

Exome Sequencing and the Management of Neurometabolic Disorders.

PubMed

Tarailo-Graovac, Maja; Shyr, Casper; Ross, Colin J; Horvath, Gabriella A; Salvarinova, Ramona; Ye, Xin C; Zhang, Lin-Hua; Bhavsar, Amit P; Lee, Jessica J Y; Drögemöller, Britt I; Abdelsayed, Mena; Alfadhel, Majid; Armstrong, Linlea; Baumgartner, Matthias R; Burda, Patricie; Connolly, Mary B; Cameron, Jessie; Demos, Michelle; Dewan, Tammie; Dionne, Janis; Evans, A Mark; Friedman, Jan M; Garber, Ian; Lewis, Suzanne; Ling, Jiqiang; Mandal, Rupasri; Mattman, Andre; McKinnon, Margaret; Michoulas, Aspasia; Metzger, Daniel; Ogunbayo, Oluseye A; Rakic, Bojana; Rozmus, Jacob; Ruben, Peter; Sayson, Bryan; Santra, Saikat; Schultz, Kirk R; Selby, Kathryn; Shekel, Paul; Sirrs, Sandra; Skrypnyk, Cristina; Superti-Furga, Andrea; Turvey, Stuart E; Van Allen, Margot I; Wishart, David; Wu, Jiang; Wu, John; Zafeiriou, Dimitrios; Kluijtmans, Leo; Wevers, Ron A; Eydoux, Patrice; Lehman, Anna M; Vallance, Hilary; Stockler-Ipsiroglu, Sylvia; Sinclair, Graham; Wasserman, Wyeth W; van Karnebeek, Clara D

2016-06-09

Whole-exome sequencing has transformed gene discovery and diagnosis in rare diseases. Translation into disease-modifying treatments is challenging, particularly for intellectual developmental disorder. However, the exception is inborn errors of metabolism, since many of these disorders are responsive to therapy that targets pathophysiological features at the molecular or cellular level. To uncover the genetic basis of potentially treatable inborn errors of metabolism, we combined deep clinical phenotyping (the comprehensive characterization of the discrete components of a patient's clinical and biochemical phenotype) with whole-exome sequencing analysis through a semiautomated bioinformatics pipeline in consecutively enrolled patients with intellectual developmental disorder and unexplained metabolic phenotypes. We performed whole-exome sequencing on samples obtained from 47 probands. Of these patients, 6 were excluded, including 1 who withdrew from the study. The remaining 41 probands had been born to predominantly nonconsanguineous parents of European descent. In 37 probands, we identified variants in 2 genes newly implicated in disease, 9 candidate genes, 22 known genes with newly identified phenotypes, and 9 genes with expected phenotypes; in most of the genes, the variants were classified as either pathogenic or probably pathogenic. Complex phenotypes of patients in five families were explained by coexisting monogenic conditions. We obtained a diagnosis in 28 of 41 probands (68%) who were evaluated. A test of a targeted intervention was performed in 18 patients (44%). Deep phenotyping and whole-exome sequencing in 41 probands with intellectual developmental disorder and unexplained metabolic abnormalities led to a diagnosis in 68%, the identification of 11 candidate genes newly implicated in neurometabolic disease, and a change in treatment beyond genetic counseling in 44%. (Funded by BC Children's Hospital Foundation and others.).

Exome Sequencing and the Management of Neurometabolic Disorders

PubMed Central

Tarailo-Graovac, M.; Shyr, C.; Ross, C.J.; Horvath, G.A.; Salvarinova, R.; Ye, X.C.; Zhang, L.-H.; Bhavsar, A.P.; Lee, J.J.Y.; Drögemöller, B.I.; Abdelsayed, M.; Alfadhel, M.; Armstrong, L.; Baumgartner, M.R.; Burda, P.; Connolly, M.B.; Cameron, J.; Demos, M.; Dewan, T.; Dionne, J.; Evans, A.M.; Friedman, J.M.; Garber, I.; Lewis, S.; Ling, J.; Mandal, R.; Mattman, A.; McKinnon, M.; Michoulas, A.; Metzger, D.; Ogunbayo, O.A.; Rakic, B.; Rozmus, J.; Ruben, P.; Sayson, B.; Santra, S.; Schultz, K.R.; Selby, K.; Shekel, P.; Sirrs, S.; Skrypnyk, C.; Superti-Furga, A.; Turvey, S.E.; Van Allen, M.I.; Wishart, D.; Wu, J.; Wu, J.; Zafeiriou, D.; Kluijtmans, L.; Wevers, R.A.; Eydoux, P.; Lehman, A.M.; Vallance, H.; Stockler-Ipsiroglu, S.; Sinclair, G.; Wasserman, W.W.; van Karnebeek, C.D.

2016-01-01

BACKGROUND Whole-exome sequencing has transformed gene discovery and diagnosis in rare diseases. Translation into disease-modifying treatments is challenging, particularly for intellectual developmental disorder. However, the exception is inborn errors of metabolism, since many of these disorders are responsive to therapy that targets pathophysiological features at the molecular or cellular level. METHODS To uncover the genetic basis of potentially treatable inborn errors of metabolism, we combined deep clinical phenotyping (the comprehensive characterization of the discrete components of a patient’s clinical and biochemical phenotype) with whole-exome sequencing analysis through a semiautomated bioinformatics pipeline in consecutively enrolled patients with intellectual developmental disorder and unexplained metabolic phenotypes. RESULTS We performed whole-exome sequencing on samples obtained from 47 probands. Of these patients, 6 were excluded, including 1 who withdrew from the study. The remaining 41 probands had been born to predominantly nonconsanguineous parents of European descent. In 37 probands, we identified variants in 2 genes newly implicated in disease, 9 candidate genes, 22 known genes with newly identified phenotypes, and 9 genes with expected phenotypes; in most of the genes, the variants were classified as either pathogenic or probably pathogenic. Complex phenotypes of patients in five families were explained by coexisting monogenic conditions. We obtained a diagnosis in 28 of 41 probands (68%) who were evaluated. A test of a targeted intervention was performed in 18 patients (44%). CONCLUSIONS Deep phenotyping and whole-exome sequencing in 41 probands with intellectual developmental disorder and unexplained metabolic abnormalities led to a diagnosis in 68%, the identification of 11 candidate genes newly implicated in neurometabolic disease, and a change in treatment beyond genetic counseling in 44%. (Funded by BC Children’s Hospital Foundation and others.) PMID:27276562

Fine-mapping and mutation analysis of TRPM1: a candidate gene for leopard complex (LP) spotting and congenital stationary night blindness in horses.

PubMed

Bellone, Rebecca R; Forsyth, George; Leeb, Tosso; Archer, Sheila; Sigurdsson, Snaevar; Imsland, Freyja; Mauceli, Evan; Engensteiner, Martina; Bailey, Ernest; Sandmeyer, Lynne; Grahn, Bruce; Lindblad-Toh, Kerstin; Wade, Claire M

2010-05-01

Leopard Complex spotting occurs in several breeds of horses and is caused by an incompletely dominant allele (LP). Homozygosity for LP is also associated with congenital stationary night blindness (CSNB) in Appaloosa horses. Previously, LP was mapped to a 6 cm region on ECA1 containing the candidate gene TRPM1 (Transient Receptor Potential Cation Channel, Subfamily M, Member 1) and decreased expression of this gene, measured by qRT-PCR, was identified as the likely cause of both spotting and ocular phenotypes. This study describes investigations for a mutation causing or associated with the Leopard Complex and CSNB phenotype in horses. Re-sequencing of the gene and associated splice sites within the 105 624 bp genomic region of TRPM1 led to the discovery of 18 SNPs. Most of the SNPs did not have a predictive value for the presence of LP. However, one SNP (ECA1:108,249,293 C>T) found within intron 11 had a strong (P < 0.0005), but not complete, association with LP and CSNB and thus is a good marker but unlikely to be causative. To further localize the association, 70 SNPs spanning over two Mb including the TRPM1 gene were genotyped in 192 horses from three different breeds segregating for LP. A single 173 kb haplotype associated with LP and CSNB (ECA1: 108,197,355- 108,370,150) was identified. Illumina sequencing of 300 kb surrounding this haplotype revealed 57 SNP variants. Based on their localization within expressed sequences or regions of high sequence conservation across mammals, six of these SNPs were considered to be the most likely candidate mutations. While the precise function of TRPM1 remains to be elucidated, this work solidifies its functional role in both pigmentation and night vision. Further, this work has identified several potential regulatory elements of the TRPM1 gene that should be investigated further in this and other species.

Horizontal gene transfer in silkworm, Bombyx mori.

PubMed

Zhu, Bo; Lou, Miao-Miao; Xie, Guan-Lin; Zhang, Guo-Qing; Zhou, Xue-Ping; Li, Bin; Jin, Gu-Lei

2011-05-19

The domesticated silkworm, Bombyx mori, is the model insect for the order Lepidoptera, has economically important values, and has gained some representative behavioral characteristics compared to its wild ancestor. The genome of B. mori has been fully sequenced while function analysis of BmChi-h and BmSuc1 genes revealed that horizontal gene transfer (HGT) maybe bestow a clear selective advantage to B. mori. However, the role of HGT in the evolutionary history of B. mori is largely unexplored. In this study, we compare the whole genome of B. mori with those of 382 prokaryotic and eukaryotic species to investigate the potential HGTs. Ten candidate HGT events were defined in B. mori by comprehensive sequence analysis using Maximum Likelihood and Bayesian method combining with EST checking. Phylogenetic analysis of the candidate HGT genes suggested that one HGT was plant-to- B. mori transfer while nine were bacteria-to- B. mori transfer. Furthermore, functional analysis based on expression, coexpression and related literature searching revealed that several HGT candidate genes have added important characters, such as resistance to pathogen, to B. mori. Results from this study clearly demonstrated that HGTs play an important role in the evolution of B. mori although the number of HGT events in B. mori is in general smaller than those of microbes and other insects. In particular, interdomain HGTs in B. mori may give rise to functional, persistent, and possibly evolutionarily significant new genes.

SNP discovery in candidate adaptive genes using exon capture in a free-ranging alpine ungulate

USGS Publications Warehouse

Roffler, Gretchen H.; Amish, Stephen J.; Smith, Seth; Cosart, Ted F.; Kardos, Marty; Schwartz, Michael K.; Luikart, Gordon

2016-01-01

Identification of genes underlying genomic signatures of natural selection is key to understanding adaptation to local conditions. We used targeted resequencing to identify SNP markers in 5321 candidate adaptive genes associated with known immunological, metabolic and growth functions in ovids and other ungulates. We selectively targeted 8161 exons in protein-coding and nearby 5′ and 3′ untranslated regions of chosen candidate genes. Targeted sequences were taken from bighorn sheep (Ovis canadensis) exon capture data and directly from the domestic sheep genome (Ovis aries v. 3; oviAri3). The bighorn sheep sequences used in the Dall's sheep (Ovis dalli dalli) exon capture aligned to 2350 genes on the oviAri3 genome with an average of 2 exons each. We developed a microfluidic qPCR-based SNP chip to genotype 476 Dall's sheep from locations across their range and test for patterns of selection. Using multiple corroborating approaches (lositan and bayescan), we detected 28 SNP loci potentially under selection. We additionally identified candidate loci significantly associated with latitude, longitude, precipitation and temperature, suggesting local environmental adaptation. The three methods demonstrated consistent support for natural selection on nine genes with immune and disease-regulating functions (e.g. Ovar-DRA, APC, BATF2, MAGEB18), cell regulation signalling pathways (e.g. KRIT1, PI3K, ORRC3), and respiratory health (CYSLTR1). Characterizing adaptive allele distributions from novel genetic techniques will facilitate investigation of the influence of environmental variation on local adaptation of a northern alpine ungulate throughout its range. This research demonstrated the utility of exon capture for gene-targeted SNP discovery and subsequent SNP chip genotyping using low-quality samples in a nonmodel species.

Comparative genomics identifies candidate genes for infectious salmon anemia (ISA) resistance in Atlantic salmon (Salmo salar).

PubMed

Li, Jieying; Boroevich, Keith A; Koop, Ben F; Davidson, William S

2011-04-01

Infectious salmon anemia (ISA) has been described as the hoof and mouth disease of salmon farming. ISA is caused by a lethal and highly communicable virus, which can have a major impact on salmon aquaculture, as demonstrated by an outbreak in Chile in 2007. A quantitative trait locus (QTL) for ISA resistance has been mapped to three microsatellite markers on linkage group (LG) 8 (Chr 15) on the Atlantic salmon genetic map. We identified bacterial artificial chromosome (BAC) clones and three fingerprint contigs from the Atlantic salmon physical map that contains these markers. We made use of the extensive BAC end sequence database to extend these contigs by chromosome walking and identified additional two markers in this region. The BAC end sequences were used to search for conserved synteny between this segment of LG8 and the fish genomes that have been sequenced. An examination of the genes in the syntenic segments of the tetraodon and medaka genomes identified candidates for association with ISA resistance in Atlantic salmon based on differential expression profiles from ISA challenges or on the putative biological functions of the proteins they encode. One gene in particular, HIV-EP2/MBP-2, caught our attention as it may influence the expression of several genes that have been implicated in the response to infection by infectious salmon anemia virus (ISAV). Therefore, we suggest that HIV-EP2/MBP-2 is a very strong candidate for the gene associated with the ISAV resistance QTL in Atlantic salmon and is worthy of further study.

Functional role of SETD2, BAP1, PARP-3 and PBRM1 candidate genes on the regulation of hTERT gene expression

PubMed Central

Linne, Hannah; Yasaei, Hemad; Marriott, Alison; Harvey, Amanda; Mokbel, Kefah; Newbold, Robert; Roberts, Terry

2017-01-01

Narrowing the search for the critical hTERT repressor sequence(s) has identified three regions on chromosome 3p (3p12-p21.1, 3p21.2 and 3p21.3-p22). However, the precise location and identity of the sequence(s) responsible for hTERT transcriptional repression remains elusive. In order to identify critical hTERT repressor sequences located within human chromosome 3p12-p22, we investigated hTERT transcriptional activity within 21NT microcell hybrid clones containing chromosome 3 fragments. Mapping of chromosome 3 structure in a single hTERT-repressed 21NT-#3fragment hybrid clone, revealed a 490kb region of deletion localised to 3p21.3 and encompassing the histone H3, lysine 36 (H3K36) trimethyltransferase enzyme SETD2; a putative tumour suppressor gene in breast cancer. Three additional genes, BAP1, PARP-3 and PBRM1, were also selected for further investigation based on their location within the 3p21.1-p21.3 region, together with their documented role in the epigenetic regulation of target gene expression or hTERT regulation. All four genes (SETD2, BAP1, PARP-3 and PBRM1) were found to be expressed at low levels in 21NT. Gene copy number variation (CNV) analysis of SETD2, BAP1, PARP-3 and PBRM1 within a panel of nine breast cancer cell lines demonstrated single copy number loss of all candidate genes within five (56%) cell lines (including 21NT cells). Stable, forced overexpression of BAP1, but not PARP2, SETD2 or PBRM1, within 21NT cells was associated with a significant reduction in hTERT expression levels relative to wild-type controls. We propose that at least two sequences exist on human chromosome 3p, that function to regulate hTERT transcription within human breast cancer cells. PMID:28977912

Functional role of SETD2, BAP1, PARP-3 and PBRM1 candidate genes on the regulation of hTERT gene expression.

PubMed

Linne, Hannah; Yasaei, Hemad; Marriott, Alison; Harvey, Amanda; Mokbel, Kefah; Newbold, Robert; Roberts, Terry

2017-09-22

Narrowing the search for the critical hTERT repressor sequence(s) has identified three regions on chromosome 3p (3p12-p21.1, 3p21.2 and 3p21.3-p22). However, the precise location and identity of the sequence(s) responsible for hTERT transcriptional repression remains elusive. In order to identify critical hTERT repressor sequences located within human chromosome 3p12-p22, we investigated hTERT transcriptional activity within 21NT microcell hybrid clones containing chromosome 3 fragments. Mapping of chromosome 3 structure in a single hTERT- repressed 21NT-#3fragment hybrid clone, revealed a 490kb region of deletion localised to 3p21.3 and encompassing the histone H3, lysine 36 (H3K36) trimethyltransferase enzyme SETD2; a putative tumour suppressor gene in breast cancer. Three additional genes, BAP1, PARP-3 and PBRM1, were also selected for further investigation based on their location within the 3p21.1-p21.3 region, together with their documented role in the epigenetic regulation of target gene expression or hTERT regulation. All four genes (SETD2, BAP1, PARP-3 and PBRM1) were found to be expressed at low levels in 21NT. Gene copy number variation (CNV) analysis of SETD2, BAP1, PARP-3 and PBRM1 within a panel of nine breast cancer cell lines demonstrated single copy number loss of all candidate genes within five (56%) cell lines (including 21NT cells). Stable, forced overexpression of BAP1, but not PARP2, SETD2 or PBRM1, within 21NT cells was associated with a significant reduction in hTERT expression levels relative to wild-type controls. We propose that at least two sequences exist on human chromosome 3p, that function to regulate hTERT transcription within human breast cancer cells.

The cld mutation: narrowing the critical chromosomal region and selecting candidate genes.

PubMed

Péterfy, Miklós; Mao, Hui Z; Doolittle, Mark H

2006-10-01

Combined lipase deficiency (cld) is a recessive, lethal mutation specific to the tw73 haplotype on mouse Chromosome 17. While the cld mutation results in lipase proteins that are inactive, aggregated, and retained in the endoplasmic reticulum (ER), it maps separately from the lipase structural genes. We have narrowed the gene critical region by about 50% using the tw18 haplotype for deletion mapping and a recombinant chromosome used originally to map cld with respect to the phenotypic marker tf. The region now extends from 22 to 25.6 Mbp on the wild-type chromosome, currently containing 149 genes and 50 expressed sequence tags (ESTs). To identify the affected gene, we have selected candidates based on their known role in associated biological processes, cellular components, and molecular functions that best fit with the predicted function of the cld gene. A secondary approach was based on differences in mRNA levels between mutant (cld/cld) and unaffected (+/cld) cells. Using both approaches, we have identified seven functional candidates with an ER localization and/or an involvement in protein maturation and folding that could explain the lipase deficiency, and six expression candidates that exhibit large differences in mRNA levels between mutant and unaffected cells. Significantly, two genes were found to be candidates with regard to both function and expression, thus emerging as the strongest candidates for cld. We discuss the implications of our mapping results and our selection of candidates with respect to other genes, deletions, and mutations occurring in the cld critical region.

Mapping autosomal recessive intellectual disability: combined microarray and exome sequencing identifies 26 novel candidate genes in 192 consanguineous families.

PubMed

Harripaul, R; Vasli, N; Mikhailov, A; Rafiq, M A; Mittal, K; Windpassinger, C; Sheikh, T I; Noor, A; Mahmood, H; Downey, S; Johnson, M; Vleuten, K; Bell, L; Ilyas, M; Khan, F S; Khan, V; Moradi, M; Ayaz, M; Naeem, F; Heidari, A; Ahmed, I; Ghadami, S; Agha, Z; Zeinali, S; Qamar, R; Mozhdehipanah, H; John, P; Mir, A; Ansar, M; French, L; Ayub, M; Vincent, J B

2018-04-01

Approximately 1% of the global population is affected by intellectual disability (ID), and the majority receive no molecular diagnosis. Previous studies have indicated high levels of genetic heterogeneity, with estimates of more than 2500 autosomal ID genes, the majority of which are autosomal recessive (AR). Here, we combined microarray genotyping, homozygosity-by-descent (HBD) mapping, copy number variation (CNV) analysis, and whole exome sequencing (WES) to identify disease genes/mutations in 192 multiplex Pakistani and Iranian consanguineous families with non-syndromic ID. We identified definite or candidate mutations (or CNVs) in 51% of families in 72 different genes, including 26 not previously reported for ARID. The new ARID genes include nine with loss-of-function mutations (ABI2, MAPK8, MPDZ, PIDD1, SLAIN1, TBC1D23, TRAPPC6B, UBA7 and USP44), and missense mutations include the first reports of variants in BDNF or TET1 associated with ID. The genes identified also showed overlap with de novo gene sets for other neuropsychiatric disorders. Transcriptional studies showed prominent expression in the prenatal brain. The high yield of AR mutations for ID indicated that this approach has excellent clinical potential and should inform clinical diagnostics, including clinical whole exome and genome sequencing, for populations in which consanguinity is common. As with other AR disorders, the relevance will also apply to outbred populations.

Identification of KCNJ11 as a functional candidate gene for bovine meat tenderness.

PubMed

Tizioto, Polyana C; Gasparin, Gustavo; Souza, Marcela M; Mudadu, Mauricio A; Coutinho, Luiz L; Mourão, Gerson B; Tholon, Patricia; Meirelles, Sarah L C; Tullio, Rymer R; Rosa, Antônio N; Alencar, Maurício M; Medeiros, Sérgio R; Siqueira, Fabiane; Feijó, Gelson L D; Nassu, Renata T; Regitano, Luciana C A

2013-12-15

The potassium inwardly rectifying channel, subfamily J, member 11 (KCNJ11) gene was investigated as a candidate for meat tenderness based on the effects reported on muscle for KCNJ11 gene knockout in rat models and its position in a quantitative trait locus (QTL) for meat tenderness in the bovine genome. Sequence variations in the KCNJ11 gene were described by sequencing six amplified fragments, covering almost the entire gene. We identified single nucleotide polymorphisms (SNP) and validated them by different approaches, taking advantage of simultaneous projects that are being developed with the same Nelore population. By sequencing the KCNJ11 in Nelore steers representing extreme phenotypes for Warner-Bratzler shear force (WBSF), it was possible to identify 22 SNPs. We validated two of the identified markers by genotyping the whole population (n = 460). Analysis of association between genotypes and WBSF values revealed a significant additive effect of a SNP at different meat aging times (P ≤ 0.05). In addition, an association between the expression levels of KCNJ11 and WBSF was found, with lower expression levels of KCNJ11 associated with more tender meat (P ≤ 0.05). The results showed that the KCNJ11 gene is a candidate mapped to a QTL for meat tenderness previously identified on BTA15 and may be useful to identify animals with genetic potential to produce tender meat. The effect of KCNJ11 observed on muscle is potentially due to changes in activity of KATP channels, which in turn influence the flow of potassium in the intracellular space, allowing establishment of the membrane potential necessary for muscle contraction.

Whole-genome sequence analyses of Western Central African Pygmy hunter-gatherers reveal a complex demographic history and identify candidate genes under positive natural selection

PubMed Central

Hsieh, PingHsun; Veeramah, Krishna R.; Lachance, Joseph; Tishkoff, Sarah A.; Wall, Jeffrey D.; Hammer, Michael F.; Gutenkunst, Ryan N.

2016-01-01

African Pygmies practicing a mobile hunter-gatherer lifestyle are phenotypically and genetically diverged from other anatomically modern humans, and they likely experienced strong selective pressures due to their unique lifestyle in the Central African rainforest. To identify genomic targets of adaptation, we sequenced the genomes of four Biaka Pygmies from the Central African Republic and jointly analyzed these data with the genome sequences of three Baka Pygmies from Cameroon and nine Yoruba famers. To account for the complex demographic history of these populations that includes both isolation and gene flow, we fit models using the joint allele frequency spectrum and validated them using independent approaches. Our two best-fit models both suggest ancient divergence between the ancestors of the farmers and Pygmies, 90,000 or 150,000 yr ago. We also find that bidirectional asymmetric gene flow is statistically better supported than a single pulse of unidirectional gene flow from farmers to Pygmies, as previously suggested. We then applied complementary statistics to scan the genome for evidence of selective sweeps and polygenic selection. We found that conventional statistical outlier approaches were biased toward identifying candidates in regions of high mutation or low recombination rate. To avoid this bias, we assigned P-values for candidates using whole-genome simulations incorporating demography and variation in both recombination and mutation rates. We found that genes and gene sets involved in muscle development, bone synthesis, immunity, reproduction, cell signaling and development, and energy metabolism are likely to be targets of positive natural selection in Western African Pygmies or their recent ancestors. PMID:26888263

Rapid Communication: MiR-92a as a housekeeping gene for analysis of bovine mastitis-related microRNA in milk.

PubMed

Lai, Y C; Fujikawa, T; Ando, T; Kitahara, G; Koiwa, M; Kubota, C; Miura, N

2017-06-01

Our aim was to identify a suitable microRNA housekeeping gene for real-time PCR analysis of bovine mastitis-related microRNA in milk. We identified , , and as housekeeping gene candidates on the basis of previous Solexa sequencing results. Threshold cycle (CT) values for , , and did not differ between milk from control cows and milk from mastitis-affected cows. NormFinder software identified as the most stable single housekeeping gene. We evaluated the suitability of the housekeeping gene candidates by using them to assess expression levels of the inflammation-related gene . Regardless of the housekeeping gene candidates used for normalization, relative expression levels of were significantly higher in mastitis-affected samples than in control samples. However, of all the housekeeping genes and gene combinations investigated, normalization with alone generated the difference in relative expression between mastitis-affected and control samples with the highest significance. These results suggest that is suitable for use as a housekeeping gene for analysis of bovine mastitis-related microRNA in milk.

Genome-Wide Prediction of the Polymorphic Ser Gene Family in Tetrahymena thermophila Based on Motif Analysis

PubMed Central

Ponsuwanna, Patrath; Kümpornsin, Krittikorn; Chookajorn, Thanat

2014-01-01

Even though antigenic variation is employed among parasitic protozoa for host immune evasion, Tetrahymena thermophila, a free-living ciliate, can also change its surface protein antigens. These cysteine-rich glycosylphosphatidylinositol (GPI)-linked surface proteins are encoded by a family of polymorphic Ser genes. Despite the availability of T. thermophila genome, a comprehensive analysis of the Ser family is limited by its high degree of polymorphism. In order to overcome this problem, a new approach was adopted by searching for Ser candidates with common motif sequences, namely length-specific repetitive cysteine pattern and GPI anchor site. The candidate genes were phylogenetically compared with the previously identified Ser genes and classified into subtypes. Ser candidates were often found to be located as tandem arrays of the same subtypes on several chromosomal scaffolds. Certain Ser candidates located in the same chromosomal arrays were transcriptionally expressed at specific T. thermophila developmental stages. These Ser candidates selected by the motif analysis approach can form the foundation for a systematic identification of the entire Ser gene family, which will contribute to the understanding of their function and the basis of T. thermophila antigenic variation. PMID:25133747

Analysis of Craniocardiac Malformations in Xenopus using Optical Coherence Tomography

PubMed Central

Deniz, Engin; Jonas, Stephan; Hooper, Michael; N. Griffin, John; Choma, Michael A.; Khokha, Mustafa K.

2017-01-01

Birth defects affect 3% of children in the United States. Among the birth defects, congenital heart disease and craniofacial malformations are major causes of mortality and morbidity. Unfortunately, the genetic mechanisms underlying craniocardiac malformations remain largely uncharacterized. To address this, human genomic studies are identifying sequence variations in patients, resulting in numerous candidate genes. However, the molecular mechanisms of pathogenesis for most candidate genes are unknown. Therefore, there is a need for functional analyses in rapid and efficient animal models of human disease. Here, we coupled the frog Xenopus tropicalis with Optical Coherence Tomography (OCT) to create a fast and efficient system for testing craniocardiac candidate genes. OCT can image cross-sections of microscopic structures in vivo at resolutions approaching histology. Here, we identify optimal OCT imaging planes to visualize and quantitate Xenopus heart and facial structures establishing normative data. Next we evaluate known human congenital heart diseases: cardiomyopathy and heterotaxy. Finally, we examine craniofacial defects by a known human teratogen, cyclopamine. We recapitulate human phenotypes readily and quantify the functional and structural defects. Using this approach, we can quickly test human craniocardiac candidate genes for phenocopy as a critical first step towards understanding disease mechanisms of the candidate genes. PMID:28195132

X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes.

PubMed

Hu, H; Haas, S A; Chelly, J; Van Esch, H; Raynaud, M; de Brouwer, A P M; Weinert, S; Froyen, G; Frints, S G M; Laumonnier, F; Zemojtel, T; Love, M I; Richard, H; Emde, A-K; Bienek, M; Jensen, C; Hambrock, M; Fischer, U; Langnick, C; Feldkamp, M; Wissink-Lindhout, W; Lebrun, N; Castelnau, L; Rucci, J; Montjean, R; Dorseuil, O; Billuart, P; Stuhlmann, T; Shaw, M; Corbett, M A; Gardner, A; Willis-Owen, S; Tan, C; Friend, K L; Belet, S; van Roozendaal, K E P; Jimenez-Pocquet, M; Moizard, M-P; Ronce, N; Sun, R; O'Keeffe, S; Chenna, R; van Bömmel, A; Göke, J; Hackett, A; Field, M; Christie, L; Boyle, J; Haan, E; Nelson, J; Turner, G; Baynam, G; Gillessen-Kaesbach, G; Müller, U; Steinberger, D; Budny, B; Badura-Stronka, M; Latos-Bieleńska, A; Ousager, L B; Wieacker, P; Rodríguez Criado, G; Bondeson, M-L; Annerén, G; Dufke, A; Cohen, M; Van Maldergem, L; Vincent-Delorme, C; Echenne, B; Simon-Bouy, B; Kleefstra, T; Willemsen, M; Fryns, J-P; Devriendt, K; Ullmann, R; Vingron, M; Wrogemann, K; Wienker, T F; Tzschach, A; van Bokhoven, H; Gecz, J; Jentsch, T J; Chen, W; Ropers, H-H; Kalscheuer, V M

2016-01-01

X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or loci are yet to be identified. Here, we have investigated 405 unresolved families with XLID. We employed massively parallel sequencing of all X-chromosome exons in the index males. The majority of these males were previously tested negative for copy number variations and for mutations in a subset of known XLID genes by Sanger sequencing. In total, 745 X-chromosomal genes were screened. After stringent filtering, a total of 1297 non-recurrent exonic variants remained for prioritization. Co-segregation analysis of potential clinically relevant changes revealed that 80 families (20%) carried pathogenic variants in established XLID genes. In 19 families, we detected likely causative protein truncating and missense variants in 7 novel and validated XLID genes (CLCN4, CNKSR2, FRMPD4, KLHL15, LAS1L, RLIM and USP27X) and potentially deleterious variants in 2 novel candidate XLID genes (CDK16 and TAF1). We show that the CLCN4 and CNKSR2 variants impair protein functions as indicated by electrophysiological studies and altered differentiation of cultured primary neurons from Clcn4(-/-) mice or after mRNA knock-down. The newly identified and candidate XLID proteins belong to pathways and networks with established roles in cognitive function and intellectual disability in particular. We suggest that systematic sequencing of all X-chromosomal genes in a cohort of patients with genetic evidence for X-chromosome locus involvement may resolve up to 58% of Fragile X-negative cases.

X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes

PubMed Central

Hu, H; Haas, S A; Chelly, J; Van Esch, H; Raynaud, M; de Brouwer, A P M; Weinert, S; Froyen, G; Frints, S G M; Laumonnier, F; Zemojtel, T; Love, M I; Richard, H; Emde, A-K; Bienek, M; Jensen, C; Hambrock, M; Fischer, U; Langnick, C; Feldkamp, M; Wissink-Lindhout, W; Lebrun, N; Castelnau, L; Rucci, J; Montjean, R; Dorseuil, O; Billuart, P; Stuhlmann, T; Shaw, M; Corbett, M A; Gardner, A; Willis-Owen, S; Tan, C; Friend, K L; Belet, S; van Roozendaal, K E P; Jimenez-Pocquet, M; Moizard, M-P; Ronce, N; Sun, R; O'Keeffe, S; Chenna, R; van Bömmel, A; Göke, J; Hackett, A; Field, M; Christie, L; Boyle, J; Haan, E; Nelson, J; Turner, G; Baynam, G; Gillessen-Kaesbach, G; Müller, U; Steinberger, D; Budny, B; Badura-Stronka, M; Latos-Bieleńska, A; Ousager, L B; Wieacker, P; Rodríguez Criado, G; Bondeson, M-L; Annerén, G; Dufke, A; Cohen, M; Van Maldergem, L; Vincent-Delorme, C; Echenne, B; Simon-Bouy, B; Kleefstra, T; Willemsen, M; Fryns, J-P; Devriendt, K; Ullmann, R; Vingron, M; Wrogemann, K; Wienker, T F; Tzschach, A; van Bokhoven, H; Gecz, J; Jentsch, T J; Chen, W; Ropers, H-H; Kalscheuer, V M

2016-01-01

X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or loci are yet to be identified. Here, we have investigated 405 unresolved families with XLID. We employed massively parallel sequencing of all X-chromosome exons in the index males. The majority of these males were previously tested negative for copy number variations and for mutations in a subset of known XLID genes by Sanger sequencing. In total, 745 X-chromosomal genes were screened. After stringent filtering, a total of 1297 non-recurrent exonic variants remained for prioritization. Co-segregation analysis of potential clinically relevant changes revealed that 80 families (20%) carried pathogenic variants in established XLID genes. In 19 families, we detected likely causative protein truncating and missense variants in 7 novel and validated XLID genes (CLCN4, CNKSR2, FRMPD4, KLHL15, LAS1L, RLIM and USP27X) and potentially deleterious variants in 2 novel candidate XLID genes (CDK16 and TAF1). We show that the CLCN4 and CNKSR2 variants impair protein functions as indicated by electrophysiological studies and altered differentiation of cultured primary neurons from Clcn4−/− mice or after mRNA knock-down. The newly identified and candidate XLID proteins belong to pathways and networks with established roles in cognitive function and intellectual disability in particular. We suggest that systematic sequencing of all X-chromosomal genes in a cohort of patients with genetic evidence for X-chromosome locus involvement may resolve up to 58% of Fragile X-negative cases. PMID:25644381

Ordered shotgun sequencing of a 135 kb Xq25 YAC containing ANT2 and four possible genes, including three confirmed by EST matches.

PubMed Central

Chen, C N; Su, Y; Baybayan, P; Siruno, A; Nagaraja, R; Mazzarella, R; Schlessinger, D; Chen, E

1996-01-01

Ordered shotgun sequencing (OSS) has been successfully carried out with an Xq25 YAC substrate. yWXD703 DNA was subcloned into lambda phage and sequences of insert ends of the lambda subclones were used to generate a map to select a minimum tiling path of clones to be completely sequenced. The sequence of 135 038 nt contains the entire ANT2 cDNA as well as four other candidates suggested by computer-assisted analyses. One of the putative genes is homologous to a gene implicated in Graves' disease and it, ANT2 and two others are confirmed by EST matches. The results suggest that OSS can be applied to YACs in accord with earlier simulations and further indicate that the sequence of the YAC accurately reflects the sequence of uncloned human DNA. PMID:8918809

The genome of Theobroma cacao.

PubMed

Argout, Xavier; Salse, Jerome; Aury, Jean-Marc; Guiltinan, Mark J; Droc, Gaetan; Gouzy, Jerome; Allegre, Mathilde; Chaparro, Cristian; Legavre, Thierry; Maximova, Siela N; Abrouk, Michael; Murat, Florent; Fouet, Olivier; Poulain, Julie; Ruiz, Manuel; Roguet, Yolande; Rodier-Goud, Maguy; Barbosa-Neto, Jose Fernandes; Sabot, Francois; Kudrna, Dave; Ammiraju, Jetty Siva S; Schuster, Stephan C; Carlson, John E; Sallet, Erika; Schiex, Thomas; Dievart, Anne; Kramer, Melissa; Gelley, Laura; Shi, Zi; Bérard, Aurélie; Viot, Christopher; Boccara, Michel; Risterucci, Ange Marie; Guignon, Valentin; Sabau, Xavier; Axtell, Michael J; Ma, Zhaorong; Zhang, Yufan; Brown, Spencer; Bourge, Mickael; Golser, Wolfgang; Song, Xiang; Clement, Didier; Rivallan, Ronan; Tahi, Mathias; Akaza, Joseph Moroh; Pitollat, Bertrand; Gramacho, Karina; D'Hont, Angélique; Brunel, Dominique; Infante, Diogenes; Kebe, Ismael; Costet, Pierre; Wing, Rod; McCombie, W Richard; Guiderdoni, Emmanuel; Quetier, Francis; Panaud, Olivier; Wincker, Patrick; Bocs, Stephanie; Lanaud, Claire

2011-02-01

We sequenced and assembled the draft genome of Theobroma cacao, an economically important tropical-fruit tree crop that is the source of chocolate. This assembly corresponds to 76% of the estimated genome size and contains almost all previously described genes, with 82% of these genes anchored on the 10 T. cacao chromosomes. Analysis of this sequence information highlighted specific expansion of some gene families during evolution, for example, flavonoid-related genes. It also provides a major source of candidate genes for T. cacao improvement. Based on the inferred paleohistory of the T. cacao genome, we propose an evolutionary scenario whereby the ten T. cacao chromosomes were shaped from an ancestor through eleven chromosome fusions.

An automatic and efficient pipeline for disease gene identification through utilizing family-based sequencing data.

PubMed

Song, Dandan; Li, Ning; Liao, Lejian

2015-01-01

Due to the generation of enormous amounts of data at both lower costs as well as in shorter times, whole-exome sequencing technologies provide dramatic opportunities for identifying disease genes implicated in Mendelian disorders. Since upwards of thousands genomic variants can be sequenced in each exome, it is challenging to filter pathogenic variants in protein coding regions and reduce the number of missing true variants. Therefore, an automatic and efficient pipeline for finding disease variants in Mendelian disorders is designed by exploiting a combination of variants filtering steps to analyze the family-based exome sequencing approach. Recent studies on the Freeman-Sheldon disease are revisited and show that the proposed method outperforms other existing candidate gene identification methods.

Isolation of a full-length CC-NBS-LRR resistance gene analog candidate from sugar pine showing low nucleotide diversity.

Treesearch

K.D. Jermstad; L.A. Sheppard; B.B. Kinloch; A. Delfino-Mix; E.S. Ersoz; K.V. Krutovsky; D.B Neale

2006-01-01

The nucleotide-binding-site and leucine-rich-repeat (NBS–LRR) class of R proteins is abundant and widely distributed in plants. By using degenerate primers designed on the NBS domain in lettuce, we amplified sequences in sugar pine that shared sequence identity with many of the NBS–LRR class resistance genes catalogued in GenBank. The polymerase chain reaction products...

Next generation sequencing identifies abnormal Y chromosome and candidate causal variants in premature ovarian failure patients.

PubMed

Lee, Yujung; Kim, Changshin; Park, YoungJoon; Pyun, Jung-A; Kwack, KyuBum

2016-12-01

Premature ovarian failure (POF) is characterized by heterogeneous genetic causes such as chromosomal abnormalities and variants in causal genes. Recently, development of techniques made next generation sequencing (NGS) possible to detect genome wide variants including chromosomal abnormalities. Among 37 Korean POF patients, XY karyotype with distal part deletions of Y chromosome, Yp11.32-31 and Yp12 end part, was observed in two patients through NGS. Six deleterious variants in POF genes were also detected which might explain the pathogenesis of POF with abnormalities in the sex chromosomes. Additionally, the two POF patients had no mutation in SRY but three non-synonymous variants were detected in genes regarding sex reversal. These findings suggest candidate causes of POF and sex reversal and show the propriety of NGS to approach the heterogeneous pathogenesis of POF. Copyright © 2016 Elsevier Inc. All rights reserved.

Mapping-by-Sequencing Identifies HvPHYTOCHROME C as a Candidate Gene for the early maturity 5 Locus Modulating the Circadian Clock and Photoperiodic Flowering in Barley

PubMed Central

Pankin, Artem; Campoli, Chiara; Dong, Xue; Kilian, Benjamin; Sharma, Rajiv; Himmelbach, Axel; Saini, Reena; Davis, Seth J; Stein, Nils; Schneeberger, Korbinian; von Korff, Maria

2014-01-01

Phytochromes play an important role in light signaling and photoperiodic control of flowering time in plants. Here we propose that the red/far-red light photoreceptor HvPHYTOCHROME C (HvPHYC), carrying a mutation in a conserved region of the GAF domain, is a candidate underlying the early maturity 5 locus in barley (Hordeum vulgare L.). We fine mapped the gene using a mapping-by-sequencing approach applied on the whole-exome capture data from bulked early flowering segregants derived from a backcross of the Bowman(eam5) introgression line. We demonstrate that eam5 disrupts circadian expression of clock genes. Moreover, it interacts with the major photoperiod response gene Ppd-H1 to accelerate flowering under noninductive short days. Our results suggest that HvPHYC participates in transmission of light signals to the circadian clock and thus modulates light-dependent processes such as photoperiodic regulation of flowering. PMID:24996910

Identifying Cancer Driver Genes Using Replication-Incompetent Retroviral Vectors

PubMed Central

Bii, Victor M.; Trobridge, Grant D.

2016-01-01

Identifying novel genes that drive tumor metastasis and drug resistance has significant potential to improve patient outcomes. High-throughput sequencing approaches have identified cancer genes, but distinguishing driver genes from passengers remains challenging. Insertional mutagenesis screens using replication-incompetent retroviral vectors have emerged as a powerful tool to identify cancer genes. Unlike replicating retroviruses and transposons, replication-incompetent retroviral vectors lack additional mutagenesis events that can complicate the identification of driver mutations from passenger mutations. They can also be used for almost any human cancer due to the broad tropism of the vectors. Replication-incompetent retroviral vectors have the ability to dysregulate nearby cancer genes via several mechanisms including enhancer-mediated activation of gene promoters. The integrated provirus acts as a unique molecular tag for nearby candidate driver genes which can be rapidly identified using well established methods that utilize next generation sequencing and bioinformatics programs. Recently, retroviral vector screens have been used to efficiently identify candidate driver genes in prostate, breast, liver and pancreatic cancers. Validated driver genes can be potential therapeutic targets and biomarkers. In this review, we describe the emergence of retroviral insertional mutagenesis screens using replication-incompetent retroviral vectors as a novel tool to identify cancer driver genes in different cancer types. PMID:27792127

Identification and analysis of pig chimeric mRNAs using RNA sequencing data

PubMed Central

2012-01-01

Background Gene fusion is ubiquitous over the course of evolution. It is expected to increase the diversity and complexity of transcriptomes and proteomes through chimeric sequence segments or altered regulation. However, chimeric mRNAs in pigs remain unclear. Here we identified some chimeric mRNAs in pigs and analyzed the expression of them across individuals and breeds using RNA-sequencing data. Results The present study identified 669 putative chimeric mRNAs in pigs, of which 251 chimeric candidates were detected in a set of RNA-sequencing data. The 618 candidates had clear trans-splicing sites, 537 of which obeyed the canonical GU-AG splice rule. Only two putative pig chimera variants whose fusion junction was overlapped with that of a known human chimeric mRNA were found. A set of unique chimeric events were considered middle variances in the expression across individuals and breeds, and revealed non-significant variance between sexes. Furthermore, the genomic region of the 5′ partner gene shares a similar DNA sequence with that of the 3′ partner gene for 458 putative chimeric mRNAs. The 81 of those shared DNA sequences significantly matched the known DNA-binding motifs in the JASPAR CORE database. Four DNA motifs shared in parental genomic regions had significant similarity with known human CTCF binding sites. Conclusions The present study provided detailed information on some pig chimeric mRNAs. We proposed a model that trans-acting factors, such as CTCF, induced the spatial organisation of parental genes to the same transcriptional factory so that parental genes were coordinatively transcribed to give birth to chimeric mRNAs. PMID:22925561

A comparative molecular analysis of water-filled limestone sinkholes in north-eastern Mexico.

PubMed

Sahl, Jason W; Gary, Marcus O; Harris, J Kirk; Spear, John R

2011-01-01

Sistema Zacatón in north-eastern Mexico is host to several deep, water-filled, anoxic, karstic sinkholes (cenotes). These cenotes were explored, mapped, and geochemically and microbiologically sampled by the autonomous underwater vehicle deep phreatic thermal explorer (DEPTHX). The community structure of the filterable fraction of the water column and extensive microbial mats that coat the cenote walls was investigated by comparative analysis of small-subunit (SSU) 16S rRNA gene sequences. Full-length Sanger gene sequence analysis revealed novel microbial diversity that included three putative bacterial candidate phyla and three additional groups that showed high intra-clade distance with poorly characterized bacterial candidate phyla. Limited functional gene sequence analysis in these anoxic environments identified genes associated with methanogenesis, sulfate reduction and anaerobic ammonium oxidation. A directed, barcoded amplicon, multiplex pyrosequencing approach was employed to compare ∼100,000 bacterial SSU gene sequences from water column and wall microbial mat samples from five cenotes in Sistema Zacatón. A new, high-resolution sequence distribution profile (SDP) method identified changes in specific phylogenetic types (phylotypes) in microbial mats at varied depths; Mantel tests showed a correlation of the genetic distances between mat communities in two cenotes and the geographic location of each cenote. Community structure profiles from the water column of three neighbouring cenotes showed distinct variation; statistically significant differences in the concentration of geochemical constituents suggest that the variation observed in microbial communities between neighbouring cenotes are due to geochemical variation. © 2010 Society for Applied Microbiology and Blackwell Publishing Ltd.

Isolation and characterization of NBS-LRR- resistance gene candidates in turmeric (Curcuma longa cv. surama).

PubMed

Joshi, R K; Mohanty, S; Subudhi, E; Nayak, S

2010-09-08

Turmeric (Curcuma longa), an important asexually reproducing spice crop of the family Zingiberaceae is highly susceptible to bacterial and fungal pathogens. The identification of resistance gene analogs holds great promise for development of resistant turmeric cultivars. Degenerate primers designed based on known resistance genes (R-genes) were used in combinations to elucidate resistance gene analogs from Curcuma longa cultivar surama. The three primers resulted in amplicons with expected sizes of 450-600 bp. The nucleotide sequence of these amplicons was obtained through sequencing; their predicted amino acid sequences compared to each other and to the amino acid sequences of known R-genes revealed significant sequence similarity. The finding of conserved domains, viz., kinase-1a, kinase-2 and hydrophobic motif, provided evidence that the sequences belong to the NBS-LRR class gene family. The presence of tryptophan as the last residue of kinase-2 motif further qualified them to be in the non-TIR-NBS-LRR subfamily of resistance genes. A cluster analysis based on the neighbor-joining method was carried out using Curcuma NBS analogs together with several resistance gene analogs and known R-genes, which classified them into two distinct subclasses, corresponding to clades N3 and N4 of non-TIR-NBS sequences described in plants. The NBS analogs that we isolated can be used as guidelines to eventually isolate numerous R-genes in turmeric.

Transcriptome sequencing and identification of cold tolerance genes in hardy Corylus species (C. heterophylla Fisch) floral buds.

PubMed

Chen, Xin; Zhang, Jin; Liu, Qingzhong; Guo, Wei; Zhao, Tiantian; Ma, Qinghua; Wang, Guixi

2014-01-01

The genus Corylus is an important woody species in Northeast China. Its products, hazelnuts, constitute one of the most important raw materials for the pastry and chocolate industry. However, limited genetic research has focused on Corylus because of the lack of genomic resources. The advent of high-throughput sequencing technologies provides a turning point for Corylus research. In the present study, we performed de novo transcriptome sequencing for the first time to produce a comprehensive database for the Corylus heterophylla Fisch floral buds. The C. heterophylla Fisch floral buds transcriptome was sequenced using the Illumina paired-end sequencing technology. We produced 28,930,890 raw reads and assembled them into 82,684 contigs. A total of 40,941 unigenes were identified, among which 30,549 were annotated in the NCBI Non-redundant (Nr) protein database and 18,581 were annotated in the Swiss-Prot database. Of these annotated unigenes, 25,311 and 10,514 unigenes were assigned to gene ontology (GO) categories and clusters of orthologous groups (COG), respectively. We could map 17,207 unigenes onto 128 pathways using the Kyoto Encyclopedia of Genes and Genomes Pathway (KEGG) database. Additionally, based on the transcriptome, we constructed a candidate cold tolerance gene set of C. heterophylla Fisch floral buds. The expression patterns of selected genes during four stages of cold acclimation suggested that these genes might be involved in different cold responsive stages in C. heterophylla Fisch floral buds. The transcriptome of C. heterophylla Fisch floral buds was deep sequenced, de novo assembled, and annotated, providing abundant data to better understand the C. heterophylla Fisch floral buds transcriptome. Candidate genes potentially involved in cold tolerance were identified, providing a material basis for future molecular mechanism analysis of C. heterophylla Fisch floral buds tolerant to cold stress.

Identification of Streptococcus mitis321A vaccine antigens based on reverse vaccinology

PubMed Central

Zhang, Qiao; Lin, Kexiong; Wang, Changzheng; Xu, Zhi; Yang, Li; Ma, Qianli

2018-01-01

Streptococcus mitis (S. mitis) may transform into highly pathogenic bacteria. The aim of the present study was to identify potential antigen targets for designing an effective vaccine against the pathogenic S. mitis321A. The genome of S. mitis321A was sequenced using an Illumina Hiseq2000 instrument. Subsequently, Glimmer 3.02 and Tandem Repeat Finder (TRF) 4.04 were used to predict genes and tandem repeats, respectively, with DNA sequence function analysis using the Basic Local Alignment Search Tool (BLAST) in the Kyoto Encyclopedia of Genes and Genomes (KEGG) and Cluster of Orthologous Groups of proteins (COG) databases. Putative gene antigen candidates were screened with BLAST ahead of phylogenetic tree analysis. The DNA sequence assembly size was 2,110,680 bp with 40.12% GC, 6 scaffolds and 9 contig. Consequently, 1,944 genes were predicted, and 119 TRF, 56 microsatellite DNA, 10 minisatellite DNA and 154 transposons were acquired. The predicted genes were associated with various pathways and functions concerning membrane transport and energy metabolism. Multiple putative genes encoding surface proteins, secreted proteins and virulence factors, as well as essential genes were determined. The majority of essential genes belonged to a phylogenetic lineage, while 321AGL000129 and 321AGL000299 were on the same branch. The current study provided useful information regarding the biological function of the S. mitis321A genome and recommends putative antigen candidates for developing a potent vaccine against S. mitis. PMID:29620181

Characterization of the canine desmin (DES) gene and evaluation as a candidate gene for dilated cardiomyopathy in the Dobermann.

PubMed

Stabej, Polona; Imholz, Sandra; Versteeg, Serge A; Zijlstra, Carla; Stokhof, Arnold A; Domanjko-Petric, Aleksandra; Leegwater, Peter A J; van Oost, Bernard A

2004-10-13

Canine-dilated cardiomyopathy (DCM) in dogs is a disease of the myocardium associated with dilatation and impaired contraction of the ventricles and is suspected to have a genetic cause. A missense mutation in the desmin gene (DES) causes DCM in a human family. Human DCM closely resembles the canine disease. In the present study, we evaluated whether DES gene mutations are responsible for DCM in Dobermann dogs. We have isolated bacterial artificial chromosome clones (BACs) containing the canine DES gene and determined the chromosomal location by fluorescence in situ hybridization (FISH). Using data deposited in the NCBI trace archive and GenBank, the canine DES gene DNA sequence was assembled and seven single nucleotide polymorphisms (SNPs) were identified. From the canine DES gene BAC clones, a polymorphic microsatellite marker was isolated. The microsatellite marker and four informative desmin SNPs were typed in a Dobermann family with frequent DCM occurrence, but the disease phenotype did not associate with a desmin haplotype. We concluded that mutations in the DES gene do not play a role in Dobermann DCM. Availability of the microsatellite marker, SNPs and DNA sequence reported in this study enable fast evaluation of the DES gene as a DCM candidate gene in other dog breeds with DCM occurrence.

Archaeal and bacterial diversity in two hot springs from geothermal regions in Bulgaria as demostrated by 16S rRNA and GH-57 genes.

PubMed

Stefanova, Katerina; Tomova, Iva; Tomova, Anna; Radchenkova, Nadja; Atanassov, Ivan; Kambourova, Margarita

2015-12-01

Archaeal and bacterial diversity in two Bulgarian hot springs, geographically separated with different tectonic origin and different temperature of water was investigated exploring two genes, 16S rRNA and GH-57. Archaeal diversity was significantly higher in the hotter spring Levunovo (LV) (82°C); on the contrary, bacterial diversity was higher in the spring Vetren Dol (VD) (68°C). The analyzed clones from LV library were referred to twenty eight different sequence types belonging to five archaeal groups from Crenarchaeota and Euryarchaeota. A domination of two groups was observed, Candidate Thaumarchaeota and Methanosarcinales. The majority of the clones from VD were referred to HWCG (Hot Water Crenarchaeotic Group). The formation of a group of thermophiles in the order Methanosarcinales was suggested. Phylogenetic analysis revealed high numbers of novel sequences, more than one third of archaeal and half of the bacterial phylotypes displayed similarity lower than 97% with known ones. The retrieved GH-57 gene sequences showed a complex phylogenic distribution. The main part of the retrieved homologous GH-57 sequences affiliated with bacterial phyla Bacteroidetes, Deltaproteobacteria, Candidate Saccharibacteria and affiliation of almost half of the analyzed sequences is not fully resolved. GH-57 gene analysis allows an increased resolution of the biodiversity assessment and in depth analysis of specific taxonomic groups. [Int Microbiol 18(4):217-223 (2015)]. Copyright© by the Spanish Society for Microbiology and Institute for Catalan Studies.

Major Quantitative Trait Loci and Putative Candidate Genes for Powdery Mildew Resistance and Fruit-Related Traits Revealed by an Intraspecific Genetic Map for Watermelon (Citrullus lanatus var. lanatus).

PubMed

Kim, Kwang-Hwan; Hwang, Ji-Hyun; Han, Dong-Yeup; Park, Minkyu; Kim, Seungill; Choi, Doil; Kim, Yongjae; Lee, Gung Pyo; Kim, Sun-Tae; Park, Young-Hoon

2015-01-01

An intraspecific genetic map for watermelon was constructed using an F2 population derived from 'Arka Manik' × 'TS34' and transcript sequence variants and quantitative trait loci (QTL) for resistance to powdery mildew (PMR), seed size (SS), and fruit shape (FS) were analyzed. The map consists of 14 linkage groups (LGs) defined by 174 cleaved amplified polymorphic sequences (CAPS), 2 derived-cleaved amplified polymorphic sequence markers, 20 sequence-characterized amplified regions, and 8 expressed sequence tag-simple sequence repeat markers spanning 1,404.3 cM, with a mean marker interval of 6.9 cM and an average of 14.6 markers per LG. Genetic inheritance and QTL analyses indicated that each of the PMR, SS, and FS traits is controlled by an incompletely dominant effect of major QTLs designated as pmr2.1, ss2.1, and fsi3.1, respectively. The pmr2.1, detected on chromosome 2 (Chr02), explained 80.0% of the phenotypic variation (LOD = 30.76). This QTL was flanked by two CAPS markers, wsb2-24 (4.00 cM) and wsb2-39 (13.97 cM). The ss2.1, located close to pmr2.1 and CAPS marker wsb2-13 (1.00 cM) on Chr02, explained 92.3% of the phenotypic variation (LOD = 68.78). The fsi3.1, detected on Chr03, explained 79.7% of the phenotypic variation (LOD = 31.37) and was flanked by two CAPS, wsb3-24 (1.91 cM) and wsb3-9 (7.00 cM). Candidate gene-based CAPS markers were developed from the disease resistance and fruit shape gene homologs located on Chr.02 and Chr03 and were mapped on the intraspecific map. Colocalization of these markers with the major QTLs indicated that watermelon orthologs of a nucleotide-binding site-leucine-rich repeat class gene containing an RPW8 domain and a member of SUN containing the IQ67 domain are candidate genes for pmr2.1 and fsi3.1, respectively. The results presented herein provide useful information for marker-assisted breeding and gene cloning for PMR and fruit-related traits.

Major Quantitative Trait Loci and Putative Candidate Genes for Powdery Mildew Resistance and Fruit-Related Traits Revealed by an Intraspecific Genetic Map for Watermelon (Citrullus lanatus var. lanatus)

PubMed Central

Kim, Kwang-Hwan; Hwang, Ji-Hyun; Han, Dong-Yeup; Park, Minkyu; Kim, Seungill; Choi, Doil; Kim, Yongjae; Lee, Gung Pyo; Kim, Sun-Tae; Park, Young-Hoon

2015-01-01

An intraspecific genetic map for watermelon was constructed using an F2 population derived from ‘Arka Manik’ × ‘TS34’ and transcript sequence variants and quantitative trait loci (QTL) for resistance to powdery mildew (PMR), seed size (SS), and fruit shape (FS) were analyzed. The map consists of 14 linkage groups (LGs) defined by 174 cleaved amplified polymorphic sequences (CAPS), 2 derived-cleaved amplified polymorphic sequence markers, 20 sequence-characterized amplified regions, and 8 expressed sequence tag-simple sequence repeat markers spanning 1,404.3 cM, with a mean marker interval of 6.9 cM and an average of 14.6 markers per LG. Genetic inheritance and QTL analyses indicated that each of the PMR, SS, and FS traits is controlled by an incompletely dominant effect of major QTLs designated as pmr2.1, ss2.1, and fsi3.1, respectively. The pmr2.1, detected on chromosome 2 (Chr02), explained 80.0% of the phenotypic variation (LOD = 30.76). This QTL was flanked by two CAPS markers, wsb2-24 (4.00 cM) and wsb2-39 (13.97 cM). The ss2.1, located close to pmr2.1 and CAPS marker wsb2-13 (1.00 cM) on Chr02, explained 92.3% of the phenotypic variation (LOD = 68.78). The fsi3.1, detected on Chr03, explained 79.7% of the phenotypic variation (LOD = 31.37) and was flanked by two CAPS, wsb3-24 (1.91 cM) and wsb3-9 (7.00 cM). Candidate gene-based CAPS markers were developed from the disease resistance and fruit shape gene homologs located on Chr.02 and Chr03 and were mapped on the intraspecific map. Colocalization of these markers with the major QTLs indicated that watermelon orthologs of a nucleotide-binding site-leucine-rich repeat class gene containing an RPW8 domain and a member of SUN containing the IQ67 domain are candidate genes for pmr2.1 and fsi3.1, respectively. The results presented herein provide useful information for marker-assisted breeding and gene cloning for PMR and fruit-related traits. PMID:26700647

Transcriptome analysis of Brassica napus pod using RNA-Seq and identification of lipid-related candidate genes.

PubMed

Xu, Hai-Ming; Kong, Xiang-Dong; Chen, Fei; Huang, Ji-Xiang; Lou, Xiang-Yang; Zhao, Jian-Yi

2015-10-24

Brassica napus is an important oilseed crop. Dissection of the genetic architecture underlying oil-related biological processes will greatly facilitates the genetic improvement of rapeseed. The differential gene expression during pod development offers a snapshot on the genes responsible for oil accumulation in. To identify candidate genes in the linkage peaks reported previously, we used RNA sequencing (RNA-Seq) technology to analyze the pod transcriptomes of German cultivar Sollux and Chinese inbred line Gaoyou. The RNA samples were collected for RNA-Seq at 5-7, 15-17 and 25-27 days after flowering (DAF). Bioinformatics analysis was performed to investigate differentially expressed genes (DEGs). Gene annotation analysis was integrated with QTL mapping and Brassica napus pod transcriptome profiling to detect potential candidate genes in oilseed. Four hundred sixty five and two thousand, one hundred fourteen candidate DEGs were identified, respectively, between two varieties at the same stages and across different periods of each variety. Then, 33 DEGs between Sollux and Gaoyou were identified as the candidate genes affecting seed oil content by combining those DEGs with the quantitative trait locus (QTL) mapping results, of which, one was found to be homologous to Arabidopsis thaliana lipid-related genes. Intervarietal DEGs of lipid pathways in QTL regions represent important candidate genes for oil-related traits. Integrated analysis of transcriptome profiling, QTL mapping and comparative genomics with other relative species leads to efficient identification of most plausible functional genes underlying oil-content related characters, offering valuable resources for bettering breeding program of Brassica napus. This study provided a comprehensive overview on the pod transcriptomes of two varieties with different oil-contents at the three developmental stages.

Identification of candidate genes affecting Δ9-tetrahydrocannabinol biosynthesis in Cannabis sativa

PubMed Central

Marks, M. David; Tian, Li; Wenger, Jonathan P.; Omburo, Stephanie N.; Soto-Fuentes, Wilfredo; He, Ji; Gang, David R.; Weiblen, George D.; Dixon, Richard A.

2009-01-01

RNA isolated from the glands of a Δ9-tetrahydrocannabinolic acid (THCA)-producing strain of Cannabis sativa was used to generate a cDNA library containing over 100 000 expressed sequence tags (ESTs). Sequencing of over 2000 clones from the library resulted in the identification of over 1000 unigenes. Candidate genes for almost every step in the biochemical pathways leading from primary metabolites to THCA were identified. Quantitative PCR analysis suggested that many of the pathway genes are preferentially expressed in the glands. Hexanoyl-CoA, one of the metabolites required for THCA synthesis, could be made via either de novo fatty acids synthesis or via the breakdown of existing lipids. qPCR analysis supported the de novo pathway. Many of the ESTs encode transcription factors and two putative MYB genes were identified that were preferentially expressed in glands. Given the similarity of the Cannabis MYB genes to those in other species with known functions, these Cannabis MYBs may play roles in regulating gland development and THCA synthesis. Three candidates for the polyketide synthase (PKS) gene responsible for the first committed step in the pathway to THCA were characterized in more detail. One of these was identical to a previously reported chalcone synthase (CHS) and was found to have CHS activity. All three could use malonyl-CoA and hexanoyl-CoA as substrates, including the CHS, but reaction conditions were not identified that allowed for the production of olivetolic acid (the proposed product of the PKS activity needed for THCA synthesis). One of the PKS candidates was highly and specifically expressed in glands (relative to whole leaves) and, on the basis of these expression data, it is proposed to be the most likely PKS responsible for olivetolic acid synthesis in Cannabis glands. PMID:19581347

Examination of AVPR1a as an autism susceptibility gene.

PubMed

Wassink, T H; Piven, J; Vieland, V J; Pietila, J; Goedken, R J; Folstein, S E; Sheffield, V C

2004-10-01

Impaired reciprocal social interaction is one of the core features of autism. While its determinants are complex, one biomolecular pathway that clearly influences social behavior is the arginine-vasopressin (AVP) system. The behavioral effects of AVP are mediated through the AVP receptor 1a (AVPR1a), making the AVPR1a gene a reasonable candidate for autism susceptibility. We tested the gene's contribution to autism by screening its exons in 125 independent autistic probands and genotyping two promoter polymorphisms in 65 autism affected sibling pair (ASP) families. While we found no nonconservative coding sequence changes, we did identify evidence of linkage and of linkage disequilibrium. These results were most pronounced in a subset of the ASP families with relatively less severe impairment of language. Thus, though we did not demonstrate a disease-causing variant in the coding sequence, numerous nontraditional disease-causing genetic abnormalities are known to exist that would escape detection by traditional gene screening methods. Given the emerging biological, animal model, and now genetic data, AVPR1a and genes in the AVP system remain strong candidates for involvement in autism susceptibility and deserve continued scrutiny.

Sequencing of five left-right cerebral asymmetry genes in a cohort of schizophrenia and schizotypal disorder patients from Russia.

PubMed

Levchenko, Anastasia; Davtian, Stepan; Petrova, Natalia; Malashichev, Yegor

2014-04-01

Schizophrenia is a severe psychiatric disorder, affecting ∼1% of the human population. The genetic contribution to schizophrenia is significant, but the genetics are complex and many aspects of brain functioning, from neural development to synapse structure, seem to be involved in the pathogenesis. A novel way to study the molecular causes of schizophrenia is to study the genetics of left-right (LR) brain asymmetry, the disease feature often observed in schizophrenic patients. In this study, we analyzed by sequencing five candidate LR cerebral asymmetry genes in a cohort of 95 schizophrenia and schizotypal disorder patients from Saint Petersburg, Russia. The gene list included LMO4, LRRTM1, FOXP2, the PCDH11X/Y gene pair, and SRY. We found 17 previously unreported variants in the genes LRRTM1, FOXP2, LMO4, and PCDH11X in the 3'-UTR and 5'-UTR. The variants might contribute toward an altered mRNA processing, which could lead to altered mRNA amounts in developing neurons of the brain and establishment of an incorrect LR asymmetry profile. This is the first study in which multiple candidate genes for cerebral LR asymmetry and schizophrenia have been analyzed by sequencing. The approach to study the genetics of schizophrenia from the perspective of an LR cerebral asymmetry disturbance deserves more attention.

Genome sequencing and analysis of the paclitaxel-producing endophytic fungus Penicillium aurantiogriseum NRRL 62431

PubMed Central

2014-01-01

Background Paclitaxel (Taxol™) is an important anticancer drug with a unique mode of action. The biosynthesis of paclitaxel had been considered restricted to the Taxus species until it was discovered in Taxomyces andreanae, an endophytic fungus of T. brevifolia. Subsequently, paclitaxel was found in hazel (Corylus avellana L.) and in several other endophytic fungi. The distribution of paclitaxel in plants and endophytic fungi and the reported sequence homology of key genes in paclitaxel biosynthesis between plant and fungi species raises the question about whether the origin of this pathway in these two physically associated groups could have been facilitated by horizontal gene transfer. Results The ability of the endophytic fungus of hazel Penicillium aurantiogriseum NRRL 62431 to independently synthesize paclitaxel was established by liquid chromatography-mass spectrometry and proton nuclear magnetic resonance. The genome of Penicillium aurantiogriseum NRRL 62431 was sequenced and gene candidates that may be involved in paclitaxel biosynthesis were identified by comparison with the 13 known paclitaxel biosynthetic genes in Taxus. We found that paclitaxel biosynthetic gene candidates in P. aurantiogriseum NRRL 62431 have evolved independently and that horizontal gene transfer between this endophytic fungus and its plant host is unlikely. Conclusions Our findings shed new light on how paclitaxel-producing endophytic fungi synthesize paclitaxel, and will facilitate metabolic engineering for the industrial production of paclitaxel from fungi. PMID:24460898

An asparagine residue at the N-terminus affects the maturation process of low molecular weight glutenin subunits of wheat endosperm

PubMed Central

2014-01-01

Background Wheat glutenin polymers are made up of two main subunit types, the high- (HMW-GS) and low- (LMW-GS) molecular weight subunits. These latter are represented by heterogeneous proteins. The most common, based on the first amino acid of the mature sequence, are known as LMW-m and LMW-s types. The mature sequences differ as a consequence of three extra amino acids (MET-) at the N-terminus of LMW-m types. The nucleotide sequences of their encoding genes are, however, nearly identical, so that the relationship between gene and protein sequences is difficult to ascertain. It has been hypothesized that the presence of an asparagine residue in position 23 of the complete coding sequence for the LMW-s type might account for the observed three-residue shortened sequence, as a consequence of cleavage at the asparagine by an asparaginyl endopeptidase. Results We performed site-directed mutagenesis of a LMW-s gene to replace asparagine at position 23 with threonine and thus convert it to a candidate LMW-m type gene. Similarly, a candidate LMW-m type gene was mutated at position 23 to replace threonine with asparagine. Next, we produced transgenic durum wheat (cultivar Svevo) lines by introducing the mutated versions of the LMW-m and LMW-s genes, along with the wild type counterpart of the LMW-m gene. Proteomic comparisons between the transgenic and null segregant plants enabled identification of transgenic proteins by mass spectrometry analyses and Edman N-terminal sequencing. Conclusions Our results show that the formation of LMW-s type relies on the presence of an asparagine residue close to the N-terminus generated by signal peptide cleavage, and that LMW-GS can be quantitatively processed most likely by vacuolar asparaginyl endoproteases, suggesting that those accumulated in the vacuole are not sequestered into stable aggregates that would hinder the action of proteolytic enzymes. Rather, whatever is the mechanism of glutenin polymer transport to the vacuole, the proteins remain available for proteolytic processing, and can be converted to the mature form by the removal of a short N-terminal sequence. PMID:24629124

DNA sequence variation and selection of tag single-nucleotide polymorphisms at candidate genes for drought-stress response in Pinus taeda L.

PubMed

González-Martínez, Santiago C; Ersoz, Elhan; Brown, Garth R; Wheeler, Nicholas C; Neale, David B

2006-03-01

Genetic association studies are rapidly becoming the experimental approach of choice to dissect complex traits, including tolerance to drought stress, which is the most common cause of mortality and yield losses in forest trees. Optimization of association mapping requires knowledge of the patterns of nucleotide diversity and linkage disequilibrium and the selection of suitable polymorphisms for genotyping. Moreover, standard neutrality tests applied to DNA sequence variation data can be used to select candidate genes or amino acid sites that are putatively under selection for association mapping. In this article, we study the pattern of polymorphism of 18 candidate genes for drought-stress response in Pinus taeda L., an important tree crop. Data analyses based on a set of 21 putatively neutral nuclear microsatellites did not show population genetic structure or genomewide departures from neutrality. Candidate genes had moderate average nucleotide diversity at silent sites (pi(sil) = 0.00853), varying 100-fold among single genes. The level of within-gene LD was low, with an average pairwise r2 of 0.30, decaying rapidly from approximately 0.50 to approximately 0.20 at 800 bp. No apparent LD among genes was found. A selective sweep may have occurred at the early-response-to-drought-3 (erd3) gene, although population expansion can also explain our results and evidence for selection was not conclusive. One other gene, ccoaomt-1, a methylating enzyme involved in lignification, showed dimorphism (i.e., two highly divergent haplotype lineages at equal frequency), which is commonly associated with the long-term action of balancing selection. Finally, a set of haplotype-tagging SNPs (htSNPs) was selected. Using htSNPs, a reduction of genotyping effort of approximately 30-40%, while sampling most common allelic variants, can be gained in our ongoing association studies for drought tolerance in pine.

In Silico Detection of Sequence Variations Modifying Transcriptional Regulation

PubMed Central

Andersen, Malin C; Engström, Pär G; Lithwick, Stuart; Arenillas, David; Eriksson, Per; Lenhard, Boris; Wasserman, Wyeth W; Odeberg, Jacob

2008-01-01

Identification of functional genetic variation associated with increased susceptibility to complex diseases can elucidate genes and underlying biochemical mechanisms linked to disease onset and progression. For genes linked to genetic diseases, most identified causal mutations alter an encoded protein sequence. Technological advances for measuring RNA abundance suggest that a significant number of undiscovered causal mutations may alter the regulation of gene transcription. However, it remains a challenge to separate causal genetic variations from linked neutral variations. Here we present an in silico driven approach to identify possible genetic variation in regulatory sequences. The approach combines phylogenetic footprinting and transcription factor binding site prediction to identify variation in candidate cis-regulatory elements. The bioinformatics approach has been tested on a set of SNPs that are reported to have a regulatory function, as well as background SNPs. In the absence of additional information about an analyzed gene, the poor specificity of binding site prediction is prohibitive to its application. However, when additional data is available that can give guidance on which transcription factor is involved in the regulation of the gene, the in silico binding site prediction improves the selection of candidate regulatory polymorphisms for further analyses. The bioinformatics software generated for the analysis has been implemented as a Web-based application system entitled RAVEN (regulatory analysis of variation in enhancers). The RAVEN system is available at http://www.cisreg.ca for all researchers interested in the detection and characterization of regulatory sequence variation. PMID:18208319

Comparative analysis of mitochondrial genomes between a wheat K-type cytoplasmic male sterility (CMS) line and its maintainer line.

