Identification of Plasmodium falciparum reticulocyte binding protein homologue 5-interacting protein, PfRipr, as a highly conserved blood-stage malaria vaccine candidate.

PubMed

Ntege, Edward H; Arisue, Nobuko; Ito, Daisuke; Hasegawa, Tomoyuki; Palacpac, Nirianne M Q; Egwang, Thomas G; Horii, Toshihiro; Takashima, Eizo; Tsuboi, Takafumi

2016-11-04

Genetic variability in Plasmodium falciparum malaria parasites hampers current malaria vaccine development efforts. Here, we hypothesize that to address the impact of genetic variability on vaccine efficacy in clinical trials, conserved antigen targets should be selected to achieve robust host immunity across multiple falciparum strains. Therefore, suitable vaccine antigens should be assessed for levels of polymorphism and genetic diversity. Using a total of one hundred and two clinical isolates from a region of high malaria transmission in Uganda, we analyzed extent of polymorphism and genetic diversity in four recently reported novel blood-stage malaria vaccine candidate proteins: Rh5 interacting protein (PfRipr), GPI anchored micronemal antigen (PfGAMA), rhoptry-associated leucine zipper-like protein 1 (PfRALP1) and Duffy binding-like merozoite surface protein 1 (PfMSPDBL1). In addition, utilizing the wheat germ cell-free system, we expressed recombinant proteins for the four candidates based on P. falciparum laboratory strain 3D7 sequences, immunized rabbits to obtain specific antibodies (Abs) and performed functional growth inhibition assay (GIA). The GIA activity of the raised Abs was demonstrated using both homologous 3D7 and heterologous FVO strains in vitro. Both pfripr and pfralp1 are less polymorphic but the latter is comparatively more diverse, with varied number of regions having insertions and deletions, asparagine and 6-mer repeats in the coding sequences. Pfgama and pfmspdbl1 are polymorphic and genetically diverse among the isolates with antibodies against the 3D7-based recombinant PfGAMA and PfMSPDBL1 inhibiting merozoite invasion only in the 3D7 but not FVO strain. Moreover, although Abs against the 3D7-based recombinant PfRipr and PfRALP1 proteins potently inhibited merozoite invasion of both 3D7 and FVO, the GIA activity of anti-PfRipr was much higher than that of anti-PfRALP1. Thus, PfRipr is regarded as a promising blood-stage vaccine candidate for next-generation vaccines against P. falciparum. Copyright © 2016 Elsevier Ltd. All rights reserved.

Genetic polymorphisms for estimating risk of atrial fibrillation: a literature-based meta-analysis

PubMed Central

Smith, J. Gustav; Almgren, Peter; Engström, Gunnar; Hedblad, Bo; Platonov, Pyotr G.; Newton-Cheh, Christopher; Melander, Olle

2013-01-01

Objectives Genome-wide association studies have recently identified genetic polymorphisms associated with common, etiologically complex diseases, for which direct-to-consumer genetic testing with provision of absolute genetic risk estimates is marketed by commercial companies. Polymorphisms associated with atrial fibrillation (AF) have shown relatively large risk estimates but the robustness of such estimates across populations and study designs has not been studied. Design A systematic literature review with meta-analysis and assessment of between-study heterogeneity was performed for single nucleotide polymorphisms (SNPs) in the six genetic regions associated with AF in genome-wide or candidate gene studies. Results Data from 18 samples of European ancestry (n=12,100 cases; 115,702 controls) were identified for the SNP on chromosome 4q25 (rs220733), 16 samples (n=12,694 cases; 132,602 controls) for the SNP on 16q22 (rs2106261) and 4 samples (n=5,272 cases; 59,725 controls) for the SNP in KCNH2 (rs1805123). Only the discovery studies were identified for SNPs on 1q21 and in GJA5 and IL6R, why no meta-analyses were performed for those SNPs. In overall random-effects meta-analyses, association with AF was observed for both SNPs from genome-wide studies on 4q25 (OR 1.67, 95% CI=1.50–1.86, p=2×10−21) and 16q22 (OR 1.21, 95% CI=1.13–1.29, p=1×10−8), but not the SNP in KCNH2 from candidate gene studies (p=0.15). There was substantial effect heterogeneity across case-control and cross-sectional studies for both polymorphisms (I2=0.50–0.78, p<0.05), but not across prospective cohort studies (I2=0.39, p=0.15). Both polymorphisms were robustly associated with AF for each study design individually (p<0.05). Conclusions In meta-analyses including up to 150,000 individuals, polymorphisms in two genetic regions were robustly associated with AF across all study designs but with substantial context-dependency of risk estimates. PMID:22690879

Single nucleotide polymorphisms in bone turnover-related genes in Koreans: ethnic differences in linkage disequilibrium and haplotype

PubMed Central

Kim, Kyung-Seon; Kim, Ghi-Su; Hwang, Joo-Yeon; Lee, Hye-Ja; Park, Mi-Hyun; Kim, Kwang-joong; Jung, Jongsun; Cha, Hyo-Soung; Shin, Hyoung Doo; Kang, Jong-Ho; Park, Eui Kyun; Kim, Tae-Ho; Hong, Jung-Min; Koh, Jung-Min; Oh, Bermseok; Kimm, Kuchan; Kim, Shin-Yoon; Lee, Jong-Young

2007-01-01

Background Osteoporosis is defined as the loss of bone mineral density that leads to bone fragility with aging. Population-based case-control studies have identified polymorphisms in many candidate genes that have been associated with bone mass maintenance or osteoporotic fracture. To investigate single nucleotide polymorphisms (SNPs) that are associated with osteoporosis, we examined the genetic variation among Koreans by analyzing 81 genes according to their function in bone formation and resorption during bone remodeling. Methods We resequenced all the exons, splice junctions and promoter regions of candidate osteoporosis genes using 24 unrelated Korean individuals. Using the common SNPs from our study and the HapMap database, a statistical analysis of deviation in heterozygosity depicted. Results We identified 942 variants, including 888 SNPs, 43 insertion/deletion polymorphisms, and 11 microsatellite markers. Of the SNPs, 557 (63%) had been previously identified and 331 (37%) were newly discovered in the Korean population. When compared SNPs in the Korean population with those in HapMap database, 1% (or less) of SNPs in the Japanese and Chinese subpopulations and 20% of those in Caucasian and African subpopulations were significantly differentiated from the Hardy-Weinberg expectations. In addition, an analysis of the genetic diversity showed that there were no significant differences among Korean, Han Chinese and Japanese populations, but African and Caucasian populations were significantly differentiated in selected genes. Nevertheless, in the detailed analysis of genetic properties, the LD and Haplotype block patterns among the five sub-populations were substantially different from one another. Conclusion Through the resequencing of 81 osteoporosis candidate genes, 118 unknown SNPs with a minor allele frequency (MAF) > 0.05 were discovered in the Korean population. In addition, using the common SNPs between our study and HapMap, an analysis of genetic diversity and deviation in heterozygosity was performed and the polymorphisms of the above genes among the five populations were substantially differentiated from one another. Further studies of osteoporosis could utilize the polymorphisms identified in our data since they may have important implications for the selection of highly informative SNPs for future association studies. PMID:18036257

Genetics of osteoporosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Urano, Tomohiko; Inoue, Satoshi, E-mail: INOUE-GER@h.u-tokyo.ac.jp; Department of Anti-Aging Medicine, Graduate School of Medicine, The University of Tokyo, Tokyo 113-8655

Highlights: • Single-nucleotide polymorphisms (SNPs) associated with osteoporosis were identified. • SNPs mapped close to or within VDR and ESR1 are associated with bone mineral density. • WNT signaling pathway plays a pivotal role in regulating bone mineral density. • Genetic studies will be useful for identification of new therapeutic targets. - Abstract: Osteoporosis is a skeletal disease characterized by low bone mineral density (BMD) and microarchitectural deterioration of bone tissue, which increases susceptibility to fractures. BMD is a complex quantitative trait with normal distribution and seems to be genetically controlled (in 50–90% of the cases), according to studies onmore » twins and families. Over the last 20 years, candidate gene approach and genome-wide association studies (GWAS) have identified single-nucleotide polymorphisms (SNPs) that are associated with low BMD, osteoporosis, and osteoporotic fractures. These SNPs have been mapped close to or within genes including those encoding nuclear receptors and WNT-β-catenin signaling proteins. Understanding the genetics of osteoporosis will help identify novel candidates for diagnostic and therapeutic targets.« less

COL5A1: Fine genetic mapping, intron/exon organization, and exclusion as candidate gene in families with tuberous sclerosis complex 1, hereditary hemorrhagic telangiectasia, and Ehlers-Danlos syndrome type II

DOE Office of Scientific and Technical Information (OSTI.GOV)

Greenspan, D.S.; Papenberg, K.A.; Marchuk, D.A.

1994-09-01

Type V collagen is the only fibrillar collagen which has yet to be implicated in the pathogenesis of genetic diseases in humans or mice. To begin examining the possible role of type V collagen in genetic disease, we have previously mapped COL5A1, the gene for the {alpha}1 chain of type V collagen, to 9q23.2{r_arrow}q34.3 and described two restriction site polymorphisms which allowed us to exclude COL5A1 as candidate gene for nail-patella syndrome. We have now used these polymorphisms to exclude COL5A1 as candidate gene for tuberous sclerosis complex 1 and Ehlers-Danlos syndrome type II. In addition, we describe a CAmore » repeat, with observed heterozygosity of about 0.5, in a COL5A1 intron, which has allowed us to exclude COL5A1 as a candidate gene in hereditary hemorrhagic telangiectasia and to place COL5A1 on the CEPH family genetic map between markers D9S66 and D9S67. We have also determined the entire intron/exon organization of COL5A1, which will facilitate characterization of mutations in genetic diseases with which COL5A1 may be linked in future studies.« less

Candidate genes associated with testicular development, sperm quality, and hormone levels of inhibin, luteinizing hormone, and insulin-like growth factor 1 in Brahman bulls.

PubMed

Fortes, Marina R S; Reverter, Antonio; Hawken, Rachel J; Bolormaa, Sunduimijid; Lehnert, Sigrid A

2012-09-01

Bull fertility is an important target for genetic improvement, and early prediction using genetic markers is therefore a goal for livestock breeding. We performed genome-wide association studies to identify genes associated with fertility traits measured in young bulls. Data from 1118 Brahman bulls were collected for six traits: blood hormone levels of inhibin (IN) at 4 mo, luteinizing hormone (LH) following a gonadotropin-releasing hormone challenge at 4 mo, and insulin-like growth factor 1 (IGF1) at 6 mo, scrotal circumference (SC) at 12 mo, ability to produce sperm (Sperm) at 18 mo, and percentage of normal sperm (PNS) at 24 mo. All the bulls were genotyped with the BovineSNP50 chip. Sires and dams of the bull population (n = 304) were genotyped with the high-density chip (∼800 000 polymorphisms) to allow for imputation, thereby contributing detail on genome regions of interest. Polymorphism associations were discovered for all traits, except for Sperm. Chromosome 2 harbored polymorphisms associated with IN. For LH, associated polymorphisms were located in five different chromosomes. A region of chromosome 14 contained polymorphisms associated with IGF1 and SC. Regions of the X chromosome showed associations with SC and PNS. Associated polymorphisms yielded candidate genes in chromosomes 2, 14, and X. These findings will contribute to the development of genetic markers to help select cattle with improved fertility and will lead to better annotation of gene function in the context of reproductive biology.

Potential genetic polymorphisms predicting polycystic ovary syndrome.

PubMed

Chen, Yao; Fang, Shu-Ying

2018-05-01

Polycystic ovary syndrome (PCOS) is a heterogenous endocrine disorder with typical symptoms of oligomenorrhoea, hyperandrogenism, hirsutism, obesity, insulin resistance and increased risk of type 2 diabetes mellitus. Extensive evidence indicates that PCOS is a genetic disease and numerous biochemical pathways have been linked with its pathogenesis. A number of genes from these pathways have been investigated, which include those involved with steroid hormone biosynthesis and metabolism, action of gonadotropin and gonadal hormones, folliculogenesis, obesity and energy regulation, insulin secretion and action and many others. In this review, we summarize the historical and recent findings in genetic polymorphisms of PCOS from the relevant publications and outline some genetic polymorphisms that are potentially associated with the risk of PCOS. This information could uncover candidate genes associating with PCOS, which will be valuable for the development of novel diagnostic and treatment platforms for PCOS patients. © 2018 The authors.

Transforming growth factor-β and toll-like receptor-4 polymorphisms are not associated with fibrosis in haemochromatosis

PubMed Central

Wood, Marnie J; Powell, Lawrie W; Dixon, Jeannette L; Subramaniam, V Nathan; Ramm, Grant A

2013-01-01

AIM: To investigate the role of genetic polymorphisms in the progression of hepatic fibrosis in hereditary haemochromatosis. METHODS: A cohort of 245 well-characterised C282Y homozygous patients with haemochromatosis was studied, with all subjects having liver biopsy data and DNA available for testing. This study assessed the association of eight single nucleotide polymorphisms (SNPs) in a total of six genes including toll-like receptor 4 (TLR4), transforming growth factor-beta (TGF-β), oxoguanine DNA glycosylase, monocyte chemoattractant protein 1, chemokine C-C motif receptor 2 and interleukin-10 with liver disease severity. Genotyping was performed using high resolution melt analysis and sequencing. The results were analysed in relation to the stage of hepatic fibrosis in multivariate analysis incorporating other cofactors including alcohol consumption and hepatic iron concentration. RESULTS: There were significant associations between the cofactors of male gender (P = 0.0001), increasing age (P = 0.006), alcohol consumption (P = 0.0001), steatosis (P = 0.03), hepatic iron concentration (P < 0.0001) and the presence of hepatic fibrosis. Of the candidate gene polymorphisms studied, none showed a significant association with hepatic fibrosis in univariate or multivariate analysis incorporating cofactors. We also specifically studied patients with hepatic iron loading above threshold levels for cirrhosis and compared the genetic polymorphisms between those with no fibrosis vs cirrhosis however there was no significant effect from any of the candidate genes studied. Importantly, in this large, well characterised cohort of patients there was no association between SNPs for TGF-β or TLR4 and the presence of fibrosis, cirrhosis or increasing fibrosis stage in multivariate analysis. CONCLUSION: In our large, well characterised group of haemochromatosis subjects we did not demonstrate any relationship between candidate gene polymorphisms and hepatic fibrosis or cirrhosis. PMID:24409064

Transforming growth factor-β and toll-like receptor-4 polymorphisms are not associated with fibrosis in haemochromatosis.

PubMed

Wood, Marnie J; Powell, Lawrie W; Dixon, Jeannette L; Subramaniam, V Nathan; Ramm, Grant A

2013-12-28

To investigate the role of genetic polymorphisms in the progression of hepatic fibrosis in hereditary haemochromatosis. A cohort of 245 well-characterised C282Y homozygous patients with haemochromatosis was studied, with all subjects having liver biopsy data and DNA available for testing. This study assessed the association of eight single nucleotide polymorphisms (SNPs) in a total of six genes including toll-like receptor 4 (TLR4), transforming growth factor-beta (TGF-β), oxoguanine DNA glycosylase, monocyte chemoattractant protein 1, chemokine C-C motif receptor 2 and interleukin-10 with liver disease severity. Genotyping was performed using high resolution melt analysis and sequencing. The results were analysed in relation to the stage of hepatic fibrosis in multivariate analysis incorporating other cofactors including alcohol consumption and hepatic iron concentration. There were significant associations between the cofactors of male gender (P = 0.0001), increasing age (P = 0.006), alcohol consumption (P = 0.0001), steatosis (P = 0.03), hepatic iron concentration (P < 0.0001) and the presence of hepatic fibrosis. Of the candidate gene polymorphisms studied, none showed a significant association with hepatic fibrosis in univariate or multivariate analysis incorporating cofactors. We also specifically studied patients with hepatic iron loading above threshold levels for cirrhosis and compared the genetic polymorphisms between those with no fibrosis vs cirrhosis however there was no significant effect from any of the candidate genes studied. Importantly, in this large, well characterised cohort of patients there was no association between SNPs for TGF-β or TLR4 and the presence of fibrosis, cirrhosis or increasing fibrosis stage in multivariate analysis. In our large, well characterised group of haemochromatosis subjects we did not demonstrate any relationship between candidate gene polymorphisms and hepatic fibrosis or cirrhosis.

Molecular insight into the association between cartilage regeneration and ear wound healing in genetic mouse models: targeting new genes in regeneration.

PubMed

Rai, Muhammad Farooq; Schmidt, Eric J; McAlinden, Audrey; Cheverud, James M; Sandell, Linda J

2013-11-06

Tissue regeneration is a complex trait with few genetic models available. Mouse strains LG/J and MRL are exceptional healers. Using recombinant inbred strains from a large (LG/J, healer) and small (SM/J, nonhealer) intercross, we have previously shown a positive genetic correlation between ear wound healing, knee cartilage regeneration, and protection from osteoarthritis. We hypothesize that a common set of genes operates in tissue healing and articular cartilage regeneration. Taking advantage of archived histological sections from recombinant inbred strains, we analyzed expression of candidate genes through branched-chain DNA technology directly from tissue lysates. We determined broad-sense heritability of candidates, Pearson correlation of candidates with healing phenotypes, and Ward minimum variance cluster analysis for strains. A bioinformatic assessment of allelic polymorphisms within and near candidate genes was also performed. The expression of several candidates was significantly heritable among strains. Although several genes correlated with both ear wound healing and cartilage healing at a marginal level, the expression of four genes representing DNA repair (Xrcc2, Pcna) and Wnt signaling (Axin2, Wnt16) pathways was significantly positively correlated with both phenotypes. Cluster analysis accurately classified healers and nonhealers for seven out of eight strains based on gene expression. Specific sequence differences between LG/J and SM/J were identified as potential causal polymorphisms. Our study suggests a common genetic basis between tissue healing and osteoarthritis susceptibility. Mapping genetic variations causing differences in diverse healing responses in multiple tissues may reveal generic healing processes in pursuit of new therapeutic targets designed to induce or enhance regeneration and, potentially, protection from osteoarthritis.

Association mapping of starch chain length distribution and amylose content in pea (Pisum sativum L.) using carbohydrate metabolism candidate genes.

PubMed

Carpenter, Margaret A; Shaw, Martin; Cooper, Rebecca D; Frew, Tonya J; Butler, Ruth C; Murray, Sarah R; Moya, Leire; Coyne, Clarice J; Timmerman-Vaughan, Gail M

2017-08-01

Although starch consists of large macromolecules composed of glucose units linked by α-1,4-glycosidic linkages with α-1,6-glycosidic branchpoints, variation in starch structural and functional properties is found both within and between species. Interest in starch genetics is based on the importance of starch in food and industrial processes, with the potential of genetics to provide novel starches. The starch metabolic pathway is complex but has been characterized in diverse plant species, including pea. To understand how allelic variation in the pea starch metabolic pathway affects starch structure and percent amylose, partial sequences of 25 candidate genes were characterized for polymorphisms using a panel of 92 diverse pea lines. Variation in the percent amylose composition of extracted seed starch and (amylopectin) chain length distribution, one measure of starch structure, were characterized for these lines. Association mapping was undertaken to identify polymorphisms associated with the variation in starch chain length distribution and percent amylose, using a mixed linear model that incorporated population structure and kinship. Associations were found for polymorphisms in seven candidate genes plus Mendel's r locus (which conditions the round versus wrinkled seed phenotype). The genes with associated polymorphisms are involved in the substrate supply, chain elongation and branching stages of the pea carbohydrate and starch metabolic pathways. The association of polymorphisms in carbohydrate and starch metabolic genes with variation in amylopectin chain length distribution and percent amylose may help to guide manipulation of pea seed starch structural and functional properties through plant breeding.

Candidate genes for alcohol dependence: A genetic association study from India.

PubMed

Malhotra, Savita; Basu, Debasish; Khullar, Madhu; Ghosh, Abhishek; Chugh, Neera

2016-11-01

Search for candidate genes for alcohol dependence (AD) has been inconsistent and inconclusive. Moreover, most of the research has been confined to a few specific ethnic groups. Hence, the aim of our study was to explore specific candidate genes for AD in north Indian male population. In this clinic-based genetic association study, 210 males with AD and 200 controls matched for age, gender and ethnicity were recruited from the clinic and the general population, respectively. Cases were diagnosed with Semi-structured Assessment for Genetics of Alcoholism-II (SSAGA-II). Single-nucleotide polymorphism genotyping was done by real-time quantitative-polymerase chain reaction (PCR) using Taq Man assay (ABI 7500) fast real-time PCR system. Both at the genotypic level and at allelic frequency, Met158 variant of catechol-O-methyl transferase (COMT) showed significant increase in cases as compared to controls. The frequency of heterozygous genotype (A/G) of gamma-aminobutyric acid receptor A1 (GABRA1) was significantly lower in cases as compared to controls. Likewise, for GABRA2, the frequency of homozygous recessive genotype (G/G) was significantly higher in the control group. With respect to the 5-hydroxytryptamine (5HT) transporter long promoter region (5HTTLPR), cholinergic receptor muscarinic (CHRM2) and alcohol dehydrogenase 1B (ADH1B) genes, there was no significant difference between the cases and the controls. Aldehyde dehydrogenase (ALDH2) gene was found to be monomorphic in our study population. Our study findings showed COMT polymorphism conferring risk and GABRA polymorphism as a protective genotype for Indian male with AD. Genes for alcohol metabolism, serotonin transporter and cholinergic receptor gene polymorphism were perhaps not contributory to AD for Indian population.

Failure of replicating the association between hippocampal volume and 3 single-nucleotide polymorphisms identified from the European genome-wide association study in Asian populations.

PubMed

Li, Ming; Ohi, Kazutaka; Chen, Chunhui; He, Qinghua; Liu, Jie-Wei; Chen, Chuansheng; Luo, Xiong-Jian; Dong, Qi; Hashimoto, Ryota; Su, Bing

2014-12-01

Hippocampal volume is a key brain structure for learning ability and memory process, and hippocampal atrophy is a recognized biological marker of Alzheimer's disease. However, the genetic bases of hippocampal volume are still unclear although it is a heritable trait. Genome-wide association studies (GWASs) on hippocampal volume have implicated several significantly associated genetic variants in Europeans. Here, to test the contributions of these GWASs identified genetic variants to hippocampal volume in different ethnic populations, we screened the GWAS-identified candidate single-nucleotide polymorphisms in 3 independent healthy Asian brain imaging samples (a total of 990 subjects). The results showed that none of these single-nucleotide polymorphisms were associated with hippocampal volume in either individual or combined Asian samples. The replication results suggested a complexity of genetic architecture for hippocampal volume and potential genetic heterogeneity between different ethnic populations. Copyright © 2014 Elsevier Inc. All rights reserved.

Cytokine gene polymorphisms and atopic disease in two European cohorts. (ECRHS-Basel and SAPALDIA)

PubMed Central

Imboden, M; Nieters, A; Bircher, AJ; Brutsche, M; Becker, N; Wjst, M; Ackermann-Liebrich, U; Berger, W; Probst-Hensch, NM

2006-01-01

Background Atopy and allergic phenotypes are biologically characterized by an imbalanced T helper cell response skewed towards a type 2 (TH2) immune response associated with elevated serum immunoglobulin E (IgE) levels. Polymorphisms in cytokine genes might modulate regulation of the TH1/TH2 balance. We thus aimed at reproducing our previous findings from a European study population on the association of various cytokine polymorphisms with self-reported hay fever as well as increased total and specific IgE levels in two comparable study populations. Methods Two prospective Caucasian cohorts were used. In the Basel center of the European Community Respiratory Health Survey (ECRHS, n = 418) ten distinct cytokine polymorphisms of putative functional relevance were genotyped. In the Swiss cohort Study on Air Pollution And Lung Disease In Adults (SAPALDIA, n = 6003) two cytokine polymorphisms were genotyped. The associations of these polymorphisms with atopy were estimated by covariance and logistic regression analysis. Results We confirmed IL4, IL10, IL6 and IL18 as candidate genes for atopic health outcomes. In the large, well-characterized SAPALDIA cohort the IL6(-174G>C) and IL18(-137G>C) polymorphisms were associated with circulating total IgE concentrations in subjects with hay fever. The IL18(-137G>C) polymorphism was also associated with the prevalence of hay fever. Conclusion Comprehensive characterization of genetic variation in extended cytokine candidate gene regions is now needed. Large study networks must follow to investigate the association of risk patterns defined by genetic predisposing and environmental risk factors with specific atopic phenotypes. PMID:16759385

The Influence of Genetics on Cystic Fibrosis Phenotypes

PubMed Central

Knowles, Michael R.; Drumm, Mitchell

2012-01-01

Technological advances in genetics have made feasible and affordable large studies to identify genetic variants that cause or modify a trait. Genetic studies have been carried out to assess variants in candidate genes, as well as polymorphisms throughout the genome, for their associations with heritable clinical outcomes of cystic fibrosis (CF), such as lung disease, meconium ileus, and CF-related diabetes. The candidate gene approach has identified some predicted relationships, while genome-wide surveys have identified several genes that would not have been obvious disease-modifying candidates, such as a methionine sulfoxide transferase gene that influences intestinal obstruction, or a region on chromosome 11 proximate to genes encoding a transcription factor and an apoptosis controller that associates with lung function. These unforeseen associations thus provide novel insight into disease pathophysiology, as well as suggesting new therapeutic strategies for CF. PMID:23209180

Evolution of the Transmission-Blocking Vaccine Candidates Pvs28 and Pvs25 in Plasmodium vivax: Geographic Differentiation and Evidence of Positive Selection

PubMed Central

Cornejo, Omar E.; Durrego, Ester; Stanley, Craig E.; Castillo, Andreína I.; Herrera, Sócrates; Escalante, Ananias A.

2016-01-01

Transmission-blocking (TB) vaccines are considered an important tool for malaria control and elimination. Among all the antigens characterized as TB vaccines against Plasmodium vivax, the ookinete surface proteins Pvs28 and Pvs25 are leading candidates. These proteins likely originated by a gene duplication event that took place before the radiation of the known Plasmodium species to primates. We report an evolutionary genetic analysis of a worldwide sample of pvs28 and pvs25 alleles. Our results show that both genes display low levels of genetic polymorphism when compared to the merozoite surface antigens AMA-1 and MSP-1; however, both ookinete antigens can be as polymorphic as other merozoite antigens such as MSP-8 and MSP-10. We found that parasite populations in Asia and the Americas are geographically differentiated with comparable levels of genetic diversity and specific amino acid replacements found only in the Americas. Furthermore, the observed variation was mainly accumulated in the EGF2- and EGF3-like domains for P. vivax in both proteins. This pattern was shared by other closely related non-human primate parasites such as Plasmodium cynomolgi, suggesting that it could be functionally important. In addition, examination with a suite of evolutionary genetic analyses indicated that the observed patterns are consistent with positive natural selection acting on Pvs28 and Pvs25 polymorphisms. The geographic pattern of genetic differentiation and the evidence for positive selection strongly suggest that the functional consequences of the observed polymorphism should be evaluated during development of TBVs that include Pvs25 and Pvs28. PMID:27347876

Characterizing the genetic risk for Type 2 diabetes in a Malaysian multi-ethnic cohort.

PubMed

Abdullah, N; Abdul Murad, N A; Attia, J; Oldmeadow, C; Mohd Haniff, E A; Syafruddin, S E; Abd Jalal, N; Ismail, N; Ishak, M; Jamal, R; Scott, R J; Holliday, E G

2015-10-01

To characterize the association with Type 2 diabetes of known Type 2 diabetes risk variants in people in Malaysia of Malay, Chinese and Indian ancestry who participated in the Malaysian Cohort project. We genotyped 1604 people of Malay ancestry (722 cases, 882 controls), 1654 of Chinese ancestry (819 cases, 835 controls) and 1728 of Indian ancestry (851 cases, 877 controls). First, 62 candidate single-nucleotide polymorphisms previously associated with Type 2 diabetes were assessed for association via logistic regression within ancestral groups and then across ancestral groups using a meta-analysis. Second, estimated odds ratios were assessed for excess directional concordance with previously studied populations. Third, a genetic risk score aggregating allele dosage across the candidate single-nucleotide polymorphisms was tested for association within and across ancestral groups. After Bonferroni correction, seven individual single-nucleotide polymorphisms were associated with Type 2 diabetes in the combined Malaysian sample. We observed a highly significant excess in concordance of effect directions between Malaysian and previously studied populations. The genetic risk score was strongly associated with Type 2 diabetes in all Malaysian groups, explaining from 1.0 to 1.7% of total Type 2 diabetes risk variance. This study suggests there is substantial overlap of the genetic risk alleles underlying Type 2 diabetes in Malaysian and other populations. © 2015 The Authors. Diabetic Medicine © 2015 Diabetes UK.

Computational Analysis of Candidate Disease Genes and Variants for Salt-Sensitive Hypertension in Indigenous Southern Africans

PubMed Central

Tiffin, Nicki; Meintjes, Ayton; Ramesar, Rajkumar; Bajic, Vladimir B.; Rayner, Brian

2010-01-01

Multiple factors underlie susceptibility to essential hypertension, including a significant genetic and ethnic component, and environmental effects. Blood pressure response of hypertensive individuals to salt is heterogeneous, but salt sensitivity appears more prevalent in people of indigenous African origin. The underlying genetics of salt-sensitive hypertension, however, are poorly understood. In this study, computational methods including text- and data-mining have been used to select and prioritize candidate aetiological genes for salt-sensitive hypertension. Additionally, we have compared allele frequencies and copy number variation for single nucleotide polymorphisms in candidate genes between indigenous Southern African and Caucasian populations, with the aim of identifying candidate genes with significant variability between the population groups: identifying genetic variability between population groups can exploit ethnic differences in disease prevalence to aid with prioritisation of good candidate genes. Our top-ranking candidate genes include parathyroid hormone precursor (PTH) and type-1angiotensin II receptor (AGTR1). We propose that the candidate genes identified in this study warrant further investigation as potential aetiological genes for salt-sensitive hypertension. PMID:20886000

APOC3 Promoter Polymorphisms C-482T and T-455C Are Associated with the Metabolic Syndrome1

PubMed Central

Miller, Michael; Rhyne, Jeffrey; Chen, Hegang; Beach, Valerie; Ericson, Richard; Luthra, Kalpana; Dwivedi, Manjari; Misra, Anoop

2007-01-01

Background Despite the growing epidemic of the metabolic syndrome (MetS), few studies have evaluated genetic polymorphisms associated with the MetS phenotype. One candidate, APOC3, modulates lipid and lipoprotein metabolism and the promoter polymorphisms C-482T/T-455C are associated with loss of insulin downregulation. Methods One hundred twenty two consecutive MetS cases were matched by age, sex and race in a 1:1 case-control design to evaluate the prevalence of common polymorphisms in the following candidate genes: APOC3, APOE, B3AR, FABP2, GNB3, LPL, and PPARα and PPARγ. Results Compared to controls, MetS subjects exhibited a greater prevalence of APOC3 promoter polymorphisms. Specifically, the frequency of the variant C-482T and T-455C alleles was 70.5 and 81.9% of cases compared to 43.4 and 54.1% in controls, respectively ( p <0.0001). Overall, APOC3 promoter variants were associated with a greater likelihood of MetS compared to wild type [C-482T (OR: 4.3; 95% CI: 2.2, 8.6 [p <0.0001]), T-455C (OR: 3.6; 95% CI: 2.0, 6.7 [p <0.0001])]. No material differences were identified between the other genetic variants tested and prevalence of MetS. Conclusions These data, therefore, suggest that the APOC3 promoter polymorphisms C-482T and T-455C are associated with the MetS. PMID:17416293

APOC3 promoter polymorphisms C-482T and T-455C are associated with the metabolic syndrome.

