Sample records for candidate genes based

  1. A computational approach to candidate gene prioritization for X-linked mental retardation using annotation-based binary filtering and motif-based linear discriminatory analysis

    PubMed Central

    2011-01-01

    Background Several computational candidate gene selection and prioritization methods have recently been developed. These in silico selection and prioritization techniques are usually based on two central approaches - the examination of similarities to known disease genes and/or the evaluation of functional annotation of genes. Each of these approaches has its own caveats. Here we employ a previously described method of candidate gene prioritization based mainly on gene annotation, in accompaniment with a technique based on the evaluation of pertinent sequence motifs or signatures, in an attempt to refine the gene prioritization approach. We apply this approach to X-linked mental retardation (XLMR), a group of heterogeneous disorders for which some of the underlying genetics is known. Results The gene annotation-based binary filtering method yielded a ranked list of putative XLMR candidate genes with good plausibility of being associated with the development of mental retardation. In parallel, a motif finding approach based on linear discriminatory analysis (LDA) was employed to identify short sequence patterns that may discriminate XLMR from non-XLMR genes. High rates (>80%) of correct classification was achieved, suggesting that the identification of these motifs effectively captures genomic signals associated with XLMR vs. non-XLMR genes. The computational tools developed for the motif-based LDA is integrated into the freely available genomic analysis portal Galaxy (http://main.g2.bx.psu.edu/). Nine genes (APLN, ZC4H2, MAGED4, MAGED4B, RAP2C, FAM156A, FAM156B, TBL1X, and UXT) were highlighted as highly-ranked XLMR methods. Conclusions The combination of gene annotation information and sequence motif-orientated computational candidate gene prediction methods highlight an added benefit in generating a list of plausible candidate genes, as has been demonstrated for XLMR. Reviewers: This article was reviewed by Dr Barbara Bardoni (nominated by Prof Juergen Brosius); Prof Neil Smalheiser and Dr Dustin Holloway (nominated by Prof Charles DeLisi). PMID:21668950

  2. Development of New Candidate Gene and EST-Based Molecular Markers for Gossypium Species

    PubMed Central

    Buyyarapu, Ramesh; Kantety, Ramesh V.; Yu, John Z.; Saha, Sukumar; Sharma, Govind C.

    2011-01-01

    New source of molecular markers accelerate the efforts in improving cotton fiber traits and aid in developing high-density integrated genetic maps. We developed new markers based on candidate genes and G. arboreum EST sequences that were used for polymorphism detection followed by genetic and physical mapping. Nineteen gene-based markers were surveyed for polymorphism detection in 26 Gossypium species. Cluster analysis generated a phylogenetic tree with four major sub-clusters for 23 species while three species branched out individually. CAP method enhanced the rate of polymorphism of candidate gene-based markers between G. hirsutum and G. barbadense. Two hundred A-genome based SSR markers were designed after datamining of G. arboreum EST sequences (Mississippi Gossypium arboreum   EST-SSR: MGAES). Over 70% of MGAES markers successfully produced amplicons while 65 of them demonstrated polymorphism between the parents of G. hirsutum and G. barbadense RIL population and formed 14 linkage groups. Chromosomal localization of both candidate gene-based and MGAES markers was assisted by euploid and hypoaneuploid CS-B analysis. Gene-based and MGAES markers were highly informative as they were designed from candidate genes and fiber transcriptome with a potential to be integrated into the existing cotton genetic and physical maps. PMID:22315588

  3. Prioritization of candidate disease genes by topological similarity between disease and protein diffusion profiles.

    PubMed

    Zhu, Jie; Qin, Yufang; Liu, Taigang; Wang, Jun; Zheng, Xiaoqi

    2013-01-01

    Identification of gene-phenotype relationships is a fundamental challenge in human health clinic. Based on the observation that genes causing the same or similar phenotypes tend to correlate with each other in the protein-protein interaction network, a lot of network-based approaches were proposed based on different underlying models. A recent comparative study showed that diffusion-based methods achieve the state-of-the-art predictive performance. In this paper, a new diffusion-based method was proposed to prioritize candidate disease genes. Diffusion profile of a disease was defined as the stationary distribution of candidate genes given a random walk with restart where similarities between phenotypes are incorporated. Then, candidate disease genes are prioritized by comparing their diffusion profiles with that of the disease. Finally, the effectiveness of our method was demonstrated through the leave-one-out cross-validation against control genes from artificial linkage intervals and randomly chosen genes. Comparative study showed that our method achieves improved performance compared to some classical diffusion-based methods. To further illustrate our method, we used our algorithm to predict new causing genes of 16 multifactorial diseases including Prostate cancer and Alzheimer's disease, and the top predictions were in good consistent with literature reports. Our study indicates that integration of multiple information sources, especially the phenotype similarity profile data, and introduction of global similarity measure between disease and gene diffusion profiles are helpful for prioritizing candidate disease genes. Programs and data are available upon request.

  4. Candidate gene prioritization by network analysis of differential expression using machine learning approaches

    PubMed Central

    2010-01-01

    Background Discovering novel disease genes is still challenging for diseases for which no prior knowledge - such as known disease genes or disease-related pathways - is available. Performing genetic studies frequently results in large lists of candidate genes of which only few can be followed up for further investigation. We have recently developed a computational method for constitutional genetic disorders that identifies the most promising candidate genes by replacing prior knowledge by experimental data of differential gene expression between affected and healthy individuals. To improve the performance of our prioritization strategy, we have extended our previous work by applying different machine learning approaches that identify promising candidate genes by determining whether a gene is surrounded by highly differentially expressed genes in a functional association or protein-protein interaction network. Results We have proposed three strategies scoring disease candidate genes relying on network-based machine learning approaches, such as kernel ridge regression, heat kernel, and Arnoldi kernel approximation. For comparison purposes, a local measure based on the expression of the direct neighbors is also computed. We have benchmarked these strategies on 40 publicly available knockout experiments in mice, and performance was assessed against results obtained using a standard procedure in genetics that ranks candidate genes based solely on their differential expression levels (Simple Expression Ranking). Our results showed that our four strategies could outperform this standard procedure and that the best results were obtained using the Heat Kernel Diffusion Ranking leading to an average ranking position of 8 out of 100 genes, an AUC value of 92.3% and an error reduction of 52.8% relative to the standard procedure approach which ranked the knockout gene on average at position 17 with an AUC value of 83.7%. Conclusion In this study we could identify promising candidate genes using network based machine learning approaches even if no knowledge is available about the disease or phenotype. PMID:20840752

  5. Reranking candidate gene models with cross-species comparison for improved gene prediction

    PubMed Central

    Liu, Qian; Crammer, Koby; Pereira, Fernando CN; Roos, David S

    2008-01-01

    Background Most gene finders score candidate gene models with state-based methods, typically HMMs, by combining local properties (coding potential, splice donor and acceptor patterns, etc). Competing models with similar state-based scores may be distinguishable with additional information. In particular, functional and comparative genomics datasets may help to select among competing models of comparable probability by exploiting features likely to be associated with the correct gene models, such as conserved exon/intron structure or protein sequence features. Results We have investigated the utility of a simple post-processing step for selecting among a set of alternative gene models, using global scoring rules to rerank competing models for more accurate prediction. For each gene locus, we first generate the K best candidate gene models using the gene finder Evigan, and then rerank these models using comparisons with putative orthologous genes from closely-related species. Candidate gene models with lower scores in the original gene finder may be selected if they exhibit strong similarity to probable orthologs in coding sequence, splice site location, or signal peptide occurrence. Experiments on Drosophila melanogaster demonstrate that reranking based on cross-species comparison outperforms the best gene models identified by Evigan alone, and also outperforms the comparative gene finders GeneWise and Augustus+. Conclusion Reranking gene models with cross-species comparison improves gene prediction accuracy. This straightforward method can be readily adapted to incorporate additional lines of evidence, as it requires only a ranked source of candidate gene models. PMID:18854050

  6. Finding gene regulatory network candidates using the gene expression knowledge base.

    PubMed

    Venkatesan, Aravind; Tripathi, Sushil; Sanz de Galdeano, Alejandro; Blondé, Ward; Lægreid, Astrid; Mironov, Vladimir; Kuiper, Martin

    2014-12-10

    Network-based approaches for the analysis of large-scale genomics data have become well established. Biological networks provide a knowledge scaffold against which the patterns and dynamics of 'omics' data can be interpreted. The background information required for the construction of such networks is often dispersed across a multitude of knowledge bases in a variety of formats. The seamless integration of this information is one of the main challenges in bioinformatics. The Semantic Web offers powerful technologies for the assembly of integrated knowledge bases that are computationally comprehensible, thereby providing a potentially powerful resource for constructing biological networks and network-based analysis. We have developed the Gene eXpression Knowledge Base (GeXKB), a semantic web technology based resource that contains integrated knowledge about gene expression regulation. To affirm the utility of GeXKB we demonstrate how this resource can be exploited for the identification of candidate regulatory network proteins. We present four use cases that were designed from a biological perspective in order to find candidate members relevant for the gastrin hormone signaling network model. We show how a combination of specific query definitions and additional selection criteria derived from gene expression data and prior knowledge concerning candidate proteins can be used to retrieve a set of proteins that constitute valid candidates for regulatory network extensions. Semantic web technologies provide the means for processing and integrating various heterogeneous information sources. The GeXKB offers biologists such an integrated knowledge resource, allowing them to address complex biological questions pertaining to gene expression. This work illustrates how GeXKB can be used in combination with gene expression results and literature information to identify new potential candidates that may be considered for extending a gene regulatory network.

  7. Search for sarcoidosis candidate genes by integration of data from genomic, transcriptomic and proteomic studies.

    PubMed

    Maver, Ales; Medica, Igor; Peterlin, Borut

    2009-12-01

    The search for gene candidates in multifactorial diseases such as sarcoidosis can be based on the integration of linkage association data, gene expression data, and protein profile data from genomic, transcriptomic and proteomic studies, respectively. In this study we performed a literature-based search for studies reporting such data, followed by integration of collected information. Different databases were examined--Medline, HugGE Navigator, ArrayExpress and Gene Expression Omnibus (GEO). Candidate genes were defined as genes which were reported in at least 2 different types of omics studies. Genes previously investigated in sarcoidosis were excluded from further analyses. We identified 177 genes associated with sarcoidosis as potential new candidate genes. Subsequently, 9 gene candidates identified to overlap in 2 different types of studies (genomic, transcriptomic and/or proteomic) were consistently reported in at least 3 studies: SERPINB1, FABP4, S100A8, HBEGF, IL7R, LRIG1, PTPN23, DPM2 and NUP214. These genes are involved in regulation of immune response, cellular proliferation, apoptosis, inhibition of protease activity, lipid metabolism. Exact biological functions of HBEGF, LRIG1, PTPN23, DPM2 and NUP214 remain to be completely elucidated. We propose 9 candidate genes: SERPINB1, FABP4, S100A8, HBEGF, IL7R, LRIG1, PTPN23, DPM2 and NUP214, as genes with high potential for association with sarcoidosis.

  8. Candidate genes for obesity-susceptibility show enriched association within a large genome-wide association study for BMI.

    PubMed

    Vimaleswaran, Karani S; Tachmazidou, Ioanna; Zhao, Jing Hua; Hirschhorn, Joel N; Dudbridge, Frank; Loos, Ruth J F

    2012-10-15

    Before the advent of genome-wide association studies (GWASs), hundreds of candidate genes for obesity-susceptibility had been identified through a variety of approaches. We examined whether those obesity candidate genes are enriched for associations with body mass index (BMI) compared with non-candidate genes by using data from a large-scale GWAS. A thorough literature search identified 547 candidate genes for obesity-susceptibility based on evidence from animal studies, Mendelian syndromes, linkage studies, genetic association studies and expression studies. Genomic regions were defined to include the genes ±10 kb of flanking sequence around candidate and non-candidate genes. We used summary statistics publicly available from the discovery stage of the genome-wide meta-analysis for BMI performed by the genetic investigation of anthropometric traits consortium in 123 564 individuals. Hypergeometric, rank tail-strength and gene-set enrichment analysis tests were used to test for the enrichment of association in candidate compared with non-candidate genes. The hypergeometric test of enrichment was not significant at the 5% P-value quantile (P = 0.35), but was nominally significant at the 25% quantile (P = 0.015). The rank tail-strength and gene-set enrichment tests were nominally significant for the full set of genes and borderline significant for the subset without SNPs at P < 10(-7). Taken together, the observed evidence for enrichment suggests that the candidate gene approach retains some value. However, the degree of enrichment is small despite the extensive number of candidate genes and the large sample size. Studies that focus on candidate genes have only slightly increased chances of detecting associations, and are likely to miss many true effects in non-candidate genes, at least for obesity-related traits.

  9. confFuse: High-Confidence Fusion Gene Detection across Tumor Entities.

    PubMed

    Huang, Zhiqin; Jones, David T W; Wu, Yonghe; Lichter, Peter; Zapatka, Marc

    2017-01-01

    Background: Fusion genes play an important role in the tumorigenesis of many cancers. Next-generation sequencing (NGS) technologies have been successfully applied in fusion gene detection for the last several years, and a number of NGS-based tools have been developed for identifying fusion genes during this period. Most fusion gene detection tools based on RNA-seq data report a large number of candidates (mostly false positives), making it hard to prioritize candidates for experimental validation and further analysis. Selection of reliable fusion genes for downstream analysis becomes very important in cancer research. We therefore developed confFuse, a scoring algorithm to reliably select high-confidence fusion genes which are likely to be biologically relevant. Results: confFuse takes multiple parameters into account in order to assign each fusion candidate a confidence score, of which score ≥8 indicates high-confidence fusion gene predictions. These parameters were manually curated based on our experience and on certain structural motifs of fusion genes. Compared with alternative tools, based on 96 published RNA-seq samples from different tumor entities, our method can significantly reduce the number of fusion candidates (301 high-confidence from 8,083 total predicted fusion genes) and keep high detection accuracy (recovery rate 85.7%). Validation of 18 novel, high-confidence fusions detected in three breast tumor samples resulted in a 100% validation rate. Conclusions: confFuse is a novel downstream filtering method that allows selection of highly reliable fusion gene candidates for further downstream analysis and experimental validations. confFuse is available at https://github.com/Zhiqin-HUANG/confFuse.

  10. EnRICH: Extraction and Ranking using Integration and Criteria Heuristics.

    PubMed

    Zhang, Xia; Greenlee, M Heather West; Serb, Jeanne M

    2013-01-15

    High throughput screening technologies enable biologists to generate candidate genes at a rate that, due to time and cost constraints, cannot be studied by experimental approaches in the laboratory. Thus, it has become increasingly important to prioritize candidate genes for experiments. To accomplish this, researchers need to apply selection requirements based on their knowledge, which necessitates qualitative integration of heterogeneous data sources and filtration using multiple criteria. A similar approach can also be applied to putative candidate gene relationships. While automation can assist in this routine and imperative procedure, flexibility of data sources and criteria must not be sacrificed. A tool that can optimize the trade-off between automation and flexibility to simultaneously filter and qualitatively integrate data is needed to prioritize candidate genes and generate composite networks from heterogeneous data sources. We developed the java application, EnRICH (Extraction and Ranking using Integration and Criteria Heuristics), in order to alleviate this need. Here we present a case study in which we used EnRICH to integrate and filter multiple candidate gene lists in order to identify potential retinal disease genes. As a result of this procedure, a candidate pool of several hundred genes was narrowed down to five candidate genes, of which four are confirmed retinal disease genes and one is associated with a retinal disease state. We developed a platform-independent tool that is able to qualitatively integrate multiple heterogeneous datasets and use different selection criteria to filter each of them, provided the datasets are tables that have distinct identifiers (required) and attributes (optional). With the flexibility to specify data sources and filtering criteria, EnRICH automatically prioritizes candidate genes or gene relationships for biologists based on their specific requirements. Here, we also demonstrate that this tool can be effectively and easily used to apply highly specific user-defined criteria and can efficiently identify high quality candidate genes from relatively sparse datasets.

  11. Prediction of gene-phenotype associations in humans, mice, and plants using phenologs.

    PubMed

    Woods, John O; Singh-Blom, Ulf Martin; Laurent, Jon M; McGary, Kriston L; Marcotte, Edward M

    2013-06-21

    Phenotypes and diseases may be related to seemingly dissimilar phenotypes in other species by means of the orthology of underlying genes. Such "orthologous phenotypes," or "phenologs," are examples of deep homology, and may be used to predict additional candidate disease genes. In this work, we develop an unsupervised algorithm for ranking phenolog-based candidate disease genes through the integration of predictions from the k nearest neighbor phenologs, comparing classifiers and weighting functions by cross-validation. We also improve upon the original method by extending the theory to paralogous phenotypes. Our algorithm makes use of additional phenotype data--from chicken, zebrafish, and E. coli, as well as new datasets for C. elegans--establishing that several types of annotations may be treated as phenotypes. We demonstrate the use of our algorithm to predict novel candidate genes for human atrial fibrillation (such as HRH2, ATP4A, ATP4B, and HOPX) and epilepsy (e.g., PAX6 and NKX2-1). We suggest gene candidates for pharmacologically-induced seizures in mouse, solely based on orthologous phenotypes from E. coli. We also explore the prediction of plant gene-phenotype associations, as for the Arabidopsis response to vernalization phenotype. We are able to rank gene predictions for a significant portion of the diseases in the Online Mendelian Inheritance in Man database. Additionally, our method suggests candidate genes for mammalian seizures based only on bacterial phenotypes and gene orthology. We demonstrate that phenotype information may come from diverse sources, including drug sensitivities, gene ontology biological processes, and in situ hybridization annotations. Finally, we offer testable candidates for a variety of human diseases, plant traits, and other classes of phenotypes across a wide array of species.

  12. Next-generation sequencing to identify candidate genes and develop diagnostic markers for a novel Phytophthora resistance gene, RpsHC18, in soybean.

    PubMed

    Zhong, Chao; Sun, Suli; Li, Yinping; Duan, Canxing; Zhu, Zhendong

    2018-03-01

    A novel Phytophthora sojae resistance gene RpsHC18 was identified and finely mapped on soybean chromosome 3. Two NBS-LRR candidate genes were identified and two diagnostic markers of RpsHC18 were developed. Phytophthora root rot caused by Phytophthora sojae is a destructive disease of soybean. The most effective disease-control strategy is to deploy resistant cultivars carrying Phytophthora-resistant Rps genes. The soybean cultivar Huachun 18 has a broad and distinct resistance spectrum to 12 P. sojae isolates. Quantitative trait loci sequencing (QTL-seq), based on the whole-genome resequencing (WGRS) of two extreme resistant and susceptible phenotype bulks from an F 2:3 population, was performed, and one 767-kb genomic region with ΔSNP-index ≥ 0.9 on chromosome 3 was identified as the RpsHC18 candidate region in Huachun 18. The candidate region was reduced to a 146-kb region by fine mapping. Nonsynonymous SNP and haplotype analyses were carried out in the 146-kb region among ten soybean genotypes using WGRS. Four specific nonsynonymous SNPs were identified in two nucleotide-binding sites-leucine-rich repeat (NBS-LRR) genes, RpsHC18-NBL1 and RpsHC18-NBL2, which were considered to be the candidate genes. Finally, one specific SNP marker in each candidate gene was successfully developed using a tetra-primer ARMS-PCR assay, and the two markers were verified to be specific for RpsHC18 and to effectively distinguish other known Rps genes. In this study, we applied an integrated genomic-based strategy combining WGRS with traditional genetic mapping to identify RpsHC18 candidate genes and develop diagnostic markers. These results suggest that next-generation sequencing is a precise, rapid and cost-effective way to identify candidate genes and develop diagnostic markers, and it can accelerate Rps gene cloning and marker-assisted selection for breeding of P. sojae-resistant soybean cultivars.

  13. Candidate gene identification of ovulation-inducing genes by RNA sequencing with an in vivo assay in zebrafish.

    PubMed

    Klangnurak, Wanlada; Fukuyo, Taketo; Rezanujjaman, M D; Seki, Masahide; Sugano, Sumio; Suzuki, Yutaka; Tokumoto, Toshinobu

    2018-01-01

    We previously reported the microarray-based selection of three ovulation-related genes in zebrafish. We used a different selection method in this study, RNA sequencing analysis. An additional eight up-regulated candidates were found as specifically up-regulated genes in ovulation-induced samples. Changes in gene expression were confirmed by qPCR analysis. Furthermore, up-regulation prior to ovulation during natural spawning was verified in samples from natural pairing. Gene knock-out zebrafish strains of one of the candidates, the starmaker gene (stm), were established by CRISPR genome editing techniques. Unexpectedly, homozygous mutants were fertile and could spawn eggs. However, a high percentage of unfertilized eggs and abnormal embryos were produced from these homozygous females. The results suggest that the stm gene is necessary for fertilization. In this study, we selected additional ovulation-inducing candidate genes, and a novel function of the stm gene was investigated.

  14. Endeavour update: a web resource for gene prioritization in multiple species

    PubMed Central

    Tranchevent, Léon-Charles; Barriot, Roland; Yu, Shi; Van Vooren, Steven; Van Loo, Peter; Coessens, Bert; De Moor, Bart; Aerts, Stein; Moreau, Yves

    2008-01-01

    Endeavour (http://www.esat.kuleuven.be/endeavourweb; this web site is free and open to all users and there is no login requirement) is a web resource for the prioritization of candidate genes. Using a training set of genes known to be involved in a biological process of interest, our approach consists of (i) inferring several models (based on various genomic data sources), (ii) applying each model to the candidate genes to rank those candidates against the profile of the known genes and (iii) merging the several rankings into a global ranking of the candidate genes. In the present article, we describe the latest developments of Endeavour. First, we provide a web-based user interface, besides our Java client, to make Endeavour more universally accessible. Second, we support multiple species: in addition to Homo sapiens, we now provide gene prioritization for three major model organisms: Mus musculus, Rattus norvegicus and Caenorhabditis elegans. Third, Endeavour makes use of additional data sources and is now including numerous databases: ontologies and annotations, protein–protein interactions, cis-regulatory information, gene expression data sets, sequence information and text-mining data. We tested the novel version of Endeavour on 32 recent disease gene associations from the literature. Additionally, we describe a number of recent independent studies that made use of Endeavour to prioritize candidate genes for obesity and Type II diabetes, cleft lip and cleft palate, and pulmonary fibrosis. PMID:18508807

  15. The cld mutation: narrowing the critical chromosomal region and selecting candidate genes.

    PubMed

    Péterfy, Miklós; Mao, Hui Z; Doolittle, Mark H

    2006-10-01

    Combined lipase deficiency (cld) is a recessive, lethal mutation specific to the tw73 haplotype on mouse Chromosome 17. While the cld mutation results in lipase proteins that are inactive, aggregated, and retained in the endoplasmic reticulum (ER), it maps separately from the lipase structural genes. We have narrowed the gene critical region by about 50% using the tw18 haplotype for deletion mapping and a recombinant chromosome used originally to map cld with respect to the phenotypic marker tf. The region now extends from 22 to 25.6 Mbp on the wild-type chromosome, currently containing 149 genes and 50 expressed sequence tags (ESTs). To identify the affected gene, we have selected candidates based on their known role in associated biological processes, cellular components, and molecular functions that best fit with the predicted function of the cld gene. A secondary approach was based on differences in mRNA levels between mutant (cld/cld) and unaffected (+/cld) cells. Using both approaches, we have identified seven functional candidates with an ER localization and/or an involvement in protein maturation and folding that could explain the lipase deficiency, and six expression candidates that exhibit large differences in mRNA levels between mutant and unaffected cells. Significantly, two genes were found to be candidates with regard to both function and expression, thus emerging as the strongest candidates for cld. We discuss the implications of our mapping results and our selection of candidates with respect to other genes, deletions, and mutations occurring in the cld critical region.

  16. Scuba: scalable kernel-based gene prioritization.

    PubMed

    Zampieri, Guido; Tran, Dinh Van; Donini, Michele; Navarin, Nicolò; Aiolli, Fabio; Sperduti, Alessandro; Valle, Giorgio

    2018-01-25

    The uncovering of genes linked to human diseases is a pressing challenge in molecular biology and precision medicine. This task is often hindered by the large number of candidate genes and by the heterogeneity of the available information. Computational methods for the prioritization of candidate genes can help to cope with these problems. In particular, kernel-based methods are a powerful resource for the integration of heterogeneous biological knowledge, however, their practical implementation is often precluded by their limited scalability. We propose Scuba, a scalable kernel-based method for gene prioritization. It implements a novel multiple kernel learning approach, based on a semi-supervised perspective and on the optimization of the margin distribution. Scuba is optimized to cope with strongly unbalanced settings where known disease genes are few and large scale predictions are required. Importantly, it is able to efficiently deal both with a large amount of candidate genes and with an arbitrary number of data sources. As a direct consequence of scalability, Scuba integrates also a new efficient strategy to select optimal kernel parameters for each data source. We performed cross-validation experiments and simulated a realistic usage setting, showing that Scuba outperforms a wide range of state-of-the-art methods. Scuba achieves state-of-the-art performance and has enhanced scalability compared to existing kernel-based approaches for genomic data. This method can be useful to prioritize candidate genes, particularly when their number is large or when input data is highly heterogeneous. The code is freely available at https://github.com/gzampieri/Scuba .

  17. PINTA: a web server for network-based gene prioritization from expression data

    PubMed Central

    Nitsch, Daniela; Tranchevent, Léon-Charles; Gonçalves, Joana P.; Vogt, Josef Korbinian; Madeira, Sara C.; Moreau, Yves

    2011-01-01

    PINTA (available at http://www.esat.kuleuven.be/pinta/; this web site is free and open to all users and there is no login requirement) is a web resource for the prioritization of candidate genes based on the differential expression of their neighborhood in a genome-wide protein–protein interaction network. Our strategy is meant for biological and medical researchers aiming at identifying novel disease genes using disease specific expression data. PINTA supports both candidate gene prioritization (starting from a user defined set of candidate genes) as well as genome-wide gene prioritization and is available for five species (human, mouse, rat, worm and yeast). As input data, PINTA only requires disease specific expression data, whereas various platforms (e.g. Affymetrix) are supported. As a result, PINTA computes a gene ranking and presents the results as a table that can easily be browsed and downloaded by the user. PMID:21602267

  18. Meta-review of protein network regulating obesity between validated obesity candidate genes in the white adipose tissue of high-fat diet-induced obese C57BL/6J mice.

    PubMed

    Kim, Eunjung; Kim, Eun Jung; Seo, Seung-Won; Hur, Cheol-Goo; McGregor, Robin A; Choi, Myung-Sook

    2014-01-01

    Worldwide obesity and related comorbidities are increasing, but identifying new therapeutic targets remains a challenge. A plethora of microarray studies in diet-induced obesity models has provided large datasets of obesity associated genes. In this review, we describe an approach to examine the underlying molecular network regulating obesity, and we discuss interactions between obesity candidate genes. We conducted network analysis on functional protein-protein interactions associated with 25 obesity candidate genes identified in a literature-driven approach based on published microarray studies of diet-induced obesity. The obesity candidate genes were closely associated with lipid metabolism and inflammation. Peroxisome proliferator activated receptor gamma (Pparg) appeared to be a core obesity gene, and obesity candidate genes were highly interconnected, suggesting a coordinately regulated molecular network in adipose tissue. In conclusion, the current network analysis approach may help elucidate the underlying molecular network regulating obesity and identify anti-obesity targets for therapeutic intervention.

  19. Candidate genes and molecular markers associated with heat tolerance in colonial Bentgrass.

    PubMed

    Jespersen, David; Belanger, Faith C; Huang, Bingru

    2017-01-01

    Elevated temperature is a major abiotic stress limiting the growth of cool-season grasses during the summer months. The objectives of this study were to determine the genetic variation in the expression patterns of selected genes involved in several major metabolic pathways regulating heat tolerance for two genotypes contrasting in heat tolerance to confirm their status as potential candidate genes, and to identify PCR-based markers associated with candidate genes related to heat tolerance in a colonial (Agrostis capillaris L.) x creeping bentgrass (Agrostis stolonifera L.) hybrid backcross population. Plants were subjected to heat stress in controlled-environmental growth chambers for phenotypic evaluation and determination of genetic variation in candidate gene expression. Molecular markers were developed for genes involved in protein degradation (cysteine protease), antioxidant defense (catalase and glutathione-S-transferase), energy metabolism (glyceraldehyde-3-phosphate dehydrogenase), cell expansion (expansin), and stress protection (heat shock proteins HSP26, HSP70, and HSP101). Kruskal-Wallis analysis, a commonly used non-parametric test used to compare population individuals with or without the gene marker, found the physiological traits of chlorophyll content, electrolyte leakage, normalized difference vegetative index, and turf quality were associated with all candidate gene markers with the exception of HSP101. Differential gene expression was frequently found for the tested candidate genes. The development of candidate gene markers for important heat tolerance genes may allow for the development of new cultivars with increased abiotic stress tolerance using marker-assisted selection.

  20. Candidate genes and molecular markers associated with heat tolerance in colonial Bentgrass

    PubMed Central

    Jespersen, David; Belanger, Faith C.; Huang, Bingru

    2017-01-01

    Elevated temperature is a major abiotic stress limiting the growth of cool-season grasses during the summer months. The objectives of this study were to determine the genetic variation in the expression patterns of selected genes involved in several major metabolic pathways regulating heat tolerance for two genotypes contrasting in heat tolerance to confirm their status as potential candidate genes, and to identify PCR-based markers associated with candidate genes related to heat tolerance in a colonial (Agrostis capillaris L.) x creeping bentgrass (Agrostis stolonifera L.) hybrid backcross population. Plants were subjected to heat stress in controlled-environmental growth chambers for phenotypic evaluation and determination of genetic variation in candidate gene expression. Molecular markers were developed for genes involved in protein degradation (cysteine protease), antioxidant defense (catalase and glutathione-S-transferase), energy metabolism (glyceraldehyde-3-phosphate dehydrogenase), cell expansion (expansin), and stress protection (heat shock proteins HSP26, HSP70, and HSP101). Kruskal-Wallis analysis, a commonly used non-parametric test used to compare population individuals with or without the gene marker, found the physiological traits of chlorophyll content, electrolyte leakage, normalized difference vegetative index, and turf quality were associated with all candidate gene markers with the exception of HSP101. Differential gene expression was frequently found for the tested candidate genes. The development of candidate gene markers for important heat tolerance genes may allow for the development of new cultivars with increased abiotic stress tolerance using marker-assisted selection. PMID:28187136

  1. Fine mapping of Restorer-of-fertility in pepper (Capsicum annuum L.) identified a candidate gene encoding a pentatricopeptide repeat (PPR)-containing protein.

    PubMed

    Jo, Yeong Deuk; Ha, Yeaseong; Lee, Joung-Ho; Park, Minkyu; Bergsma, Alex C; Choi, Hong-Il; Goritschnig, Sandra; Kloosterman, Bjorn; van Dijk, Peter J; Choi, Doil; Kang, Byoung-Cheorl

    2016-10-01

    Using fine mapping techniques, the genomic region co-segregating with Restorer - of - fertility ( Rf ) in pepper was delimited to a region of 821 kb in length. A PPR gene in this region, CaPPR6 , was identified as a strong candidate for Rf based on expression pattern and characteristics of encoding sequence. Cytoplasmic-genic male sterility (CGMS) has been used for the efficient production of hybrid seeds in peppers (Capsicum annuum L.). Although the mitochondrial candidate genes that might be responsible for cytoplasmic male sterility (CMS) have been identified, the nuclear Restorer-of-fertility (Rf) gene has not been isolated. To identify the genomic region co-segregating with Rf in pepper, we performed fine mapping using an Rf-segregating population consisting of 1068 F2 individuals, based on BSA-AFLP and a comparative mapping approach. Through six cycles of chromosome walking, the co-segregating region harboring the Rf locus was delimited to be within 821 kb of sequence. Prediction of expressed genes in this region based on transcription analysis revealed four candidate genes. Among these, CaPPR6 encodes a pentatricopeptide repeat (PPR) protein with PPR motifs that are repeated 14 times. Characterization of the CaPPR6 protein sequence, based on alignment with other homologs, showed that CaPPR6 is a typical Rf-like (RFL) gene reported to have undergone diversifying selection during evolution. A marker developed from a sequence near CaPPR6 showed a higher prediction rate of the Rf phenotype than those of previously developed markers when applied to a panel of breeding lines of diverse origin. These results suggest that CaPPR6 is a strong candidate for the Rf gene in pepper.

  2. In Silico Gene Prioritization by Integrating Multiple Data Sources

    PubMed Central

    Zhou, Yingyao; Shields, Robert; Chanda, Sumit K.; Elston, Robert C.; Li, Jing

    2011-01-01

    Identifying disease genes is crucial to the understanding of disease pathogenesis, and to the improvement of disease diagnosis and treatment. In recent years, many researchers have proposed approaches to prioritize candidate genes by considering the relationship of candidate genes and existing known disease genes, reflected in other data sources. In this paper, we propose an expandable framework for gene prioritization that can integrate multiple heterogeneous data sources by taking advantage of a unified graphic representation. Gene-gene relationships and gene-disease relationships are then defined based on the overall topology of each network using a diffusion kernel measure. These relationship measures are in turn normalized to derive an overall measure across all networks, which is utilized to rank all candidate genes. Based on the informativeness of available data sources with respect to each specific disease, we also propose an adaptive threshold score to select a small subset of candidate genes for further validation studies. We performed large scale cross-validation analysis on 110 disease families using three data sources. Results have shown that our approach consistently outperforms other two state of the art programs. A case study using Parkinson disease (PD) has identified four candidate genes (UBB, SEPT5, GPR37 and TH) that ranked higher than our adaptive threshold, all of which are involved in the PD pathway. In particular, a very recent study has observed a deletion of TH in a patient with PD, which supports the importance of the TH gene in PD pathogenesis. A web tool has been implemented to assist scientists in their genetic studies. PMID:21731658

  3. Genome-Wide Association Study Identifying Candidate Genes Influencing Important Agronomic Traits of Flax (Linum usitatissimum L.) Using SLAF-seq

    PubMed Central

    Xie, Dongwei; Dai, Zhigang; Yang, Zemao; Sun, Jian; Zhao, Debao; Yang, Xue; Zhang, Liguo; Tang, Qing; Su, Jianguang

    2018-01-01

    Flax (Linum usitatissimum L.) is an important cash crop, and its agronomic traits directly affect yield and quality. Molecular studies on flax remain inadequate because relatively few flax genes have been associated with agronomic traits or have been identified as having potential applications. To identify markers and candidate genes that can potentially be used for genetic improvement of crucial agronomic traits, we examined 224 specimens of core flax germplasm; specifically, phenotypic data for key traits, including plant height, technical length, number of branches, number of fruits, and 1000-grain weight were investigated under three environmental conditions before specific-locus amplified fragment sequencing (SLAF-seq) was employed to perform a genome-wide association study (GWAS) for these five agronomic traits. Subsequently, the results were used to screen single nucleotide polymorphism (SNP) loci and candidate genes that exhibited a significant correlation with the important agronomic traits. Our analyses identified a total of 42 SNP loci that showed significant correlations with the five important agronomic flax traits. Next, candidate genes were screened in the 10 kb zone of each of the 42 SNP loci. These SNP loci were then analyzed by a more stringent screening via co-identification using both a general linear model (GLM) and a mixed linear model (MLM) as well as co-occurrences in at least two of the three environments, whereby 15 final candidate genes were obtained. Based on these results, we determined that UGT and PL are candidate genes for plant height, GRAS and XTH are candidate genes for the number of branches, Contig1437 and LU0019C12 are candidate genes for the number of fruits, and PHO1 is a candidate gene for the 1000-seed weight. We propose that the identified SNP loci and corresponding candidate genes might serve as a biological basis for improving crucial agronomic flax traits. PMID:29375606

  4. Genome-Wide Association Study Identifying Candidate Genes Influencing Important Agronomic Traits of Flax (Linum usitatissimum L.) Using SLAF-seq.

    PubMed

    Xie, Dongwei; Dai, Zhigang; Yang, Zemao; Sun, Jian; Zhao, Debao; Yang, Xue; Zhang, Liguo; Tang, Qing; Su, Jianguang

    2017-01-01

    Flax ( Linum usitatissimum L.) is an important cash crop, and its agronomic traits directly affect yield and quality. Molecular studies on flax remain inadequate because relatively few flax genes have been associated with agronomic traits or have been identified as having potential applications. To identify markers and candidate genes that can potentially be used for genetic improvement of crucial agronomic traits, we examined 224 specimens of core flax germplasm; specifically, phenotypic data for key traits, including plant height, technical length, number of branches, number of fruits, and 1000-grain weight were investigated under three environmental conditions before specific-locus amplified fragment sequencing (SLAF-seq) was employed to perform a genome-wide association study (GWAS) for these five agronomic traits. Subsequently, the results were used to screen single nucleotide polymorphism (SNP) loci and candidate genes that exhibited a significant correlation with the important agronomic traits. Our analyses identified a total of 42 SNP loci that showed significant correlations with the five important agronomic flax traits. Next, candidate genes were screened in the 10 kb zone of each of the 42 SNP loci. These SNP loci were then analyzed by a more stringent screening via co-identification using both a general linear model (GLM) and a mixed linear model (MLM) as well as co-occurrences in at least two of the three environments, whereby 15 final candidate genes were obtained. Based on these results, we determined that UGT and PL are candidate genes for plant height, GRAS and XTH are candidate genes for the number of branches, Contig1437 and LU0019C12 are candidate genes for the number of fruits, and PHO1 is a candidate gene for the 1000-seed weight. We propose that the identified SNP loci and corresponding candidate genes might serve as a biological basis for improving crucial agronomic flax traits.

  5. Array-based comparative genomic hybridization-guided identification of reference genes for normalization of real-time quantitative polymerase chain reaction assay data for lymphomas, histiocytic sarcomas, and osteosarcomas of dogs.

    PubMed

    Tsai, Pei-Chien; Breen, Matthew

    2012-09-01

    To identify suitable reference genes for normalization of real-time quantitative PCR (RT-qPCR) assay data for common tumors of dogs. Malignant lymph node (n = 8), appendicular osteosarcoma (9), and histiocytic sarcoma (12) samples and control samples of various nonneoplastic canine tissues. Array-based comparative genomic hybridization (aCGH) data were used to guide selection of 9 candidate reference genes. Expression stability of candidate reference genes and 4 commonly used reference genes was determined for tumor samples with RT-qPCR assays and 3 software programs. LOC611555 was the candidate reference gene with the highest expression stability among the 3 tumor types. Of the commonly used reference genes, expression stability of HPRT was high in histiocytic sarcoma samples, and expression stability of Ubi and RPL32 was high in osteosarcoma samples. Some of the candidate reference genes had higher expression stability than did the commonly used reference genes. Data for constitutively expressed genes with high expression stability are required for normalization of RT-qPCR assay results. Without such data, accurate quantification of gene expression in tumor tissue samples is difficult. Results of the present study indicated LOC611555 may be a useful RT-qPCR assay reference gene for multiple tissue types. Some commonly used reference genes may be suitable for normalization of gene expression data for tumors of dogs, such as lymphomas, osteosarcomas, or histiocytic sarcomas.

  6. Bioinformatics-Based Identification of Candidate Genes from QTLs Associated with Cell Wall Traits in Populus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ranjan, Priya; Yin, Tongming; Zhang, Xinye

    2009-11-01

    Quantitative trait locus (QTL) studies are an integral part of plant research and are used to characterize the genetic basis of phenotypic variation observed in structured populations and inform marker-assisted breeding efforts. These QTL intervals can span large physical regions on a chromosome comprising hundreds of genes, thereby hampering candidate gene identification. Genome history, evolution, and expression evidence can be used to narrow the genes in the interval to a smaller list that is manageable for detailed downstream functional genomics characterization. Our primary motivation for the present study was to address the need for a research methodology that identifies candidatemore » genes within a broad QTL interval. Here we present a bioinformatics-based approach for subdividing candidate genes within QTL intervals into alternate groups of high probability candidates. Application of this approach in the context of studying cell wall traits, specifically lignin content and S/G ratios of stem and root in Populus plants, resulted in manageable sets of genes of both known and putative cell wall biosynthetic function. These results provide a roadmap for future experimental work leading to identification of new genes controlling cell wall recalcitrance and, ultimately, in the utility of plant biomass as an energy feedstock.« less

  7. Defining the Human Macula Transcriptome and Candidate Retinal Disease Genes UsingEyeSAGE

    PubMed Central

    Rickman, Catherine Bowes; Ebright, Jessica N.; Zavodni, Zachary J.; Yu, Ling; Wang, Tianyuan; Daiger, Stephen P.; Wistow, Graeme; Boon, Kathy; Hauser, Michael A.

    2009-01-01

    Purpose To develop large-scale, high-throughput annotation of the human macula transcriptome and to identify and prioritize candidate genes for inherited retinal dystrophies, based on ocular-expression profiles using serial analysis of gene expression (SAGE). Methods Two human retina and two retinal pigment epithelium (RPE)/choroid SAGE libraries made from matched macula or midperipheral retina and adjacent RPE/choroid of morphologically normal 28- to 66-year-old donors and a human central retina longSAGE library made from 41- to 66-year-old donors were generated. Their transcription profiles were entered into a relational database, EyeSAGE, including microarray expression profiles of retina and publicly available normal human tissue SAGE libraries. EyeSAGE was used to identify retina- and RPE-specific and -associated genes, and candidate genes for retina and RPE disease loci. Differential and/or cell-type specific expression was validated by quantitative and single-cell RT-PCR. Results Cone photoreceptor-associated gene expression was elevated in the macula transcription profiles. Analysis of the longSAGE retina tags enhanced tag-to-gene mapping and revealed alternatively spliced genes. Analysis of candidate gene expression tables for the identified Bardet-Biedl syndrome disease gene (BBS5) in the BBS5 disease region table yielded BBS5 as the top candidate. Compelling candidates for inherited retina diseases were identified. Conclusions The EyeSAGE database, combining three different gene-profiling platforms including the authors’ multidonor-derived retina/RPE SAGE libraries and existing single-donor retina/RPE libraries, is a powerful resource for definition of the retina and RPE transcriptomes. It can be used to identify retina-specific genes, including alternatively spliced transcripts and to prioritize candidate genes within mapped retinal disease regions. PMID:16723438

  8. Defining the human macula transcriptome and candidate retinal disease genes using EyeSAGE.

    PubMed

    Bowes Rickman, Catherine; Ebright, Jessica N; Zavodni, Zachary J; Yu, Ling; Wang, Tianyuan; Daiger, Stephen P; Wistow, Graeme; Boon, Kathy; Hauser, Michael A

    2006-06-01

    To develop large-scale, high-throughput annotation of the human macula transcriptome and to identify and prioritize candidate genes for inherited retinal dystrophies, based on ocular-expression profiles using serial analysis of gene expression (SAGE). Two human retina and two retinal pigment epithelium (RPE)/choroid SAGE libraries made from matched macula or midperipheral retina and adjacent RPE/choroid of morphologically normal 28- to 66-year-old donors and a human central retina longSAGE library made from 41- to 66-year-old donors were generated. Their transcription profiles were entered into a relational database, EyeSAGE, including microarray expression profiles of retina and publicly available normal human tissue SAGE libraries. EyeSAGE was used to identify retina- and RPE-specific and -associated genes, and candidate genes for retina and RPE disease loci. Differential and/or cell-type specific expression was validated by quantitative and single-cell RT-PCR. Cone photoreceptor-associated gene expression was elevated in the macula transcription profiles. Analysis of the longSAGE retina tags enhanced tag-to-gene mapping and revealed alternatively spliced genes. Analysis of candidate gene expression tables for the identified Bardet-Biedl syndrome disease gene (BBS5) in the BBS5 disease region table yielded BBS5 as the top candidate. Compelling candidates for inherited retina diseases were identified. The EyeSAGE database, combining three different gene-profiling platforms including the authors' multidonor-derived retina/RPE SAGE libraries and existing single-donor retina/RPE libraries, is a powerful resource for definition of the retina and RPE transcriptomes. It can be used to identify retina-specific genes, including alternatively spliced transcripts and to prioritize candidate genes within mapped retinal disease regions.

  9. [Stability analysis of reference gene based on real-time PCR in Artemisia annua under cadmium treatment].

    PubMed

    Zhou, Liang-Yun; Mo, Ge; Wang, Sheng; Tang, Jin-Fu; Yue, Hong; Huang, Lu-Qi; Shao, Ai-Juan; Guo, Lan-Ping

    2014-03-01

    In this study, Actin, 18S rRNA, PAL, GAPDH and CPR of Artemisia annua were selected as candidate reference genes, and their gene-specific primers for real-time PCR were designed, then geNorm, NormFinder, BestKeeper, Delta CT and RefFinder were used to evaluate their expression stability in the leaves of A. annua under treatment of different concentrations of Cd, with the purpose of finding a reliable reference gene to ensure the reliability of gene-expression analysis. The results showed that there were some significant differences among the candidate reference genes under different treatments and the order of expression stability of candidate reference gene was Actin > 18S rRNA > PAL > GAPDH > CPR. These results suggested that Actin, 18S rRNA and PAL could be used as ideal reference genes of gene expression analysis in A. annua and multiple internal control genes were adopted for results calibration. In addition, differences in expression stability of candidate reference genes in the leaves of A. annua under the same concentrations of Cd were observed, which suggested that the screening of candidate reference genes was needed even under the same treatment. To our best knowledge, this study for the first time provided the ideal reference genes under Cd treatment in the leaves of A. annua and offered reference for the gene expression analysis of A. annua under other conditions.

  10. A transposon-based genetic screen in mice identifies genes altered in colorectal cancer.

    PubMed

    Starr, Timothy K; Allaei, Raha; Silverstein, Kevin A T; Staggs, Rodney A; Sarver, Aaron L; Bergemann, Tracy L; Gupta, Mihir; O'Sullivan, M Gerard; Matise, Ilze; Dupuy, Adam J; Collier, Lara S; Powers, Scott; Oberg, Ann L; Asmann, Yan W; Thibodeau, Stephen N; Tessarollo, Lino; Copeland, Neal G; Jenkins, Nancy A; Cormier, Robert T; Largaespada, David A

    2009-03-27

    Human colorectal cancers (CRCs) display a large number of genetic and epigenetic alterations, some of which are causally involved in tumorigenesis (drivers) and others that have little functional impact (passengers). To help distinguish between these two classes of alterations, we used a transposon-based genetic screen in mice to identify candidate genes for CRC. Mice harboring mutagenic Sleeping Beauty (SB) transposons were crossed with mice expressing SB transposase in gastrointestinal tract epithelium. Most of the offspring developed intestinal lesions, including intraepithelial neoplasia, adenomas, and adenocarcinomas. Analysis of over 16,000 transposon insertions identified 77 candidate CRC genes, 60 of which are mutated and/or dysregulated in human CRC and thus are most likely to drive tumorigenesis. These genes include APC, PTEN, and SMAD4. The screen also identified 17 candidate genes that had not previously been implicated in CRC, including POLI, PTPRK, and RSPO2.

  11. TOM: a web-based integrated approach for identification of candidate disease genes.

    PubMed

    Rossi, Simona; Masotti, Daniele; Nardini, Christine; Bonora, Elena; Romeo, Giovanni; Macii, Enrico; Benini, Luca; Volinia, Stefano

    2006-07-01

    The massive production of biological data by means of highly parallel devices like microarrays for gene expression has paved the way to new possible approaches in molecular genetics. Among them the possibility of inferring biological answers by querying large amounts of expression data. Based on this principle, we present here TOM, a web-based resource for the efficient extraction of candidate genes for hereditary diseases. The service requires the previous knowledge of at least another gene responsible for the disease and the linkage area, or else of two disease associated genetic intervals. The algorithm uses the information stored in public resources, including mapping, expression and functional databases. Given the queries, TOM will select and list one or more candidate genes. This approach allows the geneticist to bypass the costly and time consuming tracing of genetic markers through entire families and might improve the chance of identifying disease genes, particularly for rare diseases. We present here the tool and the results obtained on known benchmark and on hereditary predisposition to familial thyroid cancer. Our algorithm is available at http://www-micrel.deis.unibo.it/~tom/.

  12. Whole exome sequencing identifies novel candidate genes that modify chronic obstructive pulmonary disease susceptibility.

    PubMed

    Bruse, Shannon; Moreau, Michael; Bromberg, Yana; Jang, Jun-Ho; Wang, Nan; Ha, Hongseok; Picchi, Maria; Lin, Yong; Langley, Raymond J; Qualls, Clifford; Klensney-Tait, Julia; Zabner, Joseph; Leng, Shuguang; Mao, Jenny; Belinsky, Steven A; Xing, Jinchuan; Nyunoya, Toru

    2016-01-07

    Chronic obstructive pulmonary disease (COPD) is characterized by an irreversible airflow limitation in response to inhalation of noxious stimuli, such as cigarette smoke. However, only 15-20 % smokers manifest COPD, suggesting a role for genetic predisposition. Although genome-wide association studies have identified common genetic variants that are associated with susceptibility to COPD, effect sizes of the identified variants are modest, as is the total heritability accounted for by these variants. In this study, an extreme phenotype exome sequencing study was combined with in vitro modeling to identify COPD candidate genes. We performed whole exome sequencing of 62 highly susceptible smokers and 30 exceptionally resistant smokers to identify rare variants that may contribute to disease risk or resistance to COPD. This was a cross-sectional case-control study without therapeutic intervention or longitudinal follow-up information. We identified candidate genes based on rare variant analyses and evaluated exonic variants to pinpoint individual genes whose function was computationally established to be significantly different between susceptible and resistant smokers. Top scoring candidate genes from these analyses were further filtered by requiring that each gene be expressed in human bronchial epithelial cells (HBECs). A total of 81 candidate genes were thus selected for in vitro functional testing in cigarette smoke extract (CSE)-exposed HBECs. Using small interfering RNA (siRNA)-mediated gene silencing experiments, we showed that silencing of several candidate genes augmented CSE-induced cytotoxicity in vitro. Our integrative analysis through both genetic and functional approaches identified two candidate genes (TACC2 and MYO1E) that augment cigarette smoke (CS)-induced cytotoxicity and, potentially, COPD susceptibility.

  13. Physiological and molecular characterization of drought responses and identification of candidate tolerance genes in cassava

    PubMed Central

    Turyagyenda, Laban F.; Kizito, Elizabeth B.; Ferguson, Morag; Baguma, Yona; Agaba, Morris; Harvey, Jagger J. W.; Osiru, David S. O.

    2013-01-01

    Cassava is an important root crop to resource-poor farmers in marginal areas, where its production faces drought stress constraints. Given the difficulties associated with cassava breeding, a molecular understanding of drought tolerance in cassava will help in the identification of markers for use in marker-assisted selection and genes for transgenic improvement of drought tolerance. This study was carried out to identify candidate drought-tolerance genes and expression-based markers of drought stress in cassava. One drought-tolerant (improved variety) and one drought-susceptible (farmer-preferred) cassava landrace were grown in the glasshouse under well-watered and water-stressed conditions. Their morphological, physiological and molecular responses to drought were characterized. Morphological and physiological measurements indicate that the tolerance of the improved variety is based on drought avoidance, through reduction of water loss via partial stomatal closure. Ten genes that have previously been biologically validated as conferring or being associated with drought tolerance in other plant species were confirmed as being drought responsive in cassava. Four genes (MeALDH, MeZFP, MeMSD and MeRD28) were identified as candidate cassava drought-tolerance genes, as they were exclusively up-regulated in the drought-tolerant genotype to comparable levels known to confer drought tolerance in other species. Based on these genes, we hypothesize that the basis of the tolerance at the cellular level is probably through mitigation of the oxidative burst and osmotic adjustment. This study provides an initial characterization of the molecular response of cassava to drought stress resembling field conditions. The drought-responsive genes can now be used as expression-based markers of drought stress tolerance in cassava, and the candidate tolerance genes tested in the context of breeding (as possible quantitative trait loci) and engineering drought tolerance in transgenics. PMID:23519782

  14. Looking into flowering time in almond (Prunus dulcis (Mill) D. A. Webb): the candidate gene approach.

    PubMed

    Silva, C; Garcia-Mas, J; Sánchez, A M; Arús, P; Oliveira, M M

    2005-03-01

    Blooming time is one of the most important agronomic traits in almond. Biochemical and molecular events underlying flowering regulation must be understood before methods to stimulate late flowering can be developed. Attempts to elucidate the genetic control of this process have led to the identification of a major gene (Lb) and quantitative trait loci (QTLs) linked to observed phenotypic differences, but although this gene and these QTLs have been placed on the Prunus reference genetic map, their sequences and specific functions remain unknown. The aim of our investigation was to associate these loci with known genes using a candidate gene approach. Two almond cDNAs and eight Prunus expressed sequence tags were selected as candidate genes (CGs) since their sequences were highly identical to those of flowering regulatory genes characterized in other species. The CGs were amplified from both parental lines of the mapping population using specific primers. Sequence comparison revealed DNA polymorphisms between the parental lines, mainly of the single nucleotide type. Polymorphisms were used to develop co-dominant cleaved amplified polymorphic sequence markers or length polymorphisms based on insertion/deletion events for mapping the candidate genes on the Prunus reference map. Ten candidate genes were assigned to six linkage groups in the Prunus genome. The positions of two of these were compatible with the regions where two QTLs for blooming time were detected. One additional candidate was localized close to the position of the Evergrowing gene, which determines a non-deciduous behaviour in peach.

  15. Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus

    NASA Astrophysics Data System (ADS)

    Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat

    2016-11-01

    In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.

  16. Signature of genetic associations in oral cancer.

    PubMed

    Sharma, Vishwas; Nandan, Amrita; Sharma, Amitesh Kumar; Singh, Harpreet; Bharadwaj, Mausumi; Sinha, Dhirendra Narain; Mehrotra, Ravi

    2017-10-01

    Oral cancer etiology is complex and controlled by multi-factorial events including genetic events. Candidate gene studies, genome-wide association studies, and next-generation sequencing identified various chromosomal loci to be associated with oral cancer. There is no available review that could give us the comprehensive picture of genetic loci identified to be associated with oral cancer by candidate gene studies-based, genome-wide association studies-based, and next-generation sequencing-based approaches. A systematic literature search was performed in the PubMed database to identify the loci associated with oral cancer by exclusive candidate gene studies-based, genome-wide association studies-based, and next-generation sequencing-based study approaches. The information of loci associated with oral cancer is made online through the resource "ORNATE." Next, screening of the loci validated by candidate gene studies and next-generation sequencing approach or by two independent studies within candidate gene studies or next-generation sequencing approaches were performed. A total of 264 loci were identified to be associated with oral cancer by candidate gene studies, genome-wide association studies, and next-generation sequencing approaches. In total, 28 loci, that is, 14q32.33 (AKT1), 5q22.2 (APC), 11q22.3 (ATM), 2q33.1 (CASP8), 11q13.3 (CCND1), 16q22.1 (CDH1), 9p21.3 (CDKN2A), 1q31.1 (COX-2), 7p11.2 (EGFR), 22q13.2 (EP300), 4q35.2 (FAT1), 4q31.3 (FBXW7), 4p16.3 (FGFR3), 1p13.3 (GSTM1-GSTT1), 11q13.2 (GSTP1), 11p15.5 (H-RAS), 3p25.3 (hOGG1), 1q32.1 (IL-10), 4q13.3 (IL-8), 12p12.1 (KRAS), 12q15 (MDM2), 12q13.12 (MLL2), 9q34.3 (NOTCH1), 17p13.1 (p53), 3q26.32 (PIK3CA), 10q23.31 (PTEN), 13q14.2 (RB1), and 5q14.2 (XRCC4), were validated to be associated with oral cancer. "ORNATE" gives a snapshot of genetic loci associated with oral cancer. All 28 loci were validated to be linked to oral cancer for which further fine-mapping followed by gene-by-gene and gene-environment interaction studies is needed to confirm their involvement in modifying oral cancer.

  17. A genomic scan for selection reveals candidates for genes involved in the evolution of cultivated sunflower (Helianthus annuus).

    PubMed

    Chapman, Mark A; Pashley, Catherine H; Wenzler, Jessica; Hvala, John; Tang, Shunxue; Knapp, Steven J; Burke, John M

    2008-11-01

    Genomic scans for selection are a useful tool for identifying genes underlying phenotypic transitions. In this article, we describe the results of a genome scan designed to identify candidates for genes targeted by selection during the evolution of cultivated sunflower. This work involved screening 492 loci derived from ESTs on a large panel of wild, primitive (i.e., landrace), and improved sunflower (Helianthus annuus) lines. This sampling strategy allowed us to identify candidates for selectively important genes and investigate the likely timing of selection. Thirty-six genes showed evidence of selection during either domestication or improvement based on multiple criteria, and a sequence-based test of selection on a subset of these loci confirmed this result. In view of what is known about the structure of linkage disequilibrium across the sunflower genome, these genes are themselves likely to have been targeted by selection, rather than being merely linked to the actual targets. While the selection candidates showed a broad range of putative functions, they were enriched for genes involved in amino acid synthesis and protein catabolism. Given that a similar pattern has been detected in maize (Zea mays), this finding suggests that selection on amino acid composition may be a general feature of the evolution of crop plants. In terms of genomic locations, the selection candidates were significantly clustered near quantitative trait loci (QTL) that contribute to phenotypic differences between wild and cultivated sunflower, and specific instances of QTL colocalization provide some clues as to the roles that these genes may have played during sunflower evolution.

  18. Network-based Analysis of Genome Wide Association Data Provides Novel Candidate Genes for Lipid and Lipoprotein Traits*

    PubMed Central

    Sharma, Amitabh; Gulbahce, Natali; Pevzner, Samuel J.; Menche, Jörg; Ladenvall, Claes; Folkersen, Lasse; Eriksson, Per; Orho-Melander, Marju; Barabási, Albert-László

    2013-01-01

    Genome wide association studies (GWAS) identify susceptibility loci for complex traits, but do not identify particular genes of interest. Integration of functional and network information may help in overcoming this limitation and identifying new susceptibility loci. Using GWAS and comorbidity data, we present a network-based approach to predict candidate genes for lipid and lipoprotein traits. We apply a prediction pipeline incorporating interactome, co-expression, and comorbidity data to Global Lipids Genetics Consortium (GLGC) GWAS for four traits of interest, identifying phenotypically coherent modules. These modules provide insights regarding gene involvement in complex phenotypes with multiple susceptibility alleles and low effect sizes. To experimentally test our predictions, we selected four candidate genes and genotyped representative SNPs in the Malmö Diet and Cancer Cardiovascular Cohort. We found significant associations with LDL-C and total-cholesterol levels for a synonymous SNP (rs234706) in the cystathionine beta-synthase (CBS) gene (p = 1 × 10−5 and adjusted-p = 0.013, respectively). Further, liver samples taken from 206 patients revealed that patients with the minor allele of rs234706 had significant dysregulation of CBS (p = 0.04). Despite the known biological role of CBS in lipid metabolism, SNPs within the locus have not yet been identified in GWAS of lipoprotein traits. Thus, the GWAS-based Comorbidity Module (GCM) approach identifies candidate genes missed by GWAS studies, serving as a broadly applicable tool for the investigation of other complex disease phenotypes. PMID:23882023

  19. Identification of Inherited Retinal Disease-Associated Genetic Variants in 11 Candidate Genes.

    PubMed

    Astuti, Galuh D N; van den Born, L Ingeborgh; Khan, M Imran; Hamel, Christian P; Bocquet, Béatrice; Manes, Gaël; Quinodoz, Mathieu; Ali, Manir; Toomes, Carmel; McKibbin, Martin; El-Asrag, Mohammed E; Haer-Wigman, Lonneke; Inglehearn, Chris F; Black, Graeme C M; Hoyng, Carel B; Cremers, Frans P M; Roosing, Susanne

    2018-01-10

    Inherited retinal diseases (IRDs) display an enormous genetic heterogeneity. Whole exome sequencing (WES) recently identified genes that were mutated in a small proportion of IRD cases. Consequently, finding a second case or family carrying pathogenic variants in the same candidate gene often is challenging. In this study, we searched for novel candidate IRD gene-associated variants in isolated IRD families, assessed their causality, and searched for novel genotype-phenotype correlations. Whole exome sequencing was performed in 11 probands affected with IRDs. Homozygosity mapping data was available for five cases. Variants with minor allele frequencies ≤ 0.5% in public databases were selected as candidate disease-causing variants. These variants were ranked based on their: (a) presence in a gene that was previously implicated in IRD; (b) minor allele frequency in the Exome Aggregation Consortium database (ExAC); (c) in silico pathogenicity assessment using the combined annotation dependent depletion (CADD) score; and (d) interaction of the corresponding protein with known IRD-associated proteins. Twelve unique variants were found in 11 different genes in 11 IRD probands. Novel autosomal recessive and dominant inheritance patterns were found for variants in Small Nuclear Ribonucleoprotein U5 Subunit 200 ( SNRNP200 ) and Zinc Finger Protein 513 ( ZNF513 ), respectively. Using our pathogenicity assessment, a variant in DEAH-Box Helicase 32 ( DHX32 ) was the top ranked novel candidate gene to be associated with IRDs, followed by eight medium and lower ranked candidate genes. The identification of candidate disease-associated sequence variants in 11 single families underscores the notion that the previously identified IRD-associated genes collectively carry > 90% of the defects implicated in IRDs. To identify multiple patients or families with variants in the same gene and thereby provide extra proof for pathogenicity, worldwide data sharing is needed.

  20. Evaluation of Gene-Based Family-Based Methods to Detect Novel Genes Associated With Familial Late Onset Alzheimer Disease

    PubMed Central

    Fernández, Maria V.; Budde, John; Del-Aguila, Jorge L.; Ibañez, Laura; Deming, Yuetiva; Harari, Oscar; Norton, Joanne; Morris, John C.; Goate, Alison M.; Cruchaga, Carlos

    2018-01-01

    Gene-based tests to study the combined effect of rare variants on a particular phenotype have been widely developed for case-control studies, but their evolution and adaptation for family-based studies, especially studies of complex incomplete families, has been slower. In this study, we have performed a practical examination of all the latest gene-based methods available for family-based study designs using both simulated and real datasets. We examined the performance of several collapsing, variance-component, and transmission disequilibrium tests across eight different software packages and 22 models utilizing a cohort of 285 families (N = 1,235) with late-onset Alzheimer disease (LOAD). After a thorough examination of each of these tests, we propose a methodological approach to identify, with high confidence, genes associated with the tested phenotype and we provide recommendations to select the best software and model for family-based gene-based analyses. Additionally, in our dataset, we identified PTK2B, a GWAS candidate gene for sporadic AD, along with six novel genes (CHRD, CLCN2, HDLBP, CPAMD8, NLRP9, and MAS1L) as candidate genes for familial LOAD. PMID:29670507

  1. Evaluation of Gene-Based Family-Based Methods to Detect Novel Genes Associated With Familial Late Onset Alzheimer Disease.

    PubMed

    Fernández, Maria V; Budde, John; Del-Aguila, Jorge L; Ibañez, Laura; Deming, Yuetiva; Harari, Oscar; Norton, Joanne; Morris, John C; Goate, Alison M; Cruchaga, Carlos

    2018-01-01

    Gene-based tests to study the combined effect of rare variants on a particular phenotype have been widely developed for case-control studies, but their evolution and adaptation for family-based studies, especially studies of complex incomplete families, has been slower. In this study, we have performed a practical examination of all the latest gene-based methods available for family-based study designs using both simulated and real datasets. We examined the performance of several collapsing, variance-component, and transmission disequilibrium tests across eight different software packages and 22 models utilizing a cohort of 285 families ( N = 1,235) with late-onset Alzheimer disease (LOAD). After a thorough examination of each of these tests, we propose a methodological approach to identify, with high confidence, genes associated with the tested phenotype and we provide recommendations to select the best software and model for family-based gene-based analyses. Additionally, in our dataset, we identified PTK2B , a GWAS candidate gene for sporadic AD, along with six novel genes ( CHRD, CLCN2, HDLBP, CPAMD8, NLRP9 , and MAS1L ) as candidate genes for familial LOAD.

  2. A random set scoring model for prioritization of disease candidate genes using protein complexes and data-mining of GeneRIF, OMIM and PubMed records.

    PubMed

    Jiang, Li; Edwards, Stefan M; Thomsen, Bo; Workman, Christopher T; Guldbrandtsen, Bernt; Sørensen, Peter

    2014-09-24

    Prioritizing genetic variants is a challenge because disease susceptibility loci are often located in genes of unknown function or the relationship with the corresponding phenotype is unclear. A global data-mining exercise on the biomedical literature can establish the phenotypic profile of genes with respect to their connection to disease phenotypes. The importance of protein-protein interaction networks in the genetic heterogeneity of common diseases or complex traits is becoming increasingly recognized. Thus, the development of a network-based approach combined with phenotypic profiling would be useful for disease gene prioritization. We developed a random-set scoring model and implemented it to quantify phenotype relevance in a network-based disease gene-prioritization approach. We validated our approach based on different gene phenotypic profiles, which were generated from PubMed abstracts, OMIM, and GeneRIF records. We also investigated the validity of several vocabulary filters and different likelihood thresholds for predicted protein-protein interactions in terms of their effect on the network-based gene-prioritization approach, which relies on text-mining of the phenotype data. Our method demonstrated good precision and sensitivity compared with those of two alternative complex-based prioritization approaches. We then conducted a global ranking of all human genes according to their relevance to a range of human diseases. The resulting accurate ranking of known causal genes supported the reliability of our approach. Moreover, these data suggest many promising novel candidate genes for human disorders that have a complex mode of inheritance. We have implemented and validated a network-based approach to prioritize genes for human diseases based on their phenotypic profile. We have devised a powerful and transparent tool to identify and rank candidate genes. Our global gene prioritization provides a unique resource for the biological interpretation of data from genome-wide association studies, and will help in the understanding of how the associated genetic variants influence disease or quantitative phenotypes.

  3. Walking the interactome for candidate prioritization in exome sequencing studies of Mendelian diseases

    DOE PAGES

    Smedley, Damian; Kohler, Sebastian; Czeschik, Johanna Christina; ...

    2014-07-30

    Here, whole-exome sequencing (WES) has opened up previously unheard of possibilities for identifying novel disease genes in Mendelian disorders, only about half of which have been elucidated to date. However, interpretation of WES data remains challenging. As a result, we analyze protein–protein association (PPA) networks to identify candidate genes in the vicinity of genes previously implicated in a disease. The analysis, using a random-walk with restart (RWR) method, is adapted to the setting of WES by developing a composite variant-gene relevance score based on the rarity, location and predicted pathogenicity of variants and the RWR evaluation of genes harboring themore » variants. Benchmarking using known disease variants from 88 disease-gene families reveals that the correct gene is ranked among the top 10 candidates in ≥50% of cases, a figure which we confirmed using a prospective study of disease genes identified in 2012 and PPA data produced before that date. In conclusion, we implement our method in a freely available Web server, ExomeWalker, that displays a ranked list of candidates together with information on PPAs, frequency and predicted pathogenicity of the variants to allow quick and effective searches for candidates that are likely to reward closer investigation.« less

  4. Integration of QTL and bioinformatic tools to identify candidate genes for triglycerides in mice[S

    PubMed Central

    Leduc, Magalie S.; Hageman, Rachael S.; Verdugo, Ricardo A.; Tsaih, Shirng-Wern; Walsh, Kenneth; Churchill, Gary A.; Paigen, Beverly

    2011-01-01

    To identify genetic loci influencing lipid levels, we performed quantitative trait loci (QTL) analysis between inbred mouse strains MRL/MpJ and SM/J, measuring triglyceride levels at 8 weeks of age in F2 mice fed a chow diet. We identified one significant QTL on chromosome (Chr) 15 and three suggestive QTL on Chrs 2, 7, and 17. We also carried out microarray analysis on the livers of parental strains of 282 F2 mice and used these data to find cis-regulated expression QTL. We then narrowed the list of candidate genes under significant QTL using a “toolbox” of bioinformatic resources, including haplotype analysis; parental strain comparison for gene expression differences and nonsynonymous coding single nucleotide polymorphisms (SNP); cis-regulated eQTL in livers of F2 mice; correlation between gene expression and phenotype; and conditioning of expression on the phenotype. We suggest Slc25a7 as a candidate gene for the Chr 7 QTL and, based on expression differences, five genes (Polr3 h, Cyp2d22, Cyp2d26, Tspo, and Ttll12) as candidate genes for Chr 15 QTL. This study shows how bioinformatics can be used effectively to reduce candidate gene lists for QTL related to complex traits. PMID:21622629

  5. Walking the interactome for candidate prioritization in exome sequencing studies of Mendelian diseases

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Smedley, Damian; Kohler, Sebastian; Czeschik, Johanna Christina

    Here, whole-exome sequencing (WES) has opened up previously unheard of possibilities for identifying novel disease genes in Mendelian disorders, only about half of which have been elucidated to date. However, interpretation of WES data remains challenging. As a result, we analyze protein–protein association (PPA) networks to identify candidate genes in the vicinity of genes previously implicated in a disease. The analysis, using a random-walk with restart (RWR) method, is adapted to the setting of WES by developing a composite variant-gene relevance score based on the rarity, location and predicted pathogenicity of variants and the RWR evaluation of genes harboring themore » variants. Benchmarking using known disease variants from 88 disease-gene families reveals that the correct gene is ranked among the top 10 candidates in ≥50% of cases, a figure which we confirmed using a prospective study of disease genes identified in 2012 and PPA data produced before that date. In conclusion, we implement our method in a freely available Web server, ExomeWalker, that displays a ranked list of candidates together with information on PPAs, frequency and predicted pathogenicity of the variants to allow quick and effective searches for candidates that are likely to reward closer investigation.« less

  6. Pivotal role of the muscle-contraction pathway in cryptorchidism and evidence for genomic connections with cardiomyopathy pathways in RASopathies.

    PubMed

    Cannistraci, Carlo V; Ogorevc, Jernej; Zorc, Minja; Ravasi, Timothy; Dovc, Peter; Kunej, Tanja

    2013-02-14

    Cryptorchidism is the most frequent congenital disorder in male children; however the genetic causes of cryptorchidism remain poorly investigated. Comparative integratomics combined with systems biology approach was employed to elucidate genetic factors and molecular pathways underlying testis descent. Literature mining was performed to collect genomic loci associated with cryptorchidism in seven mammalian species. Information regarding the collected candidate genes was stored in MySQL relational database. Genomic view of the loci was presented using Flash GViewer web tool (http://gmod.org/wiki/Flashgviewer/). DAVID Bioinformatics Resources 6.7 was used for pathway enrichment analysis. Cytoscape plug-in PiNGO 1.11 was employed for protein-network-based prediction of novel candidate genes. Relevant protein-protein interactions were confirmed and visualized using the STRING database (version 9.0). The developed cryptorchidism gene atlas includes 217 candidate loci (genes, regions involved in chromosomal mutations, and copy number variations) identified at the genomic, transcriptomic, and proteomic level. Human orthologs of the collected candidate loci were presented using a genomic map viewer. The cryptorchidism gene atlas is freely available online: http://www.integratomics-time.com/cryptorchidism/. Pathway analysis suggested the presence of twelve enriched pathways associated with the list of 179 literature-derived candidate genes. Additionally, a list of 43 network-predicted novel candidate genes was significantly associated with four enriched pathways. Joint pathway analysis of the collected and predicted candidate genes revealed the pivotal importance of the muscle-contraction pathway in cryptorchidism and evidence for genomic associations with cardiomyopathy pathways in RASopathies. The developed gene atlas represents an important resource for the scientific community researching genetics of cryptorchidism. The collected data will further facilitate development of novel genetic markers and could be of interest for functional studies in animals and human. The proposed network-based systems biology approach elucidates molecular mechanisms underlying co-presence of cryptorchidism and cardiomyopathy in RASopathies. Such approach could also aid in molecular explanation of co-presence of diverse and apparently unrelated clinical manifestations in other syndromes.

  7. Robust and Comprehensive Analysis of 20 Osteoporosis Candidate Genes by Very High-Density Single-Nucleotide Polymorphism Screen Among 405 White Nuclear Families Identified Significant Association and Gene–Gene Interaction

    PubMed Central

    Xiong, Dong-Hai; Shen, Hui; Zhao, Lan-Juan; Xiao, Peng; Yang, Tie-Lin; Guo, Yan; Wang, Wei; Guo, Yan-Fang; Liu, Yong-Jun; Recker, Robert R; Deng, Hong-Wen

    2007-01-01

    Many “novel” osteoporosis candidate genes have been proposed in recent years. To advance our knowledge of their roles in osteoporosis, we screened 20 such genes using a set of high-density SNPs in a large family-based study. Our efforts led to the prioritization of those osteoporosis genes and the detection of gene–gene interactions. Introduction We performed large-scale family-based association analyses of 20 novel osteoporosis candidate genes using 277 single nucleotide polymorphisms (SNPs) for the quantitative trait BMD variation and the qualitative trait osteoporosis (OP) at three clinically important skeletal sites: spine, hip, and ultradistal radius (UD). Materials and Methods One thousand eight hundred seventy-three subjects from 405 white nuclear families were genotyped and analyzed with an average density of one SNP per 4 kb across the 20 genes. We conducted association analyses by SNP- and haplotype-based family-based association test (FBAT) and performed gene–gene interaction analyses using multianalytic approaches such as multifactor-dimensionality reduction (MDR) and conditional logistic regression. Results and Conclusions We detected four genes (DBP, LRP5, CYP17, and RANK) that showed highly suggestive associations (10,000-permutation derived empirical global p ≤ 0.01) with spine BMD/OP; four genes (CYP19, RANK, RANKL, and CYP17) highly suggestive for hip BMD/OP; and four genes (CYP19, BMP2, RANK, and TNFR2) highly suggestive for UD BMD/OP. The associations between BMP2 with UD BMD and those between RANK with OP at the spine, hip, and UD also met the experiment-wide stringent criterion (empirical global p ≤ 0.0007). Sex-stratified analyses further showed that some of the significant associations in the total sample were driven by either male or female subjects. In addition, we identified and validated a two-locus gene–gene interaction model involving GCR and ESR2, for which prior biological evidence exists. Our results suggested the prioritization of osteoporosis candidate genes from among the many proposed in recent years and revealed the significant gene–gene interaction effects influencing osteoporosis risk. PMID:17002564

  8. Comparative analysis of protein interactome networks prioritizes candidate genes with cancer signatures.

    PubMed

    Li, Yongsheng; Sahni, Nidhi; Yi, Song

    2016-11-29

    Comprehensive understanding of human cancer mechanisms requires the identification of a thorough list of cancer-associated genes, which could serve as biomarkers for diagnoses and therapies in various types of cancer. Although substantial progress has been made in functional studies to uncover genes involved in cancer, these efforts are often time-consuming and costly. Therefore, it remains challenging to comprehensively identify cancer candidate genes. Network-based methods have accelerated this process through the analysis of complex molecular interactions in the cell. However, the extent to which various interactome networks can contribute to prediction of candidate genes responsible for cancer is still enigmatic. In this study, we evaluated different human protein-protein interactome networks and compared their application to cancer gene prioritization. Our results indicate that network analyses can increase the power to identify novel cancer genes. In particular, such predictive power can be enhanced with the use of unbiased systematic protein interaction maps for cancer gene prioritization. Functional analysis reveals that the top ranked genes from network predictions co-occur often with cancer-related terms in literature, and further, these candidate genes are indeed frequently mutated across cancers. Finally, our study suggests that integrating interactome networks with other omics datasets could provide novel insights into cancer-associated genes and underlying molecular mechanisms.

  9. Integrated computational biology analysis to evaluate target genes for chronic myelogenous leukemia.

    PubMed

    Zheng, Yu; Wang, Yu-Ping; Cao, Hongbao; Chen, Qiusheng; Zhang, Xi

    2018-06-05

    Although hundreds of genes have been linked to chronic myelogenous leukemia (CML), many of the results lack reproducibility. In the present study, data across multiple modalities were integrated to evaluate 579 CML candidate genes, including literature‑based CML‑gene relation data, Gene Expression Omnibus RNA expression data and pathway‑based gene‑gene interaction data. The expression data included samples from 76 patients with CML and 73 healthy controls. For each target gene, four metrics were proposed and tested with case/control classification. The effectiveness of the four metrics presented was demonstrated by the high classification accuracy (94.63%; P<2x10‑4). Cross metric analysis suggested nine top candidate genes for CML: Epidermal growth factor receptor, tumor protein p53, catenin β 1, janus kinase 2, tumor necrosis factor, abelson murine leukemia viral oncogene homolog 1, vascular endothelial growth factor A, B‑cell lymphoma 2 and proto‑oncogene tyrosine‑protein kinase. In addition, 145 CML candidate pathways enriched with 485 out of 579 genes were identified (P<8.2x10‑11; q=0.005). In conclusion, weighted genetic networks generated using computational biology may be complementary to biological experiments for the evaluation of known or novel CML target genes.

  10. Photoreceptor dysplasia (pd) in miniature schnauzer dogs: evaluation of candidate genes by molecular genetic analysis.

    PubMed

    Zhang, Q; Baldwin, V J; Acland, G M; Parshall, C J; Haskel, J; Aguirre, G D; Ray, K

    1999-01-01

    Photoreceptor dysplasia (pd) is one of a group of at least six distinct autosomal and one X-linked retinal disorders identified in dogs which are collectively known as progressive retinal atrophy (PRA). It is an early onset retinal disease identified in miniature schnauzer dogs, and pedigree analysis and breeding studies have established autosomal recessive inheritance of the disease. Using a gene-based approach, a number of retina-expressed genes, including some members of the phototransduction pathway, have been causally implicated in retinal diseases of humans and other animals. Here we examined seven such potential candidate genes (opsin, RDS/peripherin, ROM1, rod cGMP-gated cation channel alpha-subunit, and three subunits of transducin) for their causal association with the pd locus by testing segregation of intragenic markers with the disease locus, or, in the absence of informative polymorphisms, sequencing of the coding regions of the genes. Based on these results, we have conclusively excluded four photoreceptor-specific genes as candidates for pd by linkage analysis. For three other photoreceptor-specific genes, we did not find any mutation in the coding sequences of the genes and have excluded them provisionally. Formal exclusion would require investigation of the levels of expression of the candidate genes in pd-affected dogs relative to age-matched controls. At present we are building suitable informative pedigrees for the disease locus with a sufficient number of meiosis to be useful for genomewide screening. This should identify markers linked to the disease locus and eventually permit progress toward the identification of the photoreceptor dysplasia gene and the disease-causing mutation.

  11. Constructing an integrated gene similarity network for the identification of disease genes.

    PubMed

    Tian, Zhen; Guo, Maozu; Wang, Chunyu; Xing, LinLin; Wang, Lei; Zhang, Yin

    2017-09-20

    Discovering novel genes that are involved human diseases is a challenging task in biomedical research. In recent years, several computational approaches have been proposed to prioritize candidate disease genes. Most of these methods are mainly based on protein-protein interaction (PPI) networks. However, since these PPI networks contain false positives and only cover less half of known human genes, their reliability and coverage are very low. Therefore, it is highly necessary to fuse multiple genomic data to construct a credible gene similarity network and then infer disease genes on the whole genomic scale. We proposed a novel method, named RWRB, to infer causal genes of interested diseases. First, we construct five individual gene (protein) similarity networks based on multiple genomic data of human genes. Then, an integrated gene similarity network (IGSN) is reconstructed based on similarity network fusion (SNF) method. Finally, we employee the random walk with restart algorithm on the phenotype-gene bilayer network, which combines phenotype similarity network, IGSN as well as phenotype-gene association network, to prioritize candidate disease genes. We investigate the effectiveness of RWRB through leave-one-out cross-validation methods in inferring phenotype-gene relationships. Results show that RWRB is more accurate than state-of-the-art methods on most evaluation metrics. Further analysis shows that the success of RWRB is benefited from IGSN which has a wider coverage and higher reliability comparing with current PPI networks. Moreover, we conduct a comprehensive case study for Alzheimer's disease and predict some novel disease genes that supported by literature. RWRB is an effective and reliable algorithm in prioritizing candidate disease genes on the genomic scale. Software and supplementary information are available at http://nclab.hit.edu.cn/~tianzhen/RWRB/ .

  12. Candidate Loci for Yield-Related Traits in Maize Revealed by a Combination of MetaQTL Analysis and Regional Association Mapping

    PubMed Central

    Chen, Lin; An, Yixin; Li, Yong-xiang; Li, Chunhui; Shi, Yunsu; Song, Yanchun; Zhang, Dengfeng; Wang, Tianyu; Li, Yu

    2017-01-01

    Maize grain yield and related traits are complex and are controlled by a large number of genes of small effect or quantitative trait loci (QTL). Over the years, a large number of yield-related QTLs have been identified in maize and deposited in public databases. However, integrating and re-analyzing these data and mining candidate loci for yield-related traits has become a major issue in maize. In this study, we collected information on QTLs conferring maize yield-related traits from 33 published studies. Then, 999 of these QTLs were iteratively projected and subjected to meta-analysis to obtain metaQTLs (MQTLs). A total of 76 MQTLs were found across the maize genome. Based on a comparative genomics strategy, several maize orthologs of rice yield-related genes were identified in these MQTL regions. Furthermore, three potential candidate genes (Gene ID: GRMZM2G359974, GRMZM2G301884, and GRMZM2G083894) associated with kernel size and weight within three MQTL regions were identified using regional association mapping, based on the results of the meta-analysis. This strategy, combining MQTL analysis and regional association mapping, is helpful for functional marker development and rapid identification of candidate genes or loci. PMID:29312420

  13. The Terpene Synthase Gene Family of Carrot (Daucus carota L.): Identification of QTLs and Candidate Genes Associated with Terpenoid Volatile Compounds

    PubMed Central

    Keilwagen, Jens; Lehnert, Heike; Berner, Thomas; Budahn, Holger; Nothnagel, Thomas; Ulrich, Detlef; Dunemann, Frank

    2017-01-01

    Terpenes are an important group of secondary metabolites in carrots influencing taste and flavor, and some of them might also play a role as bioactive substances with an impact on human physiology and health. Understanding the genetic and molecular basis of terpene synthases (TPS) involved in the biosynthesis of volatile terpenoids will provide insights for improving breeding strategies aimed at quality traits and for developing specific carrot chemotypes possibly useful for pharmaceutical applications. Hence, a combination of terpene metabolite profiling, genotyping-by-sequencing (GBS), and genome-wide association study (GWAS) was used in this work to get insights into the genetic control of terpene biosynthesis in carrots and to identify several TPS candidate genes that might be involved in the production of specific monoterpenes. In a panel of 85 carrot cultivars and accessions, metabolite profiling was used to identify 31 terpenoid volatile organic compounds (VOCs) in carrot leaves and roots, and a GBS approach was used to provide dense genome-wide marker coverage (>168,000 SNPs). Based on this data, a total of 30 quantitative trait loci (QTLs) was identified for 15 terpenoid volatiles. Most QTLs were detected for the monoterpene compounds ocimene, sabinene, β-pinene, borneol and bornyl acetate. We identified four genomic regions on three different carrot chromosomes by GWAS which are both associated with high significance (LOD ≥ 5.91) to distinct monoterpenes and to TPS candidate genes, which have been identified by homology-based gene prediction utilizing RNA-seq data. In total, 65 TPS candidate gene models in carrot were identified and assigned to known plant TPS subfamilies with the exception of TPS-d and TPS-h. TPS-b was identified as largest subfamily with 32 TPS candidate genes. PMID:29170675

  14. Replication and validation of genetic polymorphisms associated with survival after allogeneic blood or marrow transplant

    PubMed Central

    Karaesmen, Ezgi; Rizvi, Abbas A.; Preus, Leah M.; McCarthy, Philip L.; Pasquini, Marcelo C.; Onel, Kenan; Zhu, Xiaochun; Spellman, Stephen; Haiman, Christopher A.; Stram, Daniel O.; Pooler, Loreall; Sheng, Xin; Zhu, Qianqian; Yan, Li; Liu, Qian; Hu, Qiang; Webb, Amy; Brock, Guy; Clay-Gilmour, Alyssa I.; Battaglia, Sebastiano; Tritchler, David; Liu, Song; Hahn, Theresa

    2017-01-01

    Multiple candidate gene-association studies of non-HLA single-nucleotide polymorphisms (SNPs) and outcomes after blood or marrow transplant (BMT) have been conducted. We identified 70 publications reporting 45 SNPs in 36 genes significantly associated with disease-related mortality, progression-free survival, transplant-related mortality, and/or overall survival after BMT. Replication and validation of these SNP associations were performed using DISCOVeRY-BMT (Determining the Influence of Susceptibility COnveying Variants Related to one-Year mortality after BMT), a well-powered genome-wide association study consisting of 2 cohorts, totaling 2888 BMT recipients with acute myeloid leukemia, acute lymphoblastic leukemia, or myelodysplastic syndrome, and their HLA-matched unrelated donors, reported to the Center for International Blood and Marrow Transplant Research. Gene-based tests were used to assess the aggregate effect of SNPs on outcome. None of the previously reported significant SNPs replicated at P < .05 in DISCOVeRY-BMT. Validation analyses showed association with one previously reported donor SNP at P < .05 and survival; more associations would be anticipated by chance alone. No gene-based tests were significant at P < .05. Functional annotation with publicly available data shows these candidate SNPs most likely do not have biochemical function; only 13% of candidate SNPs correlate with gene expression or are predicted to impact transcription factor binding. Of these, half do not impact the candidate gene of interest; the other half correlate with expression of multiple genes. These findings emphasize the peril of pursing candidate approaches and the importance of adequately powered tests of unbiased genome-wide associations with BMT clinical outcomes given the ultimate goal of improving patient outcomes. PMID:28811306

  15. Breast Tumors with Elevated Expression of 1q Candidate Genes Confer Poor Clinical Outcome and Sensitivity to Ras/PI3K Inhibition

    PubMed Central

    Viveka Thangaraj, Soundara; Periasamy, Jayaprakash; Bhaskar Rao, Divya; Barnabas, Georgina D.; Raghavan, Swetha; Ganesan, Kumaresan

    2013-01-01

    Genomic aberrations are common in cancers and the long arm of chromosome 1 is known for its frequent amplifications in breast cancer. However, the key candidate genes of 1q, and their contribution in breast cancer pathogenesis remain unexplored. We have analyzed the gene expression profiles of 1635 breast tumor samples using meta-analysis based approach and identified clinically significant candidates from chromosome 1q. Seven candidate genes including exonuclease 1 (EXO1) are consistently over expressed in breast tumors, specifically in high grade and aggressive breast tumors with poor clinical outcome. We derived a EXO1 co-expression module from the mRNA profiles of breast tumors which comprises 1q candidate genes and their co-expressed genes. By integrative functional genomics investigation, we identified the involvement of EGFR, RAS, PI3K / AKT, MYC, E2F signaling in the regulation of these selected 1q genes in breast tumors and breast cancer cell lines. Expression of EXO1 module was found as indicative of elevated cell proliferation, genomic instability, activated RAS/AKT/MYC/E2F1 signaling pathways and loss of p53 activity in breast tumors. mRNA–drug connectivity analysis indicates inhibition of RAS/PI3K as a possible targeted therapeutic approach for the patients with activated EXO1 module in breast tumors. Thus, we identified seven 1q candidate genes strongly associated with the poor survival of breast cancer patients and identified the possibility of targeting them with EGFR/RAS/PI3K inhibitors. PMID:24147022

  16. DISSECTING THE GENETICS OF HUMAN HIGH MYOPIA: A MOLECULAR BIOLOGIC APPROACH

    PubMed Central

    Young, Terri L

    2004-01-01

    ABSTRACT Purpose Despite the plethora of experimental myopia animal studies that demonstrate biochemical factor changes in various eye tissues, and limited human studies utilizing pharmacologic agents to thwart axial elongation, we have little knowledge of the basic physiology that drives myopic development. Identifying the implicated genes for myopia susceptibility will provide a fundamental molecular understanding of how myopia occurs and may lead to directed physiologic (ie, pharmacologic, gene therapy) interventions. The purpose of this proposal is to describe the results of positional candidate gene screening of selected genes within the autosomal dominant high-grade myopia-2 locus (MYP2) on chromosome 18p11.31. Methods A physical map of a contracted MYP2 interval was compiled, and gene expression studies in ocular tissues using complementary DNA library screens, microarray matches, and reverse-transcription techniques aided in prioritizing gene selection for screening. The TGIF, EMLIN-2, MLCB, and CLUL1 genes were screened in DNA samples from unrelated controls and in high-myopia affected and unaffected family members from the original seven MYP2 pedigrees. All candidate genes were screened by direct base pair sequence analysis. Results Consistent segregation of a gene sequence alteration (polymorphism) with myopia was not demonstrated in any of the seven families. Novel single nucleotide polymorphisms were found. Conclusion The positional candidate genes TGIF, EMLIN-2, MLCB, and CLUL1 are not associated with MYP2-linked high-grade myopia. Base change polymorphisms discovered with base sequence screening of these genes were submitted to an Internet database. Other genes that also map within the interval are currently undergoing mutation screening. PMID:15747770

  17. Linkage study of nonsyndromic cleft lip with or without cleft palate using candidate genes and mapped polymorphic markers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stein, J.D.; Nelson, L.D.; Conner, B.J.

    1994-09-01

    Nonsyndromic cleft lip with or without cleft palate (CL(P)) involves fusion or growth failure of facial primordia during development. Complex segregation analysis of clefting populations suggest that an autosomal dominant gene may play a role in this common craniofacial disorder. We have ascertained 16 multigenerational families with CL(P) and tested linkage to 29 candidate genes and 139 mapped short tandem repeat markers. The candidate genes were selected based on their expression in craniofacial development or were identified through murine models. These include: TGF{alpha}, TGF{beta}1, TGF{beta}2, TGF{beta}3, EGF, EGFR, GRAS, cMyc, FGFR, Jun, JunB, PDFG{alpha}, PDGF{beta}, IGF2R, GCR Hox7, Hox8, Hox2B,more » twirler, 5 collagen and 3 extracellular matrix genes. Linkage was tested assuming an autosomal dominant model with sex-specific decreased penetrance. Linkage to all of the candidate loci was excluded in 11 families. RARA was tested and was not informative. However, haplotype analysis of markers flanking RARA on 17q allowed exclusion of this candidate locus. We have previously excluded linkage to 61 STR markers in 11 families. Seventy-eight mapped short tandem repeat markers have recently been tested in 16 families and 30 have been excluded. The remaining are being analyzed and an exclusion map is being developed based on the entire study results.« less

  18. Identification of a strawberry flavor gene candidate using an integrated genetic-genomic-analytical chemistry approach.

    PubMed

    Chambers, Alan H; Pillet, Jeremy; Plotto, Anne; Bai, Jinhe; Whitaker, Vance M; Folta, Kevin M

    2014-04-17

    There is interest in improving the flavor of commercial strawberry (Fragaria × ananassa) varieties. Fruit flavor is shaped by combinations of sugars, acids and volatile compounds. Many efforts seek to use genomics-based strategies to identify genes controlling flavor, and then designing durable molecular markers to follow these genes in breeding populations. In this report, fruit from two cultivars, varying for presence-absence of volatile compounds, along with segregating progeny, were analyzed using GC/MS and RNAseq. Expression data were bulked in silico according to presence/absence of a given volatile compound, in this case γ-decalactone, a compound conferring a peach flavor note to fruits. Computationally sorting reads in segregating progeny based on γ-decalactone presence eliminated transcripts not directly relevant to the volatile, revealing transcripts possibly imparting quantitative contributions. One candidate encodes an omega-6 fatty acid desaturase, an enzyme known to participate in lactone production in fungi, noted here as FaFAD1. This candidate was induced by ripening, was detected in certain harvests, and correlated with γ-decalactone presence. The FaFAD1 gene is present in every genotype where γ-decalactone has been detected, and it was invariably missing in non-producers. A functional, PCR-based molecular marker was developed that cosegregates with the phenotype in F1 and BC1 populations, as well as in many other cultivars and wild Fragaria accessions. Genetic, genomic and analytical chemistry techniques were combined to identify FaFAD1, a gene likely controlling a key flavor volatile in strawberry. The same data may now be re-sorted based on presence/absence of any other volatile to identify other flavor-affecting candidates, leading to rapid generation of gene-specific markers.

  19. Identification of a strawberry flavor gene candidate using an integrated genetic-genomic-analytical chemistry approach

    PubMed Central

    2014-01-01

    Background There is interest in improving the flavor of commercial strawberry (Fragaria × ananassa) varieties. Fruit flavor is shaped by combinations of sugars, acids and volatile compounds. Many efforts seek to use genomics-based strategies to identify genes controlling flavor, and then designing durable molecular markers to follow these genes in breeding populations. In this report, fruit from two cultivars, varying for presence-absence of volatile compounds, along with segregating progeny, were analyzed using GC/MS and RNAseq. Expression data were bulked in silico according to presence/absence of a given volatile compound, in this case γ-decalactone, a compound conferring a peach flavor note to fruits. Results Computationally sorting reads in segregating progeny based on γ-decalactone presence eliminated transcripts not directly relevant to the volatile, revealing transcripts possibly imparting quantitative contributions. One candidate encodes an omega-6 fatty acid desaturase, an enzyme known to participate in lactone production in fungi, noted here as FaFAD1. This candidate was induced by ripening, was detected in certain harvests, and correlated with γ-decalactone presence. The FaFAD1 gene is present in every genotype where γ-decalactone has been detected, and it was invariably missing in non-producers. A functional, PCR-based molecular marker was developed that cosegregates with the phenotype in F1 and BC1 populations, as well as in many other cultivars and wild Fragaria accessions. Conclusions Genetic, genomic and analytical chemistry techniques were combined to identify FaFAD1, a gene likely controlling a key flavor volatile in strawberry. The same data may now be re-sorted based on presence/absence of any other volatile to identify other flavor-affecting candidates, leading to rapid generation of gene-specific markers. PMID:24742080

  20. Genome-Wide Prediction of the Polymorphic Ser Gene Family in Tetrahymena thermophila Based on Motif Analysis

    PubMed Central

    Ponsuwanna, Patrath; Kümpornsin, Krittikorn; Chookajorn, Thanat

    2014-01-01

    Even though antigenic variation is employed among parasitic protozoa for host immune evasion, Tetrahymena thermophila, a free-living ciliate, can also change its surface protein antigens. These cysteine-rich glycosylphosphatidylinositol (GPI)-linked surface proteins are encoded by a family of polymorphic Ser genes. Despite the availability of T. thermophila genome, a comprehensive analysis of the Ser family is limited by its high degree of polymorphism. In order to overcome this problem, a new approach was adopted by searching for Ser candidates with common motif sequences, namely length-specific repetitive cysteine pattern and GPI anchor site. The candidate genes were phylogenetically compared with the previously identified Ser genes and classified into subtypes. Ser candidates were often found to be located as tandem arrays of the same subtypes on several chromosomal scaffolds. Certain Ser candidates located in the same chromosomal arrays were transcriptionally expressed at specific T. thermophila developmental stages. These Ser candidates selected by the motif analysis approach can form the foundation for a systematic identification of the entire Ser gene family, which will contribute to the understanding of their function and the basis of T. thermophila antigenic variation. PMID:25133747

  1. Identification of Candidate Genes Responsible for Stem Pith Production Using Expression Analysis in Solid-Stemmed Wheat.

    PubMed

    Oiestad, A J; Martin, J M; Cook, J; Varella, A C; Giroux, M J

    2017-07-01

    The wheat stem sawfly (WSS) is an economically important pest of wheat in the Northern Great Plains. The primary means of WSS control is resistance associated with the single quantitative trait locus (QTL) , which controls most stem solidness variation. The goal of this study was to identify stem solidness candidate genes via RNA-seq. This study made use of 28 single nucleotide polymorphism (SNP) makers derived from expressed sequence tags (ESTs) linked to contained within a 5.13 cM region. Allele specific expression of EST markers was examined in stem tissue for solid and hollow-stemmed pairs of two spring wheat near isogenic lines (NILs) differing for the QTL. Of the 28 ESTs, 13 were located within annotated genes and 10 had detectable stem expression. Annotated genes corresponding to four of the ESTs were differentially expressed between solid and hollow-stemmed NILs and represent possible stem solidness gene candidates. Further examination of the 5.13 cM region containing the 28 EST markers identified 260 annotated genes. Twenty of the 260 linked genes were up-regulated in hollow NIL stems, while only seven genes were up-regulated in solid NIL stems. An -methyltransferase within the region of interest was identified as a candidate based on differential expression between solid and hollow-stemmed NILs and putative function. Further study of these candidate genes may lead to the identification of the gene(s) controlling stem solidness and an increased ability to select for wheat stem solidness and manage WSS. Copyright © 2017 Crop Science Society of America.

  2. Genome-wide association links candidate genes to resistance to Plum Pox Virus in apricot (Prunus armeniaca).

    PubMed

    Mariette, Stéphanie; Wong Jun Tai, Fabienne; Roch, Guillaume; Barre, Aurélien; Chague, Aurélie; Decroocq, Stéphane; Groppi, Alexis; Laizet, Yec'han; Lambert, Patrick; Tricon, David; Nikolski, Macha; Audergon, Jean-Marc; Abbott, Albert G; Decroocq, Véronique

    2016-01-01

    In fruit tree species, many important traits have been characterized genetically by using single-family descent mapping in progenies segregating for the traits. However, most mapped loci have not been sufficiently resolved to the individual genes due to insufficient progeny sizes for high resolution mapping and the previous lack of whole-genome sequence resources of the study species. To address this problem for Plum Pox Virus (PPV) candidate resistance gene identification in Prunus species, we implemented a genome-wide association (GWA) approach in apricot. This study exploited the broad genetic diversity of the apricot (Prunus armeniaca) germplasm containing resistance to PPV, next-generation sequence-based genotyping, and the high-quality peach (Prunus persica) genome reference sequence for single nucleotide polymorphism (SNP) identification. The results of this GWA study validated previously reported PPV resistance quantitative trait loci (QTL) intervals, highlighted other potential resistance loci, and resolved each to a limited set of candidate genes for further study. This work substantiates the association genetics approach for resolution of QTL to candidate genes in apricot and suggests that this approach could simplify identification of other candidate genes for other marked trait intervals in this germplasm. © 2015 INRA, UMR 1332 BFP New Phytologist © 2015 New Phytologist Trust.

  3. Association Genetics of Coastal Douglas Fir (Pseudotsuga menziesii var. menziesii, Pinaceae). I. Cold-Hardiness Related Traits

    Treesearch

    Andrew J. Eckert; Andrew D. Bower; Jill L. Wegrzyn; Barnaly Pande; Kathleen D. Jermstad; Konstantin V. Krutovsky; J. Bradley St. Clair; David B. Neale

    2009-01-01

    Adaptation to cold is one of the greatest challenges to forest trees. This process is highly synchronized with environmental cues relating to photoperiod and temperature. Here, we use a candidate gene-based approach to search for genetic associations between 384 single-nucleotide polymorphism (SNP) markers from 117 candidate genes and 21 cold-hardiness related traits....