PubMed

Liu, Huitao; Cui, Peng; Zhan, Kehui; Lin, Qiang; Zhuo, Guoyin; Guo, Xiaoli; Ding, Feng; Yang, Wenlong; Liu, Dongcheng; Hu, Songnian; Yu, Jun; Zhang, Aimin

2011-03-29

Plant mitochondria, semiautonomous organelles that function as manufacturers of cellular ATP, have their own genome that has a slow rate of evolution and rapid rearrangement. Cytoplasmic male sterility (CMS), a common phenotype in higher plants, is closely associated with rearrangements in mitochondrial DNA (mtDNA), and is widely used to produce F1 hybrid seeds in a variety of valuable crop species. Novel chimeric genes deduced from mtDNA rearrangements causing CMS have been identified in several plants, such as rice, sunflower, pepper, and rapeseed, but there are very few reports about mtDNA rearrangements in wheat. In the present work, we describe the mitochondrial genome of a wheat K-type CMS line and compare it with its maintainer line. The complete mtDNA sequence of a wheat K-type (with cytoplasm of Aegilops kotschyi) CMS line, Ks3, was assembled into a master circle (MC) molecule of 647,559 bp and found to harbor 34 known protein-coding genes, three rRNAs (18 S, 26 S, and 5 S rRNAs), and 16 different tRNAs. Compared to our previously published sequence of a K-type maintainer line, Km3, we detected Ks3-specific mtDNA (> 100 bp, 11.38%) and repeats (> 100 bp, 29 units) as well as genes that are unique to each line: rpl5 was missing in Ks3 and trnH was absent from Km3. We also defined 32 single nucleotide polymorphisms (SNPs) in 13 protein-coding, albeit functionally irrelevant, genes, and predicted 22 unique ORFs in Ks3, representing potential candidates for K-type CMS. All these sequence variations are candidates for involvement in CMS. A comparative analysis of the mtDNA of several angiosperms, including those from Ks3, Km3, rice, maize, Arabidopsis thaliana, and rapeseed, showed that non-coding sequences of higher plants had mostly divergent multiple reorganizations during the mtDNA evolution of higher plants. The complete mitochondrial genome of the wheat K-type CMS line Ks3 is very different from that of its maintainer line Km3, especially in non-coding sequences. Sequence rearrangement has produced novel chimeric ORFs, which may be candidate genes for CMS. Comparative analysis of several angiosperm mtDNAs indicated that non-coding sequences are the most frequently reorganized during mtDNA evolution in higher plants.

An efficient approach to finding Siraitia grosvenorii triterpene biosynthetic genes by RNA-seq and digital gene expression analysis.

PubMed

Tang, Qi; Ma, Xiaojun; Mo, Changming; Wilson, Iain W; Song, Cai; Zhao, Huan; Yang, Yanfang; Fu, Wei; Qiu, Deyou

2011-07-05

Siraitia grosvenorii (Luohanguo) is an herbaceous perennial plant native to southern China and most prevalent in Guilin city. Its fruit contains a sweet, fleshy, edible pulp that is widely used in traditional Chinese medicine. The major bioactive constituents in the fruit extract are the cucurbitane-type triterpene saponins known as mogrosides. Among them, mogroside V is nearly 300 times sweeter than sucrose. However, little is known about mogrosides biosynthesis in S. grosvenorii, especially the late steps of the pathway. In this study, a cDNA library generated from of equal amount of RNA taken from S. grosvenorii fruit at 50 days after flowering (DAF) and 70 DAF were sequenced using Illumina/Solexa platform. More than 48,755,516 high-quality reads from a cDNA library were generated that was assembled into 43,891 unigenes. De novo assembly and gap-filling generated 43,891 unigenes with an average sequence length of 668 base pairs. A total of 26,308 (59.9%) unique sequences were annotated and 11,476 of the unique sequences were assigned to specific metabolic pathways by the Kyoto Encyclopedia of Genes and Genomes. cDNA sequences for all of the known enzymes involved in mogrosides backbone synthesis were identified from our library. Additionally, a total of eighty-five cytochrome P450 (CYP450) and ninety UDP-glucosyltransferase (UDPG) unigenes were identified, some of which appear to encode enzymes responsible for the conversion of the mogroside backbone into the various mogrosides. Digital gene expression profile (DGE) analysis using Solexa sequencing was performed on three important stages of fruit development, and based on their expression pattern, seven CYP450s and five UDPGs were selected as the candidates most likely to be involved in mogrosides biosynthesis. A combination of RNA-seq and DGE analysis based on the next generation sequencing technology was shown to be a powerful method for identifying candidate genes encoding enzymes responsible for the biosynthesis of novel secondary metabolites in a non-model plant. Seven CYP450s and five UDPGs were selected as potential candidates involved in mogrosides biosynthesis. The transcriptome data from this study provides an important resource for understanding the formation of major bioactive constituents in the fruit extract from S. grosvenorii.

Investigating the genetics of Bti resistance using mRNA tag sequencing: application on laboratory strains and natural populations of the dengue vector Aedes aegypti

PubMed Central

Paris, Margot; Marcombe, Sebastien; Coissac, Eric; Corbel, Vincent; David, Jean-Philippe; Després, Laurence

2013-01-01

Mosquito control is often the main method used to reduce mosquito-transmitted diseases. In order to investigate the genetic basis of resistance to the bio-insecticide Bacillus thuringiensis subsp. israelensis (Bti), we used information on polymorphism obtained from cDNA tag sequences from pooled larvae of laboratory Bti-resistant and susceptible Aedes aegypti mosquito strains to identify and analyse 1520 single nucleotide polymorphisms (SNPs). Of the 372 SNPs tested, 99.2% were validated using DNA Illumina GoldenGate® array, with a strong correlation between the allelic frequencies inferred from the pooled and individual data (r = 0.85). A total of 11 genomic regions and five candidate genes were detected using a genome scan approach. One of these candidate genes showed significant departures from neutrality in the resistant strain at sequence level. Six natural populations from Martinique Island were sequenced for the 372 tested SNPs with a high transferability (87%), and association mapping analyses detected 14 loci associated with Bti resistance, including one located in a putative receptor for Cry11 toxins. Three of these loci were also significantly differentiated between the laboratory strains, suggesting that most of the genes associated with resistance might differ between the two environments. It also suggests that common selected regions might harbour key genes for Bti resistance. PMID:24187584

Targeted sequencing identifies 91 neurodevelopmental disorder risk genes with autism and developmental disability biases

PubMed Central

Stessman, Holly A. F.; Xiong, Bo; Coe, Bradley P.; Wang, Tianyun; Hoekzema, Kendra; Fenckova, Michaela; Kvarnung, Malin; Gerdts, Jennifer; Trinh, Sandy; Cosemans, Nele; Vives, Laura; Lin, Janice; Turner, Tychele N.; Santen, Gijs; Ruivenkamp, Claudia; Kriek, Marjolein; van Haeringen, Arie; Aten, Emmelien; Friend, Kathryn; Liebelt, Jan; Barnett, Christopher; Haan, Eric; Shaw, Marie; Gecz, Jozef; Anderlid, Britt-Marie; Nordgren, Ann; Lindstrand, Anna; Schwartz, Charles; Kooy, R. Frank; Vandeweyer, Geert; Helsmoortel, Celine; Romano, Corrado; Alberti, Antonino; Vinci, Mirella; Avola, Emanuela; Giusto, Stefania; Courchesne, Eric; Pramparo, Tiziano; Pierce, Karen; Nalabolu, Srinivasa; Amaral, David; Scheffer, Ingrid E.; Delatycki, Martin B.; Lockhart, Paul J.; Hormozdiari, Fereydoun; Harich, Benjamin; Castells-Nobau, Anna; Xia, Kun; Peeters, Hilde; Nordenskjöld, Magnus; Schenck, Annette; Bernier, Raphael A.; Eichler, Evan E.

2017-01-01

Gene-disruptive mutations contribute to the biology of neurodevelopmental disorders (NDDs), but most pathogenic genes are not known. We sequenced 208 candidate genes from >11,730 patients and >2,867 controls. We report 91 genes with an excess of de novo mutations or private disruptive mutations in 5.7% of patients, including 38 novel NDD genes. Drosophila functional assays of a subset bolster their involvement in NDDs. We identify 25 genes that show a bias for autism versus intellectual disability and highlight a network associated with high-functioning autism (FSIQ>100). Clinical follow-up for NAA15, KMT5B, and ASH1L reveals novel syndromic and non-syndromic forms of disease. PMID:28191889

Population structure and its effect on haplotype diversity and linkage disequilibrium surrounding the xa5 locus of rice (Oryza sativa L.).

PubMed Central

Garris, Amanda J; McCouch, Susan R; Kresovich, Stephen

2003-01-01

To assess the usefulness of linkage disequilibrium mapping in an autogamous, domesticated species, we have characterized linkage disequilibrium in the candidate region for xa5, a recessive gene conferring race-specific resistance to bacterial blight in rice. This trait and locus have good mapping information, a tractable phenotype, and available sequence data, but no cloned gene. We sampled 13 short segments from the 70-kb candidate region in 114 accessions of Oryza sativa. Five additional segments were sequenced from the adjacent 45-kb region in resistant accessions to estimate the distance at which linkage disequilibrium decays. The data show significant linkage disequilibrium between sites 100 kb apart. The presence of the xa5 resistant reaction in two ecotypes and in accessions with different haplotypes in the candidate region may indicate multiple origins or genetic heterogeneity for resistance. In addition, genetic differentiation between ecotypes emphasizes the need for controlling for population structure in the design of linkage disequilibrium studies in rice. PMID:14573486

Identification of a duplication within the GDF9 gene and novel candidate genes for primary ovarian insufficiency (POI) by a customized high-resolution array comparative genomic hybridization platform.

PubMed

Norling, A; Hirschberg, A L; Rodriguez-Wallberg, K A; Iwarsson, E; Wedell, A; Barbaro, M

2014-08-01

Can high-resolution array comparative genomic hybridization (CGH) analysis of DNA samples from women with primary ovarian insufficiency (POI) improve the diagnosis of the condition and identify novel candidate genes for POI? A mutation affecting the regulatory region of growth differentiation factor 9 (GDF9) was identified for the first time together with several novel candidate genes for POI. Most patients with POI do not receive a molecular diagnosis despite a significant genetic component in the pathogenesis. We performed a case-control study. Twenty-six patients were analyzed by array CGH for identification of copy number variants. Novel changes were investigated in 95 controls and in a separate population of 28 additional patients with POI. The experimental procedures were performed during a 1-year period. DNA samples from 26 patients with POI were analyzed by a customized 1M array-CGH platform with whole genome coverage and probe enrichment targeting 78 genes in sex development. By PCR amplification and sequencing, the breakpoint of an identified partial GDF9 gene duplication was characterized. A multiplex ligation-dependent probe amplification (MLPA) probe set for specific identification of deletions/duplications affecting GDF9 was developed. An MLPA probe set for the identification of additional cases or controls carrying novel candidate regions identified by array-CGH was developed. Sequencing of three candidate genes was performed. Eleven unique copy number changes were identified in a total of 11 patients, including a tandem duplication of 475 bp, containing part of the GDF9 gene promoter region. The duplicated region contains three NOBOX-binding elements and an E-box, important for GDF9 gene regulation. This aberration is likely causative of POI. Fifty-four patients were investigated for copy number changes within GDF9, but no additional cases were found. Ten aberrations constituting novel candidate regions were detected, including a second DNAH6 deletion in a patient with POI. Other identified candidate genes were TSPYL6, SMARCC1, CSPG5 and ZFR2. This is a descriptive study and no functional experiments were performed. The study illustrates the importance of analyzing small copy number changes in addition to sequence alterations in the genetic investigation of patients with POI. Also, promoter regions should be included in the investigation. The study was supported by grants from the Swedish Research council (project no 12198 to A.W. and project no 20324 to A.L.H.), Stockholm County Council (E.I., A.W. and K.R.W.), Foundation Frimurare Barnhuset (A.N., A.W. and M.B.), Karolinska Institutet (A.N., A.L.H., E.I., A.W. and M.B.), Novo Nordic Foundation (A.W.) and Svenska Läkaresällskapet (M.B.). The funding sources had no involvement in the design or analysis of the study. The authors have no competing interests to declare. Not applicable. © The Author 2014. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology.

No novel, high penetrant gene might remain to be found in Japanese patients with unknown MODY.

PubMed

Horikawa, Yukio; Hosomichi, Kazuyoshi; Enya, Mayumi; Ishiura, Hiroyuki; Suzuki, Yutaka; Tsuji, Shoji; Sugano, Sumio; Inoue, Ituro; Takeda, Jun

2018-07-01

MODY 5 and 6 have been shown to be low-penetrant MODYs. As the genetic background of unknown MODY is assumed to be similar, a new analytical strategy is applied here to elucidate genetic predispositions to unknown MODY. We examined to find whether there are major MODY gene loci remaining to be identified using SNP linkage analysis in Japanese. Whole-exome sequencing was performed with seven families with typical MODY. Candidates for novel MODY genes were examined combined with in silico network analysis. Some peaks were found only in either parametric or non-parametric analysis; however, none of these peaks showed a LOD score greater than 3.7, which is approved to be the significance threshold of evidence for linkage. Exome sequencing revealed that three mutated genes were common among 3 families and 42 mutated genes were common in two families. Only one of these genes, MYO5A, having rare amino acid mutations p.R849Q and p.V1601G, was involved in the biological network of known MODY genes through the intermediary of the INS. Although only one promising candidate gene, MYO5A, was identified, no novel, high penetrant MODY genes might remain to be found in Japanese MODY.

Grouping and characterization of putative glycosyltransferase genes from Panax ginseng Meyer.

PubMed

Khorolragchaa, Altanzul; Kim, Yu-Jin; Rahimi, Shadi; Sukweenadhi, Johan; Jang, Moon-Gi; Yang, Deok-Chun

2014-02-15

Glycosyltransferases are members of the multigene family of plants that can transfer single or multiple activated sugars to a range of plant molecules, resulting in the glycosylation of plant compounds. Although the activities of many glycosyltransferases and their products have been recognized for a long time, only in recent years were some glycosyltransferase genes identified and few have been functionally characterized in detail. Korean ginseng (Panax ginseng Meyer), belonging to Araliaceae, has been well known as a popular mysterious medicinal herb in East Asia for over 2,000 years. A total of 704 glycosyltransferase unique sequences have been found from a ginseng expressed sequence tag (EST) library, and these sequences encode enzymes responsible for the secondary metabolite biosynthesis. Finally, twelve UDP glycosyltransferases (UGTs) were selected as the candidates most likely to be involved in triterpenoid synthesis. In this study, we classified the candidate P. ginseng UGTs (PgUGTs) into proper families and groups, which resulted in eight UGT families and six UGT groups. We also investigated those gene candidates encoding for glycosyltransferases by analysis of gene expression in methyl jasmonate (MeJA)-treated ginseng adventitious roots and different tissues from four-year-old ginseng using quantitative reverse transcriptase-polymerase chain reaction (RT-PCR). For organ-specific expression, most of PgUGT transcription levels were higher in leaves and roots compared with flower buds and stems. The transcription of PgUGTs in adventitious roots treated with MeJA increased as compared with the control. PgUGT1 and PgUGT2, which belong to the UGT71 family genes expressed in MeJA-treated adventitious roots, were especially sensitive, showing 33.32 and 38.88-fold expression increases upon 24h post-treatments, respectively. © 2013 Elsevier B.V. All rights reserved.

Targeted resequencing of candidate genes reveals novel variants associated with severe Behçet's uveitis.

PubMed

Kim, Sang Jin; Lee, Seungbok; Park, Changho; Seo, Jeong-Sun; Kim, Jong-Il; Yu, Hyeong Gon

2013-10-18

Behçet's disease (BD) is a chronic systemic inflammatory disorder characterized by four major manifestations: recurrent uveitis, oral and genital ulcers and skin lesions. To identify some pathogenic variants associated with severe Behçet's uveitis, we used targeted and massively parallel sequencing methods to explore the genetic diversity of target regions. A solution-based target enrichment kit was designed to capture whole-exonic regions of 132 candidate genes. Using a multiplexing strategy, 32 samples from patients with a severe type of Behçet's uveitis were sequenced with a Genome Analyzer IIx. We compared the frequency of each variant with that of 59 normal Korean controls, and selected five rare and eight common single-nucleotide variants as the candidates for a replication study. The selected variants were genotyped in 61 cases and 320 controls and, as a result, two rare and seven common variants showed significant associations with severe Behçet's uveitis (P<0.05). Some of these, including rs199955684 in KIR3DL3, rs1801133 in MTHFR, rs1051790 in MICA and rs1051456 in KIR2DL4, were predicted to be damaging by either the PolyPhen-2 or SIFT prediction program. Variants on FCGR3A (rs396991) and ICAM1 (rs5498) have been previously reported as susceptibility loci of this disease, and those on IFNAR1, MTFHR and MICA also replicated the previous reports at the gene level. The KIR3DL3 and KIR2DL4 genes are novel susceptibility genes that have not been reported in association with BD. In conclusion, this study showed that target enrichment and next-generation sequencing technologies can provide valuable information on the genetic predisposition for Behçet's uveitis.

Whole-Exome Sequencing Study of Thyrotropin-Secreting Pituitary Adenomas.

PubMed

Sapkota, Santosh; Horiguchi, Kazuhiko; Tosaka, Masahiko; Yamada, Syozo; Yamada, Masanobu

2017-02-01

Thyrotropin (TSH)-secreting pituitary adenomas (TSHomas) are a rare cause of hyperthyroidism, and the genetic aberrations responsible remain unknown. To identify somatic genetic abnormalities in TSHomas. A single-nucleotide polymorphism (SNP) array analysis was performed on 8 TSHomas. Four tumors with no allelic losses or limited loss of heterozygosity were selected, and whole-exome sequencing was performed, including their corresponding blood samples. Somatic variants were confirmed by Sanger sequencing. A set of 8 tumors was also assessed to validate candidate genes. Twelve patients with sporadic TSHomas were examined. The overall performance of whole-exome sequencing was good, with an average coverage of each base in the targeted region of 97.6%. Six DNA variants were confirmed as candidate driver mutations, with an average of 1.5 somatic mutations per tumor. No mutations were recurrent. Two of these mutations were found in genes with an established role in malignant tumorigenesis (SMOX and SYTL3), and 4 had unknown roles (ZSCAN23, ASTN2, R3HDM2, and CWH43). Similarly, an SNP array analysis revealed frequent chromosomal regions of copy number gains, including recurrent gains at loci harboring 4 of these 6 genes. Several candidate somatic mutations and changes in copy numbers for TSHomas were identified. The results showed no recurrence of mutations in the tumors studied but a low number of mutations, thereby highlighting their benign nature. Further studies on a larger cohort of TSHomas, along with the use of epigenetic and transcriptomic approaches, may reveal the underlying genetic lesions. Copyright © 2017 by the Endocrine Society

Horizontal gene transfer in silkworm, Bombyx mori

PubMed Central

2011-01-01

Background The domesticated silkworm, Bombyx mori, is the model insect for the order Lepidoptera, has economically important values, and has gained some representative behavioral characteristics compared to its wild ancestor. The genome of B. mori has been fully sequenced while function analysis of BmChi-h and BmSuc1 genes revealed that horizontal gene transfer (HGT) maybe bestow a clear selective advantage to B. mori. However, the role of HGT in the evolutionary history of B. mori is largely unexplored. In this study, we compare the whole genome of B. mori with those of 382 prokaryotic and eukaryotic species to investigate the potential HGTs. Results Ten candidate HGT events were defined in B. mori by comprehensive sequence analysis using Maximum Likelihood and Bayesian method combining with EST checking. Phylogenetic analysis of the candidate HGT genes suggested that one HGT was plant-to- B. mori transfer while nine were bacteria-to- B. mori transfer. Furthermore, functional analysis based on expression, coexpression and related literature searching revealed that several HGT candidate genes have added important characters, such as resistance to pathogen, to B. mori. Conclusions Results from this study clearly demonstrated that HGTs play an important role in the evolution of B. mori although the number of HGT events in B. mori is in general smaller than those of microbes and other insects. In particular, interdomain HGTs in B. mori may give rise to functional, persistent, and possibly evolutionarily significant new genes. PMID:21595916

Target gene analyses of 39 amelogenesis imperfecta kindreds

PubMed Central

Chan, Hui-Chen; Estrella, Ninna M. R. P.; Milkovich, Rachel N.; Kim, Jung-Wook; Simmer, James P.; Hu, Jan C-C.

2012-01-01

Previously, mutational analyses identified six disease-causing mutations in 24 amelogenesis imperfecta (AI) kindreds. We have since expanded the number of AI kindreds to 39, and performed mutation analyses covering the coding exons and adjoining intron sequences for the six proven AI candidate genes [amelogenin (AMELX), enamelin (ENAM), family with sequence similarity 83, member H (FAM83H), WD repeat containing domain 72 (WDR72), enamelysin (MMP20), and kallikrein-related peptidase 4 (KLK4)] and for ameloblastin (AMBN) (a suspected candidate gene). All four of the X-linked AI families (100%) had disease-causing mutations in AMELX, suggesting that AMELX is the only gene involved in the aetiology of X-linked AI. Eighteen families showed an autosomal-dominant pattern of inheritance. Disease-causing mutations were identified in 12 (67%): eight in FAM83H, and four in ENAM. No FAM83H coding-region or splice-junction mutations were identified in three probands with autosomal-dominant hypocalcification AI (ADHCAI), suggesting that a second gene may contribute to the aetiology of ADHCAI. Six families showed an autosomal-recessive pattern of inheritance, and disease-causing mutations were identified in three (50%): two in MMP20, and one in WDR72. No disease-causing mutations were found in 11 families with only one affected member. We conclude that mutation analyses of the current candidate genes for AI have about a 50% chance of identifying the disease-causing mutation in a given kindred. PMID:22243262

Identification of Candidate Genes Responsible for Stem Pith Production Using Expression Analysis in Solid-Stemmed Wheat.

PubMed

Oiestad, A J; Martin, J M; Cook, J; Varella, A C; Giroux, M J

2017-07-01

The wheat stem sawfly (WSS) is an economically important pest of wheat in the Northern Great Plains. The primary means of WSS control is resistance associated with the single quantitative trait locus (QTL) , which controls most stem solidness variation. The goal of this study was to identify stem solidness candidate genes via RNA-seq. This study made use of 28 single nucleotide polymorphism (SNP) makers derived from expressed sequence tags (ESTs) linked to contained within a 5.13 cM region. Allele specific expression of EST markers was examined in stem tissue for solid and hollow-stemmed pairs of two spring wheat near isogenic lines (NILs) differing for the QTL. Of the 28 ESTs, 13 were located within annotated genes and 10 had detectable stem expression. Annotated genes corresponding to four of the ESTs were differentially expressed between solid and hollow-stemmed NILs and represent possible stem solidness gene candidates. Further examination of the 5.13 cM region containing the 28 EST markers identified 260 annotated genes. Twenty of the 260 linked genes were up-regulated in hollow NIL stems, while only seven genes were up-regulated in solid NIL stems. An -methyltransferase within the region of interest was identified as a candidate based on differential expression between solid and hollow-stemmed NILs and putative function. Further study of these candidate genes may lead to the identification of the gene(s) controlling stem solidness and an increased ability to select for wheat stem solidness and manage WSS. Copyright © 2017 Crop Science Society of America.

confFuse: High-Confidence Fusion Gene Detection across Tumor Entities.

PubMed

Huang, Zhiqin; Jones, David T W; Wu, Yonghe; Lichter, Peter; Zapatka, Marc

2017-01-01

Background: Fusion genes play an important role in the tumorigenesis of many cancers. Next-generation sequencing (NGS) technologies have been successfully applied in fusion gene detection for the last several years, and a number of NGS-based tools have been developed for identifying fusion genes during this period. Most fusion gene detection tools based on RNA-seq data report a large number of candidates (mostly false positives), making it hard to prioritize candidates for experimental validation and further analysis. Selection of reliable fusion genes for downstream analysis becomes very important in cancer research. We therefore developed confFuse, a scoring algorithm to reliably select high-confidence fusion genes which are likely to be biologically relevant. Results: confFuse takes multiple parameters into account in order to assign each fusion candidate a confidence score, of which score ≥8 indicates high-confidence fusion gene predictions. These parameters were manually curated based on our experience and on certain structural motifs of fusion genes. Compared with alternative tools, based on 96 published RNA-seq samples from different tumor entities, our method can significantly reduce the number of fusion candidates (301 high-confidence from 8,083 total predicted fusion genes) and keep high detection accuracy (recovery rate 85.7%). Validation of 18 novel, high-confidence fusions detected in three breast tumor samples resulted in a 100% validation rate. Conclusions: confFuse is a novel downstream filtering method that allows selection of highly reliable fusion gene candidates for further downstream analysis and experimental validations. confFuse is available at https://github.com/Zhiqin-HUANG/confFuse.

Mannosyltransferase is required for cell wall biosynthesis, morphology and control of asexual development in Neurospora crassa.

PubMed

Bowman, Shaun M; Piwowar, Amy; Ciocca, Maria; Free, Stephen J

2005-01-01

Two Neurospora mutants with a phenotype that includes a tight colonial growth pattern, an inability to form conidia and an inability to form protoperithecia have been isolated and characterized. The relevant mutations were mapped to the same locus on the sequenced Neurospora genome. The mutations responsible for the mutant phenotype then were identified by examining likely candidate genes from the mutant genomes at the mapped locus with PCR amplification and a sequencing assay. The results demonstrate that a map and sequence strategy is a feasible way to identify mutant genes in Neurospora. The gene responsible for the phenotype is a putative alpha-1,2-mannosyltransferase gene. The mutant cell wall has an altered composition demonstrating that the gene functions in cell wall biosynthesis. The results demonstrate that the mnt-1 gene is required for normal cell wall biosynthesis, morphology and for the regulation of asexual development.

Identification of mediator complex 26 (Crsp7) gametologs on platypus X1 and Y5 sex chromosomes: a candidate testis-determining gene in monotremes?

PubMed

Tsend-Ayush, Enkhjargal; Kortschak, R Daniel; Bernard, Pascal; Lim, Shu Ly; Ryan, Janelle; Rosenkranz, Ruben; Borodina, Tatiana; Dohm, Juliane C; Himmelbauer, Heinz; Harley, Vincent R; Grützner, Frank

2012-01-01

The basal lineage of monotremes features an extraordinarily complex sex chromosome system which has provided novel insights into the evolution of mammalian sex chromosomes. Recently, sequence information from autosomes, X chromosomes, and XY-shared pseudoautosomal regions has become available. However, no gene has so far been described on any of the Y chromosome-specific regions. We analyzed sequences derived from Y-specific BAC clones to identify genes with potentially male-specific function. Here, we report the identification and characterization of the mediator complex protein gametologs on platypus Y5 (Crspy). We also identified the X-chromosomal copy which unexpectedly maps to X1 (Crspx). Sequence comparison shows extensive divergence between the X and Y copy, but we found no significant positive selection on either gametolog. Expression analysis shows widespread expression of Crspx. Crspy is expressed exclusively in males with particularly strong expression in testis and kidney. Reporter gene assays to investigate whether Crspx/y can act on the recently discovered mouse Sox9 testis-specific enhancer element did reveal a modest effect together with mouse Sox9 + Sf1, but showed overall no significant upregulation of the reporter gene. This is the first report of a differentiated functional male-specific gene on platypus Y chromosomes, providing new insights into sex chromosome evolution and a candidate gene for male-specific function in monotremes.

Identification of an expressed gene in Dipylidium caninum.

PubMed

Miranda, Rodrigo R C; Costa-Júnior, Livio M; Campos, Artur K; Santos, Hudson A; Rabelo, Elida M L

2004-10-01

Recombinant DNA studies have been focused on developing vaccines to different cestodes. But few studies involving Dipylidium caninum molecular biology and genes have been done. Only partial sequences of mitochondrial DNA and ribosomal RNA gene are available in databases. Any molecular work with this parasite, including epidemiology, study of drug-resistant strains, and vaccine development, is hampered by the lack of knowledge of its genome. Thus, the knowledge of specific genes of different developmental stages of D. caninum is crucial to locate potential targets to be used as candidates to develop a vaccine and/or new drugs against this parasite. Here we report, for the first time, the sequencing of a fragment of a D. caninum expressed gene.

Porcine transcriptome analysis based on 97 non-normalized cDNA libraries and assembly of 1,021,891 expressed sequence tags

PubMed Central

Gorodkin, Jan; Cirera, Susanna; Hedegaard, Jakob; Gilchrist, Michael J; Panitz, Frank; Jørgensen, Claus; Scheibye-Knudsen, Karsten; Arvin, Troels; Lumholdt, Steen; Sawera, Milena; Green, Trine; Nielsen, Bente J; Havgaard, Jakob H; Rosenkilde, Carina; Wang, Jun; Li, Heng; Li, Ruiqiang; Liu, Bin; Hu, Songnian; Dong, Wei; Li, Wei; Yu, Jun; Wang, Jian; Stærfeldt, Hans-Henrik; Wernersson, Rasmus; Madsen, Lone B; Thomsen, Bo; Hornshøj, Henrik; Bujie, Zhan; Wang, Xuegang; Wang, Xuefei; Bolund, Lars; Brunak, Søren; Yang, Huanming; Bendixen, Christian; Fredholm, Merete

2007-01-01

Background Knowledge of the structure of gene expression is essential for mammalian transcriptomics research. We analyzed a collection of more than one million porcine expressed sequence tags (ESTs), of which two-thirds were generated in the Sino-Danish Pig Genome Project and one-third are from public databases. The Sino-Danish ESTs were generated from one normalized and 97 non-normalized cDNA libraries representing 35 different tissues and three developmental stages. Results Using the Distiller package, the ESTs were assembled to roughly 48,000 contigs and 73,000 singletons, of which approximately 25% have a high confidence match to UniProt. Approximately 6,000 new porcine gene clusters were identified. Expression analysis based on the non-normalized libraries resulted in the following findings. The distribution of cluster sizes is scaling invariant. Brain and testes are among the tissues with the greatest number of different expressed genes, whereas tissues with more specialized function, such as developing liver, have fewer expressed genes. There are at least 65 high confidence housekeeping gene candidates and 876 cDNA library-specific gene candidates. We identified differential expression of genes between different tissues, in particular brain/spinal cord, and found patterns of correlation between genes that share expression in pairs of libraries. Finally, there was remarkable agreement in expression between specialized tissues according to Gene Ontology categories. Conclusion This EST collection, the largest to date in pig, represents an essential resource for annotation, comparative genomics, assembly of the pig genome sequence, and further porcine transcription studies. PMID:17407547

Transcriptome Profiling of Khat (Catha edulis) and Ephedra sinica Reveals Gene Candidates Potentially Involved in Amphetamine-Type Alkaloid Biosynthesis

PubMed Central

Groves, Ryan A.; Hagel, Jillian M.; Zhang, Ye; Kilpatrick, Korey; Levy, Asaf; Marsolais, Frédéric; Lewinsohn, Efraim; Sensen, Christoph W.; Facchini, Peter J.

2015-01-01

Amphetamine analogues are produced by plants in the genus Ephedra and by khat (Catha edulis), and include the widely used decongestants and appetite suppressants (1S,2S)-pseudoephedrine and (1R,2S)-ephedrine. The production of these metabolites, which derive from L-phenylalanine, involves a multi-step pathway partially mapped out at the biochemical level using knowledge of benzoic acid metabolism established in other plants, and direct evidence using khat and Ephedra species as model systems. Despite the commercial importance of amphetamine-type alkaloids, only a single step in their biosynthesis has been elucidated at the molecular level. We have employed Illumina next-generation sequencing technology, paired with Trinity and Velvet-Oases assembly platforms, to establish data-mining frameworks for Ephedra sinica and khat plants. Sequence libraries representing a combined 200,000 unigenes were subjected to an annotation pipeline involving direct searches against public databases. Annotations included the assignment of Gene Ontology (GO) terms used to allocate unigenes to functional categories. As part of our functional genomics program aimed at novel gene discovery, the databases were mined for enzyme candidates putatively involved in alkaloid biosynthesis. Queries used for mining included enzymes with established roles in benzoic acid metabolism, as well as enzymes catalyzing reactions similar to those predicted for amphetamine alkaloid metabolism. Gene candidates were evaluated based on phylogenetic relationships, FPKM-based expression data, and mechanistic considerations. Establishment of expansive sequence resources is a critical step toward pathway characterization, a goal with both academic and industrial implications. PMID:25806807

Sequence analysis of the Ras-MAPK pathway genes SOS1, EGFR & GRB2 in silver foxes (Vulpes vulpes): candidate genes for hereditary hyperplastic gingivitis.

PubMed

Clark, Jo-Anna B J; Tully, Sara J; Dawn Marshall, H

2014-12-01

Hereditary hyperplastic gingivitis (HHG) is an autosomal recessive disease that presents with progressive gingival proliferation in farmed silver foxes. Hereditary gingival fibromatosis (HGF) is an analogous condition in humans that is genetically heterogeneous with several known autosomal dominant loci. For one locus the causative mutation is in the Son of sevenless homologue 1 (SOS1) gene. For the remaining loci, the molecular mechanisms are unknown but Ras pathway involvement is suspected. Here we compare sequences for the SOS1 gene, and two adjacent genes in the Ras pathway, growth receptor bound protein 2 (GRB2) and epidermal growth factor receptor (EGFR), between HHG-affected and unaffected foxes. We conclude that the known HGF causative mutation does not cause HHG in foxes, nor do the coding regions or intron-exon boundaries of these three genes contain any candidate mutations for fox gum disease. Patterns of molecular evolution among foxes and other mammals reflect high conservation and strong functional constraints for SOS1 and GRB2 but reveal a lineage-specific pattern of variability in EGFR consistent with mutational rate differences, relaxed functional constraints, and possibly positive selection.

Cracking the genomic piggy bank: identifying secrets of the pig genome.

PubMed

Mote, B E; Rothschild, M F

2006-01-01

Though researchers are uncovering valuable information about the pig genome at unprecedented speed, the porcine genome community is barely scratching the surface as to understanding interactions of the biological code. The pig genetic linkage map has nearly 5,000 loci comprised of genes, microsatellites, and amplified fragment length polymorphism markers. Likewise, the physical map is becoming denser with nearly 6,000 markers. The long awaited sequencing efforts are providing multidimensional benefits with sequence available for comparative genomics and identifying single nucleotide polymorphisms for use in linkage and trait association studies. Scientists are using exotic and commercial breeds for quantitative trait loci scans. Additionally, candidate gene studies continue to identify chromosomal regions or genes associated with economically important traits such as growth rate, leanness, feed intake, meat quality, litter size, and disease resistance. The commercial pig industry is actively incorporating these markers in marker-assisted selection along with traditional performance information to improve said traits. Researchers are utilizing novel tools including pig microarrays along with advanced bioinformatics to identify new candidate genes, understand gene function, and piece together gene networks involved in important biological processes. Advances in pig genomics and implications to the pork industry as well as human health are reviewed.

Deep Sequencing of 71 Candidate Genes to Characterize Variation Associated with Alcohol Dependence.

PubMed

Clark, Shaunna L; McClay, Joseph L; Adkins, Daniel E; Kumar, Gaurav; Aberg, Karolina A; Nerella, Srilaxmi; Xie, Linying; Collins, Ann L; Crowley, James J; Quackenbush, Corey R; Hilliard, Christopher E; Shabalin, Andrey A; Vrieze, Scott I; Peterson, Roseann E; Copeland, William E; Silberg, Judy L; McGue, Matt; Maes, Hermine; Iacono, William G; Sullivan, Patrick F; Costello, Elizabeth J; van den Oord, Edwin J

2017-04-01

Previous genomewide association studies (GWASs) have identified a number of putative risk loci for alcohol dependence (AD). However, only a few loci have replicated and these replicated variants only explain a small proportion of AD risk. Using an innovative approach, the goal of this study was to generate hypotheses about potentially causal variants for AD that can be explored further through functional studies. We employed targeted capture of 71 candidate loci and flanking regions followed by next-generation deep sequencing (mean coverage 78X) in 806 European Americans. Regions included in our targeted capture library were genes identified through published GWAS of alcohol, all human alcohol and aldehyde dehydrogenases, reward system genes including dopaminergic and opioid receptors, prioritized candidate genes based on previous associations, and genes involved in the absorption, distribution, metabolism, and excretion of drugs. We performed single-locus tests to determine if any single variant was associated with AD symptom count. Sets of variants that overlapped with biologically meaningful annotations were tested for association in aggregate. No single, common variant was significantly associated with AD in our study. We did, however, find evidence for association with several variant sets. Two variant sets were significant at the q-value <0.10 level: a genic enhancer for ADHFE1 (p = 1.47 × 10 -5 ; q = 0.019), an alcohol dehydrogenase, and ADORA1 (p = 5.29 × 10 -5 ; q = 0.035), an adenosine receptor that belongs to a G-protein-coupled receptor gene family. To our knowledge, this is the first sequencing study of AD to examine variants in entire genes, including flanking and regulatory regions. We found that in addition to protein coding variant sets, regulatory variant sets may play a role in AD. From these findings, we have generated initial functional hypotheses about how these sets may influence AD. Copyright © 2017 by the Research Society on Alcoholism.

Connectivity Mapping for Candidate Therapeutics Identification Using Next Generation Sequencing RNA-Seq Data

PubMed Central

McArt, Darragh G.; Dunne, Philip D.; Blayney, Jaine K.; Salto-Tellez, Manuel; Van Schaeybroeck, Sandra; Hamilton, Peter W.; Zhang, Shu-Dong

2013-01-01

The advent of next generation sequencing technologies (NGS) has expanded the area of genomic research, offering high coverage and increased sensitivity over older microarray platforms. Although the current cost of next generation sequencing is still exceeding that of microarray approaches, the rapid advances in NGS will likely make it the platform of choice for future research in differential gene expression. Connectivity mapping is a procedure for examining the connections among diseases, genes and drugs by differential gene expression initially based on microarray technology, with which a large collection of compound-induced reference gene expression profiles have been accumulated. In this work, we aim to test the feasibility of incorporating NGS RNA-Seq data into the current connectivity mapping framework by utilizing the microarray based reference profiles and the construction of a differentially expressed gene signature from a NGS dataset. This would allow for the establishment of connections between the NGS gene signature and those microarray reference profiles, alleviating the associated incurring cost of re-creating drug profiles with NGS technology. We examined the connectivity mapping approach on a publicly available NGS dataset with androgen stimulation of LNCaP cells in order to extract candidate compounds that could inhibit the proliferative phenotype of LNCaP cells and to elucidate their potential in a laboratory setting. In addition, we also analyzed an independent microarray dataset of similar experimental settings. We found a high level of concordance between the top compounds identified using the gene signatures from the two datasets. The nicotine derivative cotinine was returned as the top candidate among the overlapping compounds with potential to suppress this proliferative phenotype. Subsequent lab experiments validated this connectivity mapping hit, showing that cotinine inhibits cell proliferation in an androgen dependent manner. Thus the results in this study suggest a promising prospect of integrating NGS data with connectivity mapping. PMID:23840550

Rare and Coding Region Genetic Variants Associated With Risk of Ischemic Stroke: The NHLBI Exome Sequence Project.

PubMed

Auer, Paul L; Nalls, Mike; Meschia, James F; Worrall, Bradford B; Longstreth, W T; Seshadri, Sudha; Kooperberg, Charles; Burger, Kathleen M; Carlson, Christopher S; Carty, Cara L; Chen, Wei-Min; Cupples, L Adrienne; DeStefano, Anita L; Fornage, Myriam; Hardy, John; Hsu, Li; Jackson, Rebecca D; Jarvik, Gail P; Kim, Daniel S; Lakshminarayan, Kamakshi; Lange, Leslie A; Manichaikul, Ani; Quinlan, Aaron R; Singleton, Andrew B; Thornton, Timothy A; Nickerson, Deborah A; Peters, Ulrike; Rich, Stephen S

2015-07-01

Stroke is the second leading cause of death and the third leading cause of years of life lost. Genetic factors contribute to stroke prevalence, and candidate gene and genome-wide association studies (GWAS) have identified variants associated with ischemic stroke risk. These variants often have small effects without obvious biological significance. Exome sequencing may discover predicted protein-altering variants with a potentially large effect on ischemic stroke risk. To investigate the contribution of rare and common genetic variants to ischemic stroke risk by targeting the protein-coding regions of the human genome. The National Heart, Lung, and Blood Institute (NHLBI) Exome Sequencing Project (ESP) analyzed approximately 6000 participants from numerous cohorts of European and African ancestry. For discovery, 365 cases of ischemic stroke (small-vessel and large-vessel subtypes) and 809 European ancestry controls were sequenced; for replication, 47 affected sibpairs concordant for stroke subtype and an African American case-control series were sequenced, with 1672 cases and 4509 European ancestry controls genotyped. The ESP's exome sequencing and genotyping started on January 1, 2010, and continued through June 30, 2012. Analyses were conducted on the full data set between July 12, 2012, and July 13, 2013. Discovery of new variants or genes contributing to ischemic stroke risk and subtype (primary analysis) and determination of support for protein-coding variants contributing to risk in previously published candidate genes (secondary analysis). We identified 2 novel genes associated with an increased risk of ischemic stroke: a protein-coding variant in PDE4DIP (rs1778155; odds ratio, 2.15; P = 2.63 × 10(-8)) with an intracellular signal transduction mechanism and in ACOT4 (rs35724886; odds ratio, 2.04; P = 1.24 × 10(-7)) with a fatty acid metabolism; confirmation of PDE4DIP was observed in affected sibpair families with large-vessel stroke subtype and in African Americans. Replication of protein-coding variants in candidate genes was observed for 2 previously reported GWAS associations: ZFHX3 (cardioembolic stroke) and ABCA1 (large-vessel stroke). Exome sequencing discovered 2 novel genes and mechanisms, PDE4DIP and ACOT4, associated with increased risk for ischemic stroke. In addition, ZFHX3 and ABCA1 were discovered to have protein-coding variants associated with ischemic stroke. These results suggest that genetic variation in novel pathways contributes to ischemic stroke risk and serves as a target for prediction, prevention, and therapy.

Whole-Exome Sequencing to Decipher the Genetic Heterogeneity of Hearing Loss in a Chinese Family with Deaf by Deaf Mating

PubMed Central

Qing, Jie; Yan, Denise; Zhou, Yuan; Liu, Qiong; Wu, Weijing; Xiao, Zian; Liu, Yuyuan; Liu, Jia; Du, Lilin; Xie, Dinghua; Liu, Xue Zhong

2014-01-01

Inherited deafness has been shown to have high genetic heterogeneity. For many decades, linkage analysis and candidate gene approaches have been the main tools to elucidate the genetics of hearing loss. However, this associated study design is costly, time-consuming, and unsuitable for small families. This is mainly due to the inadequate numbers of available affected individuals, locus heterogeneity, and assortative mating. Exome sequencing has now become technically feasible and a cost-effective method for detection of disease variants underlying Mendelian disorders due to the recent advances in next-generation sequencing (NGS) technologies. In the present study, we have combined both the Deafness Gene Mutation Detection Array and exome sequencing to identify deafness causative variants in a large Chinese composite family with deaf by deaf mating. The simultaneous screening of the 9 common deafness mutations using the allele-specific PCR based universal array, resulted in the identification of the 1555A>G in the mitochondrial DNA (mtDNA) 12S rRNA in affected individuals in one branch of the family. We then subjected the mutation-negative cases to exome sequencing and identified novel causative variants in the MYH14 and WFS1 genes. This report confirms the effective use of a NGS technique to detect pathogenic mutations in affected individuals who were not candidates for classical genetic studies. PMID:25289672

Chromosome-based survey sequencing reveals the genome organization of wild wheat progenitor Triticum dicoccoides.

PubMed

Akpinar, Bala Ani; Biyiklioglu, Sezgi; Alptekin, Burcu; Havránková, Miroslava; Vrána, Jan; Doležel, Jaroslav; Distelfeld, Assaf; Hernandez, Pilar; Budak, Hikmet

2018-05-04

Wild emmer wheat (Triticum turgidum ssp. dicoccoides) is the progenitor of wheat. We performed chromosome-based survey sequencing of the 14 chromosomes, examining repetitive sequences, protein-coding genes, miRNA/target pairs and tRNA genes, as well as syntenic relationships with related grasses. We found considerable differences in the content and distribution of repetitive sequences between the A and B subgenomes. The gene contents of individual chromosomes varied widely, not necessarily correlating with chromosome size. We catalogued candidate agronomically important loci, along with new alleles and flanking sequences that can be used to design exome sequencing. Syntenic relationships and virtual gene orders revealed several small-scale evolutionary rearrangements, in addition to providing evidence for the 4AL-5AL-7BS translocation in wild emmer wheat. Chromosome-based sequence assemblies contained five novel miRNA families, among 59 families putatively encoded in the entire genome which provide insight into the domestication of wheat and an overview of the genome content and organization. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Permanent Draft Genome Sequence of Nocardia sp. BMG111209, an Actinobacterium Isolated from Nodules of Casuarina glauca

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ghodhbane-Gtari, Faten; Beauchemin, Nicholas; Gueddou, Abdellatif

Nocardiasp. strain BMG111209 is a non-Frankiaactinobacterium isolated from root nodules ofCasuarina glaucain Tunisia. Here, we report the 9.1-Mbp draft genome sequence ofNocardiasp. strain BMG111209 with a G + C content of 69.19% and 8,122 candidate protein-encoding genes.

Permanent Draft Genome Sequence of Nocardia sp. BMG111209, an Actinobacterium Isolated from Nodules of Casuarina glauca

DOE PAGES

Ghodhbane-Gtari, Faten; Beauchemin, Nicholas; Gueddou, Abdellatif; ...

2016-08-04

Nocardiasp. strain BMG111209 is a non-Frankiaactinobacterium isolated from root nodules ofCasuarina glaucain Tunisia. Here, we report the 9.1-Mbp draft genome sequence ofNocardiasp. strain BMG111209 with a G + C content of 69.19% and 8,122 candidate protein-encoding genes.

HomozygosityMapper2012--bridging the gap between homozygosity mapping and deep sequencing.

PubMed

Seelow, Dominik; Schuelke, Markus

2012-07-01

Homozygosity mapping is a common method to map recessive traits in consanguineous families. To facilitate these analyses, we have developed HomozygosityMapper, a web-based approach to homozygosity mapping. HomozygosityMapper allows researchers to directly upload the genotype files produced by the major genotyping platforms as well as deep sequencing data. It detects stretches of homozygosity shared by the affected individuals and displays them graphically. Users can interactively inspect the underlying genotypes, manually refine these regions and eventually submit them to our candidate gene search engine GeneDistiller to identify the most promising candidate genes. Here, we present the new version of HomozygosityMapper. The most striking new feature is the support of Next Generation Sequencing *.vcf files as input. Upon users' requests, we have implemented the analysis of common experimental rodents as well as of important farm animals. Furthermore, we have extended the options for single families and loss of heterozygosity studies. Another new feature is the export of *.bed files for targeted enrichment of the potential disease regions for deep sequencing strategies. HomozygosityMapper also generates files for conventional linkage analyses which are already restricted to the possible disease regions, hence superseding CPU-intensive genome-wide analyses. HomozygosityMapper is freely available at http://www.homozygositymapper.org/.

Mapping a candidate gene (MdMYB10) for red flesh and foliage colour in apple

PubMed Central

Chagné, David; Carlisle, Charmaine M; Blond, Céline; Volz, Richard K; Whitworth, Claire J; Oraguzie, Nnadozie C; Crowhurst, Ross N; Allan, Andrew C; Espley, Richard V; Hellens, Roger P; Gardiner, Susan E

2007-01-01

Background Integrating plant genomics and classical breeding is a challenge for both plant breeders and molecular biologists. Marker-assisted selection (MAS) is a tool that can be used to accelerate the development of novel apple varieties such as cultivars that have fruit with anthocyanin through to the core. In addition, determining the inheritance of novel alleles, such as the one responsible for red flesh, adds to our understanding of allelic variation. Our goal was to map candidate anthocyanin biosynthetic and regulatory genes in a population segregating for the red flesh phenotypes. Results We have identified the Rni locus, a major genetic determinant of the red foliage and red colour in the core of apple fruit. In a population segregating for the red flesh and foliage phenotype we have determined the inheritance of the Rni locus and DNA polymorphisms of candidate anthocyanin biosynthetic and regulatory genes. Simple Sequence Repeats (SSRs) and Single Nucleotide Polymorphisms (SNPs) in the candidate genes were also located on an apple genetic map. We have shown that the MdMYB10 gene co-segregates with the Rni locus and is on Linkage Group (LG) 09 of the apple genome. Conclusion We have performed candidate gene mapping in a fruit tree crop and have provided genetic evidence that red colouration in the fruit core as well as red foliage are both controlled by a single locus named Rni. We have shown that the transcription factor MdMYB10 may be the gene underlying Rni as there were no recombinants between the marker for this gene and the red phenotype in a population of 516 individuals. Associating markers derived from candidate genes with a desirable phenotypic trait has demonstrated the application of genomic tools in a breeding programme of a horticultural crop species. PMID:17608951

Elevated transcription factor specificity protein 1 in autistic brains alters the expression of autism candidate genes.

PubMed

Thanseem, Ismail; Anitha, Ayyappan; Nakamura, Kazuhiko; Suda, Shiro; Iwata, Keiko; Matsuzaki, Hideo; Ohtsubo, Masafumi; Ueki, Takatoshi; Katayama, Taiichi; Iwata, Yasuhide; Suzuki, Katsuaki; Minoshima, Shinsei; Mori, Norio

2012-03-01

Profound changes in gene expression can result from abnormalities in the concentrations of sequence-specific transcription factors like specificity protein 1 (Sp1). Specificity protein 1 binding sites have been reported in the promoter regions of several genes implicated in autism. We hypothesize that dysfunction of Sp1 could affect the expression of multiple autism candidate genes, contributing to the heterogeneity of autism. We assessed any alterations in the expression of Sp1 and that of autism candidate genes in the postmortem brain (anterior cingulate gyrus [ACG], motor cortex, and thalamus) of autism patients (n = 8) compared with healthy control subjects (n = 13). Alterations in the expression of candidate genes upon Sp1/DNA binding inhibition with mithramycin and Sp1 silencing by RNAi were studied in SK-N-SH neuronal cells. We observed elevated expression of Sp1 in ACG of autism patients (p = .010). We also observed altered expression of several autism candidate genes. GABRB3, RELN, and HTR2A showed reduced expression, whereas CD38, ITGB3, MAOA, MECP2, OXTR, and PTEN showed elevated expression in autism. In SK-N-SH cells, OXTR, PTEN, and RELN showed reduced expression upon Sp1/DNA binding inhibition and Sp1 silencing. The RNA integrity number was not available for any of the samples. Transcription factor Sp1 is dysfunctional in the ACG of autistic brain. Consequently, the expression of potential autism candidate genes regulated by Sp1, especially OXTR and PTEN, could be affected. The diverse downstream pathways mediated by the Sp1-regulated genes, along with the environmental and intracellular signal-related regulation of Sp1, could explain the complex phenotypes associated with autism.

Identification of candidate transmission-blocking antigen genes in Theileria annulata and related vector-borne apicomplexan parasites.

PubMed

Lempereur, Laetitia; Larcombe, Stephen D; Durrani, Zeeshan; Karagenc, Tulin; Bilgic, Huseyin Bilgin; Bakirci, Serkan; Hacilarlioglu, Selin; Kinnaird, Jane; Thompson, Joanne; Weir, William; Shiels, Brian

2017-06-05

Vector-borne apicomplexan parasites are a major cause of mortality and morbidity to humans and livestock globally. The most important disease syndromes caused by these parasites are malaria, babesiosis and theileriosis. Strategies for control often target parasite stages in the mammalian host that cause disease, but this can result in reservoir infections that promote pathogen transmission and generate economic loss. Optimal control strategies should protect against clinical disease, block transmission and be applicable across related genera of parasites. We have used bioinformatics and transcriptomics to screen for transmission-blocking candidate antigens in the tick-borne apicomplexan parasite, Theileria annulata. A number of candidate antigen genes were identified which encoded amino acid domains that are conserved across vector-borne Apicomplexa (Babesia, Plasmodium and Theileria), including the Pfs48/45 6-cys domain and a novel cysteine-rich domain. Expression profiling confirmed that selected candidate genes are expressed by life cycle stages within infected ticks. Additionally, putative B cell epitopes were identified in the T. annulata gene sequences encoding the 6-cys and cysteine rich domains, in a gene encoding a putative papain-family cysteine peptidase, with similarity to the Plasmodium SERA family, and the gene encoding the T. annulata major merozoite/piroplasm surface antigen, Tams1. Candidate genes were identified that encode proteins with similarity to known transmission blocking candidates in related parasites, while one is a novel candidate conserved across vector-borne apicomplexans and has a potential role in the sexual phase of the life cycle. The results indicate that a 'One Health' approach could be utilised to develop a transmission-blocking strategy effective against vector-borne apicomplexan parasites of animals and humans.

Genetic Variants Identified from Epilepsy of Unknown Etiology in Chinese Children by Targeted Exome Sequencing

PubMed Central

Wang, Yimin; Du, Xiaonan; Bin, Rao; Yu, Shanshan; Xia, Zhezhi; Zheng, Guo; Zhong, Jianmin; Zhang, Yunjian; Jiang, Yong-hui; Wang, Yi

2017-01-01

Genetic factors play a major role in the etiology of epilepsy disorders. Recent genomics studies using next generation sequencing (NGS) technique have identified a large number of genetic variants including copy number (CNV) and single nucleotide variant (SNV) in a small set of genes from individuals with epilepsy. These discoveries have contributed significantly to evaluate the etiology of epilepsy in clinic and lay the foundation to develop molecular specific treatment. However, the molecular basis for a majority of epilepsy patients remains elusive, and furthermore, most of these studies have been conducted in Caucasian children. Here we conducted a targeted exome-sequencing of 63 trios of Chinese epilepsy families using a custom-designed NGS panel that covers 412 known and candidate genes for epilepsy. We identified pathogenic and likely pathogenic variants in 15 of 63 (23.8%) families in known epilepsy genes including SCN1A, CDKL5, STXBP1, CHD2, SCN3A, SCN9A, TSC2, MBD5, POLG and EFHC1. More importantly, we identified likely pathologic variants in several novel candidate genes such as GABRE, MYH1, and CLCN6. Our results provide the evidence supporting the application of custom-designed NGS panel in clinic and indicate a conserved genetic susceptibility for epilepsy between Chinese and Caucasian children. PMID:28074849

Using whole-exome sequencing to investigate the genetic bases of lysosomal storage diseases of unknown etiology.

PubMed

Wang, Nan; Zhang, Yeting; Gedvilaite, Erika; Loh, Jui Wan; Lin, Timothy; Liu, Xiuping; Liu, Chang-Gong; Kumar, Dibyendu; Donnelly, Robert; Raymond, Kimiyo; Schuchman, Edward H; Sleat, David E; Lobel, Peter; Xing, Jinchuan

2017-11-01

Lysosomes are membrane-bound, acidic eukaryotic cellular organelles that play important roles in the degradation of macromolecules. Mutations that cause the loss of lysosomal protein function can lead to a group of disorders categorized as the lysosomal storage diseases (LSDs). Suspicion of LSD is frequently based on clinical and pathologic findings, but in some cases, the underlying genetic and biochemical defects remain unknown. Here, we performed whole-exome sequencing (WES) on 14 suspected LSD cases to evaluate the feasibility of using WES for identifying causal mutations. By examining 2,157 candidate genes potentially associated with lysosomal function, we identified eight variants in five genes as candidate disease-causing variants in four individuals. These included both known and novel mutations. Variants were corroborated by targeted sequencing and, when possible, functional assays. In addition, we identified nonsense mutations in two individuals in genes that are not known to have lysosomal function. However, mutations in these genes could have resulted in phenotypes that were diagnosed as LSDs. This study demonstrates that WES can be used to identify causal mutations in suspected LSD cases. We also demonstrate cases where a confounding clinical phenotype may potentially reflect more than one lysosomal protein defect. © 2017 Wiley Periodicals, Inc.

Association analysis of single nucleotide polymorphisms in candidate genes with root traits in maize (Zea mays L.) seedlings.

PubMed

Kumar, Bharath; Abdel-Ghani, Adel H; Pace, Jordon; Reyes-Matamoros, Jenaro; Hochholdinger, Frank; Lübberstedt, Thomas

2014-07-01

Several genes involved in maize root development have been isolated. Identification of SNPs associated with root traits would enable the selection of maize lines with better root architecture that might help to improve N uptake, and consequently plant growth particularly under N deficient conditions. In the present study, an association study (AS) panel consisting of 74 maize inbred lines was screened for seedling root traits in 6, 10, and 14-day-old seedlings. Allele re-sequencing of candidate root genes Rtcl, Rth3, Rum1, and Rul1 was also carried out in the same AS panel lines. All four candidate genes displayed different levels of nucleotide diversity, haplotype diversity and linkage disequilibrium. Gene based association analyses were carried out between individual polymorphisms in candidate genes, and root traits measured in 6, 10, and 14-day-old maize seedlings. Association analyses revealed several polymorphisms within the Rtcl, Rth3, Rum1, and Rul1 genes associated with seedling root traits. Several nucleotide polymorphisms in Rtcl, Rth3, Rum1, and Rul1 were significantly (P<0.05) associated with seedling root traits in maize suggesting that all four tested genes are involved in the maize root development. Thus considerable allelic variation present in these root genes can be exploited for improving maize root characteristics. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

PubMed Central

2012-01-01

Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs) and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants. PMID:22883984

Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia.

PubMed

Zuiter, Afnan Saeid; Sawwan, Jammal; Al Abdallat, Ayed

2012-08-10

Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs) and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

Converging evidence that sequence variations in the novel candidate gene MAP2K7 (MKK7) are functionally associated with schizophrenia.

PubMed

Winchester, Catherine L; Ohzeki, Hiromitsu; Vouyiouklis, Demetrius A; Thompson, Rhiannon; Penninger, Josef M; Yamagami, Keiji; Norrie, John D; Hunter, Robert; Pratt, Judith A; Morris, Brian J

2012-11-15

Schizophrenia is a debilitating psychiatric disease with a strong genetic contribution, potentially linked to altered glutamatergic function in brain regions such as the prefrontal cortex (PFC). Here, we report converging evidence to support a functional candidate gene for schizophrenia. In post-mortem PFC from patients with schizophrenia, we detected decreased expression of MKK7/MAP2K7-a kinase activated by glutamatergic activity. While mice lacking one copy of the Map2k7 gene were overtly normal in a variety of behavioural tests, these mice showed a schizophrenia-like cognitive phenotype of impaired working memory. Additional support for MAP2K7 as a candidate gene came from a genetic association study. A substantial effect size (odds ratios: ~1.9) was observed for a common variant in a cohort of case and control samples collected in the Glasgow area and also in a replication cohort of samples of Northern European descent (most significant P-value: 3 × 10(-4)). While some caution is warranted until these association data are further replicated, these results are the first to implicate the candidate gene MAP2K7 in genetic risk for schizophrenia. Complete sequencing of all MAP2K7 exons did not reveal any non-synonymous mutations. However, the MAP2K7 haplotype appeared to have functional effects, in that it influenced the level of expression of MAP2K7 mRNA in human PFC. Taken together, the results imply that reduced function of the MAP2K7-c-Jun N-terminal kinase (JNK) signalling cascade may underlie some of the neurochemical changes and core symptoms in schizophrenia.

Transcriptome sequencing analysis of novel sRNAs of Kineococcus radiotolerans in response to ionizing radiation.

PubMed

Chen, Zhouwei; Li, Lufeng; Shan, Zhan; Huang, Hannian; Chen, Huan; Ding, Xianfeng; Guo, Jiangfeng; Liu, Lili

2016-11-01

Kineococcus radiotolerans is a Gram-positive, radio-resistant bacterium isolated from a radioactive environment. The small noncoding RNAs (sRNAs) in bacteria are reported to play roles in the immediate response to stress and/or the recovery from stress. The analysis of K. radiotolerans transcriptome sequencing results can identify these sRNAs in a genome-wide detection, using RNA sequencing (RNA-seq) by the deep sequencing technique. In this study, the raw data of radiation-exposed samples (RS) and control samples (CS) were acquired separately from the sequencing platform. There were 217 common sRNA candidates in the two samples screened in the genome-wide scale by bioinformatics analysis. There were 43 differentially expressed sRNA candidates, including 28 up-regulated and 15 down-regulated ones. The down-regulated sRNAs were selected for the sRNA target prediction, of which 12 sRNAs that may modulate the genes related to the transcription regulation and DNA repair were considered as the candidates involved in the radio-resistance regulation system. Copyright © 2016 Elsevier GmbH. All rights reserved.

Construction of a high-density genetic map by specific locus amplified fragment sequencing (SLAF-seq) and its application to Quantitative Trait Loci (QTL) analysis for boll weight in upland cotton (Gossypium hirsutum.).

PubMed

Zhang, Zhen; Shang, Haihong; Shi, Yuzhen; Huang, Long; Li, Junwen; Ge, Qun; Gong, Juwu; Liu, Aiying; Chen, Tingting; Wang, Dan; Wang, Yanling; Palanga, Koffi Kibalou; Muhammad, Jamshed; Li, Weijie; Lu, Quanwei; Deng, Xiaoying; Tan, Yunna; Song, Weiwu; Cai, Juan; Li, Pengtao; Rashid, Harun or; Gong, Wankui; Yuan, Youlu

2016-04-11

Upland Cotton (Gossypium hirsutum) is one of the most important worldwide crops it provides natural high-quality fiber for the industrial production and everyday use. Next-generation sequencing is a powerful method to identify single nucleotide polymorphism markers on a large scale for the construction of a high-density genetic map for quantitative trait loci mapping. In this research, a recombinant inbred lines population developed from two upland cotton cultivars 0-153 and sGK9708 was used to construct a high-density genetic map through the specific locus amplified fragment sequencing method. The high-density genetic map harbored 5521 single nucleotide polymorphism markers which covered a total distance of 3259.37 cM with an average marker interval of 0.78 cM without gaps larger than 10 cM. In total 18 quantitative trait loci of boll weight were identified as stable quantitative trait loci and were detected in at least three out of 11 environments and explained 4.15-16.70 % of the observed phenotypic variation. In total, 344 candidate genes were identified within the confidence intervals of these stable quantitative trait loci based on the cotton genome sequence. These genes were categorized based on their function through gene ontology analysis, Kyoto Encyclopedia of Genes and Genomes analysis and eukaryotic orthologous groups analysis. This research reported the first high-density genetic map for Upland Cotton (Gossypium hirsutum) with a recombinant inbred line population using single nucleotide polymorphism markers developed by specific locus amplified fragment sequencing. We also identified quantitative trait loci of boll weight across 11 environments and identified candidate genes within the quantitative trait loci confidence intervals. The results of this research would provide useful information for the next-step work including fine mapping, gene functional analysis, pyramiding breeding of functional genes as well as marker-assisted selection.

Construction of a yeast artificial chromosome contig encompassing the chromosome 14 Alzheimer`s disease locus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sharma, V.; Bonnycastle, L.; Poorkai, P.

1994-09-01

We have constructed a yeast artificial chromosome (YAC) contig of chromosome 14q24.3 which encompasses the chromosome 14 Alzheimer`s disease locus (AD3). Determined by linkage analysis of early-onset Alzheimer`s disease kindreds, this interval is bounded by the genetic markers D14S61-D14S63 and spans approximately 15 centimorgans. The contig consists of 29 markers and 74 YACs of which 57 are defined by one or more sequence tagged sites (STSs). The STS markers comprise 5 genes, 16 short tandem repeat polymorphisms and 8 cDNA clones. An additional number of genes, expressed sequence tags and cDNA fragments have been identified and localized to the contigmore » by hybridization and sequence analysis of anonymous clones isolated by cDNA direct selection techniques. A minimal contig of about 15 YACs averaging 0.5-1.5 megabase in length will span this interval and is, at first approximation, in rough agreement with the genetic map. For two regions of the contig, our coverage has relied on L1/THE fingerprint and Alu-PCR hybridization data of YACs provided by CEPH/Genethon. We are currently developing sequence tagged sites from these to confirm the overlaps revealed by the fingerprint data. Among the genes which map to the contig are transforming growth factor beta 3, c-fos, and heat shock protein 2A (HSPA2). C-fos is not a candidate gene for AD3 based on the sequence analysis of affected and unaffected individuals. HSPA2 maps to the proximal edge of the contig and Calmodulin 1, a candidate gene from 4q24.3, maps outside of the region. The YAC contig is a framework physical map from which cosmid or P1 clone contigs can be constructed. As more genes and cDNAs are mapped, a highly resolved transcription map will emerge, a necessary step towards positionally cloning the AD3 gene.« less

Acquisition and evolution of plant pathogenesis-associated gene clusters and candidate determinants of tissue-specificity in xanthomonas.

PubMed

Lu, Hong; Patil, Prabhu; Van Sluys, Marie-Anne; White, Frank F; Ryan, Robert P; Dow, J Maxwell; Rabinowicz, Pablo; Salzberg, Steven L; Leach, Jan E; Sonti, Ramesh; Brendel, Volker; Bogdanove, Adam J

2008-01-01

Xanthomonas is a large genus of plant-associated and plant-pathogenic bacteria. Collectively, members cause diseases on over 392 plant species. Individually, they exhibit marked host- and tissue-specificity. The determinants of this specificity are unknown. To assess potential contributions to host- and tissue-specificity, pathogenesis-associated gene clusters were compared across genomes of eight Xanthomonas strains representing vascular or non-vascular pathogens of rice, brassicas, pepper and tomato, and citrus. The gum cluster for extracellular polysaccharide is conserved except for gumN and sequences downstream. The xcs and xps clusters for type II secretion are conserved, except in the rice pathogens, in which xcs is missing. In the otherwise conserved hrp cluster, sequences flanking the core genes for type III secretion vary with respect to insertion sequence element and putative effector gene content. Variation at the rpf (regulation of pathogenicity factors) cluster is more pronounced, though genes with established functional relevance are conserved. A cluster for synthesis of lipopolysaccharide varies highly, suggesting multiple horizontal gene transfers and reassortments, but this variation does not correlate with host- or tissue-specificity. Phylogenetic trees based on amino acid alignments of gum, xps, xcs, hrp, and rpf cluster products generally reflect strain phylogeny. However, amino acid residues at four positions correlate with tissue specificity, revealing hpaA and xpsD as candidate determinants. Examination of genome sequences of xanthomonads Xylella fastidiosa and Stenotrophomonas maltophilia revealed that the hrp, gum, and xcs clusters are recent acquisitions in the Xanthomonas lineage. Our results provide insight into the ancestral Xanthomonas genome and indicate that differentiation with respect to host- and tissue-specificity involved not major modifications or wholesale exchange of clusters, but subtle changes in a small number of genes or in non-coding sequences, and/or differences outside the clusters, potentially among regulatory targets or secretory substrates.

COL5A1: Genetic mapping and exclusion as candidate gene in families with nail-patella syndrome, tuberous sclerosis 1, hereditary hemorrhagic telangiectasia, and Ehlers-Danlos syndrome type II

DOE Office of Scientific and Technical Information (OSTI.GOV)

Greenspan, D.S.; Northrup, H.; Au, K.S.

1995-02-10

COL5A1, the gene for the {alpha}1 chain of type V collagen, has been considered a candidate gene for certain diseases based on chromosomal location and/or disease phenotype. We have employed 3{prime}-untranslated region RFLPs to exclude COL5A1 as a candidate gene in families with tuberous sclerosis 1, Ehlers-Danlos syndrome type H, and nail-patella syndrome. In addition, we describe a polymorphic simple sequence repeat (SSR) within a COL5A1 intron. This SSR is used to exclude COL5A1 as a candidate gene in hereditary hemorrhagic telangiectasia (Osler-Rendu-Weber disease) and to add COL5A1 to the existing map of {open_quotes}index{close_quotes} markers of chromosome 9 by evaluationmore » of the COL5A1 locus on the CEPH 40-family reference pedigree set. This genetic mapping places COL5A1 between markers D9S66 and D9S67. 14 refs., 1 fig., 2 tabs.« less

454 pyrosequencing based transcriptome analysis of Zygaena filipendulae with focus on genes involved in biosynthesis of cyanogenic glucosides.

PubMed

Zagrobelny, Mika; Scheibye-Alsing, Karsten; Jensen, Niels Bjerg; Møller, Birger Lindberg; Gorodkin, Jan; Bak, Søren

2009-12-02

An essential driving component in the co-evolution of plants and insects is the ability to produce and handle bioactive compounds. Plants produce bioactive natural products for defense, but some insects detoxify and/or sequester the compounds, opening up for new niches with fewer competitors. To study the molecular mechanism behind the co-adaption in plant-insect interactions, we have investigated the interactions between Lotus corniculatus and Zygaena filipendulae. They both contain cyanogenic glucosides which liberate toxic hydrogen cyanide upon breakdown. Moths belonging to the Zygaena family are the only insects known, able to carry out both de novo biosynthesis and sequestration of the same cyanogenic glucosides as those from their feed plants. The biosynthetic pathway for cyanogenic glucoside biosynthesis in Z. filipendulae proceeds using the same intermediates as in the well known pathway from plants, but none of the enzymes responsible have been identified. A genomics strategy founded on 454 pyrosequencing of the Z. filipendulae transcriptome was undertaken to identify some of these enzymes in Z. filipendulae. Comparisons of the Z. filipendulae transcriptome with the sequenced genomes of Bombyx mori, Drosophila melanogaster, Tribolium castaneum, Apis mellifera and Anopheles gambiae indicate a high coverage of the Z. filipendulae transcriptome. 11% of the Z. filipendulae transcriptome sequences were assigned to Gene Ontology categories. Candidate genes for enzymes functioning in the biosynthesis of cyanogenic glucosides (cytochrome P450 and family 1 glycosyltransferases) were identified based on sequence length, number of copies and presence/absence of close homologs in D. melanogaster, B. mori and the cyanogenic butterfly Heliconius. Examination of biased codon usage, GC content and selection on gene candidates support the notion of cyanogenesis as an "old" trait within Ditrysia, as well as its origins being convergent between plants and insects. Pyrosequencing is an attractive approach to gain access to genes in the biosynthesis of bio-active natural products from insects and other organisms, for which the genome sequence is not known. Based on analysis of the Z. filipendulae transcriptome, promising gene candidates for biosynthesis of cyanogenic glucosides was identified, and the suitability of Z. filipendulae as a model system for cyanogenesis in insects is evident.