PubMed

Miller, Michael; Rhyne, Jeffrey; Chen, Hegang; Beach, Valerie; Ericson, Richard; Luthra, Kalpana; Dwivedi, Manjari; Misra, Anoop

2007-05-01

Despite the growing epidemic of the metabolic syndrome (MetS), few studies have evaluated genetic polymorphisms associated with the MetS phenotype. One candidate, APOC3, modulates lipid and lipoprotein metabolism and the promoter polymorphisms C-482T/T-455C are associated with loss of insulin downregulation. One hundred twenty two consecutive MetS cases were matched by age, sex and race in a 1:1 case-control design to evaluate the prevalence of common polymorphisms in the following candidate genes: APOC3, APOE, B3AR, FABP2, GNB3, LPL, and PPARalpha and PPARgamma. Compared to controls, MetS subjects exhibited a greater prevalence of APOC3 promoter polymorphisms. Specifically, the frequency of the variant C-482T and T-455C alleles was 70.5 and 81.9% of cases compared to 43.4 and 54.1% in controls, respectively (p <0.0001). Overall, APOC3 promoter variants were associated with a greater likelihood of MetS compared to wild type [C-482T (OR: 4.3; 95% CI: 2.2, 8.6 [p <0.0001]), T-455C (OR: 3.6; 95% CI: 2.0, 6.7 [p <0.0001])]. No material differences were identified between the other genetic variants tested and prevalence of MetS. These data, therefore, suggest that the APOC3 promoter polymorphisms C-482T and T-455C are associated with the MetS.

CYP7A1-rs3808607 and APOE isoform associate with LDL cholesterol lowering after plant sterol consumption in a randomized clinical trial

USDA-ARS?s Scientific Manuscript database

The benefits of plant sterols (PS) for cholesterol lowering are hampered by large heterogeneity across individuals, potentially due to genetic polymorphisms. We investigated the impact of candidate genetic variations on cholesterol response to PS, in a trial which recruited individuals with high or ...

Vitamin D receptor genetic polymorphisms and tuberculosis: updated systematic review and meta-analysis.

PubMed

Gao, L; Tao, Y; Zhang, L; Jin, Q

2010-01-01

Host genetic susceptibility has been suggested as one of the most important explanations for inter-individual differences in tuberculosis (TB) risk. The vitamin D receptor (VDR) gene has been studied as a candidate locus due to genetic polymorphisms that affects the activity of the receptor and subsequent downstream vitamin D-mediated effects. We reviewed published studies on VDR polymorphisms and TB susceptibility up to 15 April 2009 and quantitatively summarised associations of the most widely studied polymorphisms (FokI, TaqI, ApaI and BsmI) using meta-analysis. A total of 23 eligible studies were included in this review. Heterogeneous results were observed, which may be partly explained by the differences between populations. Among Asians, the FokI ff genotype showed a pronounced positive association (OR 2.0, 95%CI 1.3-3.2), a significant inverse association was observed for the BsmI bb genotype (OR 0.5, 95%CI 0.4-0.8), and marginal significant associations were found for TaqI and ApaI polymorphisms. However, none of the polymorphisms was significantly related to TB among Africans or South Americans. The association of VDR polymorphisms with risk of TB observed in our analyses supports the hypothesis that vitamin D deficiency might play a role as risk factor during the development of TB.

[Study of genetic variants in the BDNF, COMT, DAT1 and SERT genes in Colombian children with attention deficit disorder].

PubMed

Ortega-Rojas, Jenny; Arboleda-Bustos, Carlos E; Morales, Luis; Benítez, Bruno A; Beltrán, Diana; Izquierdo, Álvaro; Arboleda, Humberto; Vásquez, Rafael

Attention deficit and hyperactive disorder (ADHD) is highly prevalent among children in Bogota City. Both genetic and environmental factors play a very important role in the etiology of ADHD. However, to date few studies have addressed the association of genetic variants and ADHD in the Colombian population. To test the genetic association between polymorphisms in the DAT1, HTTLPR, COMT and BDNF genes and ADHD in a sample from Bogota City. We genotyped the most common polymorphisms in DAT1, SERT, COMT and BDNF genes associated with ADHD using conventional PCR followed by restriction fragment length polymorphism (RFLP) in 97 trios recruited in a medical center in Bogota. The transmission disequilibrium test (TDT) was used to determine the association between such genetic variants and ADHD. The TDT analysis showed that no individual allele of any variant studied has a preferential transmission. Our results suggest that the etiology of the ADHD may be complex and involves several genetic factors. Further studies in other candidate polymorphisms in a larger sample size will improve our knowledge of the ADHD in Colombian population. Copyright © 2016 Asociación Colombiana de Psiquiatría. Publicado por Elsevier España. All rights reserved.

Indel Group in Genomes (IGG) Molecular Genetic Markers1[OPEN

PubMed Central

Burkart-Waco, Diana; Kuppu, Sundaram; Britt, Anne; Chetelat, Roger

2016-01-01

Genetic markers are essential when developing or working with genetically variable populations. Indel Group in Genomes (IGG) markers are primer pairs that amplify single-locus sequences that differ in size for two or more alleles. They are attractive for their ease of use for rapid genotyping and their codominant nature. Here, we describe a heuristic algorithm that uses a k-mer-based approach to search two or more genome sequences to locate polymorphic regions suitable for designing candidate IGG marker primers. As input to the IGG pipeline software, the user provides genome sequences and the desired amplicon sizes and size differences. Primer sequences flanking polymorphic insertions/deletions are produced as output. IGG marker files for three sets of genomes, Solanum lycopersicum/Solanum pennellii, Arabidopsis (Arabidopsis thaliana) Columbia-0/Landsberg erecta-0 accessions, and S. lycopersicum/S. pennellii/Solanum tuberosum (three-way polymorphic) are included. PMID:27436831

Genetic association studies of obesity in Africa: a systematic review.

PubMed

Yako, Y Y; Echouffo-Tcheugui, J B; Balti, E V; Matsha, T E; Sobngwi, E; Erasmus, R T; Kengne, A P

2015-03-01

Obesity is increasing in Africa, but the underlying genetic background largely remains unknown. We assessed existing evidence on genetic determinants of obesity among populations within Africa. MEDLINE and EMBASE were searched and the bibliographies of retrieved articles were examined. Included studies had to report on the association of a genetic marker with obesity indices and the presence/occurrence of obesity/obesity trait. Data were extracted on study design and characteristics, genetic determinants and effect estimates of associations with obesity indices. According to this data, over 300 polymorphisms in 42 genes have been studied in various population groups within Africa mostly through the candidate gene approach. Polymorphisms in genes such as ACE, ADIPOQ, ADRB2, AGRP, AR, CAPN10, CD36, C7orf31, DRD4, FTO, MC3R, MC4R, SGIP1 and LEP were found to be associated with various measures of obesity. Of the 36 polymorphisms previously validated by genome-wide association studies (GWAS) elsewhere, only FTO and MC4R polymorphisms showed significant associations with obesity in black South Africans, Nigerians and Ghanaians. However, these data are insufficient to establish the true nature of genetic susceptibility to obesity in populations within Africa. There has been recent progress in describing the genetic architecture of obesity among populations within Africa. This effort needs to be sustained via GWAS studies. © 2015 World Obesity.

Bulk development and stringent selection of microsatellite markers in the western flower thrips Frankliniella occidentalis

PubMed Central

Cao, Li-Jun; Li, Ze-Min; Wang, Ze-Hua; Zhu, Liang; Gong, Ya-Jun; Chen, Min; Wei, Shu-Jun

2016-01-01

Recent improvements in next-generation sequencing technologies have enabled investigation of microsatellites on a genome-wide scale. Faced with a huge amount of candidates, the use of appropriate marker selection criteria is crucial. Here, we used the western flower thrips Frankliniella occidentalis for an empirical microsatellite survey and validation; 132,251 candidate microsatellites were identified, 92,102 of which were perfect. Dinucleotides were the most abundant category, while (AG)n was the most abundant motif. Sixty primer pairs were designed and validated in two natural populations, of which 30 loci were polymorphic, stable, and repeatable, but not all in Hardy–Weinberg equilibrium (HWE) and linkage equilibrium. Four marker panels were constructed to understand effect of marker selection on population genetic analyses: (i) only accept loci with single nucleotide insertions (SNI); (ii) only accept the most polymorphic loci (MP); (iii) only accept loci that did not deviate from HWE, did not show SNIs, and had unambiguous peaks (SS) and (iv) all developed markers (ALL). Although the MP panel resulted in microsatellites of highest genetic diversity followed by the SNI, the SS performed best in individual assignment. Our study proposes stringent criteria for selection of microsatellites from a large-scale number of genomic candidates for population genetic studies. PMID:27197749

Bulk development and stringent selection of microsatellite markers in the western flower thrips Frankliniella occidentalis.

PubMed

Cao, Li-Jun; Li, Ze-Min; Wang, Ze-Hua; Zhu, Liang; Gong, Ya-Jun; Chen, Min; Wei, Shu-Jun

2016-05-20

Recent improvements in next-generation sequencing technologies have enabled investigation of microsatellites on a genome-wide scale. Faced with a huge amount of candidates, the use of appropriate marker selection criteria is crucial. Here, we used the western flower thrips Frankliniella occidentalis for an empirical microsatellite survey and validation; 132,251 candidate microsatellites were identified, 92,102 of which were perfect. Dinucleotides were the most abundant category, while (AG)n was the most abundant motif. Sixty primer pairs were designed and validated in two natural populations, of which 30 loci were polymorphic, stable, and repeatable, but not all in Hardy-Weinberg equilibrium (HWE) and linkage equilibrium. Four marker panels were constructed to understand effect of marker selection on population genetic analyses: (i) only accept loci with single nucleotide insertions (SNI); (ii) only accept the most polymorphic loci (MP); (iii) only accept loci that did not deviate from HWE, did not show SNIs, and had unambiguous peaks (SS) and (iv) all developed markers (ALL). Although the MP panel resulted in microsatellites of highest genetic diversity followed by the SNI, the SS performed best in individual assignment. Our study proposes stringent criteria for selection of microsatellites from a large-scale number of genomic candidates for population genetic studies.

Mapping a candidate gene (MdMYB10) for red flesh and foliage colour in apple

PubMed Central

Chagné, David; Carlisle, Charmaine M; Blond, Céline; Volz, Richard K; Whitworth, Claire J; Oraguzie, Nnadozie C; Crowhurst, Ross N; Allan, Andrew C; Espley, Richard V; Hellens, Roger P; Gardiner, Susan E

2007-01-01

Background Integrating plant genomics and classical breeding is a challenge for both plant breeders and molecular biologists. Marker-assisted selection (MAS) is a tool that can be used to accelerate the development of novel apple varieties such as cultivars that have fruit with anthocyanin through to the core. In addition, determining the inheritance of novel alleles, such as the one responsible for red flesh, adds to our understanding of allelic variation. Our goal was to map candidate anthocyanin biosynthetic and regulatory genes in a population segregating for the red flesh phenotypes. Results We have identified the Rni locus, a major genetic determinant of the red foliage and red colour in the core of apple fruit. In a population segregating for the red flesh and foliage phenotype we have determined the inheritance of the Rni locus and DNA polymorphisms of candidate anthocyanin biosynthetic and regulatory genes. Simple Sequence Repeats (SSRs) and Single Nucleotide Polymorphisms (SNPs) in the candidate genes were also located on an apple genetic map. We have shown that the MdMYB10 gene co-segregates with the Rni locus and is on Linkage Group (LG) 09 of the apple genome. Conclusion We have performed candidate gene mapping in a fruit tree crop and have provided genetic evidence that red colouration in the fruit core as well as red foliage are both controlled by a single locus named Rni. We have shown that the transcription factor MdMYB10 may be the gene underlying Rni as there were no recombinants between the marker for this gene and the red phenotype in a population of 516 individuals. Associating markers derived from candidate genes with a desirable phenotypic trait has demonstrated the application of genomic tools in a breeding programme of a horticultural crop species. PMID:17608951

Association of single nucleotide polymorphisms in candidate genes previously related to genetic variation in fertility with phenotypic measurements of reproductive function in Holstein cows

USDA-ARS?s Scientific Manuscript database

The objectives of this study were to evaluate the effect of 68 SNP previously associated with genetic merit for fertility and production on phenotype for reproductive and productive traits in a population of Holstein cows. In addition, we determined which SNP had repeated effects across three studie...

Gene-Environment Interactions in Asthma: Genetic and Epigenetic Effects.

PubMed

Lee, Jong-Uk; Kim, Jeong Dong; Park, Choon-Sik

2015-07-01

Over the past three decades, a large number of genetic studies have been aimed at finding genetic variants associated with the risk of asthma, applying various genetic and genomic approaches including linkage analysis, candidate gene polymorphism studies, and genome-wide association studies (GWAS). However, contrary to general expectation, even single nucleotide polymorphisms (SNPs) discovered by GWAS failed to fully explain the heritability of asthma. Thus, application of rare allele polymorphisms in well defined phenotypes and clarification of environmental factors have been suggested to overcome the problem of 'missing' heritability. Such factors include allergens, cigarette smoke, air pollutants, and infectious agents during pre- and post-natal periods. The first and simplest interaction between a gene and the environment is a candidate interaction of both a well known gene and environmental factor in a direct physical or chemical interaction such as between CD14 and endotoxin or between HLA and allergens. Several GWAS have found environmental interactions with occupational asthma, aspirin exacerbated respiratory disease, tobacco smoke-related airway dysfunction, and farm-related atopic diseases. As one of the mechanisms behind gene-environment interaction is epigenetics, a few studies on DNA CpG methylation have been reported on subphenotypes of asthma, pitching the exciting idea that it may be possible to intervene at the junction between the genome and the environment. Epigenetic studies are starting to include data from clinical samples, which will make them another powerful tool for re-search on gene-environment interactions in asthma.

Genetic association analysis of CNR1 and CNR2 polymorphisms with schizophrenia in a Korean population.

PubMed

Bae, Joon Seol; Kim, Jason Yongha; Park, Byung-Lae; Kim, Jeong-Hyun; Kim, Bomi; Park, Chul Soo; Kim, Bong-Jo; Lee, Cheol-Soon; Lee, Migyung; Choi, Woo Hyuk; Shin, Tae-Min; Hwang, Jaeuk; Shin, Hyoung Doo; Woo, Sung-Il

2014-10-01

Located on 6q15 and 1p36.11, cannabinoid receptor 1 (CNR1) and cannabinoid receptor 2 (CNR2) genes are considered to be a positional and functional candidate gene for the development of mental disorders such as schizophrenia because CNR1 is known as a regulator of dopamine signaling in the hippocampus and the cerebral cortex. However, few genetic studies have been carried out to investigate an association of CNR1 and CNR2 polymorphisms and the risk of schizophrenia. In this study, although the result indicates that CNR1 and CNR2 variations are unlikely to influence schizophrenia susceptibility in a Korean population, the findings would provide meaningful information for further genetic studies.

Recent genetic discoveries in osteoporosis, sarcopenia and obesity.

PubMed

Urano, Tomohiko; Inoue, Satoshi

2015-01-01

Osteoporosis is a skeletal disorder characterized by low bone mineral density (BMD) and an increased susceptibility to fractures. Evidence from genetic studies indicates that BMD, a complex quantitative trait with a normal distribution, is genetically controlled. Genome-wide association studies (GWAS) as well as studies using candidate gene approaches have identified single-nucleotide polymorphisms (SNPs) that are associated with BMD, osteoporosis and osteoporotic fractures. These SNPs have been mapped close to or within genes including those encoding WNT/β-catenin signaling proteins. Understanding the genetics of osteoporosis will help to identify novel candidates for diagnostic and therapeutic targets. Genetic factors are also important for the development of sarcopenia, which is characterized by a loss of lean body mass, and obesity, which is characterized by high fat mass. Hence, in this review, we discuss the genetic factors, identified by genetic studies, which regulate the body components related to osteoporosis, sarcopenia, and obesity.

An Efficient Strategy Combining SSR Markers- and Advanced QTL-seq-driven QTL Mapping Unravels Candidate Genes Regulating Grain Weight in Rice

PubMed Central

Daware, Anurag; Das, Sweta; Srivastava, Rishi; Badoni, Saurabh; Singh, Ashok K.; Agarwal, Pinky; Parida, Swarup K.; Tyagi, Akhilesh K.

2016-01-01

Development and use of genome-wide informative simple sequence repeat (SSR) markers and novel integrated genomic strategies are vital to drive genomics-assisted breeding applications and for efficient dissection of quantitative trait loci (QTLs) underlying complex traits in rice. The present study developed 6244 genome-wide informative SSR markers exhibiting in silico fragment length polymorphism based on repeat-unit variations among genomic sequences of 11 indica, japonica, aus, and wild rice accessions. These markers were mapped on diverse coding and non-coding sequence components of known cloned/candidate genes annotated from 12 chromosomes and revealed a much higher amplification (97%) and polymorphic potential (88%) along with wider genetic/functional diversity level (16–74% with a mean 53%) especially among accessions belonging to indica cultivar group, suggesting their utility in large-scale genomics-assisted breeding applications in rice. A high-density 3791 SSR markers-anchored genetic linkage map (IR 64 × Sonasal) spanning 2060 cM total map-length with an average inter-marker distance of 0.54 cM was generated. This reference genetic map identified six major genomic regions harboring robust QTLs (31% combined phenotypic variation explained with a 5.7–8.7 LOD) governing grain weight on six rice chromosomes. One strong grain weight major QTL region (OsqGW5.1) was narrowed-down by integrating traditional QTL mapping with high-resolution QTL region-specific integrated SSR and single nucleotide polymorphism markers-based QTL-seq analysis and differential expression profiling. This led us to delineate two natural allelic variants in two known cis-regulatory elements (RAV1AAT and CARGCW8GAT) of glycosyl hydrolase and serine carboxypeptidase genes exhibiting pronounced seed-specific differential regulation in low (Sonasal) and high (IR 64) grain weight mapping parental accessions. Our genome-wide SSR marker resource (polymorphic within/between diverse cultivar groups) and integrated genomic strategy can efficiently scan functionally relevant potential molecular tags (markers, candidate genes and alleles) regulating complex agronomic traits (grain weight) and expedite marker-assisted genetic enhancement in rice. PMID:27833617

High-density polymorphisms analysis of 23 candidate genes for association with bone mineral density.

PubMed

Giroux, Sylvie; Elfassihi, Latifa; Clément, Valérie; Bussières, Johanne; Bureau, Alexandre; Cole, David E C; Rousseau, François

2010-11-01

Osteoporosis is a bone disease characterized by low bone mineral density (BMD), a highly heritable and polygenic trait. Women are more prone than men to develop osteoporosis due to a lower peak bone mass and accelerated bone loss at menopause. Peak bone mass has been convincingly shown to be due to genetic factors with heritability up to 80%. Menopausal bone loss has been shown to have around 38% to 49% heritability depending on the site studied. To have more statistical power to detect small genetic effects we focused on premenopausal women. We studied 23 candidate genes, some involved in calcium and vitamin-D regulation and others because estrogens strongly induced their gene expression in mice where it was correlated with humerus trabecular bone density. High-density polymorphisms were selected to cover the entire gene variability and 231 polymorphisms were genotyped in a first sample of 709 premenopausal women. Positive associations were retested in a second, independent, sample of 673 premenopausal women. Ten polymorphisms remained associated with BMD in the combined samples and one was further associated in a large sample of postmenopausal women (1401 women). This associated polymorphism was located in the gene CSF3R (granulocyte colony stimulating factor receptor) that had never been associated with BMD before. The results reported in this study suggest a role for CSF3R in the determination of bone density in women. Copyright © 2010 Elsevier Inc. All rights reserved.

Genome-wide generation and use of informative intron-spanning and intron-length polymorphism markers for high-throughput genetic analysis in rice

PubMed Central

Badoni, Saurabh; Das, Sweta; Sayal, Yogesh K.; Gopalakrishnan, S.; Singh, Ashok K.; Rao, Atmakuri R.; Agarwal, Pinky; Parida, Swarup K.; Tyagi, Akhilesh K.

2016-01-01

We developed genome-wide 84634 ISM (intron-spanning marker) and 16510 InDel-fragment length polymorphism-based ILP (intron-length polymorphism) markers from genes physically mapped on 12 rice chromosomes. These genic markers revealed much higher amplification-efficiency (80%) and polymorphic-potential (66%) among rice accessions even by a cost-effective agarose gel-based assay. A wider level of functional molecular diversity (17–79%) and well-defined precise admixed genetic structure was assayed by 3052 genome-wide markers in a structured population of indica, japonica, aromatic and wild rice. Six major grain weight QTLs (11.9–21.6% phenotypic variation explained) were mapped on five rice chromosomes of a high-density (inter-marker distance: 0.98 cM) genetic linkage map (IR 64 x Sonasal) anchored with 2785 known/candidate gene-derived ISM and ILP markers. The designing of multiple ISM and ILP markers (2 to 4 markers/gene) in an individual gene will broaden the user-preference to select suitable primer combination for efficient assaying of functional allelic variation/diversity and realistic estimation of differential gene expression profiles among rice accessions. The genomic information generated in our study is made publicly accessible through a user-friendly web-resource, “Oryza ISM-ILP marker” database. The known/candidate gene-derived ISM and ILP markers can be enormously deployed to identify functionally relevant trait-associated molecular tags by optimal-resource expenses, leading towards genomics-assisted crop improvement in rice. PMID:27032371

Association of genetic variants and expression levels of porcine FABP4 and FABP5 genes.

PubMed

Ballester, M; Puig-Oliveras, A; Castelló, A; Revilla, M; Fernández, A I; Folch, J M

2017-12-01

The FABP4 and FABP5 genes, coding for fatty acid transport proteins, have long been studied as positional candidate genes for SSC4 QTL affecting fat deposition and composition traits in pigs. Polymorphisms in these genes, FABP4:g.2634_2635insC and FABP5:g.3000T>G, have previously been associated with fatness traits in an Iberian by Landrace cross (IBMAP). The aim of the present work was to evaluate the functional implication of these genetic variants. For this purpose, FABP4 and FABP5 mRNA expression levels in 114 BC1_LD animals (25% Iberian × 75% Landrace) were analyzed using real-time quantitative PCR in backfat and muscle. FABP4 gene expression in backfat, but not in muscle, was associated with FABP4:g.2634_2635insC. In contrast, FABP5:g.3000T>G was not associated with gene expression levels. An expression-based genome-wide association study highlighted the FABP4:g.2634_2635insC polymorphism as the polymorphism most associated with FABP4 gene expression in backfat. Furthermore, other genomic regions associated in trans with the mRNA expression of FABP4 in backfat and FABP5 in muscle were also identified. Finally, two putative transcription binding sites for PPARG and NR4A2 may be affected by the FABP4:g.2634_2635insC polymorphism, modifying FABP4 gene expression. Our results reinforce FABP4 as a candidate gene for fatness traits on SSC4. © 2017 Stichting International Foundation for Animal Genetics.

Evaluation of androgen receptor gene as a candidate gene in female androgenetic alopecia.

PubMed

el-Samahy, May H; Shaheen, Maha A; Saddik, Dina E B; Abdel-Fattah, Nermeen S A; el-Sawi, Mohammad A; Mahran, Manal Z; Shehab, Abeer A A

2009-06-01

Genetic polymorphisms of the androgen receptor (AR) gene have been studied in male androgenetic alopecia (AGA); however, little is known about gene polymorphism and female AGA. To evaluate the AR gene as a candidate gene for female AGA. Thirty premenopausal Egyptian female patients with AGA (mean age, 32.3 +/- 7 years) and 11 age- and sex-matched controls were included. All subjects underwent laboratory and pelvic ultrasound evaluation to exclude other precipitating cause(s) of hair loss. Scalp biopsy was taken and the AR gene was evaluated using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). According to Ludwig's classification, all patients had type II AGA. Statistical analysis showed no statistically significant difference in genotype (chi(2) = 5.513, P > or = 0.05) or allele frequency (chi(2) = 1.312, P > or = 0.05) between patients and controls. There was also no statistically significant difference between the genotype and allele frequency with disease duration. In contrast with male AGA, no association was found between type II AGA in Egyptian women and the AR gene. Therefore, the genetic study of this gene does not serve as a biomarker for the identification of women with a predisposition to AGA.

SLC11A1 polymorphisms and host susceptibility to cutaneous leishmaniasis in Pakistan.

PubMed

Sophie, Mariam; Hameed, Abdul; Muneer, Akhtar; Samdani, Azam J; Saleem, Saima; Azhar, Abid

2017-01-07

The vector-borne cutaneous leishmaniasis (CL) is endemic in several regions of Pakistan mainly affecting poor populations. Host genetic factors, particularly SLC11A1 (solute carrier transmembrane protein) within macrophages, play a crucial role in disease pathology and susceptibility. Association of SLC11A1 with cutaneous leishmaniasis, a neglected tropical disease, is not well established. Inconsistencies have been observed within different populations worldwide with respect to genetic susceptibility. This study was designed to investigate genetic variation(s) in SLC11A1 and to assess possible association with cutaneous leishmaniasis in Pakistan. Eight polymorphisms (rs2276631, rs3731864, rs2290708, rs2695342, rs201565523, rs17215556, rs17235409, rs17235416) were genotyped across SLC11A1 in 274 patients and 119 healthy controls. Six polymorphisms were studied by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and sequencing. Two single nucleotide polymorphisms were analyzed with newly designed semi-nested PCR assays. Case-control analysis showed no association between selected polymorphisms in SLC11A1 and cutaneous leishmaniasis. No significant difference was observed in the distribution of alleles between leishmaniasis patients and healthy individuals. Strong pairwise linkage disequilibrium was observed between rs2276631 and rs2290708 (r 2  = 64); and rs17235409 and rs17235416 (r 2  = 78). This study shows that genetic variations in the candidate gene SLC11A1 do not affect susceptibility to cutaneous leishmaniasis in the sample population from Pakistan.

Prevalence, Patterns, and Genetic Association Analysis of Modic Vertebral Endplate Changes.

PubMed

Kanna, Rishi Mugesh; Shanmuganathan, Rajasekaran; Rajagopalan, Veera Ranjani; Natesan, Senthil; Muthuraja, Raveendran; Cheung, Kenneth Man Chee; Chan, Danny; Kao, Patrick Yu Ping; Yee, Anita; Shetty, Ajoy Prasad

2017-08-01

A prospective genetic association study. The etiology of Modic changes (MCs) is unclear. Recently, the role of genetic factors in the etiology of MCs has been evaluated. However, studies with a larger patient subset are lacking, and candidate genes involved in other disc degeneration phenotypes have not been evaluated. We studied the prevalence of MCs and genetic association of 41 candidate genes in a large Indian cohort. MCs are vertebral endplate signal changes predominantly observed in the lumbar spine. A significant association between MCs and lumbar disc degeneration and nonspecific low back pain has been described, with the etiopathogenesis implicating various mechanical, infective, and biochemical factors. We studied 809 patients using 1.5-T magnetic resonance imaging to determine the prevalence, patterns, distribution, and type of lumbar MCs. Genetic association analysis of 71 single nucleotide polymorphisms (SNPs) of 41 candidate genes was performed based on the presence or absence of MCs. SNPs were genotyped using the Sequenome platform, and an association test was performed using PLINK software. The mean age of the study population (n=809) was 36.7±10.8 years. Based on the presence of MCs, the cohort was divided into 702 controls and 107 cases (prevalence, 13%). MCs were more commonly present in the lower (149/251, 59.4%) than in the upper (102/251, 40.6%) endplates. L4-5 endplates were the most commonly affected levels (30.7%). Type 2 MCs were the most commonly observed pattern (n=206, 82%). The rs2228570 SNP of VDR ( p =0.02) and rs17099008 SNP of MMP20 ( p =0.03) were significantly associated with MCs. Genetic polymorphisms of SNPs of VDR and MMP20 were significantly associated with MCs. Understanding the etiopathogenetic mechanisms of MCs is important for planning preventive and therapeutic strategies.

Identification of a QTL in Mus musculus for alcohol preference, withdrawal, and Ap3m2 expression using integrative functional genomics and precision genetics.

PubMed

Bubier, Jason A; Jay, Jeremy J; Baker, Christopher L; Bergeson, Susan E; Ohno, Hiroshi; Metten, Pamela; Crabbe, John C; Chesler, Elissa J

2014-08-01

Extensive genetic and genomic studies of the relationship between alcohol drinking preference and withdrawal severity have been performed using animal models. Data from multiple such publications and public data resources have been incorporated in the GeneWeaver database with >60,000 gene sets including 285 alcohol withdrawal and preference-related gene sets. Among these are evidence for positional candidates regulating these behaviors in overlapping quantitative trait loci (QTL) mapped in distinct mouse populations. Combinatorial integration of functional genomics experimental results revealed a single QTL positional candidate gene in one of the loci common to both preference and withdrawal. Functional validation studies in Ap3m2 knockout mice confirmed these relationships. Genetic validation involves confirming the existence of segregating polymorphisms that could account for the phenotypic effect. By exploiting recent advances in mouse genotyping, sequence, epigenetics, and phylogeny resources, we confirmed that Ap3m2 resides in an appropriately segregating genomic region. We have demonstrated genetic and alcohol-induced regulation of Ap3m2 expression. Although sequence analysis revealed no polymorphisms in the Ap3m2-coding region that could account for all phenotypic differences, there are several upstream SNPs that could. We have identified one of these to be an H3K4me3 site that exhibits strain differences in methylation. Thus, by making cross-species functional genomics readily computable we identified a common QTL candidate for two related bio-behavioral processes via functional evidence and demonstrate sufficiency of the genetic locus as a source of variation underlying two traits. Copyright © 2014 by the Genetics Society of America.

Folate-mediated one-carbon metabolism genes and interactions with nutritional factors on colorectal cancer risk: Women's Health Initiative Observational Study.