  4. Targeted capture and resequencing of 1040 genes reveal environmentally driven functional variation in grey wolves.

    PubMed

    Schweizer, Rena M; Robinson, Jacqueline; Harrigan, Ryan; Silva, Pedro; Galverni, Marco; Musiani, Marco; Green, Richard E; Novembre, John; Wayne, Robert K

    2016-01-01

    In an era of ever-increasing amounts of whole-genome sequence data for individuals and populations, the utility of traditional single nucleotide polymorphisms (SNPs) array-based genome scans is uncertain. We previously performed a SNP array-based genome scan to identify candidate genes under selection in six distinct grey wolf (Canis lupus) ecotypes. Using this information, we designed a targeted capture array for 1040 genes, including all exons and flanking regions, as well as 5000 1-kb nongenic neutral regions, and resequenced these regions in 107 wolves. Selection tests revealed striking patterns of variation within candidate genes relative to noncandidate regions and identified potentially functional variants related to local adaptation. We found 27% and 47% of candidate genes from the previous SNP array study had functional changes that were outliers in sweed and bayenv analyses, respectively. This result verifies the use of genomewide SNP surveys to tag genes that contain functional variants between populations. We highlight nonsynonymous variants in APOB, LIPG and USH2A that occur in functional domains of these proteins, and that demonstrate high correlation with precipitation seasonality and vegetation. We find Arctic and High Arctic wolf ecotypes have higher numbers of genes under selection, which highlight their conservation value and heightened threat due to climate change. This study demonstrates that combining genomewide genotyping arrays with large-scale resequencing and environmental data provides a powerful approach to discern candidate functional variants in natural populations. © 2015 John Wiley & Sons Ltd.

  5. Genetic basis of interindividual susceptibility to cancer cachexia: selection of potential candidate gene polymorphisms for association studies.

    PubMed

    Johns, N; Tan, B H; MacMillan, M; Solheim, T S; Ross, J A; Baracos, V E; Damaraju, S; Fearon, K C H

    2014-12-01

    Cancer cachexia is a complex and multifactorial disease. Evolving definitions highlight the fact that a diverse range of biological processes contribute to cancer cachexia. Part of the variation in who will and who will not develop cancer cachexia may be genetically determined. As new definitions, classifications and biological targets continue to evolve, there is a need for reappraisal of the literature for future candidate association studies. This review summarizes genes identified or implicated as well as putative candidate genes contributing to cachexia, identified through diverse technology platforms and model systems to further guide association studies. A systematic search covering 1986-2012 was performed for potential candidate genes / genetic polymorphisms relating to cancer cachexia. All candidate genes were reviewed for functional polymorphisms or clinically significant polymorphisms associated with cachexia using the OMIM and GeneRIF databases. Pathway analysis software was used to reveal possible network associations between genes. Functionality of SNPs/genes was explored based on published literature, algorithms for detecting putative deleterious SNPs and interrogating the database for expression of quantitative trait loci (eQTLs). A total of 154 genes associated with cancer cachexia were identified and explored for functional polymorphisms. Of these 154 genes, 119 had a combined total of 281 polymorphisms with functional and/or clinical significance in terms of cachexia associated with them. Of these, 80 polymorphisms (in 51 genes) were replicated in more than one study with 24 polymorphisms found to influence two or more hallmarks of cachexia (i.e., inflammation, loss of fat mass and/or lean mass and reduced survival). Selection of candidate genes and polymorphisms is a key element of multigene study design. The present study provides a contemporary basis to select genes and/or polymorphisms for further association studies in cancer cachexia, and to develop their potential as susceptibility biomarkers of cachexia.

  6. Identification of genes from the Treacher Collins candidate region

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dixon, M.; Dixon, J.; Edwards, S.

    Treacher Collins syndrome (TCOF1) is an autosomal dominant disorder of craniofacial development. The TCOF1 locus has previously been mapped to chromosome 5q32-33. The candidate gene region has been defined as being between two flanking markers, ribosomal protein S14 (RPS14) and Annexin 6 (ANX6), by analyzing recombination events in affected individuals. It is estimated that the distance between these flanking markers is 500 kb by three separate analysis methods: (1) radiation hybrid mapping; (2) genetic linkage; and (3) YAC contig analysis. A cosmid contig which spans the candidate gene region for TCOF1 has been constructed by screening the Los Alamos Nationalmore » Laboratory flow-sorted chromosome 5 cosmid library. Cosmids were obtained by using a combination of probes generated from YAC end clones, Alu-PCR fragments from YACs, and asymmetric PCR fragments from both T7 and T3 cosmid ends. Exon amplifications, the selection of genomic coding sequences based upon the presence of functional splice acceptor and donor sites, was used to identify potential exon sequences. Sequences found to be conserved between species were then used to screen cDNA libraries in order to identify candidate genes. To date, four different cDNAs have been isolated from this region and are being analyzed as potential candidate genes for TCOF1. These include the genes encoding plasma glutathione peroxidase (GPX3), heparin sulfate sulfotransferase (HSST), a gene with homology to the ETS family of proteins and one which shows no homology to any known genes. Work is also in progress to identify and characterize additional cDNAs from the candidate gene region.« less

  7. [Comparison of protective properties of the smallpox DNA-vaccine based on the variola virus A30L gene and its variant with modified codon usage].

    PubMed

    Maksiutov, R A; Shchelkunov, S N

    2011-01-01

    Efficacy of candidate DNA-vaccines based on the variola virus natural gene A30L and artificial gene A30Lopt with modified codon usage, optimized for expression in mammalian cells, was tested. The groups of mice were intracutaneously immunized three times with three-week intervals with candidate DNA-vaccines: pcDNA_A30L or pcDNA_A30Lopt, and in three weeks after the last immunization all mice in the groups were intraperitoneally infected by the ectromelia virus K1 strain in 10 LD50 dose for the estimation of protection. It was shown that the DNA-vaccines based on natural gene A30L and codon-optimized gene A30Lopt elicited virus, thereby neutralizing the antibody response and protected mice from lethal intraperitoneal challenge with the ectromelia virus with lack of statistically significant difference.

  8. An integrative, translational approach to understanding rare and orphan genetically based diseases

    PubMed Central

    Hoehndorf, Robert; Schofield, Paul N.; Gkoutos, Georgios V.

    2013-01-01

    PhenomeNet is an approach for integrating phenotypes across species and identifying candidate genes for genetic diseases based on the similarity between a disease and animal model phenotypes. In contrast to ‘guilt-by-association’ approaches, PhenomeNet relies exclusively on the comparison of phenotypes to suggest candidate genes, and can, therefore, be applied to study the molecular basis of rare and orphan diseases for which the molecular basis is unknown. In addition to disease phenotypes from the Online Mendelian Inheritance in Man (OMIM) database, we have now integrated the clinical signs from Orphanet into PhenomeNet. We demonstrate that our approach can efficiently identify known candidate genes for genetic diseases in Orphanet and OMIM. Furthermore, we find evidence that mutations in the HIP1 gene might cause Bassoe syndrome, a rare disorder with unknown genetic aetiology. Our results demonstrate that integration and computational analysis of human disease and animal model phenotypes using PhenomeNet has the potential to reveal novel insights into the pathobiology underlying genetic diseases. PMID:23853703

  9. Next-generation sequencing for identification of candidate genes for Fusarium wilt and sterility mosaic disease in pigeonpea (Cajanus cajan).

    PubMed

    Singh, Vikas K; Khan, Aamir W; Saxena, Rachit K; Kumar, Vinay; Kale, Sandip M; Sinha, Pallavi; Chitikineni, Annapurna; Pazhamala, Lekha T; Garg, Vanika; Sharma, Mamta; Sameer Kumar, Chanda Venkata; Parupalli, Swathi; Vechalapu, Suryanarayana; Patil, Suyash; Muniswamy, Sonnappa; Ghanta, Anuradha; Yamini, Kalinati Narasimhan; Dharmaraj, Pallavi Subbanna; Varshney, Rajeev K

    2016-05-01

    To map resistance genes for Fusarium wilt (FW) and sterility mosaic disease (SMD) in pigeonpea, sequencing-based bulked segregant analysis (Seq-BSA) was used. Resistant (R) and susceptible (S) bulks from the extreme recombinant inbred lines of ICPL 20096 × ICPL 332 were sequenced. Subsequently, SNP index was calculated between R- and S-bulks with the help of draft genome sequence and reference-guided assembly of ICPL 20096 (resistant parent). Seq-BSA has provided seven candidate SNPs for FW and SMD resistance in pigeonpea. In parallel, four additional genotypes were re-sequenced and their combined analysis with R- and S-bulks has provided a total of 8362 nonsynonymous (ns) SNPs. Of 8362 nsSNPs, 60 were found within the 2-Mb flanking regions of seven candidate SNPs identified through Seq-BSA. Haplotype analysis narrowed down to eight nsSNPs in seven genes. These eight nsSNPs were further validated by re-sequencing 11 genotypes that are resistant and susceptible to FW and SMD. This analysis revealed association of four candidate nsSNPs in four genes with FW resistance and four candidate nsSNPs in three genes with SMD resistance. Further, In silico protein analysis and expression profiling identified two most promising candidate genes namely C.cajan_01839 for SMD resistance and C.cajan_03203 for FW resistance. Identified candidate genomic regions/SNPs will be useful for genomics-assisted breeding in pigeonpea. © 2015 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  10. Parkinson's disease candidate gene prioritization based on expression profile of midbrain dopaminergic neurons

    PubMed Central

    2010-01-01

    Background Parkinson's disease is the second most common neurodegenerative disorder. The pathological hallmark of the disease is degeneration of midbrain dopaminergic neurons. Genetic association studies have linked 13 human chromosomal loci to Parkinson's disease. Identification of gene(s), as part of the etiology of Parkinson's disease, within the large number of genes residing in these loci can be achieved through several approaches, including screening methods, and considering appropriate criteria. Since several of the indentified Parkinson's disease genes are expressed in substantia nigra pars compact of the midbrain, expression within the neurons of this area could be a suitable criterion to limit the number of candidates and identify PD genes. Methods In this work we have used the combination of findings from six rodent transcriptome analysis studies on the gene expression profile of midbrain dopaminergic neurons and the PARK loci in OMIM (Online Mendelian Inheritance in Man) database, to identify new candidate genes for Parkinson's disease. Results Merging the two datasets, we identified 20 genes within PARK loci, 7 of which are located in an orphan Parkinson's disease locus and one, which had been identified as a disease gene. In addition to identifying a set of candidates for further genetic association studies, these results show that the criteria of expression in midbrain dopaminergic neurons may be used to narrow down the number of genes in PARK loci for such studies. PMID:20716345

  11. Candidate genes for idiopathic epilepsy in four dog breeds.

    PubMed

    Ekenstedt, Kari J; Patterson, Edward E; Minor, Katie M; Mickelson, James R

    2011-04-25

    Idiopathic epilepsy (IE) is a naturally occurring and significant seizure disorder affecting all dog breeds. Because dog breeds are genetically isolated populations, it is possible that IE is attributable to common founders and is genetically homogenous within breeds. In humans, a number of mutations, the majority of which are genes encoding ion channels, neurotransmitters, or their regulatory subunits, have been discovered to cause rare, specific types of IE. It was hypothesized that there are simple genetic bases for IE in some purebred dog breeds, specifically in Vizslas, English Springer Spaniels (ESS), Greater Swiss Mountain Dogs (GSMD), and Beagles, and that the gene(s) responsible may, in some cases, be the same as those already discovered in humans. Candidate genes known to be involved in human epilepsy, along with selected additional genes in the same gene families that are involved in murine epilepsy or are expressed in neural tissue, were examined in populations of affected and unaffected dogs. Microsatellite markers in close proximity to each candidate gene were genotyped and subjected to two-point linkage in Vizslas, and association analysis in ESS, GSMD and Beagles. Most of these candidate genes were not significantly associated with IE in these four dog breeds, while a few genes remained inconclusive. Other genes not included in this study may still be causing monogenic IE in these breeds or, like many cases of human IE, the disease in dogs may be likewise polygenic.

  12. Mutational Landscape of Candidate Genes in Familial Prostate Cancer

    PubMed Central

    Johnson, Anna M.; Zuhlke, Kimberly A.; Plotts, Chris; McDonnell, Shannon K.; Middha, Sumit; Riska, Shaun M.; Thibodeau, Stephen N.; Douglas, Julie A.; Cooney, Kathleen A.

    2014-01-01

    Background Family history is a major risk factor for prostate cancer (PCa), suggesting a genetic component to the disease. However, traditional linkage and association studies have failed to fully elucidate the underlying genetic basis of familial PCa. Methods Here we use a candidate gene approach to identify potential PCa susceptibility variants in whole exome sequencing data from familial PCa cases. Six hundred ninety-seven candidate genes were identified based on function, location near a known chromosome 17 linkage signal, and/or previous association with prostate or other cancers. Single nucleotide variants (SNVs) in these candidate genes were identified in whole exome sequence data from 33 PCa cases from 11 multiplex PCa families (3 cases/family). Results Overall, 4856 candidate gene SNVs were identified, including 1052 missense and 10 nonsense variants. Twenty missense variants were shared by all 3 family members in each family in which they were observed. Additionally, 15 missense variants were shared by 2 of 3 family members and predicted to be deleterious by 5 different algorithms. Four missense variants, BLM Gln123Arg, PARP2 Arg283Gln, LRCC46 Ala295Thr and KIF2B Pro91Leu, and 1 nonsense variant, CYP3A43 Arg441Ter, showed complete co-segregation with PCa status. Twelve additional variants displayed partial co-segregation with PCa. Conclusions Forty-three nonsense and shared, missense variants were identified in our candidate genes. Further research is needed to determine the contribution of these variants to PCa susceptibility. PMID:25111073

  13. Revealing Alzheimer's disease genes spectrum in the whole-genome by machine learning.

    PubMed

    Huang, Xiaoyan; Liu, Hankui; Li, Xinming; Guan, Liping; Li, Jiankang; Tellier, Laurent Christian Asker M; Yang, Huanming; Wang, Jian; Zhang, Jianguo

    2018-01-10

    Alzheimer's disease (AD) is an important, progressive neurodegenerative disease, with a complex genetic architecture. A key goal of biomedical research is to seek out disease risk genes, and to elucidate the function of these risk genes in the development of disease. For this purpose, expanding the AD-associated gene set is necessary. In past research, the prediction methods for AD related genes has been limited in their exploration of the target genome regions. We here present a genome-wide method for AD candidate genes predictions. We present a machine learning approach (SVM), based upon integrating gene expression data with human brain-specific gene network data, to discover the full spectrum of AD genes across the whole genome. We classified AD candidate genes with an accuracy and the area under the receiver operating characteristic (ROC) curve of 84.56% and 94%. Our approach provides a supplement for the spectrum of AD-associated genes extracted from more than 20,000 genes in a genome wide scale. In this study, we have elucidated the whole-genome spectrum of AD, using a machine learning approach. Through this method, we expect for the candidate gene catalogue to provide a more comprehensive annotation of AD for researchers.

  14. Machine Learning–Based Differential Network Analysis: A Study of Stress-Responsive Transcriptomes in Arabidopsis[W

    PubMed Central

    Ma, Chuang; Xin, Mingming; Feldmann, Kenneth A.; Wang, Xiangfeng

    2014-01-01

    Machine learning (ML) is an intelligent data mining technique that builds a prediction model based on the learning of prior knowledge to recognize patterns in large-scale data sets. We present an ML-based methodology for transcriptome analysis via comparison of gene coexpression networks, implemented as an R package called machine learning–based differential network analysis (mlDNA) and apply this method to reanalyze a set of abiotic stress expression data in Arabidopsis thaliana. The mlDNA first used a ML-based filtering process to remove nonexpressed, constitutively expressed, or non-stress-responsive “noninformative” genes prior to network construction, through learning the patterns of 32 expression characteristics of known stress-related genes. The retained “informative” genes were subsequently analyzed by ML-based network comparison to predict candidate stress-related genes showing expression and network differences between control and stress networks, based on 33 network topological characteristics. Comparative evaluation of the network-centric and gene-centric analytic methods showed that mlDNA substantially outperformed traditional statistical testing–based differential expression analysis at identifying stress-related genes, with markedly improved prediction accuracy. To experimentally validate the mlDNA predictions, we selected 89 candidates out of the 1784 predicted salt stress–related genes with available SALK T-DNA mutagenesis lines for phenotypic screening and identified two previously unreported genes, mutants of which showed salt-sensitive phenotypes. PMID:24520154

  15. Integrating genetic and toxicogenomic information for determining underlying susceptibility to developmental disorders.

    PubMed

    Robinson, Joshua F; Port, Jesse A; Yu, Xiaozhong; Faustman, Elaine M

    2010-10-01

    To understand the complex etiology of developmental disorders, an understanding of both genetic and environmental risk factors is needed. Human and rodent genetic studies have identified a multitude of gene candidates for specific developmental disorders such as neural tube defects (NTDs). With the emergence of toxicogenomic-based assessments, scientists now also have the ability to compare and understand the expression of thousands of genes simultaneously across strain, time, and exposure in developmental models. Using a systems-based approach in which we are able to evaluate information from various parts and levels of the developing organism, we propose a framework for integrating genetic information with toxicogenomic-based studies to better understand gene-environmental interactions critical for developmental disorders. This approach has allowed us to characterize candidate genes in the context of variables critical for determining susceptibility such as strain, time, and exposure. Using a combination of toxicogenomic studies and complementary bioinformatic tools, we characterize NTD candidate genes during normal development by function (gene ontology), linked phenotype (disease outcome), location, and expression (temporally and strain-dependent). In addition, we show how environmental exposures (cadmium, methylmercury) can influence expression of these genes in a strain-dependent manner. Using NTDs as an example of developmental disorder, we show how simple integration of genetic information from previous studies into the standard microarray design can enhance analysis of gene-environment interactions to better define environmental exposure-disease pathways in sensitive and resistant mouse strains. © Wiley-Liss, Inc.

  16. Combining mouse mammary gland gene expression and comparative mapping for the identification of candidate genes for QTL of milk production traits in cattle

    PubMed Central

    Ron, Micha; Israeli, Galit; Seroussi, Eyal; Weller, Joel I; Gregg, Jeffrey P; Shani, Moshe; Medrano, Juan F

    2007-01-01

    Background Many studies have found segregating quantitative trait loci (QTL) for milk production traits in different dairy cattle populations. However, even for relatively large effects with a saturated marker map the confidence interval for QTL location by linkage analysis spans tens of map units, or hundreds of genes. Combining mapping and arraying has been suggested as an approach to identify candidate genes. Thus, gene expression analysis in the mammary gland of genes positioned in the confidence interval of the QTL can bridge the gap between fine mapping and quantitative trait nucleotide (QTN) determination. Results We hybridized Affymetrix microarray (MG-U74v2), containing 12,488 murine probes, with RNA derived from mammary gland of virgin, pregnant, lactating and involuting C57BL/6J mice in a total of nine biological replicates. We combined microarray data from two additional studies that used the same design in mice with a total of 75 biological replicates. The same filtering and normalization was applied to each microarray data using GeneSpring software. Analysis of variance identified 249 differentially expressed probe sets common to the three experiments along the four developmental stages of puberty, pregnancy, lactation and involution. 212 genes were assigned to their bovine map positions through comparative mapping, and thus form a list of candidate genes for previously identified QTLs for milk production traits. A total of 82 of the genes showed mammary gland-specific expression with at least 3-fold expression over the median representing all tissues tested in GeneAtlas. Conclusion This work presents a web tool for candidate genes for QTL (cgQTL) that allows navigation between the map of bovine milk production QTL, potential candidate genes and their level of expression in mammary gland arrays and in GeneAtlas. Three out of four confirmed genes that affect QTL in livestock (ABCG2, DGAT1, GDF8, IGF2) were over expressed in the target organ. Thus, cgQTL can be used to determine priority of candidate genes for QTN analysis based on differential expression in the target organ. PMID:17584498

  17. Gene Prioritization of Resistant Rice Gene against Xanthomas oryzae pv. oryzae by Using Text Mining Technologies

    PubMed Central

    Xia, Jingbo; Zhang, Xing; Yuan, Daojun; Chen, Lingling; Webster, Jonathan; Fang, Alex Chengyu

    2013-01-01

    To effectively assess the possibility of the unknown rice protein resistant to Xanthomonas oryzae pv. oryzae, a hybrid strategy is proposed to enhance gene prioritization by combining text mining technologies with a sequence-based approach. The text mining technique of term frequency inverse document frequency is used to measure the importance of distinguished terms which reflect biomedical activity in rice before candidate genes are screened and vital terms are produced. Afterwards, a built-in classifier under the chaos games representation algorithm is used to sieve the best possible candidate gene. Our experiment results show that the combination of these two methods achieves enhanced gene prioritization. PMID:24371834

  18. Gene prioritization of resistant rice gene against Xanthomas oryzae pv. oryzae by using text mining technologies.

    PubMed

    Xia, Jingbo; Zhang, Xing; Yuan, Daojun; Chen, Lingling; Webster, Jonathan; Fang, Alex Chengyu

    2013-01-01

    To effectively assess the possibility of the unknown rice protein resistant to Xanthomonas oryzae pv. oryzae, a hybrid strategy is proposed to enhance gene prioritization by combining text mining technologies with a sequence-based approach. The text mining technique of term frequency inverse document frequency is used to measure the importance of distinguished terms which reflect biomedical activity in rice before candidate genes are screened and vital terms are produced. Afterwards, a built-in classifier under the chaos games representation algorithm is used to sieve the best possible candidate gene. Our experiment results show that the combination of these two methods achieves enhanced gene prioritization.

  19. ProDiGe: Prioritization Of Disease Genes with multitask machine learning from positive and unlabeled examples

    PubMed Central

    2011-01-01

    Background Elucidating the genetic basis of human diseases is a central goal of genetics and molecular biology. While traditional linkage analysis and modern high-throughput techniques often provide long lists of tens or hundreds of disease gene candidates, the identification of disease genes among the candidates remains time-consuming and expensive. Efficient computational methods are therefore needed to prioritize genes within the list of candidates, by exploiting the wealth of information available about the genes in various databases. Results We propose ProDiGe, a novel algorithm for Prioritization of Disease Genes. ProDiGe implements a novel machine learning strategy based on learning from positive and unlabeled examples, which allows to integrate various sources of information about the genes, to share information about known disease genes across diseases, and to perform genome-wide searches for new disease genes. Experiments on real data show that ProDiGe outperforms state-of-the-art methods for the prioritization of genes in human diseases. Conclusions ProDiGe implements a new machine learning paradigm for gene prioritization, which could help the identification of new disease genes. It is freely available at http://cbio.ensmp.fr/prodige. PMID:21977986

  20. Exploring Valid Reference Genes for Quantitative Real-time PCR Analysis in Plutella xylostella (Lepidoptera: Plutellidae)

    PubMed Central

    Fu, Wei; Xie, Wen; Zhang, Zhuo; Wang, Shaoli; Wu, Qingjun; Liu, Yong; Zhou, Xiaomao; Zhou, Xuguo; Zhang, Youjun

    2013-01-01

    Abstract: Quantitative real-time PCR (qRT-PCR), a primary tool in gene expression analysis, requires an appropriate normalization strategy to control for variation among samples. The best option is to compare the mRNA level of a target gene with that of reference gene(s) whose expression level is stable across various experimental conditions. In this study, expression profiles of eight candidate reference genes from the diamondback moth, Plutella xylostella, were evaluated under diverse experimental conditions. RefFinder, a web-based analysis tool, integrates four major computational programs including geNorm, Normfinder, BestKeeper, and the comparative ΔCt method to comprehensively rank the tested candidate genes. Elongation factor 1 (EF1) was the most suited reference gene for the biotic factors (development stage, tissue, and strain). In contrast, although appropriate reference gene(s) do exist for several abiotic factors (temperature, photoperiod, insecticide, and mechanical injury), we were not able to identify a single universal reference gene. Nevertheless, a suite of candidate reference genes were specifically recommended for selected experimental conditions. Our finding is the first step toward establishing a standardized qRT-PCR analysis of this agriculturally important insect pest. PMID:23983612

  1. HGPEC: a Cytoscape app for prediction of novel disease-gene and disease-disease associations and evidence collection based on a random walk on heterogeneous network.

    PubMed

    Le, Duc-Hau; Pham, Van-Huy

    2017-06-15

    Finding gene-disease and disease-disease associations play important roles in the biomedical area and many prioritization methods have been proposed for this goal. Among them, approaches based on a heterogeneous network of genes and diseases are considered state-of-the-art ones, which achieve high prediction performance and can be used for diseases with/without known molecular basis. Here, we developed a Cytoscape app, namely HGPEC, based on a random walk with restart algorithm on a heterogeneous network of genes and diseases. This app can prioritize candidate genes and diseases by employing a heterogeneous network consisting of a network of genes/proteins and a phenotypic disease similarity network. Based on the rankings, novel disease-gene and disease-disease associations can be identified. These associations can be supported with network- and rank-based visualization as well as evidences and annotations from biomedical data. A case study on prediction of novel breast cancer-associated genes and diseases shows the abilities of HGPEC. In addition, we showed prominence in the performance of HGPEC compared to other tools for prioritization of candidate disease genes. Taken together, our app is expected to effectively predict novel disease-gene and disease-disease associations and support network- and rank-based visualization as well as biomedical evidences for such the associations.

  2. Pool-based genome-wide association study identified novel candidate regions on BTA9 and 14 for oleic acid percentage in Japanese Black cattle.

    PubMed

    Kawaguchi, Fuki; Kigoshi, Hiroto; Nakajima, Ayaka; Matsumoto, Yuta; Uemoto, Yoshinobu; Fukushima, Moriyuki; Yoshida, Emi; Iwamoto, Eiji; Akiyama, Takayuki; Kohama, Namiko; Kobayashi, Eiji; Honda, Takeshi; Oyama, Kenji; Mannen, Hideyuki; Sasazaki, Shinji

    2018-05-17

    Fatty acid composition is an important indicator of beef quality. The objective of this study was to search the potential candidate region for fatty acid composition. We performed pool-based genome-wide association studies (GWAS) for oleic acid percentage (C18:1) in a Japanese Black cattle population from the Hyogo prefecture. GWAS analysis revealed two novel candidate regions on BTA9 and BTA14. The most significant single nucleotide polymorphisms (SNPs) in each region were genotyped in a population (n = 899) to verify their effect on C18:1. Statistical analysis revealed that both SNPs were significantly associated with C18:1 (p = .0080 and .0003), validating the quantitative trait loci (QTLs) detected in GWAS. We subsequently selected VNN1 and LYPLA1 genes as candidate genes from each region on BTA9 and BTA14, respectively. We sequenced full-length coding sequence (CDS) of these genes in eight individuals and identified a nonsynonymous SNP T66M on VNN1 gene as a putative candidate polymorphism. The polymorphism was also significantly associated with C18:1, but the p value (p = .0162) was higher than the most significant SNP on BTA9, suggesting that it would not be responsible for the QTL. Although further investigation will be needed to determine the responsible gene and polymorphism, our findings would contribute to development of selective markers for fatty acid composition in the Japanese Black cattle of Hyogo. © 2018 Japanese Society of Animal Science.

  3. Integrative analysis of gene expression and DNA methylation using unsupervised feature extraction for detecting candidate cancer biomarkers.

    PubMed

    Moon, Myungjin; Nakai, Kenta

    2018-04-01

    Currently, cancer biomarker discovery is one of the important research topics worldwide. In particular, detecting significant genes related to cancer is an important task for early diagnosis and treatment of cancer. Conventional studies mostly focus on genes that are differentially expressed in different states of cancer; however, noise in gene expression datasets and insufficient information in limited datasets impede precise analysis of novel candidate biomarkers. In this study, we propose an integrative analysis of gene expression and DNA methylation using normalization and unsupervised feature extractions to identify candidate biomarkers of cancer using renal cell carcinoma RNA-seq datasets. Gene expression and DNA methylation datasets are normalized by Box-Cox transformation and integrated into a one-dimensional dataset that retains the major characteristics of the original datasets by unsupervised feature extraction methods, and differentially expressed genes are selected from the integrated dataset. Use of the integrated dataset demonstrated improved performance as compared with conventional approaches that utilize gene expression or DNA methylation datasets alone. Validation based on the literature showed that a considerable number of top-ranked genes from the integrated dataset have known relationships with cancer, implying that novel candidate biomarkers can also be acquired from the proposed analysis method. Furthermore, we expect that the proposed method can be expanded for applications involving various types of multi-omics datasets.

  4. Association analysis of single nucleotide polymorphisms in candidate genes with root traits in maize (Zea mays L.) seedlings.

    PubMed

    Kumar, Bharath; Abdel-Ghani, Adel H; Pace, Jordon; Reyes-Matamoros, Jenaro; Hochholdinger, Frank; Lübberstedt, Thomas

    2014-07-01

    Several genes involved in maize root development have been isolated. Identification of SNPs associated with root traits would enable the selection of maize lines with better root architecture that might help to improve N uptake, and consequently plant growth particularly under N deficient conditions. In the present study, an association study (AS) panel consisting of 74 maize inbred lines was screened for seedling root traits in 6, 10, and 14-day-old seedlings. Allele re-sequencing of candidate root genes Rtcl, Rth3, Rum1, and Rul1 was also carried out in the same AS panel lines. All four candidate genes displayed different levels of nucleotide diversity, haplotype diversity and linkage disequilibrium. Gene based association analyses were carried out between individual polymorphisms in candidate genes, and root traits measured in 6, 10, and 14-day-old maize seedlings. Association analyses revealed several polymorphisms within the Rtcl, Rth3, Rum1, and Rul1 genes associated with seedling root traits. Several nucleotide polymorphisms in Rtcl, Rth3, Rum1, and Rul1 were significantly (P<0.05) associated with seedling root traits in maize suggesting that all four tested genes are involved in the maize root development. Thus considerable allelic variation present in these root genes can be exploited for improving maize root characteristics. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  5. A human functional protein interaction network and its application to cancer data analysis

    PubMed Central

    2010-01-01

    Background One challenge facing biologists is to tease out useful information from massive data sets for further analysis. A pathway-based analysis may shed light by projecting candidate genes onto protein functional relationship networks. We are building such a pathway-based analysis system. Results We have constructed a protein functional interaction network by extending curated pathways with non-curated sources of information, including protein-protein interactions, gene coexpression, protein domain interaction, Gene Ontology (GO) annotations and text-mined protein interactions, which cover close to 50% of the human proteome. By applying this network to two glioblastoma multiforme (GBM) data sets and projecting cancer candidate genes onto the network, we found that the majority of GBM candidate genes form a cluster and are closer than expected by chance, and the majority of GBM samples have sequence-altered genes in two network modules, one mainly comprising genes whose products are localized in the cytoplasm and plasma membrane, and another comprising gene products in the nucleus. Both modules are highly enriched in known oncogenes, tumor suppressors and genes involved in signal transduction. Similar network patterns were also found in breast, colorectal and pancreatic cancers. Conclusions We have built a highly reliable functional interaction network upon expert-curated pathways and applied this network to the analysis of two genome-wide GBM and several other cancer data sets. The network patterns revealed from our results suggest common mechanisms in the cancer biology. Our system should provide a foundation for a network or pathway-based analysis platform for cancer and other diseases. PMID:20482850

  6. BioGPS and MyGene.info: organizing online, gene-centric information.

    PubMed

    Wu, Chunlei; Macleod, Ian; Su, Andrew I

    2013-01-01

    Fast-evolving technologies have enabled researchers to easily generate data at genome scale, and using these technologies to compare biological states typically results in a list of candidate genes. Researchers are then faced with the daunting task of prioritizing these candidate genes for follow-up studies. There are hundreds, possibly even thousands, of web-based gene annotation resources available, but it quickly becomes impractical to manually access and review all of these sites for each gene in a candidate gene list. BioGPS (http://biogps.org) was created as a centralized gene portal for aggregating distributed gene annotation resources, emphasizing community extensibility and user customizability. BioGPS serves as a convenient tool for users to access known gene-centric resources, as well as a mechanism to discover new resources that were previously unknown to the user. This article describes updates to BioGPS made after its initial release in 2008. We summarize recent additions of features and data, as well as the robust user activity that underlies this community intelligence application. Finally, we describe MyGene.info (http://mygene.info) and related web services that provide programmatic access to BioGPS.

  7. A Strategy for Identifying Quantitative Trait Genes Using Gene Expression Analysis and Causal Analysis.

    PubMed

    Ishikawa, Akira

    2017-11-27

    Large numbers of quantitative trait loci (QTL) affecting complex diseases and other quantitative traits have been reported in humans and model animals. However, the genetic architecture of these traits remains elusive due to the difficulty in identifying causal quantitative trait genes (QTGs) for common QTL with relatively small phenotypic effects. A traditional strategy based on techniques such as positional cloning does not always enable identification of a single candidate gene for a QTL of interest because it is difficult to narrow down a target genomic interval of the QTL to a very small interval harboring only one gene. A combination of gene expression analysis and statistical causal analysis can greatly reduce the number of candidate genes. This integrated approach provides causal evidence that one of the candidate genes is a putative QTG for the QTL. Using this approach, I have recently succeeded in identifying a single putative QTG for resistance to obesity in mice. Here, I outline the integration approach and discuss its usefulness using my studies as an example.

  8. Identifying positive selection candidate loci for high-altitude adaptation in Andean populations

    PubMed Central

    2009-01-01

    High-altitude environments (>2,500 m) provide scientists with a natural laboratory to study the physiological and genetic effects of low ambient oxygen tension on human populations. One approach to understanding how life at high altitude has affected human metabolism is to survey genome-wide datasets for signatures of natural selection. In this work, we report on a study to identify selection-nominated candidate genes involved in adaptation to hypoxia in one highland group, Andeans from the South American Altiplano. We analysed dense microarray genotype data using four test statistics that detect departures from neutrality. Using a candidate gene, single nucleotide polymorphism-based approach, we identified genes exhibiting preliminary evidence of recent genetic adaptation in this population. These included genes that are part of the hypoxia-inducible transcription factor (HIF) pathway, a biochemical pathway involved in oxygen homeostasis, as well as three other genomic regions previously not known to be associated with high-altitude phenotypes. In addition to identifying selection-nominated candidate genes, we also tested whether the HIF pathway shows evidence of natural selection. Our results indicate that the genes of this biochemical pathway as a group show no evidence of having evolved in response to hypoxia in Andeans. Results from particular HIF-targeted genes, however, suggest that genes in this pathway could play a role in Andean adaptation to high altitude, even if the pathway as a whole does not show higher relative rates of evolution. These data suggest a genetic role in high-altitude adaptation and provide a basis for genotype/phenotype association studies that are necessary to confirm the role of putative natural selection candidate genes and gene regions in adaptation to altitude. PMID:20038496

  9. Indel-seq: a fast-forward genetics approach for identification of trait-associated putative candidate genomic regions and its application in pigeonpea (Cajanus cajan).

    PubMed

    Singh, Vikas K; Khan, Aamir W; Saxena, Rachit K; Sinha, Pallavi; Kale, Sandip M; Parupalli, Swathi; Kumar, Vinay; Chitikineni, Annapurna; Vechalapu, Suryanarayana; Sameer Kumar, Chanda Venkata; Sharma, Mamta; Ghanta, Anuradha; Yamini, Kalinati Narasimhan; Muniswamy, Sonnappa; Varshney, Rajeev K

    2017-07-01

    Identification of candidate genomic regions associated with target traits using conventional mapping methods is challenging and time-consuming. In recent years, a number of single nucleotide polymorphism (SNP)-based mapping approaches have been developed and used for identification of candidate/putative genomic regions. However, in the majority of these studies, insertion-deletion (Indel) were largely ignored. For efficient use of Indels in mapping target traits, we propose Indel-seq approach, which is a combination of whole-genome resequencing (WGRS) and bulked segregant analysis (BSA) and relies on the Indel frequencies in extreme bulks. Deployment of Indel-seq approach for identification of candidate genomic regions associated with fusarium wilt (FW) and sterility mosaic disease (SMD) resistance in pigeonpea has identified 16 Indels affecting 26 putative candidate genes. Of these 26 affected putative candidate genes, 24 genes showed effect in the upstream/downstream of the genic region and two genes showed effect in the genes. Validation of these 16 candidate Indels in other FW- and SMD-resistant and FW- and SMD-susceptible genotypes revealed a significant association of five Indels (three for FW and two for SMD resistance). Comparative analysis of Indel-seq with other genetic mapping approaches highlighted the importance of the approach in identification of significant genomic regions associated with target traits. Therefore, the Indel-seq approach can be used for quick and precise identification of candidate genomic regions for any target traits in any crop species. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  10. Cellular dissection of psoriasis for transcriptome analyses and the post-GWAS era

    PubMed Central

    2014-01-01

    Background Genome-scale studies of psoriasis have been used to identify genes of potential relevance to disease mechanisms. For many identified genes, however, the cell type mediating disease activity is uncertain, which has limited our ability to design gene functional studies based on genomic findings. Methods We identified differentially expressed genes (DEGs) with altered expression in psoriasis lesions (n = 216 patients), as well as candidate genes near susceptibility loci from psoriasis GWAS studies. These gene sets were characterized based upon their expression across 10 cell types present in psoriasis lesions. Susceptibility-associated variation at intergenic (non-coding) loci was evaluated to identify sites of allele-specific transcription factor binding. Results Half of DEGs showed highest expression in skin cells, although the dominant cell type differed between psoriasis-increased DEGs (keratinocytes, 35%) and psoriasis-decreased DEGs (fibroblasts, 33%). In contrast, psoriasis GWAS candidates tended to have highest expression in immune cells (71%), with a significant fraction showing maximal expression in neutrophils (24%, P < 0.001). By identifying candidate cell types for genes near susceptibility loci, we could identify and prioritize SNPs at which susceptibility variants are predicted to influence transcription factor binding. This led to the identification of potentially causal (non-coding) SNPs for which susceptibility variants influence binding of AP-1, NF-κB, IRF1, STAT3 and STAT4. Conclusions These findings underscore the role of innate immunity in psoriasis and highlight neutrophils as a cell type linked with pathogenetic mechanisms. Assignment of candidate cell types to genes emerging from GWAS studies provides a first step towards functional analysis, and we have proposed an approach for generating hypotheses to explain GWAS hits at intergenic loci. PMID:24885462

  11. Multimarker analysis suggests the involvement of BDNF signaling and microRNA biosynthesis in suicidal behavior.

    PubMed

    Pulay, Attila J; Réthelyi, János M

    2016-09-01

    Despite moderate heritability estimates the genetics of suicidal behavior remains unclear, genome-wide association and candidate gene studies focusing on single nucleotide associations reported inconsistent findings. Our study explored biologically informed, multimarker candidate gene associations with suicidal behavior in mood disorders. We analyzed the GAIN Whole Genome Association Study of Bipolar Disorder version 3 (n = 999, suicidal n = 358) and the GAIN Major Depression: Stage 1 Genomewide Association in Population-Based Samples (n = 1,753, suicidal n = 245) datasets. Suicidal behavior was defined as severe suicidal ideation or attempt. Candidate genes were selected based on literature search (Geneset1, n = 35), gene expression data of microRNA genes, (Geneset2, n = 68) and their target genes (Geneset3, n = 11,259). Quality control, dosage analyses were carried out with PLINK. Gene-based associations of Geneset1 were analyzed with KGG. Polygenic profile scores of suicidal behavior were computed in the major depression dataset both with PRSice and LDpred and validated in the bipolar disorder data. Several nominally significant gene-based associations were detected, but only DICER1 associated with suicidal behavior in both samples, while only the associations of NTRK2 in the depression sample reached family wise and experiment wise significance. Polygenic profile scores negatively predicted suicidal behavior in the bipolar sample for only Geneset2, with the strongest prediction by PRSice at Pt  < 0.03 (Nagelkerke R(2)  = 0.01, P < 0.007). Gene-based association results confirmed the potential involvement of the BDNF-NTRK2-CREB pathway in the pathogenesis of suicide and the cross-disorder association of DICER1. Polygenic risk prediction of the selected miRNA genes indicates that the miRNA system may play a mediating role, but with considerable pleiotropy. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  12. The prediction of candidate genes for cervix related cancer through gene ontology and graph theoretical approach.

    PubMed

    Hindumathi, V; Kranthi, T; Rao, S B; Manimaran, P

    2014-06-01

    With rapidly changing technology, prediction of candidate genes has become an indispensable task in recent years mainly in the field of biological research. The empirical methods for candidate gene prioritization that succors to explore the potential pathway between genetic determinants and complex diseases are highly cumbersome and labor intensive. In such a scenario predicting potential targets for a disease state through in silico approaches are of researcher's interest. The prodigious availability of protein interaction data coupled with gene annotation renders an ease in the accurate determination of disease specific candidate genes. In our work we have prioritized the cervix related cancer candidate genes by employing Csaba Ortutay and his co-workers approach of identifying the candidate genes through graph theoretical centrality measures and gene ontology. With the advantage of the human protein interaction data, cervical cancer gene sets and the ontological terms, we were able to predict 15 novel candidates for cervical carcinogenesis. The disease relevance of the anticipated candidate genes was corroborated through a literature survey. Also the presence of the drugs for these candidates was detected through Therapeutic Target Database (TTD) and DrugMap Central (DMC) which affirms that they may be endowed as potential drug targets for cervical cancer.

  13. Identification of an miRNA candidate reflects the possible significance of transcribed microsatellites in the hairpin precursors of black pepper.

    PubMed

    Joy, Nisha; Soniya, Eppurathu Vasudevan

    2012-06-01

    Plant miRNAs (18-24nt) are generated by the RNase III-type Dicer endonuclease from the endogenous hairpin precursors ('pre-miRNAs') with significant regulatory functions. The transcribed regions display a higher frequency of microsatellites, when compared to other regions of the genomic DNA. Simple sequence repeats (SSRs) resulting from replication slippage occurring in transcripts affect the expression of genes. The available experimental evidence for the incidence of SSRs in the miRNA precursors is limited. Considering the potential significance of SSRs in the miRNA genes, we carried out a preliminary analysis to verify the presence of SSRs in the pri-miRNAs of black pepper (Piper nigrum L.). We isolated a (CT) dinucleotide SSR bearing transcript using SMART strategy. The transcript was predicted to be a 'pri-miRNA candidate' with Dicer sites based on miRNA prediction tools and MFOLD structural predictions. The presence of this 'miRNA candidate' was confirmed by real-time TaqMan assays. The upstream sequence of the 'miRNA candidate' by genome walking when subjected to PlantCARE showed the presence of certain promoter elements, and the deduced amino acid showed significant similarity with NAP1 gene, which affects the transcription of many genes. Moreover the hairpin-like precursor overlapped the neighbouring NAP1 gene. In silico analysis revealed distinct putative functions for the 'miRNA candidate', of which majority were related to growth. Hence, we assume that this 'miRNA candidate' may get activated during transcription of NAP gene, thereby regulating the expression of many genes involved in developmental processes.

  14. A combination test for detection of gene-environment interaction in cohort studies.

    PubMed

    Coombes, Brandon; Basu, Saonli; McGue, Matt

    2017-07-01

    Identifying gene-environment (G-E) interactions can contribute to a better understanding of disease etiology, which may help researchers develop disease prevention strategies and interventions. One big criticism of studying G-E interaction is the lack of power due to sample size. Studies often restrict the interaction search to the top few hundred hits from a genome-wide association study or focus on potential candidate genes. In this paper, we test interactions between a candidate gene and an environmental factor to improve power by analyzing multiple variants within a gene. We extend recently developed score statistic based genetic association testing approaches to the G-E interaction testing problem. We also propose tests for interaction using gene-based summary measures that pool variants together. Although it has recently been shown that these summary measures can be biased and may lead to inflated type I error, we show that under several realistic scenarios, we can still provide valid tests of interaction. These tests use significantly less degrees of freedom and thus can have much higher power to detect interaction. Additionally, we demonstrate that the iSeq-aSum-min test, which combines a gene-based summary measure test, iSeq-aSum-G, and an interaction-based summary measure test, iSeq-aSum-I, provides a powerful alternative to test G-E interaction. We demonstrate the performance of these approaches using simulation studies and illustrate their performance to study interaction between the SNPs in several candidate genes and family climate environment on alcohol consumption using the Minnesota Center for Twin and Family Research dataset. © 2017 WILEY PERIODICALS, INC.

  15. Genetics pathway-based imaging approaches in Chinese Han population with Alzheimer's disease risk.

    PubMed

    Bai, Feng; Liao, Wei; Yue, Chunxian; Pu, Mengjia; Shi, Yongmei; Yu, Hui; Yuan, Yonggui; Geng, Leiyu; Zhang, Zhijun

    2016-01-01

    The tau hypothesis has been raised with regard to the pathophysiology of Alzheimer's disease (AD). Mild cognitive impairment (MCI) is associated with a high risk for developing AD. However, no study has directly examined the brain topological alterations based on combined effects of tau protein pathway genes in MCI population. Forty-three patients with MCI and 30 healthy controls underwent resting-state functional magnetic resonance imaging (fMRI) in Chinese Han, and a tau protein pathway-based imaging approaches (7 candidate genes: 17 SNPs) were used to investigate changes in the topological organisation of brain activation associated with MCI. Impaired regional activation is related to tau protein pathway genes (5/7 candidate genes) in patients with MCI and likely in topologically convergent and divergent functional alterations patterns associated with genes, and combined effects of tau protein pathway genes disrupt the topological architecture of cortico-cerebellar loops. The associations between the loops and behaviours further suggest that tau protein pathway genes do play a significant role in non-episodic memory impairment. Tau pathway-based imaging approaches might strengthen the credibility in imaging genetic associations and generate pathway frameworks that might provide powerful new insights into the neural mechanisms that underlie MCI.

  16. A literature search tool for intelligent extraction of disease-associated genes.

    PubMed

    Jung, Jae-Yoon; DeLuca, Todd F; Nelson, Tristan H; Wall, Dennis P

    2014-01-01

    To extract disorder-associated genes from the scientific literature in PubMed with greater sensitivity for literature-based support than existing methods. We developed a PubMed query to retrieve disorder-related, original research articles. Then we applied a rule-based text-mining algorithm with keyword matching to extract target disorders, genes with significant results, and the type of study described by the article. We compared our resulting candidate disorder genes and supporting references with existing databases. We demonstrated that our candidate gene set covers nearly all genes in manually curated databases, and that the references supporting the disorder-gene link are more extensive and accurate than other general purpose gene-to-disorder association databases. We implemented a novel publication search tool to find target articles, specifically focused on links between disorders and genotypes. Through comparison against gold-standard manually updated gene-disorder databases and comparison with automated databases of similar functionality we show that our tool can search through the entirety of PubMed to extract the main gene findings for human diseases rapidly and accurately.

  17. The Candidate Cancer Gene Database: a database of cancer driver genes from forward genetic screens in mice.

    PubMed

    Abbott, Kenneth L; Nyre, Erik T; Abrahante, Juan; Ho, Yen-Yi; Isaksson Vogel, Rachel; Starr, Timothy K

    2015-01-01

    Identification of cancer driver gene mutations is crucial for advancing cancer therapeutics. Due to the overwhelming number of passenger mutations in the human tumor genome, it is difficult to pinpoint causative driver genes. Using transposon mutagenesis in mice many laboratories have conducted forward genetic screens and identified thousands of candidate driver genes that are highly relevant to human cancer. Unfortunately, this information is difficult to access and utilize because it is scattered across multiple publications using different mouse genome builds and strength metrics. To improve access to these findings and facilitate meta-analyses, we developed the Candidate Cancer Gene Database (CCGD, http://ccgd-starrlab.oit.umn.edu/). The CCGD is a manually curated database containing a unified description of all identified candidate driver genes and the genomic location of transposon common insertion sites (CISs) from all currently published transposon-based screens. To demonstrate relevance to human cancer, we performed a modified gene set enrichment analysis using KEGG pathways and show that human cancer pathways are highly enriched in the database. We also used hierarchical clustering to identify pathways enriched in blood cancers compared to solid cancers. The CCGD is a novel resource available to scientists interested in the identification of genetic drivers of cancer. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. Combined analysis of transcriptome and proteome data as a tool for the identification of candidate biomarkers in renal cell carcinoma

    PubMed Central

    Seliger, Barbara; Dressler, Sven P.; Wang, Ena; Kellner, Roland; Recktenwald, Christian V.; Lottspeich, Friedrich; Marincola, Francesco M.; Baumgärtner, Maja; Atkins, Derek; Lichtenfels, Rudolf

    2012-01-01

    Results obtained from expression profilings of renal cell carcinoma using different “ome”-based approaches and comprehensive data analysis demonstrated that proteome-based technologies and cDNA microarray analyses complement each other during the discovery phase for disease-related candidate biomarkers. The integration of the respective data revealed the uniqueness and complementarities of the different technologies. While comparative cDNA microarray analyses though restricted to upregulated targets largely revealed genes involved in controlling gene/protein expression (19%) and signal transduction processes (13%), proteomics/PROTEOMEX-defined candidate biomarkers include enzymes of the cellular metabolism (36%), transport proteins (12%) and cell motility/structural molecules (10%). Candidate biomarkers defined by proteomics and PROTEOMEX are frequently shared, whereas the sharing rate between cDNA microarray and proteome-based profilings is limited. Putative candidate biomarkers provide insights into their cellular (dys)function and their diagnostic/prognostic value but still warrant further validation in larger patient numbers. Based on the fact that merely 3 candidate biomarkers were shared by all applied technologies, namely annexin A4, tubulin alpha-1A chain and ubiquitin carboxyl-terminal hydrolase L1 the analysis at a single hierarchical level of biological regulation seems to provide only limited results thus emphasizing the importance and benefit of performing rather combinatorial screenings which can complement the standard clinical predictors. PMID:19235166

  19. Leveraging lung tissue transcriptome to uncover candidate causal genes in COPD genetic associations.

    PubMed

    Lamontagne, Maxime; Bérubé, Jean-Christophe; Obeidat, Ma'en; Cho, Michael H; Hobbs, Brian D; Sakornsakolpat, Phuwanat; de Jong, Kim; Boezen, H Marike; Nickle, David; Hao, Ke; Timens, Wim; van den Berge, Maarten; Joubert, Philippe; Laviolette, Michel; Sin, Don D; Paré, Peter D; Bossé, Yohan

    2018-05-15

    Causal genes of chronic obstructive pulmonary disease (COPD) remain elusive. The current study aims at integrating genome-wide association studies (GWAS) and lung expression quantitative trait loci (eQTL) data to map COPD candidate causal genes and gain biological insights into the recently discovered COPD susceptibility loci. Two complementary genomic datasets on COPD were studied. First, the lung eQTL dataset which included whole-genome gene expression and genotyping data from 1038 individuals. Second, the largest COPD GWAS to date from the International COPD Genetics Consortium (ICGC) with 13 710 cases and 38 062 controls. Methods that integrated GWAS with eQTL signals including transcriptome-wide association study (TWAS), colocalization and Mendelian randomization-based (SMR) approaches were used to map causality genes, i.e. genes with the strongest evidence of being the functional effector at specific loci. These methods were applied at the genome-wide level and at COPD risk loci derived from the GWAS literature. Replication was performed using lung data from GTEx. We collated 129 non-overlapping risk loci for COPD from the GWAS literature. At the genome-wide scale, 12 new COPD candidate genes/loci were revealed and six replicated in GTEx including CAMK2A, DMPK, MYO15A, TNFRSF10A, BTN3A2 and TRBV30. In addition, we mapped candidate causal genes for 60 out of the 129 GWAS-nominated loci and 23 of them were replicated in GTEx. Mapping candidate causal genes in lung tissue represents an important contribution to the genetics of COPD, enriches our biological interpretation of GWAS findings, and brings us closer to clinical translation of genetic associations.

  20. Comparative molecular analyses of select pH- and osmoregulatory genes in three freshwater crayfish Cherax quadricarinatus, C. destructor and C. cainii.

    PubMed

    Ali, Muhammad Y; Pavasovic, Ana; Dammannagoda, Lalith K; Mather, Peter B; Prentis, Peter J

    2017-01-01

    Systemic acid-base balance and osmotic/ionic regulation in decapod crustaceans are in part maintained by a set of transport-related enzymes such as carbonic anhydrase (CA), Na + /K + -ATPase (NKA), H + -ATPase (HAT), Na + /K + /2Cl - cotransporter (NKCC), Na + /Cl - /HCO[Formula: see text] cotransporter (NBC), Na + /H + exchanger (NHE), Arginine kinase (AK), Sarcoplasmic Ca +2 -ATPase (SERCA) and Calreticulin (CRT). We carried out a comparative molecular analysis of these genes in three commercially important yet eco-physiologically distinct freshwater crayfish , Cherax quadricarinatus, C. destructor and C. cainii , with the aim to identify mutations in these genes and determine if observed patterns of mutations were consistent with the action of natural selection. We also conducted a tissue-specific expression analysis of these genes across seven different organs, including gills, hepatopancreas, heart, kidney, liver, nerve and testes using NGS transcriptome data. The molecular analysis of the candidate genes revealed a high level of sequence conservation across the three Cherax sp. Hyphy analysis revealed that all candidate genes showed patterns of molecular variation consistent with neutral evolution. The tissue-specific expression analysis showed that 46% of candidate genes were expressed in all tissue types examined, while approximately 10% of candidate genes were only expressed in a single tissue type. The largest number of genes was observed in nerve (84%) and gills (78%) and the lowest in testes (66%). The tissue-specific expression analysis also revealed that most of the master genes regulating pH and osmoregulation (CA, NKA, HAT, NKCC, NBC, NHE) were expressed in all tissue types indicating an important physiological role for these genes outside of osmoregulation in other tissue types. The high level of sequence conservation observed in the candidate genes may be explained by the important role of these genes as well as potentially having a number of other basic physiological functions in different tissue types.

  1. Identification of possible genetic polymorphisms involved in cancer cachexia: a systematic review.

    PubMed

    Tan, Benjamin H L; Ross, James A; Kaasa, Stein; Skorpen, Frank; Fearon, Kenneth C H

    2011-04-01

    Cancer cachexia is a polygenic and complex syndrome. Genetic variations in regulation of the inflammatory response, muscle and fat metabolic pathways, and pathways in appetite regulation are likely to contribute to the susceptibility or resistance to developing cancer cachexia. A systematic search of Medline and EmBase databases, covering 1986-2008 was performed for potential candidate genes/genetic polymorphisms relating to cancer cachexia. Related genes were then identified using pathway functional analysis software. All candidate genes were reviewed for functional polymorphisms or clinically significant polymorphisms associated with cachexia using the OMIM and GeneRIF databases. Genes with variants which had functional or clinical associations with cachexia and replicated in at least one study were entered into pathway analysis software to reveal possible network associations between genes. A total of 184 polymorphisms with functional or clinical relevance to cancer cachexia were identified in 92 candidate genes. Of these, 42 polymorphisms (in 33 genes) were replicated in more than one study with 13 polymorphisms found to influence two or more hallmarks of cachexia (i.e. inflammation, loss of fat mass and/or lean mass and reduced survival). Thirty-three genes were found to be significantly interconnected in two major networks with four genes (ADIPOQ, IL6, NFKB1 and TLR4) interlinking both networks. Selection of candidate genes and polymorphisms is a key element of multigene study design. The present study provides an initial framework to select genes/polymorphisms for further study in cancer cachexia, and to develop their potential as susceptibility biomarkers of developing cachexia.

  2. COL5A1: Genetic mapping and exclusion as candidate gene in families with nail-patella syndrome, tuberous sclerosis 1, hereditary hemorrhagic telangiectasia, and Ehlers-Danlos syndrome type II

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Greenspan, D.S.; Northrup, H.; Au, K.S.

    1995-02-10

    COL5A1, the gene for the {alpha}1 chain of type V collagen, has been considered a candidate gene for certain diseases based on chromosomal location and/or disease phenotype. We have employed 3{prime}-untranslated region RFLPs to exclude COL5A1 as a candidate gene in families with tuberous sclerosis 1, Ehlers-Danlos syndrome type H, and nail-patella syndrome. In addition, we describe a polymorphic simple sequence repeat (SSR) within a COL5A1 intron. This SSR is used to exclude COL5A1 as a candidate gene in hereditary hemorrhagic telangiectasia (Osler-Rendu-Weber disease) and to add COL5A1 to the existing map of {open_quotes}index{close_quotes} markers of chromosome 9 by evaluationmore » of the COL5A1 locus on the CEPH 40-family reference pedigree set. This genetic mapping places COL5A1 between markers D9S66 and D9S67. 14 refs., 1 fig., 2 tabs.« less

  3. Haplotype diversity in 11 candidate genes across four populations.

    PubMed

    Beaty, T H; Fallin, M D; Hetmanski, J B; McIntosh, I; Chong, S S; Ingersoll, R; Sheng, X; Chakraborty, R; Scott, A F

    2005-09-01

    Analysis of haplotypes based on multiple single-nucleotide polymorphisms (SNP) is becoming common for both candidate gene and fine-mapping studies. Before embarking on studies of haplotypes from genetically distinct populations, however, it is important to consider variation both in linkage disequilibrium (LD) and in haplotype frequencies within and across populations, as both vary. Such diversity will influence the choice of "tagging" SNPs for candidate gene or whole-genome association studies because some markers will not be polymorphic in all samples and some haplotypes will be poorly represented or completely absent. Here we analyze 11 genes, originally chosen as candidate genes for oral clefts, where multiple markers were genotyped on individuals from four populations. Estimated haplotype frequencies, measures of pairwise LD, and genetic diversity were computed for 135 European-Americans, 57 Chinese-Singaporeans, 45 Malay-Singaporeans, and 46 Indian-Singaporeans. Patterns of pairwise LD were compared across these four populations and haplotype frequencies were used to assess genetic variation. Although these populations are fairly similar in allele frequencies and overall patterns of LD, both haplotype frequencies and genetic diversity varied significantly across populations. Such haplotype diversity has implications for designing studies of association involving samples from genetically distinct populations.

  4. Investigation of previously implicated genetic variants in chronic tic disorders: a transmission disequilibrium test approach.

    PubMed

    Abdulkadir, Mohamed; Londono, Douglas; Gordon, Derek; Fernandez, Thomas V; Brown, Lawrence W; Cheon, Keun-Ah; Coffey, Barbara J; Elzerman, Lonneke; Fremer, Carolin; Fründt, Odette; Garcia-Delgar, Blanca; Gilbert, Donald L; Grice, Dorothy E; Hedderly, Tammy; Heyman, Isobel; Hong, Hyun Ju; Huyser, Chaim; Ibanez-Gomez, Laura; Jakubovski, Ewgeni; Kim, Young Key; Kim, Young Shin; Koh, Yun-Joo; Kook, Sodahm; Kuperman, Samuel; Leventhal, Bennett; Ludolph, Andrea G; Madruga-Garrido, Marcos; Maras, Athanasios; Mir, Pablo; Morer, Astrid; Müller-Vahl, Kirsten; Münchau, Alexander; Murphy, Tara L; Plessen, Kerstin J; Roessner, Veit; Shin, Eun-Young; Song, Dong-Ho; Song, Jungeun; Tübing, Jennifer; van den Ban, Els; Visscher, Frank; Wanderer, Sina; Woods, Martin; Zinner, Samuel H; King, Robert A; Tischfield, Jay A; Heiman, Gary A; Hoekstra, Pieter J; Dietrich, Andrea

    2018-04-01

    Genetic studies in Tourette syndrome (TS) are characterized by scattered and poorly replicated findings. We aimed to replicate findings from candidate gene and genome-wide association studies (GWAS). Our cohort included 465 probands with chronic tic disorder (93% TS) and both parents from 412 families (some probands were siblings). We assessed 75 single nucleotide polymorphisms (SNPs) in 465 parent-child trios; 117 additional SNPs in 211 trios; and 4 additional SNPs in 254 trios. We performed SNP and gene-based transmission disequilibrium tests and compared nominally significant SNP results with those from a large independent case-control cohort. After quality control 71 SNPs were available in 371 trios; 112 SNPs in 179 trios; and 3 SNPs in 192 trios. 17 were candidate SNPs implicated in TS and 2 were implicated in obsessive-compulsive disorder (OCD) or autism spectrum disorder (ASD); 142 were tagging SNPs from eight monoamine neurotransmitter-related genes (including dopamine and serotonin); 10 were top SNPs from TS GWAS; and 13 top SNPs from attention-deficit/hyperactivity disorder, OCD, or ASD GWAS. None of the SNPs or genes reached significance after adjustment for multiple testing. We observed nominal significance for the candidate SNPs rs3744161 (TBCD) and rs4565946 (TPH2) and for five tagging SNPs; none of these showed significance in the independent cohort. Also, SLC1A1 in our gene-based analysis and two TS GWAS SNPs showed nominal significance, rs11603305 (intergenic) and rs621942 (PICALM). We found no convincing support for previously implicated genetic polymorphisms. Targeted re-sequencing should fully appreciate the relevance of candidate genes.

  5. Identification of novel candidate drivers connecting different dysfunctional levels for lung adenocarcinoma using protein-protein interactions and a shortest path approach

    NASA Astrophysics Data System (ADS)

    Chen, Lei; Huang, Tao; Zhang, Yu-Hang; Jiang, Yang; Zheng, Mingyue; Cai, Yu-Dong

    2016-07-01

    Tumors are formed by the abnormal proliferation of somatic cells with disordered growth regulation under the influence of tumorigenic factors. Recently, the theory of “cancer drivers” connects tumor initiation with several specific mutations in the so-called cancer driver genes. According to the differentiation of four basic levels between tumor and adjacent normal tissues, the cancer drivers can be divided into the following: (1) Methylation level, (2) microRNA level, (3) mutation level, and (4) mRNA level. In this study, a computational method is proposed to identify novel lung adenocarcinoma drivers based on dysfunctional genes on the methylation, microRNA, mutation and mRNA levels. First, a large network was constructed using protein-protein interactions. Next, we searched all of the shortest paths connecting dysfunctional genes on different levels and extracted new candidate genes lying on these paths. Finally, the obtained candidate genes were filtered by a permutation test and an additional strict selection procedure involving a betweenness ratio and an interaction score. Several candidate genes remained, which are deemed to be related to two different levels of cancer. The analyses confirmed our assertions that some have the potential to contribute to the tumorigenesis process on multiple levels.

  6. Selection and validation of reference genes for quantitative real-time PCR in Artemisia sphaerocephala based on transcriptome sequence data.

    PubMed

    Hu, Xiaowei; Zhang, Lijing; Nan, Shuzhen; Miao, Xiumei; Yang, Pengfang; Duan, Guoqin; Fu, Hua

    2018-05-30

    Artemisia sphaerocephala, a dicotyledonous perennial semi-shrub belonging to the Artemisia genus of the Compositae family, is widely distributed in northwestern China. This shrub is one of the most important pioneer plants which is capable of protecting rangelands from wind erosion. It therefore plays a vital role in maintaining desert ecosystem stability. In addition, to its use as a forage grass, it has excellent prospective applications as a source of plant oil and as a plant-based fuel. The use of internal genes is the basis for accurately assessing Real time quantitative PCR. In this study, based on transcriptome data of A. sphaerocephala, we analyzed 21 candidate internal genes to determine the optimal internal genes in this shrub. The stabilities of candidate genes were evaluated in 16 samples of A. sphaerocephala. Finally, UBC9 and TIP41-like were determined as the optimal reference genes in A. sphaerocephala by Delta Ct and three various programs. There were GeNorm, NormFinder and BestKeeper. Copyright © 2018 Elsevier B.V. All rights reserved.

  7. Implications of genome wide association studies for addiction: are our a priori assumptions all wrong?

    PubMed

    Hall, F Scott; Drgonova, Jana; Jain, Siddharth; Uhl, George R

    2013-12-01

    Substantial genetic contributions to addiction vulnerability are supported by data from twin studies, linkage studies, candidate gene association studies and, more recently, Genome Wide Association Studies (GWAS). Parallel to this work, animal studies have attempted to identify the genes that may contribute to responses to addictive drugs and addiction liability, initially focusing upon genes for the targets of the major drugs of abuse. These studies identified genes/proteins that affect responses to drugs of abuse; however, this does not necessarily mean that variation in these genes contributes to the genetic component of addiction liability. One of the major problems with initial linkage and candidate gene studies was an a priori focus on the genes thought to be involved in addiction based upon the known contributions of those proteins to drug actions, making the identification of novel genes unlikely. The GWAS approach is systematic and agnostic to such a priori assumptions. From the numerous GWAS now completed several conclusions may be drawn: (1) addiction is highly polygenic; each allelic variant contributing in a small, additive fashion to addiction vulnerability; (2) unexpected, compared to our a priori assumptions, classes of genes are most important in explaining addiction vulnerability; (3) although substantial genetic heterogeneity exists, there is substantial convergence of GWAS signals on particular genes. This review traces the history of this research; from initial transgenic mouse models based upon candidate gene and linkage studies, through the progression of GWAS for addiction and nicotine cessation, to the current human and transgenic mouse studies post-GWAS. © 2013.

  8. No Evidence That Schizophrenia Candidate Genes Are More Associated With Schizophrenia Than Noncandidate Genes.

    PubMed

    Johnson, Emma C; Border, Richard; Melroy-Greif, Whitney E; de Leeuw, Christiaan A; Ehringer, Marissa A; Keller, Matthew C

    2017-11-15

    A recent analysis of 25 historical candidate gene polymorphisms for schizophrenia in the largest genome-wide association study conducted to date suggested that these commonly studied variants were no more associated with the disorder than would be expected by chance. However, the same study identified other variants within those candidate genes that demonstrated genome-wide significant associations with schizophrenia. As such, it is possible that variants within historic schizophrenia candidate genes are associated with schizophrenia at levels above those expected by chance, even if the most-studied specific polymorphisms are not. The present study used association statistics from the largest schizophrenia genome-wide association study conducted to date as input to a gene set analysis to investigate whether variants within schizophrenia candidate genes are enriched for association with schizophrenia. As a group, variants in the most-studied candidate genes were no more associated with schizophrenia than were variants in control sets of noncandidate genes. While a small subset of candidate genes did appear to be significantly associated with schizophrenia, these genes were not particularly noteworthy given the large number of more strongly associated noncandidate genes. The history of schizophrenia research should serve as a cautionary tale to candidate gene investigators examining other phenotypes: our findings indicate that the most investigated candidate gene hypotheses of schizophrenia are not well supported by genome-wide association studies, and it is likely that this will be the case for other complex traits as well. Copyright © 2017 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

  9. Screening of the Filamin C Gene in a Large Cohort of Hypertrophic Cardiomyopathy Patients.

    PubMed

    Gómez, Juan; Lorca, Rebeca; Reguero, Julian R; Morís, César; Martín, María; Tranche, Salvador; Alonso, Belén; Iglesias, Sara; Alvarez, Victoria; Díaz-Molina, Beatriz; Avanzas, Pablo; Coto, Eliecer

    2017-04-01

    Recent exome sequencing studies identified filamin C ( FLNC ) as a candidate gene for hypertrophic cardiomyopathy (HCM). Our aim was to determine the rate of FLNC candidate variants in a large cohort of HCM patients who were also sequenced for the main sarcomere genes. A total of 448 HCM patients were next generation-sequenced (semiconductor chip technology) for the MYH7, MYBPC3 , TNNT2 , TNNI3 , ACTC1 , TNNC1 , MYL2 , MYL3 , TPM1 , and FLNC genes. We also sequenced 450 healthy controls from the same population. Based on the reported population frequencies, bioinformatic criteria, and familial segregation, we identified 20 FLNC candidate variants (13 new; 1 nonsense; and 19 missense) in 22 patients. Compared with the patients, only 1 of the control's missense variants was nonreported ( P =0.007; Fisher exact probability test). Based on the familial segregation and the reported functional studies, 6 of the candidate variants (in 7 patients) were finally classified as likely pathogenic, 10 as variants of uncertain significance, and 4 as likely benign. We provide a compelling evidence of the involvement of FLNC in the development of HCM. Most of the FLNC variants were associated with mild forms of HCM and a reduced penetrance, with few affected in the families to confirm the segregation. Our work, together with others who found FLNC variants among patients with dilated and restrictive cardiomyopathies, pointed to this gene as an important cause of structural cardiomyopathies. © 2017 American Heart Association, Inc.

  10. Genetic analysis of the calcineurin pathway identifies members of the EGR gene family, specifically EGR3, as potential susceptibility candidates in schizophrenia

    PubMed Central

    Yamada, Kazuo; Gerber, David J.; Iwayama, Yoshimi; Ohnishi, Tetsuo; Ohba, Hisako; Toyota, Tomoko; Aruga, Jun; Minabe, Yoshio; Tonegawa, Susumu; Yoshikawa, Takeo

    2007-01-01

    The calcineurin cascade is central to neuronal signal transduction, and genes in this network are intriguing candidate schizophrenia susceptibility genes. To replicate and extend our previously reported association between the PPP3CC gene, encoding the calcineurin catalytic γ-subunit, and schizophrenia, we examined 84 SNPs from 14 calcineurin-related candidate genes for genetic association by using 124 Japanese schizophrenic pedigrees. Four of these genes (PPP3CC, EGR2, EGR3, and EGR4) showed nominally significant association with schizophrenia. In a postmortem brain study, EGR1, EGR2, and EGR3 transcripts were shown to be down-regulated in the prefrontal cortex of schizophrenic, but not bipolar, patients. These findings raise a potentially important role for EGR genes in schizophrenia pathogenesis. Because EGR3 is an attractive candidate gene based on its chromosomal location close to PPP3CC within 8p21.3 and its functional link to dopamine, glutamate, and neuregulin signaling, we extended our analysis by resequencing the entire EGR3 genomic interval and detected 15 SNPs. One of these, IVS1 + 607A→G SNP, displayed the strongest evidence for disease association, which was confirmed in 1,140 independent case-control samples. An in vitro promoter assay detected a possible expression-regulatory effect of this SNP. These findings support the previous genetic association of altered calcineurin signaling with schizophrenia pathogenesis and identify EGR3 as a compelling susceptibility gene. PMID:17360599

  11. [Screening cold-acclimation differential expression candidate genes in the brain of common carp (Cyprinus carpio)].

    PubMed

    Xu, Li-Hua; Chang, Yu-Mei; Liu, Chun-Lei; Liang, Li-Qun; Liu, Jin-Liang; Chi, Bing-Jie

    2011-03-01

    In this study, 26 candidate genes were quantified and normalized in the brain cDNA of common carp (Cyprinus carpio) at 23°C and 6°C using double-standard curve method of real-time quantitative PCR. The results showed that five candidates up-regulated in the samples at 6°C (P<0.01) and quantified 2.11, 13.9, 2.52, 7.38, and 1.83 times more than in the samples at 23°C, respectively. Gene function searching indicated that the protein products of these five candidates were elongation of very long chain fatty acids protein, Acyl-CoA desaturase, Transcription initiation factor IIB, Myo-inositol- 1-phosphate synthase, and Blood-brain barrier HT7 antigen individually. Moreover, seven down-regulated candidates were also identified in the same samples at 6°C (P>0.05), and their expression levels were decreased by 21.8%, 25.9%, 16.6%, 23.7%, 15.8%, 16.3%, and 42.5%, respectively, in comparison with the samples at 23°C. These seven down-regulated candidates mainly participated in the inhibition of glycolysis, improvement of cell apoptosis, and intervention of synapse remodeling based on the results of function searching. The five cold-induced genes identified in this study will be used as important elements for fish with cold sensitive through transgenic technology in future.

  12. Murine Stem Cell-Based Retrovirus Production for Marking Primary Mouse Mammary Cells for Metastasis Studies.

    PubMed

    Beverly, Levi J; Podsypanina, Katrina

    2016-02-01

    Since the introduction of retroviral vector technology, permanent genetic marking of cells has considerably contributed to the understanding of different physiological and disease processes in vivo. Recent marking strategies aim to elucidate the contribution of cells on the clonal level, and the advent of fluorescent proteins has opened new avenues for the in vivo analysis of gene-marked cells. Gene-modified cells are easily identifiable (e.g., via the introduced fluorescent protein) within whole organ structures, allowing one to measure the contribution of transduced cells to malignant outgrowth. In our laboratory, we use the tetracycline-inducible system to study oncogene cooperation in metastatic progression. We use bicistronic retroviruses expressing the tetracycline transactivator (tTA) and the candidate gene (MIT-gene) or the tTA alone (MIT-Rx) to infect primary mammary cells from mice harboring tetracycline-inducible transgenes. This allows for constitutive expression of the candidate gene and tTA-dependent expression of the inducible oncogene. We also use MIG-based vectors, which allow for constitutive expression of the candidate gene and a green fluorescent protein. Here we describe how to produce retroviral particles carrying both MIT- and MIG-based vectors. Because of the fragility of the retroviral envelope, we do not attempt to concentrate the virus, and we directly use packaging cell media to infect primary epithelial cells (either normal or tumor). Infected cells can be transplanted into recipient mice to investigate metastatic colonization. © 2016 Cold Spring Harbor Laboratory Press.

  13. Introgression of Novel Traits from a Wild Wheat Relative Improves Drought Adaptation in Wheat1[W

    PubMed Central

    Placido, Dante F.; Campbell, Malachy T.; Folsom, Jing J.; Cui, Xinping; Kruger, Greg R.; Baenziger, P. Stephen; Walia, Harkamal

    2013-01-01

    Root architecture traits are an important component for improving water stress adaptation. However, selection for aboveground traits under favorable environments in modern cultivars may have led to an inadvertent loss of genes and novel alleles beneficial for adapting to environments with limited water. In this study, we elucidate the physiological and molecular consequences of introgressing an alien chromosome segment (7DL) from a wild wheat relative species (Agropyron elongatum) into cultivated wheat (Triticum aestivum). The wheat translocation line had improved water stress adaptation and higher root and shoot biomass compared with the control genotypes, which showed significant drops in root and shoot biomass during stress. Enhanced access to water due to higher root biomass enabled the translocation line to maintain more favorable gas-exchange and carbon assimilation levels relative to the wild-type wheat genotypes during water stress. Transcriptome analysis identified candidate genes associated with root development. Two of these candidate genes mapped to the site of translocation on chromosome 7DL based on single-feature polymorphism analysis. A brassinosteroid signaling pathway was predicted to be involved in the novel root responses observed in the A. elongatum translocation line, based on the coexpression-based gene network generated by seeding the network with the candidate genes. We present an effective and highly integrated approach that combines root phenotyping, whole-plant physiology, and functional genomics to discover novel root traits and the underlying genes from a wild related species to improve drought adaptation in cultivated wheat. PMID:23426195

  14. Network-based analysis of differentially expressed genes in cerebrospinal fluid (CSF) and blood reveals new candidate genes for multiple sclerosis

    PubMed Central

    Safari-Alighiarloo, Nahid; Taghizadeh, Mohammad; Tabatabaei, Seyyed Mohammad; Namaki, Saeed

    2016-01-01

    Background The involvement of multiple genes and missing heritability, which are dominant in complex diseases such as multiple sclerosis (MS), entail using network biology to better elucidate their molecular basis and genetic factors. We therefore aimed to integrate interactome (protein–protein interaction (PPI)) and transcriptomes data to construct and analyze PPI networks for MS disease. Methods Gene expression profiles in paired cerebrospinal fluid (CSF) and peripheral blood mononuclear cells (PBMCs) samples from MS patients, sampled in relapse or remission and controls, were analyzed. Differentially expressed genes which determined only in CSF (MS vs. control) and PBMCs (relapse vs. remission) separately integrated with PPI data to construct the Query-Query PPI (QQPPI) networks. The networks were further analyzed to investigate more central genes, functional modules and complexes involved in MS progression. Results The networks were analyzed and high centrality genes were identified. Exploration of functional modules and complexes showed that the majority of high centrality genes incorporated in biological pathways driving MS pathogenesis. Proteasome and spliceosome were also noticeable in enriched pathways in PBMCs (relapse vs. remission) which were identified by both modularity and clique analyses. Finally, STK4, RB1, CDKN1A, CDK1, RAC1, EZH2, SDCBP genes in CSF (MS vs. control) and CDC37, MAP3K3, MYC genes in PBMCs (relapse vs. remission) were identified as potential candidate genes for MS, which were the more central genes involved in biological pathways. Discussion This study showed that network-based analysis could explicate the complex interplay between biological processes underlying MS. Furthermore, an experimental validation of candidate genes can lead to identification of potential therapeutic targets. PMID:28028462

  15. Phytoremediation of chromium using Salix species: cloning ESTs and candidate genes involved in the Cr response.

    PubMed

    Quaggiotti, Silvia; Barcaccia, Gianni; Schiavon, Michela; Nicolé, Silvia; Galla, Giulio; Rossignolo, Virginia; Soattin, Marica; Malagoli, Mario

    2007-11-01

    In this research a differential display based on the detection of cDNA-AFLP markers was used to identify candidate genes potentially involved in the regulation of the response to chromium in four different willow species (Salix alba, Salix eleagnos, Salix fragilis and Salix matsudana) chosen on the basis of their suitability in phytoremediation techniques. Our approach enabled the assay of a large set of mRNA-related fragments and increased the reliability of amplification-based transcriptome analysis. The vast majority of transcript-derived fragments were shared among samples within species and thus attributable to constitutively expressed genes. However, a number of differentially expressed mRNAs were scored in each species and a total of 68 transcripts displaying an altered expression in response to Cr were isolated and sequenced. Public database querying revealed that 44.1% and 4.4% of the cloned ESTs score significant similarity with genes encoding proteins having known or putative function, or with genes coding for unknown proteins, respectively, whereas the remaining 51.5% did not retrieve any homology. Semi-quantitative RT-PCR analysis of seven candidate genes fully confirmed the expression patterns obtained by cDNA-AFLP. Our results indicate the existence of common mechanisms of gene regulation in response to Cr, pathogen attack and senescence-mediated programmed cell death, and suggest a role for the genes isolated in the cross-talk of the signaling pathways governing the adaptation to biotic and abiotic stresses.

  16. Whole Blood mRNA Expression-Based Prognosis of Metastatic Renal Cell Carcinoma.

    PubMed

    Giridhar, Karthik V; Sosa, Carlos P; Hillman, David W; Sanhueza, Cristobal; Dalpiaz, Candace L; Costello, Brian A; Quevedo, Fernando J; Pitot, Henry C; Dronca, Roxana S; Ertz, Donna; Cheville, John C; Donkena, Krishna Vanaja; Kohli, Manish

    2017-11-03

    The Memorial Sloan Kettering Cancer Center (MSKCC) prognostic score is based on clinical parameters. We analyzed whole blood mRNA expression in metastatic clear cell renal cell carcinoma (mCCRCC) patients and compared it to the MSKCC score for predicting overall survival. In a discovery set of 19 patients with mRCC, we performed whole transcriptome RNA sequencing and selected eighteen candidate genes for further evaluation based on associations with overall survival and statistical significance. In an independent validation of set of 47 patients with mCCRCC, transcript expression of the 18 candidate genes were quantified using a customized NanoString probeset. Cox regression multivariate analysis confirmed that two of the candidate genes were significantly associated with overall survival. Higher expression of BAG1 [hazard ratio (HR) of 0.14, p < 0.0001, 95% confidence interval (CI) 0.04-0.36] and NOP56 (HR 0.13, p < 0.0001, 95% CI 0.05-0.34) were associated with better prognosis. A prognostic model incorporating expression of BAG1 and NOP56 into the MSKCC score improved prognostication significantly over a model using the MSKCC prognostic score only ( p < 0.0001). Prognostic value of using whole blood mRNA gene profiling in mCCRCC is feasible and should be prospectively confirmed in larger studies.

  17. Whole Blood mRNA Expression-Based Prognosis of Metastatic Renal Cell Carcinoma

    PubMed Central

    Sosa, Carlos P.; Hillman, David W.; Sanhueza, Cristobal; Dalpiaz, Candace L.; Costello, Brian A.; Quevedo, Fernando J.; Pitot, Henry C.; Dronca, Roxana S.; Ertz, Donna; Cheville, John C.; Donkena, Krishna Vanaja; Kohli, Manish

    2017-01-01

    The Memorial Sloan Kettering Cancer Center (MSKCC) prognostic score is based on clinical parameters. We analyzed whole blood mRNA expression in metastatic clear cell renal cell carcinoma (mCCRCC) patients and compared it to the MSKCC score for predicting overall survival. In a discovery set of 19 patients with mRCC, we performed whole transcriptome RNA sequencing and selected eighteen candidate genes for further evaluation based on associations with overall survival and statistical significance. In an independent validation of set of 47 patients with mCCRCC, transcript expression of the 18 candidate genes were quantified using a customized NanoString probeset. Cox regression multivariate analysis confirmed that two of the candidate genes were significantly associated with overall survival. Higher expression of BAG1 [hazard ratio (HR) of 0.14, p < 0.0001, 95% confidence interval (CI) 0.04–0.36] and NOP56 (HR 0.13, p < 0.0001, 95% CI 0.05–0.34) were associated with better prognosis. A prognostic model incorporating expression of BAG1 and NOP56 into the MSKCC score improved prognostication significantly over a model using the MSKCC prognostic score only (p < 0.0001). Prognostic value of using whole blood mRNA gene profiling in mCCRCC is feasible and should be prospectively confirmed in larger studies. PMID:29099775

  18. Candidate gene association studies in syndromic and non-syndromic cleft lip and palate

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Daack-Hirsch, S.; Basart, A.; Frischmeyer, P.

    1994-09-01

    Using ongoing case ascertainment through a birth defects registry, we have collected 219 nuclear families with non-syndromic cleft lip and/or palate and 111 families with a collection of syndromic forms. Syndromic cases include 24 with recognized forms and 72 with unrecognized syndromes. Candidate gene studies as well as genome-wide searches for evidence of microdeletions and isodisomy are currently being carried out. Candidate gene association studies, to date, have made use of PCR-based polymorphisms for TGFA, MSX1, CLPG13 (a CA repeat associated with a human homologue of a locus that results in craniofacial dysmorphogenesis in the mouse) and an STRP foundmore » in a Van der Woude syndrome microdeletion. Control tetranucleotide repeats, which insure that population-based differences are not responsible for any observed associations, are also tested. Studies of the syndromic cases have included the same list of candidate genes searching for evidence of microdeletions and a genome-wide search using tri- and tetranucleotide polymorphic markers to search for isodisomy or structural rearrangements. Significant associations have previously been identified for TGFA, and, in this report, identified for MSX1 and nonsyndromic cleft palate only (p = 0.04, uncorrected). Preliminary results of the genome-wide scan for isodisomy has returned no true positives and there has been no evidence for microdeletion cases.« less

  19. [Detection of novel genetic markers of susceptibility to preeclampsia based on an analysis of the regulatory genes in the placental tissue].

    PubMed

    Serebrova, V N; Trifonova, E A; Gabidulina, T V; Bukharina, I Yu; Agarkova, T A; Evtushenko, I D; Maksimova, N R; Stepanov, V A

    2016-01-01

    Regulatory single nucleotide polymorphisms (rSNPs) are the least-studied group of SNP; however, they play an essential role in the development of human pathology by altering the level of candidate genes expression. In this work, we analyzed 29 rSNPs in 17 new candidate genes associated with preeclampsia (PE) according to the analysis of the transcriptome in placental tissue. Three ethnic groups have been studied (yakut, russian, and buryat). We have detected significant associations of PE with eight rSNPs in six differentially expressed genes, i.e., rs10423795 in the LHB gene; rs3771787 in the HK2 gene; rs72959687 in the INHA gene; rs12678229, rs2227262, and rs3802252 in the NDRG1 gene; rs34845949 in the SASH1 gene; and rs66707428 in the PPP1R12C gene. We used a new approach to detecting genetic markers of multifactorial diseases in the case of PE based on a combination of genomic, transcriptomic, and bioinformatic approaches. This approach proved its efficiency and may be applied to detecting new potential genetic markers in genes involved in disease pathogenesis, which reduces missing heritability in multifactorial diseases.

  20. [Cloning,expression and functional identification of secoisolariciresinol dehydrogenase gene from Dysosma versipellis callus].

    PubMed

    Shen, Yun; Chen, Ri-Dao; Xie, Ke-Bo; Zou, Jian-Hua; Dai, Jun-Gui

    2016-12-01

    Secoisolariciresinol dehydrogenase (SDH) is a key enzyme involved in the biosynthetic pathway of podophyllotoxin.In this study, two SDH candidate genes,SO282 and SO1223, were cloned from callus of Dysosma versipellis by homology-based PCR and rapid amplification of cDNA end (RACE).The SDH candidate genes were expressed in Escherichia coli and the subsequent enzyme assay in vitro showed that recombinant SO282 had the SDH activity. These results pave the way to the follow-up investigation of the biosynthetic of podophyllotoxin. Copyright© by the Chinese Pharmaceutical Association.

  1. An integration of genome-wide association study and gene expression profiling to prioritize the discovery of novel susceptibility Loci for osteoporosis-related traits.

    PubMed

    Hsu, Yi-Hsiang; Zillikens, M Carola; Wilson, Scott G; Farber, Charles R; Demissie, Serkalem; Soranzo, Nicole; Bianchi, Estelle N; Grundberg, Elin; Liang, Liming; Richards, J Brent; Estrada, Karol; Zhou, Yanhua; van Nas, Atila; Moffatt, Miriam F; Zhai, Guangju; Hofman, Albert; van Meurs, Joyce B; Pols, Huibert A P; Price, Roger I; Nilsson, Olle; Pastinen, Tomi; Cupples, L Adrienne; Lusis, Aldons J; Schadt, Eric E; Ferrari, Serge; Uitterlinden, André G; Rivadeneira, Fernando; Spector, Timothy D; Karasik, David; Kiel, Douglas P

    2010-06-10

    Osteoporosis is a complex disorder and commonly leads to fractures in elderly persons. Genome-wide association studies (GWAS) have become an unbiased approach to identify variations in the genome that potentially affect health. However, the genetic variants identified so far only explain a small proportion of the heritability for complex traits. Due to the modest genetic effect size and inadequate power, true association signals may not be revealed based on a stringent genome-wide significance threshold. Here, we take advantage of SNP and transcript arrays and integrate GWAS and expression signature profiling relevant to the skeletal system in cellular and animal models to prioritize the discovery of novel candidate genes for osteoporosis-related traits, including bone mineral density (BMD) at the lumbar spine (LS) and femoral neck (FN), as well as geometric indices of the hip (femoral neck-shaft angle, NSA; femoral neck length, NL; and narrow-neck width, NW). A two-stage meta-analysis of GWAS from 7,633 Caucasian women and 3,657 men, revealed three novel loci associated with osteoporosis-related traits, including chromosome 1p13.2 (RAP1A, p = 3.6x10(-8)), 2q11.2 (TBC1D8), and 18q11.2 (OSBPL1A), and confirmed a previously reported region near TNFRSF11B/OPG gene. We also prioritized 16 suggestive genome-wide significant candidate genes based on their potential involvement in skeletal metabolism. Among them, 3 candidate genes were associated with BMD in women. Notably, 2 out of these 3 genes (GPR177, p = 2.6x10(-13); SOX6, p = 6.4x10(-10)) associated with BMD in women have been successfully replicated in a large-scale meta-analysis of BMD, but none of the non-prioritized candidates (associated with BMD) did. Our results support the concept of our prioritization strategy. In the absence of direct biological support for identified genes, we highlighted the efficiency of subsequent functional characterization using publicly available expression profiling relevant to the skeletal system in cellular or whole animal models to prioritize candidate genes for further functional validation.

  2. Identification of Novel Associations of Candidate Genes with Resistance to Late Blight in Solanum tuberosum Group Phureja

    PubMed Central

    Álvarez, María F.; Angarita, Myrian; Delgado, María C.; García, Celsa; Jiménez-Gomez, José; Gebhardt, Christiane; Mosquera, Teresa

    2017-01-01

    The genetic basis of quantitative disease resistance has been studied in crops for several decades as an alternative to R gene mediated resistance. The most important disease in the potato crop is late blight, caused by the oomycete Phytophthora infestans. Quantitative disease resistance (QDR), as any other quantitative trait in plants, can be genetically mapped to understand the genetic architecture. Association mapping using DNA-based markers has been implemented in many crops to dissect quantitative traits. We used an association mapping approach with candidate genes to identify the first genes associated with quantitative resistance to late blight in Solanum tuberosum Group Phureja. Twenty-nine candidate genes were selected from a set of genes that were differentially expressed during the resistance response to late blight in tetraploid European potato cultivars. The 29 genes were amplified and sequenced in 104 accessions of S. tuberosum Group Phureja from Latin America. We identified 238 SNPs in the selected genes and tested them for association with resistance to late blight. The phenotypic data were obtained under field conditions by determining the area under disease progress curve (AUDPC) in two seasons and in two locations. Two genes were associated with QDR to late blight, a potato homolog of thylakoid lumen 15 kDa protein (StTL15A) and a stem 28 kDa glycoprotein (StGP28). Key message: A first association mapping experiment was conducted in Solanum tuberosum Group Phureja germplasm, which identified among 29 candidates two genes associated with quantitative resistance to late blight. PMID:28674545

  3. Identification of Novel Associations of Candidate Genes with Resistance to Late Blight in Solanum tuberosum Group Phureja.

    PubMed

    Álvarez, María F; Angarita, Myrian; Delgado, María C; García, Celsa; Jiménez-Gomez, José; Gebhardt, Christiane; Mosquera, Teresa

    2017-01-01

    The genetic basis of quantitative disease resistance has been studied in crops for several decades as an alternative to R gene mediated resistance. The most important disease in the potato crop is late blight, caused by the oomycete Phytophthora infestans. Quantitative disease resistance (QDR), as any other quantitative trait in plants, can be genetically mapped to understand the genetic architecture. Association mapping using DNA-based markers has been implemented in many crops to dissect quantitative traits. We used an association mapping approach with candidate genes to identify the first genes associated with quantitative resistance to late blight in Solanum tuberosum Group Phureja. Twenty-nine candidate genes were selected from a set of genes that were differentially expressed during the resistance response to late blight in tetraploid European potato cultivars. The 29 genes were amplified and sequenced in 104 accessions of S. tuberosum Group Phureja from Latin America. We identified 238 SNPs in the selected genes and tested them for association with resistance to late blight. The phenotypic data were obtained under field conditions by determining the area under disease progress curve (AUDPC) in two seasons and in two locations. Two genes were associated with QDR to late blight, a potato homolog of thylakoid lumen 15 kDa protein ( StTL15A ) and a stem 28 kDa glycoprotein ( StGP28 ). Key message : A first association mapping experiment was conducted in Solanum tuberosum Group Phureja germplasm, which identified among 29 candidates two genes associated with quantitative resistance to late blight.

  4. The Prediction of Key Cytoskeleton Components Involved in Glomerular Diseases Based on a Protein-Protein Interaction Network.

    PubMed

    Ding, Fangrui; Tan, Aidi; Ju, Wenjun; Li, Xuejuan; Li, Shao; Ding, Jie

    2016-01-01

    Maintenance of the physiological morphologies of different types of cells and tissues is essential for the normal functioning of each system in the human body. Dynamic variations in cell and tissue morphologies depend on accurate adjustments of the cytoskeletal system. The cytoskeletal system in the glomerulus plays a key role in the normal process of kidney filtration. To enhance the understanding of the possible roles of the cytoskeleton in glomerular diseases, we constructed the Glomerular Cytoskeleton Network (GCNet), which shows the protein-protein interaction network in the glomerulus, and identified several possible key cytoskeletal components involved in glomerular diseases. In this study, genes/proteins annotated to the cytoskeleton were detected by Gene Ontology analysis, and glomerulus-enriched genes were selected from nine available glomerular expression datasets. Then, the GCNet was generated by combining these two sets of information. To predict the possible key cytoskeleton components in glomerular diseases, we then examined the common regulation of the genes in GCNet in the context of five glomerular diseases based on their transcriptomic data. As a result, twenty-one cytoskeleton components as potential candidate were highlighted for consistently down- or up-regulating in all five glomerular diseases. And then, these candidates were examined in relation to existing known glomerular diseases and genes to determine their possible functions and interactions. In addition, the mRNA levels of these candidates were also validated in a puromycin aminonucleoside(PAN) induced rat nephropathy model and were also matched with existing Diabetic Nephropathy (DN) transcriptomic data. As a result, there are 15 of 21 candidates in PAN induced nephropathy model were consistent with our predication and also 12 of 21 candidates were matched with differentially expressed genes in the DN transcriptomic data. By providing a novel interaction network and prediction, GCNet contributes to improving the understanding of normal glomerular function and will be useful for detecting target cytoskeleton molecules of interest that may be involved in glomerular diseases in future studies.

  5. The Prediction of Key Cytoskeleton Components Involved in Glomerular Diseases Based on a Protein-Protein Interaction Network

    PubMed Central

    Ju, Wenjun; Li, Xuejuan; Li, Shao; Ding, Jie

    2016-01-01

    Maintenance of the physiological morphologies of different types of cells and tissues is essential for the normal functioning of each system in the human body. Dynamic variations in cell and tissue morphologies depend on accurate adjustments of the cytoskeletal system. The cytoskeletal system in the glomerulus plays a key role in the normal process of kidney filtration. To enhance the understanding of the possible roles of the cytoskeleton in glomerular diseases, we constructed the Glomerular Cytoskeleton Network (GCNet), which shows the protein-protein interaction network in the glomerulus, and identified several possible key cytoskeletal components involved in glomerular diseases. In this study, genes/proteins annotated to the cytoskeleton were detected by Gene Ontology analysis, and glomerulus-enriched genes were selected from nine available glomerular expression datasets. Then, the GCNet was generated by combining these two sets of information. To predict the possible key cytoskeleton components in glomerular diseases, we then examined the common regulation of the genes in GCNet in the context of five glomerular diseases based on their transcriptomic data. As a result, twenty-one cytoskeleton components as potential candidate were highlighted for consistently down- or up-regulating in all five glomerular diseases. And then, these candidates were examined in relation to existing known glomerular diseases and genes to determine their possible functions and interactions. In addition, the mRNA levels of these candidates were also validated in a puromycin aminonucleoside(PAN) induced rat nephropathy model and were also matched with existing Diabetic Nephropathy (DN) transcriptomic data. As a result, there are 15 of 21 candidates in PAN induced nephropathy model were consistent with our predication and also 12 of 21 candidates were matched with differentially expressed genes in the DN transcriptomic data. By providing a novel interaction network and prediction, GCNet contributes to improving the understanding of normal glomerular function and will be useful for detecting target cytoskeleton molecules of interest that may be involved in glomerular diseases in future studies. PMID:27227331

  6. Pea Marker Database (PMD) - A new online database combining known pea (Pisum sativum L.) gene-based markers.

    PubMed

    Kulaeva, Olga A; Zhernakov, Aleksandr I; Afonin, Alexey M; Boikov, Sergei S; Sulima, Anton S; Tikhonovich, Igor A; Zhukov, Vladimir A

    2017-01-01

    Pea (Pisum sativum L.) is the oldest model object of plant genetics and one of the most agriculturally important legumes in the world. Since the pea genome has not been sequenced yet, identification of genes responsible for mutant phenotypes or desirable agricultural traits is usually performed via genetic mapping followed by candidate gene search. Such mapping is best carried out using gene-based molecular markers, as it opens the possibility for exploiting genome synteny between pea and its close relative Medicago truncatula Gaertn., possessing sequenced and annotated genome. In the last 5 years, a large number of pea gene-based molecular markers have been designed and mapped owing to the rapid evolution of "next-generation sequencing" technologies. However, the access to the complete set of markers designed worldwide is limited because the data are not uniformed and therefore hard to use. The Pea Marker Database was designed to combine the information about pea markers in a form of user-friendly and practical online tool. Version 1 (PMD1) comprises information about 2484 genic markers, including their locations in linkage groups, the sequences of corresponding pea transcripts and the names of related genes in M. truncatula. Version 2 (PMD2) is an updated version comprising 15944 pea markers in the same format with several advanced features. To test the performance of the PMD, fine mapping of pea symbiotic genes Sym13 and Sym27 in linkage groups VII and V, respectively, was carried out. The results of mapping allowed us to propose the Sen1 gene (a homologue of SEN1 gene of Lotus japonicus (Regel) K. Larsen) as the best candidate gene for Sym13, and to narrow the list of possible candidate genes for Sym27 to ten, thus proving PMD to be useful for pea gene mapping and cloning. All information contained in PMD1 and PMD2 is available at www.peamarker.arriam.ru.

  7. In silico identification of genetically attenuated vaccine candidate genes for Plasmodium liver stage.

    PubMed

    Kumar, Hirdesh; Frischknecht, Friedrich; Mair, Gunnar R; Gomes, James

    2015-12-01

    Genetically attenuated parasites (GAPs) that lack genes essential for the liver stage of the malaria parasite, and therefore cause developmental arrest, have been developed as live vaccines in rodent malaria models and recently been tested in humans. The genes targeted for deletion were often identified by trial and error. Here we present a systematic gene - protein and transcript - expression analyses of several Plasmodium species with the aim to identify candidate genes for the generation of novel GAPs. With a lack of liver stage expression data for human malaria parasites, we used data available for liver stage development of Plasmodium yoelii, a rodent malaria model, to identify proteins expressed in the liver stage but absent from blood stage parasites. An orthology-based search was then employed to identify orthologous proteins in the human malaria parasite Plasmodium falciparum resulting in a total of 310 genes expressed in the liver stage but lacking evidence of protein expression in blood stage parasites. Among these 310 possible GAP candidates, we further studied Plasmodium liver stage proteins by phyletic distribution and functional domain analyses and shortlisted twenty GAP-candidates; these are: fabB/F, fabI, arp, 3 genes encoding subunits of the PDH complex, dnaJ, urm1, rS5, ancp, mcp, arh, gk, lisp2, valS, palm, and four conserved Plasmodium proteins of unknown function. Parasites lacking one or several of these genes might yield new attenuated malaria parasites for experimental vaccination studies. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Electing a candidate: a speculative history of the bacterial phylum OP10.

    PubMed

    Dunfield, Peter F; Tamas, Ivica; Lee, Kevin C; Morgan, Xochitl C; McDonald, Ian R; Stott, Matthew B

    2012-12-01

    In 1998, a cultivation-independent survey of the microbial community in Obsidian Pool, Yellowstone National Park, detected 12 new phyla within the Domain Bacteria. These were dubbed 'candidate divisions' OP1 to OP12. Since that time the OP10 candidate division has been commonly detected in various environments, usually as part of the rare biosphere, but occasionally as a predominant community component. Based on 16S rRNA gene phylogeny, OP10 comprises at least 12 class-level subdivisions. However, despite this broad ecological and evolutionary diversity, all OP10 bacteria have eluded cultivation until recently. In 2011, two reference species of OP10 were taxonomically validated, removing the phylum from its 'candidate' status. Construction of a highly resolved phylogeny based on 29 universally conserved genes verifies its standing as a unique bacterial phylum. In the following paper we summarize what is known and what is suspected about the newest described bacterial phylum, the Armatimonadetes. © 2012 Society for Applied Microbiology and Blackwell Publishing Ltd.