Sympatric ecological speciation meets pyrosequencing: sampling the transcriptome of the apple maggot Rhagoletis pomonella

PubMed Central

2009-01-01

Background The full power of modern genetics has been applied to the study of speciation in only a small handful of genetic model species - all of which speciated allopatrically. Here we report the first large expressed sequence tag (EST) study of a candidate for ecological sympatric speciation, the apple maggot Rhagoletis pomonella, using massively parallel pyrosequencing on the Roche 454-FLX platform. To maximize transcript diversity we created and sequenced separate libraries from larvae, pupae, adult heads, and headless adult bodies. Results We obtained 239,531 sequences which assembled into 24,373 contigs. A total of 6810 unique protein coding genes were identified among the contigs and long singletons, corresponding to 48% of all known Drosophila melanogaster protein-coding genes. Their distribution across GO classes suggests that we have obtained a representative sample of the transcriptome. Among these sequences are many candidates for potential R. pomonella "speciation genes" (or "barrier genes") such as those controlling chemosensory and life-history timing processes. Furthermore, we identified important marker loci including more than 40,000 single nucleotide polymorphisms (SNPs) and over 100 microsatellites. An initial search for SNPs at which the apple and hawthorn host races differ suggested at least 75 loci warranting further work. We also determined that developmental expression differences remained even after normalization; transcripts expected to show different expression levels between larvae and pupae in D. melanogaster also did so in R. pomonella. Preliminary comparative analysis of transcript presences and absences revealed evidence of gene loss in Drosophila and gain in the higher dipteran clade Schizophora. Conclusions These data provide a much needed resource for exploring mechanisms of divergence in this important model for sympatric ecological speciation. Our description of ESTs from a substantial portion of the R. pomonella transcriptome will facilitate future functional studies of candidate genes for olfaction and diapause-related life history timing, and will enable large scale expression studies. Similarly, the identification of new SNP and microsatellite markers will facilitate future population and quantitative genetic studies of divergence between the apple and hawthorn-infesting host races. PMID:20035631

A population of deletion mutants and an integrated mapping and Exome-seq pipeline for gene discovery in maize

USDA-ARS?s Scientific Manuscript database

To better understand maize endosperm filling and maturation, we developed a novel functional genomics platform that combined Bulked Segregant RNA and Exome sequencing (BSREx-seq) to map causative mutations and identify candidate genes within mapping intervals. Using gamma-irradiation of B73 maize to...

Two siblings with early infantile myoclonic encephalopathy due to mutation in the gene encoding mitochondrial glutamate/H+ symporter SLC25A22.

PubMed

Cohen, Rony; Basel-Vanagaite, Lina; Goldberg-Stern, Hadassah; Halevy, Ayelet; Shuper, Avinoam; Feingold-Zadok, Michal; Behar, Doron M; Straussberg, Rachel

2014-11-01

To characterize a new subset of early myoclonic encephalopathy usually associated with metabolic etiologies with a new genetic entity. We describe two siblings with early myoclonic encephalopathy born to consanguineous parents of Arab Muslim origin from Israel. We used homozygosity mapping and candidate gene sequencing to reveal the genetic basis of the myoclonic syndrome. We found a rare missense mutation in the gene encoding one of the two mitochondrial glutamate/H symporters, SLC25A22. The phenotype of early myoclonic encephalopathy was first linked to the same mutation in 2005 in patients of the same ethnicity as our family. Owing to the devastating nature of this encephalopathy, we focus attention on its clinical history, epileptic semiology, distinct electroencephalography features, and genetic basis. We provide the evidence that an integrated diagnostic strategy combining homozygosity mapping with candidate gene sequencing is efficient in consanguineous families with highly heterogeneous autosomal recessive diseases. Copyright © 2014 European Paediatric Neurology Society. Published by Elsevier Ltd. All rights reserved.

Advances in QTL Mapping in Pigs

PubMed Central

Rothschild, Max F.; Hu, Zhi-liang; Jiang, Zhihua

2007-01-01

Over the past 15 years advances in the porcine genetic linkage map and discovery of useful candidate genes have led to valuable gene and trait information being discovered. Early use of exotic breed crosses and now commercial breed crosses for quantitative trait loci (QTL) scans and candidate gene analyses have led to 110 publications which have identified 1,675 QTL. Additionally, these studies continue to identify genes associated with economically important traits such as growth rate, leanness, feed intake, meat quality, litter size, and disease resistance. A well developed QTL database called PigQTLdb is now as a valuable tool for summarizing and pinpointing in silico regions of interest to researchers. The commercial pig industry is actively incorporating these markers in marker-assisted selection along with traditional performance information to improve traits of economic performance. The long awaited sequencing efforts are also now beginning to provide sequence available for both comparative genomics and large scale single nucleotide polymorphism (SNP) association studies. While these advances are all positive, development of useful new trait families and measurement of new or underlying traits still limits future discoveries. A review of these developments is presented. PMID:17384738

Identification of gene-specific polymorphisms and association with capsaicin pathway metabolites in Capsicum annuum L. collections.

PubMed

Reddy, Umesh K; Almeida, Aldo; Abburi, Venkata L; Alaparthi, Suresh Babu; Unselt, Desiree; Hankins, Gerald; Park, Minkyu; Choi, Doil; Nimmakayala, Padma

2014-01-01

Pepper (Capsicum annuum L.) is an economically important crop with added nutritional value. Production of capsaicin is an important quantitative trait with high environmental variance, so the development of markers regulating capsaicinoid accumulation is important for pepper breeding programs. In this study, we performed association mapping at the gene level to identify single nucleotide polymorphisms (SNPs) associated with capsaicin pathway metabolites in a diverse Capsicum annuum collection during two seasons. The genes Pun1, CCR, KAS and HCT were sequenced and matched with the whole-genome sequence draft of pepper to identify SNP locations and for further characterization. The identified SNPs for each gene underwent candidate gene association mapping. Association mapping results revealed Pun1 as a key regulator of major metabolites in the capsaicin pathway mainly affecting capsaicinoids and precursors for acyl moieties of capsaicinoids. Six different SNPs in the promoter sequence of Pun1 were found associated with capsaicin in plants from both seasons. Our results support that CCR is an important control point for the flux of p-coumaric acid to specific biosynthesis pathways. KAS was found to regulate the major precursors for acyl moieties of capsaicinoids and may play a key role in capsaicinoid production. Candidate gene association mapping of Pun1 suggested that the accumulation of capsaicinoids depends on the expression of Pun1, as revealed by the most important associated SNPs found in the promoter region of Pun1.

Identification of Gene-Specific Polymorphisms and Association with Capsaicin Pathway Metabolites in Capsicum annuum L. Collections

PubMed Central

Abburi, Venkata L.; Alaparthi, Suresh Babu; Unselt, Desiree; Hankins, Gerald; Park, Minkyu; Choi, Doil

2014-01-01

Pepper (Capsicum annuum L.) is an economically important crop with added nutritional value. Production of capsaicin is an important quantitative trait with high environmental variance, so the development of markers regulating capsaicinoid accumulation is important for pepper breeding programs. In this study, we performed association mapping at the gene level to identify single nucleotide polymorphisms (SNPs) associated with capsaicin pathway metabolites in a diverse Capsicum annuum collection during two seasons. The genes Pun1, CCR, KAS and HCT were sequenced and matched with the whole-genome sequence draft of pepper to identify SNP locations and for further characterization. The identified SNPs for each gene underwent candidate gene association mapping. Association mapping results revealed Pun1 as a key regulator of major metabolites in the capsaicin pathway mainly affecting capsaicinoids and precursors for acyl moieties of capsaicinoids. Six different SNPs in the promoter sequence of Pun1 were found associated with capsaicin in plants from both seasons. Our results support that CCR is an important control point for the flux of p-coumaric acid to specific biosynthesis pathways. KAS was found to regulate the major precursors for acyl moieties of capsaicinoids and may play a key role in capsaicinoid production. Candidate gene association mapping of Pun1 suggested that the accumulation of capsaicinoids depends on the expression of Pun1, as revealed by the most important associated SNPs found in the promoter region of Pun1. PMID:24475113

Transcriptome Analysis of Leaves, Flowers and Fruits Perisperm of Coffea arabica L. Reveals the Differential Expression of Genes Involved in Raffinose Biosynthesis

PubMed Central

dos Santos, Tiago Benedito; de Oliveira, Fernanda Freitas; Pot, David; Leroy, Thierry; Vieira, Luiz Gonzaga Esteves; Carazzolle, Marcelo Falsarella; Pereira, Gonçalo Amarante Guimarães

2017-01-01

Coffea arabica L. is an important crop in several developing countries. Despite its economic importance, minimal transcriptome data are available for fruit tissues, especially during fruit development where several compounds related to coffee quality are produced. To understand the molecular aspects related to coffee fruit and grain development, we report a large-scale transcriptome analysis of leaf, flower and perisperm fruit tissue development. Illumina sequencing yielded 41,881,572 high-quality filtered reads. De novo assembly generated 65,364 unigenes with an average length of 1,264 bp. A total of 24,548 unigenes were annotated as protein coding genes, including 12,560 full-length sequences. In the annotation process, we identified nine candidate genes related to the biosynthesis of raffinose family oligossacarides (RFOs). These sugars confer osmoprotection and are accumulated during initial fruit development. Four genes from this pathway had their transcriptional pattern validated by quantitative reverse transcription polymerase chain reaction (qRT-PCR). Furthermore, we identified ~24,000 putative target sites for microRNAs (miRNAs) and 134 putative transcriptionally active transposable elements (TE) sequences in our dataset. This C. arabica transcriptomic atlas provides an important step for identifying candidate genes related to several coffee metabolic pathways, especially those related to fruit chemical composition and therefore beverage quality. Our results are the starting point for enhancing our knowledge about the coffee genes that are transcribed during the flowering and initial fruit development stages. PMID:28068432

Transcriptome Analysis of Leaves, Flowers and Fruits Perisperm of Coffea arabica L. Reveals the Differential Expression of Genes Involved in Raffinose Biosynthesis.

PubMed

Ivamoto, Suzana Tiemi; Reis, Osvaldo; Domingues, Douglas Silva; Dos Santos, Tiago Benedito; de Oliveira, Fernanda Freitas; Pot, David; Leroy, Thierry; Vieira, Luiz Gonzaga Esteves; Carazzolle, Marcelo Falsarella; Pereira, Gonçalo Amarante Guimarães; Pereira, Luiz Filipe Protasio

2017-01-01

Coffea arabica L. is an important crop in several developing countries. Despite its economic importance, minimal transcriptome data are available for fruit tissues, especially during fruit development where several compounds related to coffee quality are produced. To understand the molecular aspects related to coffee fruit and grain development, we report a large-scale transcriptome analysis of leaf, flower and perisperm fruit tissue development. Illumina sequencing yielded 41,881,572 high-quality filtered reads. De novo assembly generated 65,364 unigenes with an average length of 1,264 bp. A total of 24,548 unigenes were annotated as protein coding genes, including 12,560 full-length sequences. In the annotation process, we identified nine candidate genes related to the biosynthesis of raffinose family oligossacarides (RFOs). These sugars confer osmoprotection and are accumulated during initial fruit development. Four genes from this pathway had their transcriptional pattern validated by quantitative reverse transcription polymerase chain reaction (qRT-PCR). Furthermore, we identified ~24,000 putative target sites for microRNAs (miRNAs) and 134 putative transcriptionally active transposable elements (TE) sequences in our dataset. This C. arabica transcriptomic atlas provides an important step for identifying candidate genes related to several coffee metabolic pathways, especially those related to fruit chemical composition and therefore beverage quality. Our results are the starting point for enhancing our knowledge about the coffee genes that are transcribed during the flowering and initial fruit development stages.

Transcriptome and proteome data reveal candidate genes for pollinator attraction in sexually deceptive orchids.

PubMed

Sedeek, Khalid E M; Qi, Weihong; Schauer, Monica A; Gupta, Alok K; Poveda, Lucy; Xu, Shuqing; Liu, Zhong-Jian; Grossniklaus, Ueli; Schiestl, Florian P; Schlüter, Philipp M

2013-01-01

Sexually deceptive orchids of the genus Ophrys mimic the mating signals of their pollinator females to attract males as pollinators. This mode of pollination is highly specific and leads to strong reproductive isolation between species. This study aims to identify candidate genes responsible for pollinator attraction and reproductive isolation between three closely related species, O. exaltata, O. sphegodes and O. garganica. Floral traits such as odour, colour and morphology are necessary for successful pollinator attraction. In particular, different odour hydrocarbon profiles have been linked to differences in specific pollinator attraction among these species. Therefore, the identification of genes involved in these traits is important for understanding the molecular basis of pollinator attraction by sexually deceptive orchids. We have created floral reference transcriptomes and proteomes for these three Ophrys species using a combination of next-generation sequencing (454 and Solexa), Sanger sequencing, and shotgun proteomics (tandem mass spectrometry). In total, 121 917 unique transcripts and 3531 proteins were identified. This represents the first orchid proteome and transcriptome from the orchid subfamily Orchidoideae. Proteome data revealed proteins corresponding to 2644 transcripts and 887 proteins not observed in the transcriptome. Candidate genes for hydrocarbon and anthocyanin biosynthesis were represented by 156 and 61 unique transcripts in 20 and 7 genes classes, respectively. Moreover, transcription factors putatively involved in the regulation of flower odour, colour and morphology were annotated, including Myb, MADS and TCP factors. Our comprehensive data set generated by combining transcriptome and proteome technologies allowed identification of candidate genes for pollinator attraction and reproductive isolation among sexually deceptive orchids. This includes genes for hydrocarbon and anthocyanin biosynthesis and regulation, and the development of floral morphology. These data will serve as an invaluable resource for research in orchid floral biology, enabling studies into the molecular mechanisms of pollinator attraction and speciation.

Transcriptome and Proteome Data Reveal Candidate Genes for Pollinator Attraction in Sexually Deceptive Orchids

PubMed Central

Sedeek, Khalid E. M.; Qi, Weihong; Schauer, Monica A.; Gupta, Alok K.; Poveda, Lucy; Xu, Shuqing; Liu, Zhong-Jian; Grossniklaus, Ueli; Schiestl, Florian P.; Schlüter, Philipp M.

2013-01-01

Background Sexually deceptive orchids of the genus Ophrys mimic the mating signals of their pollinator females to attract males as pollinators. This mode of pollination is highly specific and leads to strong reproductive isolation between species. This study aims to identify candidate genes responsible for pollinator attraction and reproductive isolation between three closely related species, O. exaltata, O. sphegodes and O. garganica. Floral traits such as odour, colour and morphology are necessary for successful pollinator attraction. In particular, different odour hydrocarbon profiles have been linked to differences in specific pollinator attraction among these species. Therefore, the identification of genes involved in these traits is important for understanding the molecular basis of pollinator attraction by sexually deceptive orchids. Results We have created floral reference transcriptomes and proteomes for these three Ophrys species using a combination of next-generation sequencing (454 and Solexa), Sanger sequencing, and shotgun proteomics (tandem mass spectrometry). In total, 121 917 unique transcripts and 3531 proteins were identified. This represents the first orchid proteome and transcriptome from the orchid subfamily Orchidoideae. Proteome data revealed proteins corresponding to 2644 transcripts and 887 proteins not observed in the transcriptome. Candidate genes for hydrocarbon and anthocyanin biosynthesis were represented by 156 and 61 unique transcripts in 20 and 7 genes classes, respectively. Moreover, transcription factors putatively involved in the regulation of flower odour, colour and morphology were annotated, including Myb, MADS and TCP factors. Conclusion Our comprehensive data set generated by combining transcriptome and proteome technologies allowed identification of candidate genes for pollinator attraction and reproductive isolation among sexually deceptive orchids. This includes genes for hydrocarbon and anthocyanin biosynthesis and regulation, and the development of floral morphology. These data will serve as an invaluable resource for research in orchid floral biology, enabling studies into the molecular mechanisms of pollinator attraction and speciation. PMID:23734209

Whole genome sequencing resource identifies 18 new candidate genes for autism spectrum disorder

PubMed Central

Yuen, Ryan KC; Merico, Daniele; Bookman, Matt; Howe, Jennifer L; Thiruvahindrapuram, Bhooma; Patel, Rohan V; Whitney, Joe; Deflaux, Nicole; Bingham, Jonathan; Wang, Zhuozhi; Pellecchia, Giovanna; Buchanan, Janet A; Walker, Susan; Marshall, Christian R; Uddin, Mohammed; Zarrei, Mehdi; Deneault, Eric; D’Abate, Lia; Chan, Ada JS; Koyanagi, Stephanie; Paton, Tara; Pereira, Sergio L; Hoang, Ny; Engchuan, Worrawat; Higginbotham, Edward J; Ho, Karen; Lamoureux, Sylvia; Li, Weili; MacDonald, Jeffrey R; Nalpathamkalam, Thomas; Sung, Wilson WL; Tsoi, Fiona J; Wei, John; Xu, Lizhen; Tasse, Anne-Marie; Kirby, Emily; Van Etten, William; Twigger, Simon; Roberts, Wendy; Drmic, Irene; Jilderda, Sanne; Modi, Bonnie MacKinnon; Kellam, Barbara; Szego, Michael; Cytrynbaum, Cheryl; Weksberg, Rosanna; Zwaigenbaum, Lonnie; Woodbury-Smith, Marc; Brian, Jessica; Senman, Lili; Iaboni, Alana; Doyle-Thomas, Krissy; Thompson, Ann; Chrysler, Christina; Leef, Jonathan; Savion-Lemieux, Tal; Smith, Isabel M; Liu, Xudong; Nicolson, Rob; Seifer, Vicki; Fedele, Angie; Cook, Edwin H; Dager, Stephen; Estes, Annette; Gallagher, Louise; Malow, Beth A; Parr, Jeremy R; Spence, Sarah J; Vorstman, Jacob; Frey, Brendan J; Robinson, James T; Strug, Lisa J; Fernandez, Bridget A; Elsabbagh, Mayada; Carter, Melissa T; Hallmayer, Joachim; Knoppers, Bartha M; Anagnostou, Evdokia; Szatmari, Peter; Ring, Robert H; Glazer, David; Pletcher, Mathew T; Scherer, Stephen W

2017-01-01

We are performing whole genome sequencing (WGS) of families with Autism Spectrum Disorder (ASD) to build a resource, named MSSNG, to enable the sub-categorization of phenotypes and underlying genetic factors involved. Here, we report WGS of 5,205 samples from families with ASD, accompanied by clinical information, creating a database accessible in a cloud platform, and through an internet portal with controlled access. We found an average of 73.8 de novo single nucleotide variants and 12.6 de novo insertion/deletions (indels) or copy number variations (CNVs) per ASD subject. We identified 18 new candidate ASD-risk genes such as MED13 and PHF3, and found that participants bearing mutations in susceptibility genes had significantly lower adaptive ability (p=6×10−4). In 294/2,620 (11.2%) of ASD cases, a molecular basis could be determined and 7.2% of these carried CNV/chromosomal abnormalities, emphasizing the importance of detecting all forms of genetic variation as diagnostic and therapeutic targets in ASD. PMID:28263302

Genome sequence comparison reveals a candidate gene involved in male-hermaphrodite differentiation in papaya (Carica papaya) trees.

PubMed

Ueno, Hiroki; Urasaki, Naoya; Natsume, Satoshi; Yoshida, Kentaro; Tarora, Kazuhiko; Shudo, Ayano; Terauchi, Ryohei; Matsumura, Hideo

2015-04-01

The sex type of papaya (Carica papaya) is determined by the pair of sex chromosomes (XX, female; XY, male; and XY(h), hermaphrodite), in which there is a non-recombining genomic region in the Y and Y(h) chromosomes. This region is presumed to be involved in determination of males and hermaphrodites; it is designated as the male-specific region in the Y chromosome (MSY) and the hermaphrodite-specific region in the Y(h) chromosome (HSY). Here, we identified the genes determining male and hermaphrodite sex types by comparing MSY and HSY genomic sequences. In the MSY and HSY genomic regions, we identified 14,528 nucleotide substitutions and 965 short indels with a large gap and two highly diverged regions. In the predicted genes expressed in flower buds, we found no nucleotide differences leading to amino acid changes between the MSY and HSY. However, we found an HSY-specific transposon insertion in a gene (SVP like) showing a similarity to the Short Vegetative Phase (SVP) gene. Study of SVP-like transcripts revealed that the MSY allele encoded an intact protein, while the HSY allele encoded a truncated protein. Our findings demonstrated that the SVP-like gene is a candidate gene for male-hermaphrodite determination in papaya.

Implementing targeted region capture sequencing for the clinical detection of Alagille syndrome: An efficient and cost‑effective method.

PubMed

Huang, Tianhong; Yang, Guilin; Dang, Xiao; Ao, Feijian; Li, Jiankang; He, Yizhou; Tang, Qiyuan; He, Qing

2017-11-01

Alagille syndrome (AGS) is a highly variable, autosomal dominant disease that affects multiple structures including the liver, heart, eyes, bones and face. Targeted region capture sequencing focuses on a panel of known pathogenic genes and provides a rapid, cost‑effective and accurate method for molecular diagnosis. In a Chinese family, this method was used on the proband and Sanger sequencing was applied to validate the candidate mutation. A de novo heterozygous mutation (c.3254_3255insT p.Leu1085PhefsX24) of the jagged 1 gene was identified as the potential disease‑causing gene mutation. In conclusion, the present study suggested that target region capture sequencing is an efficient, reliable and accurate approach for the clinical diagnosis of AGS. Furthermore, these results expand on the understanding of the pathogenesis of AGS.

Mutant prenyltransferase-like mitochondrial protein (PLMP) and mitochondrial abnormalities in kd/kd mice

PubMed Central

Peng, Min; Jarett, Leonard; Meade, Ray; Madaio, Michael P.; Hancock, Wayne W.; George, Alfred L.; Neilson, Eric G.; Gasser, David L.

2008-01-01

Background Mice that are homozygous for the kidney disease (kd) mutation are apparently healthy for the first 8 weeks of life, but spontaneously develop a severe form of interstitial nephritis that progresses to end-stage renal disease (ESRD) by 4 to 8 months of age. By testing for linkage to microsatellite markers, we previously localized the kd gene to a YAC/BAC contig. Methods The sequence of the entire critical region was examined, and candidate genes were identified. These candidate genes were sequenced in both mutant (kd/kd) mice and normal controls. The phenotype was further characterized by immunohistochemistry and electron microscopy. Transgenic mice were constructed that carried the wild-type allele of the prime candidate gene, and this transgene was transferred to a kd/kd background by breeding. Results We have obtained evidence that kd is a mutant allele of a novel gene for a prenyltransferase-like mitochondrial protein (PLMP). This gene is alternatively spliced, with the larger gene product having one domain that resembles transprenyltransferase and another that is similar to geranylgeranyl pyrophosphate synthase. The smaller gene product includes only the first domain. An antiserum to PLMP localizes to mitochondria, and ultrastructural defects are present in the mitochondria of renal tubular epithelial cells, and to a lesser extent, hepatocytes and heart cells from kd/kd mice. In a line of kd/kd mice that carried the wild-type PLMP allele as a transgene, only 1 out of 13 animals expressed the disease by 120 days of age. Conclusion The kd allele codes for a novel protein that localizes to the mitochondria, and the kd/kd mouse has dysmorphic mitochondria in the renal tubular epithelial cells. This mouse is therefore a unique animal model for studying mechanisms that lead to tubulointerstitial nephritis. PMID:15200409

Utilizing the Dog Genome in the Search for Novel Candidate Genes Involved in Glioma Development—Genome Wide Association Mapping followed by Targeted Massive Parallel Sequencing Identifies a Strongly Associated Locus

PubMed Central

Dickinson, Peter; Xiong, Anqi; York, Daniel; Jayashankar, Kartika; Pielberg, Gerli; Koltookian, Michele; Murén, Eva; Fuxelius, Hans-Henrik; Weishaupt, Holger; Andersson, Göran; Hedhammar, Åke; Bongcam-Rudloff, Erik; Forsberg-Nilsson, Karin

2016-01-01

Gliomas are the most common form of malignant primary brain tumors in humans and second most common in dogs, occurring with similar frequencies in both species. Dogs are valuable spontaneous models of human complex diseases including cancers and may provide insight into disease susceptibility and oncogenesis. Several brachycephalic breeds such as Boxer, Bulldog and Boston Terrier have an elevated risk of developing glioma, but others, including Pug and Pekingese, are not at higher risk. To identify glioma-associated genetic susceptibility factors, an across-breed genome-wide association study (GWAS) was performed on 39 dog glioma cases and 141 controls from 25 dog breeds, identifying a genome-wide significant locus on canine chromosome (CFA) 26 (p = 2.8 x 10−8). Targeted re-sequencing of the 3.4 Mb candidate region was performed, followed by genotyping of the 56 SNVs that best fit the association pattern between the re-sequenced cases and controls. We identified three candidate genes that were highly associated with glioma susceptibility: CAMKK2, P2RX7 and DENR. CAMKK2 showed reduced expression in both canine and human brain tumors, and a non-synonymous variant in P2RX7, previously demonstrated to have a 50% decrease in receptor function, was also associated with disease. Thus, one or more of these genes appear to affect glioma susceptibility. PMID:27171399

Integrative Annotation of 21,037 Human Genes Validated by Full-Length cDNA Clones

PubMed Central

Imanishi, Tadashi; Itoh, Takeshi; Suzuki, Yutaka; O'Donovan, Claire; Fukuchi, Satoshi; Koyanagi, Kanako O; Barrero, Roberto A; Tamura, Takuro; Yamaguchi-Kabata, Yumi; Tanino, Motohiko; Yura, Kei; Miyazaki, Satoru; Ikeo, Kazuho; Homma, Keiichi; Kasprzyk, Arek; Nishikawa, Tetsuo; Hirakawa, Mika; Thierry-Mieg, Jean; Thierry-Mieg, Danielle; Ashurst, Jennifer; Jia, Libin; Nakao, Mitsuteru; Thomas, Michael A; Mulder, Nicola; Karavidopoulou, Youla; Jin, Lihua; Kim, Sangsoo; Yasuda, Tomohiro; Lenhard, Boris; Eveno, Eric; Suzuki, Yoshiyuki; Yamasaki, Chisato; Takeda, Jun-ichi; Gough, Craig; Hilton, Phillip; Fujii, Yasuyuki; Sakai, Hiroaki; Tanaka, Susumu; Amid, Clara; Bellgard, Matthew; Bonaldo, Maria de Fatima; Bono, Hidemasa; Bromberg, Susan K; Brookes, Anthony J; Bruford, Elspeth; Carninci, Piero; Chelala, Claude; Couillault, Christine; de Souza, Sandro J.; Debily, Marie-Anne; Devignes, Marie-Dominique; Dubchak, Inna; Endo, Toshinori; Estreicher, Anne; Eyras, Eduardo; Fukami-Kobayashi, Kaoru; R. Gopinath, Gopal; Graudens, Esther; Hahn, Yoonsoo; Han, Michael; Han, Ze-Guang; Hanada, Kousuke; Hanaoka, Hideki; Harada, Erimi; Hashimoto, Katsuyuki; Hinz, Ursula; Hirai, Momoki; Hishiki, Teruyoshi; Hopkinson, Ian; Imbeaud, Sandrine; Inoko, Hidetoshi; Kanapin, Alexander; Kaneko, Yayoi; Kasukawa, Takeya; Kelso, Janet; Kersey, Paul; Kikuno, Reiko; Kimura, Kouichi; Korn, Bernhard; Kuryshev, Vladimir; Makalowska, Izabela; Makino, Takashi; Mano, Shuhei; Mariage-Samson, Regine; Mashima, Jun; Matsuda, Hideo; Mewes, Hans-Werner; Minoshima, Shinsei; Nagai, Keiichi; Nagasaki, Hideki; Nagata, Naoki; Nigam, Rajni; Ogasawara, Osamu; Ohara, Osamu; Ohtsubo, Masafumi; Okada, Norihiro; Okido, Toshihisa; Oota, Satoshi; Ota, Motonori; Ota, Toshio; Otsuki, Tetsuji; Piatier-Tonneau, Dominique; Poustka, Annemarie; Ren, Shuang-Xi; Saitou, Naruya; Sakai, Katsunaga; Sakamoto, Shigetaka; Sakate, Ryuichi; Schupp, Ingo; Servant, Florence; Sherry, Stephen; Shiba, Rie; Shimizu, Nobuyoshi; Shimoyama, Mary; Simpson, Andrew J; Soares, Bento; Steward, Charles; Suwa, Makiko; Suzuki, Mami; Takahashi, Aiko; Tamiya, Gen; Tanaka, Hiroshi; Taylor, Todd; Terwilliger, Joseph D; Unneberg, Per; Veeramachaneni, Vamsi; Watanabe, Shinya; Wilming, Laurens; Yasuda, Norikazu; Yoo, Hyang-Sook; Stodolsky, Marvin; Makalowski, Wojciech; Go, Mitiko; Nakai, Kenta; Takagi, Toshihisa; Kanehisa, Minoru; Sakaki, Yoshiyuki; Quackenbush, John; Okazaki, Yasushi; Hayashizaki, Yoshihide; Hide, Winston; Chakraborty, Ranajit; Nishikawa, Ken; Sugawara, Hideaki; Tateno, Yoshio; Chen, Zhu; Oishi, Michio; Tonellato, Peter; Apweiler, Rolf; Okubo, Kousaku; Wagner, Lukas; Wiemann, Stefan; Strausberg, Robert L; Isogai, Takao; Auffray, Charles; Nomura, Nobuo; Sugano, Sumio

2004-01-01

The human genome sequence defines our inherent biological potential; the realization of the biology encoded therein requires knowledge of the function of each gene. Currently, our knowledge in this area is still limited. Several lines of investigation have been used to elucidate the structure and function of the genes in the human genome. Even so, gene prediction remains a difficult task, as the varieties of transcripts of a gene may vary to a great extent. We thus performed an exhaustive integrative characterization of 41,118 full-length cDNAs that capture the gene transcripts as complete functional cassettes, providing an unequivocal report of structural and functional diversity at the gene level. Our international collaboration has validated 21,037 human gene candidates by analysis of high-quality full-length cDNA clones through curation using unified criteria. This led to the identification of 5,155 new gene candidates. It also manifested the most reliable way to control the quality of the cDNA clones. We have developed a human gene database, called the H-Invitational Database (H-InvDB; http://www.h-invitational.jp/). It provides the following: integrative annotation of human genes, description of gene structures, details of novel alternative splicing isoforms, non-protein-coding RNAs, functional domains, subcellular localizations, metabolic pathways, predictions of protein three-dimensional structure, mapping of known single nucleotide polymorphisms (SNPs), identification of polymorphic microsatellite repeats within human genes, and comparative results with mouse full-length cDNAs. The H-InvDB analysis has shown that up to 4% of the human genome sequence (National Center for Biotechnology Information build 34 assembly) may contain misassembled or missing regions. We found that 6.5% of the human gene candidates (1,377 loci) did not have a good protein-coding open reading frame, of which 296 loci are strong candidates for non-protein-coding RNA genes. In addition, among 72,027 uniquely mapped SNPs and insertions/deletions localized within human genes, 13,215 nonsynonymous SNPs, 315 nonsense SNPs, and 452 indels occurred in coding regions. Together with 25 polymorphic microsatellite repeats present in coding regions, they may alter protein structure, causing phenotypic effects or resulting in disease. The H-InvDB platform represents a substantial contribution to resources needed for the exploration of human biology and pathology. PMID:15103394

Integrated Systems Biology Analysis of Transcriptomes Reveals Candidate Genes for Acidity Control in Developing Fruits of Sweet Orange (Citrus sinensis L. Osbeck).

PubMed

Huang, Dingquan; Zhao, Yihong; Cao, Minghao; Qiao, Liang; Zheng, Zhi-Liang

2016-01-01

Organic acids, such as citrate and malate, are important contributors for the sensory traits of fleshy fruits. Although their biosynthesis has been illustrated, regulatory mechanisms of acid accumulation remain to be dissected. To provide transcriptional architecture and identify candidate genes for citrate accumulation in fruits, we have selected for transcriptome analysis four varieties of sweet orange (Citrus sinensis L. Osbeck) with varying fruit acidity, Succari (acidless), Bingtang (low acid), and Newhall and Xinhui (normal acid). Fruits of these varieties at 45 days post anthesis (DPA), which corresponds to Stage I (cell division), had similar acidity, but they displayed differential acid accumulation at 142 DPA (Stage II, cell expansion). Transcriptomes of fruits at 45 and 142 DPA were profiled using RNA sequencing and analyzed with three different algorithms (Pearson correlation, gene coexpression network and surrogate variable analysis). Our network analysis shows that the acid-correlated genes belong to three distinct network modules. Several of these candidate fruit acidity genes encode regulatory proteins involved in transport (such as AHA10), degradation (such as APD2) and transcription (such as AIL6) and act as hubs in the citrate accumulation gene networks. Taken together, our integrated systems biology analysis has provided new insights into the fruit citrate accumulation gene network and led to the identification of candidate genes likely associated with the fruit acidity control.

Integrated Systems Biology Analysis of Transcriptomes Reveals Candidate Genes for Acidity Control in Developing Fruits of Sweet Orange (Citrus sinensis L. Osbeck)

PubMed Central

Huang, Dingquan; Zhao, Yihong; Cao, Minghao; Qiao, Liang; Zheng, Zhi-Liang

2016-01-01

Organic acids, such as citrate and malate, are important contributors for the sensory traits of fleshy fruits. Although their biosynthesis has been illustrated, regulatory mechanisms of acid accumulation remain to be dissected. To provide transcriptional architecture and identify candidate genes for citrate accumulation in fruits, we have selected for transcriptome analysis four varieties of sweet orange (Citrus sinensis L. Osbeck) with varying fruit acidity, Succari (acidless), Bingtang (low acid), and Newhall and Xinhui (normal acid). Fruits of these varieties at 45 days post anthesis (DPA), which corresponds to Stage I (cell division), had similar acidity, but they displayed differential acid accumulation at 142 DPA (Stage II, cell expansion). Transcriptomes of fruits at 45 and 142 DPA were profiled using RNA sequencing and analyzed with three different algorithms (Pearson correlation, gene coexpression network and surrogate variable analysis). Our network analysis shows that the acid-correlated genes belong to three distinct network modules. Several of these candidate fruit acidity genes encode regulatory proteins involved in transport (such as AHA10), degradation (such as APD2) and transcription (such as AIL6) and act as hubs in the citrate accumulation gene networks. Taken together, our integrated systems biology analysis has provided new insights into the fruit citrate accumulation gene network and led to the identification of candidate genes likely associated with the fruit acidity control. PMID:27092171

Rapid identification of candidate genes for resistance to tomato late blight disease using next-generation sequencing technologies

PubMed Central

Arafa, Ramadan A.; Rakha, Mohamed T.; Kamel, Said M.

2017-01-01

Tomato late blight caused by Phytophthora infestans (Mont.) de Bary, also known as the Irish famine pathogen, is one of the most destructive plant diseases. Wild relatives of tomato possess useful resistance genes against this disease, and could therefore be used in breeding to improve cultivated varieties. In the genome of a wild relative of tomato, Solanum habrochaites accession LA1777, we identified a new quantitative trait locus for resistance against blight caused by an aggressive Egyptian isolate of P. infestans. Using double-digest restriction site–associated DNA sequencing (ddRAD-Seq) technology, we determined 6,514 genome-wide SNP genotypes of an F2 population derived from an interspecific cross. Subsequent association analysis of genotypes and phenotypes of the mapping population revealed that a 6.8 Mb genome region on chromosome 6 was a candidate locus for disease resistance. Whole-genome resequencing analysis revealed that 298 genes in this region potentially had functional differences between the parental lines. Among of them, two genes with missense mutations, Solyc06g071810.1 and Solyc06g083640.3, were considered to be potential candidates for disease resistance. SNP and SSR markers linking to this region can be used in marker-assisted selection in future breeding programs for late blight disease, including introgression of new genetic loci from wild species. In addition, the approach developed in this study provides a model for identification of other genes for attractive agronomical traits. PMID:29253902

Identifying the candidate genes involved in the calyx abscission process of 'Kuerlexiangli' (Pyrus sinkiangensis Yu) by digital transcript abundance measurements.

PubMed

Qi, Xiaoxiao; Wu, Jun; Wang, Lifen; Li, Leiting; Cao, Yufen; Tian, Luming; Dong, Xingguang; Zhang, Shaoling

2013-10-23

'Kuerlexiangli' (Pyrus sinkiangensis Yu), a native pear of Xinjiang, China, is an important agricultural fruit and primary export to the international market. However, fruit with persistent calyxes affect fruit shape and quality. Although several studies have looked into the physiological aspects of the calyx abscission process, the underlying molecular mechanisms remain unknown. In order to better understand the molecular basis of the process of calyx abscission, materials at three critical stages of regulation, with 6000 × Flusilazole plus 300 × PBO treatment (calyx abscising treatment) and 50 mg.L-1GA3 treatment (calyx persisting treatment), were collected and cDNA fragments were sequenced using digital transcript abundance measurements to identify candidate genes. Digital transcript abundance measurements was performed using high-throughput Illumina GAII sequencing on seven samples that were collected at three important stages of the calyx abscission process with chemical agent treatments promoting calyx abscission and persistence. Altogether more than 251,123,845 high quality reads were obtained with approximately 8.0 M raw data for each library. The values of 69.85%-71.90% of clean data in the digital transcript abundance measurements could be mapped to the pear genome database. There were 12,054 differentially expressed genes having Gene Ontology (GO) terms and associating with 251 Kyoto Encyclopedia of Genes and Genomes (KEGG) defined pathways. The differentially expressed genes correlated with calyx abscission were mainly involved in photosynthesis, plant hormone signal transduction, cell wall modification, transcriptional regulation, and carbohydrate metabolism. Furthermore, candidate calyx abscission-specific genes, e.g. Inflorescence deficient in abscission gene, were identified. Quantitative real-time PCR was used to confirm the digital transcript abundance measurements results. We identified candidate genes that showed highly dynamic changes in expression during the calyx abscission process. These genes are potential targets for future functional characterization and should be valuable for exploration of the mechanisms of calyx abscission, and eventually for developing methods based on small molecule application to induce calyx abscission in fruit production.

Exploring the genetic basis of adaptation to high elevations in reptiles: a comparative transcriptome analysis of two toad-headed agamas (genus Phrynocephalus).

PubMed

Yang, Weizhao; Qi, Yin; Fu, Jinzhong

2014-01-01

High elevation adaptation offers an excellent study system to understand the genetic basis of adaptive evolution. We acquired transcriptome sequences of two closely related lizards, Phrynocephalus przewalskii from low elevations and P. vlangalii from high elevations. Within a phylogenetic framework, we compared their genomic data along with green anole, chicken and Chinese softshell turtle, and identified candidate genes and functional categories that are potentially linked to adaptation to high elevation environments. More than 100 million sequence reads were generated for each species via Illumina sequencing. A de novo assembly produced 70,919 and 62,118 transcripts for P. przewalskii and P. vlangalii, respectively. Based on a well-established reptile phylogeny, we detected 143 positively selected genes (PSGs) along the P. vlangalii lineage from the 7,012 putative orthologs using a branch-site model. Furthermore, ten GO categories and one KEGG pathway that are over-represented by PSGs were recognized. In addition, 58 GO categories were revealed to have elevated evolutionary rates along the P. vlangalii lineage relative to P. przewalskii. These functional analyses further filter out PSGs that are most likely involved in the adaptation process to high elevations. Among them, ADAM17, MD, and HSP90B1 likely contributed to response to hypoxia, and POLK likely contributed to DNA repair. Many other candidate genes involved in gene expression and metabolism were also identified. Genome-wide scan for candidate genes may serve as the first step to explore the genetic basis of high elevation adaptation. Detailed comparative study and functional verification are needed to solidify any conclusions. High elevation adaptation requires coordinated changes in multiple genes that involve various physiological and biochemical pathways; we hope that our genetic studies will provide useful directions for future physiological or molecular studies in reptiles as well as other poikilothermic species.

Exploring the Genetic Basis of Adaptation to High Elevations in Reptiles: A Comparative Transcriptome Analysis of Two Toad-Headed Agamas (Genus Phrynocephalus)

PubMed Central

Yang, Weizhao; Qi, Yin; Fu, Jinzhong

2014-01-01

High elevation adaptation offers an excellent study system to understand the genetic basis of adaptive evolution. We acquired transcriptome sequences of two closely related lizards, Phrynocephalus przewalskii from low elevations and P. vlangalii from high elevations. Within a phylogenetic framework, we compared their genomic data along with green anole, chicken and Chinese softshell turtle, and identified candidate genes and functional categories that are potentially linked to adaptation to high elevation environments. More than 100 million sequence reads were generated for each species via Illumina sequencing. A de novo assembly produced 70,919 and 62,118 transcripts for P. przewalskii and P. vlangalii, respectively. Based on a well-established reptile phylogeny, we detected 143 positively selected genes (PSGs) along the P. vlangalii lineage from the 7,012 putative orthologs using a branch-site model. Furthermore, ten GO categories and one KEGG pathway that are over-represented by PSGs were recognized. In addition, 58 GO categories were revealed to have elevated evolutionary rates along the P. vlangalii lineage relative to P. przewalskii. These functional analyses further filter out PSGs that are most likely involved in the adaptation process to high elevations. Among them, ADAM17, MD, and HSP90B1 likely contributed to response to hypoxia, and POLK likely contributed to DNA repair. Many other candidate genes involved in gene expression and metabolism were also identified. Genome-wide scan for candidate genes may serve as the first step to explore the genetic basis of high elevation adaptation. Detailed comparative study and functional verification are needed to solidify any conclusions. High elevation adaptation requires coordinated changes in multiple genes that involve various physiological and biochemical pathways; we hope that our genetic studies will provide useful directions for future physiological or molecular studies in reptiles as well as other poikilothermic species. PMID:25386640

De Novo Sequencing and Analysis of Lemongrass Transcriptome Provide First Insights into the Essential Oil Biosynthesis of Aromatic Grasses.

PubMed

Meena, Seema; Kumar, Sarma R; Venkata Rao, D K; Dwivedi, Varun; Shilpashree, H B; Rastogi, Shubhra; Shasany, Ajit K; Nagegowda, Dinesh A

2016-01-01

Aromatic grasses of the genus Cymbopogon (Poaceae family) represent unique group of plants that produce diverse composition of monoterpene rich essential oils, which have great value in flavor, fragrance, cosmetic, and aromatherapy industries. Despite the commercial importance of these natural aromatic oils, their biosynthesis at the molecular level remains unexplored. As the first step toward understanding the essential oil biosynthesis, we performed de novo transcriptome assembly and analysis of C. flexuosus (lemongrass) by employing Illumina sequencing. Mining of transcriptome data and subsequent phylogenetic analysis led to identification of terpene synthases, pyrophosphatases, alcohol dehydrogenases, aldo-keto reductases, carotenoid cleavage dioxygenases, alcohol acetyltransferases, and aldehyde dehydrogenases, which are potentially involved in essential oil biosynthesis. Comparative essential oil profiling and mRNA expression analysis in three Cymbopogon species (C. flexuosus, aldehyde type; C. martinii, alcohol type; and C. winterianus, intermediate type) with varying essential oil composition indicated the involvement of identified candidate genes in the formation of alcohols, aldehydes, and acetates. Molecular modeling and docking further supported the role of identified protein sequences in aroma formation in Cymbopogon. Also, simple sequence repeats were found in the transcriptome with many linked to terpene pathway genes including the genes potentially involved in aroma biosynthesis. This work provides the first insights into the essential oil biosynthesis of aromatic grasses, and the identified candidate genes and markers can be a great resource for biotechnological and molecular breeding approaches to modulate the essential oil composition.

De Novo Sequencing and Analysis of Lemongrass Transcriptome Provide First Insights into the Essential Oil Biosynthesis of Aromatic Grasses

PubMed Central

Meena, Seema; Kumar, Sarma R.; Venkata Rao, D. K.; Dwivedi, Varun; Shilpashree, H. B.; Rastogi, Shubhra; Shasany, Ajit K.; Nagegowda, Dinesh A.

2016-01-01

Aromatic grasses of the genus Cymbopogon (Poaceae family) represent unique group of plants that produce diverse composition of monoterpene rich essential oils, which have great value in flavor, fragrance, cosmetic, and aromatherapy industries. Despite the commercial importance of these natural aromatic oils, their biosynthesis at the molecular level remains unexplored. As the first step toward understanding the essential oil biosynthesis, we performed de novo transcriptome assembly and analysis of C. flexuosus (lemongrass) by employing Illumina sequencing. Mining of transcriptome data and subsequent phylogenetic analysis led to identification of terpene synthases, pyrophosphatases, alcohol dehydrogenases, aldo-keto reductases, carotenoid cleavage dioxygenases, alcohol acetyltransferases, and aldehyde dehydrogenases, which are potentially involved in essential oil biosynthesis. Comparative essential oil profiling and mRNA expression analysis in three Cymbopogon species (C. flexuosus, aldehyde type; C. martinii, alcohol type; and C. winterianus, intermediate type) with varying essential oil composition indicated the involvement of identified candidate genes in the formation of alcohols, aldehydes, and acetates. Molecular modeling and docking further supported the role of identified protein sequences in aroma formation in Cymbopogon. Also, simple sequence repeats were found in the transcriptome with many linked to terpene pathway genes including the genes potentially involved in aroma biosynthesis. This work provides the first insights into the essential oil biosynthesis of aromatic grasses, and the identified candidate genes and markers can be a great resource for biotechnological and molecular breeding approaches to modulate the essential oil composition. PMID:27516768

Inheritance-mode specific pathogenicity prioritization (ISPP) for human protein coding genes.

PubMed

Hsu, Jacob Shujui; Kwan, Johnny S H; Pan, Zhicheng; Garcia-Barcelo, Maria-Mercè; Sham, Pak Chung; Li, Miaoxin

2016-10-15

Exome sequencing studies have facilitated the detection of causal genetic variants in yet-unsolved Mendelian diseases. However, the identification of disease causal genes among a list of candidates in an exome sequencing study is still not fully settled, and it is often difficult to prioritize candidate genes for follow-up studies. The inheritance mode provides crucial information for understanding Mendelian diseases, but none of the existing gene prioritization tools fully utilize this information. We examined the characteristics of Mendelian disease genes under different inheritance modes. The results suggest that Mendelian disease genes with autosomal dominant (AD) inheritance mode are more haploinsufficiency and de novo mutation sensitive, whereas those autosomal recessive (AR) genes have significantly more non-synonymous variants and regulatory transcript isoforms. In addition, the X-linked (XL) Mendelian disease genes have fewer non-synonymous and synonymous variants. As a result, we derived a new scoring system for prioritizing candidate genes for Mendelian diseases according to the inheritance mode. Our scoring system assigned to each annotated protein-coding gene (N = 18 859) three pathogenic scores according to the inheritance mode (AD, AR and XL). This inheritance mode-specific framework achieved higher accuracy (area under curve  = 0.84) in XL mode. The inheritance-mode specific pathogenicity prioritization (ISPP) outperformed other well-known methods including Haploinsufficiency, Recessive, Network centrality, Genic Intolerance, Gene Damage Index and Gene Constraint scores. This systematic study suggests that genes manifesting disease inheritance modes tend to have unique characteristics. ISPP is included in KGGSeq v1.0 (http://grass.cgs.hku.hk/limx/kggseq/), and source code is available from (https://github.com/jacobhsu35/ISPP.git). mxli@hku.hkSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Progress Report for DOE DE-FG03-98ER20317 ''Regulation of the floral homeotic gene AGAMOUS'' Current and Final Funding Period: September 1, 2002, to December 31, 2002

DOE Office of Scientific and Technical Information (OSTI.GOV)

Weigel, D.

2003-03-11

OAK-B135 Results obtained during this funding period: (1) Phylogenetic footprinting of AG regulatory sequences Sequences necessary and sufficient for AGAMOUS (AG) expression in the center of Arabidopsis flowers are located in the second intron, which is about 3 kb in size. This intron contains binding sites for two transcription factors, LEAFY (LFY) and WUSCHEL (WUS), which are direct activators of AG. We used the new method of phylogenetic shadowing to identify new regulatory elements. Among 29 Brassicaceae, several other motifs, but not the LFY and WUS binding sites previously identified, are largely invariant. Using reporter gene analyses, we tested sixmore » of these motifs and found that they are all functionally important for activity of AG regulatory sequences in A. thaliana. (2) Repression of AG by MADS box genes A candidate for repressing AG in the shoot apical meristem has been the MADS box gene FUL, since it is expressed in the shoot apical meristem and since an activated version (FUL:VP16) leads to ectopic AG expression in the shoot apical meristem. However, there is no ectopic AG expression in full single mutants. We therefore started to generate VP16 fusions of several other MADS box genes expressed in the shoot apical meristem, to determine which of these might be candidates for FUL redundant genes. We found that AGL6:VP16 has a similar phenotype as FUL:VP16, suggesting that AGL6 and FUL interact. We are now testing this hypothesis. (3) Two candidate AG regulators, WOW and ULA Because the phylogenetic footprinting project has identified several new candidate regulatory motifs, of which at least one (the CCAATCA motif) has rather strong effects, we had decided to put the analysis of WOW and ULA on hold, and to focus on using the newly identified motifs as tools. We conduct ed yeast one-hybrid screen with two of the conserved motifs, and identified several classes of transcription factors that can interact with them. One of these is encoded by the PAN gene, previously known to be expressed in a domain that overlaps the AG domain, but not known before to regulate AG. (4) New genetic modifiers of AG This part of the project was concluded in the previous funding period.« less

A DNA barcode for land plants.

PubMed

2009-08-04

DNA barcoding involves sequencing a standard region of DNA as a tool for species identification. However, there has been no agreement on which region(s) should be used for barcoding land plants. To provide a community recommendation on a standard plant barcode, we have compared the performance of 7 leading candidate plastid DNA regions (atpF-atpH spacer, matK gene, rbcL gene, rpoB gene, rpoC1 gene, psbK-psbI spacer, and trnH-psbA spacer). Based on assessments of recoverability, sequence quality, and levels of species discrimination, we recommend the 2-locus combination of rbcL+matK as the plant barcode. This core 2-locus barcode will provide a universal framework for the routine use of DNA sequence data to identify specimens and contribute toward the discovery of overlooked species of land plants.

A DNA barcode for land plants

PubMed Central

Hollingsworth, Peter M.; Forrest, Laura L.; Spouge, John L.; Hajibabaei, Mehrdad; Ratnasingham, Sujeevan; van der Bank, Michelle; Chase, Mark W.; Cowan, Robyn S.; Erickson, David L.; Fazekas, Aron J.; Graham, Sean W.; James, Karen E.; Kim, Ki-Joong; Kress, W. John; Schneider, Harald; van AlphenStahl, Jonathan; Barrett, Spencer C.H.; van den Berg, Cassio; Bogarin, Diego; Burgess, Kevin S.; Cameron, Kenneth M.; Carine, Mark; Chacón, Juliana; Clark, Alexandra; Clarkson, James J.; Conrad, Ferozah; Devey, Dion S.; Ford, Caroline S.; Hedderson, Terry A.J.; Hollingsworth, Michelle L.; Husband, Brian C.; Kelly, Laura J.; Kesanakurti, Prasad R.; Kim, Jung Sung; Kim, Young-Dong; Lahaye, Renaud; Lee, Hae-Lim; Long, David G.; Madriñán, Santiago; Maurin, Olivier; Meusnier, Isabelle; Newmaster, Steven G.; Park, Chong-Wook; Percy, Diana M.; Petersen, Gitte; Richardson, James E.; Salazar, Gerardo A.; Savolainen, Vincent; Seberg, Ole; Wilkinson, Michael J.; Yi, Dong-Keun; Little, Damon P.

2009-01-01

DNA barcoding involves sequencing a standard region of DNA as a tool for species identification. However, there has been no agreement on which region(s) should be used for barcoding land plants. To provide a community recommendation on a standard plant barcode, we have compared the performance of 7 leading candidate plastid DNA regions (atpF–atpH spacer, matK gene, rbcL gene, rpoB gene, rpoC1 gene, psbK–psbI spacer, and trnH–psbA spacer). Based on assessments of recoverability, sequence quality, and levels of species discrimination, we recommend the 2-locus combination of rbcL+matK as the plant barcode. This core 2-locus barcode will provide a universal framework for the routine use of DNA sequence data to identify specimens and contribute toward the discovery of overlooked species of land plants. PMID:19666622

Intact coding region of the serotonin transporter gene in obsessive-compulsive disorder

DOE Office of Scientific and Technical Information (OSTI.GOV)

Altemus, M.; Murphy, D.L.; Greenberg, B.

1996-07-26

Epidemiologic studies indicate that obsessive-compulsive disorder is genetically transmitted in some families, although no genetic abnormalities have been identified in individuals with this disorder. The selective response of obsessive-compulsive disorder to treatment with agents which block serotonin reuptake suggests the gene coding for the serotonin transporter as a candidate gene. The primary structure of the serotonin-transporter coding region was sequenced in 22 patients with obsessive-compulsive disorder, using direct PCR sequencing of cDNA synthesized from platelet serotonin-transporter mRNA. No variations in amino acid sequence were found among the obsessive-compulsive disorder patients or healthy controls. These results do not support a rolemore » for alteration in the primary structure of the coding region of the serotonin-transporter gene in the pathogenesis of obsessive-compulsive disorder. 27 refs.« less

Lack of specific alleles for the bovine chemokine (C-X-C) receptor type 4 (CXCR4) gene in West African cattle questions its role as a candidate for trypanotolerance.

PubMed

Álvarez, Isabel; Pérez-Pardal, Lucía; Traoré, Amadou; Fernández, Iván; Goyache, Félix

2016-08-01

A panel of 81 Asian, African and European cattle (Bos taurus and B. indicus) was analysed for the whole sequence of the CXCR4 gene (3844bp), a strong candidate for cattle trypanotolerance. Thirty-one polymorphic sites identified gave 31 different haplotypes. Neutrality tests rejected the hypothesis of either positive or purifying selection. Bayesian phylogenetic tree showed differentiation of haplotypes into two clades gathering genetic variability predating domestication. Related with clades definition, linkage disequilibrium analyses suggested the existence of one only linkage block on the CXCR4 gene. Two tag SNPs identified on exon 2 captured 50% of variability. Whatever the analysis carried out, no clear separation between cattle groups was identified. Most haplotypes identified in West African taurine cattle were also found in European cattle and in Asian and West African zebu. West African taurine samples did not carry unique variants on the CXCR4 gene sequence. The current analysis failed in identifying a causal mutation on the CXCR4 gene underlying a previously reported QTL for cattle trypanotolerance on BTA2. Copyright © 2016 Elsevier B.V. All rights reserved.

Mapping genes to human chromosome 19

DOE Office of Scientific and Technical Information (OSTI.GOV)

Connolly, Sarah

1996-05-01

For this project, 22 Expressed Sequence Tags (ESTs) were fine mapped to regions of human chromosome 19. An EST is a short DNA sequence that occurs once in the genome and corresponds to a single expressed gene. {sup 32}P-radiolabeled probes were made by polymerase chain reaction for each EST and hybridized to filters containing a chromosome 19-specific cosmid library. The location of the ESTs on the chromosome was determined by the location of the ordered cosmid to which the EST hybridized. Of the 22 ESTs that were sublocalized, 6 correspond to known genes, and 16 correspond to anonymous genes. Thesemore » localized ESTs may serve as potential candidates for disease genes, as well as markers for future physical mapping.« less

Draft Genome Sequence of Elizabethkingia anophelis Strain EM361-97 Isolated from the Blood of a Cancer Patient

PubMed Central

Lin, Jiun-Nong; Yang, Chih-Hui; Lai, Chung-Hsu; Huang, Yi-Han

2016-01-01

Elizabethkingia anophelis EM361-97 was isolated from the blood of a patient with nasopharyngeal carcinoma and lung cancer. We report the draft genome sequence of EM361-97, which contains a G+C content of 35.7% and 3,611 candidate protein-encoding genes. PMID:27789647

New splicing mutation in the choline kinase beta (CHKB) gene causing a muscular dystrophy detected by whole-exome sequencing.

PubMed

Oliveira, Jorge; Negrão, Luís; Fineza, Isabel; Taipa, Ricardo; Melo-Pires, Manuel; Fortuna, Ana Maria; Gonçalves, Ana Rita; Froufe, Hugo; Egas, Conceição; Santos, Rosário; Sousa, Mário

2015-06-01

Muscular dystrophies (MDs) are a group of hereditary muscle disorders that include two particularly heterogeneous subgroups: limb-girdle MD and congenital MD, linked to 52 different genes (seven common to both subgroups). Massive parallel sequencing technology may avoid the usual stepwise gene-by-gene analysis. We report the whole-exome sequencing (WES) analysis of a patient with childhood-onset progressive MD, also presenting mental retardation and dilated cardiomyopathy. Conventional sequencing had excluded eight candidate genes. WES of the trio (patient and parents) was performed using the ion proton sequencing system. Data analysis resorted to filtering steps using the GEMINI software revealed a novel silent variant in the choline kinase beta (CHKB) gene. Inspection of sequence alignments ultimately identified the causal variant (CHKB:c.1031+3G>C). This splice site mutation was confirmed using Sanger sequencing and its effect was further evaluated with gene expression analysis. On reassessment of the muscle biopsy, typical abnormal mitochondrial oxidative changes were observed. Mutations in CHKB have been shown to cause phosphatidylcholine deficiency in myofibers, causing a rare form of CMD (only 21 patients reported). Notwithstanding interpretative difficulties that need to be overcome before the integration of WES in the diagnostic workflow, this work corroborates its utility in solving cases from highly heterogeneous groups of diseases, in which conventional diagnostic approaches fail to provide a definitive diagnosis.

A Molecular Portrait of De Novo Genes in Yeasts.

PubMed

Vakirlis, Nikolaos; Hebert, Alex S; Opulente, Dana A; Achaz, Guillaume; Hittinger, Chris Todd; Fischer, Gilles; Coon, Joshua J; Lafontaine, Ingrid

2018-03-01

New genes, with novel protein functions, can evolve "from scratch" out of intergenic sequences. These de novo genes can integrate the cell's genetic network and drive important phenotypic innovations. Therefore, identifying de novo genes and understanding how the transition from noncoding to coding occurs are key problems in evolutionary biology. However, identifying de novo genes is a difficult task, hampered by the presence of remote homologs, fast evolving sequences and erroneously annotated protein coding genes. To overcome these limitations, we developed a procedure that handles the usual pitfalls in de novo gene identification and predicted the emergence of 703 de novo gene candidates in 15 yeast species from 2 genera whose phylogeny spans at least 100 million years of evolution. We validated 85 candidates by proteomic data, providing new translation evidence for 25 of them through mass spectrometry experiments. We also unambiguously identified the mutations that enabled the transition from noncoding to coding for 30 Saccharomyces de novo genes. We established that de novo gene origination is a widespread phenomenon in yeasts, only a few being ultimately maintained by selection. We also found that de novo genes preferentially emerge next to divergent promoters in GC-rich intergenic regions where the probability of finding a fortuitous and transcribed ORF is the highest. Finally, we found a more than 3-fold enrichment of de novo genes at recombination hot spots, which are GC-rich and nucleosome-free regions, suggesting that meiotic recombination contributes to de novo gene emergence in yeasts.

Exome sequencing in Jewish and Arab patients with rhabdomyolysis reveals single-gene etiology in 43% of cases.

PubMed

Vivante, Asaf; Ityel, Hadas; Pode-Shakked, Ben; Chen, Jing; Shril, Shirlee; van der Ven, Amelie T; Mann, Nina; Schmidt, Johanna Magdalena; Segel, Reeval; Aran, Adi; Zeharia, Avraham; Staretz-Chacham, Orna; Bar-Yosef, Omer; Raas-Rothschild, Annick; Landau, Yuval E; Lifton, Richard P; Anikster, Yair; Hildebrandt, Friedhelm

2017-12-01

Rhabdomyolysis is a clinical emergency that may cause acute kidney injury (AKI). It can be acquired or due to monogenic mutations. Around 60 different rare monogenic forms of rhabdomyolysis have been reported to date. In the clinical setting, identifying the underlying molecular diagnosis is challenging due to nonspecific presentation, the high number of causative genes, and current lack of data on the prevalence of monogenic forms. We employed whole exome sequencing (WES) to reveal the percentage of rhabdomyolysis cases explained by single-gene (monogenic) mutations in one of 58 candidate genes. We investigated a cohort of 21 unrelated families with rhabdomyolysis, in whom no underlying etiology had been previously established. Using WES, we identified causative mutations in candidate genes in nine of the 21 families (43%). We detected disease-causing mutations in eight of 58 candidate genes, grouped into the following categories: (1) disorders of fatty acid metabolism (CPT2), (2) disorders of glycogen metabolism (PFKM and PGAM2), (3) disorders of abnormal skeletal muscle relaxation and contraction (CACNA1S, MYH3, RYR1 and SCN4A), and (4) disorders of purine metabolism (AHCY). Our findings demonstrate a very high detection rate for monogenic etiologies using WES and reveal broad genetic heterogeneity for rhabdomyolysis. These results highlight the importance of molecular genetic diagnostics for establishing an etiologic diagnosis. Because these patients are at risk for recurrent episodes of rhabdomyolysis and subsequent risk for AKI, WES allows adequate prophylaxis and treatment for these patients and their family members and enables a personalized medicine approach.

Comparison and phylogenetic analysis of the ISS gene in two predominant avian pathogenic E. coli serogroups isolated from avian colibacillosis in Iran.

PubMed

Zahraei Salehi, Taghi; Derakhshandeh, Abdollah; Tadjbakhsh, Hasan; Karimi, Vahid

2013-02-01

The ISS (increased serum survival) gene and its protein product (ISS) of avian pathogenic Escherichia coli (APEC) are important characteristics of resistance to the complement system. The aims of this study were to clone, sequence and characterize sequence diversity of the ISS gene between two predominant serogroups in Iran and among those previously deposited in Genbank. The ISS gene of 309 bp from the APEC χ1390 strain was amplified by PCR, cloned and sequenced using pTZ57R/T vector. The ISS gene from the χ1390 strain has 100% identity among different serogroups of APEC in different geographical regions throughout the world. Phylogenetic analysis shows two different phylogenic groups among the different strains. Strong association of nucleotide sequences among different E. coli strains suggests that it may be a conserved gene and could be a suitable antigen to control and detect avian pathogenic E. coli, at least in our region. Currently, our group is working on the ISS protein as candidate vaccine in SPF poultry. Copyright © 2012 Elsevier Ltd. All rights reserved.

De novo sequencing and analysis of the transcriptome of Panax ginseng in the leaf-expansion period.

PubMed

Liu, Shichao; Wang, Siming; Liu, Meichen; Yang, Fei; Zhang, Hui; Liu, Shiyang; Wang, Qun; Zhao, Yu

2016-08-01

Panax ginseng, a traditional Chinese medicine, is used worldwide for its variety of health benefits and its treatment efficacy. However, it is difficult to cultivate due to its vulnerability to environmental stresses. The present study provided the first report, to the best of our knowledge, of transcriptome analysis of ginseng at the leaf‑expansion stage. Using the Illumina sequencing platform, >40,000,000 high‑quality paired‑end reads were obtained and assembled into 100,533 unique sequences. When the sequences were searched against the publicly available National Center for Biotechnology Information protein database using The Basic Local Alignment Search Tool, 61,599 sequences exhibited similarity to known proteins. Functional annotation and classification, including use of the Gene Ontology, Clusters of Orthologous Groups, and Kyoto Encyclopedia of Genes and Genomes databases, revealed that the activated genes in ginseng were predominantly ribonuclease‑like storage genes, environmental stress genes, pathogenesis-related genes and other antioxidant genes. A number of candidate genes in environmental stress‑associated pathways were also identified. These novel data provide useful information on the growth and development stages of ginseng, and serve as an important public information platform for further understanding of the molecular mechanisms and functional genomics of ginseng.

Mutational Analysis of Extranodal NK/T-Cell Lymphoma Using Targeted Sequencing with a Comprehensive Cancer Panel.

PubMed

Choi, Seungkyu; Go, Jai Hyang; Kim, Eun Kyung; Lee, Hojung; Lee, Won Mi; Cho, Chun-Sung; Han, Kyudong

2016-09-01

Extranodal natural killer (NK)/T-cell lymphoma, nasal type (NKTCL), is a malignant disorder of cytotoxic lymphocytes of NK or T cells. It is an aggressive neoplasm with a very poor prognosis. Although extranodal NKTCL reportedly has a strong association with Epstein-Barr virus, the molecular pathogenesis of NKTCL has been unexplored. The recent technological advancements in next-generation sequencing (NGS) have made DNA sequencing cost- and time-effective, with more reliable results. Using the Ion Proton Comprehensive Cancer Panel, we sequenced 409 cancer-related genes to identify somatic mutations in five NKTCL tissue samples. The sequencing analysis detected 25 mutations in 21 genes. Among them, KMT2D , a histone modification-related gene, was the most frequently mutated gene (four of the five cases). This result was consistent with recent NGS studies that have suggested KMT2D as a novel driver gene in NKTCL. Mutations were also found in ARID1A , a chromatin remodeling gene, and TP53 , which also recurred in recent NGS studies. We also found mutations in 18 novel candidate genes, with molecular functions that were potentially implicated in cancer development. We suggest that these genes may result in multiple oncogenic events and may be used as potential bio-markers of NKTCL in the future.

PpeTAC1 promotes the horizontal growth of branches in peach trees and is a member of a functionally conserved gene family found in diverse plants species.

PubMed

Dardick, Chris; Callahan, Ann; Horn, Renate; Ruiz, Karina B; Zhebentyayeva, Tetyana; Hollender, Courtney; Whitaker, Michael; Abbott, Albert; Scorza, Ralph

2013-08-01

Trees are capable of tremendous architectural plasticity, allowing them to maximize their light exposure under highly competitive environments. One key component of tree architecture is the branch angle, yet little is known about the molecular basis for the spatial patterning of branches in trees. Here, we report the identification of a candidate gene for the br mutation in Prunus persica (peach) associated with vertically oriented growth of branches, referred to as 'pillar' or 'broomy'. Ppa010082, annotated as hypothetical protein in the peach genome sequence, was identified as a candidate gene for br using a next generation sequence-based mapping approach. Sequence similarity searches identified rice TAC1 (tiller angle control 1) as a putative ortholog, and we thus named it PpeTAC1. In monocots, TAC1 is known to lead to less compact growth by increasing the tiller angle. In Arabidopsis, an attac1 mutant showed more vertical branch growth angles, suggesting that the gene functions universally to promote the horizontal growth of branches. TAC1 genes belong to a gene family (here named IGT for a shared conserved motif) found in all plant genomes, consisting of two clades: one containing TAC1-like genes; the other containing LAZY1, which contains an EAR motif, and promotes vertical shoot growth in Oryza sativa (rice) and Arabidopsis through influencing polar auxin transport. The data suggest that IGT genes are ancient, and play conserved roles in determining shoot growth angles in plants. Understanding how IGT genes modulate branch angles will provide insights into how different architectural growth habits evolved in terrestrial plants. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.

Extensive structural variations between mitochondrial genomes of CMS and normal peppers (Capsicum annuum L.) revealed by complete nucleotide sequencing.

PubMed

Jo, Yeong Deuk; Choi, Yoomi; Kim, Dong-Hwan; Kim, Byung-Dong; Kang, Byoung-Cheorl

2014-07-04

Cytoplasmic male sterility (CMS) is an inability to produce functional pollen that is caused by mutation of the mitochondrial genome. Comparative analyses of mitochondrial genomes of lines with and without CMS in several species have revealed structural differences between genomes, including extensive rearrangements caused by recombination. However, the mitochondrial genome structure and the DNA rearrangements that may be related to CMS have not been characterized in Capsicum spp. We obtained the complete mitochondrial genome sequences of the pepper CMS line FS4401 (507,452 bp) and the fertile line Jeju (511,530 bp). Comparative analysis between mitochondrial genomes of peppers and tobacco that are included in Solanaceae revealed extensive DNA rearrangements and poor conservation in non-coding DNA. In comparison between pepper lines, FS4401 and Jeju mitochondrial DNAs contained the same complement of protein coding genes except for one additional copy of an atp6 gene (ψatp6-2) in FS4401. In terms of genome structure, we found eighteen syntenic blocks in the two mitochondrial genomes, which have been rearranged in each genome. By contrast, sequences between syntenic blocks, which were specific to each line, accounted for 30,380 and 17,847 bp in FS4401 and Jeju, respectively. The previously-reported CMS candidate genes, orf507 and ψatp6-2, were located on the edges of the largest sequence segments that were specific to FS4401. In this region, large number of small sequence segments which were absent or found on different locations in Jeju mitochondrial genome were combined together. The incorporation of repeats and overlapping of connected sequence segments by a few nucleotides implied that extensive rearrangements by homologous recombination might be involved in evolution of this region. Further analysis using mtDNA pairs from other plant species revealed common features of DNA regions around CMS-associated genes. Although large portion of sequence context was shared by mitochondrial genomes of CMS and male-fertile pepper lines, extensive genome rearrangements were detected. CMS candidate genes located on the edges of highly-rearranged CMS-specific DNA regions and near to repeat sequences. These characteristics were detected among CMS-associated genes in other species, implying a common mechanism might be involved in the evolution of CMS-associated genes.

A genomic scan for selection reveals candidates for genes involved in the evolution of cultivated sunflower (Helianthus annuus).

PubMed

Chapman, Mark A; Pashley, Catherine H; Wenzler, Jessica; Hvala, John; Tang, Shunxue; Knapp, Steven J; Burke, John M

2008-11-01

Genomic scans for selection are a useful tool for identifying genes underlying phenotypic transitions. In this article, we describe the results of a genome scan designed to identify candidates for genes targeted by selection during the evolution of cultivated sunflower. This work involved screening 492 loci derived from ESTs on a large panel of wild, primitive (i.e., landrace), and improved sunflower (Helianthus annuus) lines. This sampling strategy allowed us to identify candidates for selectively important genes and investigate the likely timing of selection. Thirty-six genes showed evidence of selection during either domestication or improvement based on multiple criteria, and a sequence-based test of selection on a subset of these loci confirmed this result. In view of what is known about the structure of linkage disequilibrium across the sunflower genome, these genes are themselves likely to have been targeted by selection, rather than being merely linked to the actual targets. While the selection candidates showed a broad range of putative functions, they were enriched for genes involved in amino acid synthesis and protein catabolism. Given that a similar pattern has been detected in maize (Zea mays), this finding suggests that selection on amino acid composition may be a general feature of the evolution of crop plants. In terms of genomic locations, the selection candidates were significantly clustered near quantitative trait loci (QTL) that contribute to phenotypic differences between wild and cultivated sunflower, and specific instances of QTL colocalization provide some clues as to the roles that these genes may have played during sunflower evolution.

Comparative genomics and prediction of conditionally dispensable sequences in legume-infecting Fusarium oxysporum formae speciales facilitates identification of candidate effectors.