PubMed

Cheng, Ting-Yuan David; Makar, Karen W; Neuhouser, Marian L; Miller, Joshua W; Song, Xiaoling; Brown, Elissa C; Beresford, Shirley A A; Zheng, Yingye; Poole, Elizabeth M; Galbraith, Rachel L; Duggan, David J; Habermann, Nina; Bailey, Lynn B; Maneval, David R; Caudill, Marie A; Toriola, Adetunji T; Green, Ralph; Ulrich, Cornelia M

2015-10-15

Investigations of folate-mediated one-carbon metabolism (FOCM) genes and gene-nutrient interactions with respect to colorectal cancer (CRC) risk are limited to candidate polymorphisms and dietary folate. This study comprehensively investigated associations between genetic variants in FOCM and CRC risk and whether the FOCM nutrient status modified these associations. Two hundred eighty-eight candidate and tagging single-nucleotide polymorphisms (SNPs) in 30 FOCM genes were genotyped for 821 incident CRC case-control matched pairs in the Women's Health Initiative Observational Study cohort. FOCM biomarkers (red blood cell [RBC] folate, plasma folate, pyridoxal-5'-phosphate [PLP], vitamin B12, and homocysteine) and self-reported alcohol consumption were measured at the baseline. Conditional logistic regression was implemented; effect modification was examined on the basis of known enzyme-nutrient relations. Statistically significant associations were observed between CRC risk and functionally defined candidate SNPs of methylenetetrahydrofolate dehydrogenase 1 (MTHFD1; K134R), 5-methyltetrahydrofolate-homocysteine methyltransferase reductase (MTRR; P450R), and PR domain containing 2 with ZNF domain (PRDM2; S450N) and a literature candidate SNP of thymidylate synthase (TYMS; g.676789A>T; nominal P < .05). In addition, suggestive associations were noted for tagging SNPs in cystathionine-β-synthase (CBS), dihydrofolate reductase (DHFR), DNA (cytosine-5-)-methyltransferase 3β (DNMT3B), methionine adenosyltransferase I α (MAT1A), MTHFD1, and MTRR (nominal P < .05; adjusted P, not significant). Significant interactions between nutrient biomarkers and candidate polymorphisms were observed for 1) plasma/RBC folate and folate hydrolase 1 (FOLH1), paraoxonase 1 (PON1), transcobalamin II (TCN2), DNMT1, and DNMT3B; 2) plasma PLP and TYMS TS3; 3) plasma B12 and betaine-homocysteine S-methyltransferase 2 (BHMT2); and 4) homocysteine and methylenetetrahydrofolate reductase (MTHFR) and alanyl-transfer RNA synthetase (AARS). Genetic variants in FOCM genes are associated with CRC risk among postmenopausal women. FOCM nutrients continue to emerge as effect modifiers of genetic influences on CRC risk. © 2015 American Cancer Society.

Genetic polymorphisms of Th2 interleukins, history of asthma or eczema and childhood acute lymphoid leukaemia: Findings from the ESCALE study (SFCE).

PubMed

Bonaventure, A; Orsi, L; Rudant, J; Goujon-Bellec, S; Leverger, G; Baruchel, A; Bertrand, Y; Nelken, B; Pasquet, M; Michel, G; Sirvent, N; Chastagner, P; Ducassou, S; Thomas, C; Besse, C; Hémon, D; Clavel, J

2018-06-05

Previous studies on the putative role of allergy in the aetiology of childhood leukaemia have reported contradictory results. The present study aimed to analyse the relation between a medical history of asthma or eczema and childhood acute lymphoid leukaemia (ALL) in light of potential candidate gene-environment interactions. Analyses were based on a subset of 434 cases of ALL and 442 controls successfully genotyped and of European ancestry children enrolled in a French population-based case-control study conducted in 2003-2004. Information about medical history was obtained during a standardized interview with the mothers. Candidate polymorphisms in genes of the Th2 cytokines IL4, IL10, IL13 and IL4-receptor, were genotyped or imputed. None of the variant alleles were directly associated with childhood acute lymphoid leukaemia. A medical history of asthma or eczema was reported more often in the control group (OR = 0.7 [0.5-1.0]). This association was mostly seen in the group of children not carrying the IL13-rs20541 variant allele (Interaction Odds Ratio IOR 1.9, p-interaction = 0.07) and in those carrying the IL10 triple variant haplotype (IOR 0.5, p-interaction = 0.04). No interaction was observed with the candidate polymorphisms in IL4 and IL4R. This study provides a new insight into the relationship between allergic symptoms and childhood acute lymphoid leukaemia, by suggesting this inverse association could be limited to children carrying certain genetic polymorphisms. If confirmed, these results could help better understand the biological mechanisms involved in the development of childhood acute lymphoid leukaemia. Copyright © 2018. Published by Elsevier Ltd.

Genetic influences on insight problem solving: the role of catechol-O-methyltransferase (COMT) gene polymorphisms

PubMed Central

Jiang, Weili; Shang, Siyuan; Su, Yanjie

2015-01-01

People may experience an “aha” moment, when suddenly realizing a solution of a puzzling problem. This experience is called insight problem solving. Several findings suggest that catecholamine-related genes may contribute to insight problem solving, among which the catechol-O-methyltransferase (COMT) gene is the most promising candidate. The current study examined 753 healthy individuals to determine the associations between 7 candidate single nucleotide polymorphisms on the COMT gene and insight problem-solving performance, while considering gender differences. The results showed that individuals carrying A allele of rs4680 or T allele of rs4633 scored significantly higher on insight problem-solving tasks, and the COMT gene rs5993883 combined with gender interacted with correct solutions of insight problems, specifically showing that this gene only influenced insight problem-solving performance in males. This study presents the first investigation of the genetic impact on insight problem solving and provides evidence that highlights the role that the COMT gene plays in insight problem solving. PMID:26528222

Genetic influences on insight problem solving: the role of catechol-O-methyltransferase (COMT) gene polymorphisms.

PubMed

Jiang, Weili; Shang, Siyuan; Su, Yanjie

2015-01-01

People may experience an "aha" moment, when suddenly realizing a solution of a puzzling problem. This experience is called insight problem solving. Several findings suggest that catecholamine-related genes may contribute to insight problem solving, among which the catechol-O-methyltransferase (COMT) gene is the most promising candidate. The current study examined 753 healthy individuals to determine the associations between 7 candidate single nucleotide polymorphisms on the COMT gene and insight problem-solving performance, while considering gender differences. The results showed that individuals carrying A allele of rs4680 or T allele of rs4633 scored significantly higher on insight problem-solving tasks, and the COMT gene rs5993883 combined with gender interacted with correct solutions of insight problems, specifically showing that this gene only influenced insight problem-solving performance in males. This study presents the first investigation of the genetic impact on insight problem solving and provides evidence that highlights the role that the COMT gene plays in insight problem solving.

Prolactin receptor gene polymorphism and the risk of recurrent pregnancy loss: a case-control study.

PubMed

Kim, Jin Ju; Choi, Young Min; Lee, Sung Ki; Yang, Kwang Moon; Paik, Eun Chan; Jeong, Hyeon Jeong; Jun, Jong Kwan; Han, Ae Ra; Hwang, Kyu Ri; Hong, Min A

2018-02-01

Since the first study was published reporting the candidate association between the prolactin receptor gene intron C/T polymorphism (rs37389) and recurrent miscarriage, no replication study has been performed. In this study, we investigated the role of the prolactin receptor gene C/T polymorphism in 311 Korean women with recurrent pregnancy loss and 314 controls. Genotyping for prolactin receptor gene intron C/T polymorphism was performed using a TaqMan assay. The significance of difference in the genotype distribution was assessed using a chi-square test, and continuous variables were compared using a Student's t-test. The genotype distribution of the prolactin receptor gene C/T polymorphism in the recurrent pregnancy loss group did not differ from that in the control group (CC/CT/TT rates were 49.8%/41.5%/8.7% and 52.5%/37.6%/9.9% for the recurrent pregnancy loss patient and control groups, respectively, p = .587). When the analysis was restricted to patients with three or more consecutive spontaneous miscarriages or patients without prior live birth, there were also no differences in the genotype distribution between these subgroups and controls. In conclusion, the findings of the current study suggest that the prolactin receptor gene intron C/T polymorphism is not a major determinant of the development of recurrent pregnancy loss. Impact statement What is already known: Many studies have investigated whether there is a genetic component for the risk of recurrent pregnancy loss. Recently, one study investigated whether genetic polymorphisms involved in the regulation of the hypothalamic-pituitary-ovarian axis would be associated with recurrent miscarriage. Among 35 polymorphisms in 20 candidate genes, genotype distribution with regard to the prolactin receptor gene intron C/T polymorphism (rs37389) differed between the recurrent miscarriage and the control groups. Since this study reporting the candidate association between the prolactin receptor gene and recurrent miscarriage, no replication study has been performed. What the results of this study add: The genotype distribution of the prolactin receptor gene C/T polymorphism in the recurrent miscarriage group did not differ from that in the control group. What the implications are of these findings: Our study may be useful in that it is the first replication study since the initial report of the association of prolactin receptor gene polymorphism with recurrent miscarriage. Although no association was found, the potential role of prolactin in pregnancy loss needs to be further investigated because prolactin and its receptor have been postulated to play an important role in the maintenance of normal pregnancy.

Mapping autism risk loci using genetic linkage and chromosomal rearrangements

PubMed Central

Szatmari, Peter; Paterson, Andrew; Zwaigenbaum, Lonnie; Roberts, Wendy; Brian, Jessica; Liu, Xiao-Qing; Vincent, John; Skaug, Jennifer; Thompson, Ann; Senman, Lili; Feuk, Lars; Qian, Cheng; Bryson, Susan; Jones, Marshall; Marshall, Christian; Scherer, Stephen; Vieland, Veronica; Bartlett, Christopher; Mangin, La Vonne; Goedken, Rhinda; Segre, Alberto; Pericak-Vance, Margaret; Cuccaro, Michael; Gilbert, John; Wright, Harry; Abramson, Ruth; Betancur, Catalina; Bourgeron, Thomas; Gillberg, Christopher; Leboyer, Marion; Buxbaum, Joseph; Davis, Kenneth; Hollander, Eric; Silverman, Jeremy; Hallmayer, Joachim; Lotspeich, Linda; Sutcliffe, James; Haines, Jonathan; Folstein, Susan; Piven, Joseph; Wassink, Thomas; Sheffield, Val; Geschwind, Daniel; Bucan, Maja; Brown, Ted; Cantor, Rita; Constantino, John; Gilliam, Conrad; Herbert, Martha; Lajonchere, Clara; Ledbetter, David; Lese-Martin, Christa; Miller, Janet; Nelson, Stan; Samango-Sprouse, Carol; Spence, Sarah; State, Matthew; Tanzi, Rudolph; Coon, Hilary; Dawson, Geraldine; Devlin, Bernie; Estes, Annette; Flodman, Pamela; Klei, Lambertus; Mcmahon, William; Minshew, Nancy; Munson, Jeff; Korvatska, Elena; Rodier, Patricia; Schellenberg, Gerard; Smith, Moyra; Spence, Anne; Stodgell, Chris; Tepper, Ping Guo; Wijsman, Ellen; Yu, Chang-En; Rogé, Bernadette; Mantoulan, Carine; Wittemeyer, Kerstin; Poustka, Annemarie; Felder, Bärbel; Klauck, Sabine; Schuster, Claudia; Poustka, Fritz; Bölte, Sven; Feineis-Matthews, Sabine; Herbrecht, Evelyn; Schmötzer, Gabi; Tsiantis, John; Papanikolaou, Katerina; Maestrini, Elena; Bacchelli, Elena; Blasi, Francesca; Carone, Simona; Toma, Claudio; Van Engeland, Herman; De Jonge, Maretha; Kemner, Chantal; Koop, Frederieke; Langemeijer, Marjolein; Hijmans, Channa; Staal, Wouter; Baird, Gillian; Bolton, Patrick; Rutter, Michael; Weisblatt, Emma; Green, Jonathan; Aldred, Catherine; Wilkinson, Julie-Anne; Pickles, Andrew; Le Couteur, Ann; Berney, Tom; Mcconachie, Helen; Bailey, Anthony; Francis, Kostas; Honeyman, Gemma; Hutchinson, Aislinn; Parr, Jeremy; Wallace, Simon; Monaco, Anthony; Barnby, Gabrielle; Kobayashi, Kazuhiro; Lamb, Janine; Sousa, Ines; Sykes, Nuala; Cook, Edwin; Guter, Stephen; Leventhal, Bennett; Salt, Jeff; Lord, Catherine; Corsello, Christina; Hus, Vanessa; Weeks, Daniel; Volkmar, Fred; Tauber, Maïté; Fombonne, Eric; Shih, Andy; Meyer, Kacie

2007-01-01

Autism spectrum disorders (ASD) are common, heritable neurodevelopmental conditions. The genetic architecture of ASD is complex, requiring large samples to overcome heterogeneity. Here we broaden coverage and sample size relative to other studies of ASD by using Affymetrix 10K single nucleotide polymorphism (SNP) arrays and 1168 families with ≥ 2 affected individuals to perform the largest linkage scan to date, while also analyzing copy number variation (CNV) in these families. Linkage and CNV analyses implicate chromosome 11p12-p13 and neurexins, respectively, amongst other candidate loci. Neurexins team with previously-implicated neuroligins for glutamatergic synaptogenesis, highlighting glutamate-related genes as promising candidates for ASD. PMID:17322880

[Antipsychotic-induced weight gain--pharmacogenetic studies].

PubMed

Olajossy-Hilkesberger, Luiza; Godlewska, Beata; Marmurowska-Michałowskal, Halina; Olajossy, Marcin; Landowski, Jerzy

2006-01-01

Drug-naive patients with schizophrenia often present metabolic abnormalities and obesity. Weight gain may be the side effect of treatment with many antipsychotic drugs. Genetic effects, besides many other factors, are known to influence obesity in patients with schizophrenia treated with antipsychotics. Numerous studies of several genes' polymorphisms have been performed. -759C/T polymorphism of 5HT2C gene attracted most attention. In 5 independent studies of this polymorphism the association between T allele with the lower AP-induced weight gain was detected. No associations could be detected between weight gain and other polymorphisms of serotonergic system genes as well as histaminergic system genes. Studies of adrenergic and dopaminergic system have neither produced any unambiguous results. Analysis of the newest candidate genes (SAP-25, leptin gene) confirmed the role of genetic factors in AP-induced weight gain. It is worth emphasising, that the studies have been conducted in relatively small and heterogenic groups and that various treatment strategies were used.

Restriction site polymorphism-based candidate gene mapping for seedling drought tolerance in cowpea [Vigna unguiculata (L.) Walp.].

PubMed

Muchero, Wellington; Ehlers, Jeffrey D; Roberts, Philip A

2010-02-01

Quantitative trait loci (QTL) studies provide insight into the complexity of drought tolerance mechanisms. Molecular markers used in these studies also allow for marker-assisted selection (MAS) in breeding programs, enabling transfer of genetic factors between breeding lines without complete knowledge of their exact nature. However, potential for recombination between markers and target genes limit the utility of MAS-based strategies. Candidate gene mapping offers an alternative solution to identify trait determinants underlying QTL of interest. Here, we used restriction site polymorphisms to investigate co-location of candidate genes with QTL for seedling drought stress-induced premature senescence identified previously in cowpea. Genomic DNA isolated from 113 F(2:8) RILs of drought-tolerant IT93K503-1 and drought susceptible CB46 genotypes was digested with combinations of EcoR1 and HpaII, Mse1, or Msp1 restriction enzymes and amplified with primers designed from 13 drought-responsive cDNAs. JoinMap 3.0 and MapQTL 4.0 software were used to incorporate polymorphic markers onto the AFLP map and to analyze their association with the drought response QTL. Seven markers co-located with peaks of previously identified QTL. Isolation, sequencing, and blast analysis of these markers confirmed their significant homology with drought or other abiotic stress-induced expressed sequence tags (EST) from cowpea and other plant systems. Further, homology with coding sequences for a multidrug resistance protein 3 and a photosystem I assembly protein ycf3 was revealed in two of these candidates. These results provide a platform for the identification and characterization of genetic trait determinants underlying seedling drought tolerance in cowpea.

Investigation of previously implicated genetic variants in chronic tic disorders: a transmission disequilibrium test approach.

PubMed

Abdulkadir, Mohamed; Londono, Douglas; Gordon, Derek; Fernandez, Thomas V; Brown, Lawrence W; Cheon, Keun-Ah; Coffey, Barbara J; Elzerman, Lonneke; Fremer, Carolin; Fründt, Odette; Garcia-Delgar, Blanca; Gilbert, Donald L; Grice, Dorothy E; Hedderly, Tammy; Heyman, Isobel; Hong, Hyun Ju; Huyser, Chaim; Ibanez-Gomez, Laura; Jakubovski, Ewgeni; Kim, Young Key; Kim, Young Shin; Koh, Yun-Joo; Kook, Sodahm; Kuperman, Samuel; Leventhal, Bennett; Ludolph, Andrea G; Madruga-Garrido, Marcos; Maras, Athanasios; Mir, Pablo; Morer, Astrid; Müller-Vahl, Kirsten; Münchau, Alexander; Murphy, Tara L; Plessen, Kerstin J; Roessner, Veit; Shin, Eun-Young; Song, Dong-Ho; Song, Jungeun; Tübing, Jennifer; van den Ban, Els; Visscher, Frank; Wanderer, Sina; Woods, Martin; Zinner, Samuel H; King, Robert A; Tischfield, Jay A; Heiman, Gary A; Hoekstra, Pieter J; Dietrich, Andrea

2018-04-01

Genetic studies in Tourette syndrome (TS) are characterized by scattered and poorly replicated findings. We aimed to replicate findings from candidate gene and genome-wide association studies (GWAS). Our cohort included 465 probands with chronic tic disorder (93% TS) and both parents from 412 families (some probands were siblings). We assessed 75 single nucleotide polymorphisms (SNPs) in 465 parent-child trios; 117 additional SNPs in 211 trios; and 4 additional SNPs in 254 trios. We performed SNP and gene-based transmission disequilibrium tests and compared nominally significant SNP results with those from a large independent case-control cohort. After quality control 71 SNPs were available in 371 trios; 112 SNPs in 179 trios; and 3 SNPs in 192 trios. 17 were candidate SNPs implicated in TS and 2 were implicated in obsessive-compulsive disorder (OCD) or autism spectrum disorder (ASD); 142 were tagging SNPs from eight monoamine neurotransmitter-related genes (including dopamine and serotonin); 10 were top SNPs from TS GWAS; and 13 top SNPs from attention-deficit/hyperactivity disorder, OCD, or ASD GWAS. None of the SNPs or genes reached significance after adjustment for multiple testing. We observed nominal significance for the candidate SNPs rs3744161 (TBCD) and rs4565946 (TPH2) and for five tagging SNPs; none of these showed significance in the independent cohort. Also, SLC1A1 in our gene-based analysis and two TS GWAS SNPs showed nominal significance, rs11603305 (intergenic) and rs621942 (PICALM). We found no convincing support for previously implicated genetic polymorphisms. Targeted re-sequencing should fully appreciate the relevance of candidate genes.

Validation of candidate genes associated with cardiovascular risk factors in psychiatric patients

PubMed Central

Windemuth, Andreas; de Leon, Jose; Goethe, John W.; Schwartz, Harold I.; Woolley, Stephen; Susce, Margaret; Kocherla, Mohan; Bogaard, Kali; Holford, Theodore R.; Seip, Richard L.; Ruaño, Gualberto

2016-01-01

The purpose of this study was to identify genetic variants predictive of cardiovascular risk factors in a psychiatric population treated with second generation antipsychotics (SGA). 924 patients undergoing treatment for severe mental illness at four US hospitals were genotyped at 1.2 million single nucleotide polymorphisms. Patients were assessed for fasting serum lipid (low density lipoprotein cholesterol [LDLc], high density lipoprotein cholesterol [HDLc], and triglycerides) and obesity phenotypes (body mass index, BMI). Thirteen candidate genes from previous studies of the same phenotypes in non-psychiatric populations were tested for association. We confirmed 8 of the 13 candidate genes at the 95% confidence level. An increased genetic effect size was observed for triglycerides in the psychiatric population compared to that in the cardiovascular population. PMID:21851846

An SNP within the Angiotensin-Converting Enzyme Distinguishes between Sprint and Distance Performing Alaskan Sled Dogs in a Candidate Gene Analysis

PubMed Central

Huson, Heather J.; Byers, Alexandra M.; Runstadler, Jonathan

2011-01-01

The Alaskan sled dog offers a unique mechanism for studying the genetics of elite athletic performance. They are a group of mixed breed dogs, comprised of multiple common breeds, and a unique breed entity seen only as a part of the sled dog mix. Alaskan sled dogs are divided into 2 primary groups as determined by their racing skills. Distance dogs are capable of running over 1000 miles in 10 days, whereas sprint dogs run much shorter distances, approximately 30 miles, but in faster times, that is, 18–25 mph. Finding the genes that distinguish these 2 types of performers is likely to illuminate genetic contributors to human athletic performance. In this study, we tested for association between polymorphisms in 2 candidate genes; angiotensin-converting enzyme (ACE) and myostatin (MSTN) and enhanced speed and endurance performance in 174 Alaskan sled dogs. We observed 81 novel genetic variants within the ACE gene and 4 within the MSTN gene, including a polymorphism within the ACE gene that significantly (P value 2.38 × 10−5) distinguished the sprint versus distance populations. PMID:21846742

APOE polymorphism as a potential determinant of functional fitness in the elderly regardless of nutritional status.

PubMed

Snejdrlova, Michaela; Kalvach, Zdenek; Topinkova, Eva; Vrablik, Michal; Prochazkova, Renata; Kvasilova, Marie; Lanska, Vera; Zlatohlavek, Lukas; Prusikova, Martina; Ceska, Richard

2011-01-01

Life expectancy is determined by a combination of genetic predisposition (~25%) and environmental influences (~75%). Nevertheless a stronger genetic influence is anticipated in long-living individuals. Apolipoprotein E (APOE) gene belongs among the most studied candidate genes of longevity. We evaluated the relation of APOE polymorphism and fitness status in the elderly. We examined a total number of 128 subjects, over 80 years of age. Using a battery of functional tests their fitness status was assessed and the subjects were stratified into 5 functional categories according to Spirduso´s classification. Biochemistry analysis was performed by enzymatic method using automated analyzers. APOE gene polymorphism was analysed performed using PCR-RFLP. APOE4 allele carriers had significantly worse fitness status compared to non-carriers (p=0.025). Multiple logistic regression analysis showed the APOE4 carriers had higher risk (p=0.05) of functional unfitness compared to APOE2/E3 individuals. APOE gene polymorphism seems be an important genetic contributor to frailty development in the elderly. While APOE2 carriers tend to remain functionally fit till higher age, the functional status of APOE4 carriers deteriorates more rapidly. © 2011 Neuroendocrinology Letters

Identification of a QTL in Mus musculus for Alcohol Preference, Withdrawal, and Ap3m2 Expression Using Integrative Functional Genomics and Precision Genetics

PubMed Central

Bubier, Jason A.; Jay, Jeremy J.; Baker, Christopher L.; Bergeson, Susan E.; Ohno, Hiroshi; Metten, Pamela; Crabbe, John C.; Chesler, Elissa J.

2014-01-01

Extensive genetic and genomic studies of the relationship between alcohol drinking preference and withdrawal severity have been performed using animal models. Data from multiple such publications and public data resources have been incorporated in the GeneWeaver database with >60,000 gene sets including 285 alcohol withdrawal and preference-related gene sets. Among these are evidence for positional candidates regulating these behaviors in overlapping quantitative trait loci (QTL) mapped in distinct mouse populations. Combinatorial integration of functional genomics experimental results revealed a single QTL positional candidate gene in one of the loci common to both preference and withdrawal. Functional validation studies in Ap3m2 knockout mice confirmed these relationships. Genetic validation involves confirming the existence of segregating polymorphisms that could account for the phenotypic effect. By exploiting recent advances in mouse genotyping, sequence, epigenetics, and phylogeny resources, we confirmed that Ap3m2 resides in an appropriately segregating genomic region. We have demonstrated genetic and alcohol-induced regulation of Ap3m2 expression. Although sequence analysis revealed no polymorphisms in the Ap3m2-coding region that could account for all phenotypic differences, there are several upstream SNPs that could. We have identified one of these to be an H3K4me3 site that exhibits strain differences in methylation. Thus, by making cross-species functional genomics readily computable we identified a common QTL candidate for two related bio-behavioral processes via functional evidence and demonstrate sufficiency of the genetic locus as a source of variation underlying two traits. PMID:24923803

RAPD and SSR Polymorphisms in Mutant Lines of Transgenic Wheat Mediated by Low Energy Ion Beam

NASA Astrophysics Data System (ADS)

Wang, Tiegu; Huang, Qunce; Feng, Weisen

2007-10-01

Two types of markers-random amplified polymorphic DNA (RAPD) and simple sequence repeat DNA (SSR)-have been used to characterize the genetic diversity among nine mutant lines of transgenic wheat intermediated by low energy ion beam and their four receptor cultivars. The objectives of this study were to analyze RAPD-based and SSR-based genetic variance among transgenic wheat lines and with their receptors, and to find specific genetic markers of special traits of transgenic wheat lines. 170 RAPD primers were amplified to 733 fragments in all the experimental materials. There were 121 polymorphic fragments out of the 733 fragments with a ratio of polymorphic fragments of 16.5%. 29 SSR primer pairs were amplified to 83 fragments in all the experiment materials. There were 57 polymorphic fragments out of the 83 fragments with a ratio of polymorphic fragments of 68.7%. The dendrograms were prepared based on a genetic distance matrix using the UPGMA (Unweighted Pair-group Method with Arithmetic averaging) algorithm, which corresponded well to the results of the wheat pedigree analysis and separated the 13 genotypes into four groups. Association analysis between RAPD and SSR markers with the special traits of transgenic wheat mutant lines discovered that three RAPD markers, s1, opt-16, and f14, were significantly associated with the muticate trait, while three SSR markers, Rht8 (Xgwm261), Rht-B1b, and Rht-D1b, highly associated with the dwarf trait. These markers will be useful for marker-assistant breeding and can be used as candidate markers for further gene mapping and cloning.

5' UTR polymorphism of dopamine receptor D1 (DRD1) associated with severity and temperament of alcoholism.

PubMed

Kim, Dai-Jin; Park, Byung Lae; Yoon, Sujung; Lee, Hae-Kook; Joe, Keun-Ho; Cheon, Young-Hoon; Gwon, Do-Hoon; Cho, Sung-Nam; Lee, Hye Won; NamGung, Suk; Shin, Hyoung Doo

2007-06-15

Multiple dopamine receptors in the dopaminergic system may be prime candidates for genetic influence on alcohol abuse and dependence due to their involvement in reward and reinforcing mechanisms. Genetic polymorphisms in dopamine receptor genes are believed to influence the development and/or severity of alcoholism. To examine the genetic effects of the Dopamine Receptor D1 (DRD) gene family (DRD1-DRD5) in the Korean population, 11 polymorphisms in the DRD gene family were genotyped and analyzed in 535 alcohol-dependent subjects and 273 population controls. Although none of the polymorphisms of DRD1-5 genes were found to be associated with the risk of alcoholism, one 5' UTR polymorphism in the DRD1 (DRD1-48A>G) gene was significantly associated with severity of alcohol-related problem, as measured by the Alcohol Use Disorders Identification Test (AUDIT) in a gene dose-dependent manner, i.e., 24.37 (+/-8.19) among patients with -48A/A genotype, 22.37 (+/-9.49) among those with -48A/G genotype, and 17.38 (+/-8.28) among those with -48G/G genotype (P=0.002). The genetic effects of DRD1-48A>G were further analyzed with other phenotypes among alcohol-dependent subjects. Interestingly, the DRD1-48A>A genotype was also found to be associated with novelty seeking (NC), harm avoidance (HA), and persistence (P) (P =0.01, 0.02, and 0.003, respectively). The information derived from this study could be valuable for understanding the genetic factors involved in alcoholic phenotypes and genetic distribution of the DRD gene family, and could facilitate further investigation in other ethnic groups.

Association and linkage studies of candidate genes involved in GABAergic neurotransmission in lithium-responsive bipolar disorder.

PubMed Central

Duffy, A; Turecki, G; Grof, P; Cavazzoni, P; Grof, E; Joober, R; Ahrens, B; Berghöfer, A; Müller-Oerlinghausen, B; Dvoráková, M; Libigerová, E; Vojtĕchovský, M; Zvolský, P; Nilsson, A; Licht, R W; Rasmussen, N A; Schou, M; Vestergaard, P; Holzinger, A; Schumann, C; Thau, K; Robertson, C; Rouleau, G A; Alda, M

2000-01-01

OBJECTIVE: To test for genetic linkage and association with GABAergic candidate genes in lithium-responsive bipolar disorder. DESIGN: Polymorphisms located in genes that code for GABRA3, GABRA5 and GABRB3 subunits of the GABAA receptor were investigated using association and linkage strategies. PARTICIPANTS: A total of 138 patients with bipolar 1 disorder with a clear response to lithium prophylaxis, selected from specialized lithium clinics in Canada and Europe that are part of the International Group for the Study of Lithium-Treated Patients, and 108 psychiatrically healthy controls. Families of 24 probands were suitable for linkage analysis. OUTCOME MEASURES: The association between the candidate genes and patients with bipolar disorder versus that of controls and genetic linkage within families. RESULTS: There was no significant association or linkage found between lithium-responsive bipolar disorder and the GABAergic candidate genes investigated. CONCLUSIONS: This study does not support a major role for the GABAergic candidate genes tested in lithium-responsive bipolar disorder. PMID:11022400

Human genetic factors in tuberculosis: an update.

PubMed

van Tong, Hoang; Velavan, Thirumalaisamy P; Thye, Thorsten; Meyer, Christian G

2017-09-01

Tuberculosis (TB) is a major threat to human health, especially in many developing countries. Human genetic variability has been recognised to be of great relevance in host responses to Mycobacterium tuberculosis infection and in regulating both the establishment and the progression of the disease. An increasing number of candidate gene and genome-wide association studies (GWAS) have focused on human genetic factors contributing to susceptibility or resistance to TB. To update previous reviews on human genetic factors in TB we searched the MEDLINE database and PubMed for articles from 1 January 2014 through 31 March 2017 and reviewed the role of human genetic variability in TB. Search terms applied in various combinations were 'tuberculosis', 'human genetics', 'candidate gene studies', 'genome-wide association studies' and 'Mycobacterium tuberculosis'. Articles in English retrieved and relevant references cited in these articles were reviewed. Abstracts and reports from meetings were also included. This review provides a recent summary of associations of polymorphisms of human genes with susceptibility/resistance to TB. © 2017 John Wiley & Sons Ltd.

Genetic and environmental factors in human osteoporosis.

PubMed

Özbaş, Halil; Tutgun Onrat, Serap; Özdamar, Kazım

2012-12-01

Osteoporosis is a common disorder, with prolongation of the average life span it has become a major public health problem. On the formation of osteoporosis genetic factors and environmental influences could play a role then it is considered as multi-factorial. Because a variety of functions to affect susceptibility to the formation of osteoporosis VDR-F, VDR-B, COL1A1, ESR1X, ESR1P and CTR are thought to be candidate genes. In this study, the aim is to investigate the relationship between these genes polymorphism and bone mineral density (BMD) values of lumbar vertebra and femoral neck in 188 Turkish people. Lumbar spine and femoral neck BMD of the individuals included in the study were measured by the dual X-ray absorptiometry method. The genotyped polymorphisms by simultaneous amplification of five regions of the genome, containing six SNPs of interest and detecting the amplified product, using the kit MetaBone Clinical Arrays(®). Statistical analyses indicated that; VDR-B gene polymorphisms major (P = 0.013), VDR-F polymorphisms have minor (P = 0.082) effect on femur BMD. None of the other genes has any significant effect on spinal BMD. Patient age, body mass index and diet has significant effect on femoral and spinal BMD. Osteoporosis is a multi-factorial disease and many genetic and non-genetic risk factors contribute to the development of osteoporosis. Early detection of a genetic predisposition to osteoporosis should allow delay and/or limit unfavorable changes in the bone tissue.

Associations between serotonin-related gene polymorphisms and panic disorder.