  9. Prioritization of Disease Susceptibility Genes Using LSM/SVD.

    PubMed

    Gong, Lejun; Yang, Ronggen; Yan, Qin; Sun, Xiao

    2013-12-01

    Understanding the role of genetics in diseases is one of the most important tasks in the postgenome era. It is generally too expensive and time consuming to perform experimental validation for all candidate genes related to disease. Computational methods play important roles for prioritizing these candidates. Herein, we propose an approach to prioritize disease genes using latent semantic mapping based on singular value decomposition. Our hypothesis is that similar functional genes are likely to cause similar diseases. Measuring the functional similarity between known disease susceptibility genes and unknown genes is to predict new disease susceptibility genes. Taking autism as an instance, the analysis results of the top ten genes prioritized demonstrate they might be autism susceptibility genes, which also indicates our approach could discover new disease susceptibility genes. The novel approach of disease gene prioritization could discover new disease susceptibility genes, and latent disease-gene relations. The prioritized results could also support the interpretive diversity and experimental views as computational evidence for disease researchers.

  10. Selection and Validation of Reference Genes for qRT-PCR Expression Analysis of Candidate Genes Involved in Olfactory Communication in the Butterfly Bicyclus anynana

    PubMed Central

    Arun, Alok; Baumlé, Véronique; Amelot, Gaël; Nieberding, Caroline M.

    2015-01-01

    Real-time quantitative reverse transcription PCR (qRT-PCR) is a technique widely used to quantify the transcriptional expression level of candidate genes. qRT-PCR requires the selection of one or several suitable reference genes, whose expression profiles remain stable across conditions, to normalize the qRT-PCR expression profiles of candidate genes. Although several butterfly species (Lepidoptera) have become important models in molecular evolutionary ecology, so far no study aimed at identifying reference genes for accurate data normalization for any butterfly is available. The African bush brown butterfly Bicyclus anynana has drawn considerable attention owing to its suitability as a model for evolutionary ecology, and we here provide a maiden extensive study to identify suitable reference gene in this species. We monitored the expression profile of twelve reference genes: eEF-1α, FK506, UBQL40, RpS8, RpS18, HSP, GAPDH, VATPase, ACT3, TBP, eIF2 and G6PD. We tested the stability of their expression profiles in three different tissues (wings, brains, antennae), two developmental stages (pupal and adult) and two sexes (male and female), all of which were subjected to two food treatments (food stress and control feeding ad libitum). The expression stability and ranking of twelve reference genes was assessed using two algorithm-based methods, NormFinder and geNorm. Both methods identified RpS8 as the best suitable reference gene for expression data normalization. We also showed that the use of two reference genes is sufficient to effectively normalize the qRT-PCR data under varying tissues and experimental conditions that we used in B. anynana. Finally, we tested the effect of choosing reference genes with different stability on the normalization of the transcript abundance of a candidate gene involved in olfactory communication in B. anynana, the Fatty Acyl Reductase 2, and we confirmed that using an unstable reference gene can drastically alter the expression profile of the target candidate genes. PMID:25793735

  11. Selection and validation of reference genes for qRT-PCR expression analysis of candidate genes involved in olfactory communication in the butterfly Bicyclus anynana.

    PubMed

    Arun, Alok; Baumlé, Véronique; Amelot, Gaël; Nieberding, Caroline M

    2015-01-01

    Real-time quantitative reverse transcription PCR (qRT-PCR) is a technique widely used to quantify the transcriptional expression level of candidate genes. qRT-PCR requires the selection of one or several suitable reference genes, whose expression profiles remain stable across conditions, to normalize the qRT-PCR expression profiles of candidate genes. Although several butterfly species (Lepidoptera) have become important models in molecular evolutionary ecology, so far no study aimed at identifying reference genes for accurate data normalization for any butterfly is available. The African bush brown butterfly Bicyclus anynana has drawn considerable attention owing to its suitability as a model for evolutionary ecology, and we here provide a maiden extensive study to identify suitable reference gene in this species. We monitored the expression profile of twelve reference genes: eEF-1α, FK506, UBQL40, RpS8, RpS18, HSP, GAPDH, VATPase, ACT3, TBP, eIF2 and G6PD. We tested the stability of their expression profiles in three different tissues (wings, brains, antennae), two developmental stages (pupal and adult) and two sexes (male and female), all of which were subjected to two food treatments (food stress and control feeding ad libitum). The expression stability and ranking of twelve reference genes was assessed using two algorithm-based methods, NormFinder and geNorm. Both methods identified RpS8 as the best suitable reference gene for expression data normalization. We also showed that the use of two reference genes is sufficient to effectively normalize the qRT-PCR data under varying tissues and experimental conditions that we used in B. anynana. Finally, we tested the effect of choosing reference genes with different stability on the normalization of the transcript abundance of a candidate gene involved in olfactory communication in B. anynana, the Fatty Acyl Reductase 2, and we confirmed that using an unstable reference gene can drastically alter the expression profile of the target candidate genes.

  12. Computational Analysis of Candidate Disease Genes and Variants for Salt-Sensitive Hypertension in Indigenous Southern Africans

    PubMed Central

    Tiffin, Nicki; Meintjes, Ayton; Ramesar, Rajkumar; Bajic, Vladimir B.; Rayner, Brian

    2010-01-01

    Multiple factors underlie susceptibility to essential hypertension, including a significant genetic and ethnic component, and environmental effects. Blood pressure response of hypertensive individuals to salt is heterogeneous, but salt sensitivity appears more prevalent in people of indigenous African origin. The underlying genetics of salt-sensitive hypertension, however, are poorly understood. In this study, computational methods including text- and data-mining have been used to select and prioritize candidate aetiological genes for salt-sensitive hypertension. Additionally, we have compared allele frequencies and copy number variation for single nucleotide polymorphisms in candidate genes between indigenous Southern African and Caucasian populations, with the aim of identifying candidate genes with significant variability between the population groups: identifying genetic variability between population groups can exploit ethnic differences in disease prevalence to aid with prioritisation of good candidate genes. Our top-ranking candidate genes include parathyroid hormone precursor (PTH) and type-1angiotensin II receptor (AGTR1). We propose that the candidate genes identified in this study warrant further investigation as potential aetiological genes for salt-sensitive hypertension. PMID:20886000

  13. Candidate innate immune system gene expression in the ecological model Daphnia

    PubMed Central

    Decaestecker, Ellen; Labbé, Pierrick; Ellegaard, Kirsten; Allen, Judith E.; Little, Tom J.

    2011-01-01

    The last ten years have witnessed increasing interest in host–pathogen interactions involving invertebrate hosts. The invertebrate innate immune system is now relatively well characterised, but in a limited range of genetic model organisms and under a limited number of conditions. Immune systems have been little studied under real-world scenarios of environmental variation and parasitism. Thus, we have investigated expression of candidate innate immune system genes in the water flea Daphnia, a model organism for ecological genetics, and whose capacity for clonal reproduction facilitates an exceptionally rigorous control of exposure dose or the study of responses at many time points. A unique characteristic of the particular Daphnia clones and pathogen strain combinations used presently is that they have been shown to be involved in specific host–pathogen coevolutionary interactions in the wild. We choose five genes, which are strong candidates to be involved in Daphnia–pathogen interactions, given that they have been shown to code for immune effectors in related organisms. Differential expression of these genes was quantified by qRT-PCR following exposure to the bacterial pathogen Pasteuria ramosa. Constitutive expression levels differed between host genotypes, and some genes appeared to show correlated expression. However, none of the genes appeared to show a major modification of expression level in response to Pasteuria exposure. By applying knowledge from related genetic model organisms (e.g. Drosophila) to models for the study of evolutionary ecology and coevolution (i.e. Daphnia), the candidate gene approach is temptingly efficient. However, our results show that detection of only weak patterns is likely if one chooses target genes for study based on previously identified genome sequences by comparison to homologues from other related organisms. Future work on the Daphnia–Pasteuria system will need to balance a candidate gene approach with more comprehensive approaches to de novo identify immune system genes specific to the Daphnia–Pasteuria interaction. PMID:21550363

  14. Candidate innate immune system gene expression in the ecological model Daphnia.

    PubMed

    Decaestecker, Ellen; Labbé, Pierrick; Ellegaard, Kirsten; Allen, Judith E; Little, Tom J

    2011-10-01

    The last ten years have witnessed increasing interest in host-pathogen interactions involving invertebrate hosts. The invertebrate innate immune system is now relatively well characterised, but in a limited range of genetic model organisms and under a limited number of conditions. Immune systems have been little studied under real-world scenarios of environmental variation and parasitism. Thus, we have investigated expression of candidate innate immune system genes in the water flea Daphnia, a model organism for ecological genetics, and whose capacity for clonal reproduction facilitates an exceptionally rigorous control of exposure dose or the study of responses at many time points. A unique characteristic of the particular Daphnia clones and pathogen strain combinations used presently is that they have been shown to be involved in specific host-pathogen coevolutionary interactions in the wild. We choose five genes, which are strong candidates to be involved in Daphnia-pathogen interactions, given that they have been shown to code for immune effectors in related organisms. Differential expression of these genes was quantified by qRT-PCR following exposure to the bacterial pathogen Pasteuria ramosa. Constitutive expression levels differed between host genotypes, and some genes appeared to show correlated expression. However, none of the genes appeared to show a major modification of expression level in response to Pasteuria exposure. By applying knowledge from related genetic model organisms (e.g. Drosophila) to models for the study of evolutionary ecology and coevolution (i.e. Daphnia), the candidate gene approach is temptingly efficient. However, our results show that detection of only weak patterns is likely if one chooses target genes for study based on previously identified genome sequences by comparison to homologues from other related organisms. Future work on the Daphnia-Pasteuria system will need to balance a candidate gene approach with more comprehensive approaches to de novo identify immune system genes specific to the Daphnia-Pasteuria interaction. Copyright © 2011 Elsevier Ltd. All rights reserved.

  15. Genomic approaches for the elucidation of genes and gene networks underlying cardiovascular traits.

    PubMed

    Adriaens, M E; Bezzina, C R

    2018-06-22

    Genome-wide association studies have shed light on the association between natural genetic variation and cardiovascular traits. However, linking a cardiovascular trait associated locus to a candidate gene or set of candidate genes for prioritization for follow-up mechanistic studies is all but straightforward. Genomic technologies based on next-generation sequencing technology nowadays offer multiple opportunities to dissect gene regulatory networks underlying genetic cardiovascular trait associations, thereby aiding in the identification of candidate genes at unprecedented scale. RNA sequencing in particular becomes a powerful tool when combined with genotyping to identify loci that modulate transcript abundance, known as expression quantitative trait loci (eQTL), or loci modulating transcript splicing known as splicing quantitative trait loci (sQTL). Additionally, the allele-specific resolution of RNA-sequencing technology enables estimation of allelic imbalance, a state where the two alleles of a gene are expressed at a ratio differing from the expected 1:1 ratio. When multiple high-throughput approaches are combined with deep phenotyping in a single study, a comprehensive elucidation of the relationship between genotype and phenotype comes into view, an approach known as systems genetics. In this review, we cover key applications of systems genetics in the broad cardiovascular field.

  16. Integration of biological data by kernels on graph nodes allows prediction of new genes involved in mitotic chromosome condensation

    PubMed Central

    Hériché, Jean-Karim; Lees, Jon G.; Morilla, Ian; Walter, Thomas; Petrova, Boryana; Roberti, M. Julia; Hossain, M. Julius; Adler, Priit; Fernández, José M.; Krallinger, Martin; Haering, Christian H.; Vilo, Jaak; Valencia, Alfonso; Ranea, Juan A.; Orengo, Christine; Ellenberg, Jan

    2014-01-01

    The advent of genome-wide RNA interference (RNAi)–based screens puts us in the position to identify genes for all functions human cells carry out. However, for many functions, assay complexity and cost make genome-scale knockdown experiments impossible. Methods to predict genes required for cell functions are therefore needed to focus RNAi screens from the whole genome on the most likely candidates. Although different bioinformatics tools for gene function prediction exist, they lack experimental validation and are therefore rarely used by experimentalists. To address this, we developed an effective computational gene selection strategy that represents public data about genes as graphs and then analyzes these graphs using kernels on graph nodes to predict functional relationships. To demonstrate its performance, we predicted human genes required for a poorly understood cellular function—mitotic chromosome condensation—and experimentally validated the top 100 candidates with a focused RNAi screen by automated microscopy. Quantitative analysis of the images demonstrated that the candidates were indeed strongly enriched in condensation genes, including the discovery of several new factors. By combining bioinformatics prediction with experimental validation, our study shows that kernels on graph nodes are powerful tools to integrate public biological data and predict genes involved in cellular functions of interest. PMID:24943848

  17. Google Goes Cancer: Improving Outcome Prediction for Cancer Patients by Network-Based Ranking of Marker Genes

    PubMed Central

    Roy, Janine; Aust, Daniela; Knösel, Thomas; Rümmele, Petra; Jahnke, Beatrix; Hentrich, Vera; Rückert, Felix; Niedergethmann, Marco; Weichert, Wilko; Bahra, Marcus; Schlitt, Hans J.; Settmacher, Utz; Friess, Helmut; Büchler, Markus; Saeger, Hans-Detlev; Schroeder, Michael; Pilarsky, Christian; Grützmann, Robert

    2012-01-01

    Predicting the clinical outcome of cancer patients based on the expression of marker genes in their tumors has received increasing interest in the past decade. Accurate predictors of outcome and response to therapy could be used to personalize and thereby improve therapy. However, state of the art methods used so far often found marker genes with limited prediction accuracy, limited reproducibility, and unclear biological relevance. To address this problem, we developed a novel computational approach to identify genes prognostic for outcome that couples gene expression measurements from primary tumor samples with a network of known relationships between the genes. Our approach ranks genes according to their prognostic relevance using both expression and network information in a manner similar to Google's PageRank. We applied this method to gene expression profiles which we obtained from 30 patients with pancreatic cancer, and identified seven candidate marker genes prognostic for outcome. Compared to genes found with state of the art methods, such as Pearson correlation of gene expression with survival time, we improve the prediction accuracy by up to 7%. Accuracies were assessed using support vector machine classifiers and Monte Carlo cross-validation. We then validated the prognostic value of our seven candidate markers using immunohistochemistry on an independent set of 412 pancreatic cancer samples. Notably, signatures derived from our candidate markers were independently predictive of outcome and superior to established clinical prognostic factors such as grade, tumor size, and nodal status. As the amount of genomic data of individual tumors grows rapidly, our algorithm meets the need for powerful computational approaches that are key to exploit these data for personalized cancer therapies in clinical practice. PMID:22615549

  18. Longevity candidate genes and their association with personality traits in the elderly

    PubMed Central

    Luciano, Michelle; Lopez, Lorna M.; de Moor, Marleen H.M.; Harris, Sarah E.; Davies, Gail; Nutile, Teresa; Krueger, Robert F.; Esko, Tõnu; Schlessinger, David; Toshiko, Tanaka; Derringer, Jaime L.; Realo, Anu; Hansell, Narelle K.; Pergadia, Michele L.; Pesonen, Anu-Katriina; Sanna, Serena; Terracciano, Antonio; Madden, Pamela A.F.; Penninx, Brenda; Spinhoven, Philip; Hartman, Catherine; Oostra, Ben A.; Janssens, A. Cecile J.W.; Eriksson, Johan G; Starr, John M.; Cannas, Alessandra; Ferrucci, Luigi; Metspalu, Andres; Wright, Margeret J.; Heath, Andrew C.; van Duijn, Cornelia M.; Bierut, Laura J.; Raikkonen, Katri; Martin, Nicholas G.; Ciullo, Marina; Rujescu, Dan; Boomsma, Dorret I.; Deary, Ian J.

    2013-01-01

    Human longevity and personality traits are both heritable and are consistently linked at the phenotypic level. We test the hypothesis that candidate genes influencing longevity in lower organisms are associated with variance in the five major dimensions of human personality (measured by the NEO-FFI and IPIP inventories) plus related mood states of anxiety and depression. Seventy single nucleotide polymorphisms (SNPs) in six brain expressed, longevity candidate genes (AFG3L2, FRAP1, MAT1A, MAT2A, SYNJ1 and SYNJ2) were typed in over one thousand 70-year old participants from the Lothian Birth Cohort of 1936 (LBC1936). No SNPs were associated with the personality and psychological distress traits at a Bonferroni corrected level of significance (p < 0.0002), but there was an over-representation of nominally significant (p < 0.05) SNPs in the synaptojanin-2 (SYNJ2) gene associated with agreeableness and symptoms of depression. Eight SNPs which showed nominally significant association across personality measurement instruments were tested in an extremely large replication sample of 17 106 participants. SNP rs350292, in SYNJ2, was significant: the minor allele was associated with an average decrease in NEO agreeableness scale scores of 0.25 points, and 0.67 points in the restricted analysis of elderly cohorts (most aged > 60 years). Because we selected a specific set of longevity genes based on functional genomics findings, further research on other longevity gene candidates is warranted to discover whether they are relevant candidates for personality and psychological distress traits. PMID:22213687

  19. Molecular insight into the association between cartilage regeneration and ear wound healing in genetic mouse models: targeting new genes in regeneration.

    PubMed

    Rai, Muhammad Farooq; Schmidt, Eric J; McAlinden, Audrey; Cheverud, James M; Sandell, Linda J

    2013-11-06

    Tissue regeneration is a complex trait with few genetic models available. Mouse strains LG/J and MRL are exceptional healers. Using recombinant inbred strains from a large (LG/J, healer) and small (SM/J, nonhealer) intercross, we have previously shown a positive genetic correlation between ear wound healing, knee cartilage regeneration, and protection from osteoarthritis. We hypothesize that a common set of genes operates in tissue healing and articular cartilage regeneration. Taking advantage of archived histological sections from recombinant inbred strains, we analyzed expression of candidate genes through branched-chain DNA technology directly from tissue lysates. We determined broad-sense heritability of candidates, Pearson correlation of candidates with healing phenotypes, and Ward minimum variance cluster analysis for strains. A bioinformatic assessment of allelic polymorphisms within and near candidate genes was also performed. The expression of several candidates was significantly heritable among strains. Although several genes correlated with both ear wound healing and cartilage healing at a marginal level, the expression of four genes representing DNA repair (Xrcc2, Pcna) and Wnt signaling (Axin2, Wnt16) pathways was significantly positively correlated with both phenotypes. Cluster analysis accurately classified healers and nonhealers for seven out of eight strains based on gene expression. Specific sequence differences between LG/J and SM/J were identified as potential causal polymorphisms. Our study suggests a common genetic basis between tissue healing and osteoarthritis susceptibility. Mapping genetic variations causing differences in diverse healing responses in multiple tissues may reveal generic healing processes in pursuit of new therapeutic targets designed to induce or enhance regeneration and, potentially, protection from osteoarthritis.

  20. RNA-Seq analysis and annotation of a draft blueberry genome assembly identifies candidate genes involved in fruit ripening, biosynthesis of bioactive compounds, and stage-specific alternative splicing.

    PubMed

    Gupta, Vikas; Estrada, April D; Blakley, Ivory; Reid, Rob; Patel, Ketan; Meyer, Mason D; Andersen, Stig Uggerhøj; Brown, Allan F; Lila, Mary Ann; Loraine, Ann E

    2015-01-01

    Blueberries are a rich source of antioxidants and other beneficial compounds that can protect against disease. Identifying genes involved in synthesis of bioactive compounds could enable the breeding of berry varieties with enhanced health benefits. Toward this end, we annotated a previously sequenced draft blueberry genome assembly using RNA-Seq data from five stages of berry fruit development and ripening. Genome-guided assembly of RNA-Seq read alignments combined with output from ab initio gene finders produced around 60,000 gene models, of which more than half were similar to proteins from other species, typically the grape Vitis vinifera. Comparison of gene models to the PlantCyc database of metabolic pathway enzymes identified candidate genes involved in synthesis of bioactive compounds, including bixin, an apocarotenoid with potential disease-fighting properties, and defense-related cyanogenic glycosides, which are toxic. Cyanogenic glycoside (CG) biosynthetic enzymes were highly expressed in green fruit, and a candidate CG detoxification enzyme was up-regulated during fruit ripening. Candidate genes for ethylene, anthocyanin, and 400 other biosynthetic pathways were also identified. Homology-based annotation using Blast2GO and InterPro assigned Gene Ontology terms to around 15,000 genes. RNA-Seq expression profiling showed that blueberry growth, maturation, and ripening involve dynamic gene expression changes, including coordinated up- and down-regulation of metabolic pathway enzymes and transcriptional regulators. Analysis of RNA-seq alignments identified developmentally regulated alternative splicing, promoter use, and 3' end formation. We report genome sequence, gene models, functional annotations, and RNA-Seq expression data that provide an important new resource enabling high throughput studies in blueberry.

  1. Fine-mapping of qGW4.05, a major QTL for kernel weight and size in maize.

    PubMed

    Chen, Lin; Li, Yong-xiang; Li, Chunhui; Wu, Xun; Qin, Weiwei; Li, Xin; Jiao, Fuchao; Zhang, Xiaojing; Zhang, Dengfeng; Shi, Yunsu; Song, Yanchun; Li, Yu; Wang, Tianyu

    2016-04-12

    Kernel weight and size are important components of grain yield in cereals. Although some information is available concerning the map positions of quantitative trait loci (QTL) for kernel weight and size in maize, little is known about the molecular mechanisms of these QTLs. qGW4.05 is a major QTL that is associated with kernel weight and size in maize. We combined linkage analysis and association mapping to fine-map and identify candidate gene(s) at qGW4.05. QTL qGW4.05 was fine-mapped to a 279.6-kb interval in a segregating population derived from a cross of Huangzaosi with LV28. By combining the results of regional association mapping and linkage analysis, we identified GRMZM2G039934 as a candidate gene responsible for qGW4.05. Candidate gene-based association mapping was conducted using a panel of 184 inbred lines with variable kernel weights and kernel sizes. Six polymorphic sites in the gene GRMZM2G039934 were significantly associated with kernel weight and kernel size. The results of linkage analysis and association mapping revealed that GRMZM2G039934 is the most likely candidate gene for qGW4.05. These results will improve our understanding of the genetic architecture and molecular mechanisms underlying kernel development in maize.

  2. Diet and Colorectal Cancer: Analysis of a Candidate Pathway Using SNPS, Haplotypes, and Multi-Gene Assessment

    PubMed Central

    Slattery, Martha L.; Lundgreen, Abbie; Herrick, Jennifer S.; Caan, Bette J.; Potter, John D.; Wolff, Roger K.

    2012-01-01

    There is considerable biologic plausibility to the hypothesis that genetic variability in pathways involved in insulin signaling and energy homeostasis may modulate dietary risk associated with colorectal cancer. We utilized data from 2 population-based case-control studies of colon (n = 1,574 cases, 1,970 controls) and rectal (n = 791 cases, 999 controls) cancer to evaluate genetic variation in candidate SNPs identified from 9 genes in a candidate pathway: PDK1, RP6KA1, RPS6KA2, RPS6KB1, RPS6KB2, PTEN, FRAP1 (mTOR), TSC1, TSC2, Akt1, PIK3CA, and PRKAG2 with dietary intake of total energy, carbohydrates, fat, and fiber. We employed SNP, haplotype, and multiple-gene analysis to evaluate associations. PDK1 interacted with dietary fat for both colon and rectal cancer and with dietary carbohydrates for colon cancer. Statistically significant interaction with dietary carbohydrates and rectal cancer was detected by haplotype analysis of PDK1. Evaluation of dietary interactions with multiple genes in this candidate pathway showed several interactions with pairs of genes: Akt1 and PDK1, PDK1 and PTEN, PDK1 and TSC1, and PRKAG2 and PTEN. Analyses show that genetic variation influences risk of colorectal cancer associated with diet and illustrate the importance of evaluating dietary interactions beyond the level of single SNPs or haplotypes when a biologically relevant candidate pathway is examined. PMID:21999454

  3. A comprehensive meta-analysis of plant morphology, yield, stay-green, and virus disease resistance QTL in maize (Zea mays L.).

    PubMed

    Wang, Yijun; Xu, Jing; Deng, Dexiang; Ding, Haidong; Bian, Yunlong; Yin, Zhitong; Wu, Yarong; Zhou, Bo; Zhao, Ye

    2016-02-01

    The meta-QTL and candidate genes will facilitate the elucidation of molecular bases underlying agriculturally important traits and open new avenues for functional markers development and elite alleles introgression in maize breeding program. A large number of QTLs attributed to grain productivity and other agriculturally important traits have been identified and deposited in public repositories. The integration of fruitful QTL becomes a major issue in current plant genomics. To this end, we first collected QTL for six agriculturally important traits in maize, including yield, plant height, ear height, leaf angle, stay-green, and maize rough dwarf disease resistance. The meta-analysis method was then employed to retrieve 113 meta-QTL. Additionally, we also isolated candidate genes for target traits by the bioinformatic technique. Several candidates, including some well-characterized genes, GA3ox2 for plant height, lg1 and lg4 for leaf angle, zfl1 and zfl2 for flowering time, were co-localized with established meta-QTL intervals. Intriguingly, in a relatively narrow meta-QTL region, the maize ortholog of rice yield-related gene GW8/OsSPL16 was believed to be a candidate for yield. Leveraging results presented in this study will provide further insights into the genetic architecture of maize agronomic traits. Moreover, the meta-QTL and candidate genes reported here could be harnessed for the enhancement of stress tolerance and yield performance in maize and translation to other crops.

  4. Methylation analysis of plasma cell-free DNA for breast cancer early detection using bisulfite next-generation sequencing.

    PubMed

    Li, Zibo; Guo, Xinwu; Tang, Lili; Peng, Limin; Chen, Ming; Luo, Xipeng; Wang, Shouman; Xiao, Zhi; Deng, Zhongping; Dai, Lizhong; Xia, Kun; Wang, Jun

    2016-10-01

    Circulating cell-free DNA (cfDNA) has been considered as a potential biomarker for non-invasive cancer detection. To evaluate the methylation levels of six candidate genes (EGFR, GREM1, PDGFRB, PPM1E, SOX17, and WRN) in plasma cfDNA as biomarkers for breast cancer early detection, quantitative analysis of the promoter methylation of these genes from 86 breast cancer patients and 67 healthy controls was performed by using microfluidic-PCR-based target enrichment and next-generation bisulfite sequencing technology. The predictive performance of different logistic models based on methylation status of candidate genes was investigated by means of the area under the ROC curve (AUC) and odds ratio (OR) analysis. Results revealed that EGFR, PPM1E, and 8 gene-specific CpG sites showed significantly hypermethylation in cancer patients' plasma and significantly associated with breast cancer (OR ranging from 2.51 to 9.88). The AUC values for these biomarkers were ranging from 0.66 to 0.75. Combinations of multiple hypermethylated genes or CpG sites substantially improved the predictive performance for breast cancer detection. Our study demonstrated the feasibility of quantitative measurement of candidate gene methylation in cfDNA by using microfluidic-PCR-based target enrichment and bisulfite next-generation sequencing, which is worthy of further validation and potentially benefits a broad range of applications in clinical oncology practice. Quantitative analysis of methylation pattern of plasma cfDNA by next-generation sequencing might be a valuable non-invasive tool for early detection of breast cancer.

  5. Identification of Enzyme Genes Using Chemical Structure Alignments of Substrate-Product Pairs.

    PubMed

    Moriya, Yuki; Yamada, Takuji; Okuda, Shujiro; Nakagawa, Zenichi; Kotera, Masaaki; Tokimatsu, Toshiaki; Kanehisa, Minoru; Goto, Susumu

    2016-03-28

    Although there are several databases that contain data on many metabolites and reactions in biochemical pathways, there is still a big gap in the numbers between experimentally identified enzymes and metabolites. It is supposed that many catalytic enzyme genes are still unknown. Although there are previous studies that estimate the number of candidate enzyme genes, these studies required some additional information aside from the structures of metabolites such as gene expression and order in the genome. In this study, we developed a novel method to identify a candidate enzyme gene of a reaction using the chemical structures of the substrate-product pair (reactant pair). The proposed method is based on a search for similar reactant pairs in a reference database and offers ortholog groups that possibly mediate the given reaction. We applied the proposed method to two experimentally validated reactions. As a result, we confirmed that the histidine transaminase was correctly identified. Although our method could not directly identify the asparagine oxo-acid transaminase, we successfully found the paralog gene most similar to the correct enzyme gene. We also applied our method to infer candidate enzyme genes in the mesaconate pathway. The advantage of our method lies in the prediction of possible genes for orphan enzyme reactions where any associated gene sequences are not determined yet. We believe that this approach will facilitate experimental identification of genes for orphan enzymes.

  6. A family with X-linked anophthalmia: exclusion of SOX3 as a candidate gene.

    PubMed

    Slavotinek, Anne; Lee, Stephen S; Hamilton, Steven P

    2005-10-01

    We report on a four-generation family with X-linked anophthalmia in four affected males and show that this family has LOD scores consistent with linkage to Xq27, the third family reported to be linked to the ANOP1 locus. We sequenced the SOX3 gene at Xq27 as a candidate gene for the X-linked anophthalmia based on the high homology of this gene to SOX2, a gene previously mutated in bilateral anophthlamia. However, no amino acid sequence alterations were identified in SOX3. We have improved the definition of the phenotype in males with anophthalmia linked to the ANOP1 locus, as microcephaly, ocular colobomas, and severe renal malformations have not been described in families linked to ANOP1. (c) 2005 Wiley-Liss, Inc.

  7. Identification of KIF3A as a Novel Candidate Gene for Childhood Asthma Using RNA Expression and Population Allelic Frequencies Differences

    PubMed Central

    Butsch Kovacic, Melinda; Biagini Myers, Jocelyn M.; Wang, Ning; Martin, Lisa J.; Lindsey, Mark; Ericksen, Mark B.; He, Hua; Patterson, Tia L.; Baye, Tesfaye M.; Torgerson, Dara; Roth, Lindsey A.; Gupta, Jayanta; Sivaprasad, Umasundari; Gibson, Aaron M.; Tsoras, Anna M.; Hu, Donglei; Eng, Celeste; Chapela, Rocío; Rodríguez-Santana, José R.; Rodríguez-Cintrón, William; Avila, Pedro C.; Beckman, Kenneth; Seibold, Max A.; Gignoux, Chris; Musaad, Salma M.; Chen, Weiguo; Burchard, Esteban González; Khurana Hershey, Gurjit K.

    2011-01-01

    Background Asthma is a chronic inflammatory disease with a strong genetic predisposition. A major challenge for candidate gene association studies in asthma is the selection of biologically relevant genes. Methodology/Principal Findings Using epithelial RNA expression arrays, HapMap allele frequency variation, and the literature, we identified six possible candidate susceptibility genes for childhood asthma including ADCY2, DNAH5, KIF3A, PDE4B, PLAU, SPRR2B. To evaluate these genes, we compared the genotypes of 194 predominantly tagging SNPs in 790 asthmatic, allergic and non-allergic children. We found that SNPs in all six genes were nominally associated with asthma (p<0.05) in our discovery cohort and in three independent cohorts at either the SNP or gene level (p<0.05). Further, we determined that our selection approach was superior to random selection of genes either differentially expressed in asthmatics compared to controls (p = 0.0049) or selected based on the literature alone (p = 0.0049), substantiating the validity of our gene selection approach. Importantly, we observed that 7 of 9 SNPs in the KIF3A gene more than doubled the odds of asthma (OR = 2.3, p<0.0001) and increased the odds of allergic disease (OR = 1.8, p<0.008). Our data indicate that KIF3A rs7737031 (T-allele) has an asthma population attributable risk of 18.5%. The association between KIF3A rs7737031 and asthma was validated in 3 independent populations, further substantiating the validity of our gene selection approach. Conclusions/Significance Our study demonstrates that KIF3A, a member of the kinesin superfamily of microtubule associated motors that are important in the transport of protein complexes within cilia, is a novel candidate gene for childhood asthma. Polymorphisms in KIF3A may in part be responsible for poor mucus and/or allergen clearance from the airways. Furthermore, our study provides a promising framework for the identification and evaluation of novel candidate susceptibility genes. PMID:21912604

  8. Comparative molecular analyses of select pH- and osmoregulatory genes in three freshwater crayfish Cherax quadricarinatus, C. destructor and C. cainii

    PubMed Central

    Pavasovic, Ana; Dammannagoda, Lalith K.; Mather, Peter B.; Prentis, Peter J.

    2017-01-01

    Systemic acid-base balance and osmotic/ionic regulation in decapod crustaceans are in part maintained by a set of transport-related enzymes such as carbonic anhydrase (CA), Na+/K+-ATPase (NKA), H+-ATPase (HAT), Na+/K+/2Cl− cotransporter (NKCC), Na+/Cl−/HCO\\documentclass[12pt]{minimal} \\usepackage{amsmath} \\usepackage{wasysym} \\usepackage{amsfonts} \\usepackage{amssymb} \\usepackage{amsbsy} \\usepackage{upgreek} \\usepackage{mathrsfs} \\setlength{\\oddsidemargin}{-69pt} \\begin{document} }{}${}_{3}^{-}$\\end{document}3− cotransporter (NBC), Na+/H+ exchanger (NHE), Arginine kinase (AK), Sarcoplasmic Ca+2-ATPase (SERCA) and Calreticulin (CRT). We carried out a comparative molecular analysis of these genes in three commercially important yet eco-physiologically distinct freshwater crayfish, Cherax quadricarinatus, C. destructor and C. cainii, with the aim to identify mutations in these genes and determine if observed patterns of mutations were consistent with the action of natural selection. We also conducted a tissue-specific expression analysis of these genes across seven different organs, including gills, hepatopancreas, heart, kidney, liver, nerve and testes using NGS transcriptome data. The molecular analysis of the candidate genes revealed a high level of sequence conservation across the three Cherax sp. Hyphy analysis revealed that all candidate genes showed patterns of molecular variation consistent with neutral evolution. The tissue-specific expression analysis showed that 46% of candidate genes were expressed in all tissue types examined, while approximately 10% of candidate genes were only expressed in a single tissue type. The largest number of genes was observed in nerve (84%) and gills (78%) and the lowest in testes (66%). The tissue-specific expression analysis also revealed that most of the master genes regulating pH and osmoregulation (CA, NKA, HAT, NKCC, NBC, NHE) were expressed in all tissue types indicating an important physiological role for these genes outside of osmoregulation in other tissue types. The high level of sequence conservation observed in the candidate genes may be explained by the important role of these genes as well as potentially having a number of other basic physiological functions in different tissue types. PMID:28852583

  9. Development and application of microsatellites in candidate genes related to wood properties in the Chinese white poplar (Populus tomentosa Carr.).

    PubMed

    Du, Qingzhang; Gong, Chenrui; Pan, Wei; Zhang, Deqiang

    2013-02-01

    Gene-derived simple sequence repeats (genic SSRs), also known as functional markers, are often preferred over random genomic markers because they represent variation in gene coding and/or regulatory regions. We characterized 544 genic SSR loci derived from 138 candidate genes involved in wood formation, distributed throughout the genome of Populus tomentosa, a key ecological and cultivated wood production species. Of these SSRs, three-quarters were located in the promoter or intron regions, and dinucleotide (59.7%) and trinucleotide repeat motifs (26.5%) predominated. By screening 15 wild P. tomentosa ecotypes, we identified 188 polymorphic genic SSRs with 861 alleles, 2-7 alleles for each marker. Transferability analysis of 30 random genic SSRs, testing whether these SSRs work in 26 genotypes of five genus Populus sections (outgroup, Salix matsudana), showed that 72% of the SSRs could be amplified in Turanga and 100% could be amplified in Leuce. Based on genotyping of these 26 genotypes, a neighbour-joining analysis showed the expected six phylogenetic groupings. In silico analysis of SSR variation in 220 sequences that are homologous between P. tomentosa and Populus trichocarpa suggested that genic SSR variations between relatives were predominantly affected by repeat motif variations or flanking sequence mutations. Inheritance tests and single-marker associations demonstrated the power of genic SSRs in family-based linkage mapping and candidate gene-based association studies, as well as marker-assisted selection and comparative genomic studies of P. tomentosa and related species.

  10. Association of candidate genes with drought tolerance traits in diverse perennial ryegrass accessions

    PubMed Central

    Jiang, Yiwei

    2013-01-01

    Drought is a major environmental stress limiting growth of perennial grasses in temperate regions. Plant drought tolerance is a complex trait that is controlled by multiple genes. Candidate gene association mapping provides a powerful tool for dissection of complex traits. Candidate gene association mapping of drought tolerance traits was conducted in 192 diverse perennial ryegrass (Lolium perenne L.) accessions from 43 countries. The panel showed significant variations in leaf wilting, leaf water content, canopy and air temperature difference, and chlorophyll fluorescence under well-watered and drought conditions across six environments. Analysis of 109 simple sequence repeat markers revealed five population structures in the mapping panel. A total of 2520 expression-based sequence readings were obtained for a set of candidate genes involved in antioxidant metabolism, dehydration, water movement across membranes, and signal transduction, from which 346 single nucleotide polymorphisms were identified. Significant associations were identified between a putative LpLEA3 encoding late embryogenesis abundant group 3 protein and a putative LpFeSOD encoding iron superoxide dismutase and leaf water content, as well as between a putative LpCyt Cu-ZnSOD encoding cytosolic copper-zinc superoxide dismutase and chlorophyll fluorescence under drought conditions. Four of these identified significantly associated single nucleotide polymorphisms from these three genes were also translated to amino acid substitutions in different genotypes. These results indicate that allelic variation in these genes may affect whole-plant response to drought stress in perennial ryegrass. PMID:23386684

  11. Comprehensive analysis of alternative splicing and functionality in neuronal differentiation of P19 cells.

    PubMed

    Suzuki, Hitoshi; Osaki, Ken; Sano, Kaori; Alam, A H M Khurshid; Nakamura, Yuichiro; Ishigaki, Yasuhito; Kawahara, Kozo; Tsukahara, Toshifumi

    2011-02-18

    Alternative splicing, which produces multiple mRNAs from a single gene, occurs in most human genes and contributes to protein diversity. Many alternative isoforms are expressed in a spatio-temporal manner, and function in diverse processes, including in the neural system. The purpose of the present study was to comprehensively investigate neural-splicing using P19 cells. GeneChip Exon Array analysis was performed using total RNAs purified from cells during neuronal cell differentiation. To efficiently and readily extract the alternative exon candidates, 9 filtering conditions were prepared, yielding 262 candidate exons (236 genes). Semiquantitative RT-PCR results in 30 randomly selected candidates suggested that 87% of the candidates were differentially alternatively spliced in neuronal cells compared to undifferentiated cells. Gene ontology and pathway analyses suggested that many of the candidate genes were associated with neural events. Together with 66 genes whose functions in neural cells or organs were reported previously, 47 candidate genes were found to be linked to 189 events in the gene-level profile of neural differentiation. By text-mining for the alternative isoform, distinct functions of the isoforms of 9 candidate genes indicated by the result of Exon Array were confirmed. Alternative exons were successfully extracted. Results from the informatics analyses suggested that neural events were primarily governed by genes whose expression was increased and whose transcripts were differentially alternatively spliced in the neuronal cells. In addition to known functions in neural cells or organs, the uninvestigated alternative splicing events of 11 genes among 47 candidate genes suggested that cell cycle events are also potentially important. These genes may help researchers to differentiate the roles of alternative splicing in cell differentiation and cell proliferation.

  12. Candidate-gene association study of mothers with pre-eclampsia, and their infants, analyzing 775 SNPs in 190 genes.

    PubMed

    Goddard, Katrina A B; Tromp, Gerard; Romero, Roberto; Olson, Jane M; Lu, Qing; Xu, Zhiying; Parimi, Neeta; Nien, Jyh Kae; Gomez, Ricardo; Behnke, Ernesto; Solari, Margarita; Espinoza, Jimmy; Santolaya, Joaquin; Chaiworapongsa, Tinnakorn; Lenk, Guy M; Volkenant, Kimberly; Anant, Madan Kumar; Salisbury, Benjamin A; Carr, Janet; Lee, Min Soeb; Vovis, Gerald F; Kuivaniemi, Helena

    2007-01-01

    Pre-eclampsia (PE) affects 5-7% of pregnancies in the US, and is a leading cause of maternal death and perinatal morbidity and mortality worldwide. To identify genes with a role in PE, we conducted a large-scale association study evaluating 775 SNPs in 190 candidate genes selected for a potential role in obstetrical complications. SNP discovery was performed by DNA sequencing, and genotyping was carried out in a high-throughput facility using the MassARRAY(TM) System. Women with PE (n = 394) and their offspring (n = 324) were compared with control women (n = 602) and their offspring (n = 631) from the same hospital-based population. Haplotypes were estimated for each gene using the EM algorithm, and empirical p values were obtained for a logistic regression-based score test, adjusted for significant covariates. An interaction model between maternal and offspring genotypes was also evaluated. The most significant findings for association with PE were COL1A1 (p = 0.0011) and IL1A (p = 0.0014) for the maternal genotype, and PLAUR (p = 0.0008) for the offspring genotype. Common candidate genes for PE, including MTHFR and NOS3, were not significantly associated with PE. For the interaction model, SNPs within IGF1 (p = 0.0035) and IL4R (p = 0.0036) gave the most significant results. This study is one of the most comprehensive genetic association studies of PE to date, including an evaluation of offspring genotypes that have rarely been considered in previous studies. Although we did not identify statistically significant evidence of association for any of the candidate loci evaluated here after adjusting for multiple testing using the false discovery rate, additional compelling evidence exists, including multiple SNPs with nominally significant p values in COL1A1 and the IL1A region, and previous reports of association for IL1A, to support continued interest in these genes as candidates for PE. Identification of the genetic regulators of PE may have broader implications, since women with PE are at increased risk of death from cardiovascular diseases later in life.

  13. An Expressed Sequence Tag collection from the male antennae of the Noctuid moth Spodoptera littoralis: a resource for olfactory and pheromone detection research

    PubMed Central

    2011-01-01

    Background Nocturnal insects such as moths are ideal models to study the molecular bases of olfaction that they use, among examples, for the detection of mating partners and host plants. Knowing how an odour generates a neuronal signal in insect antennae is crucial for understanding the physiological bases of olfaction, and also could lead to the identification of original targets for the development of olfactory-based control strategies against herbivorous moth pests. Here, we describe an Expressed Sequence Tag (EST) project to characterize the antennal transcriptome of the noctuid pest model, Spodoptera littoralis, and to identify candidate genes involved in odour/pheromone detection. Results By targeting cDNAs from male antennae, we biased gene discovery towards genes potentially involved in male olfaction, including pheromone reception. A total of 20760 ESTs were obtained from a normalized library and were assembled in 9033 unigenes. 6530 were annotated based on BLAST analyses and gene prediction software identified 6738 ORFs. The unigenes were compared to the Bombyx mori proteome and to ESTs derived from Lepidoptera transcriptome projects. We identified a large number of candidate genes involved in odour and pheromone detection and turnover, including 31 candidate chemosensory receptor genes, but also genes potentially involved in olfactory modulation. Conclusions Our project has generated a large collection of antennal transcripts from a Lepidoptera. The normalization process, allowing enrichment in low abundant genes, proved to be particularly relevant to identify chemosensory receptors in a species for which no genomic data are available. Our results also suggest that olfactory modulation can take place at the level of the antennae itself. These EST resources will be invaluable for exploring the mechanisms of olfaction and pheromone detection in S. littoralis, and for ultimately identifying original targets to fight against moth herbivorous pests. PMID:21276261

  14. Disease gene prioritization by integrating tissue-specific molecular networks using a robust multi-network model.

    PubMed

    Ni, Jingchao; Koyuturk, Mehmet; Tong, Hanghang; Haines, Jonathan; Xu, Rong; Zhang, Xiang

    2016-11-10

    Accurately prioritizing candidate disease genes is an important and challenging problem. Various network-based methods have been developed to predict potential disease genes by utilizing the disease similarity network and molecular networks such as protein interaction or gene co-expression networks. Although successful, a common limitation of the existing methods is that they assume all diseases share the same molecular network and a single generic molecular network is used to predict candidate genes for all diseases. However, different diseases tend to manifest in different tissues, and the molecular networks in different tissues are usually different. An ideal method should be able to incorporate tissue-specific molecular networks for different diseases. In this paper, we develop a robust and flexible method to integrate tissue-specific molecular networks for disease gene prioritization. Our method allows each disease to have its own tissue-specific network(s). We formulate the problem of candidate gene prioritization as an optimization problem based on network propagation. When there are multiple tissue-specific networks available for a disease, our method can automatically infer the relative importance of each tissue-specific network. Thus it is robust to the noisy and incomplete network data. To solve the optimization problem, we develop fast algorithms which have linear time complexities in the number of nodes in the molecular networks. We also provide rigorous theoretical foundations for our algorithms in terms of their optimality and convergence properties. Extensive experimental results show that our method can significantly improve the accuracy of candidate gene prioritization compared with the state-of-the-art methods. In our experiments, we compare our methods with 7 popular network-based disease gene prioritization algorithms on diseases from Online Mendelian Inheritance in Man (OMIM) database. The experimental results demonstrate that our methods recover true associations more accurately than other methods in terms of AUC values, and the performance differences are significant (with paired t-test p-values less than 0.05). This validates the importance to integrate tissue-specific molecular networks for studying disease gene prioritization and show the superiority of our network models and ranking algorithms toward this purpose. The source code and datasets are available at http://nijingchao.github.io/CRstar/ .

  15. Discovery of new candidate genes for rheumatoid arthritis through integration of genetic association data with expression pathway analysis.

    PubMed

    Shchetynsky, Klementy; Diaz-Gallo, Lina-Marcella; Folkersen, Lasse; Hensvold, Aase Haj; Catrina, Anca Irinel; Berg, Louise; Klareskog, Lars; Padyukov, Leonid

    2017-02-02

    Here we integrate verified signals from previous genetic association studies with gene expression and pathway analysis for discovery of new candidate genes and signaling networks, relevant for rheumatoid arthritis (RA). RNA-sequencing-(RNA-seq)-based expression analysis of 377 genes from previously verified RA-associated loci was performed in blood cells from 5 newly diagnosed, non-treated patients with RA, 7 patients with treated RA and 12 healthy controls. Differentially expressed genes sharing a similar expression pattern in treated and untreated RA sub-groups were selected for pathway analysis. A set of "connector" genes derived from pathway analysis was tested for differential expression in the initial discovery cohort and validated in blood cells from 73 patients with RA and in 35 healthy controls. There were 11 qualifying genes selected for pathway analysis and these were grouped into two evidence-based functional networks, containing 29 and 27 additional connector molecules. The expression of genes, corresponding to connector molecules was then tested in the initial RNA-seq data. Differences in the expression of ERBB2, TP53 and THOP1 were similar in both treated and non-treated patients with RA and an additional nine genes were differentially expressed in at least one group of patients compared to healthy controls. The ERBB2, TP53. THOP1 expression profile was successfully replicated in RNA-seq data from peripheral blood mononuclear cells from healthy controls and non-treated patients with RA, in an independent collection of samples. Integration of RNA-seq data with findings from association studies, and consequent pathway analysis implicate new candidate genes, ERBB2, TP53 and THOP1 in the pathogenesis of RA.

  16. Exome-based analysis of cardiac arrhythmia, respiratory control, and epilepsy genes in sudden unexpected death in epilepsy.

    PubMed

    Bagnall, Richard D; Crompton, Douglas E; Petrovski, Slavé; Lam, Lien; Cutmore, Carina; Garry, Sarah I; Sadleir, Lynette G; Dibbens, Leanne M; Cairns, Anita; Kivity, Sara; Afawi, Zaid; Regan, Brigid M; Duflou, Johan; Berkovic, Samuel F; Scheffer, Ingrid E; Semsarian, Christopher

    2016-04-01

    The leading cause of epilepsy-related premature mortality is sudden unexpected death in epilepsy (SUDEP). The cause of SUDEP remains unknown. To search for genetic risk factors in SUDEP cases, we performed an exome-based analysis of rare variants. Demographic and clinical information of 61 SUDEP cases were collected. Exome sequencing and rare variant collapsing analysis with 2,936 control exomes were performed to test for genes enriched with damaging variants. Additionally, cardiac arrhythmia, respiratory control, and epilepsy genes were screened for variants with frequency of <0.1% and predicted to be pathogenic with multiple in silico tools. The 61 SUDEP cases were categorized as definite SUDEP (n = 54), probable SUDEP (n = 5), and definite SUDEP plus (n = 2). We identified de novo mutations, previously reported pathogenic mutations, or candidate pathogenic variants in 28 of 61 (46%) cases. Four SUDEP cases (7%) had mutations in common genes responsible for the cardiac arrhythmia disease, long QT syndrome (LQTS). Nine cases (15%) had candidate pathogenic variants in dominant cardiac arrhythmia genes. Fifteen cases (25%) had mutations or candidate pathogenic variants in dominant epilepsy genes. No gene reached genome-wide significance with rare variant collapsing analysis; however, DEPDC5 (p = 0.00015) and KCNH2 (p = 0.0037) were among the top 30 genes, genome-wide. A sizeable proportion of SUDEP cases have clinically relevant mutations in cardiac arrhythmia and epilepsy genes. In cases with an LQTS gene mutation, SUDEP may occur as a result of a predictable and preventable cause. Understanding the genetic basis of SUDEP may inform cascade testing of at-risk family members. © 2016 American Neurological Association.

  17. Genetic findings in anorexia and bulimia nervosa.

    PubMed

    Hinney, Anke; Scherag, Susann; Hebebrand, Johannes

    2010-01-01

    Anorexia nervosa (AN) and bulimia nervosa (BN) are complex disorders associated with disordered eating behavior. Heritability estimates derived from twin and family studies are high, so that substantial genetic influences on the etiology can be assumed for both. As the monoaminergic neurotransmitter systems are involved in eating disorders (EDs), candidate gene studies have centered on related genes; additionally, genes relevant for body weight regulation have been considered as candidates. Unfortunately, this approach has yielded very few positive results; confirmed associations or findings substantiated in meta-analyses are scant. None of these associations can be considered unequivocally validated. Systematic genome-wide approaches have been performed to identify genes with no a priori evidence for their relevance in EDs. Family-based scans revealed linkage peaks in single chromosomal regions for AN and BN. Analyses of candidate genes in one of these regions led to the identification of genetic variants associated with AN. Currently, an international consortium is conducting a genome-wide association study for AN, which will hopefully lead to the identification of the first genome-wide significant markers. Copyright © 2010 Elsevier Inc. All rights reserved.

  18. Association of Genetic Loci with Sleep Apnea in European Americans and African-Americans: The Candidate Gene Association Resource (CARe)

    PubMed Central

    Patel, Sanjay R.; Goodloe, Robert; De, Gourab; Kowgier, Matthew; Weng, Jia; Buxbaum, Sarah G.; Cade, Brian; Fulop, Tibor; Gharib, Sina A.; Gottlieb, Daniel J.; Hillman, David; Larkin, Emma K.; Lauderdale, Diane S.; Li, Li; Mukherjee, Sutapa; Palmer, Lyle; Zee, Phyllis; Zhu, Xiaofeng; Redline, Susan

    2012-01-01

    Although obstructive sleep apnea (OSA) is known to have a strong familial basis, no genetic polymorphisms influencing apnea risk have been identified in cross-cohort analyses. We utilized the National Heart, Lung, and Blood Institute (NHLBI) Candidate Gene Association Resource (CARe) to identify sleep apnea susceptibility loci. Using a panel of 46,449 polymorphisms from roughly 2,100 candidate genes on a customized Illumina iSelect chip, we tested for association with the apnea hypopnea index (AHI) as well as moderate to severe OSA (AHI≥15) in 3,551 participants of the Cleveland Family Study and two cohorts participating in the Sleep Heart Health Study. Among 647 African-Americans, rs11126184 in the pleckstrin (PLEK) gene was associated with OSA while rs7030789 in the lysophosphatidic acid receptor 1 (LPAR1) gene was associated with AHI using a chip-wide significance threshold of p-value<2×10−6. Among 2,904 individuals of European ancestry, rs1409986 in the prostaglandin E2 receptor (PTGER3) gene was significantly associated with OSA. Consistency of effects between rs7030789 and rs1409986 in LPAR1 and PTGER3 and apnea phenotypes were observed in independent clinic-based cohorts. Novel genetic loci for apnea phenotypes were identified through the use of customized gene chips and meta-analyses of cohort data with replication in clinic-based samples. The identified SNPs all lie in genes associated with inflammation suggesting inflammation may play a role in OSA pathogenesis. PMID:23155414

  19. Genetic variation predicting cisplatin cytotoxicity associated with overall survival in lung cancer patients receiving platinum-based chemotherapy †, ‡

    PubMed Central

    Tan, Xiang-Lin; Moyer, Ann M.; Fridley, Brooke L.; Schaid, Daniel J.; Niu, Nifang; Batzler, Anthony J.; Jenkins, Gregory D.; Abo, Ryan P.; Li, Liang; Cunningham, Julie M.; Sun, Zhifu; Yang, Ping; Wang, Liewei

    2011-01-01

    Purpose Inherited variability in the prognosis of lung cancer patients treated with platinum-based chemotherapy has been widely investigated. However, the overall contribution of genetic variation to platinum response is not well established. To identify novel candidate SNPs/genes, we performed a genome-wide association study (GWAS) for cisplatin cytotoxicity using lymphoblastoid cell lines (LCLs), followed by an association study of selected SNPs from the GWAS with overall survival (OS) in lung cancer patients. Experimental Design GWAS for cisplatin were performed with 283 ethnically diverse LCLs. 168 top SNPs were genotyped in 222 small cell and 961 non-small cell lung cancer (SCLC, NSCLC) patients treated with platinum-based therapy. Association of the SNPs with OS was determined using the Cox regression model. Selected candidate genes were functionally validated by siRNA knockdown in human lung cancer cells. Results Among 157 successfully genotyped SNPs, 9 and 10 SNPs were top SNPs associated with OS for patients with NSCLC and SCLC, respectively, although they were not significant after adjusting for multiple testing. Fifteen genes, including 7 located within 200 kb up or downstream of the four top SNPs and 8 genes for which expression was correlated with three SNPs in LCLs were selected for siRNA screening. Knockdown of DAPK3 and METTL6, for which expression levels were correlated with the rs11169748 and rs2440915 SNPs, significantly decreased cisplatin sensitivity in lung cancer cells. Conclusions This series of clinical and complementary laboratory-based functional studies identified several candidate genes/SNPs that might help predict treatment outcomes for platinum-based therapy of lung cancer. PMID:21775533

  20. Identification and fine mapping of a stay-green gene (Brnye1) in pakchoi (Brassica campestris L. ssp. chinensis).

    PubMed

    Wang, Nan; Liu, Zhiyong; Zhang, Yun; Li, Chengyu; Feng, Hui

    2018-03-01

    Using bulked segregant analysis combined with next-generation sequencing, we delimited the Brnye1 gene responsible for the stay-green trait of nye in pakchoi. Sequence analysis identified Bra019346 as the candidate gene. "Stay-green" refers to a plant trait whereby leaves remain green during senescence. This trait is useful in the cultivation of pakchoi (Brassica campestris L. ssp. chinensis), which is marketed as a green leaf product. This study aimed to identify the gene responsible for the stay-green trait in pakchoi. We identified a stay-green mutant in pakchoi, which we termed "nye". Genetic analysis revealed that the stay-green trait is controlled by a single recessive gene, Brnye1. Using the BSA-seq method, a 3.0-Mb candidate region was mapped on chromosome A03, which helped us localize Brnye1 to an 81.01-kb interval between SSR markers SSRWN27 and SSRWN30 via linkage analysis in an F 2 population. We identified 12 genes in this region, 11 of which were annotated based on the Brassica rapa annotation database, and one was a functionally unknown gene. An orthologous gene of the Arabidopsis gene AtNYE1, Bra019346, was identified as the potential candidate for Brnye1. Sequence analysis revealed a 40-bp insertion in the second exon of Bra019346 in nye, which generated the TAA stop codon. A candidate gene-specific Indel marker in 1561 F 2 individuals showed perfect cosegregation with Brnye1 in the nye mutant. These results provide a foundation for uncovering the molecular mechanism of the stay-green trait in pakchoi.

  1. Prioritization of candidate disease genes by combining topological similarity and semantic similarity.

    PubMed

    Liu, Bin; Jin, Min; Zeng, Pan

    2015-10-01

    The identification of gene-phenotype relationships is very important for the treatment of human diseases. Studies have shown that genes causing the same or similar phenotypes tend to interact with each other in a protein-protein interaction (PPI) network. Thus, many identification methods based on the PPI network model have achieved good results. However, in the PPI network, some interactions between the proteins encoded by candidate gene and the proteins encoded by known disease genes are very weak. Therefore, some studies have combined the PPI network with other genomic information and reported good predictive performances. However, we believe that the results could be further improved. In this paper, we propose a new method that uses the semantic similarity between the candidate gene and known disease genes to set the initial probability vector of a random walk with a restart algorithm in a human PPI network. The effectiveness of our method was demonstrated by leave-one-out cross-validation, and the experimental results indicated that our method outperformed other methods. Additionally, our method can predict new causative genes of multifactor diseases, including Parkinson's disease, breast cancer and obesity. The top predictions were good and consistent with the findings in the literature, which further illustrates the effectiveness of our method. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. Convergence of GWA and candidate gene studies for alcoholism

    PubMed Central

    Olfson, Emily; Bierut, Laura Jean

    2012-01-01

    Background Genome-wide association (GWA) studies have led to a paradigm shift in how researchers study the genetics underlying disease. Many GWA studies are now publicly available and can be used to examine whether or not previously proposed candidate genes are supported by GWA data. This approach is particularly important for the field of alcoholism because the contribution of many candidate genes remains controversial. Methods Using the Human Genome Epidemiology (HuGE) Navigator, we selected candidate genes for alcoholism that have been frequently examined in scientific articles in the past decade. Specific candidate loci as well as all the reported SNPs in candidate genes were examined in the Study of Alcohol Addiction: Genetics and Addiction (SAGE), a GWA study comparing alcohol dependent and non-dependent subjects. Results Several commonly reported candidate loci, including rs1800497 in DRD2, rs698 in ADH1C, rs1799971 in OPRM1 and rs4680 in COMT, are not replicated in SAGE (p> .05). Among candidate loci available for analysis, only rs279858 in GABRA2 (p=0.0052, OR=1.16) demonstrated a modest association. Examination of all SNPs reported in SAGE in over 50 candidate genes revealed no SNPs with large frequency differences between cases and controls and the lowest p value of any SNP was .0006. Discussion We provide evidence that several extensively studied candidate loci do not have a strong contribution to risk of developing alcohol dependence in European and African Ancestry populations. Due to lack of coverage, we were unable to rule out the contribution of other variants and these genes and particular loci warrant further investigation. Our analysis demonstrates that publicly available GWA results can be used to better understand which if any of previously proposed candidate genes contribute to disease. Furthermore, we illustrate how examining the convergence of candidate gene and GWA studies can help elucidate the genetic architecture of alcoholism and more generally complex diseases. PMID:22978509

  3. NDRC: A Disease-Causing Genes Prioritized Method Based on Network Diffusion and Rank Concordance.

    PubMed

    Fang, Minghong; Hu, Xiaohua; Wang, Yan; Zhao, Junmin; Shen, Xianjun; He, Tingting

    2015-07-01

    Disease-causing genes prioritization is very important to understand disease mechanisms and biomedical applications, such as design of drugs. Previous studies have shown that promising candidate genes are mostly ranked according to their relatedness to known disease genes or closely related disease genes. Therefore, a dangling gene (isolated gene) with no edges in the network can not be effectively prioritized. These approaches tend to prioritize those genes that are highly connected in the PPI network while perform poorly when they are applied to loosely connected disease genes. To address these problems, we propose a new disease-causing genes prioritization method that based on network diffusion and rank concordance (NDRC). The method is evaluated by leave-one-out cross validation on 1931 diseases in which at least one gene is known to be involved, and it is able to rank the true causal gene first in 849 of all 2542 cases. The experimental results suggest that NDRC significantly outperforms other existing methods such as RWR, VAVIEN, DADA and PRINCE on identifying loosely connected disease genes and successfully put dangling genes as potential candidate disease genes. Furthermore, we apply NDRC method to study three representative diseases, Meckel syndrome 1, Protein C deficiency and Peroxisome biogenesis disorder 1A (Zellweger). Our study has also found that certain complex disease-causing genes can be divided into several modules that are closely associated with different disease phenotype.

  4. Report from the Maryland epidemiology schizophrenia linkage study: No evidence for linkage between schizophrenia and a number of candidate and other genomic regions using a complex dominant model

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Karayiorgou, M.; Hwang, J.; Elango, R.

    Our collaborative group has undertaken a linkage study of schizophrenia, using a systematic sample of patients admitted to Maryland hospitals. An initial sample of 39 families, each having two or more affecteds, was available for genotyping candidate genes, candidate regions, and highly polymorphic markers randomly distributed throughout the genome. We used a single complex dominant model (with a disease gene frequency of 0.005 and age-dependent penetrance for affected phenotype: for under 35, penetrance = .45; for 35 and older, penetrance = .85). We report here 130 markers which met the exclusion criteria of LOD score < -2.00 at theta >more » 0.01 in at least 10 informative families, and no evidence for heterogeneity. We also report here markers that were tested as candidates for linkage to the schizophrenic phenotype. They were selected based on the following criteria: (a) proximity to reported chromosomal rearrangements (both 5q and 11q), (b) suggestions of linkage from other families (5q), or (c) presence of a candidate gene (5q, 11q, 3q: dopamine receptors 1, 2, and 3, respectively). We also tested for mutations of codon 717 in exon 17 of the amyloid precursor protein (APP) gene and were unable to detect the C to T substitution in our schizophrenic group. 48 refs., 2 tabs.« less

  5. A direct molecular link between the autism candidate gene RORa and the schizophrenia candidate MIR137

    NASA Astrophysics Data System (ADS)

    Devanna, Paolo; Vernes, Sonja C.

    2014-02-01

    Retinoic acid-related orphan receptor alpha gene (RORa) and the microRNA MIR137 have both recently been identified as novel candidate genes for neuropsychiatric disorders. RORa encodes a ligand-dependent orphan nuclear receptor that acts as a transcriptional regulator and miR-137 is a brain enriched small non-coding RNA that interacts with gene transcripts to control protein levels. Given the mounting evidence for RORa in autism spectrum disorders (ASD) and MIR137 in schizophrenia and ASD, we investigated if there was a functional biological relationship between these two genes. Herein, we demonstrate that miR-137 targets the 3'UTR of RORa in a site specific manner. We also provide further support for MIR137 as an autism candidate by showing that a large number of previously implicated autism genes are also putatively targeted by miR-137. This work supports the role of MIR137 as an ASD candidate and demonstrates a direct biological link between these previously unrelated autism candidate genes.

  6. Identifying metabolic enzymes with multiple types of association evidence

    PubMed Central

    Kharchenko, Peter; Chen, Lifeng; Freund, Yoav; Vitkup, Dennis; Church, George M

    2006-01-01

    Background Existing large-scale metabolic models of sequenced organisms commonly include enzymatic functions which can not be attributed to any gene in that organism. Existing computational strategies for identifying such missing genes rely primarily on sequence homology to known enzyme-encoding genes. Results We present a novel method for identifying genes encoding for a specific metabolic function based on a local structure of metabolic network and multiple types of functional association evidence, including clustering of genes on the chromosome, similarity of phylogenetic profiles, gene expression, protein fusion events and others. Using E. coli and S. cerevisiae metabolic networks, we illustrate predictive ability of each individual type of association evidence and show that significantly better predictions can be obtained based on the combination of all data. In this way our method is able to predict 60% of enzyme-encoding genes of E. coli metabolism within the top 10 (out of 3551) candidates for their enzymatic function, and as a top candidate within 43% of the cases. Conclusion We illustrate that a combination of genome context and other functional association evidence is effective in predicting genes encoding metabolic enzymes. Our approach does not rely on direct sequence homology to known enzyme-encoding genes, and can be used in conjunction with traditional homology-based metabolic reconstruction methods. The method can also be used to target orphan metabolic activities. PMID:16571130

  7. A Gene-Oriented Haplotype Comparison Reveals Recently Selected Genomic Regions in Temperate and Tropical Maize Germplasm

    PubMed Central

    Zhang, Jie; Li, Yongxiang; Zheng, Jun; Zhang, Hongwei; Yang, Xiaohong; Wang, Jianhua; Wang, Guoying

    2017-01-01

    The extensive genetic variation present in maize (Zea mays) germplasm makes it possible to detect signatures of positive artificial selection that occurred during temperate and tropical maize improvement. Here we report an analysis of 532,815 polymorphisms from a maize association panel consisting of 368 diverse temperate and tropical inbred lines. We developed a gene-oriented approach adapting exonic polymorphisms to identify recently selected alleles by comparing haplotypes across the maize genome. This analysis revealed evidence of selection for more than 1100 genomic regions during recent improvement, and included regulatory genes and key genes with visible mutant phenotypes. We find that selected candidate target genes in temperate maize are enriched in biosynthetic processes, and further examination of these candidates highlights two cases, sucrose flux and oil storage, in which multiple genes in a common pathway can be cooperatively selected. Finally, based on available parallel gene expression data, we hypothesize that some genes were selected for regulatory variations, resulting in altered gene expression. PMID:28099470

  8. Modulators of the microRNA biogenesis pathway via arrayed lentiviral enabled RNAi screening for drug and biomarker discovery

    PubMed Central

    Shum, David; Bhinder, Bhavneet; Djaballah, Hakim

    2013-01-01

    MicroRNAs (miRNAs) are small endogenous and conserved non-coding RNA molecules that regulate gene expression. Although the first miRNA was discovered well over sixteen years ago, little is known about their biogenesis and it is only recently that we have begun to understand their scope and diversity. For this purpose, we performed an RNAi screen aimed at identifying genes involved in their biogenesis pathway with a potential use as biomarkers. Using a previously developed miRNA 21 (miR-21) EGFP-based biosensor cell based assay monitoring green fluorescence enhancements, we performed an arrayed short hairpin RNA (shRNA) screen against a lentiviral particle ready TRC1 library covering 16,039 genes in 384-well plate format, and interrogating the genome one gene at a time building a panoramic view of endogenous miRNA activity. Using the BDA method for RNAi data analysis, we nominate 497 gene candidates the knockdown of which increased the EGFP fluorescence and yielding an initial hit rate of 3.09%; of which only 22, with reported validated clones, are deemed high-confidence gene candidates. An unexpected and surprising result was that only DROSHA was identified as a hit out of the seven core essential miRNA biogenesis genes; suggesting that perhaps intracellular shRNA processing into the correct duplex may be cell dependent and with differential outcome. Biological classification revealed several major control junctions among them genes involved in transport and vesicular trafficking. In summary, we report on 22 high confidence gene candidate regulators of miRNA biogenesis with potential use in drug and biomarker discovery. PMID:23977983

  9. A small number of candidate gene SNPs reveal continental ancestry in African Americans

    PubMed Central

    KODAMAN, NURI; ALDRICH, MELINDA C.; SMITH, JEFFREY R.; SIGNORELLO, LISA B.; BRADLEY, KEVIN; BREYER, JOAN; COHEN, SARAH S.; LONG, JIRONG; CAI, QIUYIN; GILES, JUSTIN; BUSH, WILLIAM S.; BLOT, WILLIAM J.; MATTHEWS, CHARLES E.; WILLIAMS, SCOTT M.

    2013-01-01

    SUMMARY Using genetic data from an obesity candidate gene study of self-reported African Americans and European Americans, we investigated the number of Ancestry Informative Markers (AIMs) and candidate gene SNPs necessary to infer continental ancestry. Proportions of African and European ancestry were assessed with STRUCTURE (K=2), using 276 AIMs. These reference values were compared to estimates derived using 120, 60, 30, and 15 SNP subsets randomly chosen from the 276 AIMs and from 1144 SNPs in 44 candidate genes. All subsets generated estimates of ancestry consistent with the reference estimates, with mean correlations greater than 0.99 for all subsets of AIMs, and mean correlations of 0.99±0.003; 0.98± 0.01; 0.93±0.03; and 0.81± 0.11 for subsets of 120, 60, 30, and 15 candidate gene SNPs, respectively. Among African Americans, the median absolute difference from reference African ancestry values ranged from 0.01 to 0.03 for the four AIMs subsets and from 0.03 to 0.09 for the four candidate gene SNP subsets. Furthermore, YRI/CEU Fst values provided a metric to predict the performance of candidate gene SNPs. Our results demonstrate that a small number of SNPs randomly selected from candidate genes can be used to estimate admixture proportions in African Americans reliably. PMID:23278390

  10. Presymptomatic Diagnosis of Celiac Disease in Predisposed Children: The Role of Gene Expression Profile.

    PubMed

    Galatola, Martina; Cielo, Donatella; Panico, Camilla; Stellato, Pio; Malamisura, Basilio; Carbone, Lorenzo; Gianfrani, Carmen; Troncone, Riccardo; Greco, Luigi; Auricchio, Renata

    2017-09-01

    The prevalence of celiac disease (CD) has increased significantly in recent years, and risk prediction and early diagnosis have become imperative especially in at-risk families. In a previous study, we identified individuals with CD based on the expression profile of a set of candidate genes in peripheral blood monocytes. Here we evaluated the expression of a panel of CD candidate genes in peripheral blood mononuclear cells from at-risk infants long time before any symptom or production of antibodies. We analyzed the gene expression of a set of 9 candidate genes, associated with CD, in 22 human leukocyte antigen predisposed children from at-risk families for CD, studied from birth to 6 years of age. Nine of them developed CD (patients) and 13 did not (controls). We analyzed gene expression at 3 different time points (age matched in the 2 groups): 4-19 months before diagnosis, at the time of CD diagnosis, and after at least 1 year of a gluten-free diet. At similar age points, controls were also evaluated. Three genes (KIAA, TAGAP [T-cell Activation GTPase Activating Protein], and SH2B3 [SH2B Adaptor Protein 3]) were overexpressed in patients, compared with controls, at least 9 months before CD diagnosis. At a stepwise discriminant analysis, 4 genes (RGS1 [Regulator of G-protein signaling 1], TAGAP, TNFSF14 [Tumor Necrosis Factor (Ligand) Superfamily member 14], and SH2B3) differentiate patients from controls before serum antibodies production and clinical symptoms. Multivariate equation correctly classified CD from non-CD children in 95.5% of patients. The expression of a small set of candidate genes in peripheral blood mononuclear cells can predict CD at least 9 months before the appearance of any clinical and serological signs of the disease.

  11. Genetic neuropathology of obsessive psychiatric syndromes

    PubMed Central

    Jaffe, A E; Deep-Soboslay, A; Tao, R; Hauptman, D T; Kaye, W H; Arango, V; Weinberger, D R; Hyde, T M; Kleinman, J E

    2014-01-01

    Anorexia nervosa (AN), bulimia nervosa (BN) and obsessive-compulsive disorder (OCD) are complex psychiatric disorders with shared obsessive features, thought to arise from the interaction of multiple genes of small effect with environmental factors. Potential candidate genes for AN, BN and OCD have been identified through clinical association and neuroimaging studies; however, recent genome-wide association studies of eating disorders (ED) so far have failed to report significant findings. In addition, few, if any, studies have interrogated postmortem brain tissue for evidence of expression quantitative trait loci (eQTLs) associated with candidate genes, which has particular promise as an approach to elucidating molecular mechanisms of association. We therefore selected single-nucleotide polymorphisms (SNPs) based on candidate gene studies for AN, BN and OCD from the literature, and examined the association of these SNPs with gene expression across the lifespan in prefrontal cortex of a nonpsychiatric control cohort (N=268). Several risk-predisposing SNPs were significantly associated with gene expression among control subjects. We then measured gene expression in the prefrontal cortex of cases previously diagnosed with obsessive psychiatric disorders, for example, ED (N=15) and OCD/obsessive-compulsive personality disorder or tics (OCD/OCPD/Tic; N=16), and nonpsychiatric controls (N=102) and identified 6 and 286 genes that were differentially expressed between ED compared with controls and OCD cases compared with controls, respectively (false discovery rate (FDR) <5%). However, none of the clinical risk SNPs were among the eQTLs and none were significantly associated with gene expression within the broad obsessive cohort, suggesting larger sample sizes or other brain regions may be required to identify candidate molecular mechanisms of clinical association in postmortem brain data sets. PMID:25180571

  12. Genetic neuropathology of obsessive psychiatric syndromes.

    PubMed

    Jaffe, A E; Deep-Soboslay, A; Tao, R; Hauptman, D T; Kaye, W H; Arango, V; Weinberger, D R; Hyde, T M; Kleinman, J E

    2014-09-02

    Anorexia nervosa (AN), bulimia nervosa (BN) and obsessive-compulsive disorder (OCD) are complex psychiatric disorders with shared obsessive features, thought to arise from the interaction of multiple genes of small effect with environmental factors. Potential candidate genes for AN, BN and OCD have been identified through clinical association and neuroimaging studies; however, recent genome-wide association studies of eating disorders (ED) so far have failed to report significant findings. In addition, few, if any, studies have interrogated postmortem brain tissue for evidence of expression quantitative trait loci (eQTLs) associated with candidate genes, which has particular promise as an approach to elucidating molecular mechanisms of association. We therefore selected single-nucleotide polymorphisms (SNPs) based on candidate gene studies for AN, BN and OCD from the literature, and examined the association of these SNPs with gene expression across the lifespan in prefrontal cortex of a nonpsychiatric control cohort (N=268). Several risk-predisposing SNPs were significantly associated with gene expression among control subjects. We then measured gene expression in the prefrontal cortex of cases previously diagnosed with obsessive psychiatric disorders, for example, ED (N=15) and OCD/obsessive-compulsive personality disorder or tics (OCD/OCPD/Tic; N=16), and nonpsychiatric controls (N=102) and identified 6 and 286 genes that were differentially expressed between ED compared with controls and OCD cases compared with controls, respectively (false discovery rate (FDR) <5%). However, none of the clinical risk SNPs were among the eQTLs and none were significantly associated with gene expression within the broad obsessive cohort, suggesting larger sample sizes or other brain regions may be required to identify candidate molecular mechanisms of clinical association in postmortem brain data sets.

  13. Selection of Reference Genes for Expression Studies of Xenobiotic Adaptation in Tetranychus urticae.

    PubMed

    Morales, Mariany Ashanty; Mendoza, Bianca Marie; Lavine, Laura Corley; Lavine, Mark Daniel; Walsh, Douglas Bruce; Zhu, Fang

    2016-01-01

    Quantitative real-time PCR (qRT-PCR) is an extensively used, high-throughput method to analyze transcriptional expression of genes of interest. An appropriate normalization strategy with reliable reference genes is required for calculating gene expression across diverse experimental conditions. In this study, we aim to identify the most stable reference genes for expression studies of xenobiotic adaptation in Tetranychus urticae, an extremely polyphagous herbivore causing significant yield reduction of agriculture. We chose eight commonly used housekeeping genes as candidates. The qRT-PCR expression data for these genes were evaluated from seven populations: a susceptible and three acaricide resistant populations feeding on lima beans, and three other susceptible populations which had been shifted host from lima beans to three other plant species. The stability of the candidate reference genes was then assessed using four different algorithms (comparative ΔCt method, geNorm, NormFinder, and BestKeeper). Additionally, we used an online web-based tool (RefFinder) to assign an overall final rank for each candidate gene. Our study found that CycA and Rp49 are best for investigating gene expression in acaricide susceptible and resistant populations. GAPDH, Rp49, and Rpl18 are best for host plant shift studies. And GAPDH and Rp49 were the most stable reference genes when investigating gene expression under changes in both experimental conditions. These results will facilitate research in revealing molecular mechanisms underlying the xenobiotic adaptation of this notorious agricultural pest.

  14. Selection of Reference Genes for Expression Studies of Xenobiotic Adaptation in Tetranychus urticae

    PubMed Central

    Morales, Mariany Ashanty; Mendoza, Bianca Marie; Lavine, Laura Corley; Lavine, Mark Daniel; Walsh, Douglas Bruce; Zhu, Fang

    2016-01-01

    Quantitative real-time PCR (qRT-PCR) is an extensively used, high-throughput method to analyze transcriptional expression of genes of interest. An appropriate normalization strategy with reliable reference genes is required for calculating gene expression across diverse experimental conditions. In this study, we aim to identify the most stable reference genes for expression studies of xenobiotic adaptation in Tetranychus urticae, an extremely polyphagous herbivore causing significant yield reduction of agriculture. We chose eight commonly used housekeeping genes as candidates. The qRT-PCR expression data for these genes were evaluated from seven populations: a susceptible and three acaricide resistant populations feeding on lima beans, and three other susceptible populations which had been shifted host from lima beans to three other plant species. The stability of the candidate reference genes was then assessed using four different algorithms (comparative ΔCt method, geNorm, NormFinder, and BestKeeper). Additionally, we used an online web-based tool (RefFinder) to assign an overall final rank for each candidate gene. Our study found that CycA and Rp49 are best for investigating gene expression in acaricide susceptible and resistant populations. GAPDH, Rp49, and Rpl18 are best for host plant shift studies. And GAPDH and Rp49 were the most stable reference genes when investigating gene expression under changes in both experimental conditions. These results will facilitate research in revealing molecular mechanisms underlying the xenobiotic adaptation of this notorious agricultural pest. PMID:27570487

  15. Nucleotide polymorphisms in a pine ortholog of the Arabidopsis degrading enzyme cellulase KORRIGAN are associated with early growth performance in Pinus pinaster.

    PubMed

    Cabezas, José Antonio; González-Martínez, Santiago C; Collada, Carmen; Guevara, María Angeles; Boury, Christophe; de María, Nuria; Eveno, Emmanuelle; Aranda, Ismael; Garnier-Géré, Pauline H; Brach, Jean; Alía, Ricardo; Plomion, Christophe; Cervera, María Teresa

    2015-09-01

    We have carried out a candidate-gene-based association genetic study in Pinus pinaster Aiton and evaluated the predictive performance for genetic merit gain of the most significantly associated genes and single nucleotide polymorphisms (SNPs). We used a second generation 384-SNP array enriched with candidate genes for growth and wood properties to genotype mother trees collected in 20 natural populations covering most of the European distribution of the species. Phenotypic data for total height, polycyclism, root-collar diameter and biomass were obtained from a replicated provenance-progeny trial located in two sites with contrasting environments (Atlantic vs Mediterranean climate). General linear models identified strong associations between growth traits (total height and polycyclism) and four SNPs from the korrigan candidate gene, after multiple testing corrections using false discovery rate. The combined genomic breeding value predictions assessed for the four associated korrigan SNPs by ridge regression-best linear unbiased prediction (RR-BLUP) and cross-validation accounted for up to 8 and 15% of the phenotypic variance for height and polycyclic growth, respectively, and did not improve adding SNPs from other growth-related candidate genes. For root-collar diameter and total biomass, they accounted for 1.6 and 1.1% of the phenotypic variance, respectively, but increased to 15 and 4.1% when other SNPs from lp3.1, lp3.3 and cad were included in RR-BLUP models. These results point towards a desirable integration of candidate-gene studies as a means to pre-select relevant markers, and aid genomic selection in maritime pine breeding programs. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  16. Elevated risks for amyotrophic lateral sclerosis and blood disorders in Ashkenazi schizophrenic pedigrees suggest new candidate genes in schizophrenia

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Goodman, A.B.

    1994-09-15

    Among relatives of Ashkenazi schizophrenic probands the rate of amyotrophic lateral sclerosis was 3/1,000, compared to expected population rates of approximately 2/100,000. Relative risk of bleeding disorders, including hematologic cancers, was increased more than three-fold compared to controls. Co-occurrence of motor neuron disease and blood dyscrasias, accompanied by psychosis, has long been recognized. A virally-mediated autoimmune pathogenesis has been proposed. However, the familial co-occurrence of these three disease entities raises the possibility that the disease constellation be considered as a manifestation of a common underlying genetic defect. Such expansion of the spectrum of affectation might enhance the power of bothmore » candidate gene and linkage studies. Based on these findings, the loci suggested as candidate regions in schizophrenia include a potential hot spot on chromosome 21q21-q22, involving the superoxide dismutase and amyloid precursor protein genes. Alternatively, genes on other chromosomes involved in the expression, transcription, or regulation of these genes, or associated with the illnesses of high frequency in these pedigrees are suggested. Candidates include the choroid plexus transport protein, transthyretin at 18q11.2-q12.1; the t(14;18)(q22;21) characterizing B-cell lymphoma-2, the most common form of hematologic cancer; and the 14q24 locus of early onset Alzheimer`s disease, c-Fos, transforming growth factor beta 3, and heat shock protein A2. Expression of hematologic cancers and the suggested candidate genes are known to involve retinoid pathways, and retinoid disregulation has been proposed as a cause of schizophrenia. 67 refs., 2 figs., 1 tab.« less

  17. MorphDB: Prioritizing Genes for Specialized Metabolism Pathways and Gene Ontology Categories in Plants.

    PubMed

    Zwaenepoel, Arthur; Diels, Tim; Amar, David; Van Parys, Thomas; Shamir, Ron; Van de Peer, Yves; Tzfadia, Oren

    2018-01-01

    Recent times have seen an enormous growth of "omics" data, of which high-throughput gene expression data are arguably the most important from a functional perspective. Despite huge improvements in computational techniques for the functional classification of gene sequences, common similarity-based methods often fall short of providing full and reliable functional information. Recently, the combination of comparative genomics with approaches in functional genomics has received considerable interest for gene function analysis, leveraging both gene expression based guilt-by-association methods and annotation efforts in closely related model organisms. Besides the identification of missing genes in pathways, these methods also typically enable the discovery of biological regulators (i.e., transcription factors or signaling genes). A previously built guilt-by-association method is MORPH, which was proven to be an efficient algorithm that performs particularly well in identifying and prioritizing missing genes in plant metabolic pathways. Here, we present MorphDB, a resource where MORPH-based candidate genes for large-scale functional annotations (Gene Ontology, MapMan bins) are integrated across multiple plant species. Besides a gene centric query utility, we present a comparative network approach that enables researchers to efficiently browse MORPH predictions across functional gene sets and species, facilitating efficient gene discovery and candidate gene prioritization. MorphDB is available at http://bioinformatics.psb.ugent.be/webtools/morphdb/morphDB/index/. We also provide a toolkit, named "MORPH bulk" (https://github.com/arzwa/morph-bulk), for running MORPH in bulk mode on novel data sets, enabling researchers to apply MORPH to their own species of interest.

  18. SomInaClust: detection of cancer genes based on somatic mutation patterns of inactivation and clustering.

    PubMed

    Van den Eynden, Jimmy; Fierro, Ana Carolina; Verbeke, Lieven P C; Marchal, Kathleen

    2015-04-23

    With the advances in high throughput technologies, increasing amounts of cancer somatic mutation data are being generated and made available. Only a small number of (driver) mutations occur in driver genes and are responsible for carcinogenesis, while the majority of (passenger) mutations do not influence tumour biology. In this study, SomInaClust is introduced, a method that accurately identifies driver genes based on their mutation pattern across tumour samples and then classifies them into oncogenes or tumour suppressor genes respectively. SomInaClust starts from the observation that oncogenes mainly contain mutations that, due to positive selection, cluster at similar positions in a gene across patient samples, whereas tumour suppressor genes contain a high number of protein-truncating mutations throughout the entire gene length. The method was shown to prioritize driver genes in 9 different solid cancers. Furthermore it was found to be complementary to existing similar-purpose methods with the additional advantages that it has a higher sensitivity, also for rare mutations (occurring in less than 1% of all samples), and it accurately classifies candidate driver genes in putative oncogenes and tumour suppressor genes. Pathway enrichment analysis showed that the identified genes belong to known cancer signalling pathways, and that the distinction between oncogenes and tumour suppressor genes is biologically relevant. SomInaClust was shown to detect candidate driver genes based on somatic mutation patterns of inactivation and clustering and to distinguish oncogenes from tumour suppressor genes. The method could be used for the identification of new cancer genes or to filter mutation data for further data-integration purposes.

  19. Degrees of separation as a statistical tool for evaluating candidate genes.

    PubMed

    Nelson, Ronald M; Pettersson, Mats E

    2014-12-01

    Selection of candidate genes is an important step in the exploration of complex genetic architecture. The number of gene networks available is increasing and these can provide information to help with candidate gene selection. It is currently common to use the degree of connectedness in gene networks as validation in Genome Wide Association (GWA) and Quantitative Trait Locus (QTL) mapping studies. However, it can cause misleading results if not validated properly. Here we present a method and tool for validating the gene pairs from GWA studies given the context of the network they co-occur in. It ensures that proposed interactions and gene associations are not statistical artefacts inherent to the specific gene network architecture. The CandidateBacon package provides an easy and efficient method to calculate the average degree of separation (DoS) between pairs of genes to currently available gene networks. We show how these empirical estimates of average connectedness are used to validate candidate gene pairs. Validation of interacting genes by comparing their connectedness with the average connectedness in the gene network will provide support for said interactions by utilising the growing amount of gene network information available. Copyright © 2014 Elsevier Ltd. All rights reserved.

  20. An Integration of Genome-Wide Association Study and Gene Expression Profiling to Prioritize the Discovery of Novel Susceptibility Loci for Osteoporosis-Related Traits

    PubMed Central

    Demissie, Serkalem; Soranzo, Nicole; Bianchi, Estelle N.; Grundberg, Elin; Liang, Liming; Richards, J. Brent; Estrada, Karol; Zhou, Yanhua; van Nas, Atila; Moffatt, Miriam F.; Zhai, Guangju; Hofman, Albert; van Meurs, Joyce B.; Pols, Huibert A. P.; Price, Roger I.; Nilsson, Olle; Pastinen, Tomi; Cupples, L. Adrienne; Lusis, Aldons J.; Schadt, Eric E.; Ferrari, Serge; Uitterlinden, André G.

    2010-01-01

    Osteoporosis is a complex disorder and commonly leads to fractures in elderly persons. Genome-wide association studies (GWAS) have become an unbiased approach to identify variations in the genome that potentially affect health. However, the genetic variants identified so far only explain a small proportion of the heritability for complex traits. Due to the modest genetic effect size and inadequate power, true association signals may not be revealed based on a stringent genome-wide significance threshold. Here, we take advantage of SNP and transcript arrays and integrate GWAS and expression signature profiling relevant to the skeletal system in cellular and animal models to prioritize the discovery of novel candidate genes for osteoporosis-related traits, including bone mineral density (BMD) at the lumbar spine (LS) and femoral neck (FN), as well as geometric indices of the hip (femoral neck-shaft angle, NSA; femoral neck length, NL; and narrow-neck width, NW). A two-stage meta-analysis of GWAS from 7,633 Caucasian women and 3,657 men, revealed three novel loci associated with osteoporosis-related traits, including chromosome 1p13.2 (RAP1A, p = 3.6×10−8), 2q11.2 (TBC1D8), and 18q11.2 (OSBPL1A), and confirmed a previously reported region near TNFRSF11B/OPG gene. We also prioritized 16 suggestive genome-wide significant candidate genes based on their potential involvement in skeletal metabolism. Among them, 3 candidate genes were associated with BMD in women. Notably, 2 out of these 3 genes (GPR177, p = 2.6×10−13; SOX6, p = 6.4×10−10) associated with BMD in women have been successfully replicated in a large-scale meta-analysis of BMD, but none of the non-prioritized candidates (associated with BMD) did. Our results support the concept of our prioritization strategy. In the absence of direct biological support for identified genes, we highlighted the efficiency of subsequent functional characterization using publicly available expression profiling relevant to the skeletal system in cellular or whole animal models to prioritize candidate genes for further functional validation. PMID:20548944

  1. Association between Variants in Atopy-Related Immunologic Candidate Genes and Pancreatic Cancer Risk.

    PubMed

    Cotterchio, Michelle; Lowcock, Elizabeth; Bider-Canfield, Zoe; Lemire, Mathieu; Greenwood, Celia; Gallinger, Steven; Hudson, Thomas

    2015-01-01

    Many epidemiology studies report that atopic conditions such as allergies are associated with reduced pancreas cancer risk. The reason for this relationship is not yet understood. This is the first study to comprehensively evaluate the association between variants in atopy-related candidate genes and pancreatic cancer risk. A population-based case-control study of pancreas cancer cases diagnosed during 2011-2012 (via Ontario Cancer Registry), and controls recruited using random digit dialing utilized DNA from 179 cases and 566 controls. Following an exhaustive literature review, SNPs in 180 candidate genes were pre-screened using dbGaP pancreas cancer GWAS data; 147 SNPs in 56 allergy-related immunologic genes were retained and genotyped. Logistic regression was used to estimate age-adjusted odd ratio (AOR) for each variant and false discovery rate was used to adjust Wald p-values for multiple testing. Subsequently, a risk allele score was derived based on statistically significant variants. 18 SNPs in 14 candidate genes (CSF2, DENND1B, DPP10, FLG, IL13, IL13RA2, LRP1B, NOD1, NPSR1, ORMDL3, RORA, STAT4, TLR6, TRA) were significantly associated with pancreas cancer risk. After adjustment for multiple comparisons, two LRP1B SNPs remained statistically significant; for example, LRP1B rs1449477 (AA vs. CC: AOR=0.37, 95% CI: 0.22-0.62; p (adjusted)=0.04). Furthermore, the risk allele score was associated with a significant reduction in pancreas cancer risk (p=0.0007). Preliminary findings suggest certain atopy-related variants may be associated with pancreas cancer risk. Further studies are needed to replicate this, and to elucidate the biology behind the growing body of epidemiologic evidence suggesting allergies may reduce pancreatic cancer risk.

  2. No Association of BDNF, COMT, MAOA, SLC6A3, and SLC6A4 Genes and Depressive Symptoms in a Sample of Healthy Colombian Subjects.

    PubMed

    González-Giraldo, Yeimy; Camargo, Andrés; López-León, Sandra; Forero, Diego A

    2015-01-01

    Background. Major depressive disorder (MDD) is the second cause of years lived with disability around the world. A large number of studies have been carried out to identify genetic risk factors for MDD and related endophenotypes, mainly in populations of European and Asian descent, with conflicting results. The main aim of the current study was to analyze the possible association of five candidate genes and depressive symptoms in a Colombian sample of healthy subjects. Methods and Materials. The Spanish adaptation of the Hospital Anxiety and Depression Scale (HADS) was applied to one hundred eighty-eight healthy Colombian subjects. Five functional polymorphisms were genotyped using PCR-based assays: BDNF-Val66Met (rs6265), COMT-Val158Met (rs4680), SLC6A4-HTTLPR (rs4795541), MAOA-uVNTR, and SLC6A3-VNTR (rs28363170). Result. We did not find significant associations with scores of depressive symptoms, derived from the HADS, for any of the five candidate genes (nominal p values >0.05). In addition, we did not find evidence of significant gene-gene interactions. Conclusion. This work is one of the first studies of candidate genes for depressive symptoms in a Latin American sample. Study of additional genetic and epigenetic variants, taking into account other pathophysiological theories, will help to identify novel candidates for MDD in populations around the world.

  3. Comparative ecological transcriptomics and the contribution of gene expression to the evolutionary potential of a threatened fish.

    PubMed

    Brauer, Chris J; Unmack, Peter J; Beheregaray, Luciano B

    2017-12-01

    Understanding whether small populations with low genetic diversity can respond to rapid environmental change via phenotypic plasticity is an outstanding research question in biology. RNA sequencing (RNA-seq) has recently provided the opportunity to examine variation in gene expression, a surrogate for phenotypic variation, in nonmodel species. We used a comparative RNA-seq approach to assess expression variation within and among adaptively divergent populations of a threatened freshwater fish, Nannoperca australis, found across a steep hydroclimatic gradient in the Murray-Darling Basin, Australia. These populations evolved under contrasting selective environments (e.g., dry/hot lowland; wet/cold upland) and represent opposite ends of the species' spectrum of genetic diversity and population size. We tested the hypothesis that environmental variation among isolated populations has driven the evolution of divergent expression at ecologically important genes using differential expression (DE) analysis and an anova-based comparative phylogenetic expression variance and evolution model framework based on 27,425 de novo assembled transcripts. Additionally, we tested whether gene expression variance within populations was correlated with levels of standing genetic diversity. We identified 290 DE candidate transcripts, 33 transcripts with evidence for high expression plasticity, and 50 candidates for divergent selection on gene expression after accounting for phylogenetic structure. Variance in gene expression appeared unrelated to levels of genetic diversity. Functional annotation of the candidate transcripts revealed that variation in water quality is an important factor influencing expression variation for N. australis. Our findings suggest that gene expression variation can contribute to the evolutionary potential of small populations. © 2017 John Wiley & Sons Ltd.

  4. LOD score exclusion analyses for candidate QTLs using random population samples.

    PubMed

    Deng, Hong-Wen

    2003-11-01

    While extensive analyses have been conducted to test for, no formal analyses have been conducted to test against, the importance of candidate genes as putative QTLs using random population samples. Previously, we developed an LOD score exclusion mapping approach for candidate genes for complex diseases. Here, we extend this LOD score approach for exclusion analyses of candidate genes for quantitative traits. Under this approach, specific genetic effects (as reflected by heritability) and inheritance models at candidate QTLs can be analyzed and if an LOD score is < or = -2.0, the locus can be excluded from having a heritability larger than that specified. Simulations show that this approach has high power to exclude a candidate gene from having moderate genetic effects if it is not a QTL and is robust to population admixture. Our exclusion analysis complements association analysis for candidate genes as putative QTLs in random population samples. The approach is applied to test the importance of Vitamin D receptor (VDR) gene as a potential QTL underlying the variation of bone mass, an important determinant of osteoporosis.

  5. RNA expression of genes involved in cytarabine metabolism and transport predicts cytarabine response in acute myeloid leukemia.

    PubMed

    Abraham, Ajay; Varatharajan, Savitha; Karathedath, Sreeja; Philip, Chepsy; Lakshmi, Kavitha M; Jayavelu, Ashok Kumar; Mohanan, Ezhilpavai; Janet, Nancy Beryl; Srivastava, Vivi M; Shaji, Ramachandran V; Zhang, Wei; Abraham, Aby; Viswabandya, Auro; George, Biju; Chandy, Mammen; Srivastava, Alok; Mathews, Vikram; Balasubramanian, Poonkuzhali

    2015-07-01

    Variation in terms of outcome and toxic side effects of treatment exists among acute myeloid leukemia (AML) patients on chemotherapy with cytarabine (Ara-C) and daunorubicin (Dnr). Candidate Ara-C metabolizing gene expression in primary AML cells is proposed to account for this variation. Ex vivo Ara-C sensitivity was determined in primary AML samples using MTT assay. mRNA expression of candidate Ara-C metabolizing genes were evaluated by RQPCR analysis. Global gene expression profiling was carried out for identifying differentially expressed genes between exvivo Ara-C sensitive and resistant samples. Wide interindividual variations in ex vivo Ara-C cytotoxicity were observed among samples from patients with AML and were stratified into sensitive, intermediately sensitive and resistant, based on IC50 values obtained by MTT assay. RNA expression of deoxycytidine kinase (DCK), human equilibrative nucleoside transporter-1 (ENT1) and ribonucleotide reductase M1 (RRM1) were significantly higher and cytidine deaminase (CDA) was significantly lower in ex vivo Ara-C sensitive samples. Higher DCK and RRM1 expression in AML patient's blast correlated with better DFS. Ara-C resistance index (RI), a mathematically derived quotient was proposed based on candidate gene expression pattern. Ara-C ex vivo sensitive samples were found to have significantly lower RI compared with resistant as well as samples from patients presenting with relapse. Patients with low RI supposedly highly sensitive to Ara-C were found to have higher incidence of induction death (p = 0.002; RR: 4.35 [95% CI: 1.69-11.22]). Global gene expression profiling undertaken to find out additional contributors of Ara-C resistance identified many apoptosis as well as metabolic pathway genes to be differentially expressed between Ara-C resistant and sensitive samples. This study highlights the importance of evaluating expression of candidate Ara-C metabolizing genes in predicting ex vivo drug response as well as treatment outcome. RI could be a predictor of ex vivo Ara-C response irrespective of cytogenetic and molecular risk groups and a potential biomarker for AML treatment outcome and toxicity. Original submitted 22 December 2014; Revision submitted 9 April 2015.

  6. Association of candidate genes with drought tolerance traits in diverse perennial ryegrass accessions

    Treesearch

    Xiaoqing Yu; Guihua Bai; Shuwei Liu; Na Luo; Ying Wang; Douglas S. Richmond; Paula M. Pijut; Scott A. Jackson; Jianming Yu; Yiwei Jiang

    2013-01-01

    Drought is a major environmental stress limiting growth of perennial grasses in temperate regions. Plant drought tolerance is a complex trait that is controlled by multiple genes. Candidate gene association mapping provides a powerful tool for dissection of complex traits. Candidate gene association mapping of drought tolerance traits was conducted in 192 diverse...

  7. Convergence of genome-wide association and candidate gene studies for alcoholism.

    PubMed

    Olfson, Emily; Bierut, Laura Jean

    2012-12-01

    Genome-wide association (GWA) studies have led to a paradigm shift in how researchers study the genetics underlying disease. Many GWA studies are now publicly available and can be used to examine whether or not previously proposed candidate genes are supported by GWA data. This approach is particularly important for the field of alcoholism because the contribution of many candidate genes remains controversial. Using the Human Genome Epidemiology (HuGE) Navigator, we selected candidate genes for alcoholism that have been frequently examined in scientific articles in the past decade. Specific candidate loci as well as all the reported single nucleotide polymorphisms (SNPs) in candidate genes were examined in the Study of Addiction: Genetics and Environment (SAGE), a GWA study comparing alcohol-dependent and nondependent subjects. Several commonly reported candidate loci, including rs1800497 in DRD2, rs698 in ADH1C, rs1799971 in OPRM1, and rs4680 in COMT, are not replicated in SAGE (p > 0.05). Among candidate loci available for analysis, only rs279858 in GABRA2 (p = 0.0052, OR = 1.16) demonstrated a modest association. Examination of all SNPs reported in SAGE in over 50 candidate genes revealed no SNPs with large frequency differences between cases and controls, and the lowest p-value of any SNP was 0.0006. We provide evidence that several extensively studied candidate loci do not have a strong contribution to risk of developing alcohol dependence in European and African ancestry populations. Owing to the lack of coverage, we were unable to rule out the contribution of other variants, and these genes and particular loci warrant further investigation. Our analysis demonstrates that publicly available GWA results can be used to better understand which if any of previously proposed candidate genes contribute to disease. Furthermore, we illustrate how examining the convergence of candidate gene and GWA studies can help elucidate the genetic architecture of alcoholism and more generally complex diseases. Copyright © 2012 by the Research Society on Alcoholism.