PubMed

Williams, Angela H; Sharma, Mamta; Thatcher, Louise F; Azam, Sarwar; Hane, James K; Sperschneider, Jana; Kidd, Brendan N; Anderson, Jonathan P; Ghosh, Raju; Garg, Gagan; Lichtenzveig, Judith; Kistler, H Corby; Shea, Terrance; Young, Sarah; Buck, Sally-Anne G; Kamphuis, Lars G; Saxena, Rachit; Pande, Suresh; Ma, Li-Jun; Varshney, Rajeev K; Singh, Karam B

2016-03-05

Soil-borne fungi of the Fusarium oxysporum species complex cause devastating wilt disease on many crops including legumes that supply human dietary protein needs across many parts of the globe. We present and compare draft genome assemblies for three legume-infecting formae speciales (ff. spp.): F. oxysporum f. sp. ciceris (Foc-38-1) and f. sp. pisi (Fop-37622), significant pathogens of chickpea and pea respectively, the world's second and third most important grain legumes, and lastly f. sp. medicaginis (Fom-5190a) for which we developed a model legume pathosystem utilising Medicago truncatula. Focusing on the identification of pathogenicity gene content, we leveraged the reference genomes of Fusarium pathogens F. oxysporum f. sp. lycopersici (tomato-infecting) and F. solani (pea-infecting) and their well-characterised core and dispensable chromosomes to predict genomic organisation in the newly sequenced legume-infecting isolates. Dispensable chromosomes are not essential for growth and in Fusarium species are known to be enriched in host-specificity and pathogenicity-associated genes. Comparative genomics of the publicly available Fusarium species revealed differential patterns of sequence conservation across F. oxysporum formae speciales, with legume-pathogenic formae speciales not exhibiting greater sequence conservation between them relative to non-legume-infecting formae speciales, possibly indicating the lack of a common ancestral source for legume pathogenicity. Combining predicted dispensable gene content with in planta expression in the model legume-infecting isolate, we identified small conserved regions and candidate effectors, four of which shared greatest similarity to proteins from another legume-infecting ff. spp. We demonstrate that distinction of core and potential dispensable genomic regions of novel F. oxysporum genomes is an effective tool to facilitate effector discovery and the identification of gene content possibly linked to host specificity. While the legume-infecting isolates didn't share large genomic regions of pathogenicity-related content, smaller regions and candidate effector proteins were highly conserved, suggesting that they may play specific roles in inducing disease on legume hosts.

The genomic organization of a human creatine transporter (CRTR) gene located in Xq28

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sandoval, N.; Bauer, D.; Brenner, V.

1996-07-15

During the course of a large-scale sequencing project in Xq28, a human creatine transporter (CRTR) gene was discovered. The gene is located approximately 36 kb centromeric to ALD. The gene contains 13 exons and spans about 8.5 kb of genomic DNA. Since the creatine transporter has a prominent function in muscular physiology, it is a candidate gene for Barth syndrome and infantile cardiomyopathy mapped to Xq28. 19 refs., 1 fig., 1 tab.

Genetic diversity of the merozoite surface protein-3 gene in Plasmodium falciparum populations in Thailand.

PubMed

Pattaradilokrat, Sittiporn; Sawaswong, Vorthon; Simpalipan, Phumin; Kaewthamasorn, Morakot; Siripoon, Napaporn; Harnyuttanakorn, Pongchai

2016-10-21

An effective malaria vaccine is an urgently needed tool to fight against human malaria, the most deadly parasitic disease of humans. One promising candidate is the merozoite surface protein-3 (MSP-3) of Plasmodium falciparum. This antigenic protein, encoded by the merozoite surface protein (msp-3) gene, is polymorphic and classified according to size into the two allelic types of K1 and 3D7. A recent study revealed that both the K1 and 3D7 alleles co-circulated within P. falciparum populations in Thailand, but the extent of the sequence diversity and variation within each allelic type remains largely unknown. The msp-3 gene was sequenced from 59 P. falciparum samples collected from five endemic areas (Mae Hong Son, Kanchanaburi, Ranong, Trat and Ubon Ratchathani) in Thailand and analysed for nucleotide sequence diversity, haplotype diversity and deduced amino acid sequence diversity. The gene was also subject to population genetic analysis (F st ) and neutrality tests (Tajima's D, Fu and Li D* and Fu and Li' F* tests) to determine any signature of selection. The sequence analyses revealed eight unique DNA haplotypes and seven amino acid sequence variants, with a haplotype and nucleotide diversity of 0.828 and 0.049, respectively. Neutrality tests indicated that the polymorphism detected in the alanine heptad repeat region of MSP-3 was maintained by positive diversifying selection, suggesting its role as a potential target of protective immune responses and supporting its role as a vaccine candidate. Comparison of MSP-3 variants among parasite populations in Thailand, India and Nigeria also inferred a close genetic relationship between P. falciparum populations in Asia. This study revealed the extent of the msp-3 gene diversity in P. falciparum in Thailand, providing the fundamental basis for the better design of future blood stage malaria vaccines against P. falciparum.

Candidate Chemosensory Genes in the Stemborer Sesamia nonagrioides

PubMed Central

Glaser, Nicolas; Gallot, Aurore; Legeai, Fabrice; Montagné, Nicolas; Poivet, Erwan; Harry, Myriam; Calatayud, Paul-André; Jacquin-Joly, Emmanuelle

2013-01-01

The stemborer Sesamia nonagrioides is an important pest of maize in the Mediterranean Basin. Like other moths, this noctuid uses its chemosensory system to efficiently interact with its environment. However, very little is known on the molecular mechanisms that underlie chemosensation in this species. Here, we used next-generation sequencing (454 and Illumina) on different tissues from adult and larvae, including chemosensory organs and female ovipositors, to describe the chemosensory transcriptome of S. nonagrioides and identify key molecular components of the pheromone production and detection systems. We identified a total of 68 candidate chemosensory genes in this species, including 31 candidate binding-proteins and 23 chemosensory receptors. In particular, we retrieved the three co-receptors Orco, IR25a and IR8a necessary for chemosensory receptor functioning. Focusing on the pheromonal communication system, we identified a new pheromone-binding protein in this species, four candidate pheromone receptors and 12 carboxylesterases as candidate acetate degrading enzymes. In addition, we identified enzymes putatively involved in S. nonagrioides pheromone biosynthesis, including a ∆11-desaturase and different acetyltransferases and reductases. RNAseq analyses and RT-PCR were combined to profile gene expression in different tissues. This study constitutes the first large scale description of chemosensory genes in S. nonagrioides. PMID:23781142

Many human accelerated regions are developmental enhancers

PubMed Central

Capra, John A.; Erwin, Genevieve D.; McKinsey, Gabriel; Rubenstein, John L. R.; Pollard, Katherine S.

2013-01-01

The genetic changes underlying the dramatic differences in form and function between humans and other primates are largely unknown, although it is clear that gene regulatory changes play an important role. To identify regulatory sequences with potentially human-specific functions, we and others used comparative genomics to find non-coding regions conserved across mammals that have acquired many sequence changes in humans since divergence from chimpanzees. These regions are good candidates for performing human-specific regulatory functions. Here, we analysed the DNA sequence, evolutionary history, histone modifications, chromatin state and transcription factor (TF) binding sites of a combined set of 2649 non-coding human accelerated regions (ncHARs) and predicted that at least 30% of them function as developmental enhancers. We prioritized the predicted ncHAR enhancers using analysis of TF binding site gain and loss, along with the functional annotations and expression patterns of nearby genes. We then tested both the human and chimpanzee sequence for 29 ncHARs in transgenic mice, and found 24 novel developmental enhancers active in both species, 17 of which had very consistent patterns of activity in specific embryonic tissues. Of these ncHAR enhancers, five drove expression patterns suggestive of different activity for the human and chimpanzee sequence at embryonic day 11.5. The changes to human non-coding DNA in these ncHAR enhancers may modify the complex patterns of gene expression necessary for proper development in a human-specific manner and are thus promising candidates for understanding the genetic basis of human-specific biology. PMID:24218637

Bisphenol A-Associated Alterations in the Expression and Epigenetic Regulation of Genes Encoding Xenobiotic Metabolizing Enzymes in Human Fetal Liver

PubMed Central

Nahar, Muna S.; Kim, Jung H.; Sartor, Maureen A.; Dolinoy, Dana C.

2014-01-01

Alterations in xenobiotic metabolizing enzyme (XME) expression across the life course, along with genetic, nutritional, and environmental regulation, can influence how organisms respond to toxic insults. In this study, we investigated the hypothesis that in utero exposure to the endocrine active compound, bisphenol A (BPA), influences expression and epigenetic regulation of phase I and II XME genes during development. Using healthy 1st to 2nd trimester human fetal liver specimens quantified for internal BPA levels, we examined XME gene expression using PCR Array (n =8) and RNA-sequencing (n =12) platforms. Of the greater than 160 XME genes assayed, 2 phase I and 12 phase II genes exhibited significantly reduced expression with higher BPA levels, including isoforms from the carboxylesterase, catechol O-methyltransferase, glutathione S-transferase, sulfotransferase, and UDP-glucuronosyltransferase families. When the promoters of these candidate genes were evaluated in silico, putative binding sites for the E-twenty-six (ETS) and activator protein1 (AP1) related transcription factor families were identified and unique to 97% of all candidate transcripts. Interestingly, many ETS binding sites contain cytosine-guanine dinucleotides (CpGs) within their consensus sequences. Thus, quantitative analysis of CpG methylation of three candidate genes was conducted across n =50 samples. Higher BPA levels were associated with increased site-specific methylation at COMT (P <0.005) and increased average methylation at SULT2A1 (P <0.020) promoters. While toxicological studies have traditionally focused on high-dose effects and hormonal receptor mediated regulation, our findings suggest the importance of low-dose effects and nonclassical mechanisms of endocrine disruption during development. PMID:24214726

GENOMIC BASIS OF AGING AND LIFE HISTORY EVOLUTION IN DROSOPHILA MELANOGASTER

PubMed Central

Remolina, Silvia C.; Chang, Peter L.; Leips, Jeff; Nuzhdin, Sergey V.; Hughes, Kimberly A.

2015-01-01

Natural diversity in aging and other life history patterns is a hallmark of organismal variation. Related species, populations, and individuals within populations show genetically based variation in life span and other aspects of age-related performance. Population differences are especially informative because these differences can be large relative to within-population variation and because they occur in organisms with otherwise similar genomes. We used experimental evolution to produce populations divergent for life span and late-age fertility and then used deep genome sequencing to detect sequence variants with nucleotide-level resolution. Several genes and genome regions showed strong signatures of selection, and the same regions were implicated in independent comparisons, suggesting that the same alleles were selected in replicate lines. Genes related to oogenesis, immunity, and protein degradation were implicated as important modifiers of late-life performance. Expression profiling and functional annotation narrowed the list of strong candidate genes to 38, most of which are novel candidates for regulating aging. Life span and early-age fecundity were negatively correlated among populations; therefore the alleles we identified also are candidate regulators of a major life-history trade-off. More generally, we argue that hitchhiking mapping can be a powerful tool for uncovering the molecular bases of quantitative genetic variation. PMID:23106705

The molecular genetic makeup of acute lymphoblastic leukemia | Office of Cancer Genomics

Cancer.gov

Abstract: Genomic profiling has transformed our understanding of the genetic basis of acute lymphoblastic leukemia (ALL). Recent years have seen a shift from microarray analysis and candidate gene sequencing to next-generation sequencing. Together, these approaches have shown that many ALL subtypes are characterized by constellations of structural rearrangements, submicroscopic DNA copy number alterations, and sequence mutations, several of which have clear implications for risk stratification and targeted therapeutic intervention.

Gene Targeting in Rabbits: Single-Step Generation of Knock-out Rabbits by Microinjection of CRISPR/Cas9 Plasmids.

PubMed

Kawano, Yoshihiro; Honda, Arata

2017-01-01

The development of genome editing technology has allowed gene disruptions to be achieved in various animal species and has been beneficial to many mammals. Gene disruption using pluripotent stem cells is difficult to achieve in rabbits, but thanks to advances in genome editing technology, a number of gene disruptions have been conducted. This paper describes a simple and easy method for carrying out gene disruptions in rabbits using CRISPR/Cas9 in which the gene to be disrupted is marked, the presence or absence of off-target candidates is checked, and a plasmid allowing simultaneous expression of Cas9 and sgRNA is constructed. Next, the cleaving activity of candidate sequences is investigated, and assessments are carried out to determine whether the target sequences can be cut. Female rabbits subjected to superovulation treatment are mated with male rabbits and fertilized eggs are collected, and then pronuclear injection of plasmid DNA is performed. The next day, the two-cell stage embryos are transplanted into pseudopregnant rabbits, and offspring are born within approximately 29-30 days. The genomic DNA of the offspring is then examined to check what types of genetic modifications have occurred. With the advent of CRISPR/Cas9, the accessibility of gene disruptions in rabbits has improved remarkably. This paper summarizes specifically how to carry out gene disruptions in rabbits.

Comparative Genomics Analyses Reveal Extensive Chromosome Colinearity and Novel Quantitative Trait Loci in Eucalyptus.

PubMed

Li, Fagen; Zhou, Changpin; Weng, Qijie; Li, Mei; Yu, Xiaoli; Guo, Yong; Wang, Yu; Zhang, Xiaohong; Gan, Siming

2015-01-01

Dense genetic maps, along with quantitative trait loci (QTLs) detected on such maps, are powerful tools for genomics and molecular breeding studies. In the important woody genus Eucalyptus, the recent release of E. grandis genome sequence allows for sequence-based genomic comparison and searching for positional candidate genes within QTL regions. Here, dense genetic maps were constructed for E. urophylla and E. tereticornis using genomic simple sequence repeats (SSR), expressed sequence tag (EST) derived SSR, EST-derived cleaved amplified polymorphic sequence (EST-CAPS), and diversity arrays technology (DArT) markers. The E. urophylla and E. tereticornis maps comprised 700 and 585 markers across 11 linkage groups, totaling at 1,208.2 and 1,241.4 cM in length, respectively. Extensive synteny and colinearity were observed as compared to three earlier DArT-based eucalypt maps (two maps with E. grandis × E. urophylla and one map of E. globulus) and with the E. grandis genome sequence. Fifty-three QTLs for growth (10-56 months of age) and wood density (56 months) were identified in 22 discrete regions on both maps, in which only one colocalizaiton was found between growth and wood density. Novel QTLs were revealed as compared with those previously detected on DArT-based maps for similar ages in Eucalyptus. Eleven to 585 positional candidate genes were obained for a 56-month-old QTL through aligning QTL confidence interval with the E. grandis genome. These results will assist in comparative genomics studies, targeted gene characterization, and marker-assisted selection in Eucalyptus and the related taxa.

Comparative Genomics Analyses Reveal Extensive Chromosome Colinearity and Novel Quantitative Trait Loci in Eucalyptus

PubMed Central

Weng, Qijie; Li, Mei; Yu, Xiaoli; Guo, Yong; Wang, Yu; Zhang, Xiaohong; Gan, Siming

2015-01-01

Dense genetic maps, along with quantitative trait loci (QTLs) detected on such maps, are powerful tools for genomics and molecular breeding studies. In the important woody genus Eucalyptus, the recent release of E. grandis genome sequence allows for sequence-based genomic comparison and searching for positional candidate genes within QTL regions. Here, dense genetic maps were constructed for E. urophylla and E. tereticornis using genomic simple sequence repeats (SSR), expressed sequence tag (EST) derived SSR, EST-derived cleaved amplified polymorphic sequence (EST-CAPS), and diversity arrays technology (DArT) markers. The E. urophylla and E. tereticornis maps comprised 700 and 585 markers across 11 linkage groups, totaling at 1,208.2 and 1,241.4 cM in length, respectively. Extensive synteny and colinearity were observed as compared to three earlier DArT-based eucalypt maps (two maps with E. grandis × E. urophylla and one map of E. globulus) and with the E. grandis genome sequence. Fifty-three QTLs for growth (10–56 months of age) and wood density (56 months) were identified in 22 discrete regions on both maps, in which only one colocalizaiton was found between growth and wood density. Novel QTLs were revealed as compared with those previously detected on DArT-based maps for similar ages in Eucalyptus. Eleven to 585 positional candidate genes were obained for a 56-month-old QTL through aligning QTL confidence interval with the E. grandis genome. These results will assist in comparative genomics studies, targeted gene characterization, and marker-assisted selection in Eucalyptus and the related taxa. PMID:26695430

Transcriptomic Analysis Identifies Candidate Genes Related to Intramuscular Fat Deposition and Fatty Acid Composition in the Breast Muscle of Squabs (Columba)

PubMed Central

Ye, Manhong; Zhou, Bin; Wei, Shanshan; Ding, MengMeng; Lu, Xinghui; Shi, Xuehao; Ding, Jiatong; Yang, Shengmei; Wei, Wanhong

2016-01-01

Despite the fact that squab is consumed throughout the world because of its high nutritional value and appreciated sensory attributes, aspects related to its characterization, and in particular genetic issues, have rarely been studied. In this study, meat traits in terms of pH, water-holding capacity, intramuscular fat content, and fatty acid profile of the breast muscle of squabs from two meat pigeon breeds were determined. Breed-specific differences were detected in fat-related traits of intramuscular fat content and fatty acid composition. RNA-Sequencing was applied to compare the transcriptomes of muscle and liver tissues between squabs of two breeds to identify candidate genes associated with the differences in the capacity of fat deposition. A total of 27 differentially expressed genes assigned to pathways of lipid metabolism were identified, of which, six genes belonged to the peroxisome proliferator-activated receptor signaling pathway along with four other genes. Our results confirmed in part previous reports in livestock and provided also a number of genes which had not been related to fat deposition so far. These genes can serve as a basis for further investigations to screen markers closely associated with intramuscular fat content and fatty acid composition in squabs. The data from this study were deposited in the National Center for Biotechnology Information (NCBI)’s Sequence Read Archive under the accession numbers SRX1680021 and SRX1680022. This is the first transcriptome analysis of the muscle and liver tissue in Columba using next generation sequencing technology. Data provided here are of potential value to dissect functional genes influencing fat deposition in squabs. PMID:27175015

Somatic mutation profiles of clear cell endometrial tumors revealed by whole exome and targeted gene sequencing.

PubMed

Le Gallo, Matthieu; Rudd, Meghan L; Urick, Mary Ellen; Hansen, Nancy F; Zhang, Suiyuan; Lozy, Fred; Sgroi, Dennis C; Vidal Bel, August; Matias-Guiu, Xavier; Broaddus, Russell R; Lu, Karen H; Levine, Douglas A; Mutch, David G; Goodfellow, Paul J; Salvesen, Helga B; Mullikin, James C; Bell, Daphne W

2017-09-01

The molecular pathogenesis of clear cell endometrial cancer (CCEC), a tumor type with a relatively unfavorable prognosis, is not well defined. We searched exome-wide for novel somatically mutated genes in CCEC and assessed the mutational spectrum of known and candidate driver genes in a large cohort of cases. We conducted whole exome sequencing of paired tumor-normal DNAs from 16 cases of CCEC (12 CCECs and the CCEC components of 4 mixed histology tumors). Twenty-two genes-of-interest were Sanger-sequenced from another 47 cases of CCEC. Microsatellite instability (MSI) and microsatellite stability (MSS) were determined by genotyping 5 mononucleotide repeats. Two tumor exomes had relatively high mutational loads and MSI. The other 14 tumor exomes were MSS and had 236 validated nonsynonymous or splice junction somatic mutations among 222 protein-encoding genes. Among the 63 cases of CCEC in this study, we identified frequent somatic mutations in TP53 (39.7%), PIK3CA (23.8%), PIK3R1 (15.9%), ARID1A (15.9%), PPP2R1A (15.9%), SPOP (14.3%), and TAF1 (9.5%), as well as MSI (11.3%). Five of 8 mutations in TAF1, a gene with no known role in CCEC, localized to the putative histone acetyltransferase domain and included 2 recurrently mutated residues. Based on patterns of MSI and mutations in 7 genes, CCEC subsets molecularly resembled serous endometrial cancer (SEC) or endometrioid endometrial cancer (EEC). Our findings demonstrate molecular similarities between CCEC and SEC and EEC and implicate TAF1 as a novel candidate CCEC driver gene. Cancer 2017;123:3261-8. © 2017 American Cancer Society. © 2017 American Cancer Society.

Comparative sequence analysis of a region on human chromosome 13q14, frequently deleted in B-cell chronic lymphocytic leukemia, and its homologous region on mouse chromosome 14.

PubMed

Kapanadze, B; Makeeva, N; Corcoran, M; Jareborg, N; Hammarsund, M; Baranova, A; Zabarovsky, E; Vorontsova, O; Merup, M; Gahrton, G; Jansson, M; Yankovsky, N; Einhorn, S; Oscier, D; Grandér, D; Sangfelt, O

2000-12-15

Previous studies have indicated the presence of a putative tumor suppressor gene on human chromosome 13q14, commonly deleted in patients with B-cell chronic lymphocytic leukemia (B-CLL). We have recently identified a minimally deleted region encompassing parts of two adjacent genes, termed LEU1 and LEU2 (leukemia-associated genes 1 and 2), and several additional transcripts. In addition, 50 kb centromeric to this region we have identified another gene, LEU5/RFP2. To elucidate further the complex genomic organization of this region, we have identified, mapped, and sequenced the homologous region in the mouse. Fluorescence in situ hybridization analysis demonstrated that the region maps to mouse chromosome 14. The overall organization and gene order in this region were found to be highly conserved in the mouse. Sequence comparison between the human deletion hotspot region and its homologous mouse region revealed a high degree of sequence conservation with an overall score of 74%. However, our data also show that in terms of transcribed sequences, only two of those, human LEU2 and LEU5/RFP2, are clearly conserved, strengthening the case for these genes as putative candidate B-CLL tumor suppressor genes.

Characterization of a rabbit germ-line VH gene that is a candidate donor for VH gene conversion in mutant Alicia rabbits.

PubMed

Chen, H T; Alexander, C B; Mage, R G

1995-06-15

Normal rabbits preferentially rearrange the 3'-most VH gene, VH1, to encode Igs with VHa allotypes, which constitute the majority of rabbit serum Igs. A gene conversion-like mechanism is employed to diversify the primary Ab repertoire. In mutant Alicia rabbits that derived from a rabbit with VHa2 allotype, the VH1 gene was deleted. Our previous studies showed that the first functional gene (VH4) or VH4-like genes were rearranged in 2- to 8-wk-old homozygous Alicia. The VH1a2-like sequences that were found in splenic mRNA from 6-wk and older Alicia rabbits still had some residues that were typical of VH4. The appearances of sequences resembling that of VH1a2 may have been caused by gene conversions that altered the sequences of the rearranged VH or there may have been rearrangement of upstream VH1a2-like genes later in development. To investigate this further, we constructed a cosmid library and isolated a VH1a2-like gene, VH12-1-6, with a sequence almost identical to VH1a2. This gene had a deleted base in the heptamer of its recombination signal sequence. However, even if this defect diminished or eliminated its ability to rearrange, the a2-like gene could have acted as a donor for gene-conversion-like alteration of rearranged VH genes. Sequence comparisons suggested that this gene or a gene like it could have acted as a donor for gene conversion in mutant Alicia and in normal rabbits.

A candidate gene for autoimmune myasthenia gravis

PubMed Central

Landouré, Guida; Knight, Melanie A.; Stanescu, Horia; Taye, Addis A.; Shi, Yijun; Diallo, Oumarou; Johnson, Janel O.; Hernandez, Dena; Traynor, Bryan J.; Biesecker, Leslie G.; Elkahloun, Abdel; Rinaldi, Carlo; Vincent, Angela; Willcox, Nick; Kleta, Robert; Fischbeck, Kenneth H.

2012-01-01

Objective: We sought to identify a causative mutation in a previously reported kindred with parental consanguinity and 5 of 10 siblings with adult-onset autoimmune myasthenia gravis. Methods: We performed genome-wide homozygosity mapping, and sequenced all known genes in the one region of extended homozygosity. Quantitative and allele-specific reverse transcriptase PCR (RT-PCR) were performed on a candidate gene to determine the RNA expression level in affected siblings and controls and the relative abundance of the wild-type and mutant alleles in a heterozygote. Results: A region of shared homozygosity at chromosome 13q13.3–13q14.11 was found in 4 affected siblings and 1 unaffected sibling. A homozygous single nucleotide variant was found in the 3′-untranslated region of the ecto-NADH oxidase 1 gene (ENOX1). No other variants likely to be pathogenic were found in genes in this region or elsewhere. The ENOX1 sequence variant was not found in 764 controls. Quantitative RT-PCR showed that expression of ENOX1 decreased to about 20% of normal levels in lymphoblastoid cells from individuals homozygous for the variant and to about 50% in 2 unaffected heterozygotes. Allele-specific RT-PCR showed a 55%–60% reduction in the level of the variant transcript in heterozygous cells due to reduced mRNA stability. Conclusion: These results indicate that this sequence variant in ENOX1 may contribute to the familial autoimmune myasthenia in these patients. PMID:22744667

Parallel Selection Revealed by Population Sequencing in Chicken.

PubMed

Qanbari, Saber; Seidel, Michael; Strom, Tim-Mathias; Mayer, Klaus F X; Preisinger, Ruedi; Simianer, Henner

2015-11-13

Human-driven selection during domestication and subsequent breed formation has likely left detectable signatures within the genome of modern chicken. The elucidation of these signatures of selection is of interest from the perspective of evolutionary biology, and for identifying genes relevant to domestication and improvement that ultimately may help to further genetically improve this economically important animal. We used whole genome sequence data from 50 hens of commercial white (WL) and brown (BL) egg-laying chicken along with pool sequences of three meat-type chicken to perform a systematic screening of past selection in modern chicken. Evidence of positive selection was investigated in two steps. First, we explored evidence of parallel fixation in regions with overlapping elevated allele frequencies in replicated populations of layers and broilers, suggestive of selection during domestication or preimprovement ages. We confirmed parallel fixation in BCDO2 and TSHR genes and found four candidates including AGTR2, a gene heavily involved in "Ascites" in commercial birds. Next, we explored differentiated loci between layers and broilers suggestive of selection during improvement in chicken. This analysis revealed evidence of parallel differentiation in genes relevant to appearance and production traits exemplified with the candidate gene OPG, implicated in Osteoporosis, a disorder related to overconsumption of calcium in egg-laying hens. Our results illustrate the potential for population genetic techniques to identify genomic regions relevant to the phenotypes of importance to breeders. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Sequencing of a QTL-rich region of the Theobroma cacao genome using pooled BACs and the identification of trait specific candidate genes

USDA-ARS?s Scientific Manuscript database

Background: BAC-based physical maps provide for sequencing across an entire genome or selected sub-genome regions of biological interest. Using the minimum tiling path as a guide, it is possible to select specific BAC clones from prioritized genome sections such as a genetically defined QTL interv...

High-density genetic map using whole-genome re-sequencing for fine mapping and candidate gene discovery for disease resistance in peanut

USDA-ARS?s Scientific Manuscript database

High-density genetic linkage maps are essential for fine mapping QTLs controlling disease resistance traits, such as early leaf spot (ELS), late leaf spot (LLS), and Tomato spotted wilt virus (TSWV). With completion of the genome sequences of two diploid ancestors of cultivated peanut, we could use ...

Complete Genome Sequence of Elizabethkingia miricola Strain EM798-26 Isolated from the Blood of a Cancer Patient

PubMed Central

Lai, Chung-Hsu; Yang, Chih-Hui; Huang, Yi-Han; Lin, Hsi-Hsun

2018-01-01

ABSTRACT Elizabethkingia miricola EM798-26 was isolated from the blood of a patient with diffuse large B-cell lymphoma in Taiwan. We report here the complete genome sequence of EM798-26, which contains a G+C content of 35.7% and 3,877 candidate protein-coding genes. PMID:29301886

Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes

NASA Astrophysics Data System (ADS)

Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat

2016-11-01

In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.

Application of Whole Exome Sequencing in Six Families with an Initial Diagnosis of Autosomal Dominant Retinitis Pigmentosa: Lessons Learned

PubMed Central

Fernandez-San Jose, Patricia; Liu, Yichuan; March, Michael; Pellegrino, Renata; Golhar, Ryan; Corton, Marta; Blanco-Kelly, Fiona; López-Molina, Maria Isabel; García-Sandoval, Blanca; Guo, Yiran; Tian, Lifeng; Liu, Xuanzhu; Guan, Liping; Zhang, Jianguo; Keating, Brendan; Xu, Xun

2015-01-01

This study aimed to identify the genetics underlying dominant forms of inherited retinal dystrophies using whole exome sequencing (WES) in six families extensively screened for known mutations or genes. Thirty-eight individuals were subjected to WES. Causative variants were searched among single nucleotide variants (SNVs) and insertion/deletion variants (indels) and whenever no potential candidate emerged, copy number variant (CNV) analysis was performed. Variants or regions harboring a candidate variant were prioritized and segregation of the variant with the disease was further assessed using Sanger sequencing in case of SNVs and indels, and quantitative PCR (qPCR) for CNVs. SNV and indel analysis led to the identification of a previously reported mutation in PRPH2. Two additional mutations linked to different forms of retinal dystrophies were identified in two families: a known frameshift deletion in RPGR, a gene responsible for X-linked retinitis pigmentosa and p.Ser163Arg in C1QTNF5 associated with Late-Onset Retinal Degeneration. A novel heterozygous deletion spanning the entire region of PRPF31 was also identified in the affected members of a fourth family, which was confirmed with qPCR. This study allowed the identification of the genetic cause of the retinal dystrophy and the establishment of a correct diagnosis in four families, including a large heterozygous deletion in PRPF31, typically considered one of the pitfalls of this method. Since all findings in this study are restricted to known genes, we propose that targeted sequencing using gene-panel is an optimal first approach for the genetic screening and that once known genetic causes are ruled out, WES might be used to uncover new genes involved in inherited retinal dystrophies. PMID:26197217

Regulatory versus coding signatures of natural selection in a candidate gene involved in the adaptive divergence of whitefish species pairs (Coregonus spp.)

PubMed Central

Jeukens, Julie; Bernatchez, Louis

2012-01-01

While gene expression divergence is known to be involved in adaptive phenotypic divergence and speciation, the relative importance of regulatory and structural evolution of genes is poorly understood. A recent next-generation sequencing experiment allowed identifying candidate genes potentially involved in the ongoing speciation of sympatric dwarf and normal lake whitefish (Coregonus clupeaformis), such as cytosolic malate dehydrogenase (MDH1), which showed both significant expression and sequence divergence. The main goal of this study was to investigate into more details the signatures of natural selection in the regulatory and coding sequences of MDH1 in lake whitefish and test for parallelism of these signatures with other coregonine species. Sequencing of the two regions in 118 fish from four sympatric pairs of whitefish and two cisco species revealed a total of 35 single nucleotide polymorphisms (SNPs), with more genetic diversity in European compared to North American coregonine species. While the coding region was found to be under purifying selection, an SNP in the proximal promoter exhibited significant allele frequency divergence in a parallel manner among independent sympatric pairs of North American lake whitefish and European whitefish (C. lavaretus). According to transcription factor binding simulation for 22 regulatory haplotypes of MDH1, putative binding profiles were fairly conserved among species, except for the region around this SNP. Moreover, we found evidence for the role of this SNP in the regulation of MDH1 expression level. Overall, these results provide further evidence for the role of natural selection in gene regulation evolution among whitefish species pairs and suggest its possible link with patterns of phenotypic diversity observed in coregonine species. PMID:22408741

Regulatory versus coding signatures of natural selection in a candidate gene involved in the adaptive divergence of whitefish species pairs (Coregonus spp.).

PubMed

Jeukens, Julie; Bernatchez, Louis

2012-01-01

While gene expression divergence is known to be involved in adaptive phenotypic divergence and speciation, the relative importance of regulatory and structural evolution of genes is poorly understood. A recent next-generation sequencing experiment allowed identifying candidate genes potentially involved in the ongoing speciation of sympatric dwarf and normal lake whitefish (Coregonus clupeaformis), such as cytosolic malate dehydrogenase (MDH1), which showed both significant expression and sequence divergence. The main goal of this study was to investigate into more details the signatures of natural selection in the regulatory and coding sequences of MDH1 in lake whitefish and test for parallelism of these signatures with other coregonine species. Sequencing of the two regions in 118 fish from four sympatric pairs of whitefish and two cisco species revealed a total of 35 single nucleotide polymorphisms (SNPs), with more genetic diversity in European compared to North American coregonine species. While the coding region was found to be under purifying selection, an SNP in the proximal promoter exhibited significant allele frequency divergence in a parallel manner among independent sympatric pairs of North American lake whitefish and European whitefish (C. lavaretus). According to transcription factor binding simulation for 22 regulatory haplotypes of MDH1, putative binding profiles were fairly conserved among species, except for the region around this SNP. Moreover, we found evidence for the role of this SNP in the regulation of MDH1 expression level. Overall, these results provide further evidence for the role of natural selection in gene regulation evolution among whitefish species pairs and suggest its possible link with patterns of phenotypic diversity observed in coregonine species.

Genome-Wide Identification of Regulatory Elements and Reconstruction of Gene Regulatory Networks of the Green Alga Chlamydomonas reinhardtii under Carbon Deprivation

PubMed Central

Vischi Winck, Flavia; Arvidsson, Samuel; Riaño-Pachón, Diego Mauricio; Hempel, Sabrina; Koseska, Aneta; Nikoloski, Zoran; Urbina Gomez, David Alejandro; Rupprecht, Jens; Mueller-Roeber, Bernd

2013-01-01

The unicellular green alga Chlamydomonas reinhardtii is a long-established model organism for studies on photosynthesis and carbon metabolism-related physiology. Under conditions of air-level carbon dioxide concentration [CO2], a carbon concentrating mechanism (CCM) is induced to facilitate cellular carbon uptake. CCM increases the availability of carbon dioxide at the site of cellular carbon fixation. To improve our understanding of the transcriptional control of the CCM, we employed FAIRE-seq (formaldehyde-assisted Isolation of Regulatory Elements, followed by deep sequencing) to determine nucleosome-depleted chromatin regions of algal cells subjected to carbon deprivation. Our FAIRE data recapitulated the positions of known regulatory elements in the promoter of the periplasmic carbonic anhydrase (Cah1) gene, which is upregulated during CCM induction, and revealed new candidate regulatory elements at a genome-wide scale. In addition, time series expression patterns of 130 transcription factor (TF) and transcription regulator (TR) genes were obtained for cells cultured under photoautotrophic condition and subjected to a shift from high to low [CO2]. Groups of co-expressed genes were identified and a putative directed gene-regulatory network underlying the CCM was reconstructed from the gene expression data using the recently developed IOTA (inner composition alignment) method. Among the candidate regulatory genes, two members of the MYB-related TF family, Lcr1 (Low-CO 2 response regulator 1) and Lcr2 (Low-CO 2 response regulator 2), may play an important role in down-regulating the expression of a particular set of TF and TR genes in response to low [CO2]. The results obtained provide new insights into the transcriptional control of the CCM and revealed more than 60 new candidate regulatory genes. Deep sequencing of nucleosome-depleted genomic regions indicated the presence of new, previously unknown regulatory elements in the C. reinhardtii genome. Our work can serve as a basis for future functional studies of transcriptional regulator genes and genomic regulatory elements in Chlamydomonas. PMID:24224019

RNA-Seq Analysis Reveals Candidate Genes for Ontogenic Resistance in Malus-Venturia Pathosystem

PubMed Central

Gusberti, Michele; Gessler, Cesare; Broggini, Giovanni A. L.

2013-01-01

Ontogenic scab resistance in apple leaves and fruits is a horizontal resistance against the plant pathogen Venturia inaequalis and is expressed as a decrease in disease symptoms and incidence with the ageing of the leaves. Several studies at the biochemical level tried to unveil the nature of this resistance; however, no conclusive results were reported. We decided therefore to investigate the genetic origin of this phenomenon by performing a full quantitative transcriptome sequencing and comparison of young (susceptible) and old (ontogenic resistant) leaves, infected or not with the pathogen. Two time points at 72 and 96 hours post-inoculation were chosen for RNA sampling and sequencing. Comparison between the different conditions (young and old leaves, inoculated or not) should allow the identification of differentially expressed genes which may represent different induced plant defence reactions leading to ontogenic resistance or may be the cause of a constitutive (uninoculated with the pathogen) shift toward resistance in old leaves. Differentially expressed genes were then characterised for their function by homology to A. thaliana and other plant genes, particularly looking for genes involved in pathways already suspected of appertaining to ontogenic resistance in apple or other hosts, or to plant defence mechanisms in general. In this work, five candidate genes putatively involved in the ontogenic resistance of apple were identified: a gene encoding an “enhanced disease susceptibility 1 protein” was found to be down-regulated in both uninoculated and inoculated old leaves at 96 hpi, while the other four genes encoding proteins (metallothionein3-like protein, lipoxygenase, lipid transfer protein, and a peroxidase 3) were found to be constitutively up-regulated in inoculated and uninoculated old leaves. The modulation of the five candidate genes has been validated using the real-time quantitative PCR. Thus, ontogenic resistance may be the result of the corresponding up- and down-regulation of these genes. PMID:24223809

Genetic study of intracranial aneurysms.

PubMed

Yan, Junxia; Hitomi, Toshiaki; Takenaka, Katsunobu; Kato, Masayasu; Kobayashi, Hatasu; Okuda, Hiroko; Harada, Kouji H; Koizumi, Akio

2015-03-01

Rupture of intracranial aneurysms (IAs) causes subarachnoid hemorrhage, leading to immediate death or severe disability. Identification of the genetic factors involved is critical for disease prevention and treatment. We aimed to identify the susceptibility genes for IAs. Exome sequencing was performed in 12 families with histories of multiple cases of IA (number of cases per family ≥3), with a total of 42 cases. Various filtering strategies were used to select the candidate variants. Replicate association studies of several candidate variants were performed in probands of 24 additional IA families and 426 sporadic IA cases. Functional analysis for the mutations was conducted. After sequencing and filtering, 78 variants were selected for the following reasons: allele frequencies of variants in 42 patients was significantly (P<0.05) larger than expected; variants were completely shared by all patients with IA within ≥1 family; variants predicted damage to the structure or function of the protein by PolyPhen-2 (Polymorphism Phenotyping V2) and SIFT (Sorting Intolerance From Tolerant). We selected 10 variants from 9 genes (GPR63, ADAMST15, MLL2, IL10RA, PAFAH2, THBD, IL11RA, FILIP1L, and ZNF222) to form 78 candidate variants by considering commonness in families, known disease genes, or ontology association with angiogenesis. Replicate association studies revealed that only p.E133Q in ADAMTS15 was aggregated in the familial IA cases (odds ratio, 5.96; 95% confidence interval, 2.40-14.82; P=0.0001; significant after the Bonferroni correction [P=0.05/78=0.0006]). Silencing ADAMTS15 and overexpression of ADAMTS15 p.E133Q accelerated endothelial cell migration, suggesting that ADAMTS15 may have antiangiogenic activity. ADAMTS15 is a candidate gene for IAs. © 2015 American Heart Association, Inc.

Genome-wide association study reveals a QTL and strong candidate genes for umbilical hernia in pigs on SSC14.

PubMed

Grindflek, Eli; Hansen, Marianne H S; Lien, Sigbjørn; van Son, Maren

2018-05-29

Umbilical hernia is one of the most prevalent congenital defect in pigs, causing economic losses and substantial animal welfare problems. Identification and implementation of genomic regions controlling umbilical hernia in breeding is of great interest to reduce incidences of hernia in commercial pig production. The aim of this study was to identify such regions and possibly identify causative variation affecting umbilical hernia in pigs. A case/control material consisting of 739 Norwegian Landrace pigs was collected and applied in a GWAS study with a genome-wide distributed panel of 60 K SNPs. Additionally candidate genes were sequenced to detect additional polymorphisms that were used for single SNP and haplotype association analyses in 453 of the pigs. The GWAS in this report detected a highly significant region affecting umbilical hernia around 50 Mb on SSC14 (P < 0.0001) explaining up to 8.6% of the phenotypic variance of the trait. The region is rather broad and includes 62 significant SNPs in high linkage disequilibrium with each other. Targeted sequencing of candidate genes within the region revealed polymorphisms within the Leukemia inhibitory factor (LIF) and Oncostatin M (OSM) that were significantly associated with umbilical hernia (P < 0.001). A highly significant QTL for umbilical hernia in Norwegian Landrace pigs was detected around 50 Mb on SSC14. Resequencing of candidate genes within the region revealed SNPs within LIF and OSM highly associated with the trait. However, because of extended LD within the region, studies in other populations and functional studies are needed to determine whether these variants are causal or not. Still without this knowledge, SNPs within the region can be used as genetic markers to reduce incidences of umbilical hernia in Norwegian Landrace pigs.

[Isolation and function of genes regulating aphB expression in Vibrio cholerae].

PubMed

Chen, Haili; Zhu, Zhaoqin; Zhong, Zengtao; Zhu, Jun; Kan, Biao

2012-02-04

We identified genes that regulate the expression of aphB, the gene encoding a key virulence regulator in Vibrio cholerae O1 E1 Tor C6706(-). We constructed a transposon library in V. cholerae C6706 strain containing a P(aphB)-luxCDABE and P(aphB)-lacZ transcriptional reporter plasmids. Using a chemiluminescence imager system, we rapidly detected aphB promoter expression level at a large scale. We then sequenced the transposon insertion sites by arbitrary PCR and sequencing analysis. We obtained two candidate mutants T1 and T2 which displayed reduced aphB expression from approximately 40,000 transposon insertion mutants. Sequencing analysis shows that Tn inserted in vc1585 reading frame in the T1 mutant and Tn inserted in the end of coding sequence of vc1602 in the T2 mutant. By using a genetic screen, we identified two potential genes that may involve in regulation of the expression of the key virulence regulator AphB. This study sheds light on our further investigation to fully understand V. cholerae virulence gene regulatory cascades.

Next-generation sequencing reveals a novel NDP gene mutation in a Chinese family with Norrie disease.

PubMed

Huang, Xiaoyan; Tian, Mao; Li, Jiankang; Cui, Ling; Li, Min; Zhang, Jianguo

2017-11-01

Norrie disease (ND) is a rare X-linked genetic disorder, the main symptoms of which are congenital blindness and white pupils. It has been reported that ND is caused by mutations in the NDP gene. Although many mutations in NDP have been reported, the genetic cause for many patients remains unknown. In this study, the aim is to investigate the genetic defect in a five-generation family with typical symptoms of ND. To identify the causative gene, next-generation sequencing based target capture sequencing was performed. Segregation analysis of the candidate variant was performed in additional family members using Sanger sequencing. We identified a novel missense variant (c.314C>A) located within the NDP gene. The mutation cosegregated within all affected individuals in the family and was not found in unaffected members. By happenstance, in this family, we also detected a known pathogenic variant of retinitis pigmentosa in a healthy individual. c.314C>A mutation of NDP gene is a novel mutation and broadens the genetic spectrum of ND.

Next-generation sequencing reveals a novel NDP gene mutation in a Chinese family with Norrie disease

PubMed Central

Huang, Xiaoyan; Tian, Mao; Li, Jiankang; Cui, Ling; Li, Min; Zhang, Jianguo

2017-01-01

Purpose: Norrie disease (ND) is a rare X-linked genetic disorder, the main symptoms of which are congenital blindness and white pupils. It has been reported that ND is caused by mutations in the NDP gene. Although many mutations in NDP have been reported, the genetic cause for many patients remains unknown. In this study, the aim is to investigate the genetic defect in a five-generation family with typical symptoms of ND. Methods: To identify the causative gene, next-generation sequencing based target capture sequencing was performed. Segregation analysis of the candidate variant was performed in additional family members using Sanger sequencing. Results: We identified a novel missense variant (c.314C>A) located within the NDP gene. The mutation cosegregated within all affected individuals in the family and was not found in unaffected members. By happenstance, in this family, we also detected a known pathogenic variant of retinitis pigmentosa in a healthy individual. Conclusion: c.314C>A mutation of NDP gene is a novel mutation and broadens the genetic spectrum of ND. PMID:29133643

BAC and RNA sequencing reveal the brown planthopper resistance gene BPH15 in a recombination cold spot that mediates a unique defense mechanism.

PubMed

Lv, Wentang; Du, Ba; Shangguan, Xinxin; Zhao, Yan; Pan, Yufang; Zhu, Lili; He, Yuqing; He, Guangcun

2014-08-11

Brown planthopper (BPH, Nilaparvata lugens Stål), is the most destructive phloem-feeding insect pest of rice (Oryza sativa). The BPH-resistance gene BPH15 has been proved to be effective in controlling the pest and widely applied in rice breeding programs. Nevertheless, molecular mechanism of the resistance remain unclear. In this study, we narrowed down the position of BPH15 on chromosome 4 and investigated the transcriptome of BPH15 rice after BPH attacked. We analyzed 13,000 BC2F2 plants of cross between susceptible rice TN1 and the recombinant inbred line RI93 that carrying the BPH15 gene from original resistant donor B5. BPH15 was mapped to a 0.0269 cM region on chromosome 4, which is 210-kb in the reference genome of Nipponbare. Sequencing bacterial artificial chromosome (BAC) clones that span the BPH15 region revealed that the physical size of BPH15 region in resistant rice B5 is 580-kb, much bigger than the corresponding region in the reference genome of Nipponbare. There were 87 predicted genes in the BPH15 region in resistant rice. The expression profiles of predicted genes were analyzed. Four jacalin-related lectin proteins genes and one LRR protein gene were found constitutively expressed in resistant parent and considered the candidate genes of BPH15. The transcriptomes of resistant BPH15 introgression line and the susceptible recipient line were analyzed using high-throughput RNA sequencing. In total, 2,914 differentially expressed genes (DEGs) were identified. BPH-responsive transcript profiles were distinct between resistant and susceptible plants and between the early stage (6 h after infestation, HAI) and late stage (48 HAI). The key defense mechanism was related to jasmonate signaling, ethylene signaling, receptor kinase, MAPK cascades, Ca(2+) signaling, PR genes, transcription factors, and protein posttranslational modifications. Our work combined BAC and RNA sequencing to identify candidate genes of BPH15 and revealed the resistance mechanism that it mediated. These results increase our understanding of plant-insect interactions and can be used to protect against this destructive agricultural pest.

[Linkage analysis of a family with familial hypertriglyceridemia].

PubMed

Tang, Xin; Lin, Ying; Liu, Bing; Ma, Shi; Yang, Yang; Yang, Zheng-lin

2009-10-01

To perform linkage analysis and mutation screening in a Chinese family with familial hpertriglyceridemia (FHTG). Thirty-two family members including 12 hypertriglyceridemia patients participated in the study. Genotyping and haplotype analysis for 22 subjects were performed using short tandem repeat (STR) microsatellite polymorphism markers on 16 candidate genes and/or loci related to lipid metabolism. Two of the sixteen known candidate genes, APOA2 and USF1 were screened for mutation by direct DNA sequencing. No linkage was found between the candidate genes/loci of APOA5, LIPI, RP1, APOC2, ABC1, LMF1, APOA1-APOC3-APOA4, LPL, APOB, CETP, LCAT, LDLR, APOE and the phenotype in this family. The two-point Lod scores (theta =0) were all less than-1.0 for all the markers tested. Linkage analysis suggested linkage to chromosome 1q23.3-24.2 between the disease phenotype and STR marker D1S194 with a two-point maximum Lod score of 2.44 at theta =0. Fine mapping indicated that the disease gene was localized to a 5.87 cM interval between D1S104 and D1S196. No disease-causing mutation was detected in the APOA2 and USF1 genes. The above mentioned candidate genes were excluded as the disease causing genes for this family. The results implied that there might be a novel gene/locus for FHTG on chromosome 1q23.3-1q24.2.

Study of cnidarian-algal symbiosis in the "omics" age.

PubMed

Meyer, Eli; Weis, Virginia M

2012-08-01

The symbiotic associations between cnidarians and dinoflagellate algae (Symbiodinium) support productive and diverse ecosystems in coral reefs. Many aspects of this association, including the mechanistic basis of host-symbiont recognition and metabolic interaction, remain poorly understood. The first completed genome sequence for a symbiotic anthozoan is now available (the coral Acropora digitifera), and extensive expressed sequence tag resources are available for a variety of other symbiotic corals and anemones. These resources make it possible to profile gene expression, protein abundance, and protein localization associated with the symbiotic state. Here we review the history of "omics" studies of cnidarian-algal symbiosis and the current availability of sequence resources for corals and anemones, identifying genes putatively involved in symbiosis across 10 anthozoan species. The public availability of candidate symbiosis-associated genes leaves the field of cnidarian-algal symbiosis poised for in-depth comparative studies of sequence diversity and gene expression and for targeted functional studies of genes associated with symbiosis. Reviewing the progress to date suggests directions for future investigations of cnidarian-algal symbiosis that include (i) sequencing of Symbiodinium, (ii) proteomic analysis of the symbiosome membrane complex, (iii) glycomic analysis of Symbiodinium cell surfaces, and (iv) expression profiling of the gastrodermal cells hosting Symbiodinium.

Association Between Germline Mutation in VSIG10L and Familial Barrett Neoplasia.

PubMed

Fecteau, Ryan E; Kong, Jianping; Kresak, Adam; Brock, Wendy; Song, Yeunjoo; Fujioka, Hisashi; Elston, Robert; Willis, Joseph E; Lynch, John P; Markowitz, Sanford D; Guda, Kishore; Chak, Amitabh

2016-10-01

Esophageal adenocarcinoma and its precursor lesion Barrett esophagus have seen a dramatic increase in incidence over the past 4 decades yet marked genetic heterogeneity of this disease has precluded advances in understanding its pathogenesis and improving treatment. To identify novel disease susceptibility variants in a familial syndrome of esophageal adenocarcinoma and Barrett esophagus, termed familial Barrett esophagus, by using high-throughput sequencing in affected individuals from a large, multigenerational family. We performed whole exome sequencing (WES) from peripheral lymphocyte DNA on 4 distant relatives from our multiplex, multigenerational familial Barrett esophagus family to identify candidate disease susceptibility variants. Gene variants were filtered, verified, and segregation analysis performed to identify a single candidate variant. Gene expression analysis was done with both quantitative real-time polymerase chain reaction and in situ RNA hybridization. A 3-dimensional organotypic cell culture model of esophageal maturation was utilized to determine the phenotypic effects of our gene variant. We used electron microscopy on esophageal mucosa from an affected family member carrying the gene variant to assess ultrastructural changes. Identification of a novel, germline disease susceptibility variant in a previously uncharacterized gene. A multiplex, multigenerational family with 14 members affected (3 members with esophageal adenocarcinoma and 11 with Barrett esophagus) was identified, and whole-exome sequencing identified a germline mutation (S631G) at a highly conserved serine residue in the uncharacterized gene VSIG10L that segregated in affected members. Transfection of S631G variant into a 3-dimensional organotypic culture model of normal esophageal squamous cells dramatically inhibited epithelial maturation compared with the wild-type. VSIG10L exhibited high expression in normal squamous esophagus with marked loss of expression in Barrett-associated lesions. Electron microscopy of squamous esophageal mucosa harboring the S631G variant revealed dilated intercellular spaces and reduced desmosomes. This study presents VSIG10L as a candidate familial Barrett esophagus susceptibility gene, with a putative role in maintaining normal esophageal homeostasis. Further research assessing VSIG10L function may reveal pathways important for esophageal maturation and the pathogenesis of Barrett esophagus and esophageal adenocarcinoma.

Association Between Germline Mutation in VSIG10L and Familial Barrett Neoplasia

PubMed Central

Fecteau, Ryan E.; Kong, Jianping; Kresak, Adam; Brock, Wendy; Song, Yeunjoo; Fujioka, Hisashi; Elston, Robert; Willis, Joseph E.; Lynch, John P.; Markowitz, Sanford D.; Guda, Kishore; Chak, Amitabh

2016-01-01

IMPORTANCE Esophageal adenocarcinoma and its precursor lesion Barrett esophagus have seen a dramatic increase in incidence over the past 4 decades yet marked genetic heterogeneity of this disease has precluded advances in understanding its pathogenesis and improving treatment. OBJECTIVE To identify novel disease susceptibility variants in a familial syndrome of esophageal adenocarcinoma and Barrett esophagus, termed familial Barrett esophagus, by using high-throughput sequencing in affected individuals from a large, multigenerational family. DESIGN, SETTING, AND PARTICIPANTS We performed whole exome sequencing (WES) from peripheral lymphocyte DNA on 4 distant relatives from our multiplex, multigenerational familial Barrett esophagus family to identify candidate disease susceptibility variants. Gene variants were filtered, verified, and segregation analysis performed to identify a single candidate variant. Gene expression analysis was done with both quantitative real-time polymerase chain reaction and in situ RNA hybridization. A 3-dimensional organotypic cell culture model of esophageal maturation was utilized to determine the phenotypic effects of our gene variant. We used electron microscopy on esophageal mucosa from an affected family member carrying the gene variant to assess ultrastructural changes. MAIN OUTCOMES AND MEASURES Identification of a novel, germline disease susceptibility variant in a previously uncharacterized gene. RESULTS A multiplex, multigenerational family with 14 members affected (3 members with esophageal adenocarcinoma and 11 with Barrett esophagus) was identified, and whole-exome sequencing identified a germline mutation (S631G) at a highly conserved serine residue in the uncharacterized gene VSIG10L that segregated in affected members. Transfection of S631G variant into a 3-dimensional organotypic culture model of normal esophageal squamous cells dramatically inhibited epithelial maturation compared with the wild-type. VSIG10L exhibited high expression in normal squamous esophagus with marked loss of expression in Barrett-associated lesions. Electron microscopy of squamous esophageal mucosa harboring the S631G variant revealed dilated intercellular spaces and reduced desmosomes. CONCLUSIONS AND RELEVANCE This study presents VSIG10L as a candidate familial Barrett esophagus susceptibility gene, with a putative role in maintaining normal esophageal homeostasis. Further research assessing VSIG10L function may reveal pathways important for esophageal maturation and the pathogenesis of Barrett esophagus and esophageal adenocarcinoma. PMID:27467440

Whole-Exome Sequencing Identifies Novel Variants for Tooth Agenesis.

PubMed

Dinckan, N; Du, R; Petty, L E; Coban-Akdemir, Z; Jhangiani, S N; Paine, I; Baugh, E H; Erdem, A P; Kayserili, H; Doddapaneni, H; Hu, J; Muzny, D M; Boerwinkle, E; Gibbs, R A; Lupski, J R; Uyguner, Z O; Below, J E; Letra, A

2018-01-01

Tooth agenesis is a common craniofacial abnormality in humans and represents failure to develop 1 or more permanent teeth. Tooth agenesis is complex, and variations in about a dozen genes have been reported as contributing to the etiology. Here, we combined whole-exome sequencing, array-based genotyping, and linkage analysis to identify putative pathogenic variants in candidate disease genes for tooth agenesis in 10 multiplex Turkish families. Novel homozygous and heterozygous variants in LRP6, DKK1, LAMA3, and COL17A1 genes, as well as known variants in WNT10A, were identified as likely pathogenic in isolated tooth agenesis. Novel variants in KREMEN1 were identified as likely pathogenic in 2 families with suspected syndromic tooth agenesis. Variants in more than 1 gene were identified segregating with tooth agenesis in 2 families, suggesting oligogenic inheritance. Structural modeling of missense variants suggests deleterious effects to the encoded proteins. Functional analysis of an indel variant (c.3607+3_6del) in LRP6 suggested that the predicted resulting mRNA is subject to nonsense-mediated decay. Our results support a major role for WNT pathways genes in the etiology of tooth agenesis while revealing new candidate genes. Moreover, oligogenic cosegregation was suggestive for complex inheritance and potentially complex gene product interactions during development, contributing to improved understanding of the genetic etiology of familial tooth agenesis.

Candidate Genes for Inherited Autism Susceptibility in the Lebanese Population.

PubMed

Kourtian, Silva; Soueid, Jihane; Makhoul, Nadine J; Guisso, Dikran Richard; Chahrour, Maria; Boustany, Rose-Mary N

2017-03-30

Autism spectrum disorder (ASD) is characterized by ritualistic-repetitive behaviors and impaired verbal/non-verbal communication. Many ASD susceptibility genes implicated in neuronal pathways/brain development have been identified. The Lebanese population is ideal for uncovering recessive genes because of shared ancestry and a high rate of consanguineous marriages. Aims here are to analyze for published ASD genes and uncover novel inherited ASD susceptibility genes specific to the Lebanese. We recruited 36 ASD families (ASD: 37, unaffected parents: 36, unaffected siblings: 33) and 100 unaffected Lebanese controls. Cytogenetics 2.7 M Microarrays/CytoScan™ HD arrays allowed mapping of homozygous regions of the genome. The CNTNAP2 gene was screened by Sanger sequencing. Homozygosity mapping uncovered DPP4, TRHR, and MLF1 as novel candidate susceptibility genes for ASD in the Lebanese. Sequencing of hot spot exons in CNTNAP2 led to discovery of a 5 bp insertion in 23/37 ASD patients. This mutation was present in unaffected family members and unaffected Lebanese controls. Although a slight increase in number was observed in ASD patients and family members compared to controls, there were no significant differences in allele frequencies between affecteds and controls (C/TTCTG: γ 2 value = 0.014; p = 0.904). The CNTNAP2 polymorphism identified in this population, hence, is not linked to the ASD phenotype.

Candidate Genes for Inherited Autism Susceptibility in the Lebanese Population

PubMed Central

Kourtian, Silva; Soueid, Jihane; Makhoul, Nadine J.; Guisso, Dikran Richard; Chahrour, Maria; Boustany, Rose-Mary N.

2017-01-01

Autism spectrum disorder (ASD) is characterized by ritualistic-repetitive behaviors and impaired verbal/non-verbal communication. Many ASD susceptibility genes implicated in neuronal pathways/brain development have been identified. The Lebanese population is ideal for uncovering recessive genes because of shared ancestry and a high rate of consanguineous marriages. Aims here are to analyze for published ASD genes and uncover novel inherited ASD susceptibility genes specific to the Lebanese. We recruited 36 ASD families (ASD: 37, unaffected parents: 36, unaffected siblings: 33) and 100 unaffected Lebanese controls. Cytogenetics 2.7 M Microarrays/CytoScan™ HD arrays allowed mapping of homozygous regions of the genome. The CNTNAP2 gene was screened by Sanger sequencing. Homozygosity mapping uncovered DPP4, TRHR, and MLF1 as novel candidate susceptibility genes for ASD in the Lebanese. Sequencing of hot spot exons in CNTNAP2 led to discovery of a 5 bp insertion in 23/37 ASD patients. This mutation was present in unaffected family members and unaffected Lebanese controls. Although a slight increase in number was observed in ASD patients and family members compared to controls, there were no significant differences in allele frequencies between affecteds and controls (C/TTCTG: γ2 value = 0.014; p = 0.904). The CNTNAP2 polymorphism identified in this population, hence, is not linked to the ASD phenotype. PMID:28358038

Cloning, characterization, and physical mapping of the canine Prop-1 gene (PROP1): exclusion as a candidate for combined pituitary hormone deficiency in German shepherd dogs.

PubMed

Lantinga-van Leeuwen, I S; Kooistra, H S; Mol, J A; Renier, C; Breen, M; van Oost, B A

2000-01-01

Abnormalities in the genes encoding Pit-1 and Prop-1 have been reported to cause combined pituitary hormone deficiency (CPHD) in mice and humans. In dogs, a similar phenotype has been described in the German shepherd breed. We have previously reported that the Pit-1 gene (POU1F1) is not mutated in affected German shepherd dogs. In this study, we report the isolation and mapping of the canine Prop-1 gene (PROP1), and we assessed the involvement of PROP1 in German shepherd dog dwarfism. The canine PROP1 gene was found to contain three exons, encoding a 226 amino acid protein. The deduced amino acid sequence was 79% and 84% homologous with the mouse and human Prop-1 protein, respectively. Using fluorescence in situ hybridization, PROP1 was mapped to canine chromosome 11. Further mapping with a canine radiation hybrid panel showed co-localization with the polymorphic DNA marker AHT137. Sequence analysis of genomic DNA from dwarf German shepherd dogs revealed no alterations in the PROP1 gene. Moreover, linkage analysis of AHT137 revealed no co-segregation between the PROP1 locus and the CPHD phenotype, excluding this gene as candidate for canine CPHD and providing a new spontaneous model of hypopituitarism. Copyright 2000 S. Karger AG, Basel

Analysis of the transcriptome of Panax notoginseng root uncovers putative triterpene saponin-biosynthetic genes and genetic markers

PubMed Central

2011-01-01

Background Panax notoginseng (Burk) F.H. Chen is important medicinal plant of the Araliacease family. Triterpene saponins are the bioactive constituents in P. notoginseng. However, available genomic information regarding this plant is limited. Moreover, details of triterpene saponin biosynthesis in the Panax species are largely unknown. Results Using the 454 pyrosequencing technology, a one-quarter GS FLX titanium run resulted in 188,185 reads with an average length of 410 bases for P. notoginseng root. These reads were processed and assembled by 454 GS De Novo Assembler software into 30,852 unique sequences. A total of 70.2% of unique sequences were annotated by Basic Local Alignment Search Tool (BLAST) similarity searches against public sequence databases. The Kyoto Encyclopedia of Genes and Genomes (KEGG) assignment discovered 41 unique sequences representing 11 genes involved in triterpene saponin backbone biosynthesis in the 454-EST dataset. In particular, the transcript encoding dammarenediol synthase (DS), which is the first committed enzyme in the biosynthetic pathway of major triterpene saponins, is highly expressed in the root of four-year-old P. notoginseng. It is worth emphasizing that the candidate cytochrome P450 (Pn02132 and Pn00158) and UDP-glycosyltransferase (Pn00082) gene most likely to be involved in hydroxylation or glycosylation of aglycones for triterpene saponin biosynthesis were discovered from 174 cytochrome P450s and 242 glycosyltransferases by phylogenetic analysis, respectively. Putative transcription factors were detected in 906 unique sequences, including Myb, homeobox, WRKY, basic helix-loop-helix (bHLH), and other family proteins. Additionally, a total of 2,772 simple sequence repeat (SSR) were identified from 2,361 unique sequences, of which, di-nucleotide motifs were the most abundant motif. Conclusion This study is the first to present a large-scale EST dataset for P. notoginseng root acquired by next-generation sequencing (NGS) technology. The candidate genes involved in triterpene saponin biosynthesis, including the putative CYP450s and UGTs, were obtained in this study. Additionally, the identification of SSRs provided plenty of genetic makers for molecular breeding and genetics applications in this species. These data will provide information on gene discovery, transcriptional regulation and marker-assisted selection for P. notoginseng. The dataset establishes an important foundation for the study with the purpose of ensuring adequate drug resources for this species. PMID:22369100

CaAP2 transcription factor is a candidate gene for a flowering repressor and a candidate for controlling natural variation of flowering time in Capsicum annuum.

PubMed

Borovsky, Yelena; Sharma, Vinod K; Verbakel, Henk; Paran, Ilan

2015-06-01

The APETALA2 transcription factor homolog CaAP2 is a candidate gene for a flowering repressor in pepper, as revealed by induced-mutation phenotype, and a candidate underlying a major QTL controlling natural variation in flowering time. To decipher the genetic control of transition to flowering in pepper (Capsicum spp.) and determine the extent of gene function conservation compared to model species, we isolated and characterized several ethyl methanesulfonate (EMS)-induced mutants that vary in their flowering time compared to the wild type. In the present study, we report on the isolation of an early-flowering mutant that flowers after four leaves on the primary stem compared to nine leaves in the wild-type 'Maor'. By genetic mapping and sequencing of putative candidate genes linked to the mutant phenotype, we identified a member of the APETALA2 (AP2) transcription factor family, CaAP2, which was disrupted in the early-flowering mutant. CaAP2 is a likely ortholog of AP2 that functions as a repressor of flowering in Arabidopsis. To test whether CaAP2 has an effect on controlling natural variation in the transition to flowering in pepper, we performed QTL mapping for flowering time in a cross between early and late-flowering C. annuum accessions. We identified a major QTL in a region of chromosome 2 in which CaAP2 was the most significant marker, explaining 52 % of the phenotypic variation of the trait. Sequence comparison of the CaAP2 open reading frames in the two parents used for QTL mapping did not reveal significant variation. In contrast, significant differences in expression level of CaAP2 were detected between near-isogenic lines that differ for the flowering time QTL, supporting the putative function of CaAP2 as a major repressor of flowering in pepper.

Analysis of Ethnic Admixture in Prostate Cancer

DTIC Science & Technology

2006-12-01

low penetrant genes have been identified as potential PCA suscept- ibility genes. These candidate genes include SRD5A2 (MIM 607306), CYP3A4 (MIM 124010...progression [13]. The CDH1gene is located at 16q22.1 and consists of 16 exons spanning approximately 100 kb of genomic DNA. Several polymorphisms, germline and...upstreamof theATGstart site and all 16 exons of CDH1 were screened for DNA sequence variation by denaturing high-performance liquid chro- matography

A Genomics Approach to Deciphering Lignin Biosynthesis in Switchgrass[W

PubMed Central

Shen, Hui; Mazarei, Mitra; Hisano, Hiroshi; Escamilla-Trevino, Luis; Fu, Chunxiang; Pu, Yunqiao; Rudis, Mary R.; Tang, Yuhong; Xiao, Xirong; Jackson, Lisa; Li, Guifen; Hernandez, Tim; Chen, Fang; Ragauskas, Arthur J.; Stewart, C. Neal; Wang, Zeng-Yu; Dixon, Richard A.

2013-01-01

It is necessary to overcome recalcitrance of the biomass to saccharification (sugar release) to make switchgrass (Panicum virgatum) economically viable as a feedstock for liquid biofuels. Lignin content correlates negatively with sugar release efficiency in switchgrass, but selecting the right gene candidates for engineering lignin biosynthesis in this tetraploid outcrossing species is not straightforward. To assist this endeavor, we have used an inducible switchgrass cell suspension system for studying lignin biosynthesis in response to exogenous brassinolide. By applying a combination of protein sequence phylogeny with whole-genome microarray analyses of induced cell cultures and developing stem internode sections, we have generated a list of candidate monolignol biosynthetic genes for switchgrass. Several genes that were strongly supported through our bioinformatics analysis as involved in lignin biosynthesis were confirmed by gene silencing studies, in which lignin levels were reduced as a result of targeting a single gene. However, candidate genes encoding enzymes involved in the early steps of the currently accepted monolignol biosynthesis pathway in dicots may have functionally redundant paralogues in switchgrass and therefore require further evaluation. This work provides a blueprint and resources for the systematic genome-wide study of the monolignol pathway in switchgrass, as well as other C4 monocot species. PMID:24285795

Genome and Transcriptome sequence of Finger millet (Eleusine coracana (L.) Gaertn.) provides insights into drought tolerance and nutraceutical properties.

PubMed

Hittalmani, Shailaja; Mahesh, H B; Shirke, Meghana Deepak; Biradar, Hanamareddy; Uday, Govindareddy; Aruna, Y R; Lohithaswa, H C; Mohanrao, A

2017-06-15

Finger millet (Eleusine coracana (L.) Gaertn.) is an important staple food crop widely grown in Africa and South Asia. Among the millets, finger millet has high amount of calcium, methionine, tryptophan, fiber, and sulphur containing amino acids. In addition, it has C4 photosynthetic carbon assimilation mechanism, which helps to utilize water and nitrogen efficiently under hot and arid conditions without severely affecting yield. Therefore, development and utilization of genomic resources for genetic improvement of this crop is immensely useful. Experimental results from whole genome sequencing and assembling process of ML-365 finger millet cultivar yielded 1196 Mb covering approximately 82% of total estimated genome size. Genome analysis showed the presence of 85,243 genes and one half of the genome is repetitive in nature. The finger millet genome was found to have higher colinearity with foxtail millet and rice as compared to other Poaceae species. Mining of simple sequence repeats (SSRs) yielded abundance of SSRs within the finger millet genome. Functional annotation and mining of transcription factors revealed finger millet genome harbors large number of drought tolerance related genes. Transcriptome analysis of low moisture stress and non-stress samples revealed the identification of several drought-induced candidate genes, which could be used in drought tolerance breeding. This genome sequencing effort will strengthen plant breeders for allele discovery, genetic mapping, and identification of candidate genes for agronomically important traits. Availability of genomic resources of finger millet will enhance the novel breeding possibilities to address potential challenges of finger millet improvement.

In Silico Comparative Transcriptome Analysis of Two Color Morphs of the Common Coral Trout (Plectropomus Leopardus)

PubMed Central

Wang, Le; Yu, Cuiping; Guo, Liang; Lin, Haoran; Meng, Zining

2015-01-01

The common coral trout is one species of major importance in commercial fisheries and aquaculture. Recently, two different color morphs of Plectropomus leopardus were discovered and the biological importance of the color difference is unknown. Since coral trout species are poorly characterized at the molecular level, we undertook the transcriptomic characterization of the two color morphs, one black and one red coral trout, using Illumina next generation sequencing technologies. The study produced 55162966 and 54588952 paired-end reads, for black and red trout, respectively. De novo transcriptome assembly generated 95367 and 99424 unique sequences in black and red trout, respectively, with 88813 sequences shared between them. Approximately 50% of both trancriptomes were functionally annotated by BLAST searches against protein databases. The two trancriptomes were enriched into 25 functional categories and showed similar profiles of Gene Ontology category compositions. 34110 unigenes were grouped into 259 KEGG pathways. Moreover, we identified 14649 simple sequence repeats (SSRs) and designed primers for potential application. We also discovered 130524 putative single nucleotide polymorphisms (SNPs) in the two transcriptomes, supplying potential genomic resources for the coral trout species. In addition, we identified 936 fast-evolving genes and 165 candidate genes under positive selection between the two color morphs. Finally, 38 candidate genes underlying the mechanism of color and pigmentation were also isolated. This study presents the first transcriptome resources for the common coral trout and provides basic information for the development of genomic tools for the identification, conservation, and understanding of the speciation and local adaptation of coral reef fish species. PMID:26713756

Identification of Novel Associations of Candidate Genes with Resistance to Late Blight in Solanum tuberosum Group Phureja

PubMed Central

Álvarez, María F.; Angarita, Myrian; Delgado, María C.; García, Celsa; Jiménez-Gomez, José; Gebhardt, Christiane; Mosquera, Teresa

2017-01-01

The genetic basis of quantitative disease resistance has been studied in crops for several decades as an alternative to R gene mediated resistance. The most important disease in the potato crop is late blight, caused by the oomycete Phytophthora infestans. Quantitative disease resistance (QDR), as any other quantitative trait in plants, can be genetically mapped to understand the genetic architecture. Association mapping using DNA-based markers has been implemented in many crops to dissect quantitative traits. We used an association mapping approach with candidate genes to identify the first genes associated with quantitative resistance to late blight in Solanum tuberosum Group Phureja. Twenty-nine candidate genes were selected from a set of genes that were differentially expressed during the resistance response to late blight in tetraploid European potato cultivars. The 29 genes were amplified and sequenced in 104 accessions of S. tuberosum Group Phureja from Latin America. We identified 238 SNPs in the selected genes and tested them for association with resistance to late blight. The phenotypic data were obtained under field conditions by determining the area under disease progress curve (AUDPC) in two seasons and in two locations. Two genes were associated with QDR to late blight, a potato homolog of thylakoid lumen 15 kDa protein (StTL15A) and a stem 28 kDa glycoprotein (StGP28). Key message: A first association mapping experiment was conducted in Solanum tuberosum Group Phureja germplasm, which identified among 29 candidates two genes associated with quantitative resistance to late blight. PMID:28674545

Identification of Novel Associations of Candidate Genes with Resistance to Late Blight in Solanum tuberosum Group Phureja.