PubMed

Maron, Eduard; Lang, Aavo; Tasa, Gunnar; Liivlaid, Liivi; Tõru, Innar; Must, Anne; Vasar, Veiko; Shlik, Jakov

2005-06-01

Studies suggest that vulnerability to panic attacks and panic disorder (PD) may be related to a deficient serotonin (5-HT) neurotransmission. In the present case-control study we investigated possible associations between PD phenotype and five candidate polymorphisms including 5-HT transporter (5-HTTLPR and VNTR), monoamine oxidase A (MAOA promoter region), tryptophan hydroxylase 1 (TPH1 218A/C) and 5-HT1B receptor (5-HT1BR 861G/C) genes. The study sample consisted of 158 patients with PD and 215 healthy control subjects. The analysis showed higher frequencies of LL genotype (p = 0.016) and L allele variant (p = 0.007) of 5-HTTLPR in the patients. No significant associations were observed between PD and other candidate gene polymorphisms. However, a higher frequency of longer allele genotypes of the MAOA promoter region was observed in female PD patients with agoraphobia than in female controls (p = 0.016). These findings indicate that genetic variants conceivably related to lower 5-HT neurotransmission may be involved in the development of PD.

Naturally acquired antibody responses to recombinant Pfs230 and Pfs48/45 transmission blocking vaccine candidates.

PubMed

Jones, Sophie; Grignard, Lynn; Nebie, Issa; Chilongola, Jaffu; Dodoo, Daniel; Sauerwein, Robert; Theisen, Michael; Roeffen, Will; Singh, Shrawan Kumar; Singh, Rajesh Kumar; Singh, Sanjay; Kyei-Baafour, Eric; Tetteh, Kevin; Drakeley, Chris; Bousema, Teun

2015-07-01

Pfs48/45 and Pfs230 are Plasmodium falciparum sexual stage proteins and promising malaria transmission-blocking vaccine candidates. Antibody responses against these proteins may be naturally acquired and target antigens may be under selective pressure. This has consequences for the future evaluation of vaccine immunogenicity and efficacy in populations naturally exposed to malaria. We determined naturally acquired antibody responses to the recombinant proteins Pfs48/45-10C and Pfs230-230CMB in children from three malaria endemic settings in Ghana, Tanzania and Burkina Faso. We also examined genetic polymorphisms in the P. falciparum gene pfs48/45. Antibody prevalence was 1.1-18.2% for 10C and 6.7-18.9% for 230CMB. In Burkina Faso we observed evidence of an age-dependent acquisition pattern for both 10C (p < 0.001) and 230CMB (p = 0.031). Membrane feeding assays on a separate dataset demonstrated an association between functional transmission reducing activity and antibody prevalence for both 10C (p = 0.017) and 230CMB (p = 0.049). 17 single nucleotide polymorphisms were found in pfs48/45 (from 126 samples), with 5 non-synonymous SNPs in the Pfs48/45 10C region. We conclude there are naturally acquired antibody responses to both vaccine candidates which have functional relevance by reducing the transmissibility of infected individuals. We identified genetic polymorphisms, in pfs48/45 which exhibited geographical specificity. Copyright © 2015 The British Infection Association. Published by Elsevier Ltd. All rights reserved.

Novel approach of molecular genetic understanding of iridology: relationship between iris constitution and angiotensin converting enzyme gene polymorphism.

PubMed

Um, Jae-Young; An, Nyeon-Hyoung; Yang, Gui-Bi; Lee, Geon-Mok; Cho, Ju-Jang; Cho, Jae-Woon; Hwang, Woo-Jun; Chae, Han-Jung; Kim, Hyung-Ryong; Hong, Seung-Heon; Kim, Hyung-Min

2005-01-01

Iridology is the study of the iris of the eye to detect the conditions of the body and its organs, genetic strengths and weaknesses, etc. Although iridology is not widely used as a scientific tool for healthcare professionals to get to the source of people's health conditions, it has been used as a supplementary source to help the diagnosis of medical conditions by noting irregularities of the pigmentation in the iris among some Korean Oriental medical doctors. Angiotensin converting enzyme (ACE) gene polymorphism is one of the most well studied genetic markers of vascular disease. We investigated the relationship between iridological constitution and ACE polymorphism in hypertensives. We classified 87 hypertensives and 79 controls according to iris constitution and determined the ACE genotype of each individual. DD genotype was more prevalent in patients with a neurogenic constitution than in controls. This finding supports the hypothesis that D allele is a candidate gene for hypertension and demonstrates the association among ACE genotype, Korean hypertensives and iris constitution.

Polymorphisms in candidate genes for type 2 diabetes mellitus in a Mexican population with metabolic syndrome findings.

PubMed

Sánchez-Corona, J; Flores-Martínez, S E; Machorro-Lazo, M V; Galaviz-Hernández, C; Morán-Moguel, M C; Perea, F J; Mújica-López, K I; Vargas-Ancona, L; Laviada-Molina, H A; Fernández, V; Pardío, J; Arroyo, P; Barrera, H; Hanson, R L

2004-01-01

The metabolic or insulin resistance syndrome, characterized by hypertension, dyslipidemia, glucose intolerance and hyperinsulinemia, may have genetic determinants. The insulin gene (INS), insulin receptor gene (INSR) and insulin receptor substrate 1 gene (IRS1) have been proposed as candidate genes. We examined eight polymorphisms in these genes in 163 individuals from Yucatan, Mexico; this population has a high prevalence of obesity, type 2 diabetes mellitus and dyslipidemia. Subjects were evaluated for body mass index (BMI) and blood pressure. Blood samples were collected to determine glucose, insulin, triglycerides and cholesterol levels, as well as for DNA isolation. Restriction fragment length polymorphisms in INS, INSR and IRS1 were identified by polymerase chain reaction and digestion with selected restriction enzymes. Among the eight polymorphisms analyzed, the PstI polymorphism in INS was significantly associated with hypertriglyceridemia and with the presence of at least one abnormality related to the metabolic syndrome (P=0.007 and 0.004, respectively). The MaeIII polymorphism in INS was associated with fasting hyperinsulinemia (P=0.045). In multilocus analyses including both INS polymorphisms, significant associations were seen with hypertriglyceridemia (P=0.006), hypercholesterolemia (P=0.031) and with presence of at least one metabolic abnormality (P=0.009). None of the polymorphisms in INSR or IRS1 was associated with any of these traits. These findings suggest that the insulin gene may be an important determinant of metabolic syndrome, and particularly of dyslipidemia, in this population.

Selection signatures in four lignin genes from switchgrass populations divergently selected for in vitro dry matter digestibility

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Shiyu; Kaeppler, Shawn M.; Vogel, Kenneth P.

Switchgrass is undergoing development as a dedicated cellulosic bioenergy crop. Fermentation of lignocellulosic biomass to ethanol in a bioenergy system or to volatile fatty acids in a livestock production system is strongly and negatively influenced by lignification of cell walls. This study detects specific loci that exhibit selection signatures across switchgrass breeding populations that differ in in vitro dry matter digestibility (IVDMD), ethanol yield, and lignin concentration. Allele frequency changes in candidate genes were used to detect loci under selection. Out of the 183 polymorphisms identified in the four candidate genes, twenty-five loci in the intron regions and four locimore » in coding regions were found to display a selection signature. All loci in the coding regions are synonymous substitutions. Selection in both directions were observed on polymorphisms that appeared to be under selection. Genetic diversity and linkage disequilibrium within the candidate genes were low. The recurrent divergent selection caused excessive moderate allele frequencies in the cycle 3 reduced lignin population as compared to the base population. As a result, this study provides valuable insight on genetic changes occurring in short-term selection in the polyploid populations, and discovered potential markers for breeding switchgrass with improved biomass quality.« less

Selection signatures in four lignin genes from switchgrass populations divergently selected for in vitro dry matter digestibility

DOE PAGES

Chen, Shiyu; Kaeppler, Shawn M.; Vogel, Kenneth P.; ...

2016-11-28

Switchgrass is undergoing development as a dedicated cellulosic bioenergy crop. Fermentation of lignocellulosic biomass to ethanol in a bioenergy system or to volatile fatty acids in a livestock production system is strongly and negatively influenced by lignification of cell walls. This study detects specific loci that exhibit selection signatures across switchgrass breeding populations that differ in in vitro dry matter digestibility (IVDMD), ethanol yield, and lignin concentration. Allele frequency changes in candidate genes were used to detect loci under selection. Out of the 183 polymorphisms identified in the four candidate genes, twenty-five loci in the intron regions and four locimore » in coding regions were found to display a selection signature. All loci in the coding regions are synonymous substitutions. Selection in both directions were observed on polymorphisms that appeared to be under selection. Genetic diversity and linkage disequilibrium within the candidate genes were low. The recurrent divergent selection caused excessive moderate allele frequencies in the cycle 3 reduced lignin population as compared to the base population. As a result, this study provides valuable insight on genetic changes occurring in short-term selection in the polyploid populations, and discovered potential markers for breeding switchgrass with improved biomass quality.« less

Polymorphisms in VDR gene in Tunisian postmenopausal women are associated with osteopenia phenotype.

PubMed

Sassi, R; Sahli, H; Souissi, C; Sellami, S; Ben Ammar El Gaaied, A

2015-01-01

Osteopenia is characterized by intermediate values of bone mineral density (BMD) as compared to normal and osteoporotic subjects. BMD, a surrogate phenotype for osteoporosis, is influenced in part by genetic factors. Among the genes associated with BMD, the vitamin D receptor (VDR) was the first gene studied as a potential candidate associated with BMD in adult and postmenopausal bone loss. However, results are controversial. To determine whether VDR polymorphisms ApaI and TaqI are associated with BMD, osteopenia, osteoporosis and low-impact fracture risk in North Africans, these genotypes were analyzed in 566 postmenopausal Tunisian women. In postmenopausal Tunisian women, the GT ApaI genotype seems to be protective against osteoporosis development (p = 0.02; odds ratio = 0.54). Moreover, the presence of the combined GT/TT genotype of ApaI and TaqI polymorphisms is more frequent in normal BMD women than in osteoporotic women (p = 0.00; odds ratio = 0.41). Interestingly, the GG ApaI genotype is associated with osteopenia development (p = 0.02; odds ratio = 1.86) and also the TT TaqI polymorphism (p = 0.02; odds ratio = 1.53). The GG ApaI genotype is associated with a three times risk of vertebral fracture. The ApaI polymorphism showed an association with osteopenia and low-impact vertebral fracture incidence but not with osteoporosis. The TaqI polymorphism is associated specifically with the osteopenia phenotype. The presence of the two polymorphisms increases the risk to develop osteopenia in postmenopausal Tunisian women. Osteopenia seems to be genetically determined. However, osteoporosis is the result of interaction between genetic and environmental factors.

Clinical application of antidepressant pharmacogenetics: considerations for the design of future studies.

PubMed

Fabbri, Chiara; Serretti, Alessandro

2018-06-12

A frustrating inertia has affected the development of clinical applications of antidepressant pharmacogenetics and personalized treatments of depression are still lacking 20 years after the first findings. Candidate gene studies provided replicated findings for some polymorphisms, but each of them shows at best a small effect on antidepressant efficacy and the cumulative effect of different polymorphisms is unclear. Further, no candidate was immune by at least some negative studies. These considerations give rise to some concerns about the clinical benefits of currently available pharmacogenetic tests since they are based on the results of candidate gene studies. Clinical guidelines in fact suggest that only polymorphisms that alter cytochrome 2D6 or 2C19 enzymatic activity probably provide useful clinical indications, while variants in genes involved in antidepressant pharmacodynamics have no recommended clinical applications. The present review discusses possible strategies to facilitate the identification of genetic biomarkers with clinical usefulness in guiding antidepressant treatments. These include analysis methods for the study of the polygenic/omnigenic nature of antidepressant response, the prioritization of polymorphisms on the basis of functional considerations, the incorporation of clinical-demographic predictors in pharmacogenetic studies (e.g. mixed polygenic and clinical risk scores), the application of methodological improvements to the design of future studies in order to maximize the comparability of results and improve power. Copyright © 2018. Published by Elsevier B.V.

Genetic modification of the association between peripubertal dioxin exposure and pubertal onset in a cohort of Russian boys.

PubMed

Humblet, Olivier; Korrick, Susan A; Williams, Paige L; Sergeyev, Oleg; Emond, Claude; Birnbaum, Linda S; Burns, Jane S; Altshul, Larisa M; Patterson, Donald G; Turner, Wayman E; Lee, Mary M; Revich, Boris; Hauser, Russ

2013-01-01

Exposure to dioxins has been associated with delayed pubertal onset in both epidemiologic and animal studies. Whether genetic polymorphisms may modify this association is currently unknown. Identifying such genes could provide insight into mechanistic pathways. This is one of the first studies to assess genetic susceptibility to dioxins. We evaluated whether common polymorphisms in genes affecting either molecular responses to dioxin exposure or pubertal onset influence the association between peripubertal serum dioxin concentration and male pubertal onset. In this prospective cohort of Russian adolescent boys (n = 392), we assessed gene-environment interactions for 337 tagging single-nucleotide polymorphisms (SNPs) from 46 candidate genes and two intergenic regions. Dioxins were measured in the boys' serum at age 8-9 years. Pubertal onset was based on testicular volume and on genitalia staging. Statistical approaches for controlling for multiple testing were used, both with and without prescreening for marginal genetic associations. After accounting for multiple testing, two tag SNPs in the glucocorticoid receptor (GR/NR3C1) gene and one in the estrogen receptor-α (ESR1) gene were significant (q < 0.2) modifiers of the association between peripubertal serum dioxin concentration and male pubertal onset defined by genitalia staging, although not by testicular volume. The results were sensitive to whether multiple comparison adjustment was applied to all gene-environment tests or only to those with marginal genetic associations. Common genetic polymorphisms in the glucocorticoid receptor and estrogen receptor-α genes may modify the association between peripubertal serum dioxin concentration and pubertal onset. Further studies are warranted to confirm these findings.

Using Single-nucleotide Polymorphisms and Genetic Mapping to find Candidate Genes that Influence Varroa-Specific Hygiene

USDA-ARS?s Scientific Manuscript database

Varroa-sensitive hygienic (VSH) behavior is one of two behaviors identified that are most important for controlling the growth of Varroa mite populations in bee hives. A study was conducted to map quantitative trait loci (QTL) that influence VSH so that resistance genes could be identified. Crosses ...

Sequence-Based Prioritization of Nonsynonymous Single-Nucleotide Polymorphisms for the Study of Disease Mutations

PubMed Central

Jiang, Rui ; Yang, Hua ; Zhou, Linqi ; Kuo, C.-C. Jay ; Sun, Fengzhu ; Chen, Ting 

2007-01-01

The increasing demand for the identification of genetic variation responsible for common diseases has translated into a need for sophisticated methods for effectively prioritizing mutations occurring in disease-associated genetic regions. In this article, we prioritize candidate nonsynonymous single-nucleotide polymorphisms (nsSNPs) through a bioinformatics approach that takes advantages of a set of improved numeric features derived from protein-sequence information and a new statistical learning model called “multiple selection rule voting” (MSRV). The sequence-based features can maximize the scope of applications of our approach, and the MSRV model can capture subtle characteristics of individual mutations. Systematic validation of the approach demonstrates that this approach is capable of prioritizing causal mutations for both simple monogenic diseases and complex polygenic diseases. Further studies of familial Alzheimer diseases and diabetes show that the approach can enrich mutations underlying these polygenic diseases among the top of candidate mutations. Application of this approach to unclassified mutations suggests that there are 10 suspicious mutations likely to cause diseases, and there is strong support for this in the literature. PMID:17668383

USP38, FREM3, SDC1, DDC, and LOC727982 Gene Polymorphisms and Differential Susceptibility to Severe Malaria in Tanzania.

PubMed

Manjurano, Alphaxard; Sepúlveda, Nuno; Nadjm, Behzad; Mtove, George; Wangai, Hannah; Maxwell, Caroline; Olomi, Raimos; Reyburn, Hugh; Drakeley, Christopher J; Riley, Eleanor M; Clark, Taane G

2015-10-01

Populations exposed to Plasmodium falciparum infection develop genetic mechanisms of protection against severe malarial disease. Despite decades of genetic epidemiological research, the sickle cell trait (HbAS) sickle cell polymorphism, ABO blood group, and other hemoglobinopathies remain the few major determinants in severe malaria to be replicated across different African populations and study designs. Within a case-control study in a region of high transmission in Tanzania (n = 983), we investigated the role of 40 new loci identified in recent genome-wide studies. In 32 loci passing quality control procedures, we found polymorphisms in USP38, FREM3, SDC1, DDC, and LOC727982 genes to be putatively associated with differential susceptibility to severe malaria. Established candidates explained 7.4% of variation in severe malaria risk (HbAS polymorphism, 6.3%; α-thalassemia, 0.3%; ABO group, 0.3%; and glucose-6-phosphate dehydrogenase deficiency, 0.5%) and the new polymorphisms, another 4.3%. The regions encompassing the loci identified are promising targets for the design of future treatment and control interventions. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America.

Candidate gene study of genetic thrombophilic polymorphisms in pre-eclampsia and recurrent pregnancy loss in Sinhalese women.

PubMed

Dissanayake, Vajira H W; Sirisena, Nirmala D; Weerasekera, Lakshini Y; Gammulla, Chumithri G; Seneviratne, Harshalal R; Jayasekara, Rohan W

2012-09-01

Genetic thrombophilias are known to contribute to adverse pregnancy outcomes. Studies in Western populations show that 5, 10-methylenetetrahydrofolate reductase (MTHFR) 677C>T and Factor V (F5) 1691G>A (Leiden) polymorphisms are commonly associated with pre-eclampsia and recurrent spontaneous pregnancy loss. The objective of this study was to investigate the association of MTHFR 677C>T (rs1801133); 1298A>C (rs1801131) and F5 1691G>A (rs6025); 4070A>G (rs1800595) polymorphisms with pre-eclampsia and recurrent pregnancy loss among Sinhalese women in Sri Lanka. Genotype and allele frequencies at each polymorphic site in the MTHFR and F5 genes and the haplotypes defined by them were determined in 175 Sinhalese women with pre-eclampsia, 171 normotensive controls, 200 Sinhalese women with two or more recurrent pregnancy losses and 200 controls with two or more living children and no pregnancy losses. Genotyping was done by polymerase chain reaction/restriction fragment length polymorphism. Odds ratios and χ(2) -testing were performed to compare genotype/haplotype frequencies at each polymorphic site for both cases and controls. The genotype frequencies at each polymorphic site in the MTHFR 677C>T; 1298A>C; F5 1691G>A and 4070A>G genes and the haplotypes defined by them were not significantly associated with either pre-eclampsia or recurrent pregnancy loss. There was no significant association of genetic thrombophilia with either early or late pregnancy losses. The MTHFR and F5 polymorphisms and the haplotypes defined by them were not significantly associated with either pre-eclampsia or recurrent pregnancy loss in this group of Sinhalese women. © 2012 The Authors. Journal of Obstetrics and Gynaecology Research © 2012 Japan Society of Obstetrics and Gynecology.

Association between polymorphisms in prostanoid receptor genes and aspirin-intolerant asthma.

PubMed

Kim, Sang-Heon; Kim, Yoon-Keun; Park, Heung-Woo; Jee, Young-Koo; Kim, Sang-Hoon; Bahn, Joon-Woo; Chang, Yoon-Seok; Kim, Seung-Hyun; Ye, Young-Min; Shin, Eun-Soon; Lee, Jong-Eun; Park, Hae-Sim; Min, Kyung-Up

2007-04-01

Genetic predisposition is linked to the pathogenesis of aspirin-intolerant asthma. Most candidate gene approaches have focused on leukotriene-related pathways, whereas there have been relatively few studies evaluating the effects of polymorphisms in prostanoid receptor genes on the development of aspirin-intolerant asthma. Therefore, we investigated the potential association between prostanoid receptor gene polymorphisms and the aspirin-intolerant asthma phenotype. We screened for genetic variations in the prostanoid receptor genes PTGER1, PTGER2, PTGER3, PTGER4, PTGDR, PTGIR, PTGFR, and TBXA2R using direct sequencing, and selected 32 tagging single nucleotide polymorphisms among the 77 polymorphisms with frequencies >0.02 based on linkage disequilibrium for genotyping. We compared the genotype distributions and allele frequencies of three participant groups (108 patients with aspirin-intolerant asthma, 93 patients with aspirin-tolerant asthma, and 140 normal controls). Through association analyses studies of the 32 single nucleotide polymorphisms, the following single nucleotide polymorphisms were found to have significant associations with the aspirin-intolerant asthma phenotype: -616C>G (P=0.038) and -166G>A (P=0.023) in PTGER2; -1709T>A (P=0.043) in PTGER3; -1254A>G (P=0.018) in PTGER4; 1915T>C (P=0.015) in PTGIR; and -4684C>T (P=0.027), and 795T>C (P=0.032) in TBXA2R. In the haplotype analysis of each gene, the frequency of PTGIR ht3[G-G-C-C], which includes 1915T>C, differed significantly between the aspirin-intolerant asthma patients and aspirin-tolerant asthma patients (P=0.015). These findings suggest that genetic polymorphisms in PTGER2, PTGER3, PTGER4, PTGIR, and TBXA2R play important roles in the pathogenesis of aspirin-intolerant asthma.

Genetic factors contribute to bleeding after cardiac surgery.

PubMed

Welsby, I J; Podgoreanu, M V; Phillips-Bute, B; Mathew, J P; Smith, P K; Newman, M F; Schwinn, D A; Stafford-Smith, M

2005-06-01

Postoperative bleeding remains a common, serious problem for cardiac surgery patients, with striking inter-patient variability poorly explained by clinical, procedural, and biological markers. We tested the hypothesis that genetic polymorphisms of coagulation proteins and platelet glycoproteins are associated with bleeding after cardiac surgery. Seven hundred and eighty patients undergoing aortocoronary surgery with cardiopulmonary bypass were studied. Clinical covariates previously associated with bleeding were recorded and DNA isolated from preoperative blood. Matrix Assisted Laser Desorption/Ionization, Time-Of-Flight (MALDI-TOF) mass spectroscopy or polymerase chain reaction were used for genotype analysis. Multivariable linear regression modeling, including all genetic main effects and two-way gene-gene interactions, related clinical and genetic predictors to bleeding from the thorax and mediastinum. Nineteen candidate polymorphisms were assessed; seven [GPIaIIa-52C>T and 807C>T, GPIb alpha 524C>T, tissue factor-603A>G, prothrombin 20210G>A, tissue factor pathway inhibitor-399C>T, and angiotensin converting enzyme (ACE) deletion/insertion] demonstrate significant association with bleeding (P < 0.01). Adding genetic to clinical predictors results improves the model, doubling overall ability to predict bleeding (P < 0.01). We identified seven genetic polymorphisms associated with bleeding after cardiac surgery. Genetic factors appear primarily independent of, and explain at least as much variation in bleeding as clinical covariates; combining genetic and clinical factors double our ability to predict bleeding after cardiac surgery. Accounting for genotype may be necessary when stratifying risk of bleeding after cardiac surgery.

Polymorphisms in HLA-DPB1 Are Associated With Differences in Rubella Virus–Specific Humoral Immunity After Vaccination

PubMed Central

Lambert, Nathaniel D.; Haralambieva, Iana H.; Kennedy, Richard B.; Ovsyannikova, Inna G.; Pankratz, Vernon Shane; Poland, Gregory A.

2015-01-01

Vaccination with live attenuated rubella virus induces a strong immune response in most individuals. However, small numbers of subjects never reach or maintain protective antibody levels, and there is a high degree of variability in immune response. We have previously described genetic polymorphisms in HLA and other candidate genes that are associated with interindividual differences in humoral immunity to rubella virus. To expand our previous work, we performed a genome-wide association study (GWAS) to discover single-nucleotide polymorphisms (SNPs) associated with rubella virus–specific neutralizing antibodies. We identified rs2064479 in the HLA-DPB1 genetic region as being significantly associated with humoral immune response variations after rubella vaccination (P = 8.62 × 10−8). All other significant SNPs in this GWAS were located near the HLA-DPB1 gene (P ≤ 1 × 10−7). These findings demonstrate that polymorphisms in HLA-DPB1 are strongly associated with interindividual differences in neutralizing antibody levels to rubella vaccination and represent a validation of our previous HLA work. PMID:25293367

Prevalence, Patterns, and Genetic Association Analysis of Modic Vertebral Endplate Changes

PubMed Central

Kanna, Rishi Mugesh; Rajagopalan, Veera Ranjani; Natesan, Senthil; Muthuraja, Raveendran; Cheung, Kenneth Man Chee; Chan, Danny; Kao, Patrick Yu Ping; Yee, Anita; Shetty, Ajoy Prasad

2017-01-01

Study Design A prospective genetic association study. Purpose The etiology of Modic changes (MCs) is unclear. Recently, the role of genetic factors in the etiology of MCs has been evaluated. However, studies with a larger patient subset are lacking, and candidate genes involved in other disc degeneration phenotypes have not been evaluated. We studied the prevalence of MCs and genetic association of 41 candidate genes in a large Indian cohort. Overview of Literature MCs are vertebral endplate signal changes predominantly observed in the lumbar spine. A significant association between MCs and lumbar disc degeneration and nonspecific low back pain has been described, with the etiopathogenesis implicating various mechanical, infective, and biochemical factors. Methods We studied 809 patients using 1.5-T magnetic resonance imaging to determine the prevalence, patterns, distribution, and type of lumbar MCs. Genetic association analysis of 71 single nucleotide polymorphisms (SNPs) of 41 candidate genes was performed based on the presence or absence of MCs. SNPs were genotyped using the Sequenome platform, and an association test was performed using PLINK software. Results The mean age of the study population (n=809) was 36.7±10.8 years. Based on the presence of MCs, the cohort was divided into 702 controls and 107 cases (prevalence, 13%). MCs were more commonly present in the lower (149/251, 59.4%) than in the upper (102/251, 40.6%) endplates. L4–5 endplates were the most commonly affected levels (30.7%). Type 2 MCs were the most commonly observed pattern (n=206, 82%). The rs2228570 SNP of VDR (p=0.02) and rs17099008 SNP of MMP20 (p=0.03) were significantly associated with MCs. Conclusions Genetic polymorphisms of SNPs of VDR and MMP20 were significantly associated with MCs. Understanding the etiopathogenetic mechanisms of MCs is important for planning preventive and therapeutic strategies. PMID:28874978

Identification of trends in scientific publications related to genetic polymorphisms in gestational diabetes mellitus.

PubMed

Gomes, J S; Minasi, L B; da Cruz, A D; Rodrigues, F M

2016-05-09

Gestational diabetes is a genetic multifactorial systemic disease that has been extensively studied. Consequently, there is a large volume of scientific literature pertaining to genes associated with gestational diabetes. The aim of this study was to characterize the main trends in scientific publications focusing on the associations between genetic polymorphisms and gestational diabetes mellitus (GDM). The related articles were extracted from Scopus using the key words "genetic polymorphism" and "gestational diabetes mellitus"; the collected data focused on various fields (medical, biochemical, etc.) and included papers published within December 2013. One hundred and eighty-three relevant articles published between 1987 and 2013 were identified; we observed a significantly increasing trend in the number of publications pertaining to GDM. A majority of the articles focused on the medical (59.9%), biochemical, and genetics and molecular biological (29.6%) aspects of the disease. The genes coding for transcription factor 7-like 2 and glucokinase (TCF7L2, 29% and GCK, 28%) were predominantly studied and reported. This study helped quantify the growth in research pertaining to GDM; researchers from the USA have published a majority of the publications related to GDM. Several candidate genes have been linked to diabetes; however, the specific gene locus responsible for GDM has not yet been identified. The results of this study could help determine the orientation of future research on genetic factors associated with GDM.

CYBRD1 as a modifier gene that modulates iron phenotype in HFE p.C282Y homozygous patients.

PubMed

Pelucchi, Sara; Mariani, Raffaella; Calza, Stefano; Fracanzani, Anna Ludovica; Modignani, Giulia Litta; Bertola, Francesca; Busti, Fabiana; Trombini, Paola; Fraquelli, Mirella; Forni, Gian Luca; Girelli, Domenico; Fargion, Silvia; Specchia, Claudia; Piperno, Alberto

2012-12-01

Most patients with hereditary hemochromatosis in the Caucasian population are homozygous for the p.C282Y mutation in the HFE gene. The penetrance and expression of hereditary hemochromatosis differ largely among cases of homozygous p.C282Y. Genetic factors might be involved in addition to environmental factors. In the present study, we analyzed 50 candidate genes involved in iron metabolism and evaluated the association between 214 single nucleotide polymorphisms in these genes and three phenotypic outcomes of iron overload (serum ferritin, iron removed and transferrin saturation) in a large group of 296 p.C282Y homozygous Italians. Polymorphisms were tested for genetic association with each single outcome using linear regression models adjusted for age, sex and alcohol consumption. We found a series of 17 genetic variants located in different genes with possible additive effects on the studied outcomes. In order to evaluate whether the selected polymorphisms could provide a predictive signature for adverse phenotype, we re-evaluated data by dividing patients in two extreme phenotype classes based on the three phenotypic outcomes. We found that only a small improvement in prediction could be achieved by adding genetic information to clinical data. Among the selected polymorphisms, a significant association was observed between rs3806562, located in the 5'UTR of CYBRD1, and transferrin saturation. This variant belongs to the same haplotype block that contains the CYBRD1 polymorphism rs884409, found to be associated with serum ferritin in another population of p.C282Y homozygotes, and able to modulate promoter activity. A luciferase assay indicated that rs3806562 does not have a significant functional role, suggesting that it is a genetic marker linked to the putative genetic modifier rs884409. While our results support the hypothesis that polymorphisms in genes regulating iron metabolism may modulate penetrance of HFE-hereditary hemochromatosis, with emphasis on CYBRD1, they strengthen the notion that none of these polymorphisms alone is a major modifier of the phenotype of hereditary hemochromatosis.

CYBRD1 as a modifier gene that modulates iron phenotype in HFE p.C282Y homozygous patients

PubMed Central

Pelucchi, Sara; Mariani, Raffaella; Calza, Stefano; Fracanzani, Anna Ludovica; Modignani, Giulia Litta; Bertola, Francesca; Busti, Fabiana; Trombini, Paola; Fraquelli, Mirella; Forni, Gian Luca; Girelli, Domenico; Fargion, Silvia; Specchia, Claudia; Piperno, Alberto

2012-01-01

Background Most patients with hereditary hemochromatosis in the Caucasian population are homozygous for the p.C282Y mutation in the HFE gene. The penetrance and expression of hereditary hemochromatosis differ largely among cases of homozygous p.C282Y. Genetic factors might be involved in addition to environmental factors. Design and Methods: In the present study, we analyzed 50 candidate genes involved in iron metabolism and evaluated the association between 214 single nucleotide polymorphisms in these genes and three phenotypic outcomes of iron overload (serum ferritin, iron removed and transferrin saturation) in a large group of 296 p.C282Y homozygous Italians. Polymorphisms were tested for genetic association with each single outcome using linear regression models adjusted for age, sex and alcohol consumption. Results We found a series of 17 genetic variants located in different genes with possible additive effects on the studied outcomes. In order to evaluate whether the selected polymorphisms could provide a predictive signature for adverse phenotype, we re-evaluated data by dividing patients in two extreme phenotype classes based on the three phenotypic outcomes. We found that only a small improvement in prediction could be achieved by adding genetic information to clinical data. Among the selected polymorphisms, a significant association was observed between rs3806562, located in the 5'UTR of CYBRD1, and transferrin saturation. This variant belongs to the same haplotype block that contains the CYBRD1 polymorphism rs884409, found to be associated with serum ferritin in another population of p.C282Y homozygotes, and able to modulate promoter activity. A luciferase assay indicated that rs3806562 does not have a significant functional role, suggesting that it is a genetic marker linked to the putative genetic modifier rs884409. Conclusions While our results support the hypothesis that polymorphisms in genes regulating iron metabolism may modulate penetrance of HFE-hereditary hemochromatosis, with emphasis on CYBRD1, they strengthen the notion that none of these polymorphisms alone is a major modifier of the phenotype of hereditary hemochromatosis. PMID:22773607

Polymorphisms in the oxytocin receptor gene are associated with the development of psychopathy.