  8. Identification of Human Disease Genes from Interactome Network Using Graphlet Interaction

    PubMed Central

    Yang, Lun; Wei, Dong-Qing; Qi, Ying-Xin; Jiang, Zong-Lai

    2014-01-01

    Identifying genes related to human diseases, such as cancer and cardiovascular disease, etc., is an important task in biomedical research because of its applications in disease diagnosis and treatment. Interactome networks, especially protein-protein interaction networks, had been used to disease genes identification based on the hypothesis that strong candidate genes tend to closely relate to each other in some kinds of measure on the network. We proposed a new measure to analyze the relationship between network nodes which was called graphlet interaction. The graphlet interaction contained 28 different isomers. The results showed that the numbers of the graphlet interaction isomers between disease genes in interactome networks were significantly larger than random picked genes, while graphlet signatures were not. Then, we designed a new type of score, based on the network properties, to identify disease genes using graphlet interaction. The genes with higher scores were more likely to be disease genes, and all candidate genes were ranked according to their scores. Then the approach was evaluated by leave-one-out cross-validation. The precision of the current approach achieved 90% at about 10% recall, which was apparently higher than the previous three predominant algorithms, random walk, Endeavour and neighborhood based method. Finally, the approach was applied to predict new disease genes related to 4 common diseases, most of which were identified by other independent experimental researches. In conclusion, we demonstrate that the graphlet interaction is an effective tool to analyze the network properties of disease genes, and the scores calculated by graphlet interaction is more precise in identifying disease genes. PMID:24465923

  9. Construction of a β-galactosidase-gene-based fusion is convenient for screening candidate genes involved in regulation of pyrrolnitrin biosynthesis in Pseudomonas chlororaphis G05.

    PubMed

    Luo, Wangtai; Miao, Jing; Feng, Zhibin; Lu, Ruiyang; Sun, Xiaoqiang; Zhang, Baoshen; Ding, Weiqiu; Lu, Yang; Wang, Yanhua; Chi, Xiaoyan; Ge, Yihe

    2018-05-28

    In our recent work, we found that pyrrolnitrin, and not phenazines, pyrrolnitrin contributed to the suppression of the mycelia growth of Fusarium graminearum that causes heavy Fusarium head blight (FHB) disease in cereal crops. However, pyrrolnitrin production of Pseudomonas chlororaphis G05 in King's B medium was very low. Although a few regulatory genes mediating the prnABCD (the prn operon, pyrrolnitrin biosynthetic locus) expression have been identified, it is not enough for us to enhance pyrrolnitrin production by systematically constructing a genetically-engineered strain. To obtain new candidate genes involved in regulation of the prn operon expression, we successfully constructed a fusion mutant G05ΔphzΔprn::lacZ, in which most of the coding regions of the prn operon and the phzABCDEFG (the phz operon, phenazine biosynthetic locus) were deleted, and the promoter region plus the first thirty condons of the prnA was in-frame fused with the truncated lacZ gene on its chromosome. The expression of the fused lacZ reporter gene driven by the promoter of the prn operon made it easy for us to detect the level of the prn expression in terms of the color variation of colonies on LB agar plates supplemented with 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-Gal). With this fusion mutant as a recipient strain, mini-Tn5-based random insertional mutagenesis was then conducted. By picking up colonies with color change, it is possible for us to screen and identify new candidate genes involved in regulation of the prn expression. Identification of additional regulatory genes in further work could reasonably be expected to increase pyrrolnitrin production in G05 and to improve its biological control function.

  10. Evaluation of candidate methylation markers to detect cervical neoplasia.

    PubMed

    Shivapurkar, Narayan; Sherman, Mark E; Stastny, Victor; Echebiri, Chinyere; Rader, Janet S; Nayar, Ritu; Bonfiglio, Thomas A; Gazdar, Adi F; Wang, Sophia S

    2007-12-01

    Studies of cervical cancer and its immediate precursor, cervical intraepithelial neoplasia 3 (CIN3), have identified genes that often show aberrant DNA methylation and therefore represent candidate early detection markers. We used quantitative PCR assays to evaluate methylation in five candidate genes (TNFRSF10C, DAPK1, SOCS3, HS3ST2 and CDH1) previously demonstrated as methylated in cervical cancer. In this analysis, we performed methylation assays for the five candidate genes in 45 invasive cervical cancers, 12 histologically normal cervical specimens, and 23 liquid-based cervical cytology specimens confirmed by expert review as unequivocal demonstrating cytologic high-grade squamous intraepithelial lesions, thus representing the counterparts of histologic CIN3. We found hypermethylation of HS3ST2 in 93% of cancer tissues and 70% of cytology specimens interpreted as CIN3; hypermethylation of CDH1 was found in 89% of cancers and 26% of CIN3 cytology specimens. Methylation of either HS3ST2 or CDH1 was observed in 100% of cervical cancer tissues and 83% of CIN3 cytology specimens. None of the five genes showed detectable methylation in normal cervical tissues. Our data support further evaluation of HS3ST2 and CDH1 methylation as potential markers of cervical cancer and its precursor lesions.

  11. ADHD Candidate Gene Study in a Population-Based Birth Cohort: Association with DBH and DRD2

    ERIC Educational Resources Information Center

    Nyman, Emma S.; Ogdie, Matthew N.; Loukola, Anu; Varilo, Teppo; Taanila, Anja; Hurtig, Tuula; Moilanen, Irma K.; Loo, Sandra K.; McGough, James J.; Jarvelin, Marjo-Riitta; Smalley, Susan L.

    2007-01-01

    A study aims to examine the genetic contribution if any to attention-deficit/hyperactivity disorder (ADHD). The results confirm the hypothesis and the association of dopamine [beta]-hydroxylase and dopamine receptor D2 genes with ADHD.

  12. Identification and validation of single nucleotide polymorphisms in growth- and maturation-related candidate genes in sole (Solea solea L.).

    PubMed

    Diopere, Eveline; Hellemans, Bart; Volckaert, Filip A M; Maes, Gregory E

    2013-03-01

    Genomic methodologies applied in evolutionary and fisheries research have been of great benefit to understand the marine ecosystem and the management of natural resources. Although single nucleotide polymorphisms (SNPs) are attractive for the study of local adaptation, spatial stock management and traceability, and investigating the effects of fisheries-induced selection, they have rarely been exploited in non-model organisms. This is partly due to difficulties in finding and validating SNPs in species with limited or no genomic resources. Complementary to random genome-scan approaches, a targeted candidate gene approach has the potential to unveil pre-selected functional diversity and provides more in depth information on the action of selection at specific genes. For example genes can be under selective pressure due to climate change and sustained periods of heavy fishing pressure. In this study, we applied a candidate gene approach in sole (Solea solea L.), an important member of the demersal ecosystem. As consumption flatfish it is heavy exploited and has experienced associated life-history changes over the last 60years. To discover novel genetic polymorphisms in or around genes linked to important life history traits in sole, we screened a total of 76 candidate genes related to growth and maturation using a targeted resequencing approach. We identified in total 86 putative SNPs in 22 genes and validated 29 SNPs using a multiplex single-base extension genotyping assay. We found 22 informative SNPs, of which two represent non-synonymous mutations, potentially of functional relevance. These novel markers should be rapidly and broadly applicable in analyses of natural sole populations, as a measure of the evolutionary signature of overfishing and for initiatives on marker assisted selection. Copyright © 2012 Elsevier B.V. All rights reserved.

  13. NCG 4.0: the network of cancer genes in the era of massive mutational screenings of cancer genomes

    PubMed Central

    An, Omer; Pendino, Vera; D’Antonio, Matteo; Ratti, Emanuele; Gentilini, Marco; Ciccarelli, Francesca D.

    2014-01-01

    NCG 4.0 is the latest update of the Network of Cancer Genes, a web-based repository of systems-level properties of cancer genes. In its current version, the database collects information on 537 known (i.e. experimentally supported) and 1463 candidate (i.e. inferred using statistical methods) cancer genes. Candidate cancer genes derive from the manual revision of 67 original publications describing the mutational screening of 3460 human exomes and genomes in 23 different cancer types. For all 2000 cancer genes, duplicability, evolutionary origin, expression, functional annotation, interaction network with other human proteins and with microRNAs are reported. In addition to providing a substantial update of cancer-related information, NCG 4.0 also introduces two new features. The first is the annotation of possible false-positive cancer drivers, defined as candidate cancer genes inferred from large-scale screenings whose association with cancer is likely to be spurious. The second is the description of the systems-level properties of 64 human microRNAs that are causally involved in cancer progression (oncomiRs). Owing to the manual revision of all information, NCG 4.0 constitutes a complete and reliable resource on human coding and non-coding genes whose deregulation drives cancer onset and/or progression. NCG 4.0 can also be downloaded as a free application for Android smart phones. Database URL: http://bio.ieo.eu/ncg/ PMID:24608173

  14. Ancestry-based stratified analysis of Immunochip data identifies novel associations with celiac disease.

    PubMed

    Garcia-Etxebarria, Koldo; Jauregi-Miguel, Amaia; Romero-Garmendia, Irati; Plaza-Izurieta, Leticia; Legarda, Maria; Irastorza, Iñaki; Bilbao, Jose Ramon

    2016-12-01

    To identify candidate genes in celiac disease (CD), we reanalyzed the whole Immunochip CD cohort using a different approach that clusters individuals based on immunoancestry prior to disease association analysis, rather than by geographical origin. We detected 636 new associated SNPs (P<7.02 × 10 -07 ) and identified 5 novel genomic regions, extended 8 others previously identified and also detected 18 isolated signals defined by one or very few significant SNPs. To test whether we could identify putative candidate genes, we performed expression analyses of several genes from the top novel region (chr2:134533564-136169524), from a previously identified locus that is now extended, and a gene marked by an isolated SNP, in duodenum biopsies of active and treated CD patients, and non-celiac controls. In the largest novel region, CCNT2 and R3HDM1 were constitutively underexpressed in disease, even after gluten removal. Moreover, several genes within this region were coexpressed in patients, but not in controls. Other novel genes like KIF21B, REL and SORD also showed altered expression in active disease. Apart from the identification of novel CD loci, these results suggest that ancestry-based stratified analysis is an efficient strategy for association studies in complex diseases.

  15. In Silico Identification of Candidate Genes for Fertility Restoration in Cytoplasmic Male Sterile Perennial Ryegrass (Lolium perenne L.)

    PubMed Central

    Sykes, Timothy; Yates, Steven; Nagy, Istvan; Asp, Torben; Small, Ian

    2017-01-01

    Perennial ryegrass (Lolium perenne L.) is widely used for forage production in both permanent and temporary grassland systems. To increase yields in perennial ryegrass, recent breeding efforts have been focused on strategies to more efficiently exploit heterosis by hybrid breeding. Cytoplasmic male sterility (CMS) is a widely applied mechanism to control pollination for commercial hybrid seed production and although CMS systems have been identified in perennial ryegrass, they are yet to be fully characterized. Here, we present a bioinformatics pipeline for efficient identification of candidate restorer of fertility (Rf) genes for CMS. From a high-quality draft of the perennial ryegrass genome, 373 pentatricopeptide repeat (PPR) genes were identified and classified, further identifying 25 restorer of fertility-like PPR (RFL) genes through a combination of DNA sequence clustering and comparison to known Rf genes. This extensive gene family was targeted as the majority of Rf genes in higher plants are RFL genes. These RFL genes were further investigated by phylogenetic analyses, identifying three groups of perennial ryegrass RFLs. These three groups likely represent genomic regions of active RFL generation and identify the probable location of perennial ryegrass PPR-Rf genes. This pipeline allows for the identification of candidate PPR-Rf genes from genomic sequence data and can be used in any plant species. Functional markers for PPR-Rf genes will facilitate map-based cloning of Rf genes and enable the use of CMS as an efficient tool to control pollination for hybrid crop production. PMID:26951780

  16. Breeding maize for silage and biofuel production, an illustration of a step forward with the genome sequence.

    PubMed

    Barrière, Yves; Courtial, Audrey; Chateigner-Boutin, Anne-Laure; Denoue, Dominique; Grima-Pettenati, Jacqueline

    2016-01-01

    The knowledge of the gene families mostly impacting cell wall digestibility variations would significantly increase the efficiency of marker-assisted selection when breeding maize and grass varieties with improved silage feeding value and/or with better straw fermentability into alcohol or methane. The maize genome sequence of the B73 inbred line was released at the end of 2009, opening up new avenues to identify the genetic determinants of quantitative traits. Colocalizations between a large set of candidate genes putatively involved in secondary cell wall assembly and QTLs for cell wall digestibility (IVNDFD) were then investigated, considering physical positions of both genes and QTLs. Based on available data from six RIL progenies, 59 QTLs corresponding to 38 non-overlapping positions were matched up with a list of 442 genes distributed all over the genome. Altogether, 176 genes colocalized with IVNDFD QTLs and most often, several candidate genes colocalized at each QTL position. Frequent QTL colocalizations were found firstly with genes encoding ZmMYB and ZmNAC transcription factors, and secondly with genes encoding zinc finger, bHLH, and xylogen regulation factors. In contrast, close colocalizations were less frequent with genes involved in monolignol biosynthesis, and found only with the C4H2, CCoAOMT5, and CCR1 genes. Close colocalizations were also infrequent with genes involved in cell wall feruloylation and cross-linkages. Altogether, investigated colocalizations between candidate genes and cell wall digestibility QTLs suggested a prevalent role of regulation factors over constitutive cell wall genes on digestibility variations. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  17. IFRD1 Is a Candidate Gene for SMNA on Chromosome 7q22-q23

    PubMed Central

    Brkanac, Zoran; Spencer, David; Shendure, Jay; Robertson, Peggy D.; Matsushita, Mark; Vu, Tiffany; Bird, Thomas D.; Olson, Maynard V.; Raskind, Wendy H.

    2009-01-01

    We have established strong linkage evidence that supports mapping autosomal-dominant sensory/motor neuropathy with ataxia (SMNA) to chromosome 7q22-q32. SMNA is a rare neurological disorder whose phenotype encompasses both the central and the peripheral nervous system. In order to identify a gene responsible for SMNA, we have undertaken a comprehensive genomic evaluation of the region of linkage, including evaluation for repeat expansion and small deletions or duplications, capillary sequencing of candidate genes, and massively parallel sequencing of all coding exons. We excluded repeat expansion and small deletions or duplications as causative, and through microarray-based hybrid capture and massively parallel short-read sequencing, we identified a nonsynonymous variant in the human interferon-related developmental regulator gene 1 (IFRD1) as a disease-causing candidate. Sequence conservation, animal models, and protein structure evaluation support the involvement of IFRD1 in SMNA. Mutation analysis of IFRD1 in additional patients with similar phenotypes is needed for demonstration of causality and further evaluation of its importance in neurological diseases. PMID:19409521

  18. Identifying New Candidate Genes and Chemicals Related to Prostate Cancer Using a Hybrid Network and Shortest Path Approach

    PubMed Central

    Wang, Meng; Wu, Kai; Lu, Changhong; Kong, Xiangyin

    2015-01-01

    Prostate cancer is a type of cancer that occurs in the male prostate, a gland in the male reproductive system. Because prostate cancer cells may spread to other parts of the body and can influence human reproduction, understanding the mechanisms underlying this disease is critical for designing effective treatments. The identification of as many genes and chemicals related to prostate cancer as possible will enhance our understanding of this disease. In this study, we proposed a computational method to identify new candidate genes and chemicals based on currently known genes and chemicals related to prostate cancer by applying a shortest path approach in a hybrid network. The hybrid network was constructed according to information concerning chemical-chemical interactions, chemical-protein interactions, and protein-protein interactions. Many of the obtained genes and chemicals are associated with prostate cancer. PMID:26504486

  19. Database of cattle candidate genes and genetic markers for milk production and mastitis

    PubMed Central

    Ogorevc, J; Kunej, T; Razpet, A; Dovc, P

    2009-01-01

    A cattle database of candidate genes and genetic markers for milk production and mastitis has been developed to provide an integrated research tool incorporating different types of information supporting a genomic approach to study lactation, udder development and health. The database contains 943 genes and genetic markers involved in mammary gland development and function, representing candidates for further functional studies. The candidate loci were drawn on a genetic map to reveal positional overlaps. For identification of candidate loci, data from seven different research approaches were exploited: (i) gene knockouts or transgenes in mice that result in specific phenotypes associated with mammary gland (143 loci); (ii) cattle QTL for milk production (344) and mastitis related traits (71); (iii) loci with sequence variations that show specific allele-phenotype interactions associated with milk production (24) or mastitis (10) in cattle; (iv) genes with expression profiles associated with milk production (207) or mastitis (107) in cattle or mouse; (v) cattle milk protein genes that exist in different genetic variants (9); (vi) miRNAs expressed in bovine mammary gland (32) and (vii) epigenetically regulated cattle genes associated with mammary gland function (1). Fourty-four genes found by multiple independent analyses were suggested as the most promising candidates and were further in silico analysed for expression levels in lactating mammary gland, genetic variability and top biological functions in functional networks. A miRNA target search for mammary gland expressed miRNAs identified 359 putative binding sites in 3′UTRs of candidate genes. PMID:19508288

  20. Targeted and Untargeted Approaches Unravel Novel Candidate Genes and Diagnostic SNPs for Quantitative Resistance of the Potato (Solanum tuberosum L.) to Phytophthora infestans Causing the Late Blight Disease.

    PubMed

    Mosquera, Teresa; Alvarez, Maria Fernanda; Jiménez-Gómez, José M; Muktar, Meki Shehabu; Paulo, Maria João; Steinemann, Sebastian; Li, Jinquan; Draffehn, Astrid; Hofmann, Andrea; Lübeck, Jens; Strahwald, Josef; Tacke, Eckhard; Hofferbert, Hans-Reinhardt; Walkemeier, Birgit; Gebhardt, Christiane

    2016-01-01

    The oomycete Phytophthora infestans causes late blight of potato, which can completely destroy the crop. Therefore, for the past 160 years, late blight has been the most important potato disease worldwide. The identification of cultivars with high and durable field resistance to P. infestans is an objective of most potato breeding programs. This type of resistance is polygenic and therefore quantitative. Its evaluation requires multi-year and location trials. Furthermore, quantitative resistance to late blight correlates with late plant maturity, a negative agricultural trait. Knowledge of the molecular genetic basis of quantitative resistance to late blight not compromised by late maturity is very limited. It is however essential for developing diagnostic DNA markers that facilitate the efficient combination of superior resistance alleles in improved cultivars. We used association genetics in a population of 184 tetraploid potato cultivars in order to identify single nucleotide polymorphisms (SNPs) that are associated with maturity corrected resistance (MCR) to late blight. The population was genotyped for almost 9000 SNPs from three different sources. The first source was candidate genes specifically selected for their function in the jasmonate pathway. The second source was novel candidate genes selected based on comparative transcript profiling (RNA-Seq) of groups of genotypes with contrasting levels of quantitative resistance to P. infestans. The third source was the first generation 8.3k SolCAP SNP genotyping array available in potato for genome wide association studies (GWAS). Twenty seven SNPs from all three sources showed robust association with MCR. Some of those were located in genes that are strong candidates for directly controlling quantitative resistance, based on functional annotation. Most important were: a lipoxygenase (jasmonate pathway), a 3-hydroxy-3-methylglutaryl coenzyme A reductase (mevalonate pathway), a P450 protein (terpene biosynthesis), a transcription factor and a homolog of a major gene for resistance to P. infestans from the wild potato species Solanum venturii. The candidate gene approach and GWAS complemented each other as they identified different genes. The results of this study provide new insight in the molecular genetic basis of quantitative resistance in potato and a toolbox of diagnostic SNP markers for breeding applications.

  1. Targeted and Untargeted Approaches Unravel Novel Candidate Genes and Diagnostic SNPs for Quantitative Resistance of the Potato (Solanum tuberosum L.) to Phytophthora infestans Causing the Late Blight Disease

    PubMed Central

    Jiménez-Gómez, José M.; Muktar, Meki Shehabu; Paulo, Maria João; Steinemann, Sebastian; Li, Jinquan; Draffehn, Astrid; Hofmann, Andrea; Lübeck, Jens; Strahwald, Josef; Tacke, Eckhard; Hofferbert, Hans-Reinhardt; Walkemeier, Birgit; Gebhardt, Christiane

    2016-01-01

    The oomycete Phytophthora infestans causes late blight of potato, which can completely destroy the crop. Therefore, for the past 160 years, late blight has been the most important potato disease worldwide. The identification of cultivars with high and durable field resistance to P. infestans is an objective of most potato breeding programs. This type of resistance is polygenic and therefore quantitative. Its evaluation requires multi-year and location trials. Furthermore, quantitative resistance to late blight correlates with late plant maturity, a negative agricultural trait. Knowledge of the molecular genetic basis of quantitative resistance to late blight not compromised by late maturity is very limited. It is however essential for developing diagnostic DNA markers that facilitate the efficient combination of superior resistance alleles in improved cultivars. We used association genetics in a population of 184 tetraploid potato cultivars in order to identify single nucleotide polymorphisms (SNPs) that are associated with maturity corrected resistance (MCR) to late blight. The population was genotyped for almost 9000 SNPs from three different sources. The first source was candidate genes specifically selected for their function in the jasmonate pathway. The second source was novel candidate genes selected based on comparative transcript profiling (RNA-Seq) of groups of genotypes with contrasting levels of quantitative resistance to P. infestans. The third source was the first generation 8.3k SolCAP SNP genotyping array available in potato for genome wide association studies (GWAS). Twenty seven SNPs from all three sources showed robust association with MCR. Some of those were located in genes that are strong candidates for directly controlling quantitative resistance, based on functional annotation. Most important were: a lipoxygenase (jasmonate pathway), a 3-hydroxy-3-methylglutaryl coenzyme A reductase (mevalonate pathway), a P450 protein (terpene biosynthesis), a transcription factor and a homolog of a major gene for resistance to P. infestans from the wild potato species Solanum venturii. The candidate gene approach and GWAS complemented each other as they identified different genes. The results of this study provide new insight in the molecular genetic basis of quantitative resistance in potato and a toolbox of diagnostic SNP markers for breeding applications. PMID:27281327

  2. Dissecting the organ specificity of insecticide resistance candidate genes in Anopheles gambiae: known and novel candidate genes.

    PubMed

    Ingham, Victoria A; Jones, Christopher M; Pignatelli, Patricia; Balabanidou, Vasileia; Vontas, John; Wagstaff, Simon C; Moore, Jonathan D; Ranson, Hilary

    2014-11-25

    The elevated expression of enzymes with insecticide metabolism activity can lead to high levels of insecticide resistance in the malaria vector, Anopheles gambiae. In this study, adult female mosquitoes from an insecticide susceptible and resistant strain were dissected into four different body parts. RNA from each of these samples was used in microarray analysis to determine the enrichment patterns of the key detoxification gene families within the mosquito and to identify additional candidate insecticide resistance genes that may have been overlooked in previous experiments on whole organisms. A general enrichment in the transcription of genes from the four major detoxification gene families (carboxylesterases, glutathione transferases, UDP glucornyltransferases and cytochrome P450s) was observed in the midgut and malpighian tubules. Yet the subset of P450 genes that have previously been implicated in insecticide resistance in An gambiae, show a surprisingly varied profile of tissue enrichment, confirmed by qPCR and, for three candidates, by immunostaining. A stringent selection process was used to define a list of 105 genes that are significantly (p ≤0.001) over expressed in body parts from the resistant versus susceptible strain. Over half of these, including all the cytochrome P450s on this list, were identified in previous whole organism comparisons between the strains, but several new candidates were detected, notably from comparisons of the transcriptomes from dissected abdomen integuments. The use of RNA extracted from the whole organism to identify candidate insecticide resistance genes has a risk of missing candidates if key genes responsible for the phenotype have restricted expression within the body and/or are over expression only in certain tissues. However, as transcription of genes implicated in metabolic resistance to insecticides is not enriched in any one single organ, comparison of the transcriptome of individual dissected body parts cannot be recommended as a preferred means to identify new candidate insecticide resistant genes. Instead the rich data set on in vivo sites of transcription should be consulted when designing follow up qPCR validation steps, or for screening known candidates in field populations.

  3. Collaboratively charting the gene-to-phenotype network of human congenital heart defects

    PubMed Central

    2010-01-01

    Background How to efficiently integrate the daily practice of molecular biologists, geneticists, and clinicians with the emerging computational strategies from systems biology is still much of an open question. Description We built on the recent advances in Wiki-based technologies to develop a collaborative knowledge base and gene prioritization portal aimed at mapping genes and genomic regions, and untangling their relations with corresponding human phenotypes, congenital heart defects (CHDs). This portal is not only an evolving community repository of current knowledge on the genetic basis of CHDs, but also a collaborative environment for the study of candidate genes potentially implicated in CHDs - in particular by integrating recent strategies for the statistical prioritization of candidate genes. It thus serves and connects the broad community that is facing CHDs, ranging from the pediatric cardiologist and clinical geneticist to the basic investigator of cardiogenesis. Conclusions This study describes the first specialized portal to collaboratively annotate and analyze gene-phenotype networks. Of broad interest to the biological community, we argue that such portals will play a significant role in systems biology studies of numerous complex biological processes. CHDWiki is accessible at http://www.esat.kuleuven.be/~bioiuser/chdwiki PMID:20193066

  4. Synteny analysis of genes and distribution of loci controlling oil content and fatty acid profile based on QTL alignment map in Brassica napus.

    PubMed

    Raboanatahiry, Nadia; Chao, Hongbo; Guo, Liangxing; Gan, Jianping; Xiang, Jun; Yan, Mingli; Zhang, Libin; Yu, Longjiang; Li, Maoteng

    2017-10-12

    Deciphering the genetic architecture of a species is a good way to understand its evolutionary history, but also to tailor its profile for breeding elite cultivars with desirable traits. Aligning QTLs from diverse population in one map and utilizing it for comparison, but also as a basis for multiple analyses assure a stronger evidence to understand the genetic system related to a given phenotype. In this study, 439 genes involved in fatty acid (FA) and triacylglycerol (TAG) biosyntheses were identified in Brassica napus. B. napus genome showed mixed gene loss and insertion compared to B. rapa and B. oleracea, and C genome had more inserted genes. Identified QTLs for oil (OC-QTLs) and fatty acids (FA-QTLs) from nine reported populations were projected on the physical map of the reference genome "Darmor-bzh" to generate a map. Thus, 335 FA-QTLs and OC-QTLs could be highlighted and 82 QTLs were overlapping. Chromosome C3 contained 22 overlapping QTLs with all trait studied except for C18:3. In total, 218 candidate genes which were potentially involved in FA and TAG were identified in 162 QTLs confidence intervals and some of them might affect many traits. Also, 76 among these candidate genes were found inside 57 overlapping QTLs, and candidate genes for oil content were in majority (61/76 genes). Then, sixteen genes were found in overlapping QTLs involving three populations, and the remaining 60 genes were found in overlapping QTLs of two populations. Interaction network and pathway analysis of these candidate genes indicated ten genes that might have strong influence over the other genes that control fatty acids and oil formation. The present results provided new information for genetic basis of FA and TAG formation in B. napus. A map including QTLs from numerous populations was built, which could serve as reference to study the genome profile of B. napus, and new potential genes emerged which might affect seed oil. New useful tracks were showed for the selection of population or/and selection of interesting genes for breeding improvement purpose.

  5. Exploring candidate biomarkers for lung and prostate cancers using gene expression and flux variability analysis.

    PubMed

    Asgari, Yazdan; Khosravi, Pegah; Zabihinpour, Zahra; Habibi, Mahnaz

    2018-02-19

    Genome-scale metabolic models have provided valuable resources for exploring changes in metabolism under normal and cancer conditions. However, metabolism itself is strongly linked to gene expression, so integration of gene expression data into metabolic models might improve the detection of genes involved in the control of tumor progression. Herein, we considered gene expression data as extra constraints to enhance the predictive powers of metabolic models. We reconstructed genome-scale metabolic models for lung and prostate, under normal and cancer conditions to detect the major genes associated with critical subsystems during tumor development. Furthermore, we utilized gene expression data in combination with an information theory-based approach to reconstruct co-expression networks of the human lung and prostate in both cohorts. Our results revealed 19 genes as candidate biomarkers for lung and prostate cancer cells. This study also revealed that the development of a complementary approach (integration of gene expression and metabolic profiles) could lead to proposing novel biomarkers and suggesting renovated cancer treatment strategies which have not been possible to detect using either of the methods alone.

  6. Associations of candidate genes to age-related macular degeneration among racial/ethnic groups in the multi-ethnic study of atherosclerosis.

    PubMed

    Klein, Ronald; Li, Xiaohui; Kuo, Jane Z; Klein, Barbara E K; Cotch, Mary Frances; Wong, Tien Y; Taylor, Kent D; Rotter, Jerome I

    2013-11-01

    To describe the relationships of selected candidate genes to the prevalence of early age-related macular degeneration (AMD) in a cohort of whites, blacks, Hispanics, and Chinese Americans. Cross-sectional study. setting: Multicenter study. study population: A total of 2456 persons aged 45-84 years with genotype information and fundus photographs. procedures: Twelve of 2862 single nucleotide polymorphisms (SNPs) from 11 of 233 candidate genes for cardiovascular disease were selected for analysis based on screening with marginal unadjusted P value <.001 within 1 or more racial/ethnic groups. Logistic regression models tested for association in case-control samples. main outcome measure: Prevalence of early AMD. Early AMD was present in 4.0% of the cohort and varied from 2.4% in blacks to 6.0% in whites. The odds ratio increased from 2.3 for 1 to 10.0 for 4 risk alleles in a joint effect analysis of Age-Related Maculopathy Susceptibility 2 rs10490924 and Complement Factor H Y402H (P for trend = 4.2×10(-7)). Frequencies of each SNP varied among the racial/ethnic groups. Adjusting for age and other factors, few statistically significant associations of the 12 SNPs with AMD were consistent across all groups. In a multivariate model, most candidate genes did not attenuate the comparatively higher odds of AMD in whites. The higher frequency of risk alleles for several SNPs in Chinese Americans may partially explain their AMD frequency's approaching that of whites. The relationships of 11 candidate genes to early AMD varied among 4 racial/ethnic groups, and partially explained the observed variations in early AMD prevalence among them. Copyright © 2013 Elsevier Inc. All rights reserved.

  7. Network-based analysis of oligodendrogliomas predicts novel cancer gene candidates within the region of the 1p/19q co-deletion.

    PubMed

    Gladitz, Josef; Klink, Barbara; Seifert, Michael

    2018-06-11

    Oligodendrogliomas are primary human brain tumors with a characteristic 1p/19q co-deletion of important prognostic relevance, but little is known about the pathology of this chromosomal mutation. We developed a network-based approach to identify novel cancer gene candidates in the region of the 1p/19q co-deletion. Gene regulatory networks were learned from gene expression and copy number data of 178 oligodendrogliomas and further used to quantify putative impacts of differentially expressed genes of the 1p/19q region on cancer-relevant pathways. We predicted 8 genes with strong impact on signaling pathways and 14 genes with strong impact on metabolic pathways widespread across the region of the 1p/19 co-deletion. Many of these candidates (e.g. ELTD1, SDHB, SEPW1, SLC17A7, SZRD1, THAP3, ZBTB17) are likely to push, whereas others (e.g. CAP1, HBXIP, KLK6, PARK7, PTAFR) might counteract oligodendroglioma development. For example, ELTD1, a functionally validated glioblastoma oncogene located on 1p, was overexpressed. Further, the known glioblastoma tumor suppressor SLC17A7 located on 19q was underexpressed. Moreover, known epigenetic alterations triggered by mutated SDHB in paragangliomas suggest that underexpressed SDHB in oligodendrogliomas may support and possibly enhance the epigenetic reprogramming induced by the IDH-mutation. We further analyzed rarely observed deletions and duplications of chromosomal arms within oligodendroglioma subcohorts identifying putative oncogenes and tumor suppressors that possibly influence the development of oligodendroglioma subgroups. Our in-depth computational study contributes to a better understanding of the pathology of the 1p/19q co-deletion and other chromosomal arm mutations. This might open opportunities for functional validations and new therapeutic strategies.

  8. Network-Based Identification and Prioritization of Key Regulators of Coronary Artery Disease Loci

    PubMed Central

    Zhao, Yuqi; Chen, Jing; Freudenberg, Johannes M.; Meng, Qingying; Rajpal, Deepak K.; Yang, Xia

    2017-01-01

    Objective Recent genome-wide association studies of coronary artery disease (CAD) have revealed 58 genome-wide significant and 148 suggestive genetic loci. However, the molecular mechanisms through which they contribute to CAD and the clinical implications of these findings remain largely unknown. We aim to retrieve gene subnetworks of the 206 CAD loci and identify and prioritize candidate regulators to better understand the biological mechanisms underlying the genetic associations. Approach and Results We devised a new integrative genomics approach that incorporated (1) candidate genes from the top CAD loci, (2) the complete genetic association results from the 1000 genomes-based CAD genome-wide association studies from the Coronary Artery Disease Genome Wide Replication and Meta-Analysis Plus the Coronary Artery Disease consortium, (3) tissue-specific gene regulatory networks that depict the potential relationship and interactions between genes, and (4) tissue-specific gene expression patterns between CAD patients and controls. The networks and top-ranked regulators according to these data-driven criteria were further queried against literature, experimental evidence, and drug information to evaluate their disease relevance and potential as drug targets. Our analysis uncovered several potential novel regulators of CAD such as LUM and STAT3, which possess properties suitable as drug targets. We also revealed molecular relations and potential mechanisms through which the top CAD loci operate. Furthermore, we found that multiple CAD-relevant biological processes such as extracellular matrix, inflammatory and immune pathways, complement and coagulation cascades, and lipid metabolism interact in the CAD networks. Conclusions Our data-driven integrative genomics framework unraveled tissue-specific relations among the candidate genes of the CAD genome-wide association studies loci and prioritized novel network regulatory genes orchestrating biological processes relevant to CAD. PMID:26966275

  9. Evaluating Reported Candidate Gene Associations with Polycystic Ovary Syndrome

    PubMed Central

    Pau, Cindy; Saxena, Richa; Welt, Corrine Kolka

    2013-01-01

    Objective To replicate variants in candidate genes associated with PCOS in a population of European PCOS and control subjects. Design Case-control association analysis and meta-analysis. Setting Major academic hospital Patients Women of European ancestry with PCOS (n=525) and controls (n=472), aged 18 to 45 years. Intervention Variants previously associated with PCOS in candidate gene studies were genotyped (n=39). Metabolic, reproductive and anthropomorphic parameters were examined as a function of the candidate variants. All genetic association analyses were adjusted for age, BMI and ancestry and were reported after correction for multiple testing. Main Outcome Measure Association of candidate gene variants with PCOS. Results Three variants, rs3797179 (SRD5A1), rs12473543 (POMC), and rs1501299 (ADIPOQ), were nominally associated with PCOS. However, they did not remain significant after correction for multiple testing and none of the variants replicated in a sufficiently powered meta-analysis. Variants in the FBN3 gene (rs17202517 and rs73503752) were associated with smaller waist circumferences and variant rs727428 in the SHBG gene was associated with lower SHBG levels. Conclusion Previously identified variants in candidate genes do not appear to be associated with PCOS risk. PMID:23375202

  10. Neurotransmitter systems and neurotrophic factors in autism: association study of 37 genes suggests involvement of DDC.

    PubMed

    Toma, Claudio; Hervás, Amaia; Balmaña, Noemí; Salgado, Marta; Maristany, Marta; Vilella, Elisabet; Aguilera, Francisco; Orejuela, Carmen; Cuscó, Ivon; Gallastegui, Fátima; Pérez-Jurado, Luis Alberto; Caballero-Andaluz, Rafaela; Diego-Otero, Yolanda de; Guzmán-Alvarez, Guadalupe; Ramos-Quiroga, Josep Antoni; Ribasés, Marta; Bayés, Mònica; Cormand, Bru

    2013-09-01

    Neurotransmitter systems and neurotrophic factors can be considered strong candidates for autism spectrum disorder (ASD). The serotoninergic and dopaminergic systems are involved in neurotransmission, brain maturation and cortical organization, while neurotrophic factors (NTFs) participate in neurodevelopment, neuronal survival and synapses formation. We aimed to test the contribution of these candidate pathways to autism through a case-control association study of genes selected both for their role in central nervous system functions and for pathophysiological evidences. The study sample consisted of 326 unrelated autistic patients and 350 gender-matched controls from Spain. We genotyped 369 tagSNPs to perform a case-control association study of 37 candidate genes. A significant association was obtained between the DDC gene and autism in the single-marker analysis (rs6592961, P = 0.00047). Haplotype-based analysis pinpointed a four-marker combination in this gene associated with the disorder (rs2329340C-rs2044859T-rs6592961A-rs11761683T, P = 4.988e-05). No significant results were obtained for the remaining genes after applying multiple testing corrections. However, the rs167771 marker in DRD3, associated with ASD in a previous study, displayed a nominal association in our analysis (P = 0.023). Our data suggest that common allelic variants in the DDC gene may be involved in autism susceptibility.

  11. An assessment of heavy ion irradiation mutagenesis for reverse genetics in wheat (Triticum aestivum L.).

    PubMed

    Fitzgerald, Timothy L; Powell, Jonathan J; Stiller, Jiri; Weese, Terri L; Abe, Tomoko; Zhao, Guangyao; Jia, Jizeng; McIntyre, C Lynne; Li, Zhongyi; Manners, John M; Kazan, Kemal

    2015-01-01

    Reverse genetic techniques harnessing mutational approaches are powerful tools that can provide substantial insight into gene function in plants. However, as compared to diploid species, reverse genetic analyses in polyploid plants such as bread wheat can present substantial challenges associated with high levels of sequence and functional similarity amongst homoeologous loci. We previously developed a high-throughput method to identify deletions of genes within a physically mutagenized wheat population. Here we describe our efforts to combine multiple homoeologous deletions of three candidate disease susceptibility genes (TaWRKY11, TaPFT1 and TaPLDß1). We were able to produce lines featuring homozygous deletions at two of the three homoeoloci for all genes, but this was dependent on the individual mutants used in crossing. Intriguingly, despite extensive efforts, viable lines possessing homozygous deletions at all three homoeoloci could not be produced for any of the candidate genes. To investigate deletion size as a possible reason for this phenomenon, we developed an amplicon sequencing approach based on synteny to Brachypodium distachyon to assess the size of the deletions removing one candidate gene (TaPFT1) in our mutants. These analyses revealed that genomic deletions removing the locus are relatively large, resulting in the loss of multiple additional genes. The implications of this work for the use of heavy ion mutagenesis for reverse genetic analyses in wheat are discussed.

  12. An Assessment of Heavy Ion Irradiation Mutagenesis for Reverse Genetics in Wheat (Triticum aestivum L.)

    PubMed Central

    Fitzgerald, Timothy L.; Powell, Jonathan J.; Stiller, Jiri; Weese, Terri L.; Abe, Tomoko; Zhao, Guangyao; Jia, Jizeng; McIntyre, C. Lynne; Li, Zhongyi; Manners, John M.; Kazan, Kemal

    2015-01-01

    Reverse genetic techniques harnessing mutational approaches are powerful tools that can provide substantial insight into gene function in plants. However, as compared to diploid species, reverse genetic analyses in polyploid plants such as bread wheat can present substantial challenges associated with high levels of sequence and functional similarity amongst homoeologous loci. We previously developed a high-throughput method to identify deletions of genes within a physically mutagenized wheat population. Here we describe our efforts to combine multiple homoeologous deletions of three candidate disease susceptibility genes (TaWRKY11, TaPFT1 and TaPLDß1). We were able to produce lines featuring homozygous deletions at two of the three homoeoloci for all genes, but this was dependent on the individual mutants used in crossing. Intriguingly, despite extensive efforts, viable lines possessing homozygous deletions at all three homoeoloci could not be produced for any of the candidate genes. To investigate deletion size as a possible reason for this phenomenon, we developed an amplicon sequencing approach based on synteny to Brachypodium distachyon to assess the size of the deletions removing one candidate gene (TaPFT1) in our mutants. These analyses revealed that genomic deletions removing the locus are relatively large, resulting in the loss of multiple additional genes. The implications of this work for the use of heavy ion mutagenesis for reverse genetic analyses in wheat are discussed. PMID:25719507

  13. SNP discovery in candidate adaptive genes using exon capture in a free-ranging alpine ungulate

    USGS Publications Warehouse

    Roffler, Gretchen H.; Amish, Stephen J.; Smith, Seth; Cosart, Ted F.; Kardos, Marty; Schwartz, Michael K.; Luikart, Gordon

    2016-01-01

    Identification of genes underlying genomic signatures of natural selection is key to understanding adaptation to local conditions. We used targeted resequencing to identify SNP markers in 5321 candidate adaptive genes associated with known immunological, metabolic and growth functions in ovids and other ungulates. We selectively targeted 8161 exons in protein-coding and nearby 5′ and 3′ untranslated regions of chosen candidate genes. Targeted sequences were taken from bighorn sheep (Ovis canadensis) exon capture data and directly from the domestic sheep genome (Ovis aries v. 3; oviAri3). The bighorn sheep sequences used in the Dall's sheep (Ovis dalli dalli) exon capture aligned to 2350 genes on the oviAri3 genome with an average of 2 exons each. We developed a microfluidic qPCR-based SNP chip to genotype 476 Dall's sheep from locations across their range and test for patterns of selection. Using multiple corroborating approaches (lositan and bayescan), we detected 28 SNP loci potentially under selection. We additionally identified candidate loci significantly associated with latitude, longitude, precipitation and temperature, suggesting local environmental adaptation. The three methods demonstrated consistent support for natural selection on nine genes with immune and disease-regulating functions (e.g. Ovar-DRA, APC, BATF2, MAGEB18), cell regulation signalling pathways (e.g. KRIT1, PI3K, ORRC3), and respiratory health (CYSLTR1). Characterizing adaptive allele distributions from novel genetic techniques will facilitate investigation of the influence of environmental variation on local adaptation of a northern alpine ungulate throughout its range. This research demonstrated the utility of exon capture for gene-targeted SNP discovery and subsequent SNP chip genotyping using low-quality samples in a nonmodel species.

  14. Genome-wide detection of selection signatures in Chinese indigenous Laiwu pigs revealed candidate genes regulating fat deposition in muscle.

    PubMed

    Chen, Minhui; Wang, Jiying; Wang, Yanping; Wu, Ying; Fu, Jinluan; Liu, Jian-Feng

    2018-05-18

    Currently, genome-wide scans for positive selection signatures in commercial breed have been investigated. However, few studies have focused on selection footprints of indigenous breeds. Laiwu pig is an invaluable Chinese indigenous pig breed with extremely high proportion of intramuscular fat (IMF), and an excellent model to detect footprint as the result of natural and artificial selection for fat deposition in muscle. In this study, based on GeneSeek Genomic profiler Porcine HD data, three complementary methods, F ST , iHS (integrated haplotype homozygosity score) and CLR (composite likelihood ratio), were implemented to detect selection signatures in the whole genome of Laiwu pigs. Totally, 175 candidate selected regions were obtained by at least two of the three methods, which covered 43.75 Mb genomic regions and corresponded to 1.79% of the genome sequence. Gene annotation of the selected regions revealed a list of functionally important genes for feed intake and fat deposition, reproduction, and immune response. Especially, in accordance to the phenotypic features of Laiwu pigs, among the candidate genes, we identified several genes, NPY1R, NPY5R, PIK3R1 and JAKMIP1, involved in the actions of two sets of neurons, which are central regulators in maintaining the balance between food intake and energy expenditure. Our results identified a number of regions showing signatures of selection, as well as a list of functionally candidate genes with potential effect on phenotypic traits, especially fat deposition in muscle. Our findings provide insights into the mechanisms of artificial selection of fat deposition and further facilitate follow-up functional studies.

  15. Candidate genes that have facilitated freshwater adaptation by palaemonid prawns in the genus Macrobrachium: identification and expression validation in a model species (M. koombooloomba).

    PubMed

    Rahi, Md Lifat; Amin, Shorash; Mather, Peter B; Hurwood, David A

    2017-01-01

    The endemic Australian freshwater prawn, Macrobrachium koombooloomba , provides a model for exploring genes involved with freshwater adaptation because it is one of the relatively few Macrobrachium species that can complete its entire life cycle in freshwater. The present study was conducted to identify potential candidate genes that are likely to contribute to effective freshwater adaptation by M. koombooloomba using a transcriptomics approach. De novo assembly of 75 bp paired end 227,564,643 high quality Illumina raw reads from 6 different cDNA libraries revealed 125,917 contigs of variable lengths (200-18,050 bp) with an N50 value of 1597. In total, 31,272 (24.83%) of the assembled contigs received significant blast hits, of which 27,686 and 22,560 contigs were mapped and functionally annotated, respectively. CEGMA (Core Eukaryotic Genes Mapping Approach) based transcriptome quality assessment revealed 96.37% completeness. We identified 43 different potential genes that are likely to be involved with freshwater adaptation in M. koombooloomba . Identified candidate genes included: 25 genes for osmoregulation, five for cell volume regulation, seven for stress tolerance, three for body fluid (haemolymph) maintenance, eight for epithelial permeability and water channel regulation, nine for egg size control and three for larval development. RSEM (RNA-Seq Expectation Maximization) based abundance estimation revealed that 6,253, 5,753 and 3,795 transcripts were expressed (at TPM value ≥10) in post larvae, juveniles and adults, respectively. Differential gene expression (DGE) analysis showed that 15 genes were expressed differentially in different individuals but these genes apparently were not involved with freshwater adaptation but rather were involved in growth, development and reproductive maturation. The genomic resources developed here will be useful for better understanding the molecular basis of freshwater adaptation in Macrobrachium prawns and other crustaceans more broadly.

  16. Candidate genes that have facilitated freshwater adaptation by palaemonid prawns in the genus Macrobrachium: identification and expression validation in a model species (M. koombooloomba)

    PubMed Central

    Amin, Shorash; Mather, Peter B.; Hurwood, David A.

    2017-01-01

    Background The endemic Australian freshwater prawn, Macrobrachium koombooloomba, provides a model for exploring genes involved with freshwater adaptation because it is one of the relatively few Macrobrachium species that can complete its entire life cycle in freshwater. Methods The present study was conducted to identify potential candidate genes that are likely to contribute to effective freshwater adaptation by M. koombooloomba using a transcriptomics approach. De novo assembly of 75 bp paired end 227,564,643 high quality Illumina raw reads from 6 different cDNA libraries revealed 125,917 contigs of variable lengths (200–18,050 bp) with an N50 value of 1597. Results In total, 31,272 (24.83%) of the assembled contigs received significant blast hits, of which 27,686 and 22,560 contigs were mapped and functionally annotated, respectively. CEGMA (Core Eukaryotic Genes Mapping Approach) based transcriptome quality assessment revealed 96.37% completeness. We identified 43 different potential genes that are likely to be involved with freshwater adaptation in M. koombooloomba. Identified candidate genes included: 25 genes for osmoregulation, five for cell volume regulation, seven for stress tolerance, three for body fluid (haemolymph) maintenance, eight for epithelial permeability and water channel regulation, nine for egg size control and three for larval development. RSEM (RNA-Seq Expectation Maximization) based abundance estimation revealed that 6,253, 5,753 and 3,795 transcripts were expressed (at TPM value ≥10) in post larvae, juveniles and adults, respectively. Differential gene expression (DGE) analysis showed that 15 genes were expressed differentially in different individuals but these genes apparently were not involved with freshwater adaptation but rather were involved in growth, development and reproductive maturation. Discussion The genomic resources developed here will be useful for better understanding the molecular basis of freshwater adaptation in Macrobrachium prawns and other crustaceans more broadly. PMID:28194319

  17. Mapping and genomic targeting of the major leaf shape gene (L) in Upland cotton (Gossypium hirsutum L.).

    PubMed

    Andres, Ryan J; Bowman, Daryl T; Kaur, Baljinder; Kuraparthy, Vasu

    2014-01-01

    A major leaf shape locus (L) was mapped with molecular markers and genomically targeted to a small region in the D-genome of cotton. By using expression analysis and candidate gene mapping, two LMI1 -like genes are identified as possible candidates for leaf shape trait in cotton. Leaf shape in cotton is an important trait that influences yield, flowering rates, disease resistance, lint trash, and the efficacy of foliar chemical application. The leaves of okra leaf cotton display a significantly enhanced lobing pattern, as well as ectopic outgrowths along the lobe margins when compared with normal leaf cotton. These phenotypes are the hallmark characteristics of mutations in various known modifiers of leaf shape that culminate in the mis/over-expression of Class I KNOX genes. To better understand the molecular and genetic processes underlying leaf shape in cotton, a normal leaf accession (PI607650) was crossed to an okra leaf breeding line (NC05AZ21). An F2 population of 236 individuals confirmed the incompletely dominant single gene nature of the okra leaf shape trait in Gossypium hirsutum L. Molecular mapping with simple sequence repeat markers localized the leaf shape gene to 5.4 cM interval in the distal region of the short arm of chromosome 15. Orthologous mapping of the closely linked markers with the sequenced diploid D-genome (Gossypium raimondii) tentatively resolved the leaf shape locus to a small genomic region. RT-PCR-based expression analysis and candidate gene mapping indicated that the okra leaf shape gene (L (o) ) in cotton might be an upstream regulator of Class I KNOX genes. The linked molecular markers and delineated genomic region in the sequenced diploid D-genome will assist in the future high-resolution mapping and map-based cloning of the leaf shape gene in cotton.

  18. Identifying candidate driver genes by integrative ovarian cancer genomics data

    NASA Astrophysics Data System (ADS)

    Lu, Xinguo; Lu, Jibo

    2017-08-01

    Integrative analysis of molecular mechanics underlying cancer can distinguish interactions that cannot be revealed based on one kind of data for the appropriate diagnosis and treatment of cancer patients. Tumor samples exhibit heterogeneity in omics data, such as somatic mutations, Copy Number Variations CNVs), gene expression profiles and so on. In this paper we combined gene co-expression modules and mutation modulators separately in tumor patients to obtain the candidate driver genes for resistant and sensitive tumor from the heterogeneous data. The final list of modulators identified are well known in biological processes associated with ovarian cancer, such as CCL17, CACTIN, CCL16, CCL22, APOB, KDF1, CCL11, HNF1B, LRG1, MED1 and so on, which can help to facilitate the discovery of biomarkers, molecular diagnostics, and drug discovery.

  19. A genome-wide association study of corneal astigmatism: The CREAM Consortium.

    PubMed

    Shah, Rupal L; Li, Qing; Zhao, Wanting; Tedja, Milly S; Tideman, J Willem L; Khawaja, Anthony P; Fan, Qiao; Yazar, Seyhan; Williams, Katie M; Verhoeven, Virginie J M; Xie, Jing; Wang, Ya Xing; Hess, Moritz; Nickels, Stefan; Lackner, Karl J; Pärssinen, Olavi; Wedenoja, Juho; Biino, Ginevra; Concas, Maria Pina; Uitterlinden, André; Rivadeneira, Fernando; Jaddoe, Vincent W V; Hysi, Pirro G; Sim, Xueling; Tan, Nicholas; Tham, Yih-Chung; Sensaki, Sonoko; Hofman, Albert; Vingerling, Johannes R; Jonas, Jost B; Mitchell, Paul; Hammond, Christopher J; Höhn, René; Baird, Paul N; Wong, Tien-Yin; Cheng, Chinfsg-Yu; Teo, Yik Ying; Mackey, David A; Williams, Cathy; Saw, Seang-Mei; Klaver, Caroline C W; Guggenheim, Jeremy A; Bailey-Wilson, Joan E

    2018-01-01

    To identify genes and genetic markers associated with corneal astigmatism. A meta-analysis of genome-wide association studies (GWASs) of corneal astigmatism undertaken for 14 European ancestry (n=22,250) and 8 Asian ancestry (n=9,120) cohorts was performed by the Consortium for Refractive Error and Myopia. Cases were defined as having >0.75 diopters of corneal astigmatism. Subsequent gene-based and gene-set analyses of the meta-analyzed results of European ancestry cohorts were performed using VEGAS2 and MAGMA software. Additionally, estimates of single nucleotide polymorphism (SNP)-based heritability for corneal and refractive astigmatism and the spherical equivalent were calculated for Europeans using LD score regression. The meta-analysis of all cohorts identified a genome-wide significant locus near the platelet-derived growth factor receptor alpha ( PDGFRA ) gene: top SNP: rs7673984, odds ratio=1.12 (95% CI:1.08-1.16), p=5.55×10 -9 . No other genome-wide significant loci were identified in the combined analysis or European/Asian ancestry-specific analyses. Gene-based analysis identified three novel candidate genes for corneal astigmatism in Europeans-claudin-7 ( CLDN7 ), acid phosphatase 2, lysosomal ( ACP2 ), and TNF alpha-induced protein 8 like 3 ( TNFAIP8L3 ). In addition to replicating a previously identified genome-wide significant locus for corneal astigmatism near the PDGFRA gene, gene-based analysis identified three novel candidate genes, CLDN7 , ACP2 , and TNFAIP8L3 , that warrant further investigation to understand their role in the pathogenesis of corneal astigmatism. The much lower number of genetic variants and genes demonstrating an association with corneal astigmatism compared to published spherical equivalent GWAS analyses suggest a greater influence of rare genetic variants, non-additive genetic effects, or environmental factors in the development of astigmatism.

  20. Systematic prediction of gene function in Arabidopsis thaliana using a probabilistic functional gene network

    PubMed Central

    Hwang, Sohyun; Rhee, Seung Y; Marcotte, Edward M; Lee, Insuk

    2012-01-01

    AraNet is a functional gene network for the reference plant Arabidopsis and has been constructed in order to identify new genes associated with plant traits. It is highly predictive for diverse biological pathways and can be used to prioritize genes for functional screens. Moreover, AraNet provides a web-based tool with which plant biologists can efficiently discover novel functions of Arabidopsis genes (http://www.functionalnet.org/aranet/). This protocol explains how to conduct network-based prediction of gene functions using AraNet and how to interpret the prediction results. Functional discovery in plant biology is facilitated by combining candidate prioritization by AraNet with focused experimental tests. PMID:21886106

  1. Non-coding cancer driver candidates identified with a sample- and position-specific model of the somatic mutation rate

    PubMed Central

    Juul, Malene; Bertl, Johanna; Guo, Qianyun; Nielsen, Morten Muhlig; Świtnicki, Michał; Hornshøj, Henrik; Madsen, Tobias; Hobolth, Asger; Pedersen, Jakob Skou

    2017-01-01

    Non-coding mutations may drive cancer development. Statistical detection of non-coding driver regions is challenged by a varying mutation rate and uncertainty of functional impact. Here, we develop a statistically founded non-coding driver-detection method, ncdDetect, which includes sample-specific mutational signatures, long-range mutation rate variation, and position-specific impact measures. Using ncdDetect, we screened non-coding regulatory regions of protein-coding genes across a pan-cancer set of whole-genomes (n = 505), which top-ranked known drivers and identified new candidates. For individual candidates, presence of non-coding mutations associates with altered expression or decreased patient survival across an independent pan-cancer sample set (n = 5454). This includes an antigen-presenting gene (CD1A), where 5’UTR mutations correlate significantly with decreased survival in melanoma. Additionally, mutations in a base-excision-repair gene (SMUG1) correlate with a C-to-T mutational-signature. Overall, we find that a rich model of mutational heterogeneity facilitates non-coding driver identification and integrative analysis points to candidates of potential clinical relevance. DOI: http://dx.doi.org/10.7554/eLife.21778.001 PMID:28362259

  2. Genetic variation in cell death genes and risk of non-Hodgkin lymphoma.

    PubMed

    Schuetz, Johanna M; Daley, Denise; Graham, Jinko; Berry, Brian R; Gallagher, Richard P; Connors, Joseph M; Gascoyne, Randy D; Spinelli, John J; Brooks-Wilson, Angela R

    2012-01-01

    Non-Hodgkin lymphomas are a heterogeneous group of solid tumours that constitute the 5(th) highest cause of cancer mortality in the United States and Canada. Poor control of cell death in lymphocytes can lead to autoimmune disease or cancer, making genes involved in programmed cell death of lymphocytes logical candidate genes for lymphoma susceptibility. We tested for genetic association with NHL and NHL subtypes, of SNPs in lymphocyte cell death genes using an established population-based study. 17 candidate genes were chosen based on biological function, with 123 SNPs tested. These included tagSNPs from HapMap and novel SNPs discovered by re-sequencing 47 cases in genes for which SNP representation was judged to be low. The main analysis, which estimated odds ratios by fitting data to an additive logistic regression model, used European ancestry samples that passed quality control measures (569 cases and 547 controls). A two-tiered approach for multiple testing correction was used: correction for number of tests within each gene by permutation-based methodology, followed by correction for the number of genes tested using the false discovery rate. Variant rs928883, near miR-155, showed an association (OR per A-allele: 2.80 [95% CI: 1.63-4.82]; p(F) = 0.027) with marginal zone lymphoma that is significant after correction for multiple testing. This is the first reported association between a germline polymorphism at a miRNA locus and lymphoma.

  3. Prediction of Human Disease Genes by Human-Mouse Conserved Coexpression Analysis

    PubMed Central

    Grassi, Elena; Damasco, Christian; Silengo, Lorenzo; Oti, Martin; Provero, Paolo; Di Cunto, Ferdinando

    2008-01-01

    Background Even in the post-genomic era, the identification of candidate genes within loci associated with human genetic diseases is a very demanding task, because the critical region may typically contain hundreds of positional candidates. Since genes implicated in similar phenotypes tend to share very similar expression profiles, high throughput gene expression data may represent a very important resource to identify the best candidates for sequencing. However, so far, gene coexpression has not been used very successfully to prioritize positional candidates. Methodology/Principal Findings We show that it is possible to reliably identify disease-relevant relationships among genes from massive microarray datasets by concentrating only on genes sharing similar expression profiles in both human and mouse. Moreover, we show systematically that the integration of human-mouse conserved coexpression with a phenotype similarity map allows the efficient identification of disease genes in large genomic regions. Finally, using this approach on 850 OMIM loci characterized by an unknown molecular basis, we propose high-probability candidates for 81 genetic diseases. Conclusion Our results demonstrate that conserved coexpression, even at the human-mouse phylogenetic distance, represents a very strong criterion to predict disease-relevant relationships among human genes. PMID:18369433

  4. ICan: an integrated co-alteration network to identify ovarian cancer-related genes.

    PubMed

    Zhou, Yuanshuai; Liu, Yongjing; Li, Kening; Zhang, Rui; Qiu, Fujun; Zhao, Ning; Xu, Yan

    2015-01-01

    Over the last decade, an increasing number of integrative studies on cancer-related genes have been published. Integrative analyses aim to overcome the limitation of a single data type, and provide a more complete view of carcinogenesis. The vast majority of these studies used sample-matched data of gene expression and copy number to investigate the impact of copy number alteration on gene expression, and to predict and prioritize candidate oncogenes and tumor suppressor genes. However, correlations between genes were neglected in these studies. Our work aimed to evaluate the co-alteration of copy number, methylation and expression, allowing us to identify cancer-related genes and essential functional modules in cancer. We built the Integrated Co-alteration network (ICan) based on multi-omics data, and analyzed the network to uncover cancer-related genes. After comparison with random networks, we identified 155 ovarian cancer-related genes, including well-known (TP53, BRCA1, RB1 and PTEN) and also novel cancer-related genes, such as PDPN and EphA2. We compared the results with a conventional method: CNAmet, and obtained a significantly better area under the curve value (ICan: 0.8179, CNAmet: 0.5183). In this paper, we describe a framework to find cancer-related genes based on an Integrated Co-alteration network. Our results proved that ICan could precisely identify candidate cancer genes and provide increased mechanistic understanding of carcinogenesis. This work suggested a new research direction for biological network analyses involving multi-omics data.

  5. ICan: An Integrated Co-Alteration Network to Identify Ovarian Cancer-Related Genes

    PubMed Central

    Zhou, Yuanshuai; Liu, Yongjing; Li, Kening; Zhang, Rui; Qiu, Fujun; Zhao, Ning; Xu, Yan

    2015-01-01

    Background Over the last decade, an increasing number of integrative studies on cancer-related genes have been published. Integrative analyses aim to overcome the limitation of a single data type, and provide a more complete view of carcinogenesis. The vast majority of these studies used sample-matched data of gene expression and copy number to investigate the impact of copy number alteration on gene expression, and to predict and prioritize candidate oncogenes and tumor suppressor genes. However, correlations between genes were neglected in these studies. Our work aimed to evaluate the co-alteration of copy number, methylation and expression, allowing us to identify cancer-related genes and essential functional modules in cancer. Results We built the Integrated Co-alteration network (ICan) based on multi-omics data, and analyzed the network to uncover cancer-related genes. After comparison with random networks, we identified 155 ovarian cancer-related genes, including well-known (TP53, BRCA1, RB1 and PTEN) and also novel cancer-related genes, such as PDPN and EphA2. We compared the results with a conventional method: CNAmet, and obtained a significantly better area under the curve value (ICan: 0.8179, CNAmet: 0.5183). Conclusion In this paper, we describe a framework to find cancer-related genes based on an Integrated Co-alteration network. Our results proved that ICan could precisely identify candidate cancer genes and provide increased mechanistic understanding of carcinogenesis. This work suggested a new research direction for biological network analyses involving multi-omics data. PMID:25803614

  6. Teaching bioinformatics and neuroinformatics by using free web-based tools.

    PubMed

    Grisham, William; Schottler, Natalie A; Valli-Marill, Joanne; Beck, Lisa; Beatty, Jackson

    2010-01-01

    This completely computer-based module's purpose is to introduce students to bioinformatics resources. We present an easy-to-adopt module that weaves together several important bioinformatic tools so students can grasp how these tools are used in answering research questions. Students integrate information gathered from websites dealing with anatomy (Mouse Brain Library), quantitative trait locus analysis (WebQTL from GeneNetwork), bioinformatics and gene expression analyses (University of California, Santa Cruz Genome Browser, National Center for Biotechnology Information's Entrez Gene, and the Allen Brain Atlas), and information resources (PubMed). Instructors can use these various websites in concert to teach genetics from the phenotypic level to the molecular level, aspects of neuroanatomy and histology, statistics, quantitative trait locus analysis, and molecular biology (including in situ hybridization and microarray analysis), and to introduce bioinformatic resources. Students use these resources to discover 1) the region(s) of chromosome(s) influencing the phenotypic trait, 2) a list of candidate genes-narrowed by expression data, 3) the in situ pattern of a given gene in the region of interest, 4) the nucleotide sequence of the candidate gene, and 5) articles describing the gene. Teaching materials such as a detailed student/instructor's manual, PowerPoints, sample exams, and links to free Web resources can be found at http://mdcune.psych.ucla.edu/modules/bioinformatics.

  7. LNDriver: identifying driver genes by integrating mutation and expression data based on gene-gene interaction network.

    PubMed

    Wei, Pi-Jing; Zhang, Di; Xia, Junfeng; Zheng, Chun-Hou

    2016-12-23

    Cancer is a complex disease which is characterized by the accumulation of genetic alterations during the patient's lifetime. With the development of the next-generation sequencing technology, multiple omics data, such as cancer genomic, epigenomic and transcriptomic data etc., can be measured from each individual. Correspondingly, one of the key challenges is to pinpoint functional driver mutations or pathways, which contributes to tumorigenesis, from millions of functional neutral passenger mutations. In this paper, in order to identify driver genes effectively, we applied a generalized additive model to mutation profiles to filter genes with long length and constructed a new gene-gene interaction network. Then we integrated the mutation data and expression data into the gene-gene interaction network. Lastly, greedy algorithm was used to prioritize candidate driver genes from the integrated data. We named the proposed method Length-Net-Driver (LNDriver). Experiments on three TCGA datasets, i.e., head and neck squamous cell carcinoma, kidney renal clear cell carcinoma and thyroid carcinoma, demonstrated that the proposed method was effective. Also, it can identify not only frequently mutated drivers, but also rare candidate driver genes.

  8. Prioritizing chronic obstructive pulmonary disease (COPD) candidate genes in COPD-related networks

    PubMed Central

    Zhang, Yihua; Li, Wan; Feng, Yuyan; Guo, Shanshan; Zhao, Xilei; Wang, Yahui; He, Yuehan; He, Weiming; Chen, Lina

    2017-01-01

    Chronic obstructive pulmonary disease (COPD) is a multi-factor disease, which could be caused by many factors, including disturbances of metabolism and protein-protein interactions (PPIs). In this paper, a weighted COPD-related metabolic network and a weighted COPD-related PPI network were constructed base on COPD disease genes and functional information. Candidate genes in these weighted COPD-related networks were prioritized by making use of a gene prioritization method, respectively. Literature review and functional enrichment analysis of the top 100 genes in these two networks suggested the correlation of COPD and these genes. The performance of our gene prioritization method was superior to that of ToppGene and ToppNet for genes from the COPD-related metabolic network or the COPD-related PPI network after assessing using leave-one-out cross-validation, literature validation and functional enrichment analysis. The top-ranked genes prioritized from COPD-related metabolic and PPI networks could promote the better understanding about the molecular mechanism of this disease from different perspectives. The top 100 genes in COPD-related metabolic network or COPD-related PPI network might be potential markers for the diagnosis and treatment of COPD. PMID:29262568

  9. Prioritizing chronic obstructive pulmonary disease (COPD) candidate genes in COPD-related networks.

    PubMed

    Zhang, Yihua; Li, Wan; Feng, Yuyan; Guo, Shanshan; Zhao, Xilei; Wang, Yahui; He, Yuehan; He, Weiming; Chen, Lina

    2017-11-28

    Chronic obstructive pulmonary disease (COPD) is a multi-factor disease, which could be caused by many factors, including disturbances of metabolism and protein-protein interactions (PPIs). In this paper, a weighted COPD-related metabolic network and a weighted COPD-related PPI network were constructed base on COPD disease genes and functional information. Candidate genes in these weighted COPD-related networks were prioritized by making use of a gene prioritization method, respectively. Literature review and functional enrichment analysis of the top 100 genes in these two networks suggested the correlation of COPD and these genes. The performance of our gene prioritization method was superior to that of ToppGene and ToppNet for genes from the COPD-related metabolic network or the COPD-related PPI network after assessing using leave-one-out cross-validation, literature validation and functional enrichment analysis. The top-ranked genes prioritized from COPD-related metabolic and PPI networks could promote the better understanding about the molecular mechanism of this disease from different perspectives. The top 100 genes in COPD-related metabolic network or COPD-related PPI network might be potential markers for the diagnosis and treatment of COPD.

  10. Association and linkage studies of candidate genes involved in GABAergic neurotransmission in lithium-responsive bipolar disorder.

    PubMed Central

    Duffy, A; Turecki, G; Grof, P; Cavazzoni, P; Grof, E; Joober, R; Ahrens, B; Berghöfer, A; Müller-Oerlinghausen, B; Dvoráková, M; Libigerová, E; Vojtĕchovský, M; Zvolský, P; Nilsson, A; Licht, R W; Rasmussen, N A; Schou, M; Vestergaard, P; Holzinger, A; Schumann, C; Thau, K; Robertson, C; Rouleau, G A; Alda, M

    2000-01-01

    OBJECTIVE: To test for genetic linkage and association with GABAergic candidate genes in lithium-responsive bipolar disorder. DESIGN: Polymorphisms located in genes that code for GABRA3, GABRA5 and GABRB3 subunits of the GABAA receptor were investigated using association and linkage strategies. PARTICIPANTS: A total of 138 patients with bipolar 1 disorder with a clear response to lithium prophylaxis, selected from specialized lithium clinics in Canada and Europe that are part of the International Group for the Study of Lithium-Treated Patients, and 108 psychiatrically healthy controls. Families of 24 probands were suitable for linkage analysis. OUTCOME MEASURES: The association between the candidate genes and patients with bipolar disorder versus that of controls and genetic linkage within families. RESULTS: There was no significant association or linkage found between lithium-responsive bipolar disorder and the GABAergic candidate genes investigated. CONCLUSIONS: This study does not support a major role for the GABAergic candidate genes tested in lithium-responsive bipolar disorder. PMID:11022400

  11. DNA sequence variation and selection of tag single-nucleotide polymorphisms at candidate genes for drought-stress response in Pinus taeda L.

    PubMed

    González-Martínez, Santiago C; Ersoz, Elhan; Brown, Garth R; Wheeler, Nicholas C; Neale, David B

    2006-03-01

    Genetic association studies are rapidly becoming the experimental approach of choice to dissect complex traits, including tolerance to drought stress, which is the most common cause of mortality and yield losses in forest trees. Optimization of association mapping requires knowledge of the patterns of nucleotide diversity and linkage disequilibrium and the selection of suitable polymorphisms for genotyping. Moreover, standard neutrality tests applied to DNA sequence variation data can be used to select candidate genes or amino acid sites that are putatively under selection for association mapping. In this article, we study the pattern of polymorphism of 18 candidate genes for drought-stress response in Pinus taeda L., an important tree crop. Data analyses based on a set of 21 putatively neutral nuclear microsatellites did not show population genetic structure or genomewide departures from neutrality. Candidate genes had moderate average nucleotide diversity at silent sites (pi(sil) = 0.00853), varying 100-fold among single genes. The level of within-gene LD was low, with an average pairwise r2 of 0.30, decaying rapidly from approximately 0.50 to approximately 0.20 at 800 bp. No apparent LD among genes was found. A selective sweep may have occurred at the early-response-to-drought-3 (erd3) gene, although population expansion can also explain our results and evidence for selection was not conclusive. One other gene, ccoaomt-1, a methylating enzyme involved in lignification, showed dimorphism (i.e., two highly divergent haplotype lineages at equal frequency), which is commonly associated with the long-term action of balancing selection. Finally, a set of haplotype-tagging SNPs (htSNPs) was selected. Using htSNPs, a reduction of genotyping effort of approximately 30-40%, while sampling most common allelic variants, can be gained in our ongoing association studies for drought tolerance in pine.

  12. Restriction site polymorphism-based candidate gene mapping for seedling drought tolerance in cowpea [Vigna unguiculata (L.) Walp.].

    PubMed

    Muchero, Wellington; Ehlers, Jeffrey D; Roberts, Philip A

    2010-02-01

    Quantitative trait loci (QTL) studies provide insight into the complexity of drought tolerance mechanisms. Molecular markers used in these studies also allow for marker-assisted selection (MAS) in breeding programs, enabling transfer of genetic factors between breeding lines without complete knowledge of their exact nature. However, potential for recombination between markers and target genes limit the utility of MAS-based strategies. Candidate gene mapping offers an alternative solution to identify trait determinants underlying QTL of interest. Here, we used restriction site polymorphisms to investigate co-location of candidate genes with QTL for seedling drought stress-induced premature senescence identified previously in cowpea. Genomic DNA isolated from 113 F(2:8) RILs of drought-tolerant IT93K503-1 and drought susceptible CB46 genotypes was digested with combinations of EcoR1 and HpaII, Mse1, or Msp1 restriction enzymes and amplified with primers designed from 13 drought-responsive cDNAs. JoinMap 3.0 and MapQTL 4.0 software were used to incorporate polymorphic markers onto the AFLP map and to analyze their association with the drought response QTL. Seven markers co-located with peaks of previously identified QTL. Isolation, sequencing, and blast analysis of these markers confirmed their significant homology with drought or other abiotic stress-induced expressed sequence tags (EST) from cowpea and other plant systems. Further, homology with coding sequences for a multidrug resistance protein 3 and a photosystem I assembly protein ycf3 was revealed in two of these candidates. These results provide a platform for the identification and characterization of genetic trait determinants underlying seedling drought tolerance in cowpea.

  13. Leishmania genome analysis and high-throughput immunological screening identifies tuzin as a novel vaccine candidate against visceral leishmaniasis.

    PubMed

    Lakshmi, Bhavana Sethu; Wang, Ruobing; Madhubala, Rentala

    2014-06-24

    Leishmaniasis is a neglected tropical disease caused by Leishmania species. It is a major health concern affecting 88 countries and threatening 350 million people globally. Unfortunately, there are no vaccines and there are limitations associated with the current therapeutic regimens for leishmaniasis. The emerging cases of drug-resistance further aggravate the situation, demanding rapid drug and vaccine development. The genome sequence of Leishmania, provides access to novel genes that hold potential as chemotherapeutic targets or vaccine candidates. In this study, we selected 19 antigenic genes from about 8000 common Leishmania genes based on the Leishmania major and Leishmania infantum genome information available in the pathogen databases. Potential vaccine candidates thus identified were screened using an in vitro high throughput immunological platform developed in the laboratory. Four candidate genes coding for tuzin, flagellar glycoprotein-like protein (FGP), phospholipase A1-like protein (PLA1) and potassium voltage-gated channel protein (K VOLT) showed a predominant protective Th1 response over disease exacerbating Th2. We report the immunogenic properties and protective efficacy of one of the four antigens, tuzin, as a DNA vaccine against Leishmania donovani challenge. Our results show that administration of tuzin DNA protected BALB/c mice against L. donovani challenge and that protective immunity was associated with higher levels of IFN-γ and IL-12 production in comparison to IL-4 and IL-10. Our study presents a simple approach to rapidly identify potential vaccine candidates using the exhaustive information stored in the genome and an in vitro high-throughput immunological platform. Copyright © 2014. Published by Elsevier Ltd.

  14. Genome-Wide Identification of Differentially Expressed Genes Associated with the High Yielding of Oleoresin in Secondary Xylem of Masson Pine (Pinus massoniana Lamb) by Transcriptomic Analysis

    PubMed Central

    Liu, Qinghua; Zhou, Zhichun; Wei, Yongcheng; Shen, Danyu; Feng, Zhongping; Hong, Shanping

    2015-01-01

    Masson pine is an important timber and resource for oleoresin in South China. Increasing yield of oleoresin in stems can raise economic benefits and enhance the resistance to bark beetles. However, the genetic mechanisms for regulating the yield of oleoresin were still unknown. Here, high-throughput sequencing technology was used to investigate the transcriptome and compare the gene expression profiles of high and low oleoresin-yielding genotypes. A total of 40,690,540 reads were obtained and assembled into 137,499 transcripts from the secondary xylem tissues. We identified 84,842 candidate unigenes based on sequence annotation using various databases and 96 unigenes were candidates for terpenoid backbone biosynthesis in pine. By comparing the expression profiles of high and low oleoresin-yielding genotypes, 649 differentially expressed genes (DEGs) were identified. GO enrichment analysis of DEGs revealed that multiple pathways were related to high yield of oleoresin. Nine candidate genes were validated by QPCR analysis. Among them, the candidate genes encoding geranylgeranyl diphosphate synthase (GGPS) and (-)-alpha/beta-pinene synthase were up-regulated in the high oleoresin-yielding genotype, while tricyclene synthase revealed lower expression level, which was in good agreement with the GC/MS result. In addition, DEG encoding ABC transporters, pathogenesis-related proteins (PR5 and PR9), phosphomethylpyrimidine synthase, non-specific lipid-transfer protein-like protein and ethylene responsive transcription factors (ERFs) were also confirmed to be critical for the biosynthesis of oleoresin. The next-generation sequencing strategy used in this study has proven to be a powerful means for analyzing transcriptome variation related to the yield of oleoresin in masson pine. The candidate genes encoding GGPS, (-)-alpha/beta-pinene, tricyclene synthase, ABC transporters, non-specific lipid-transfer protein-like protein, phosphomethylpyrimidine synthase, ERFs and pathogen responses may play important roles in regulating the yield of oleoresin. These DEGs are worthy of special attention in future studies. PMID:26167875

  15. Metagenomic gene annotation by a homology-independent approach

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Froula, Jeff; Zhang, Tao; Salmeen, Annette

    2011-06-02

    Fully understanding the genetic potential of a microbial community requires functional annotation of all the genes it encodes. The recently developed deep metagenome sequencing approach has enabled rapid identification of millions of genes from a complex microbial community without cultivation. Current homology-based gene annotation fails to detect distantly-related or structural homologs. Furthermore, homology searches with millions of genes are very computational intensive. To overcome these limitations, we developed rhModeller, a homology-independent software pipeline to efficiently annotate genes from metagenomic sequencing projects. Using cellulases and carbonic anhydrases as two independent test cases, we demonstrated that rhModeller is much faster than HMMERmore » but with comparable accuracy, at 94.5percent and 99.9percent accuracy, respectively. More importantly, rhModeller has the ability to detect novel proteins that do not share significant homology to any known protein families. As {approx}50percent of the 2 million genes derived from the cow rumen metagenome failed to be annotated based on sequence homology, we tested whether rhModeller could be used to annotate these genes. Preliminary results suggest that rhModeller is robust in the presence of missense and frameshift mutations, two common errors in metagenomic genes. Applying the pipeline to the cow rumen genes identified 4,990 novel cellulases candidates and 8,196 novel carbonic anhydrase candidates.In summary, we expect rhModeller to dramatically increase the speed and quality of metagnomic gene annotation.« less

  16. Leveraging multiple gene networks to prioritize GWAS candidate genes via network representation learning.

    PubMed

    Wu, Mengmeng; Zeng, Wanwen; Liu, Wenqiang; Lv, Hairong; Chen, Ting; Jiang, Rui

    2018-06-03

    Genome-wide association studies (GWAS) have successfully discovered a number of disease-associated genetic variants in the past decade, providing an unprecedented opportunity for deciphering genetic basis of human inherited diseases. However, it is still a challenging task to extract biological knowledge from the GWAS data, due to such issues as missing heritability and weak interpretability. Indeed, the fact that the majority of discovered loci fall into noncoding regions without clear links to genes has been preventing the characterization of their functions and appealing for a sophisticated approach to bridge genetic and genomic studies. Towards this problem, network-based prioritization of candidate genes, which performs integrated analysis of gene networks with GWAS data, has emerged as a promising direction and attracted much attention. However, most existing methods overlook the sparse and noisy properties of gene networks and thus may lead to suboptimal performance. Motivated by this understanding, we proposed a novel method called REGENT for integrating multiple gene networks with GWAS data to prioritize candidate genes for complex diseases. We leveraged a technique called the network representation learning to embed a gene network into a compact and robust feature space, and then designed a hierarchical statistical model to integrate features of multiple gene networks with GWAS data for the effective inference of genes associated with a disease of interest. We applied our method to six complex diseases and demonstrated the superior performance of REGENT over existing approaches in recovering known disease-associated genes. We further conducted a pathway analysis and showed that the ability of REGENT to discover disease-associated pathways. We expect to see applications of our method to a broad spectrum of diseases for post-GWAS analysis. REGENT is freely available at https://github.com/wmmthu/REGENT. Copyright © 2018 Elsevier Inc. All rights reserved.

  17. Defining a new candidate gene for amelogenesis imperfecta: from molecular genetics to biochemistry.

    PubMed

    Urzúa, Blanca; Ortega-Pinto, Ana; Morales-Bozo, Irene; Rojas-Alcayaga, Gonzalo; Cifuentes, Víctor

    2011-02-01

    Amelogenesis imperfecta is a group of genetic conditions that affect the structure and clinical appearance of tooth enamel. The types (hypoplastic, hypocalcified, and hypomature) are correlated with defects in different stages of the process of enamel synthesis. Autosomal dominant, recessive, and X-linked types have been previously described. These disorders are considered clinically and genetically heterogeneous in etiology, involving a variety of genes, such as AMELX, ENAM, DLX3, FAM83H, MMP-20, KLK4, and WDR72. The mutations identified within these causal genes explain less than half of all cases of amelogenesis imperfecta. Most of the candidate and causal genes currently identified encode proteins involved in enamel synthesis. We think it is necessary to refocus the search for candidate genes using biochemical processes. This review provides theoretical evidence that the human SLC4A4 gene (sodium bicarbonate cotransporter) may be a new candidate gene.

  18. A public platform for the verification of the phenotypic effect of candidate genes for resistance to aflatoxin accumulation and Aspergillus flavus infection in maize.

    PubMed

    Warburton, Marilyn L; Williams, William Paul; Hawkins, Leigh; Bridges, Susan; Gresham, Cathy; Harper, Jonathan; Ozkan, Seval; Mylroie, J Erik; Shan, Xueyan

    2011-07-01

    A public candidate gene testing pipeline for resistance to aflatoxin accumulation or Aspergillus flavus infection in maize is presented here. The pipeline consists of steps for identifying, testing, and verifying the association of selected maize gene sequences with resistance under field conditions. Resources include a database of genetic and protein sequences associated with the reduction in aflatoxin contamination from previous studies; eight diverse inbred maize lines for polymorphism identification within any maize gene sequence; four Quantitative Trait Loci (QTL) mapping populations and one association mapping panel, all phenotyped for aflatoxin accumulation resistance and associated phenotypes; and capacity for Insertion/Deletion (InDel) and SNP genotyping in the population(s) for mapping. To date, ten genes have been identified as possible candidate genes and put through the candidate gene testing pipeline, and results are presented here to demonstrate the utility of the pipeline.

  19. ENU Mutagenesis in Mice Identifies Candidate Genes For Hypogonadism

    PubMed Central

    Weiss, Jeffrey; Hurley, Lisa A.; Harris, Rebecca M.; Finlayson, Courtney; Tong, Minghan; Fisher, Lisa A.; Moran, Jennifer L.; Beier, David R.; Mason, Christopher; Jameson, J. Larry

    2012-01-01

    Genome-wide mutagenesis was performed in mice to identify candidate genes for male infertility, for which the predominant causes remain idiopathic. Mice were mutagenized using N-ethyl-N-nitrosourea (ENU), bred, and screened for phenotypes associated with the male urogenital system. Fifteen heritable lines were isolated and chromosomal loci were assigned using low density genome-wide SNP arrays. Ten of the fifteen lines were pursued further using higher resolution SNP analysis to narrow the candidate gene regions. Exon sequencing of candidate genes identified mutations in mice with cystic kidneys (Bicc1), cryptorchidism (Rxfp2), restricted germ cell deficiency (Plk4), and severe germ cell deficiency (Prdm9). In two other lines with severe hypogonadism candidate sequencing failed to identify mutations, suggesting defects in genes with previously undocumented roles in gonadal function. These genomic intervals were sequenced in their entirety and a candidate mutation was identified in SnrpE in one of the two lines. The line harboring the SnrpE variant retains substantial spermatogenesis despite small testis size, an unusual phenotype. In addition to the reproductive defects, heritable phenotypes were observed in mice with ataxia (Myo5a), tremors (Pmp22), growth retardation (unknown gene), and hydrocephalus (unknown gene). These results demonstrate that the ENU screen is an effective tool for identifying potential causes of male infertility. PMID:22258617

  20. Factors predicting the occurrence of germline mutations in candidate genes among patients with cutaneous malignant melanoma from South Italy.

    PubMed

    Casula, Milena; Colombino, Maria; Satta, Maria P; Cossu, Antonio; Lissia, Amelia; Budroni, Mario; Simeone, Ester; Calemma, Rosa; Loddo, Cinzia; Caracò, Corrado; Mozzillo, Nicola; Daponte, Antonio; Comella, Giuseppe; Canzanella, Sergio; Guida, Michele; Castello, Giuseppe; Ascierto, Paolo A; Palmieri, Giuseppe

    2007-01-01

    Clinical predictors for germline mutations of candidate genes in large clinic based population of patients with cutaneous malignant melanoma (CMM) are widely awaited. Using denaturing high-performance liquid chromatography (DHPLC) analysis and DNA sequencing, 557 consecutively-collected CMM patients originating from South Italy were screened for CDKN2A germline mutations; subsets of them were screened for mutations in the BRAF and BRCA2 genes. Seven CDKN2A mutations were detected in 14 (2.5%) CMM patients. Relative risk of carrying a CDKN2A mutation for CMM patients was demonstrated to significantly increase with the presence of familial recurrence of melanoma (risk ratio (RR)=6.31; p=0.0009), multiple primary melanomas (RR=3.43; p=0.0014), and early onset age (RR=4.56; p=0.0026). All CDKN2A mutations were observed in non-Sardinian patients (14/441; 3.2%), whereas BRAF and BRCA2 genes were found mutated in Sardinian patients (3/116; 2.6%). Such indicators of the presence of CDKN2A mutations will be useful in counselling patients about undergoing genetic testing. Our findings strongly suggest that mutation rates of candidate cancer genes may deeply vary among CMM patients from different geographical areas.

  1. Mutation spectrum in BBS genes guided by homozygosity mapping in an Indian cohort.

    PubMed

    Sathya Priya, C; Sen, P; Umashankar, V; Gupta, N; Kabra, M; Kumaramanickavel, G; Stoetzel, C; Dollfus, H; Sripriya, S

    2015-02-01

    Bardet-Biedl syndrome (BBS), a ciliopathy disorder with pleiotropic effect manifests primarily as retinal degeneration along with renal insufficiency, polydactyly and obesity. In this study, we have performed homozygosity mapping using NspI 250K affymetrix gene chip followed by mutation screening of the candidate genes located in the homozygous blocks. These regions are prioritized based on the block length and candidature of the genes in BBS and other ciliopathies. Gene alterations in known BBS (22) and other ciliopathy genes such as ALMS1 (2) were seen in 24 of 30 families (80%). Mutations in BBS3 gene, inclusive of a novel recurrent mutation (p.I91T) accounted for 18% of the identified variations. Disease associated polymorphisms p.S70N (BBS2), rs1545 and rs1547 (BBS6) were also observed. This is the first study in Indian BBS patients and homozygosity mapping has proved to be an effective tool in prioritizing the candidate genes in consanguineous pedigrees. The study reveals a different mutation profile in the ciliopathy genes in Indian population and implication of novel loci/genes in 20% of the study group. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  2. Ontology based molecular signatures for immune cell types via gene expression analysis

    PubMed Central

    2013-01-01

    Background New technologies are focusing on characterizing cell types to better understand their heterogeneity. With large volumes of cellular data being generated, innovative methods are needed to structure the resulting data analyses. Here, we describe an ‘Ontologically BAsed Molecular Signature’ (OBAMS) method that identifies novel cellular biomarkers and infers biological functions as characteristics of particular cell types. This method finds molecular signatures for immune cell types based on mapping biological samples to the Cell Ontology (CL) and navigating the space of all possible pairwise comparisons between cell types to find genes whose expression is core to a particular cell type’s identity. Results We illustrate this ontological approach by evaluating expression data available from the Immunological Genome project (IGP) to identify unique biomarkers of mature B cell subtypes. We find that using OBAMS, candidate biomarkers can be identified at every strata of cellular identity from broad classifications to very granular. Furthermore, we show that Gene Ontology can be used to cluster cell types by shared biological processes in order to find candidate genes responsible for somatic hypermutation in germinal center B cells. Moreover, through in silico experiments based on this approach, we have identified genes sets that represent genes overexpressed in germinal center B cells and identify genes uniquely expressed in these B cells compared to other B cell types. Conclusions This work demonstrates the utility of incorporating structured ontological knowledge into biological data analysis – providing a new method for defining novel biomarkers and providing an opportunity for new biological insights. PMID:24004649

  3. Exploiting Differential Gene Expression and Epistasis to Discover Candidate Genes for Drought-Associated QTLs in Arabidopsis thaliana.

    PubMed

    Lovell, John T; Mullen, Jack L; Lowry, David B; Awole, Kedija; Richards, James H; Sen, Saunak; Verslues, Paul E; Juenger, Thomas E; McKay, John K

    2015-04-01

    Soil water availability represents one of the most important selective agents for plants in nature and the single greatest abiotic determinant of agricultural productivity, yet the genetic bases of drought acclimation responses remain poorly understood. Here, we developed a systems-genetic approach to characterize quantitative trait loci (QTLs), physiological traits and genes that affect responses to soil moisture deficit in the TSUxKAS mapping population of Arabidopsis thaliana. To determine the effects of candidate genes underlying QTLs, we analyzed gene expression as a covariate within the QTL model in an effort to mechanistically link markers, RNA expression, and the phenotype. This strategy produced ranked lists of candidate genes for several drought-associated traits, including water use efficiency, growth, abscisic acid concentration (ABA), and proline concentration. As a proof of concept, we recovered known causal loci for several QTLs. For other traits, including ABA, we identified novel loci not previously associated with drought. Furthermore, we documented natural variation at two key steps in proline metabolism and demonstrated that the mitochondrial genome differentially affects genomic QTLs to influence proline accumulation. These findings demonstrate that linking genome, transcriptome, and phenotype data holds great promise to extend the utility of genetic mapping, even when QTL effects are modest or complex. © 2015 American Society of Plant Biologists. All rights reserved.

  4. Horizontal gene transfer in silkworm, Bombyx mori.

    PubMed

    Zhu, Bo; Lou, Miao-Miao; Xie, Guan-Lin; Zhang, Guo-Qing; Zhou, Xue-Ping; Li, Bin; Jin, Gu-Lei

    2011-05-19

    The domesticated silkworm, Bombyx mori, is the model insect for the order Lepidoptera, has economically important values, and has gained some representative behavioral characteristics compared to its wild ancestor. The genome of B. mori has been fully sequenced while function analysis of BmChi-h and BmSuc1 genes revealed that horizontal gene transfer (HGT) maybe bestow a clear selective advantage to B. mori. However, the role of HGT in the evolutionary history of B. mori is largely unexplored. In this study, we compare the whole genome of B. mori with those of 382 prokaryotic and eukaryotic species to investigate the potential HGTs. Ten candidate HGT events were defined in B. mori by comprehensive sequence analysis using Maximum Likelihood and Bayesian method combining with EST checking. Phylogenetic analysis of the candidate HGT genes suggested that one HGT was plant-to- B. mori transfer while nine were bacteria-to- B. mori transfer. Furthermore, functional analysis based on expression, coexpression and related literature searching revealed that several HGT candidate genes have added important characters, such as resistance to pathogen, to B. mori. Results from this study clearly demonstrated that HGTs play an important role in the evolution of B. mori although the number of HGT events in B. mori is in general smaller than those of microbes and other insects. In particular, interdomain HGTs in B. mori may give rise to functional, persistent, and possibly evolutionarily significant new genes.

  5. Clinical germline diagnostic exome sequencing for hereditary cancer: Findings within novel candidate genes are prevalent.

    PubMed

    Powis, Zöe; Espenschied, Carin R; LaDuca, Holly; Hagman, Kelly D; Paudyal, Tripti; Li, Shuwei; Inaba, Hiroto; Mauer, Ann; Nathanson, Katherine L; Knost, James; Chao, Elizabeth C; Tang, Sha

    2018-08-01

    Clinical diagnostic exome sequencing (DES) has been effective in diagnosing individuals with suspected genetic conditions; nevertheless little has been described regarding its clinical utility in individuals with a personal and family history of cancer. This study aimed to assess diagnostic yield and clinical characteristics of pediatric and adult patients undergoing germline DES for hereditary cancer. We retrospectively reviewed 2171 patients referred for DES; cases with a personal and/or family history of cancer were further studied. Of 39 cancer patients, relevant alterations were found in eight individuals (21%), including one (3%) positive pathogenic alteration within a characterized gene, two (5%) uncertain findings in characterized genes, and five (13%) alterations in novel candidate genes. Two of the 5 pediatric patients, undergoing testing, (40%) had findings in novel candidate genes, with the remainder being negative. We include brief case studies to illustrate the variety of challenging issues related to these patients. Our observations demonstrate utility of family-based exome sequencing in patients for suspected hereditary cancer, including familial co-segregation analysis, and comprehensive medical review. DES may be particularly useful when traditional approaches do not result in a diagnosis or in families with unique phenotypes. This work also highlights the importance and complexity of analysis of uncharacterized genes in exome sequencing for hereditary cancer. Copyright © 2018 Elsevier Inc. All rights reserved.

  6. Neuroprotective therapies in glaucoma: II. Genetic nanotechnology tools.

    PubMed

    Nafissi, Nafiseh; Foldvari, Marianna

    2015-01-01

    Neurotrophic factor genome engineering could have many potential applications not only in the deeper understanding of neurodegenerative disorders but also in improved therapeutics. The fields of nanomedicine, regenerative medicine, and gene/cell-based therapy have been revolutionized by the development of safer and efficient non-viral technologies for gene delivery and genome editing with modern techniques for insertion of the neurotrophic factors into clinically relevant cells for a more sustained pharmaceutical effect. It has been suggested that the long-term expression of neurotrophic factors is the ultimate approach to prevent and/or treat neurodegenerative disorders such as glaucoma in patients who do not respond to available treatments or are at the progressive stage of the disease. Recent preclinical research suggests that novel neuroprotective gene and cell therapeutics could be promising approaches for both non-invasive neuroprotection and regenerative functions in the eye. Several progenitor and retinal cell types have been investigated as potential candidates for glaucoma neurotrophin therapy either as targets for gene therapy, options for cell replacement therapy, or as vehicles for gene delivery. Therefore, in parallel with deeper understanding of the specific protective effects of different neurotrophic factors and the potential therapeutic cell candidates for glaucoma neuroprotection, the development of non-invasive and highly specific gene delivery methods with safe and effective technologies to modify cell candidates for life-long neuroprotection in the eye is essential before investing in this field.

  7. Noncoding copy-number variations are associated with congenital limb malformation.

    PubMed

    Flöttmann, Ricarda; Kragesteen, Bjørt K; Geuer, Sinje; Socha, Magdalena; Allou, Lila; Sowińska-Seidler, Anna; Bosquillon de Jarcy, Laure; Wagner, Johannes; Jamsheer, Aleksander; Oehl-Jaschkowitz, Barbara; Wittler, Lars; de Silva, Deepthi; Kurth, Ingo; Maya, Idit; Santos-Simarro, Fernando; Hülsemann, Wiebke; Klopocki, Eva; Mountford, Roger; Fryer, Alan; Borck, Guntram; Horn, Denise; Lapunzina, Pablo; Wilson, Meredith; Mascrez, Bénédicte; Duboule, Denis; Mundlos, Stefan; Spielmann, Malte

    2017-10-12

    PurposeCopy-number variants (CNVs) are generally interpreted by linking the effects of gene dosage with phenotypes. The clinical interpretation of noncoding CNVs remains challenging. We investigated the percentage of disease-associated CNVs in patients with congenital limb malformations that affect noncoding cis-regulatory sequences versus genes sensitive to gene dosage effects.MethodsWe applied high-resolution copy-number analysis to 340 unrelated individuals with isolated limb malformation. To investigate novel candidate CNVs, we re-engineered human CNVs in mice using clustered regularly interspaced short palindromic repeats (CRISPR)-based genome editing.ResultsOf the individuals studied, 10% harbored CNVs segregating with the phenotype in the affected families. We identified 31 CNVs previously associated with congenital limb malformations and four novel candidate CNVs. Most of the disease-associated CNVs (57%) affected the noncoding cis-regulatory genome, while only 43% included a known disease gene and were likely to result from gene dosage effects. In transgenic mice harboring four novel candidate CNVs, we observed altered gene expression in all cases, indicating that the CNVs had a regulatory effect either by changing the enhancer dosage or altering the topological associating domain architecture of the genome.ConclusionOur findings suggest that CNVs affecting noncoding regulatory elements are a major cause of congenital limb malformations.Genetics in Medicine advance online publication, 12 October 2017; doi:10.1038/gim.2017.154.

  8. Exome sequencing of oral squamous cell carcinoma in users of Arabian snuff reveals novel candidates for driver genes.

    PubMed

    Al-Hebshi, Nezar Noor; Li, Shiyong; Nasher, Akram Thabet; El-Setouhy, Maged; Alsanosi, Rashad; Blancato, Jan; Loffredo, Christopher

    2016-07-15

    The study sought to identify genetic aberrations driving oral squamous cell carcinoma (OSCC) development among users of shammah, an Arabian preparation of smokeless tobacco. Twenty archival OSCC samples, 15 of which with a history of shammah exposure, were whole-exome sequenced at an average depth of 127×. Somatic mutations were identified using a novel, matched controls-independent filtration algorithm. CODEX and Exomedepth coupled with a novel, Database of Genomic Variant-based filter were employed to call somatic gene-copy number variations. Significantly mutated genes were identified with Oncodrive FM and the Youn and Simon's method. Candidate driver genes were nominated based on Gene Set Enrichment Analysis. The observed mutational spectrum was similar to that reported by the TCGA project. In addition to confirming known genes of OSCC (TP53, CDKNA2, CASP8, PIK3CA, HRAS, FAT1, TP63, CCND1 and FADD) the analysis identified several candidate novel driver events including mutations of NOTCH3, CSMD3, CRB1, CLTCL1, OSMR and TRPM2, amplification of the proto-oncogenes FOSL1, RELA, TRAF6, MDM2, FRS2 and BAG1, and deletion of the recently described tumor suppressor SMARCC1. Analysis also revealed significantly altered pathways not previously implicated in OSCC including Oncostatin-M signalling pathway, AP-1 and C-MYB transcription networks and endocytosis. There was a trend for higher number of mutations, amplifications and driver events in samples with history of shammah exposure particularly those that tested EBV positive, suggesting an interaction between tobacco exposure and EBV. The work provides further evidence for the genetic heterogeneity of oral cancer and suggests shammah-associated OSCC is characterized by extensive amplification of oncogenes. © 2016 UICC.

  9. iSyTE 2.0: a database for expression-based gene discovery in the eye

    PubMed Central

    Kakrana, Atul; Yang, Andrian; Anand, Deepti; Djordjevic, Djordje; Ramachandruni, Deepti; Singh, Abhyudai; Huang, Hongzhan

    2018-01-01

    Abstract Although successful in identifying new cataract-linked genes, the previous version of the database iSyTE (integrated Systems Tool for Eye gene discovery) was based on expression information on just three mouse lens stages and was functionally limited to visualization by only UCSC-Genome Browser tracks. To increase its efficacy, here we provide an enhanced iSyTE version 2.0 (URL: http://research.bioinformatics.udel.edu/iSyTE) based on well-curated, comprehensive genome-level lens expression data as a one-stop portal for the effective visualization and analysis of candidate genes in lens development and disease. iSyTE 2.0 includes all publicly available lens Affymetrix and Illumina microarray datasets representing a broad range of embryonic and postnatal stages from wild-type and specific gene-perturbation mouse mutants with eye defects. Further, we developed a new user-friendly web interface for direct access and cogent visualization of the curated expression data, which supports convenient searches and a range of downstream analyses. The utility of these new iSyTE 2.0 features is illustrated through examples of established genes associated with lens development and pathobiology, which serve as tutorials for its application by the end-user. iSyTE 2.0 will facilitate the prioritization of eye development and disease-linked candidate genes in studies involving transcriptomics or next-generation sequencing data, linkage analysis and GWAS approaches. PMID:29036527

  10. HerDing: herb recommendation system to treat diseases using genes and chemicals

    PubMed Central

    Choi, Wonjun; Choi, Chan-Hun; Kim, Young Ran; Kim, Seon-Jong; Na, Chang-Su; Lee, Hyunju

    2016-01-01

    In recent years, herbs have been researched for new drug candidates because they have a long empirical history of treating diseases and are relatively free from side effects. Studies to scientifically prove the medical efficacy of herbs for target diseases often spend a considerable amount of time and effort in choosing candidate herbs and in performing experiments to measure changes of marker genes when treating herbs. A computational approach to recommend herbs for treating diseases might be helpful to promote efficiency in the early stage of such studies. Although several databases related to traditional Chinese medicine have been already developed, there is no specialized Web tool yet recommending herbs to treat diseases based on disease-related genes. Therefore, we developed a novel search engine, HerDing, focused on retrieving candidate herb-related information with user search terms (a list of genes, a disease name, a chemical name or an herb name). HerDing was built by integrating public databases and by applying a text-mining method. The HerDing website is free and open to all users, and there is no login requirement. Database URL: http://combio.gist.ac.kr/herding PMID:26980517

  11. HerDing: herb recommendation system to treat diseases using genes and chemicals.

    PubMed

    Choi, Wonjun; Choi, Chan-Hun; Kim, Young Ran; Kim, Seon-Jong; Na, Chang-Su; Lee, Hyunju

    2016-01-01

    In recent years, herbs have been researched for new drug candidates because they have a long empirical history of treating diseases and are relatively free from side effects. Studies to scientifically prove the medical efficacy of herbs for target diseases often spend a considerable amount of time and effort in choosing candidate herbs and in performing experiments to measure changes of marker genes when treating herbs. A computational approach to recommend herbs for treating diseases might be helpful to promote efficiency in the early stage of such studies. Although several databases related to traditional Chinese medicine have been already developed, there is no specialized Web tool yet recommending herbs to treat diseases based on disease-related genes. Therefore, we developed a novel search engine, HerDing, focused on retrieving candidate herb-related information with user search terms (a list of genes, a disease name, a chemical name or an herb name). HerDing was built by integrating public databases and by applying a text-mining method. The HerDing website is free and open to all users, and there is no login requirement. Database URL: http://combio.gist.ac.kr/herding. © The Author(s) 2016. Published by Oxford University Press.