PubMed

Álvarez, María F; Angarita, Myrian; Delgado, María C; García, Celsa; Jiménez-Gomez, José; Gebhardt, Christiane; Mosquera, Teresa

2017-01-01

The genetic basis of quantitative disease resistance has been studied in crops for several decades as an alternative to R gene mediated resistance. The most important disease in the potato crop is late blight, caused by the oomycete Phytophthora infestans. Quantitative disease resistance (QDR), as any other quantitative trait in plants, can be genetically mapped to understand the genetic architecture. Association mapping using DNA-based markers has been implemented in many crops to dissect quantitative traits. We used an association mapping approach with candidate genes to identify the first genes associated with quantitative resistance to late blight in Solanum tuberosum Group Phureja. Twenty-nine candidate genes were selected from a set of genes that were differentially expressed during the resistance response to late blight in tetraploid European potato cultivars. The 29 genes were amplified and sequenced in 104 accessions of S. tuberosum Group Phureja from Latin America. We identified 238 SNPs in the selected genes and tested them for association with resistance to late blight. The phenotypic data were obtained under field conditions by determining the area under disease progress curve (AUDPC) in two seasons and in two locations. Two genes were associated with QDR to late blight, a potato homolog of thylakoid lumen 15 kDa protein ( StTL15A ) and a stem 28 kDa glycoprotein ( StGP28 ). Key message : A first association mapping experiment was conducted in Solanum tuberosum Group Phureja germplasm, which identified among 29 candidates two genes associated with quantitative resistance to late blight.

Expressed sequence tags from larval gut of the european corn borer (Ostrinia nubilalis): exploring candidate genes potenially involved in Bacillus thuringiensis toxicity and resistance

USDA-ARS?s Scientific Manuscript database

Background: Knowledge of the genes that are expressed in the insect gut are crucial for understanding basic physiology of food digestion, their interactions with Bacillus thuringiensis (Bt) toxin and for discovering new targets for novel toxins for use in pest management. This study analyzed the ES...

A Driving Bioinformatics Approach to Explore Co-regulation of AOX Gene Family Members During Growth and Development.

PubMed

Costa, José Hélio; Arnholdt-Schmitt, Birgit

2017-01-01

The alternative oxidase (AOX) gene family is a hot candidate for functional marker development that could help plant breeding on yield stability through more robust plants based on multi-stress tolerance. However, there is missing knowledge on the interplay between gene family members that might interfere with the efficiency of marker development. It is common view that AOX1 and AOX2 have different physiological roles. Nevertheless, both family member groups act in terms of molecular-biochemical function as "typical" alternative oxidases and co-regulation of AOX1 and AOX2 had been reported. Although conserved sequence differences had been identified, the basis for differential effects on physiology regulation is not sufficiently explored.This protocol gives instructions for a bioinformatics approach that supports discovering potential interaction of AOX family members in regulating growth and development. It further provides a strategy to elucidate the relevance of gene sequence diversity and copy number variation for final functionality in target tissues and finally the whole plant. Thus, overall this protocol provides the means for efficiently identifying plant AOX variants as functional marker candidates related to growth and development.

Genes for seed longevity in barley identified by genomic analysis on Near Isogenic Lines.

PubMed

Wozny, Dorothee; Kramer, Katharina; Finkemeier, Iris; Acosta, Ivan F; Koornneef, Maarten

2018-05-09

Genes controlling differences in seed longevity between two barley (Hordeum vulgare) accessions were identified by combining quantitative genetics 'omics' technologies in Near Isogenic Lines (NILs). The NILs were derived from crosses between the spring barley landraces L94 from Ethiopia and Cebada Capa from Argentina. A combined transcriptome and proteome analysis on mature, non-aged seeds of the two parental lines and the L94 NILs by RNA-sequencing and total seed proteomic profiling identified the UDP-glycosyltransferase MLOC_11661.1 as candidate gene for the QTL on 2H, and the NADP-dependent malic enzyme (NADP-ME) MLOC_35785.1 as possible downstream target gene. To validate these candidates, they were expressed in Arabidopsis under the control of constitutive promoters to attempt complementing the T-DNA knock-out line nadp-me1. Both the NADP-ME MLOC_35785.1 and the UDP-glycosyltransferase MLOC_11661.1 were able to rescue the nadp-me1 seed longevity phenotype. In the case of the UDP-glycosyltransferase, with high accumulation in NILs, only the coding sequence of Cebada Capa had a rescue effect. This article is protected by copyright. All rights reserved.

PAINT: a promoter analysis and interaction network generation tool for gene regulatory network identification.

PubMed

Vadigepalli, Rajanikanth; Chakravarthula, Praveen; Zak, Daniel E; Schwaber, James S; Gonye, Gregory E

2003-01-01

We have developed a bioinformatics tool named PAINT that automates the promoter analysis of a given set of genes for the presence of transcription factor binding sites. Based on coincidence of regulatory sites, this tool produces an interaction matrix that represents a candidate transcriptional regulatory network. This tool currently consists of (1) a database of promoter sequences of known or predicted genes in the Ensembl annotated mouse genome database, (2) various modules that can retrieve and process the promoter sequences for binding sites of known transcription factors, and (3) modules for visualization and analysis of the resulting set of candidate network connections. This information provides a substantially pruned list of genes and transcription factors that can be examined in detail in further experimental studies on gene regulation. Also, the candidate network can be incorporated into network identification methods in the form of constraints on feasible structures in order to render the algorithms tractable for large-scale systems. The tool can also produce output in various formats suitable for use in external visualization and analysis software. In this manuscript, PAINT is demonstrated in two case studies involving analysis of differentially regulated genes chosen from two microarray data sets. The first set is from a neuroblastoma N1E-115 cell differentiation experiment, and the second set is from neuroblastoma N1E-115 cells at different time intervals following exposure to neuropeptide angiotensin II. PAINT is available for use as an agent in BioSPICE simulation and analysis framework (www.biospice.org), and can also be accessed via a WWW interface at www.dbi.tju.edu/dbi/tools/paint/.

Exome sequencing of oral squamous cell carcinoma in users of Arabian snuff reveals novel candidates for driver genes.

PubMed

Al-Hebshi, Nezar Noor; Li, Shiyong; Nasher, Akram Thabet; El-Setouhy, Maged; Alsanosi, Rashad; Blancato, Jan; Loffredo, Christopher

2016-07-15

The study sought to identify genetic aberrations driving oral squamous cell carcinoma (OSCC) development among users of shammah, an Arabian preparation of smokeless tobacco. Twenty archival OSCC samples, 15 of which with a history of shammah exposure, were whole-exome sequenced at an average depth of 127×. Somatic mutations were identified using a novel, matched controls-independent filtration algorithm. CODEX and Exomedepth coupled with a novel, Database of Genomic Variant-based filter were employed to call somatic gene-copy number variations. Significantly mutated genes were identified with Oncodrive FM and the Youn and Simon's method. Candidate driver genes were nominated based on Gene Set Enrichment Analysis. The observed mutational spectrum was similar to that reported by the TCGA project. In addition to confirming known genes of OSCC (TP53, CDKNA2, CASP8, PIK3CA, HRAS, FAT1, TP63, CCND1 and FADD) the analysis identified several candidate novel driver events including mutations of NOTCH3, CSMD3, CRB1, CLTCL1, OSMR and TRPM2, amplification of the proto-oncogenes FOSL1, RELA, TRAF6, MDM2, FRS2 and BAG1, and deletion of the recently described tumor suppressor SMARCC1. Analysis also revealed significantly altered pathways not previously implicated in OSCC including Oncostatin-M signalling pathway, AP-1 and C-MYB transcription networks and endocytosis. There was a trend for higher number of mutations, amplifications and driver events in samples with history of shammah exposure particularly those that tested EBV positive, suggesting an interaction between tobacco exposure and EBV. The work provides further evidence for the genetic heterogeneity of oral cancer and suggests shammah-associated OSCC is characterized by extensive amplification of oncogenes. © 2016 UICC.

Exclusion of known gene for enamel development in two Brazilian families with amelogenesis imperfecta

PubMed Central

Santos, Maria CLG; Hart, P Suzanne; Ramaswami, Mukundhan; Kanno, Cláudia M; Hart, Thomas C; Line, Sergio RP

2007-01-01

Amelogenesis imperfecta (AI) is a genetically heterogeneous group of diseases that result in defective development of tooth enamel. Mutations in several enamel proteins and proteinases have been associated with AI. The object of this study was to evaluate evidence of etiology for the six major candidate gene loci in two Brazilian families with AI. Genomic DNA was obtained from family members and all exons and exon-intron boundaries of the ENAM, AMBN, AMELX, MMP20, KLK4 and Amelotin gene were amplified and sequenced. Each family was also evaluated for linkage to chromosome regions known to contain genes important in enamel development. The present study indicates that the AI in these two families is not caused by any of the known loci for AI or any of the major candidate genes proposed in the literature. These findings indicate extensive genetic heterogeneity for non-syndromic AI. PMID:17266769

Exclusion of known gene for enamel development in two Brazilian families with amelogenesis imperfecta.

PubMed

Santos, Maria C L G; Hart, P Suzanne; Ramaswami, Mukundhan; Kanno, Cláudia M; Hart, Thomas C; Line, Sergio R P

2007-01-31

Amelogenesis imperfecta (AI) is a genetically heterogeneous group of diseases that result in defective development of tooth enamel. Mutations in several enamel proteins and proteinases have been associated with AI. The object of this study was to evaluate evidence of etiology for the six major candidate gene loci in two Brazilian families with AI. Genomic DNA was obtained from family members and all exons and exon-intron boundaries of the ENAM, AMBN, AMELX, MMP20, KLK4 and Amelotin gene were amplified and sequenced. Each family was also evaluated for linkage to chromosome regions known to contain genes important in enamel development. The present study indicates that the AI in these two families is not caused by any of the known loci for AI or any of the major candidate genes proposed in the literature. These findings indicate extensive genetic heterogeneity for non-syndromic AI.

A molecular analysis of desiccation tolerance mechanisms in the anhydrobiotic nematode Panagrolaimus superbus using expressed sequenced tags

PubMed Central

2012-01-01

Background Some organisms can survive extreme desiccation by entering into a state of suspended animation known as anhydrobiosis. Panagrolaimus superbus is a free-living anhydrobiotic nematode that can survive rapid environmental desiccation. The mechanisms that P. superbus uses to combat the potentially lethal effects of cellular dehydration may include the constitutive and inducible expression of protective molecules, along with behavioural and/or morphological adaptations that slow the rate of cellular water loss. In addition, inducible repair and revival programmes may also be required for successful rehydration and recovery from anhydrobiosis. Results To identify constitutively expressed candidate anhydrobiotic genes we obtained 9,216 ESTs from an unstressed mixed stage population of P. superbus. We derived 4,009 unigenes from these ESTs. These unigene annotations and sequences can be accessed at http://www.nematodes.org/nembase4/species_info.php?species=PSC. We manually annotated a set of 187 constitutively expressed candidate anhydrobiotic genes from P. superbus. Notable among those is a putative lineage expansion of the lea (late embryogenesis abundant) gene family. The most abundantly expressed sequence was a member of the nematode specific sxp/ral-2 family that is highly expressed in parasitic nematodes and secreted onto the surface of the nematodes' cuticles. There were 2,059 novel unigenes (51.7% of the total), 149 of which are predicted to encode intrinsically disordered proteins lacking a fixed tertiary structure. One unigene may encode an exo-β-1,3-glucanase (GHF5 family), most similar to a sequence from Phytophthora infestans. GHF5 enzymes have been reported from several species of plant parasitic nematodes, with horizontal gene transfer (HGT) from bacteria proposed to explain their evolutionary origin. This P. superbus sequence represents another possible HGT event within the Nematoda. The expression of five of the 19 putative stress response genes tested was upregulated in response to desiccation. These were the antioxidants glutathione peroxidase, dj-1 and 1-Cys peroxiredoxin, an shsp sequence and an lea gene. Conclusions P. superbus appears to utilise a strategy of combined constitutive and inducible gene expression in preparation for entry into anhydrobiosis. The apparent lineage expansion of lea genes, together with their constitutive and inducible expression, suggests that LEA3 proteins are important components of the anhydrobiotic protection repertoire of P. superbus. PMID:22281184

A comprehensive resource of drought- and salinity- responsive ESTs for gene discovery and marker development in chickpea (Cicer arietinum L.)

PubMed Central

2009-01-01

Background Chickpea (Cicer arietinum L.), an important grain legume crop of the world is seriously challenged by terminal drought and salinity stresses. However, very limited number of molecular markers and candidate genes are available for undertaking molecular breeding in chickpea to tackle these stresses. This study reports generation and analysis of comprehensive resource of drought- and salinity-responsive expressed sequence tags (ESTs) and gene-based markers. Results A total of 20,162 (18,435 high quality) drought- and salinity- responsive ESTs were generated from ten different root tissue cDNA libraries of chickpea. Sequence editing, clustering and assembly analysis resulted in 6,404 unigenes (1,590 contigs and 4,814 singletons). Functional annotation of unigenes based on BLASTX analysis showed that 46.3% (2,965) had significant similarity (≤1E-05) to sequences in the non-redundant UniProt database. BLASTN analysis of unique sequences with ESTs of four legume species (Medicago, Lotus, soybean and groundnut) and three model plant species (rice, Arabidopsis and poplar) provided insights on conserved genes across legumes as well as novel transcripts for chickpea. Of 2,965 (46.3%) significant unigenes, only 2,071 (32.3%) unigenes could be functionally categorised according to Gene Ontology (GO) descriptions. A total of 2,029 sequences containing 3,728 simple sequence repeats (SSRs) were identified and 177 new EST-SSR markers were developed. Experimental validation of a set of 77 SSR markers on 24 genotypes revealed 230 alleles with an average of 4.6 alleles per marker and average polymorphism information content (PIC) value of 0.43. Besides SSR markers, 21,405 high confidence single nucleotide polymorphisms (SNPs) in 742 contigs (with ≥ 5 ESTs) were also identified. Recognition sites for restriction enzymes were identified for 7,884 SNPs in 240 contigs. Hierarchical clustering of 105 selected contigs provided clues about stress- responsive candidate genes and their expression profile showed predominance in specific stress-challenged libraries. Conclusion Generated set of chickpea ESTs serves as a resource of high quality transcripts for gene discovery and development of functional markers associated with abiotic stress tolerance that will be helpful to facilitate chickpea breeding. Mapping of gene-based markers in chickpea will also add more anchoring points to align genomes of chickpea and other legume species. PMID:19912666

Identification of Enzyme Genes Using Chemical Structure Alignments of Substrate-Product Pairs.

PubMed

Moriya, Yuki; Yamada, Takuji; Okuda, Shujiro; Nakagawa, Zenichi; Kotera, Masaaki; Tokimatsu, Toshiaki; Kanehisa, Minoru; Goto, Susumu

2016-03-28

Although there are several databases that contain data on many metabolites and reactions in biochemical pathways, there is still a big gap in the numbers between experimentally identified enzymes and metabolites. It is supposed that many catalytic enzyme genes are still unknown. Although there are previous studies that estimate the number of candidate enzyme genes, these studies required some additional information aside from the structures of metabolites such as gene expression and order in the genome. In this study, we developed a novel method to identify a candidate enzyme gene of a reaction using the chemical structures of the substrate-product pair (reactant pair). The proposed method is based on a search for similar reactant pairs in a reference database and offers ortholog groups that possibly mediate the given reaction. We applied the proposed method to two experimentally validated reactions. As a result, we confirmed that the histidine transaminase was correctly identified. Although our method could not directly identify the asparagine oxo-acid transaminase, we successfully found the paralog gene most similar to the correct enzyme gene. We also applied our method to infer candidate enzyme genes in the mesaconate pathway. The advantage of our method lies in the prediction of possible genes for orphan enzyme reactions where any associated gene sequences are not determined yet. We believe that this approach will facilitate experimental identification of genes for orphan enzymes.

A dual role for a polyketide synthase in dynemicin enediyne and anthraquinone biosynthesis

NASA Astrophysics Data System (ADS)

Cohen, Douglas R.; Townsend, Craig A.

2018-02-01

Dynemicin A is a member of a subfamily of enediyne antitumour antibiotics characterized by a 10-membered carbocycle fused to an anthraquinone, both of polyketide origin. Sequencing of the dynemicin biosynthetic gene cluster in Micromonospora chersina previously identified an enediyne polyketide synthase (PKS), but no anthraquinone PKS, suggesting gene(s) for biosynthesis of the latter were distant from the core dynemicin cluster. To identify these gene(s), we sequenced and analysed the genome of M. chersina. Sequencing produced a short list of putative PKS candidates, yet CRISPR-Cas9 mutants of each locus retained dynemicin production. Subsequently, deletion of two cytochromes P450 in the dynemicin cluster suggested that the dynemicin enediyne PKS, DynE8, may biosynthesize the anthraquinone. Together with 18O-labelling studies, we now present evidence that DynE8 produces the core scaffolds of both the enediyne and anthraquinone, and provide a working model to account for their formation from the programmed octaketide of the enediyne PKS.

DArT Markers Effectively Target Gene Space in the Rye Genome

PubMed Central

Gawroński, Piotr; Pawełkowicz, Magdalena; Tofil, Katarzyna; Uszyński, Grzegorz; Sharifova, Saida; Ahluwalia, Shivaksh; Tyrka, Mirosław; Wędzony, Maria; Kilian, Andrzej; Bolibok-Brągoszewska, Hanna

2016-01-01

Large genome size and complexity hamper considerably the genomics research in relevant species. Rye (Secale cereale L.) has one of the largest genomes among cereal crops and repetitive sequences account for over 90% of its length. Diversity Arrays Technology is a high-throughput genotyping method, in which a preferential sampling of gene-rich regions is achieved through the use of methylation sensitive restriction enzymes. We obtained sequences of 6,177 rye DArT markers and following a redundancy analysis assembled them into 3,737 non-redundant sequences, which were then used in homology searches against five Pooideae sequence sets. In total 515 DArT sequences could be incorporated into publicly available rye genome zippers providing a starting point for the integration of DArT- and transcript-based genomics resources in rye. Using Blast2Go pipeline we attributed putative gene functions to 1101 (29.4%) of the non-redundant DArT marker sequences, including 132 sequences with putative disease resistance-related functions, which were found to be preferentially located in the 4RL and 6RL chromosomes. Comparative analysis based on the DArT sequences revealed obvious inconsistencies between two recently published high density consensus maps of rye. Furthermore we demonstrated that DArT marker sequences can be a source of SSR polymorphisms. Obtained data demonstrate that DArT markers effectively target gene space in the large, complex, and repetitive rye genome. Through the annotation of putative gene functions and the alignment of DArT sequences relative to reference genomes we obtained information, that will complement the results of the studies, where DArT genotyping was deployed, by simplifying the gene ontology and microcolinearity based identification of candidate genes. PMID:27833625

DArT Markers Effectively Target Gene Space in the Rye Genome.

PubMed

Gawroński, Piotr; Pawełkowicz, Magdalena; Tofil, Katarzyna; Uszyński, Grzegorz; Sharifova, Saida; Ahluwalia, Shivaksh; Tyrka, Mirosław; Wędzony, Maria; Kilian, Andrzej; Bolibok-Brągoszewska, Hanna

2016-01-01

Large genome size and complexity hamper considerably the genomics research in relevant species. Rye ( Secale cereale L.) has one of the largest genomes among cereal crops and repetitive sequences account for over 90% of its length. Diversity Arrays Technology is a high-throughput genotyping method, in which a preferential sampling of gene-rich regions is achieved through the use of methylation sensitive restriction enzymes. We obtained sequences of 6,177 rye DArT markers and following a redundancy analysis assembled them into 3,737 non-redundant sequences, which were then used in homology searches against five Pooideae sequence sets. In total 515 DArT sequences could be incorporated into publicly available rye genome zippers providing a starting point for the integration of DArT- and transcript-based genomics resources in rye. Using Blast2Go pipeline we attributed putative gene functions to 1101 (29.4%) of the non-redundant DArT marker sequences, including 132 sequences with putative disease resistance-related functions, which were found to be preferentially located in the 4RL and 6RL chromosomes. Comparative analysis based on the DArT sequences revealed obvious inconsistencies between two recently published high density consensus maps of rye. Furthermore we demonstrated that DArT marker sequences can be a source of SSR polymorphisms. Obtained data demonstrate that DArT markers effectively target gene space in the large, complex, and repetitive rye genome. Through the annotation of putative gene functions and the alignment of DArT sequences relative to reference genomes we obtained information, that will complement the results of the studies, where DArT genotyping was deployed, by simplifying the gene ontology and microcolinearity based identification of candidate genes.

Evolutionary conservation of regulatory elements in vertebrate HOX gene clusters

DOE Office of Scientific and Technical Information (OSTI.GOV)

Santini, Simona; Boore, Jeffrey L.; Meyer, Axel

2003-12-31

Due to their high degree of conservation, comparisons of DNA sequences among evolutionarily distantly-related genomes permit to identify functional regions in noncoding DNA. Hox genes are optimal candidate sequences for comparative genome analyses, because they are extremely conserved in vertebrates and occur in clusters. We aligned (Pipmaker) the nucleotide sequences of HoxA clusters of tilapia, pufferfish, striped bass, zebrafish, horn shark, human and mouse (over 500 million years of evolutionary distance). We identified several highly conserved intergenic sequences, likely to be important in gene regulation. Only a few of these putative regulatory elements have been previously described as being involvedmore » in the regulation of Hox genes, while several others are new elements that might have regulatory functions. The majority of these newly identified putative regulatory elements contain short fragments that are almost completely conserved and are identical to known binding sites for regulatory proteins (Transfac). The conserved intergenic regions located between the most rostrally expressed genes in the developing embryo are longer and better retained through evolution. We document that presumed regulatory sequences are retained differentially in either A or A clusters resulting from a genome duplication in the fish lineage. This observation supports both the hypothesis that the conserved elements are involved in gene regulation and the Duplication-Deletion-Complementation model.« less

Pharmacogenetics: Implications of Race and Ethnicity on Defining Genetic Profiles for Personalized Medicine

PubMed Central

Ortega, Victor E.; Meyers, Deborah A.

2014-01-01

Pharmacogenetics is being used to develop personalized therapies specific to individuals from different ethnic or racial groups. Pharmacogenetic studies to date have been primarily performed in trial cohorts consisting of non-Hispanic whites of European descent. A “bottleneck” or collapse of genetic diversity associated with the first human colonization of Europe during the Upper Paleolithic period, followed by the recent mixing of African, European, and Native American ancestries has resulted in different ethnic groups with varying degrees of genetic diversity. Differences in genetic ancestry may introduce genetic variation which has the potential to alter the therapeutic efficacy of commonly used asthma therapies, for example β2-adrenergic receptor agonists (beta agonists). Pharmacogenetic studies of admixed ethnic groups have been limited to small candidate gene association studies of which the best example is the gene coding for the receptor target of beta agonist therapy, ADRB2. Large consortium-based sequencing studies are using next-generation whole-genome sequencing to provide a diverse genome map of different admixed populations which can be used for future pharmacogenetic studies. These studies will include candidate gene studies, genome-wide association studies, and whole-genome admixture-based approaches which account for ancestral genetic structure, complex haplotypes, gene-gene interactions, and rare variants to detect and replicate novel pharmacogenetic loci. PMID:24369795

Transcriptome sequencing of three Ranunculus species (Ranunculaceae) reveals candidate genes in adaptation from terrestrial to aquatic habitats

PubMed Central

Chen, Ling-Yun; Zhao, Shu-Ying; Wang, Qing-Feng; Moody, Michael L.

2015-01-01

Adaptation to aquatic habitats is a formidable challenge for terrestrial angiosperms that has long intrigued scientists. As part of a suite of work to explore the molecular mechanism of adaptation to aquatic habitats, we here sequenced the transcriptome of the submerged aquatic plant Ranunculus bungei, and two terrestrial relatives R. cantoniensis and R. brotherusii, followed by comparative evolutionary analyses to determine candidate genes for adaption to aquatic habitats. We obtained 126,037, 140,218 and 114,753 contigs for R. bungei, R. cantoniensis and R. brotherusii respectively. Bidirectional Best Hit method and OrthoMCL method identified 11,362 and 8,174 1:1:1 orthologous genes (one ortholog is represented in each of the three species) respectively. Non-synonymous/synonymous (dN/dS) analyses were performed with a maximum likelihood method and an approximate method for the three species-pairs. In total, 14 genes of R. bungei potentially involved in the adaptive transition from terrestrial to aquatic habitats were identified. Some of the homologs to these genes in model plants are involved in vacuole protein formation, regulating ‘water transport process’ and ‘microtubule cytoskeleton organization’. Our study opens the door to understand the molecular mechanism of plant adaptation from terrestrial to aquatic habitats. PMID:25993393

Comparative transcriptome analyses of flower development in four species of Achimenes (Gesneriaceae).

PubMed

Roberts, Wade R; Roalson, Eric H

2017-03-20

Flowers have an amazingly diverse display of colors and shapes, and these characteristics often vary significantly among closely related species. The evolution of diverse floral form can be thought of as an adaptive response to pollination and reproduction, but it can also be seen through the lens of morphological and developmental constraints. To explore these interactions, we use RNA-seq across species and development to investigate gene expression and sequence evolution as they relate to the evolution of the diverse flowers in a group of Neotropical plants native to Mexico-magic flowers (Achimenes, Gesneriaceae). The assembled transcriptomes contain between 29,000 and 42,000 genes expressed during development. We combine sequence orthology and coexpression clustering with analyses of protein evolution to identify candidate genes for roles in floral form evolution. Over 25% of transcripts captured were distinctive to Achimenes and overrepresented by genes involved in transcription factor activity. Using a model-based clustering approach we find dynamic, temporal patterns of gene expression among species. Selection tests provide evidence of positive selection in several genes with roles in pigment production, flowering time, and morphology. Combining these approaches to explore genes related to flower color and flower shape, we find distinct patterns that correspond to transitions of floral form among Achimenes species. The floral transcriptomes developed from four species of Achimenes provide insight into the mechanisms involved in the evolution of diverse floral form among closely related species with different pollinators. We identified several candidate genes that will serve as an important and useful resource for future research. High conservation of sequence structure, patterns of gene coexpression, and detection of positive selection acting on few genes suggests that large phenotypic differences in floral form may be caused by genetic differences in a small set of genes. Our characterized floral transcriptomes provided here should facilitate further analyses into the genomics of flower development and the mechanisms underlying the evolution of diverse flowers in Achimenes and other Neotropical Gesneriaceae.

Population genomics reveals a candidate gene involved in bumble bee pigmentation.

PubMed

Pimsler, Meaghan L; Jackson, Jason M; Lozier, Jeffrey D

2017-05-01

Variation in bumble bee color patterns is well-documented within and between species. Identifying the genetic mechanisms underlying such variation may be useful in revealing evolutionary forces shaping rapid phenotypic diversification. The widespread North American species Bombus bifarius exhibits regional variation in abdominal color forms, ranging from red-banded to black-banded phenotypes and including geographically and phenotypically intermediate forms. Identifying genomic regions linked to this variation has been complicated by strong, near species level, genome-wide differentiation between red- and black-banded forms. Here, we instead focus on the closely related black-banded and intermediate forms that both belong to the subspecies B. bifarius nearcticus . We analyze an RNA sequencing (RNAseq) data set and identify a cluster of single nucleotide polymorphisms (SNPs) within one gene, Xanthine dehydrogenase/oxidase -like, that exhibit highly unusual differentiation compared to the rest of the sequenced genome. Homologs of this gene contribute to pigmentation in other insects, and results thus represent a strong candidate for investigating the genetic basis of pigment variation in B. bifarius and other bumble bee mimicry complexes.

A candidate gene for choanal atresia in alpaca.

PubMed

Reed, Kent M; Bauer, Miranda M; Mendoza, Kristelle M; Armién, Aníbal G

2010-03-01

Choanal atresia (CA) is a common nasal craniofacial malformation in New World domestic camelids (alpaca and llama). CA results from abnormal development of the nasal passages and is especially debilitating to newborn crias. CA in camelids shares many of the clinical manifestations of a similar condition in humans (CHARGE syndrome). Herein we report on the regulatory gene CHD7 of alpaca, whose homologue in humans is most frequently associated with CHARGE. Sequence of the CHD7 coding region was obtained from a non-affected cria. The complete coding region was 9003 bp, corresponding to a translated amino acid sequence of 3000 aa. Additional genomic sequences corresponding to a significant portion of the CHD7 gene were identified and assembled from the 2x alpaca whole genome sequence, providing confirmatory sequence for much of the CHD7 coding region. The alpaca CHD7 mRNA sequence was 97.9% similar to the human sequence, with the greatest sequence difference being an insertion in exon 38 that results in a polyalanine repeat (A12). Polymorphism in this repeat was tested for association with CA in alpaca by cloning and sequencing the repeat from both affected and non-affected individuals. Variation in length of the poly-A repeat was not associated with CA. Complete sequencing of the CHD7 gene will be necessary to determine whether other mutations in CHD7 are the cause of CA in camelids.

Identification of differentially expressed genes through RNA sequencing in goats (Capra hircus) at different postnatal stages

PubMed Central

Li, Qian; Lin, Sen

2017-01-01

Intramuscular fat (IMF) content and fatty acid composition of longissimus dorsi muscle (LM) change with growth, which partially determines the flavor and nutritional value of goat (Capra hircus) meat. However, unlike cattle, little information is available on the transcriptome-wide changes during different postnatal stages in small ruminants, especially goats. In this study, the sequencing reads of goat LM tissues collected from kid, youth, and adult period were mapped to the goat genome. Results showed that out of total 24 689 Unigenes, 20 435 Unigenes were annotated. Based on expected number of fragments per kilobase of transcript sequence per million base pairs sequenced (FPKM), 111 annotated differentially expressed genes (DEGs) were identified among different postnatal stages, which were subsequently assigned to 16 possible expression patterns by series-cluster analysis. Functional classification by Gene Ontology (GO) analysis was used for selecting the genes showing highest expression related to lipid metabolism. Finally, we identified the node genes for lipid metabolism regulation using co-expression analysis. In conclusion, these data may uncover candidate genes having functional roles in regulation of goat muscle development and lipid metabolism during the various growth stages in goats. PMID:28800357

Identification of differentially expressed genes through RNA sequencing in goats (Capra hircus) at different postnatal stages.

PubMed

Lin, Yaqiu; Zhu, Jiangjiang; Wang, Yong; Li, Qian; Lin, Sen

2017-01-01

Intramuscular fat (IMF) content and fatty acid composition of longissimus dorsi muscle (LM) change with growth, which partially determines the flavor and nutritional value of goat (Capra hircus) meat. However, unlike cattle, little information is available on the transcriptome-wide changes during different postnatal stages in small ruminants, especially goats. In this study, the sequencing reads of goat LM tissues collected from kid, youth, and adult period were mapped to the goat genome. Results showed that out of total 24 689 Unigenes, 20 435 Unigenes were annotated. Based on expected number of fragments per kilobase of transcript sequence per million base pairs sequenced (FPKM), 111 annotated differentially expressed genes (DEGs) were identified among different postnatal stages, which were subsequently assigned to 16 possible expression patterns by series-cluster analysis. Functional classification by Gene Ontology (GO) analysis was used for selecting the genes showing highest expression related to lipid metabolism. Finally, we identified the node genes for lipid metabolism regulation using co-expression analysis. In conclusion, these data may uncover candidate genes having functional roles in regulation of goat muscle development and lipid metabolism during the various growth stages in goats.

X-ray irradiation has positive effects for the recovery of peripheral nerve injury maybe through the vascular smooth muscle contraction signaling pathway.

PubMed

Jiang, Bo; Zhang, Yong; She, Chang; Zhao, Jiaju; Zhou, Kailong; Zuo, Zhicheng; Zhou, Xiaozhong; Wang, Peiji; Dong, Qirong

2017-09-01

It is well known that moderate to high doses of ionizing radiation have a toxic effect on the organism. However, there are few experimental studies on the mechanisms of LDR ionizing radiation on nerve regeneration after peripheral nerve injury. We established the rats' peripheral nerve injury model via repaired Peripheral nerve injury nerve, vascular endothelial growth factor a and Growth associated protein-43 were detected from different treatment groups. We performed transcriptome sequencing focusing on investigating the differentially expressed genes and gene functions between the control group and 1Gy group. Sequencing was done by using high-throughput RNA-sequencing (RNA-seq) technologies. The results showed the 1Gy group to be the most effective promoting repair. RNA-sequencing identified 619 differently expressed genes between control and treated groups. A Gene Ontology analysis of the differentially expressed genes revealed enrichment in the functional pathways. Among them, candidate genes associated with nerve repair were identified. Pathways involved in cell-substrate adhesion, vascular smooth muscle contraction and cell adhesion molecule signaling may be involved in recovery from peripheral nerve injury. Copyright © 2017. Published by Elsevier B.V.

New mutations in non-syndromic primary ovarian insufficiency patients identified via whole-exome sequencing.

PubMed

Patiño, Liliana Catherine; Beau, Isabelle; Carlosama, Carolina; Buitrago, July Constanza; González, Ronald; Suárez, Carlos Fernando; Patarroyo, Manuel Alfonso; Delemer, Brigitte; Young, Jacques; Binart, Nadine; Laissue, Paul

2017-07-01

Is it possible to identify new mutations potentially associated with non-syndromic primary ovarian insufficiency (POI) via whole-exome sequencing (WES)? WES is an efficient tool to study genetic causes of POI as we have identified new mutations, some of which lead to protein destablization potentially contributing to the disease etiology. POI is a frequently occurring complex pathology leading to infertility. Mutations in only few candidate genes, mainly identified by Sanger sequencing, have been definitively related to the pathogenesis of the disease. This is a retrospective cohort study performed on 69 women affected by POI. WES and an innovative bioinformatics analysis were used on non-synonymous sequence variants in a subset of 420 selected POI candidate genes. Mutations in BMPR1B and GREM1 were modeled by using fragment molecular orbital analysis. Fifty-five coding variants in 49 genes potentially related to POI were identified in 33 out of 69 patients (48%). These genes participate in key biological processes in the ovary, such as meiosis, follicular development, granulosa cell differentiation/proliferation and ovulation. The presence of at least two mutations in distinct genes in 42% of the patients argued in favor of a polygenic nature of POI. It is possible that regulatory regions, not analyzed in the present study, carry further variants related to POI. WES and the in silico analyses presented here represent an efficient approach for mapping variants associated with POI etiology. Sequence variants presented here represents potential future genetic biomarkers. This study was supported by the Universidad del Rosario and Colciencias (Grants CS/CIGGUR-ABN062-2016 and 672-2014). Colciencias supported Liliana Catherine Patiño´s work (Fellowship: 617, 2013). The authors declare no conflict of interest. © The Author 2017. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

Next-generation DNA sequencing identifies novel gene variants and pathways involved in specific language impairment.

PubMed

Chen, Xiaowei Sylvia; Reader, Rose H; Hoischen, Alexander; Veltman, Joris A; Simpson, Nuala H; Francks, Clyde; Newbury, Dianne F; Fisher, Simon E

2017-04-25

A significant proportion of children have unexplained problems acquiring proficient linguistic skills despite adequate intelligence and opportunity. Developmental language disorders are highly heritable with substantial societal impact. Molecular studies have begun to identify candidate loci, but much of the underlying genetic architecture remains undetermined. We performed whole-exome sequencing of 43 unrelated probands affected by severe specific language impairment, followed by independent validations with Sanger sequencing, and analyses of segregation patterns in parents and siblings, to shed new light on aetiology. By first focusing on a pre-defined set of known candidates from the literature, we identified potentially pathogenic variants in genes already implicated in diverse language-related syndromes, including ERC1, GRIN2A, and SRPX2. Complementary analyses suggested novel putative candidates carrying validated variants which were predicted to have functional effects, such as OXR1, SCN9A and KMT2D. We also searched for potential "multiple-hit" cases; one proband carried a rare AUTS2 variant in combination with a rare inherited haplotype affecting STARD9, while another carried a novel nonsynonymous variant in SEMA6D together with a rare stop-gain in SYNPR. On broadening scope to all rare and novel variants throughout the exomes, we identified biological themes that were enriched for such variants, including microtubule transport and cytoskeletal regulation.

Next-generation DNA sequencing identifies novel gene variants and pathways involved in specific language impairment

PubMed Central

Chen, Xiaowei Sylvia; Reader, Rose H.; Hoischen, Alexander; Veltman, Joris A.; Simpson, Nuala H.; Francks, Clyde; Newbury, Dianne F.; Fisher, Simon E.

2017-01-01

A significant proportion of children have unexplained problems acquiring proficient linguistic skills despite adequate intelligence and opportunity. Developmental language disorders are highly heritable with substantial societal impact. Molecular studies have begun to identify candidate loci, but much of the underlying genetic architecture remains undetermined. We performed whole-exome sequencing of 43 unrelated probands affected by severe specific language impairment, followed by independent validations with Sanger sequencing, and analyses of segregation patterns in parents and siblings, to shed new light on aetiology. By first focusing on a pre-defined set of known candidates from the literature, we identified potentially pathogenic variants in genes already implicated in diverse language-related syndromes, including ERC1, GRIN2A, and SRPX2. Complementary analyses suggested novel putative candidates carrying validated variants which were predicted to have functional effects, such as OXR1, SCN9A and KMT2D. We also searched for potential “multiple-hit” cases; one proband carried a rare AUTS2 variant in combination with a rare inherited haplotype affecting STARD9, while another carried a novel nonsynonymous variant in SEMA6D together with a rare stop-gain in SYNPR. On broadening scope to all rare and novel variants throughout the exomes, we identified biological themes that were enriched for such variants, including microtubule transport and cytoskeletal regulation. PMID:28440294

Transcriptional Analysis of Flowering Time in Switchgrass

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tornqvist, Carl-Erik; Vaillancourt, Brieanne; Kim, Jeongwoon

Over the past two decades, switchgrass (Panicum virgatum) has emerged as a priority biofuel feedstock. The bulk of switchgrass biomass is in the vegetative portion of the plant; therefore, increasing the length of vegetative growth will lead to an increase in overall biomass yield. The goal of this study was to gain insight into the control of flowering time in switchgrass that would assist in development of cultivars with longer vegetative phases through delayed flowering. RNA sequencing was used to assess genome-wide expression profiles across a developmental series between switchgrass genotypes belonging to the two main ecotypes: upland, typically earlymore » flowering, and lowland, typically late flowering. Leaf blades and tissues enriched for the shoot apical meristem (SAM) were collected in a developmental series from emergence through anthesis for RNA extraction. RNA from samples that flanked the SAM transition stage was sequenced for expression analyses. The analyses revealed differential expression patterns between early- and late-flowering genotypes for known flowering time orthologs. Namely, genes shown to play roles in photoperiod response and the circadian clock in other species were identified as potential candidates for regulating flowering time in the switchgrass genotypes analyzed. Based on their expression patterns, many of the differentially expressed genes could also be classified as putative promoters or repressors of flowering. The candidate genes presented here may be used to guide switchgrass improvement through marker-assisted breeding and/or transgenic or gene editing approaches.Over the past two decades, switchgrass (Panicum virgatum) has emerged as a priority biofuel feedstock. The bulk of switchgrass biomass is in the vegetative portion of the plant; therefore, increasing the length of vegetative growth will lead to an increase in overall biomass yield. The goal of this study was to gain insight into the control of flowering time in switchgrass that would assist in development of cultivars with longer vegetative phases through delayed flowering. RNA sequencing was used to assess genome-wide expression profiles across a developmental series between switchgrass genotypes belonging to the two main ecotypes: upland, typically early flowering, and lowland, typically late flowering. Leaf blades and tissues enriched for the shoot apical meristem (SAM) were collected in a developmental series from emergence through anthesis for RNA extraction. RNA from samples that flanked the SAM transition stage was sequenced for expression analyses. The analyses revealed differential expression patterns between early- and late-flowering genotypes for known flowering time orthologs. Namely, genes shown to play roles in photoperiod response and the circadian clock in other species were identified as potential candidates for regulating flowering time in the switchgrass genotypes analyzed. Based on their expression patterns, many of the differentially expressed genes could also be classified as putative promoters or repressors of flowering. The candidate genes presented here may then be used to guide switchgrass improvement through marker-assisted breeding and/or transgenic or gene editing approaches.« less

Transcriptional Analysis of Flowering Time in Switchgrass

DOE PAGES

Tornqvist, Carl-Erik; Vaillancourt, Brieanne; Kim, Jeongwoon; ...

2017-04-27

Over the past two decades, switchgrass (Panicum virgatum) has emerged as a priority biofuel feedstock. The bulk of switchgrass biomass is in the vegetative portion of the plant; therefore, increasing the length of vegetative growth will lead to an increase in overall biomass yield. The goal of this study was to gain insight into the control of flowering time in switchgrass that would assist in development of cultivars with longer vegetative phases through delayed flowering. RNA sequencing was used to assess genome-wide expression profiles across a developmental series between switchgrass genotypes belonging to the two main ecotypes: upland, typically earlymore » flowering, and lowland, typically late flowering. Leaf blades and tissues enriched for the shoot apical meristem (SAM) were collected in a developmental series from emergence through anthesis for RNA extraction. RNA from samples that flanked the SAM transition stage was sequenced for expression analyses. The analyses revealed differential expression patterns between early- and late-flowering genotypes for known flowering time orthologs. Namely, genes shown to play roles in photoperiod response and the circadian clock in other species were identified as potential candidates for regulating flowering time in the switchgrass genotypes analyzed. Based on their expression patterns, many of the differentially expressed genes could also be classified as putative promoters or repressors of flowering. The candidate genes presented here may be used to guide switchgrass improvement through marker-assisted breeding and/or transgenic or gene editing approaches.Over the past two decades, switchgrass (Panicum virgatum) has emerged as a priority biofuel feedstock. The bulk of switchgrass biomass is in the vegetative portion of the plant; therefore, increasing the length of vegetative growth will lead to an increase in overall biomass yield. The goal of this study was to gain insight into the control of flowering time in switchgrass that would assist in development of cultivars with longer vegetative phases through delayed flowering. RNA sequencing was used to assess genome-wide expression profiles across a developmental series between switchgrass genotypes belonging to the two main ecotypes: upland, typically early flowering, and lowland, typically late flowering. Leaf blades and tissues enriched for the shoot apical meristem (SAM) were collected in a developmental series from emergence through anthesis for RNA extraction. RNA from samples that flanked the SAM transition stage was sequenced for expression analyses. The analyses revealed differential expression patterns between early- and late-flowering genotypes for known flowering time orthologs. Namely, genes shown to play roles in photoperiod response and the circadian clock in other species were identified as potential candidates for regulating flowering time in the switchgrass genotypes analyzed. Based on their expression patterns, many of the differentially expressed genes could also be classified as putative promoters or repressors of flowering. The candidate genes presented here may then be used to guide switchgrass improvement through marker-assisted breeding and/or transgenic or gene editing approaches.« less

Targeted capture and resequencing of 1040 genes reveal environmentally driven functional variation in grey wolves.

PubMed

Schweizer, Rena M; Robinson, Jacqueline; Harrigan, Ryan; Silva, Pedro; Galverni, Marco; Musiani, Marco; Green, Richard E; Novembre, John; Wayne, Robert K

2016-01-01

In an era of ever-increasing amounts of whole-genome sequence data for individuals and populations, the utility of traditional single nucleotide polymorphisms (SNPs) array-based genome scans is uncertain. We previously performed a SNP array-based genome scan to identify candidate genes under selection in six distinct grey wolf (Canis lupus) ecotypes. Using this information, we designed a targeted capture array for 1040 genes, including all exons and flanking regions, as well as 5000 1-kb nongenic neutral regions, and resequenced these regions in 107 wolves. Selection tests revealed striking patterns of variation within candidate genes relative to noncandidate regions and identified potentially functional variants related to local adaptation. We found 27% and 47% of candidate genes from the previous SNP array study had functional changes that were outliers in sweed and bayenv analyses, respectively. This result verifies the use of genomewide SNP surveys to tag genes that contain functional variants between populations. We highlight nonsynonymous variants in APOB, LIPG and USH2A that occur in functional domains of these proteins, and that demonstrate high correlation with precipitation seasonality and vegetation. We find Arctic and High Arctic wolf ecotypes have higher numbers of genes under selection, which highlight their conservation value and heightened threat due to climate change. This study demonstrates that combining genomewide genotyping arrays with large-scale resequencing and environmental data provides a powerful approach to discern candidate functional variants in natural populations. © 2015 John Wiley & Sons Ltd.

Fine mapping and candidate gene analysis of the virescent gene v 1 in Upland cotton (Gossypium hirsutum).

PubMed

Mao, Guangzhi; Ma, Qiang; Wei, Hengling; Su, Junji; Wang, Hantao; Ma, Qifeng; Fan, Shuli; Song, Meizhen; Zhang, Xianlong; Yu, Shuxun

2018-02-01

The young leaves of virescent mutants are yellowish and gradually turn green as the plants reach maturity. Understanding the genetic basis of virescent mutants can aid research of the regulatory mechanisms underlying chloroplast development and chlorophyll biosynthesis, as well as contribute to the application of virescent traits in crop breeding. In this study, fine mapping was employed, and a recessive gene (v 1 ) from a virescent mutant of Upland cotton was narrowed to an 84.1-Kb region containing ten candidate genes. The GhChlI gene encodes the cotton Mg-chelatase I subunit (CHLI) and was identified as the candidate gene for the virescent mutation using gene annotation. BLAST analysis showed that the GhChlI gene has two copies, Gh_A10G0282 and Gh_D10G0283. Sequence analysis indicated that the coding region (CDS) of GhChlI is 1269 bp in length, with three predicted exons and one non-synonymous nucleotide mutation (G1082A) in the third exon of Gh_D10G0283, with an amino acid (AA) substitution of arginine (R) to lysine (K). GhChlI-silenced TM-1 plants exhibited a lower GhChlI expression level, a lower chlorophyll content, and the virescent phenotype. Analysis of upstream regulatory elements and expression levels of GhChlI showed that the expression quantity of GhChlI may be normal, and with the development of the true leaf, the increase in the Gh_A10G0282 dosage may partially make up for the deficiency of Gh_D10G0283 in the v 1 mutant. Phylogenetic analysis and sequence alignment revealed that the protein sequence encoded by the third exon of GhChlI is highly conserved across diverse plant species, in which AA substitutions among the completely conserved residues frequently result in changes in leaf color in various species. These results suggest that the mutation (G1082A) within the GhChlI gene may cause a functional defect of the GhCHLI subunit and thus the virescent phenotype in the v 1 mutant. The GhChlI mutation not only provides a tool for understanding the associations of CHLI protein function and the chlorophyll biosynthesis pathway but also has implications for cotton breeding.

Search for Novel Candidate Mutations for Metronidazole Resistance in Helicobacter pylori Using Next-Generation Sequencing

PubMed Central

Binh, Tran Thanh; Suzuki, Rumiko; Trang, Tran Thi Huyen; Kwon, Dong Hyeon

2015-01-01

Metronidazole resistance is a key factor associated with Helicobacter pylori treatment failure. Although this resistance is mainly associated with mutations in the rdxA and frxA genes, the question of whether metronidazole resistance is caused by the inactivation of frxA alone is still debated. Furthermore, it is unclear whether there are other mutations involved in addition to the two genes that are associated with resistance. A metronidazole-resistant strain was cultured from the metronidazole-susceptible H. pylori strain 26695-1 by exposure to low concentrations of metronidazole. The genome sequences of both susceptible and resistant H. pylori strains were determined by Illumina next-generation sequencing, from which putative candidate resistance mutations were identified. Natural transformation was used to introduce PCR products containing candidate mutations into the susceptible parent strain 26695-1, and the metronidazole MIC was determined for each strain. Mutations in frxA (hp0642), rdxA (hp0954), and rpsU (hp0562) were confirmed by the Sanger method. The mutated sequence in rdxA was successfully transformed into strain 26695-1, and the transformants showed resistance to metronidazole. The transformants containing a single mutation in rdxA showed a low MIC (16 mg/liter), while those containing mutations in both rdxA and frxA showed a higher MIC (48 mg/liter). No transformants containing a single mutation in frxA or rpsU were obtained. Next-generation sequencing was used to identify mutations related to drug resistance. We confirmed that the mutations in rdxA are mainly associated with metronidazole resistance, and mutations in frxA are able to enhance H. pylori resistance only in the presence of rdxA mutations. Moreover, mutations in rpsU may play a role in metronidazole resistance. PMID:25645832

Identification of rare paired box 3 variant in strabismus by whole exome sequencing

PubMed Central

Gong, Hui-Min; Wang, Jing; Xu, Jing; Zhou, Zhan-Yu; Li, Jing-Wen; Chen, Shu-Fang

2017-01-01

AIM To identify the potentially pathogenic gene variants that contributes to the etiology of strabismus. METHODS A Chinese pedigree with strabismus was collected and the exomes of two affected individuals were sequenced using the next-generation sequencing technology. The resulting variants from exome sequencing were filtered by subsequent bioinformatics methods and the candidate mutation was verified as heterozygous in the affected proposita and her mother by sanger sequencing. RESULTS Whole exome sequencing and filtering identified a nonsynonymous mutation c.434G-T transition in paired box 3 (PAX3) in the two affected individuals, which were predicted to be deleterious by more than 4 bioinformatics programs. This altered amino acid residue was located in the conserved PAX domain of PAX3. This gene encodes a member of the PAX family of transcription factors, which play critical roles during fetal development. Mutations in PAX3 were associated with Waardenburg syndrome with strabismus. CONCLUSION Our results report that the c.434G-T mutation (p.R145L) in PAX3 may contribute to strabismus, expanding our understanding of the causally relevant genes for this disorder. PMID:28861346

Association of Amine-Receptor DNA Sequence Variants with Associative Learning in the Honeybee.

PubMed

Lagisz, Malgorzata; Mercer, Alison R; de Mouzon, Charlotte; Santos, Luana L S; Nakagawa, Shinichi

2016-03-01

Octopamine- and dopamine-based neuromodulatory systems play a critical role in learning and learning-related behaviour in insects. To further our understanding of these systems and resulting phenotypes, we quantified DNA sequence variations at six loci coding octopamine-and dopamine-receptors and their association with aversive and appetitive learning traits in a population of honeybees. We identified 79 polymorphic sequence markers (mostly SNPs and a few insertions/deletions) located within or close to six candidate genes. Intriguingly, we found that levels of sequence variation in the protein-coding regions studied were low, indicating that sequence variation in the coding regions of receptor genes critical to learning and memory is strongly selected against. Non-coding and upstream regions of the same genes, however, were less conserved and sequence variations in these regions were weakly associated with between-individual differences in learning-related traits. While these associations do not directly imply a specific molecular mechanism, they suggest that the cross-talk between dopamine and octopamine signalling pathways may influence olfactory learning and memory in the honeybee.

Identification of rare paired box 3 variant in strabismus by whole exome sequencing.

PubMed

Gong, Hui-Min; Wang, Jing; Xu, Jing; Zhou, Zhan-Yu; Li, Jing-Wen; Chen, Shu-Fang

2017-01-01

To identify the potentially pathogenic gene variants that contributes to the etiology of strabismus. A Chinese pedigree with strabismus was collected and the exomes of two affected individuals were sequenced using the next-generation sequencing technology. The resulting variants from exome sequencing were filtered by subsequent bioinformatics methods and the candidate mutation was verified as heterozygous in the affected proposita and her mother by sanger sequencing. Whole exome sequencing and filtering identified a nonsynonymous mutation c.434G-T transition in paired box 3 (PAX3) in the two affected individuals, which were predicted to be deleterious by more than 4 bioinformatics programs. This altered amino acid residue was located in the conserved PAX domain of PAX3. This gene encodes a member of the PAX family of transcription factors, which play critical roles during fetal development. Mutations in PAX3 were associated with Waardenburg syndrome with strabismus. Our results report that the c.434G-T mutation (p.R145L) in PAX3 may contribute to strabismus, expanding our understanding of the causally relevant genes for this disorder.

Automatic annotation of protein motif function with Gene Ontology terms.

PubMed

Lu, Xinghua; Zhai, Chengxiang; Gopalakrishnan, Vanathi; Buchanan, Bruce G

2004-09-02

Conserved protein sequence motifs are short stretches of amino acid sequence patterns that potentially encode the function of proteins. Several sequence pattern searching algorithms and programs exist foridentifying candidate protein motifs at the whole genome level. However, a much needed and important task is to determine the functions of the newly identified protein motifs. The Gene Ontology (GO) project is an endeavor to annotate the function of genes or protein sequences with terms from a dynamic, controlled vocabulary and these annotations serve well as a knowledge base. This paper presents methods to mine the GO knowledge base and use the association between the GO terms assigned to a sequence and the motifs matched by the same sequence as evidence for predicting the functions of novel protein motifs automatically. The task of assigning GO terms to protein motifs is viewed as both a binary classification and information retrieval problem, where PROSITE motifs are used as samples for mode training and functional prediction. The mutual information of a motif and aGO term association is found to be a very useful feature. We take advantage of the known motifs to train a logistic regression classifier, which allows us to combine mutual information with other frequency-based features and obtain a probability of correct association. The trained logistic regression model has intuitively meaningful and logically plausible parameter values, and performs very well empirically according to our evaluation criteria. In this research, different methods for automatic annotation of protein motifs have been investigated. Empirical result demonstrated that the methods have a great potential for detecting and augmenting information about the functions of newly discovered candidate protein motifs.

NEIBank: Genomics and bioinformatics resources for vision research

PubMed Central

Peterson, Katherine; Gao, James; Buchoff, Patee; Jaworski, Cynthia; Bowes-Rickman, Catherine; Ebright, Jessica N.; Hauser, Michael A.; Hoover, David

2008-01-01

NEIBank is an integrated resource for genomics and bioinformatics in vision research. It includes expressed sequence tag (EST) data and sequence-verified cDNA clones for multiple eye tissues of several species, web-based access to human eye-specific SAGE data through EyeSAGE, and comprehensive, annotated databases of known human eye disease genes and candidate disease gene loci. All expression- and disease-related data are integrated in EyeBrowse, an eye-centric genome browser. NEIBank provides a comprehensive overview of current knowledge of the transcriptional repertoires of eye tissues and their relation to pathology. PMID:18648525

Lack of haplotype structuring for two candidate genes for trypanotolerance in cattle.

PubMed

Álvarez, I; Pérez-Pardal, L; Traoré, A; Fernández, I; Goyache, F

2016-04-01

Bovine trypanotolerance is a heritable trait associated to the ability of the individuals to control parasitaemia and anaemia. The INHBA (BTA4) and TICAM1 (BTA7) genes are strong candidates for trypanotolerance-related traits. The coding sequence of both genes (3951 bp in total) were analysed in a panel including 79 Asian, African and European cattle (Bos taurus and B. indicus) to identify naturally occurring polymorphisms on both genes. In general, the genetic diversity was low. Nineteen of the 33 mutations identified were found just one time. Seventeen different haplotypes were defined for the TICAM1 gene, and 9 and 12 were defined for the exon 1 and the exon 2 of the INHBA gene, respectively. There was no clear separation between cattle groups. The most frequent haplotypes identified in West African taurine samples were also identified in other cattle groups including Asian zebu and European cattle. Phylogenetic trees and principal component analysis confirmed that divergence among the cattle groups analysed was poor, particularly for the INHBA sequences. The European cattle subset had the lowest values of haplotype diversity for both the exon1 (monomorphic) and the exon2 (0.077 ± 0.066) of the INHBA gene. Neutrality tests, in general, did not suggest that the analysed genes were under positive selection. The assessed scenario would be consistent with the identification of recent mutations in evolutionary terms. © 2015 Blackwell Verlag GmbH.

Mutation in the epsilon subunit of the cytosolic chaperonin-containing t-complex peptide-1 (Cct5) gene causes autosomal recessive mutilating sensory neuropathy with spastic paraplegia.

PubMed

Bouhouche, A; Benomar, A; Bouslam, N; Chkili, T; Yahyaoui, M

2006-05-01

Mutilating sensory neuropathy with spastic paraplegia is a very rare disease with both autosomal dominant and recessive modes of inheritance. We previously mapped the locus of the autosomal recessive form to a 25 cM interval between markers D5S2048 and D5S648 on chromosome 5p. In this candidate interval, the Cct5 gene encoding the epsilon subunit of the cytosolic chaperonin-containing t-complex peptide-1 (CCT) was the most obvious candidate gene since mutation in the Cct4 gene encoding the CCT delta subunit has been reported to be associated with autosomal recessive mutilating sensory neuropathy in mutilated foot (mf) rat mutant. A consanguineous Moroccan family with four patients displaying mutilating sensory neuropathy associated with spastic paraplegia was investigated. To identify the disease causing gene, the 11 coding exons of the Cct5 gene were screened for mutations by direct sequencing in all family members including the four patients, parents, and six at risk relatives. Sequence analysis of the Cct5 gene revealed a missense A492G mutation in exon 4 that results in the substitution of a highly conserved histidine for arginine amino acid 147. Interestingly, R147 was absent in 384 control matched chromosomes tested. This is the first disease causing mutation that has been identified in the human CCT subunit genes; the mf rat mutant could serve as an animal model for studying these chaperonopathies.

Draft Genome Sequence, and a Sequence-Defined Genetic Linkage Map of the Legume Crop Species Lupinus angustifolius L

PubMed Central

Zheng, Zequn; Zhang, Qisen; Zhou, Gaofeng; Sweetingham, Mark W.; Howieson, John G.; Li, Chengdao

2013-01-01

Lupin (Lupinus angustifolius L.) is the most recently domesticated crop in major agricultural cultivation. Its seeds are high in protein and dietary fibre, but low in oil and starch. Medical and dietetic studies have shown that consuming lupin-enriched food has significant health benefits. We report the draft assembly from a whole genome shotgun sequencing dataset for this legume species with 26.9x coverage of the genome, which is predicted to contain 57,807 genes. Analysis of the annotated genes with metabolic pathways provided a partial understanding of some key features of lupin, such as the amino acid profile of storage proteins in seeds. Furthermore, we applied the NGS-based RAD-sequencing technology to obtain 8,244 sequence-defined markers for anchoring the genomic sequences. A total of 4,214 scaffolds from the genome sequence assembly were aligned into the genetic map. The combination of the draft assembly and a sequence-defined genetic map made it possible to locate and study functional genes of agronomic interest. The identification of co-segregating SNP markers, scaffold sequences and gene annotation facilitated the identification of a candidate R gene associated with resistance to the major lupin disease anthracnose. We demonstrated that the combination of medium-depth genome sequencing and a high-density genetic linkage map by application of NGS technology is a cost-effective approach to generating genome sequence data and a large number of molecular markers to study the genomics, genetics and functional genes of lupin, and to apply them to molecular plant breeding. This strategy does not require prior genome knowledge, which potentiates its application to a wide range of non-model species. PMID:23734219

Draft genome sequence, and a sequence-defined genetic linkage map of the legume crop species Lupinus angustifolius L.

PubMed

Yang, Huaan; Tao, Ye; Zheng, Zequn; Zhang, Qisen; Zhou, Gaofeng; Sweetingham, Mark W; Howieson, John G; Li, Chengdao

2013-01-01

Lupin (Lupinus angustifolius L.) is the most recently domesticated crop in major agricultural cultivation. Its seeds are high in protein and dietary fibre, but low in oil and starch. Medical and dietetic studies have shown that consuming lupin-enriched food has significant health benefits. We report the draft assembly from a whole genome shotgun sequencing dataset for this legume species with 26.9x coverage of the genome, which is predicted to contain 57,807 genes. Analysis of the annotated genes with metabolic pathways provided a partial understanding of some key features of lupin, such as the amino acid profile of storage proteins in seeds. Furthermore, we applied the NGS-based RAD-sequencing technology to obtain 8,244 sequence-defined markers for anchoring the genomic sequences. A total of 4,214 scaffolds from the genome sequence assembly were aligned into the genetic map. The combination of the draft assembly and a sequence-defined genetic map made it possible to locate and study functional genes of agronomic interest. The identification of co-segregating SNP markers, scaffold sequences and gene annotation facilitated the identification of a candidate R gene associated with resistance to the major lupin disease anthracnose. We demonstrated that the combination of medium-depth genome sequencing and a high-density genetic linkage map by application of NGS technology is a cost-effective approach to generating genome sequence data and a large number of molecular markers to study the genomics, genetics and functional genes of lupin, and to apply them to molecular plant breeding. This strategy does not require prior genome knowledge, which potentiates its application to a wide range of non-model species.

De Novo Foliar Transcriptome of Chenopodium amaranticolor and Analysis of Its Gene Expression During Virus-Induced Hypersensitive Response

PubMed Central

Zhang, Yongqiang; Pei, Xinwu; Zhang, Chao; Lu, Zifeng; Wang, Zhixing; Jia, Shirong; Li, Weimin

2012-01-01

Background The hypersensitive response (HR) system of Chenopodium spp. confers broad-spectrum virus resistance. However, little knowledge exists at the genomic level for Chenopodium, thus impeding the advanced molecular research of this attractive feature. Hence, we took advantage of RNA-seq to survey the foliar transcriptome of C. amaranticolor, a Chenopodium species widely used as laboratory indicator for pathogenic viruses, in order to facilitate the characterization of the HR-type of virus resistance. Methodology and Principal Findings Using Illumina HiSeq™ 2000 platform, we obtained 39,868,984 reads with 3,588,208,560 bp, which were assembled into 112,452 unigenes (3,847 clusters and 108,605 singletons). BlastX search against the NCBI NR database identified 61,698 sequences with a cut-off E-value above 10−5. Assembled sequences were annotated with gene descriptions, GO, COG and KEGG terms, respectively. A total number of 738 resistance gene analogs (RGAs) and homology sequences of 6 key signaling proteins within the R proteins-directed signaling pathway were identified. Based on this transcriptome data, we investigated the gene expression profiles over the stage of HR induced by Tobacco mosaic virus and Cucumber mosaic virus by using digital gene expression analysis. Numerous candidate genes specifically or commonly regulated by these two distinct viruses at early and late stages of the HR were identified, and the dynamic changes of the differently expressed genes enriched in the pathway of plant-pathogen interaction were particularly emphasized. Conclusions To our knowledge, this study is the first description of the genetic makeup of C. amaranticolor, providing deep insight into the comprehensive gene expression information at transcriptional level in this species. The 738 RGAs as well as the differentially regulated genes, particularly the common genes regulated by both TMV and CMV, are suitable candidates which merit further functional characterization to dissect the molecular mechanisms and regulatory pathways of the HR-type of virus resistance in Chenopodium. PMID:23029338

What is currently known about the genetics of venous thromboembolism at the dawn of next generation sequencing technologies.

PubMed

Trégouët, David-Alexandre; Morange, Pierre-Emmanuel

2018-02-01

Venous thromboembolism (VTE) has a strong genetic component. This review summarizes what is known at the seventeen genes that are now well established to harbour VTE-associated genetic variants. In addition, it discusses additional candidate genes that deserve further validation before being claimed as VTE associated genes. Finally, several research strategies are briefly described to identify other molecular determinants of the disease. © 2017 John Wiley & Sons Ltd.

The comprehensive liver transcriptome of two cattle breeds with different intramuscular fat content.

PubMed

Wang, Xi; Zhang, Yuanqing; Zhang, Xizhong; Wang, Dongcai; Jin, Guang; Li, Bo; Xu, Fang; Cheng, Jing; Zhang, Feng; Wu, Sujun; Rui, Su; He, Jiang; Zhang, Ronghua; Liu, Wenzhong

2017-08-26

Intramuscular fat (IMF) content is an important determinant factor of meat quality in cattle. There is significant difference in IMF content between Jinnan and Simmental cattle. Here, to identify candidate genes and networks associated with IMF deposition, we deeply explored the transcriptome architecture of liver in these two cattle breeds. We sequenced the liver transcriptome of five Jinnan and three Simmental cattle, yielding about 413.9 million sequencing reads. 124 differentially expressed genes (DEGs) were detected, of which 53 were up-regulated and 71 were down-regulated in Jinnan cattle. 1282 potentially novel genes were also identified. Gene ontology analysis revealed these DEGs (including CYP21A2, PC, ACACB, APOA1, and FADS2) were significantly enriched in lipid biosynthetic process, regulation of cholesterol esterification, reverse cholesterol transport, and regulation of lipoprotein lipase activity. Genes involved in pyruvate metabolism pathway were also significantly overrepresented. Moreover, we identified an interaction network which related to lipid metabolism, which might be contributed to the IMF deposition in cattle. We concluded that the DEGs involved in the regulation of lipid metabolism could play an important role in IMF deposition. Overall, we proposed a new panel of candidate genes and interaction networks that can be associated with IMF deposition and used as biomarkers in cattle breeding. Copyright © 2017 Elsevier Inc. All rights reserved.

Functional molecular markers for crop improvement.

PubMed

Kage, Udaykumar; Kumar, Arun; Dhokane, Dhananjay; Karre, Shailesh; Kushalappa, Ajjamada C

2016-10-01

A tremendous decline in cultivable land and resources and a huge increase in food demand calls for immediate attention to crop improvement. Though molecular plant breeding serves as a viable solution and is considered as "foundation for twenty-first century crop improvement", a major stumbling block for crop improvement is the availability of a limited functional gene pool for cereal crops. Advancement in the next generation sequencing (NGS) technologies integrated with tools like metabolomics, proteomics and association mapping studies have facilitated the identification of candidate genes, their allelic variants and opened new avenues to accelerate crop improvement through development and use of functional molecular markers (FMMs). The FMMs are developed from the sequence polymorphisms present within functional gene(s) which are associated with phenotypic trait variations. Since FMMs obviate the problems associated with random DNA markers, these are considered as "the holy grail" of plant breeders who employ targeted marker assisted selections (MAS) for crop improvement. This review article attempts to consider the current resources and novel methods such as metabolomics, proteomics and association studies for the identification of candidate genes and their validation through virus-induced gene silencing (VIGS) for the development of FMMs. A number of examples where the FMMs have been developed and used for the improvement of cereal crops for agronomic, food quality, disease resistance and abiotic stress tolerance traits have been considered.

Exome sequencing and digital PCR analyses reveal novel mutated genes related to the metastasis of pancreatic ductal adenocarcinoma.

PubMed

Zhou, Bin; Irwanto, Astrid; Guo, Yun-Miao; Bei, Jin-Xin; Wu, Qiao; Chen, Ge; Zhang, Tai-Ping; Lei, Jin-Jv; Feng, Qi-Sheng; Chen, Li-Zhen; Liu, Jianjun; Zhao, Yu-Pei

2012-08-01

Pancreatic ductal adenocarcinoma (PDAC) is one of the most malignant cancers with more than 94% mortality rate mainly due to the widespread metastases. To find out the somatically mutated genes related to the metastasis of PDAC, we analyzed the matched tumor and normal tissue samples from a patient diagnosed with liver metastatic PDAC using intensive exome capture-sequencing analysis (> 170× coverage). Searching for the somatic mutations that drive the clonal expansion of metastasis, we identified 12 genes with higher allele frequencies (AFs) of functional mutations in the metastatic tumor, including known genes KRAS and TP53 for metastasis. Of the 10 candidate genes, 6 (ADRB1, DCLK1, KCNH2, NOP14, SIGLEC1, and ZC3H7A), together with KRAS and TP53, were clustered into a single network (p value = 1 × 10(-22)) that is related to cancer development. Moreover, these candidate genes showed abnormal expression in PDAC tissues and functional impacts on the migration, proliferation, and colony formation abilities of pancreatic cancer cell lines. Furthermore, through digital PCR analysis, we revealed potential genomic mechanisms for the KRAS and TP53 mutations in the metastatic tumor. Taken together, our study shows the possibility for such personalized genomic profiling to provide new biological insight into the metastasis of PDAC.

Molecular insight into the association between cartilage regeneration and ear wound healing in genetic mouse models: targeting new genes in regeneration.

PubMed

Rai, Muhammad Farooq; Schmidt, Eric J; McAlinden, Audrey; Cheverud, James M; Sandell, Linda J

2013-11-06

Tissue regeneration is a complex trait with few genetic models available. Mouse strains LG/J and MRL are exceptional healers. Using recombinant inbred strains from a large (LG/J, healer) and small (SM/J, nonhealer) intercross, we have previously shown a positive genetic correlation between ear wound healing, knee cartilage regeneration, and protection from osteoarthritis. We hypothesize that a common set of genes operates in tissue healing and articular cartilage regeneration. Taking advantage of archived histological sections from recombinant inbred strains, we analyzed expression of candidate genes through branched-chain DNA technology directly from tissue lysates. We determined broad-sense heritability of candidates, Pearson correlation of candidates with healing phenotypes, and Ward minimum variance cluster analysis for strains. A bioinformatic assessment of allelic polymorphisms within and near candidate genes was also performed. The expression of several candidates was significantly heritable among strains. Although several genes correlated with both ear wound healing and cartilage healing at a marginal level, the expression of four genes representing DNA repair (Xrcc2, Pcna) and Wnt signaling (Axin2, Wnt16) pathways was significantly positively correlated with both phenotypes. Cluster analysis accurately classified healers and nonhealers for seven out of eight strains based on gene expression. Specific sequence differences between LG/J and SM/J were identified as potential causal polymorphisms. Our study suggests a common genetic basis between tissue healing and osteoarthritis susceptibility. Mapping genetic variations causing differences in diverse healing responses in multiple tissues may reveal generic healing processes in pursuit of new therapeutic targets designed to induce or enhance regeneration and, potentially, protection from osteoarthritis.

The Terpene Synthase Gene Family of Carrot (Daucus carota L.): Identification of QTLs and Candidate Genes Associated with Terpenoid Volatile Compounds

PubMed Central

Keilwagen, Jens; Lehnert, Heike; Berner, Thomas; Budahn, Holger; Nothnagel, Thomas; Ulrich, Detlef; Dunemann, Frank

2017-01-01

Terpenes are an important group of secondary metabolites in carrots influencing taste and flavor, and some of them might also play a role as bioactive substances with an impact on human physiology and health. Understanding the genetic and molecular basis of terpene synthases (TPS) involved in the biosynthesis of volatile terpenoids will provide insights for improving breeding strategies aimed at quality traits and for developing specific carrot chemotypes possibly useful for pharmaceutical applications. Hence, a combination of terpene metabolite profiling, genotyping-by-sequencing (GBS), and genome-wide association study (GWAS) was used in this work to get insights into the genetic control of terpene biosynthesis in carrots and to identify several TPS candidate genes that might be involved in the production of specific monoterpenes. In a panel of 85 carrot cultivars and accessions, metabolite profiling was used to identify 31 terpenoid volatile organic compounds (VOCs) in carrot leaves and roots, and a GBS approach was used to provide dense genome-wide marker coverage (>168,000 SNPs). Based on this data, a total of 30 quantitative trait loci (QTLs) was identified for 15 terpenoid volatiles. Most QTLs were detected for the monoterpene compounds ocimene, sabinene, β-pinene, borneol and bornyl acetate. We identified four genomic regions on three different carrot chromosomes by GWAS which are both associated with high significance (LOD ≥ 5.91) to distinct monoterpenes and to TPS candidate genes, which have been identified by homology-based gene prediction utilizing RNA-seq data. In total, 65 TPS candidate gene models in carrot were identified and assigned to known plant TPS subfamilies with the exception of TPS-d and TPS-h. TPS-b was identified as largest subfamily with 32 TPS candidate genes. PMID:29170675

Elasmobranch qPCR reference genes: a case study of hypoxia preconditioned epaulette sharks

PubMed Central

2010-01-01

Background Elasmobranch fishes are an ancient group of vertebrates which have high potential as model species for research into evolutionary physiology and genomics. However, no comparative studies have established suitable reference genes for quantitative PCR (qPCR) in elasmobranchs for any physiological conditions. Oxygen availability has been a major force shaping the physiological evolution of vertebrates, especially fishes. Here we examined the suitability of 9 reference candidates from various functional categories after a single hypoxic insult or after hypoxia preconditioning in epaulette shark (Hemiscyllium ocellatum). Results Epaulette sharks were caught and exposed to hypoxia. Tissues were collected from 10 controls, 10 individuals with single hypoxic insult and 10 individuals with hypoxia preconditioning (8 hypoxic insults, 12 hours apart). We produced sequence information for reference gene candidates and monitored mRNA expression levels in four tissues: cerebellum, heart, gill and eye. The stability of the genes was examined with analysis of variance, geNorm and NormFinder. The best ranking genes in our study were eukaryotic translation elongation factor 1 beta (eef1b), ubiquitin (ubq) and polymerase (RNA) II (DNA directed) polypeptide F (polr2f). The performance of the ribosomal protein L6 (rpl6) was tissue-dependent. Notably, in one tissue the analysis of variance indicated statistically significant differences between treatments for genes that were ranked as the most stable candidates by reference gene software. Conclusions Our results indicate that eef1b and ubq are generally the most suitable reference genes for the conditions and tissues in the present epaulette shark studies. These genes could also be potential reference gene candidates for other physiological studies examining stress in elasmobranchs. The results emphasise the importance of inter-group variation in reference gene evaluation. PMID:20416043

Whole genome sequences of Japanese porcine species C rotaviruses reveal a high diversity of genotypes of individual genes and will contribute to a comprehensive, generally accepted classification system.