PubMed

Dadds, Mark R; Moul, Caroline; Cauchi, Avril; Dobson-Stone, Carol; Hawes, David J; Brennan, John; Urwin, Ruth; Ebstein, Richard E

2014-02-01

The co-occurrence of child conduct problems (CPs) and callous-unemotional (CU) traits confers risk for psychopathy. The oxytocin (OXT) system is a likely candidate for involvement in the development of psychopathy. We tested variations in the OXT receptor gene (OXTR) in CP children and adolescents with varying levels of CU traits. Two samples of Caucasian children, aged 4-16 years, who met DSM criteria for disruptive behavior problems and had no features of autism spectrum disorder, were stratified into low versus high CU traits. Measures were the frequencies of nine candidate OXTR polymorphisms (single nucleotide polymorphisms). In Sample 1, high CU traits were associated with single nucleotide polymorphism rs1042778 in the 3' untranslated region of OXTR and the CGCT haplotype of rs2268490, rs2254298, rs237889, and rs13316193. The association of rs1042778 was replicated in the second rural sample and held across gender and child versus adolescent age groups. We conclude that polymorphic variation of the OXTR characterizes children with high levels of CU traits and CPs. The results are consistent with a hypothesized role of OXT in the developmental antecedents of psychopathy, particularly the differential amygdala activation model of psychopathic traits, and add genetic evidence that high CU traits specify a distinct subgroup within CP children.

A 34K SNP genotyping array for Populus trichocarpa: design, application to the study of natural populations and transferability to other Populus species.

PubMed

Geraldes, A; Difazio, S P; Slavov, G T; Ranjan, P; Muchero, W; Hannemann, J; Gunter, L E; Wymore, A M; Grassa, C J; Farzaneh, N; Porth, I; McKown, A D; Skyba, O; Li, E; Fujita, M; Klápště, J; Martin, J; Schackwitz, W; Pennacchio, C; Rokhsar, D; Friedmann, M C; Wasteneys, G O; Guy, R D; El-Kassaby, Y A; Mansfield, S D; Cronk, Q C B; Ehlting, J; Douglas, C J; Tuskan, G A

2013-03-01

Genetic mapping of quantitative traits requires genotypic data for large numbers of markers in many individuals. For such studies, the use of large single nucleotide polymorphism (SNP) genotyping arrays still offers the most cost-effective solution. Herein we report on the design and performance of a SNP genotyping array for Populus trichocarpa (black cottonwood). This genotyping array was designed with SNPs pre-ascertained in 34 wild accessions covering most of the species latitudinal range. We adopted a candidate gene approach to the array design that resulted in the selection of 34 131 SNPs, the majority of which are located in, or within 2 kb of, 3543 candidate genes. A subset of the SNPs on the array (539) was selected based on patterns of variation among the SNP discovery accessions. We show that more than 95% of the loci produce high quality genotypes and that the genotyping error rate for these is likely below 2%. We demonstrate that even among small numbers of samples (n = 10) from local populations over 84% of loci are polymorphic. We also tested the applicability of the array to other species in the genus and found that the number of polymorphic loci decreases rapidly with genetic distance, with the largest numbers detected in other species in section Tacamahaca. Finally, we provide evidence for the utility of the array to address evolutionary questions such as intraspecific studies of genetic differentiation, species assignment and the detection of natural hybrids. © 2013 Blackwell Publishing Ltd.

Sensitivity to House Dust Mites Allergens with Atopic Asthma and Its Relationship with CD14 C(-159T) Polymorphism in Patients of West Bengal, India.

PubMed

Ghosh, Amlan; Dutta, Shampa; Podder, Sanjoy; Mondal, Priti; Laha, Arghya; Saha, Nimai Chandra; Moitra, Saibal; Saha, Goutam Kumar

2018-01-10

India is the home to around 15-20 million asthmatics, and asthma prevalence is increasing in Indian metropolitan area, including Kolkata, West Bengal. Complex interactions of genetic and environmental factors are involved in asthma. Genome-wide search for susceptible loci regulating IgE response (atopy) have identified a candidate gene CD14 which is most important in the context of allergic responses of respiratory system. This study was aimed to investigate the role of house dust and house dust mites in development of bronchial asthma and to explore the possible association of candidate gene CD14 with disease manifestation among Kolkata patient population. Skin-prick test was done among 950 asthmatic patients against 8 aeroallergens, including house dust and house dust mites and total serum IgE and allergen-specific IgE were measured. Polymerase chain reaction-restriction fragment length polymorphism was done in patients and nonasthmatic control (n = 255 in each) to characterize a functional polymorphism, C(-159)T, of CD14, a positional candidate gene for allergy. We identified house dust as the most common aeroallergen sensitizer among atopic patients in Kolkata followed by Dermatophagoides pteronyssinus and Dermatophagoides farinae Hughes (Acari: Pyroglyphidae) mites. Patient's sera contain significantly higher IgE level than that of control. Allergen-specific IgE antibody test revealed that 76.36% patients had specific IgE antibody against D. pteronyssinus mite. There was a significant difference in the distribution of alleles and genotypes for CD14 polymorphism with an increase in disease severity. So, in Kolkata, house dust mite is a common aeroallergen and D. pteronyssinus is predominant among mites. The present study revealed that bronchial asthma has a genetic background. © The Author(s) 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Construction of a high-density genetic map by specific locus amplified fragment sequencing (SLAF-seq) and its application to Quantitative Trait Loci (QTL) analysis for boll weight in upland cotton (Gossypium hirsutum.).

PubMed

Zhang, Zhen; Shang, Haihong; Shi, Yuzhen; Huang, Long; Li, Junwen; Ge, Qun; Gong, Juwu; Liu, Aiying; Chen, Tingting; Wang, Dan; Wang, Yanling; Palanga, Koffi Kibalou; Muhammad, Jamshed; Li, Weijie; Lu, Quanwei; Deng, Xiaoying; Tan, Yunna; Song, Weiwu; Cai, Juan; Li, Pengtao; Rashid, Harun or; Gong, Wankui; Yuan, Youlu

2016-04-11

Upland Cotton (Gossypium hirsutum) is one of the most important worldwide crops it provides natural high-quality fiber for the industrial production and everyday use. Next-generation sequencing is a powerful method to identify single nucleotide polymorphism markers on a large scale for the construction of a high-density genetic map for quantitative trait loci mapping. In this research, a recombinant inbred lines population developed from two upland cotton cultivars 0-153 and sGK9708 was used to construct a high-density genetic map through the specific locus amplified fragment sequencing method. The high-density genetic map harbored 5521 single nucleotide polymorphism markers which covered a total distance of 3259.37 cM with an average marker interval of 0.78 cM without gaps larger than 10 cM. In total 18 quantitative trait loci of boll weight were identified as stable quantitative trait loci and were detected in at least three out of 11 environments and explained 4.15-16.70 % of the observed phenotypic variation. In total, 344 candidate genes were identified within the confidence intervals of these stable quantitative trait loci based on the cotton genome sequence. These genes were categorized based on their function through gene ontology analysis, Kyoto Encyclopedia of Genes and Genomes analysis and eukaryotic orthologous groups analysis. This research reported the first high-density genetic map for Upland Cotton (Gossypium hirsutum) with a recombinant inbred line population using single nucleotide polymorphism markers developed by specific locus amplified fragment sequencing. We also identified quantitative trait loci of boll weight across 11 environments and identified candidate genes within the quantitative trait loci confidence intervals. The results of this research would provide useful information for the next-step work including fine mapping, gene functional analysis, pyramiding breeding of functional genes as well as marker-assisted selection.

Associations of polymorphisms in the Pit-1 gene with growth and carcass traits in Angus beef cattle.

PubMed

Zhao, Q; Davis, M E; Hines, H C

2004-08-01

The Pit-1 gene was studied as a candidate for genetic markers of growth and carcass traits. Angus beef cattle that were divergently selected for high- or low-blood serum IGF-I concentration were used in this study. The single-strand conformation polymorphism method was used to identify polymorphism in the Pit-1 gene including regions from intron 2 to exon 6. Two polymorphisms, Pit1I3H (HinfI) and Pit1I3NL (NlaIII), were detected in intron 3 of the Pit-1 gene. One polymorphism, Pit1I4N (BstNI), was found in intron 4, and a single nucleotide polymorphism, Pit1I5, was found in intron 5. The previously reported polymorphism in exon 6, Pit1E6H (HinfI), was also studied in 416 Angus beef cattle. Associations of the polymorphisms with growth traits, carcass traits, and IGF-I concentration were analyzed using a general linear model procedure. No significant associations were observed between these polymorphisms and growth and carcass traits.

Characterization of Heterobasidion occidentale transcriptomes reveals candidate genes and DNA polymorphisms for virulence variations.

PubMed

Liu, Jun-Jun; Shamoun, Simon Francis; Leal, Isabel; Kowbel, Robert; Sumampong, Grace; Zamany, Arezoo

2018-05-01

Characterization of genes involved in differentiation of pathogen species and isolates with variations of virulence traits provides valuable information to control tree diseases for meeting the challenges of sustainable forest health and phytosanitary trade issues. Lack of genetic knowledge and genomic resources hinders novel gene discovery, molecular mechanism studies and development of diagnostic tools in the management of forest pathogens. Here, we report on transcriptome profiling of Heterobasidion occidentale isolates with contrasting virulence levels. Comparative transcriptomic analysis identified orthologous groups exclusive to H. occidentale and its isolates, revealing biological processes involved in the differentiation of isolates. Further bioinformatics analyses identified an H. occidentale secretome, CYPome and other candidate effectors, from which genes with species- and isolate-specific expression were characterized. A large proportion of differentially expressed genes were revealed to have putative activities as cell wall modification enzymes and transcription factors, suggesting their potential roles in virulence and fungal pathogenesis. Next, large numbers of simple sequence repeats (SSRs) and single nucleotide polymorphisms (SNPs) were detected, including more than 14 000 interisolate non-synonymous SNPs. These polymorphic loci and species/isolate-specific genes may contribute to virulence variations and provide ideal DNA markers for development of diagnostic tools and investigation of genetic diversity. © 2018 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.

The Influence of Genetic and Environmental Factors among MDMA Users in Cognitive Performance

PubMed Central

Cuyàs, Elisabet; Verdejo-García, Antonio; Fagundo, Ana Beatriz; Khymenets, Olha; Rodríguez, Joan; Cuenca, Aida; de Sola Llopis, Susana; Langohr, Klaus; Peña-Casanova, Jordi; Torrens, Marta; Martín-Santos, Rocío; Farré, Magí; de la Torre, Rafael

2011-01-01

This study is aimed to clarify the association between MDMA cumulative use and cognitive dysfunction, and the potential role of candidate genetic polymorphisms in explaining individual differences in the cognitive effects of MDMA. Gene polymorphisms related to reduced serotonin function, poor competency of executive control and memory consolidation systems, and high enzymatic activity linked to bioactivation of MDMA to neurotoxic metabolites may contribute to explain variations in the cognitive impact of MDMA across regular users of this drug. Sixty ecstasy polydrug users, 110 cannabis users and 93 non-drug users were assessed using cognitive measures of Verbal Memory (California Verbal Learning Test, CVLT), Visual Memory (Rey-Osterrieth Complex Figure Test, ROCFT), Semantic Fluency, and Perceptual Attention (Symbol Digit Modalities Test, SDMT). Participants were also genotyped for polymorphisms within the 5HTT, 5HTR2A, COMT, CYP2D6, BDNF, and GRIN2B genes using polymerase chain reaction and TaqMan polymerase assays. Lifetime cumulative MDMA use was significantly associated with poorer performance on visuospatial memory and perceptual attention. Heavy MDMA users (>100 tablets lifetime use) interacted with candidate gene polymorphisms in explaining individual differences in cognitive performance between MDMA users and controls. MDMA users carrying COMT val/val and SERT s/s had poorer performance than paired controls on visuospatial attention and memory, and MDMA users with CYP2D6 ultra-rapid metabolizers performed worse than controls on semantic fluency. Both MDMA lifetime use and gene-related individual differences influence cognitive dysfunction in ecstasy users. PMID:22110616

Genome-wide association links candidate genes to resistance to Plum Pox Virus in apricot (Prunus armeniaca).

PubMed

Mariette, Stéphanie; Wong Jun Tai, Fabienne; Roch, Guillaume; Barre, Aurélien; Chague, Aurélie; Decroocq, Stéphane; Groppi, Alexis; Laizet, Yec'han; Lambert, Patrick; Tricon, David; Nikolski, Macha; Audergon, Jean-Marc; Abbott, Albert G; Decroocq, Véronique

2016-01-01

In fruit tree species, many important traits have been characterized genetically by using single-family descent mapping in progenies segregating for the traits. However, most mapped loci have not been sufficiently resolved to the individual genes due to insufficient progeny sizes for high resolution mapping and the previous lack of whole-genome sequence resources of the study species. To address this problem for Plum Pox Virus (PPV) candidate resistance gene identification in Prunus species, we implemented a genome-wide association (GWA) approach in apricot. This study exploited the broad genetic diversity of the apricot (Prunus armeniaca) germplasm containing resistance to PPV, next-generation sequence-based genotyping, and the high-quality peach (Prunus persica) genome reference sequence for single nucleotide polymorphism (SNP) identification. The results of this GWA study validated previously reported PPV resistance quantitative trait loci (QTL) intervals, highlighted other potential resistance loci, and resolved each to a limited set of candidate genes for further study. This work substantiates the association genetics approach for resolution of QTL to candidate genes in apricot and suggests that this approach could simplify identification of other candidate genes for other marked trait intervals in this germplasm. © 2015 INRA, UMR 1332 BFP New Phytologist © 2015 New Phytologist Trust.

Dog obesity--the need for identifying predisposing genetic markers.

PubMed

Switonski, M; Mankowska, M

2013-12-01

Incidence of overweight and obesity in dogs exceeds 30%, and several breeds are predisposed to this heritable phenotype. Rapid progress of canine genomics and advanced knowledge on the genetic background of human obesity bring a unique opportunity to perform such studies in dogs. Natural candidate genes for obesity are these encoding adipokines. Extended studies in humans indicated that polymorphisms of three of them, i.e. ADIPOQ, IL1 and TNF, are associated with predisposition to obesity. On the other hand, the use of genome-wide association studies revealed an association between human obesity and polymorphism of more than 50 other genes. Until now only few preliminary reports on polymorphism of canine FTO, MC4R, MC3R and PPARG genes have been published. Since the dog is a valuable model organism for human diseases one can foresee that such studies may also contribute to an in-depth understanding of human obesity pathogenesis. Copyright © 2013 Elsevier Ltd. All rights reserved.

Association between genetic polymorphisms in the XRCC1, XRCC3, XPD, GSTM1, GSTT1, MSH2, MLH1, MSH3, and MGMT genes and radiosensitivity in breast cancer patients.

PubMed

Mangoni, Monica; Bisanzi, Simonetta; Carozzi, Francesca; Sani, Cristina; Biti, Giampaolo; Livi, Lorenzo; Barletta, Emanuela; Costantini, Adele Seniori; Gorini, Giuseppe

2011-09-01

Clinical radiosensitivity varies considerably among patients, and radiation-induced side effects developing in normal tissue can be therapy limiting. Some single nucleotide polymorphisms (SNPs) have been shown to correlate with hypersensitivity to radiotherapy. We conducted a prospective study of 87 female patients with breast cancer who received radiotherapy after breast surgery. We evaluated the association between acute skin reaction following radiotherapy and 11 genetic polymorphisms in DNA repair genes: XRCC1 (Arg399Gln and Arg194Trp), XRCC3 (Thr241Met), XPD (Asp312Asn and Lys751Gln), MSH2 (gIVS12-6T>C), MLH1 (Ile219Val), MSH3 (Ala1045Thr), MGMT (Leu84Phe), and in damage-detoxification GSTM1 and GSTT1 genes (allele deletion). Individual genetic polymorphisms were determined by polymerase chain reaction and single nucleotide primer extension for single nucleotide polymorphisms or by a multiplex polymerase chain reaction assay for deletion polymorphisms. The development of severe acute skin reaction (moist desquamation or interruption of radiotherapy due to toxicity) associated with genetic polymorphisms was modeled using Cox proportional hazards, accounting for cumulative biologically effective radiation dose. Radiosensitivity developed in eight patients and was increased in carriers of variants XRCC3-241Met allele (hazard ratio [HR] unquantifiably high), MSH2 gIVS12-6nt-C allele (HR=53.36; 95% confidence intervals [95% CI], 3.56-798.98), and MSH3-1045Ala allele (HR unquantifiably high). Carriers of XRCC1-Arg194Trp variant allele in combination with XRCC1-Arg399Gln wild-type allele had a significant risk of radiosensitivity (HR=38.26; 95% CI, 1.19-1232.52). To our knowledge, this is the first report to find an association between MSH2 and MSH3 genetic variants and the development of radiosensitivity in breast cancer patients. Our findings suggest the hypothesis that mismatch repair mechanisms may be involved in cellular response to radiotherapy. Genetic polymorphisms may be promising candidates for predicting acute radiosensitivity, but further studies are necessary to confirm our findings. Copyright © 2011 Elsevier Inc. All rights reserved.

Lack of association between temporal lobe epilepsy and a novel polymorphism in the alpha 2 subunit gene (ATP1A2) of the sodium potassium transporting ATPase.

PubMed

Buono, R J; Ferraro, T N; O'Connor, M J; Sperling, M R; Abbey, M; Finanger, E; Lohoff, F; Mulholland, N; Berrettini, W H

2000-02-07

Genetic linkage studies in rodents and humans have identified specific chromosomal regions harboring seizure susceptibility genes. We have identified a novel polymorphism in the human alpha 2 subunit gene (ATP1A2) of the sodium potassium transporting ATPase (NaK-pump), a candidate gene for human temporal lobe epilepsy (TLE) based on its chromosomal location and function in ion homeostasis. The polymorphism consists of a four base pair insertion 12 base pairs upstream of the start of exon 2. We performed an association study between this polymorphism and TLE. Our study did not find a significant difference in the frequency of this polymorphism between TLE patients and controls, indicating that this variation is not a major susceptibility factor. However, since the number of patients studied so far is small and the functional consequence of the polymorphism is unknown, the variation may yet be found to play a minor role in increased risk for seizure susceptibility. In contrast to the findings in TLE patients and controls, we did find a significant difference in the frequency of the variation between African Americans and persons of European descent. This finding demonstrates the potential effect of population stratification on studies of this type and supports the growing use of parental and familial samples for controls in association studies. Further study of this polymorphism is warranted as it may be involved in other disease processes for which there are known ethnic-specific susceptibilities. Am. J. Med. Genet. (Neuropsychiatr. Genet.) 96:79-83, 2000. Copyright 2000 Wiley-Liss, Inc.

DNA sequence variation and selection of tag single-nucleotide polymorphisms at candidate genes for drought-stress response in Pinus taeda L.

PubMed

González-Martínez, Santiago C; Ersoz, Elhan; Brown, Garth R; Wheeler, Nicholas C; Neale, David B

2006-03-01

Genetic association studies are rapidly becoming the experimental approach of choice to dissect complex traits, including tolerance to drought stress, which is the most common cause of mortality and yield losses in forest trees. Optimization of association mapping requires knowledge of the patterns of nucleotide diversity and linkage disequilibrium and the selection of suitable polymorphisms for genotyping. Moreover, standard neutrality tests applied to DNA sequence variation data can be used to select candidate genes or amino acid sites that are putatively under selection for association mapping. In this article, we study the pattern of polymorphism of 18 candidate genes for drought-stress response in Pinus taeda L., an important tree crop. Data analyses based on a set of 21 putatively neutral nuclear microsatellites did not show population genetic structure or genomewide departures from neutrality. Candidate genes had moderate average nucleotide diversity at silent sites (pi(sil) = 0.00853), varying 100-fold among single genes. The level of within-gene LD was low, with an average pairwise r2 of 0.30, decaying rapidly from approximately 0.50 to approximately 0.20 at 800 bp. No apparent LD among genes was found. A selective sweep may have occurred at the early-response-to-drought-3 (erd3) gene, although population expansion can also explain our results and evidence for selection was not conclusive. One other gene, ccoaomt-1, a methylating enzyme involved in lignification, showed dimorphism (i.e., two highly divergent haplotype lineages at equal frequency), which is commonly associated with the long-term action of balancing selection. Finally, a set of haplotype-tagging SNPs (htSNPs) was selected. Using htSNPs, a reduction of genotyping effort of approximately 30-40%, while sampling most common allelic variants, can be gained in our ongoing association studies for drought tolerance in pine.

Association of Genetic Loci with Sleep Apnea in European Americans and African-Americans: The Candidate Gene Association Resource (CARe)

PubMed Central

Patel, Sanjay R.; Goodloe, Robert; De, Gourab; Kowgier, Matthew; Weng, Jia; Buxbaum, Sarah G.; Cade, Brian; Fulop, Tibor; Gharib, Sina A.; Gottlieb, Daniel J.; Hillman, David; Larkin, Emma K.; Lauderdale, Diane S.; Li, Li; Mukherjee, Sutapa; Palmer, Lyle; Zee, Phyllis; Zhu, Xiaofeng; Redline, Susan

2012-01-01

Although obstructive sleep apnea (OSA) is known to have a strong familial basis, no genetic polymorphisms influencing apnea risk have been identified in cross-cohort analyses. We utilized the National Heart, Lung, and Blood Institute (NHLBI) Candidate Gene Association Resource (CARe) to identify sleep apnea susceptibility loci. Using a panel of 46,449 polymorphisms from roughly 2,100 candidate genes on a customized Illumina iSelect chip, we tested for association with the apnea hypopnea index (AHI) as well as moderate to severe OSA (AHI≥15) in 3,551 participants of the Cleveland Family Study and two cohorts participating in the Sleep Heart Health Study. Among 647 African-Americans, rs11126184 in the pleckstrin (PLEK) gene was associated with OSA while rs7030789 in the lysophosphatidic acid receptor 1 (LPAR1) gene was associated with AHI using a chip-wide significance threshold of p-value<2×10−6. Among 2,904 individuals of European ancestry, rs1409986 in the prostaglandin E2 receptor (PTGER3) gene was significantly associated with OSA. Consistency of effects between rs7030789 and rs1409986 in LPAR1 and PTGER3 and apnea phenotypes were observed in independent clinic-based cohorts. Novel genetic loci for apnea phenotypes were identified through the use of customized gene chips and meta-analyses of cohort data with replication in clinic-based samples. The identified SNPs all lie in genes associated with inflammation suggesting inflammation may play a role in OSA pathogenesis. PMID:23155414

A meta-analysis of Th2 pathway genetic variants and risk for allergic rhinitis.

PubMed

Bunyavanich, Supinda; Shargorodsky, Josef; Celedón, Juan C

2011-06-01

There is a significant genetic contribution to allergic rhinitis (AR). Genetic association studies for AR have been performed, but varying results make it challenging to decipher the overall potential effect of specific variants. The Th2 pathway plays an important role in the immunological development of AR. We performed meta-analyses of genetic association studies of variants in Th2 pathway genes and AR. PubMed and Phenopedia were searched by double extraction for original studies on Th2 pathway-related genetic polymorphisms and their associations with AR. A meta-analysis was conducted on each genetic polymorphism with data meeting our predetermined selection criteria. Analyses were performed using both fixed and random effects models, with stratification by age group, ethnicity, and AR definition where appropriate. Heterogeneity and publication bias were assessed. Six independent studies analyzing three candidate polymorphisms and involving a total of 1596 cases and 2892 controls met our inclusion criteria. Overall, the A allele of IL13 single nucleotide polymorphism (SNP) rs20541 was associated with increased odds of AR (estimated OR=1.2; 95% CI 1.1-1.3, p-value 0.004 in fixed effects model, 95% CI 1.0-1.5, p-value 0.056 in random effects model). The A allele of rs20541 was associated with increased odds of AR in mixed age groups using both fixed effects and random effects modeling. IL13 SNP rs1800925 and IL4R SNP 1801275 did not demonstrate overall associations with AR. We conclude that there is evidence for an overall association between IL13 SNP rs20541 and increased risk of AR, especially in mixed-age populations. © 2011 John Wiley & Sons A/S.

The Genomic Architecture of Sporadic Heart Failure

PubMed Central

Dorn, Gerald W

2011-01-01

Common or sporadic systolic heart failure (heart failure) is the clinical syndrome of insufficient forward cardiac output resulting from myocardial disease. Most heart failure is the consequence of ischemic or idiopathic cardiomyopathy. There is a clear familial predisposition to heart failure, with a genetic component estimated to confer between 20 and 30% of overall risk. The multifactorial etiology of this syndrome has complicated identification of its genetic underpinnings. Until recently, almost all genetic studies of heart failure were designed and deployed according to the common disease-common variant hypothesis, in which individual risk alleles impart a small positive or negative effect and overall genetic risk is the cumulative impact of all functional genetic variations. Early studies employed a candidate gene approach, focused mainly on factors within adrenergic and renin-angiotensin pathways that affect heart failure progression and are targeted by standard pharmacotherapeutics. Many of these reported allelic associations with heart failure have not been replicated. However, the preponderance of data support risk-modifier effects for the Arg389Gly polymorphism of β1-adrenergic receptors and the intron 16 in/del polymorphism of angiotensin converting enzyme. Recent unbiased studies using genome-wide single nucleotide polymorphism (SNP) microarrays have shown fewer positive results than when these platforms were applied to hypertension, myocardial infarction, or diabetes, possibly reflecting the complex etiology of heart failure. A new cardiovascular gene-centric sub-genome SNP array identified a common heat failure risk allele at 1p36 in multiple independent cohorts, but the biological mechanism for this association is still uncertain. It is likely that common gene polymorphisms account for only a fraction of individual genetic heart failure risk, and future studies using deep resequencing are likely to identify rare gene variants with larger biological effects. PMID:21566223

Analysis of polymorphic patterns in candidate genes in Israeli patients with prostate cancer.

PubMed

Figer, Arie; Friedman, Tal; Manguoglu, Ayse Esra; Flex, Dov; Vazina, Amnon; Novikov, Ilia; Shtrieker, Avi; Sidi, A Ami; Tichler, Thomas; Sapir, Einat Even; Baniel, Jack; Friedman, Eitan

2003-10-01

The precise genes involved in conferring prostate cancer risk in sporadic and familial cases are not fully known. To evaluate the genetic profile within several candidate genes of unselected prostate cancer cases and to correlate this profile with disease parameters. Jewish Israeli prostate cancer patients (n = 224) were genotyped for polymorphisms within candidate genes: p53, ER, VDR, GSTT1, CYP1A1, GSTP1, GSTM1, EPHX and HPC2/ELAC2, followed by analysis of the genotype with relevant clinical and pathologic parameters. The EPHX gene His113 allele was detected in 21.4% (33/154) of patients in whom disease was diagnosed above 61 years, compared with 5.7% (4/70) in earlier onset disease (P < 0.001). Within the group of late-onset disease, the same allele was noted in 5.5% (2/36) with grade I tumors compared with 18% (34/188) with grade II and up (P = 0.004). All other tested polymorphisms were not associated with a distinct clinical or pathologic feature in a statistically significant manner. In Israeli prostate cancer patients, the EPHX His113 allele is seemingly associated with a more advanced, late-onset disease. These preliminary data need to be confirmed by a larger and more ethnically diverse study.

Investigating the genetic basis of theory of mind (ToM): the role of catechol-O-methyltransferase (COMT) gene polymorphisms.

PubMed

Xia, Haiwei; Wu, Nan; Su, Yanjie

2012-01-01

The ability to deduce other persons' mental states and emotions which has been termed 'theory of mind (ToM)' is highly heritable. First molecular genetic studies focused on some dopamine-related genes, while the genetic basis underlying different components of ToM (affective ToM and cognitive ToM) remain unknown. The current study tested 7 candidate polymorphisms (rs4680, rs4633, rs2020917, rs2239393, rs737865, rs174699 and rs59938883) on the catechol-O-methyltransferase (COMT) gene. We investigated how these polymorphisms relate to different components of ToM. 101 adults participated in our study; all were genetically unrelated, non-clinical and healthy Chinese subjects. Different ToM tasks were applied to detect their theory of mind ability. The results showed that the COMT gene rs2020917 and rs737865 SNPs were associated with cognitive ToM performance, while the COMT gene rs5993883 SNP was related to affective ToM, in which a significant gender-genotype interaction was found (p = 0.039). Our results highlighted the contribution of DA-related COMT gene on ToM performance. Moreover, we found out that the different SNP at the same gene relates to the discriminative aspect of ToM. Our research provides some preliminary evidence to the genetic basis of theory of mind which still awaits further studies.

Nucleotide polymorphisms in a pine ortholog of the Arabidopsis degrading enzyme cellulase KORRIGAN are associated with early growth performance in Pinus pinaster.

PubMed

Cabezas, José Antonio; González-Martínez, Santiago C; Collada, Carmen; Guevara, María Angeles; Boury, Christophe; de María, Nuria; Eveno, Emmanuelle; Aranda, Ismael; Garnier-Géré, Pauline H; Brach, Jean; Alía, Ricardo; Plomion, Christophe; Cervera, María Teresa

2015-09-01

We have carried out a candidate-gene-based association genetic study in Pinus pinaster Aiton and evaluated the predictive performance for genetic merit gain of the most significantly associated genes and single nucleotide polymorphisms (SNPs). We used a second generation 384-SNP array enriched with candidate genes for growth and wood properties to genotype mother trees collected in 20 natural populations covering most of the European distribution of the species. Phenotypic data for total height, polycyclism, root-collar diameter and biomass were obtained from a replicated provenance-progeny trial located in two sites with contrasting environments (Atlantic vs Mediterranean climate). General linear models identified strong associations between growth traits (total height and polycyclism) and four SNPs from the korrigan candidate gene, after multiple testing corrections using false discovery rate. The combined genomic breeding value predictions assessed for the four associated korrigan SNPs by ridge regression-best linear unbiased prediction (RR-BLUP) and cross-validation accounted for up to 8 and 15% of the phenotypic variance for height and polycyclic growth, respectively, and did not improve adding SNPs from other growth-related candidate genes. For root-collar diameter and total biomass, they accounted for 1.6 and 1.1% of the phenotypic variance, respectively, but increased to 15 and 4.1% when other SNPs from lp3.1, lp3.3 and cad were included in RR-BLUP models. These results point towards a desirable integration of candidate-gene studies as a means to pre-select relevant markers, and aid genomic selection in maritime pine breeding programs. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Genetic Diversity and Natural Selection in 42 kDa Region of Plasmodium vivax Merozoite Surface Protein-1 from China-Myanmar Endemic Border.