  12. Association Analysis Suggests SOD2 as a Newly Identified Candidate Gene Associated With Leprosy Susceptibility.

    PubMed

    Ramos, Geovana Brotto; Salomão, Heloisa; Francio, Angela Schneider; Fava, Vinícius Medeiros; Werneck, Renata Iani; Mira, Marcelo Távora

    2016-08-01

    Genetic studies have identified several genes and genomic regions contributing to the control of host susceptibility to leprosy. Here, we test variants of the positional and functional candidate gene SOD2 for association with leprosy in 2 independent population samples. Family-based analysis revealed an association between leprosy and allele G of marker rs295340 (P = .042) and borderline evidence of an association between leprosy and alleles C and A of markers rs4880 (P = .077) and rs5746136 (P = .071), respectively. Findings were validated in an independent case-control sample for markers rs295340 (P = .049) and rs4880 (P = .038). These results suggest SOD2 as a newly identified gene conferring susceptibility to leprosy. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

  13. Identifying candidate drivers of drug response in heterogeneous cancer by mining high throughput genomics data.

    PubMed

    Nabavi, Sheida

    2016-08-15

    With advances in technologies, huge amounts of multiple types of high-throughput genomics data are available. These data have tremendous potential to identify new and clinically valuable biomarkers to guide the diagnosis, assessment of prognosis, and treatment of complex diseases, such as cancer. Integrating, analyzing, and interpreting big and noisy genomics data to obtain biologically meaningful results, however, remains highly challenging. Mining genomics datasets by utilizing advanced computational methods can help to address these issues. To facilitate the identification of a short list of biologically meaningful genes as candidate drivers of anti-cancer drug resistance from an enormous amount of heterogeneous data, we employed statistical machine-learning techniques and integrated genomics datasets. We developed a computational method that integrates gene expression, somatic mutation, and copy number aberration data of sensitive and resistant tumors. In this method, an integrative method based on module network analysis is applied to identify potential driver genes. This is followed by cross-validation and a comparison of the results of sensitive and resistance groups to obtain the final list of candidate biomarkers. We applied this method to the ovarian cancer data from the cancer genome atlas. The final result contains biologically relevant genes, such as COL11A1, which has been reported as a cis-platinum resistant biomarker for epithelial ovarian carcinoma in several recent studies. The described method yields a short list of aberrant genes that also control the expression of their co-regulated genes. The results suggest that the unbiased data driven computational method can identify biologically relevant candidate biomarkers. It can be utilized in a wide range of applications that compare two conditions with highly heterogeneous datasets.

  14. Revisiting genome wide association studies (GWAS) in coeliac disease: replication study in Spanish population and expression analysis of candidate genes.

    PubMed

    Plaza-Izurieta, Leticia; Castellanos-Rubio, Ainara; Irastorza, Iñaki; Fernández-Jimenez, Nora; Gutierrez, Galder; Bilbao, Jose Ramon

    2011-07-01

    Recent genome wide association studies (GWAS) on coeliac disease (CD) have identified risk loci harbouring genes that fit the accepted pathogenic model and are considered aetiological candidates. Using Taqman single nucleotide polymorphism (SNP) and expression assays, the study genotyped 11 SNPs tagging eight GWAS regions (1q31, 2q11-2q12, 3p21, 3q25-3q26, 3q28, 4q27, 6q25 and 12q24) in a Spanish cohort of 1094 CD patients and 540 controls, and performed expression analyses of candidate genes (RGS1, IL18R1/IL18RAP, CCR3, IL12A/SCHIP1, LPP, IL2/IL21-KIAA1109, TAGAP, and SH2B3) in intestinal mucosa from 29 CD children and eight controls. Polymorphisms in 1q31, 2q11-2q12, and 3q25 showed association in our cohort, and also 3q28 and 4q27 when combined with a previous study. Expression levels of IL12A, IL18RAP, IL21, KIAA1109, LPP, SCHIP1, and SH2B3 were affected by disease status, but the correlation between genotype and mRNA levels was observed only in IL12A, LPP, SCHIP1, and SH2B3. Expression differences between treated CD patients and controls along with SNP expression associations suggest a possible primary role for these four genes and their variants in pathogenesis. The lack of SNP effect in the remaining genes is probably a consequence of arbitrary candidate gene selection within association signals that are not based on functional studies.

  15. Molecular cloning of the potato Gro1-4 gene conferring resistance to pathotype Ro1 of the root cyst nematode Globodera rostochiensis, based on a candidate gene approach.

    PubMed

    Paal, Jürgen; Henselewski, Heike; Muth, Jost; Meksem, Khalid; Menéndez, Cristina M; Salamini, Francesco; Ballvora, Agim; Gebhardt, Christiane

    2004-04-01

    The endoparasitic root cyst nematode Globodera rostochiensis causes considerable damage in potato cultivation. In the past, major genes for nematode resistance have been introgressed from related potato species into cultivars. Elucidating the molecular basis of resistance will contribute to the understanding of nematode-plant interactions and assist in breeding nematode-resistant cultivars. The Gro1 resistance locus to G. rostochiensis on potato chromosome VII co-localized with a resistance-gene-like (RGL) DNA marker. This marker was used to isolate from genomic libraries 15 members of a closely related candidate gene family. Analysis of inheritance, linkage mapping, and sequencing reduced the number of candidate genes to three. Complementation analysis by stable potato transformation showed that the gene Gro1-4 conferred resistance to G. rostochiensis pathotype Ro1. Gro1-4 encodes a protein of 1136 amino acids that contains Toll-interleukin 1 receptor (TIR), nucleotide-binding (NB), leucine-rich repeat (LRR) homology domains and a C-terminal domain with unknown function. The deduced Gro1-4 protein differed by 29 amino acid changes from susceptible members of the Gro1 gene family. Sequence characterization of 13 members of the Gro1 gene family revealed putative regulatory elements and a variable microsatellite in the promoter region, insertion of a retrotransposon-like element in the first intron, and a stop codon in the NB coding region of some genes. Sequence analysis of RT-PCR products showed that Gro1-4 is expressed, among other members of the family including putative pseudogenes, in non-infected roots of nematode-resistant plants. RT-PCR also demonstrated that members of the Gro1 gene family are expressed in most potato tissues.

  16. Placental genome and maternal-placental genetic interactions: a genome-wide and candidate gene association study of placental abruption.

    PubMed

    Denis, Marie; Enquobahrie, Daniel A; Tadesse, Mahlet G; Gelaye, Bizu; Sanchez, Sixto E; Salazar, Manuel; Ananth, Cande V; Williams, Michelle A

    2014-01-01

    While available evidence supports the role of genetics in the pathogenesis of placental abruption (PA), PA-related placental genome variations and maternal-placental genetic interactions have not been investigated. Maternal blood and placental samples collected from participants in the Peruvian Abruptio Placentae Epidemiology study were genotyped using Illumina's Cardio-Metabochip platform. We examined 118,782 genome-wide SNPs and 333 SNPs in 32 candidate genes from mitochondrial biogenesis and oxidative phosphorylation pathways in placental DNA from 280 PA cases and 244 controls. We assessed maternal-placental interactions in the candidate gene SNPS and two imprinted regions (IGF2/H19 and C19MC). Univariate and penalized logistic regression models were fit to estimate odds ratios. We examined the combined effect of multiple SNPs on PA risk using weighted genetic risk scores (WGRS) with repeated ten-fold cross-validations. A multinomial model was used to investigate maternal-placental genetic interactions. In placental genome-wide and candidate gene analyses, no SNP was significant after false discovery rate correction. The top genome-wide association study (GWAS) hits were rs544201, rs1484464 (CTNNA2), rs4149570 (TNFRSF1A) and rs13055470 (ZNRF3) (p-values: 1.11e-05 to 3.54e-05). The top 200 SNPs of the GWAS overrepresented genes involved in cell cycle, growth and proliferation. The top candidate gene hits were rs16949118 (COX10) and rs7609948 (THRB) (p-values: 6.00e-03 and 8.19e-03). Participants in the highest quartile of WGRS based on cross-validations using SNPs selected from the GWAS and candidate gene analyses had a 8.40-fold (95% CI: 5.8-12.56) and a 4.46-fold (95% CI: 2.94-6.72) higher odds of PA compared to participants in the lowest quartile. We found maternal-placental genetic interactions on PA risk for two SNPs in PPARG (chr3:12313450 and chr3:12412978) and maternal imprinting effects for multiple SNPs in the C19MC and IGF2/H19 regions. Variations in the placental genome and interactions between maternal-placental genetic variations may contribute to PA risk. Larger studies may help advance our understanding of PA pathogenesis.

  17. How Artificial Intelligence Can Improve Our Understanding of the Genes Associated with Endometriosis: Natural Language Processing of the PubMed Database

    PubMed Central

    Mashiach, R.; Cohen, S.; Kedem, A.; Baron, A.; Zajicek, M.; Feldman, I.; Seidman, D.; Soriano, D.

    2018-01-01

    Endometriosis is a disease characterized by the development of endometrial tissue outside the uterus, but its cause remains largely unknown. Numerous genes have been studied and proposed to help explain its pathogenesis. However, the large number of these candidate genes has made functional validation through experimental methodologies nearly impossible. Computational methods could provide a useful alternative for prioritizing those most likely to be susceptibility genes. Using artificial intelligence applied to text mining, this study analyzed the genes involved in the pathogenesis, development, and progression of endometriosis. The data extraction by text mining of the endometriosis-related genes in the PubMed database was based on natural language processing, and the data were filtered to remove false positives. Using data from the text mining and gene network information as input for the web-based tool, 15,207 endometriosis-related genes were ranked according to their score in the database. Characterization of the filtered gene set through gene ontology, pathway, and network analysis provided information about the numerous mechanisms hypothesized to be responsible for the establishment of ectopic endometrial tissue, as well as the migration, implantation, survival, and proliferation of ectopic endometrial cells. Finally, the human genome was scanned through various databases using filtered genes as a seed to determine novel genes that might also be involved in the pathogenesis of endometriosis but which have not yet been characterized. These genes could be promising candidates to serve as useful diagnostic biomarkers and therapeutic targets in the management of endometriosis. PMID:29750165

  18. How Artificial Intelligence Can Improve Our Understanding of the Genes Associated with Endometriosis: Natural Language Processing of the PubMed Database.

    PubMed

    Bouaziz, J; Mashiach, R; Cohen, S; Kedem, A; Baron, A; Zajicek, M; Feldman, I; Seidman, D; Soriano, D

    2018-01-01

    Endometriosis is a disease characterized by the development of endometrial tissue outside the uterus, but its cause remains largely unknown. Numerous genes have been studied and proposed to help explain its pathogenesis. However, the large number of these candidate genes has made functional validation through experimental methodologies nearly impossible. Computational methods could provide a useful alternative for prioritizing those most likely to be susceptibility genes. Using artificial intelligence applied to text mining, this study analyzed the genes involved in the pathogenesis, development, and progression of endometriosis. The data extraction by text mining of the endometriosis-related genes in the PubMed database was based on natural language processing, and the data were filtered to remove false positives. Using data from the text mining and gene network information as input for the web-based tool, 15,207 endometriosis-related genes were ranked according to their score in the database. Characterization of the filtered gene set through gene ontology, pathway, and network analysis provided information about the numerous mechanisms hypothesized to be responsible for the establishment of ectopic endometrial tissue, as well as the migration, implantation, survival, and proliferation of ectopic endometrial cells. Finally, the human genome was scanned through various databases using filtered genes as a seed to determine novel genes that might also be involved in the pathogenesis of endometriosis but which have not yet been characterized. These genes could be promising candidates to serve as useful diagnostic biomarkers and therapeutic targets in the management of endometriosis.

  19. A Catalog of Genes Homozygously Deleted in Human Lung Cancer and the Candidacy of PTPRD as a Tumor Suppressor Gene

    PubMed Central

    Kohno, Takashi; Otsuka, Ayaka; Girard, Luc; Sato, Masanori; Iwakawa, Reika; Ogiwara, Hideaki; Sanchez-Cespedes, Montse; Minna, John D.; Yokota, Jun

    2010-01-01

    A total of 176 genes homozygously deleted in human lung cancer were identified by DNA array-based whole genome scanning of 52 lung cancer cell lines and subsequent genomic PCR in 74 cell lines, including the 52 cell lines scanned. One or more exons of these genes were homozygously deleted in one (1%) to 20 (27%) cell lines. These genes included known tumor suppressor genes, e.g., CDKN2A/p16, RB1, and SMAD4, and candidate tumor suppressor genes whose hemizygous or homozygous deletions were reported in several types of human cancers, such as FHIT, KEAP1, and LRP1B/LRP-DIP. CDKN2A/p16 and p14ARF located in 9p21 were most frequently deleted (20/74, 27%). The PTPRD gene was most frequently deleted (8/74, 11%) among genes mapping to regions other than 9p21. Somatic mutations, including a nonsense mutation, of the PTPRD gene were detected in 8/74 (11%) of cell lines and 4/95 (4%) of surgical specimens of lung cancer. Reduced PTPRD expression was observed in the majority (>80%) of cell lines and surgical specimens of lung cancer. Therefore, PTPRD is a candidate tumor suppressor gene in lung cancer. Microarray-based expression profiling of 19 lung cancer cell lines also indicated that some of the 176 genes, such as KANK and ADAMTS1, are preferentially inactivated by epigenetic alterations. Genetic/epigenetic as well as functional studies of these 176 genes will increase our understanding of molecular mechanisms behind lung carcinogenesis. PMID:20073072

  20. Shared heritability of attention-deficit/hyperactivity disorder and autism spectrum disorder.

    PubMed

    Rommelse, Nanda N J; Franke, Barbara; Geurts, Hilde M; Hartman, Catharina A; Buitelaar, Jan K

    2010-03-01

    Attention-deficit/hyperactivity disorder (ADHD) and autism spectrum disorder (ASD) are both highly heritable neurodevelopmental disorders. Evidence indicates both disorders co-occur with a high frequency, in 20-50% of children with ADHD meeting criteria for ASD and in 30-80% of ASD children meeting criteria for ADHD. This review will provide an overview on all available studies [family based, twin, candidate gene, linkage, and genome wide association (GWA) studies] shedding light on the role of shared genetic underpinnings of ADHD and ASD. It is concluded that family and twin studies do provide support for the hypothesis that ADHD and ASD originate from partly similar familial/genetic factors. Only a few candidate gene studies, linkage studies and GWA studies have specifically addressed this co-occurrence, pinpointing to some promising pleiotropic genes, loci and single nucleotide polymorphisms (SNPs), but the research field is in urgent need for better designed and powered studies to tackle this complex issue. We propose that future studies examining shared familial etiological factors for ADHD and ASD use a family-based design in which the same phenotypic (ADHD and ASD), candidate endophenotypic, and environmental measurements are obtained from all family members. Multivariate multi-level models are probably best suited for the statistical analysis.

  1. GENOMIC BASIS OF AGING AND LIFE HISTORY EVOLUTION IN DROSOPHILA MELANOGASTER

    PubMed Central

    Remolina, Silvia C.; Chang, Peter L.; Leips, Jeff; Nuzhdin, Sergey V.; Hughes, Kimberly A.

    2015-01-01

    Natural diversity in aging and other life history patterns is a hallmark of organismal variation. Related species, populations, and individuals within populations show genetically based variation in life span and other aspects of age-related performance. Population differences are especially informative because these differences can be large relative to within-population variation and because they occur in organisms with otherwise similar genomes. We used experimental evolution to produce populations divergent for life span and late-age fertility and then used deep genome sequencing to detect sequence variants with nucleotide-level resolution. Several genes and genome regions showed strong signatures of selection, and the same regions were implicated in independent comparisons, suggesting that the same alleles were selected in replicate lines. Genes related to oogenesis, immunity, and protein degradation were implicated as important modifiers of late-life performance. Expression profiling and functional annotation narrowed the list of strong candidate genes to 38, most of which are novel candidates for regulating aging. Life span and early-age fecundity were negatively correlated among populations; therefore the alleles we identified also are candidate regulators of a major life-history trade-off. More generally, we argue that hitchhiking mapping can be a powerful tool for uncovering the molecular bases of quantitative genetic variation. PMID:23106705

  2. Identification of Linkages between EDCs in Personal Care Products and Breast Cancer through Data Integration Combined with Gene Network Analysis.

    PubMed

    Jeong, Hyeri; Kim, Jongwoon; Kim, Youngjun

    2017-09-30

    Approximately 1000 chemicals have been reported to possibly have endocrine disrupting effects, some of which are used in consumer products, such as personal care products (PCPs) and cosmetics. We conducted data integration combined with gene network analysis to: (i) identify causal molecular mechanisms between endocrine disrupting chemicals (EDCs) used in PCPs and breast cancer; and (ii) screen candidate EDCs associated with breast cancer. Among EDCs used in PCPs, four EDCs having correlation with breast cancer were selected, and we curated 27 common interacting genes between those EDCs and breast cancer to perform the gene network analysis. Based on the gene network analysis, ESR1, TP53, NCOA1, AKT1, and BCL6 were found to be key genes to demonstrate the molecular mechanisms of EDCs in the development of breast cancer. Using GeneMANIA, we additionally predicted 20 genes which could interact with the 27 common genes. In total, 47 genes combining the common and predicted genes were functionally grouped with the gene ontology and KEGG pathway terms. With those genes, we finally screened candidate EDCs for their potential to increase breast cancer risk. This study highlights that our approach can provide insights to understand mechanisms of breast cancer and identify potential EDCs which are in association with breast cancer.

  3. Fine mapping and characterization of candidate genes that control resistance to Cercospora Sojina K. Hara in two soybean germplasm accessions

    USDA-ARS?s Scientific Manuscript database

    In order to fine map the novel FLS resistance gene(s) in two PIs, PI 594891 and PI 594774, F2:3 seeds from the crosses Blackhawk (FLS susceptible genotype) ×PI 594891, and Blackhawk ×PI 594774 were genotyped with KASP markers that were designed based on the SoySNP 50k Infinium Chip data to identi...

  4. Detection of gene communities in multi-networks reveals cancer drivers

    NASA Astrophysics Data System (ADS)

    Cantini, Laura; Medico, Enzo; Fortunato, Santo; Caselle, Michele

    2015-12-01

    We propose a new multi-network-based strategy to integrate different layers of genomic information and use them in a coordinate way to identify driving cancer genes. The multi-networks that we consider combine transcription factor co-targeting, microRNA co-targeting, protein-protein interaction and gene co-expression networks. The rationale behind this choice is that gene co-expression and protein-protein interactions require a tight coregulation of the partners and that such a fine tuned regulation can be obtained only combining both the transcriptional and post-transcriptional layers of regulation. To extract the relevant biological information from the multi-network we studied its partition into communities. To this end we applied a consensus clustering algorithm based on state of art community detection methods. Even if our procedure is valid in principle for any pathology in this work we concentrate on gastric, lung, pancreas and colorectal cancer and identified from the enrichment analysis of the multi-network communities a set of candidate driver cancer genes. Some of them were already known oncogenes while a few are new. The combination of the different layers of information allowed us to extract from the multi-network indications on the regulatory pattern and functional role of both the already known and the new candidate driver genes.

  5. A family-based association study identified CYP17 as a candidate gene for obesity susceptibility in Caucasians.

    PubMed

    Yan, H; Guo, Y; Yang, T-L; Zhao, L-J; Deng, H-W

    2012-08-06

    The cytochrome P450c17α gene (CYP17) encodes a key biosynthesis enzyme of estrogen, which is critical in regulating adipogenesis and adipocyte development in humans. We therefore hypothesized that CYP17 is a candidate gene for predicting obesity. In order to test this hypothesis, we performed a family-based association test to investigate the relationship between the CYP17 gene and obesity phenotypes in a large sample comprising 1873 subjects from 405 Caucasian nuclear families of European origin recruited by the Osteoporosis Research Center of Creighton University, USA. Both single SNPs and haplotypes were tested for associations with obesity-related phenotypes, including body mass index (BMI) and fat mass. We identified three SNPs to be significantly associated with BMI, including rs3740397, rs6163, and rs619824. We further characterized the linkage disequilibrium structure for CYP17 and found that the whole CYP17 gene was located in a single-linkage disequilibrium block. This block was observed to be significantly associated with BMI. A major haplotype in this block was significantly associated with both BMI and fat mass. In conclusion, we suggest that the CYP17 gene has an effect on obesity in the Caucasian population. Further independent studies will be needed to confirm our findings.

  6. Identification and expression analysis of CYS-A1, CYS-C1, NIT4 genes in rice seedlings exposed to cyanide.

    PubMed

    Yu, Xiao-Zhang; Lin, Yu-Juan; Lu, Chun-Jiao; Zhang, Xue-Hong

    2017-09-01

    Involvement of genes (CYS-A1, CYS-C1 and NIT4) encoded with cysteine synthase, β-cyanoalanine synthase, nitrilase and cyanide metabolisms are evident in Arabidopsis. In the present study, identifications of CYS-A1, CYS-C1 and NIT4, predictions of conserved motifs, and constructions of phylogenetic relationships, based on their amino acid sequences in rice, were conducted. In order to elucidate the transcriptional responses of these cyanide-degrading genes, two candidate homologues were selected for each gene to test their expression changes upon exposure to exogenous KCN in rice seedlings using RT-PCR. Results showed that all selected candidate homologous genes were differentially expressed at different exposure points in roots and shoots of rice seedlings, suggesting their distinct roles during cyanide assimilation. Both candidate homologues for CYS-A1 constantly exhibited more abundant transcripts in comparison to control. However, only one candidate homologue for CYS-C1 and NIT4 showed a remarkable up-regulation during KCN exposure. Analysis of both tissue and solution cyanide indicated that rice seedlings were quickly able to metabolize exogenous KCN with minor accumulation in plant tissues. In conclusion, significant up-regulation of CYS-A1 suggested that the endogenous pool of cysteine catalyzed by cysteine synthase does not restrict the conversion of exogenous KCN into cyanoalanine through the β-cyanoalanine pathway. However, insufficient responses of the transcription level of NIT4 suggested that NIT enzyme may be a limiting factor for cyanoalanine assimilation by rice seedlings.

  7. Genomic expression analysis of rat chromosome 4 for skeletal traits at femoral neck.

    PubMed

    Alam, Imranul; Sun, Qiwei; Liu, Lixiang; Koller, Daniel L; Liu, Yunlong; Edenberg, Howard J; Econs, Michael J; Foroud, Tatiana; Turner, Charles H

    2008-10-08

    Hip fracture is the most devastating osteoporotic fracture type with significant morbidity and mortality. Several studies in humans and animal models identified chromosomal regions linked to hip size and bone mass. Previously, we identified that the region of 4q21-q41 on rat chromosome (Chr) 4 harbors multiple femoral neck quantitative trait loci (QTLs) in inbred Fischer 344 (F344) and Lewis (LEW) rats. The purpose of this study is to identify the candidate genes for femoral neck structure and density by correlating gene expression in the proximal femur with the femoral neck phenotypes linked to the QTLs on Chr 4. RNA was extracted from proximal femora of 4-wk-old rats from F344 and LEW strains, and two other strains, Copenhagen 2331 and Dark Agouti, were used as a negative control. Microarray analysis was performed using Affymetrix Rat Genome 230 2.0 arrays. A total of 99 genes in the 4q21-q41 region were differentially expressed (P < 0.05) among all strains of rats with a false discovery rate <10%. These 99 genes were then ranked based on the strength of correlation between femoral neck phenotypes measured in F2 animals, homozygous for a particular strain's allele at the Chr 4 QTL and the expression level of the gene in that strain. A total of 18 candidate genes were strongly correlated (r(2) > 0.50) with femoral neck width and prioritized for further analysis. Quantitative PCR analysis confirmed 14 of 18 of the candidate genes. Ingenuity pathway analysis revealed several direct or indirect relationships among the candidate genes related to angiogenesis (VEGF), bone growth (FGF2), bone formation (IGF2 and IGF2BP3), and resorption (TNF). This study provides a shortened list of genetic determinants of skeletal traits at the hip and may lead to novel approaches for prevention and treatment of hip fracture.

  8. Genomic expression analysis of rat chromosome 4 for skeletal traits at femoral neck

    PubMed Central

    Alam, Imranul; Sun, Qiwei; Liu, Lixiang; Koller, Daniel L.; Liu, Yunlong; Edenberg, Howard J.; Econs, Michael J.; Foroud, Tatiana; Turner, Charles H.

    2008-01-01

    Hip fracture is the most devastating osteoporotic fracture type with significant morbidity and mortality. Several studies in humans and animal models identified chromosomal regions linked to hip size and bone mass. Previously, we identified that the region of 4q21-q41 on rat chromosome (Chr) 4 harbors multiple femoral neck quantitative trait loci (QTLs) in inbred Fischer 344 (F344) and Lewis (LEW) rats. The purpose of this study is to identify the candidate genes for femoral neck structure and density by correlating gene expression in the proximal femur with the femoral neck phenotypes linked to the QTLs on Chr 4. RNA was extracted from proximal femora of 4-wk-old rats from F344 and LEW strains, and two other strains, Copenhagen 2331 and Dark Agouti, were used as a negative control. Microarray analysis was performed using Affymetrix Rat Genome 230 2.0 arrays. A total of 99 genes in the 4q21-q41 region were differentially expressed (P < 0.05) among all strains of rats with a false discovery rate <10%. These 99 genes were then ranked based on the strength of correlation between femoral neck phenotypes measured in F2 animals, homozygous for a particular strain's allele at the Chr 4 QTL and the expression level of the gene in that strain. A total of 18 candidate genes were strongly correlated (r2 > 0.50) with femoral neck width and prioritized for further analysis. Quantitative PCR analysis confirmed 14 of 18 of the candidate genes. Ingenuity pathway analysis revealed several direct or indirect relationships among the candidate genes related to angiogenesis (VEGF), bone growth (FGF2), bone formation (IGF2 and IGF2BP3), and resorption (TNF). This study provides a shortened list of genetic determinants of skeletal traits at the hip and may lead to novel approaches for prevention and treatment of hip fracture. PMID:18728226

  9. Unsupervised text mining for assessing and augmenting GWAS results.

    PubMed

    Ailem, Melissa; Role, François; Nadif, Mohamed; Demenais, Florence

    2016-04-01

    Text mining can assist in the analysis and interpretation of large-scale biomedical data, helping biologists to quickly and cheaply gain confirmation of hypothesized relationships between biological entities. We set this question in the context of genome-wide association studies (GWAS), an actively emerging field that contributed to identify many genes associated with multifactorial diseases. These studies allow to identify groups of genes associated with the same phenotype, but provide no information about the relationships between these genes. Therefore, our objective is to leverage unsupervised text mining techniques using text-based cosine similarity comparisons and clustering applied to candidate and random gene vectors, in order to augment the GWAS results. We propose a generic framework which we used to characterize the relationships between 10 genes reported associated with asthma by a previous GWAS. The results of this experiment showed that the similarities between these 10 genes were significantly stronger than would be expected by chance (one-sided p-value<0.01). The clustering of observed and randomly selected gene also allowed to generate hypotheses about potential functional relationships between these genes and thus contributed to the discovery of new candidate genes for asthma. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Adolescent idiopathic scoliosis and the single-nucleotide polymorphism of the growth hormone receptor and IGF-1 genes.

    PubMed

    Yang, Yong; Wu, Zhihong; Zhao, Taimao; Wang, Hai; Zhao, Dong; Zhang, Jianguo; Wang, Yipeng; Ding, Yaozhong; Qiu, Guixing

    2009-06-01

    The etiology of adolescent idiopathic scoliosis is undetermined despite years of research. A number of hypotheses have been postulated to explain its development, including growth abnormalities. The irregular expression of growth hormone and insulin-like growth factor-1 (IGF-1) may disturb hormone metabolism, result in a gross asymmetry, and promote the progress of adolescent idiopathic scoliosis. Initial association studies in complex diseases have demonstrated the power of candidate gene association. Prior to our study, 1 study in this field had a negative result. A replicable study is vital for reliability. To determine the relationship of growth hormone receptor and IGF-1 genes with adolescent idiopathic scoliosis, a population-based association study was performed. Single nucleotide polymorphisms with potential function were selected from candidate genes and a distribution analysis was performed. A conclusion was made confirming the insufficiency of an association between adolescent idiopathic scoliosis and the single-nucleotide polymorphism of the growth hormone receptor and IGF-1 genes in Han Chinese.

  11. A Case of Two Sisters Suffering from 46,XY Gonadal Dysgenesis and Carrying a Mutation of a Novel Candidate Sex-Determining Gene STARD8 on the X Chromosome.

    PubMed

    Ilaslan, Erkut; Calvel, Pierre; Nowak, Dominika; Szarras-Czapnik, Maria; Slowikowska-Hilczer, Jolanta; Spik, Anna; Sararols, Pauline; Nef, Serge; Jaruzelska, Jadwiga; Kusz-Zamelczyk, Kamila

    2018-06-08

    Identification of novel genes involved in sexual development is crucial for understanding disorders of sex development (DSD). Here, we propose a member of the START domain family, the X chromosome STARD8, as a DSD candidate gene. We have identified a missense mutation of this gene in 2 sisters with 46,XY gonadal dysgenesis, inherited from their heterozygous mother. Gonadal tissue of one of the sisters contained Leydig cells overloaded with cholesterol droplets, i.e., structures previously identified in 46,XY DSD patients carrying mutations in the STAR gene encoding another START domain family member, which is crucial for steroidogenesis. Based on the phenotypes of our patients, we propose a dual role of STARD8 in sexual development, namely in testes determination and testosterone synthesis. However, further studies are needed to confirm the involvement of STARD8 in sexual development. © 2018 S. Karger AG, Basel.

  12. Differences in Brain Transcriptomes of Closely Related Baikal Coregonid Species

    PubMed Central

    Bychenko, Oksana S.; Sukhanova, Lyubov V.; Azhikina, Tatyana L.; Skvortsov, Timofey A.; Belomestnykh, Tuyana V.; Sverdlov, Eugene D.

    2014-01-01

    The aim of this work was to get deeper insight into genetic factors involved in the adaptive divergence of closely related species, specifically two representatives of Baikal coregonids—Baikal whitefish (Coregonus baicalensis Dybowski) and Baikal omul (Coregonus migratorius Georgi)—that diverged from a common ancestor as recently as 10–20 thousand years ago. Using the Serial Analysis of Gene Expression method, we obtained libraries of short representative cDNA sequences (tags) from the brains of Baikal whitefish and omul. A comparative analysis of the libraries revealed quantitative differences among ~4% tags of the fishes under study. Based on the similarity of these tags with cDNA of known organisms, we identified candidate genes taking part in adaptive divergence. The most important candidate genes related to the adaptation of Baikal whitefish and Baikal omul, identified in this work, belong to the genes of cell metabolism, nervous and immune systems, protein synthesis, and regulatory genes as well as to DTSsa4 Tc1-like transposons which are widespread among fishes. PMID:24719892

  13. Axon Regeneration Genes Identified by RNAi Screening in C. elegans

    PubMed Central

    Nix, Paola; Hammarlund, Marc; Hauth, Linda; Lachnit, Martina; Jorgensen, Erik M.

    2014-01-01

    Axons of the mammalian CNS lose the ability to regenerate soon after development due to both an inhibitory CNS environment and the loss of cell-intrinsic factors necessary for regeneration. The complex molecular events required for robust regeneration of mature neurons are not fully understood, particularly in vivo. To identify genes affecting axon regeneration in Caenorhabditis elegans, we performed both an RNAi-based screen for defective motor axon regeneration in unc-70/β-spectrin mutants and a candidate gene screen. From these screens, we identified at least 50 conserved genes with growth-promoting or growth-inhibiting functions. Through our analysis of mutants, we shed new light on certain aspects of regeneration, including the role of β-spectrin and membrane dynamics, the antagonistic activity of MAP kinase signaling pathways, and the role of stress in promoting axon regeneration. Many gene candidates had not previously been associated with axon regeneration and implicate new pathways of interest for therapeutic intervention. PMID:24403161

  14. Evidence of linkage and association on chromosome 20 for late-onset Alzheimer disease.

    PubMed

    Goddard, Katrina A B; Olson, Jane M; Payami, Haydeh; van der Voet, Monique; Kuivaniemi, Helena; Tromp, Gerard

    2004-06-01

    Recently, we reported evidence of linkage on chromosome 20 for Alzheimer disease (AD) using a novel statistical approach to incorporate covariates (e.g., age, ApoE genotype) into the analysis. These results suggest that very elderly subjects (>85 years), and individuals who carry an epsilon2 allele at the ApoE locus are more likely to be linked to this candidate region. The region on chromosome 20 includes a strong candidate gene, cystatin C (CST3), which has previously been associated with AD in case-control studies. We investigated these findings further by genotyping additional markers to narrow the candidate region, and to identify evidence of linkage disequilibrium as additional support for a susceptibility locus on chromosome 20. We selected 43 elderly sibships (89 subjects) from the NIMH AD Genetics Initiative based on current age older than 84 years, and identified 129 unrelated control subjects who were older than 84 years from the Oregon Brain Aging Study to conduct linkage and association studies in this region. Fourteen additional markers were evaluated, including 4 markers located within or near CST3. We narrowed the candidate region on chromosome 20 to an 11.8-cM region between markers D20S174 and D20S471, which includes the CST3 candidate gene. In addition, we observed evidence of association for markers located near the CST3 candidate gene, with P values between 0.002 and 0.08 for two-locus haplotypes. These results support the presence of a susceptibility locus for AD in the vicinity of CST3 for very elderly subjects with AD.

  15. The CanOE strategy: integrating genomic and metabolic contexts across multiple prokaryote genomes to find candidate genes for orphan enzymes.

    PubMed

    Smith, Adam Alexander Thil; Belda, Eugeni; Viari, Alain; Medigue, Claudine; Vallenet, David

    2012-05-01

    Of all biochemically characterized metabolic reactions formalized by the IUBMB, over one out of four have yet to be associated with a nucleic or protein sequence, i.e. are sequence-orphan enzymatic activities. Few bioinformatics annotation tools are able to propose candidate genes for such activities by exploiting context-dependent rather than sequence-dependent data, and none are readily accessible and propose result integration across multiple genomes. Here, we present CanOE (Candidate genes for Orphan Enzymes), a four-step bioinformatics strategy that proposes ranked candidate genes for sequence-orphan enzymatic activities (or orphan enzymes for short). The first step locates "genomic metabolons", i.e. groups of co-localized genes coding proteins catalyzing reactions linked by shared metabolites, in one genome at a time. These metabolons can be particularly helpful for aiding bioanalysts to visualize relevant metabolic data. In the second step, they are used to generate candidate associations between un-annotated genes and gene-less reactions. The third step integrates these gene-reaction associations over several genomes using gene families, and summarizes the strength of family-reaction associations by several scores. In the final step, these scores are used to rank members of gene families which are proposed for metabolic reactions. These associations are of particular interest when the metabolic reaction is a sequence-orphan enzymatic activity. Our strategy found over 60,000 genomic metabolons in more than 1,000 prokaryote organisms from the MicroScope platform, generating candidate genes for many metabolic reactions, of which more than 70 distinct orphan reactions. A computational validation of the approach is discussed. Finally, we present a case study on the anaerobic allantoin degradation pathway in Escherichia coli K-12.

  16. Transcriptome analysis of Brassica napus pod using RNA-Seq and identification of lipid-related candidate genes.

    PubMed

    Xu, Hai-Ming; Kong, Xiang-Dong; Chen, Fei; Huang, Ji-Xiang; Lou, Xiang-Yang; Zhao, Jian-Yi

    2015-10-24

    Brassica napus is an important oilseed crop. Dissection of the genetic architecture underlying oil-related biological processes will greatly facilitates the genetic improvement of rapeseed. The differential gene expression during pod development offers a snapshot on the genes responsible for oil accumulation in. To identify candidate genes in the linkage peaks reported previously, we used RNA sequencing (RNA-Seq) technology to analyze the pod transcriptomes of German cultivar Sollux and Chinese inbred line Gaoyou. The RNA samples were collected for RNA-Seq at 5-7, 15-17 and 25-27 days after flowering (DAF). Bioinformatics analysis was performed to investigate differentially expressed genes (DEGs). Gene annotation analysis was integrated with QTL mapping and Brassica napus pod transcriptome profiling to detect potential candidate genes in oilseed. Four hundred sixty five and two thousand, one hundred fourteen candidate DEGs were identified, respectively, between two varieties at the same stages and across different periods of each variety. Then, 33 DEGs between Sollux and Gaoyou were identified as the candidate genes affecting seed oil content by combining those DEGs with the quantitative trait locus (QTL) mapping results, of which, one was found to be homologous to Arabidopsis thaliana lipid-related genes. Intervarietal DEGs of lipid pathways in QTL regions represent important candidate genes for oil-related traits. Integrated analysis of transcriptome profiling, QTL mapping and comparative genomics with other relative species leads to efficient identification of most plausible functional genes underlying oil-content related characters, offering valuable resources for bettering breeding program of Brassica napus. This study provided a comprehensive overview on the pod transcriptomes of two varieties with different oil-contents at the three developmental stages.

  17. Lumbosacral stenosis in Labrador retriever military working dogs - an exomic exploratory study.

    PubMed

    Mukherjee, Meenakshi; Jones, Jeryl C; Yao, Jianbo

    2017-01-01

    Canine lumbosacral stenosis is defined as narrowing of the caudal lumbar and/or sacral vertebral canal. A risk factor for neurologic problems in many large sized breeds, lumbosacral stenosis can also cause early retirement in Labrador retriever military working dogs. Though vital for conservative management of the condition, early detection is complicated by the ambiguous nature of clinical signs of lumbosacral stenosis in stoic and high-drive Labrador retriever military working dogs. Though clinical diagnoses of lumbosacral stenosis using CT imaging are standard, they are usually not performed unless dogs present with clinical symptoms. Understanding the underlying genomic mechanisms would be beneficial in developing early detection methods for lumbosacral stenosis, which could prevent premature retirement in working dogs. The exomes of 8 young Labrador retriever military working dogs (4 affected and 4 unaffected by lumbosacral stenosis, phenotypically selected by CT image analyses from 40 dogs with no reported clinical signs of the condition) were sequenced to identify and annotate exonic variants between dogs negative and positive for lumbosacral stenosis. Two-hundred and fifty-two variants were detected to be homozygous for the wild allele and either homozygous or heterozygous for the variant allele. Seventeen non-disruptive variants were detected that could affect protein effectiveness in 7 annotated (SCN1B, RGS9BP, ASXL3, TTR, LRRC16B, PTPRO, ZBBX) and 3 predicted genes (EEF1A1, DNAJA1, ZFX). No exonic variants were detected in any of the canine orthologues for human lumbar spinal stenosis candidate genes. TTR (transthyretin) gene could be a possible candidate for lumbosacral stenosis in Labrador retrievers based on previous human studies that have reported an association between human lumbar spinal stenosis and transthyretin protein amyloidosis. Other genes identified with exonic variants in this study but with no known published association with lumbosacral stenosis and/or lumbar spinal stenosis could also be candidate genes for future canine lumbosacral stenosis studies but their roles remain currently unknown. Human lumbar spinal stenosis candidate genes also cannot be ruled out as lumbosacral stenosis candidate genes. More definitive genetic investigations of this condition are needed before any genetic test for lumbosacral stenosis in Labrador retriever can be developed.

  18. Detecting Horizontal Gene Transfer between Closely Related Taxa

    PubMed Central

    Adato, Orit; Ninyo, Noga; Gophna, Uri; Snir, Sagi

    2015-01-01

    Horizontal gene transfer (HGT), the transfer of genetic material between organisms, is crucial for genetic innovation and the evolution of genome architecture. Existing HGT detection algorithms rely on a strong phylogenetic signal distinguishing the transferred sequence from ancestral (vertically derived) genes in its recipient genome. Detecting HGT between closely related species or strains is challenging, as the phylogenetic signal is usually weak and the nucleotide composition is normally nearly identical. Nevertheless, there is a great importance in detecting HGT between congeneric species or strains, especially in clinical microbiology, where understanding the emergence of new virulent and drug-resistant strains is crucial, and often time-sensitive. We developed a novel, self-contained technique named Near HGT, based on the synteny index, to measure the divergence of a gene from its native genomic environment and used it to identify candidate HGT events between closely related strains. The method confirms candidate transferred genes based on the constant relative mutability (CRM). Using CRM, the algorithm assigns a confidence score based on “unusual” sequence divergence. A gene exhibiting exceptional deviations according to both synteny and mutability criteria, is considered a validated HGT product. We first employed the technique to a set of three E. coli strains and detected several highly probable horizontally acquired genes. We then compared the method to existing HGT detection tools using a larger strain data set. When combined with additional approaches our new algorithm provides richer picture and brings us closer to the goal of detecting all newly acquired genes in a particular strain. PMID:26439115

  19. Informed walks: whispering hints to gene hunters inside networks' jungle.

    PubMed

    Bourdakou, Marilena M; Spyrou, George M

    2017-10-11

    Systemic approaches offer a different point of view on the analysis of several types of molecular associations as well as on the identification of specific gene communities in several cancer types. However, due to lack of sufficient data needed to construct networks based on experimental evidence, statistical gene co-expression networks are widely used instead. Many efforts have been made to exploit the information hidden in these networks. However, these approaches still need to capitalize comprehensively the prior knowledge encrypted into molecular pathway associations and improve their efficiency regarding the discovery of both exclusive subnetworks as candidate biomarkers and conserved subnetworks that may uncover common origins of several cancer types. In this study we present the development of the Informed Walks model based on random walks that incorporate information from molecular pathways to mine candidate genes and gene-gene links. The proposed model has been applied to TCGA (The Cancer Genome Atlas) datasets from seven different cancer types, exploring the reconstructed co-expression networks of the whole set of genes and driving to highlighted sub-networks for each cancer type. In the sequel, we elucidated the impact of each subnetwork on the indication of underlying exclusive and common molecular mechanisms as well as on the short-listing of drugs that have the potential to suppress the corresponding cancer type through a drug-repurposing pipeline. We have developed a method of gene subnetwork highlighting based on prior knowledge, capable to give fruitful insights regarding the underlying molecular mechanisms and valuable input to drug-repurposing pipelines for a variety of cancer types.

  20. Identification of downy mildew resistance gene candidates by positional cloning in maize (Zea mays subsp. mays; Poaceae)1

    PubMed Central

    Kim, Jae Yoon; Moon, Jun-Cheol; Kim, Hyo Chul; Shin, Seungho; Song, Kitae; Kim, Kyung-Hee; Lee, Byung-Moo

    2017-01-01

    Premise of the study: Positional cloning in combination with phenotyping is a general approach to identify disease-resistance gene candidates in plants; however, it requires several time-consuming steps including population or fine mapping. Therefore, in the present study, we suggest a new combined strategy to improve the identification of disease-resistance gene candidates. Methods and Results: Downy mildew (DM)–resistant maize was selected from five cultivars using a spreader row technique. Positional cloning and bioinformatics tools were used to identify the DM-resistance quantitative trait locus marker (bnlg1702) and 47 protein-coding gene annotations. Eventually, five DM-resistance gene candidates, including bZIP34, Bak1, and Ppr, were identified by quantitative reverse-transcription PCR (RT-PCR) without fine mapping of the bnlg1702 locus. Conclusions: The combined protocol with the spreader row technique, quantitative trait locus positional cloning, and quantitative RT-PCR was effective for identifying DM-resistance candidate genes. This cloning approach may be applied to other whole-genome-sequenced crops or resistance to other diseases. PMID:28224059

  1. Integrative strategies to identify candidate genes in rodent models of human alcoholism.

    PubMed

    Treadwell, Julie A

    2006-01-01

    The search for genes underlying alcohol-related behaviours in rodent models of human alcoholism has been ongoing for many years with only limited success. Recently, new strategies that integrate several of the traditional approaches have provided new insights into the molecular mechanisms underlying ethanol's actions in the brain. We have used alcohol-preferring C57BL/6J (B6) and alcohol-avoiding DBA/2J (D2) genetic strains of mice in an integrative strategy combining high-throughput gene expression screening, genetic segregation analysis, and mapping to previously published quantitative trait loci to uncover candidate genes for the ethanol-preference phenotype. In our study, 2 genes, retinaldehyde binding protein 1 (Rlbp1) and syntaxin 12 (Stx12), were found to be strong candidates for ethanol preference. Such experimental approaches have the power and the potential to greatly speed up the laborious process of identifying candidate genes for the animal models of human alcoholism.

  2. LOD score exclusion analyses for candidate genes using random population samples.

    PubMed

    Deng, H W; Li, J; Recker, R R

    2001-05-01

    While extensive analyses have been conducted to test for, no formal analyses have been conducted to test against, the importance of candidate genes with random population samples. We develop a LOD score approach for exclusion analyses of candidate genes with random population samples. Under this approach, specific genetic effects and inheritance models at candidate genes can be analysed and if a LOD score is < or = - 2.0, the locus can be excluded from having an effect larger than that specified. Computer simulations show that, with sample sizes often employed in association studies, this approach has high power to exclude a gene from having moderate genetic effects. In contrast to regular association analyses, population admixture will not affect the robustness of our analyses; in fact, it renders our analyses more conservative and thus any significant exclusion result is robust. Our exclusion analysis complements association analysis for candidate genes in random population samples and is parallel to the exclusion mapping analyses that may be conducted in linkage analyses with pedigrees or relative pairs. The usefulness of the approach is demonstrated by an application to test the importance of vitamin D receptor and estrogen receptor genes underlying the differential risk to osteoporotic fractures.

  3. Scanning the genome for gene single nucleotide polymorphisms involved in adaptive population differentiation in white spruce

    PubMed Central

    Namroud, Marie-Claire; Beaulieu, Jean; Juge, Nicolas; Laroche, Jérôme; Bousquet, Jean

    2008-01-01

    Conifers are characterized by a large genome size and a rapid decay of linkage disequilibrium, most often within gene limits. Genome scans based on noncoding markers are less likely to detect molecular adaptation linked to genes in these species. In this study, we assessed the effectiveness of a genome-wide single nucleotide polymorphism (SNP) scan focused on expressed genes in detecting local adaptation in a conifer species. Samples were collected from six natural populations of white spruce (Picea glauca) moderately differentiated for several quantitative characters. A total of 534 SNPs representing 345 expressed genes were analysed. Genes potentially under natural selection were identified by estimating the differentiation in SNP frequencies among populations (FST) and identifying outliers, and by estimating local differentiation using a Bayesian approach. Both average expected heterozygosity and population differentiation estimates (HE = 0.270 and FST = 0.006) were comparable to those obtained with other genetic markers. Of all genes, 5.5% were identified as outliers with FST at the 95% confidence level, while 14% were identified as candidates for local adaptation with the Bayesian method. There was some overlap between the two gene sets. More than half of the candidate genes for local adaptation were specific to the warmest population, about 20% to the most arid population, and 15% to the coldest and most humid higher altitude population. These adaptive trends were consistent with the genes’ putative functions and the divergence in quantitative traits noted among the populations. The results suggest that an approach separating the locus and population effects is useful to identify genes potentially under selection. These candidates are worth exploring in more details at the physiological and ecological levels. PMID:18662225

  4. A comprehensive approach to identify reliable reference gene candidates to investigate the link between alcoholism and endocrinology in Sprague-Dawley rats.

    PubMed

    Taki, Faten A; Abdel-Rahman, Abdel A; Zhang, Baohong

    2014-01-01

    Gender and hormonal differences are often correlated with alcohol dependence and related complications like addiction and breast cancer. Estrogen (E2) is an important sex hormone because it serves as a key protein involved in organism level signaling pathways. Alcoholism has been reported to affect estrogen receptor signaling; however, identifying the players involved in such multi-faceted syndrome is complex and requires an interdisciplinary approach. In many situations, preliminary investigations included a straight forward, yet informative biotechniques such as gene expression analyses using quantitative real time PCR (qRT-PCR). The validity of qRT-PCR-based conclusions is affected by the choice of reliable internal controls. With this in mind, we compiled a list of 15 commonly used housekeeping genes (HKGs) as potential reference gene candidates in rat biological models. A comprehensive comparison among 5 statistical approaches (geNorm, dCt method, NormFinder, BestKeeper, and RefFinder) was performed to identify the minimal number as well the most stable reference genes required for reliable normalization in experimental rat groups that comprised sham operated (SO), ovariectomized rats in the absence (OVX) or presence of E2 (OVXE2). These rat groups were subdivided into subgroups that received alcohol in liquid diet or isocalroic control liquid diet for 12 weeks. Our results showed that U87, 5S rRNA, GAPDH, and U5a were the most reliable gene candidates for reference genes in heart and brain tissue. However, different gene stability ranking was specific for each tissue input combination. The present preliminary findings highlight the variability in reference gene rankings across different experimental conditions and analytic methods and constitute a fundamental step for gene expression assays.

  5. A current view of Alzheimer's disease.

    PubMed

    Hooli, Basavaraj V; Tanzi, Rudolph E

    2009-07-08

    Several genes that influence susceptibility to Alzheimer's disease (AD) have been known for over two decades. Recent advances have elucidated novel candidate genes and the pathogenetic mechanisms underlying neurodegeneration in AD. Here, we summarize what we have learned from studies of the known AD genes with regard to the causes of AD and emerging therapies. We also review key recent discoveries that have enhanced our understanding of the etiology and pathogenesis of this devastating disease, based on new investigations into the genes and molecular mechanisms underlying AD.

  6. Risk of type 1 diabetes progression in islet autoantibody-positive children can be further stratified using expression patterns of multiple genes implicated in peripheral blood lymphocyte activation and function.

    PubMed

    Jin, Yulan; Sharma, Ashok; Bai, Shan; Davis, Colleen; Liu, Haitao; Hopkins, Diane; Barriga, Kathy; Rewers, Marian; She, Jin-Xiong

    2014-07-01

    There is tremendous scientific and clinical value to further improving the predictive power of autoantibodies because autoantibody-positive (AbP) children have heterogeneous rates of progression to clinical diabetes. This study explored the potential of gene expression profiles as biomarkers for risk stratification among 104 AbP subjects from the Diabetes Autoimmunity Study in the Young (DAISY) using a discovery data set based on microarray and a validation data set based on real-time RT-PCR. The microarray data identified 454 candidate genes with expression levels associated with various type 1 diabetes (T1D) progression rates. RT-PCR analyses of the top-27 candidate genes confirmed 5 genes (BACH2, IGLL3, EIF3A, CDC20, and TXNDC5) associated with differential progression and implicated in lymphocyte activation and function. Multivariate analyses of these five genes in the discovery and validation data sets identified and confirmed four multigene models (BI, ICE, BICE, and BITE, with each letter representing a gene) that consistently stratify high- and low-risk subsets of AbP subjects with hazard ratios >6 (P < 0.01). The results suggest that these genes may be involved in T1D pathogenesis and potentially serve as excellent gene expression biomarkers to predict the risk of progression to clinical diabetes for AbP subjects. © 2014 by the American Diabetes Association.

  7. Dehydration induced transcriptomic responses in two Tibetan hulless barley (Hordeum vulgare var. nudum) accessions distinguished by drought tolerance.

    PubMed

    Liang, Junjun; Chen, Xin; Deng, Guangbing; Pan, Zhifen; Zhang, Haili; Li, Qiao; Yang, Kaijun; Long, Hai; Yu, Maoqun

    2017-10-11

    The harsh environment on the Qinghai-Tibetan Plateau gives Tibetan hulless barley (Hordeum vulgare var. nudum) great ability to resist adversities such as drought, salinity, and low temperature, and makes it a good subject for the analysis of drought tolerance mechanism. To elucidate the specific gene networks and pathways that contribute to its drought tolerance, and for identifying new candidate genes for breeding purposes, we performed a transcriptomic analysis using two accessions of Tibetan hulless barley, namely Z772 (drought-tolerant) and Z013 (drought-sensitive). There were more up-regulated genes of Z772 than Z013 under both mild (5439-VS-2604) and severe (7203-VS-3359) dehydration treatments. Under mild dehydration stress, the pathways exclusively enriched in drought-tolerance genotype Z772 included Protein processing in endoplasmic reticulum, tricarboxylic acid (TCA) cycle, Wax biosynthesis, and Spliceosome. Under severe dehydration stress, the pathways that were mainly enriched in Z772 included Carbon fixation in photosynthetic organisms, Pyruvate metabolism, Porphyrin and chlorophyll metabolism. The main differentially expressed genes (DEGs) in response to dehydration stress and genes whose expression was different between tolerant and sensitive genotypes were presented in this study, respectively. The candidate genes for drought tolerance were selected based on their expression patterns. The RNA-Seq data obtained in this study provided an initial overview on global gene expression patterns and networks that related to dehydration shock in Tibetan hulless barley. Furthermore, these data provided pathways and a targeted set of candidate genes that might be essential for deep analyzing the molecular mechanisms of plant tolerance to drought stress.

  8. Phenoscape: Identifying Candidate Genes for Evolutionary Phenotypes

    PubMed Central

    Edmunds, Richard C.; Su, Baofeng; Balhoff, James P.; Eames, B. Frank; Dahdul, Wasila M.; Lapp, Hilmar; Lundberg, John G.; Vision, Todd J.; Dunham, Rex A.; Mabee, Paula M.; Westerfield, Monte

    2016-01-01

    Phenotypes resulting from mutations in genetic model organisms can help reveal candidate genes for evolutionarily important phenotypic changes in related taxa. Although testing candidate gene hypotheses experimentally in nonmodel organisms is typically difficult, ontology-driven information systems can help generate testable hypotheses about developmental processes in experimentally tractable organisms. Here, we tested candidate gene hypotheses suggested by expert use of the Phenoscape Knowledgebase, specifically looking for genes that are candidates responsible for evolutionarily interesting phenotypes in the ostariophysan fishes that bear resemblance to mutant phenotypes in zebrafish. For this, we searched ZFIN for genetic perturbations that result in either loss of basihyal element or loss of scales phenotypes, because these are the ancestral phenotypes observed in catfishes (Siluriformes). We tested the identified candidate genes by examining their endogenous expression patterns in the channel catfish, Ictalurus punctatus. The experimental results were consistent with the hypotheses that these features evolved through disruption in developmental pathways at, or upstream of, brpf1 and eda/edar for the ancestral losses of basihyal element and scales, respectively. These results demonstrate that ontological annotations of the phenotypic effects of genetic alterations in model organisms, when aggregated within a knowledgebase, can be used effectively to generate testable, and useful, hypotheses about evolutionary changes in morphology. PMID:26500251

  9. Beyond main effects of gene-sets: harsh parenting moderates the association between a dopamine gene-set and child externalizing behavior.

    PubMed

    Windhorst, Dafna A; Mileva-Seitz, Viara R; Rippe, Ralph C A; Tiemeier, Henning; Jaddoe, Vincent W V; Verhulst, Frank C; van IJzendoorn, Marinus H; Bakermans-Kranenburg, Marian J

    2016-08-01

    In a longitudinal cohort study, we investigated the interplay of harsh parenting and genetic variation across a set of functionally related dopamine genes, in association with children's externalizing behavior. This is one of the first studies to employ gene-based and gene-set approaches in tests of Gene by Environment (G × E) effects on complex behavior. This approach can offer an important alternative or complement to candidate gene and genome-wide environmental interaction (GWEI) studies in the search for genetic variation underlying individual differences in behavior. Genetic variants in 12 autosomal dopaminergic genes were available in an ethnically homogenous part of a population-based cohort. Harsh parenting was assessed with maternal (n = 1881) and paternal (n = 1710) reports at age 3. Externalizing behavior was assessed with the Child Behavior Checklist (CBCL) at age 5 (71 ± 3.7 months). We conducted gene-set analyses of the association between variation in dopaminergic genes and externalizing behavior, stratified for harsh parenting. The association was statistically significant or approached significance for children without harsh parenting experiences, but was absent in the group with harsh parenting. Similarly, significant associations between single genes and externalizing behavior were only found in the group without harsh parenting. Effect sizes in the groups with and without harsh parenting did not differ significantly. Gene-environment interaction tests were conducted for individual genetic variants, resulting in two significant interaction effects (rs1497023 and rs4922132) after correction for multiple testing. Our findings are suggestive of G × E interplay, with associations between dopamine genes and externalizing behavior present in children without harsh parenting, but not in children with harsh parenting experiences. Harsh parenting may overrule the role of genetic factors in externalizing behavior. Gene-based and gene-set analyses offer promising new alternatives to analyses focusing on single candidate polymorphisms when examining the interplay between genetic and environmental factors.

  10. Pediatric Glioblastoma Therapies Based on Patient-Derived Stem Cell Resources

    DTIC Science & Technology

    2014-11-01

    genomic DNA and then subjected to Illumina high-throughput sequencing . In this analysis, shRNAs lost in the GSC population represent candidate gene...and genomic DNA and then subjected to Illumina high-throughput sequencing . In this analysis, shRNAs lost in the GSC population represent candidate...PRISM 7900 Sequence Detection System ( Genomics Resource, FHCRC). Relative transcript abundance was analyzed using the 2−ΔΔCt method. TRIzol (Invitrogen

  11. Identifying the candidate genes involved in the calyx abscission process of 'Kuerlexiangli' (Pyrus sinkiangensis Yu) by digital transcript abundance measurements.

    PubMed

    Qi, Xiaoxiao; Wu, Jun; Wang, Lifen; Li, Leiting; Cao, Yufen; Tian, Luming; Dong, Xingguang; Zhang, Shaoling

    2013-10-23

    'Kuerlexiangli' (Pyrus sinkiangensis Yu), a native pear of Xinjiang, China, is an important agricultural fruit and primary export to the international market. However, fruit with persistent calyxes affect fruit shape and quality. Although several studies have looked into the physiological aspects of the calyx abscission process, the underlying molecular mechanisms remain unknown. In order to better understand the molecular basis of the process of calyx abscission, materials at three critical stages of regulation, with 6000 × Flusilazole plus 300 × PBO treatment (calyx abscising treatment) and 50 mg.L-1GA3 treatment (calyx persisting treatment), were collected and cDNA fragments were sequenced using digital transcript abundance measurements to identify candidate genes. Digital transcript abundance measurements was performed using high-throughput Illumina GAII sequencing on seven samples that were collected at three important stages of the calyx abscission process with chemical agent treatments promoting calyx abscission and persistence. Altogether more than 251,123,845 high quality reads were obtained with approximately 8.0 M raw data for each library. The values of 69.85%-71.90% of clean data in the digital transcript abundance measurements could be mapped to the pear genome database. There were 12,054 differentially expressed genes having Gene Ontology (GO) terms and associating with 251 Kyoto Encyclopedia of Genes and Genomes (KEGG) defined pathways. The differentially expressed genes correlated with calyx abscission were mainly involved in photosynthesis, plant hormone signal transduction, cell wall modification, transcriptional regulation, and carbohydrate metabolism. Furthermore, candidate calyx abscission-specific genes, e.g. Inflorescence deficient in abscission gene, were identified. Quantitative real-time PCR was used to confirm the digital transcript abundance measurements results. We identified candidate genes that showed highly dynamic changes in expression during the calyx abscission process. These genes are potential targets for future functional characterization and should be valuable for exploration of the mechanisms of calyx abscission, and eventually for developing methods based on small molecule application to induce calyx abscission in fruit production.

  12. The Genetic Basis for Variation in Sensitivity to Lead Toxicity in Drosophila melanogaster.

    PubMed

    Zhou, Shanshan; Morozova, Tatiana V; Hussain, Yasmeen N; Luoma, Sarah E; McCoy, Lenovia; Yamamoto, Akihiko; Mackay, Trudy F C; Anholt, Robert R H

    2016-07-01

    Lead toxicity presents a worldwide health problem, especially due to its adverse effects on cognitive development in children. However, identifying genes that give rise to individual variation in susceptibility to lead toxicity is challenging in human populations. Our goal was to use Drosophila melanogaster to identify evolutionarily conserved candidate genes associated with individual variation in susceptibility to lead exposure. To identify candidate genes associated with variation in susceptibility to lead toxicity, we measured effects of lead exposure on development time, viability and adult activity in the Drosophila melanogaster Genetic Reference Panel (DGRP) and performed genome-wide association analyses to identify candidate genes. We used mutants to assess functional causality of candidate genes and constructed a genetic network associated with variation in sensitivity to lead exposure, on which we could superimpose human orthologs. We found substantial heritabilities for all three traits and identified candidate genes associated with variation in susceptibility to lead exposure for each phenotype. The genetic architectures that determine variation in sensitivity to lead exposure are highly polygenic. Gene ontology and network analyses showed enrichment of genes associated with early development and function of the nervous system. Drosophila melanogaster presents an advantageous model to study the genetic underpinnings of variation in susceptibility to lead toxicity. Evolutionary conservation of cellular pathways that respond to toxic exposure allows predictions regarding orthologous genes and pathways across phyla. Thus, studies in the D. melanogaster model system can identify candidate susceptibility genes to guide subsequent studies in human populations. Zhou S, Morozova TV, Hussain YN, Luoma SE, McCoy L, Yamamoto A, Mackay TF, Anholt RR. 2016. The genetic basis for variation in sensitivity to lead toxicity in Drosophila melanogaster. Environ Health Perspect 124:1062-1070; http://dx.doi.org/10.1289/ehp.1510513.

  13. Replication of type 2 diabetes candidate genes variations in three geographically unrelated Indian population groups.

    PubMed

    Ali, Shafat; Chopra, Rupali; Manvati, Siddharth; Singh, Yoginder Pal; Kaul, Nabodita; Behura, Anita; Mahajan, Ankit; Sehajpal, Prabodh; Gupta, Subash; Dhar, Manoj K; Chainy, Gagan B N; Bhanwer, Amarjit S; Sharma, Swarkar; Bamezai, Rameshwar N K

    2013-01-01

    Type 2 diabetes (T2D) is a syndrome of multiple metabolic disorders and is genetically heterogeneous. India comprises one of the largest global populations with highest number of reported type 2 diabetes cases. However, limited information about T2D associated loci is available for Indian populations. It is, therefore, pertinent to evaluate the previously associated candidates as well as identify novel genetic variations in Indian populations to understand the extent of genetic heterogeneity. We chose to do a cost effective high-throughput mass-array genotyping and studied the candidate gene variations associated with T2D in literature. In this case-control candidate genes association study, 91 SNPs from 55 candidate genes have been analyzed in three geographically independent population groups from India. We report the genetic variants in five candidate genes: TCF7L2, HHEX, ENPP1, IDE and FTO, are significantly associated (after Bonferroni correction, p<5.5E-04) with T2D susceptibility in combined population. Interestingly, SNP rs7903146 of the TCF7L2 gene passed the genome wide significance threshold (combined P value = 2.05E-08) in the studied populations. We also observed the association of rs7903146 with blood glucose (fasting and postprandial) levels, supporting the role of TCF7L2 gene in blood glucose homeostasis. Further, we noted that the moderate risk provided by the independently associated loci in combined population with Odds Ratio (OR)<1.38 increased to OR = 2.44, (95%CI = 1.67-3.59) when the risk providing genotypes of TCF7L2, HHEX, ENPP1 and FTO genes were combined, suggesting the importance of gene-gene interactions evaluation in complex disorders like T2D.

  14. Replication of Type 2 Diabetes Candidate Genes Variations in Three Geographically Unrelated Indian Population Groups

    PubMed Central

    Ali, Shafat; Chopra, Rupali; Manvati, Siddharth; Mahajan, Ankit; Sehajpal, Prabodh; Gupta, Subash; Dhar, Manoj K.; Chainy, Gagan B. N.; Bhanwer, Amarjit S.; Sharma, Swarkar; Bamezai, Rameshwar N. K.

    2013-01-01

    Type 2 diabetes (T2D) is a syndrome of multiple metabolic disorders and is genetically heterogeneous. India comprises one of the largest global populations with highest number of reported type 2 diabetes cases. However, limited information about T2D associated loci is available for Indian populations. It is, therefore, pertinent to evaluate the previously associated candidates as well as identify novel genetic variations in Indian populations to understand the extent of genetic heterogeneity. We chose to do a cost effective high-throughput mass-array genotyping and studied the candidate gene variations associated with T2D in literature. In this case-control candidate genes association study, 91 SNPs from 55 candidate genes have been analyzed in three geographically independent population groups from India. We report the genetic variants in five candidate genes: TCF7L2, HHEX, ENPP1, IDE and FTO, are significantly associated (after Bonferroni correction, p<5.5E−04) with T2D susceptibility in combined population. Interestingly, SNP rs7903146 of the TCF7L2 gene passed the genome wide significance threshold (combined P value = 2.05E−08) in the studied populations. We also observed the association of rs7903146 with blood glucose (fasting and postprandial) levels, supporting the role of TCF7L2 gene in blood glucose homeostasis. Further, we noted that the moderate risk provided by the independently associated loci in combined population with Odds Ratio (OR)<1.38 increased to OR = 2.44, (95%CI = 1.67–3.59) when the risk providing genotypes of TCF7L2, HHEX, ENPP1 and FTO genes were combined, suggesting the importance of gene-gene interactions evaluation in complex disorders like T2D. PMID:23527042

  15. Prioritizing Genes Related to Nicotine Addiction Via a Multi-source-Based Approach.

    PubMed

    Liu, Xinhua; Liu, Meng; Li, Xia; Zhang, Lihua; Fan, Rui; Wang, Ju

    2015-08-01

    Nicotine has a broad impact on both the central and peripheral nervous systems. Over the past decades, an increasing number of genes potentially involved in nicotine addiction have been identified by different technical approaches. However, the molecular mechanisms underlying nicotine addiction remain largely unknown. Under such situation, prioritizing the candidate genes for further investigation is becoming increasingly important. In this study, we presented a multi-source-based gene prioritization approach for nicotine addiction by utilizing the vast amounts of information generated from for nicotine addiction study during the past years. In this approach, we first collected and curated genes from studies in four categories, i.e., genetic association analysis, genetic linkage analysis, high-throughput gene/protein expression analysis, and literature search of single gene/protein-based studies. Based on these resources, the genes were scored and a weight value was determined for each category. Finally, the genes were ranked by their combined scores, and 220 genes were selected as the prioritized nicotine addiction-related genes. Evaluation suggested the prioritized genes were promising targets for further analysis and replication study.

  16. Identification of Candidate B-Lymphoma Genes by Cross-Species Gene Expression Profiling

    PubMed Central

    Tompkins, Van S.; Han, Seong-Su; Olivier, Alicia; Syrbu, Sergei; Bair, Thomas; Button, Anna; Jacobus, Laura; Wang, Zebin; Lifton, Samuel; Raychaudhuri, Pradip; Morse, Herbert C.; Weiner, George; Link, Brian; Smith, Brian J.; Janz, Siegfried

    2013-01-01

    Comparative genome-wide expression profiling of malignant tumor counterparts across the human-mouse species barrier has a successful track record as a gene discovery tool in liver, breast, lung, prostate and other cancers, but has been largely neglected in studies on neoplasms of mature B-lymphocytes such as diffuse large B cell lymphoma (DLBCL) and Burkitt lymphoma (BL). We used global gene expression profiles of DLBCL-like tumors that arose spontaneously in Myc-transgenic C57BL/6 mice as a phylogenetically conserved filter for analyzing the human DLBCL transcriptome. The human and mouse lymphomas were found to have 60 concordantly deregulated genes in common, including 8 genes that Cox hazard regression analysis associated with overall survival in a published landmark dataset of DLBCL. Genetic network analysis of the 60 genes followed by biological validation studies indicate FOXM1 as a candidate DLBCL and BL gene, supporting a number of studies contending that FOXM1 is a therapeutic target in mature B cell tumors. Our findings demonstrate the value of the “mouse filter” for genomic studies of human B-lineage neoplasms for which a vast knowledge base already exists. PMID:24130802

  17. RNA interference of tubulin genes has lethal effects in Mythimna separate.

    PubMed

    Wang, Jin-da; Wang, Ya-Ru; Wang, Yong-Zhi; Wang, Wei-Zhong; Wang, Rong; Gao, San-Ji

    2018-05-23

    RNAi (RNA interference) is a technology for silencing expression of target genes via sequence-specific double-stranded RNA (dsRNA). Recently, dietary introduction of bacterially expressed dsRNA has shown great potential in the field of pest management. Identification of potential candidate genes for RNAi is the first step in this application. The oriental armyworm, Mythimna separata Walker (Lepidoptera: Noctuidae) is a polyphagous, migratory pest, and outbreaks have led to severe crop damage in China. In the present study, two tubulin genes were chosen as target genes because of their crucial role in insect development. Both Msα-tubulin and Msβ-tubulin genes are expressed across all life stages and are highly expressed in the head and epidermis. Feeding of bacterially expressed dsRNA of Msα-tubulin and Msβ-tubulin to third-instar larvae knocked down target mRNAs. A lethal phenotype was observed with knockdown of Msα-tubulin and Msβ-tubulin concurrent with reduction in body weight. Bacterially expressed dsRNA can be used to control M. separata, and tubulin genes could be effective candidate genes for an RNAi-based control strategy of this pest. Copyright © 2017. Published by Elsevier B.V.

  18. Discovery of a novel restriction endonuclease by genome comparison and application of a wheat-germ-based cell-free translation assay: PabI (5'-GTA/C) from the hyperthermophilic archaeon Pyrococcus abyssi.

    PubMed

    Ishikawa, Ken; Watanabe, Miki; Kuroita, Toshihiro; Uchiyama, Ikuo; Bujnicki, Janusz M; Kawakami, Bunsei; Tanokura, Masaru; Kobayashi, Ichizo

    2005-07-21

    To search for restriction endonucleases, we used a novel plant-based cell-free translation procedure that bypasses the toxicity of these enzymes. To identify candidate genes, the related genomes of the hyperthermophilic archaea Pyrococcus abyssi and Pyrococcus horikoshii were compared. In line with the selfish mobile gene hypothesis for restriction-modification systems, apparent genome rearrangement around putative restriction genes served as a selecting criterion. Several candidate restriction genes were identified and then amplified in such a way that they were removed from their own translation signal. During their cloning into a plasmid, the genes became connected with a plant translation signal. After in vitro transcription by T7 RNA polymerase, the mRNAs were separated from the template DNA and translated in a wheat-germ-based cell-free protein synthesis system. The resulting solution could be directly assayed for restriction activity. We identified two deoxyribonucleases. The novel enzyme was denoted as PabI, purified and found to recognize 5'-GTAC and leave a 3'-TA overhang (5'-GTA/C), a novel restriction enzyme-generated terminus. PabI is active up to 90 degrees C and optimally active at a pH of around 6 and in NaCl concentrations ranging from 100 to 200 mM. We predict that it has a novel 3D structure.

  19. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

  20. A fruit quality gene map of Prunus

    PubMed Central

    2009-01-01

    Background Prunus fruit development, growth, ripening, and senescence includes major biochemical and sensory changes in texture, color, and flavor. The genetic dissection of these complex processes has important applications in crop improvement, to facilitate maximizing and maintaining stone fruit quality from production and processing through to marketing and consumption. Here we present an integrated fruit quality gene map of Prunus containing 133 genes putatively involved in the determination of fruit texture, pigmentation, flavor, and chilling injury resistance. Results A genetic linkage map of 211 markers was constructed for an intraspecific peach (Prunus persica) progeny population, Pop-DG, derived from a canning peach cultivar 'Dr. Davis' and a fresh market cultivar 'Georgia Belle'. The Pop-DG map covered 818 cM of the peach genome and included three morphological markers, 11 ripening candidate genes, 13 cold-responsive genes, 21 novel EST-SSRs from the ChillPeach database, 58 previously reported SSRs, 40 RAFs, 23 SRAPs, 14 IMAs, and 28 accessory markers from candidate gene amplification. The Pop-DG map was co-linear with the Prunus reference T × E map, with 39 SSR markers in common to align the maps. A further 158 markers were bin-mapped to the reference map: 59 ripening candidate genes, 50 cold-responsive genes, and 50 novel EST-SSRs from ChillPeach, with deduced locations in Pop-DG via comparative mapping. Several candidate genes and EST-SSRs co-located with previously reported major trait loci and quantitative trait loci for chilling injury symptoms in Pop-DG. Conclusion The candidate gene approach combined with bin-mapping and availability of a community-recognized reference genetic map provides an efficient means of locating genes of interest in a target genome. We highlight the co-localization of fruit quality candidate genes with previously reported fruit quality QTLs. The fruit quality gene map developed here is a valuable tool for dissecting the genetic architecture of fruit quality traits in Prunus crops. PMID:19995417

  1. Clinical and Functional Analyses of p73R1 Mutations in Prostate Cancer

    DTIC Science & Technology

    2005-02-01

    mutations in several genes (BRCA 1, BRCA2, and CHEK2) whose products are involved in this pathway have been associated with increased risk for this...screened this gene for mutations in prostate cancer. Two germline truncating mutations were identified. Genotyping of 403 men with sporadic prostate...based on mutation screening of candidate genes involved in the DNA damage- signaling pathway. Genomic instability is a common feature of all human

  2. Candidate Gene Identification of Feed Efficiency and Coat Color Traits in a C57BL/6J × Kunming F2 Mice Population Using Genome-Wide Association Study.

    PubMed

    Miao, Yuanxin; Soudy, Fathia; Xu, Zhong; Liao, Mingxing; Zhao, Shuhong; Li, Xinyun

    2017-01-01

    Feed efficiency (FE) is a very important trait in livestock industry. Identification of the candidate genes could be of benefit for the improvement of FE trait. Mouse is used as the model for many studies in mammals. In this study, the candidate genes related to FE and coat color were identified using C57BL/6J (C57) × Kunming (KM) F2 mouse population. GWAS results showed that 61 and 2 SNPs were genome-wise suggestive significantly associated with feed conversion ratio (FCR) and feed intake (FI) traits, respectively. Moreover, the Erbin, Msrb2, Ptf1a, and Fgf10 were considered as the candidate genes of FE. The Lpl was considered as the candidate gene of FI. Further, the coat color trait was studied. KM mice are white and C57 ones are black. The GWAS results showed that the most significant SNP was located at chromosome 7, and the closely linked gene was Tyr. Therefore, our study offered useful target genes related to FE in mice; these genes may play similar roles in FE of livestock. Also, we identified the major gene of coat color in mice, which would be useful for better understanding of natural mutation of the coat color in mice.

  3. Defining the role of the MADS-box gene, Zea agamous like1, in maize domestication

    USDA-ARS?s Scientific Manuscript database

    Genomic scans for genes that show the signature of past selection have been widely applied to a number of species and have identified a large number of selection candidate genes. In cultivated maize (Zea mays ssp. mays) selection scans have identified several hundred candidate domestication genes...

  4. Genetic and Proteomic Interrogation of Lower Confidence Candidate Genes Reveals Signaling Networks in beta-Catenin-Active Cancers | Office of Cancer Genomics

    Cancer.gov

    Genome-scale expression studies and comprehensive loss-of-function genetic screens have focused almost exclusively on the highest confidence candidate genes. Here, we describe a strategy for characterizing the lower confidence candidates identified by such approaches.

  5. Combining Genotype, Phenotype, and Environment to Infer Potential Candidate Genes.

    PubMed

    Talbot, Benoit; Chen, Ting-Wen; Zimmerman, Shawna; Joost, Stéphane; Eckert, Andrew J; Crow, Taylor M; Semizer-Cuming, Devrim; Seshadri, Chitra; Manel, Stéphanie

    2017-03-01

    Population genomic analysis can be an important tool in understanding local adaptation. Identification of potential adaptive loci in such analyses is usually based on the survey of a large genomic dataset in combination with environmental variables. Phenotypic data are less commonly incorporated into such studies, although combining a genome scan analysis with a phenotypic trait analysis can greatly improve the insights obtained from each analysis individually. Here, we aimed to identify loci potentially involved in adaptation to climate in 283 Loblolly pine (Pinus taeda) samples from throughout the species' range in the southeastern United States. We analyzed associations between phenotypic, molecular, and environmental variables from datasets of 3082 single nucleotide polymorphism (SNP) loci and 3 categories of phenotypic traits (gene expression, metabolites, and whole-plant traits). We found only 6 SNP loci that displayed potential signals of local adaptation. Five of the 6 identified SNPs are linked to gene expression traits for lignin development, and 1 is linked with whole-plant traits. We subsequently compared the 6 candidate genes with environmental variables and found a high correlation in only 3 of them (R2 > 0.2). Our study highlights the need for a combination of genotypes, phenotypes, and environmental variables, and for an appropriate sampling scheme and study design, to improve confidence in the identification of potential candidate genes. © The American Genetic Association 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  6. PosMed-plus: an intelligent search engine that inferentially integrates cross-species information resources for molecular breeding of plants.

    PubMed

    Makita, Yuko; Kobayashi, Norio; Mochizuki, Yoshiki; Yoshida, Yuko; Asano, Satomi; Heida, Naohiko; Deshpande, Mrinalini; Bhatia, Rinki; Matsushima, Akihiro; Ishii, Manabu; Kawaguchi, Shuji; Iida, Kei; Hanada, Kosuke; Kuromori, Takashi; Seki, Motoaki; Shinozaki, Kazuo; Toyoda, Tetsuro

    2009-07-01

    Molecular breeding of crops is an efficient way to upgrade plant functions useful to mankind. A key step is forward genetics or positional cloning to identify the genes that confer useful functions. In order to accelerate the whole research process, we have developed an integrated database system powered by an intelligent data-retrieval engine termed PosMed-plus (Positional Medline for plant upgrading science), allowing us to prioritize highly promising candidate genes in a given chromosomal interval(s) of Arabidopsis thaliana and rice, Oryza sativa. By inferentially integrating cross-species information resources including genomes, transcriptomes, proteomes, localizomes, phenomes and literature, the system compares a user's query, such as phenotypic or functional keywords, with the literature associated with the relevant genes located within the interval. By utilizing orthologous and paralogous correspondences, PosMed-plus efficiently integrates cross-species information to facilitate the ranking of rice candidate genes based on evidence from other model species such as Arabidopsis. PosMed-plus is a plant science version of the PosMed system widely used by mammalian researchers, and provides both a powerful integrative search function and a rich integrative display of the integrated databases. PosMed-plus is the first cross-species integrated database that inferentially prioritizes candidate genes for forward genetics approaches in plant science, and will be expanded for wider use in plant upgrading in many species.

  7. QTL-seq for rapid identification of candidate genes for flowering time in broccoli × cabbage.

    PubMed

    Shu, Jinshuai; Liu, Yumei; Zhang, Lili; Li, Zhansheng; Fang, Zhiyuan; Yang, Limei; Zhuang, Mu; Zhang, Yangyong; Lv, Honghao

    2018-04-01

    A major QTL controlling early flowering in broccoli × cabbage was identified by marker analysis and next-generation sequencing, corresponding to GRF6 gene conditioning flowering time in Arabidopsis. Flowering is an important agronomic trait for hybrid production in broccoli and cabbage, but the genetic mechanism underlying this process is unknown. In this study, segregation analysis with BC 1 P1, BC 1 P2, F 2 , and F 2:3 populations derived from a cross between two inbred lines "195" (late-flowering) and "93219" (early flowering) suggested that flowering time is a quantitative trait. Next, employing a next-generation sequencing-based whole-genome QTL-seq strategy, we identified a major genomic region harboring a robust flowering time QTL using an F 2 mapping population, designated Ef2.1 on cabbage chromosome 2 for early flowering. Ef2.1 was further validated by indel (insertion or deletion) marker-based classical QTL mapping, explaining 51.5% (LOD = 37.67) and 54.0% (LOD = 40.5) of the phenotypic variation in F 2 and F 2:3 populations, respectively. Combined QTL-seq and classical QTL analysis narrowed down Ef1.1 to a 228-kb genomic region containing 29 genes. A cabbage gene, Bol024659, was identified in this region, which is a homolog of GRF6, a major gene regulating flowering in Arabidopsis, and was designated BolGRF6. qRT-PCR study of the expression level of BolGRF6 revealed significantly higher expression in the early flowering genotypes. Taken together, our results provide support for BolGRF6 as a possible candidate gene for early flowering in the broccoli line 93219. The identified candidate genomic regions and genes may be useful for molecular breeding to improve broccoli and cabbage flowering times.

  8. Connectivity Mapping for Candidate Therapeutics Identification Using Next Generation Sequencing RNA-Seq Data

    PubMed Central

    McArt, Darragh G.; Dunne, Philip D.; Blayney, Jaine K.; Salto-Tellez, Manuel; Van Schaeybroeck, Sandra; Hamilton, Peter W.; Zhang, Shu-Dong

    2013-01-01

    The advent of next generation sequencing technologies (NGS) has expanded the area of genomic research, offering high coverage and increased sensitivity over older microarray platforms. Although the current cost of next generation sequencing is still exceeding that of microarray approaches, the rapid advances in NGS will likely make it the platform of choice for future research in differential gene expression. Connectivity mapping is a procedure for examining the connections among diseases, genes and drugs by differential gene expression initially based on microarray technology, with which a large collection of compound-induced reference gene expression profiles have been accumulated. In this work, we aim to test the feasibility of incorporating NGS RNA-Seq data into the current connectivity mapping framework by utilizing the microarray based reference profiles and the construction of a differentially expressed gene signature from a NGS dataset. This would allow for the establishment of connections between the NGS gene signature and those microarray reference profiles, alleviating the associated incurring cost of re-creating drug profiles with NGS technology. We examined the connectivity mapping approach on a publicly available NGS dataset with androgen stimulation of LNCaP cells in order to extract candidate compounds that could inhibit the proliferative phenotype of LNCaP cells and to elucidate their potential in a laboratory setting. In addition, we also analyzed an independent microarray dataset of similar experimental settings. We found a high level of concordance between the top compounds identified using the gene signatures from the two datasets. The nicotine derivative cotinine was returned as the top candidate among the overlapping compounds with potential to suppress this proliferative phenotype. Subsequent lab experiments validated this connectivity mapping hit, showing that cotinine inhibits cell proliferation in an androgen dependent manner. Thus the results in this study suggest a promising prospect of integrating NGS data with connectivity mapping. PMID:23840550

  9. A genome-wide association study of corneal astigmatism: The CREAM Consortium

    PubMed Central

    Shah, Rupal L.; Li, Qing; Zhao, Wanting; Tedja, Milly S.; Tideman, J. Willem L.; Khawaja, Anthony P.; Fan, Qiao; Yazar, Seyhan; Williams, Katie M.; Verhoeven, Virginie J.M.; Xie, Jing; Wang, Ya Xing; Hess, Moritz; Nickels, Stefan; Lackner, Karl J.; Pärssinen, Olavi; Wedenoja, Juho; Biino, Ginevra; Concas, Maria Pina; Uitterlinden, André; Rivadeneira, Fernando; Jaddoe, Vincent W.V.; Hysi, Pirro G.; Sim, Xueling; Tan, Nicholas; Tham, Yih-Chung; Sensaki, Sonoko; Hofman, Albert; Vingerling, Johannes R.; Jonas, Jost B.; Mitchell, Paul; Hammond, Christopher J.; Höhn, René; Baird, Paul N.; Wong, Tien-Yin; Cheng, Chinfsg-Yu; Teo, Yik Ying; Mackey, David A.; Williams, Cathy; Saw, Seang-Mei; Klaver, Caroline C.W.; Bailey-Wilson, Joan E.

    2018-01-01

    Purpose To identify genes and genetic markers associated with corneal astigmatism. Methods A meta-analysis of genome-wide association studies (GWASs) of corneal astigmatism undertaken for 14 European ancestry (n=22,250) and 8 Asian ancestry (n=9,120) cohorts was performed by the Consortium for Refractive Error and Myopia. Cases were defined as having >0.75 diopters of corneal astigmatism. Subsequent gene-based and gene-set analyses of the meta-analyzed results of European ancestry cohorts were performed using VEGAS2 and MAGMA software. Additionally, estimates of single nucleotide polymorphism (SNP)-based heritability for corneal and refractive astigmatism and the spherical equivalent were calculated for Europeans using LD score regression. Results The meta-analysis of all cohorts identified a genome-wide significant locus near the platelet-derived growth factor receptor alpha (PDGFRA) gene: top SNP: rs7673984, odds ratio=1.12 (95% CI:1.08–1.16), p=5.55×10−9. No other genome-wide significant loci were identified in the combined analysis or European/Asian ancestry-specific analyses. Gene-based analysis identified three novel candidate genes for corneal astigmatism in Europeans—claudin-7 (CLDN7), acid phosphatase 2, lysosomal (ACP2), and TNF alpha-induced protein 8 like 3 (TNFAIP8L3). Conclusions In addition to replicating a previously identified genome-wide significant locus for corneal astigmatism near the PDGFRA gene, gene-based analysis identified three novel candidate genes, CLDN7, ACP2, and TNFAIP8L3, that warrant further investigation to understand their role in the pathogenesis of corneal astigmatism. The much lower number of genetic variants and genes demonstrating an association with corneal astigmatism compared to published spherical equivalent GWAS analyses suggest a greater influence of rare genetic variants, non-additive genetic effects, or environmental factors in the development of astigmatism. PMID:29422769

  10. A candidate gene study in low HDL-cholesterol families provides evidence for the involvement of the APOA2 gene and the APOA1C3A4 gene cluster.

    PubMed

    Lilja, Heidi E; Soro, Aino; Ylitalo, Kati; Nuotio, Ilpo; Viikari, Jorma S A; Salomaa, Veikko; Vartiainen, Erkki; Taskinen, Marja-Riitta; Peltonen, Leena; Pajukanta, Päivi

    2002-09-01

    In patients with premature coronary heart disease, the most common lipoprotein abnormality is high-density lipoprotein (HDL) deficiency. To assess the genetic background of the low HDL-cholesterol trait, we performed a candidate gene study in 25 families with low HDL, collected from the genetically isolated population of Finland. We studied 21 genes encoding essential proteins involved in the HDL metabolism by genotyping intragenic and flanking markers for these genes. We found suggestive evidence for linkage in two candidate regions: Marker D1S2844, in the apolipoprotein A-II (APOA2) region, yielded a LOD score of 2.14 and marker D11S939 flanking the apolipoprotein A-I/C-III/A-IV gene cluster (APOA1C3A4) produced a LOD score of 1.69. Interestingly, we identified potential shared haplotypes in these two regions in a subset of low HDL families. These families also contributed to the obtained positive LOD scores, whereas the rest of the families produced negative LOD scores. None of the remaining candidate regions provided any evidence for linkage. Since only a limited number of loci were tested in this candidate gene study, these LOD scores suggest significant involvement of the APOA2 gene and the APOA1C3A4 gene cluster, or loci in their immediate vicinity, in the pathogenesis of low HDL.

  11. Horizontal gene transfer in silkworm, Bombyx mori

    PubMed Central

    2011-01-01

    Background The domesticated silkworm, Bombyx mori, is the model insect for the order Lepidoptera, has economically important values, and has gained some representative behavioral characteristics compared to its wild ancestor. The genome of B. mori has been fully sequenced while function analysis of BmChi-h and BmSuc1 genes revealed that horizontal gene transfer (HGT) maybe bestow a clear selective advantage to B. mori. However, the role of HGT in the evolutionary history of B. mori is largely unexplored. In this study, we compare the whole genome of B. mori with those of 382 prokaryotic and eukaryotic species to investigate the potential HGTs. Results Ten candidate HGT events were defined in B. mori by comprehensive sequence analysis using Maximum Likelihood and Bayesian method combining with EST checking. Phylogenetic analysis of the candidate HGT genes suggested that one HGT was plant-to- B. mori transfer while nine were bacteria-to- B. mori transfer. Furthermore, functional analysis based on expression, coexpression and related literature searching revealed that several HGT candidate genes have added important characters, such as resistance to pathogen, to B. mori. Conclusions Results from this study clearly demonstrated that HGTs play an important role in the evolution of B. mori although the number of HGT events in B. mori is in general smaller than those of microbes and other insects. In particular, interdomain HGTs in B. mori may give rise to functional, persistent, and possibly evolutionarily significant new genes. PMID:21595916

  12. Selection of suitable reference genes from bone cells in large gradient high magnetic field based on GeNorm algorithm.

    PubMed

    Di, Shengmeng; Tian, Zongcheng; Qian, Airong; Gao, Xiang; Yu, Dan; Brandi, Maria Luisa; Shang, Peng

    2011-12-01

    Studies of animals and humans subjected to spaceflight demonstrate that weightlessness negatively affects the mass and mechanical properties of bone tissue. Bone cells could sense and respond to the gravity unloading, and genes sensitive to gravity change were considered to play a critical role in the mechanotransduction of bone cells. To evaluate the fold-change of gene expression, appropriate reference genes should be identified because there is no housekeeping gene having stable expression in all experimental conditions. Consequently, expression stability of ten candidate housekeeping genes were examined in osteoblast-like MC3T3-E1, osteocyte-like MLO-Y4, and preosteoclast-like FLG29.1 cells under different apparent gravities (μg, 1 g, and 2 g) in the high-intensity gradient magnetic field produced by a superconducting magnet. The results showed that the relative expression of these ten candidate housekeeping genes was different in different bone cells; Moreover, the most suitable reference genes of the same cells in altered gravity conditions were also different from that in strong magnetic field. It demonstrated the importance of selecting suitable reference genes in experimental set-ups. Furthermore, it provides an alternative choice to the traditionally accepted housekeeping genes used so far about studies of gravitational biology and magneto biology.

  13. Text mining-based in silico drug discovery in oral mucositis caused by high-dose cancer therapy.

    PubMed

    Kirk, Jon; Shah, Nirav; Noll, Braxton; Stevens, Craig B; Lawler, Marshall; Mougeot, Farah B; Mougeot, Jean-Luc C

    2018-08-01

    Oral mucositis (OM) is a major dose-limiting side effect of chemotherapy and radiation used in cancer treatment. Due to the complex nature of OM, currently available drug-based treatments are of limited efficacy. Our objectives were (i) to determine genes and molecular pathways associated with OM and wound healing using computational tools and publicly available data and (ii) to identify drugs formulated for topical use targeting the relevant OM molecular pathways. OM and wound healing-associated genes were determined by text mining, and the intersection of the two gene sets was selected for gene ontology analysis using the GeneCodis program. Protein interaction network analysis was performed using STRING-db. Enriched gene sets belonging to the identified pathways were queried against the Drug-Gene Interaction database to find drug candidates for topical use in OM. Our analysis identified 447 genes common to both the "OM" and "wound healing" text mining concepts. Gene enrichment analysis yielded 20 genes representing six pathways and targetable by a total of 32 drugs which could possibly be formulated for topical application. A manual search on ClinicalTrials.gov confirmed no relevant pathway/drug candidate had been overlooked. Twenty-five of the 32 drugs can directly affect the PTGS2 (COX-2) pathway, the pathway that has been targeted in previous clinical trials with limited success. Drug discovery using in silico text mining and pathway analysis tools can facilitate the identification of existing drugs that have the potential of topical administration to improve OM treatment.

  14. A possible genetic association with chronic fatigue in primary Sjögren's syndrome: a candidate gene study.

    PubMed

    Norheim, Katrine Brække; Le Hellard, Stephanie; Nordmark, Gunnel; Harboe, Erna; Gøransson, Lasse; Brun, Johan G; Wahren-Herlenius, Marie; Jonsson, Roland; Omdal, Roald

    2014-02-01

    Fatigue is prevalent and disabling in primary Sjögren's syndrome (pSS). Results from studies in chronic fatigue syndrome (CFS) indicate that genetic variation may influence fatigue. The aim of this study was to investigate single nucleotide polymorphism (SNP) variations in pSS patients with high and low fatigue. A panel of 85 SNPs in 12 genes was selected based on previous studies in CFS. A total of 207 pSS patients and 376 healthy controls were genotyped. One-hundred and ninety-three patients and 70 SNPs in 11 genes were available for analysis after quality control. Patients were dichotomized based on fatigue visual analogue scale (VAS) scores, with VAS <50 denominated "low fatigue" (n = 53) and VAS ≥50 denominated "high fatigue" (n = 140). We detected signals of association with pSS for one SNP in SLC25A40 (unadjusted p = 0.007) and two SNPs in PKN1 (both p = 0.03) in our pSS case versus control analysis. The association with SLC25A40 was stronger when only pSS high fatigue patients were analysed versus controls (p = 0.002). One SNP in PKN1 displayed an association in the case-only analysis of pSS high fatigue versus pSS low fatigue (p = 0.005). This candidate gene study in pSS did reveal a trend for associations between genetic variation in candidate genes and fatigue. The results will need to be replicated. More research on genetic associations with fatigue is warranted, and future trials should include larger cohorts and multicentre collaborations with sharing of genetic material to increase the statistical power.

  15. Mapping a candidate gene (MdMYB10) for red flesh and foliage colour in apple

    PubMed Central

    Chagné, David; Carlisle, Charmaine M; Blond, Céline; Volz, Richard K; Whitworth, Claire J; Oraguzie, Nnadozie C; Crowhurst, Ross N; Allan, Andrew C; Espley, Richard V; Hellens, Roger P; Gardiner, Susan E

    2007-01-01

    Background Integrating plant genomics and classical breeding is a challenge for both plant breeders and molecular biologists. Marker-assisted selection (MAS) is a tool that can be used to accelerate the development of novel apple varieties such as cultivars that have fruit with anthocyanin through to the core. In addition, determining the inheritance of novel alleles, such as the one responsible for red flesh, adds to our understanding of allelic variation. Our goal was to map candidate anthocyanin biosynthetic and regulatory genes in a population segregating for the red flesh phenotypes. Results We have identified the Rni locus, a major genetic determinant of the red foliage and red colour in the core of apple fruit. In a population segregating for the red flesh and foliage phenotype we have determined the inheritance of the Rni locus and DNA polymorphisms of candidate anthocyanin biosynthetic and regulatory genes. Simple Sequence Repeats (SSRs) and Single Nucleotide Polymorphisms (SNPs) in the candidate genes were also located on an apple genetic map. We have shown that the MdMYB10 gene co-segregates with the Rni locus and is on Linkage Group (LG) 09 of the apple genome. Conclusion We have performed candidate gene mapping in a fruit tree crop and have provided genetic evidence that red colouration in the fruit core as well as red foliage are both controlled by a single locus named Rni. We have shown that the transcription factor MdMYB10 may be the gene underlying Rni as there were no recombinants between the marker for this gene and the red phenotype in a population of 516 individuals. Associating markers derived from candidate genes with a desirable phenotypic trait has demonstrated the application of genomic tools in a breeding programme of a horticultural crop species. PMID:17608951

  16. Antennal transcriptome analysis of the piercing moth Oraesia emarginata (Lepidoptera: Noctuidae)

    PubMed Central

    Feng, Bo; Guo, Qianshuang; Zheng, Kaidi; Qin, Yuanxia; Du, Yongjun

    2017-01-01

    The piercing fruit moth Oraesia emarginata is an economically significant pest; however, our understanding of its olfactory mechanisms in infestation is limited. The present study conducted antennal transcriptome analysis of olfactory genes using real-time quantitative reverse transcription PCR analysis (RT-qPCR). We identified a total of 104 candidate chemosensory genes from several gene families, including 35 olfactory receptors (ORs), 41 odorant-binding proteins, 20 chemosensory proteins, 6 ionotropic receptors, and 2 sensory neuron membrane proteins. Seven candidate pheromone receptors (PRs) and 3 candidate pheromone-binding proteins (PBPs) for sex pheromone recognition were found. OemaOR29 and OemaPBP1 had the highest fragments per kb per million fragments (FPKM) values in all ORs and OBPs, respectively. Eighteen olfactory genes were upregulated in females, including 5 candidate PRs, and 20 olfactory genes were upregulated in males, including 2 candidate PRs (OemaOR29 and 4) and 2 PBPs (OemaPBP1 and 3). These genes may have roles in mediating sex-specific behaviors. Most candidate olfactory genes of sex pheromone recognition (except OemaOR29 and OemaPBP3) in O. emarginata were not clustered with those of studied noctuid species (type I pheromone). In addition, OemaOR29 was belonged to cluster PRIII, which comprise proteins that recognize type II pheromones instead of type I pheromones. The structure and function of olfactory genes that encode sex pheromones in O. emarginata might thus differ from those of other studied noctuids. The findings of the present study may help explain the molecular mechanism underlying olfaction and the evolution of olfactory genes encoding sex pheromones in O. emarginata. PMID:28614384

  17. Elevated transcription factor specificity protein 1 in autistic brains alters the expression of autism candidate genes.

    PubMed

    Thanseem, Ismail; Anitha, Ayyappan; Nakamura, Kazuhiko; Suda, Shiro; Iwata, Keiko; Matsuzaki, Hideo; Ohtsubo, Masafumi; Ueki, Takatoshi; Katayama, Taiichi; Iwata, Yasuhide; Suzuki, Katsuaki; Minoshima, Shinsei; Mori, Norio

    2012-03-01

    Profound changes in gene expression can result from abnormalities in the concentrations of sequence-specific transcription factors like specificity protein 1 (Sp1). Specificity protein 1 binding sites have been reported in the promoter regions of several genes implicated in autism. We hypothesize that dysfunction of Sp1 could affect the expression of multiple autism candidate genes, contributing to the heterogeneity of autism. We assessed any alterations in the expression of Sp1 and that of autism candidate genes in the postmortem brain (anterior cingulate gyrus [ACG], motor cortex, and thalamus) of autism patients (n = 8) compared with healthy control subjects (n = 13). Alterations in the expression of candidate genes upon Sp1/DNA binding inhibition with mithramycin and Sp1 silencing by RNAi were studied in SK-N-SH neuronal cells. We observed elevated expression of Sp1 in ACG of autism patients (p = .010). We also observed altered expression of several autism candidate genes. GABRB3, RELN, and HTR2A showed reduced expression, whereas CD38, ITGB3, MAOA, MECP2, OXTR, and PTEN showed elevated expression in autism. In SK-N-SH cells, OXTR, PTEN, and RELN showed reduced expression upon Sp1/DNA binding inhibition and Sp1 silencing. The RNA integrity number was not available for any of the samples. Transcription factor Sp1 is dysfunctional in the ACG of autistic brain. Consequently, the expression of potential autism candidate genes regulated by Sp1, especially OXTR and PTEN, could be affected. The diverse downstream pathways mediated by the Sp1-regulated genes, along with the environmental and intracellular signal-related regulation of Sp1, could explain the complex phenotypes associated with autism.