PubMed

Niira, Kazutaka; Ito, Mika; Masuda, Tsuneyuki; Saitou, Toshiya; Abe, Tadatsugu; Komoto, Satoshi; Sato, Mitsuo; Yamasato, Hiroshi; Kishimoto, Mai; Naoi, Yuki; Sano, Kaori; Tuchiaka, Shinobu; Okada, Takashi; Omatsu, Tsutomu; Furuya, Tetsuya; Aoki, Hiroshi; Katayama, Yukie; Oba, Mami; Shirai, Junsuke; Taniguchi, Koki; Mizutani, Tetsuya; Nagai, Makoto

2016-10-01

Porcine rotavirus C (RVC) is distributed throughout the world and is thought to be a pathogenic agent of diarrhea in piglets. Although, the VP7, VP4, and VP6 gene sequences of Japanese porcine RVCs are currently available, there is no whole-genome sequence data of Japanese RVC. Furthermore, only one to three sequences are available for porcine RVC VP1-VP3 and NSP1-NSP3 genes. Therefore, we determined nearly full-length whole-genome sequences of nine Japanese porcine RVCs from seven piglets with diarrhea and two healthy pigs and compared them with published RVC sequences from a database. The VP7 genes of two Japanese RVCs from healthy pigs were highly divergent from other known RVC strains and were provisionally classified as G12 and G13 based on the 86% nucleotide identity cut-off value. Pairwise sequence identity calculations and phylogenetic analyses revealed that candidate novel genotypes of porcine Japanese RVC were identified in the NSP1, NSP2 and NSP3 encoding genes, respectively. Furthermore, VP3 of Japanese porcine RVCs was shown to be closely related to human RVCs, suggesting a gene reassortment event between porcine and human RVCs and past interspecies transmission. The present study demonstrated that porcine RVCs show greater genetic diversity among strains than human and bovine RVCs. Copyright © 2016 Elsevier B.V. All rights reserved.

Identification of Abundantly Expressed Novel and Conserved Genes from the Infective Larval Stage of Toxocara canis by an Expressed Sequence Tag Strategy

PubMed Central

Tetteh, Kevin K. A.; Loukas, Alex; Tripp, Cindy; Maizels, Rick M.

1999-01-01

Larvae of Toxocara canis, a nematode parasite of dogs, infect humans, causing visceral and ocular larva migrans. In noncanid hosts, larvae neither grow nor differentiate but endure in a state of arrested development. Reasoning that parasite protein production is orientated to immune evasion, we undertook a random sequencing project from a larval cDNA library to characterize the most highly expressed transcripts. In all, 266 clones were sequenced, most from both 3′ and 5′ ends, and similarity searches against GenBank protein and dbEST nucleotide databases were conducted. Cluster analyses showed that 128 distinct gene products had been found, all but 3 of which represented newly identified genes. Ninety-five genes were represented by a single clone, but seven transcripts were present at high frequencies, each composing >2% of all clones sequenced. These high-abundance transcripts include a mucin and a C-type lectin, which are both major excretory-secretory antigens released by parasites. Four highly expressed novel gene transcripts, termed ant (abundant novel transcript) genes, were found. Together, these four genes comprised 18% of all cDNA clones isolated, but no similar sequences occur in the Caenorhabditis elegans genome. While the coding regions of the four genes are dissimilar, their 3′ untranslated tracts have significant homology in nucleotide sequence. The discovery of these abundant, parasite-specific genes of newly identified lectins and mucins, as well as a range of conserved and novel proteins, provides defined candidates for future analysis of the molecular basis of immune evasion by T. canis. PMID:10456930

Identification of Alternative Splicing and Fusion Transcripts in Non-Small Cell Lung Cancer by RNA Sequencing.

PubMed

Hong, Yoonki; Kim, Woo Jin; Bang, Chi Young; Lee, Jae Cheol; Oh, Yeon-Mok

2016-04-01

Lung cancer is the most common cause of cancer related death. Alterations in gene sequence, structure, and expression have an important role in the pathogenesis of lung cancer. Fusion genes and alternative splicing of cancer-related genes have the potential to be oncogenic. In the current study, we performed RNA-sequencing (RNA-seq) to investigate potential fusion genes and alternative splicing in non-small cell lung cancer. RNA was isolated from lung tissues obtained from 86 subjects with lung cancer. The RNA samples from lung cancer and normal tissues were processed with RNA-seq using the HiSeq 2000 system. Fusion genes were evaluated using Defuse and ChimeraScan. Candidate fusion transcripts were validated by Sanger sequencing. Alternative splicing was analyzed using multivariate analysis of transcript sequencing and validated using quantitative real time polymerase chain reaction. RNA-seq data identified oncogenic fusion genes EML4-ALK and SLC34A2-ROS1 in three of 86 normal-cancer paired samples. Nine distinct fusion transcripts were selected using DeFuse and ChimeraScan; of which, four fusion transcripts were validated by Sanger sequencing. In 33 squamous cell carcinoma, 29 tumor specific skipped exon events and six mutually exclusive exon events were identified. ITGB4 and PYCR1 were top genes that showed significant tumor specific splice variants. In conclusion, RNA-seq data identified novel potential fusion transcripts and splice variants. Further evaluation of their functional significance in the pathogenesis of lung cancer is required.

Exploiting proteomic data for genome annotation and gene model validation in Aspergillus niger.

PubMed

Wright, James C; Sugden, Deana; Francis-McIntyre, Sue; Riba-Garcia, Isabel; Gaskell, Simon J; Grigoriev, Igor V; Baker, Scott E; Beynon, Robert J; Hubbard, Simon J

2009-02-04

Proteomic data is a potentially rich, but arguably unexploited, data source for genome annotation. Peptide identifications from tandem mass spectrometry provide prima facie evidence for gene predictions and can discriminate over a set of candidate gene models. Here we apply this to the recently sequenced Aspergillus niger fungal genome from the Joint Genome Institutes (JGI) and another predicted protein set from another A.niger sequence. Tandem mass spectra (MS/MS) were acquired from 1d gel electrophoresis bands and searched against all available gene models using Average Peptide Scoring (APS) and reverse database searching to produce confident identifications at an acceptable false discovery rate (FDR). 405 identified peptide sequences were mapped to 214 different A.niger genomic loci to which 4093 predicted gene models clustered, 2872 of which contained the mapped peptides. Interestingly, 13 (6%) of these loci either had no preferred predicted gene model or the genome annotators' chosen "best" model for that genomic locus was not found to be the most parsimonious match to the identified peptides. The peptides identified also boosted confidence in predicted gene structures spanning 54 introns from different gene models. This work highlights the potential of integrating experimental proteomics data into genomic annotation pipelines much as expressed sequence tag (EST) data has been. A comparison of the published genome from another strain of A.niger sequenced by DSM showed that a number of the gene models or proteins with proteomics evidence did not occur in both genomes, further highlighting the utility of the method.

An Expressed Sequence Tag collection from the male antennae of the Noctuid moth Spodoptera littoralis: a resource for olfactory and pheromone detection research

PubMed Central

2011-01-01

Background Nocturnal insects such as moths are ideal models to study the molecular bases of olfaction that they use, among examples, for the detection of mating partners and host plants. Knowing how an odour generates a neuronal signal in insect antennae is crucial for understanding the physiological bases of olfaction, and also could lead to the identification of original targets for the development of olfactory-based control strategies against herbivorous moth pests. Here, we describe an Expressed Sequence Tag (EST) project to characterize the antennal transcriptome of the noctuid pest model, Spodoptera littoralis, and to identify candidate genes involved in odour/pheromone detection. Results By targeting cDNAs from male antennae, we biased gene discovery towards genes potentially involved in male olfaction, including pheromone reception. A total of 20760 ESTs were obtained from a normalized library and were assembled in 9033 unigenes. 6530 were annotated based on BLAST analyses and gene prediction software identified 6738 ORFs. The unigenes were compared to the Bombyx mori proteome and to ESTs derived from Lepidoptera transcriptome projects. We identified a large number of candidate genes involved in odour and pheromone detection and turnover, including 31 candidate chemosensory receptor genes, but also genes potentially involved in olfactory modulation. Conclusions Our project has generated a large collection of antennal transcripts from a Lepidoptera. The normalization process, allowing enrichment in low abundant genes, proved to be particularly relevant to identify chemosensory receptors in a species for which no genomic data are available. Our results also suggest that olfactory modulation can take place at the level of the antennae itself. These EST resources will be invaluable for exploring the mechanisms of olfaction and pheromone detection in S. littoralis, and for ultimately identifying original targets to fight against moth herbivorous pests. PMID:21276261

Genetics of primary ovarian insufficiency: new developments and opportunities

PubMed Central

Qin, Yingying; Jiao, Xue; Simpson, Joe Leigh; Chen, Zi-Jiang

2015-01-01

BACKGROUND Primary ovarian insufficiency (POI) is characterized by marked heterogeneity, but with a significant genetic contribution. Identifying exact causative genes has been challenging, with many discoveries not replicated. It is timely to take stock of the field, outlining the progress made, framing the controversies and anticipating future directions in elucidating the genetics of POI. METHODS A search for original articles published up to May 2015 was performed using PubMed and Google Scholar, identifying studies on the genetic etiology of POI. Studies were included if chromosomal analysis, candidate gene screening and a genome-wide study were conducted. Articles identified were restricted to English language full-text papers. RESULTS Chromosomal abnormalities have long been recognized as a frequent cause of POI, with a currently estimated prevalence of 10–13%. Using the traditional karyotype methodology, monosomy X, mosaicism, X chromosome deletions and rearrangements, X-autosome translocations, and isochromosomes have been detected. Based on candidate gene studies, single gene perturbations unequivocally having a deleterious effect in at least one population include Bone morphogenetic protein 15 (BMP15), Progesterone receptor membrane component 1 (PGRMC1), and Fragile X mental retardation 1 (FMR1) premutation on the X chromosome; Growth differentiation factor 9 (GDF9), Folliculogenesis specific bHLH transcription factor (FIGLA), Newborn ovary homeobox gene (NOBOX), Nuclear receptor subfamily 5, group A, member 1 (NR5A1) and Nanos homolog 3 (NANOS3) seem likely as well, but mostly being found in no more than 1–2% of a single population studied. Whole genome approaches have utilized genome-wide association studies (GWAS) to reveal loci not predicted on the basis of a candidate gene, but it remains difficult to locate causative genes and susceptible loci were not always replicated. Cytogenomic methods (array CGH) have identified other regions of interest but studies have not shown consistent results, the resolution of arrays has varied and replication is uncommon. Whole-exome sequencing in non-syndromic POI kindreds has only recently begun, revealing mutations in the Stromal antigen 3 (STAG3), Synaptonemal complex central element 1 (SYCE1), minichromosome maintenance complex component 8 and 9 (MCM8, MCM9) and ATP-dependent DNA helicase homolog (HFM1) genes. Given the slow progress in candidate-gene analysis and relatively small sample sizes available for GWAS, family-based whole exome and whole genome sequencing appear to be the most promising approaches for detecting potential genes responsible for POI. CONCLUSION Taken together, the cytogenetic, cytogenomic (array CGH) and exome sequencing approaches have revealed a genetic causation in ∼20–25% of POI cases. Uncovering the remainder of the causative genes will be facilitated not only by whole genome approaches involving larger cohorts in multiple populations but also incorporating environmental exposures and exploring signaling pathways in intragenic and intergenic regions that point to perturbations in regulatory genes and networks. PMID:26243799

Genetics of primary ovarian insufficiency: new developments and opportunities.

PubMed

Qin, Yingying; Jiao, Xue; Simpson, Joe Leigh; Chen, Zi-Jiang

2015-01-01

Primary ovarian insufficiency (POI) is characterized by marked heterogeneity, but with a significant genetic contribution. Identifying exact causative genes has been challenging, with many discoveries not replicated. It is timely to take stock of the field, outlining the progress made, framing the controversies and anticipating future directions in elucidating the genetics of POI. A search for original articles published up to May 2015 was performed using PubMed and Google Scholar, identifying studies on the genetic etiology of POI. Studies were included if chromosomal analysis, candidate gene screening and a genome-wide study were conducted. Articles identified were restricted to English language full-text papers. Chromosomal abnormalities have long been recognized as a frequent cause of POI, with a currently estimated prevalence of 10-13%. Using the traditional karyotype methodology, monosomy X, mosaicism, X chromosome deletions and rearrangements, X-autosome translocations, and isochromosomes have been detected. Based on candidate gene studies, single gene perturbations unequivocally having a deleterious effect in at least one population include Bone morphogenetic protein 15 (BMP15), Progesterone receptor membrane component 1 (PGRMC1), and Fragile X mental retardation 1 (FMR1) premutation on the X chromosome; Growth differentiation factor 9 (GDF9), Folliculogenesis specific bHLH transcription factor (FIGLA), Newborn ovary homeobox gene (NOBOX), Nuclear receptor subfamily 5, group A, member 1 (NR5A1) and Nanos homolog 3 (NANOS3) seem likely as well, but mostly being found in no more than 1-2% of a single population studied. Whole genome approaches have utilized genome-wide association studies (GWAS) to reveal loci not predicted on the basis of a candidate gene, but it remains difficult to locate causative genes and susceptible loci were not always replicated. Cytogenomic methods (array CGH) have identified other regions of interest but studies have not shown consistent results, the resolution of arrays has varied and replication is uncommon. Whole-exome sequencing in non-syndromic POI kindreds has only recently begun, revealing mutations in the Stromal antigen 3 (STAG3), Synaptonemal complex central element 1 (SYCE1), minichromosome maintenance complex component 8 and 9 (MCM8, MCM9) and ATP-dependent DNA helicase homolog (HFM1) genes. Given the slow progress in candidate-gene analysis and relatively small sample sizes available for GWAS, family-based whole exome and whole genome sequencing appear to be the most promising approaches for detecting potential genes responsible for POI. Taken together, the cytogenetic, cytogenomic (array CGH) and exome sequencing approaches have revealed a genetic causation in ∼20-25% of POI cases. Uncovering the remainder of the causative genes will be facilitated not only by whole genome approaches involving larger cohorts in multiple populations but also incorporating environmental exposures and exploring signaling pathways in intragenic and intergenic regions that point to perturbations in regulatory genes and networks. © The Author 2015. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology.

Infantile spasms with periventricular nodular heterotopia, unbalanced chromosomal translocation 3p26.2 -10p15.1 and 6q22.31 duplication.

PubMed

Jones, Kevin; Weiss, Shelly K; Minassian, Berge

2016-07-01

Patients presenting with infantile spasms, dysmorphic features, and periventricular nodular heterotopia may benefit from genetic copy number variation microarray, or whole-exome sequencing to identify candidate genes. This will allow personalized diagnosis and prognostication and the eventual understanding of single and combined gene functions in brain health and disease.

Genetics of intellectual disability in consanguineous families.

PubMed

Hu, Hao; Kahrizi, Kimia; Musante, Luciana; Fattahi, Zohreh; Herwig, Ralf; Hosseini, Masoumeh; Oppitz, Cornelia; Abedini, Seyedeh Sedigheh; Suckow, Vanessa; Larti, Farzaneh; Beheshtian, Maryam; Lipkowitz, Bettina; Akhtarkhavari, Tara; Mehvari, Sepideh; Otto, Sabine; Mohseni, Marzieh; Arzhangi, Sanaz; Jamali, Payman; Mojahedi, Faezeh; Taghdiri, Maryam; Papari, Elaheh; Soltani Banavandi, Mohammad Javad; Akbari, Saeide; Tonekaboni, Seyed Hassan; Dehghani, Hossein; Ebrahimpour, Mohammad Reza; Bader, Ingrid; Davarnia, Behzad; Cohen, Monika; Khodaei, Hossein; Albrecht, Beate; Azimi, Sarah; Zirn, Birgit; Bastami, Milad; Wieczorek, Dagmar; Bahrami, Gholamreza; Keleman, Krystyna; Vahid, Leila Nouri; Tzschach, Andreas; Gärtner, Jutta; Gillessen-Kaesbach, Gabriele; Varaghchi, Jamileh Rezazadeh; Timmermann, Bernd; Pourfatemi, Fatemeh; Jankhah, Aria; Chen, Wei; Nikuei, Pooneh; Kalscheuer, Vera M; Oladnabi, Morteza; Wienker, Thomas F; Ropers, Hans-Hilger; Najmabadi, Hossein

2018-01-04

Autosomal recessive (AR) gene defects are the leading genetic cause of intellectual disability (ID) in countries with frequent parental consanguinity, which account for about 1/7th of the world population. Yet, compared to autosomal dominant de novo mutations, which are the predominant cause of ID in Western countries, the identification of AR-ID genes has lagged behind. Here, we report on whole exome and whole genome sequencing in 404 consanguineous predominantly Iranian families with two or more affected offspring. In 219 of these, we found likely causative variants, involving 77 known and 77 novel AR-ID (candidate) genes, 21 X-linked genes, as well as 9 genes previously implicated in diseases other than ID. This study, the largest of its kind published to date, illustrates that high-throughput DNA sequencing in consanguineous families is a superior strategy for elucidating the thousands of hitherto unknown gene defects underlying AR-ID, and it sheds light on their prevalence.

In silico identification and analysis of phytoene synthase genes in plants.

PubMed

Han, Y; Zheng, Q S; Wei, Y P; Chen, J; Liu, R; Wan, H J

2015-08-14

In this study, we examined phytoene synthetase (PSY), the first key limiting enzyme in the synthesis of carotenoids and catalyzing the formation of geranylgeranyl pyrophosphate in terpenoid biosynthesis. We used known amino acid sequences of the PSY gene in tomato plants to conduct a genome-wide search and identify putative candidates in 34 sequenced plants. A total of 101 homologous genes were identified. Phylogenetic analysis revealed that PSY evolved independently in algae as well as monocotyledonous and dicotyledonous plants. Our results showed that the amino acid structures exhibited 5 motifs (motifs 1 to 5) in algae and those in higher plants were highly conserved. The PSY gene structures showed that the number of intron in algae varied widely, while the number of introns in higher plants was 4 to 5. Identification of PSY genes in plants and the analysis of the gene structure may provide a theoretical basis for studying evolutionary relationships in future analyses.

Characterization of the 3p12.3-pcen region associated with tumor suppression in a novel ovarian cancer cell line model genetically modified by chromosome 3 fragment transfer.

PubMed

Cody, Neal A L; Shen, Zhen; Ripeau, Jean-Sebastien; Provencher, Diane M; Mes-Masson, Anne-Marie; Chevrette, Mario; Tonin, Patricia N

2009-12-01

The genetic analysis of nontumorigenic radiation hybrids generated by transfer of chromosome 3 fragments into the tumorigenic OV-90 ovarian cancer cell line identified the 3p12.3-pcen region as a candidate tumor suppressor gene (TSG) locus. In the present study, polymorphic microsatellite repeat analysis of the hybrids further defined the 3p12.3-pcen interval to a 16.1 Mb common region containing 12 known or hypothetical genes: 3ptel-ROBO2-ROBO1-GBE1-CADM2-VGLL3-CHMP2B-POU1F1-HTR1F-CGGBP1-ZNF654-C3orf38-EPHA3-3pcen. Seven of these genes, ROBO1, GBE1, VGLL3, CHMP2B, CGGBP1, ZNF654, and C3orf38, exhibited gene expression in the hybrids, placing them as top TSG candidates for further analysis. The expression of all but one (VGLL3) of these genes was also detected in the parental OV-90 cell line. Mutations were not identified in a comparative sequence analysis of the predicted protein coding regions of these candidates in OV-90 and donor normal chromosome 3 contig. However, the nondeleterious sequence variants identified in the transcribed regions distinguished parent of origin alleles for ROBO1, VGLL3, CHMP2B, and CGGBP1 and cDNA sequencing of the hybrids revealed biallelic expression of these genes. Interestingly, underexpression of VGLL3 and ZNF654 were observed in malignant ovarian tumor samples as compared with primary cultures of normal ovarian surface epithelial cells or benign ovarian tumors, and this occurred regardless of allelic content of 3p12.3-pcen. The results taken together suggest that dysregulation of VGLL3 and/or ZNF654 expression may have affected pathways important in ovarian tumorigenesis which was offset by the transfer of chromosome 3 fragments in OV-90, a cell line hemizygous for 3p.

Spontaneous preterm birth and single nucleotide gene polymorphisms: a recent update.

PubMed

Sheikh, Ishfaq A; Ahmad, Ejaz; Jamal, Mohammad S; Rehan, Mohd; Assidi, Mourad; Tayubi, Iftikhar A; AlBasri, Samera F; Bajouh, Osama S; Turki, Rola F; Abuzenadah, Adel M; Damanhouri, Ghazi A; Beg, Mohd A; Al-Qahtani, Mohammed

2016-10-17

Preterm birth (PTB), birth at <37 weeks of gestation, is a significant global public health problem. World-wide, about 15 million babies are born preterm each year resulting in more than a million deaths of children. Preterm neonates are more prone to problems and need intensive care hospitalization. Health issues may persist through early adulthood and even be carried on to the next generation. Majority (70 %) of PTBs are spontaneous with about a half without any apparent cause and the other half associated with a number of risk factors. Genetic factors are one of the significant risks for PTB. The focus of this review is on single nucleotide gene polymorphisms (SNPs) that are reported to be associated with PTB. A comprehensive evaluation of studies on SNPs known to confer potential risk of PTB was done by performing a targeted PubMed search for the years 2007-2015 and systematically reviewing all relevant studies. Evaluation of 92 studies identified 119 candidate genes with SNPs that had potential association with PTB. The genes were associated with functions of a wide spectrum of tissue and cell types such as endocrine, tissue remodeling, vascular, metabolic, and immune and inflammatory systems. A number of potential functional candidate gene variants have been reported that predispose women for PTB. Understanding the complex genomic landscape of PTB needs high-throughput genome sequencing methods such as whole-exome sequencing and whole-genome sequencing approaches that will significantly enhance the understanding of PTB. Identification of high risk women, avoidance of possible risk factors, and provision of personalized health care are important to manage PTB.

Exome sequencing links corticospinal motor neuron disease to common neurodegenerative disorders.

PubMed

Novarino, Gaia; Fenstermaker, Ali G; Zaki, Maha S; Hofree, Matan; Silhavy, Jennifer L; Heiberg, Andrew D; Abdellateef, Mostafa; Rosti, Basak; Scott, Eric; Mansour, Lobna; Masri, Amira; Kayserili, Hulya; Al-Aama, Jumana Y; Abdel-Salam, Ghada M H; Karminejad, Ariana; Kara, Majdi; Kara, Bulent; Bozorgmehri, Bita; Ben-Omran, Tawfeg; Mojahedi, Faezeh; El Din Mahmoud, Iman Gamal; Bouslam, Naima; Bouhouche, Ahmed; Benomar, Ali; Hanein, Sylvain; Raymond, Laure; Forlani, Sylvie; Mascaro, Massimo; Selim, Laila; Shehata, Nabil; Al-Allawi, Nasir; Bindu, P S; Azam, Matloob; Gunel, Murat; Caglayan, Ahmet; Bilguvar, Kaya; Tolun, Aslihan; Issa, Mahmoud Y; Schroth, Jana; Spencer, Emily G; Rosti, Rasim O; Akizu, Naiara; Vaux, Keith K; Johansen, Anide; Koh, Alice A; Megahed, Hisham; Durr, Alexandra; Brice, Alexis; Stevanin, Giovanni; Gabriel, Stacy B; Ideker, Trey; Gleeson, Joseph G

2014-01-31

Hereditary spastic paraplegias (HSPs) are neurodegenerative motor neuron diseases characterized by progressive age-dependent loss of corticospinal motor tract function. Although the genetic basis is partly understood, only a fraction of cases can receive a genetic diagnosis, and a global view of HSP is lacking. By using whole-exome sequencing in combination with network analysis, we identified 18 previously unknown putative HSP genes and validated nearly all of these genes functionally or genetically. The pathways highlighted by these mutations link HSP to cellular transport, nucleotide metabolism, and synapse and axon development. Network analysis revealed a host of further candidate genes, of which three were mutated in our cohort. Our analysis links HSP to other neurodegenerative disorders and can facilitate gene discovery and mechanistic understanding of disease.

Metagenomic discovery of biomass-degrading genes and genomes from cow rumen.

PubMed

Hess, Matthias; Sczyrba, Alexander; Egan, Rob; Kim, Tae-Wan; Chokhawala, Harshal; Schroth, Gary; Luo, Shujun; Clark, Douglas S; Chen, Feng; Zhang, Tao; Mackie, Roderick I; Pennacchio, Len A; Tringe, Susannah G; Visel, Axel; Woyke, Tanja; Wang, Zhong; Rubin, Edward M

2011-01-28

The paucity of enzymes that efficiently deconstruct plant polysaccharides represents a major bottleneck for industrial-scale conversion of cellulosic biomass into biofuels. Cow rumen microbes specialize in degradation of cellulosic plant material, but most members of this complex community resist cultivation. To characterize biomass-degrading genes and genomes, we sequenced and analyzed 268 gigabases of metagenomic DNA from microbes adherent to plant fiber incubated in cow rumen. From these data, we identified 27,755 putative carbohydrate-active genes and expressed 90 candidate proteins, of which 57% were enzymatically active against cellulosic substrates. We also assembled 15 uncultured microbial genomes, which were validated by complementary methods including single-cell genome sequencing. These data sets provide a substantially expanded catalog of genes and genomes participating in the deconstruction of cellulosic biomass.

Deep sequencing of the Camellia sinensis transcriptome revealed candidate genes for major metabolic pathways of tea-specific compounds

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shi, CY; Yang, H; Wei, CL

Tea is one of the most popular non-alcoholic beverages worldwide. However, the tea plant, Camellia sinensis, is difficult to culture in vitro, to transform, and has a large genome, rendering little genomic information available. Recent advances in large-scale RNA sequencing (RNA-seq) provide a fast, cost-effective, and reliable approach to generate large expression datasets for functional genomic analysis, which is especially suitable for non-model species with un-sequenced genomes. Using high-throughput Illumina RNA-seq, the transcriptome from poly (A){sup +} RNA of C. sinensis was analyzed at an unprecedented depth (2.59 gigabase pairs). Approximate 34.5 million reads were obtained, trimmed, and assembled intomore » 127,094 unigenes, with an average length of 355 bp and an N50 of 506 bp, which consisted of 788 contig clusters and 126,306 singletons. This number of unigenes was 10-fold higher than existing C. sinensis sequences deposited in GenBank (as of August 2010). Sequence similarity analyses against six public databases (Uniprot, NR and COGs at NCBI, Pfam, InterPro and KEGG) found 55,088 unigenes that could be annotated with gene descriptions, conserved protein domains, or gene ontology terms. Some of the unigenes were assigned to putative metabolic pathways. Targeted searches using these annotations identified the majority of genes associated with several primary metabolic pathways and natural product pathways that are important to tea quality, such as flavonoid, theanine and caffeine biosynthesis pathways. Novel candidate genes of these secondary pathways were discovered. Comparisons with four previously prepared cDNA libraries revealed that this transcriptome dataset has both a high degree of consistency with previous EST data and an approximate 20 times increase in coverage. Thirteen unigenes related to theanine and flavonoid synthesis were validated. Their expression patterns in different organs of the tea plant were analyzed by RT-PCR and quantitative real time PCR (qRT-PCR). An extensive transcriptome dataset has been obtained from the deep sequencing of tea plant. The coverage of the transcriptome is comprehensive enough to discover all known genes of several major metabolic pathways. This transcriptome dataset can serve as an important public information platform for gene expression, genomics, and functional genomic studies in C. sinensis.« less

Deep sequencing of the Camellia sinensis transcriptome revealed candidate genes for major metabolic pathways of tea-specific compounds

PubMed Central

2011-01-01

Background Tea is one of the most popular non-alcoholic beverages worldwide. However, the tea plant, Camellia sinensis, is difficult to culture in vitro, to transform, and has a large genome, rendering little genomic information available. Recent advances in large-scale RNA sequencing (RNA-seq) provide a fast, cost-effective, and reliable approach to generate large expression datasets for functional genomic analysis, which is especially suitable for non-model species with un-sequenced genomes. Results Using high-throughput Illumina RNA-seq, the transcriptome from poly (A)+ RNA of C. sinensis was analyzed at an unprecedented depth (2.59 gigabase pairs). Approximate 34.5 million reads were obtained, trimmed, and assembled into 127,094 unigenes, with an average length of 355 bp and an N50 of 506 bp, which consisted of 788 contig clusters and 126,306 singletons. This number of unigenes was 10-fold higher than existing C. sinensis sequences deposited in GenBank (as of August 2010). Sequence similarity analyses against six public databases (Uniprot, NR and COGs at NCBI, Pfam, InterPro and KEGG) found 55,088 unigenes that could be annotated with gene descriptions, conserved protein domains, or gene ontology terms. Some of the unigenes were assigned to putative metabolic pathways. Targeted searches using these annotations identified the majority of genes associated with several primary metabolic pathways and natural product pathways that are important to tea quality, such as flavonoid, theanine and caffeine biosynthesis pathways. Novel candidate genes of these secondary pathways were discovered. Comparisons with four previously prepared cDNA libraries revealed that this transcriptome dataset has both a high degree of consistency with previous EST data and an approximate 20 times increase in coverage. Thirteen unigenes related to theanine and flavonoid synthesis were validated. Their expression patterns in different organs of the tea plant were analyzed by RT-PCR and quantitative real time PCR (qRT-PCR). Conclusions An extensive transcriptome dataset has been obtained from the deep sequencing of tea plant. The coverage of the transcriptome is comprehensive enough to discover all known genes of several major metabolic pathways. This transcriptome dataset can serve as an important public information platform for gene expression, genomics, and functional genomic studies in C. sinensis. PMID:21356090

Whole-exome sequencing identifies novel candidate predisposition genes for familial polycythemia vera.

PubMed

Hirvonen, Elina A M; Pitkänen, Esa; Hemminki, Kari; Aaltonen, Lauri A; Kilpivaara, Outi

2017-04-20

Polycythemia vera (PV), characterized by massive production of erythrocytes, is one of the myeloproliferative neoplasms. Most patients carry a somatic gain-of-function mutation in JAK2, c.1849G > T (p.Val617Phe), leading to constitutive activation of JAK-STAT signaling pathway. Familial clustering is also observed occasionally, but high-penetrance predisposition genes to PV have remained unidentified. We studied the predisposition to PV by exome sequencing (three cases) in a Finnish PV family with four patients. The 12 shared variants (maximum allowed minor allele frequency <0.001 in Finnish population in ExAC database) predicted damaging in silico and absent in an additional control set of over 500 Finns were further validated by Sanger sequencing in a fourth affected family member. Three novel predisposition candidate variants were identified: c.1254C > G (p.Phe418Leu) in ZXDC, c.1931C > G (p.Pro644Arg) in ATN1, and c.701G > A (p.Arg234Gln) in LRRC3. We also observed a rare, predicted benign germline variant c.2912C > G (p.Ala971Gly) in BCORL1 in all four patients. Somatic mutations in BCORL1 have been reported in myeloid malignancies. We further screened the variants in eight PV patients in six other Finnish families, but no other carriers were found. Exome sequencing provides a powerful tool for the identification of novel variants, and understanding the familial predisposition of diseases. This is the first report on Finnish familial PV cases, and we identified three novel candidate variants that may predispose to the disease.

RNA-Seq reveals 10 novel promising candidate genes affecting milk protein concentration in the Chinese Holstein population.

PubMed

Li, Cong; Cai, Wentao; Zhou, Chenghao; Yin, Hongwei; Zhang, Ziqi; Loor, Juan J; Sun, Dongxiao; Zhang, Qin; Liu, Jianfeng; Zhang, Shengli

2016-06-02

Paired-end RNA sequencing (RNA-Seq) was used to explore the bovine transcriptome from the mammary tissue of 12 Chinese Holstein cows with 6 extremely high and 6 low phenotypic values for milk protein percentage. We defined the differentially expressed transcripts between the two comparison groups, extremely high and low milk protein percentage during the peak lactation (HP vs LP) and during the non-lactating period (HD vs LD), respectively. Within the differentially expressed genes (DEGs), we detected 157 at peak lactation and 497 in the non-lactating period with a highly significant correlation with milk protein concentration. Integrated interpretation of differential gene expression indicated that SERPINA1, CLU, CNTFR, ERBB2, NEDD4L, ANG, GALE, HSPA8, LPAR6 and CD14 are the most promising candidate genes affecting milk protein concentration. Similarly, LTF, FCGR3A, MEGF10, RRM2 and UBE2C are the most promising candidates that in the non-lactating period could help the mammary tissue prevent issues with inflammation and udder disorders. Putative genes will be valuable resources for designing better breeding strategies to optimize the content of milk protein and also to provide new insights into regulation of lactogenesis.

Effects of DGAT1 gene on meat and carcass fatness quality in Chinese commercial cattle.

PubMed

Yuan, Zhengrong; Li, Junya; Li, Jiao; Gao, Xue; Gao, Huijiang; Xu, Shangzhong

2013-02-01

This study was designed to investigate the candidate single nucleotide polymorphisms (SNPs) in the exon's region of bovine diacylglycerol O-acyltransferase (DGAT1) gene using bioinformatics and experimental methods. A total of 17 SNPs were screened from public data resources and DNA sequencing. Three SNPs (c.572A>G, c.1241C>T and c.1416T>G) of these candidate SNPs were genotyped by created restriction site-polymerase chain reaction (CRS-PCR) methods. The gene-specific SNP markers and their effects on meat and carcass fatness quality traits were evaluated in Chinese commercial cattle. The c.572A>G and c.1416T>G significantly effected on backfat thickness, longissimus muscle area, marbling score, fat color and Warner-Bratzler shear force. No significant association was detected between the c.1241C>T and measured traits. Results from this study suggested that the SNP markers may be effective for the marker-assisted selection of meat and carcass fatness quality traits, and added new evidence that DGAT1 gene is an important candidate gene for the improvement of meat and carcass fatness quality in beef cattle industry.

Differential Gene Expression Reveals Candidate Genes for Drought Stress Response in Abies alba (Pinaceae)

PubMed Central

Ziegenhagen, Birgit; Liepelt, Sascha

2015-01-01

Increasing drought periods as a result of global climate change pose a threat to many tree species by possibly outpacing their adaptive capabilities. Revealing the genetic basis of drought stress response is therefore implemental for future conservation strategies and risk assessment. Access to informative genomic regions is however challenging, especially for conifers, partially due to their large genomes, which puts constraints on the feasibility of whole genome scans. Candidate genes offer a valuable tool to reduce the complexity of the analysis and the amount of sequencing work and costs. For this study we combined an improved drought stress phenotyping of needles via a novel terahertz water monitoring technique with Massive Analysis of cDNA Ends to identify candidate genes for drought stress response in European silver fir (Abies alba Mill.). A pooled cDNA library was constructed from the cotyledons of six drought stressed and six well-watered silver fir seedlings, respectively. Differential expression analyses of these libraries revealed 296 candidate genes for drought stress response in silver fir (247 up- and 49 down-regulated) of which a subset was validated by RT-qPCR of the twelve individual cotyledons. A majority of these genes code for currently uncharacterized proteins and hint on new genomic resources to be explored in conifers. Furthermore, we could show that some traditional reference genes from model plant species (GAPDH and eIF4A2) are not suitable for differential analysis and we propose a new reference gene, TPC1, for drought stress expression profiling in needles of conifer seedlings. PMID:25924061

Candidate innate immune system gene expression in the ecological model Daphnia

PubMed Central

Decaestecker, Ellen; Labbé, Pierrick; Ellegaard, Kirsten; Allen, Judith E.; Little, Tom J.

2011-01-01

The last ten years have witnessed increasing interest in host–pathogen interactions involving invertebrate hosts. The invertebrate innate immune system is now relatively well characterised, but in a limited range of genetic model organisms and under a limited number of conditions. Immune systems have been little studied under real-world scenarios of environmental variation and parasitism. Thus, we have investigated expression of candidate innate immune system genes in the water flea Daphnia, a model organism for ecological genetics, and whose capacity for clonal reproduction facilitates an exceptionally rigorous control of exposure dose or the study of responses at many time points. A unique characteristic of the particular Daphnia clones and pathogen strain combinations used presently is that they have been shown to be involved in specific host–pathogen coevolutionary interactions in the wild. We choose five genes, which are strong candidates to be involved in Daphnia–pathogen interactions, given that they have been shown to code for immune effectors in related organisms. Differential expression of these genes was quantified by qRT-PCR following exposure to the bacterial pathogen Pasteuria ramosa. Constitutive expression levels differed between host genotypes, and some genes appeared to show correlated expression. However, none of the genes appeared to show a major modification of expression level in response to Pasteuria exposure. By applying knowledge from related genetic model organisms (e.g. Drosophila) to models for the study of evolutionary ecology and coevolution (i.e. Daphnia), the candidate gene approach is temptingly efficient. However, our results show that detection of only weak patterns is likely if one chooses target genes for study based on previously identified genome sequences by comparison to homologues from other related organisms. Future work on the Daphnia–Pasteuria system will need to balance a candidate gene approach with more comprehensive approaches to de novo identify immune system genes specific to the Daphnia–Pasteuria interaction. PMID:21550363

Candidate innate immune system gene expression in the ecological model Daphnia.

PubMed

Decaestecker, Ellen; Labbé, Pierrick; Ellegaard, Kirsten; Allen, Judith E; Little, Tom J

2011-10-01

The last ten years have witnessed increasing interest in host-pathogen interactions involving invertebrate hosts. The invertebrate innate immune system is now relatively well characterised, but in a limited range of genetic model organisms and under a limited number of conditions. Immune systems have been little studied under real-world scenarios of environmental variation and parasitism. Thus, we have investigated expression of candidate innate immune system genes in the water flea Daphnia, a model organism for ecological genetics, and whose capacity for clonal reproduction facilitates an exceptionally rigorous control of exposure dose or the study of responses at many time points. A unique characteristic of the particular Daphnia clones and pathogen strain combinations used presently is that they have been shown to be involved in specific host-pathogen coevolutionary interactions in the wild. We choose five genes, which are strong candidates to be involved in Daphnia-pathogen interactions, given that they have been shown to code for immune effectors in related organisms. Differential expression of these genes was quantified by qRT-PCR following exposure to the bacterial pathogen Pasteuria ramosa. Constitutive expression levels differed between host genotypes, and some genes appeared to show correlated expression. However, none of the genes appeared to show a major modification of expression level in response to Pasteuria exposure. By applying knowledge from related genetic model organisms (e.g. Drosophila) to models for the study of evolutionary ecology and coevolution (i.e. Daphnia), the candidate gene approach is temptingly efficient. However, our results show that detection of only weak patterns is likely if one chooses target genes for study based on previously identified genome sequences by comparison to homologues from other related organisms. Future work on the Daphnia-Pasteuria system will need to balance a candidate gene approach with more comprehensive approaches to de novo identify immune system genes specific to the Daphnia-Pasteuria interaction. Copyright © 2011 Elsevier Ltd. All rights reserved.

Retroviral insertions in the VISION database identify molecular pathways in mouse lymphoid leukemia and lymphoma

PubMed Central

Weiser, Keith C.; Liu, Bin; Hansen, Gwenn M.; Skapura, Darlene; Hentges, Kathryn E.; Yarlagadda, Sujatha; Morse III, Herbert C.

2007-01-01

AKXD recombinant inbred (RI) strains develop a variety of leukemias and lymphomas due to somatically acquired insertions of retroviral DNA into the genome of hematopoetic cells that can mutate cellular proto-oncogenes and tumor suppressor genes. We generated a new set of tumors from nine AKXD RI strains selected for their propensity to develop B-cell tumors, the most common type of human hematopoietic cancers. We employed a PCR technique called viral insertion site amplification (VISA) to rapidly isolate genomic sequence at the site of provirus insertion. Here we describe 550 VISA sequence tags (VSTs) that identify 74 common insertion sites (CISs), of which 21 have not been identified previously. Several suspected proto-oncogenes and tumor suppressor genes lie near CISs, providing supportive evidence for their roles in cancer. Furthermore, numerous previously uncharacterized genes lie near CISs, providing a pool of candidate disease genes for future research. Pathway analysis of candidate genes identified several signaling pathways as common and powerful routes to blood cancer, including Notch, E-protein, NFκB, and Ras signaling. Misregulation of several Notch signaling genes was confirmed by quantitative RT-PCR. Our data suggest that analyses of insertional mutagenesis on a single genetic background are biased toward the identification of cooperating mutations. This tumor collection represents the most comprehensive study of the genetics of B-cell leukemia and lymphoma development in mice. We have deposited the VST sequences, CISs in a genome viewer, histopathology, and molecular tumor typing data in a public web database called VISION (Viral Insertion Sites Identifying Oncogenes), which is located at http://www.mouse-genome.bcm.tmc.edu/vision. PMID:17926094

Retroviral insertions in the VISION database identify molecular pathways in mouse lymphoid leukemia and lymphoma.

PubMed

Weiser, Keith C; Liu, Bin; Hansen, Gwenn M; Skapura, Darlene; Hentges, Kathryn E; Yarlagadda, Sujatha; Morse Iii, Herbert C; Justice, Monica J

2007-10-01

AKXD recombinant inbred (RI) strains develop a variety of leukemias and lymphomas due to somatically acquired insertions of retroviral DNA into the genome of hematopoetic cells that can mutate cellular proto-oncogenes and tumor suppressor genes. We generated a new set of tumors from nine AKXD RI strains selected for their propensity to develop B-cell tumors, the most common type of human hematopoietic cancers. We employed a PCR technique called viral insertion site amplification (VISA) to rapidly isolate genomic sequence at the site of provirus insertion. Here we describe 550 VISA sequence tags (VSTs) that identify 74 common insertion sites (CISs), of which 21 have not been identified previously. Several suspected proto-oncogenes and tumor suppressor genes lie near CISs, providing supportive evidence for their roles in cancer. Furthermore, numerous previously uncharacterized genes lie near CISs, providing a pool of candidate disease genes for future research. Pathway analysis of candidate genes identified several signaling pathways as common and powerful routes to blood cancer, including Notch, E-protein, NFkappaB, and Ras signaling. Misregulation of several Notch signaling genes was confirmed by quantitative RT-PCR. Our data suggest that analyses of insertional mutagenesis on a single genetic background are biased toward the identification of cooperating mutations. This tumor collection represents the most comprehensive study of the genetics of B-cell leukemia and lymphoma development in mice. We have deposited the VST sequences, CISs in a genome viewer, histopathology, and molecular tumor typing data in a public web database called VISION (Viral Insertion Sites Identifying Oncogenes), which is located at http://www.mouse-genome.bcm.tmc.edu/vision .

Genome-wide identification of lineage-specific genes in Arabidopsis, Oryza and Populus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, Xiaohan; Jawdy, Sara; Tschaplinski, Timothy J

2009-01-01

Protein sequences were compared among Arabidopsis, Oryza and Populus to identify differential gene (DG) sets that are in one but not the other two genomes. The DG sets were screened against a plant transcript database, the NR protein database and six newly-sequenced genomes (Carica, Glycine, Medicago, Sorghum, Vitis and Zea) to identify a set of species-specific genes (SS). Gene expression, protein motif and intron number were examined. 192, 641 and 109 SS genes were identified in Arabidopsis, Oryza and Populus, respectively. Some SS genes were preferentially expressed in flowers, roots, xylem and cambium or up-regulated by stress. Six conserved motifsmore » in Arabidopsis and Oryza SS proteins were found in other distant lineages. The SS gene sets were enriched with intronless genes. The results reflect functional and/or anatomical differences between monocots and eudicots or between herbaceous and woody plants. The Populus-specific genes are candidates for carbon sequestration and biofuel research.« less

Xenopus as a Model Organism for Birth Defects – Congenital Heart Disease and Heterotaxy

PubMed Central

Duncan, Anna R.; Khokha, Mustafa K.

2016-01-01

Congenital heart disease is the leading cause of birth defects, affecting 9 out of 1000 newborns each year. A particularly severe form of congenital heart disease is heterotaxy, a disorder of left-right development. Despite aggressive surgical management, patients with heterotaxy have poor survival rates and severe morbidity due to their complex congenital heart disease. Recent genetic analysis of affected patients has found novel candidate genes for heterotaxy although their underlying mechanisms remain unknown. In this review, we discuss the importance and challenges of birth defects research including high locus heterogeneity and few second alleles that make defining disease causality difficult. A powerful strategy moving forward is to analyze these candidate genes in a high-throughput human disease model. Xenopus is ideal for these studies. We present multiple examples demonstrating the power of Xenopus in discovery new biology from the analysis of candidate heterotaxy genes such as GALNT11, NEK2 and BCOR. These genes have diverse roles in embryos and have led to a greater understanding of complex signaling pathways and basic developmental biology. It is our hope that the mechanistic analysis of these candidate genes in Xenopus enabled by next generation sequencing of patients will provide clinicians with a greater understanding of patient pathophysiology allowing more precise and personalized medicine, to help them more effectively in the future. PMID:26910255

A role for genetic susceptibility in sporadic focal segmental glomerulosclerosis

PubMed Central

Yu, Haiyang; Artomov, Mykyta; Brähler, Sebastian; Stander, M. Christine; Shamsan, Ghaidan; Sampson, Matthew G.; White, J. Michael; Kretzler, Matthias; Jain, Sanjay; Winkler, Cheryl A.; Mitra, Robi D.; Daly, Mark J.; Shaw, Andrey S.

2016-01-01

Focal segmental glomerulosclerosis (FSGS) is a syndrome that involves kidney podocyte dysfunction and causes chronic kidney disease. Multiple factors including chemical toxicity, inflammation, and infection underlie FSGS; however, highly penetrant disease genes have been identified in a small fraction of patients with a family history of FSGS. Variants of apolipoprotein L1 (APOL1) have been linked to FSGS in African Americans with HIV or hypertension, supporting the proposal that genetic factors enhance FSGS susceptibility. Here, we used sequencing to investigate whether genetics plays a role in the majority of FSGS cases that are identified as primary or sporadic FSGS and have no known cause. Given the limited number of biopsy-proven cases with ethnically matched controls, we devised an analytic strategy to identify and rank potential candidate genes and used an animal model for validation. Nine candidate FSGS susceptibility genes were identified in our patient cohort, and three were validated using a high-throughput mouse method that we developed. Specifically, we introduced a podocyte-specific, doxycycline-inducible transactivator into a murine embryonic stem cell line with an FSGS-susceptible genetic background that allows shRNA-mediated targeting of candidate genes in the adult kidney. Our analysis supports a broader role for genetic susceptibility of both sporadic and familial cases of FSGS and provides a tool to rapidly evaluate candidate FSGS-associated genes. PMID:26901816

Genome analysis of the foxtail millet pathogen Sclerospora graminicola reveals the complex effector repertoire of graminicolous downy mildews.

PubMed

Kobayashi, Michie; Hiraka, Yukie; Abe, Akira; Yaegashi, Hiroki; Natsume, Satoshi; Kikuchi, Hideko; Takagi, Hiroki; Saitoh, Hiromasa; Win, Joe; Kamoun, Sophien; Terauchi, Ryohei

2017-11-22

Downy mildew, caused by the oomycete pathogen Sclerospora graminicola, is an economically important disease of Gramineae crops including foxtail millet (Setaria italica). Plants infected with S. graminicola are generally stunted and often undergo a transformation of flower organs into leaves (phyllody or witches' broom), resulting in serious yield loss. To establish the molecular basis of downy mildew disease in foxtail millet, we carried out whole-genome sequencing and an RNA-seq analysis of S. graminicola. Sequence reads were generated from S. graminicola using an Illumina sequencing platform and assembled de novo into a draft genome sequence comprising approximately 360 Mbp. Of this sequence, 73% comprised repetitive elements, and a total of 16,736 genes were predicted from the RNA-seq data. The predicted genes included those encoding effector-like proteins with high sequence similarity to those previously identified in other oomycete pathogens. Genes encoding jacalin-like lectin-domain-containing secreted proteins were enriched in S. graminicola compared to other oomycetes. Of a total of 1220 genes encoding putative secreted proteins, 91 significantly changed their expression levels during the infection of plant tissues compared to the sporangia and zoospore stages of the S. graminicola lifecycle. We established the draft genome sequence of a downy mildew pathogen that infects Gramineae plants. Based on this sequence and our transcriptome analysis, we generated a catalog of in planta-induced candidate effector genes, providing a solid foundation from which to identify the effectors causing phyllody.

A method for the further assembly of targeted unigenes in a transcriptome after assembly by Trinity

PubMed Central

Xiao, Xinlong; Ma, Jinbiao; Sun, Yufang; Yao, Yinan

2015-01-01

RNA-sequencing has been widely used to obtain high throughput transcriptome sequences in various species, but the assembly of a full set of complete transcripts is still a significant challenge. Judging by the number of expected transcripts and assembled unigenes in a transcriptome library, we believe that some unigenes could be reassembled. In this study, using the nitrate transporter (NRT) gene family and phosphate transporter (PHT) gene family in Salicornia europaea as examples, we introduced an approach to further assemble unigenes found in transcriptome libraries which had been previously generated by Trinity. To find the unigenes of a particular transcript that contained gaps, we respectively selected 16 NRT candidate unigene pairs and 12 PHT candidate unigene pairs for which the two unigenes had the same annotations, the same expression patterns among various RNA-seq samples, and different positions of the proteins coded as mapped to a reference protein. To fill a gap between the two unigenes, PCR was performed using primers that mapped to the two unigenes and the PCR products were sequenced, which demonstrated that 5 unigene pairs of NRT and 3 unigene pairs of PHT could be reassembled when the gaps were filled using the corresponding PCR product sequences. This fast and simple method will reduce the redundancy of targeted unigenes and allow acquisition of complete coding sequences (CDS). PMID:26528307

Fine mapping of RYMV3: a new resistance gene to Rice yellow mottle virus from Oryza glaberrima.

PubMed

Pidon, Hélène; Ghesquière, Alain; Chéron, Sophie; Issaka, Souley; Hébrard, Eugénie; Sabot, François; Kolade, Olufisayo; Silué, Drissa; Albar, Laurence

2017-04-01

A new resistance gene against Rice yellow mottle virus was identified and mapped in a 15-kb interval. The best candidate is a CC-NBS-LRR gene. Rice yellow mottle virus (RYMV) disease is a serious constraint to the cultivation of rice in Africa and selection for resistance is considered to be the most effective management strategy. The aim of this study was to characterize the resistance of Tog5307, a highly resistant accession belonging to the African cultivated rice species (Oryza glaberrima), that has none of the previously identified resistance genes to RYMV. The specificity of Tog5307 resistance was analyzed using 18 RYMV isolates. While three of them were able to infect Tog5307 very rapidly, resistance against the others was effective despite infection events attributed to resistance-breakdown or incomplete penetrance of the resistance. Segregation of resistance in an interspecific backcross population derived from a cross between Tog5307 and the susceptible Oryza sativa variety IR64 showed that resistance is dominant and is controlled by a single gene, named RYMV3. RYMV3 was mapped in an approximately 15-kb interval in which two candidate genes, coding for a putative transmembrane protein and a CC-NBS-LRR domain-containing protein, were annotated. Sequencing revealed non-synonymous polymorphisms between Tog5307 and the O. glaberrima susceptible accession CG14 in both candidate genes. An additional resistant O. glaberrima accession, Tog5672, was found to have the Tog5307 genotype for the CC-NBS-LRR gene but not for the putative transmembrane protein gene. Analysis of the cosegregation of Tog5672 resistance with the RYMV3 locus suggests that RYMV3 is also involved in Tog5672 resistance, thereby supporting the CC-NBS-LRR gene as the best candidate for RYMV3.

Complete Genome Sequence of Ralstonia solanacearum FJAT-1458, a Potential Biocontrol Agent for Tomato Wilt.

PubMed

Chen, Deju; Liu, Bo; Zhu, Yujing; Wang, Jieping; Chen, Zheng; Che, Jiamei; Zheng, Xuefang; Chen, Xiaoqiang

2017-04-06

An avirulent strain of Ralstonia solanacearum FJAT-1458 was isolated from a living tomato. Here, we report the complete R. solanacearum FJAT-1458 genome sequence of 6,059,899 bp and 5,241 genes. This bacterial strain is a potential candidate as a biocontrol agent in the form of a plant vaccine for bacterial wilt. Copyright © 2017 Chen et al.

Hybridization-based antibody cDNA recovery for the production of recombinant antibodies identified by repertoire sequencing.

PubMed

Valdés-Alemán, Javier; Téllez-Sosa, Juan; Ovilla-Muñoz, Marbella; Godoy-Lozano, Elizabeth; Velázquez-Ramírez, Daniel; Valdovinos-Torres, Humberto; Gómez-Barreto, Rosa E; Martinez-Barnetche, Jesús

2014-01-01

High-throughput sequencing of the antibody repertoire is enabling a thorough analysis of B cell diversity and clonal selection, which may improve the novel antibody discovery process. Theoretically, an adequate bioinformatic analysis could allow identification of candidate antigen-specific antibodies, requiring their recombinant production for experimental validation of their specificity. Gene synthesis is commonly used for the generation of recombinant antibodies identified in silico. Novel strategies that bypass gene synthesis could offer more accessible antibody identification and validation alternatives. We developed a hybridization-based recovery strategy that targets the complementarity-determining region 3 (CDRH3) for the enrichment of cDNA of candidate antigen-specific antibody sequences. Ten clonal groups of interest were identified through bioinformatic analysis of the heavy chain antibody repertoire of mice immunized with hen egg white lysozyme (HEL). cDNA from eight of the targeted clonal groups was recovered efficiently, leading to the generation of recombinant antibodies. One representative heavy chain sequence from each clonal group recovered was paired with previously reported anti-HEL light chains to generate full antibodies, later tested for HEL-binding capacity. The recovery process proposed represents a simple and scalable molecular strategy that could enhance antibody identification and specificity assessment, enabling a more cost-efficient generation of recombinant antibodies.

Analysis of JAK-STAT signaling pathway genes and their microRNAs in the intestinal mucosa of genetically disparate chicken lines induced with necrotic enteritis.

PubMed

Truong, Anh Duc; Rengaraj, Deivendran; Hong, Yeojin; Hoang, Cong Thanh; Hong, Yeong Ho; Lillehoj, Hyun S

2017-05-01

The JAK-STAT signaling pathway plays a key role in cytokine and growth factor activation and is involved in several cellular functions and diseases. The main objective of this study was to investigate the expression of candidate JAK-STAT pathway genes and their regulators and interactors in the intestinal mucosal layer of two genetically disparate chicken lines [Marek's disease (MD)-resistant line 6.3 and MD-susceptible line 7.2] induced with necrotic enteritis (NE). Through RNA-sequencing, we investigated 116 JAK-STAT signaling pathway-related genes that were significant and differentially expressed between the intestinal mucosa of the two lines compared with respective uninfected controls. About 15 JAK-STAT pathway genes were further verified by qRT-PCR, and the results were in agreement with our sequencing data. All the identified 116 genes were annotated through Gene Ontology and mapped to the KEGG chicken JAK-STAT signaling pathway. To the best of our knowledge, this is the first study to represent the transcriptional analysis of a large number of candidate genes, regulators, and potential interactors in the JAK-STAT pathway of the two chicken lines induced with NE. Several key genes of the interactome, namely, STAT1/3/4, STAT5B, JAK1-3, TYK2, AKT1/3, SOCS1-5, PIAS1/2/4, PTPN6/11, and PIK3, were determined to be differentially expressed in the two lines. Moreover, we detected 68 known miRNAs variably targeting JAK-STAT pathway genes and differentially expressed in the two lines induced with NE. The RNA-sequencing and bioinformatics analyses in this study provided an abundance of data that will be useful for future studies on JAK-STAT pathways associated with the functions of two genetically disparate chicken lines induced with NE. Copyright © 2017 Elsevier B.V. All rights reserved.

Horizontal gene transfer from Bacteria to rumen Ciliates indicates adaptation to their anaerobic, carbohydrates-rich environment

PubMed Central

Ricard, Guénola; McEwan, Neil R; Dutilh, Bas E; Jouany, Jean-Pierre; Macheboeuf, Didier; Mitsumori, Makoto; McIntosh, Freda M; Michalowski, Tadeusz; Nagamine, Takafumi; Nelson, Nancy; Newbold, Charles J; Nsabimana, Eli; Takenaka, Akio; Thomas, Nadine A; Ushida, Kazunari; Hackstein, Johannes HP; Huynen, Martijn A

2006-01-01

Background The horizontal transfer of expressed genes from Bacteria into Ciliates which live in close contact with each other in the rumen (the foregut of ruminants) was studied using ciliate Expressed Sequence Tags (ESTs). More than 4000 ESTs were sequenced from representatives of the two major groups of rumen Cilates: the order Entodiniomorphida (Entodinium simplex, Entodinium caudatum, Eudiplodinium maggii, Metadinium medium, Diploplastron affine, Polyplastron multivesiculatum and Epidinium ecaudatum) and the order Vestibuliferida, previously called Holotricha (Isotricha prostoma, Isotricha intestinalis and Dasytricha ruminantium). Results A comparison of the sequences with the completely sequenced genomes of Eukaryotes and Prokaryotes, followed by large-scale construction and analysis of phylogenies, identified 148 ciliate genes that specifically cluster with genes from the Bacteria and Archaea. The phylogenetic clustering with bacterial genes, coupled with the absence of close relatives of these genes in the Ciliate Tetrahymena thermophila, indicates that they have been acquired via Horizontal Gene Transfer (HGT) after the colonization of the gut by the rumen Ciliates. Conclusion Among the HGT candidates, we found an over-representation (>75%) of genes involved in metabolism, specifically in the catabolism of complex carbohydrates, a rich food source in the rumen. We propose that the acquisition of these genes has greatly facilitated the Ciliates' colonization of the rumen providing evidence for the role of HGT in the adaptation to new niches. PMID:16472398

Horizontal gene transfer from Bacteria to rumen Ciliates indicates adaptation to their anaerobic, carbohydrates-rich environment.

PubMed

Ricard, Guénola; McEwan, Neil R; Dutilh, Bas E; Jouany, Jean-Pierre; Macheboeuf, Didier; Mitsumori, Makoto; McIntosh, Freda M; Michalowski, Tadeusz; Nagamine, Takafumi; Nelson, Nancy; Newbold, Charles J; Nsabimana, Eli; Takenaka, Akio; Thomas, Nadine A; Ushida, Kazunari; Hackstein, Johannes H P; Huynen, Martijn A

2006-02-10

The horizontal transfer of expressed genes from Bacteria into Ciliates which live in close contact with each other in the rumen (the foregut of ruminants) was studied using ciliate Expressed Sequence Tags (ESTs). More than 4000 ESTs were sequenced from representatives of the two major groups of rumen Cilates: the order Entodiniomorphida (Entodinium simplex, Entodinium caudatum, Eudiplodinium maggii, Metadinium medium, Diploplastron affine, Polyplastron multivesiculatum and Epidinium ecaudatum) and the order Vestibuliferida, previously called Holotricha (Isotricha prostoma, Isotricha intestinalis and Dasytricha ruminantium). A comparison of the sequences with the completely sequenced genomes of Eukaryotes and Prokaryotes, followed by large-scale construction and analysis of phylogenies, identified 148 ciliate genes that specifically cluster with genes from the Bacteria and Archaea. The phylogenetic clustering with bacterial genes, coupled with the absence of close relatives of these genes in the Ciliate Tetrahymena thermophila, indicates that they have been acquired via Horizontal Gene Transfer (HGT) after the colonization of the gut by the rumen Ciliates. Among the HGT candidates, we found an over-representation (>75%) of genes involved in metabolism, specifically in the catabolism of complex carbohydrates, a rich food source in the rumen. We propose that the acquisition of these genes has greatly facilitated the Ciliates' colonization of the rumen providing evidence for the role of HGT in the adaptation to new niches.

OVA: integrating molecular and physical phenotype data from multiple biomedical domain ontologies with variant filtering for enhanced variant prioritization.

PubMed

Antanaviciute, Agne; Watson, Christopher M; Harrison, Sally M; Lascelles, Carolina; Crinnion, Laura; Markham, Alexander F; Bonthron, David T; Carr, Ian M

2015-12-01

Exome sequencing has become a de facto standard method for Mendelian disease gene discovery in recent years, yet identifying disease-causing mutations among thousands of candidate variants remains a non-trivial task. Here we describe a new variant prioritization tool, OVA (ontology variant analysis), in which user-provided phenotypic information is exploited to infer deeper biological context. OVA combines a knowledge-based approach with a variant-filtering framework. It reduces the number of candidate variants by considering genotype and predicted effect on protein sequence, and scores the remainder on biological relevance to the query phenotype.We take advantage of several ontologies in order to bridge knowledge across multiple biomedical domains and facilitate computational analysis of annotations pertaining to genes, diseases, phenotypes, tissues and pathways. In this way, OVA combines information regarding molecular and physical phenotypes and integrates both human and model organism data to effectively prioritize variants. By assessing performance on both known and novel disease mutations, we show that OVA performs biologically meaningful candidate variant prioritization and can be more accurate than another recently published candidate variant prioritization tool. OVA is freely accessible at http://dna2.leeds.ac.uk:8080/OVA/index.jsp. Supplementary data are available at Bioinformatics online. umaan@leeds.ac.uk. © The Author 2015. Published by Oxford University Press.

Characterization of the Chromosome 1q41q42.12 region, and the Candidate Gene DISP1, in Patients with CDH

PubMed Central

Kantarci, Sibel; Ackerman, Kate G; Russell, Meaghan N; Longoni, Mauro; Sougnez, Carrie; Noonan, Kristin M; Hatchwell, Eli; Zhang, Xiaoyun; Vanmarcke, Rafael Pieretti; Anyane-Yeboa, Kwame; Dickman, Paul; Wilson, Jay; Donahoe, Patricia K; Pober, Barbara R

2010-01-01

Cytogenetic and molecular cytogenetic studies demonstrate association between congenital diaphragmatic hernia (CDH) and chromosome 1q41q42 deletions. In this study, we screened a large CDH cohort (N=179) for microdeletions in this interval by the multiplex ligation-dependent probe amplification (MLPA) technique, and also sequenced two candidate genes located therein, dispatched 1 (DISP1) and homo sapiens H2.0-like homeobox (HLX). MLPA analysis verified deletions of this region in two cases, an unreported patient with a 46,XY,del(1)(q41q42.13) karyotype and a previously reported patient with a Fryns syndrome phenotype [Kantarci et al., 2006]. HLX sequencing showed a novel but maternally inherited single nucleotide variant (c.27C>G) in a patient with isolated CDH, while DISP1 sequencing revealed a mosaic de novo heterozygous substitution (c.4412C>G; p.Ala1471Gly) in a male with a left-sided Bochdalek hernia plus multiple other anomalies. Pyrosequencing demonstrated the mutant allele was present in 43%, 12%, and 4.5% of the patient’s lymphoblastoid, peripheral blood lymphocytes, and saliva cells, respectively. We examined Disp1 expression at day E11.5 of mouse diaphragm formation and confirmed its presence in the pleuroperitoneal fold, as well as the nearby lung which also expresses Sonic hedgehog (Shh). Our report describes the first de novo DISP1 point mutation in a patient with complex CDH. Combining this finding with Disp1 embryonic mouse diaphragm and lung tissue expression, as well as previously reported human chromosome 1q41q42 aberrations in patients with CDH, suggests that DISP1 may warrant further consideration as a CDH candidate gene. PMID:20799323

Novel small RNA (sRNA) landscape of the starvation-stress response transcriptome of Salmonella enterica serovar typhimurium.

PubMed

Amin, Shivam V; Roberts, Justin T; Patterson, Dillon G; Coley, Alexander B; Allred, Jonathan A; Denner, Jason M; Johnson, Justin P; Mullen, Genevieve E; O'Neal, Trenton K; Smith, Jason T; Cardin, Sara E; Carr, Hank T; Carr, Stacie L; Cowart, Holly E; DaCosta, David H; Herring, Brendon R; King, Valeria M; Polska, Caroline J; Ward, Erin E; Wise, Alice A; McAllister, Kathleen N; Chevalier, David; Spector, Michael P; Borchert, Glen M

2016-01-01

Small RNAs (sRNAs) are short (∼50-200 nucleotides) noncoding RNAs that regulate cellular activities across bacteria. Salmonella enterica starved of a carbon-energy (C) source experience a host of genetic and physiological changes broadly referred to as the starvation-stress response (SSR). In an attempt to identify novel sRNAs contributing to SSR control, we grew log-phase, 5-h C-starved and 24-h C-starved cultures of the virulent Salmonella enterica subspecies enterica serovar Typhimurium strain SL1344 and comprehensively sequenced their small RNA transcriptomes. Strikingly, after employing a novel strategy for sRNA discovery based on identifying dynamic transcripts arising from "gene-empty" regions, we identify 58 wholly undescribed Salmonella sRNA genes potentially regulating SSR averaging an ∼1,000-fold change in expression between log-phase and C-starved cells. Importantly, the expressions of individual sRNA loci were confirmed by both comprehensive transcriptome analyses and northern blotting of select candidates. Of note, we find 43 candidate sRNAs share significant sequence identity to characterized sRNAs in other bacteria, and ∼70% of our sRNAs likely assume characteristic sRNA structural conformations. In addition, we find 53 of our 58 candidate sRNAs either overlap neighboring mRNA loci or share significant sequence complementarity to mRNAs transcribed elsewhere in the SL1344 genome strongly suggesting they regulate the expression of transcripts via antisense base-pairing. Finally, in addition to this work resulting in the identification of 58 entirely novel Salmonella enterica genes likely participating in the SSR, we also find evidence suggesting that sRNAs are significantly more prevalent than currently appreciated and that Salmonella sRNAs may actually number in the thousands.

Novel small RNA (sRNA) landscape of the starvation-stress response transcriptome of Salmonella enterica serovar typhimurium

PubMed Central

Amin, Shivam V.; Roberts, Justin T.; Patterson, Dillon G.; Coley, Alexander B.; Allred, Jonathan A.; Denner, Jason M.; Johnson, Justin P.; Mullen, Genevieve E.; O'Neal, Trenton K.; Smith, Jason T.; Cardin, Sara E.; Carr, Hank T.; Carr, Stacie L.; Cowart, Holly E.; DaCosta, David H.; Herring, Brendon R.; King, Valeria M.; Polska, Caroline J.; Ward, Erin E.; Wise, Alice A.; McAllister, Kathleen N.; Chevalier, David; Spector, Michael P.; Borchert, Glen M.

2016-01-01

ABSTRACT Small RNAs (sRNAs) are short (∼50–200 nucleotides) noncoding RNAs that regulate cellular activities across bacteria. Salmonella enterica starved of a carbon-energy (C) source experience a host of genetic and physiological changes broadly referred to as the starvation-stress response (SSR). In an attempt to identify novel sRNAs contributing to SSR control, we grew log-phase, 5-h C-starved and 24-h C-starved cultures of the virulent Salmonella enterica subspecies enterica serovar Typhimurium strain SL1344 and comprehensively sequenced their small RNA transcriptomes. Strikingly, after employing a novel strategy for sRNA discovery based on identifying dynamic transcripts arising from “gene-empty” regions, we identify 58 wholly undescribed Salmonella sRNA genes potentially regulating SSR averaging an ∼1,000-fold change in expression between log-phase and C-starved cells. Importantly, the expressions of individual sRNA loci were confirmed by both comprehensive transcriptome analyses and northern blotting of select candidates. Of note, we find 43 candidate sRNAs share significant sequence identity to characterized sRNAs in other bacteria, and ∼70% of our sRNAs likely assume characteristic sRNA structural conformations. In addition, we find 53 of our 58 candidate sRNAs either overlap neighboring mRNA loci or share significant sequence complementarity to mRNAs transcribed elsewhere in the SL1344 genome strongly suggesting they regulate the expression of transcripts via antisense base-pairing. Finally, in addition to this work resulting in the identification of 58 entirely novel Salmonella enterica genes likely participating in the SSR, we also find evidence suggesting that sRNAs are significantly more prevalent than currently appreciated and that Salmonella sRNAs may actually number in the thousands. PMID:26853797

Virus-Induced Gene Silencing Using Tobacco Rattle Virus as a Tool to Study the Interaction between Nicotiana attenuata and Rhizophagus irregularis.

PubMed

Groten, Karin; Pahari, Nabin T; Xu, Shuqing; Miloradovic van Doorn, Maja; Baldwin, Ian T

2015-01-01

Most land plants live in a symbiotic association with arbuscular mycorrhizal fungi (AMF) that belong to the phylum Glomeromycota. Although a number of plant genes involved in the plant-AMF interactions have been identified by analyzing mutants, the ability to rapidly manipulate gene expression to study the potential functions of new candidate genes remains unrealized. We analyzed changes in gene expression of wild tobacco roots (Nicotiana attenuata) after infection with mycorrhizal fungi (Rhizophagus irregularis) by serial analysis of gene expression (SuperSAGE) combined with next generation sequencing, and established a virus-induced gene-silencing protocol to study the function of candidate genes in the interaction. From 92,434 SuperSAGE Tag sequences, 32,808 (35%) matched with our in-house Nicotiana attenuata transcriptome database and 3,698 (4%) matched to Rhizophagus genes. In total, 11,194 Tags showed a significant change in expression (p<0.05, >2-fold change) after infection. When comparing the functions of highly up-regulated annotated Tags in this study with those of two previous large-scale gene expression studies, 18 gene functions were found to be up-regulated in all three studies mainly playing roles related to phytohormone metabolism, catabolism and defense. To validate the function of identified candidate genes, we used the technique of virus-induced gene silencing (VIGS) to silence the expression of three putative N. attenuata genes: germin-like protein, indole-3-acetic acid-amido synthetase GH3.9 and, as a proof-of-principle, calcium and calmodulin-dependent protein kinase (CCaMK). The silencing of the three plant genes in roots was successful, but only CCaMK silencing had a significant effect on the interaction with R. irregularis. Interestingly, when a highly activated inoculum was used for plant inoculation, the effect of CCaMK silencing on fungal colonization was masked, probably due to trans-complementation. This study demonstrates that large-scale gene expression studies across different species induce of a core set of genes of similar functions. However, additional factors seem to influence the overall pattern of gene expression, resulting in high variability among independent studies with different hosts. We conclude that VIGS is a powerful tool with which to investigate the function of genes involved in plant-AMF interactions but that inoculum strength can strongly influence the outcome of the interaction.