PubMed

Zhou, Xia; Tambo, Ernest; Su, Jing; Fang, Qiang; Ruan, Wei; Chen, Jun-Hu; Yin, Ming-Bo; Zhou, Xiao-Nong

2017-10-01

Plasmodium vivax merozoite surface protein-1 (PvMSP1) gene codes for a major malaria vaccine candidate antigen. However, its polymorphic nature represents an obstacle to the design of a protective vaccine. In this study, we analyzed the genetic polymorphism and natural selection of the C-terminal 42 kDa fragment within PvMSP1 gene (Pv MSP142) from 77 P. vivax isolates, collected from imported cases of China-Myanmar border (CMB) areas in Yunnan province and the inland cases from Anhui, Yunnan, and Zhejiang province in China during 2009-2012. Totally, 41 haplotypes were identified and 30 of them were new haplotypes. The differences between the rates of non-synonymous and synonymous mutations suggest that PvMSP142 has evolved under natural selection, and a high selective pressure preferentially acted on regions identified of PvMSP133. Our results also demonstrated that PvMSP142 of P. vivax isolates collected on China-Myanmar border areas display higher genetic polymorphisms than those collected from inland of China. Such results have significant implications for understanding the dynamic of the P. vivax population and may be useful information towards China malaria elimination campaign strategies.

Sequence polymorphism in candidate genes for differences in winter plumage between Scottish and Scandinavian Willow Grouse (Lagopus lagopus).

PubMed

Skoglund, Pontus; Höglund, Jacob

2010-04-23

Population variation in the degree of seasonal polymorphism is rare in birds, and the genetic basis of this phenomenon remains largely undescribed. Both sexes of Scandinavian and Scottish Willow grouse (Lagopus lagopus) display marked differences in their winter phenotypes, with Scottish grouse retaining a pigmented plumage year-round and Scandinavian Willow grouse molting to a white morph during winter. A widely studied pathway implicated in vertebrate pigmentation is the melanin system, for which functional variation has been characterised in many taxa. We sequenced coding regions from four genes involved in melanin pigmentation (DCT, MC1R, TYR and TYRP1), and an additional control involved in the melanocortin pathway (AGRP), to investigate the genetic basis of winter plumage in Lagopus. Despite the well documented role of the melanin system in animal coloration, we found no plumage-associated polymorphism or evidence for selection in a total of approximately 2.6 kb analysed sequence. Our results indicate that the genetic basis of alternating between pigmented and unpigmented seasonal phenotypes is more likely explained by regulatory changes controlling the expression of these or other loci in the physiological pathway leading to pigmentation.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mangoni, Monica; Bisanzi, Simonetta; Carozzi, Francesca

Purpose: Clinical radiosensitivity varies considerably among patients, and radiation-induced side effects developing in normal tissue can be therapy limiting. Some single nucleotide polymorphisms (SNPs) have been shown to correlate with hypersensitivity to radiotherapy. We conducted a prospective study of 87 female patients with breast cancer who received radiotherapy after breast surgery. We evaluated the association between acute skin reaction following radiotherapy and 11 genetic polymorphisms in DNA repair genes: XRCC1 (Arg399Gln and Arg194Trp), XRCC3 (Thr241Met), XPD (Asp312Asn and Lys751Gln), MSH2 (gIVS12-6T>C), MLH1 (Ile219Val), MSH3 (Ala1045Thr), MGMT (Leu84Phe), and in damage-detoxification GSTM1 and GSTT1 genes (allele deletion). Methods and Materials: Individualmore » genetic polymorphisms were determined by polymerase chain reaction and single nucleotide primer extension for single nucleotide polymorphisms or by a multiplex polymerase chain reaction assay for deletion polymorphisms. The development of severe acute skin reaction (moist desquamation or interruption of radiotherapy due to toxicity) associated with genetic polymorphisms was modeled using Cox proportional hazards, accounting for cumulative biologically effective radiation dose. Results: Radiosensitivity developed in eight patients and was increased in carriers of variants XRCC3-241Met allele (hazard ratio [HR] unquantifiably high), MSH2 gIVS12-6nt-C allele (HR = 53.36; 95% confidence intervals [95% CI], 3.56-798.98), and MSH3-1045Ala allele (HR unquantifiably high). Carriers of XRCC1-Arg194Trp variant allele in combination with XRCC1-Arg399Gln wild-type allele had a significant risk of radiosensitivity (HR = 38.26; 95% CI, 1.19-1232.52). Conclusions: To our knowledge, this is the first report to find an association between MSH2 and MSH3 genetic variants and the development of radiosensitivity in breast cancer patients. Our findings suggest the hypothesis that mismatch repair mechanisms may be involved in cellular response to radiotherapy. Genetic polymorphisms may be promising candidates for predicting acute radiosensitivity, but further studies are necessary to confirm our findings.« less

Effects of bovine SMO gene polymorphisms on the body measurement and meat quality traits of Qinchuan cattle.

PubMed

Zhang, Y R; Li, Y K; Fu, C Z; Wang, J L; Wang, H B; Zan, L S

2014-10-07

Beef cattle breeding programs focus on improving important economic traits, including growth rates, and meat quantity and quality. Molecular marker-assisted selection based on genetic variation represents a potential method for breeding genetically improved livestock with better economic traits. Smoothened (SMO) protein is a signal transducer that contributes to the regulation of both osteogenesis and adipogenesis through the hedgehog pathway. In this study, we detected polymorphisms in the bovine SMO gene of Qinchuan cattle, and we analyzed their associations with body measurement traits (BMTs) and meat quality traits (MQTs). Using DNA sequencing and polymerase chain reaction-restriction fragment length polymorphism, 3 novel single nucleotide polymorphisms were identified in the SMO gene of 562 cattle: 1 G > C mutation on exon 9 (G21234C) and 2 C > T mutations on exon 11 (C22424T and C22481T). Association analysis showed that polymorphisms on both the G21234C and C22424T loci significantly affected certain BMTs and MQTs (P < 0.05 or P < 0.01), whereas those on the C22481T locus did not (P > 0.05). Therefore, the SMO gene could be used as a candidate gene to alter BMTs and MQTs in Qinchuan cattle or for marker-assisted selection to breed cattle with superior BMTs and MQTs.

Genetics in Diabetic Retinopathy: Current Concepts and New Insights

PubMed Central

Simó-Servat, Olga; Hernández, Cristina; Simó, Rafael

2013-01-01

There is emerging evidence which indicates the essential role of genetic factors in the development of diabetic retinopathy (DR). In this regard it should be highlighted that genetic factors account for 25-50% of the risk of developing DR. Therefore, the use of genetic analysis to identify those diabetic patients most prone to developing DR might be useful in designing a more individualized treatment. In this regard, there are three main research strategies: candidate gene studies, linkage studies and Genome-Wide Association Studies (GWAS). In the candidate gene approach, several genes encoding proteins closely related to DR development have been analyzed. The linkage studies analyze shared alleles among family members with DR under the assumption that these predispose to a more aggressive development of DR. Finally, Genome-Wide Association Studies (GWAS) are a new tool involving a massive evaluation of single nucleotide polymorphisms (SNP) in large samples. In this review the available information using these three methodologies is critically analyzed. A genetic approach in order to identify new candidates in the pathogenesis of DR would permit us to design more targeted therapeutic strategies in order to decrease this devastating complication of diabetes. Basic researchers, ophthalmologists, diabetologists and geneticists should work together in order to gain new insights into this issue. PMID:24403848

Clock gene polymorphism and scheduling of migration: a geolocator study of the barn swallow Hirundo rustica

PubMed Central

Bazzi, Gaia; Ambrosini, Roberto; Caprioli, Manuela; Costanzo, Alessandra; Liechti, Felix; Gatti, Emanuele; Gianfranceschi, Luca; Podofillini, Stefano; Romano, Andrea; Romano, Maria; Scandolara, Chiara; Saino, Nicola; Rubolini, Diego

2015-01-01

Circannual rhythms often rely on endogenous seasonal photoperiodic timers involving ‘clock’ genes, and Clock gene polymorphism has been associated to variation in phenology in some bird species. In the long-distance migratory barn swallow Hirundo rustica, individuals bearing the rare Clock allele with the largest number of C-terminal polyglutamine repeats found in this species (Q8) show a delayed reproduction and moult later. We explored the association between Clock polymorphism and migration scheduling, as gauged by light-level geolocators, in two barn swallow populations (Switzerland; Po Plain, Italy). Genetic polymorphism was low: 91% of the 64 individuals tracked year-round were Q7/Q7 homozygotes. We compared the phenology of the rare genotypes with the phenotypic distribution of Q7/Q7 homozygotes within each population. In Switzerland, compared to Q7/Q7, two Q6/Q7 males departed earlier from the wintering grounds and arrived earlier to their colony in spring, while a single Q7/Q8 female was delayed for both phenophases. On the other hand, in the Po Plain, three Q6/Q7 individuals had a similar phenology compared to Q7/Q7. The Swiss data are suggestive for a role of genetic polymorphism at a candidate phenological gene in shaping migration traits, and support the idea that Clock polymorphism underlies phenological variation in birds. PMID:26197782

Genetic polymorphism and natural selection of Duffy binding protein of Plasmodium vivax Myanmar isolates

PubMed Central

2012-01-01

Background Plasmodium vivax Duffy binding protein (PvDBP) plays an essential role in erythrocyte invasion and a potential asexual blood stage vaccine candidate antigen against P. vivax. The polymorphic nature of PvDBP, particularly amino terminal cysteine-rich region (PvDBPII), represents a major impediment to the successful design of a protective vaccine against vivax malaria. In this study, the genetic polymorphism and natural selection at PvDBPII among Myanmar P. vivax isolates were analysed. Methods Fifty-four P. vivax infected blood samples collected from patients in Myanmar were used. The region flanking PvDBPII was amplified by PCR, cloned into Escherichia coli, and sequenced. The polymorphic characters and natural selection of the region were analysed using the DnaSP and MEGA4 programs. Results Thirty-two point mutations (28 non-synonymous and four synonymous mutations) were identified in PvDBPII among the Myanmar P. vivax isolates. Sequence analyses revealed that 12 different PvDBPII haplotypes were identified in Myanmar P. vivax isolates and that the region has evolved under positive natural selection. High selective pressure preferentially acted on regions identified as B- and T-cell epitopes of PvDBPII. Recombination may also be played a role in the resulting genetic diversity of PvDBPII. Conclusions PvDBPII of Myanmar P. vivax isolates displays a high level of genetic polymorphism and is under selective pressure. Myanmar P. vivax isolates share distinct types of PvDBPII alleles that are different from those of other geographical areas. These results will be useful for understanding the nature of the P. vivax population in Myanmar and for development of PvDBPII-based vaccine. PMID:22380592

Association of polymorphisms in growth hormone and leptin candidate genes with live weight traits of Brahman cattle.

PubMed

Hernández, N; Martínez-González, J C; Parra-Bracamonte, G M; Sifuentes-Rincón, A M; López-Villalobos, N; Morris, S T; Briones-Encinia, F; Ortega-Rivas, E; Pacheco-Contreras, V I; L A Meza-García, And

2016-09-02

Polymorphisms in candidate genes can produce significant and favorable changes in the phenotype, and therefore are useful for the identification of the best combination of favorable variants for marker-assisted selection. In the present study, an assessment to evaluate the effect of 11 single nucleotide polymorphisms (SNPs) in candidate genes on live weight traits of registered Brahman cattle was performed. Data from purebred bulls were used in this assessment. The dataset included birth (BW), weaning (WW), and yearling (YW) weights. A panel of 11 SNP markers, selected by their formerly reported or apparent direct and indirect association with live weight traits, was included in an assessment previously confirming their minimum allele frequency (<0.05). Live weights were adjusted BW (aBW), WW (aWW), and YW (aYW) using a generalized linear model, which included the fixed effects of herd and season of birth and the random effect of the sire and year of birth. An SNP in a growth hormone gene (GH4.1) was significantly related to aWW (P = 0.035) with an estimate substitution effect of 3.97 kg (P = 0.0210). In addition, a leptin SNP (LEPg.978) was significantly associated with aYW (P = 0.003) with an estimate substitution effect of 9.57 kg (P = 0.0007). The results suggest that markers GH4.1 and LEPg.978 can be considered as candidate loci for assisted genetic improvement programs in Mexican Brahman cattle.

Meta-analysis of genetic studies from journals published in China of ischemic stroke in the Han Chinese population.

PubMed

Xu, Xiaowei; Li, Jiejie; Sheng, Wenli; Liu, Lin

2008-01-01

The aim of this study was to confirm the nature and number of genes contributing to stroke risk and qualify the genetic risk of each susceptibility gene in the Han Chinese population. After collecting all case-control studies related to DNA polymorphism of any candidate gene for ischemic stroke in Han Chinese, strict selection criteria and exclusion criteria were determined and different effect models were used according to the difference in heterogeneity. Meta-analyses were carried out by Revman 4.0 software and the publication bias was further evaluated through calculation of fail-safe numbers in the included gene polymorphisms. Seventy-six studies were included in the meta-analyses which were all published in mainland China and referred to 6 candidate genes and 7 polymorphisms. Among the gene polymorphisms tested in the study, association of gene polymorphisms with increasing risk of ischemic stroke was confirmed in 6 polymorphisms including angiotensin-converting enzyme insertion/deletion (ACE I/D; OR = 1.87, 95% CI = 1.45-2.42), methylenetetrahydrofolate reductase (MTHFR) C677T (OR = 1.55, 95% CI = 1.26-1.90), plasminogen activator inhibitor 1 (PAI-1) 4G/5G (OR = 1.79, 95% CI = 1.20-2.67), beta-fibrinogen (beta-Fg) -455A/G (OR = 1.48, 95% CI = 1.14-1.92), beta-Fg -148T/C (OR = 1.72, 95% CI = 1.42-2.07), apolipoprotein E (ApoE) epsilon2-4 (OR = 2.39, 95% CI = 1.94-2.95). Because of the obvious publication bias, the association between paraoxonase 1 (PON-1) polymorphisms and stroke risk was not established although the OR of the meta-analysis suggested a positive result (OR = 1.14, 95% CI = 1.01-1.35). ACE D/I, MTHFR C677T, beta-Fg -455A/G, beta-Fg -148T/C, PAI-1 4G/5G, and ApoE epsilon2-4 were associated with risk of ischemic stroke in Han Chinese. (c) 2008 S. Karger AG, Basel

Genetic and genomic analysis of hyperlipidemia, obesity and diabetes using (C57BL/6J × TALLYHO/JngJ) F2 mice.

PubMed

Stewart, Taryn P; Kim, Hyoung Yon; Saxton, Arnold M; Kim, Jung Han

2010-12-19

Type 2 diabetes (T2D) is the most common form of diabetes in humans and is closely associated with dyslipidemia and obesity that magnifies the mortality and morbidity related to T2D. The genetic contribution to human T2D and related metabolic disorders is evident, and mostly follows polygenic inheritance. The TALLYHO/JngJ (TH) mice are a polygenic model for T2D characterized by obesity, hyperinsulinemia, impaired glucose uptake and tolerance, hyperlipidemia, and hyperglycemia. In order to determine the genetic factors that contribute to these T2D related characteristics in TH mice, we interbred TH mice with C57BL/6J (B6) mice. The parental, F1, and F2 mice were phenotyped at 8, 12, 16, 20, and 24 weeks of age for 4-hour fasting plasma triglyceride, cholesterol, insulin, and glucose levels and body, fat pad and carcass weights. The F2 mice were genotyped genome-wide and used for quantitative trait locus (QTL) mapping. We also applied a genetical genomic approach using a subset of the F2 mice to seek candidate genes underlying the QTLs. Major QTLs were detected on chromosomes (Chrs) 1, 11, 4, and 8 for hypertriglyceridemia, 1 and 3 for hypercholesterolemia, 4 for hyperglycemia, 11 and 1 for body weight, 1 for fat pad weight, and 11 and 14 for carcass weight. Most alleles, except for Chr 3 and 14 QTLs, increased phenotypic values when contributed by the TH strain. Fourteen pairs of interacting loci were detected, none of which overlapped the major QTLs. The QTL interval linked to hypercholesterolemia and hypertriglyceridemia on distal Chr 1 contains Apoa2 gene. Sequencing analysis revealed polymorphisms of Apoa2 in TH mice, suggesting Apoa2 as the candidate gene for the hyperlipidemia QTL. Gene expression analysis added novel information and aided in selection of candidates underlying the QTLs. We identified several genetic loci that affect the quantitative variations of plasma lipid and glucose levels and obesity traits in a TH × B6 intercross. Polymorphisms in Apoa2 gene are suggested to be responsible for the Chr 1 QTL linked to hypercholesterolemia and hypertriglyceridemia. Further, genetical genomic analysis led to potential candidate genes for the QTLs.

Genetic and genomic analysis of hyperlipidemia, obesity and diabetes using (C57BL/6J × TALLYHO/JngJ) F2 mice

PubMed Central

2010-01-01

Background Type 2 diabetes (T2D) is the most common form of diabetes in humans and is closely associated with dyslipidemia and obesity that magnifies the mortality and morbidity related to T2D. The genetic contribution to human T2D and related metabolic disorders is evident, and mostly follows polygenic inheritance. The TALLYHO/JngJ (TH) mice are a polygenic model for T2D characterized by obesity, hyperinsulinemia, impaired glucose uptake and tolerance, hyperlipidemia, and hyperglycemia. Results In order to determine the genetic factors that contribute to these T2D related characteristics in TH mice, we interbred TH mice with C57BL/6J (B6) mice. The parental, F1, and F2 mice were phenotyped at 8, 12, 16, 20, and 24 weeks of age for 4-hour fasting plasma triglyceride, cholesterol, insulin, and glucose levels and body, fat pad and carcass weights. The F2 mice were genotyped genome-wide and used for quantitative trait locus (QTL) mapping. We also applied a genetical genomic approach using a subset of the F2 mice to seek candidate genes underlying the QTLs. Major QTLs were detected on chromosomes (Chrs) 1, 11, 4, and 8 for hypertriglyceridemia, 1 and 3 for hypercholesterolemia, 4 for hyperglycemia, 11 and 1 for body weight, 1 for fat pad weight, and 11 and 14 for carcass weight. Most alleles, except for Chr 3 and 14 QTLs, increased phenotypic values when contributed by the TH strain. Fourteen pairs of interacting loci were detected, none of which overlapped the major QTLs. The QTL interval linked to hypercholesterolemia and hypertriglyceridemia on distal Chr 1 contains Apoa2 gene. Sequencing analysis revealed polymorphisms of Apoa2 in TH mice, suggesting Apoa2 as the candidate gene for the hyperlipidemia QTL. Gene expression analysis added novel information and aided in selection of candidates underlying the QTLs. Conclusions We identified several genetic loci that affect the quantitative variations of plasma lipid and glucose levels and obesity traits in a TH × B6 intercross. Polymorphisms in Apoa2 gene are suggested to be responsible for the Chr 1 QTL linked to hypercholesterolemia and hypertriglyceridemia. Further, genetical genomic analysis led to potential candidate genes for the QTLs. PMID:21167066

Use of single nucleotide polymorphisms in candidate genes associated with daughter pregnancy rate for prediction of genetic merit for reproduction in Holstein cows

USDA-ARS?s Scientific Manuscript database

We evaluated 69 SNPs in genes previously related to fertility and production traits for relationship to daughter pregnancy rate (DPR), cow conception rate (CCR) and heifer conception rate (HCR) in a separate population of Holstein cows grouped according to their predicted transmitting ability for DP...

Polymorphisms in HLA-DPB1 are associated with differences in rubella virus-specific humoral immunity after vaccination.

PubMed

Lambert, Nathaniel D; Haralambieva, Iana H; Kennedy, Richard B; Ovsyannikova, Inna G; Pankratz, Vernon Shane; Poland, Gregory A

2015-03-15

Vaccination with live attenuated rubella virus induces a strong immune response in most individuals. However, small numbers of subjects never reach or maintain protective antibody levels, and there is a high degree of variability in immune response. We have previously described genetic polymorphisms in HLA and other candidate genes that are associated with interindividual differences in humoral immunity to rubella virus. To expand our previous work, we performed a genome-wide association study (GWAS) to discover single-nucleotide polymorphisms (SNPs) associated with rubella virus-specific neutralizing antibodies. We identified rs2064479 in the HLA-DPB1 genetic region as being significantly associated with humoral immune response variations after rubella vaccination (P = 8.62 × 10(-8)). All other significant SNPs in this GWAS were located near the HLA-DPB1 gene (P ≤ 1 × 10(-7)). These findings demonstrate that polymorphisms in HLA-DPB1 are strongly associated with interindividual differences in neutralizing antibody levels to rubella vaccination and represent a validation of our previous HLA work. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

An ADAM33 polymorphism associates with progression of preschool wheeze into childhood asthma: a prospective case-control study with replication in a birth cohort study.

PubMed

Klaassen, Ester M M; Penders, John; Jöbsis, Quirijn; van de Kant, Kim D G; Thijs, Carel; Mommers, Monique; van Schayck, Constant P; van Eys, Guillaume; Koppelman, Gerard H; Dompeling, Edward

2015-01-01

The influence of asthma candidate genes on the development from wheeze to asthma in young children still needs to be defined. To link genetic variants in asthma candidate genes to progression of wheeze to persistent wheeze into childhood asthma. In a prospective study, children with recurrent wheeze from the ADEM (Asthma DEtection and Monitoring) study were followed until the age of six. At that age a classification (transient wheeze or asthma) was based on symptoms, lung function and medication use. In 198 children the relationship between this classification and 30 polymorphisms in 16 asthma candidate genes was assessed by logistic regression. In case of an association based on a p<0.10, replication analysis was performed in an independent birth cohort study (KOALA study, n = 248 included for the present analysis). In the ADEM study, the minor alleles of ADAM33 rs511898 and rs528557 and the ORMDL3/GSDMB rs7216389 polymorphisms were negatively associated, whereas the minor alleles of IL4 rs2243250 and rs2070874 polymorphisms were positively associated with childhood asthma. When replicated in the KOALA study, ADAM33 rs528557 showed a negative association of the CG/GG-genotype with progression of recurrent wheeze into childhood asthma (0.50 (0.26-0.97) p = 0.04) and no association with preschool wheeze. Polymorphisms in ADAM33, ORMDL3/GSDMB and IL4 were associated with childhood asthma in a group of children with recurrent wheeze. The replication of the negative association of the CG/GG-genotype of rs528557 ADAM33 with childhood asthma in an independent birth cohort study confirms that a compromised ADAM33 gene may be implicated in the progression of wheeze into childhood asthma.

A Family-Based Association Analysis and Meta-Analysis of the Reading Disabilities Candidate Gene DYX1C1

PubMed Central

Tran, C.; Gagnon, F.; Wigg, K.G.; Feng, Y.; Gomez, L.; Cate-Carter, T.D.; Kerr, E.N.; Field, L.L.; Kaplan, B.J.; Lovett, M.W.; Barr, C.L.

2017-01-01

Reading disabilities (RD) have a significant genetic basis and have shown linkage to multiple regions including chromosome 15q. Dyslexia susceptibility 1 candidate gene 1 (DYX1C1) on chromosome 15q21 was originally proposed as a candidate gene with two potentially functional polymorphisms at the −3G/A and 1249G/T positions showing association with RD. However, subsequent studies have yielded mixed results. We performed a literature review and meta-analysis of the −3G/A and 1249G/T polymorphisms, including new unpublished data from two family-based samples. Ten markers in DYX1C1 were genotyped in the two independently ascertained samples. Single marker and −3G/A:1249G/T haplotype analyses were performed for RD in both samples, and quantitative trait analyses using standardized reading-related measures was performed in one of the samples. For the meta-analysis, we used a random-effects model to summarize studies that tested for association between −3G/A or 1249G/T and RD. No significant association was found between the DYX1C1 SNPs and RD or any of the reading-related measures tested after correction for the number of tests performed. The previously reported risk haplotype (−3A:1249T) was not biased in transmission. A total of 9 and 10 study samples were included in the meta-analysis of the −3G/A and 1249G/T polymorphisms, respectively. Neither polymorphism reached statistical significance, but the heterogeneity for the 1249G/T polymorphism was high. The results of this study do not provide evidence for association between the putatively functional SNPs −3G/A and 1249G/T and RD. PMID:23341075

Validation of microRNA pathway polymorphisms in esophageal adenocarcinoma survival.

PubMed

Faluyi, Olusola O; Eng, Lawson; Qiu, Xin; Che, Jiahua; Zhang, Qihuang; Cheng, Dangxiao; Ying, Nanjiao; Tse, Alvina; Kuang, Qin; Dodbiba, Lorin; Renouf, Daniel J; Marsh, Sharon; Savas, Sevtap; Mackay, Helen J; Knox, Jennifer J; Darling, Gail E; Wong, Rebecca K S; Xu, Wei; Azad, Abul Kalam; Liu, Geoffrey

2017-02-01

Polymorphisms in miRNA and miRNA pathway genes have been previously associated with cancer risk and outcome, but have not been studied in esophageal adenocarcinoma outcomes. Here, we evaluate candidate miRNA pathway polymorphisms in esophageal adenocarcinoma prognosis and attempt to validate them in an independent cohort of esophageal adenocarcinoma patients. Among 231 esophageal adenocarcinoma patients of all stages/treatment plans, 38 candidate genetic polymorphisms (17 biogenesis, 9 miRNA targets, 5 pri-miRNA, 7 pre-miRNA) were genotyped and analyzed. Cox proportional hazard models adjusted for sociodemographic and clinicopathological covariates helped assess the association of genetic polymorphisms with overall survival (OS) and progression-free survival (PFS). Significantly associated polymorphisms were then evaluated in an independent cohort of 137 esophageal adenocarcinoma patients. Among the 231 discovery cohort patients, 86% were male, median diagnosis age was 64 years, 34% were metastatic at diagnosis, and median OS and PFS were 20 and 12 months, respectively. GEMIN3 rs197412 (aHR = 1.37, 95%CI: [1.04-1.80]; P = 0.02), hsa-mir-124-1 rs531564 (aHR = 0.60, 95% CI: [0.53-0.90]; P = 0.05), and KIAA0423 rs1053667 (aHR = 0.51, 95% CI: [0.28-0.96]; P = 0.04) were found associated with OS. Furthermore, GEMIN3 rs197412 (aHR = 1.33, 95% CI: [1.03-1.74]; P = 0.03) and KRT81 rs3660 (aHR = 1.29, 95% CI: [1.01-1.64]; P = 0.04) were found associated with PFS. Although none of these polymorphisms were significant in the second cohort, hsa-mir-124-1 rs531564 and KIAA0423 rs1053667 had trends in the same direction; when both cohorts were combined together, GEMIN3 rs197412, hsa-mir-124-1 rs531564, and KIAA0423 rs1053667 remained significantly associated with OS. We demonstrate the association of multiple miRNA pathway polymorphisms with esophageal adenocarcinoma prognosis in a discovery cohort of patients, which did not validate in a separate cohort but had consistent associations in the pooled cohort. Larger studies are required to confirm/validate the prognostic value of these polymorphisms in esophageal adenocarcinoma. © 2017 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

Whole-Genome Resequencing of Experimental Populations Reveals Polygenic Basis of Egg-Size Variation in Drosophila melanogaster

PubMed Central

Jha, Aashish R.; Miles, Cecelia M.; Lippert, Nodia R.; Brown, Christopher D.; White, Kevin P.; Kreitman, Martin

2015-01-01

Complete genome resequencing of populations holds great promise in deconstructing complex polygenic traits to elucidate molecular and developmental mechanisms of adaptation. Egg size is a classic adaptive trait in insects, birds, and other taxa, but its highly polygenic architecture has prevented high-resolution genetic analysis. We used replicated experimental evolution in Drosophila melanogaster and whole-genome sequencing to identify consistent signatures of polygenic egg-size adaptation. A generalized linear-mixed model revealed reproducible allele frequency differences between replicated experimental populations selected for large and small egg volumes at approximately 4,000 single nucleotide polymorphisms (SNPs). Several hundred distinct genomic regions contain clusters of these SNPs and have lower heterozygosity than the genomic background, consistent with selection acting on polymorphisms in these regions. These SNPs are also enriched among genes expressed in Drosophila ovaries and many of these genes have well-defined functions in Drosophila oogenesis. Additional genes regulating egg development, growth, and cell size show evidence of directional selection as genes regulating these biological processes are enriched for highly differentiated SNPs. Genetic crosses performed with a subset of candidate genes demonstrated that these genes influence egg size, at least in the large genetic background. These findings confirm the highly polygenic architecture of this adaptive trait, and suggest the involvement of many novel candidate genes in regulating egg size. PMID:26044351

Genetic, comparative genomic, and expression analyses of the Mc1r locus in the polychromatic Midas cichlid fish (Teleostei, Cichlidae Amphilophus sp.) species group.

PubMed

Henning, Frederico; Renz, Adina Josepha; Fukamachi, Shoji; Meyer, Axel

2010-05-01

Natural populations of the Midas cichlid species in several different crater lakes in Nicaragua exhibit a conspicuous color polymorphism. Most individuals are dark and the remaining have a gold coloration. The color morphs mate assortatively and sympatric population differentiation has been shown based on neutral molecular data. We investigated the color polymorphism using segregation analysis and a candidate gene approach. The segregation patterns observed in a mapping cross between a gold and a dark individual were consistent with a single dominant gene as a cause of the gold phenotype. This suggests that a simple genetic architecture underlies some of the speciation events in the Midas cichlids. We compared the expression levels of several candidate color genes Mc1r, Ednrb1, Slc45a2, and Tfap1a between the color morphs. Mc1r was found to be up regulated in the gold morph. Given its widespread association in color evolution and role on melanin synthesis, the Mc1r locus was further investigated using sequences derived from a genomic library. Comparative analysis revealed conserved synteny in relation to the majority of teleosts and highlighted several previously unidentified conserved non-coding elements (CNEs) in the upstream and downstream regions in the vicinity of Mc1r. The identification of the CNEs regions allowed the comparison of sequences from gold and dark specimens of natural populations. No polymorphisms were found between in the population sample and Mc1r showed no linkage to the gold phenotype in the mapping cross, demonstrating that it is not causally related to the color polymorphism in the Midas cichlid.

Oxytocin Receptor Genetic Variation Promotes Human Trust Behavior

PubMed Central

Krueger, Frank; Parasuraman, Raja; Iyengar, Vijeth; Thornburg, Matthew; Weel, Jaap; Lin, Mingkuan; Clarke, Ellen; McCabe, Kevin; Lipsky, Robert H.

2012-01-01

Given that human trust behavior is heritable and intranasal administration of oxytocin enhances trust, the oxytocin receptor (OXTR) gene is an excellent candidate to investigate genetic contributions to individual variations in trust behavior. Although a single-nucleotide polymorphism involving an adenine (A)/guanine (G) transition (rs53576) has been associated with socio-emotional phenotypes, its link to trust behavior is unclear. We combined genotyping of healthy male students (n = 108) with the administration of a trust game experiment. Our results show that a common occurring genetic variation (rs53576) in the OXTR gene is reliably associated with trust behavior rather than a general increase in trustworthy or risk behaviors. Individuals homozygous for the G allele (GG) showed higher trust behavior than individuals with A allele carriers (AA/AG). Although the molecular functionality of this polymorphism is still unknown, future research should clarify how the OXTR gene interacts with other genes and the environment in promoting socio-emotional behaviors. PMID:22347177

Effects of BDNF polymorphisms on antidepressant action.