  18. Case-control approach application for finding a relationship between candidate genes and clinical mastitis in Holstein dairy cattle.

    PubMed

    Bagheri, Masoumeh; Moradi-Sharhrbabak, M; Miraie-Ashtiani, R; Safdari-Shahroudi, M; Abdollahi-Arpanahi, R

    2016-02-01

    Mastitis is a major source of economic loss in dairy herds. The objective of this research was to evaluate the association between genotypes within SLC11A1 and CXCR1 candidate genes and clinical mastitis in Holstein dairy cattle using the selective genotyping method. The data set contained clinical mastitis records of 3,823 Holstein cows from two Holstein dairy herds located in two different regions in Iran. Data included the number of cases of clinical mastitis per lactation. Selective genotyping was based on extreme values for clinical mastitis residuals (CMR) from mixed model analyses. Two extreme groups consisting of 135 cows were formed (as cases and controls), and genotyped for the two candidate genes, namely, SLC11A1 and CXCR1, using polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) and polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), respectively. Associations between single nucleotide polymorphism (SNP) genotypes with CMR and breeding values for milk and protein yield were carried out by applying logistic regression analyses, i.e. estimating the probability of the heterogeneous genotype in the dependency of values for CMR and breeding values (BVs). The sequencing results revealed a novel mutation in 1139 bp of exon 11 of the SLC11A1 gene and this SNP had a significant association with CMR (P < 0.05). PCR-RFLP analysis leads to three banding patterns for CXCR1c.735C>G and these genotypes had significant relationships with CMR. Overall, the results showed that SLC11A1 and CXCR1 are valuable candidate genes for the improvement of mastitis resistance as well as production traits in dairy cattle populations.

  19. Dissecting Vancomycin-Intermediate Resistance in Staphylococcus aureus Using Genome-Wide Association

    PubMed Central

    Alam, Md Tauqeer; Petit, Robert A.; Crispell, Emily K.; Thornton, Timothy A.; Conneely, Karen N.; Jiang, Yunxuan; Satola, Sarah W.; Read, Timothy D.

    2014-01-01

    Vancomycin-intermediate Staphylococcus aureus (VISA) is currently defined as having minimal inhibitory concentration (MIC) of 4–8 µg/ml. VISA evolves through changes in multiple genetic loci with at least 16 candidate genes identified in clinical and in vitro-selected VISA strains. We report a whole-genome comparative analysis of 49 vancomycin-sensitive S. aureus and 26 VISA strains. Resistance to vancomycin was determined by broth microdilution, Etest, and population analysis profile-area under the curve (PAP-AUC). Genome-wide association studies (GWAS) of 55,977 single-nucleotide polymorphisms identified in one or more strains found one highly significant association (P = 8.78E-08) between a nonsynonymous mutation at codon 481 (H481) of the rpoB gene and increased vancomycin MIC. Additionally, we used a database of public S. aureus genome sequences to identify rare mutations in candidate genes associated with VISA. On the basis of these data, we proposed a preliminary model called ECM+RMCG for the VISA phenotype as a benchmark for future efforts. The model predicted VISA based on the presence of a rare mutation in a set of candidate genes (walKR, vraSR, graSR, and agrA) and/or three previously experimentally verified mutations (including the rpoB H481 locus) with an accuracy of 81% and a sensitivity of 73%. Further, the level of resistance measured by both Etest and PAP-AUC regressed positively with the number of mutations present in a strain. This study demonstrated 1) the power of GWAS for identifying common genetic variants associated with antibiotic resistance in bacteria and 2) that rare mutations in candidate gene, identified using large genomic data sets, can also be associated with resistance phenotypes. PMID:24787619

  20. EBF factors drive expression of multiple classes of target genes governing neuronal development.

    PubMed

    Green, Yangsook S; Vetter, Monica L

    2011-04-30

    Early B cell factor (EBF) family members are transcription factors known to have important roles in several aspects of vertebrate neurogenesis, including commitment, migration and differentiation. Knowledge of how EBF family members contribute to neurogenesis is limited by a lack of detailed understanding of genes that are transcriptionally regulated by these factors. We performed a microarray screen in Xenopus animal caps to search for targets of EBF transcriptional activity, and identified candidate targets with multiple roles, including transcription factors of several classes. We determined that, among the most upregulated candidate genes with expected neuronal functions, most require EBF activity for some or all of their expression, and most have overlapping expression with ebf genes. We also found that the candidate target genes that had the most strongly overlapping expression patterns with ebf genes were predicted to be direct transcriptional targets of EBF transcriptional activity. The identification of candidate targets that are transcription factor genes, including nscl-1, emx1 and aml1, improves our understanding of how EBF proteins participate in the hierarchy of transcription control during neuronal development, and suggests novel mechanisms by which EBF activity promotes migration and differentiation. Other candidate targets, including pcdh8 and kcnk5, expand our knowledge of the types of terminal differentiated neuronal functions that EBF proteins regulate.

  1. Identification and Comparison of Candidate Olfactory Genes in the Olfactory and Non-Olfactory Organs of Elm Pest Ambrostoma quadriimpressum (Coleoptera: Chrysomelidae) Based on Transcriptome Analysis.

    PubMed

    Wang, Yinliang; Chen, Qi; Zhao, Hanbo; Ren, Bingzhong

    2016-01-01

    The leaf beetle Ambrostoma quadriimpressum (Coleoptera: Chrysomelidae) is a predominant forest pest that causes substantial damage to the lumber industry and city management. However, no effective and environmentally friendly chemical method has been discovered to control this pest. Until recently, the molecular basis of the olfactory system in A. quadriimpressum was completely unknown. In this study, antennae and leg transcriptomes were analyzed and compared using deep sequencing data to identify the olfactory genes in A. quadriimpressum. Moreover, the expression profiles of both male and female candidate olfactory genes were analyzed and validated by bioinformatics, motif analysis, homology analysis, semi-quantitative RT-PCR and RT-qPCR experiments in antennal and non-olfactory organs to explore the candidate olfactory genes that might play key roles in the life cycle of A. quadriimpressum. As a result, approximately 102.9 million and 97.3 million clean reads were obtained from the libraries created from the antennas and legs, respectively. Annotation led to 34344 Unigenes, which were matched to known proteins. Annotation data revealed that the number of genes in antenna with binding functions and receptor activity was greater than that of legs. Furthermore, many pathway genes were differentially expressed in the two organs. Sixteen candidate odorant binding proteins (OBPs), 10 chemosensory proteins (CSPs), 34 odorant receptors (ORs), 20 inotropic receptors [1] and 2 sensory neuron membrane proteins (SNMPs) and their isoforms were identified. Additionally, 15 OBPs, 9 CSPs, 18 ORs, 6 IRs and 2 SNMPs were predicted to be complete ORFs. Using RT-PCR, RT-qPCR and homology analysis, AquaOBP1/2/4/7/C1/C6, AquaCSP3/9, AquaOR8/9/10/14/15/18/20/26/29/33, AquaIR8a/13/25a showed olfactory-specific expression, indicating that these genes might play a key role in olfaction-related behaviors in A. quadriimpressum such as foraging and seeking. AquaOBP4/C5, AquaOBP4/C5, AquaCSP7/9/10, AquaOR17/24/32 and AquaIR4 were highly expressed in the antenna of males, suggesting that these genes were related to sex-specific behaviors, and expression trends that were male specific were observed for most candidate olfactory genes, which supported the existence of a female-produced sex pheromone in A. quadriimpressum. All of these results could provide valuable information and guidance for future functional studies on these genes and provide better molecular knowledge regarding the olfactory system in A. quadriimpressum.

  2. Pharmacogenetics: Implications of Race and Ethnicity on Defining Genetic Profiles for Personalized Medicine

    PubMed Central

    Ortega, Victor E.; Meyers, Deborah A.

    2014-01-01

    Pharmacogenetics is being used to develop personalized therapies specific to individuals from different ethnic or racial groups. Pharmacogenetic studies to date have been primarily performed in trial cohorts consisting of non-Hispanic whites of European descent. A “bottleneck” or collapse of genetic diversity associated with the first human colonization of Europe during the Upper Paleolithic period, followed by the recent mixing of African, European, and Native American ancestries has resulted in different ethnic groups with varying degrees of genetic diversity. Differences in genetic ancestry may introduce genetic variation which has the potential to alter the therapeutic efficacy of commonly used asthma therapies, for example β2-adrenergic receptor agonists (beta agonists). Pharmacogenetic studies of admixed ethnic groups have been limited to small candidate gene association studies of which the best example is the gene coding for the receptor target of beta agonist therapy, ADRB2. Large consortium-based sequencing studies are using next-generation whole-genome sequencing to provide a diverse genome map of different admixed populations which can be used for future pharmacogenetic studies. These studies will include candidate gene studies, genome-wide association studies, and whole-genome admixture-based approaches which account for ancestral genetic structure, complex haplotypes, gene-gene interactions, and rare variants to detect and replicate novel pharmacogenetic loci. PMID:24369795

  3. Gene expression factor analysis to differentiate pathways linked to fibromyalgia, chronic fatigue syndrome, and depression in a diverse patient sample

    PubMed Central

    Iacob, Eli; Light, Alan R.; Donaldson, Gary W.; Okifuji, Akiko; Hughen, Ronald W.; White, Andrea T.; Light, Kathleen C.

    2015-01-01

    Objective To determine if independent candidate genes can be grouped into meaningful biological factors and if these factors are associated with the diagnosis of chronic fatigue syndrome (CFS) and fibromyalgia (FMS) while controlling for co-morbid depression, sex, and age. Methods We included leukocyte mRNA gene expression from a total of 261 individuals including healthy controls (n=61), patients with FMS only (n=15), CFS only (n=33), co-morbid CFS and FMS (n=79), and medication-resistant (n=42) or medication-responsive (n=31) depression. We used Exploratory Factor Analysis (EFA) on 34 candidate genes to determine factor scores and regression analysis to examine if these factors were associated with specific diagnoses. Results EFA resulted in four independent factors with minimal overlap of genes between factors explaining 51% of the variance. We labeled these factors by function as: 1) Purinergic and cellular modulators; 2) Neuronal growth and immune function; 3) Nociception and stress mediators; 4) Energy and mitochondrial function. Regression analysis predicting these biological factors using FMS, CFS, depression severity, age, and sex revealed that greater expression in Factors 1 and 3 was positively associated with CFS and negatively associated with depression severity (QIDS score), but not associated with FMS. Conclusion Expression of candidate genes can be grouped into meaningful clusters, and CFS and depression are associated with the same 2 clusters but in opposite directions when controlling for co-morbid FMS. Given high co-morbid disease and interrelationships between biomarkers, EFA may help determine patient subgroups in this population based on gene expression. PMID:26097208

  4. Behavioral genomics of honeybee foraging and nest defense

    NASA Astrophysics Data System (ADS)

    Hunt, Greg J.; Amdam, Gro V.; Schlipalius, David; Emore, Christine; Sardesai, Nagesh; Williams, Christie E.; Rueppell, Olav; Guzmán-Novoa, Ernesto; Arechavaleta-Velasco, Miguel; Chandra, Sathees; Fondrk, M. Kim; Beye, Martin; Page, Robert E.

    2007-04-01

    The honeybee has been the most important insect species for study of social behavior. The recently released draft genomic sequence for the bee will accelerate honeybee behavioral genetics. Although we lack sufficient tools to manipulate this genome easily, quantitative trait loci (QTLs) that influence natural variation in behavior have been identified and tested for their effects on correlated behavioral traits. We review what is known about the genetics and physiology of two behavioral traits in honeybees, foraging specialization (pollen versus nectar), and defensive behavior, and present evidence that map-based cloning of genes is more feasible in the bee than in other metazoans. We also present bioinformatic analyses of candidate genes within QTL confidence intervals (CIs). The high recombination rate of the bee made it possible to narrow the search to regions containing only 17-61 predicted peptides for each QTL, although CIs covered large genetic distances. Knowledge of correlated behavioral traits, comparative bioinformatics, and expression assays facilitated evaluation of candidate genes. An overrepresentation of genes involved in ovarian development and insulin-like signaling components within pollen foraging QTL regions suggests that an ancestral reproductive gene network was co-opted during the evolution of foraging specialization. The major QTL influencing defensive/aggressive behavior contains orthologs of genes involved in central nervous system activity and neurogenesis. Candidates at the other two defensive-behavior QTLs include modulators of sensory signaling ( Am5HT 7 serotonin receptor, AmArr4 arrestin, and GABA-B-R1 receptor). These studies are the first step in linking natural variation in honeybee social behavior to the identification of underlying genes.

  5. A gene-signature progression approach to identifying candidate small-molecule cancer therapeutics with connectivity mapping.

    PubMed

    Wen, Qing; Kim, Chang-Sik; Hamilton, Peter W; Zhang, Shu-Dong

    2016-05-11

    Gene expression connectivity mapping has gained much popularity recently with a number of successful applications in biomedical research testifying its utility and promise. Previously methodological research in connectivity mapping mainly focused on two of the key components in the framework, namely, the reference gene expression profiles and the connectivity mapping algorithms. The other key component in this framework, the query gene signature, has been left to users to construct without much consensus on how this should be done, albeit it has been an issue most relevant to end users. As a key input to the connectivity mapping process, gene signature is crucially important in returning biologically meaningful and relevant results. This paper intends to formulate a standardized procedure for constructing high quality gene signatures from a user's perspective. We describe a two-stage process for making quality gene signatures using gene expression data as initial inputs. First, a differential gene expression analysis comparing two distinct biological states; only the genes that have passed stringent statistical criteria are considered in the second stage of the process, which involves ranking genes based on statistical as well as biological significance. We introduce a "gene signature progression" method as a standard procedure in connectivity mapping. Starting from the highest ranked gene, we progressively determine the minimum length of the gene signature that allows connections to the reference profiles (drugs) being established with a preset target false discovery rate. We use a lung cancer dataset and a breast cancer dataset as two case studies to demonstrate how this standardized procedure works, and we show that highly relevant and interesting biological connections are returned. Of particular note is gefitinib, identified as among the candidate therapeutics in our lung cancer case study. Our gene signature was based on gene expression data from Taiwan female non-smoker lung cancer patients, while there is evidence from independent studies that gefitinib is highly effective in treating women, non-smoker or former light smoker, advanced non-small cell lung cancer patients of Asian origin. In summary, we introduced a gene signature progression method into connectivity mapping, which enables a standardized procedure for constructing high quality gene signatures. This progression method is particularly useful when the number of differentially expressed genes identified is large, and when there is a need to prioritize them to be included in the query signature. The results from two case studies demonstrate that the approach we have developed is capable of obtaining pertinent candidate drugs with high precision.

  6. In Vitro Evaluation of Glycoengineered RSV-F in the Human Artificial Lymph Node Reactor.

    PubMed

    Radke, Lars; Sandig, Grit; Lubitz, Annika; Schließer, Ulrike; von Horsten, Hans Henning; Blanchard, Veronique; Keil, Karolin; Sandig, Volker; Giese, Christoph; Hummel, Michael; Hinderlich, Stephan; Frohme, Marcus

    2017-08-15

    Subunit vaccines often require adjuvants to elicit sustained immune activity. Here, a method is described to evaluate the efficacy of single vaccine candidates in the preclinical stage based on cytokine and gene expression analysis. As a model, the recombinant human respiratory syncytial virus (RSV) fusion protein (RSV-F) was produced in CHO cells. For comparison, wild-type and glycoengineered, afucosylated RSV-F were established. Both glycoprotein vaccines were tested in a commercial Human Artificial Lymph Node in vitro model (HuALN ® ). The analysis of six key cytokines in cell culture supernatants showed well-balanced immune responses for the afucosylated RSV-F, while immune response of wild-type RSV-F was more Th1 accentuated. In particular, stronger and specific secretion of interleukin-4 after each round of re-stimulation underlined higher potency and efficacy of the afucosylated vaccine candidate. Comprehensive gene expression analysis by nCounter gene expression assay confirmed the stronger onset of the immunologic reaction in stimulation experiments with the afucosylated vaccine in comparison to wild-type RSV-F and particularly revealed prominent activation of Th17 related genes, innate immunity, and comprehensive activation of humoral immunity. We, therefore, show that our method is suited to distinguish the potency of two vaccine candidates with minor structural differences.

  7. Selection signatures in four lignin genes from switchgrass populations divergently selected for in vitro dry matter digestibility

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen, Shiyu; Kaeppler, Shawn M.; Vogel, Kenneth P.

    Switchgrass is undergoing development as a dedicated cellulosic bioenergy crop. Fermentation of lignocellulosic biomass to ethanol in a bioenergy system or to volatile fatty acids in a livestock production system is strongly and negatively influenced by lignification of cell walls. This study detects specific loci that exhibit selection signatures across switchgrass breeding populations that differ in in vitro dry matter digestibility (IVDMD), ethanol yield, and lignin concentration. Allele frequency changes in candidate genes were used to detect loci under selection. Out of the 183 polymorphisms identified in the four candidate genes, twenty-five loci in the intron regions and four locimore » in coding regions were found to display a selection signature. All loci in the coding regions are synonymous substitutions. Selection in both directions were observed on polymorphisms that appeared to be under selection. Genetic diversity and linkage disequilibrium within the candidate genes were low. The recurrent divergent selection caused excessive moderate allele frequencies in the cycle 3 reduced lignin population as compared to the base population. As a result, this study provides valuable insight on genetic changes occurring in short-term selection in the polyploid populations, and discovered potential markers for breeding switchgrass with improved biomass quality.« less

  8. Selection signatures in four lignin genes from switchgrass populations divergently selected for in vitro dry matter digestibility

    DOE PAGES

    Chen, Shiyu; Kaeppler, Shawn M.; Vogel, Kenneth P.; ...

    2016-11-28

    Switchgrass is undergoing development as a dedicated cellulosic bioenergy crop. Fermentation of lignocellulosic biomass to ethanol in a bioenergy system or to volatile fatty acids in a livestock production system is strongly and negatively influenced by lignification of cell walls. This study detects specific loci that exhibit selection signatures across switchgrass breeding populations that differ in in vitro dry matter digestibility (IVDMD), ethanol yield, and lignin concentration. Allele frequency changes in candidate genes were used to detect loci under selection. Out of the 183 polymorphisms identified in the four candidate genes, twenty-five loci in the intron regions and four locimore » in coding regions were found to display a selection signature. All loci in the coding regions are synonymous substitutions. Selection in both directions were observed on polymorphisms that appeared to be under selection. Genetic diversity and linkage disequilibrium within the candidate genes were low. The recurrent divergent selection caused excessive moderate allele frequencies in the cycle 3 reduced lignin population as compared to the base population. As a result, this study provides valuable insight on genetic changes occurring in short-term selection in the polyploid populations, and discovered potential markers for breeding switchgrass with improved biomass quality.« less

  9. Combined meta-genomics analyses unravel candidate genes for the grain dietary fiber content in bread wheat (Triticum aestivum L.).

    PubMed

    Quraishi, Umar Masood; Murat, Florent; Abrouk, Mickael; Pont, Caroline; Confolent, Carole; Oury, François Xavier; Ward, Jane; Boros, Danuta; Gebruers, Kurt; Delcour, Jan A; Courtin, Christophe M; Bedo, Zoltan; Saulnier, Luc; Guillon, Fabienne; Balzergue, Sandrine; Shewry, Peter R; Feuillet, Catherine; Charmet, Gilles; Salse, Jerome

    2011-03-01

    Grain dietary fiber content in wheat not only affects its end use and technological properties including milling, baking and animal feed but is also of great importance for health benefits. In this study, integration of association genetics (seven detected loci on chromosomes 1B, 3A, 3D, 5B, 6B, 7A, 7B) and meta-QTL (three consensus QTL on chromosomes 1B, 3D and 6B) analyses allowed the identification of seven chromosomal regions underlying grain dietary fiber content in bread wheat. Based either on a diversity panel or on bi-parental populations, we clearly demonstrate that this trait is mainly driven by a major locus located on chromosome 1B associated with a log of p value >13 and a LOD score >8, respectively. In parallel, we identified 73 genes differentially expressed during the grain development and between genotypes with contrasting grain fiber contents. Integration of quantitative genetics and transcriptomic data allowed us to propose a short list of candidate genes that are conserved in the rice, sorghum and Brachypodium chromosome regions orthologous to the seven wheat grain fiber content QTL and that can be considered as major candidate genes for future improvement of the grain dietary fiber content in bread wheat breeding programs.

  10. Identification of candidate transmission-blocking antigen genes in Theileria annulata and related vector-borne apicomplexan parasites.

    PubMed

    Lempereur, Laetitia; Larcombe, Stephen D; Durrani, Zeeshan; Karagenc, Tulin; Bilgic, Huseyin Bilgin; Bakirci, Serkan; Hacilarlioglu, Selin; Kinnaird, Jane; Thompson, Joanne; Weir, William; Shiels, Brian

    2017-06-05

    Vector-borne apicomplexan parasites are a major cause of mortality and morbidity to humans and livestock globally. The most important disease syndromes caused by these parasites are malaria, babesiosis and theileriosis. Strategies for control often target parasite stages in the mammalian host that cause disease, but this can result in reservoir infections that promote pathogen transmission and generate economic loss. Optimal control strategies should protect against clinical disease, block transmission and be applicable across related genera of parasites. We have used bioinformatics and transcriptomics to screen for transmission-blocking candidate antigens in the tick-borne apicomplexan parasite, Theileria annulata. A number of candidate antigen genes were identified which encoded amino acid domains that are conserved across vector-borne Apicomplexa (Babesia, Plasmodium and Theileria), including the Pfs48/45 6-cys domain and a novel cysteine-rich domain. Expression profiling confirmed that selected candidate genes are expressed by life cycle stages within infected ticks. Additionally, putative B cell epitopes were identified in the T. annulata gene sequences encoding the 6-cys and cysteine rich domains, in a gene encoding a putative papain-family cysteine peptidase, with similarity to the Plasmodium SERA family, and the gene encoding the T. annulata major merozoite/piroplasm surface antigen, Tams1. Candidate genes were identified that encode proteins with similarity to known transmission blocking candidates in related parasites, while one is a novel candidate conserved across vector-borne apicomplexans and has a potential role in the sexual phase of the life cycle. The results indicate that a 'One Health' approach could be utilised to develop a transmission-blocking strategy effective against vector-borne apicomplexan parasites of animals and humans.

  11. Identification of Linkages between EDCs in Personal Care Products and Breast Cancer through Data Integration Combined with Gene Network Analysis

    PubMed Central

    Kim, Jongwoon

    2017-01-01

    Approximately 1000 chemicals have been reported to possibly have endocrine disrupting effects, some of which are used in consumer products, such as personal care products (PCPs) and cosmetics. We conducted data integration combined with gene network analysis to: (i) identify causal molecular mechanisms between endocrine disrupting chemicals (EDCs) used in PCPs and breast cancer; and (ii) screen candidate EDCs associated with breast cancer. Among EDCs used in PCPs, four EDCs having correlation with breast cancer were selected, and we curated 27 common interacting genes between those EDCs and breast cancer to perform the gene network analysis. Based on the gene network analysis, ESR1, TP53, NCOA1, AKT1, and BCL6 were found to be key genes to demonstrate the molecular mechanisms of EDCs in the development of breast cancer. Using GeneMANIA, we additionally predicted 20 genes which could interact with the 27 common genes. In total, 47 genes combining the common and predicted genes were functionally grouped with the gene ontology and KEGG pathway terms. With those genes, we finally screened candidate EDCs for their potential to increase breast cancer risk. This study highlights that our approach can provide insights to understand mechanisms of breast cancer and identify potential EDCs which are in association with breast cancer. PMID:28973975

  12. Sleeping Beauty transposon mutagenesis identifies genes that cooperate with mutant Smad4 in gastric cancer development

    PubMed Central

    Takeda, Haruna; Rust, Alistair G.; Ward, Jerrold M.; Yew, Christopher Chin Kuan; Jenkins, Nancy A.; Copeland, Neal G.

    2016-01-01

    Mutations in SMAD4 predispose to the development of gastrointestinal cancer, which is the third leading cause of cancer-related deaths. To identify genes driving gastric cancer (GC) development, we performed a Sleeping Beauty (SB) transposon mutagenesis screen in the stomach of Smad4+/− mutant mice. This screen identified 59 candidate GC trunk drivers and a much larger number of candidate GC progression genes. Strikingly, 22 SB-identified trunk drivers are known or candidate cancer genes, whereas four SB-identified trunk drivers, including PTEN, SMAD4, RNF43, and NF1, are known human GC trunk drivers. Similar to human GC, pathway analyses identified WNT, TGF-β, and PI3K-PTEN signaling, ubiquitin-mediated proteolysis, adherens junctions, and RNA degradation in addition to genes involved in chromatin modification and organization as highly deregulated pathways in GC. Comparative oncogenomic filtering of the complete list of SB-identified genes showed that they are highly enriched for genes mutated in human GC and identified many candidate human GC genes. Finally, by comparing our complete list of SB-identified genes against the list of mutated genes identified in five large-scale human GC sequencing studies, we identified LDL receptor-related protein 1B (LRP1B) as a previously unidentified human candidate GC tumor suppressor gene. In LRP1B, 129 mutations were found in 462 human GC samples sequenced, and LRP1B is one of the top 10 most deleted genes identified in a panel of 3,312 human cancers. SB mutagenesis has, thus, helped to catalog the cooperative molecular mechanisms driving SMAD4-induced GC growth and discover genes with potential clinical importance in human GC. PMID:27006499

  13. Sleeping Beauty transposon mutagenesis identifies genes that cooperate with mutant Smad4 in gastric cancer development.

    PubMed

    Takeda, Haruna; Rust, Alistair G; Ward, Jerrold M; Yew, Christopher Chin Kuan; Jenkins, Nancy A; Copeland, Neal G

    2016-04-05

    Mutations in SMAD4 predispose to the development of gastrointestinal cancer, which is the third leading cause of cancer-related deaths. To identify genes driving gastric cancer (GC) development, we performed a Sleeping Beauty (SB) transposon mutagenesis screen in the stomach of Smad4(+/-) mutant mice. This screen identified 59 candidate GC trunk drivers and a much larger number of candidate GC progression genes. Strikingly, 22 SB-identified trunk drivers are known or candidate cancer genes, whereas four SB-identified trunk drivers, including PTEN, SMAD4, RNF43, and NF1, are known human GC trunk drivers. Similar to human GC, pathway analyses identified WNT, TGF-β, and PI3K-PTEN signaling, ubiquitin-mediated proteolysis, adherens junctions, and RNA degradation in addition to genes involved in chromatin modification and organization as highly deregulated pathways in GC. Comparative oncogenomic filtering of the complete list of SB-identified genes showed that they are highly enriched for genes mutated in human GC and identified many candidate human GC genes. Finally, by comparing our complete list of SB-identified genes against the list of mutated genes identified in five large-scale human GC sequencing studies, we identified LDL receptor-related protein 1B (LRP1B) as a previously unidentified human candidate GC tumor suppressor gene. In LRP1B, 129 mutations were found in 462 human GC samples sequenced, and LRP1B is one of the top 10 most deleted genes identified in a panel of 3,312 human cancers. SB mutagenesis has, thus, helped to catalog the cooperative molecular mechanisms driving SMAD4-induced GC growth and discover genes with potential clinical importance in human GC.

  14. Identification of Cellular Proteins Required for Replication of Human Immunodeficiency Virus Type 1

    PubMed Central

    Dziuba, Natallia; Ferguson, Monique R.; O'Brien, William A.; Sanchez, Anthony; Prussia, Andrew J.; McDonald, Natalie J.; Friedrich, Brian M.; Li, Guangyu; Shaw, Michael W.; Sheng, Jinsong; Hodge, Thomas W.; Rubin, Donald H.

    2012-01-01

    Abstract Cellular proteins are essential for human immunodeficiency virus type 1 (HIV-1) replication and may serve as viable new targets for treating infection. Using gene trap insertional mutagenesis, a high-throughput approach based on random inactivation of cellular genes, candidate genes were found that limit virus replication when mutated. Disrupted genes (N=87) conferring resistance to lytic infection with several viruses were queried for an affect on HIV-1 replication by utilizing small interfering RNA (siRNA) screens in TZM-bl cells. Several genes regulating diverse pathways were found to be required for HIV-1 replication, including DHX8, DNAJA1, GTF2E1, GTF2E2, HAP1, KALRN, UBA3, UBE2E3, and VMP1. Candidate genes were independently tested in primary human macrophages, toxicity assays, and/or Tat-dependent β-galactosidase reporter assays. Bioinformatics analyses indicated that several host factors present in this study participate in canonical pathways and functional processes implicated in prior genome-wide studies. However, the genes presented in this study did not share identity with those found previously. Novel antiviral targets identified in this study should open new avenues for mechanistic investigation. PMID:22404213

  15. Identification of cellular proteins required for replication of human immunodeficiency virus type 1.

    PubMed

    Dziuba, Natallia; Ferguson, Monique R; O'Brien, William A; Sanchez, Anthony; Prussia, Andrew J; McDonald, Natalie J; Friedrich, Brian M; Li, Guangyu; Shaw, Michael W; Sheng, Jinsong; Hodge, Thomas W; Rubin, Donald H; Murray, James L

    2012-10-01

    Cellular proteins are essential for human immunodeficiency virus type 1 (HIV-1) replication and may serve as viable new targets for treating infection. Using gene trap insertional mutagenesis, a high-throughput approach based on random inactivation of cellular genes, candidate genes were found that limit virus replication when mutated. Disrupted genes (N=87) conferring resistance to lytic infection with several viruses were queried for an affect on HIV-1 replication by utilizing small interfering RNA (siRNA) screens in TZM-bl cells. Several genes regulating diverse pathways were found to be required for HIV-1 replication, including DHX8, DNAJA1, GTF2E1, GTF2E2, HAP1, KALRN, UBA3, UBE2E3, and VMP1. Candidate genes were independently tested in primary human macrophages, toxicity assays, and/or Tat-dependent β-galactosidase reporter assays. Bioinformatics analyses indicated that several host factors present in this study participate in canonical pathways and functional processes implicated in prior genome-wide studies. However, the genes presented in this study did not share identity with those found previously. Novel antiviral targets identified in this study should open new avenues for mechanistic investigation.

  16. Identification and Evolutionary Analysis of Potential Candidate Genes in a Human Eating Disorder.

    PubMed

    Sabbagh, Ubadah; Mullegama, Saman; Wyckoff, Gerald J

    2016-01-01

    The purpose of this study was to find genes linked with eating disorders and associated with both metabolic and neural systems. Our operating hypothesis was that there are genetic factors underlying some eating disorders resting in both those pathways. Specifically, we are interested in disorders that may rest in both sleep and metabolic function, generally called Night Eating Syndrome (NES). A meta-analysis of the Gene Expression Omnibus targeting the mammalian nervous system, sleep, and obesity studies was performed, yielding numerous genes of interest. Through a text-based analysis of the results, a number of potential candidate genes were identified. VGF, in particular, appeared to be relevant both to obesity and, broadly, to brain or neural development. VGF is a highly connected protein that interacts with numerous targets via proteolytically digested peptides. We examined VGF from an evolutionary perspective to determine whether other available evidence supported a role for the gene in human disease. We conclude that some of the already identified variants in VGF from human polymorphism studies may contribute to eating disorders and obesity. Our data suggest that there is enough evidence to warrant eGWAS and GWAS analysis of these genes in NES patients in a case-control study.

  17. Survey of candidate genes for maize resistance to infection by Aspergillus flavus and/or aflatoxin contamination

    Treesearch

    Leigh Hawkins; Marilyn Warburton; Juliet Tang; John Tomashek; Dafne Alves Oliveira; Oluwaseun Ogunola; J. Smith; W. Williams

    2018-01-01

    Many projects have identified candidate genes for resistance to aflatoxin accumulation or Aspergillus flavus infection and growth in maize using genetic mapping, genomics, transcriptomics and/or proteomics studies. However, only a small percentage of these candidates have been validated in field conditions, and their relative contribution to...

  18. Phytoplasma phylogenetics based on analysis of secA and 23S rRNA gene sequences for improved resolution of candidate species of 'Candidatus Phytoplasma'.

    PubMed

    Hodgetts, Jennifer; Boonham, Neil; Mumford, Rick; Harrison, Nigel; Dickinson, Matthew

    2008-08-01

    Phytoplasma phylogenetics has focused primarily on sequences of the non-coding 16S rRNA gene and the 16S-23S rRNA intergenic spacer region (16-23S ISR), and primers that enable amplification of these regions from all phytoplasmas by PCR are well established. In this study, primers based on the secA gene have been developed into a semi-nested PCR assay that results in a sequence of the expected size (about 480 bp) from all 34 phytoplasmas examined, including strains representative of 12 16Sr groups. Phylogenetic analysis of secA gene sequences showed similar clustering of phytoplasmas when compared with clusters resolved by similar sequence analyses of a 16-23S ISR-23S rRNA gene contig or of the 16S rRNA gene alone. The main differences between trees were in the branch lengths, which were elongated in the 16-23S ISR-23S rRNA gene tree when compared with the 16S rRNA gene tree and elongated still further in the secA gene tree, despite this being a shorter sequence. The improved resolution in the secA gene-derived phylogenetic tree resulted in the 16SrII group splitting into two distinct clusters, while phytoplasmas associated with coconut lethal yellowing-type diseases split into three distinct groups, thereby supporting past proposals that they represent different candidate species within 'Candidatus Phytoplasma'. The ability to differentiate 16Sr groups and subgroups by virtual RFLP analysis of secA gene sequences suggests that this gene may provide an informative alternative molecular marker for pathogen identification and diagnosis of phytoplasma diseases.

  19. Genetics and fine mapping of a purple leaf gene, BoPr, in ornamental kale (Brassica oleracea L. var. acephala).

    PubMed

    Liu, Xiao-Ping; Gao, Bao-Zhen; Han, Feng-Qing; Fang, Zhi-Yuan; Yang, Li-Mei; Zhuang, Mu; Lv, Hong-Hao; Liu, Yu-Mei; Li, Zhan-Sheng; Cai, Cheng-Cheng; Yu, Hai-Long; Li, Zhi-Yuan; Zhang, Yang-Yong

    2017-03-14

    Due to its variegated and colorful leaves, ornamental kale (Brassica oleracea L. var. acephala) has become a popular ornamental plant. In this study, we report the fine mapping and analysis of a candidate purple leaf gene using a backcross population and an F 2 population derived from two parental lines: W1827 (with white leaves) and P1835 (with purple leaves). Genetic analysis indicated that the purple leaf trait is controlled by a single dominant gene, which we named BoPr. Using markers developed based on the reference genome '02-12', the BoPr gene was preliminarily mapped to a 280-kb interval of chromosome C09, with flanking markers M17 and BoID4714 at genetic distances of 4.3 cM and 1.5 cM, respectively. The recombination rate within this interval is almost 12 times higher than the usual level, which could be caused by assembly error for reference genome '02-12' at this interval. Primers were designed based on 'TO1000', another B. oleracea reference genome. Among the newly designed InDel markers, BRID485 and BRID490 were found to be the closest to BoPr, flanking the gene at genetic distances of 0.1 cM and 0.2 cM, respectively; the interval between the two markers is 44.8 kb (reference genome 'TO1000'). Seven annotated genes are located within the 44.8 kb genomic region, of which only Bo9g058630 shows high homology to AT5G42800 (dihydroflavonol reductase), which was identified as a candidate gene for BoPr. Blast analysis revealed that this 44.8 kb interval is located on an unanchored scaffold (Scaffold000035_P2) of '02-12', confirming the existence of assembly error at the interval between M17 and BoID4714 for reference genome '02-12'. This study identified a candidate gene for BoPr and lays a foundation for the cloning and functional analysis of this gene.

  20. Deploying QTL-seq for rapid delineation of a potential candidate gene underlying major trait-associated QTL in chickpea

    PubMed Central

    Das, Shouvik; Upadhyaya, Hari D.; Bajaj, Deepak; Kujur, Alice; Badoni, Saurabh; Laxmi; Kumar, Vinod; Tripathi, Shailesh; Gowda, C. L. Laxmipathi; Sharma, Shivali; Singh, Sube; Tyagi, Akhilesh K.; Parida, Swarup K.

    2015-01-01

    A rapid high-resolution genome-wide strategy for molecular mapping of major QTL(s)/gene(s) regulating important agronomic traits is vital for in-depth dissection of complex quantitative traits and genetic enhancement in chickpea. The present study for the first time employed a NGS-based whole-genome QTL-seq strategy to identify one major genomic region harbouring a robust 100-seed weight QTL using an intra-specific 221 chickpea mapping population (desi cv. ICC 7184 × desi cv. ICC 15061). The QTL-seq-derived major SW QTL (CaqSW1.1) was further validated by single-nucleotide polymorphism (SNP) and simple sequence repeat (SSR) marker-based traditional QTL mapping (47.6% R2 at higher LOD >19). This reflects the reliability and efficacy of QTL-seq as a strategy for rapid genome-wide scanning and fine mapping of major trait regulatory QTLs in chickpea. The use of QTL-seq and classical QTL mapping in combination narrowed down the 1.37 Mb (comprising 177 genes) major SW QTL (CaqSW1.1) region into a 35 kb genomic interval on desi chickpea chromosome 1 containing six genes. One coding SNP (G/A)-carrying constitutive photomorphogenic9 (COP9) signalosome complex subunit 8 (CSN8) gene of these exhibited seed-specific expression, including pronounced differential up-/down-regulation in low and high seed weight mapping parents and homozygous individuals during seed development. The coding SNP mined in this potential seed weight-governing candidate CSN8 gene was found to be present exclusively in all cultivated species/genotypes, but not in any wild species/genotypes of primary, secondary and tertiary gene pools. This indicates the effect of strong artificial and/or natural selection pressure on target SW locus during chickpea domestication. The proposed QTL-seq-driven integrated genome-wide strategy has potential to delineate major candidate gene(s) harbouring a robust trait regulatory QTL rapidly with optimal use of resources. This will further assist us to extrapolate the molecular mechanism underlying complex quantitative traits at a genome-wide scale leading to fast-paced marker-assisted genetic improvement in diverse crop plants, including chickpea. PMID:25922536

  1. A comparative analysis of genetic diversity of candidate genes associated with type 2 diabetes in worldwide populations.

    PubMed

    Gong, Xian; Zhang, Chao; Yiliyasi·Aisa, Yiliyasi·Aisa; Shi, Ying; Yang, Xue-wei; NuersimanguliAosiman, NuersimanguliAosiman; Guan, Ya-qun; Xu, Shu-hua

    2016-06-20

    Over the last decade, a larger number of type 2 diabetes mellitus (T2DM) susceptible candidate genes have been reported by numerous genome-wide association studies (GWAS). Understanding the genetic diversity of these candidate genes among worldwide populations not only facilitates to elucidating the genetic mechanism of T2DM, but also provides guidance to further studies of pathogenesis of T2DM in any certain population. In this study, we identified 170 genes or genomic regions associated with T2DM by searching the GWAS databases and related literatures. We next analyzed the genetic diversity of these genes (or genomic regions) among present-day human populations by curetting the 1000 Genomes Projects phase1 dataset covering 14 worldwide populations. We further compared the characteristics of T2DM genes in different populations. No significant differences of genetic diversity were observed among the 14 worldwide populations between the T2DM candidate genes and the non-T2DM genes in terms of overall pattern. However, we observed some genes, such as IL20RA, RNMTL1-NXN, NOTCH2, ADRA2A-BTBD7P2, TBC1D4, RBM38-HMGB1P1, UBE2E2, and PPARD, show considerable differentiation between populations. In particular, IL20RA (FST=0.1521) displays the greatest population difference which is mainly contributed by that between Africans and non-Africans. Moreover, we revealed genetic differences between East Asians and Europeans on some candidate genes such as DGKB-AGMO (FST=0.173) and JAZF1 (FST=0.182). Our results indicate that some T2DM susceptible candidate genes harbor highly-differentiated variants between populations. These analyses, despite preliminary, should advance our understanding of the population difference of susceptibility to T2DM and provide insightful reference that future studies can relay on.

  2. Selection and Validation of Appropriate Reference Genes for qRT-PCR Analysis in Isatis indigotica Fort.

    PubMed Central

    Li, Tao; Wang, Jing; Lu, Miao; Zhang, Tianyi; Qu, Xinyun; Wang, Zhezhi

    2017-01-01

    Due to its sensitivity and specificity, real-time quantitative PCR (qRT-PCR) is a popular technique for investigating gene expression levels in plants. Based on the Minimum Information for Publication of Real-Time Quantitative PCR Experiments (MIQE) guidelines, it is necessary to select and validate putative appropriate reference genes for qRT-PCR normalization. In the current study, three algorithms, geNorm, NormFinder, and BestKeeper, were applied to assess the expression stability of 10 candidate reference genes across five different tissues and three different abiotic stresses in Isatis indigotica Fort. Additionally, the IiYUC6 gene associated with IAA biosynthesis was applied to validate the candidate reference genes. The analysis results of the geNorm, NormFinder, and BestKeeper algorithms indicated certain differences for the different sample sets and different experiment conditions. Considering all of the algorithms, PP2A-4 and TUB4 were recommended as the most stable reference genes for total and different tissue samples, respectively. Moreover, RPL15 and PP2A-4 were considered to be the most suitable reference genes for abiotic stress treatments. The obtained experimental results might contribute to improved accuracy and credibility for the expression levels of target genes by qRT-PCR normalization in I. indigotica. PMID:28702046

  3. Genome-Wide Identification and Expression Analyses of Aquaporin Gene Family during Development and Abiotic Stress in Banana

    PubMed Central

    Hu, Wei; Hou, Xiaowan; Huang, Chao; Yan, Yan; Tie, Weiwei; Ding, Zehong; Wei, Yunxie; Liu, Juhua; Miao, Hongxia; Lu, Zhiwei; Li, Meiying; Xu, Biyu; Jin, Zhiqiang

    2015-01-01

    Aquaporins (AQPs) function to selectively control the flow of water and other small molecules through biological membranes, playing crucial roles in various biological processes. However, little information is available on the AQP gene family in bananas. In this study, we identified 47 banana AQP genes based on the banana genome sequence. Evolutionary analysis of AQPs from banana, Arabidopsis, poplar, and rice indicated that banana AQPs (MaAQPs) were clustered into four subfamilies. Conserved motif analysis showed that all banana AQPs contained the typical AQP-like or major intrinsic protein (MIP) domain. Gene structure analysis suggested the majority of MaAQPs had two to four introns with a highly specific number and length for each subfamily. Expression analysis of MaAQP genes during fruit development and postharvest ripening showed that some MaAQP genes exhibited high expression levels during these stages, indicating the involvement of MaAQP genes in banana fruit development and ripening. Additionally, some MaAQP genes showed strong induction after stress treatment and therefore, may represent potential candidates for improving banana resistance to abiotic stress. Taken together, this study identified some excellent tissue-specific, fruit development- and ripening-dependent, and abiotic stress-responsive candidate MaAQP genes, which could lay a solid foundation for genetic improvement of banana cultivars. PMID:26307965

  4. Identification of Immunity Related Genes to Study the Physalis peruviana – Fusarium oxysporum Pathosystem

    PubMed Central

    Enciso-Rodríguez, Felix E.; González, Carolina; Rodríguez, Edwin A.; López, Camilo E.; Landsman, David; Barrero, Luz Stella; Mariño-Ramírez, Leonardo

    2013-01-01

    The Cape gooseberry ( Physalis peruviana L) is an Andean exotic fruit with high nutritional value and appealing medicinal properties. However, its cultivation faces important phytosanitary problems mainly due to pathogens like Fusarium oxysporum, Cercosporaphysalidis and Alternaria spp. Here we used the Cape gooseberry foliar transcriptome to search for proteins that encode conserved domains related to plant immunity including: NBS (Nucleotide Binding Site), CC (Coiled-Coil), TIR (Toll/Interleukin-1 Receptor). We identified 74 immunity related gene candidates in P . peruviana which have the typical resistance gene (R-gene) architecture, 17 Receptor like kinase (RLKs) candidates related to PAMP-Triggered Immunity (PTI), eight (TIR-NBS-LRR, or TNL) and nine (CC–NBS-LRR, or CNL) candidates related to Effector-Triggered Immunity (ETI) genes among others. These candidate genes were categorized by molecular function (98%), biological process (85%) and cellular component (79%) using gene ontology. Some of the most interesting predicted roles were those associated with binding and transferase activity. We designed 94 primers pairs from the 74 immunity-related genes (IRGs) to amplify the corresponding genomic regions on six genotypes that included resistant and susceptible materials. From these, we selected 17 single band amplicons and sequenced them in 14 F. oxysporum resistant and susceptible genotypes. Sequence polymorphisms were analyzed through preliminary candidate gene association, which allowed the detection of one SNP at the PpIRG-63 marker revealing a nonsynonymous mutation in the predicted LRR domain suggesting functional roles for resistance. PMID:23844210

  5. Identification of immunity related genes to study the Physalis peruviana--Fusarium oxysporum pathosystem.

    PubMed

    Enciso-Rodríguez, Felix E; González, Carolina; Rodríguez, Edwin A; López, Camilo E; Landsman, David; Barrero, Luz Stella; Mariño-Ramírez, Leonardo

    2013-01-01

    The Cape gooseberry (Physalisperuviana L) is an Andean exotic fruit with high nutritional value and appealing medicinal properties. However, its cultivation faces important phytosanitary problems mainly due to pathogens like Fusarium oxysporum, Cercosporaphysalidis and Alternaria spp. Here we used the Cape gooseberry foliar transcriptome to search for proteins that encode conserved domains related to plant immunity including: NBS (Nucleotide Binding Site), CC (Coiled-Coil), TIR (Toll/Interleukin-1 Receptor). We identified 74 immunity related gene candidates in P. peruviana which have the typical resistance gene (R-gene) architecture, 17 Receptor like kinase (RLKs) candidates related to PAMP-Triggered Immunity (PTI), eight (TIR-NBS-LRR, or TNL) and nine (CC-NBS-LRR, or CNL) candidates related to Effector-Triggered Immunity (ETI) genes among others. These candidate genes were categorized by molecular function (98%), biological process (85%) and cellular component (79%) using gene ontology. Some of the most interesting predicted roles were those associated with binding and transferase activity. We designed 94 primers pairs from the 74 immunity-related genes (IRGs) to amplify the corresponding genomic regions on six genotypes that included resistant and susceptible materials. From these, we selected 17 single band amplicons and sequenced them in 14 F. oxysporum resistant and susceptible genotypes. Sequence polymorphisms were analyzed through preliminary candidate gene association, which allowed the detection of one SNP at the PpIRG-63 marker revealing a nonsynonymous mutation in the predicted LRR domain suggesting functional roles for resistance.

  6. A Novel Strategy for Selection and Validation of Reference Genes in Dynamic Multidimensional Experimental Design in Yeast

    PubMed Central

    Cankorur-Cetinkaya, Ayca; Dereli, Elif; Eraslan, Serpil; Karabekmez, Erkan; Dikicioglu, Duygu; Kirdar, Betul

    2012-01-01

    Background Understanding the dynamic mechanism behind the transcriptional organization of genes in response to varying environmental conditions requires time-dependent data. The dynamic transcriptional response obtained by real-time RT-qPCR experiments could only be correctly interpreted if suitable reference genes are used in the analysis. The lack of available studies on the identification of candidate reference genes in dynamic gene expression studies necessitates the identification and the verification of a suitable gene set for the analysis of transient gene expression response. Principal Findings In this study, a candidate reference gene set for RT-qPCR analysis of dynamic transcriptional changes in Saccharomyces cerevisiae was determined using 31 different publicly available time series transcriptome datasets. Ten of the twelve candidates (TPI1, FBA1, CCW12, CDC19, ADH1, PGK1, GCN4, PDC1, RPS26A and ARF1) we identified were not previously reported as potential reference genes. Our method also identified the commonly used reference genes ACT1 and TDH3. The most stable reference genes from this pool were determined as TPI1, FBA1, CDC19 and ACT1 in response to a perturbation in the amount of available glucose and as FBA1, TDH3, CCW12 and ACT1 in response to a perturbation in the amount of available ammonium. The use of these newly proposed gene sets outperformed the use of common reference genes in the determination of dynamic transcriptional response of the target genes, HAP4 and MEP2, in response to relaxation from glucose and ammonium limitations, respectively. Conclusions A candidate reference gene set to be used in dynamic real-time RT-qPCR expression profiling in yeast was proposed for the first time in the present study. Suitable pools of stable reference genes to be used under different experimental conditions could be selected from this candidate set in order to successfully determine the expression profiles for the genes of interest. PMID:22675547

  7. Evolutionary transgenomics: prospects and challenges.

    PubMed

    Correa, Raul; Baum, David A

    2015-01-01

    Many advances in our understanding of the genetic basis of species differences have arisen from transformation experiments, which allow us to study the effect of genes from one species (the donor) when placed in the genetic background of another species (the recipient). Such interspecies transformation experiments are usually focused on candidate genes - genes that, based on work in model systems, are suspected to be responsible for certain phenotypic differences between the donor and recipient species. We suggest that the high efficiency of transformation in a few plant species, most notably Arabidopsis thaliana, combined with the small size of typical plant genes and their cis-regulatory regions allow implementation of a screening strategy that does not depend upon a priori candidate gene identification. This approach, transgenomics, entails moving many large genomic inserts of a donor species into the wild type background of a recipient species and then screening for dominant phenotypic effects. As a proof of concept, we recently conducted a transgenomic screen that analyzed more than 1100 random, large genomic inserts of the Alabama gladecress Leavenworthia alabamica for dominant phenotypic effects in the A. thaliana background. This screen identified one insert that shortens fruit and decreases A. thaliana fertility. In this paper we discuss the principles of transgenomic screens and suggest methods to help minimize the frequencies of false positive and false negative results. We argue that, because transgenomics avoids committing in advance to candidate genes it has the potential to help us identify truly novel genes or cryptic functions of known genes. Given the valuable knowledge that is likely to be gained, we believe the time is ripe for the plant evolutionary community to invest in transgenomic screens, at least in the mustard family Brassicaceae where many species are amenable to efficient transformation.

  8. Porcine transcriptome analysis based on 97 non-normalized cDNA libraries and assembly of 1,021,891 expressed sequence tags

    PubMed Central

    Gorodkin, Jan; Cirera, Susanna; Hedegaard, Jakob; Gilchrist, Michael J; Panitz, Frank; Jørgensen, Claus; Scheibye-Knudsen, Karsten; Arvin, Troels; Lumholdt, Steen; Sawera, Milena; Green, Trine; Nielsen, Bente J; Havgaard, Jakob H; Rosenkilde, Carina; Wang, Jun; Li, Heng; Li, Ruiqiang; Liu, Bin; Hu, Songnian; Dong, Wei; Li, Wei; Yu, Jun; Wang, Jian; Stærfeldt, Hans-Henrik; Wernersson, Rasmus; Madsen, Lone B; Thomsen, Bo; Hornshøj, Henrik; Bujie, Zhan; Wang, Xuegang; Wang, Xuefei; Bolund, Lars; Brunak, Søren; Yang, Huanming; Bendixen, Christian; Fredholm, Merete

    2007-01-01

    Background Knowledge of the structure of gene expression is essential for mammalian transcriptomics research. We analyzed a collection of more than one million porcine expressed sequence tags (ESTs), of which two-thirds were generated in the Sino-Danish Pig Genome Project and one-third are from public databases. The Sino-Danish ESTs were generated from one normalized and 97 non-normalized cDNA libraries representing 35 different tissues and three developmental stages. Results Using the Distiller package, the ESTs were assembled to roughly 48,000 contigs and 73,000 singletons, of which approximately 25% have a high confidence match to UniProt. Approximately 6,000 new porcine gene clusters were identified. Expression analysis based on the non-normalized libraries resulted in the following findings. The distribution of cluster sizes is scaling invariant. Brain and testes are among the tissues with the greatest number of different expressed genes, whereas tissues with more specialized function, such as developing liver, have fewer expressed genes. There are at least 65 high confidence housekeeping gene candidates and 876 cDNA library-specific gene candidates. We identified differential expression of genes between different tissues, in particular brain/spinal cord, and found patterns of correlation between genes that share expression in pairs of libraries. Finally, there was remarkable agreement in expression between specialized tissues according to Gene Ontology categories. Conclusion This EST collection, the largest to date in pig, represents an essential resource for annotation, comparative genomics, assembly of the pig genome sequence, and further porcine transcription studies. PMID:17407547

  9. Proteomic analysis of isolated chlamydomonas centrioles reveals orthologs of ciliary-disease genes.

    PubMed

    Keller, Lani C; Romijn, Edwin P; Zamora, Ivan; Yates, John R; Marshall, Wallace F

    2005-06-21

    The centriole is one of the most enigmatic organelles in the cell. Centrioles are cylindrical, microtubule-based barrels found in the core of the centrosome. Centrioles also act as basal bodies during interphase to nucleate the assembly of cilia and flagella. There are currently only a handful of known centriole proteins. We used mass-spectrometry-based MudPIT (multidimensional protein identification technology) to identify the protein composition of basal bodies (centrioles) isolated from the green alga Chlamydomonas reinhardtii. This analysis detected the majority of known centriole proteins, including centrin, epsilon tubulin, and the cartwheel protein BLD10p. By combining proteomic data with information about gene expression and comparative genomics, we identified 45 cross-validated centriole candidate proteins in two classes. Members of the first class of proteins (BUG1-BUG27) are encoded by genes whose expression correlates with flagellar assembly and which therefore may play a role in ciliogenesis-related functions of basal bodies. Members of the second class (POC1-POC18) are implicated by comparative-genomics and -proteomics studies to be conserved components of the centriole. We confirmed centriolar localization for the human homologs of four candidate proteins. Three of the cross-validated centriole candidate proteins are encoded by orthologs of genes (OFD1, NPHP-4, and PACRG) implicated in mammalian ciliary function and disease, suggesting that oral-facial-digital syndrome and nephronophthisis may involve a dysfunction of centrioles and/or basal bodies. By analyzing isolated Chlamydomonas basal bodies, we have been able to obtain the first reported proteomic analysis of the centriole.

  10. Transcriptome Profiling of Khat (Catha edulis) and Ephedra sinica Reveals Gene Candidates Potentially Involved in Amphetamine-Type Alkaloid Biosynthesis

    PubMed Central

    Groves, Ryan A.; Hagel, Jillian M.; Zhang, Ye; Kilpatrick, Korey; Levy, Asaf; Marsolais, Frédéric; Lewinsohn, Efraim; Sensen, Christoph W.; Facchini, Peter J.

    2015-01-01

    Amphetamine analogues are produced by plants in the genus Ephedra and by khat (Catha edulis), and include the widely used decongestants and appetite suppressants (1S,2S)-pseudoephedrine and (1R,2S)-ephedrine. The production of these metabolites, which derive from L-phenylalanine, involves a multi-step pathway partially mapped out at the biochemical level using knowledge of benzoic acid metabolism established in other plants, and direct evidence using khat and Ephedra species as model systems. Despite the commercial importance of amphetamine-type alkaloids, only a single step in their biosynthesis has been elucidated at the molecular level. We have employed Illumina next-generation sequencing technology, paired with Trinity and Velvet-Oases assembly platforms, to establish data-mining frameworks for Ephedra sinica and khat plants. Sequence libraries representing a combined 200,000 unigenes were subjected to an annotation pipeline involving direct searches against public databases. Annotations included the assignment of Gene Ontology (GO) terms used to allocate unigenes to functional categories. As part of our functional genomics program aimed at novel gene discovery, the databases were mined for enzyme candidates putatively involved in alkaloid biosynthesis. Queries used for mining included enzymes with established roles in benzoic acid metabolism, as well as enzymes catalyzing reactions similar to those predicted for amphetamine alkaloid metabolism. Gene candidates were evaluated based on phylogenetic relationships, FPKM-based expression data, and mechanistic considerations. Establishment of expansive sequence resources is a critical step toward pathway characterization, a goal with both academic and industrial implications. PMID:25806807

  11. Schizophrenia, vitamin D, and brain development.

    PubMed

    Mackay-Sim, Alan; Féron, François; Eyles, Darryl; Burne, Thomas; McGrath, John

    2004-01-01

    Schizophrenia research is invigorated at present by the recent discovery of several plausible candidate susceptibility genes identified from genetic linkage and gene expression studies of brains from persons with schizophrenia. It is a current challenge to reconcile this gathering evidence for specific candidate susceptibility genes with the "neurodevelopmental hypothesis," which posits that schizophrenia arises from gene-environment interactions that disrupt brain development. We make the case here that schizophrenia may result not from numerous genes of small effect, but a few genes of transcriptional regulation acting during brain development. In particular we propose that low vitamin D during brain development interacts with susceptibility genes to alter the trajectory of brain development, probably by epigenetic regulation that alters gene expression throughout adult life. Vitamin D is an attractive "environmental" candidate because it appears to explain several key epidemiological features of schizophrenia. Vitamin D is an attractive "genetic" candidate because its nuclear hormone receptor regulates gene expression and nervous system development. The polygenic quality of schizophrenia, with linkage to many genes of small effect, maybe brought together via this "vitamin D hypothesis." We also discuss the possibility of a broader set of environmental and genetic factors interacting via the nuclear hormone receptors to affect the development of the brain leading to schizophrenia.

  12. Multi-Dimensional Prioritization of Dental Caries Candidate Genes and Its Enriched Dense Network Modules

    PubMed Central

    Wang, Quan; Jia, Peilin; Cuenco, Karen T.; Feingold, Eleanor; Marazita, Mary L.; Wang, Lily; Zhao, Zhongming

    2013-01-01

    A number of genetic studies have suggested numerous susceptibility genes for dental caries over the past decade with few definite conclusions. The rapid accumulation of relevant information, along with the complex architecture of the disease, provides a challenging but also unique opportunity to review and integrate the heterogeneous data for follow-up validation and exploration. In this study, we collected and curated candidate genes from four major categories: association studies, linkage scans, gene expression analyses, and literature mining. Candidate genes were prioritized according to the magnitude of evidence related to dental caries. We then searched for dense modules enriched with the prioritized candidate genes through their protein-protein interactions (PPIs). We identified 23 modules comprising of 53 genes. Functional analyses of these 53 genes revealed three major clusters: cytokine network relevant genes, matrix metalloproteinases (MMPs) family, and transforming growth factor-beta (TGF-β) family, all of which have been previously implicated to play important roles in tooth development and carious lesions. Through our extensive data collection and an integrative application of gene prioritization and PPI network analyses, we built a dental caries-specific sub-network for the first time. Our study provided insights into the molecular mechanisms underlying dental caries. The framework we proposed in this work can be applied to other complex diseases. PMID:24146904

  13. Cancer in silico drug discovery: a systems biology tool for identifying candidate drugs to target specific molecular tumor subtypes.

    PubMed

    San Lucas, F Anthony; Fowler, Jerry; Chang, Kyle; Kopetz, Scott; Vilar, Eduardo; Scheet, Paul

    2014-12-01

    Large-scale cancer datasets such as The Cancer Genome Atlas (TCGA) allow researchers to profile tumors based on a wide range of clinical and molecular characteristics. Subsequently, TCGA-derived gene expression profiles can be analyzed with the Connectivity Map (CMap) to find candidate drugs to target tumors with specific clinical phenotypes or molecular characteristics. This represents a powerful computational approach for candidate drug identification, but due to the complexity of TCGA and technology differences between CMap and TCGA experiments, such analyses are challenging to conduct and reproduce. We present Cancer in silico Drug Discovery (CiDD; scheet.org/software), a computational drug discovery platform that addresses these challenges. CiDD integrates data from TCGA, CMap, and Cancer Cell Line Encyclopedia (CCLE) to perform computational drug discovery experiments, generating hypotheses for the following three general problems: (i) determining whether specific clinical phenotypes or molecular characteristics are associated with unique gene expression signatures; (ii) finding candidate drugs to repress these expression signatures; and (iii) identifying cell lines that resemble the tumors being studied for subsequent in vitro experiments. The primary input to CiDD is a clinical or molecular characteristic. The output is a biologically annotated list of candidate drugs and a list of cell lines for in vitro experimentation. We applied CiDD to identify candidate drugs to treat colorectal cancers harboring mutations in BRAF. CiDD identified EGFR and proteasome inhibitors, while proposing five cell lines for in vitro testing. CiDD facilitates phenotype-driven, systematic drug discovery based on clinical and molecular data from TCGA. ©2014 American Association for Cancer Research.

  14. Integrative Approach to Pain Genetics Identifies Pain Sensitivity Loci across Diseases

    PubMed Central

    Ruau, David; Dudley, Joel T.; Chen, Rong; Phillips, Nicholas G.; Swan, Gary E.; Lazzeroni, Laura C.; Clark, J. David

    2012-01-01

    Identifying human genes relevant for the processing of pain requires difficult-to-conduct and expensive large-scale clinical trials. Here, we examine a novel integrative paradigm for data-driven discovery of pain gene candidates, taking advantage of the vast amount of existing disease-related clinical literature and gene expression microarray data stored in large international repositories. First, thousands of diseases were ranked according to a disease-specific pain index (DSPI), derived from Medical Subject Heading (MESH) annotations in MEDLINE. Second, gene expression profiles of 121 of these human diseases were obtained from public sources. Third, genes with expression variation significantly correlated with DSPI across diseases were selected as candidate pain genes. Finally, selected candidate pain genes were genotyped in an independent human cohort and prospectively evaluated for significant association between variants and measures of pain sensitivity. The strongest signal was with rs4512126 (5q32, ABLIM3, P = 1.3×10−10) for the sensitivity to cold pressor pain in males, but not in females. Significant associations were also observed with rs12548828, rs7826700 and rs1075791 on 8q22.2 within NCALD (P = 1.7×10−4, 1.8×10−4, and 2.2×10−4 respectively). Our results demonstrate the utility of a novel paradigm that integrates publicly available disease-specific gene expression data with clinical data curated from MEDLINE to facilitate the discovery of pain-relevant genes. This data-derived list of pain gene candidates enables additional focused and efficient biological studies validating additional candidates. PMID:22685391

  15. Genome-wide association studies and epistasis analyses of candidate genes related to age at menarche and age at natural menopause in a Korean population.

    PubMed

    Pyun, Jung-A; Kim, Sunshin; Cho, Nam H; Koh, InSong; Lee, Jong-Young; Shin, Chol; Kwack, KyuBum

    2014-05-01

    The aim of this study was to identify polymorphisms and gene-gene interactions that are significantly associated with age at menarche and age at menopause in a Korean population. A total of 3,452 and 1,827 women participated in studies of age at menarche and age at natural menopause, respectively. Linear regression analyses adjusted for residence area were used to perform genome-wide association studies (GWAS), candidate gene association studies, and interactions between the candidate genes for age at menarche and age at natural menopause. In GWAS, four single nucleotide polymorphisms (SNPs; rs7528241, rs1324329, rs11597068, and rs6495785) were strongly associated with age at natural menopause (lowest P = 9.66 × 10). However, GWAS of age at menarche did not reveal any strong associations. In candidate gene association studies, SNPs with P < 0.01 were selected to test their synergistic interactions. For age at natural menopause, there was a significant interaction between intronic SNPs on ADAM metallopeptidase with thrombospondin type I motif 9 (ADAMTS9) and SMAD family member 3 (SMAD3) genes (P = 9.52 × 10). For age at menarche, there were three significant interactions between three intronic SNPs on follicle-stimulating hormone receptor (FSHR) gene and one SNP located at the 3' flanking region of insulin-like growth factor 2 receptor (IGF2R) gene (lowest P = 1.95 × 10). Novel SNPs and synergistic interactions between candidate genes are significantly associated with age at menarche and age at natural menopause in a Korean population.

  16. The Effects of Selenium Supplementation on Gene Expression Related to Insulin and Lipid in Infertile Polycystic Ovary Syndrome Women Candidate for In Vitro Fertilization: a Randomized, Double-Blind, Placebo-Controlled Trial.

    PubMed

    Zadeh Modarres, Shahrzad; Heidar, Zahra; Foroozanfard, Fatemeh; Rahmati, Zahra; Aghadavod, Esmat; Asemi, Zatollah

    2018-06-01

    This study was conducted to evaluate the effects of selenium supplementation on gene expression related to insulin and lipid in infertile women with polycystic ovary syndrome (PCOS) candidate for in vitro fertilization (IVF). This randomized double-blind, placebo-controlled trial was conducted among 40 infertile women with PCOS candidate for IVF. Subjects were randomly allocated into two groups to intake either 200-μg selenium (n = 20) or placebo (n = 20) per day for 8 weeks. Gene expression levels related to insulin and lipid were quantified in lymphocytes of women with PCOS candidate for IVF with RT-PCR method. Results of RT-PCR demonstrated that after the 8-week intervention, compared with the placebo, selenium supplementation upregulated gene expression of peroxisome proliferator-activated receptor gamma (PPAR-γ) (1.06 ± 0.15-fold increase vs. 0.94 ± 0.18-fold reduction, P = 0.02) and glucose transporter 1 (GLUT-1) (1.07 ± 0.20-fold increase vs. 0.87 ± 0.18-fold reduction, P = 0.003) in lymphocytes of women with PCOS candidate for IVF. In addition, compared with the placebo, selenium supplementation downregulated gene expression of low-density lipoprotein receptor (LDLR) (0.88 ± 0.17-fold reduction vs. 1.05 ± 0.22-fold increase, P = 0.01) in lymphocytes of women with PCOS candidate for IVF. We did not observe any significant effect of selenium supplementation on gene expression levels of lipoprotein(a) [LP(a)] in lymphocytes of women with PCOS candidate for IVF. Overall, selenium supplementation for 8 weeks in lymphocytes of women with infertile PCOS candidate for IVF significantly increased gene expression levels of PPAR-γ and GLUT-1 and significantly decreased gene expression levels of LDLR, but did not affect LP(a). http://www.irct.ir : IRCT201704245623N113.

  17. Quantitative Trait Loci for BMD in an SM/J by NZB/BlNJ Intercross Population and Identification of Trps1 as a Probable Candidate Gene

    PubMed Central

    Ishimori, Naoki; Stylianou, Ioannis M; Korstanje, Ron; Marion, Michael A; Li, Renhua; Donahue, Leah Rae; Rosen, Clifford J; Beamer, Wesley G; Paigen, Beverly; Churchill, Gary A

    2008-01-01

    Identification of genes that regulate BMD will enhance our understanding of osteoporosis and could provide novel molecular targets for treatment or prevention. We generated a mouse intercross population and carried out a quantitative trait locus (QTL) analysis of 143 female and 124 male F2 progeny from progenitor strains SM/J and NZB/BlNJ using whole body and vertebral areal BMD (aBMD) as measured by DXA. We found that both whole body and vertebral aBMD was affected by two loci on chromosome 9: one with a significant epistatic interaction on distal chromosome 8 and the other with a sex-specific effect. Two additional significant QTLs were identified on chromosome 12, and several suggestive ones were identified on chromosomes 5, 8, 15, and 19. The chromosome 9, 12, and 15 loci have been previously identified in other crosses. SNP-based haplotype analysis of the progenitor strains identified blocks within the QTL region that distinguish the low allele strains from the high allele strains, significantly narrowing the QTL region and reducing the possible candidate genes to 98 for chromosome 9, 31 for chromosome 12, and only 2 for chromosome 15. Trps1 is the most probable candidate gene for the chromosome 15 QTL. The sex-specific effects may help to elucidate the BMD differences between males and females. This study shows the power of statistical modeling to resolve linked QTLs and the use of haplotype analysis in narrowing the list of candidates. PMID:18442308

  18. PRKCA: A Positional Candidate Gene for Body Mass Index and Asthma

    PubMed Central

    Murphy, Amy; Tantisira, Kelan G.; Soto-Quirós, Manuel E.; Avila, Lydiana; Klanderman, Barbara J.; Lake, Stephen; Weiss, Scott T.; Celedón, Juan C.

    2009-01-01

    Asthma incidence and prevalence are higher in obese individuals. A potential mechanistic basis for this relationship is pleiotropy. We hypothesized that significant linkage and candidate-gene association would be found for body mass index (BMI) in a population ascertained on asthma affection status. Linkage analysis for BMI was performed on 657 subjects in eight Costa Rican families enrolled in a study of asthma. Family-based association studies were conducted for BMI with SNPs within a positional candidate gene, PRKCA. SNPs within PRKCA were also tested for association with asthma. Association studies were conducted in 415 Costa Rican parent-child trios and 493 trios participating in the Childhood Asthma Management Program (CAMP). Although only modest evidence of linkage for BMI was obtained for the whole cohort, significant linkage was noted for BMI in females on chromosome 17q (peak LOD = 3.39). Four SNPs in a candidate gene in this region (PRKCA) had unadjusted association p values < 0.05 for BMI in both cohorts, with the joint p value for two SNPs remaining significant after adjustment for multiple comparisons (rs228883 and rs1005651, joint p values = 9.5 × 10−5 and 5.6 × 10−5). Similarly, eight SNPs had unadjusted association p values < 0.05 for asthma in both populations, with one SNP remaining significant after adjustment for multiple comparisons (rs11079657, joint p value = 2.6 × 10−5). PRKCA is a pleiotropic locus that is associated with both BMI and asthma and that has been identified via linkage analysis of BMI in a population ascertained on asthma. PMID:19576566

  19. The effects of polymorphisms in IL-2, IFN-γ, TGF-β2, IgL, TLR-4, MD-2, and iNOS genes on resistance to Salmonella enteritidis in indigenous chickens.

    PubMed

    Tohidi, Reza; Idris, Ismail Bin; Panandam, Jothi Malar; Bejo, Mohd Hair

    2012-12-01

    Salmonella Enteritidis is a major cause of food poisoning worldwide, and poultry products are the main source of S. Enteritidis contamination for humans. Among the numerous strategies for disease control, improving genetic resistance to S. Enteritidis has been the most effective approach. We investigated the association between S. Enteritidis burden in the caecum, spleen, and liver of young indigenous chickens and seven candidate genes, selected on the basis of their critical roles in immunological functions. The genes included those encoding interleukin 2 (IL-2), interferon-γ (IFN-γ), transforming growth factor β2 (TGF-β2), immunoglobulin light chain (IgL), toll-like receptor 4 (TLR-4), myeloid differentiation protein 2 (MD-2), and inducible nitric oxide synthase (iNOS). Two Malaysian indigenous chicken breeds were used as sustainable genetic sources of alleles that are resistant to salmonellosis. The polymerase chain reaction restriction fragment-length polymorphism technique was used to genotype the candidate genes. Three different genotypes were observed in all of the candidate genes, except for MD-2. All of the candidate genes showed the Hardy-Weinberg equilibrium for the two populations. The IL-2-MnlI polymorphism was associated with S. Enteritidis burden in the caecum and spleen. The TGF-β2-RsaI, TLR-4-Sau 96I, and iNOS-AluI polymorphisms were associated with the caecum S. Enteritidis load. The other candidate genes were not associated with S. Enteritidis load in any organ. The results indicate that the IL-2, TGF-β2, TLR-4, and iNOS genes are potential candidates for use in selection programmes for increasing genetic resistance against S. Enteritidis in Malaysian indigenous chickens.

  20. EDdb: a web resource for eating disorder and its application to identify an extended adipocytokine signaling pathway related to eating disorder.

    PubMed

    Zhao, Min; Li, XiaoMo; Qu, Hong

    2013-12-01

    Eating disorder is a group of physiological and psychological disorders affecting approximately 1% of the female population worldwide. Although the genetic epidemiology of eating disorder is becoming increasingly clear with accumulated studies, the underlying molecular mechanisms are still unclear. Recently, integration of various high-throughput data expanded the range of candidate genes and started to generate hypotheses for understanding potential pathogenesis in complex diseases. This article presents EDdb (Eating Disorder database), the first evidence-based gene resource for eating disorder. Fifty-nine experimentally validated genes from the literature in relation to eating disorder were collected as the core dataset. Another four datasets with 2824 candidate genes across 601 genome regions were expanded based on the core dataset using different criteria (e.g., protein-protein interactions, shared cytobands, and related complex diseases). Based on human protein-protein interaction data, we reconstructed a potential molecular sub-network related to eating disorder. Furthermore, with an integrative pathway enrichment analysis of genes in EDdb, we identified an extended adipocytokine signaling pathway in eating disorder. Three genes in EDdb (ADIPO (adiponectin), TNF (tumor necrosis factor) and NR3C1 (nuclear receptor subfamily 3, group C, member 1)) link the KEGG (Kyoto Encyclopedia of Genes and Genomes) "adipocytokine signaling pathway" with the BioCarta "visceral fat deposits and the metabolic syndrome" pathway to form a joint pathway. In total, the joint pathway contains 43 genes, among which 39 genes are related to eating disorder. As the first comprehensive gene resource for eating disorder, EDdb ( http://eddb.cbi.pku.edu.cn ) enables the exploration of gene-disease relationships and cross-talk mechanisms between related disorders. Through pathway statistical studies, we revealed that abnormal body weight caused by eating disorder and obesity may both be related to dysregulation of the novel joint pathway of adipocytokine signaling. In addition, this joint pathway may be the common pathway for body weight regulation in complex human diseases related to unhealthy lifestyle.

  1. Changing the Game: Using Integrative Genomics to Probe Virulence Mechanisms of the Stem Rust Pathogen Puccinia graminis f. sp. tritici.

    PubMed

    Figueroa, Melania; Upadhyaya, Narayana M; Sperschneider, Jana; Park, Robert F; Szabo, Les J; Steffenson, Brian; Ellis, Jeff G; Dodds, Peter N

    2016-01-01

    The recent resurgence of wheat stem rust caused by new virulent races of Puccinia graminis f. sp. tritici (Pgt) poses a threat to food security. These concerns have catalyzed an extensive global effort toward controlling this disease. Substantial research and breeding programs target the identification and introduction of new stem rust resistance (Sr) genes in cultivars for genetic protection against the disease. Such resistance genes typically encode immune receptor proteins that recognize specific components of the pathogen, known as avirulence (Avr) proteins. A significant drawback to deploying cultivars with single Sr genes is that they are often overcome by evolution of the pathogen to escape recognition through alterations in Avr genes. Thus, a key element in achieving durable rust control is the deployment of multiple effective Sr genes in combination, either through conventional breeding or transgenic approaches, to minimize the risk of resistance breakdown. In this situation, evolution of pathogen virulence would require changes in multiple Avr genes in order to bypass recognition. However, choosing the optimal Sr gene combinations to deploy is a challenge that requires detailed knowledge of the pathogen Avr genes with which they interact and the virulence phenotypes of Pgt existing in nature. Identifying specific Avr genes from Pgt will provide screening tools to enhance pathogen virulence monitoring, assess heterozygosity and propensity for mutation in pathogen populations, and confirm individual Sr gene functions in crop varieties carrying multiple effective resistance genes. Toward this goal, much progress has been made in assembling a high quality reference genome sequence for Pgt, as well as a Pan-genome encompassing variation between multiple field isolates with diverse virulence spectra. In turn this has allowed prediction of Pgt effector gene candidates based on known features of Avr genes in other plant pathogens, including the related flax rust fungus. Upregulation of gene expression in haustoria and evidence for diversifying selection are two useful parameters to identify candidate Avr genes. Recently, we have also applied machine learning approaches to agnostically predict candidate effectors. Here, we review progress in stem rust pathogenomics and approaches currently underway to identify Avr genes recognized by wheat Sr genes.

  2. Function-driven discovery of disease genes in zebrafish using an integrated genomics big data resource.

    PubMed

    Shim, Hongseok; Kim, Ji Hyun; Kim, Chan Yeong; Hwang, Sohyun; Kim, Hyojin; Yang, Sunmo; Lee, Ji Eun; Lee, Insuk

    2016-11-16

    Whole exome sequencing (WES) accelerates disease gene discovery using rare genetic variants, but further statistical and functional evidence is required to avoid false-discovery. To complement variant-driven disease gene discovery, here we present function-driven disease gene discovery in zebrafish (Danio rerio), a promising human disease model owing to its high anatomical and genomic similarity to humans. To facilitate zebrafish-based function-driven disease gene discovery, we developed a genome-scale co-functional network of zebrafish genes, DanioNet (www.inetbio.org/danionet), which was constructed by Bayesian integration of genomics big data. Rigorous statistical assessment confirmed the high prediction capacity of DanioNet for a wide variety of human diseases. To demonstrate the feasibility of the function-driven disease gene discovery using DanioNet, we predicted genes for ciliopathies and performed experimental validation for eight candidate genes. We also validated the existence of heterozygous rare variants in the candidate genes of individuals with ciliopathies yet not in controls derived from the UK10K consortium, suggesting that these variants are potentially involved in enhancing the risk of ciliopathies. These results showed that an integrated genomics big data for a model animal of diseases can expand our opportunity for harnessing WES data in disease gene discovery. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. DNA methylation profiles distinguish different subtypes of gastroenteropancreatic neuroendocrine tumors.

    PubMed

    How-Kit, Alexandre; Dejeux, Emelyne; Dousset, Bertrand; Renault, Victor; Baudry, Marion; Terris, Benoit; Tost, Jörg

    2015-01-01

    Most studies have considered gastroenteropancreatic neuroendocrine tumors (GEP-NETs) as a homogenous group of samples or distinguish only gastrointestinal from pancreatic endocrine tumors. This article investigates if DNA methylation patterns could distinguish subtypes of GEP-NETs. The DNA methylation level of 807 cancer-related genes was investigated in insulinomas, gastrinomas, non-functioning pancreatic endocrine tumors and small intestine endocrine tumors. DNA methylation patterns were found to be tumor type specific for each of the pancreatic tumor subtypes and identified two distinct methylation-based groups in small intestine endocrine tumors. Differences of DNA methylation levels were validated by pyrosequencing for 20 candidate genes and correlated with differences at the transcriptional level for four candidate genes. The heterogeneity of DNA methylation patterns in the different subtypes of gastroenteropancreatic neuroendocrine tumors suggests different underlying pathways and, therefore, these tumors should be considered as distinct entities in molecular and clinical studies.

  4. Mapping Gene Associations in Human Mitochondria using Clinical Disease Phenotypes

    PubMed Central

    Scharfe, Curt; Lu, Henry Horng-Shing; Neuenburg, Jutta K.; Allen, Edward A.; Li, Guan-Cheng; Klopstock, Thomas; Cowan, Tina M.; Enns, Gregory M.; Davis, Ronald W.

    2009-01-01

    Nuclear genes encode most mitochondrial proteins, and their mutations cause diverse and debilitating clinical disorders. To date, 1,200 of these mitochondrial genes have been recorded, while no standardized catalog exists of the associated clinical phenotypes. Such a catalog would be useful to develop methods to analyze human phenotypic data, to determine genotype-phenotype relations among many genes and diseases, and to support the clinical diagnosis of mitochondrial disorders. Here we establish a clinical phenotype catalog of 174 mitochondrial disease genes and study associations of diseases and genes. Phenotypic features such as clinical signs and symptoms were manually annotated from full-text medical articles and classified based on the hierarchical MeSH ontology. This classification of phenotypic features of each gene allowed for the comparison of diseases between different genes. In turn, we were then able to measure the phenotypic associations of disease genes for which we calculated a quantitative value that is based on their shared phenotypic features. The results showed that genes sharing more similar phenotypes have a stronger tendency for functional interactions, proving the usefulness of phenotype similarity values in disease gene network analysis. We then constructed a functional network of mitochondrial genes and discovered a higher connectivity for non-disease than for disease genes, and a tendency of disease genes to interact with each other. Utilizing these differences, we propose 168 candidate genes that resemble the characteristic interaction patterns of mitochondrial disease genes. Through their network associations, the candidates are further prioritized for the study of specific disorders such as optic neuropathies and Parkinson disease. Most mitochondrial disease phenotypes involve several clinical categories including neurologic, metabolic, and gastrointestinal disorders, which might indicate the effects of gene defects within the mitochondrial system. The accompanying knowledgebase (http://www.mitophenome.org/) supports the study of clinical diseases and associated genes. PMID:19390613

  5. Genomic association for sexual precocity in beef heifers using pre-selection of genes and haplotype reconstruction

    PubMed Central

    Barbero, Marina M. D.; Oliveira, Henrique N.; de Camargo, Gregório M. F.; Fernandes Júnior, Gerardo A.; Aspilcueta-Borquis, Rusbel R.; Souza, Fabio R. P.; Boligon, Arione A.; Melo, Thaise P.; Regatieri, Inaê C.; Feitosa, Fabieli L. B.; Fonseca, Larissa F. S.; Magalhães, Ana F. B.; Costa, Raphael B.; Albuquerque, Lucia G.

    2018-01-01

    Reproductive traits are of the utmost importance for any livestock farming, but are difficult to measure and to interpret since they are influenced by various factors. The objective of this study was to detect associations between known polymorphisms in candidate genes related to sexual precocity in Nellore heifers, which could be used in breeding programs. Records of 1,689 precocious and non-precocious heifers from farms participating in the Conexão Delta G breeding program were analyzed. A subset of single nucleotide polymorphisms (SNP) located in the region of the candidate genes at a distance of up to 5 kb from the boundaries of each gene, were selected from the panel of 777,000 SNPs of the High-Density Bovine SNP BeadChip. Linear mixed models were used for statistical analysis of early heifer pregnancy, relating the trait with isolated SNPs or with haplotype groups. The model included the contemporary group (year and month of birth) as fixed effect and parent of the animal (sire effect) as random effect. The fastPHASE® and GenomeStudio® were used for reconstruction of the haplotypes and for analysis of linkage disequilibrium based on r2 statistics. A total of 125 candidate genes and 2,024 SNPs forming haplotypes were analyzed. Statistical analysis after Bonferroni correction showed that nine haplotypes exerted a significant effect (p<0.05) on sexual precocity. Four of these haplotypes were located in the Pregnancy-associated plasma protein-A2 gene (PAPP-A2), two in the Estrogen-related receptor gamma gene (ESRRG), and one each in the Pregnancy-associated plasma protein-A gene (PAPP-A), Kell blood group complex subunit-related family (XKR4) and mannose-binding lectin genes (MBL-1) genes. Although the present results indicate that the PAPP-A2, PAPP-A, XKR4, MBL-1 and ESRRG genes influence sexual precocity in Nellore heifers, further studies are needed to evaluate their possible use in breeding programs. PMID:29293544

  6. Genomic association for sexual precocity in beef heifers using pre-selection of genes and haplotype reconstruction.

    PubMed

    Takada, Luciana; Barbero, Marina M D; Oliveira, Henrique N; de Camargo, Gregório M F; Fernandes Júnior, Gerardo A; Aspilcueta-Borquis, Rusbel R; Souza, Fabio R P; Boligon, Arione A; Melo, Thaise P; Regatieri, Inaê C; Feitosa, Fabieli L B; Fonseca, Larissa F S; Magalhães, Ana F B; Costa, Raphael B; Albuquerque, Lucia G

    2018-01-01

    Reproductive traits are of the utmost importance for any livestock farming, but are difficult to measure and to interpret since they are influenced by various factors. The objective of this study was to detect associations between known polymorphisms in candidate genes related to sexual precocity in Nellore heifers, which could be used in breeding programs. Records of 1,689 precocious and non-precocious heifers from farms participating in the Conexão Delta G breeding program were analyzed. A subset of single nucleotide polymorphisms (SNP) located in the region of the candidate genes at a distance of up to 5 kb from the boundaries of each gene, were selected from the panel of 777,000 SNPs of the High-Density Bovine SNP BeadChip. Linear mixed models were used for statistical analysis of early heifer pregnancy, relating the trait with isolated SNPs or with haplotype groups. The model included the contemporary group (year and month of birth) as fixed effect and parent of the animal (sire effect) as random effect. The fastPHASE® and GenomeStudio® were used for reconstruction of the haplotypes and for analysis of linkage disequilibrium based on r2 statistics. A total of 125 candidate genes and 2,024 SNPs forming haplotypes were analyzed. Statistical analysis after Bonferroni correction showed that nine haplotypes exerted a significant effect (p<0.05) on sexual precocity. Four of these haplotypes were located in the Pregnancy-associated plasma protein-A2 gene (PAPP-A2), two in the Estrogen-related receptor gamma gene (ESRRG), and one each in the Pregnancy-associated plasma protein-A gene (PAPP-A), Kell blood group complex subunit-related family (XKR4) and mannose-binding lectin genes (MBL-1) genes. Although the present results indicate that the PAPP-A2, PAPP-A, XKR4, MBL-1 and ESRRG genes influence sexual precocity in Nellore heifers, further studies are needed to evaluate their possible use in breeding programs.

  7. The Genetic Basis for Variation in Sensitivity to Lead Toxicity in Drosophila melanogaster

    PubMed Central

    Zhou, Shanshan; Morozova, Tatiana V.; Hussain, Yasmeen N.; Luoma, Sarah E.; McCoy, Lenovia; Yamamoto, Akihiko; Mackay, Trudy F.C.; Anholt, Robert R.H.

    2016-01-01

    Background: Lead toxicity presents a worldwide health problem, especially due to its adverse effects on cognitive development in children. However, identifying genes that give rise to individual variation in susceptibility to lead toxicity is challenging in human populations. Objectives: Our goal was to use Drosophila melanogaster to identify evolutionarily conserved candidate genes associated with individual variation in susceptibility to lead exposure. Methods: To identify candidate genes associated with variation in susceptibility to lead toxicity, we measured effects of lead exposure on development time, viability and adult activity in the Drosophila melanogaster Genetic Reference Panel (DGRP) and performed genome-wide association analyses to identify candidate genes. We used mutants to assess functional causality of candidate genes and constructed a genetic network associated with variation in sensitivity to lead exposure, on which we could superimpose human orthologs. Results: We found substantial heritabilities for all three traits and identified candidate genes associated with variation in susceptibility to lead exposure for each phenotype. The genetic architectures that determine variation in sensitivity to lead exposure are highly polygenic. Gene ontology and network analyses showed enrichment of genes associated with early development and function of the nervous system. Conclusions: Drosophila melanogaster presents an advantageous model to study the genetic underpinnings of variation in susceptibility to lead toxicity. Evolutionary conservation of cellular pathways that respond to toxic exposure allows predictions regarding orthologous genes and pathways across phyla. Thus, studies in the D. melanogaster model system can identify candidate susceptibility genes to guide subsequent studies in human populations. Citation: Zhou S, Morozova TV, Hussain YN, Luoma SE, McCoy L, Yamamoto A, Mackay TF, Anholt RR. 2016. The genetic basis for variation in sensitivity to lead toxicity in Drosophila melanogaster. Environ Health Perspect 124:1062–1070; http://dx.doi.org/10.1289/ehp.1510513 PMID:26859824

  8. Secretome Characterization and Correlation Analysis Reveal Putative Pathogenicity Mechanisms and Identify Candidate Avirulence Genes in the Wheat Stripe Rust Fungus Puccinia striiformis f. sp. tritici.

    PubMed

    Xia, Chongjing; Wang, Meinan; Cornejo, Omar E; Jiwan, Derick A; See, Deven R; Chen, Xianming

    2017-01-01

    Stripe (yellow) rust, caused by Puccinia striiformis f. sp. tritici ( Pst ), is one of the most destructive diseases of wheat worldwide. Planting resistant cultivars is an effective way to control this disease, but race-specific resistance can be overcome quickly due to the rapid evolving Pst population. Studying the pathogenicity mechanisms is critical for understanding how Pst virulence changes and how to develop wheat cultivars with durable resistance to stripe rust. We re-sequenced 7 Pst isolates and included additional 7 previously sequenced isolates to represent balanced virulence/avirulence profiles for several avirulence loci in seretome analyses. We observed an uneven distribution of heterozygosity among the isolates. Secretome comparison of Pst with other rust fungi identified a large portion of species-specific secreted proteins, suggesting that they may have specific roles when interacting with the wheat host. Thirty-two effectors of Pst were identified from its secretome. We identified candidates for Avr genes corresponding to six Yr genes by correlating polymorphisms for effector genes to the virulence/avirulence profiles of the 14 Pst isolates. The putative AvYr76 was present in the avirulent isolates, but absent in the virulent isolates, suggesting that deleting the coding region of the candidate avirulence gene has produced races virulent to resistance gene Yr76 . We conclude that incorporating avirulence/virulence phenotypes into correlation analysis with variations in genomic structure and secretome, particularly presence/absence polymorphisms of effectors, is an efficient way to identify candidate Avr genes in Pst . The candidate effector genes provide a rich resource for further studies to determine the evolutionary history of Pst populations and the co-evolutionary arms race between Pst and wheat. The Avr candidates identified in this study will lead to cloning avirulence genes in Pst , which will enable us to understand molecular mechanisms underlying Pst -wheat interactions, to determine the effectiveness of resistance genes and further to develop durable resistance to stripe rust.

  9. "Contrasting patterns of selection at Pinus pinaster Ait. Drought stress candidate genes as revealed by genetic differentiation analyses".

    PubMed

    Eveno, Emmanuelle; Collada, Carmen; Guevara, M Angeles; Léger, Valérie; Soto, Alvaro; Díaz, Luis; Léger, Patrick; González-Martínez, Santiago C; Cervera, M Teresa; Plomion, Christophe; Garnier-Géré, Pauline H

    2008-02-01

    The importance of natural selection for shaping adaptive trait differentiation among natural populations of allogamous tree species has long been recognized. Determining the molecular basis of local adaptation remains largely unresolved, and the respective roles of selection and demography in shaping population structure are actively debated. Using a multilocus scan that aims to detect outliers from simulated neutral expectations, we analyzed patterns of nucleotide diversity and genetic differentiation at 11 polymorphic candidate genes for drought stress tolerance in phenotypically contrasted Pinus pinaster Ait. populations across its geographical range. We compared 3 coalescent-based methods: 2 frequentist-like, including 1 approach specifically developed for biallelic single nucleotide polymorphisms (SNPs) here and 1 Bayesian. Five genes showed outlier patterns that were robust across methods at the haplotype level for 2 of them. Two genes presented higher F(ST) values than expected (PR-AGP4 and erd3), suggesting that they could have been affected by the action of diversifying selection among populations. In contrast, 3 genes presented lower F(ST) values than expected (dhn-1, dhn2, and lp3-1), which could represent signatures of homogenizing selection among populations. A smaller proportion of outliers were detected at the SNP level suggesting the potential functional significance of particular combinations of sites in drought-response candidate genes. The Bayesian method appeared robust to low sample sizes, flexible to assumptions regarding migration rates, and powerful for detecting selection at the haplotype level, but the frequentist-like method adapted to SNPs was more efficient for the identification of outlier SNPs showing low differentiation. Population-specific effects estimated in the Bayesian method also revealed populations with lower immigration rates, which could have led to favorable situations for local adaptation. Outlier patterns are discussed in relation to the different genes' putative involvement in drought tolerance responses, from published results in transcriptomics and association mapping in P. pinaster and other related species. These genes clearly constitute relevant candidates for future association studies in P. pinaster.

  10. Genetic Basis of Variation in Rice Seed Storage Protein (Albumin, Globulin, Prolamin, and Glutelin) Content Revealed by Genome-Wide Association Analysis.

    PubMed

    Chen, Pingli; Shen, Zhikang; Ming, Luchang; Li, Yibo; Dan, Wenhan; Lou, Guangming; Peng, Bo; Wu, Bian; Li, Yanhua; Zhao, Da; Gao, Guanjun; Zhang, Qinglu; Xiao, Jinghua; Li, Xianghua; Wang, Gongwei; He, Yuqing

    2018-01-01

    Rice seed storage protein (SSP) is an important source of nutrition and energy. Understanding the genetic basis of SSP content and mining favorable alleles that control it will be helpful for breeding new improved cultivars. An association analysis for SSP content was performed to identify underlying genes using 527 diverse Oryza sativa accessions grown in two environments. We identified more than 107 associations for five different traits, including the contents of albumin (Alb), globulin (Glo), prolamin (Pro), glutelin (Glu), and total SSP (Total). A total of 28 associations were located at previously reported QTLs or intervals. A lead SNP sf0709447538, associated for Glu content in the indica subpopulation in 2015, was further validated in near isogenic lines NIL(Zhenshan97) and NIL(Delong208), and the Glu phenotype had significantly difference between two NILs. The association region could be target for map-based cloning of the candidate genes. There were 13 associations in regions close to grain-quality-related genes; five lead single nucleotide polymorphisms (SNPs) were located less than 20 kb upstream from grain-quality-related genes ( PG5a , Wx , AGPS2a , RP6 , and, RM1 ). Several starch-metabolism-related genes ( AGPS2a , OsACS6 , PUL , GBSSII , and ISA2 ) were also associated with SSP content. We identified favorable alleles of functional candidate genes, such as RP6 , RM1 , Wx , and other four candidate genes by haplotype analysis and expression pattern. Genotypes of RP6 and RM1 with higher Pro were not identified in japonica and exhibited much higher expression levels in indica group. The lead SNP sf0601764762, repeatedly detected for Alb content in 2 years in the whole association population, was located in the Wx locus that controls the synthesis of amylose. And Alb content was significantly and negatively correlated with amylose content and the level of 2.3 kb Wx pre-mRNA examined in this study. The associations or candidate genes identified would provide new insights into the genetic basis of SSP content that will help in developing rice cultivars with improved grain nutritional quality through marker-assisted breeding.

  11. Demographically-Based Evaluation of Genomic Regions under Selection in Domestic Dogs

    PubMed Central

    Freedman, Adam H.; Schweizer, Rena M.; Ortega-Del Vecchyo, Diego; Han, Eunjung; Davis, Brian W.; Gronau, Ilan; Silva, Pedro M.; Galaverni, Marco; Fan, Zhenxin; Marx, Peter; Lorente-Galdos, Belen; Ramirez, Oscar; Hormozdiari, Farhad; Alkan, Can; Vilà, Carles; Squire, Kevin; Geffen, Eli; Kusak, Josip; Boyko, Adam R.; Parker, Heidi G.; Lee, Clarence; Tadigotla, Vasisht; Siepel, Adam; Bustamante, Carlos D.; Harkins, Timothy T.; Nelson, Stanley F.; Marques-Bonet, Tomas; Ostrander, Elaine A.; Wayne, Robert K.; Novembre, John

    2016-01-01

    Controlling for background demographic effects is important for accurately identifying loci that have recently undergone positive selection. To date, the effects of demography have not yet been explicitly considered when identifying loci under selection during dog domestication. To investigate positive selection on the dog lineage early in the domestication, we examined patterns of polymorphism in six canid genomes that were previously used to infer a demographic model of dog domestication. Using an inferred demographic model, we computed false discovery rates (FDR) and identified 349 outlier regions consistent with positive selection at a low FDR. The signals in the top 100 regions were frequently centered on candidate genes related to brain function and behavior, including LHFPL3, CADM2, GRIK3, SH3GL2, MBP, PDE7B, NTAN1, and GLRA1. These regions contained significant enrichments in behavioral ontology categories. The 3rd top hit, CCRN4L, plays a major role in lipid metabolism, that is supported by additional metabolism related candidates revealed in our scan, including SCP2D1 and PDXC1. Comparing our method to an empirical outlier approach that does not directly account for demography, we found only modest overlaps between the two methods, with 60% of empirical outliers having no overlap with our demography-based outlier detection approach. Demography-aware approaches have lower-rates of false discovery. Our top candidates for selection, in addition to expanding the set of neurobehavioral candidate genes, include genes related to lipid metabolism, suggesting a dietary target of selection that was important during the period when proto-dogs hunted and fed alongside hunter-gatherers. PMID:26943675

  12. Application of selection mapping to identify genomic regions associated with dairy production in sheep.

    PubMed

    Gutiérrez-Gil, Beatriz; Arranz, Juan Jose; Pong-Wong, Ricardo; García-Gámez, Elsa; Kijas, James; Wiener, Pamela

    2014-01-01

    In Europe, especially in Mediterranean areas, the sheep has been traditionally exploited as a dual purpose species, with income from both meat and milk. Modernization of husbandry methods and the establishment of breeding schemes focused on milk production have led to the development of "dairy breeds." This study investigated selective sweeps specifically related to dairy production in sheep by searching for regions commonly identified in different European dairy breeds. With this aim, genotypes from 44,545 SNP markers covering the sheep autosomes were analysed in both European dairy and non-dairy sheep breeds using two approaches: (i) identification of genomic regions showing extreme genetic differentiation between each dairy breed and a closely related non-dairy breed, and (ii) identification of regions with reduced variation (heterozygosity) in the dairy breeds using two methods. Regions detected in at least two breeds (breed pairs) by the two approaches (genetic differentiation and at least one of the heterozygosity-based analyses) were labeled as core candidate convergence regions and further investigated for candidate genes. Following this approach six regions were detected. For some of them, strong candidate genes have been proposed (e.g. ABCG2, SPP1), whereas some other genes designated as candidates based on their association with sheep and cattle dairy traits (e.g. LALBA, DGAT1A) were not associated with a detectable sweep signal. Few of the identified regions were coincident with QTL previously reported in sheep, although many of them corresponded to orthologous regions in cattle where QTL for dairy traits have been identified. Due to the limited number of QTL studies reported in sheep compared with cattle, the results illustrate the potential value of selection mapping to identify genomic regions associated with dairy traits in sheep.