De novo Transcriptome Assembly of Floral Buds of Pineapple and Identification of Differentially Expressed Genes in Response to Ethephon Induction

PubMed Central

Liu, Chuan-He; Fan, Chao

2016-01-01

A remarkable characteristic of pineapple is its ability to undergo floral induction in response to external ethylene stimulation. However, little information is available regarding the molecular mechanism underlying this process. In this study, the differentially expressed genes (DEGs) in plants exposed to 1.80 mL·L−1 (T1) or 2.40 mL·L−1 ethephon (T2) compared with Ct plants (control, cleaning water) were identified using RNA-seq and gene expression profiling. Illumina sequencing generated 65,825,224 high-quality reads that were assembled into 129,594 unigenes with an average sequence length of 1173 bp. Of these unigenes, 24,775 were assigned to specific KEGG pathways, of which metabolic pathways and biosynthesis of secondary metabolites were the most highly represented. Gene Ontology (GO) analysis of the annotated unigenes revealed that the majority were involved in metabolic and cellular processes, cell and cell part, catalytic activity and binding. Gene expression profiling analysis revealed 3788, 3062, and 758 DEGs in the comparisons of T1 with Ct, T2 with Ct, and T2 with T1, respectively. GO analysis indicated that these DEGs were predominantly annotated to metabolic and cellular processes, cell and cell part, catalytic activity, and binding. KEGG pathway analysis revealed the enrichment of several important pathways among the DEGs, including metabolic pathways, biosynthesis of secondary metabolites and plant hormone signal transduction. Thirteen DEGs were identified as candidate genes associated with the process of floral induction by ethephon, including three ERF-like genes, one ETR-like gene, one LTI-like gene, one FT-like gene, one VRN1-like gene, three FRI-like genes, one AP1-like gene, one CAL-like gene, and one AG-like gene. qPCR analysis indicated that the changes in the expression of these 13 candidate genes were consistent with the alterations in the corresponding RPKM values, confirming the accuracy and credibility of the RNA-seq and gene expression profiling results. Ethephon-mediated induction likely mimics the process of vernalization in the floral transition in pineapple by increasing LTI, FT, and VRN1 expression and promoting the up-regulation of floral meristem identity genes involved in flower development. The candidate genes screened can be used in investigations of the molecular mechanisms of the flowering pathway and of various other biological mechanisms in pineapple. PMID:26955375

A Single Transcriptome of a Green Toad (Bufo viridis) Yields Candidate Genes for Sex Determination and -Differentiation and Non-Anonymous Population Genetic Markers

PubMed Central

Gerchen, Jörn F.; Reichert, Samuel J.; Röhr, Johannes T.; Dieterich, Christoph; Kloas, Werner

2016-01-01

Large genome size, including immense repetitive and non-coding fractions, still present challenges for capacity, bioinformatics and thus affordability of whole genome sequencing in most amphibians. Here, we test the performance of a single transcriptome to understand whether it can provide a cost-efficient resource for species with large unknown genomes. Using RNA from six different tissues from a single Palearctic green toad (Bufo viridis) specimen and Hiseq2000, we obtained 22,5 Mio reads and publish >100,000 unigene sequences. To evaluate efficacy and quality, we first use this data to identify green toad specific candidate genes, known from other vertebrates for their role in sex determination and differentiation. Of a list of 37 genes, the transcriptome yielded 32 (87%), many of which providing the first such data for this non-model anuran species. However, for many of these genes, only fragments could be retrieved. In order to allow also applications to population genetics, we further used the transcriptome for the targeted development of 21 non-anonymous microsatellites and tested them in genetic families and backcrosses. Eleven markers were specifically developed to be located on the B. viridis sex chromosomes; for eight markers we can indeed demonstrate sex-specific transmission in genetic families. Depending on phylogenetic distance, several markers, which are sex-linked in green toads, show high cross-amplification success across the anuran phylogeny, involving nine systematic anuran families. Our data support the view that single transcriptome sequencing (based on multiple tissues) provides a reliable genomic resource and cost-efficient method for non-model amphibian species with large genome size and, despite limitations, should be considered as long as genome sequencing remains unaffordable for most species. PMID:27232626

Mining candidate genes associated with powdery mildew resistance in cucumber via super-BSA by specific length amplified fragment (SLAF) sequencing.

PubMed

Zhang, Peng; Zhu, Yuqiang; Wang, Lili; Chen, Liping; Zhou, Shengjun

2015-12-14

Powdery mildew (PM) is the most common fungal disease of cucumber and other cucurbit crops, while breeding the PM-resistant materials is the effective way to defense this disease, and the recent development of modern genetics and genomics make us aware of that studying the resistance genes is the essential way to breed the PM high-resistance plant. With the ever increasing throughput of next-generation sequencing (NGS), the development of specific length amplified fragment sequencing (SLAF-seq) as a high-resolution strategy for large-scale de novo SNP discovery is gradually applied for functional gene mining. Here we combined the bulked segregant analysis (BSA) with SLAF-seq to identify candidate genes associated with PM resistance in cucumber. A segregating population comprising 251 F2 individuals was developed using H136 (female parent) as susceptible parent and BK2 (male parent) as resistance donor. After PMR test, total genomic DNA was prepared from each plant. Systemic genomic analysis of the GC content, repeat sequence, etc. was carried out by prediction software SLAF_Predict to establish condition to ensure the uniformity and density of the molecular markers. After samples were gel purified, SLAFs were generated at Biomarker Technologies Corporation in Beijing. Based on SLAF tags and the PMR test result, the hot region were annotated. A total of 73,100 high-quality SLAF tags with an average depth of 99.11× were sequenced. Among these, 5,355 polymorphic tags were identified with a polymorphism rate of 7.34 %, including 7.09 % SNPs and other polymorphism types. Finally, 140 associated SLAFs were identified, and two main Hot Regions were detected on chromosome 1 and 6, which contained five genes invovled in defense response, toxin metabolism, cell stress response, and injury response in cucumber. Associated markers identified by super-BSA in this study, could not only speed up the study of the PMR genes, but also provide a feasible solution for breeding the marker-assisted PMR cucumber. Moreover, this study could also be extended to any other species with reference genome.

Genetic analysis of tolerance to the root lesion nematode Pratylenchus neglectus in the legume Medicago littoralis.

PubMed

Oldach, Klaus H; Peck, David M; Nair, Ramakrishnan M; Sokolova, Maria; Harris, John; Bogacki, Paul; Ballard, Ross

2014-04-17

The nematode Pratylenchus neglectus has a wide host range and is able to feed on the root systems of cereals, oilseeds, grain and pasture legumes. Under the Mediterranean low rainfall environments of Australia, annual Medicago pasture legumes are used in rotation with cereals to fix atmospheric nitrogen and improve soil parameters. Considerable efforts are being made in breeding programs to improve resistance and tolerance to Pratylenchus neglectus in the major crops wheat and barley, which makes it vital to develop appropriate selection tools in medics. A strong source of tolerance to root damage by the root lesion nematode (RLN) Pratylenchus neglectus had previously been identified in line RH-1 (strand medic, M. littoralis). Using RH-1, we have developed a single seed descent (SSD) population of 138 lines by crossing it to the intolerant cultivar Herald. After inoculation, RLN-associated root damage clearly segregated in the population. Genetic analysis was performed by constructing a genetic map using simple sequence repeat (SSR) and gene-based SNP markers. A highly significant quantitative trait locus (QTL), QPnTolMl.1, was identified explaining 49% of the phenotypic variation in the SSD population. All SSRs and gene-based markers in the QTL region were derived from chromosome 1 of the sequenced genome of the closely related species M. truncatula. Gene-based markers were validated in advanced breeding lines derived from the RH-1 parent and also a second RLN tolerance source, RH-2 (M. truncatula ssp. tricycla). Comparative analysis to sequenced legume genomes showed that the physical QTL interval exists as a synteny block in Lotus japonicus, common bean, soybean and chickpea. Furthermore, using the sequenced genome information of M. truncatula, the QTL interval contains 55 genes out of which five are discussed as potential candidate genes responsible for the mapped tolerance. The closely linked set of SNP-based PCR markers is directly applicable to select for two different sources of RLN tolerance in breeding programs. Moreover, genome sequence information has allowed proposing candidate genes for further functional analysis and nominates QPnTolMl.1 as a target locus for RLN tolerance in economically important grain legumes, e.g. chickpea.

Large-scale deletions of the ABCA1 gene in patients with hypoalphalipoproteinemia.

PubMed

Dron, Jacqueline S; Wang, Jian; Berberich, Amanda J; Iacocca, Michael A; Cao, Henian; Yang, Ping; Knoll, Joan; Tremblay, Karine; Brisson, Diane; Netzer, Christian; Gouni-Berthold, Ioanna; Gaudet, Daniel; Hegele, Robert A

2018-06-04

Copy-number variations (CNVs) have been studied in the context of familial hypercholesterolemia but have not yet been evaluated in patients with extremes of high-density lipoprotein (HDL) cholesterol levels. We evaluated targeted next-generation sequencing data from patients with very low HDL cholesterol (i.e. hypoalphalipoproteinemia) using the VarSeq-CNV caller algorithm to screen for CNVs disrupting the ABCA1, LCAT or APOA1 genes. In four individuals, we found three unique deletions in ABCA1: a heterozygous deletion of exon 4, a heterozygous deletion spanning exons 8 to 31, and a heterozygous deletion of the entire ABCA1 gene. Breakpoints were identified using Sanger sequencing, and the full-gene deletion was also confirmed using exome sequencing and the Affymetrix CytoScanTM HD Array. Before now, large-scale deletions in candidate HDL genes have not been associated with hypoalphalipoproteinemia; our findings indicate that CNVs in ABCA1 may be a previously unappreciated genetic determinant of low HDL cholesterol levels. By coupling bioinformatic analyses with next-generation sequencing data, we can successfully assess the spectrum of genetic determinants of many dyslipidemias, now including hypoalphalipoproteinemia. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.

De novo Transcriptome Assembly of Common Wild Rice (Oryza rufipogon Griff.) and Discovery of Drought-Response Genes in Root Tissue Based on Transcriptomic Data.

PubMed

Tian, Xin-Jie; Long, Yan; Wang, Jiao; Zhang, Jing-Wen; Wang, Yan-Yan; Li, Wei-Min; Peng, Yu-Fa; Yuan, Qian-Hua; Pei, Xin-Wu

2015-01-01

The perennial O. rufipogon (common wild rice), which is considered to be the ancestor of Asian cultivated rice species, contains many useful genetic resources, including drought resistance genes. However, few studies have identified the drought resistance and tissue-specific genes in common wild rice. In this study, transcriptome sequencing libraries were constructed, including drought-treated roots (DR) and control leaves (CL) and roots (CR). Using Illumina sequencing technology, we generated 16.75 million bases of high-quality sequence data for common wild rice and conducted de novo assembly and annotation of genes without prior genome information. These reads were assembled into 119,332 unigenes with an average length of 715 bp. A total of 88,813 distinct sequences (74.42% of unigenes) significantly matched known genes in the NCBI NT database. Differentially expressed gene (DEG) analysis showed that 3617 genes were up-regulated and 4171 genes were down-regulated in the CR library compared with the CL library. Among the DEGs, 535 genes were expressed in roots but not in shoots. A similar comparison between the DR and CR libraries showed that 1393 genes were up-regulated and 315 genes were down-regulated in the DR library compared with the CR library. Finally, 37 genes that were specifically expressed in roots were screened after comparing the DEGs identified in the above-described analyses. This study provides a transcriptome sequence resource for common wild rice plants and establishes a digital gene expression profile of wild rice plants under drought conditions using the assembled transcriptome data as a reference. Several tissue-specific and drought-stress-related candidate genes were identified, representing a fully characterized transcriptome and providing a valuable resource for genetic and genomic studies in plants.

Exome Sequencing of 18 Chinese Families with Congenital Cataracts: A New Sight of the NHS Gene

PubMed Central

Sun, Wenmin; Xiao, Xueshan; Li, Shiqiang; Guo, Xiangming; Zhang, Qingjiong

2014-01-01

Purpose The aim of this study was to investigate the mutation spectrum and frequency of 34 known genes in 18 Chinese families with congenital cataracts. Methods Genomic DNA and clinical data was collected from 18 families with congenital cataracts. Variations in 34 cataract-associated genes were screened by whole exome sequencing and then validated by Sanger sequencing. Results Eleven candidate variants in seven of the 34 genes were detected by exome sequencing and then confirmed by Sanger sequencing, including two variants predicted to be benign and the other pathogenic mutations. The nine mutations were present in 9 of the 18 (50%) families with congenital cataracts. Of the four families with mutations in the X-linked NHS gene, no other abnormalities were recorded except for cataract, in which a pseudo-dominant inheritance form was suggested, as female carriers also had different forms of cataracts. Conclusion This study expands the mutation spectrum and frequency of genes responsible for congenital cataract. Mutation in NHS is a common cause of nonsyndromic congenital cataract with pseudo-autosomal dominant inheritance. Combined with our previous studies, a genetic basis could be identified in 67.6% of families with congenital cataracts in our case series, in which mutations in genes encoding crystallins, genes encoding connexins, and NHS are responsible for 29.4%, 14.7%, and 11.8% of families, respectively. Our results suggest that mutations in NHS are the common cause of congenital cataract, both syndromic and nonsyndromic. PMID:24968223

A Reevaluation of Rice Mitochondrial Evolution Based on the Complete Sequence of Male-Fertile and Male-Sterile Mitochondrial Genomes1[C][W][OA

PubMed Central

Bentolila, Stéphane; Stefanov, Stefan

2012-01-01

Plant mitochondrial genomes have features that distinguish them radically from their animal counterparts: a high rate of rearrangement, of uptake and loss of DNA sequences, and an extremely low point mutation rate. Perhaps the most unique structural feature of plant mitochondrial DNAs is the presence of large repeated sequences involved in intramolecular and intermolecular recombination. In addition, rare recombination events can occur across shorter repeats, creating rearrangements that result in aberrant phenotypes, including pollen abortion, which is known as cytoplasmic male sterility (CMS). Using next-generation sequencing, we pyrosequenced two rice (Oryza sativa) mitochondrial genomes that belong to the indica subspecies. One genome is normal, while the other carries the wild abortive-CMS. We find that numerous rearrangements in the rice mitochondrial genome occur even between close cytotypes during rice evolution. Unlike maize (Zea mays), a closely related species also belonging to the grass family, integration of plastid sequences did not play a role in the sequence divergence between rice cytotypes. This study also uncovered an excellent candidate for the wild abortive-CMS-encoding gene; like most of the CMS-associated open reading frames that are known in other species, this candidate was created via a rearrangement, is chimeric in structure, possesses predicted transmembrane domains, and coopted the promoter of a genuine mitochondrial gene. Our data give new insights into rice mitochondrial evolution, correcting previous reports. PMID:22128137

Analysis of Aspergillus nidulans metabolism at the genome-scale

PubMed Central

David, Helga; Özçelik, İlknur Ş; Hofmann, Gerald; Nielsen, Jens

2008-01-01

Background Aspergillus nidulans is a member of a diverse group of filamentous fungi, sharing many of the properties of its close relatives with significance in the fields of medicine, agriculture and industry. Furthermore, A. nidulans has been a classical model organism for studies of development biology and gene regulation, and thus it has become one of the best-characterized filamentous fungi. It was the first Aspergillus species to have its genome sequenced, and automated gene prediction tools predicted 9,451 open reading frames (ORFs) in the genome, of which less than 10% were assigned a function. Results In this work, we have manually assigned functions to 472 orphan genes in the metabolism of A. nidulans, by using a pathway-driven approach and by employing comparative genomics tools based on sequence similarity. The central metabolism of A. nidulans, as well as biosynthetic pathways of relevant secondary metabolites, was reconstructed based on detailed metabolic reconstructions available for A. niger and Saccharomyces cerevisiae, and information on the genetics, biochemistry and physiology of A. nidulans. Thereby, it was possible to identify metabolic functions without a gene associated, and to look for candidate ORFs in the genome of A. nidulans by comparing its sequence to sequences of well-characterized genes in other species encoding the function of interest. A classification system, based on defined criteria, was developed for evaluating and selecting the ORFs among the candidates, in an objective and systematic manner. The functional assignments served as a basis to develop a mathematical model, linking 666 genes (both previously and newly annotated) to metabolic roles. The model was used to simulate metabolic behavior and additionally to integrate, analyze and interpret large-scale gene expression data concerning a study on glucose repression, thereby providing a means of upgrading the information content of experimental data and getting further insight into this phenomenon in A. nidulans. Conclusion We demonstrate how pathway modeling of A. nidulans can be used as an approach to improve the functional annotation of the genome of this organism. Furthermore we show how the metabolic model establishes functional links between genes, enabling the upgrade of the information content of transcriptome data. PMID:18405346

Convergent evolution of marine mammals is associated with distinct substitutions in common genes

PubMed Central

Zhou, Xuming; Seim, Inge; Gladyshev, Vadim N.

2015-01-01

Phenotypic convergence is thought to be driven by parallel substitutions coupled with natural selection at the sequence level. Multiple independent evolutionary transitions of mammals to an aquatic environment offer an opportunity to test this thesis. Here, whole genome alignment of coding sequences identified widespread parallel amino acid substitutions in marine mammals; however, the majority of these changes were not unique to these animals. Conversely, we report that candidate aquatic adaptation genes, identified by signatures of likelihood convergence and/or elevated ratio of nonsynonymous to synonymous nucleotide substitution rate, are characterized by very few parallel substitutions and exhibit distinct sequence changes in each group. Moreover, no significant positive correlation was found between likelihood convergence and positive selection in all three marine lineages. These results suggest that convergence in protein coding genes associated with aquatic lifestyle is mainly characterized by independent substitutions and relaxed negative selection. PMID:26549748

De novo characterization of fall dormant and nondormant alfalfa (Medicago sativa L.) leaf transcriptome and identification of candidate genes related to fall dormancy.

PubMed

Zhang, Senhao; Shi, Yinghua; Cheng, Ningning; Du, Hongqi; Fan, Wenna; Wang, Chengzhang

2015-01-01

Alfalfa (Medicago sativa L.) is one of the most widely cultivated perennial forage legumes worldwide. Fall dormancy is an adaptive character related to the biomass production and winter survival in alfalfa. The physiological, biochemical and molecular mechanisms causing fall dormancy and the related genes have not been well studied. In this study, we sequenced two standard varieties of alfalfa (dormant and non-dormant) at two time points and generated approximately 160 million high quality paired-end sequence reads using sequencing by synthesis (SBS) technology. The de novo transcriptome assembly generated a set of 192,875 transcripts with an average length of 856 bp representing about 165.1 Mb of the alfalfa leaf transcriptome. After assembly, 111,062 (57.6%) transcripts were annotated against the NCBI non-redundant database. A total of 30,165 (15.6%) transcripts were mapped to 323 Kyoto Encyclopedia of Genes and Genomes pathways. We also identified 41,973 simple sequence repeats, which can be used to generate markers for alfalfa, and 1,541 transcription factors were identified across 1,350 transcripts. Gene expression between dormant and non-dormant alfalfa at different time points were performed, and we identified several differentially expressed genes potentially related to fall dormancy. The Gene Ontology and pathways information were also identified. We sequenced and assembled the leaf transcriptome of alfalfa related to fall dormancy, and also identified some genes of interest involved in the fall dormancy mechanism. Thus, our research focused on studying fall dormancy in alfalfa through transcriptome sequencing. The sequencing and gene expression data generated in this study may be used further to elucidate the complete mechanisms governing fall dormancy in alfalfa.

De Novo Characterization of Fall Dormant and Nondormant Alfalfa (Medicago sativa L.) Leaf Transcriptome and Identification of Candidate Genes Related to Fall Dormancy

PubMed Central

Cheng, Ningning; Du, Hongqi; Fan, Wenna; Wang, Chengzhang

2015-01-01

Alfalfa (Medicago sativa L.) is one of the most widely cultivated perennial forage legumes worldwide. Fall dormancy is an adaptive character related to the biomass production and winter survival in alfalfa. The physiological, biochemical and molecular mechanisms causing fall dormancy and the related genes have not been well studied. In this study, we sequenced two standard varieties of alfalfa (dormant and non-dormant) at two time points and generated approximately 160 million high quality paired-end sequence reads using sequencing by synthesis (SBS) technology. The de novo transcriptome assembly generated a set of 192,875 transcripts with an average length of 856 bp representing about 165.1 Mb of the alfalfa leaf transcriptome. After assembly, 111,062 (57.6%) transcripts were annotated against the NCBI non-redundant database. A total of 30,165 (15.6%) transcripts were mapped to 323 Kyoto Encyclopedia of Genes and Genomes pathways. We also identified 41,973 simple sequence repeats, which can be used to generate markers for alfalfa, and 1,541 transcription factors were identified across 1,350 transcripts. Gene expression between dormant and non-dormant alfalfa at different time points were performed, and we identified several differentially expressed genes potentially related to fall dormancy. The Gene Ontology and pathways information were also identified. We sequenced and assembled the leaf transcriptome of alfalfa related to fall dormancy, and also identified some genes of interest involved in the fall dormancy mechanism. Thus, our research focused on studying fall dormancy in alfalfa through transcriptome sequencing. The sequencing and gene expression data generated in this study may be used further to elucidate the complete mechanisms governing fall dormancy in alfalfa. PMID:25799491

Molecular evolution of candidate male reproductive genes in the brown algal model Ectocarpus.

PubMed

Lipinska, Agnieszka P; Van Damme, Els J M; De Clerck, Olivier

2016-01-05

Evolutionary studies of genes that mediate recognition between sperm and egg contribute to our understanding of reproductive isolation and speciation. Surface receptors involved in fertilization are targets of sexual selection, reinforcement, and other evolutionary forces including positive selection. This observation was made across different lineages of the eukaryotic tree from land plants to mammals, and is particularly evident in free-spawning animals. Here we use the brown algal model species Ectocarpus (Phaeophyceae) to investigate the evolution of candidate gamete recognition proteins in a distant major phylogenetic group of eukaryotes. Male gamete specific genes were identified by comparing transcriptome data covering different stages of the Ectocarpus life cycle and screened for characteristics expected from gamete recognition receptors. Selected genes were sequenced in a representative number of strains from distant geographical locations and varying stages of reproductive isolation, to search for signatures of adaptive evolution. One of the genes (Esi0130_0068) showed evidence of selective pressure. Interestingly, that gene displayed domain similarities to the receptor for egg jelly (REJ) protein involved in sperm-egg recognition in sea urchins. We have identified a male gamete specific gene with similarity to known gamete recognition receptors and signatures of adaptation. Altogether, this gene could contribute to gamete interaction during reproduction as well as reproductive isolation in Ectocarpus and is therefore a good candidate for further functional evaluation.

Novel Single-Base Deletional Mutation in Major Intrinsic Protein (MIP) in Autosomal Dominant Cataract

PubMed Central

Geyer, David D.; Spence, M. Anne; Johannes, Meriam; Flodman, Pamela; Clancy, Kevin P.; Berry, Rebecca; Sparkes, Robert S.; Jonsen, Matthew D.; Isenberg, Sherwin J.; Bateman, J. Bronwyn

2006-01-01

PURPOSE To further elucidate the cataract phenotype, and identify the gene and mutation for autosomal dominant cataract (ADC) in an American family of European descent (ADC2) by sequencing the major intrinsic protein gene (MIP), a candidate based on linkage to chromosome 12q13. DESIGN Observational case series and laboratory experimental study. METHODS We examined two at-risk individuals in ADC2. We PCR-amplified and sequenced all four exons and all intron-exon boundaries of the MIP gene from genomic and cloned DNA in affected members to confirm one variant as the putative mutation. RESULTS We found a novel single deletion of nucleotide (nt) 3223 (within codon 235) in exon four, causing a frameshift that alters 41 of 45 subsequent amino acids and creates a premature stop codon. CONCLUSIONS We identified a novel single base pair deletion in the MIP gene and conclude that it is a pathogenic sequence alteration. PMID:16564824

Analysis of protein-coding genetic variation in 60,706 humans.

PubMed

Lek, Monkol; Karczewski, Konrad J; Minikel, Eric V; Samocha, Kaitlin E; Banks, Eric; Fennell, Timothy; O'Donnell-Luria, Anne H; Ware, James S; Hill, Andrew J; Cummings, Beryl B; Tukiainen, Taru; Birnbaum, Daniel P; Kosmicki, Jack A; Duncan, Laramie E; Estrada, Karol; Zhao, Fengmei; Zou, James; Pierce-Hoffman, Emma; Berghout, Joanne; Cooper, David N; Deflaux, Nicole; DePristo, Mark; Do, Ron; Flannick, Jason; Fromer, Menachem; Gauthier, Laura; Goldstein, Jackie; Gupta, Namrata; Howrigan, Daniel; Kiezun, Adam; Kurki, Mitja I; Moonshine, Ami Levy; Natarajan, Pradeep; Orozco, Lorena; Peloso, Gina M; Poplin, Ryan; Rivas, Manuel A; Ruano-Rubio, Valentin; Rose, Samuel A; Ruderfer, Douglas M; Shakir, Khalid; Stenson, Peter D; Stevens, Christine; Thomas, Brett P; Tiao, Grace; Tusie-Luna, Maria T; Weisburd, Ben; Won, Hong-Hee; Yu, Dongmei; Altshuler, David M; Ardissino, Diego; Boehnke, Michael; Danesh, John; Donnelly, Stacey; Elosua, Roberto; Florez, Jose C; Gabriel, Stacey B; Getz, Gad; Glatt, Stephen J; Hultman, Christina M; Kathiresan, Sekar; Laakso, Markku; McCarroll, Steven; McCarthy, Mark I; McGovern, Dermot; McPherson, Ruth; Neale, Benjamin M; Palotie, Aarno; Purcell, Shaun M; Saleheen, Danish; Scharf, Jeremiah M; Sklar, Pamela; Sullivan, Patrick F; Tuomilehto, Jaakko; Tsuang, Ming T; Watkins, Hugh C; Wilson, James G; Daly, Mark J; MacArthur, Daniel G

2016-08-18

Large-scale reference data sets of human genetic variation are critical for the medical and functional interpretation of DNA sequence changes. Here we describe the aggregation and analysis of high-quality exome (protein-coding region) DNA sequence data for 60,706 individuals of diverse ancestries generated as part of the Exome Aggregation Consortium (ExAC). This catalogue of human genetic diversity contains an average of one variant every eight bases of the exome, and provides direct evidence for the presence of widespread mutational recurrence. We have used this catalogue to calculate objective metrics of pathogenicity for sequence variants, and to identify genes subject to strong selection against various classes of mutation; identifying 3,230 genes with near-complete depletion of predicted protein-truncating variants, with 72% of these genes having no currently established human disease phenotype. Finally, we demonstrate that these data can be used for the efficient filtering of candidate disease-causing variants, and for the discovery of human 'knockout' variants in protein-coding genes.

Genetic analysis of familial non-syndromic primary failure of eruption

PubMed Central

Frazier-Bowers, S.; Simmons, D; Koehler, K; Zhou, J

2009-01-01

Objectives While some eruption disorders occur as part of a medical syndrome, primary failure of eruption (PFE) – defined as a localized failure of secondary tooth eruption -exists without systemic involvement. Recent studies support that heredity may play an important role in the pathogenesis of PFE. The objective of our human genetic study is to investigate the genetic contribution to PFE. Materials and Methods Four candidate genes POSTN, RUNX2, AMELX, and AMBN) were investigated due to their relationship to tooth eruption or putative relationship to each other. Families and individuals were ascertained based on the clinical diagnosis of PFE. Pedigrees were constructed and analyzed by inspection to determine the mode of inheritance in 4 families. The candidate genes were directly sequenced for both unrelated affected individuals and unaffected individuals. A genome wide scan using 500 microsatellite markers followed by linkage analysis was carried out for one family. Results Pedigree analysis of families suggests an autosomal dominant inheritance pattern with complete penetrance and variable expressivity. Sequence analysis revealed 2 non-functional polymorphisms in the POSTN gene and no other sequence variations in the remaining candidate genes. Genotyping and linkage analysis of one family yielded a LOD score of 1.51 for markers D13S272; D15S118 and D17S831 on chromosomes 13, 15 and 17 respectively. Conclusions While LOD scores were not significant evidence of linkage, extension of current pedigrees and novel SNP chip technology holds great promise for identification of a causative locus for PFE. Clinical Relevance When the process of normal tooth eruption fails, it may result in a clinically guarded or hopeless prognosis. Our studies aim to understand the etiological basis of Primary Failure of Eruption (PFE) toward the development of future orthodontic or pharmocologic interventions that will successfully treat this problem. PMID:19419450

Production of individualized V gene databases reveals high levels of immunoglobulin genetic diversity

NASA Astrophysics Data System (ADS)

Corcoran, Martin M.; Phad, Ganesh E.; Bernat, Néstor Vázquez; Stahl-Hennig, Christiane; Sumida, Noriyuki; Persson, Mats A. A.; Martin, Marcel; Hedestam, Gunilla B. Karlsson

2016-12-01

Comprehensive knowledge of immunoglobulin genetics is required to advance our understanding of B cell biology. Validated immunoglobulin variable (V) gene databases are close to completion only for human and mouse. We present a novel computational approach, IgDiscover, that identifies germline V genes from expressed repertoires to a specificity of 100%. IgDiscover uses a cluster identification process to produce candidate sequences that, once filtered, results in individualized germline V gene databases. IgDiscover was tested in multiple species, validated by genomic cloning and cross library comparisons and produces comprehensive gene databases even where limited genomic sequence is available. IgDiscover analysis of the allelic content of the Indian and Chinese-origin rhesus macaques reveals high levels of immunoglobulin gene diversity in this species. Further, we describe a novel human IGHV3-21 allele and confirm significant gene differences between Balb/c and C57BL6 mouse strains, demonstrating the power of IgDiscover as a germline V gene discovery tool.

Production of individualized V gene databases reveals high levels of immunoglobulin genetic diversity

PubMed Central

Corcoran, Martin M.; Phad, Ganesh E.; Bernat, Néstor Vázquez; Stahl-Hennig, Christiane; Sumida, Noriyuki; Persson, Mats A.A.; Martin, Marcel; Hedestam, Gunilla B. Karlsson

2016-01-01

Comprehensive knowledge of immunoglobulin genetics is required to advance our understanding of B cell biology. Validated immunoglobulin variable (V) gene databases are close to completion only for human and mouse. We present a novel computational approach, IgDiscover, that identifies germline V genes from expressed repertoires to a specificity of 100%. IgDiscover uses a cluster identification process to produce candidate sequences that, once filtered, results in individualized germline V gene databases. IgDiscover was tested in multiple species, validated by genomic cloning and cross library comparisons and produces comprehensive gene databases even where limited genomic sequence is available. IgDiscover analysis of the allelic content of the Indian and Chinese-origin rhesus macaques reveals high levels of immunoglobulin gene diversity in this species. Further, we describe a novel human IGHV3-21 allele and confirm significant gene differences between Balb/c and C57BL6 mouse strains, demonstrating the power of IgDiscover as a germline V gene discovery tool. PMID:27995928

Isolation and characterization of multiple F-box genes linked to the S9- and S10-RNase in apple (Malus × domestica Borkh.).

PubMed

Okada, Kazuma; Moriya, Shigeki; Haji, Takashi; Abe, Kazuyuki

2013-06-01

Using 11 consensus primer pairs designed from S-linked F-box genes of apple and Japanese pear, 10 new F-box genes (MdFBX21 to 30) were isolated from the apple cultivar 'Spartan' (S(9)S(10)). MdFBX21 to 23 and MdFBX24 to 30 were completely linked to the S(9) -RNase and S(10-)RNase, respectively, and showed pollen-specific expression and S-haplotype-specific polymorphisms. Therefore, these 10 F-box genes are good candidates for the pollen determinant of self-incompatibility in apple. Phylogenetic analysis and comparison of deduced amino acid sequences of MdFBX21 to 30 with those of 25 S-linked F-box genes previously isolated from apple showed that a deduced amino acid identity of greater than 88.0 % can be used as the tentative criterion to classify F-box genes into one type. Using this criterion, 31 of 35 F-box genes of apple were classified into 11 types (SFBB1-11). All types included F-box genes derived from S(3-) and S(9-)haplotypes, and seven types included F-box genes derived from S(3-), S(9-), and S(10-)haplotypes. Moreover, comparison of nucleotide sequences of S-RNases and multiple F-box genes among S(3-), S(9-), and S(10-)haplotypes suggested that F-box genes within each type showed high nucleotide identity regardless of the identity of the S-RNase. The large number of F-box genes as candidates for the pollen determinant and the high degree of conservation within each type are consistent with the collaborative non-self-recognition model reported for Petunia. These findings support that the collaborative non-self-recognition system also exists in apple.

The human myelin oligodendrocyte glycoprotein (MOG) gene: Complete nucleotide sequence and structural characterization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Paule Roth, M.; Malfroy, L.; Offer, C.

1995-07-20

Human myelin oligodendrocyte glycoprotein (MOG), a myelin component of the central nervous system, is a candidate target antigen for autoimmune-mediated demyelination. We have isolated and sequenced part of a cosmid clone that contains the entire human MOG gene. The primary nuclear transcript, extending from the putative start of transcription to the site of poly(A) addition, is 15,561 nucleotides in length. The human MOG gene contains 8 exons, separated by 7 introns; canonical intron/exon boundary sites are observed at each junction. The introns vary in size from 242 to 6484 bp and contain numerous repetitive DNA elements, including 14 Alu sequencesmore » within 3 introns. Another Alu element is located in the 3{prime}-untranslated region of the gene. Alu sequences were classified with respect to subfamily assignment. Seven hundred sixty-three nucleotides 5{prime} of the transcription start and 1214 nucleotides 3{prime} of the poly(A) addition sites were also sequenced. The 5{prime}-flanking region revealed the presence of several consensus sequences that could be relevant in the transcription of the MOG gene, in particular binding sites in common with other myelin gene promoters. Two polymorphic intragenic dinucleotide (CA){sub n} and tetranucleotide (TAAA){sub n} repeats were identified and may provide genetic marker tools for association and linkage studies. 50 refs., 3 figs., 3 tabs.« less

Multiple-strand displacement and identification of single nucleotide polymorphisms as markers of genotypic variation of Pasteuria penetrans biotypes infecting root-knot nematodes.

PubMed

Nong, Guang; Chow, Virginia; Schmidt, Liesbeth M; Dickson, Don W; Preston, James F

2007-08-01

Pasteuria species are endospore-forming obligate bacterial parasites of soil-inhabiting nematodes and water-inhabiting cladocerans, e.g. water fleas, and are closely related to Bacillus spp. by 16S rRNA gene sequence. As naturally occurring bacteria, biotypes of Pasteuria penetrans are attractive candidates for the biocontrol of various Meloidogyne spp. (root-knot nematodes). Failure to culture these bacteria outside their hosts has prevented isolation of genomic DNA in quantities sufficient for identification of genes associated with host recognition and virulence. We have applied multiple-strand displacement amplification (MDA) to generate DNA for comparative genomics of biotypes exhibiting different host preferences. Using the genome of Bacillus subtilis as a paradigm, MDA allowed quantitative detection and sequencing of 12 marker genes from 2000 cells. Meloidogyne spp. infected with P. penetrans P20 or B4 contained single nucleotide polymorphisms (SNPs) in the spoIIAB gene that did not change the amino acid sequence, or that substituted amino acids with similar chemical properties. Individual nematodes infected with P. penetrans P20 or B4 contained SNPs in the spoIIAB gene sequenced in MDA-generated products. Detection of SNPs in the spoIIAB gene in a nematode indicates infection by more than one genotype, supporting the need to sequence genomes of Pasteuria spp. derived from single spore isolates.

QTL-seq for rapid identification of candidate genes for flowering time in broccoli × cabbage.

PubMed

Shu, Jinshuai; Liu, Yumei; Zhang, Lili; Li, Zhansheng; Fang, Zhiyuan; Yang, Limei; Zhuang, Mu; Zhang, Yangyong; Lv, Honghao

2018-04-01

A major QTL controlling early flowering in broccoli × cabbage was identified by marker analysis and next-generation sequencing, corresponding to GRF6 gene conditioning flowering time in Arabidopsis. Flowering is an important agronomic trait for hybrid production in broccoli and cabbage, but the genetic mechanism underlying this process is unknown. In this study, segregation analysis with BC 1 P1, BC 1 P2, F 2 , and F 2:3 populations derived from a cross between two inbred lines "195" (late-flowering) and "93219" (early flowering) suggested that flowering time is a quantitative trait. Next, employing a next-generation sequencing-based whole-genome QTL-seq strategy, we identified a major genomic region harboring a robust flowering time QTL using an F 2 mapping population, designated Ef2.1 on cabbage chromosome 2 for early flowering. Ef2.1 was further validated by indel (insertion or deletion) marker-based classical QTL mapping, explaining 51.5% (LOD = 37.67) and 54.0% (LOD = 40.5) of the phenotypic variation in F 2 and F 2:3 populations, respectively. Combined QTL-seq and classical QTL analysis narrowed down Ef1.1 to a 228-kb genomic region containing 29 genes. A cabbage gene, Bol024659, was identified in this region, which is a homolog of GRF6, a major gene regulating flowering in Arabidopsis, and was designated BolGRF6. qRT-PCR study of the expression level of BolGRF6 revealed significantly higher expression in the early flowering genotypes. Taken together, our results provide support for BolGRF6 as a possible candidate gene for early flowering in the broccoli line 93219. The identified candidate genomic regions and genes may be useful for molecular breeding to improve broccoli and cabbage flowering times.

Whole-exome sequencing identifies USH2A mutations in a pseudo-dominant Usher syndrome family.

PubMed

Zheng, Sui-Lian; Zhang, Hong-Liang; Lin, Zhen-Lang; Kang, Qian-Yan

2015-10-01

Usher syndrome (USH) is an autosomal recessive (AR) multi-sensory degenerative disorder leading to deaf-blindness. USH is clinically subdivided into three subclasses, and 10 genes have been identified thus far. Clinical and genetic heterogeneities in USH make a precise diagnosis difficult. A dominant‑like USH family in successive generations was identified, and the present study aimed to determine the genetic predisposition of this family. Whole‑exome sequencing was performed in two affected patients and an unaffected relative. Systematic data were analyzed by bioinformatic analysis to remove the candidate mutations via step‑wise filtering. Direct Sanger sequencing and co‑segregation analysis were performed in the pedigree. One novel and two known mutations in the USH2A gene were identified, and were further confirmed by direct sequencing and co‑segregation analysis. The affected mother carried compound mutations in the USH2A gene, while the unaffected father carried a heterozygous mutation. The present study demonstrates that whole‑exome sequencing is a robust approach for the molecular diagnosis of disorders with high levels of genetic heterogeneity.

HomSI: a homozygous stretch identifier from next-generation sequencing data.

PubMed

Görmez, Zeliha; Bakir-Gungor, Burcu; Sagiroglu, Mahmut Samil

2014-02-01

In consanguineous families, as a result of inheriting the same genomic segments through both parents, the individuals have stretches of their genomes that are homozygous. This situation leads to the prevalence of recessive diseases among the members of these families. Homozygosity mapping is based on this observation, and in consanguineous families, several recessive disease genes have been discovered with the help of this technique. The researchers typically use single nucleotide polymorphism arrays to determine the homozygous regions and then search for the disease gene by sequencing the genes within this candidate disease loci. Recently, the advent of next-generation sequencing enables the concurrent identification of homozygous regions and the detection of mutations relevant for diagnosis, using data from a single sequencing experiment. In this respect, we have developed a novel tool that identifies homozygous regions using deep sequence data. Using *.vcf (variant call format) files as an input file, our program identifies the majority of homozygous regions found by microarray single nucleotide polymorphism genotype data. HomSI software is freely available at www.igbam.bilgem.tubitak.gov.tr/softwares/HomSI, with an online manual.

Annotating novel genes by integrating synthetic lethals and genomic information

PubMed Central

Schöner, Daniel; Kalisch, Markus; Leisner, Christian; Meier, Lukas; Sohrmann, Marc; Faty, Mahamadou; Barral, Yves; Peter, Matthias; Gruissem, Wilhelm; Bühlmann, Peter

2008-01-01

Background Large scale screening for synthetic lethality serves as a common tool in yeast genetics to systematically search for genes that play a role in specific biological processes. Often the amounts of data resulting from a single large scale screen far exceed the capacities of experimental characterization of every identified target. Thus, there is need for computational tools that select promising candidate genes in order to reduce the number of follow-up experiments to a manageable size. Results We analyze synthetic lethality data for arp1 and jnm1, two spindle migration genes, in order to identify novel members in this process. To this end, we use an unsupervised statistical method that integrates additional information from biological data sources, such as gene expression, phenotypic profiling, RNA degradation and sequence similarity. Different from existing methods that require large amounts of synthetic lethal data, our method merely relies on synthetic lethality information from two single screens. Using a Multivariate Gaussian Mixture Model, we determine the best subset of features that assign the target genes to two groups. The approach identifies a small group of genes as candidates involved in spindle migration. Experimental testing confirms the majority of our candidates and we present she1 (YBL031W) as a novel gene involved in spindle migration. We applied the statistical methodology also to TOR2 signaling as another example. Conclusion We demonstrate the general use of Multivariate Gaussian Mixture Modeling for selecting candidate genes for experimental characterization from synthetic lethality data sets. For the given example, integration of different data sources contributes to the identification of genetic interaction partners of arp1 and jnm1 that play a role in the same biological process. PMID:18194531

CRAWview: for viewing splicing variation, gene families, and polymorphism in clusters of ESTs and full-length sequences.

PubMed

Chou, A; Burke, J

1999-05-01

DNA sequence clustering has become a valuable method in support of gene discovery and gene expression analysis. Our interest lies in leveraging the sequence diversity within clusters of expressed sequence tags (ESTs) to model gene structure for the study of gene variants that arise from, among other things, alternative mRNA splicing, polymorphism, and divergence after gene duplication, fusion, and translocation events. In previous work, CRAW was developed to discover gene variants from assembled clusters of ESTs. Most importantly, novel gene features (the differing units between gene variants, for example alternative exons, polymorphisms, transposable elements, etc.) that are specialized to tissue, disease, population, or developmental states can be identified when these tools collate DNA source information with gene variant discrimination. While the goal is complete automation of novel feature and gene variant detection, current methods are far from perfect and hence the development of effective tools for visualization and exploratory data analysis are of paramount importance in the process of sifting through candidate genes and validating targets. We present CRAWview, a Java based visualization extension to CRAW. Features that vary between gene forms are displayed using an automatically generated color coded index. The reporting format of CRAWview gives a brief, high level summary report to display overlap and divergence within clusters of sequences as well as the ability to 'drill down' and see detailed information concerning regions of interest. Additionally, the alignment viewing and editing capabilities of CRAWview make it possible to interactively correct frame-shifts and otherwise edit cluster assemblies. We have implemented CRAWview as a Java application across windows NT/95 and UNIX platforms. A beta version of CRAWview will be freely available to academic users from Pangea Systems (http://www.pangeasystems.com). Contact :

Structure and variation of three canine genes involved in serotonin binding and transport: the serotonin receptor 1A gene (htr1A), serotonin receptor 2A gene (htr2A), and serotonin transporter gene (slc6A4).

PubMed

van den Berg, L; Kwant, L; Hestand, M S; van Oost, B A; Leegwater, P A J

2005-01-01

Aggressive behavior is the most frequently encountered behavioral problem in dogs. Abnormalities in brain serotonin metabolism have been described in aggressive dogs. We studied canine serotonergic genes to investigate genetic factors underlying canine aggression. Here, we describe the characterization of three genes of the canine serotonergic system: the serotonin receptor 1A and 2A gene (htr1A and htr2A) and the serotonin transporter gene (slc6A4). We isolated canine bacterial artificial chromosome clones containing these genes and designed oligonucleotides for genomic sequencing of coding regions and intron-exon boundaries. Golden retrievers were analyzed for DNA sequence variations. We found two nonsynonymous single nucleotide polymorphisms (SNPs) in the coding sequence of htr1A; one SNP close to a splice site in htr2A; and two SNPs in slc6A4, one in the coding sequence and one close to a splice site. In addition, we identified a polymorphic microsatellite marker for each gene. Htr1A is a strong candidate for involvement in the domestication of the dog. We genotyped the htr1A SNPs in 41 dogs of seven breeds with diverse behavioral characteristics. At least three SNP haplotypes were found. Our results do not support involvement of the gene in domestication.

Genomic Diversity of Burkholderia pseudomallei Clinical Isolates: Subtractive Hybridization Reveals a Burkholderia mallei-Specific Propage in B. pseudomallei 1026b

DTIC Science & Technology

2004-06-01

identification of several new virulence gene candidates. In particular, K96243 harbors multiple genomic islands with relatively low GC contents, suggesting...coli, Streptococcus pyogenes, Staphylococcus aureus, S. enterica, and Xylella fastidiosa (11, 16, 17). The genomic sequencing results for multiple... virulence genes by subtractive hybridization: identifica- tion of capsular polysaccharide of Burkholderia pseudomallei as a major virulence determinant

Computational evaluation of exome sequence data using human and model organism phenotypes improves diagnostic efficiency

PubMed Central

Bone, William P.; Washington, Nicole L.; Buske, Orion J.; Adams, David R.; Davis, Joie; Draper, David; Flynn, Elise D.; Girdea, Marta; Godfrey, Rena; Golas, Gretchen; Groden, Catherine; Jacobsen, Julius; Köhler, Sebastian; Lee, Elizabeth M. J.; Links, Amanda E.; Markello, Thomas C.; Mungall, Christopher J.; Nehrebecky, Michele; Robinson, Peter N.; Sincan, Murat; Soldatos, Ariane G.; Tifft, Cynthia J.; Toro, Camilo; Trang, Heather; Valkanas, Elise; Vasilevsky, Nicole; Wahl, Colleen; Wolfe, Lynne A.; Boerkoel, Cornelius F.; Brudno, Michael; Haendel, Melissa A.; Gahl, William A.; Smedley, Damian

2016-01-01

Purpose: Medical diagnosis and molecular or biochemical confirmation typically rely on the knowledge of the clinician. Although this is very difficult in extremely rare diseases, we hypothesized that the recording of patient phenotypes in Human Phenotype Ontology (HPO) terms and computationally ranking putative disease-associated sequence variants improves diagnosis, particularly for patients with atypical clinical profiles. Genet Med 18 6, 608–617. Methods: Using simulated exomes and the National Institutes of Health Undiagnosed Diseases Program (UDP) patient cohort and associated exome sequence, we tested our hypothesis using Exomiser. Exomiser ranks candidate variants based on patient phenotype similarity to (i) known disease–gene phenotypes, (ii) model organism phenotypes of candidate orthologs, and (iii) phenotypes of protein–protein association neighbors. Genet Med 18 6, 608–617. Results: Benchmarking showed Exomiser ranked the causal variant as the top hit in 97% of known disease–gene associations and ranked the correct seeded variant in up to 87% when detectable disease–gene associations were unavailable. Using UDP data, Exomiser ranked the causative variant(s) within the top 10 variants for 11 previously diagnosed variants and achieved a diagnosis for 4 of 23 cases undiagnosed by clinical evaluation. Genet Med 18 6, 608–617. Conclusion: Structured phenotyping of patients and computational analysis are effective adjuncts for diagnosing patients with genetic disorders. Genet Med 18 6, 608–617. PMID:26562225

Whole genome sequencing of turbot (Scophthalmus maximus; Pleuronectiformes): a fish adapted to demersal life

PubMed Central

Figueras, Antonio; Robledo, Diego; Corvelo, André; Hermida, Miguel; Pereiro, Patricia; Rubiolo, Juan A.; Gómez-Garrido, Jèssica; Carreté, Laia; Bello, Xabier; Gut, Marta; Gut, Ivo Glynne; Marcet-Houben, Marina; Forn-Cuní, Gabriel; Galán, Beatriz; García, José Luis; Abal-Fabeiro, José Luis; Pardo, Belen G.; Taboada, Xoana; Fernández, Carlos; Vlasova, Anna; Hermoso-Pulido, Antonio; Guigó, Roderic; Álvarez-Dios, José Antonio; Gómez-Tato, Antonio; Viñas, Ana; Maside, Xulio; Gabaldón, Toni; Novoa, Beatriz; Bouza, Carmen; Alioto, Tyler; Martínez, Paulino

2016-01-01

The turbot is a flatfish (Pleuronectiformes) with increasing commercial value, which has prompted active genomic research aimed at more efficient selection. Here we present the sequence and annotation of the turbot genome, which represents a milestone for both boosting breeding programmes and ascertaining the origin and diversification of flatfish. We compare the turbot genome with model fish genomes to investigate teleost chromosome evolution. We observe a conserved macrosyntenic pattern within Percomorpha and identify large syntenic blocks within the turbot genome related to the teleost genome duplication. We identify gene family expansions and positive selection of genes associated with vision and metabolism of membrane lipids, which suggests adaptation to demersal lifestyle and to cold temperatures, respectively. Our data indicate a quick evolution and diversification of flatfish to adapt to benthic life and provide clues for understanding their controversial origin. Moreover, we investigate the genomic architecture of growth, sex determination and disease resistance, key traits for understanding local adaptation and boosting turbot production, by mapping candidate genes and previously reported quantitative trait loci. The genomic architecture of these productive traits has allowed the identification of candidate genes and enriched pathways that may represent useful information for future marker-assisted selection in turbot. PMID:26951068

Whole genome sequencing of turbot (Scophthalmus maximus; Pleuronectiformes): a fish adapted to demersal life.

PubMed

Figueras, Antonio; Robledo, Diego; Corvelo, André; Hermida, Miguel; Pereiro, Patricia; Rubiolo, Juan A; Gómez-Garrido, Jèssica; Carreté, Laia; Bello, Xabier; Gut, Marta; Gut, Ivo Glynne; Marcet-Houben, Marina; Forn-Cuní, Gabriel; Galán, Beatriz; García, José Luis; Abal-Fabeiro, José Luis; Pardo, Belen G; Taboada, Xoana; Fernández, Carlos; Vlasova, Anna; Hermoso-Pulido, Antonio; Guigó, Roderic; Álvarez-Dios, José Antonio; Gómez-Tato, Antonio; Viñas, Ana; Maside, Xulio; Gabaldón, Toni; Novoa, Beatriz; Bouza, Carmen; Alioto, Tyler; Martínez, Paulino

2016-06-01

The turbot is a flatfish (Pleuronectiformes) with increasing commercial value, which has prompted active genomic research aimed at more efficient selection. Here we present the sequence and annotation of the turbot genome, which represents a milestone for both boosting breeding programmes and ascertaining the origin and diversification of flatfish. We compare the turbot genome with model fish genomes to investigate teleost chromosome evolution. We observe a conserved macrosyntenic pattern within Percomorpha and identify large syntenic blocks within the turbot genome related to the teleost genome duplication. We identify gene family expansions and positive selection of genes associated with vision and metabolism of membrane lipids, which suggests adaptation to demersal lifestyle and to cold temperatures, respectively. Our data indicate a quick evolution and diversification of flatfish to adapt to benthic life and provide clues for understanding their controversial origin. Moreover, we investigate the genomic architecture of growth, sex determination and disease resistance, key traits for understanding local adaptation and boosting turbot production, by mapping candidate genes and previously reported quantitative trait loci. The genomic architecture of these productive traits has allowed the identification of candidate genes and enriched pathways that may represent useful information for future marker-assisted selection in turbot. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

Genetic investigation of 93 families with microphthalmia or posterior microphthalmos.

PubMed

Patel, N; Khan, A O; Alsahli, S; Abdel-Salam, G; Nowilaty, S R; Mansour, A M; Nabil, A; Al-Owain, M; Sogati, S; Salih, M A; Kamal, A M; Alsharif, H; Alsaif, H S; Alzahrani, S S; Abdulwahab, F; Ibrahim, N; Hashem, M; Faquih, T; Shah, Z A; Abouelhoda, M; Monies, D; Dasouki, M; Shaheen, R; Wakil, S M; Aldahmesh, M A; Alkuraya, F S

2018-06-01

Microphthalmia is a developmental eye defect that is highly variable in severity and in its potential for systemic association. Despite the discovery of many disease genes in microphthalmia, at least 50% of patients remain undiagnosed genetically. Here, we describe a cohort of 147 patients (93 families) from our highly consanguineous population with various forms of microphthalmia (including the distinct entity of posterior microphthalmos) that were investigated using a next-generation sequencing multi-gene panel (i-panel) as well as whole exome sequencing and molecular karyotyping. A potentially causal mutation was identified in the majority of the cohort with microphthalmia (61%) and posterior microphthalmos (82%). The identified mutations (55 point mutations, 15 of which are novel) spanned 24 known disease genes, some of which have not or only very rarely been linked to microphthalmia (PAX6, SLC18A2, DSC3 and CNKSR1). Our study has also identified interesting candidate variants in 2 genes that have not been linked to human diseases (MYO10 and ZNF219), which we present here as novel candidates for microphthalmia. In addition to revealing novel phenotypic aspects of microphthalmia, this study expands its allelic and locus heterogeneity and highlights the need for expanded testing of patients with this condition. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Systematic screening of isogenic cancer cells identifies DUSP6 as context-specific synthetic lethal target in melanoma

PubMed Central

Wittig-Blaich, Stephanie; Wittig, Rainer; Schmidt, Steffen; Lyer, Stefan; Bewerunge-Hudler, Melanie; Gronert-Sum, Sabine; Strobel-Freidekind, Olga; Müller, Carolin; List, Markus; Jaskot, Aleksandra; Christiansen, Helle; Hafner, Mathias; Schadendorf, Dirk; Block, Ines; Mollenhauer, Jan

2017-01-01

Next-generation sequencing has dramatically increased genome-wide profiling options and conceptually initiates the possibility for personalized cancer therapy. State-of-the-art sequencing studies yield large candidate gene sets comprising dozens or hundreds of mutated genes. However, few technologies are available for the systematic downstream evaluation of these results to identify novel starting points of future cancer therapies. We improved and extended a site-specific recombination-based system for systematic analysis of the individual functions of a large number of candidate genes. This was facilitated by a novel system for the construction of isogenic constitutive and inducible gain- and loss-of-function cell lines. Additionally, we demonstrate the construction of isogenic cell lines with combinations of the traits for advanced functional in vitro analyses. In a proof-of-concept experiment, a library of 108 isogenic melanoma cell lines was constructed and 8 genes were identified that significantly reduced viability in a discovery screen and in an independent validation screen. Here, we demonstrate the broad applicability of this recombination-based method and we proved its potential to identify new drug targets via the identification of the tumor suppressor DUSP6 as potential synthetic lethal target in melanoma cell lines with BRAF V600E mutations and high DUSP6 expression. PMID:28423600

X-linked intellectual disability update 2017.

PubMed

Neri, Giovanni; Schwartz, Charles E; Lubs, Herbert A; Stevenson, Roger E

2018-04-25

The X-chromosome comprises only about 5% of the human genome but accounts for about 15% of the genes currently known to be associated with intellectual disability. The early progress in identifying the X-linked intellectual disability (XLID)-associated genes through linkage analysis and candidate gene sequencing has been accelerated with the use of high-throughput technologies. In the 10 years since the last update, the number of genes associated with XLID has increased by 96% from 72 to 141 and duplications of all 141 XLID genes have been described, primarily through the application of high-resolution microarrays and next generation sequencing. The progress in identifying genetic and genomic alterations associated with XLID has not been matched with insights that improve the clinician's ability to form differential diagnoses, that bring into view the possibility of curative therapies for patients, or that inform scientists of the impact of the genetic alterations on cell organization and function. © 2018 Wiley Periodicals, Inc.

Molecular cloning and expression analysis of annexin A2 gene in sika deer antler tip.

PubMed

Xia, Yanling; Qu, Haomiao; Lu, Binshan; Zhang, Qiang; Li, Heping

2018-04-01

Molecular cloning and bioinformatics analysis of annexin A2 ( ANXA2 ) gene in sika deer antler tip were conducted. The role of ANXA2 gene in the growth and development of the antler were analyzed initially. The reverse transcriptase polymerase chain reaction (RT-PCR) was used to clone the cDNA sequence of the ANXA2 gene from antler tip of sika deer ( Cervus Nippon hortulorum ) and the bioinformatics methods were applied to analyze the amino acid sequence of Anxa2 protein. The mRNA expression levels of the ANXA2 gene in different growth stages were examined by real time reverse transcriptase polymerase chain reaction (real time RT-PCR). The nucleotide sequence analysis revealed an open reading frame of 1,020 bp encoding 339 amino acids long protein of calculated molecular weight 38.6 kDa and isoelectric point 6.09. Homologous sequence alignment and phylogenetic analysis indicated that the Anxa2 mature protein of sika deer had the closest genetic distance with Cervus elaphus and Bos mutus . Real time RT-PCR results showed that the gene had differential expression levels in different growth stages, and the expression level of the ANXA2 gene was the highest at metaphase (rapid growing period). ANXA2 gene may promote the cell proliferation, and the finding suggested Anxa2 as an important candidate for regulating the growth and development of deer antler.

Identification and characterization of two bisabolene synthases from linear glandular trichomes of sunflower (Helianthus annuus L., Asteraceae).

PubMed

Aschenbrenner, Anna-Katharina; Kwon, Moonhyuk; Conrad, Jürgen; Ro, Dae-Kyun; Spring, Otmar

2016-04-01

Sunflower is known to produce a variety of bisabolene-type sesquiterpenes and accumulates these substances in trichomes of leaves, stems and flowering parts. A bioinformatics approach was used to identify the enzyme responsible for the initial step in the biosynthesis of these compounds from its precursor farnesyl pyrophosphate. Based on sequence similarity with a known bisabolene synthases from Arabidopsis thaliana AtTPS12, candidate genes of Helianthus were searched in EST-database and used to design specific primers. PCR experiments identified two candidates in the RNA pool of linear glandular trichomes of sunflower. Their sequences contained the typical motifs of sesquiterpene synthases and their expression in yeast functionally characterized them as bisabolene synthases. Spectroscopic analysis identified the stereochemistry of the product of both enzymes as (Z)-γ-bisabolene. The origin of the two sunflower bisabolene synthase genes from the transcripts of linear trichomes indicates that they may be involved in the synthesis of sesquiterpenes produced in these trichomes. Comparison of the amino acid sequences of the sunflower bisabolene synthases showed high similarity with sesquiterpene synthases from other Asteracean species and indicated putative evolutionary origin from a β-farnesene synthase. Copyright © 2016 Elsevier Ltd. All rights reserved.

Germline transformation of the butterfly Bicyclus anynana.

PubMed

Marcus, Jeffrey M; Ramos, Diane M; Monteiro, Antónia

2004-08-07

Ecological and evolutionary theory has frequently been inspired by the diversity of colour patterns on the wings of butterflies. More recently, these varied patterns have also become model systems for studying the evolution of developmental mechanisms. A technique that will facilitate our understanding of butterfly colour-pattern development is germline transformation. Germline transformation permits functional tests of candidate gene products and of cis-regulatory regions, and provides a means of generating new colour-pattern mutants by insertional mutagenesis. We report the successful transformation of the African satyrid butterfly Bicyclus anynana with two different transposable element vectors, Hermes and piggyBac, each carrying EGFP coding sequences driven by the 3XP3 synthetic enhancer that drives gene expression in the eyes. Candidate lines identified by screening for EGFP in adult eyes were later confirmed by PCR amplification of a fragment of the EGFP coding sequence from genomic DNA. Flanking DNA surrounding the insertions was amplified by inverse PCR and sequenced. Transformation rates were 5% for piggyBac and 10.2% for Hermes. Ultimately, the new data generated by these techniques may permit an integrated understanding of the developmental genetics of colour-pattern formation and of the ecological and evolutionary processes in which these patterns play a role.

Identification of Small RNAs in Desulfovibrio vulgaris Hildenborough

DOE Office of Scientific and Technical Information (OSTI.GOV)

Burns, Andrew; Joachimiak, Marcin; Deutschbauer, Adam

2010-05-17

Desulfovibrio vulgaris is an anaerobic sulfate-reducing bacterium capable of facilitating the removal of toxic metals such as uranium from contaminated sites via reduction. As such, it is essential to understand the intricate regulatory cascades involved in how D. vulgaris and its relatives respond to stressors in such sites. One approach is the identification and analysis of small non-coding RNAs (sRNAs); molecules ranging in size from 20-200 nucleotides that predominantly affect gene regulation by binding to complementary mRNA in an anti-sense fashion and therefore provide an immediate regulatory response. To identify sRNAs in D. vulgaris, a bacterium that does not possessmore » an annotated hfq gene, RNA was pooled from stationary and exponential phases, nitrate exposure, and biofilm conditions. The subsequent RNA was size fractionated, modified, and converted to cDNA for high throughput transcriptomic deep sequencing. A computational approach to identify sRNAs via the alignment of seven separate Desulfovibrio genomes was also performed. From the deep sequencing analysis, 2,296 reads between 20 and 250 nt were identified with expression above genome background. Analysis of those reads limited the number of candidates to ~;;87 intergenic, while ~;;140 appeared to be antisense to annotated open reading frames (ORFs). Further BLAST analysis of the intergenic candidates and other Desulfovibrio genomes indicated that eight candidates were likely portions of ORFs not previously annotated in the D. vulgaris genome. Comparison of the intergenic and antisense data sets to the bioinformatical predicted candidates, resulted in ~;;54 common candidates. Current approaches using Northern analysis and qRT-PCR are being used toverify expression of the candidates and to further develop the role these sRNAs play in D. vulgaris regulation.« less

Candidate Luminal B Breast Cancer Genes Identified by Genome, Gene Expression and DNA Methylation Profiling

PubMed Central

Addou-Klouche, Lynda; Finetti, Pascal; Saade, Marie-Rose; Manai, Marwa; Carbuccia, Nadine; Bekhouche, Ismahane; Letessier, Anne; Charafe-Jauffret, Emmanuelle; Jacquemier, Jocelyne; Spicuglia, Salvatore; de The, Hugues; Viens, Patrice; Bertucci, François; Birnbaum, Daniel; Chaffanet, Max

2014-01-01

Breast cancers (BCs) of the luminal B subtype are estrogen receptor-positive (ER+), highly proliferative, resistant to standard therapies and have a poor prognosis. To better understand this subtype we compared DNA copy number aberrations (CNAs), DNA promoter methylation, gene expression profiles, and somatic mutations in nine selected genes, in 32 luminal B tumors with those observed in 156 BCs of the other molecular subtypes. Frequent CNAs included 8p11-p12 and 11q13.1-q13.2 amplifications, 7q11.22-q34, 8q21.12-q24.23, 12p12.3-p13.1, 12q13.11-q24.11, 14q21.1-q23.1, 17q11.1-q25.1, 20q11.23-q13.33 gains and 6q14.1-q24.2, 9p21.3-p24,3, 9q21.2, 18p11.31-p11.32 losses. A total of 237 and 101 luminal B-specific candidate oncogenes and tumor suppressor genes (TSGs) presented a deregulated expression in relation with their CNAs, including 11 genes previously reported associated with endocrine resistance. Interestingly, 88% of the potential TSGs are located within chromosome arm 6q, and seven candidate oncogenes are potential therapeutic targets. A total of 100 candidate oncogenes were validated in a public series of 5,765 BCs and the overexpression of 67 of these was associated with poor survival in luminal tumors. Twenty-four genes presented a deregulated expression in relation with a high DNA methylation level. FOXO3, PIK3CA and TP53 were the most frequent mutated genes among the nine tested. In a meta-analysis of next-generation sequencing data in 875 BCs, KCNB2 mutations were associated with luminal B cases while candidate TSGs MDN1 (6q15) and UTRN (6q24), were mutated in this subtype. In conclusion, we have reported luminal B candidate genes that may play a role in the development and/or hormone resistance of this aggressive subtype. PMID:24416132

Refinement of the X-linked cataract locus (CXN) and gene analysis for CXN and Nance-Horan syndrome (NHS).

PubMed

Brooks, Simon; Ebenezer, Neil; Poopalasundaram, Subathra; Maher, Eamonn; Francis, Peter; Moore, Anthony; Hardcastle, Alison

2004-06-01

The X-linked congenital cataract (CXN) locus has been mapped to a 3-cM (approximately 3.5 Mb) interval on chromosome Xp22.13, which is syntenic to the mouse cataract disease locus Xcat and encompasses the recently refined Nance-Horan syndrome (NHS) locus. A positional cloning strategy has been adopted to identify the causative gene. In an attempt to refine the CXN locus, seven microsatellites were analysed within 21 individuals of a CXN family. Haplotypes were reconstructed confirming disease segregation with markers on Xp22.13. In addition, a proximal cross-over was observed between markers S3 and S4, thereby refining the CXN disease interval by approximately 400 Kb to 3.2 Mb, flanked by markers DXS9902 and S4. Two known genes (RAI2 and RBBP7) and a novel gene (TL1) were screened for mutations within an affected male from the CXN family and an NHS family by direct sequencing of coding exons and intron- exon splice sites. No mutations or polymorphisms were identified, therefore excluding them as disease-causative in CXN and NHS. In conclusion, the CXN locus has been successfully refined and excludes PPEF1 as a candidate gene. A further three candidates were excluded based on sequence analysis. Future positional cloning efforts will focus on the region of overlap between CXN, Xcat, and NHS.

Adaptive genomic divergence under high gene flow between freshwater and brackish-water ecotypes of prickly sculpin (Cottus asper) revealed by Pool-Seq.

PubMed

Dennenmoser, Stefan; Vamosi, Steven M; Nolte, Arne W; Rogers, Sean M

2017-01-01

Understanding the genomic basis of adaptive divergence in the presence of gene flow remains a major challenge in evolutionary biology. In prickly sculpin (Cottus asper), an abundant euryhaline fish in northwestern North America, high genetic connectivity among brackish-water (estuarine) and freshwater (tributary) habitats of coastal rivers does not preclude the build-up of neutral genetic differentiation and emergence of different life history strategies. Because these two habitats present different osmotic niches, we predicted high genetic differentiation at known teleost candidate genes underlying salinity tolerance and osmoregulation. We applied whole-genome sequencing of pooled DNA samples (Pool-Seq) to explore adaptive divergence between two estuarine and two tributary habitats. Paired-end sequence reads were mapped against genomic contigs of European Cottus, and the gene content of candidate regions was explored based on comparisons with the threespine stickleback genome. Genes showing signals of repeated differentiation among brackish-water and freshwater habitats included functions such as ion transport and structural permeability in freshwater gills, which suggests that local adaptation to different osmotic niches might contribute to genomic divergence among habitats. Overall, the presence of both repeated and unique signatures of differentiation across many loci scattered throughout the genome is consistent with polygenic adaptation from standing genetic variation and locally variable selection pressures in the early stages of life history divergence. © 2016 John Wiley & Sons Ltd.

Structural analysis of the HLA-A/HLA-F subregion: Precise localization of two new multigene families closely associated with the HLA class I sequences

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pichon, L.; Carn, G.; Bouric, P.

1996-03-01

Positional cloning strategies for the hemochromatosis gene have previously concentrated on a target area restricted to a maximum genomic expanse of 400 kb around the HLA-A and HLA-F loci. Recently, the candidate region has been extended to 2-3 Mb on the distal side of the MHC. In this study, 10 coding sequences [hemochromatosis candidate genes (HCG) I to X] were isolated by cDNA selection using YACs covering the HLA-A/HLA-F subregion. Two of these (HCG II and HCG IV) belong to multigene families, as well as other sequences already described in this region, i.e., P5, pMC 6.7, and HLA class I.more » Fingerprinting of the four YACSs overlapping the region was performed and allowed partial localization of the different multigene family sequences on each YAC without defining their exact positions. Fingerprinting on cosmids isolated from the ICRF chromosome 6-specific cosmid library allowed more precise localization of the redundant sequences in all of the multigene families and revealed their apparent organization in clusters. Further examination of these intertwined sequences demonstrated that this structural organization resulted from a succession of complex phenomena, including duplications and contractions. This study presents a precise description of the structural organization of the HLA-A/HLA-F region and a determination of the sequences involved in the megabase size polymorphism observed among the A3, A24, and A31 haplotypes. 29 refs., 2 figs., 2 tabs.« less

Discovery of sex-related genes through high-throughput transcriptome sequencing from the salmon louse Caligus rogercresseyi.

PubMed

Farlora, Rodolfo; Araya-Garay, José; Gallardo-Escárate, Cristian

2014-06-01

Understanding the molecular underpinnings involved in the reproduction of the salmon louse is critical for designing novel strategies of pest management for this ectoparasite. However, genomic information on sex-related genes is still limited. In the present work, sex-specific gene transcription was revealed in the salmon louse Caligus rogercresseyi using high-throughput Illumina sequencing. A total of 30,191,914 and 32,292,250 high quality reads were generated for females and males, and these were de novo assembled into 32,173 and 38,177 contigs, respectively. Gene ontology analysis showed a pattern of higher expression in the female as compared to the male transcriptome. Based on our sequence analysis and known sex-related proteins, several genes putatively involved in sex differentiation, including Dmrt3, FOXL2, VASA, and FEM1, and other potentially significant candidate genes in C. rogercresseyi, were identified for the first time. In addition, the occurrence of SNPs in several differentially expressed contigs annotating for sex-related genes was found. This transcriptome dataset provides a useful resource for future functional analyses, opening new opportunities for sea lice pest control. Copyright © 2014 Elsevier B.V. All rights reserved.

Isolation and characterization of the human CDX1 gene: A candidate gene for diastrophic dysplasia

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bonner, C.; Loftus, S.; Wasmuth, J.J.

1994-09-01

Diastrophic dysplasia is an autosomal recessive disorder characterized by short stature, dislocation of the joints, spinal deformities and malformation of the hands and feet. Multipoint linkage analysis places the diastrophic dysplasia (DTD) locus in 5q31-5q34. Linkage disequilibrium mapping places the DTD locus near CSFIR in the direction of PDGFRB (which is tandem to CSFIR). This same study tentatively placed PDGFRB and DTD proximal to CSFIR. Our results, as well as recently reported work from other laboratories, suggest that PDGFRB (and possibly DTD) is distal rather than proximal to CSFIR. We have constructed a cosmid contig covering approximately 200 kb ofmore » the region containing CSFIR. Several exons have been {open_quotes}trapped{close_quotes} from these cosmids using exon amplification. One of these exons was trapped from a cosmid isolated from a walk from PDGFRB, approximately 80 kb from CSFIR. This exon was sequenced and was determined to be 89% identical to the nucleotide sequence of exon two of the murine CDX1 gene (100% amino acid identity). The exon was used to isolate the human CDX gene. Sequence analysis of the human CDX1 gene indicates a very high degree of homology to the murine gene. CDX1 is a caudal type homeobox gene expressed during gastrulation. In the mouse, expression during gastrulation begins in the primitive streak and subsequently localizes to the ectodermal and mesodermal cells of the primitive streak, neural tube, somites, and limb buds. Later in gastrulation, CDX1 expression becomes most prominent in the mesoderm of the forelimbs, and, to a lesser extent, the hindlimbs. CDX1 is an intriguing candidate gene for diastrophic dysplasia. We are currently screening DNA from affected individuals and hope to shortly determine whether CDX1 is involved in this disorder.« less

Fine-scale genetic mapping of a hybrid sterility factor between Drosophila simulans and D. mauritiana: the varied and elusive functions of "speciation genes".