PubMed

Tsai, Shih-Jen; Hong, Chen-Jee; Liou, Ying-Jay

2010-12-01

Evidence suggests that the down-regulation of the signaling pathway involving brain-derived neurotrophic factor (BDNF), a molecular element known to regulate neuronal plasticity and survival, plays an important role in the pathogenesis of major depression. The restoration of BDNF activity induced by antidepressant treatment has been implicated in the antidepressant therapeutic mechanism. Because there is variability among patients with major depressive disorder in terms of response to antidepressant treatment and since genetic factors may contribute to this inter-individual variability in antidepressant response, pharmacogenetic studies have tested the associations between genetic polymorphisms in candidate genes related to antidepressant therapeutic action. In human BDNF gene, there is a common functional polymorphism (Val66Met) in the pro-region of BDNF, which affects the intracellular trafficking of proBDNF. Because of the potentially important role of BDNF in the antidepressant mechanism, many pharmacogenetic studies have tested the association between this polymorphism and the antidepressant therapeutic response, but they have produced inconsistent results. A recent meta-analysis of eight studies, which included data from 1,115 subjects, suggested that the Val/Met carriers have increased antidepressant response in comparison to Val/Val homozygotes, particularly in the Asian population. The positive molecular heterosis effect (subjects heterozygous for a specific genetic polymorphism show a significantly greater effect) is compatible with animal studies showing that, although BDNF exerts an antidepressant effect, too much BDNF may have a detrimental effect on mood. Several recommendations are proposed for future antidepressant pharmacogenetic studies of BDNF, including the consideration of multiple polymorphisms and a haplotype approach, gene-gene interaction, a single antidepressant regimen, controlling for age and gender interactions, and pharmacogenetic effects on specific depressive symptom-clusters.

Genetic polymorphisms in one-carbon metabolism: associations with CpG island methylator phenotype (CIMP) in colon cancer and the modifying effects of diet

PubMed Central

Curtin, Karen; Slattery, Martha L.; Ulrich, Cornelia M.; Bigler, Jeannette; Levin, Theodore R.; Wolff, Roger K.; Albertsen, Hans; Potter, John D.; Samowitz, Wade S.

2008-01-01

This study investigated associations between CpG island methylator phenotype (CIMP) colon cancer and genetic polymorphisms relevant to one-carbon metabolism and thus, potentially the provision of methyl groups and risk of colon cancer. Data from a large, population-based case–control study (916 incident colon cancer cases and 1972 matched controls) were used. Candidate polymorphisms in methylenetetrahydrofolate reductase (MTHFR), thymidylate synthase (TS), transcobalamin II (TCNII), methionine synthase (MTR), reduced folate carrier (RFC), methylene-tetrahydrofolate dehydrogenase 1 (MTHFD1), dihydrofolate reductase (DHFR) and alcohol dehydrogenase 3 (ADH3) were evaluated. CIMP− or CIMP+ phenotype was based on five CpG island markers: MINT1, MINT2, MINT31, p16 and MLH1. The influence of specific dietary factors (folate, methionine, vitamin B12 and alcohol) on these associations was also analyzed. We hypothesized that polymorphisms involved in the provision of methyl groups would be associated with CIMP+ tumors (two or more of five markers methylated), potentially modified by diet. Few associations specific to CIMP+ tumors were observed overall, which does not support the hypothesis that the provision of methyl groups is important in defining a methylator phenotype. However, our data suggest that genetic polymorphisms in MTHFR 1298A > C, interacting with diet, may be involved in the development of highly CpG-methylated colon cancers. AC and CC genotypes in conjunction with a high-risk dietary pattern (low folate and methionine intake and high alcohol use) were associated with CIMP+ (OR = 2.1, 95% CI = 1.3–3.4 versus AA/high risk; P-interaction = 0.03). These results provide only limited support for a role of polymorphisms in one-carbon metabolism in the etiology of CIMP colon cancer. PMID:17449906

Genetic polymorphisms in one-carbon metabolism: associations with CpG island methylator phenotype (CIMP) in colon cancer and the modifying effects of diet.

PubMed

Curtin, Karen; Slattery, Martha L; Ulrich, Cornelia M; Bigler, Jeannette; Levin, Theodore R; Wolff, Roger K; Albertsen, Hans; Potter, John D; Samowitz, Wade S

2007-08-01

This study investigated associations between CpG island methylator phenotype (CIMP) colon cancer and genetic polymorphisms relevant to one-carbon metabolism and thus, potentially the provision of methyl groups and risk of colon cancer. Data from a large, population-based case-control study (916 incident colon cancer cases and 1,972 matched controls) were used. Candidate polymorphisms in methylenetetrahydrofolate reductase (MTHFR), thymidylate synthase (TS), transcobalamin II (TCNII), methionine synthase (MTR), reduced folate carrier (RFC), methylenetetrahydrofolate dehydrogenase 1 (MTHFD1), dihydrofolate reductase (DHFR) and alcohol dehydrogenase 3 (ADH3) were evaluated. CIMP- or CIMP+ phenotype was based on five CpG island markers: MINT1, MINT2, MINT31, p16 and MLH1. The influence of specific dietary factors (folate, methionine, vitamin B(12) and alcohol) on these associations was also analyzed. We hypothesized that polymorphisms involved in the provision of methyl groups would be associated with CIMP+ tumors (two or more of five markers methylated), potentially modified by diet. Few associations specific to CIMP+ tumors were observed overall, which does not support the hypothesis that the provision of methyl groups is important in defining a methylator phenotype. However, our data suggest that genetic polymorphisms in MTHFR 1,298A > C, interacting with diet, may be involved in the development of highly CpG-methylated colon cancers. AC and CC genotypes in conjunction with a high-risk dietary pattern (low folate and methionine intake and high alcohol use) were associated with CIMP+ (OR = 2.1, 95% CI = 1.3-3.4 versus AA/high risk; P-interaction = 0.03). These results provide only limited support for a role of polymorphisms in one-carbon metabolism in the etiology of CIMP colon cancer.

Association of genetic polymorphisms with risk of renal injury after coronary bypass graft surgery.

PubMed

Stafford-Smith, Mark; Podgoreanu, Mihai; Swaminathan, Madhav; Phillips-Bute, Barbara; Mathew, Joseph P; Hauser, Elizabeth H; Winn, Michelle P; Milano, Carmelo; Nielsen, Dahlia M; Smith, Mike; Morris, Richard; Newman, Mark F; Schwinn, Debra A

2005-03-01

Post-cardiac surgery renal dysfunction is a common, serious, multifactorial disorder, with interpatient variability predicted poorly by preoperative clinical, procedural, and biological markers. Therefore, we tested the hypothesis that selected gene variants are associated with acute renal injury, reflected by a serum creatinine level increase after cardiac surgery. One thousand six hundred seventy-one patients undergoing aortocoronary surgery were studied. Clinical covariates were recorded. DNA was isolated from preoperative blood; mass spectrometry was used for genotype analysis. A model was developed relating clinical and genetic factors to postoperative acute renal injury. A race effect was found; therefore, Caucasians and African Americans were analyzed separately. Overall, clinical factors alone account poorly for postoperative renal injury, although more so in African Americans than Caucasians. When 12 candidate polymorphisms were assessed, 2 alleles (interleukin 6 -572C and angiotensinogen 842C) showed a strong association with renal injury in Caucasians (P < 0.0001; >50% decrease in renal filtration when they present together). Using less stringent criteria for significance (0.01 > P > 0.001), 4 additional polymorphisms are identified (apolipoproteinE 448C [4], angiotensin receptor1 1166C, and endothelial nitric oxide synthase [eNOS] 894T in Caucasians; eNOS 894T and angiotensin-converting enzyme deletion and insertion in African Americans). Adding genetic to clinical factors resulted in the best model, with overall ability to explain renal injury increasing approximately 4-fold in Caucasians and doubling in African Americans (P < 0.0005). In this study, we identify genetic polymorphisms that collectively provide 2- to 4-fold improvement over preoperative clinical factors alone in explaining post-cardiac surgery renal dysfunction. From a mechanistic perspective, most identified genetic variants are associated with increased renal inflammatory and/or vasoconstrictor responses.

Polymorphism of Cyp1a1 (T6235C) is not a significant risk factor of osteoporosis in postmenopausal Indonesian woman

NASA Astrophysics Data System (ADS)

Auerkari, EI; Budhy, LW; Kiranahayu, R.; Djamal, NZ; Kusdhany, LS; Rahardjo, TBW; Talbot, Christopher

2018-05-01

Osteoporosis is an increasingly common disease resulting in reduced bone mineral density (BMD) and elevated likelihood of bone fracture, and particularly affected are postmenopausal women with additional risk factors including genetic predisposition. The CYP1A1, is one of the candidate genes that have been suggested to be associated with the pathogenesis of osteoporosis. This work aimed to evaluate the distribution of a selected polymorphism of this gene (T6235C) with respect to the BMD status in postmenopausal Indonesian women. The results show that osteoporosis is associated with age and menopause, as expected, but not with the tested polymorphism of CYP1A1 in the Indonesian sample population. It is suggested that other P450 cytochrome enzymes and their polymorphisms could provide more significant indicators of the future health of postmenopausal women.

PON1 promoter polymorphisms contribute to PCOS susceptibility and phenotypic outcomes in Indian women.

PubMed

Dadachanji, Roshan; Shaikh, Nuzhat; Patil, Anushree; Shah, Nalini; Mukherjee, Srabani

2018-06-30

Polycystic ovary syndrome is a common endocrinopathy characterized by anovulatory infertility, hyperandrogenism, insulin resistance and oxidative stress, which predisposes affected women to reproductive and cardiometabolic complications in later life. We have investigated the association of PON1 promoter polymorphisms with PCOS susceptibility, PON1 activity and its related traits in Indian women. The genotypic and allelic frequency distribution of only -907G/C polymorphism in PON1 promoter showed significant difference between non-hyperandrogenic control and PCOS women, and was significantly associated with reduced susceptibility to PCOS, considering the recessive model. PON1 lactonase and arylesterase activities were also significantly decreased in women with PCOS compared to controls. Further, PON1 promoter polymorphisms were linked to altered insulin and testosterone levels in hyperandrogenic and non-hyperandrogenic women with PCOS. This study highlights PON1 as an important candidate gene influencing genetic pathophysiology of PCOS. Copyright © 2018 Elsevier B.V. All rights reserved.

Systematic review: genetic biomarkers associated with anti-TNF treatment response in inflammatory bowel diseases.

PubMed

Bek, S; Nielsen, J V; Bojesen, A B; Franke, A; Bank, S; Vogel, U; Andersen, V

2016-09-01

Personalised medicine, including biomarkers for treatment selection, may provide new algorithms for more effective treatment of patients. Genetic variation may impact drug response and genetic markers could help selecting the best treatment strategy for the individual patient. To identify polymorphisms and candidate genes from the literature that are associated with anti-tumour necrosis factor (TNF) treatment response in patients with inflammatory bowel diseases (IBD), Crohn's disease (CD) and ulcerative colitis. We performed a PubMed literature search and retrieved studies reporting original data on association between polymorphisms and anti-TNF treatment response and conducted a meta-analysis. A functional polymorphism in FCGR3A was significantly associated with anti-TNF treatment response among CD patients using biological response criterion (decrease in C-reactive protein, levels). Meta-analyses showed that polymorphisms in TLR2 (rs3804099, OR (95% CI) = 2.17 (1.35-3.47)], rs11938228 [OR = 0.64 (0.43-0.96)], TLR4 (rs5030728) [OR = 3.18 (1.63-6.21)], TLR9 (rs352139) [OR = 0.43 (0.21-0.88)], TNFRSF1A (rs4149570) [OR = 2.06 (1.02-4.17)], IFNG (rs2430561) [OR = 1.66 (1.05-2.63)], IL6 (rs10499563) [OR = 1.65 (1.04-2.63)] and IL1B (rs4848306) [OR = 1.88 (1.05-3.35)] were significantly associated with response among IBD patients using clinical response criteria. A positive predictive value of 0.96 was achieved by combining five genetic markers in an explorative analysis. There are no genetic markers currently available which are adequately predictive of anti-TNF response for use in the clinic. Genetic markers bear the advantage that they do not change over time. Therefore, hypothesis-free approaches, testing a large number of polymorphisms in large, well-characterised cohorts, are required in order to identify genetic profiles with larger effect sizes, which could be employed as biomarkers for treatment selection in clinical settings. © 2016 The Authors. Alimentary Pharmacology & Therapeutics published by John Wiley & Sons Ltd.

Genetic variants in oxytocin receptor gene (OXTR) and childhood physical abuse collaborate to modify the risk of aggression in chinese adolescents.

PubMed

Zhang, Yanmei; Wu, Chunxia; Chang, Hongjuan; Yan, Qiuge; Wu, Linguo; Yuan, Shanshan; Xiang, Jingjing; Hao, Wen; Yu, Yizhen

2018-03-15

Accumulating evidence suggests that genetic and environmental factors may influence aggression susceptibility. However, the etiology of aggressive behavior remains unknown. Compared to some extensively studied candidate genes of aggression, very little is known about the OXTR gene. The objective of this study was to determine whether OXTR genetic variants were associated with aggression risk and whether these polymorphisms showed interactive effects with childhood maltreatment on aggression in Chinese adolescents. A total of 996 participants including 488 cases and 488 controls were selected in our study. Aggression, childhood maltreatment were measured by self-reported questionnaire. Buccal cells were collected. Genotyping was performed using SNPscan. Logistic regressions were used to estimate both main effects of OXTR polymorphisms and the interactive effects with childhood maltreatment on aggressive behavior. Participants who carried the rs237885 TT genotypes in OXTR had a higher risk of aggression compared to those who carried GG or GT genotypes under the recessive model (OR=1.40, 95% CI, 1.04-1.89) after controlling for potential confounders. In addition, we also found that the polymorphism had a synergic additive interaction with childhood physical abuse on the aggression risk. The subjects in the present study were only males, thus our findings and conclusions could not be generalized to females. The present study provides evidence that OXTR genetic variants may contribute to aggression susceptibility. Moreover, this is the first study reporting significant interactive effects of OXTR polymorphism and childhood physical abuse on aggressive behavior in Chinese adolescents. Copyright © 2018 Elsevier B.V. All rights reserved.

Gene-gene interactions among genetic variants from obesity candidate genes for nonobese and obese populations in type 2 diabetes.

PubMed

Lin, Eugene; Pei, Dee; Huang, Yi-Jen; Hsieh, Chang-Hsun; Wu, Lawrence Shih-Hsin

2009-08-01

Recent studies indicate that obesity may play a key role in modulating genetic predispositions to type 2 diabetes (T2D). This study examines the main effects of both single-locus and multilocus interactions among genetic variants in Taiwanese obese and nonobese individuals to test the hypothesis that obesity-related genes may contribute to the etiology of T2D independently and/or through such complex interactions. We genotyped 11 single nucleotide polymorphisms for 10 obesity candidate genes including adrenergic beta-2-receptor surface, adrenergic beta-3-receptor surface, angiotensinogen, fat mass and obesity associated gene, guanine nucleotide binding protein beta polypeptide 3 (GNB3), interleukin 6 receptor, proprotein convertase subtilisin/kexin type 1 (PCSK1), uncoupling protein 1, uncoupling protein 2, and uncoupling protein 3. There were 389 patients diagnosed with T2D and 186 age- and sex-matched controls. Single-locus analyses showed significant main effects of the GNB3 and PCSK1 genes on the risk of T2D among the nonobese group (p = 0.002 and 0.047, respectively). Further, interactions involving GNB3 and PCSK1 were suggested among the nonobese population using the generalized multifactor dimensionality reduction method (p = 0.001). In addition, interactions among angiotensinogen, fat mass and obesity associated gene, GNB3, and uncoupling protein 3 genes were found in a significant four-locus generalized multifactor dimensionality reduction model among the obese population (p = 0.001). The results suggest that the single nucleotide polymorphisms from the obesity candidate genes may contribute to the risk of T2D independently and/or in an interactive manner according to the presence or absence of obesity.

How immunogenetically different are domestic pigs from wild boars: a perspective from single-nucleotide polymorphisms of 19 immunity-related candidate genes.

PubMed

Chen, Shanyuan; Gomes, Rui; Costa, Vânia; Santos, Pedro; Charneca, Rui; Zhang, Ya-ping; Liu, Xue-hong; Wang, Shao-qing; Bento, Pedro; Nunes, Jose-Luis; Buzgó, József; Varga, Gyula; Anton, István; Zsolnai, Attila; Beja-Pereira, Albano

2013-10-01

The coexistence of wild boars and domestic pigs across Eurasia makes it feasible to conduct comparative genetic or genomic analyses for addressing how genetically different a domestic species is from its wild ancestor. To test whether there are differences in patterns of genetic variability between wild and domestic pigs at immunity-related genes and to detect outlier loci putatively under selection that may underlie differences in immune responses, here we analyzed 54 single-nucleotide polymorphisms (SNPs) of 19 immunity-related candidate genes on 11 autosomes in three pairs of wild boar and domestic pig populations from China, Iberian Peninsula, and Hungary. Our results showed no statistically significant differences in allele frequency and heterozygosity across SNPs between three pairs of wild and domestic populations. This observation was more likely due to the widespread and long-lasting gene flow between wild boars and domestic pigs across Eurasia. In addition, we detected eight coding SNPs from six genes as outliers being under selection consistently by three outlier tests (BayeScan2.1, FDIST2, and Arlequin3.5). Among four non-synonymous outlier SNPs, one from TLR4 gene was identified as being subject to positive (diversifying) selection and three each from CD36, IFNW1, and IL1B genes were suggested as under balancing selection. All of these four non-synonymous variants were predicted as being benign by PolyPhen-2. Our results were supported by other independent lines of evidence for positive selection or balancing selection acting on these four immune genes (CD36, IFNW1, IL1B, and TLR4). Our study showed an example applying a candidate gene approach to identify functionally important mutations (i.e., outlier loci) in wild and domestic pigs for subsequent functional experiments.

Genetic susceptibility to renal scar formation after urinary tract infection: a systematic review and meta-analysis of candidate gene polymorphisms.

PubMed

Zaffanello, Marco; Tardivo, Stefano; Cataldi, Luigi; Fanos, Vassilios; Biban, Paolo; Malerba, Giovanni

2011-07-01

Identifying patients who may develop renal scarring after urinary tract infections (UTI) remains challenging, as clinical determinants explain only a portion of individual risk. An additional factor that likely affects risk is individual genetic variability. We searched for peer-reviewed articles from 1980 to December 2009 in electronic databases that reported results showing an association between gene polymorphims and renal scaring after UTI. Two independent researchers screened articles using predetermined criteria. Studies were assessed for methodological quality using an aggregate scoring system. The 18 studies ultimately included in the review had investigated 16 polymorphisms in nine genes in association with renal scarring formation after UTI. Based on the predetermined criteria for assessing the quality of the studies, 12 studies (67%) were identified as being of poor quality design. A meta-analysis of cumulative studies showed on association between renal scarring formation after UTI and the angiotensin converting enzyme insertion/deletion polymorphism [ACE I/D; recessive model for D allele; odds ratio (OR) 1.73, 95% confidence interval (CI) 1.09-2.74, P = 0.02] or transforming growth factor (TGF)-β1 c.-509 T > C polymorphism (dominant model for T allele; OR 2.24, 95% CI 1.34-3.76, P = 0.002). However, heterogeneity among studies was large, indicating a strong difference that cannot only be explained by differences in study design. The studies reviewed in this article support a modest involvement of the vasomotor and inflammatory genes in the development of renal scarring after UTIs. This review also shows that only few possible candidate genes have been investigated for an association with renal scarring, raising the hypothesis that some gene polymorphisms may exert their effects through an interaction with as yet uninvestigated factors that may be related to geographic and/or socio-economic differences.

Two functional serotonin polymorphisms moderate the effect of food reinforcement on BMI

PubMed Central

Carr, Katelyn A.; Lin, Henry; Fletcher, Kelly D.; Sucheston, Lara; Singh, Prashant K.; Salis, Robbert; Erbe, Richard; Faith, Myles; Allison, David; Stice, Eric; Epstein, Leonard H.

2014-01-01

Food reinforcement, or the motivation to eat, has been associated with increased energy intake, greater body weight and prospective weight gain. Much of the previous research on the reinforcing value of food has focused on the role of dopamine, but it may be worthwhile to examine genetic polymorphisms in the serotonin and opioid systems as these neurotransmitters have been shown to be related to reinforcement processes and to influence energy intake. We examined the relationship among 44 candidate genetic polymorphisms in the dopamine, serotonin and opioid systems, and food reinforcement and body mass index (BMI) in a sample of 245 individuals. Polymorphisms in the Monoamine oxidase A (MAOA-LPR) and serotonin receptor 2A genes (rs6314) moderated the effect of food reinforcement on BMI, accounting for an additional 5-10% variance and revealed a potential role of the single nucleotide polymorphism, rs6314 in the serotonin 2A receptor as a differential susceptibility factor for obesity. Differential susceptibility describes a factor that can confer either risk or protection depending on a second variable, such that rs6314 is predictive of both high and low BMI based on the level of food reinforcement, while the diathesis stress or dual-gain model influences only one end of the outcome measure. The interaction with MAOA-LPR better fit the dual-risk or diathesis stress model, with the 3.5R/4R allele conferring protection for individuals low in food reinforcement. These results provide new insight into genes theoretically involved in obesity and support the hypothesis that genetics moderate the association between food reinforcement on BMI. PMID:23544600

Multilocus patterns of polymorphism and selection across the X chromosome of Caenorhabditis remanei.

PubMed

Cutter, Asher D

2008-03-01

Natural selection and neutral processes such as demography, mutation, and gene conversion all contribute to patterns of polymorphism within genomes. Identifying the relative importance of these varied components in evolution provides the principal challenge for population genetics. To address this issue in the nematode Caenorhabditis remanei, I sampled nucleotide polymorphism at 40 loci across the X chromosome. The site-frequency spectrum for these loci provides no evidence for population size change, and one locus presents a candidate for linkage to a target of balancing selection. Selection for codon usage bias leads to the non-neutrality of synonymous sites, and despite its weak magnitude of effect (N(e)s approximately 0.1), is responsible for profound patterns of diversity and divergence in the C. remanei genome. Although gene conversion is evident for many loci, biased gene conversion is not identified as a significant evolutionary process in this sample. No consistent association is observed between synonymous-site diversity and linkage-disequilibrium-based estimators of the population recombination parameter, despite theoretical predictions about background selection or widespread genetic hitchhiking, but genetic map-based estimates of recombination are needed to rigorously test for a diversity-recombination relationship. Coalescent simulations also illustrate how a spurious correlation between diversity and linkage-disequilibrium-based estimators of recombination can occur, due in part to the presence of unbiased gene conversion. These results illustrate the influence that subtle natural selection can exert on polymorphism and divergence, in the form of codon usage bias, and demonstrate the potential of C. remanei for detecting natural selection from genomic scans of polymorphism.

Candidate genes have sex-specific effects on timing of spring migration and moult speed in a long-distance migratory bird.

PubMed

Bazzi, Gaia; Podofillini, Stefano; Gatti, Emanuele; Gianfranceschi, Luca; Cecere, Jacopo G; Spina, Fernando; Saino, Nicola; Rubolini, Diego

2017-10-01

The timing of major life-history events, such as migration and moult, is set by endogenous circadian and circannual clocks, that have been well characterized at the molecular level. Conversely, the genetic sources of variation in phenology and in other behavioral traits have been sparsely addressed. It has been proposed that inter-individual variability in the timing of seasonal events may arise from allelic polymorphism at phenological candidate genes involved in the signaling cascade of the endogenous clocks. In this study of a long-distance migratory passerine bird, the willow warbler Phylloscopus trochilus , we investigated whether allelic variation at 5 polymorphic loci of 4 candidate genes ( Adcyap1 , Clock , Creb1 , and Npas2 ), predicted 2 major components of the annual schedule, namely timing of spring migration across the central Mediterranean sea and moult speed, the latter gauged from ptilochronological analyses of tail feathers moulted in the African winter quarters. We identified a novel Clock gene locus ( Clock region 3) showing polyQ polymorphism, which was however not significantly associated with any phenotypic trait. Npas2 allele size predicted male (but not female) spring migration date, with males bearing longer alleles migrating significantly earlier than those bearing shorter alleles. Creb1 allele size significantly predicted male (but not female) moult speed, longer alleles being associated with faster moult. All other genotype-phenotype associations were statistically non-significant. These findings provide new evidence for a role of candidate genes in modulating the phenology of different circannual activities in long-distance migratory birds, and for the occurrence of sex-specific candidate gene effects.

Association of genetic variations in the serotonin and dopamine systems with aggressive behavior in the Chinese adolescent population: Single- and multiple-risk genetic variants.

PubMed

Chang, Hongjuan; Yan, Qiuge; Tang, Lina; Huang, Juan; Ma, Yuqiao; Ye, Xiaozhou; Wu, Chunxia; Wu, Linguo; Yu, Yizhen

2018-01-01

Genetic predisposition is an important factor leading to aggressive behavior. However, the relationship between genetic polymorphisms and aggressive behavior has not been elucidated. We identified candidate genes located in the dopaminergic and serotonin system (DRD3, DRD4, and FEV) that had been previously reported to be associated with aggressive behavior. We investigated 14 tag single-nucleotide polymorphisms (SNPs) using a multi-analytic strategy combining logistic regression (LR) and classification and regression tree (CART) to explore higher-order interactions between these SNPs and aggressive behavior in 318 patients and 558 controls. Both LR and CART analyses suggested that the rs16859448 polymorphism is the strongest individual factor associated with aggressive behavior risk. In CART analysis, individuals carrying the combined genotypes of rs16859448TT/GT-rs11246228CT/TT-rs3773679TT had the highest risk, while rs16859448GG-rs2134655CT had the lowest risk (OR = 5.25, 95% CI: 2.53-10.86). This study adds to the growing evidence on the association of single- and multiple-risk variants in DRD3, DRD4, and FEV with aggressive behavior in Chinese adolescents. However, the aggressive behavior scale used to diagnose aggression in this study did not account for comorbid conditions; therefore, further studies are needed to confirm our observations. Copyright © 2017 Elsevier B.V. All rights reserved.

Association of vWA and TPOX Polymorphisms with Venous Thrombosis in Mexican Mestizos

PubMed Central

Meraz-Ríos, Marco Antonio; Majluf-Cruz, Abraham; Santana, Carla; Noris, Gino; Camacho-Mejorado, Rafael; Acosta-Saavedra, Leonor C.; Calderón-Aranda, Emma S.; Hernández-Juárez, Jesús; Magaña, Jonathan J.; Gómez, Rocío

2014-01-01

Objective. Venous thromboembolism (VTE) is a multifactorial disorder and, worldwide, the most important cause of morbidity and mortality. Genetic factors play a critical role in its aetiology. Microsatellites are the most important source of human genetic variation having more phenotypic effect than many single nucleotide polymorphisms. Hence, we evaluate a possible relationship between VTE and the genetic variants in von Willebrand factor, human alpha fibrinogen, and human thyroid peroxidase microsatellites to identify possible diagnostic markers. Methods. Genotypes were obtained from 177 patients with VTE and 531 nonrelated individuals using validated genotyping methods. The allelic frequencies were compared; Bayesian methods were used to correct population stratification to avoid spurious associations. Results. The vWA-18, TPOX-9, and TPOX-12 alleles were significantly associated with VTE. Moreover, subjects bearing the combination vWA-18/TPOX-12 loci exhibited doubled risk for VTE (95% CI = 1.02–3.64), whereas the combination vWA-18/TPOX-9 showed an OR = 10 (95% CI = 4.93–21.49). Conclusions. The vWA and TPOX microsatellites are good candidate biomarkers in venous thromboembolism diseases and could help to elucidate their origins. Additionally, these polymorphisms could become useful markers for genetic studies of VTE in the Mexican population; however, further studies should be done owing that this data only show preliminary evidence. PMID:25250329

Exploration of genetically determined resistance against hepatitis C infection in high-risk injecting drug users.

PubMed

Sugden, P B; Cameron, B; Luciani, F; Lloyd, A R

2014-08-01

Genetic resistance to specific infections is well recognized. In hepatitis C virus (HCV) infection, genetic polymorphisms in IL-28B and the killer cell immunoglobulin-like receptors (KIR) and their HLA class I ligands have been shown to affect clearance of the virus following infection. There are limited data regarding resistance to established HCV infection. Reliable quantification of repeated exposure in high-risk populations, such as injecting drug users (IDU), is a key limitation of previous studies of resistance. Behavioural data and DNA from IDU (n = 210) in the Hepatitis C Incidence and Transmission Study in prisons (HITS-p) cohort were genotyped for polymorphisms in: IL-28B, peptidyl-prolyl isomerase A (PPIA), HLA-C and KIR2. To quantify risk, a composite risk index based on factors predictive of incident HCV infection was derived. Logistic regression analysis revealed the risk index was strongly associated with incident HCV infection (P < 0.0001). The upper tertile of the uninfected individuals had risk indices comparable to the incident cases, but remained uninfected. There were no significant differences in the frequencies of IL-28B or PPIA polymorphisms between these exposed-uninfected cases, or in the frequencies of KIR2-DL3, HLA-C1, or their combination. A framework for the investigation of genetic determinants of resistance to HCV infection has been developed. Several candidate gene associations were investigated and excluded. Further investigation of genetic determinants of resistance to HCV infection is warranted. © 2014 John Wiley & Sons Ltd.

New generation pharmacogenomic tools: a SNP linkage disequilibrium Map, validated SNP assay resource, and high-throughput instrumentation system for large-scale genetic studies.

PubMed

De La Vega, Francisco M; Dailey, David; Ziegle, Janet; Williams, Julie; Madden, Dawn; Gilbert, Dennis A

2002-06-01

Since public and private efforts announced the first draft of the human genome last year, researchers have reported great numbers of single nucleotide polymorphisms (SNPs). We believe that the availability of well-mapped, quality SNP markers constitutes the gateway to a revolution in genetics and personalized medicine that will lead to better diagnosis and treatment of common complex disorders. A new generation of tools and public SNP resources for pharmacogenomic and genetic studies--specifically for candidate-gene, candidate-region, and whole-genome association studies--will form part of the new scientific landscape. This will only be possible through the greater accessibility of SNP resources and superior high-throughput instrumentation-assay systems that enable affordable, highly productive large-scale genetic studies. We are contributing to this effort by developing a high-quality linkage disequilibrium SNP marker map and an accompanying set of ready-to-use, validated SNP assays across every gene in the human genome. This effort incorporates both the public sequence and SNP data sources, and Celera Genomics' human genome assembly and enormous resource ofphysically mapped SNPs (approximately 4,000,000 unique records). This article discusses our approach and methodology for designing the map, choosing quality SNPs, designing and validating these assays, and obtaining population frequency ofthe polymorphisms. We also discuss an advanced, high-performance SNP assay chemisty--a new generation of the TaqMan probe-based, 5' nuclease assay-and high-throughput instrumentation-software system for large-scale genotyping. We provide the new SNP map and validation information, validated SNP assays and reagents, and instrumentation systems as a novel resource for genetic discoveries.