  13. Application of Selection Mapping to Identify Genomic Regions Associated with Dairy Production in Sheep

    PubMed Central

    Gutiérrez-Gil, Beatriz; Arranz, Juan Jose; Pong-Wong, Ricardo; García-Gámez, Elsa; Kijas, James; Wiener, Pamela

    2014-01-01

    In Europe, especially in Mediterranean areas, the sheep has been traditionally exploited as a dual purpose species, with income from both meat and milk. Modernization of husbandry methods and the establishment of breeding schemes focused on milk production have led to the development of “dairy breeds.” This study investigated selective sweeps specifically related to dairy production in sheep by searching for regions commonly identified in different European dairy breeds. With this aim, genotypes from 44,545 SNP markers covering the sheep autosomes were analysed in both European dairy and non-dairy sheep breeds using two approaches: (i) identification of genomic regions showing extreme genetic differentiation between each dairy breed and a closely related non-dairy breed, and (ii) identification of regions with reduced variation (heterozygosity) in the dairy breeds using two methods. Regions detected in at least two breeds (breed pairs) by the two approaches (genetic differentiation and at least one of the heterozygosity-based analyses) were labeled as core candidate convergence regions and further investigated for candidate genes. Following this approach six regions were detected. For some of them, strong candidate genes have been proposed (e.g. ABCG2, SPP1), whereas some other genes designated as candidates based on their association with sheep and cattle dairy traits (e.g. LALBA, DGAT1A) were not associated with a detectable sweep signal. Few of the identified regions were coincident with QTL previously reported in sheep, although many of them corresponded to orthologous regions in cattle where QTL for dairy traits have been identified. Due to the limited number of QTL studies reported in sheep compared with cattle, the results illustrate the potential value of selection mapping to identify genomic regions associated with dairy traits in sheep. PMID:24788864

  14. Genome-wide scan for selection signatures in six cattle breeds in South Africa.

    PubMed

    Makina, Sithembile O; Muchadeyi, Farai C; van Marle-Köster, Este; Taylor, Jerry F; Makgahlela, Mahlako L; Maiwashe, Azwihangwisi

    2015-11-26

    The detection of selection signatures in breeds of livestock species can contribute to the identification of regions of the genome that are, or have been, functionally important and, as a consequence, have been targeted by selection. This study used two approaches to detect signatures of selection within and between six cattle breeds in South Africa, including Afrikaner (n = 44), Nguni (n = 54), Drakensberger (n = 47), Bonsmara (n = 44), Angus (n = 31) and Holstein (n = 29). The first approach was based on the detection of genomic regions in which haplotypes have been driven towards complete fixation within breeds. The second approach identified regions of the genome that had very different allele frequencies between populations (F ST). Forty-seven candidate genomic regions were identified as harbouring putative signatures of selection using both methods. Twelve of these candidate selected regions were shared among the breeds and ten were validated by previous studies. Thirty-three of these regions were successfully annotated and candidate genes were identified. Among these genes the keratin genes (KRT222, KRT24, KRT25, KRT26, and KRT27) and one heat shock protein gene (HSPB9) on chromosome 19 between 42,896,570 and 42,897,840 bp were detected for the Nguni breed. These genes were previously associated with adaptation to tropical environments in Zebu cattle. In addition, a number of candidate genes associated with the nervous system (WNT5B, FMOD, PRELP, and ATP2B), immune response (CYM, CDC6, and CDK10), production (MTPN, IGFBP4, TGFB1, and AJAP1) and reproductive performance (ADIPOR2, OVOS2, and RBBP8) were also detected as being under selection. The results presented here provide a foundation for detecting mutations that underlie genetic variation of traits that have economic importance for cattle breeds in South Africa.

  15. A Controlled Pharmacogenetic Trial of Sibutramine on Weight Loss and Body Composition in Obese or Overweight Adults

    PubMed Central

    Grudell, April B.M.; Sweetser, Seth; Camilleri, Michael; Eckert, Deborah J.; Vazquez-Roque, Maria I.; Carlson, Paula J.; Burton, Duane D.; Braddock, Autumn E.; Clark, Matthew M.; Graszer, Karen M.; Kalsy, Sarah A.; Zinsmeister, Alan R.

    2008-01-01

    Background/ Aim Weight loss in response to sibutramine is highly variable. We assessed the association of specific markers of polymorphisms of candidate a2A adrenoreceptor, 5-HT transporter and GNβ3 genes and weight loss with sibutramine. Methods We conducted a randomized, double-blind, pharmacogenetic study of behavioral therapy and sibutramine (10 or 15 mg daily) or placebo for 12 weeks in 181 overweight or obese participants. We measured body weight, BMI, body composition, gastric emptying and genetic variation (α2A C1291G, 5-HTTLPR, and GNβ3 C825T genotypes). ANCOVA was used to assess treatment effects on, and associations of the specific markers of candidate genes with weight loss and body composition. Results Sibutramine, 10 and 15 mg, caused significant weight loss (p = 0.009); there was a statistically significant gene by dose interaction for GNβ3 genotype. For each candidate gene, significant treatment effects at 12 weeks were observed (p<0.017) for all specific genotype variants (delta weight loss in the 2 sibutramine doses versus placebo): α2A CC genotype ( Δ ~5kg), GNβ3 TC/TT genotype (Δ ~6kg), and 5-HTTLPR LS/SS (Δ ~4.5kg). Gene pairs resulted in significantly greater sibutramine treatment effects on weight (both p<0.002): in participants with 5-HTTLPR LS/SS with GNβ3 TC/TT, Δ ~6kg and those with a2A CC with GNβ3 TC/TT, Δ ~8kg; however, effects were not synergistic. Treatment with sibutramine also resulted in significantly greater reduction of body fat for specific α2A CC and GNβ3 TC/TT genotype variants individually (both p<0.02). Conclusions Selection of patients with obesity based on candidate genes may enhance response to multidimensional sibutramine and behavioral therapy. PMID:18725220

  16. A high-throughput screening system for barley/powdery mildew interactions based on automated analysis of light micrographs.

    PubMed

    Ihlow, Alexander; Schweizer, Patrick; Seiffert, Udo

    2008-01-23

    To find candidate genes that potentially influence the susceptibility or resistance of crop plants to powdery mildew fungi, an assay system based on transient-induced gene silencing (TIGS) as well as transient over-expression in single epidermal cells of barley has been developed. However, this system relies on quantitative microscopic analysis of the barley/powdery mildew interaction and will only become a high-throughput tool of phenomics upon automation of the most time-consuming steps. We have developed a high-throughput screening system based on a motorized microscope which evaluates the specimens fully automatically. A large-scale double-blind verification of the system showed an excellent agreement of manual and automated analysis and proved the system to work dependably. Furthermore, in a series of bombardment experiments an RNAi construct targeting the Mlo gene was included, which is expected to phenocopy resistance mediated by recessive loss-of-function alleles such as mlo5. In most cases, the automated analysis system recorded a shift towards resistance upon RNAi of Mlo, thus providing proof of concept for its usefulness in detecting gene-target effects. Besides saving labor and enabling a screening of thousands of candidate genes, this system offers continuous operation of expensive laboratory equipment and provides a less subjective analysis as well as a complete and enduring documentation of the experimental raw data in terms of digital images. In general, it proves the concept of enabling available microscope hardware to handle challenging screening tasks fully automatically.

  17. Polymorphisms in the AOX2 gene are associated with the rooting ability of olive cuttings.

    PubMed

    Hedayati, Vahideh; Mousavi, Amir; Razavi, Khadijeh; Cultrera, Nicolò; Alagna, Fiammetta; Mariotti, Roberto; Hosseini-Mazinani, Mehdi; Baldoni, Luciana

    2015-07-01

    Different rooting ability candidate genes were tested on an olive cross progeny. Our results demonstrated that only the AOX2 gene was strongly induced. OeAOX2 was fully characterised and correlated to phenotypical traits. The formation of adventitious roots is a key step in the vegetative propagation of trees crop species, and this ability is under strict genetic control. While numerous studies have been carried out to identify genes controlling adventitious root formation, only a few loci have been characterised. In this work, candidate genes that were putatively involved in rooting ability were identified in olive (Olea europaea L.) by similarity with orthologs identified in other plant species. The mRNA levels of these genes were analysed by real-time PCR during root induction in high- (HR) and low-rooting (LR) individuals. Interestingly, alternative oxidase 2 (AOX2), which was previously reported to be a functional marker for rooting in olive cuttings, showed a strong induction in HR individuals. From the OeAOX2 full-length gene, alleles and effective polymorphisms were distinguished and analysed in the cross progeny, which were segregated based on rooting. The results revealed a possible correlation between two single nucleotide polymorphisms of OeAOX2 gene and rooting ability.

  18. Analysis of Differentially Expressed Genes and Signaling Pathways Related to Intramuscular Fat Deposition in Skeletal Muscle of Sex-Linked Dwarf Chickens

    PubMed Central

    Ye, Yaqiong; Lin, Shumao; Mu, Heping; Tang, Xiaohong; Ou, Yangdan; Chen, Jian; Ma, Yongjiang; Li, Yugu

    2014-01-01

    Intramuscular fat (IMF) plays an important role in meat quality. However, the molecular mechanisms underlying IMF deposition in skeletal muscle have not been addressed for the sex-linked dwarf (SLD) chicken. In this study, potential candidate genes and signaling pathways related to IMF deposition in chicken leg muscle tissue were characterized using gene expression profiling of both 7-week-old SLD and normal chickens. A total of 173 differentially expressed genes (DEGs) were identified between the two breeds. Subsequently, 6 DEGs related to lipid metabolism or muscle development were verified in each breed based on gene ontology (GO) analysis. In addition, KEGG pathway analysis of DEGs indicated that some of them (GHR, SOCS3, and IGF2BP3) participate in adipocytokine and insulin signaling pathways. To investigate the role of the above signaling pathways in IMF deposition, the gene expression of pathway factors and other downstream genes were measured by using qRT-PCR and Western blot analyses. Collectively, the results identified potential candidate genes related to IMF deposition and suggested that IMF deposition in skeletal muscle of SLD chicken is regulated partially by pathways of adipocytokine and insulin and other downstream signaling pathways (TGF-β/SMAD3 and Wnt/catenin-β pathway). PMID:24757673

  19. 454 pyrosequencing based transcriptome analysis of Zygaena filipendulae with focus on genes involved in biosynthesis of cyanogenic glucosides.

    PubMed

    Zagrobelny, Mika; Scheibye-Alsing, Karsten; Jensen, Niels Bjerg; Møller, Birger Lindberg; Gorodkin, Jan; Bak, Søren

    2009-12-02

    An essential driving component in the co-evolution of plants and insects is the ability to produce and handle bioactive compounds. Plants produce bioactive natural products for defense, but some insects detoxify and/or sequester the compounds, opening up for new niches with fewer competitors. To study the molecular mechanism behind the co-adaption in plant-insect interactions, we have investigated the interactions between Lotus corniculatus and Zygaena filipendulae. They both contain cyanogenic glucosides which liberate toxic hydrogen cyanide upon breakdown. Moths belonging to the Zygaena family are the only insects known, able to carry out both de novo biosynthesis and sequestration of the same cyanogenic glucosides as those from their feed plants. The biosynthetic pathway for cyanogenic glucoside biosynthesis in Z. filipendulae proceeds using the same intermediates as in the well known pathway from plants, but none of the enzymes responsible have been identified. A genomics strategy founded on 454 pyrosequencing of the Z. filipendulae transcriptome was undertaken to identify some of these enzymes in Z. filipendulae. Comparisons of the Z. filipendulae transcriptome with the sequenced genomes of Bombyx mori, Drosophila melanogaster, Tribolium castaneum, Apis mellifera and Anopheles gambiae indicate a high coverage of the Z. filipendulae transcriptome. 11% of the Z. filipendulae transcriptome sequences were assigned to Gene Ontology categories. Candidate genes for enzymes functioning in the biosynthesis of cyanogenic glucosides (cytochrome P450 and family 1 glycosyltransferases) were identified based on sequence length, number of copies and presence/absence of close homologs in D. melanogaster, B. mori and the cyanogenic butterfly Heliconius. Examination of biased codon usage, GC content and selection on gene candidates support the notion of cyanogenesis as an "old" trait within Ditrysia, as well as its origins being convergent between plants and insects. Pyrosequencing is an attractive approach to gain access to genes in the biosynthesis of bio-active natural products from insects and other organisms, for which the genome sequence is not known. Based on analysis of the Z. filipendulae transcriptome, promising gene candidates for biosynthesis of cyanogenic glucosides was identified, and the suitability of Z. filipendulae as a model system for cyanogenesis in insects is evident.

  20. Transcriptome analysis reveals candidate genes involved in luciferin metabolism in Luciola aquatilis (Coleoptera: Lampyridae)

    PubMed Central

    Vongsangnak, Wanwipa; Chumnanpuen, Pramote

    2016-01-01

    Bioluminescence, which living organisms such as fireflies emit light, has been studied extensively for over half a century. This intriguing reaction, having its origins in nature where glowing insects can signal things such as attraction or defense, is now widely used in biotechnology with applications of bioluminescence and chemiluminescence. Luciferase, a key enzyme in this reaction, has been well characterized; however, the enzymes involved in the biosynthetic pathway of its substrate, luciferin, remains unsolved at present. To elucidate the luciferin metabolism, we performed a de novo transcriptome analysis using larvae of the firefly species, Luciola aquatilis. Here, a comparative analysis is performed with the model coleopteran insect Tribolium casteneum to elucidate the metabolic pathways in L. aquatilis. Based on a template luciferin biosynthetic pathway, combined with a range of protein and pathway databases, and various prediction tools for functional annotation, the candidate genes, enzymes, and biochemical reactions involved in luciferin metabolism are proposed for L. aquatilis. The candidate gene expression is validated in the adult L. aquatilis using reverse transcription PCR (RT-PCR). This study provides useful information on the bio-production of luciferin in the firefly and will benefit to future applications of the valuable firefly bioluminescence system. PMID:27761329

  1. Adaptation to climate through flowering phenology: a case study in Medicago truncatula.

    PubMed

    Burgarella, Concetta; Chantret, Nathalie; Gay, Laurène; Prosperi, Jean-Marie; Bonhomme, Maxime; Tiffin, Peter; Young, Nevin D; Ronfort, Joelle

    2016-07-01

    Local climatic conditions likely constitute an important selective pressure on genes underlying important fitness-related traits such as flowering time, and in many species, flowering phenology and climatic gradients strongly covary. To test whether climate shapes the genetic variation on flowering time genes and to identify candidate flowering genes involved in the adaptation to environmental heterogeneity, we used a large Medicago truncatula core collection to examine the association between nucleotide polymorphisms at 224 candidate genes and both climate variables and flowering phenotypes. Unlike genome-wide studies, candidate gene approaches are expected to enrich for the number of meaningful trait associations because they specifically target genes that are known to affect the trait of interest. We found that flowering time mediates adaptation to climatic conditions mainly by variation at genes located upstream in the flowering pathways, close to the environmental stimuli. Variables related to the annual precipitation regime reflected selective constraints on flowering time genes better than the other variables tested (temperature, altitude, latitude or longitude). By comparing phenotype and climate associations, we identified 12 flowering genes as the most promising candidates responsible for phenological adaptation to climate. Four of these genes were located in the known flowering time QTL region on chromosome 7. However, climate and flowering associations also highlighted largely distinct gene sets, suggesting different genetic architectures for adaptation to climate and flowering onset. © 2016 John Wiley & Sons Ltd.

  2. Analysis of genetic association using hierarchical clustering and cluster validation indices.

    PubMed

    Pagnuco, Inti A; Pastore, Juan I; Abras, Guillermo; Brun, Marcel; Ballarin, Virginia L

    2017-10-01

    It is usually assumed that co-expressed genes suggest co-regulation in the underlying regulatory network. Determining sets of co-expressed genes is an important task, based on some criteria of similarity. This task is usually performed by clustering algorithms, where the genes are clustered into meaningful groups based on their expression values in a set of experiment. In this work, we propose a method to find sets of co-expressed genes, based on cluster validation indices as a measure of similarity for individual gene groups, and a combination of variants of hierarchical clustering to generate the candidate groups. We evaluated its ability to retrieve significant sets on simulated correlated and real genomics data, where the performance is measured based on its detection ability of co-regulated sets against a full search. Additionally, we analyzed the quality of the best ranked groups using an online bioinformatics tool that provides network information for the selected genes. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Comparative Transcriptional Profiling of the Axolotl Limb Identifies a Tripartite Regeneration-Specific Gene Program

    PubMed Central

    Knapp, Dunja; Schulz, Herbert; Rascon, Cynthia Alexander; Volkmer, Michael; Scholz, Juliane; Nacu, Eugen; Le, Mu; Novozhilov, Sergey; Tazaki, Akira; Protze, Stephanie; Jacob, Tina; Hubner, Norbert; Habermann, Bianca; Tanaka, Elly M.

    2013-01-01

    Understanding how the limb blastema is established after the initial wound healing response is an important aspect of regeneration research. Here we performed parallel expression profile time courses of healing lateral wounds versus amputated limbs in axolotl. This comparison between wound healing and regeneration allowed us to identify amputation-specific genes. By clustering the expression profiles of these samples, we could detect three distinguishable phases of gene expression – early wound healing followed by a transition-phase leading to establishment of the limb development program, which correspond to the three phases of limb regeneration that had been defined by morphological criteria. By focusing on the transition-phase, we identified 93 strictly amputation-associated genes many of which are implicated in oxidative-stress response, chromatin modification, epithelial development or limb development. We further classified the genes based on whether they were or were not significantly expressed in the developing limb bud. The specific localization of 53 selected candidates within the blastema was investigated by in situ hybridization. In summary, we identified a set of genes that are expressed specifically during regeneration and are therefore, likely candidates for the regulation of blastema formation. PMID:23658691

  4. Vanilloid receptor-related osmotically activated channel (VR-OAC), a candidate vertebrate osmoreceptor

    PubMed Central

    Liedtke, Wolfgang; Choe, Yong; Martí-Renom, Marc A.; Bell, Andrea M.; Denis, Charlotte S.; Šali, Andrej; Hudspeth, A. J.; Friedman, Jeffrey M.; Heller, Stefan

    2008-01-01

    SUMMARY The detection of osmotic stimuli is essential for all organisms, yet few osmoreceptive proteins are known, none of them in vertebrates. By employing a candidate-gene approach based on genes encoding members of the TRP superfamily of ion channels, we cloned cDNAs encoding the vanilloid receptor-related osmotically activated channel (VR-OAC) from the rat, mouse, human, and chicken. This novel cation-selective channel is gated by exposure to hypotonicity within the physiological range. In the central nevous system, the channel is expressed neurons of the circumventricular organs, neurosensory cells responsive to systemic osmotic pressure. The channel also occurs in other neurosensory cells, including inner-ear hair cells, sensory neurons, and Merkel cells. PMID:11081638

  5. Gene expression profiles of putative biomarker candidates in Mycobacterium avium subsp. paratuberculosis-infected cattle.

    PubMed

    Park, Hyun-Eui; Shin, Min-Kyoung; Park, Hong-Tae; Jung, Myunghwan; Cho, Yong Il; Yoo, Han Sang

    2016-06-01

    This study was conducted to analyze the gene expression of prognostic potential biomarker candidates using the whole blood of cattle naturally infected with ITALIC! Mycobacterium aviumsubsp. ITALIC! paratuberculosis(MAP). We conducted real-time PCR to evaluate 23 potential biomarker candidates. Experimental animals were divided into four groups based on fecal MAP PCR and serum ELISA. Seven ( ITALIC! KLRB1, ITALIC! HGF, ITALIC! MPO, ITALIC! LTF, ITALIC! SERPINE1, ITALIC! S100A8and ITALIC! S100A9) genes were up-regulated in fecal MAP-positive cattle and three ( ITALIC! KLRB1, ITALIC! MPOand ITALIC! S100A9) were up-regulated in MAP-seropositive cattle relative to uninfected cattle. In subclinically infected animals, 17 genes ( ITALIC! TFRC, ITALIC! S100A8, ITALIC! S100A9, ITALIC! MPO, ITALIC! GBP6, ITALIC! LTF, ITALIC! KLRB1, ITALIC! SERPINE1, ITALIC! PIGR, ITALIC! IL-10, ITALIC! CXCR3, ITALIC! CD14, ITALIC! MMP9, ITALIC! ELANE, ITALIC! CHI3L1, ITALIC! HPand ITALIC! HGF) were up-regulated compared with the control group. Moreover, six genes ( ITALIC! CXCR3, ITALIC! HP, ITALIC! HGF, ITALIC! LTF, ITALIC! TFRCand ITALIC! GBP6) showed significant differences between experimental groups. Taken together, our data suggest that six genes ( ITALIC! LTF, ITALIC! HGF, ITALIC! HP, ITALIC! CXCR3, ITALIC! GBP6and ITALIC! TFRC) played essential roles in the immune response to MAP during the subclinical stage and therefore might be useful as prognostic biomarkers. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  6. Genome-wide association study discovered genetic variation and candidate genes of fibre quality traits in Gossypium hirsutum L.

    PubMed

    Sun, Zhengwen; Wang, Xingfen; Liu, Zhengwen; Gu, Qishen; Zhang, Yan; Li, Zhikun; Ke, Huifeng; Yang, Jun; Wu, Jinhua; Wu, Liqiang; Zhang, Guiyin; Zhang, Caiying; Ma, Zhiying

    2017-08-01

    Genetic improvement of fibre quality is one of the main breeding goals for the upland cotton, Gossypium hirsutum, but there are difficulties with precise selection of traits. Therefore, it is important to improve the understanding of the genetic basis of phenotypic variation. In this study, we conducted phenotyping and genetic variation analyses of 719 diverse accessions of upland cotton based on multiple environment tests and a recently developed Cotton 63K Illumina Infinium SNP array and performed a genome-wide association study (GWAS) of fibre quality traits. A total of 10 511 polymorphic SNPs distributed in 26 chromosomes were screened across the cotton germplasms, and forty-six significant SNPs associated with five fibre quality traits were detected. These significant SNPs were scattered over 15 chromosomes and were involved in 612 unique candidate genes, many related to polysaccharide biosynthesis, signal transduction and protein translocation. Two major haplotypes for fibre length and strength were identified on chromosomes Dt11 and At07. Furthermore, by combining GWAS and transcriptome analysis, we identified 163 and 120 fibre developmental genes related to length and strength, respectively, of which a number of novel genes and 19 promising genes were screened. These results provide new insight into the genetic basis of fibre quality in G. hirsutum and provide candidate SNPs and genes to accelerate the improvement of upland cotton. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  7. Transcriptome profiling of two maize inbreds with distinct responses to Gibberella ear rot disease to identify candidate resistance genes.

    PubMed

    Kebede, Aida Z; Johnston, Anne; Schneiderman, Danielle; Bosnich, Whynn; Harris, Linda J

    2018-02-09

    Gibberella ear rot (GER) is one of the most economically important fungal diseases of maize in the temperate zone due to moldy grain contaminated with health threatening mycotoxins. To develop resistant genotypes and control the disease, understanding the host-pathogen interaction is essential. RNA-Seq-derived transcriptome profiles of fungal- and mock-inoculated developing kernel tissues of two maize inbred lines were used to identify differentially expressed transcripts and propose candidate genes mapping within GER resistance quantitative trait loci (QTL). A total of 1255 transcripts were significantly (P ≤ 0.05) up regulated due to fungal infection in both susceptible and resistant inbreds. A greater number of transcripts were up regulated in the former (1174) than the latter (497) and increased as the infection progressed from 1 to 2 days after inoculation. Focusing on differentially expressed genes located within QTL regions for GER resistance, we identified 81 genes involved in membrane transport, hormone regulation, cell wall modification, cell detoxification, and biosynthesis of pathogenesis related proteins and phytoalexins as candidate genes contributing to resistance. Applying droplet digital PCR, we validated the expression profiles of a subset of these candidate genes from QTL regions contributed by the resistant inbred on chromosomes 1, 2 and 9. By screening global gene expression profiles for differentially expressed genes mapping within resistance QTL regions, we have identified candidate genes for gibberella ear rot resistance on several maize chromosomes which could potentially lead to a better understanding of Fusarium resistance mechanisms.

  8. An Integrative Genetics Approach to Identify Candidate Genes Regulating BMD: Combining Linkage, Gene Expression, and Association

    PubMed Central

    Farber, Charles R; van Nas, Atila; Ghazalpour, Anatole; Aten, Jason E; Doss, Sudheer; Sos, Brandon; Schadt, Eric E; Ingram-Drake, Leslie; Davis, Richard C; Horvath, Steve; Smith, Desmond J; Drake, Thomas A; Lusis, Aldons J

    2009-01-01

    Numerous quantitative trait loci (QTLs) affecting bone traits have been identified in the mouse; however, few of the underlying genes have been discovered. To improve the process of transitioning from QTL to gene, we describe an integrative genetics approach, which combines linkage analysis, expression QTL (eQTL) mapping, causality modeling, and genetic association in outbred mice. In C57BL/6J × C3H/HeJ (BXH) F2 mice, nine QTLs regulating femoral BMD were identified. To select candidate genes from within each QTL region, microarray gene expression profiles from individual F2 mice were used to identify 148 genes whose expression was correlated with BMD and regulated by local eQTLs. Many of the genes that were the most highly correlated with BMD have been previously shown to modulate bone mass or skeletal development. Candidates were further prioritized by determining whether their expression was predicted to underlie variation in BMD. Using network edge orienting (NEO), a causality modeling algorithm, 18 of the 148 candidates were predicted to be causally related to differences in BMD. To fine-map QTLs, markers in outbred MF1 mice were tested for association with BMD. Three chromosome 11 SNPs were identified that were associated with BMD within the Bmd11 QTL. Finally, our approach provides strong support for Wnt9a, Rasd1, or both underlying Bmd11. Integration of multiple genetic and genomic data sets can substantially improve the efficiency of QTL fine-mapping and candidate gene identification. PMID:18767929

  9. Association of candidate gene polymorphisms with clinical subtypes of preterm birth in a Latin American population

    PubMed Central

    Gimenez, Lucas G.; Momany, Allison M.; Poletta, Fernando A.; Krupitzki, Hugo B.; Gili, Juan A.; Busch, Tamara D.; Saleme, Cesar; Cosentino, Viviana R.; Pawluk, Mariela S.; Campaña, Hebe; Gadow, Enrique C.; Murray, Jeffrey C.; Lopez-Camelo, Jorge S.

    2017-01-01

    Background Preterm birth (PTB) is the leading cause of neonatal mortality and morbidity. PTB is often classified according to clinical presentation: Idiopathic (PTB-I), preterm premature rupture of membranes (PTB-PPROM), and medically induced (PTB-M). The aim of this study was to evaluate the associations between specific candidate genes and clinical subtypes of PTB. Methods 24 SNPs were genotyped in 18 candidate genes in 709 infant triads. Of them, 243 were PTB-I, 256 PTB-PPROM, and 210 PTB-M. These data were analyzed with a Family-Based Association. Results PTB was nominally associated with rs2272365 in PON1, rs883319 in KCNN3, rs4458044 in CRHR1, and rs610277 in F3. Regarding clinical subtypes analysis, 3 SNPs were associated with PTB-I (rs2272365 in PON1, rs10178458 in COL4A3, and rs4458044 in CRHR1), rs610277 in F3 was associated with PTB-PPROM, and rs883319 in KCNN3 and rs610277 in F3 were associated with PTB-M. Conclusions Our study identified polymorphisms potentially associated with specific clinical subtypes of PTB in this Latin American population. These results could suggest a specific role of such genes in the mechanisms involved in each clinical subtype. Further studies are required to confirm our results and to determine the role of these genes in the pathophysiology of clinical subtypes. PMID:28426651

  10. Association of candidate gene polymorphisms with clinical subtypes of preterm birth in a Latin American population.

    PubMed

    Gimenez, Lucas G; Momany, Allison M; Poletta, Fernando A; Krupitzki, Hugo B; Gili, Juan A; Busch, Tamara D; Saleme, Cesar; Cosentino, Viviana R; Pawluk, Mariela S; Campaña, Hebe; Gadow, Enrique C; Murray, Jeffrey C; Lopez-Camelo, Jorge S

    2017-09-01

    BackgroundPreterm birth (PTB) is the leading cause of neonatal mortality and morbidity. PTB is often classified according to clinical presentation as follows: idiopathic (PTB-I), preterm premature rupture of membranes (PTB-PPROM), and medically induced (PTB-M). The aim of this study was to evaluate the associations between specific candidate genes and clinical subtypes of PTB.MethodsTwenty-four single-nucleotide polymorphisms (SNPs) were genotyped in 18 candidate genes in 709 infant triads. Of them, 243 were PTB-I, 256 were PTB-PPROM, and 210 were PTB-M. These data were analyzed with a Family-Based Association.ResultsPTB was nominally associated with rs2272365 in PON1, rs883319 in KCNN3, rs4458044 in CRHR1, and rs610277 in F3. Regarding clinical subtypes analysis, three SNPs were associated with PTB-I (rs2272365 in PON1, rs10178458 in COL4A3, and rs4458044 in CRHR1), rs610277 in F3 was associated with PTB-PPROM, and rs883319 in KCNN3 and rs610277 in F3 were associated with PTB-M.ConclusionOur study identified polymorphisms potentially associated with specific clinical subtypes of PTB in this Latin American population. These results could suggest a specific role of such genes in the mechanisms involved in each clinical subtype. Further studies are required to confirm our results and to determine the role of these genes in the pathophysiology of clinical subtypes.

  11. RNA-Seq identification of candidate defense genes targeted by endophytic Bacillus cereus-mediated induced systemic resistance against Meloidogyne incognita in tomato.

    PubMed

    Hu, Haijing; Wang, Cong; Li, Xia; Tang, Yunyun; Wang, Yufang; Chen, Shuanglin; Yan, Shuzhen

    2018-05-08

    The endophytic bacteria Bacillus cereus BCM2 has shown great potential as a defense against the parasitic nematode Meloidogyne incognita. Here, we studied the endophytic bacteria-mediated plant defense against M. incognita and searched for defense-related candidate genes using RNA-Seq. The induced systemic resistance of BCM2 against M. incognita was tested using the split-root method. Pre-inoculated BCM2 on the inducer side was associated with a dramatic reduction in galls and egg masses at the responder side, but inoculated BCM2 alone did not produce the same effect. In order to investigate which plant defense-related genes are specifically activated by BCM2, four RNA samples from tomato roots were sequenced, and four high quality total clean bases were obtained, ranging from 6.64 to 6.75 Gb, with an average of 21558 total genes. The 34 candidate defense-related genes were identified by pair-wise comparison among libraries, representing the targets for BCM2 priming resistance against M. incognita. Functional characterization revealed that the plant-pathogen interaction pathway (ID: ko04626) was significantly enriched for BCM2-mediated M. incognita resistance. This study demonstrates that B. cereus BCM2 maintains a harmonious host-microbe relationship with tomato, but appeared to prime the plant, resulting in more vigorous defense response toward the infection nematode. This article is protected by copyright. All rights reserved.

  12. A Stratified Transcriptomics Analysis of Polygenic Fat and Lean Mouse Adipose Tissues Identifies Novel Candidate Obesity Genes

    PubMed Central

    Morton, Nicholas M.; Nelson, Yvonne B.; Michailidou, Zoi; Di Rollo, Emma M.; Ramage, Lynne; Hadoke, Patrick W. F.; Seckl, Jonathan R.; Bunger, Lutz; Horvat, Simon; Kenyon, Christopher J.; Dunbar, Donald R.

    2011-01-01

    Background Obesity and metabolic syndrome results from a complex interaction between genetic and environmental factors. In addition to brain-regulated processes, recent genome wide association studies have indicated that genes highly expressed in adipose tissue affect the distribution and function of fat and thus contribute to obesity. Using a stratified transcriptome gene enrichment approach we attempted to identify adipose tissue-specific obesity genes in the unique polygenic Fat (F) mouse strain generated by selective breeding over 60 generations for divergent adiposity from a comparator Lean (L) strain. Results To enrich for adipose tissue obesity genes a ‘snap-shot’ pooled-sample transcriptome comparison of key fat depots and non adipose tissues (muscle, liver, kidney) was performed. Known obesity quantitative trait loci (QTL) information for the model allowed us to further filter genes for increased likelihood of being causal or secondary for obesity. This successfully identified several genes previously linked to obesity (C1qr1, and Np3r) as positional QTL candidate genes elevated specifically in F line adipose tissue. A number of novel obesity candidate genes were also identified (Thbs1, Ppp1r3d, Tmepai, Trp53inp2, Ttc7b, Tuba1a, Fgf13, Fmr) that have inferred roles in fat cell function. Quantitative microarray analysis was then applied to the most phenotypically divergent adipose depot after exaggerating F and L strain differences with chronic high fat feeding which revealed a distinct gene expression profile of line, fat depot and diet-responsive inflammatory, angiogenic and metabolic pathways. Selected candidate genes Npr3 and Thbs1, as well as Gys2, a non-QTL gene that otherwise passed our enrichment criteria were characterised, revealing novel functional effects consistent with a contribution to obesity. Conclusions A focussed candidate gene enrichment strategy in the unique F and L model has identified novel adipose tissue-enriched genes contributing to obesity. PMID:21915269

  13. A stratified transcriptomics analysis of polygenic fat and lean mouse adipose tissues identifies novel candidate obesity genes.

    PubMed

    Morton, Nicholas M; Nelson, Yvonne B; Michailidou, Zoi; Di Rollo, Emma M; Ramage, Lynne; Hadoke, Patrick W F; Seckl, Jonathan R; Bunger, Lutz; Horvat, Simon; Kenyon, Christopher J; Dunbar, Donald R

    2011-01-01

    Obesity and metabolic syndrome results from a complex interaction between genetic and environmental factors. In addition to brain-regulated processes, recent genome wide association studies have indicated that genes highly expressed in adipose tissue affect the distribution and function of fat and thus contribute to obesity. Using a stratified transcriptome gene enrichment approach we attempted to identify adipose tissue-specific obesity genes in the unique polygenic Fat (F) mouse strain generated by selective breeding over 60 generations for divergent adiposity from a comparator Lean (L) strain. To enrich for adipose tissue obesity genes a 'snap-shot' pooled-sample transcriptome comparison of key fat depots and non adipose tissues (muscle, liver, kidney) was performed. Known obesity quantitative trait loci (QTL) information for the model allowed us to further filter genes for increased likelihood of being causal or secondary for obesity. This successfully identified several genes previously linked to obesity (C1qr1, and Np3r) as positional QTL candidate genes elevated specifically in F line adipose tissue. A number of novel obesity candidate genes were also identified (Thbs1, Ppp1r3d, Tmepai, Trp53inp2, Ttc7b, Tuba1a, Fgf13, Fmr) that have inferred roles in fat cell function. Quantitative microarray analysis was then applied to the most phenotypically divergent adipose depot after exaggerating F and L strain differences with chronic high fat feeding which revealed a distinct gene expression profile of line, fat depot and diet-responsive inflammatory, angiogenic and metabolic pathways. Selected candidate genes Npr3 and Thbs1, as well as Gys2, a non-QTL gene that otherwise passed our enrichment criteria were characterised, revealing novel functional effects consistent with a contribution to obesity. A focussed candidate gene enrichment strategy in the unique F and L model has identified novel adipose tissue-enriched genes contributing to obesity.

  14. A whole genome SNP genotyping by DNA microarray and candidate gene association study for kidney stone disease

    PubMed Central

    2014-01-01

    Background Kidney stone disease (KSD) is a complex disorder with unknown etiology in majority of the patients. Genetic and environmental factors may cause the disease. In the present study, we used DNA microarray to genotype single nucleotide polymorphisms (SNP) and performed candidate gene association analysis to determine genetic variations associated with the disease. Methods A whole genome SNP genotyping by DNA microarray was initially conducted in 101 patients and 105 control subjects. A set of 104 candidate genes reported to be involved in KSD, gathered from public databases and candidate gene association study databases, were evaluated for their variations associated with KSD. Results Altogether 82 SNPs distributed within 22 candidate gene regions showed significant differences in SNP allele frequencies between the patient and control groups (P < 0.05). Of these, 4 genes including BGLAP, AHSG, CD44, and HAO1, encoding osteocalcin, fetuin-A, CD44-molecule and glycolate oxidase 1, respectively, were further assessed for their associations with the disease because they carried high proportion of SNPs with statistical differences of allele frequencies between the patient and control groups within the gene. The total of 26 SNPs showed significant differences of allele frequencies between the patient and control groups and haplotypes associated with disease risk were identified. The SNP rs759330 located 144 bp downstream of BGLAP where it is a predicted microRNA binding site at 3′UTR of PAQR6 – a gene encoding progestin and adipoQ receptor family member VI, was genotyped in 216 patients and 216 control subjects and found to have significant differences in its genotype and allele frequencies (P = 0.0007, OR 2.02 and P = 0.0001, OR 2.02, respectively). Conclusions Our results suggest that these candidate genes are associated with KSD and PAQR6 comes into our view as the most potent candidate since associated SNP rs759330 is located in the miRNA binding site and may affect mRNA expression level. PMID:24886237

  15. A de novo transcriptome and valid reference genes for quantitative real-time PCR in Colaphellus bowringi.

    PubMed

    Tan, Qian-Qian; Zhu, Li; Li, Yi; Liu, Wen; Ma, Wei-Hua; Lei, Chao-Liang; Wang, Xiao-Ping

    2015-01-01

    The cabbage beetle Colaphellus bowringi Baly is a serious insect pest of crucifers and undergoes reproductive diapause in soil. An understanding of the molecular mechanisms of diapause regulation, insecticide resistance, and other physiological processes is helpful for developing new management strategies for this beetle. However, the lack of genomic information and valid reference genes limits knowledge on the molecular bases of these physiological processes in this species. Using Illumina sequencing, we obtained more than 57 million sequence reads derived from C. bowringi, which were assembled into 39,390 unique sequences. A Clusters of Orthologous Groups classification was obtained for 9,048 of these sequences, covering 25 categories, and 16,951 were assigned to 255 Kyoto Encyclopedia of Genes and Genomes pathways. Eleven candidate reference gene sequences from the transcriptome were then identified through reverse transcriptase polymerase chain reaction. Among these candidate genes, EF1α, ACT1, and RPL19 proved to be the most stable reference genes for different reverse transcriptase quantitative polymerase chain reaction experiments in C. bowringi. Conversely, aTUB and GAPDH were the least stable reference genes. The abundant putative C. bowringi transcript sequences reported enrich the genomic resources of this beetle. Importantly, the larger number of gene sequences and valid reference genes provide a valuable platform for future gene expression studies, especially with regard to exploring the molecular mechanisms of different physiological processes in this species.

  16. A data science approach to candidate gene selection of pain regarded as a process of learning and neural plasticity.

    PubMed

    Ultsch, Alfred; Kringel, Dario; Kalso, Eija; Mogil, Jeffrey S; Lötsch, Jörn

    2016-12-01

    The increasing availability of "big data" enables novel research approaches to chronic pain while also requiring novel techniques for data mining and knowledge discovery. We used machine learning to combine the knowledge about n = 535 genes identified empirically as relevant to pain with the knowledge about the functions of thousands of genes. Starting from an accepted description of chronic pain as displaying systemic features described by the terms "learning" and "neuronal plasticity," a functional genomics analysis proposed that among the functions of the 535 "pain genes," the biological processes "learning or memory" (P = 8.6 × 10) and "nervous system development" (P = 2.4 × 10) are statistically significantly overrepresented as compared with the annotations to these processes expected by chance. After establishing that the hypothesized biological processes were among important functional genomics features of pain, a subset of n = 34 pain genes were found to be annotated with both Gene Ontology terms. Published empirical evidence supporting their involvement in chronic pain was identified for almost all these genes, including 1 gene identified in March 2016 as being involved in pain. By contrast, such evidence was virtually absent in a randomly selected set of 34 other human genes. Hence, the present computational functional genomics-based method can be used for candidate gene selection, providing an alternative to established methods.

  17. MIPHENO: Data normalization for high throughput metabolic analysis.

    EPA Science Inventory

    High throughput methodologies such as microarrays, mass spectrometry and plate-based small molecule screens are increasingly used to facilitate discoveries from gene function to drug candidate identification. These large-scale experiments are typically carried out over the course...

  18. [Identification of candidate genes and expression profiles, as doping biomarkers].

    PubMed

    Paparini, A; Impagnatiello, F; Pistilli, A; Rinaldi, M; Gianfranceschi, G; Signori, E; Stabile, A M; Fazio, V; Rende, M; Romano Spica, V

    2007-01-01

    Administration of prohibited substances to enhance athletic performance represents an emerging medical, social, ethical and legal issue. Traditional controls are based on direct detection of substances or their catabolites. However out-of-competition doping may not be easily revealed by standard analytical methods. Alternative indirect control strategies are based on the evaluation of mid- and long-term effects of doping in tissues. Drug-induced long-lasting changes of gene expression may be taken as effective indicators of doping exposure. To validate this approach, we used real-time PCR to monitor the expression pattern of selected genes in human haematopoietic cells exposed to nandrolone, insulin-like growth factor I (IGF-I) or growth hormone (GH). Some candidate genes were found significantly and consistently modulated by treatments. Nandrolone up-regulated AR, ESR2 and PGR in K562 cells, and SRD5A1, PPARA and JAK2 in Jurkat cells; IGF-I up-regulated EPOR and PGR in HL60 cells, and SRD5A1 in Jurkat; GH up-regulated SRD5A1 and GHR in K562. GATA1 expression was down-regulated in IGF-1-treated HL60, ESR2 was down-regulated in nandrolone-treated Jurkat, and AR and PGR were down-regulated in GH-treated Jurkat. This pilot study shows the potential of molecular biology-based strategies in anti-doping controls.

  19. Analysis of Craniocardiac Malformations in Xenopus using Optical Coherence Tomography

    PubMed Central

    Deniz, Engin; Jonas, Stephan; Hooper, Michael; N. Griffin, John; Choma, Michael A.; Khokha, Mustafa K.

    2017-01-01

    Birth defects affect 3% of children in the United States. Among the birth defects, congenital heart disease and craniofacial malformations are major causes of mortality and morbidity. Unfortunately, the genetic mechanisms underlying craniocardiac malformations remain largely uncharacterized. To address this, human genomic studies are identifying sequence variations in patients, resulting in numerous candidate genes. However, the molecular mechanisms of pathogenesis for most candidate genes are unknown. Therefore, there is a need for functional analyses in rapid and efficient animal models of human disease. Here, we coupled the frog Xenopus tropicalis with Optical Coherence Tomography (OCT) to create a fast and efficient system for testing craniocardiac candidate genes. OCT can image cross-sections of microscopic structures in vivo at resolutions approaching histology. Here, we identify optimal OCT imaging planes to visualize and quantitate Xenopus heart and facial structures establishing normative data. Next we evaluate known human congenital heart diseases: cardiomyopathy and heterotaxy. Finally, we examine craniofacial defects by a known human teratogen, cyclopamine. We recapitulate human phenotypes readily and quantify the functional and structural defects. Using this approach, we can quickly test human craniocardiac candidate genes for phenocopy as a critical first step towards understanding disease mechanisms of the candidate genes. PMID:28195132

  20. Fine mapping and identification of candidate genes for the sy-2 locus in a temperature-sensitive chili pepper (Capsicum chinense).

    PubMed

    Liu, Li; Venkatesh, Jelli; Jo, Yeong Deuk; Koeda, Sota; Hosokawa, Munetaka; Kang, Jin-Ho; Goritschnig, Sandra; Kang, Byoung-Cheorl

    2016-08-01

    The sy - 2 temperature-sensitive gene from Capsicum chinense was fine mapped to a 138.8-kb region at the distal portion of pepper chromosome 1. Based on expression analyses, two putative F-box genes were identified as sy - 2 candidate genes. Seychelles-2 ('sy-2') is a temperature-sensitive natural mutant of Capsicum chinense, which exhibits an abnormal leaf phenotype when grown at temperatures below 24 °C. We previously showed that the sy-2 phenotype is controlled by a single recessive gene, sy-2, located on pepper chromosome 1. In this study, a high-resolution genetic and physical map for the sy-2 locus was constructed using two individual F2 mapping populations derived from a cross between C. chinense mutant 'sy-2' and wild-type 'No. 3341'. The sy-2 gene was fine mapped to a 138.8-kb region between markers SNP 5-5 and SNP 3-8 at the distal portion of chromosome 1, based on comparative genomic analysis and genomic information from pepper. The sy-2 target region was predicted to contain 27 genes. Expression analysis of these predicted genes showed a differential expression pattern for ORF10 and ORF20 between mutant and wild-type plants; with both having significantly lower expression in 'sy-2' than in wild-type plants. In addition, the coding sequences of both ORF10 and ORF20 contained single nucleotide polymorphisms (SNPs) causing amino acid changes, which may have important functional consequences. ORF10 and ORF20 are predicted to encode F-box proteins, which are components of the SCF complex. Based on the differential expression pattern and the presence of nonsynonymous SNPs, we suggest that these two putative F-box genes are most likely responsible for the temperature-sensitive phenotypes in pepper. Further investigation of these genes may enable a better understanding of the molecular mechanisms of low temperature sensitivity in plants.

  1. Using Association Mapping in Teosinte (Zea Mays ssp Parviglumis) to Investigate the Function of Selection-Candidate Genes

    USDA-ARS?s Scientific Manuscript database

    Large-scale screens of the maize genome identified 48 genes that show the putative signature of artificial selection during maize domestication or improvement. These selection-candidate genes may act as quantitative trait loci (QTL) that control the phenotypic differences between maize and its proge...

  2. The genome sequence of the most widely cultivated cacao type and its use to identify candidate genes regulating pod color.

    PubMed

    Motamayor, Juan C; Mockaitis, Keithanne; Schmutz, Jeremy; Haiminen, Niina; Livingstone, Donald; Cornejo, Omar; Findley, Seth D; Zheng, Ping; Utro, Filippo; Royaert, Stefan; Saski, Christopher; Jenkins, Jerry; Podicheti, Ram; Zhao, Meixia; Scheffler, Brian E; Stack, Joseph C; Feltus, Frank A; Mustiga, Guiliana M; Amores, Freddy; Phillips, Wilbert; Marelli, Jean Philippe; May, Gregory D; Shapiro, Howard; Ma, Jianxin; Bustamante, Carlos D; Schnell, Raymond J; Main, Dorrie; Gilbert, Don; Parida, Laxmi; Kuhn, David N

    2013-06-03

    Theobroma cacao L. cultivar Matina 1-6 belongs to the most cultivated cacao type. The availability of its genome sequence and methods for identifying genes responsible for important cacao traits will aid cacao researchers and breeders. We describe the sequencing and assembly of the genome of Theobroma cacao L. cultivar Matina 1-6. The genome of the Matina 1-6 cultivar is 445 Mbp, which is significantly larger than a sequenced Criollo cultivar, and more typical of other cultivars. The chromosome-scale assembly, version 1.1, contains 711 scaffolds covering 346.0 Mbp, with a contig N50 of 84.4 kbp, a scaffold N50 of 34.4 Mbp, and an evidence-based gene set of 29,408 loci. Version 1.1 has 10x the scaffold N50 and 4x the contig N50 as Criollo, and includes 111 Mb more anchored sequence. The version 1.1 assembly has 4.4% gap sequence, while Criollo has 10.9%. Through a combination of haplotype, association mapping and gene expression analyses, we leverage this robust reference genome to identify a promising candidate gene responsible for pod color variation. We demonstrate that green/red pod color in cacao is likely regulated by the R2R3 MYB transcription factor TcMYB113, homologs of which determine pigmentation in Rosaceae, Solanaceae, and Brassicaceae. One SNP within the target site for a highly conserved trans-acting siRNA in dicots, found within TcMYB113, seems to affect transcript levels of this gene and therefore pod color variation. We report a high-quality sequence and annotation of Theobroma cacao L. and demonstrate its utility in identifying candidate genes regulating traits.

  3. Phenome-driven disease genetics prediction toward drug discovery.

    PubMed

    Chen, Yang; Li, Li; Zhang, Guo-Qiang; Xu, Rong

    2015-06-15

    Discerning genetic contributions to diseases not only enhances our understanding of disease mechanisms, but also leads to translational opportunities for drug discovery. Recent computational approaches incorporate disease phenotypic similarities to improve the prediction power of disease gene discovery. However, most current studies used only one data source of human disease phenotype. We present an innovative and generic strategy for combining multiple different data sources of human disease phenotype and predicting disease-associated genes from integrated phenotypic and genomic data. To demonstrate our approach, we explored a new phenotype database from biomedical ontologies and constructed Disease Manifestation Network (DMN). We combined DMN with mimMiner, which was a widely used phenotype database in disease gene prediction studies. Our approach achieved significantly improved performance over a baseline method, which used only one phenotype data source. In the leave-one-out cross-validation and de novo gene prediction analysis, our approach achieved the area under the curves of 90.7% and 90.3%, which are significantly higher than 84.2% (P < e(-4)) and 81.3% (P < e(-12)) for the baseline approach. We further demonstrated that our predicted genes have the translational potential in drug discovery. We used Crohn's disease as an example and ranked the candidate drugs based on the rank of drug targets. Our gene prediction approach prioritized druggable genes that are likely to be associated with Crohn's disease pathogenesis, and our rank of candidate drugs successfully prioritized the Food and Drug Administration-approved drugs for Crohn's disease. We also found literature evidence to support a number of drugs among the top 200 candidates. In summary, we demonstrated that a novel strategy combining unique disease phenotype data with system approaches can lead to rapid drug discovery. nlp. edu/public/data/DMN © The Author 2015. Published by Oxford University Press.

  4. Fine Mapping Identifies SmFAS Encoding an Anthocyanidin Synthase as a Putative Candidate Gene for Flower Purple Color in Solanum melongena L.

    PubMed Central

    Chen, Mengqiang; Xu, Mengyun; Xiao, Yao; Cui, Dandan; Qin, Yongqiang; Wu, Jiaqi; Wang, Wenyi; Wang, Guoping

    2018-01-01

    Anthocyanins are the main pigments in flowers and fruits. These pigments are responsible for the red, red-purple, violet, and purple color in plants, and act as insect and animal attractants. In this study, phenotypic analysis of the purple flower color in eggplant indicated that the flower color is controlled by a single dominant gene, FAS. Using an F2 mapping population derived from a cross between purple-flowered ‘Blacknite’ and white-flowered ‘Small Round’, Flower Anthocyanidin Synthase (FAS) was fine mapped to an approximately 165.6-kb region between InDel marker Indel8-11 and Cleaved Amplified Polymorphic Sequences (CAPS) marker Efc8-32 on Chromosome 8. On the basis of bioinformatic analysis, 29 genes were subsequently located in the FAS target region, among which were two potential Anthocyanidin Synthase (ANS) gene candidates. Allelic sequence comparison results showed that one ANS gene (Sme2.5_01638.1_g00003.1) was conserved in promoter and coding sequences without any nucleotide change between parents, whereas four single-nucleotide polymorphisms were detected in another ANS gene (Sme2.5_01638.1_g00005.1). Crucially, a single base pair deletion at site 438 resulted in premature termination of FAS, leading to the loss of anthocyanin accumulation. In addition, FAS displayed strong expression in purple flowers compared with white flowers and other tissues. Collectively, our results indicate that Sme2.5_01638.1_g00005.1 is a good candidate gene for FAS, which controls anthocyanidin synthase in eggplant flowers. The present study provides information for further potential facilitate genetic engineering for improvement of anthocyanin levels in plants. PMID:29522465

  5. Adaptations to Climate in Candidate Genes for Common Metabolic Disorders

    PubMed Central

    Hancock, Angela M; Witonsky, David B; Gordon, Adam S; Eshel, Gidon; Pritchard, Jonathan K; Coop, Graham; Di Rienzo, Anna

    2008-01-01

    Evolutionary pressures due to variation in climate play an important role in shaping phenotypic variation among and within species and have been shown to influence variation in phenotypes such as body shape and size among humans. Genes involved in energy metabolism are likely to be central to heat and cold tolerance. To test the hypothesis that climate shaped variation in metabolism genes in humans, we used a bioinformatics approach based on network theory to select 82 candidate genes for common metabolic disorders. We genotyped 873 tag SNPs in these genes in 54 worldwide populations (including the 52 in the Human Genome Diversity Project panel) and found correlations with climate variables using rank correlation analysis and a newly developed method termed Bayesian geographic analysis. In addition, we genotyped 210 carefully matched control SNPs to provide an empirical null distribution for spatial patterns of allele frequency due to population history alone. For nearly all climate variables, we found an excess of genic SNPs in the tail of the distributions of the test statistics compared to the control SNPs, implying that metabolic genes as a group show signals of spatially varying selection. Among our strongest signals were several SNPs (e.g., LEPR R109K, FABP2 A54T) that had previously been associated with phenotypes directly related to cold tolerance. Since variation in climate may be correlated with other aspects of environmental variation, it is possible that some of the signals that we detected reflect selective pressures other than climate. Nevertheless, our results are consistent with the idea that climate has been an important selective pressure acting on candidate genes for common metabolic disorders. PMID:18282109

  6. The genome sequence of the most widely cultivated cacao type and its use to identify candidate genes regulating pod color

    PubMed Central

    2013-01-01

    Background Theobroma cacao L. cultivar Matina 1-6 belongs to the most cultivated cacao type. The availability of its genome sequence and methods for identifying genes responsible for important cacao traits will aid cacao researchers and breeders. Results We describe the sequencing and assembly of the genome of Theobroma cacao L. cultivar Matina 1-6. The genome of the Matina 1-6 cultivar is 445 Mbp, which is significantly larger than a sequenced Criollo cultivar, and more typical of other cultivars. The chromosome-scale assembly, version 1.1, contains 711 scaffolds covering 346.0 Mbp, with a contig N50 of 84.4 kbp, a scaffold N50 of 34.4 Mbp, and an evidence-based gene set of 29,408 loci. Version 1.1 has 10x the scaffold N50 and 4x the contig N50 as Criollo, and includes 111 Mb more anchored sequence. The version 1.1 assembly has 4.4% gap sequence, while Criollo has 10.9%. Through a combination of haplotype, association mapping and gene expression analyses, we leverage this robust reference genome to identify a promising candidate gene responsible for pod color variation. We demonstrate that green/red pod color in cacao is likely regulated by the R2R3 MYB transcription factor TcMYB113, homologs of which determine pigmentation in Rosaceae, Solanaceae, and Brassicaceae. One SNP within the target site for a highly conserved trans-acting siRNA in dicots, found within TcMYB113, seems to affect transcript levels of this gene and therefore pod color variation. Conclusions We report a high-quality sequence and annotation of Theobroma cacao L. and demonstrate its utility in identifying candidate genes regulating traits. PMID:23731509

  7. Candidate genes for alcohol dependence: A genetic association study from India.

    PubMed

    Malhotra, Savita; Basu, Debasish; Khullar, Madhu; Ghosh, Abhishek; Chugh, Neera

    2016-11-01

    Search for candidate genes for alcohol dependence (AD) has been inconsistent and inconclusive. Moreover, most of the research has been confined to a few specific ethnic groups. Hence, the aim of our study was to explore specific candidate genes for AD in north Indian male population. In this clinic-based genetic association study, 210 males with AD and 200 controls matched for age, gender and ethnicity were recruited from the clinic and the general population, respectively. Cases were diagnosed with Semi-structured Assessment for Genetics of Alcoholism-II (SSAGA-II). Single-nucleotide polymorphism genotyping was done by real-time quantitative-polymerase chain reaction (PCR) using Taq Man assay (ABI 7500) fast real-time PCR system. Both at the genotypic level and at allelic frequency, Met158 variant of catechol-O-methyl transferase (COMT) showed significant increase in cases as compared to controls. The frequency of heterozygous genotype (A/G) of gamma-aminobutyric acid receptor A1 (GABRA1) was significantly lower in cases as compared to controls. Likewise, for GABRA2, the frequency of homozygous recessive genotype (G/G) was significantly higher in the control group. With respect to the 5-hydroxytryptamine (5HT) transporter long promoter region (5HTTLPR), cholinergic receptor muscarinic (CHRM2) and alcohol dehydrogenase 1B (ADH1B) genes, there was no significant difference between the cases and the controls. Aldehyde dehydrogenase (ALDH2) gene was found to be monomorphic in our study population. Our study findings showed COMT polymorphism conferring risk and GABRA polymorphism as a protective genotype for Indian male with AD. Genes for alcohol metabolism, serotonin transporter and cholinergic receptor gene polymorphism were perhaps not contributory to AD for Indian population.

  8. Genome-wide association study for host response to bovine leukemia virus in Holstein cows.

    PubMed

    Brym, P; Bojarojć-Nosowicz, B; Oleński, K; Hering, D M; Ruść, A; Kaczmarczyk, E; Kamiński, S

    2016-07-01

    The mechanisms of leukemogenesis induced by bovine leukemia virus (BLV) and the processes underlying the phenomenon of differential host response to BLV infection still remain poorly understood. The aim of the study was to screen the entire cattle genome to identify markers and candidate genes that might be involved in host response to bovine leukemia virus infection. A genome-wide association study was performed using Holstein cows naturally infected by BLV. A data set included 43 cows (BLV positive) and 30 cows (BLV negative) genotyped for 54,609 SNP markers (Illumina Bovine SNP50 BeadChip). The BLV status of cows was determined by serum ELISA, nested-PCR and hematological counts. Linear Regression Analysis with a False Discovery Rate and kinship matrix (computed on the autosomal SNPs) was calculated to find out which SNP markers significantly differentiate BLV-positive and BLV-negative cows. Nine markers reached genome-wide significance. The most significant SNPs were located on chromosomes 23 (rs41583098), 3 (rs109405425, rs110785500) and 8 (rs43564499) in close vicinity of a patatin-like phospholipase domain containing 1 (PNPLA1); adaptor-related protein complex 4, beta 1 subunit (AP4B1); tripartite motif-containing 45 (TRIM45) and cell division cycle associated 2 (CDCA2) genes, respectively. Furthermore, a list of 41 candidate genes was composed based on their proximity to significant markers (within a distance of ca. 1 Mb) and functional involvement in processes potentially underlying BLV-induced pathogenesis. In conclusion, it was demonstrated that host response to BLV infection involves nine sub-regions of the cattle genome (represented by 9 SNP markers), containing many genes which, based on the literature, could be involved to enzootic bovine leukemia progression. New group of promising candidate genes associated with the host response to BLV infection were identified and could therefore be a target for future studies. The functions of candidate genes surrounding significant SNP markers imply that there is no single regulatory process that is solely targeted by BLV infection, but rather the network of interrelated pathways is deregulated, leading to the disruption of the control of B-cell proliferation and programmed cell death. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Knowledge Discovery in Biological Databases for Revealing Candidate Genes Linked to Complex Phenotypes.

    PubMed

    Hassani-Pak, Keywan; Rawlings, Christopher

    2017-06-13

    Genetics and "omics" studies designed to uncover genotype to phenotype relationships often identify large numbers of potential candidate genes, among which the causal genes are hidden. Scientists generally lack the time and technical expertise to review all relevant information available from the literature, from key model species and from a potentially wide range of related biological databases in a variety of data formats with variable quality and coverage. Computational tools are needed for the integration and evaluation of heterogeneous information in order to prioritise candidate genes and components of interaction networks that, if perturbed through potential interventions, have a positive impact on the biological outcome in the whole organism without producing negative side effects. Here we review several bioinformatics tools and databases that play an important role in biological knowledge discovery and candidate gene prioritization. We conclude with several key challenges that need to be addressed in order to facilitate biological knowledge discovery in the future.

  10. Time-course microarray analysis for identifying candidate genes involved in obesity-associated pathological changes in the mouse colon.

    PubMed

    Bae, Yun Jung; Kim, Sung-Eun; Hong, Seong Yeon; Park, Taesun; Lee, Sang Gyu; Choi, Myung-Sook; Sung, Mi-Kyung

    2016-01-01

    Obesity is known to increase the risk of colorectal cancer. However, mechanisms underlying the pathogenesis of obesity-induced colorectal cancer are not completely understood. The purposes of this study were to identify differentially expressed genes in the colon of mice with diet-induced obesity and to select candidate genes as early markers of obesity-associated abnormal cell growth in the colon. C57BL/6N mice were fed normal diet (11% fat energy) or high-fat diet (40% fat energy) and were euthanized at different time points. Genome-wide expression profiles of the colon were determined at 2, 4, 8, and 12 weeks. Cluster analysis was performed using expression data of genes showing log 2 fold change of ≥1 or ≤-1 (twofold change), based on time-dependent expression patterns, followed by virtual network analysis. High-fat diet-fed mice showed significant increase in body weight and total visceral fat weight over 12 weeks. Time-course microarray analysis showed that 50, 47, 36, and 411 genes were differentially expressed at 2, 4, 8, and 12 weeks, respectively. Ten cluster profiles representing distinguishable patterns of genes differentially expressed over time were determined. Cluster 4, which consisted of genes showing the most significant alterations in expression in response to high-fat diet over 12 weeks, included Apoa4 (apolipoprotein A-IV), Ppap2b (phosphatidic acid phosphatase type 2B), Cel (carboxyl ester lipase), and Clps (colipase, pancreatic), which interacted strongly with surrounding genes associated with colorectal cancer or obesity. Our data indicate that Apoa4 , Ppap2b , Cel , and Clps are candidate early marker genes associated with obesity-related pathological changes in the colon. Genome-wide analyses performed in the present study provide new insights on selecting novel genes that may be associated with the development of diseases of the colon.

  11. Analysis of 60 reported glioma risk SNPs replicates published GWAS findings but fails to replicate associations from published candidate-gene studies.

    PubMed

    Walsh, Kyle M; Anderson, Erik; Hansen, Helen M; Decker, Paul A; Kosel, Matt L; Kollmeyer, Thomas; Rice, Terri; Zheng, Shichun; Xiao, Yuanyuan; Chang, Jeffrey S; McCoy, Lucie S; Bracci, Paige M; Wiemels, Joe L; Pico, Alexander R; Smirnov, Ivan; Lachance, Daniel H; Sicotte, Hugues; Eckel-Passow, Jeanette E; Wiencke, John K; Jenkins, Robert B; Wrensch, Margaret R

    2013-02-01

    Genomewide association studies (GWAS) and candidate-gene studies have implicated single-nucleotide polymorphisms (SNPs) in at least 45 different genes as putative glioma risk factors. Attempts to validate these associations have yielded variable results and few genetic risk factors have been consistently replicated. We conducted a case-control study of Caucasian glioma cases and controls from the University of California San Francisco (810 cases, 512 controls) and the Mayo Clinic (852 cases, 789 controls) in an attempt to replicate previously reported genetic risk factors for glioma. Sixty SNPs selected from the literature (eight from GWAS and 52 from candidate-gene studies) were successfully genotyped on an Illumina custom genotyping panel. Eight SNPs in/near seven different genes (TERT, EGFR, CCDC26, CDKN2A, PHLDB1, RTEL1, TP53) were significantly associated with glioma risk in the combined dataset (P < 0.05), with all associations in the same direction as in previous reports. Several SNP associations showed considerable differences across histologic subtype. All eight successfully replicated associations were first identified by GWAS, although none of the putative risk SNPs from candidate-gene studies was associated in the full case-control sample (all P values > 0.05). Although several confirmed associations are located near genes long known to be involved in gliomagenesis (e.g., EGFR, CDKN2A, TP53), these associations were first discovered by the GWAS approach and are in noncoding regions. These results highlight that the deficiencies of the candidate-gene approach lay in selecting both appropriate genes and relevant SNPs within these genes. © 2012 WILEY PERIODICALS, INC.

  12. Candidate EDA targets revealed by expression profiling of primary keratinocytes from Tabby mutant mice

    PubMed Central

    Esibizione, Diana; Cui, Chang-Yi; Schlessinger, David

    2009-01-01

    EDA, the gene mutated in anhidrotic ectodermal dysplasia, encodes ectodysplasin, a TNF superfamily member that activates NF-kB mediated transcription. To identify EDA target genes, we have earlier used expression profiling to infer genes differentially expressed at various developmental time points in Tabby (Eda-deficient) compared to wild-type mouse skin. To increase the resolution to find genes whose expression may be restricted to epidermal cells, we have now extended studies to primary keratinocyte cultures established from E19 wild-type and Tabby skin. Using microarrays bearing 44,000 gene probes, we found 385 preliminary candidate genes whose expression was significantly affected by Eda loss. By comparing expression profiles to those from Eda-A1 transgenic skin, we restricted the list to 38 “candidate EDA targets”, 14 of which were already known to be expressed in hair follicles or epidermis. We confirmed expression changes for 3 selected genes, Tbx1, Bmp7, and Jag1, both in keratinocytes and in whole skin, by Q-PCR and Western blotting analyses. Thus, by the analysis of keratinocytes, novel candidate pathways downstream of EDA were detected. PMID:18848976

  13. A comprehensive study of the genomic differentiation between temperate Dent and Flint maize.

    PubMed

    Unterseer, Sandra; Pophaly, Saurabh D; Peis, Regina; Westermeier, Peter; Mayer, Manfred; Seidel, Michael A; Haberer, Georg; Mayer, Klaus F X; Ordas, Bernardo; Pausch, Hubert; Tellier, Aurélien; Bauer, Eva; Schön, Chris-Carolin

    2016-07-08

    Dent and Flint represent two major germplasm pools exploited in maize breeding. Several traits differentiate the two pools, like cold tolerance, early vigor, and flowering time. A comparative investigation of their genomic architecture relevant for quantitative trait expression has not been reported so far. Understanding the genomic differences between germplasm pools may contribute to a better understanding of the complementarity in heterotic patterns exploited in hybrid breeding and of mechanisms involved in adaptation to different environments. We perform whole-genome screens for signatures of selection specific to temperate Dent and Flint maize by comparing high-density genotyping data of 70 American and European Dent and 66 European Flint inbred lines. We find 2.2 % and 1.4 % of the genes are under selective pressure, respectively, and identify candidate genes associated with agronomic traits known to differ between the two pools. Taking flowering time as an example for the differentiation between Dent and Flint, we investigate candidate genes involved in the flowering network by phenotypic analyses in a Dent-Flint introgression library and find that the Flint haplotypes of the candidates promote earlier flowering. Within the flowering network, the majority of Flint candidates are associated with endogenous pathways in contrast to Dent candidate genes, which are mainly involved in response to environmental factors like light and photoperiod. The diversity patterns of the candidates in a unique panel of more than 900 individuals from 38 European landraces indicate a major contribution of landraces from France, Germany, and Spain to the candidate gene diversity of the Flint elite lines. In this study, we report the investigation of pool-specific differences between temperate Dent and Flint on a genome-wide scale. The identified candidate genes represent a promising source for the functional investigation of pool-specific haplotypes in different genetic backgrounds and for the evaluation of their potential for future crop improvement like the adaptation to specific environments.

  14. Identification of candidate genes associated with fibromyalgia susceptibility in southern Spanish women: the al-Ándalus project.

    PubMed

    Estévez-López, Fernando; Camiletti-Moirón, Daniel; Aparicio, Virginia A; Segura-Jiménez, Víctor; Álvarez-Gallardo, Inmaculada C; Soriano-Maldonado, Alberto; Borges-Cosic, Milkana; Acosta-Manzano, Pedro; Geenen, Rinie; Delgado-Fernández, Manuel; Martínez-González, Luis J; Ruiz, Jonatan R; Álvarez-Cubero, María J

    2018-02-27

    Candidate-gene studies on fibromyalgia susceptibility often include a small number of single nucleotide polymorphisms (SNPs), which is a limitation. Moreover, there is a paucity of evidence in Europe. Therefore, we compared genotype frequencies of candidate SNPs in a well-characterised sample of Spanish women with fibromyalgia and healthy non-fibromyalgia women. A total of 314 women with a diagnosis of fibromyalgia (cases) and 112 non-fibromyalgia healthy (controls) women participated in this candidate-gene study. Buccal swabs were collected for DNA extraction. Using TaqMan™ OpenArray™, we analysed 61 SNPs of 33 genes related to fibromyalgia susceptibility, symptoms, or potential mechanisms. We observed that the rs841 and rs1799971 GG genotype was more frequently observed in fibromyalgia than in controls (p = 0.04 and p = 0.02, respectively). The rs2097903 AT/TT genotypes were also more often present in the fibromyalgia participants than in their control peers (p = 0.04). There were no differences for the remaining SNPs. We identified, for the first time, associations of the rs841 (guanosine triphosphate cyclohydrolase 1 gene) and rs2097903 (catechol-O-methyltransferase gene) SNPs with higher risk of fibromyalgia susceptibility. We also confirmed that the rs1799971 SNP (opioid receptor μ1 gene) might confer genetic risk of fibromyalgia. We did not adjust for multiple comparisons, which would be too stringent and yield to non-significant differences in the genotype frequencies between cases and controls. Our findings may be biologically meaningful and informative, and should be further investigated in other populations. Of particular interest is to replicate the present study in a larger independent sample to confirm or refute our findings. On the other hand, by including 61 SNPs of 33 candidate-genes with a strong rationale (they were previously investigated in relation to fibromyalgia susceptibility, symptoms or potential mechanisms), the present research is the most comprehensive candidate-gene study on fibromyalgia susceptibility to date.

  15. Genetics of primary ovarian insufficiency: new developments and opportunities

    PubMed Central

    Qin, Yingying; Jiao, Xue; Simpson, Joe Leigh; Chen, Zi-Jiang

    2015-01-01

    BACKGROUND Primary ovarian insufficiency (POI) is characterized by marked heterogeneity, but with a significant genetic contribution. Identifying exact causative genes has been challenging, with many discoveries not replicated. It is timely to take stock of the field, outlining the progress made, framing the controversies and anticipating future directions in elucidating the genetics of POI. METHODS A search for original articles published up to May 2015 was performed using PubMed and Google Scholar, identifying studies on the genetic etiology of POI. Studies were included if chromosomal analysis, candidate gene screening and a genome-wide study were conducted. Articles identified were restricted to English language full-text papers. RESULTS Chromosomal abnormalities have long been recognized as a frequent cause of POI, with a currently estimated prevalence of 10–13%. Using the traditional karyotype methodology, monosomy X, mosaicism, X chromosome deletions and rearrangements, X-autosome translocations, and isochromosomes have been detected. Based on candidate gene studies, single gene perturbations unequivocally having a deleterious effect in at least one population include Bone morphogenetic protein 15 (BMP15), Progesterone receptor membrane component 1 (PGRMC1), and Fragile X mental retardation 1 (FMR1) premutation on the X chromosome; Growth differentiation factor 9 (GDF9), Folliculogenesis specific bHLH transcription factor (FIGLA), Newborn ovary homeobox gene (NOBOX), Nuclear receptor subfamily 5, group A, member 1 (NR5A1) and Nanos homolog 3 (NANOS3) seem likely as well, but mostly being found in no more than 1–2% of a single population studied. Whole genome approaches have utilized genome-wide association studies (GWAS) to reveal loci not predicted on the basis of a candidate gene, but it remains difficult to locate causative genes and susceptible loci were not always replicated. Cytogenomic methods (array CGH) have identified other regions of interest but studies have not shown consistent results, the resolution of arrays has varied and replication is uncommon. Whole-exome sequencing in non-syndromic POI kindreds has only recently begun, revealing mutations in the Stromal antigen 3 (STAG3), Synaptonemal complex central element 1 (SYCE1), minichromosome maintenance complex component 8 and 9 (MCM8, MCM9) and ATP-dependent DNA helicase homolog (HFM1) genes. Given the slow progress in candidate-gene analysis and relatively small sample sizes available for GWAS, family-based whole exome and whole genome sequencing appear to be the most promising approaches for detecting potential genes responsible for POI. CONCLUSION Taken together, the cytogenetic, cytogenomic (array CGH) and exome sequencing approaches have revealed a genetic causation in ∼20–25% of POI cases. Uncovering the remainder of the causative genes will be facilitated not only by whole genome approaches involving larger cohorts in multiple populations but also incorporating environmental exposures and exploring signaling pathways in intragenic and intergenic regions that point to perturbations in regulatory genes and networks. PMID:26243799

  16. Genetics of primary ovarian insufficiency: new developments and opportunities.

    PubMed

    Qin, Yingying; Jiao, Xue; Simpson, Joe Leigh; Chen, Zi-Jiang

    2015-01-01

    Primary ovarian insufficiency (POI) is characterized by marked heterogeneity, but with a significant genetic contribution. Identifying exact causative genes has been challenging, with many discoveries not replicated. It is timely to take stock of the field, outlining the progress made, framing the controversies and anticipating future directions in elucidating the genetics of POI. A search for original articles published up to May 2015 was performed using PubMed and Google Scholar, identifying studies on the genetic etiology of POI. Studies were included if chromosomal analysis, candidate gene screening and a genome-wide study were conducted. Articles identified were restricted to English language full-text papers. Chromosomal abnormalities have long been recognized as a frequent cause of POI, with a currently estimated prevalence of 10-13%. Using the traditional karyotype methodology, monosomy X, mosaicism, X chromosome deletions and rearrangements, X-autosome translocations, and isochromosomes have been detected. Based on candidate gene studies, single gene perturbations unequivocally having a deleterious effect in at least one population include Bone morphogenetic protein 15 (BMP15), Progesterone receptor membrane component 1 (PGRMC1), and Fragile X mental retardation 1 (FMR1) premutation on the X chromosome; Growth differentiation factor 9 (GDF9), Folliculogenesis specific bHLH transcription factor (FIGLA), Newborn ovary homeobox gene (NOBOX), Nuclear receptor subfamily 5, group A, member 1 (NR5A1) and Nanos homolog 3 (NANOS3) seem likely as well, but mostly being found in no more than 1-2% of a single population studied. Whole genome approaches have utilized genome-wide association studies (GWAS) to reveal loci not predicted on the basis of a candidate gene, but it remains difficult to locate causative genes and susceptible loci were not always replicated. Cytogenomic methods (array CGH) have identified other regions of interest but studies have not shown consistent results, the resolution of arrays has varied and replication is uncommon. Whole-exome sequencing in non-syndromic POI kindreds has only recently begun, revealing mutations in the Stromal antigen 3 (STAG3), Synaptonemal complex central element 1 (SYCE1), minichromosome maintenance complex component 8 and 9 (MCM8, MCM9) and ATP-dependent DNA helicase homolog (HFM1) genes. Given the slow progress in candidate-gene analysis and relatively small sample sizes available for GWAS, family-based whole exome and whole genome sequencing appear to be the most promising approaches for detecting potential genes responsible for POI. Taken together, the cytogenetic, cytogenomic (array CGH) and exome sequencing approaches have revealed a genetic causation in ∼20-25% of POI cases. Uncovering the remainder of the causative genes will be facilitated not only by whole genome approaches involving larger cohorts in multiple populations but also incorporating environmental exposures and exploring signaling pathways in intragenic and intergenic regions that point to perturbations in regulatory genes and networks. © The Author 2015. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology.

  17. CRISPR/Cas9: An inexpensive, efficient loss of function tool to screen human disease genes in Xenopus.

    PubMed

    Bhattacharya, Dipankan; Marfo, Chris A; Li, Davis; Lane, Maura; Khokha, Mustafa K

    2015-12-15

    Congenital malformations are the major cause of infant mortality in the US and Europe. Due to rapid advances in human genomics, we can now efficiently identify sequence variants that may cause disease in these patients. However, establishing disease causality remains a challenge. Additionally, in the case of congenital heart disease, many of the identified candidate genes are either novel to embryonic development or have no known function. Therefore, there is a pressing need to develop inexpensive and efficient technologies to screen these candidate genes for disease phenocopy in model systems and to perform functional studies to uncover their role in development. For this purpose, we sought to test F0 CRISPR based gene editing as a loss of function strategy for disease phenocopy in the frog model organism, Xenopus tropicalis. We demonstrate that the CRISPR/Cas9 system can efficiently modify both alleles in the F0 generation within a few hours post fertilization, recapitulating even early disease phenotypes that are highly similar to knockdowns from morpholino oligos (MOs) in nearly all cases tested. We find that injecting Cas9 protein is dramatically more efficacious and less toxic than cas9 mRNA. We conclude that CRISPR based F0 gene modification in X. tropicalis is efficient and cost effective and readily recapitulates disease and MO phenotypes. Copyright © 2015 Elsevier Inc. All rights reserved.

  18. Gene silencing in Tribolium castaneum as a tool for the targeted identification of candidate RNAi targets in crop pests.

    PubMed

    Knorr, Eileen; Fishilevich, Elane; Tenbusch, Linda; Frey, Meghan L F; Rangasamy, Murugesan; Billion, Andre; Worden, Sarah E; Gandra, Premchand; Arora, Kanika; Lo, Wendy; Schulenberg, Greg; Valverde-Garcia, Pablo; Vilcinskas, Andreas; Narva, Kenneth E

    2018-02-01

    RNAi shows potential as an agricultural technology for insect control, yet, a relatively low number of robust lethal RNAi targets have been demonstrated to control insects of agricultural interest. In the current study, a selection of lethal RNAi target genes from the iBeetle (Tribolium castaneum) screen were used to demonstrate efficacy of orthologous targets in the economically important coleopteran pests Diabrotica virgifera virgifera and Meligethes aeneus. Transcript orthologs of 50 selected genes were analyzed in D. v. virgifera diet-based RNAi bioassays; 21 of these RNAi targets showed mortality and 36 showed growth inhibition. Low dose injection- and diet-based dsRNA assays in T. castaneum and D. v. virgifera, respectively, enabled the identification of the four highly potent RNAi target genes: Rop, dre4, ncm, and RpII140. Maize was genetically engineered to express dsRNA directed against these prioritized candidate target genes. T 0 plants expressing Rop, dre4, or RpII140 RNA hairpins showed protection from D. v. virgifera larval feeding damage. dsRNA targeting Rop, dre4, ncm, and RpII140 in M. aeneus also caused high levels of mortality both by injection and feeding. In summary, high throughput systems for model organisms can be successfully used to identify potent RNA targets for difficult-to-work with agricultural insect pests.

  19. Fine mapping of the NRC-1 tumor suppressor locus within chromosome 3p12.

    PubMed

    Zhang, Kun; Lott, Steven T; Jin, Li; Killary, Ann McNeill

    2007-08-31

    Identification of tumor suppressor genes based on physical mapping exercises has proven to be a challenging endeavor, due to the difficulty of narrowing regions of loss of heterozygosity (LOH), infrequency of homozygous deletions, and the labor-intensive characterization process for screening candidates in a given genomic interval. We previously defined a chromosome 3p12 tumor suppressor locus NRC-1 (Nonpapillary Renal Carcinoma-1) by functional complementation experiments in which renal cell carcinoma microcell hybrids containing introduced normal chromosome 3p fragments were either suppressed or unsuppressed for tumorigenicity following injection into athymic nude mice. We now present the fine-scale physical mapping of NRC-1 using a QPCR-based approach for measuring copy number at sequence tagged sites (STS) which allowed a sub-exon mapping resolution. Using STS-QPCR and a novel statistical algorithm, the NRC-1 locus was narrowed to 4.615-Mb with the distal boundary mapping within a 38-Kb interval between exon 3 and exon 4 of the DUTT1/Robo1 gene, currently the only candidate tumor suppressor gene in the interval. Further mutational screening and gene expression analyses indicate that DUTT1/ROBO1 is not involved in the tumor suppressor activity of NRC-1, suggesting that there are at least two important tumor suppressor genes within the chromosome 3p12 interval.

  20. Association of lung function genes with chronic obstructive pulmonary disease.

    PubMed

    Kim, Woo Jin; Lim, Myoung Nam; Hong, Yoonki; Silverman, Edwin K; Lee, Ji-Hyun; Jung, Bock Hyun; Ra, Seung Won; Choi, Hye Sook; Jung, Young Ju; Park, Yong Bum; Park, Myung Jae; Lee, Sei Won; Lee, Jae Seung; Oh, Yeon-Mok; Lee, Sang Do

    2014-08-01

    Spirometric measurements of pulmonary function are important in diagnosing and determining the severity of chronic obstructive pulmonary disease (COPD). We performed this study to determine whether candidate genes identified in genome-wide association studies of spirometric measurements were associated with COPD and if they interacted with smoking intensity. The current analysis included 1,000 COPD subjects and 1,000 controls recruited from 24 hospital-based pulmonary clinics. Thirteen SNPs, chosen based on genome-wide association studies of spirometric measurements in the Korean population cohorts, were genotyped. Genetic association tests were performed, adjusting for age, sex, and smoking intensity, using models including a SNP-by-smoking interaction term. PID1 and FAM13A were significantly associated with COPD susceptibility. There were also significant interactions between SNPs in ACN9 and FAM13A and smoking pack-years, and an association of ACN9 with COPD in the lowest smoking tertile. The risk allele of FAM13A was associated with increased expression of FAM13A in the lung. We have validated associations of FAM13A and PID1 with COPD. ACN9 showed significant interaction with smoking and is a potential candidate gene for COPD. Significant associations of genetic variants of FAM13A with gene expression levels suggest that the associated loci may act as genetic regulatory elements for FAM13A gene expression.

  1. New candidate loci identified by array-CGH in a cohort of 100 children presenting with syndromic obesity.

    PubMed

    Vuillaume, Marie-Laure; Naudion, Sophie; Banneau, Guillaume; Diene, Gwenaelle; Cartault, Audrey; Cailley, Dorothée; Bouron, Julie; Toutain, Jérôme; Bourrouillou, Georges; Vigouroux, Adeline; Bouneau, Laurence; Nacka, Fabienne; Kieffer, Isabelle; Arveiler, Benoit; Knoll-Gellida, Anja; Babin, Patrick J; Bieth, Eric; Jouret, Béatrice; Julia, Sophie; Sarda, Pierre; Geneviève, David; Faivre, Laurence; Lacombe, Didier; Barat, Pascal; Tauber, Maithé; Delrue, Marie-Ange; Rooryck, Caroline

    2014-08-01

    Syndromic obesity is defined by the association of obesity with one or more feature(s) including developmental delay, dysmorphic traits, and/or congenital malformations. Over 25 syndromic forms of obesity have been identified. However, most cases remain of unknown etiology. The aim of this study was to identify new candidate loci associated with syndromic obesity to find new candidate genes and to better understand molecular mechanisms involved in this pathology. We performed oligonucleotide microarray-based comparative genomic hybridization in a cohort of 100 children presenting with syndromic obesity of unknown etiology, after exhaustive clinical, biological, and molecular studies. Chromosomal copy number variations were detected in 42% of the children in our cohort, with 23% of patients with potentially pathogenic copy number variants. Our results support that chromosomal rearrangements are frequently associated with syndromic obesity with a variety of contributory genes having relevance to either obesity or developmental delay. A list of inherited or apparently de novo duplications and deletions including their enclosed genes and not previously linked to syndromic obesity was established. Proteins encoded by several of these genes are involved in lipid metabolism (ACOXL, MSMO1, MVD, and PDZK1) linked with nervous system function (BDH1 and LINGO2), neutral lipid storage (PLIN2), energy homeostasis and metabolic processes (CDH13, CNTNAP2, CPPED1, NDUFA4, PTGS2, and SOCS6). © 2014 Wiley Periodicals, Inc.

  2. Novel candidate genes may be possible predisposing factors revealed by whole exome sequencing in familial esophageal squamous cell carcinoma.

    PubMed

    Forouzanfar, Narjes; Baranova, Ancha; Milanizadeh, Saman; Heravi-Moussavi, Alireza; Jebelli, Amir; Abbaszadegan, Mohammad Reza

    2017-05-01

    Esophageal squamous cell carcinoma is one of the deadliest of all the cancers. Its metastatic properties portend poor prognosis and high rate of recurrence. A more advanced method to identify new molecular biomarkers predicting disease prognosis can be whole exome sequencing. Here, we report the most effective genetic variants of the Notch signaling pathway in esophageal squamous cell carcinoma susceptibility by whole exome sequencing. We analyzed nine probands in unrelated familial esophageal squamous cell carcinoma pedigrees to identify candidate genes. Genomic DNA was extracted and whole exome sequencing performed to generate information about genetic variants in the coding regions. Bioinformatics software applications were utilized to exploit statistical algorithms to demonstrate protein structure and variants conservation. Polymorphic regions were excluded by false-positive investigations. Gene-gene interactions were analyzed for Notch signaling pathway candidates. We identified novel and damaging variants of the Notch signaling pathway through extensive pathway-oriented filtering and functional predictions, which led to the study of 27 candidate novel mutations in all nine patients. Detection of the trinucleotide repeat containing 6B gene mutation (a slice site alteration) in five of the nine probands, but not in any of the healthy samples, suggested that it may be a susceptibility factor for familial esophageal squamous cell carcinoma. Noticeably, 8 of 27 novel candidate gene mutations (e.g. epidermal growth factor, signal transducer and activator of transcription 3, MET) act in a cascade leading to cell survival and proliferation. Our results suggest that the trinucleotide repeat containing 6B mutation may be a candidate predisposing gene in esophageal squamous cell carcinoma. In addition, some of the Notch signaling pathway genetic mutations may act as key contributors to esophageal squamous cell carcinoma.

  3. Candidate OP Phyla: Importance, Ecology and Cultivation Prospects.

    PubMed

    Rohini Kumar, M; Saravanan, V S

    2010-10-01

    OP phyla were created in the domain bacteria, based on the group of 16S rRNA gene sequences recovered from the Obsidian Pool. However, due to the lack of cultured representative it is referred to as candidate phyla. Wider ecological occurrence was predicted for the OP phyla, especially OP3, OP10 and OP11. Recently, members of phylum OP5 and OP10 were cultured, providing clues to their cultivation prospects. At last the bioprospecting potentials of the OP members are discussed herein.

  4. ICSNPathway: identify candidate causal SNPs and pathways from genome-wide association study by one analytical framework.

    PubMed

    Zhang, Kunlin; Chang, Suhua; Cui, Sijia; Guo, Liyuan; Zhang, Liuyan; Wang, Jing

    2011-07-01

    Genome-wide association study (GWAS) is widely utilized to identify genes involved in human complex disease or some other trait. One key challenge for GWAS data interpretation is to identify causal SNPs and provide profound evidence on how they affect the trait. Currently, researches are focusing on identification of candidate causal variants from the most significant SNPs of GWAS, while there is lack of support on biological mechanisms as represented by pathways. Although pathway-based analysis (PBA) has been designed to identify disease-related pathways by analyzing the full list of SNPs from GWAS, it does not emphasize on interpreting causal SNPs. To our knowledge, so far there is no web server available to solve the challenge for GWAS data interpretation within one analytical framework. ICSNPathway is developed to identify candidate causal SNPs and their corresponding candidate causal pathways from GWAS by integrating linkage disequilibrium (LD) analysis, functional SNP annotation and PBA. ICSNPathway provides a feasible solution to bridge the gap between GWAS and disease mechanism study by generating hypothesis of SNP → gene → pathway(s). The ICSNPathway server is freely available at http://icsnpathway.psych.ac.cn/.

  5. A large-scale RNA interference screen identifies genes that regulate autophagy at different stages.

    PubMed

    Guo, Sujuan; Pridham, Kevin J; Virbasius, Ching-Man; He, Bin; Zhang, Liqing; Varmark, Hanne; Green, Michael R; Sheng, Zhi

    2018-02-12

    Dysregulated autophagy is central to the pathogenesis and therapeutic development of cancer. However, how autophagy is regulated in cancer is not well understood and genes that modulate cancer autophagy are not fully defined. To gain more insights into autophagy regulation in cancer, we performed a large-scale RNA interference screen in K562 human chronic myeloid leukemia cells using monodansylcadaverine staining, an autophagy-detecting approach equivalent to immunoblotting of the autophagy marker LC3B or fluorescence microscopy of GFP-LC3B. By coupling monodansylcadaverine staining with fluorescence-activated cell sorting, we successfully isolated autophagic K562 cells where we identified 336 short hairpin RNAs. After candidate validation using Cyto-ID fluorescence spectrophotometry, LC3B immunoblotting, and quantitative RT-PCR, 82 genes were identified as autophagy-regulating genes. 20 genes have been reported previously and the remaining 62 candidates are novel autophagy mediators. Bioinformatic analyses revealed that most candidate genes were involved in molecular pathways regulating autophagy, rather than directly participating in the autophagy process. Further autophagy flux assays revealed that 57 autophagy-regulating genes suppressed autophagy initiation, whereas 21 candidates promoted autophagy maturation. Our RNA interference screen identifies identified genes that regulate autophagy at different stages, which helps decode autophagy regulation in cancer and offers novel avenues to develop autophagy-related therapies for cancer.

  6. A data-mining approach to rank candidate protein-binding partners-The case of biogenesis of lysosome-related organelles complex-1 (BLOC-1).

    PubMed

    Rodriguez-Fernandez, I A; Dell'Angelica, E C

    2009-04-01

    The study of protein-protein interactions is a powerful approach to uncovering the molecular function of gene products associated with human disease. Protein-protein interaction data are accumulating at an unprecedented pace owing to interactomics projects, although it has been recognized that a significant fraction of these data likely represents false positives. During our studies of biogenesis of lysosome-related organelles complex-1 (BLOC-1), a protein complex involved in protein trafficking and containing the products of genes mutated in Hermansky-Pudlak syndrome, we faced the problem of having too many candidate binding partners to pursue experimentally. In this work, we have explored ways of efficiently gathering high-quality information about candidate binding partners and presenting the information in a visually friendly manner. We applied the approach to rank 70 candidate binding partners of human BLOC-1 and 102 candidates of its counterpart from Drosophila melanogaster. The top candidate for human BLOC-1 was the small GTPase encoded by the RAB11A gene, which is a paralogue of the Rab38 and Rab32 proteins in mammals and the lightoid gene product in flies. Interestingly, genetic analyses in D. melanogaster uncovered a synthetic sick/lethal interaction between Rab11 and lightoid. The data-mining approach described herein can be customized to study candidate binding partners for other proteins or possibly candidates derived from other types of 'omics' data.

  7. High-throughput cell-based screening reveals a role for ZNF131 as a repressor of ERalpha signaling

    PubMed Central

    Han, Xiao; Guo, Jinhai; Deng, Weiwei; Zhang, Chenying; Du, Peige; Shi, Taiping; Ma, Dalong

    2008-01-01

    Background Estrogen receptor α (ERα) is a transcription factor whose activity is affected by multiple regulatory cofactors. In an effort to identify the human genes involved in the regulation of ERα, we constructed a high-throughput, cell-based, functional screening platform by linking a response element (ERE) with a reporter gene. This allowed the cellular activity of ERα, in cells cotransfected with the candidate gene, to be quantified in the presence or absence of its cognate ligand E2. Results From a library of 570 human cDNA clones, we identified zinc finger protein 131 (ZNF131) as a repressor of ERα mediated transactivation. ZNF131 is a typical member of the BTB/POZ family of transcription factors, and shows both ubiquitous expression and a high degree of sequence conservation. The luciferase reporter gene assay revealed that ZNF131 inhibits ligand-dependent transactivation by ERα in a dose-dependent manner. Electrophoretic mobility shift assay clearly demonstrated that the interaction between ZNF131 and ERα interrupts or prevents ERα binding to the estrogen response element (ERE). In addition, ZNF131 was able to suppress the expression of pS2, an ERα target gene. Conclusion We suggest that the functional screening platform we constructed can be applied for high-throughput genomic screening candidate ERα-related genes. This in turn may provide new insights into the underlying molecular mechanisms of ERα regulation in mammalian cells. PMID:18847501

  8. Selection of reference genes for RT-qPCR analysis in a predatory biological control agent, Coleomegilla maculata (Coleoptera: Coccinellidae).

    PubMed

    Yang, Chunxiao; Pan, Huipeng; Noland, Jeffrey Edward; Zhang, Deyong; Zhang, Zhanhong; Liu, Yong; Zhou, Xuguo

    2015-12-10

    Reverse transcriptase-quantitative polymerase chain reaction (RT-qPCR) is a reliable technique for quantifying gene expression across various biological processes, of which requires a set of suited reference genes to normalize the expression data. Coleomegilla maculata (Coleoptera: Coccinellidae), is one of the most extensively used biological control agents in the field to manage arthropod pest species. In this study, expression profiles of 16 housekeeping genes selected from C. maculata were cloned and investigated. The performance of these candidates as endogenous controls under specific experimental conditions was evaluated by dedicated algorithms, including geNorm, Normfinder, BestKeeper, and ΔCt method. In addition, RefFinder, a comprehensive platform integrating all the above-mentioned algorithms, ranked the overall stability of these candidate genes. As a result, various sets of suitable reference genes were recommended specifically for experiments involving different tissues, developmental stages, sex, and C. maculate larvae treated with dietary double stranded RNA. This study represents the critical first step to establish a standardized RT-qPCR protocol for the functional genomics research in a ladybeetle C. maculate. Furthermore, it lays the foundation for conducting ecological risk assessment of RNAi-based gene silencing biotechnologies on non-target organisms; in this case, a key predatory biological control agent.

  9. Identification of evolutionarily conserved DNA damage response genes that alter sensitivity to cisplatin

    PubMed Central

    Gaponova, Anna V.; Deneka, Alexander Y.; Beck, Tim N.; Liu, Hanqing; Andrianov, Gregory; Nikonova, Anna S.; Nicolas, Emmanuelle; Einarson, Margret B.; Golemis, Erica A.; Serebriiskii, Ilya G.

    2017-01-01

    Ovarian, head and neck, and other cancers are commonly treated with cisplatin and other DNA damaging cytotoxic agents. Altered DNA damage response (DDR) contributes to resistance of these tumors to chemotherapies, some targeted therapies, and radiation. DDR involves multiple protein complexes and signaling pathways, some of which are evolutionarily ancient and involve protein orthologs conserved from yeast to humans. To identify new regulators of cisplatin-resistance in human tumors, we integrated high throughput and curated datasets describing yeast genes that regulate sensitivity to cisplatin and/or ionizing radiation. Next, we clustered highly validated genes based on chemogenomic profiling, and then mapped orthologs of these genes in expanded genomic networks for multiple metazoans, including humans. This approach identified an enriched candidate set of genes involved in the regulation of resistance to radiation and/or cisplatin in humans. Direct functional assessment of selected candidate genes using RNA interference confirmed their activity in influencing cisplatin resistance, degree of γH2AX focus formation and ATR phosphorylation, in ovarian and head and neck cancer cell lines, suggesting impaired DDR signaling as the driving mechanism. This work enlarges the set of genes that may contribute to chemotherapy resistance and provides a new contextual resource for interpreting next generation sequencing (NGS) genomic profiling of tumors. PMID:27863405

  10. Direct and long-term detection of gene doping in conventional blood samples.

    PubMed

    Beiter, T; Zimmermann, M; Fragasso, A; Hudemann, J; Niess, A M; Bitzer, M; Lauer, U M; Simon, P

    2011-03-01

    The misuse of somatic gene therapy for the purpose of enhancing athletic performance is perceived as a coming threat to the world of sports and categorized as 'gene doping'. This article describes a direct detection approach for gene doping that gives a clear yes-or-no answer based on the presence or absence of transgenic DNA in peripheral blood samples. By exploiting a priming strategy to specifically amplify intronless DNA sequences, we developed PCR protocols allowing the detection of very small amounts of transgenic DNA in genomic DNA samples to screen for six prime candidate genes. Our detection strategy was verified in a mouse model, giving positive signals from minute amounts (20 μl) of blood samples for up to 56 days following intramuscular adeno-associated virus-mediated gene transfer, one of the most likely candidate vector systems to be misused for gene doping. To make our detection strategy amenable for routine testing, we implemented a robust sample preparation and processing protocol that allows cost-efficient analysis of small human blood volumes (200 μl) with high specificity and reproducibility. The practicability and reliability of our detection strategy was validated by a screening approach including 327 blood samples taken from professional and recreational athletes under field conditions.

  11. Tumour gene expression predicts response to cetuximab in patients with KRAS wild-type metastatic colorectal cancer.

    PubMed

    Baker, J B; Dutta, D; Watson, D; Maddala, T; Munneke, B M; Shak, S; Rowinsky, E K; Xu, L-A; Harbison, C T; Clark, E A; Mauro, D J; Khambata-Ford, S

    2011-02-01

    Although it is accepted that metastatic colorectal cancers (mCRCs) that carry activating mutations in KRAS are unresponsive to anti-epidermal growth factor receptor (EGFR) monoclonal antibodies, a significant fraction of KRAS wild-type (wt) mCRCs are also unresponsive to anti-EGFR therapy. Genes encoding EGFR ligands amphiregulin (AREG) and epiregulin (EREG) are promising gene expression-based markers but have not been incorporated into a test to dichotomise KRAS wt mCRC patients with respect to sensitivity to anti-EGFR treatment. We used RT-PCR to test 110 candidate gene expression markers in primary tumours from 144 KRAS wt mCRC patients who received monotherapy with the anti-EGFR antibody cetuximab. Results were correlated with multiple clinical endpoints: disease control, objective response, and progression-free survival (PFS). Expression of many of the tested candidate genes, including EREG and AREG, strongly associate with all clinical endpoints. Using multivariate analysis with two-layer five-fold cross-validation, we constructed a four-gene predictive classifier. Strikingly, patients below the classifier cutpoint had PFS and disease control rates similar to those of patients with KRAS mutant mCRC. Gene expression appears to identify KRAS wt mCRC patients who receive little benefit from cetuximab. It will be important to test this model in an independent validation study.

  12. Exploiting induced variation to dissect quantitative traits in barley.

    PubMed

    Druka, Arnis; Franckowiak, Jerome; Lundqvist, Udda; Bonar, Nicola; Alexander, Jill; Guzy-Wrobelska, Justyna; Ramsay, Luke; Druka, Ilze; Grant, Iain; Macaulay, Malcolm; Vendramin, Vera; Shahinnia, Fahimeh; Radovic, Slobodanka; Houston, Kelly; Harrap, David; Cardle, Linda; Marshall, David; Morgante, Michele; Stein, Nils; Waugh, Robbie

    2010-04-01

    The identification of genes underlying complex quantitative traits such as grain yield by means of conventional genetic analysis (positional cloning) requires the development of several large mapping populations. However, it is possible that phenotypically related, but more extreme, allelic variants generated by mutational studies could provide a means for more efficient cloning of QTLs (quantitative trait loci). In barley (Hordeum vulgare), with the development of high-throughput genome analysis tools, efficient genome-wide identification of genetic loci harbouring mutant alleles has recently become possible. Genotypic data from NILs (near-isogenic lines) that carry induced or natural variants of genes that control aspects of plant development can be compared with the location of QTLs to potentially identify candidate genes for development--related traits such as grain yield. As yield itself can be divided into a number of allometric component traits such as tillers per plant, kernels per spike and kernel size, mutant alleles that both affect these traits and are located within the confidence intervals for major yield QTLs may represent extreme variants of the underlying genes. In addition, the development of detailed comparative genomic models based on the alignment of a high-density barley gene map with the rice and sorghum physical maps, has enabled an informed prioritization of 'known function' genes as candidates for both QTLs and induced mutant genes.

  13. RNA-Seq reveals seven promising candidate genes affecting the proportion of thick egg albumen in layer-type chickens.

    PubMed

    Wan, Yi; Jin, Sihua; Ma, Chendong; Wang, Zhicheng; Fang, Qi; Jiang, Runshen

    2017-12-22

    Eggs with a much higher proportion of thick albumen are preferred in the layer industry, as they are favoured by consumers. However, the genetic factors affecting the thick egg albumen trait have not been elucidated. Using RNA sequencing, we explored the magnum transcriptome in 9 Rhode Island white layers: four layers with phenotypes of extremely high ratios of thick to thin albumen (high thick albumen, HTA) and five with extremely low ratios (low thick albumen, LTA). A total of 220 genes were differentially expressed, among which 150 genes were up-regulated and 70 were down-regulated in the HTA group compared with the LTA group. Gene Ontology (GO) analysis revealed that the up-regulated genes in HTA were mainly involved in a wide range of regulatory functions. In addition, a large number of these genes were related to glycosphingolipid biosynthesis, focal adhesion, ECM-receptor interactions and cytokine-cytokine receptor interactions. Based on functional analysis, ST3GAL4, FUT4, ITGA2, SDC3, PRLR, CDH4 and GALNT9 were identified as promising candidate genes for thick albumen synthesis and metabolism during egg formation. These results provide new insights into the molecular mechanisms of egg albumen traits and may contribute to future breeding strategies that optimise the proportion of thick egg albumen.

  14. Unsupervised, statistically-based systems biology approach for unraveling the genetics of complex traits: A demonstration with ethanol metabolism.