PubMed

Araripe, Luciana O; Montenegro, Horácio; Lemos, Bernardo; Hartl, Daniel L

2010-12-14

Hybrid male sterility (HMS) is a usual outcome of hybridization between closely related animal species. It arises because interactions between alleles that are functional within one species may be disrupted in hybrids. The identification of genes leading to hybrid sterility is of great interest for understanding the evolutionary process of speciation. In the current work we used marked P-element insertions as dominant markers to efficiently locate one genetic factor causing a severe reduction in fertility in hybrid males of Drosophila simulans and D. mauritiana. Our mapping effort identified a region of 9 kb on chromosome 3, containing three complete and one partial coding sequences. Within this region, two annotated genes are suggested as candidates for the HMS factor, based on the comparative molecular characterization and public-source information. Gene Taf1 is partially contained in the region, but yet shows high polymorphism with four fixed non-synonymous substitutions between the two species. Its molecular functions involve sequence-specific DNA binding and transcription factor activity. Gene agt is a small, intronless gene, whose molecular function is annotated as methylated-DNA-protein-cysteine S-methyltransferase activity. High polymorphism and one fixed non-synonymous substitution suggest this is a fast evolving gene. The gene trees of both genes perfectly separate D. simulans and D. mauritiana into monophyletic groups. Analysis of gene expression using microarray revealed trends that were similar to those previously found in comparisons between whole-genome hybrids and parental species. The identification following confirmation of the HMS candidate gene will add another case study leading to understanding the evolutionary process of hybrid incompatibility.

PRGdb 3.0: a comprehensive platform for prediction and analysis of plant disease resistance genes.

PubMed

Osuna-Cruz, Cristina M; Paytuvi-Gallart, Andreu; Di Donato, Antimo; Sundesha, Vicky; Andolfo, Giuseppe; Aiese Cigliano, Riccardo; Sanseverino, Walter; Ercolano, Maria R

2018-01-04

The Plant Resistance Genes database (PRGdb; http://prgdb.org) has been redesigned with a new user interface, new sections, new tools and new data for genetic improvement, allowing easy access not only to the plant science research community but also to breeders who want to improve plant disease resistance. The home page offers an overview of easy-to-read search boxes that streamline data queries and directly show plant species for which data from candidate or cloned genes have been collected. Bulk data files and curated resistance gene annotations are made available for each plant species hosted. The new Gene Model view offers detailed information on each cloned resistance gene structure to highlight shared attributes with other genes. PRGdb 3.0 offers 153 reference resistance genes and 177 072 annotated candidate Pathogen Receptor Genes (PRGs). Compared to the previous release, the number of putative genes has been increased from 106 to 177 K from 76 sequenced Viridiplantae and algae genomes. The DRAGO 2 tool, which automatically annotates and predicts (PRGs) from DNA and amino acid with high accuracy and sensitivity, has been added. BLAST search has been implemented to offer users the opportunity to annotate and compare their own sequences. The improved section on plant diseases displays useful information linked to genes and genomes to connect complementary data and better address specific needs. Through, a revised and enlarged collection of data, the development of new tools and a renewed portal, PRGdb 3.0 engages the plant science community in developing a consensus plan to improve knowledge and strategies to fight diseases that afflict main crops and other plants. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

LNDriver: identifying driver genes by integrating mutation and expression data based on gene-gene interaction network.

PubMed

Wei, Pi-Jing; Zhang, Di; Xia, Junfeng; Zheng, Chun-Hou

2016-12-23

Cancer is a complex disease which is characterized by the accumulation of genetic alterations during the patient's lifetime. With the development of the next-generation sequencing technology, multiple omics data, such as cancer genomic, epigenomic and transcriptomic data etc., can be measured from each individual. Correspondingly, one of the key challenges is to pinpoint functional driver mutations or pathways, which contributes to tumorigenesis, from millions of functional neutral passenger mutations. In this paper, in order to identify driver genes effectively, we applied a generalized additive model to mutation profiles to filter genes with long length and constructed a new gene-gene interaction network. Then we integrated the mutation data and expression data into the gene-gene interaction network. Lastly, greedy algorithm was used to prioritize candidate driver genes from the integrated data. We named the proposed method Length-Net-Driver (LNDriver). Experiments on three TCGA datasets, i.e., head and neck squamous cell carcinoma, kidney renal clear cell carcinoma and thyroid carcinoma, demonstrated that the proposed method was effective. Also, it can identify not only frequently mutated drivers, but also rare candidate driver genes.

DNA sequence polymorphisms in a panel of eight candidate bovine imprinted genes and their association with performance traits in Irish Holstein-Friesian cattle.

PubMed

Magee, David A; Sikora, Klaudia M; Berkowicz, Erik W; Berry, Donagh P; Howard, Dawn J; Mullen, Michael P; Evans, Ross D; Spillane, Charles; MacHugh, David E

2010-10-13

Studies in mice and humans have shown that imprinted genes, whereby expression from one of the two parentally inherited alleles is attenuated or completely silenced, have a major effect on mammalian growth, metabolism and physiology. More recently, investigations in livestock species indicate that genes subject to this type of epigenetic regulation contribute to, or are associated with, several performance traits, most notably muscle mass and fat deposition. In the present study, a candidate gene approach was adopted to assess 17 validated single nucleotide polymorphisms (SNPs) and their association with a range of performance traits in 848 progeny-tested Irish Holstein-Friesian artificial insemination sires. These SNPs are located proximal to, or within, the bovine orthologs of eight genes (CALCR, GRB10, PEG3, PHLDA2, RASGRF1, TSPAN32, ZIM2 and ZNF215) that have been shown to be imprinted in cattle or in at least one other mammalian species (i.e. human/mouse/pig/sheep). Heterozygosities for all SNPs analysed ranged from 0.09 to 0.46 and significant deviations from Hardy-Weinberg proportions (P ≤ 0.01) were observed at four loci. Phenotypic associations (P ≤ 0.05) were observed between nine SNPs proximal to, or within, six of the eight analysed genes and a number of performance traits evaluated, including milk protein percentage, somatic cell count, culled cow and progeny carcass weight, angularity, body conditioning score, progeny carcass conformation, body depth, rump angle, rump width, animal stature, calving difficulty, gestation length and calf perinatal mortality. Notably, SNPs within the imprinted paternally expressed gene 3 (PEG3) gene cluster were associated (P ≤ 0.05) with calving, calf performance and fertility traits, while a single SNP in the zinc finger protein 215 gene (ZNF215) was associated with milk protein percentage (P ≤ 0.05), progeny carcass weight (P ≤ 0.05), culled cow carcass weight (P ≤ 0.01), angularity (P ≤ 0.01), body depth (P ≤ 0.01), rump width (P ≤ 0.01) and animal stature (P ≤ 0.01). Of the eight candidate bovine imprinted genes assessed, DNA sequence polymorphisms in six of these genes (CALCR, GRB10, PEG3, RASGRF1, ZIM2 and ZNF215) displayed associations with several of the phenotypes included for analyses. The genotype-phenotype associations detected here are further supported by the biological function of these six genes, each of which plays important roles in mammalian growth, development and physiology. The associations between SNPs within the imprinted PEG3 gene cluster and traits related to calving, calf performance and gestation length suggest that this domain on chromosome 18 may play a role regulating pre-natal growth and development and fertility. SNPs within the bovine ZNF215 gene were associated with bovine growth and body conformation traits and studies in humans have revealed that the human ZNF215 ortholog belongs to the imprinted gene cluster associated with Beckwith-Wiedemann syndrome--a genetic disorder characterised by growth abnormalities. Similarly, the data presented here suggest that the ZNF215 gene may have an important role in regulating bovine growth. Collectively, our results support previous work showing that (candidate) imprinted genes/loci contribute to heritable variation in bovine performance traits and suggest that DNA sequence polymorphisms within these genes/loci represents an important reservoir of genomic markers for future genetic improvement of dairy and beef cattle populations.

DNA sequence polymorphisms in a panel of eight candidate bovine imprinted genes and their association with performance traits in Irish Holstein-Friesian cattle

PubMed Central

2010-01-01

Background Studies in mice and humans have shown that imprinted genes, whereby expression from one of the two parentally inherited alleles is attenuated or completely silenced, have a major effect on mammalian growth, metabolism and physiology. More recently, investigations in livestock species indicate that genes subject to this type of epigenetic regulation contribute to, or are associated with, several performance traits, most notably muscle mass and fat deposition. In the present study, a candidate gene approach was adopted to assess 17 validated single nucleotide polymorphisms (SNPs) and their association with a range of performance traits in 848 progeny-tested Irish Holstein-Friesian artificial insemination sires. These SNPs are located proximal to, or within, the bovine orthologs of eight genes (CALCR, GRB10, PEG3, PHLDA2, RASGRF1, TSPAN32, ZIM2 and ZNF215) that have been shown to be imprinted in cattle or in at least one other mammalian species (i.e. human/mouse/pig/sheep). Results Heterozygosities for all SNPs analysed ranged from 0.09 to 0.46 and significant deviations from Hardy-Weinberg proportions (P ≤ 0.01) were observed at four loci. Phenotypic associations (P ≤ 0.05) were observed between nine SNPs proximal to, or within, six of the eight analysed genes and a number of performance traits evaluated, including milk protein percentage, somatic cell count, culled cow and progeny carcass weight, angularity, body conditioning score, progeny carcass conformation, body depth, rump angle, rump width, animal stature, calving difficulty, gestation length and calf perinatal mortality. Notably, SNPs within the imprinted paternally expressed gene 3 (PEG3) gene cluster were associated (P ≤ 0.05) with calving, calf performance and fertility traits, while a single SNP in the zinc finger protein 215 gene (ZNF215) was associated with milk protein percentage (P ≤ 0.05), progeny carcass weight (P ≤ 0.05), culled cow carcass weight (P ≤ 0.01), angularity (P ≤ 0.01), body depth (P ≤ 0.01), rump width (P ≤ 0.01) and animal stature (P ≤ 0.01). Conclusions Of the eight candidate bovine imprinted genes assessed, DNA sequence polymorphisms in six of these genes (CALCR, GRB10, PEG3, RASGRF1, ZIM2 and ZNF215) displayed associations with several of the phenotypes included for analyses. The genotype-phenotype associations detected here are further supported by the biological function of these six genes, each of which plays important roles in mammalian growth, development and physiology. The associations between SNPs within the imprinted PEG3 gene cluster and traits related to calving, calf performance and gestation length suggest that this domain on chromosome 18 may play a role regulating pre-natal growth and development and fertility. SNPs within the bovine ZNF215 gene were associated with bovine growth and body conformation traits and studies in humans have revealed that the human ZNF215 ortholog belongs to the imprinted gene cluster associated with Beckwith-Wiedemann syndrome--a genetic disorder characterised by growth abnormalities. Similarly, the data presented here suggest that the ZNF215 gene may have an important role in regulating bovine growth. Collectively, our results support previous work showing that (candidate) imprinted genes/loci contribute to heritable variation in bovine performance traits and suggest that DNA sequence polymorphisms within these genes/loci represents an important reservoir of genomic markers for future genetic improvement of dairy and beef cattle populations. PMID:20942903

Contig Maps and Genomic Sequencing Identify Candidate Genes in the Usher 1C Locus

PubMed Central

Higgins, Michael J.; Day, Colleen D.; Smilinich, Nancy J.; Ni, L.; Cooper, Paul R.; Nowak, Norma J.; Davies, Chris; de Jong, Pieter J.; Hejtmancik, Fielding; Evans, Glen A.; Smith, Richard J.H.; Shows, Thomas B.

1998-01-01

Usher syndrome 1C (USH1C) is a congenital condition manifesting profound hearing loss, the absence of vestibular function, and eventual retinal degeneration. The USH1C locus has been mapped genetically to a 2- to 3-cM interval in 11p14–15.1 between D11S899 and D11S861. In an effort to identify the USH1C disease gene we have isolated the region between these markers in yeast artificial chromosomes (YACs) using a combination of STS content mapping and Alu–PCR hybridization. The YAC contig is ∼3.5 Mb and has located several other loci within this interval, resulting in the order CEN-LDHA-SAA1-TPH-D11S1310-(D11S1888/KCNC1)-MYOD1-D11S902D11S921-D11S1890-TEL. Subsequent haplotyping and homozygosity analysis refined the location of the disease gene to a 400-kb interval between D11S902 and D11S1890 with all affected individuals being homozygous for the internal marker D11S921. To facilitate gene identification, the critical region has been converted into P1 artificial chromosome (PAC) clones using sequence-tagged sites (STSs) mapped to the YAC contig, Alu–PCR products generated from the YACs, and PAC end probes. A contig of >50 PAC clones has been assembled between D11S1310 and D11S1890, confirming the order of markers used in haplotyping. Three PAC clones representing nearly two-thirds of the USH1C critical region have been sequenced. PowerBLAST analysis identified six clusters of expressed sequence tags (ESTs), two known genes (BIR,SUR1) mapped previously to this region, and a previously characterized but unmapped gene NEFA (DNA binding/EF hand/acidic amino-acid-rich). GRAIL analysis identified 11 CpG islands and 73 exons of excellent quality. These data allowed the construction of a transcription map for the USH1C critical region, consisting of three known genes and six or more novel transcripts. Based on their map location, these loci represent candidate disease loci for USH1C. The NEFA gene was assessed as the USH1C locus by the sequencing of an amplified NEFA cDNA from an USH1C patient; however, no mutations were detected. [The sequence data described in this paper have been submitted to GenBank under accession numbers AC000406–AC000407.] PMID:9445488

Candidate OP Phyla: Importance, Ecology and Cultivation Prospects.

PubMed

Rohini Kumar, M; Saravanan, V S

2010-10-01

OP phyla were created in the domain bacteria, based on the group of 16S rRNA gene sequences recovered from the Obsidian Pool. However, due to the lack of cultured representative it is referred to as candidate phyla. Wider ecological occurrence was predicted for the OP phyla, especially OP3, OP10 and OP11. Recently, members of phylum OP5 and OP10 were cultured, providing clues to their cultivation prospects. At last the bioprospecting potentials of the OP members are discussed herein.

Differences in Brain Transcriptomes of Closely Related Baikal Coregonid Species

PubMed Central

Bychenko, Oksana S.; Sukhanova, Lyubov V.; Azhikina, Tatyana L.; Skvortsov, Timofey A.; Belomestnykh, Tuyana V.; Sverdlov, Eugene D.

2014-01-01

The aim of this work was to get deeper insight into genetic factors involved in the adaptive divergence of closely related species, specifically two representatives of Baikal coregonids—Baikal whitefish (Coregonus baicalensis Dybowski) and Baikal omul (Coregonus migratorius Georgi)—that diverged from a common ancestor as recently as 10–20 thousand years ago. Using the Serial Analysis of Gene Expression method, we obtained libraries of short representative cDNA sequences (tags) from the brains of Baikal whitefish and omul. A comparative analysis of the libraries revealed quantitative differences among ~4% tags of the fishes under study. Based on the similarity of these tags with cDNA of known organisms, we identified candidate genes taking part in adaptive divergence. The most important candidate genes related to the adaptation of Baikal whitefish and Baikal omul, identified in this work, belong to the genes of cell metabolism, nervous and immune systems, protein synthesis, and regulatory genes as well as to DTSsa4 Tc1-like transposons which are widespread among fishes. PMID:24719892

The Calcitonin Receptor Gene Is a Candidate for Regulation of Susceptibility to Herpes simplex Type 1 Neuronal Infection Leading to Encephalitis in Rat

PubMed Central

Abdelmagid, Nada; Bereczky-Veress, Biborka; Guerreiro-Cacais, André Ortlieb; Bergman, Petra; Luhr, Katarina M.; Bergström, Tomas; Sköldenberg, Birgit; Piehl, Fredrik

2012-01-01

Herpes simplex encephalitis (HSE) is a fatal infection of the central nervous system (CNS) predominantly caused by Herpes simplex virus type 1. Factors regulating the susceptibility to HSE are still largely unknown. To identify host gene(s) regulating HSE susceptibility we performed a genome-wide linkage scan in an intercross between the susceptible DA and the resistant PVG rat. We found one major quantitative trait locus (QTL), Hse1, on rat chromosome 4 (confidence interval 24.3–31 Mb; LOD score 29.5) governing disease susceptibility. Fine mapping of Hse1 using recombinants, haplotype mapping and sequencing, as well as expression analysis of all genes in the interval identified the calcitonin receptor gene (Calcr) as the main candidate, which also is supported by functional studies. Thus, using unbiased genetic approach variability in Calcr was identified as potentially critical for infection and viral spread to the CNS and subsequent HSE development. PMID:22761571

Fourteen-Genome Comparison Identifies DNA Markers for Severe-Disease-Associated Strains of Clostridium difficile▿†

PubMed Central

Forgetta, Vincenzo; Oughton, Matthew T.; Marquis, Pascale; Brukner, Ivan; Blanchette, Ruth; Haub, Kevin; Magrini, Vince; Mardis, Elaine R.; Gerding, Dale N.; Loo, Vivian G.; Miller, Mark A.; Mulvey, Michael R.; Rupnik, Maja; Dascal, Andre; Dewar, Ken

2011-01-01

Clostridium difficile is a common cause of infectious diarrhea in hospitalized patients. A severe and increased incidence of C. difficile infection (CDI) is associated predominantly with the NAP1 strain; however, the existence of other severe-disease-associated (SDA) strains and the extensive genetic diversity across C. difficile complicate reliable detection and diagnosis. Comparative genome analysis of 14 sequenced genomes, including those of a subset of NAP1 isolates, allowed the assessment of genetic diversity within and between strain types to identify DNA markers that are associated with severe disease. Comparative genome analysis of 14 isolates, including five publicly available strains, revealed that C. difficile has a core genome of 3.4 Mb, comprising ∼3,000 genes. Analysis of the core genome identified candidate DNA markers that were subsequently evaluated using a multistrain panel of 177 isolates, representing more than 50 pulsovars and 8 toxinotypes. A subset of 117 isolates from the panel had associated patient data that allowed assessment of an association between the DNA markers and severe CDI. We identified 20 candidate DNA markers for species-wide detection and 10,683 single nucleotide polymorphisms (SNPs) associated with the predominant SDA strain (NAP1). A species-wide detection candidate marker, the sspA gene, was found to be the same across 177 sequenced isolates and lacked significant similarity to those of other species. Candidate SNPs in genes CD1269 and CD1265 were found to associate more closely with disease severity than currently used diagnostic markers, as they were also present in the toxin A-negative and B-positive (A-B+) strain types. The genetic markers identified illustrate the potential of comparative genomics for the discovery of diagnostic DNA-based targets that are species specific or associated with multiple SDA strains. PMID:21508155

Candidate Gene Identification with SNP Marker-Based Fine Mapping of Anthracnose Resistance Gene Co-4 in Common Bean.

PubMed

Burt, Andrew J; William, H Manilal; Perry, Gregory; Khanal, Raja; Pauls, K Peter; Kelly, James D; Navabi, Alireza

2015-01-01

Anthracnose, caused by Colletotrichum lindemuthianum, is an important fungal disease of common bean (Phaseolus vulgaris). Alleles at the Co-4 locus confer resistance to a number of races of C. lindemuthianum. A population of 94 F4:5 recombinant inbred lines of a cross between resistant black bean genotype B09197 and susceptible navy bean cultivar Nautica was used to identify markers associated with resistance in bean chromosome 8 (Pv08) where Co-4 is localized. Three SCAR markers with known linkage to Co-4 and a panel of single nucleotide markers were used for genotyping. A refined physical region on Pv08 with significant association with anthracnose resistance identified by markers was used in BLAST searches with the genomic sequence of common bean accession G19833. Thirty two unique annotated candidate genes were identified that spanned a physical region of 936.46 kb. A majority of the annotated genes identified had functional similarity to leucine rich repeats/receptor like kinase domains. Three annotated genes had similarity to 1, 3-β-glucanase domains. There were sequence similarities between some of the annotated genes found in the study and the genes associated with phosphoinositide-specific phosphilipases C associated with Co-x and the COK-4 loci found in previous studies. It is possible that the Co-4 locus is structured as a group of genes with functional domains dominated by protein tyrosine kinase along with leucine rich repeats/nucleotide binding site, phosphilipases C as well as β-glucanases.

Candidate Gene Identification with SNP Marker-Based Fine Mapping of Anthracnose Resistance Gene Co-4 in Common Bean

PubMed Central

Burt, Andrew J.; William, H. Manilal; Perry, Gregory; Khanal, Raja; Pauls, K. Peter; Kelly, James D.; Navabi, Alireza

2015-01-01

Anthracnose, caused by Colletotrichum lindemuthianum, is an important fungal disease of common bean (Phaseolus vulgaris). Alleles at the Co–4 locus confer resistance to a number of races of C. lindemuthianum. A population of 94 F4:5 recombinant inbred lines of a cross between resistant black bean genotype B09197 and susceptible navy bean cultivar Nautica was used to identify markers associated with resistance in bean chromosome 8 (Pv08) where Co–4 is localized. Three SCAR markers with known linkage to Co–4 and a panel of single nucleotide markers were used for genotyping. A refined physical region on Pv08 with significant association with anthracnose resistance identified by markers was used in BLAST searches with the genomic sequence of common bean accession G19833. Thirty two unique annotated candidate genes were identified that spanned a physical region of 936.46 kb. A majority of the annotated genes identified had functional similarity to leucine rich repeats/receptor like kinase domains. Three annotated genes had similarity to 1, 3-β-glucanase domains. There were sequence similarities between some of the annotated genes found in the study and the genes associated with phosphoinositide-specific phosphilipases C associated with Co-x and the COK–4 loci found in previous studies. It is possible that the Co–4 locus is structured as a group of genes with functional domains dominated by protein tyrosine kinase along with leucine rich repeats/nucleotide binding site, phosphilipases C as well as β-glucanases. PMID:26431031

Detecting Horizontal Gene Transfer between Closely Related Taxa

PubMed Central

Adato, Orit; Ninyo, Noga; Gophna, Uri; Snir, Sagi

2015-01-01

Horizontal gene transfer (HGT), the transfer of genetic material between organisms, is crucial for genetic innovation and the evolution of genome architecture. Existing HGT detection algorithms rely on a strong phylogenetic signal distinguishing the transferred sequence from ancestral (vertically derived) genes in its recipient genome. Detecting HGT between closely related species or strains is challenging, as the phylogenetic signal is usually weak and the nucleotide composition is normally nearly identical. Nevertheless, there is a great importance in detecting HGT between congeneric species or strains, especially in clinical microbiology, where understanding the emergence of new virulent and drug-resistant strains is crucial, and often time-sensitive. We developed a novel, self-contained technique named Near HGT, based on the synteny index, to measure the divergence of a gene from its native genomic environment and used it to identify candidate HGT events between closely related strains. The method confirms candidate transferred genes based on the constant relative mutability (CRM). Using CRM, the algorithm assigns a confidence score based on “unusual” sequence divergence. A gene exhibiting exceptional deviations according to both synteny and mutability criteria, is considered a validated HGT product. We first employed the technique to a set of three E. coli strains and detected several highly probable horizontally acquired genes. We then compared the method to existing HGT detection tools using a larger strain data set. When combined with additional approaches our new algorithm provides richer picture and brings us closer to the goal of detecting all newly acquired genes in a particular strain. PMID:26439115

Exploiting proteomic data for genome annotation and gene model validation in Aspergillus niger

PubMed Central

Wright, James C; Sugden, Deana; Francis-McIntyre, Sue; Riba-Garcia, Isabel; Gaskell, Simon J; Grigoriev, Igor V; Baker, Scott E; Beynon, Robert J; Hubbard, Simon J

2009-01-01

Background Proteomic data is a potentially rich, but arguably unexploited, data source for genome annotation. Peptide identifications from tandem mass spectrometry provide prima facie evidence for gene predictions and can discriminate over a set of candidate gene models. Here we apply this to the recently sequenced Aspergillus niger fungal genome from the Joint Genome Institutes (JGI) and another predicted protein set from another A.niger sequence. Tandem mass spectra (MS/MS) were acquired from 1d gel electrophoresis bands and searched against all available gene models using Average Peptide Scoring (APS) and reverse database searching to produce confident identifications at an acceptable false discovery rate (FDR). Results 405 identified peptide sequences were mapped to 214 different A.niger genomic loci to which 4093 predicted gene models clustered, 2872 of which contained the mapped peptides. Interestingly, 13 (6%) of these loci either had no preferred predicted gene model or the genome annotators' chosen "best" model for that genomic locus was not found to be the most parsimonious match to the identified peptides. The peptides identified also boosted confidence in predicted gene structures spanning 54 introns from different gene models. Conclusion This work highlights the potential of integrating experimental proteomics data into genomic annotation pipelines much as expressed sequence tag (EST) data has been. A comparison of the published genome from another strain of A.niger sequenced by DSM showed that a number of the gene models or proteins with proteomics evidence did not occur in both genomes, further highlighting the utility of the method. PMID:19193216

Global Gene Expression Patterns and Somatic Mutations in Sporadic Intracranial Aneurysms.

PubMed

Li, Zhili; Tan, Haibin; Shi, Yi; Huang, Guangfu; Wang, Zhenyu; Liu, Ling; Yin, Cheng; Wang, Qi

2017-04-01

High-throughput sequencing technologies can expand our understanding of the pathologic basis of intracranial aneurysms (IAs). Our study was aimed to decipher the gene expression signature and genetic factors associated with IAs. We determined the gene expression levels of 3 cases of IAs by RNA sequencing. Bioinformatics analysis was conducted to identify the differentially expressed genes (DEGs) and uncover their biological function. In addition, whole genome sequencing was performed on an additional 6 cases of IAs to detect the potential somatic alterations in DEGs. Compared with the normal arterial tissue, 1709 genes were differentially expressed in IAs arterial tissue. The most significantly up-regulated gene and down-regulated gene, H19 and HIST1H3J, may be essential for tumorigenesis of IAs. Hub protein of IKBKG in protein-protein interaction network was probably involved in the inflammation process in aneurysms. Another 2 hub proteins, ACTB and MKI67IP, as well as up-regulated genes, might be abnormally activated in aneurysms and involved in the pathogenesis of IAs. Further whole genome sequencing and filtering yielded 4 candidate somatic single nucleotide variants including MUC3B, and BLM may be involved in the pathogenesis of IAs. Even though, our results do not support the hypothesis of somatic mutations occurred in the DEGs. Two-dimensional genomic data from transcriptome and whole genome sequencing indicated that no somatic mutations occurred in DEGs. In addition, 3 DEGs (IKBKG, ACTB, and MKI67IP) and 2 mutant genes (MUC3B and BLM) were essential in IAs. Copyright © 2017 Elsevier Inc. All rights reserved.

Genome-Wide Linkage, Exome Sequencing and Functional Analyses Identify ABCB6 as the Pathogenic Gene of Dyschromatosis Universalis Hereditaria

PubMed Central

Wang, Na; Wang, Chuan; Chen, Xuechao; Sheng, Donglai; Fu, Xi’an; See, Kelvin; Foo, Jia Nee; Low, Huiqi; Liany, Herty; Irwan, Ishak Darryl; Liu, Jian; Yang, Baoqi; Chen, Mingfei; Yu, Yongxiang; Yu, Gongqi; Niu, Guiye; You, Jiabao; Zhou, Yan; Ma, Shanshan; Wang, Ting; Yan, Xiaoxiao; Goh, Boon Kee; Common, John E. A.; Lane, Birgitte E.; Sun, Yonghu; Zhou, Guizhi; Lu, Xianmei; Wang, Zhenhua; Tian, Hongqing; Cao, Yuanhua; Chen, Shumin; Liu, Qiji; Liu, Jianjun; Zhang, Furen

2014-01-01

Background As a genetic disorder of abnormal pigmentation, the molecular basis of dyschromatosis universalis hereditaria (DUH) had remained unclear until recently when ABCB6 was reported as a causative gene of DUH. Methodology We performed genome-wide linkage scan using Illumina Human 660W-Quad BeadChip and exome sequencing analyses using Agilent SureSelect Human All Exon Kits in a multiplex Chinese DUH family to identify the pathogenic mutations and verified the candidate mutations using Sanger sequencing. Quantitative RT-PCR and Immunohistochemistry was performed to verify the expression of the pathogenic gene, Zebrafish was also used to confirm the functional role of ABCB6 in melanocytes and pigmentation. Results Genome-wide linkage (assuming autosomal dominant inheritance mode) and exome sequencing analyses identified ABCB6 as the disease candidate gene by discovering a coding mutation (c.1358C>T; p.Ala453Val) that co-segregates with the disease phenotype. Further mutation analysis of ABCB6 in four other DUH families and two sporadic cases by Sanger sequencing confirmed the mutation (c.1358C>T; p.Ala453Val) and discovered a second, co-segregating coding mutation (c.964A>C; p.Ser322Lys) in one of the four families. Both mutations were heterozygous in DUH patients and not present in the 1000 Genome Project and dbSNP database as well as 1,516 unrelated Chinese healthy controls. Expression analysis in human skin and mutagenesis interrogation in zebrafish confirmed the functional role of ABCB6 in melanocytes and pigmentation. Given the involvement of ABCB6 mutations in coloboma, we performed ophthalmological examination of the DUH carriers of ABCB6 mutations and found ocular abnormalities in them. Conclusion Our study has advanced our understanding of DUH pathogenesis and revealed the shared pathological mechanism between pigmentary DUH and ocular coloboma. PMID:24498303

Identification of Quantitative Trait Loci for Resistance to RSIVD in Red Sea Bream (Pagrus major).

PubMed

Sawayama, Eitaro; Tanizawa, Shiho; Kitamura, Shin-Ichi; Nakayama, Kei; Ohta, Kohei; Ozaki, Akiyuki; Takagi, Motohiro

2017-12-01

Red sea bream iridoviral disease (RSIVD) is a major viral disease in red sea bream farming in Japan. Previously, we identified one candidate male individual of red sea bream that was significantly associated with convalescent individuals after RSIVD. The purpose of this study is to identify the quantitative trait loci (QTL) linked to the RSIVD-resistant trait for future marker-assisted selection (MAS). Two test families were developed using the candidate male in 2014 (Fam-2014) and 2015 (Fam-2015). These test families were challenged with RSIV, and phenotypes were evaluated. Then, de novo genome sequences of red sea bream were obtained through next-generation sequencing, and microsatellite markers were searched and selected for linkage map construction. One immune-related gene, MHC class IIβ, was also used for linkage map construction. Of the microsatellite markers searched, 148 and 197 were mapped on 23 and 27 linkage groups in the female and male linkage maps, respectively, covering approximately 65% of genomes in both sexes. One QTL linked to an RSIVD-resistant trait was found in linkage group 2 of the candidate male in Fam-2014, and the phenotypic variance of the QTL was 31.1%. The QTL was closely linked to MHC class IIβ. Moreover, the QTL observed in Fam-2014 was also significantly linked to an RSIVD-resistant trait in the candidate male of Fam-2015. Our results suggest that the RSIVD-resistant trait in the candidate male was controlled by one major QTL closely linked to the MHC class IIβ gene and could be useful for MAS of red sea bream.

Transcriptome Sequencing of Lima Bean (Phaseolus lunatus) to Identify Putative Positive Selection in Phaseolus and Legumes

PubMed Central

Li, Fengqi; Cao, Depan; Liu, Yang; Yang, Ting; Wang, Guirong

2015-01-01

The identification of genes under positive selection is a central goal of evolutionary biology. Many legume species, including Phaseolus vulgaris (common bean) and Phaseolus lunatus (lima bean), have important ecological and economic value. In this study, we sequenced and assembled the transcriptome of one Phaseolus species, lima bean. A comparison with the genomes of six other legume species, including the common bean, Medicago, lotus, soybean, chickpea, and pigeonpea, revealed 15 and 4 orthologous groups with signatures of positive selection among the two Phaseolus species and among the seven legume species, respectively. Characterization of these positively selected genes using Non redundant (nr) annotation, gene ontology (GO) classification, GO term enrichment and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses revealed that these genes are mostly involved in thylakoids, photosynthesis and metabolism. This study identified genes that may be related to the divergence of the Phaseolus and legume species. These detected genes are particularly good candidates for subsequent functional studies. PMID:26151849

Genealogy-based methods for inference of historical recombination and gene flow and their application in Saccharomyces cerevisiae.

PubMed

Jenkins, Paul A; Song, Yun S; Brem, Rachel B

2012-01-01

Genetic exchange between isolated populations, or introgression between species, serves as a key source of novel genetic material on which natural selection can act. While detecting historical gene flow from DNA sequence data is of much interest, many existing methods can be limited by requirements for deep population genomic sampling. In this paper, we develop a scalable genealogy-based method to detect candidate signatures of gene flow into a given population when the source of the alleles is unknown. Our method does not require sequenced samples from the source population, provided that the alleles have not reached fixation in the sampled recipient population. The method utilizes recent advances in algorithms for the efficient reconstruction of ancestral recombination graphs, which encode genealogical histories of DNA sequence data at each site, and is capable of detecting the signatures of gene flow whose footprints are of length up to single genes. Further, we employ a theoretical framework based on coalescent theory to test for statistical significance of certain recombination patterns consistent with gene flow from divergent sources. Implementing these methods for application to whole-genome sequences of environmental yeast isolates, we illustrate the power of our approach to highlight loci with unusual recombination histories. By developing innovative theory and methods to analyze signatures of gene flow from population sequence data, our work establishes a foundation for the continued study of introgression and its evolutionary relevance.

Genealogy-Based Methods for Inference of Historical Recombination and Gene Flow and Their Application in Saccharomyces cerevisiae

PubMed Central

Jenkins, Paul A.; Song, Yun S.; Brem, Rachel B.

2012-01-01

Genetic exchange between isolated populations, or introgression between species, serves as a key source of novel genetic material on which natural selection can act. While detecting historical gene flow from DNA sequence data is of much interest, many existing methods can be limited by requirements for deep population genomic sampling. In this paper, we develop a scalable genealogy-based method to detect candidate signatures of gene flow into a given population when the source of the alleles is unknown. Our method does not require sequenced samples from the source population, provided that the alleles have not reached fixation in the sampled recipient population. The method utilizes recent advances in algorithms for the efficient reconstruction of ancestral recombination graphs, which encode genealogical histories of DNA sequence data at each site, and is capable of detecting the signatures of gene flow whose footprints are of length up to single genes. Further, we employ a theoretical framework based on coalescent theory to test for statistical significance of certain recombination patterns consistent with gene flow from divergent sources. Implementing these methods for application to whole-genome sequences of environmental yeast isolates, we illustrate the power of our approach to highlight loci with unusual recombination histories. By developing innovative theory and methods to analyze signatures of gene flow from population sequence data, our work establishes a foundation for the continued study of introgression and its evolutionary relevance. PMID:23226196

Medical subject heading (MeSH) annotations illuminate maize genetics and evolution

USDA-ARS?s Scientific Manuscript database

In the modern era, high-density marker panels and/or whole-genome sequencing,coupled with advanced phenotyping pipelines and sophisticated statistical methods, have dramatically increased our ability to generate lists of candidate genes or regions that are putatively associated with phenotypes or pr...

Current and future developments in patents for quantitative trait loci in dairy cattle.

PubMed

Weller, Joel I

2007-01-01

Many studies have proposed that rates of genetic gain in dairy cattle can be increased by direct selection on the individual quantitative loci responsible for the genetic variation in these traits, or selection on linked genetic markers. The development of DNA-level genetic markers has made detection of QTL nearly routine in all major livestock species. The studies that attempted to detect genes affecting quantitative traits can be divided into two categories: analysis of candidate genes, and genome scans based on within-family genetic linkage. To date, 12 patent cooperative treaty (PCT) and US patents have been registered for DNA sequences claimed to be associated with effects on economic traits in dairy cattle. All claim effects on milk production, but other traits are also included in some of the claims. Most of the sequences found by the candidate gene approach are of dubious validity, and have been repeated in only very few independent studies. The two missense mutations on chromosomes 6 and 14 affecting milk concentration derived from genome scans are more solidly based, but the claims are also disputed. A few PCT in dairy cattle are commercialized as genetic tests where commercial dairy farmers are the target market.

Mutations in PYCR1 cause cutis laxa with progeroid features.

PubMed

Reversade, Bruno; Escande-Beillard, Nathalie; Dimopoulou, Aikaterini; Fischer, Björn; Chng, Serene C; Li, Yun; Shboul, Mohammad; Tham, Puay-Yoke; Kayserili, Hülya; Al-Gazali, Lihadh; Shahwan, Monzer; Brancati, Francesco; Lee, Hane; O'Connor, Brian D; Schmidt-von Kegler, Mareen; Merriman, Barry; Nelson, Stanley F; Masri, Amira; Alkazaleh, Fawaz; Guerra, Deanna; Ferrari, Paola; Nanda, Arti; Rajab, Anna; Markie, David; Gray, Mary; Nelson, John; Grix, Arthur; Sommer, Annemarie; Savarirayan, Ravi; Janecke, Andreas R; Steichen, Elisabeth; Sillence, David; Hausser, Ingrid; Budde, Birgit; Nürnberg, Gudrun; Nürnberg, Peter; Seemann, Petra; Kunkel, Désirée; Zambruno, Giovanna; Dallapiccola, Bruno; Schuelke, Markus; Robertson, Stephen; Hamamy, Hanan; Wollnik, Bernd; Van Maldergem, Lionel; Mundlos, Stefan; Kornak, Uwe

2009-09-01

Autosomal recessive cutis laxa (ARCL) describes a group of syndromal disorders that are often associated with a progeroid appearance, lax and wrinkled skin, osteopenia and mental retardation. Homozygosity mapping in several kindreds with ARCL identified a candidate region on chromosome 17q25. By high-throughput sequencing of the entire candidate region, we detected disease-causing mutations in the gene PYCR1. We found that the gene product, an enzyme involved in proline metabolism, localizes to mitochondria. Altered mitochondrial morphology, membrane potential and increased apoptosis rate upon oxidative stress were evident in fibroblasts from affected individuals. Knockdown of the orthologous genes in Xenopus and zebrafish led to epidermal hypoplasia and blistering that was accompanied by a massive increase of apoptosis. Our findings link mutations in PYCR1 to altered mitochondrial function and progeroid changes in connective tissues.

Generation and analysis of expressed sequence tags from a cDNA library of the fruiting body of Ganoderma lucidum

PubMed Central

2010-01-01

Background Little genomic or trancriptomic information on Ganoderma lucidum (Lingzhi) is known. This study aims to discover the transcripts involved in secondary metabolite biosynthesis and developmental regulation of G. lucidum using an expressed sequence tag (EST) library. Methods A cDNA library was constructed from the G. lucidum fruiting body. Its high-quality ESTs were assembled into unique sequences with contigs and singletons. The unique sequences were annotated according to sequence similarities to genes or proteins available in public databases. The detection of simple sequence repeats (SSRs) was preformed by online analysis. Results A total of 1,023 clones were randomly selected from the G. lucidum library and sequenced, yielding 879 high-quality ESTs. These ESTs showed similarities to a diverse range of genes. The sequences encoding squalene epoxidase (SE) and farnesyl-diphosphate synthase (FPS) were identified in this EST collection. Several candidate genes, such as hydrophobin, MOB2, profilin and PHO84 were detected for the first time in G. lucidum. Thirteen (13) potential SSR-motif microsatellite loci were also identified. Conclusion The present study demonstrates a successful application of EST analysis in the discovery of transcripts involved in the secondary metabolite biosynthesis and the developmental regulation of G. lucidum. PMID:20230644

Next generation sequencing in women affected by nonsyndromic premature ovarian failure displays new potential causative genes and mutations.

PubMed

Fonseca, Dora Janeth; Patiño, Liliana Catherine; Suárez, Yohjana Carolina; de Jesús Rodríguez, Asid; Mateus, Heidi Eliana; Jiménez, Karen Marcela; Ortega-Recalde, Oscar; Díaz-Yamal, Ivonne; Laissue, Paul

2015-07-01

To identify new molecular actors involved in nonsyndromic premature ovarian failure (POF) etiology. This is a retrospective case-control cohort study. University research group and IVF medical center. Twelve women affected by nonsyndromic POF. The control group included 176 women whose menopause had occurred after age 50 and had no antecedents regarding gynecological disease. A further 345 women from the same ethnic origin (general population group) were also recruited to assess allele frequency for potentially deleterious sequence variants. Next generation sequencing (NGS), Sanger sequencing, and bioinformatics analysis. The complete coding regions of 70 candidate genes were massively sequenced, via NGS, in POF patients. Bioinformatics and genetics were used to confirm NGS results and to identify potential sequence variants related to the disease pathogenesis. We have identified mutations in two novel genes, ADAMTS19 and BMPR2, that are potentially related to POF origin. LHCGR mutations, which might have contributed to the phenotype, were also detected. We thus recommend NGS as a powerful tool for identifying new molecular actors in POF and for future diagnostic/prognostic purposes. Copyright © 2015 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

Transcript Analysis and Regulative Events during Flower Development in Olive (Olea europaea L.).

PubMed

Alagna, Fiammetta; Cirilli, Marco; Galla, Giulio; Carbone, Fabrizio; Daddiego, Loretta; Facella, Paolo; Lopez, Loredana; Colao, Chiara; Mariotti, Roberto; Cultrera, Nicolò; Rossi, Martina; Barcaccia, Gianni; Baldoni, Luciana; Muleo, Rosario; Perrotta, Gaetano

2016-01-01

The identification and characterization of transcripts involved in flower organ development, plant reproduction and metabolism represent key steps in plant phenotypic and physiological pathways, and may generate high-quality transcript variants useful for the development of functional markers. This study was aimed at obtaining an extensive characterization of the olive flower transcripts, by providing sound information on the candidate MADS-box genes related to the ABC model of flower development and on the putative genetic and molecular determinants of ovary abortion and pollen-pistil interaction. The overall sequence data, obtained by pyrosequencing of four cDNA libraries from flowers at different developmental stages of three olive varieties with distinct reproductive features (Leccino, Frantoio and Dolce Agogia), included approximately 465,000 ESTs, which gave rise to more than 14,600 contigs and approximately 92,000 singletons. As many as 56,700 unigenes were successfully annotated and provided gene ontology insights into the structural organization and putative molecular function of sequenced transcripts and deduced proteins in the context of their corresponding biological processes. Differentially expressed genes with potential regulatory roles in biosynthetic pathways and metabolic networks during flower development were identified. The gene expression studies allowed us to select the candidate genes that play well-known molecular functions in a number of biosynthetic pathways and specific biological processes that affect olive reproduction. A sound understanding of gene functions and regulatory networks that characterize the olive flower is provided.

Transcript Analysis and Regulative Events during Flower Development in Olive (Olea europaea L.)

PubMed Central

Alagna, Fiammetta; Cirilli, Marco; Galla, Giulio; Carbone, Fabrizio; Daddiego, Loretta; Facella, Paolo; Lopez, Loredana; Colao, Chiara; Mariotti, Roberto; Cultrera, Nicolò; Rossi, Martina; Barcaccia, Gianni; Baldoni, Luciana; Muleo, Rosario; Perrotta, Gaetano

2016-01-01

The identification and characterization of transcripts involved in flower organ development, plant reproduction and metabolism represent key steps in plant phenotypic and physiological pathways, and may generate high-quality transcript variants useful for the development of functional markers. This study was aimed at obtaining an extensive characterization of the olive flower transcripts, by providing sound information on the candidate MADS-box genes related to the ABC model of flower development and on the putative genetic and molecular determinants of ovary abortion and pollen-pistil interaction. The overall sequence data, obtained by pyrosequencing of four cDNA libraries from flowers at different developmental stages of three olive varieties with distinct reproductive features (Leccino, Frantoio and Dolce Agogia), included approximately 465,000 ESTs, which gave rise to more than 14,600 contigs and approximately 92,000 singletons. As many as 56,700 unigenes were successfully annotated and provided gene ontology insights into the structural organization and putative molecular function of sequenced transcripts and deduced proteins in the context of their corresponding biological processes. Differentially expressed genes with potential regulatory roles in biosynthetic pathways and metabolic networks during flower development were identified. The gene expression studies allowed us to select the candidate genes that play well-known molecular functions in a number of biosynthetic pathways and specific biological processes that affect olive reproduction. A sound understanding of gene functions and regulatory networks that characterize the olive flower is provided. PMID:27077738

Identification of Candidate Genes Underlying an Iron Efficiency Quantitative Trait Locus in Soybean1

PubMed Central

Peiffer, Gregory A.; King, Keith E.; Severin, Andrew J.; May, Gregory D.; Cianzio, Silvia R.; Lin, Shun Fu; Lauter, Nicholas C.; Shoemaker, Randy C.

2012-01-01

Prevalent on calcareous soils in the United States and abroad, iron deficiency is among the most common and severe nutritional stresses in plants. In soybean (Glycine max) commercial plantings, the identification and use of iron-efficient genotypes has proven to be the best form of managing this soil-related plant stress. Previous studies conducted in soybean identified a significant iron efficiency quantitative trait locus (QTL) explaining more than 70% of the phenotypic variation for the trait. In this research, we identified candidate genes underlying this QTL through molecular breeding, mapping, and transcriptome sequencing. Introgression mapping was performed using two related near-isogenic lines in which a region located on soybean chromosome 3 required for iron efficiency was identified. The region corresponds to the previously reported iron efficiency QTL. The location was further confirmed through QTL mapping conducted in this study. Transcriptome sequencing and quantitative real-time-polymerase chain reaction identified two genes encoding transcription factors within the region that were significantly induced in soybean roots under iron stress. The two induced transcription factors were identified as homologs of the subgroup lb basic helix-loop-helix (bHLH) genes that are known to regulate the strategy I response in Arabidopsis (Arabidopsis thaliana). Resequencing of these differentially expressed genes unveiled a significant deletion within a predicted dimerization domain. We hypothesize that this deletion disrupts the Fe-DEFICIENCY-INDUCED TRANSCRIPTION FACTOR (FIT)/bHLH heterodimer that has been shown to induce known iron acquisition genes. PMID:22319075

Genome-wide association study using high-density single nucleotide polymorphism arrays and whole-genome sequences for clinical mastitis traits in dairy cattle.

PubMed

Sahana, G; Guldbrandtsen, B; Thomsen, B; Holm, L-E; Panitz, F; Brøndum, R F; Bendixen, C; Lund, M S

2014-11-01

Mastitis is a mammary disease that frequently affects dairy cattle. Despite considerable research on the development of effective prevention and treatment strategies, mastitis continues to be a significant issue in bovine veterinary medicine. To identify major genes that affect mastitis in dairy cattle, 6 chromosomal regions on Bos taurus autosome (BTA) 6, 13, 16, 19, and 20 were selected from a genome scan for 9 mastitis phenotypes using imputed high-density single nucleotide polymorphism arrays. Association analyses using sequence-level variants for the 6 targeted regions were carried out to map causal variants using whole-genome sequence data from 3 breeds. The quantitative trait loci (QTL) discovery population comprised 4,992 progeny-tested Holstein bulls, and QTL were confirmed in 4,442 Nordic Red and 1,126 Jersey cattle. The targeted regions were imputed to the sequence level. The highest association signal for clinical mastitis was observed on BTA 6 at 88.97 Mb in Holstein cattle and was confirmed in Nordic Red cattle. The peak association region on BTA 6 contained 2 genes: vitamin D-binding protein precursor (GC) and neuropeptide FF receptor 2 (NPFFR2), which, based on known biological functions, are good candidates for affecting mastitis. However, strong linkage disequilibrium in this region prevented conclusive determination of the causal gene. A different QTL on BTA 6 located at 88.32 Mb in Holstein cattle affected mastitis. In addition, QTL on BTA 13 and 19 were confirmed to segregate in Nordic Red cattle and QTL on BTA 16 and 20 were confirmed in Jersey cattle. Although several candidate genes were identified in these targeted regions, it was not possible to identify a gene or polymorphism as the causal factor for any of these regions. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Identifying transposon insertions and their effects from RNA-sequencing data.

PubMed

de Ruiter, Julian R; Kas, Sjors M; Schut, Eva; Adams, David J; Koudijs, Marco J; Wessels, Lodewyk F A; Jonkers, Jos

2017-07-07

Insertional mutagenesis using engineered transposons is a potent forward genetic screening technique used to identify cancer genes in mouse model systems. In the analysis of these screens, transposon insertion sites are typically identified by targeted DNA-sequencing and subsequently assigned to predicted target genes using heuristics. As such, these approaches provide no direct evidence that insertions actually affect their predicted targets or how transcripts of these genes are affected. To address this, we developed IM-Fusion, an approach that identifies insertion sites from gene-transposon fusions in standard single- and paired-end RNA-sequencing data. We demonstrate IM-Fusion on two separate transposon screens of 123 mammary tumors and 20 B-cell acute lymphoblastic leukemias, respectively. We show that IM-Fusion accurately identifies transposon insertions and their true target genes. Furthermore, by combining the identified insertion sites with expression quantification, we show that we can determine the effect of a transposon insertion on its target gene(s) and prioritize insertions that have a significant effect on expression. We expect that IM-Fusion will significantly enhance the accuracy of cancer gene discovery in forward genetic screens and provide initial insight into the biological effects of insertions on candidate cancer genes. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Sequence analysis of chromosome 1 revealed different selection patterns between Chinese wild mice and laboratory strains.

PubMed

Xu, Fuyi; Hu, Shixian; Chao, Tianzhu; Wang, Maochun; Li, Kai; Zhou, Yuxun; Xu, Hongyan; Xiao, Junhua

2017-10-01

Both natural and artificial selection play a critical role in animals' adaptation to the environment. Detection of the signature of selection in genomic regions can provide insights for understanding the function of specific phenotypes. It is generally assumed that laboratory mice may experience intense artificial selection while wild mice more natural selection. However, the differences of selection signature in the mouse genome and underlying genes between wild and laboratory mice remain unclear. In this study, we used two mouse populations: chromosome 1 (Chr 1) substitution lines (C1SLs) derived from Chinese wild mice and mouse genome project (MGP) sequenced inbred strains and two selection detection statistics: Fst and Tajima's D to identify the signature of selection footprint on Chr 1. For the differentiation between the C1SLs and MGP, 110 candidate selection regions containing 47 protein coding genes were detected. A total of 149 selection regions which encompass 7.215 Mb were identified in the C1SLs by Tajima's D approach. While for the MGP, we identified nearly twice selection regions (243) compared with the C1SLs which accounted for 13.27 Mb Chr 1 sequence. Through functional annotation, we identified several biological processes with significant enrichment including seven genes in the olfactory transduction pathway. In addition, we searched the phenotypes associated with the 47 candidate selection genes identified by Fst. These genes were involved in behavior, growth or body weight, mortality or aging, and immune systems which align well with the phenotypic differences between wild and laboratory mice. Therefore, the findings would be helpful for our understanding of the phenotypic differences between wild and laboratory mice and applications for using this new mouse resource (C1SLs) for further genetics studies.

De novo transcriptome sequencing and digital gene expression analysis predict biosynthetic pathway of rhynchophylline and isorhynchophylline from Uncaria rhynchophylla, a non-model plant with potent anti-alzheimer's properties.

PubMed

Guo, Qianqian; Ma, Xiaojun; Wei, Shugen; Qiu, Deyou; Wilson, Iain W; Wu, Peng; Tang, Qi; Liu, Lijun; Dong, Shoukun; Zu, Wei

2014-08-12

The major medicinal alkaloids isolated from Uncaria rhynchophylla (gouteng in chinese) capsules are rhynchophylline (RIN) and isorhynchophylline (IRN). Extracts containing these terpene indole alkaloids (TIAs) can inhibit the formation and destabilize preformed fibrils of amyloid β protein (a pathological marker of Alzheimer's disease), and have been shown to improve the cognitive function of mice with Alzheimer-like symptoms. The biosynthetic pathways of RIN and IRN are largely unknown. In this study, RNA-sequencing of pooled Uncaria capsules RNA samples taken at three developmental stages that accumulate different amount of RIN and IRN was performed. More than 50 million high-quality reads from a cDNA library were generated and de novo assembled. Sequences for all of the known enzymes involved in TIAs synthesis were identified. Additionally, 193 cytochrome P450 (CYP450), 280 methyltransferase and 144 isomerase genes were identified, that are potential candidates for enzymes involved in RIN and IRN synthesis. Digital gene expression profile (DGE) analysis was performed on the three capsule developmental stages, and based on genes possessing expression profiles consistent with RIN and IRN levels; four CYP450s, three methyltransferases and three isomerases were identified as the candidates most likely to be involved in the later steps of RIN and IRN biosynthesis. A combination of de novo transcriptome assembly and DGE analysis was shown to be a powerful method for identifying genes encoding enzymes potentially involved in the biosynthesis of important secondary metabolites in a non-model plant. The transcriptome data from this study provides an important resource for understanding the formation of major bioactive constituents in the capsule extract from Uncaria, and provides information that may aid in metabolic engineering to increase yields of these important alkaloids.

Intra- and inter-isolate variation of ribosomal and protein-coding genes in Pleurotus: implications for molecular identification and phylogeny on fungal groups.

PubMed

He, Xiao-Lan; Li, Qian; Peng, Wei-Hong; Zhou, Jie; Cao, Xue-Lian; Wang, Di; Huang, Zhong-Qian; Tan, Wei; Li, Yu; Gan, Bing-Cheng

2017-06-26

The internal transcribed spacer (ITS), RNA polymerase II second largest subunit (RPB2), and elongation factor 1-alpha (EF1α) are often used in fungal taxonomy and phylogenetic analysis. As we know, an ideal molecular marker used in molecular identification and phylogenetic studies is homogeneous within species, and interspecific variation exceeds intraspecific variation. However, during our process of performing ITS, RPB2, and EF1α sequencing on the Pleurotus spp., we found that intra-isolate sequence polymorphism might be present in these genes because direct sequencing of PCR products failed in some isolates. Therefore, we detected intra- and inter-isolate variation of the three genes in Pleurotus by polymerase chain reaction amplification and cloning in this study. Results showed that intra-isolate variation of ITS was not uncommon but the polymorphic level in each isolate was relatively low in Pleurotus; intra-isolate variations of EF1α and RPB2 sequences were present in an unexpectedly high amount. The polymorphism level differed significantly between ITS, RPB2, and EF1α in the same individual, and the intra-isolate heterogeneity level of each gene varied between isolates within the same species. Intra-isolate and intraspecific variation of ITS in the tested isolates was less than interspecific variation, and intra-isolate and intraspecific variation of RPB2 was probably equal with interspecific divergence. Meanwhile, intra-isolate and intraspecific variation of EF1α could exceed interspecific divergence. These findings suggested that RPB2 and EF1α are not desirable barcoding candidates for Pleurotus. We also discussed the reason why rDNA and protein-coding genes showed variants within a single isolate in Pleurotus, but must be addressed in further research. Our study demonstrated that intra-isolate variation of ribosomal and protein-coding genes are likely widespread in fungi. This has implications for studies on fungal evolution, taxonomy, phylogenetics, and population genetics. More extensive sampling of these genes and other candidates will be required to ensure reliability as phylogenetic markers and DNA barcodes.

The genetic characteristics of congenital hypothyroidism in China by comprehensive screening of 21 candidate genes.

PubMed

Sun, Feng; Zhang, Jun-Xiu; Yang, Chang-Yi; Gao, Guan-Qi; Zhu, Wen-Bin; Han, Bing; Zhang, Le-Le; Wan, Yue-Yue; Ye, Xiao-Ping; Ma, Yu-Ru; Zhang, Man-Man; Yang, Liu; Zhang, Qian-Yue; Liu, Wei; Guo, Cui-Cui; Chen, Gang; Zhao, Shuang-Xia; Song, Ke-Yi; Song, Huai-Dong

2018-06-01

Congenital hypothyroidism (CH), the most common neonatal metabolic disorder, is characterized by impaired neurodevelopment. Although several candidate genes have been associated with CH, comprehensive screening of causative genes has been limited. One hundred ten patients with primary CH were recruited in this study. All exons and exon-intron boundaries of 21 candidate genes for CH were analyzed by next-generation sequencing. And the inheritance pattern of causative genes was analyzed by the study of family pedigrees. Our results showed that 57 patients (51.82%) carried biallelic mutations (containing compound heterozygous mutations and homozygous mutations) in six genes ( DUOX2 , DUOXA2 , DUOXA1 , TG , TPO and TSHR ) involved in thyroid hormone synthesis. Autosomal recessive inheritance of CH caused by mutations in DUOX2 , DUOXA2 , TG and TPO was confirmed by analysis of 22 family pedigrees. Notably, eight mutations in four genes ( FOXE1 , NKX2-1 , PAX8 and HHEX ) that lead to thyroid dysgenesis were identified in eight probands. These mutations were heterozygous in all cases and hypothyroidism was not observed in parents of these probands. Most cases of congenital hypothyroidism in China were caused by thyroid dyshormonogenesis rather than thyroid dysgenesis. This study identified previously reported causative genes for 57/110 Chinese patients and revealed DUOX2 was the most frequently mutated gene in these patients. Our study expanded the mutation spectrum of CH in Chinese patients, which was significantly different from Western countries. © 2018 The authors.

POLR2C Mutations Are Associated With Primary Ovarian Insufficiency in Women.

PubMed

Moriwaki, Mika; Moore, Barry; Mosbruger, Timothy; Neklason, Deborah W; Yandell, Mark; Jorde, Lynn B; Welt, Corrine K

2017-03-01

Primary ovarian insufficiency (POI) results from a premature loss of oocytes, causing infertility and early menopause. The etiology of POI remains unknown in a majority of cases. To identify candidate genes in families affected by POI. This was a family-based genetic study. The study was performed at two academic institutions. A family with four generations of women affected by POI (n = 5). Four of these women, three with an associated autoimmune diagnosis, were studied. The controls (n = 387) were recruited for health in old age. Whole-genome sequencing was performed. Candidate genes were identified by comparing gene mutations in three family members and 387 control subjects analyzed simultaneously using the pedigree Variant Annotation, Analysis and Search Tool. Data were also compared with that in publicly available databases. We identified a heterozygous nonsense mutation in a subunit of RNA polymerase II ( POLR2C ) that synthesizes messenger RNA. A rare sequence variant in POLR2C was also identified in one of 96 women with sporadic POI. POLR2C expression was decreased in the proband compared with women with POI from another cause. Knockdown in an embryonic carcinoma cell line resulted in decreased protein production and impaired cell proliferation. These data support a role for RNA polymerase II mutations as candidates in the etiology of POI. The current data also support results from genome-wide association studies that hypothesize a role for RNA polymerase II subunits in age at menopause in the population.

HuMiChip: Development of a Functional Gene Array for the Study of Human Microbiomes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tu, Q.; Deng, Ye; Lin, Lu

Microbiomes play very important roles in terms of nutrition, health and disease by interacting with their hosts. Based on sequence data currently available in public domains, we have developed a functional gene array to monitor both organismal and functional gene profiles of normal microbiota in human and mouse hosts, and such an array is called human and mouse microbiota array, HMM-Chip. First, seed sequences were identified from KEGG databases, and used to construct a seed database (seedDB) containing 136 gene families in 19 metabolic pathways closely related to human and mouse microbiomes. Second, a mother database (motherDB) was constructed withmore » 81 genomes of bacterial strains with 54 from gut and 27 from oral environments, and 16 metagenomes, and used for selection of genes and probe design. Gene prediction was performed by Glimmer3 for bacterial genomes, and by the Metagene program for metagenomes. In total, 228,240 and 801,599 genes were identified for bacterial genomes and metagenomes, respectively. Then the motherDB was searched against the seedDB using the HMMer program, and gene sequences in the motherDB that were highly homologous with seed sequences in the seedDB were used for probe design by the CommOligo software. Different degrees of specific probes, including gene-specific, inclusive and exclusive group-specific probes were selected. All candidate probes were checked against the motherDB and NCBI databases for specificity. Finally, 7,763 probes covering 91.2percent (12,601 out of 13,814) HMMer confirmed sequences from 75 bacterial genomes and 16 metagenomes were selected. This developed HMM-Chip is able to detect the diversity and abundance of functional genes, the gene expression of microbial communities, and potentially, the interactions of microorganisms and their hosts.« less

Novel Phenotype-Genotype Correlations of Restrictive Cardiomyopathy With Myosin-Binding Protein C (MYBPC3) Gene Mutations Tested by Next-Generation Sequencing.

PubMed

Wu, Wei; Lu, Chao-Xia; Wang, Yi-Ning; Liu, Fang; Chen, Wei; Liu, Yong-Tai; Han, Ye-Chen; Cao, Jian; Zhang, Shu-Yang; Zhang, Xue

2015-07-10

MYBPC3 dysfunctions have been proven to induce dilated cardiomyopathy, hypertrophic cardiomyopathy, and/or left ventricular noncompaction; however, the genotype-phenotype correlation between MYBPC3 and restrictive cardiomyopathy (RCM) has not been established. The newly developed next-generation sequencing method is capable of broad genomic DNA sequencing with high throughput and can help explore novel correlations between genetic variants and cardiomyopathies. A proband from a multigenerational family with 3 live patients and 1 unrelated patient with clinical diagnoses of RCM underwent a next-generation sequencing workflow based on a custom AmpliSeq panel, including 64 candidate pathogenic genes for cardiomyopathies, on the Ion Personal Genome Machine high-throughput sequencing benchtop instrument. The selected panel contained a total of 64 genes that were reportedly associated with inherited cardiomyopathies. All patients fulfilled strict criteria for RCM with clinical characteristics, echocardiography, and/or cardiac magnetic resonance findings. The multigenerational family with 3 adult RCM patients carried an identical nonsense MYBPC3 mutation, and the unrelated patient carried a missense mutation in the MYBPC3 gene. All of these results were confirmed by the Sanger sequencing method. This study demonstrated that MYBPC3 gene mutations, revealed by next-generation sequencing, were associated with familial and sporadic RCM patients. It is suggested that the next-generation sequencing platform with a selected panel provides a highly efficient approach for molecular diagnosis of hereditary and idiopathic RCM and helps build new genotype-phenotype correlations. © 2015 The Authors. Published on behalf of the American Heart Association, Inc., by Wiley Blackwell.

Digital gene expression analysis of the zebra finch genome

PubMed Central

2010-01-01

Background In order to understand patterns of adaptation and molecular evolution it is important to quantify both variation in gene expression and nucleotide sequence divergence. Gene expression profiling in non-model organisms has recently been facilitated by the advent of massively parallel sequencing technology. Here we investigate tissue specific gene expression patterns in the zebra finch (Taeniopygia guttata) with special emphasis on the genes of the major histocompatibility complex (MHC). Results Almost 2 million 454-sequencing reads from cDNA of six different tissues were assembled and analysed. A total of 11,793 zebra finch transcripts were represented in this EST data, indicating a transcriptome coverage of about 65%. There was a positive correlation between the tissue specificity of gene expression and non-synonymous to synonymous nucleotide substitution ratio of genes, suggesting that genes with a specialised function are evolving at a higher rate (or with less constraint) than genes with a more general function. In line with this, there was also a negative correlation between overall expression levels and expression specificity of contigs. We found evidence for expression of 10 different genes related to the MHC. MHC genes showed relatively tissue specific expression levels and were in general primarily expressed in spleen. Several MHC genes, including MHC class I also showed expression in brain. Furthermore, for all genes with highest levels of expression in spleen there was an overrepresentation of several gene ontology terms related to immune function. Conclusions Our study highlights the usefulness of next-generation sequence data for quantifying gene expression in the genome as a whole as well as in specific candidate genes. Overall, the data show predicted patterns of gene expression profiles and molecular evolution in the zebra finch genome. Expression of MHC genes in particular, corresponds well with expression patterns in other vertebrates. PMID:20359325

Chemosensory Gene Families in Ectropis grisescens and Candidates for Detection of Type-II Sex Pheromones.

PubMed

Li, Zhao-Qun; Luo, Zong-Xiu; Cai, Xiao-Ming; Bian, Lei; Xin, Zhao-Jun; Liu, Yan; Chu, Bo; Chen, Zong-Mao

2017-01-01

Tea grey geometrid ( Ectropis grisescens ), a devastating chewing pest in tea plantations throughout China, produces Type-II pheromone components. Little is known about the genes encoding proteins involved in the perception of Type-II sex pheromone components. To investigate the olfaction genes involved in E . grisescens sex pheromones and plant volatiles perception, we sequenced female and male antennae transcriptomes of E . grisescens . After assembly and annotation, we identified 153 candidate chemoreception genes in E. grisescens , including 40 odorant-binding proteins (OBPs), 30 chemosensory proteins (CSPs), 59 odorant receptors (ORs), and 24 ionotropic receptors (IRs). The results of phylogenetic, qPCR, and mRNA abundance analyses suggested that three candidate pheromone-binding proteins (EgriOBP2, 3, and 25), two candidate general odorant-binding proteins (EgriOBP1 and 29), six pheromone receptors (EgriOR24, 25, 28, 31, 37, and 44), and EgriCSP8 may be involved in the detection of Type-II sex pheromone components. Functional investigation by heterologous expression in Xenopus oocytes revealed that EgriOR31 was robustly tuned to the E . grisescens sex pheromone component (Z,Z,Z)-3,6,9-octadecatriene and weakly to the other sex pheromone component (Z,Z)-3,9-6,7-epoxyoctadecadiene. Our results represent a systematic functional analysis of the molecular mechanism of olfaction perception in E . grisescens with an emphasis on gene encoding proteins involved in perception of Type-II sex pheromones, and provide information that will be relevant to other Lepidoptera species.

A novel truncation mutation in CRYBB1 associated with autosomal dominant congenital cataract with nystagmus.

PubMed

Rao, Yan; Dong, Sufang; Li, Zuhua; Yang, Guohua; Peng, Chunyan; Yan, Ming; Zheng, Fang

2017-01-01

To identify the potential candidate genes for a large Chinese family with autosomal dominant congenital cataract (ADCC) and nystagmus, and investigate the possible molecular mechanism underlying the role of the candidate genes in cataractogenesis. We combined the linkage analysis and direct sequencing for the candidate genes in the linkage regions to identify the causative mutation. The molecular and bio-functional properties of the proteins encoded by the candidate genes was further explored with biophysical and biochemical studies of the recombinant wild-type and mutant proteins. We identified a c. C749T (p.Q227X) transversion in exon 6 of CRYBB1 , a cataract-causative gene. This nonsense mutation changes a phylogenetically conserved glutamine to a stop codon and is predicted to truncate the C-terminus of the wild-type protein by 26 amino acids. Comparison of the biophysical and biochemical properties of the recombinant full-length and truncated βB1-crystallins revealed that the mutation led to the insolubility and the phase separation phenomenon of the truncated protein with a changed conformation. Meanwhile, the thermal stability of the truncated βB1-crystallin was significantly decreased, and the mutation diminished the chaperoning ability of αA-crystallin with the mutant under heating stress. Our findings highlight the importance of the C-terminus in βB1-crystallin in maintaining the crystalline function and stability, and provide a novel insight into the molecular mechanism underlying the pathogenesis of human autosomal dominant congenital cataract.

Chemosensory Gene Families in Ectropis grisescens and Candidates for Detection of Type-II Sex Pheromones

PubMed Central

Li, Zhao-Qun; Luo, Zong-Xiu; Cai, Xiao-Ming; Bian, Lei; Xin, Zhao-Jun; Liu, Yan; Chu, Bo; Chen, Zong-Mao

2017-01-01

Tea grey geometrid (Ectropis grisescens), a devastating chewing pest in tea plantations throughout China, produces Type-II pheromone components. Little is known about the genes encoding proteins involved in the perception of Type-II sex pheromone components. To investigate the olfaction genes involved in E. grisescens sex pheromones and plant volatiles perception, we sequenced female and male antennae transcriptomes of E. grisescens. After assembly and annotation, we identified 153 candidate chemoreception genes in E. grisescens, including 40 odorant-binding proteins (OBPs), 30 chemosensory proteins (CSPs), 59 odorant receptors (ORs), and 24 ionotropic receptors (IRs). The results of phylogenetic, qPCR, and mRNA abundance analyses suggested that three candidate pheromone-binding proteins (EgriOBP2, 3, and 25), two candidate general odorant-binding proteins (EgriOBP1 and 29), six pheromone receptors (EgriOR24, 25, 28, 31, 37, and 44), and EgriCSP8 may be involved in the detection of Type-II sex pheromone components. Functional investigation by heterologous expression in Xenopus oocytes revealed that EgriOR31 was robustly tuned to the E. grisescens sex pheromone component (Z,Z,Z)-3,6,9-octadecatriene and weakly to the other sex pheromone component (Z,Z)-3,9-6,7-epoxyoctadecadiene. Our results represent a systematic functional analysis of the molecular mechanism of olfaction perception in E. grisescens with an emphasis on gene encoding proteins involved in perception of Type-II sex pheromones, and provide information that will be relevant to other Lepidoptera species. PMID:29209233

A novel nonsense mutation in CRYBB1 associated with autosomal dominant congenital cataract

PubMed Central

Yang, Juhua; Zhu, Yihua; Gu, Feng; He, Xiang; Cao, Zongfu; Li, Xuexi; Tong, Yi

2008-01-01

Purpose To identify the molecular defect underlying an autosomal dominant congenital nuclear cataract in a Chinese family. Methods Twenty-two members of a three-generation pedigree were recruited, clinical examinations were performed, and genomic DNA was extracted from peripheral blood leukocytes. All members were genotyped with polymorphic microsatellite markers adjacent to each of the known cataract-related genes. Linkage analysis was performed after genotyping. Candidate genes were screened for mutation using direct sequencing. Individuals were screened for presence of a mutation by restriction fragment length polymorphism (RFLP) analysis. Results Linkage analysis identified a maximum LOD score of 3.31 (recombination fraction [θ]=0.0) with marker D22S1167 on chromosome 22, which flanks the β-crystallin gene cluster (CRYBB3, CRYBB2, CRYBB1, and CRYBA4). Sequencing the coding regions and the flanking intronic sequences of these four candidate genes identified a novel, heterozygous C→T transition in exon 6 of CRYBB1 in the affected individuals of the family. This single nucleotide change introduced a novel BfaI site and was predicted to result in a nonsense mutation at codon 223 that changed a phylogenetically conserved amino acid to a stop codon (p.Q223X). RFLP analysis confirmed that this mutation co-segregated with the disease phenotype in all available family members and was not found in 100 normal unrelated individuals from the same ethnic background. Conclusions This study has identified a novel nonsense mutation in CRYBB1 (p.Q223X) associated with autosomal dominant congenital nuclear cataract. PMID:18432316