    PubMed

    Lusk, Ryan; Saba, Laura M; Vanderlinden, Lauren A; Zidek, Vaclav; Silhavy, Jan; Pravenec, Michal; Hoffman, Paula L; Tabakoff, Boris

    2018-04-24

    A statistical pipeline was developed and used for determining candidate genes and candidate gene co-expression networks involved in two alcohol (i.e., ethanol) metabolism phenotypes, namely alcohol clearance and acetate area under the curve (AUC) in a recombinant inbred (HXB/BXH) rat panel. The approach was also used to provide an indication of how ethanol metabolism can impact the normal function of the identified networks. RNA was extracted from alcohol-naïve liver tissue of 30 strains of HXB/BXH recombinant inbred rats. The reconstructed transcripts were quantitated and data was used to construct gene co-expression modules and networks. A separate group of rats, comprising the same 30 strains, were injected with ethanol (2 gm/kg) for measurement of blood ethanol and acetate levels. These data were used for QTL analysis of the rate of ethanol disappearance and circulating acetate levels. The analysis pipeline required calculation of the module eigengene values, the correction of these values with ethanol metabolism rates and acetate levels across the rat strains and the determination of the eigengene QTLs. For a module to be considered a candidate for determining phenotype, the module eigengene values had to have significant correlation with the strain phenotypic values and the module eigengene QTLs had to overlap the phenotypic QTLs. Of the 658 transcript co-expression modules generated from liver RNA sequencing data, a single module satisfied all criteria for being a candidate for determining the alcohol clearance trait. This module contained two alcohol dehydrogenase genes, including the gene whose product was previously shown to be responsible for the majority of alcohol elimination in the rat. This module was also the only module identified as a candidate for influencing circulating acetate levels. This module was also linked to the process of generation and utilization of retinoic acid as related to the autonomous immune response. We propose that our analytical pipeline can successfully identify genetic regions and transcripts which predispose a particular phenotype and our analysis provides functional context for co-expression module components. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  15. Identification of genes related to proliferative diabetic retinopathy through RWR algorithm based on protein-protein interaction network.

    PubMed

    Zhang, Jian; Suo, Yan; Liu, Min; Xu, Xun

    2018-06-01

    Proliferative diabetic retinopathy (PDR) is one of the most common complications of diabetes and can lead to blindness. Proteomic studies have provided insight into the pathogenesis of PDR and a series of PDR-related genes has been identified but are far from fully characterized because the experimental methods are expensive and time consuming. In our previous study, we successfully identified 35 candidate PDR-related genes through the shortest-path algorithm. In the current study, we developed a computational method using the random walk with restart (RWR) algorithm and the protein-protein interaction (PPI) network to identify potential PDR-related genes. After some possible genes were obtained by the RWR algorithm, a three-stage filtration strategy, which includes the permutation test, interaction test and enrichment test, was applied to exclude potential false positives caused by the structure of PPI network, the poor interaction strength, and the limited similarity on gene ontology (GO) terms and biological pathways. As a result, 36 candidate genes were discovered by the method which was different from the 35 genes reported in our previous study. A literature review showed that 21 of these 36 genes are supported by previous experiments. These findings suggest the robustness and complementary effects of both our efforts using different computational methods, thus providing an alternative method to study PDR pathogenesis. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Mutation analysis in 129 genes associated with other forms of retinal dystrophy in 157 families with retinitis pigmentosa based on exome sequencing.

    PubMed

    Xu, Yan; Guan, Liping; Xiao, Xueshan; Zhang, Jianguo; Li, Shiqiang; Jiang, Hui; Jia, Xiaoyun; Yang, Jianhua; Guo, Xiangming; Yin, Ye; Wang, Jun; Zhang, Qingjiong

    2015-01-01

    Mutations in 60 known genes were previously identified by exome sequencing in 79 of 157 families with retinitis pigmentosa (RP). This study analyzed variants in 129 genes associated with other forms of hereditary retinal dystrophy in the same cohort. Apart from the 73 genes previously analyzed, a further 129 genes responsible for other forms of hereditary retinal dystrophy were selected based on RetNet. Variants in the 129 genes determined by whole exome sequencing were selected and filtered by bioinformatics analysis. Candidate variants were confirmed by Sanger sequencing and validated by analysis of available family members and controls. A total of 90 candidate variants were present in the 129 genes. Sanger sequencing confirmed 83 of the 90 variants. Analysis of family members and controls excluded 76 of these 83 variants. The remaining seven variants were considered to be potential pathogenic mutations; these were c.899A>G, c.1814C>G, and c.2107C>T in BBS2; c.1073C>T and c.1669C>T in INPP5E; and c.3582C>G and c.5704-5C>G in CACNA1F. Six of these seven mutations were novel. The mutations were detected in five unrelated patients without a family history, including three patients with homozygous or compound heterozygous mutations in BBS2 and INPP5E, and two patients with hemizygous mutations in CACNA1F. None of the patients had mutations in the genes associated with autosome dominant retinal dystrophy. Only a small portion of patients with RP, about 3% (5/157), had causative mutations in the 129 genes associated with other forms of hereditary retinal dystrophy.

  17. The genome of Theobroma cacao.

    PubMed

    Argout, Xavier; Salse, Jerome; Aury, Jean-Marc; Guiltinan, Mark J; Droc, Gaetan; Gouzy, Jerome; Allegre, Mathilde; Chaparro, Cristian; Legavre, Thierry; Maximova, Siela N; Abrouk, Michael; Murat, Florent; Fouet, Olivier; Poulain, Julie; Ruiz, Manuel; Roguet, Yolande; Rodier-Goud, Maguy; Barbosa-Neto, Jose Fernandes; Sabot, Francois; Kudrna, Dave; Ammiraju, Jetty Siva S; Schuster, Stephan C; Carlson, John E; Sallet, Erika; Schiex, Thomas; Dievart, Anne; Kramer, Melissa; Gelley, Laura; Shi, Zi; Bérard, Aurélie; Viot, Christopher; Boccara, Michel; Risterucci, Ange Marie; Guignon, Valentin; Sabau, Xavier; Axtell, Michael J; Ma, Zhaorong; Zhang, Yufan; Brown, Spencer; Bourge, Mickael; Golser, Wolfgang; Song, Xiang; Clement, Didier; Rivallan, Ronan; Tahi, Mathias; Akaza, Joseph Moroh; Pitollat, Bertrand; Gramacho, Karina; D'Hont, Angélique; Brunel, Dominique; Infante, Diogenes; Kebe, Ismael; Costet, Pierre; Wing, Rod; McCombie, W Richard; Guiderdoni, Emmanuel; Quetier, Francis; Panaud, Olivier; Wincker, Patrick; Bocs, Stephanie; Lanaud, Claire

    2011-02-01

    We sequenced and assembled the draft genome of Theobroma cacao, an economically important tropical-fruit tree crop that is the source of chocolate. This assembly corresponds to 76% of the estimated genome size and contains almost all previously described genes, with 82% of these genes anchored on the 10 T. cacao chromosomes. Analysis of this sequence information highlighted specific expansion of some gene families during evolution, for example, flavonoid-related genes. It also provides a major source of candidate genes for T. cacao improvement. Based on the inferred paleohistory of the T. cacao genome, we propose an evolutionary scenario whereby the ten T. cacao chromosomes were shaped from an ancestor through eleven chromosome fusions.

  18. Systematic Characterization and Prediction of Human Hypertension Genes.

    PubMed

    Li, Yan-Hui; Zhang, Gai-Gai; Wang, Nanping

    2017-02-01

    Hypertension is a major cardiovascular risk factor and accounts for a large part of cardiovascular mortality. In this work, we analyzed the properties of hypertension genes and found that when compared with genes not yet known to be involved in hypertension regulation, known hypertension genes display distinguishing features: (1) hypertension genes tend to be located at network center; (2) hypertension genes tend to interact with each other; and (3) hypertension genes tend to enrich in certain biological processes and show certain phenotypes. Based on these features, we developed a machine-learning algorithm to predict new hypertension genes. One hundred and seventy-seven candidates were predicted with a posterior probability >0.9. Evidence supporting 17 of the predictions has been found. © 2016 American Heart Association, Inc.

  19. Transcriptomic analysis of Siberian ginseng (Eleutherococcus senticosus) to discover genes involved in saponin biosynthesis.

    PubMed

    Hwang, Hwan-Su; Lee, Hyoshin; Choi, Yong Eui

    2015-03-14

    Eleutherococcus senticosus, Siberian ginseng, is a highly valued woody medicinal plant belonging to the family Araliaceae. E. senticosus produces a rich variety of saponins such as oleanane-type, noroleanane-type, 29-hydroxyoleanan-type, and lupane-type saponins. Genomic or transcriptomic approaches have not been used to investigate the saponin biosynthetic pathway in this plant. In this study, de novo sequencing was performed to select candidate genes involved in the saponin biosynthetic pathway. A half-plate 454 pyrosequencing run produced 627,923 high-quality reads with an average sequence length of 422 bases. De novo assembly generated 72,811 unique sequences, including 15,217 contigs and 57,594 singletons. Approximately 48,300 (66.3%) unique sequences were annotated using BLAST similarity searches. All of the mevalonate pathway genes for saponin biosynthesis starting from acetyl-CoA were isolated. Moreover, 206 reads of cytochrome P450 (CYP) and 145 reads of uridine diphosphate glycosyltransferase (UGT) sequences were isolated. Based on methyl jasmonate (MeJA) treatment and real-time PCR (qPCR) analysis, 3 CYPs and 3 UGTs were finally selected as candidate genes involved in the saponin biosynthetic pathway. The identified sequences associated with saponin biosynthesis will facilitate the study of the functional genomics of saponin biosynthesis and genetic engineering of E. senticosus.

  20. Using whole-exome sequencing to investigate the genetic bases of lysosomal storage diseases of unknown etiology.

    PubMed

    Wang, Nan; Zhang, Yeting; Gedvilaite, Erika; Loh, Jui Wan; Lin, Timothy; Liu, Xiuping; Liu, Chang-Gong; Kumar, Dibyendu; Donnelly, Robert; Raymond, Kimiyo; Schuchman, Edward H; Sleat, David E; Lobel, Peter; Xing, Jinchuan

    2017-11-01

    Lysosomes are membrane-bound, acidic eukaryotic cellular organelles that play important roles in the degradation of macromolecules. Mutations that cause the loss of lysosomal protein function can lead to a group of disorders categorized as the lysosomal storage diseases (LSDs). Suspicion of LSD is frequently based on clinical and pathologic findings, but in some cases, the underlying genetic and biochemical defects remain unknown. Here, we performed whole-exome sequencing (WES) on 14 suspected LSD cases to evaluate the feasibility of using WES for identifying causal mutations. By examining 2,157 candidate genes potentially associated with lysosomal function, we identified eight variants in five genes as candidate disease-causing variants in four individuals. These included both known and novel mutations. Variants were corroborated by targeted sequencing and, when possible, functional assays. In addition, we identified nonsense mutations in two individuals in genes that are not known to have lysosomal function. However, mutations in these genes could have resulted in phenotypes that were diagnosed as LSDs. This study demonstrates that WES can be used to identify causal mutations in suspected LSD cases. We also demonstrate cases where a confounding clinical phenotype may potentially reflect more than one lysosomal protein defect. © 2017 Wiley Periodicals, Inc.

  1. Systematic screening of isogenic cancer cells identifies DUSP6 as context-specific synthetic lethal target in melanoma

    PubMed Central

    Wittig-Blaich, Stephanie; Wittig, Rainer; Schmidt, Steffen; Lyer, Stefan; Bewerunge-Hudler, Melanie; Gronert-Sum, Sabine; Strobel-Freidekind, Olga; Müller, Carolin; List, Markus; Jaskot, Aleksandra; Christiansen, Helle; Hafner, Mathias; Schadendorf, Dirk; Block, Ines; Mollenhauer, Jan

    2017-01-01

    Next-generation sequencing has dramatically increased genome-wide profiling options and conceptually initiates the possibility for personalized cancer therapy. State-of-the-art sequencing studies yield large candidate gene sets comprising dozens or hundreds of mutated genes. However, few technologies are available for the systematic downstream evaluation of these results to identify novel starting points of future cancer therapies. We improved and extended a site-specific recombination-based system for systematic analysis of the individual functions of a large number of candidate genes. This was facilitated by a novel system for the construction of isogenic constitutive and inducible gain- and loss-of-function cell lines. Additionally, we demonstrate the construction of isogenic cell lines with combinations of the traits for advanced functional in vitro analyses. In a proof-of-concept experiment, a library of 108 isogenic melanoma cell lines was constructed and 8 genes were identified that significantly reduced viability in a discovery screen and in an independent validation screen. Here, we demonstrate the broad applicability of this recombination-based method and we proved its potential to identify new drug targets via the identification of the tumor suppressor DUSP6 as potential synthetic lethal target in melanoma cell lines with BRAF V600E mutations and high DUSP6 expression. PMID:28423600

  2. An extensive analysis of disease-gene associations using network integration and fast kernel-based gene prioritization methods.

    PubMed

    Valentini, Giorgio; Paccanaro, Alberto; Caniza, Horacio; Romero, Alfonso E; Re, Matteo

    2014-06-01

    In the context of "network medicine", gene prioritization methods represent one of the main tools to discover candidate disease genes by exploiting the large amount of data covering different types of functional relationships between genes. Several works proposed to integrate multiple sources of data to improve disease gene prioritization, but to our knowledge no systematic studies focused on the quantitative evaluation of the impact of network integration on gene prioritization. In this paper, we aim at providing an extensive analysis of gene-disease associations not limited to genetic disorders, and a systematic comparison of different network integration methods for gene prioritization. We collected nine different functional networks representing different functional relationships between genes, and we combined them through both unweighted and weighted network integration methods. We then prioritized genes with respect to each of the considered 708 medical subject headings (MeSH) diseases by applying classical guilt-by-association, random walk and random walk with restart algorithms, and the recently proposed kernelized score functions. The results obtained with classical random walk algorithms and the best single network achieved an average area under the curve (AUC) across the 708 MeSH diseases of about 0.82, while kernelized score functions and network integration boosted the average AUC to about 0.89. Weighted integration, by exploiting the different "informativeness" embedded in different functional networks, outperforms unweighted integration at 0.01 significance level, according to the Wilcoxon signed rank sum test. For each MeSH disease we provide the top-ranked unannotated candidate genes, available for further bio-medical investigation. Network integration is necessary to boost the performances of gene prioritization methods. Moreover the methods based on kernelized score functions can further enhance disease gene ranking results, by adopting both local and global learning strategies, able to exploit the overall topology of the network. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.

  3. A public platform for the verification of the phenotypic effect of candidate genes for resistance to aflatoxin accumulation and Aspergillus flavus infection in maize

    USDA-ARS?s Scientific Manuscript database

    A public candidate gene testing pipeline for resistance to aflatoxin accumulation or Aspergillus flavus infection in maize is presented here. The pipeline consists of steps for identifying, testing, and verifying the association of any maize gene sequence with resistance under field conditions. Reso...

  4. SNP discovery in candidate adaptive genes using exon capture in a free-ranging alpine ungulate

    Treesearch

    Gretchen H. Roffler; Stephen J. Amish; Seth Smith; Ted Cosart; Marty Kardos; Michael K. Schwartz; Gordon Luikart

    2016-01-01

    Identification of genes underlying genomic signatures of natural selection is key to understanding adaptation to local conditions. We used targeted resequencing to identify SNP markers in 5321 candidate adaptive genes associated with known immunological, metabolic and growth functions in ovids and other ungulates. We selectively targeted 8161 exons in protein-coding...

  5. A priori and a posteriori approaches for finding genes of evolutionary interest in non-model species: osmoregulatory genes in the kidney transcriptome of the desert rodent Dipodomys spectabilis (banner-tailed kangaroo rat).

    PubMed

    Marra, Nicholas J; Eo, Soo Hyung; Hale, Matthew C; Waser, Peter M; DeWoody, J Andrew

    2012-12-01

    One common goal in evolutionary biology is the identification of genes underlying adaptive traits of evolutionary interest. Recently next-generation sequencing techniques have greatly facilitated such evolutionary studies in species otherwise depauperate of genomic resources. Kangaroo rats (Dipodomys sp.) serve as exemplars of adaptation in that they inhabit extremely arid environments, yet require no drinking water because of ultra-efficient kidney function and osmoregulation. As a basis for identifying water conservation genes in kangaroo rats, we conducted a priori bioinformatics searches in model rodents (Mus musculus and Rattus norvegicus) to identify candidate genes with known or suspected osmoregulatory function. We then obtained 446,758 reads via 454 pyrosequencing to characterize genes expressed in the kidney of banner-tailed kangaroo rats (Dipodomys spectabilis). We also determined candidates a posteriori by identifying genes that were overexpressed in the kidney. The kangaroo rat sequences revealed nine different a priori candidate genes predicted from our Mus and Rattus searches, as well as 32 a posteriori candidate genes that were overexpressed in kidney. Mutations in two of these genes, Slc12a1 and Slc12a3, cause human renal diseases that result in the inability to concentrate urine. These genes are likely key determinants of physiological water conservation in desert rodents. Copyright © 2012 Elsevier Inc. All rights reserved.

  6. An ADAM33 polymorphism associates with progression of preschool wheeze into childhood asthma: a prospective case-control study with replication in a birth cohort study.

    PubMed

    Klaassen, Ester M M; Penders, John; Jöbsis, Quirijn; van de Kant, Kim D G; Thijs, Carel; Mommers, Monique; van Schayck, Constant P; van Eys, Guillaume; Koppelman, Gerard H; Dompeling, Edward

    2015-01-01

    The influence of asthma candidate genes on the development from wheeze to asthma in young children still needs to be defined. To link genetic variants in asthma candidate genes to progression of wheeze to persistent wheeze into childhood asthma. In a prospective study, children with recurrent wheeze from the ADEM (Asthma DEtection and Monitoring) study were followed until the age of six. At that age a classification (transient wheeze or asthma) was based on symptoms, lung function and medication use. In 198 children the relationship between this classification and 30 polymorphisms in 16 asthma candidate genes was assessed by logistic regression. In case of an association based on a p<0.10, replication analysis was performed in an independent birth cohort study (KOALA study, n = 248 included for the present analysis). In the ADEM study, the minor alleles of ADAM33 rs511898 and rs528557 and the ORMDL3/GSDMB rs7216389 polymorphisms were negatively associated, whereas the minor alleles of IL4 rs2243250 and rs2070874 polymorphisms were positively associated with childhood asthma. When replicated in the KOALA study, ADAM33 rs528557 showed a negative association of the CG/GG-genotype with progression of recurrent wheeze into childhood asthma (0.50 (0.26-0.97) p = 0.04) and no association with preschool wheeze. Polymorphisms in ADAM33, ORMDL3/GSDMB and IL4 were associated with childhood asthma in a group of children with recurrent wheeze. The replication of the negative association of the CG/GG-genotype of rs528557 ADAM33 with childhood asthma in an independent birth cohort study confirms that a compromised ADAM33 gene may be implicated in the progression of wheeze into childhood asthma.

  7. Allelism analysis of BrRfp locus in different restorer lines and map-based cloning of a fertility restorer gene, BrRfp1, for pol CMS in Chinese cabbage (Brassica rapa L.).

    PubMed

    Zhang, Huamin; Wu, Junqing; Dai, Zihui; Qin, Meiling; Hao, Lingyu; Ren, Yanjing; Li, Qingfei; Zhang, Lugang

    2017-03-01

    In Chinese cabbage, there are two Rf loci for pol CMS and one of them was mapped to a 12.6-kb region containing a potential candidate gene encoding PPR protein. In Chinese cabbage (Brassica rapa), polima cytoplasmic male sterility (pol CMS) is an important CMS type and is widely used for hybrid breeding. By extensive test crossing in Chinese cabbage, four restorer lines (92s105, 01s325, 00s109, and 88s148) for pol CMS were screened. By analyzing the allelism of the four restorer lines, it was found that 92s105, 01s325, and 00s109 had the same "restorers of fertility" (Rf) locus (designated as BrRfp1), but 88s148 had a different Rf locus (designated as BrRfp2). For fine mapping the BrRfp1 locus of 92s105, a BC 1 F 1 population with 487 individuals and a BC 1 F 2 population with 2485 individuals were successively constructed. Using simple sequence repeat (SSR) markers developed from Brassica rapa reference genome and InDel markers derived from whole-genome resequencing data of 94c9 and 92s105, BrRfp1 was mapped to a 12.6-kb region containing a potential candidate gene encoding pentatricopeptide repeat-containing protein. Based on the nucleotide polymorphisms of the candidate gene sequence between the restoring and nonrestoring alleles, a co-segregating marker SC718 was developed, which would be helpful for hybrid breeding by marker-assisted screening and for detecting new restorer lines.

  8. Sarcoidosis Related Novel Candidate Genes Identified by Multi-Omics Integrative Analyses.

    PubMed

    Hočevar, Keli; Maver, Aleš; Kunej, Tanja; Peterlin, Borut

    2018-05-01

    Sarcoidosis is a multifactorial systemic disease characterized by granulomatous inflammation and greatly impacting on global public health. The etiology and mechanisms of sarcoidosis are not fully understood. Recent high-throughput biological research has generated vast amounts of multi-omics big data on sarcoidosis, but their significance remains to be determined. We sought to identify novel candidate regions, and genes consistently altered in heterogeneous omics studies so as to reveal the underlying molecular mechanisms. We conducted a comprehensive integrative literature analysis on global data on sarcoidosis, including genomic, transcriptomic, proteomic, and phenomic studies. We performed positional integration analysis of 38 eligible datasets originating from 17 different biological layers. Using the integration interval length of 50 kb, we identified 54 regions reaching significance value p ≤ 0.0001 and 15 regions with significance value p ≤ 0.00001, when applying more stringent criteria. Secondary literature analysis of the top 20 regions, with the most significant accumulation of signals, revealed several novel candidate genes for which associations with sarcoidosis have not yet been established, but have considerable support for their involvement based on omic data. These new plausible candidate genes include NELFE, CFB, EGFL7, AGPAT2, FKBPL, NRC3, and NEU1. Furthermore, annotated data were prepared to enable custom visualization and browsing of these sarcoidosis related omics evidence in the University of California Santa Cruz (UCSC) Genome Browser. Further multi-omics approaches are called for sarcoidosis biomarkers and diagnostic and therapeutic innovation. Our approach for harnessing multi-omics data and the findings presented herein reflect important steps toward understanding the etiology and underlying pathological mechanisms of sarcoidosis.

  9. An integrated and comparative approach towards identification, characterization and functional annotation of candidate genes for drought tolerance in sorghum (Sorghum bicolor (L.) Moench).

    PubMed

    Woldesemayat, Adugna Abdi; Van Heusden, Peter; Ndimba, Bongani K; Christoffels, Alan

    2017-12-22

    Drought is the most disastrous abiotic stress that severely affects agricultural productivity worldwide. Understanding the biological basis of drought-regulated traits, requires identification and an in-depth characterization of genetic determinants using model organisms and high-throughput technologies. However, studies on drought tolerance have generally been limited to traditional candidate gene approach that targets only a single gene in a pathway that is related to a trait. In this study, we used sorghum, one of the model crops that is well adapted to arid regions, to mine genes and define determinants for drought tolerance using drought expression libraries and RNA-seq data. We provide an integrated and comparative in silico candidate gene identification, characterization and annotation approach, with an emphasis on genes playing a prominent role in conferring drought tolerance in sorghum. A total of 470 non-redundant functionally annotated drought responsive genes (DRGs) were identified using experimental data from drought responses by employing pairwise sequence similarity searches, pathway and interpro-domain analysis, expression profiling and orthology relation. Comparison of the genomic locations between these genes and sorghum quantitative trait loci (QTLs) showed that 40% of these genes were co-localized with QTLs known for drought tolerance. The genome reannotation conducted using the Program to Assemble Spliced Alignment (PASA), resulted in 9.6% of existing single gene models being updated. In addition, 210 putative novel genes were identified using AUGUSTUS and PASA based analysis on expression dataset. Among these, 50% were single exonic, 69.5% represented drought responsive and 5.7% were complete gene structure models. Analysis of biochemical metabolism revealed 14 metabolic pathways that are related to drought tolerance and also had a strong biological network, among categories of genes involved. Identification of these pathways, signifies the interplay of biochemical reactions that make up the metabolic network, constituting fundamental interface for sorghum defence mechanism against drought stress. This study suggests untapped natural variability in sorghum that could be used for developing drought tolerance. The data presented here, may be regarded as an initial reference point in functional and comparative genomics in the Gramineae family.

  10. Rapid Communication: MiR-92a as a housekeeping gene for analysis of bovine mastitis-related microRNA in milk.

    PubMed

    Lai, Y C; Fujikawa, T; Ando, T; Kitahara, G; Koiwa, M; Kubota, C; Miura, N

    2017-06-01

    Our aim was to identify a suitable microRNA housekeeping gene for real-time PCR analysis of bovine mastitis-related microRNA in milk. We identified , , and as housekeeping gene candidates on the basis of previous Solexa sequencing results. Threshold cycle (CT) values for , , and did not differ between milk from control cows and milk from mastitis-affected cows. NormFinder software identified as the most stable single housekeeping gene. We evaluated the suitability of the housekeeping gene candidates by using them to assess expression levels of the inflammation-related gene . Regardless of the housekeeping gene candidates used for normalization, relative expression levels of were significantly higher in mastitis-affected samples than in control samples. However, of all the housekeeping genes and gene combinations investigated, normalization with alone generated the difference in relative expression between mastitis-affected and control samples with the highest significance. These results suggest that is suitable for use as a housekeeping gene for analysis of bovine mastitis-related microRNA in milk.

  11. Detecting short spatial scale local adaptation and epistatic selection in climate-related candidate genes in European beech (Fagus sylvatica) populations.

    PubMed

    Csilléry, Katalin; Lalagüe, Hadrien; Vendramin, Giovanni G; González-Martínez, Santiago C; Fady, Bruno; Oddou-Muratorio, Sylvie

    2014-10-01

    Detecting signatures of selection in tree populations threatened by climate change is currently a major research priority. Here, we investigated the signature of local adaptation over a short spatial scale using 96 European beech (Fagus sylvatica L.) individuals originating from two pairs of populations on the northern and southern slopes of Mont Ventoux (south-eastern France). We performed both single and multilocus analysis of selection based on 53 climate-related candidate genes containing 546 SNPs. FST outlier methods at the SNP level revealed a weak signal of selection, with three marginally significant outliers in the northern populations. At the gene level, considering haplotypes as alleles, two additional marginally significant outliers were detected, one on each slope. To account for the uncertainty of haplotype inference, we averaged the Bayes factors over many possible phase reconstructions. Epistatic selection offers a realistic multilocus model of selection in natural populations. Here, we used a test suggested by Ohta based on the decomposition of the variance of linkage disequilibrium. Overall populations, 0.23% of the SNP pairs (haplotypes) showed evidence of epistatic selection, with nearly 80% of them being within genes. One of the between gene epistatic selection signals arose between an FST outlier and a nonsynonymous mutation in a drought response gene. Additionally, we identified haplotypes containing selectively advantageous allele combinations which were unique to high or low elevations and northern or southern populations. Several haplotypes contained nonsynonymous mutations situated in genes with known functional importance for adaptation to climatic factors. © 2014 John Wiley & Sons Ltd.

  12. An intersection network based on combining SNP co-association and RNA co-expression networks for feed utilization traits in Japanese Black cattle.

    PubMed

    Okada, D; Endo, S; Matsuda, H; Ogawa, S; Taniguchi, Y; Katsuta, T; Watanabe, T; Iwaisaki, H

    2018-05-12

    Genome-wide association studies (GWAS) of quantitative traits have detected numerous genetic associations, but they encounter difficulties in pinpointing prominent candidate genes and inferring gene networks. The present study used a systems genetics approach integrating GWAS results with external RNA-expression data to detect candidate gene networks in feed utilization and growth traits of Japanese Black cattle, which are matters of concern. A SNP co-association network was derived from significant correlations between SNPs with effects estimated by GWAS across seven phenotypic traits. The resulting network genes contained significant numbers of annotations related to the traits. Using bovine transcriptome data from a public database, an RNA co-expression network was inferred based on the similarity of expression patterns across different tissues. An intersection network was then generated by superimposing the SNP and RNA networks and extracting shared interactions. This intersection network contained four tissue-specific modules: nervous system, reproductive system, muscular system, and glands. To characterize the structure (topographical properties) of the three networks, their scale-free properties were evaluated, which revealed that the intersection network was the most scale-free. In the sub-network containing the most connected transcription factors (URI1, ROCK2 and ETV6), most genes were widely expressed across tissues, and genes previously shown to be involved in the traits were found. Results indicated that the current approach might be used to construct a gene network that better reflects biological information, providing encouragement for the genetic dissection of economically important quantitative traits.

  13. Discovering novel subsystems using comparative genomics

    PubMed Central

    Ferrer, Luciana; Shearer, Alexander G.; Karp, Peter D.

    2011-01-01

    Motivation: Key problems for computational genomics include discovering novel pathways in genome data, and discovering functional interaction partners for genes to define new members of partially elucidated pathways. Results: We propose a novel method for the discovery of subsystems from annotated genomes. For each gene pair, a score measuring the likelihood that the two genes belong to a same subsystem is computed using genome context methods. Genes are then grouped based on these scores, and the resulting groups are filtered to keep only high-confidence groups. Since the method is based on genome context analysis, it relies solely on structural annotation of the genomes. The method can be used to discover new pathways, find missing genes from a known pathway, find new protein complexes or other kinds of functional groups and assign function to genes. We tested the accuracy of our method in Escherichia coli K-12. In one configuration of the system, we find that 31.6% of the candidate groups generated by our method match a known pathway or protein complex closely, and that we rediscover 31.2% of all known pathways and protein complexes of at least 4 genes. We believe that a significant proportion of the candidates that do not match any known group in E.coli K-12 corresponds to novel subsystems that may represent promising leads for future laboratory research. We discuss in-depth examples of these findings. Availability: Predicted subsystems are available at http://brg.ai.sri.com/pwy-discovery/journal.html. Contact: lferrer@ai.sri.com Supplementary information: Supplementary data are available at Bioinformatics online. PMID:21775308

  14. Assignment of Alzheimer's presenilin-2 (PS-2) gene to 1q42.1 by fluorescence in situ hybridization.

    PubMed

    Takano, T; Sahara, N; Yamanouchi, Y; Mori, H

    1997-01-17

    Presenilin-2 (PS-2) was suggested to be localized on 1q31-42 based on linkage analysis and cDNA cloning. The final identification of PS-2 as the causal gene for early-onset familial Alzheimer's disease in Voga-German pedigrees was concluded based on the point mutation found in the candidate cDNA isolated from this familial AD. We present evidence of its physical genome mapping of PS-2 on chromosome 1q42.1 by fluorescence in situ hybridization method.

  15. Commentary on "predicting metastasized seminoma using gene expression." Ruf CG, Linbecker M, Port M, Riecke A, Schmelz HU, Wagner W, Meineke V, Abend M, Department of Urology, Federal Armed Forces Hospital, Hamburg, Germany: BJU Int 2012;110:E14.

    PubMed

    Richie, Jerome

    2013-02-01

    Treatment options for testis cancer depend on the histological subtype as well as on the clinical stage. An accurate staging is essential for correct treatment. The 'golden standard' for staging purposes is CT, but occult metastasis cannot be detected with this method. Currently, parameters such as primary tumour size, vessel invasion or invasion of the rete testis are used for predicting occult metastasis. Last year the association of these parameters with metastasis could not be validated in a new independent cohort. Gene expression analysis in testis cancer allowed discrimination between the different histological subtypes (seminoma and non-seminoma) as well as testis cancer and normal testis tissue. In a two-stage study design we (i) screened the whole genome (using human whole genome microarrays) for candidate genes associated with the metastatic stage in seminoma and (ii) validated and quantified gene expression of our candidate genes (real-time quantitative polymerase chain reaction) on another independent group. Gene expression measurements of two of our candidate genes (dopamine receptor D1 [DRD1] and family with sequence similarity 71, member F2 [FAM71F2]) examined in primary testis cancers made it possible to discriminate the metastasis status in seminoma. The discriminative ability of the genes exceeded the predictive significance of currently used histological/pathological parameters. Based on gene expression analysis the present study provides suggestions for improved individual decision making either in favour of early adjuvant therapy or increased surveillance. To evaluate the usefulness of gene expression profiling for predicting metastatic status in testicular seminoma at the time of first diagnosis compared with established clinical and pathological parameters. Total RNA was isolated from testicular tumours of metastasized patients (12 patients, clinical stage IIa-III), non-metastasized patients (40, clinical stage I) and adjacent 'normal' tissue (n = 36). The RNA was then converted into cDNA and real-time quantitative polymerase chain reaction was run on 94 candidate genes selected from previous work. Normalised gene expression of these genes and histological variables, e.g. tumour size and rete testis infiltration, were analysed using logistic regression analysis. Expression of two genes (dopamine receptor D1 [DRD1] and family with sequence similarity 71, member F2 [FAM71F2], P = 0.005 and 0.024 in separate analysis and P = 0.004 and 0.016 when combining both genes, respectively) made it possible to significantly discriminate the metastasis status. Concordance increased from 77.9% (DRD1) and 72.3% (FAM71F2) in separate analysis and up to 87.7% when combining both genes in one model. Only primary tumour size in separate analysis (continuous or categorical with tumour size>6cm) was significantly associated with metastasis (P = 0.039/P = 0.02), but concordance was lower (61%). When we combined tumour size with our two genes in one model there was no further statistical improvement or increased concordance. Based on gene expression analysis our study provides suggestions for improved individual decision making either in favour of early adjuvant therapy or increased surveillance. Copyright © 2013 Elsevier Inc. All rights reserved.

  16. QTL Mapping and CRISPR/Cas9 Editing to Identify a Drug Resistance Gene in Toxoplasma gondii.

    PubMed

    Shen, Bang; Powell, Robin H; Behnke, Michael S

    2017-06-22

    Scientific knowledge is intrinsically linked to available technologies and methods. This article will present two methods that allowed for the identification and verification of a drug resistance gene in the Apicomplexan parasite Toxoplasma gondii, the method of Quantitative Trait Locus (QTL) mapping using a Whole Genome Sequence (WGS) -based genetic map and the method of Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/Cas9 -based gene editing. The approach of QTL mapping allows one to test if there is a correlation between a genomic region(s) and a phenotype. Two datasets are required to run a QTL scan, a genetic map based on the progeny of a recombinant cross and a quantifiable phenotype assessed in each of the progeny of that cross. These datasets are then formatted to be compatible with R/qtl software that generates a QTL scan to identify significant loci correlated with the phenotype. Although this can greatly narrow the search window of possible candidates, QTLs span regions containing a number of genes from which the causal gene needs to be identified. Having WGS of the progeny was critical to identify the causal drug resistance mutation at the gene level. Once identified, the candidate mutation can be verified by genetic manipulation of drug sensitive parasites. The most facile and efficient method to genetically modify T. gondii is the CRISPR/Cas9 system. This system comprised of just 2 components both encoded on a single plasmid, a single guide RNA (gRNA) containing a 20 bp sequence complementary to the genomic target and the Cas9 endonuclease that generates a double-strand DNA break (DSB) at the target, repair of which allows for insertion or deletion of sequences around the break site. This article provides detailed protocols to use CRISPR/Cas9 based genome editing tools to verify the gene responsible for sinefungin resistance and to construct transgenic parasites.

  17. QTL Mapping and CRISPR/Cas9 Editing to Identify a Drug Resistance Gene in Toxoplasma gondii

    PubMed Central

    Shen, Bang; Powell, Robin H.; Behnke, Michael S.

    2017-01-01

    Scientific knowledge is intrinsically linked to available technologies and methods. This article will present two methods that allowed for the identification and verification of a drug resistance gene in the Apicomplexan parasite Toxoplasma gondii, the method of Quantitative Trait Locus (QTL) mapping using a Whole Genome Sequence (WGS) -based genetic map and the method of Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/Cas9 -based gene editing. The approach of QTL mapping allows one to test if there is a correlation between a genomic region(s) and a phenotype. Two datasets are required to run a QTL scan, a genetic map based on the progeny of a recombinant cross and a quantifiable phenotype assessed in each of the progeny of that cross. These datasets are then formatted to be compatible with R/qtl software that generates a QTL scan to identify significant loci correlated with the phenotype. Although this can greatly narrow the search window of possible candidates, QTLs span regions containing a number of genes from which the causal gene needs to be identified. Having WGS of the progeny was critical to identify the causal drug resistance mutation at the gene level. Once identified, the candidate mutation can be verified by genetic manipulation of drug sensitive parasites. The most facile and efficient method to genetically modify T. gondii is the CRISPR/Cas9 system. This system comprised of just 2 components both encoded on a single plasmid, a single guide RNA (gRNA) containing a 20 bp sequence complementary to the genomic target and the Cas9 endonuclease that generates a double-strand DNA break (DSB) at the target, repair of which allows for insertion or deletion of sequences around the break site. This article provides detailed protocols to use CRISPR/Cas9 based genome editing tools to verify the gene responsible for sinefungin resistance and to construct transgenic parasites. PMID:28671645

  18. A taxonomic framework for cable bacteria and proposal of the candidate genera Electrothrix and Electronema.

    PubMed

    Trojan, Daniela; Schreiber, Lars; Bjerg, Jesper T; Bøggild, Andreas; Yang, Tingting; Kjeldsen, Kasper U; Schramm, Andreas

    2016-07-01

    Cable bacteria are long, multicellular filaments that can conduct electric currents over centimeter-scale distances. All cable bacteria identified to date belong to the deltaproteobacterial family Desulfobulbaceae and have not been isolated in pure culture yet. Their taxonomic delineation and exact phylogeny is uncertain, as most studies so far have reported only short partial 16S rRNA sequences or have relied on identification by a combination of filament morphology and 16S rRNA-targeted fluorescence in situ hybridization with a Desulfobulbaceae-specific probe. In this study, nearly full-length 16S rRNA gene sequences of 16 individual cable bacteria filaments from freshwater, salt marsh, and marine sites of four geographic locations are presented. These sequences formed a distinct, monophyletic sister clade to the genus Desulfobulbus and could be divided into six coherent, species-level clusters, arranged as two genus-level groups. The same grouping was retrieved by phylogenetic analysis of full or partial dsrAB genes encoding the dissimilatory sulfite reductase. Based on these results, it is proposed to accommodate cable bacteria within two novel candidate genera: the mostly marine "Candidatus Electrothrix", with four candidate species, and the mostly freshwater "Candidatus Electronema", with two candidate species. This taxonomic framework can be used to assign environmental sequences confidently to the cable bacteria clade, even without morphological information. Database searches revealed 185 16S rRNA gene sequences that affiliated within the clade formed by the proposed cable bacteria genera, of which 120 sequences could be assigned to one of the six candidate species, while the remaining 65 sequences indicated the existence of up to five additional species. Copyright © 2016 The Author(s). Published by Elsevier GmbH.. All rights reserved.

  19. Detection of genomic signatures of recent selection in commercial broiler chickens.

    PubMed

    Fu, Weixuan; Lee, William R; Abasht, Behnam

    2016-08-26

    Identification of the genomic signatures of recent selection may help uncover causal polymorphisms controlling traits relevant to recent decades of selective breeding in livestock. In this study, we aimed at detecting signatures of recent selection in commercial broiler chickens using genotype information from single nucleotide polymorphisms (SNPs). A total of 565 chickens from five commercial purebred lines, including three broiler sire (male) lines and two broiler dam (female) lines, were genotyped using the 60K SNP Illumina iSelect chicken array. To detect genomic signatures of recent selection, we applied two methods based on population comparison, cross-population extended haplotype homozygosity (XP-EHH) and cross-population composite likelihood ratio (XP-CLR), and further analyzed the results to find genomic regions under recent selection in multiple purebred lines. A total of 321 candidate selection regions spanning approximately 1.45 % of the chicken genome in each line were detected by consensus of results of both XP-EHH and XP-CLR methods. To minimize false discovery due to genetic drift, only 42 of the candidate selection regions that were shared by 2 or more purebred lines were considered as high-confidence selection regions in the study. Of these 42 regions, 20 were 50 kb or less while 4 regions were larger than 0.5 Mb. In total, 91 genes could be found in the 42 regions, among which 19 regions contained only 1 or 2 genes, and 9 regions were located at gene deserts. Our results provide a genome-wide scan of recent selection signatures in five purebred lines of commercial broiler chickens. We found several candidate genes for recent selection in multiple lines, such as SOX6 (Sex Determining Region Y-Box 6) and cTR (Thyroid hormone receptor beta). These genes may have been under recent selection due to their essential roles in growth, development and reproduction in chickens. Furthermore, our results suggest that in some candidate regions, the same or opposite alleles have been under recent selection in multiple lines. Most of the candidate genes in the selection regions are novel, and as such they should be of great interest for future research into the genetic architecture of traits relevant to modern broiler breeding.

  20. Selection and evaluation of reference genes for expression studies with quantitative PCR in the model fungus Neurospora crassa under different environmental conditions in continuous culture.

    PubMed

    Cusick, Kathleen D; Fitzgerald, Lisa A; Pirlo, Russell K; Cockrell, Allison L; Petersen, Emily R; Biffinger, Justin C

    2014-01-01

    Neurospora crassa has served as a model organism for studying circadian pathways and more recently has gained attention in the biofuel industry due to its enhanced capacity for cellulase production. However, in order to optimize N. crassa for biotechnological applications, metabolic pathways during growth under different environmental conditions must be addressed. Reverse-transcription quantitative PCR (RT-qPCR) is a technique that provides a high-throughput platform from which to measure the expression of a large set of genes over time. The selection of a suitable reference gene is critical for gene expression studies using relative quantification, as this strategy is based on normalization of target gene expression to a reference gene whose expression is stable under the experimental conditions. This study evaluated twelve candidate reference genes for use with N. crassa when grown in continuous culture bioreactors under different light and temperature conditions. Based on combined stability values from NormFinder and Best Keeper software packages, the following are the most appropriate reference genes under conditions of: (1) light/dark cycling: btl, asl, and vma1; (2) all-dark growth: btl, tbp, vma1, and vma2; (3) temperature flux: btl, vma1, act, and asl; (4) all conditions combined: vma1, vma2, tbp, and btl. Since N. crassa exists as different cell types (uni- or multi-nucleated), expression changes in a subset of the candidate genes was further assessed using absolute quantification. A strong negative correlation was found to exist between ratio and threshold cycle (CT) values, demonstrating that CT changes serve as a reliable reflection of transcript, and not gene copy number, fluctuations. The results of this study identified genes that are appropriate for use as reference genes in RT-qPCR studies with N. crassa and demonstrated that even with the presence of different cell types, relative quantification is an acceptable method for measuring gene expression changes during growth in bioreactors.

  1. PCR-based detection of gene transfer vectors: application to gene doping surveillance.

    PubMed

    Perez, Irene C; Le Guiner, Caroline; Ni, Weiyi; Lyles, Jennifer; Moullier, Philippe; Snyder, Richard O

    2013-12-01

    Athletes who illicitly use drugs to enhance their athletic performance are at risk of being banned from sports competitions. Consequently, some athletes may seek new doping methods that they expect to be capable of circumventing detection. With advances in gene transfer vector design and therapeutic gene transfer, and demonstrations of safety and therapeutic benefit in humans, there is an increased probability of the pursuit of gene doping by athletes. In anticipation of the potential for gene doping, assays have been established to directly detect complementary DNA of genes that are top candidates for use in doping, as well as vector control elements. The development of molecular assays that are capable of exposing gene doping in sports can serve as a deterrent and may also identify athletes who have illicitly used gene transfer for performance enhancement. PCR-based methods to detect foreign DNA with high reliability, sensitivity, and specificity include TaqMan real-time PCR, nested PCR, and internal threshold control PCR.

  2. Characterization and Amplification of Gene-Based Simple Sequence Repeat (SSR) Markers in Date Palm.

    PubMed

    Zhao, Yongli; Keremane, Manjunath; Prakash, Channapatna S; He, Guohao

    2017-01-01

    The paucity of molecular markers limits the application of genetic and genomic research in date palm (Phoenix dactylifera L.). Availability of expressed sequence tag (EST) sequences in date palm may provide a good resource for developing gene-based markers. This study characterizes a substantial fraction of transcriptome sequences containing simple sequence repeats (SSRs) from the EST sequences in date palm. The EST sequences studied are mainly homologous to those of Elaeis guineensis and Musa acuminata. A total of 911 gene-based SSR markers, characterized with functional annotations, have provided a useful basis not only for discovering candidate genes and understanding genetic basis of traits of interest but also for developing genetic and genomic tools for molecular research in date palm, such as diversity study, quantitative trait locus (QTL) mapping, and molecular breeding. The procedures of DNA extraction, polymerase chain reaction (PCR) amplification of these gene-based SSR markers, and gel electrophoresis of PCR products are described in this chapter.

  3. Kassiopeia: a database and web application for the analysis of mutually exclusive exomes of eukaryotes

    PubMed Central

    2014-01-01

    Background Alternative splicing is an important process in higher eukaryotes that allows obtaining several transcripts from one gene. A specific case of alternative splicing is mutually exclusive splicing, in which exactly one exon out of a cluster of neighbouring exons is spliced into the mature transcript. Recently, a new algorithm for the prediction of these exons has been developed based on the preconditions that the exons of the cluster have similar lengths, sequence homology, and conserved splice sites, and that they are translated in the same reading frame. Description In this contribution we introduce Kassiopeia, a database and web application for the generation, storage, and presentation of genome-wide analyses of mutually exclusive exomes. Currently, Kassiopeia provides access to the mutually exclusive exomes of twelve Drosophila species, the thale cress Arabidopsis thaliana, the flatworm Caenorhabditis elegans, and human. Mutually exclusive spliced exons (MXEs) were predicted based on gene reconstructions from Scipio. Based on the standard prediction values, with which 83.5% of the annotated MXEs of Drosophila melanogaster were reconstructed, the exomes contain surprisingly more MXEs than previously supposed and identified. The user can search Kassiopeia using BLAST or browse the genes of each species optionally adjusting the parameters used for the prediction to reveal more divergent or only very similar exon candidates. Conclusions We developed a pipeline to predict MXEs in the genomes of several model organisms and a web interface, Kassiopeia, for their visualization. For each gene Kassiopeia provides a comprehensive gene structure scheme, the sequences and predicted secondary structures of the MXEs, and, if available, further evidence for MXE candidates from cDNA/EST data, predictions of MXEs in homologous genes of closely related species, and RNA secondary structure predictions. Kassiopeia can be accessed at http://www.motorprotein.de/kassiopeia. PMID:24507667

  4. Children’s Hospital of Pittsburgh and Diabetes Institute of the Walter Reed Health Care System Genetic Screening in Diabetes: Candidate Gene Analysis for Diabetic Retinopathy

    DTIC Science & Technology

    2010-05-01

    Screening in Diabetes : Candidate Gene Analysis for Diabetic Retinopathy PRINCIPAL INVESTIGATOR: Robert A. Vigersky, COL MC CONTRACTING ORGANIZATION... Diabetes Institute of the Walter Reed Health Care System Genetic Screening in Diabetes : Candidate Gene Analysis for Diabetic Retinopathy 5c. PROGRAM... diabetic  neuropathy, and  diabetic   retinopathy .  This was an observational study in which the investigators obtained DNA samples from the blood of

  5. TREAT (TREe-based Association Test)

    Cancer.gov

    TREAT is an R package for detecting complex joint effects in case-control studies. The test statistic is derived from a tree-structure model by recursive partitioning the data. Ultra-fast algorithm is designed to evaluate the significance of association between candidate gene and disease outcome

  6. Conditional lethality strains for the biological control of Anastrepha species

    USDA-ARS?s Scientific Manuscript database

    Pro-apoptotic cell death genes are promising candidates for biologically-based autocidal control of pest insects as demonstrated by tetracycline (tet)-suppressible systems for conditional embryonic lethality in Drosophila melanogaster (Dm) and the medfly, Ceratitis capitata (Cc). However, for medfly...

  7. Linkage of autosomal recessive lamellar ichthyosis to chromosome 14q

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Russell, L.J.; Compton, J.G.; Bale, S.J.

    The authors have mapped the locus for lamellar ichthyosis (LI), an autosomal recessive skin disease characterized by abnormal cornification of the epidermis. Analysis using both inbred and outbred families manifesting severe LI showed complete linkage to several markers within a 9.3-cM region on chromosome 14q11. Affected individuals in inbred families were also found to have striking homozygosity for markers in this region. Linkage-based genetic counseling and prenatal diagnosis is now available for informative at-risk families. Several transcribed genes have been mapped to the chromosome 14 region containing the LI gene. The transglutaminase 1 gene (TGM1), which encodes one of themore » enzymes responsible for cross-linking epidermal proteins during formation of the stratum corneum, maps to this interval. The TGM1 locus was completely linked to LI (Z = 9.11), suggesting that TGM1 is a good candidate for further investigation of this disorder. The genes for four serine proteases also map to this region but are expressed only in hematopoietic or mast cells, making them less likely candidates.« less

  8. snoSeeker: an advanced computational package for screening of guide and orphan snoRNA genes in the human genome.

    PubMed

    Yang, Jian-Hua; Zhang, Xiao-Chen; Huang, Zhan-Peng; Zhou, Hui; Huang, Mian-Bo; Zhang, Shu; Chen, Yue-Qin; Qu, Liang-Hu

    2006-01-01

    Small nucleolar RNAs (snoRNAs) represent an abundant group of non-coding RNAs in eukaryotes. They can be divided into guide and orphan snoRNAs according to the presence or absence of antisense sequence to rRNAs or snRNAs. Current snoRNA-searching programs, which are essentially based on sequence complementarity to rRNAs or snRNAs, exist only for the screening of guide snoRNAs. In this study, we have developed an advanced computational package, snoSeeker, which includes CDseeker and ACAseeker programs, for the highly efficient and specific screening of both guide and orphan snoRNA genes in mammalian genomes. By using these programs, we have systematically scanned four human-mammal whole-genome alignment (WGA) sequences and identified 54 novel candidates including 26 orphan candidates as well as 266 known snoRNA genes. Eighteen novel snoRNAs were further experimentally confirmed with four snoRNAs exhibiting a tissue-specific or restricted expression pattern. The results of this study provide the most comprehensive listing of two families of snoRNA genes in the human genome till date.

  9. An efficient method for native protein purification in the selected range from prostate cancer tissue digests

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ahmad, Rumana; Nicora, Carrie D.; Shukla, Anil K.

    Prostate cancer (CP) cells differ from their normal counterpart in gene expression. Genes encoding secreted or extracellular proteins with increased expression in CP may serve as potential biomarkers. For their detection and quantification, assays based on monoclonal antibodies are best suited for development in a clinical setting. One approach to obtain antibodies is to use recombinant proteins as immunogen. However, the synthesis of recombinant protein for each identified candidate is time-consuming and expensive. It is also not practical to generate high quality antibodies to all identified candidates individually. Furthermore, non-native forms (e.g., recombinant) of proteins may not always lead tomore » useful antibodies. Our approach was to purify a subset of proteins from CP tissue specimens for use as immunogen.« less

  10. Gene Expression Profiling of Gastric Cancer

    PubMed Central

    Marimuthu, Arivusudar; Jacob, Harrys K.C.; Jakharia, Aniruddha; Subbannayya, Yashwanth; Keerthikumar, Shivakumar; Kashyap, Manoj Kumar; Goel, Renu; Balakrishnan, Lavanya; Dwivedi, Sutopa; Pathare, Swapnali; Dikshit, Jyoti Bajpai; Maharudraiah, Jagadeesha; Singh, Sujay; Sameer Kumar, Ghantasala S; Vijayakumar, M.; Veerendra Kumar, Kariyanakatte Veeraiah; Premalatha, Chennagiri Shrinivasamurthy; Tata, Pramila; Hariharan, Ramesh; Roa, Juan Carlos; Prasad, T.S.K; Chaerkady, Raghothama; Kumar, Rekha Vijay; Pandey, Akhilesh

    2015-01-01

    Gastric cancer is the second leading cause of cancer death worldwide, both in men and women. A genomewide gene expression analysis was carried out to identify differentially expressed genes in gastric adenocarcinoma tissues as compared to adjacent normal tissues. We used Agilent’s whole human genome oligonucleotide microarray platform representing ~41,000 genes to carry out gene expression analysis. Two-color microarray analysis was employed to directly compare the expression of genes between tumor and normal tissues. Through this approach, we identified several previously known candidate genes along with a number of novel candidate genes in gastric cancer. Testican-1 (SPOCK1) was one of the novel molecules that was 10-fold upregulated in tumors. Using tissue microarrays, we validated the expression of testican-1 by immunohistochemical staining. It was overexpressed in 56% (160/282) of the cases tested. Pathway analysis led to the identification of several networks in which SPOCK1 was among the topmost networks of interacting genes. By gene enrichment analysis, we identified several genes involved in cell adhesion and cell proliferation to be significantly upregulated while those corresponding to metabolic pathways were significantly downregulated. The differentially expressed genes identified in this study are candidate biomarkers for gastric adenoacarcinoma. PMID:27030788

  11. Chapter 15: Disease Gene Prioritization

    PubMed Central

    Bromberg, Yana

    2013-01-01

    Disease-causing aberrations in the normal function of a gene define that gene as a disease gene. Proving a causal link between a gene and a disease experimentally is expensive and time-consuming. Comprehensive prioritization of candidate genes prior to experimental testing drastically reduces the associated costs. Computational gene prioritization is based on various pieces of correlative evidence that associate each gene with the given disease and suggest possible causal links. A fair amount of this evidence comes from high-throughput experimentation. Thus, well-developed methods are necessary to reliably deal with the quantity of information at hand. Existing gene prioritization techniques already significantly improve the outcomes of targeted experimental studies. Faster and more reliable techniques that account for novel data types are necessary for the development of new diagnostics, treatments, and cure for many diseases. PMID:23633938

  12. A specific endogenous reference for genetically modified common bean (Phaseolus vulgaris L.) DNA quantification by real-time PCR targeting lectin gene.

    PubMed

    Venturelli, Gustavo L; Brod, Fábio C A; Rossi, Gabriela B; Zimmermann, Naíra F; Oliveira, Jaison P; Faria, Josias C; Arisi, Ana C M

    2014-11-01

    The Embrapa 5.1 genetically modified (GM) common bean was approved for commercialization in Brazil. Methods for the quantification of this new genetically modified organism (GMO) are necessary. The development of a suitable endogenous reference is essential for GMO quantification by real-time PCR. Based on this, a new taxon-specific endogenous reference quantification assay was developed for Phaseolus vulgaris L. Three genes encoding common bean proteins (phaseolin, arcelin, and lectin) were selected as candidates for endogenous reference. Primers targeting these candidate genes were designed and the detection was evaluated using the SYBR Green chemistry. The assay targeting lectin gene showed higher specificity than the remaining assays, and a hydrolysis probe was then designed. This assay showed high specificity for 50 common bean samples from two gene pools, Andean and Mesoamerican. For GM common bean varieties, the results were similar to those obtained for non-GM isogenic varieties with PCR efficiency values ranging from 92 to 101 %. Moreover, this assay presented a limit of detection of ten haploid genome copies. The primers and probe developed in this work are suitable to detect and quantify either GM or non-GM common bean.

  13. Transcriptomic analysis of the mussel Elliptio complanata identifies candidate stress-response genes and an abundance of novel or noncoding transcripts

    USGS Publications Warehouse

    Cornman, Robert S.; Robertson, Laura S.; Galbraith, Heather S.; Blakeslee, Carrie J.

    2014-01-01

    Mussels are useful indicator species of environmental stress and degradation, and the global decline in freshwater mussel diversity and abundance is of conservation concern. Elliptio complanata is a common freshwater mussel of eastern North America that can serve both as an indicator and as an experimental model for understanding mussel physiology and genetics. To support genetic components of these research goals, we assembled transcriptome contigs from Illumina paired-end reads. Despite efforts to collapse similar contigs, the final assembly was in excess of 136,000 contigs with an N50 of 982 bp. Even so, comparisons to the CEGMA database of conserved eukaryotic genes indicated that ∼20% of genes remain unrepresented. However, numerous candidate stress-response genes were present, and we identified lineage-specific patterns of diversification among molluscs for cytochrome P450 detoxification genes and two saccharide-modifying enzymes: 1,3 beta-galactosyltransferase and fucosyltransferase. Less than a quarter of contigs had protein-level similarity based on modest BLAST and Hmmer3 statistical thresholds. These results add comparative genomic resources for molluscs and suggest a wealth of novel proteins and noncoding transcripts.

  14. Association Studies of 22 Candidate SNPs with Late-Onset Alzheimer's Disease

    PubMed Central

    Figgins, Jessica A.; Minster, Ryan L.; Demirci, F. Yesim; DeKosky, Steven T.; Kamboh, M. Ilyas

    2009-01-01

    Alzheimer's disease (AD) is a complex and multifactorial disease with the possible involvement of several genes. With the exception of the APOE gene as a susceptibility marker, no other genes have been shown consistently to be associated with late-onset AD (LOAD). A recent genome-wide association study of 17,343 gene-based putative functional single nucleotide polymorphisms (SNPs) found 19 significant variants, including 3 linked to APOE, showing association with LOAD (Hum Mol Genet 2007; 16:865–873). We have set out to replicate the 16 new significant associations in a large case-control cohort of American Whites. Additionally, we examined six variants present in positional and/or biological candidate genes for AD. We genotyped the 22 SNPs in up to 1,009 Caucasian Americans with LOAD and up to 1,010 age-matched healthy Caucasian Americans, using 5′ nuclease assays. We did not observe a statistically significant association between the SNPs and the risk of AD, either individually or stratified by APOE. Our data suggest that the association of the studied variants with LOAD risk, if it exists, is not statistically significant in our sample. PMID:18780302

  15. A simple PCR-based marker to determine sex in aspen.

    PubMed

    Pakull, B; Kersten, B; Lüneburg, J; Fladung, M

    2015-01-01

    The genus Populus features a genetically controlled sex determination system, located on chromosome 19. However, different Populus species vary in the position of the sex-linked region on the respective chromosome and the apparent heterogametic sex, and the precise mechanism of sex determination in Populus is still unknown. Using next generation sequencing of pooled samples of male and female aspens, we identified the aspen homologue of the P. trichocarpa gene Potri.019G047300 ('TOZ19') to be male-specific. While in P. tremuloides, the complete gene is missing in the genome of female plants, a short fragment of the 3'-part of the gene is still present in P. tremula females. The male-specific presence and transcription of TOZ19 was further verified using PCR in various different aspen individuals and RT-PCR expression analysis. TOZ19 is potentially involved in early steps of flower development, and represents an interesting candidate gene for involvement in sex determination in aspen. Regardless of its role as candidate gene, TOZ19 represents an ideal marker for determination of the sex of non-flowering aspen individuals or seedlings. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.

  16. Scanning of selection signature provides a glimpse into important economic traits in goats (Capra hircus).

    PubMed

    Guan, Dailu; Luo, Nanjian; Tan, Xiaoshan; Zhao, Zhongquan; Huang, Yongfu; Na, Risu; Zhang, Jiahua; Zhao, Yongju

    2016-10-31

    Goats (Capra hircus) are one of the oldest livestock domesticated species, and have been used for their milk, meat, hair and skins over much of the world. Detection of selection footprints in genomic regions can provide potential insights for understanding the genetic mechanism of specific phenotypic traits and better guide in animal breeding. The study presented here has generated 192.747G raw data and identified more than 5.03 million single-nucleotide polymorphisms (SNPs) and 334,151 Indels (insertions and deletions). In addition, we identified 155 and 294 candidate regions harboring 86 and 97 genes based on allele frequency differences in Dazu black goats (DBG) and Inner Mongolia cashmere goats (IMCG), respectively. Populations differentiation reflected by Fst values detected 368 putative selective sweep regions including 164 genes. The top 1% regions of both low heterozygosity and high genetic differentiation contained 239 (135 genes) and 176 (106 genes) candidate regions in DBG and IMCG, respectively. These genes were related to reproductive and productive traits, such as "neurohypophyseal hormone activity" and "adipocytokine signaling pathway". These findings may be conducive to molecular breeding and the long-term preservation of the valuable genetic resources for this species.

  17. Transcription map of Xq27: candidates for several X-linked diseases.

    PubMed

    Zucchi, I; Jones, J; Affer, M; Montagna, C; Redolfi, E; Susani, L; Vezzoni, P; Parvari, R; Schlessinger, D; Whyte, M P; Mumm, S

    1999-04-15

    Human Xq27 contains candidate regions for several disorders, yet is predicted to be a gene-poor cytogenetic band. We have developed a transcription map for the entire cytogenetic band to facilitate the identification of the relatively small number of expected candidate genes. Two approaches were taken to identify genes: (1) a group of 64 unique STSs that were generated during the physical mapping of the region were used in RT-PCR with RNA from human adult and fetal brain and (2) ESTs that have been broadly mapped to this region of the chromosome were finely mapped using a high-resolution yeast artificial chromosome contig. This combined approach identified four distinct regions of transcriptional activity within the Xq27 band. Among them is a region at the centromeric boundary that contains candidate regions for several rare developmental disorders (X-linked recessive hypoparathyroidism, thoracoabdominal syndrome, albinism-deafness syndrome, and Borjeson-Forssman-Lehman syndrome). Two transcriptionally active regions were identified in the center of Xq27 and include candidate regions for X-linked mental retardation syndrome 6, X-linked progressive cone dystrophy, X-linked retinitis pigmentosa 24, and a prostate cancer susceptibility locus. The fourth region of transcriptional activity encompasses the FMR1 (FRAXA) and FMR2 (FRAXE) genes. The analysis thus suggests clustered transcription in Xq27 and provides candidates for several heritable disorders for which the causative genes have not yet been found. Copyright 1999 Academic Press.

  18. An integrative “omics” approach identifies new candidate genes to impact aroma volatiles in peach fruit

    PubMed Central

    2013-01-01

    Background Ever since the recent completion of the peach genome, the focus of genetic research in this area has turned to the identification of genes related to important traits, such as fruit aroma volatiles. Of the over 100 volatile compounds described in peach, lactones most likely have the strongest effect on fruit aroma, while esters, terpenoids, and aldehydes have minor, yet significant effects. The identification of key genes underlying the production of aroma compounds is of interest for any fruit-quality improvement strategy. Results Volatile (52 compounds) and gene expression (4348 genes) levels were profiled in peach fruit from a maturity time-course series belonging to two peach genotypes that showed considerable differences in maturation characteristics and postharvest ripening. This data set was analyzed by complementary correlation-based approaches to discover the genes related to the main aroma-contributing compounds: lactones, esters, and phenolic volatiles, among others. As a case study, one of the candidate genes was cloned and expressed in yeast to show specificity as an ω-6 Oleate desaturase, which may be involved in the production of a precursor of lactones/esters. Conclusions Our approach revealed a set of genes (an alcohol acyl transferase, fatty acid desaturases, transcription factors, protein kinases, cytochromes, etc.) that are highly associated with peach fruit volatiles, and which could prove useful in breeding or for biotechnological purposes. PMID:23701715

  19. Identification of KCNJ11 as a functional candidate gene for bovine meat tenderness.

    PubMed

    Tizioto, Polyana C; Gasparin, Gustavo; Souza, Marcela M; Mudadu, Mauricio A; Coutinho, Luiz L; Mourão, Gerson B; Tholon, Patricia; Meirelles, Sarah L C; Tullio, Rymer R; Rosa, Antônio N; Alencar, Maurício M; Medeiros, Sérgio R; Siqueira, Fabiane; Feijó, Gelson L D; Nassu, Renata T; Regitano, Luciana C A

    2013-12-15

    The potassium inwardly rectifying channel, subfamily J, member 11 (KCNJ11) gene was investigated as a candidate for meat tenderness based on the effects reported on muscle for KCNJ11 gene knockout in rat models and its position in a quantitative trait locus (QTL) for meat tenderness in the bovine genome. Sequence variations in the KCNJ11 gene were described by sequencing six amplified fragments, covering almost the entire gene. We identified single nucleotide polymorphisms (SNP) and validated them by different approaches, taking advantage of simultaneous projects that are being developed with the same Nelore population. By sequencing the KCNJ11 in Nelore steers representing extreme phenotypes for Warner-Bratzler shear force (WBSF), it was possible to identify 22 SNPs. We validated two of the identified markers by genotyping the whole population (n = 460). Analysis of association between genotypes and WBSF values revealed a significant additive effect of a SNP at different meat aging times (P ≤ 0.05). In addition, an association between the expression levels of KCNJ11 and WBSF was found, with lower expression levels of KCNJ11 associated with more tender meat (P ≤ 0.05). The results showed that the KCNJ11 gene is a candidate mapped to a QTL for meat tenderness previously identified on BTA15 and may be useful to identify animals with genetic potential to produce tender meat. The effect of KCNJ11 observed on muscle is potentially due to changes in activity of KATP channels, which in turn influence the flow of potassium in the intracellular space, allowing establishment of the membrane potential necessary for muscle contraction.

  20. PAINT: a promoter analysis and interaction network generation tool for gene regulatory network identification.

    PubMed

    Vadigepalli, Rajanikanth; Chakravarthula, Praveen; Zak, Daniel E; Schwaber, James S; Gonye, Gregory E

    2003-01-01

    We have developed a bioinformatics tool named PAINT that automates the promoter analysis of a given set of genes for the presence of transcription factor binding sites. Based on coincidence of regulatory sites, this tool produces an interaction matrix that represents a candidate transcriptional regulatory network. This tool currently consists of (1) a database of promoter sequences of known or predicted genes in the Ensembl annotated mouse genome database, (2) various modules that can retrieve and process the promoter sequences for binding sites of known transcription factors, and (3) modules for visualization and analysis of the resulting set of candidate network connections. This information provides a substantially pruned list of genes and transcription factors that can be examined in detail in further experimental studies on gene regulation. Also, the candidate network can be incorporated into network identification methods in the form of constraints on feasible structures in order to render the algorithms tractable for large-scale systems. The tool can also produce output in various formats suitable for use in external visualization and analysis software. In this manuscript, PAINT is demonstrated in two case studies involving analysis of differentially regulated genes chosen from two microarray data sets. The first set is from a neuroblastoma N1E-115 cell differentiation experiment, and the second set is from neuroblastoma N1E-115 cells at different time intervals following exposure to neuropeptide angiotensin II. PAINT is available for use as an agent in BioSPICE simulation and analysis framework (www.biospice.org), and can also be accessed via a WWW interface at www.dbi.tju.edu/dbi/tools/paint/.

  1. Fine mapping and candidate gene analysis of qFL-chr1, a fiber length QTL in cotton.

    PubMed

    Xu, Peng; Gao, Jin; Cao, Zhibin; Chee, Peng W; Guo, Qi; Xu, Zhenzhen; Paterson, Andrew H; Zhang, Xianggui; Shen, Xinlian

    2017-06-01

    A fiber length QTL, qFL-chr1, was fine mapped to a 0.9 cM interval of cotton chromosome 1. Two positional candidate genes showed positive correlation between gene expression level and fiber length. Prior analysis of a backcross-self mapping population derived from a cross between Gossypium hirsutum L. and G. barbadense L. revealed a QTL on chromosome 1 associated with increased fiber length (qFL-chr1), which was confirmed in three independent populations of near-isogenic introgression lines (NIILs). Here, a single NIIL, R01-40-08, was used to develop a large population segregating for the target region. Twenty-two PCR-based polymorphic markers used to genotype 1672 BC 4 F 2 plants identified 432 recombinants containing breakpoints in the target region. Substitution mapping using 141 informative recombinants narrowed the position of qFL-chr1 to a 1.0-cM interval between SSR markers MUSS084 and CIR018. To exclude possible effects of non-target introgressions on fiber length, different heterozygous BC 4 F 3 plants introgressed between SSR markers NAU3384 and CGR5144 were selected to develop sub-NILs. The qFL-chr1 was further mapped at 0.9-cM interval between MUSS422 and CIR018 by comparisons of sub-NIL phenotype, and increased fiber length by ~1 mm. The 2.38-Mb region between MUSS422 and CIR018 in G. barbadense contained 19 annotated genes. Expression levels of two of these genes, GOBAR07705 (encoding 1-aminocyclopropane-1-carboxylate synthase) and GOBAR25992 (encoding amino acid permease), were positively correlated with fiber length in a small F 2 population, supporting these genes as candidates for qFL-chr1.

  2. A Near-Complete Haplotype-Phased Genome of the Dikaryotic Wheat Stripe Rust Fungus Puccinia striiformis f. sp. tritici Reveals High Interhaplotype Diversity

    PubMed Central

    Sperschneider, Jana; Garnica, Diana P.; Miller, Marisa E.; Taylor, Jennifer M.; Dodds, Peter N.; Park, Robert F.

    2018-01-01

    ABSTRACT A long-standing biological question is how evolution has shaped the genomic architecture of dikaryotic fungi. To answer this, high-quality genomic resources that enable haplotype comparisons are essential. Short-read genome assemblies for dikaryotic fungi are highly fragmented and lack haplotype-specific information due to the high heterozygosity and repeat content of these genomes. Here, we present a diploid-aware assembly of the wheat stripe rust fungus Puccinia striiformis f. sp. tritici based on long reads using the FALCON-Unzip assembler. Transcriptome sequencing data sets were used to infer high-quality gene models and identify virulence genes involved in plant infection referred to as effectors. This represents the most complete Puccinia striiformis f. sp. tritici genome assembly to date (83 Mb, 156 contigs, N50 of 1.5 Mb) and provides phased haplotype information for over 92% of the genome. Comparisons of the phase blocks revealed high interhaplotype diversity of over 6%. More than 25% of all genes lack a clear allelic counterpart. When we investigated genome features that potentially promote the rapid evolution of virulence, we found that candidate effector genes are spatially associated with conserved genes commonly found in basidiomycetes. Yet, candidate effectors that lack an allelic counterpart are more distant from conserved genes than allelic candidate effectors and are less likely to be evolutionarily conserved within the P. striiformis species complex and Pucciniales. In summary, this haplotype-phased assembly enabled us to discover novel genome features of a dikaryotic plant-pathogenic fungus previously hidden in collapsed and fragmented genome assemblies. PMID:29463659

  3. Mapping and characterization of the amplicon near APOA2 in 1q23 in human sarcomas by FISH and array CGH.

    PubMed

    Kresse, Stine H; Berner, Jeanne-Marie; Meza-Zepeda, Leonardo A; Gregory, Simon G; Kuo, Wen-Lin; Gray, Joe W; Forus, Anne; Myklebost, Ola

    2005-11-07

    Amplification of the q21-q23 region on chromosome 1 is frequently found in sarcomas and a variety of other solid tumours. Previous analyses of sarcomas have indicated the presence of at least two separate amplicons within this region, one located in 1q21 and one located near the apolipoprotein A-II (APOA2) gene in 1q23. In this study we have mapped and characterized the amplicon in 1q23 in more detail. We have used fluorescence in situ hybridisation (FISH) and microarray-based comparative genomic hybridisation (array CGH) to map and define the borders of the amplicon in 10 sarcomas. A subregion of approximately 800 kb was identified as the core of the amplicon. The amplification patterns of nine possible candidate target genes located to this subregion were determined by Southern blot analysis. The genes activating transcription factor 6 (ATF6) and dual specificity phosphatase 12 (DUSP12) showed the highest level of amplification, and they were also shown to be over-expressed by quantitative real-time reverse transcription PCR (RT-PCR). In general, the level of expression reflected the level of amplification in the different tumours. DUSP12 was expressed significantly higher than ATF6 in a subset of the tumours. In addition, two genes known to be transcriptionally activated by ATF6, glucose-regulated protein 78 kDa and -94 kDa (GRP78 and GRP94), were shown to be over-expressed in the tumours that showed over-expression of ATF6. ATF6 and DUSP12 seem to be the most likely candidate target genes for the 1q23 amplification in sarcomas. Both genes have possible roles in promoting cell growth, which makes them interesting candidate targets.

  4. Major histocompatibility complex and other allergy-related candidate genes associated with insect bite hypersensitivity in Icelandic horses.

    PubMed

    Klumplerova, Marie; Vychodilova, Leona; Bobrova, Olga; Cvanova, Michaela; Futas, Jan; Janova, Eva; Vyskocil, Mirko; Vrtkova, Irena; Putnova, Lenka; Dusek, Ladislav; Marti, Eliane; Horin, Petr

    2013-04-01

    Insect bite hypersensitivity (IBH) is an allergic dermatitis of horses caused by bites of insects. IBH is a multifactorial disease with contribution of genetic and environmental factors. Candidate gene association analysis of IBH was performed in a group of 89 Icelandic horses all born in Iceland and imported to Europe. Horses were classified in IBH-affected and non-affected based on clinical signs and history of recurrent dermatitis, and on the results of an in vitro sulfidoleukotriene (sLT)-release assay with Culicoides nubeculosus and Simulium vittatum extract. Different genetic markers were tested for association with IBH by the Fisher's exact test. The effect of the major histocompatibility complex (MHC) gene region was studied by genotyping five microsatellites spanning the MHC region (COR112, COR113, COR114, UM011 and UMN-JH34-2), and exon 2 polymorphisms of the class II Eqca-DRA gene. Associations with Eqca-DRA and COR113 were identified (p < 0.05). In addition, a panel of 20 single nucleotide polymorphisms (SNPs) in 17 candidate allergy-related genes was tested. During the initial screen, no marker from the panel was significantly (p < 0.05) associated with IBH. Five SNPs associated with IBH at p < 0.10 were therefore used for analysis of combined genotypes. Out of them, SNPs located in the genes coding for the CD14 receptor (CD14), interleukin 23 receptor (IL23R), thymic stromal lymphopoietin (TSLP) and transforming growth factor beta 3 (TGFB3) molecules were associated with IBH as parts of complex genotypes. These results are supported by similar associations and by expression data from different horse populations and from human studies.

  5. Genetic regulation of bone metabolism in the chicken: similarities and differences to Mammalian systems.

    PubMed

    Johnsson, Martin; Jonsson, Kenneth B; Andersson, Leif; Jensen, Per; Wright, Dominic

    2015-05-01

    Birds have a unique bone physiology, due to the demands placed on them through egg production. In particular their medullary bone serves as a source of calcium for eggshell production during lay and undergoes continuous and rapid remodelling. We take advantage of the fact that bone traits have diverged massively during chicken domestication to map the genetic basis of bone metabolism in the chicken. We performed a quantitative trait locus (QTL) and expression QTL (eQTL) mapping study in an advanced intercross based on Red Junglefowl (the wild progenitor of the modern domestic chicken) and White Leghorn chickens. We measured femoral bone traits in 456 chickens by peripheral computerised tomography and femoral gene expression in a subset of 125 females from the cross with microarrays. This resulted in 25 loci for female bone traits, 26 loci for male bone traits and 6318 local eQTL loci. We then overlapped bone and gene expression loci, before checking for an association between gene expression and trait values to identify candidate quantitative trait genes for bone traits. A handful of our candidates have been previously associated with bone traits in mice, but our results also implicate unexpected and largely unknown genes in bone metabolism. In summary, by utilising the unique bone metabolism of an avian species, we have identified a number of candidate genes affecting bone allocation and metabolism. These findings can have ramifications not only for the understanding of bone metabolism genetics in general, but could also be used as a potential model for osteoporosis as well as revealing new aspects of vertebrate bone regulation or features that distinguish avian and mammalian bone.

  6. A Genome-Wide Association Study for Culm Cellulose Content in Barley Reveals Candidate Genes Co-Expressed with Members of the CELLULOSE SYNTHASE A Gene Family

    PubMed Central

    Houston, Kelly; Burton, Rachel A.; Sznajder, Beata; Rafalski, Antoni J.; Dhugga, Kanwarpal S.; Mather, Diane E.; Taylor, Jillian; Steffenson, Brian J.; Waugh, Robbie; Fincher, Geoffrey B.

    2015-01-01

    Cellulose is a fundamentally important component of cell walls of higher plants. It provides a scaffold that allows the development and growth of the plant to occur in an ordered fashion. Cellulose also provides mechanical strength, which is crucial for both normal development and to enable the plant to withstand both abiotic and biotic stresses. We quantified the cellulose concentration in the culm of 288 two – rowed and 288 six – rowed spring type barley accessions that were part of the USDA funded barley Coordinated Agricultural Project (CAP) program in the USA. When the population structure of these accessions was analysed we identified six distinct populations, four of which we considered to be comprised of a sufficient number of accessions to be suitable for genome-wide association studies (GWAS). These lines had been genotyped with 3072 SNPs so we combined the trait and genetic data to carry out GWAS. The analysis allowed us to identify regions of the genome containing significant associations between molecular markers and cellulose concentration data, including one region cross-validated in multiple populations. To identify candidate genes we assembled the gene content of these regions and used these to query a comprehensive RNA-seq based gene expression atlas. This provided us with gene annotations and associated expression data across multiple tissues, which allowed us to formulate a supported list of candidate genes that regulate cellulose biosynthesis. Several regions identified by our analysis contain genes that are co-expressed with CELLULOSE SYNTHASE A (HvCesA) across a range of tissues and developmental stages. These genes are involved in both primary and secondary cell wall development. In addition, genes that have been previously linked with cellulose synthesis by biochemical methods, such as HvCOBRA, a gene of unknown function, were also associated with cellulose levels in the association panel. Our analyses provide new insights into the genes that contribute to cellulose content in cereal culms and to a greater understanding of the interactions between them. PMID:26154104

  7. High-density genetic map using whole-genome resequencing for fine mapping and candidate gene discovery for disease resistance in peanut.

    PubMed

    Agarwal, Gaurav; Clevenger, Josh; Pandey, Manish K; Wang, Hui; Shasidhar, Yaduru; Chu, Ye; Fountain, Jake C; Choudhary, Divya; Culbreath, Albert K; Liu, Xin; Huang, Guodong; Wang, Xingjun; Deshmukh, Rupesh; Holbrook, C Corley; Bertioli, David J; Ozias-Akins, Peggy; Jackson, Scott A; Varshney, Rajeev K; Guo, Baozhu

    2018-04-10

    Whole-genome resequencing (WGRS) of mapping populations has facilitated development of high-density genetic maps essential for fine mapping and candidate gene discovery for traits of interest in crop species. Leaf spots, including early leaf spot (ELS) and late leaf spot (LLS), and Tomato spotted wilt virus (TSWV) are devastating diseases in peanut causing significant yield loss. We generated WGRS data on a recombinant inbred line population, developed a SNP-based high-density genetic map, and conducted fine mapping, candidate gene discovery and marker validation for ELS, LLS and TSWV. The first sequence-based high-density map was constructed with 8869 SNPs assigned to 20 linkage groups, representing 20 chromosomes, for the 'T' population (Tifrunner × GT-C20) with a map length of 3120 cM and an average distance of 1.45 cM. The quantitative trait locus (QTL) analysis using high-density genetic map and multiple season phenotyping data identified 35 main-effect QTLs with phenotypic variation explained (PVE) from 6.32% to 47.63%. Among major-effect QTLs mapped, there were two QTLs for ELS on B05 with 47.42% PVE and B03 with 47.38% PVE, two QTLs for LLS on A05 with 47.63% and B03 with 34.03% PVE and one QTL for TSWV on B09 with 40.71% PVE. The epistasis and environment interaction analyses identified significant environmental effects on these traits. The identified QTL regions had disease resistance genes including R-genes and transcription factors. KASP markers were developed for major QTLs and validated in the population and are ready for further deployment in genomics-assisted breeding in peanut. © 2018 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  8. TGIF1 is a potential candidate gene for high myopia in ethnic Kashmiri population.

    PubMed

    Ahmed, Ishfaq; Rasool, Shabhat; Jan, Tariq; Qureshi, Tariq; Naykoo, Niyaz A; Andrabi, Khurshid I

    2014-03-01

    High myopia is a complex disorder that imposes serious consequences on ocular health. Linkage analysis has identified several genetic loci with a series of potential candidate genes that reveal an ambiguous pattern of association with high myopia due to population heterogeneity. We have accordingly chosen to examine the prospect of association of one such gene [transforming growth β-induced factor 1 (TGIF1)] in population that is purely ethnic (Kashmiri) and represents a homogeneous cohort from Northern India. Cases with high myopia with a spherical equivalent of ≥-6 diopters (D) and emmetropic controls with spherical equivalent within ±0.5 D in one or both eyes represented by a sample size of 212 ethnic Kashmiri subjects and 239 matched controls. Genomic DNA was genotyped for sequence variations in TGIF1 gene and allele frequencies tested for Hardy-Weinberg disequilibrium. Potential association was evaluated using χ(2) or Fisher's exact test. Two previously reported missense variations C > T, rs4468717 (first base of codon 143) changing proline to serine and rs2229333 (second base of codon 143) changing proline to leucine were identified in exon 10 of TGIF1. Both variations exhibited possibly significant (p < 0.05) association with the disease phenotype. Since the variant allele frequency of both the single-nucleotide polymorphisms in cases is higher than controls with odds ratio greater than 1.Therefore, variant allele of both the single-nucleotide polymorphisms represents the possible risk factor for myopia in the Kashmiri population. In silico predictions show that substitutions are likely to have an impact on the structure and functional properties of the protein, making it imperative to understand their functional consequences in relation to high myopia. TGIF1 is a relevant candidate gene with potential to contribute in the genesis of high myopia.

  9. Genetic risk factors of systemic lupus erythematosus in the Malaysian population: a minireview.

    PubMed

    Chai, Hwa Chia; Phipps, Maude Elvira; Chua, Kek Heng

    2012-01-01

    SLE is an autoimmune disease that is not uncommon in Malaysia. In contrast to Malays and Indians, the Chinese seem to be most affected. SLE is characterized by deficiency of body's immune response that leads to production of autoantibodies and failure of immune complex clearance. This minireview attempts to summarize the association of several candidate genes with risk for SLE in the Malaysian population and discuss the genetic heterogeneity that exists locally in Asians and in comparison with SLE in Caucasians. Several groups of researchers have been actively investigating genes that are associated with SLE susceptibility in the Malaysian population by screening possible reported candidate genes across the SLE patients and healthy controls. These candidate genes include MHC genes and genes encoding complement components, TNF, FcγR, T-cell receptors, and interleukins. However, most of the polymorphisms investigated in these genes did not show significant associations with susceptibility to SLE in the Malaysian scenario, except for those occurring in MHC genes and genes coding for TNF-α, IL-1β, IL-1RN, and IL-6.

  10. Genetic Risk Factors of Systemic Lupus Erythematosus in the Malaysian Population: A Minireview

    PubMed Central

    Chai, Hwa Chia; Phipps, Maude Elvira; Chua, Kek Heng

    2012-01-01

    SLE is an autoimmune disease that is not uncommon in Malaysia. In contrast to Malays and Indians, the Chinese seem to be most affected. SLE is characterized by deficiency of body's immune response that leads to production of autoantibodies and failure of immune complex clearance. This minireview attempts to summarize the association of several candidate genes with risk for SLE in the Malaysian population and discuss the genetic heterogeneity that exists locally in Asians and in comparison with SLE in Caucasians. Several groups of researchers have been actively investigating genes that are associated with SLE susceptibility in the Malaysian population by screening possible reported candidate genes across the SLE patients and healthy controls. These candidate genes include MHC genes and genes encoding complement components, TNF, FcγR, T-cell receptors, and interleukins. However, most of the polymorphisms investigated in these genes did not show significant associations with susceptibility to SLE in the Malaysian scenario, except for those occurring in MHC genes and genes coding for TNF-α, IL-1β, IL-1RN, and IL-6. PMID:21941582

  11. SNPs in stress-responsive rice genes: validation, genotyping, functional relevance and population structure

    PubMed Central

    2012-01-01

    Background Single nucleotide polymorphism (SNP) validation and large-scale genotyping are required to maximize the use of DNA sequence variation and determine the functional relevance of candidate genes for complex stress tolerance traits through genetic association in rice. We used the bead array platform-based Illumina GoldenGate assay to validate and genotype SNPs in a select set of stress-responsive genes to understand their functional relevance and study the population structure in rice. Results Of the 384 putative SNPs assayed, we successfully validated and genotyped 362 (94.3%). Of these 325 (84.6%) showed polymorphism among the 91 rice genotypes examined. Physical distribution, degree of allele sharing, admixtures and introgression, and amino acid replacement of SNPs in 263 abiotic and 62 biotic stress-responsive genes provided clues for identification and targeted mapping of trait-associated genomic regions. We assessed the functional and adaptive significance of validated SNPs in a set of contrasting drought tolerant upland and sensitive lowland rice genotypes by correlating their allelic variation with amino acid sequence alterations in catalytic domains and three-dimensional secondary protein structure encoded by stress-responsive genes. We found a strong genetic association among SNPs in the nine stress-responsive genes with upland and lowland ecological adaptation. Higher nucleotide diversity was observed in indica accessions compared with other rice sub-populations based on different population genetic parameters. The inferred ancestry of 16% among rice genotypes was derived from admixed populations with the maximum between upland aus and wild Oryza species. Conclusions SNPs validated in biotic and abiotic stress-responsive rice genes can be used in association analyses to identify candidate genes and develop functional markers for stress tolerance in rice. PMID:22921105

  12. Insight into Catechins Metabolic Pathways of Camellia sinensis Based on Genome and Transcriptome Analysis.

    PubMed

    Wang, Wenzhao; Zhou, Yihui; Wu, Yingling; Dai, Xinlong; Liu, Yajun; Qian, Yumei; Li, Mingzhuo; Jiang, Xiaolan; Wang, Yunsheng; Gao, Liping; Xia, Tao

    2018-04-25

    Tea is an important economic crop with a 3.02 Gb genome. It accumulates various bioactive compounds, especially catechins, which are closely associated with tea flavor and quality. Catechins are biosynthesized through the phenylpropanoid and flavonoid pathways, with 12 structural genes being involved in their synthesis. However, we found that in Camellia sinensis the understanding of the basic profile of catechins biosynthesis is still unclear. The gene structure, locus, transcript number, transcriptional variation, and function of multigene families have not yet been clarified. Our previous studies demonstrated that the accumulation of flavonoids in tea is species, tissue, and induction specific, which indicates that gene coexpression patterns may be involved in tea catechins and flavonoids biosynthesis. In this paper, we screened candidate genes of multigene families involved in the phenylpropanoid and flavonoid pathways based on an analysis of genome and transcriptome sequence data. The authenticity of candidate genes was verified by PCR cloning, and their function was validated by reverse genetic methods. In the present study, 36 genes from 12 gene families were identified and were accessed in the NCBI database. During this process, some intron retention events of the CsCHI and CsDFR genes were found. Furthermore, the transcriptome sequencing of various tea tissues and subcellular location assays revealed coexpression and colocalization patterns. The correlation analysis showed that CsCHIc, CsF3'H, and CsANRb expression levels are associated significantly with the concentration of soluble PA as well as the expression levels of CsPALc and CsPALf with the concentration of insoluble PA. This work provides insights into catechins metabolism in tea and provides a foundation for future studies.

  13. Genomic analysis of Meckel–Gruber syndrome in Arabs reveals marked genetic heterogeneity and novel candidate genes

    PubMed Central

    Shaheen, Ranad; Faqeih, Eissa; Alshammari, Muneera J; Swaid, Abdulrahman; Al-Gazali, Lihadh; Mardawi, Elham; Ansari, Shinu; Sogaty, Sameera; Seidahmed, Mohammed Z; AlMotairi, Muhammed I; Farra, Chantal; Kurdi, Wesam; Al-Rasheed, Shatha; Alkuraya, Fowzan S

    2013-01-01

    Meckel–Gruber syndrome (MKS, OMIM #249000) is a multiple congenital malformation syndrome that represents the severe end of the ciliopathy phenotypic spectrum. Despite the relatively common occurrence of this syndrome among Arabs, little is known about its genetic architecture in this population. This is a series of 18 Arab families with MKS, who were evaluated clinically and studied using autozygome-guided mutation analysis and exome sequencing. We show that autozygome-guided candidate gene analysis identified the underlying mutation in the majority (n=12, 71%). Exome sequencing revealed a likely pathogenic mutation in three novel candidate MKS disease genes. These include C5orf42, Ellis–van-Creveld disease gene EVC2 and SEC8 (also known as EXOC4), which encodes an exocyst protein with an established role in ciliogenesis. This is the largest and most comprehensive genomic study on MKS in Arabs and the results, in addition to revealing genetic and allelic heterogeneity, suggest that previously reported disease genes and the novel candidates uncovered by this study account for the overwhelming majority of MKS patients in our population. PMID:23169490

  14. Identification of candidate genes in Populus cell wall biosynthesis using text-mining, co-expression network and comparative genomics

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yang, Xiaohan; Ye, Chuyu; Bisaria, Anjali

    2011-01-01

    Populus is an important bioenergy crop for bioethanol production. A greater understanding of cell wall biosynthesis processes is critical in reducing biomass recalcitrance, a major hindrance in efficient generation of ethanol from lignocellulosic biomass. Here, we report the identification of candidate cell wall biosynthesis genes through the development and application of a novel bioinformatics pipeline. As a first step, via text-mining of PubMed publications, we obtained 121 Arabidopsis genes that had the experimental evidences supporting their involvement in cell wall biosynthesis or remodeling. The 121 genes were then used as bait genes to query an Arabidopsis co-expression database and additionalmore » genes were identified as neighbors of the bait genes in the network, increasing the number of genes to 548. The 548 Arabidopsis genes were then used to re-query the Arabidopsis co-expression database and re-construct a network that captured additional network neighbors, expanding to a total of 694 genes. The 694 Arabidopsis genes were computationally divided into 22 clusters. Queries of the Populus genome using the Arabidopsis genes revealed 817 Populus orthologs. Functional analysis of gene ontology and tissue-specific gene expression indicated that these Arabidopsis and Populus genes are high likelihood candidates for functional genomics in relation to cell wall biosynthesis.« less

  15. Association mapping of starch chain length distribution and amylose content in pea (Pisum sativum L.) using carbohydrate metabolism candidate genes.

    PubMed

    Carpenter, Margaret A; Shaw, Martin; Cooper, Rebecca D; Frew, Tonya J; Butler, Ruth C; Murray, Sarah R; Moya, Leire; Coyne, Clarice J; Timmerman-Vaughan, Gail M

    2017-08-01

    Although starch consists of large macromolecules composed of glucose units linked by α-1,4-glycosidic linkages with α-1,6-glycosidic branchpoints, variation in starch structural and functional properties is found both within and between species. Interest in starch genetics is based on the importance of starch in food and industrial processes, with the potential of genetics to provide novel starches. The starch metabolic pathway is complex but has been characterized in diverse plant species, including pea. To understand how allelic variation in the pea starch metabolic pathway affects starch structure and percent amylose, partial sequences of 25 candidate genes were characterized for polymorphisms using a panel of 92 diverse pea lines. Variation in the percent amylose composition of extracted seed starch and (amylopectin) chain length distribution, one measure of starch structure, were characterized for these lines. Association mapping was undertaken to identify polymorphisms associated with the variation in starch chain length distribution and percent amylose, using a mixed linear model that incorporated population structure and kinship. Associations were found for polymorphisms in seven candidate genes plus Mendel's r locus (which conditions the round versus wrinkled seed phenotype). The genes with associated polymorphisms are involved in the substrate supply, chain elongation and branching stages of the pea carbohydrate and starch metabolic pathways. The association of polymorphisms in carbohydrate and starch metabolic genes with variation in amylopectin chain length distribution and percent amylose may help to guide manipulation of pea seed starch structural and functional properties through plant breeding.

  16. Candidate genes, pathways and mechanisms for alcoholism: an expanded convergent functional genomics approach.

    PubMed

    Rodd, Z A; Bertsch, B A; Strother, W N; Le-Niculescu, H; Balaraman, Y; Hayden, E; Jerome, R E; Lumeng, L; Nurnberger, J I; Edenberg, H J; McBride, W J; Niculescu, A B

    2007-08-01

    We describe a comprehensive translational approach for identifying candidate genes for alcoholism. The approach relies on the cross-matching of animal model brain gene expression data with human genetic linkage data, as well as human tissue data and biological roles data, an approach termed convergent functional genomics. An analysis of three animal model paradigms, based on inbred alcohol-preferring (iP) and alcohol-non-preferring (iNP) rats, and their response to treatments with alcohol, was used. A comprehensive analysis of microarray gene expression data from five key brain regions (frontal cortex, amygdala, caudate-putamen, nucleus accumbens and hippocampus) was carried out. The Bayesian-like integration of multiple independent lines of evidence, each by itself lacking sufficient discriminatory power, led to the identification of high probability candidate genes, pathways and mechanisms for alcoholism. These data reveal that alcohol has pleiotropic effects on multiple systems, which may explain the diverse neuropsychiatric and medical pathology in alcoholism. Some of the pathways identified suggest avenues for pharmacotherapy of alcoholism with existing agents, such as angiotensin-converting enzyme (ACE) inhibitors. Experiments we carried out in alcohol-preferring rats with an ACE inhibitor show a marked modulation of alcohol intake. Other pathways are new potential targets for drug development. The emergent overall picture is that physical and physiological robustness may permit alcohol-preferring individuals to withstand the aversive effects of alcohol. In conjunction with a higher reactivity to its rewarding effects, they may able to ingest enough of this nonspecific drug for a strong hedonic and addictive effect to occur.

  17. Comparative genomics identifies candidate genes for infectious salmon anemia (ISA) resistance in Atlantic salmon (Salmo salar).

    PubMed

    Li, Jieying; Boroevich, Keith A; Koop, Ben F; Davidson, William S

    2011-04-01

    Infectious salmon anemia (ISA) has been described as the hoof and mouth disease of salmon farming. ISA is caused by a lethal and highly communicable virus, which can have a major impact on salmon aquaculture, as demonstrated by an outbreak in Chile in 2007. A quantitative trait locus (QTL) for ISA resistance has been mapped to three microsatellite markers on linkage group (LG) 8 (Chr 15) on the Atlantic salmon genetic map. We identified bacterial artificial chromosome (BAC) clones and three fingerprint contigs from the Atlantic salmon physical map that contains these markers. We made use of the extensive BAC end sequence database to extend these contigs by chromosome walking and identified additional two markers in this region. The BAC end sequences were used to search for conserved synteny between this segment of LG8 and the fish genomes that have been sequenced. An examination of the genes in the syntenic segments of the tetraodon and medaka genomes identified candidates for association with ISA resistance in Atlantic salmon based on differential expression profiles from ISA challenges or on the putative biological functions of the proteins they encode. One gene in particular, HIV-EP2/MBP-2, caught our attention as it may influence the expression of several genes that have been implicated in the response to infection by infectious salmon anemia virus (ISAV). Therefore, we suggest that HIV-EP2/MBP-2 is a very strong candidate for the gene associated with the ISAV resistance QTL in Atlantic salmon and is worthy of further study.

  18. Deciphering the pharmacological mechanism of the Chinese formula Huanglian-Jie-Du decoction in the treatment of ischemic stroke using a systems biology-based strategy

    PubMed Central

    Zhang, Yan-qiong; Wang, Song-song; Zhu, Wei-liang; Ma, Yan; Zhang, Fang-bo; Liang, Ri-xin; Xu, Hai-yu; Yang, Hong-jun

    2015-01-01

    Aim: Huanglian-Jie-Du decoction (HLJDD) is an important multiherb remedy in TCM, which is recently demonstrated to be effective to treat ischemic stroke. Here, we aimed to investigate the pharmacological mechanisms of HLJDD in the treatment of ischemic stroke using systems biology approaches. Methods: Putative targets of HLJDD were predicted using MetaDrug. An interaction network of putative HLJDD targets and known therapeutic targets for the treatment of ischemic stroke was then constructed, and candidate HLJDD targets were identified by calculating topological features, including 'Degree', 'Node-betweenness', 'Closeness', and 'K-coreness'. The binding efficiencies of the candidate HLJDD targets with the corresponding compositive compounds were further validated by a molecular docking simulation. Results: A total of 809 putative targets were obtained for 168 compositive compounds in HLJDD. Additionally, 39 putative targets were common to all four herbs of HLJDD. Next, 49 major nodes were identified as candidate HLJDD targets due to their network topological importance. The enrichment analysis based on the Gene Ontology (GO) annotation system and the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway demonstrated that candidate HLJDD targets were more frequently involved in G-protein-coupled receptor signaling pathways, neuroactive ligand-receptor interactions and gap junctions, which all played important roles in the progression of ischemic stroke. Finally, the molecular docking simulation showed that 170 pairs of chemical components and candidate HLJDD targets had strong binding efficiencies. Conclusion: This study has developed for the first time a comprehensive systems approach integrating drug target prediction, network analysis and molecular docking simulation to reveal the relationships between the herbs contained in HLJDD and their putative targets and ischemic stroke-related pathways. PMID:25937634

  19. Single Nucleotide Polymorphisms in IL8 and TLR4 Genes as Candidates for Digital Dermatitis Resistance/Susceptibility in Holstein Cattle.

    PubMed

    El-Shafaey, El-Sayed; Ateya, Ahmed; Ramadan, Hazem; Saleh, Rasha; Elseady, Yousef; Abo El Fadl, Eman; El-Khodery, Sabry

    2017-04-03

    Relatedness between single nucleotide polymorphisms in IL8 and TLR4 genes and digital dermatitis resistance/susceptibility was investigated in seventy Holstein dairy cows. Animals were assigned into two groups, affected group (n = 35) and resistant group (n = 35) based on clinical signs and previous history of farm clinical records. Blood samples were collected for DNA extraction to ampliy fragments of 267-bp and 382-bp for IL8 and TLR4 genes, respectively. PCR-DNA sequencing revealed three SNPs in each of IL8 and TLR4 genes. The identified SNPs associated with digital dermatitis resistance were C94T, A220G, and T262A for IL8 and C118T for TLR4. However, the G349C and C355A SNPs in TLR4 gene were associated with digital dermatitis susceptibility. Chi-square analysis for comparison the distribution of all identified SNPs in both IL8 and TLR4 genes between resistant and affected animals showed no significant variation among the identified SNPs in IL8 gene. Meanwhile, there was a significant variation in case of TLR4 gene. As a pilot study, the present results revealed that identified SNPs in IL8 and TLR4 genes can be used as a genetic marker and predisposing factor for resistance/susceptibility to digital dermatitis in dairy cows. However, TLR4 gene may be a potential candidate for such disease.

  20. The Influence of Genetics on Cystic Fibrosis Phenotypes

    PubMed Central

    Knowles, Michael R.; Drumm, Mitchell

    2012-01-01

    Technological advances in genetics have made feasible and affordable large studies to identify genetic variants that cause or modify a trait. Genetic studies have been carried out to assess variants in candidate genes, as well as polymorphisms throughout the genome, for their associations with heritable clinical outcomes of cystic fibrosis (CF), such as lung disease, meconium ileus, and CF-related diabetes. The candidate gene approach has identified some predicted relationships, while genome-wide surveys have identified several genes that would not have been obvious disease-modifying candidates, such as a methionine sulfoxide transferase gene that influences intestinal obstruction, or a region on chromosome 11 proximate to genes encoding a transcription factor and an apoptosis controller that associates with lung function. These unforeseen associations thus provide novel insight into disease pathophysiology, as well as suggesting new therapeutic strategies for CF. PMID:23209180

Top