Identification of Immune-Relevant Factors Conferring Sarcoidosis Genetic Risk

PubMed Central

Fischer, Annegret; Ellinghaus, David; Nutsua, Marcel; Hofmann, Sylvia; Montgomery, Courtney G.; Iannuzzi, Michael C.; Rybicki, Benjamin A.; Petrek, Martin; Mrazek, Frantisek; Pabst, Stefan; Grohé, Christian; Grunewald, Johan; Ronninger, Marcus; Eklund, Anders; Padyukov, Leonid; Mihailovic-Vucinic, Violeta; Jovanovic, Dragana; Sterclova, Martina; Homolka, Jiri; Nöthen, Markus M.; Herms, Stefan; Gieger, Christian; Strauch, Konstantin; Winkelmann, Juliane; Boehm, Bernhard O.; Brand, Stephan; Büning, Carsten; Schürmann, Manfred; Ellinghaus, Eva; Baurecht, Hansjörg; Lieb, Wolfgang; Nebel, Almut; Müller-Quernheim, Joachim; Franke, Andre

2015-01-01

Rationale: Genetic variation plays a significant role in the etiology of sarcoidosis. However, only a small fraction of its heritability has been explained so far. Objectives: To define further genetic risk loci for sarcoidosis, we used the Immunochip for a candidate gene association study of immune-associated loci. Methods: Altogether the study population comprised over 19,000 individuals. In a two-stage design, 1,726 German sarcoidosis cases and 5,482 control subjects were genotyped for 128,705 single-nucleotide polymorphisms using the Illumina Immunochip for the screening step. The remaining 3,955 cases, 7,514 control subjects, and 684 parents of affected offspring were used for validation and replication of 44 candidate and two established risk single-nucleotide polymorphisms. Measurements and Main Results: Four novel susceptibility loci were identified with genome-wide significance in the European case-control populations, located on chromosomes 12q24.12 (rs653178; ATXN2/SH2B3), 5q33.3 (rs4921492; IL12B), 4q24 (rs223498; MANBA/NFKB1), and 2q33.2 (rs6748088; FAM117B). We further defined three independent association signals in the HLA region with genome-wide significance, peaking in the BTNL2 promoter region (rs5007259), at HLA-B (rs4143332/HLA-B*0801) and at HLA-DPB1 (rs9277542), and found another novel independent signal near IL23R (rs12069782) on chromosome 1p31.3. Conclusions: Functional predictions and protein network analyses suggest a prominent role of the drug-targetable IL23/Th17 signaling pathway in the genetic etiology of sarcoidosis. Our findings reveal a substantial genetic overlap of sarcoidosis with diverse immune-mediated inflammatory disorders, which could be of relevance for the clinical application of modern therapeutics PMID:26051272

A preliminary study for identification of candidate AFLP markers under artificial selection for shell color in pearl oyster Pinctada fucata.

PubMed

Zou, Keshu; Zhang, Dianchang; Guo, Huayang; Zhu, Caiyan; Li, Min; Jiang, Shigui

2014-05-25

Pearl oyster Pinctada fucata is widely cultured to produce seawater pearl in South China, and the quality of pearl is significantly affected by its shell color. Thus the Pearl Oyster Selective Breeding Program (POSBP) was carried out for the shell color and growth traits. The black (B), gold (G), red (R) and white (W) shell strains with fast growth trait were achieved after five successive generation selection. In this study, AFLP technique was used to scan genome of four strains with different shell colors to identify the candidate markers under artificial selection. Eight AFLP primer combinations were screened and yielded 688 loci, 676 (98.26%) of which were polymorphic. In black, gold, red and white strains, the percentage of polymorphic loci was 90.41%, 87.79%, 93.60% and 93.31%, respectively, Nei's gene diversity was 0.3225, 0.2829, 0.3221 and 0.3292, Shannon's information index was 0.4801, 0.4271, 0.4825 and 0.4923, and the value of FST was 0.1805. These results suggested that the four different shell color strains had high genetic diversity and great genetic differentiation among strains, which had been subjected to the continuous selective pressures during the artificial selective breeding. Furthermore, six outlier loci were considered as the candidate markers under artificial selection for shell color. This study provides a molecular evidence for the inheritance of shell color of P. fucata. Copyright © 2014 Elsevier B.V. All rights reserved.

Multilocus adaptation associated with heat resistance in reef-building corals.

PubMed

Bay, Rachael A; Palumbi, Stephen R

2014-12-15

The evolution of tolerance to future climate change depends on the standing stock of genetic variation for resistance to climate-related impacts, but genes contributing to climate tolerance in wild populations are poorly described in number and effect. Physiology and gene expression patterns have shown that corals living in naturally high-temperature microclimates are more resistant to bleaching because of both acclimation and fixed effects, including adaptation. To search for potential genetic correlates of these fixed effects, we genotyped 15,399 single nucleotide polymorphisms (SNPs) in 23 individual tabletop corals, Acropora hyacinthus, within a natural temperature mosaic in backreef lagoons on Ofu Island, American Samoa. Despite overall lack of population substructure, we identified 114 highly divergent SNPs as candidates for environmental selection, via multiple stringent outlier tests, and correlations with temperature. Corals from the warmest reef location had higher minor allele frequencies across these candidate SNPs, a pattern not seen for noncandidate loci. Furthermore, within backreef pools, colonies in the warmest microclimates had a higher number and frequency of alternative alleles at candidate loci. These data suggest mild selection for alternate alleles at many loci in these corals during high heat episodes and possible maintenance of extensive polymorphism through multilocus balancing selection in a heterogeneous environment. In this case, a natural population harbors a reservoir of alleles preadapted to high temperatures, suggesting potential for future evolutionary response to climate change. Copyright © 2014 Elsevier Ltd. All rights reserved.

Obstructive heart defects associated with candidate genes, maternal obesity, and folic acid supplementation.

PubMed

Tang, Xinyu; Cleves, Mario A; Nick, Todd G; Li, Ming; MacLeod, Stewart L; Erickson, Stephen W; Li, Jingyun; Shaw, Gary M; Mosley, Bridget S; Hobbs, Charlotte A

2015-06-01

Right-sided and left-sided obstructive heart defects (OHDs) are subtypes of congenital heart defects, in which the heart valves, arteries, or veins are abnormally narrow or blocked. Previous studies have suggested that the development of OHDs involved a complex interplay between genetic variants and maternal factors. Using the data from 569 OHD case families and 1,644 control families enrolled in the National Birth Defects Prevention Study (NBDPS) between 1997 and 2008, we conducted an analysis to investigate the genetic effects of 877 single nucleotide polymorphisms (SNPs) in 60 candidate genes for association with the risk of OHDs, and their interactions with maternal use of folic acid supplements, and pre-pregnancy obesity. Applying log-linear models based on the hybrid design, we identified a SNP in methylenetetrahydrofolate reductase (MTHFR) gene (C677T polymorphism) with a main genetic effect on the occurrence of OHDs. In addition, multiple SNPs in betaine-homocysteine methyltransferase (BHMT and BHMT2) were also identified to be associated with the occurrence of OHDs through significant main infant genetic effects and interaction effects with maternal use of folic acid supplements. We also identified multiple SNPs in glutamate-cysteine ligase, catalytic subunit (GCLC) and DNA (cytosine-5-)-methyltransferase 3 beta (DNMT3B) that were associated with elevated risk of OHDs among obese women. Our findings suggested that the risk of OHDs was closely related to a combined effect of variations in genes in the folate, homocysteine, or glutathione/transsulfuration pathways, maternal use of folic acid supplements and pre-pregnancy obesity. © 2015 Wiley Periodicals, Inc.

Genetic variants influencing effectiveness of weight loss strategies.

PubMed

Deram, Sophie; Villares, Sandra M F

2009-03-01

Body weight excess has an increasingly high prevalence in the world. Obesity is a complex disease of multifactorial origin with a polygenic condition affected by environmental factors. Weight loss is a primary strategy to treat obesity and its morbidities. Weight changes through life depend on the interaction of environmental, behavioral and genetic factors. Interindividual variation of weight loss in response to different types of interventions (behavioral, caloric restriction, exercise, drug or surgery) has been observed. In this article, currently available data on the role of candidate gene polymorphisms in weight loss are reviewed. Even though control of weight loss by genotype was described in twin and family studies, it is premature to recommend use of genotyping in the design of therapeutic diets or drug treatment. Future studies will have to be large in order to assess the effects of multiple polymorphisms, and will have to control factors other than diet.

Association of brain-derived neurotrophic factor valine to methionine polymorphism with sexual dysfunction following selective serotonin reuptake inhibitor treatment in female patients with major depressive disorder.

PubMed

Nazree, Nur Elia; Mohamed, Zahurin; Reynolds, Gavin P; Mohd Zain, Shamsul; Masiran, Ruziana; Sidi, Hatta; Chong, Lu Ann; Hway, Anne Yee; Adlan, Aida Syarinaz; Zainal, Nor Zuraida

2016-12-01

The occurrence of female sexual dysfunction (FSD) in patients with major depressive disorder (MDD) receiving selective serotonin reuptake inhibitors (SSRIs) treatment gives negative impacts on patients' quality of life and causes treatment discontinuation. We aimed to investigate whether genetic polymorphism of identified candidate gene is associated with FSD in our study population. This is a cross-sectional study. A total of 95 female patients with MDD who met the criteria of the study were recruited and were specifically assessed on the sexual function by trained psychiatrists. Patients' DNA was genotyped for BDNF Val66Met polymorphism using real-time polymerase chain reaction. The prevalence of FSD in this study is 31.6%. In the FSD group, patients with problematic marriage were significantly more frequent compared with patients who did not have problematic marriage (P = 0.009). Significant association was detected in the lubrication domain with BDNF Val66Met polymorphism (P = 0.030) using additive genetic model, with even stronger association when using the recessive model (P = 0.013). This study suggested that there was no significant association between BDNF Val66Met with FSD. However, this polymorphism is significantly associated with lubrication disorder in patients treated with SSRIs. © 2015 Wiley Publishing Asia Pty Ltd.

How does mother-to-child transmission of HIV differ among African populations? Lessons from MBL2 genetic variation in Zimbabweans.

PubMed

Mhandire, Kudakwashe; Pharo, Gavin; Kandawasvika, Gwendolene Q; Duri, Kerina; Swart, Marelize; Stray-Pedersen, Babill; Dandara, Collet

2014-07-01

Mannose binding lectin (MBL) is a pathogen pattern recognition protein involved in antimicrobial activities. Variation in MBL2 gene has been extensively implicated in differential outcomes of infectious diseases in studies conducted outside Africa, but virtually very little is known on the role of this candidate gene in the African continent. We investigated human genetic variations in MBL2 in a Zimbabwean pediatric population and their putative associations with HIV infection in perinatally exposed children. One hundred and four children aged 7 to 9 years comprising 68 perinatally exposed to HIV (32 who were born infected and 36 who were uninfected) and 36 unexposed controls were recruited. DNA samples were genotyped for MBL2 polymorphisms using PCR-RFLP and sequencing. HIV infected children had markedly variable and significantly lower mean height (p=0.03) and weight (p=0.005) when compared to the uninfected children. Using all samples, frequencies for MBL2 genetic variants for the Zimbabwean population were calculated. Twelve single nucleotide polymorphisms were observed and minor alleles occurred with the following frequencies: -550C>G (G: 0.02), -435G>A (A: 0.08), -428A>C (C: 0.39), -394A>G (A: 0.39), -328AGAGAA ins/del (AGAGAA ins: 0.44), -245G>A (A: 0.05), -221C>G (C: 0.12), -111A>T (T: 0.10), -70C>T (C: 0.46), +4C>T (C: 0.45), novel -595G>A (A: 0.02), and 170G>A (0.24). We found that the MBL2 +4T variant displayed a trend for association with reduced risk of HIV transmission from mother-to-child but the remaining vast majority of the genetic markers did not show a significant association. We conclude (1) the MBL2 gene is highly polymorphic in the Zimbabwean population, and (2) MBL2 genetic variation does not appear to play a major role in influencing the risk of mother-to-child HIV transmission in our study sample. These observations contest the hitherto significant role of this candidate gene for HIV transmission from mother-to-child in non-African populations and thus, further speak to the limits of extrapolating genomic association studies directly to the African populations from studies conducted elsewhere. It is hoped that more OMICS research in a diverse set of African countries can shed further light on the putative role (or the lack thereof ) of this candidate gene in HIV transmission in the continent, a major global health burden in Africa.

Multilocus Genotypes of Relevance for Drug Metabolizing Enzymes and Therapy with Thiopurines in Patients with Acute Lymphoblastic Leukemia

PubMed Central

Stocco, Gabriele; Franca, Raffaella; Verzegnassi, Federico; Londero, Margherita; Rabusin, Marco; Decorti, Giuliana

2013-01-01

Multilocus genotypes have been shown to be of relevance for using pharmacogenomic principles to individualize drug therapy. As it relates to thiopurine therapy, genetic polymorphisms of TPMT are strongly associated with the pharmacokinetics and clinical effects of thiopurines (mercaptopurine and azathioprine), influencing their toxicity and efficacy. We have recently demonstrated that TPMT and ITPA genotypes constitute a multilocus genotype of pharmacogenetic relevance for children with acute lymphoblastic leukemia (ALL) receiving thiopurine therapy. The use of high-throughput genomic analysis allows identification of additional candidate genetic factors associated with pharmacogenetic phenotypes, such as TPMT enzymatic activity: PACSIN2 polymorphisms have been identified by a genome-wide analysis, combining evaluation of polymorphisms and gene expression, as a significant determinant of TPMT activity in the HapMap CEU cell lines and the effects of PACSIN2 on TPMT activity and mercaptopurine induced adverse effects were confirmed in children with ALL. Combination of genetic factors of relevance for thiopurine metabolizing enzyme activity, based on the growing understanding of their association with drug metabolism and efficacy, is particularly promising for patients with pediatric ALL. The knowledge basis and clinical applications for multilocus genotypes of importance for therapy with mercaptopurine in pediatric ALL is discussed in the present review. PMID:23335936

Initial evidence that polymorphisms in neurotransmitter-regulating genes contribute to being born small for gestational age

PubMed Central

Morgan, Angharad R.; Thompson, John M.D.; Waldie, Karen E.; Cornforth, Christine M.; Turic, Darko; Sonuga-Barke, Edmund J.S.; Lam, Wen-Jiun; Ferguson, Lynnette R.; Mitchell, Edwin A.

2012-01-01

Being born small for gestational age (SGA) is a putative risk factor for the development of later cognitive and psychiatric health problems. While the inter-uterine environment has been shown to play an important role in predicting birth weight, little is known about the genetic factors that might be important. Here we test the hypothesis that neurotransmitter-regulating genes implicated in psychiatric disorders previously shown to be associated with SGA (such as attention-deficit hyperactivity disorder) are themselves predictive of SGA. DNA was collected from 227 SGA and 319 appropriate for gestational age children taking part in the Auckland Birthweight Collaborative Study. Candidate single nucleotide polymorphisms in genes regulating activity within dopamine, serotonin, glutamate and gamma-aminobutyric acid pathways were genotyped. Multiple regression analysis, controlling for potentially confounding factors, supported nominally significant associations between SGA and single nucleotide polymorphisms in COMT, HTR2A, SLC1A1 and SLC6A1. This is the first evidence that genes implicated in psychiatric disorders previously linked to SGA status themselves predict SGA. This highlights the possibility that the link between SGA and psychiatric disorders such as attention-deficit hyperactivity disorder may in part be genetically determined – that SGA marks pre-existing genetic risk for later problems. PMID:27625810

Functional polymorphisms associated with human muscle size and strength.

PubMed

Thompson, Paul D; Moyna, Niall; Seip, Richard; Price, Thomas; Clarkson, Priscilla; Angelopoulos, Theodore; Gordon, Paul; Pescatello, Linda; Visich, Paul; Zoeller, Robert; Devaney, Joseph M; Gordish, Heather; Bilbie, Stephen; Hoffman, Eric P

2004-07-01

Skeletal muscle is critically important to human performance and health, but little is known of the genetic factors influencing muscle size, strength, and its response to exercise training. The Functional single nucleotide polymorphisms (SNP) Associated with Muscle Size and Strength, or FAMuSS, Study is a multicenter, NIH-funded program to examine the influence of gene polymorphisms on skeletal muscle size and strength before and after resistance exercise training. One thousand men and women, age 18 - 40 yr, will train their nondominant arm for 12 wk. Skeletal muscle size (magnetic resonance imaging) and isometric and dynamic strength will be measured before and after training. Individuals whose baseline values or response to training deviate > or = 1.5 SD will be defined as outliers and examined for genetic variants. Initially candidate genes previously associated with muscle performance will be examined, but the study will ultimately attempt to identify genes associated with muscle performance. FAMuSS should help identify genetic factors associated with muscle performance and the response to exercise training. Such insight should contribute to our ability to predict the individual response to exercise training but may also contribute to understanding better muscle physiology, to identifying individuals who are susceptible to muscle loss with environmental challenge, and to developing pharmacologic agents capable of preserving muscle size and function.

Heritability and molecular-genetic basis of the P3 event-related brain potential: A genome-wide association study

PubMed Central

MALONE, STEPHEN M.; VAIDYANATHAN, UMA; BASU, SAONLI; MILLER, MICHAEL B.; MCGUE, MATT; IACONO, WILLIAM G.

2014-01-01

P3 amplitude is a candidate endophenotype for disinhibitory psychopathology, psychosis, and other disorders. The present study is a comprehensive analysis of the behavioral- and molecular-genetic basis of P3 amplitude and a P3 genetic factor score in a large community sample (N = 4,211) of adolescent twins and their parents, genotyped for 527,829 single nucleotide polymorphisms (SNPs). Biometric models indicated that as much as 65% of the variance in each measure was due to additive genes. All SNPs in aggregate accounted for approximately 40% to 50% of the heritable variance. However, analyses of individual SNPs did not yield any significant associations. Analyses of individual genes did not confirm previous associations between P3 amplitude and candidate genes but did yield a novel association with myelin expression factor 2 (MYEF2). Main effects of individual variants may be too small to be detected by GWAS without larger samples. PMID:25387705

Non-additive Effects in Genomic Selection

PubMed Central

Varona, Luis; Legarra, Andres; Toro, Miguel A.; Vitezica, Zulma G.

2018-01-01

In the last decade, genomic selection has become a standard in the genetic evaluation of livestock populations. However, most procedures for the implementation of genomic selection only consider the additive effects associated with SNP (Single Nucleotide Polymorphism) markers used to calculate the prediction of the breeding values of candidates for selection. Nevertheless, the availability of estimates of non-additive effects is of interest because: (i) they contribute to an increase in the accuracy of the prediction of breeding values and the genetic response; (ii) they allow the definition of mate allocation procedures between candidates for selection; and (iii) they can be used to enhance non-additive genetic variation through the definition of appropriate crossbreeding or purebred breeding schemes. This study presents a review of methods for the incorporation of non-additive genetic effects into genomic selection procedures and their potential applications in the prediction of future performance, mate allocation, crossbreeding, and purebred selection. The work concludes with a brief outline of some ideas for future lines of that may help the standard inclusion of non-additive effects in genomic selection. PMID:29559995

Non-additive Effects in Genomic Selection.

PubMed

Varona, Luis; Legarra, Andres; Toro, Miguel A; Vitezica, Zulma G

2018-01-01

In the last decade, genomic selection has become a standard in the genetic evaluation of livestock populations. However, most procedures for the implementation of genomic selection only consider the additive effects associated with SNP (Single Nucleotide Polymorphism) markers used to calculate the prediction of the breeding values of candidates for selection. Nevertheless, the availability of estimates of non-additive effects is of interest because: (i) they contribute to an increase in the accuracy of the prediction of breeding values and the genetic response; (ii) they allow the definition of mate allocation procedures between candidates for selection; and (iii) they can be used to enhance non-additive genetic variation through the definition of appropriate crossbreeding or purebred breeding schemes. This study presents a review of methods for the incorporation of non-additive genetic effects into genomic selection procedures and their potential applications in the prediction of future performance, mate allocation, crossbreeding, and purebred selection. The work concludes with a brief outline of some ideas for future lines of that may help the standard inclusion of non-additive effects in genomic selection.

Association studies on the bovine lipoprotein lipase gene polymorphism with growth and carcass quality traits in Qinchuan cattle.

PubMed

Gui, Linsheng; Jia, Cuiling; Zhang, Yaran; Zhao, Chunping; Zan, Linsen

2016-04-01

Lipoprotein lipase (LPL) is considered as an essential enzyme in lipid deposition and tissue metabolism. It has been proposed to be a lead candidate gene for genetic markers of lipid deposition and energy balance. In this paper, polymorphisms in the LPL gene were investigated in 554 Chinese Qinchuan cattle by PCR-RFLP and DNA sequencing. Seven single nucleotide polymorphisms (SNPs) were identified, which included one mutation (g.91C > T) in the 5'untranslated region (UTR), four synonymous mutations (g.17015A > G, g.18362G > A, g.18377T > C and g.19873T > C) and two mutations (g.25225A > G and g.25316T > G) in the 3'UTR. The frequencies of SNP g.18377T > C and g.25316T > G were skewed from Hardy-Weinberg equilibrium in all the samples (chi-square test, P < 0.05). An association analysis showed that five loci (except for g.91C > T and g.18377T > C) were significantly correlated with some growth and carcass quality traits. These results demonstrate that LPL might be a potential candidate gene for marker-assisted selection (MAS). Copyright © 2016. Published by Elsevier Ltd.

Population structure and genetic basis of the agronomic traits of upland cotton in China revealed by a genome-wide association study using high-density SNPs.

PubMed

Huang, Cong; Nie, Xinhui; Shen, Chao; You, Chunyuan; Li, Wu; Zhao, Wenxia; Zhang, Xianlong; Lin, Zhongxu

2017-11-01

Gossypium hirsutum L. represents the largest source of textile fibre, and China is one of the largest cotton-producing and cotton-consuming countries in the world. To investigate the genetic architecture of the agronomic traits of upland cotton in China, a diverse and nationwide population containing 503 G. hirsutum accessions was collected for a genome-wide association study (GWAS) on 16 agronomic traits. The accessions were planted in four places from 2012 to 2013 for phenotyping. The CottonSNP63K array and a published high-density map based on this array were used for genotyping. The 503 G. hirsutum accessions were divided into three subpopulations based on 11 975 quantified polymorphic single-nucleotide polymorphisms (SNPs). By comparing the genetic structure and phenotypic variation among three genetic subpopulations, seven geographic distributions and four breeding periods, we found that geographic distribution and breeding period were not the determinants of genetic structure. In addition, no obvious phenotypic differentiations were found among the three subpopulations, even though they had different genetic backgrounds. A total of 324 SNPs and 160 candidate quantitative trait loci (QTL) regions were identified as significantly associated with the 16 agronomic traits. A network was established for multieffects in QTLs and interassociations among traits. Thirty-eight associated regions had pleiotropic effects controlling more than one trait. One candidate gene, Gh_D08G2376, was speculated to control the lint percentage (LP). This GWAS is the first report using high-resolution SNPs in upland cotton in China to comprehensively investigate agronomic traits, and it provides a fundamental resource for cotton genetic research and breeding. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Impact of DNA repair genes polymorphism (XPD and XRCC1) on the risk of breast cancer in Egyptian female patients.

PubMed

Hussien, Yousry Mostafa; Gharib, Amal F; Awad, Hanan A; Karam, Rehab A; Elsawy, Wael H

2012-02-01

The genes involved in DNA repair system play a crucial role in the protection against mutations. It has been hypothesized that functional deficiencies in highly conserved DNA repair processes resulting from polymorphic variation may increase genetic susceptibility to breast cancer (BC). The aim of the present study was to evaluate the association of genetic polymorphisms in 2 DNA repair genes, XPD (Asp312Asn) and XRCC1 (A399G), with BC susceptibility. We further investigated the potential combined effect of these DNA repair variants on BC risk. Both XPD (xeroderma pigmentosum group D) and XRCC1 (X-ray repair cross-complementing group 1) polymorphisms were characterized in 100 BC Egyptian females and 100 healthy women who had no history of any malignancy by amplification refractory mutation system-polymerase chain reaction (ARMS-PCR) method and PCR with confronting two-pair primers (PCR-CTPP), using DNA from peripheral blood in a case control study. Our results revealed that the frequencies of AA genotype of XPD codon 312 polymorphism were significantly higher in the BC patients than in the normal individuals (P ≤ 0.003), and did not observe any association between the XRCC1 Arg399Gln polymorphism and risk of developing BC. Also, no association between both XPD Asp312Asn and XRCC1 A399G polymorphisms and the clinical characteristics of disease. Finally, the combination of AA(XPD) + AG(XRCC1) were significantly associated with BC risk. Our results suggested that, XPD gene is an important candidate gene for susceptibility to BC. Also, gene-gene interaction between XPD(AA) + XRCC1(AG) polymorphism may be associated with increased risk of BC in Egyptian women.

Genetic variation of the porcine NR5A1 is associated with meat color.

PubMed

Görres, Andreas; Ponsuksili, Siriluck; Wimmers, Klaus; Muráni, Eduard

2016-02-01

Because of the central role of Steroidogenic factor 1 in the regulation of the development and function of steroidogenic tissues, including the adrenal gland, we chose the encoding gene NR5A1 as a candidate for stress response, meat quality and carcass composition in the domestic pig. To identify polymorphisms of the porcine NR5A1 we comparatively sequenced the coding, untranslated and regulatory regions in four commercial pig lines. Single nucleotide polymorphisms could be found in the 3' UTR and in an intronic enhancer, whereas no polymorphisms were detected in the proximal promoter and coding region. A subset of the detected polymorphisms was genotyped in Piétrain x (German Large White x German Landrace) and German Landrace pigs. For the same animals, carcass composition traits, meat quality characteristics and parameters of adrenal function were recorded. Associations with meat color were found for two of the discovered SNPs in Piétrain x (German Large White x German Landrace) and German Landrace pigs but no connections to parameters of adrenal function could be established. We conclude that NR5A1 variations influence meat color in a hypothalamus-pituitary-adrenal axis independent manner and that further regulatory regions need to be analyzed for genetic variations to understand the discovered effects.

Genetic variants associated with the root system architecture of oilseed rape (Brassica napus L.) under contrasting phosphate supply.

PubMed

Wang, Xiaohua; Chen, Yanling; Thomas, Catherine L; Ding, Guangda; Xu, Ping; Shi, Dexu; Grandke, Fabian; Jin, Kemo; Cai, Hongmei; Xu, Fangsen; Yi, Bin; Broadley, Martin R; Shi, Lei

2017-08-01

Breeding crops with ideal root system architecture for efficient absorption of phosphorus is an important strategy to reduce the use of phosphate fertilizers. To investigate genetic variants leading to changes in root system architecture, 405 oilseed rape cultivars were genotyped with a 60K Brassica Infinium SNP array in low and high P environments. A total of 285 single-nucleotide polymorphisms were associated with root system architecture traits at varying phosphorus levels. Nine single-nucleotide polymorphisms corroborate a previous linkage analysis of root system architecture quantitative trait loci in the BnaTNDH population. One peak single-nucleotide polymorphism region on A3 was associated with all root system architecture traits and co-localized with a quantitative trait locus for primary root length at low phosphorus. Two more single-nucleotide polymorphism peaks on A5 for root dry weight at low phosphorus were detected in both growth systems and co-localized with a quantitative trait locus for the same trait. The candidate genes identified on A3 form a haplotype 'BnA3Hap', that will be important for understanding the phosphorus/root system interaction and for the incorporation into Brassica napus breeding programs. © The Author 2017. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

Whole-Genome Resequencing of Experimental Populations Reveals Polygenic Basis of Egg-Size Variation in Drosophila melanogaster.

PubMed

Jha, Aashish R; Miles, Cecelia M; Lippert, Nodia R; Brown, Christopher D; White, Kevin P; Kreitman, Martin

2015-10-01

Complete genome resequencing of populations holds great promise in deconstructing complex polygenic traits to elucidate molecular and developmental mechanisms of adaptation. Egg size is a classic adaptive trait in insects, birds, and other taxa, but its highly polygenic architecture has prevented high-resolution genetic analysis. We used replicated experimental evolution in Drosophila melanogaster and whole-genome sequencing to identify consistent signatures of polygenic egg-size adaptation. A generalized linear-mixed model revealed reproducible allele frequency differences between replicated experimental populations selected for large and small egg volumes at approximately 4,000 single nucleotide polymorphisms (SNPs). Several hundred distinct genomic regions contain clusters of these SNPs and have lower heterozygosity than the genomic background, consistent with selection acting on polymorphisms in these regions. These SNPs are also enriched among genes expressed in Drosophila ovaries and many of these genes have well-defined functions in Drosophila oogenesis. Additional genes regulating egg development, growth, and cell size show evidence of directional selection as genes regulating these biological processes are enriched for highly differentiated SNPs. Genetic crosses performed with a subset of candidate genes demonstrated that these genes influence egg size, at least in the large genetic background. These findings confirm the highly polygenic architecture of this adaptive trait, and suggest the involvement of many novel candidate genes in regulating egg size. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Genetic association of angiogenesis- and hypoxia-related gene polymorphisms with osteonecrosis of the femoral head

PubMed Central

Hong, Jung Min; Kim, Tae-Ho; Kim, Hyun-Ju; Park, Eui-Kyun

2010-01-01

Multiple factors have been implicated in the development of osteonecrosis of the femoral head (ONFH). In particular, non-traumatic ONFH is directly or indirectly related to injury of the vascular supply to the femoral head. Thus, hypoxia in the femoral head caused by impaired blood flow may be an important risk factor for ONFH. In this study, we investigated whether genetic variations of angiogenesis- and hypoxia-related genes contribute to an increased risk for the development of ONFH. Candidate genes were selected based on known hypoxia and angiogenesis pathways. An association study was performed using an Affymetrix Targeted Genotyping 3K Chip array with 460 ONFH patients and 300 control subjects. We showed that single nucleotide polymorphisms (SNPs) in the genes TF, VEGFC, IGFBP3, and ACE were associated with an increased risk of ONFH. On the other hand, SNPs in the KDR and NRP1 genes were associated with protection against ONFH. The most important finding was that one SNP (rs2453839) in the IGFBP3 gene was significantly associated with a higher risk of ONFH (P = 0.0061, OR 7.74). In subgroup analysis, most candidate gene variations that were associated with ONFH occurred in the idiopathic subgroup. Among other SNPs, ACE SNPs were associated with steroid-induced ONFH (P = 0.0018-0.0037, OR > 3). Collectively, our findings suggest that genetic variations in angiogenesis- and hypoxia-related genes may help to identify susceptibility factors for the development of ONFH in the Korean population. PMID:20215856

A combinatorial approach of comprehensive QTL-based comparative genome mapping and transcript profiling identified a seed weight-regulating candidate gene in chickpea

PubMed Central

Bajaj, Deepak; Upadhyaya, Hari D.; Khan, Yusuf; Das, Shouvik; Badoni, Saurabh; Shree, Tanima; Kumar, Vinod; Tripathi, Shailesh; Gowda, C. L. L.; Singh, Sube; Sharma, Shivali; Tyagi, Akhilesh K.; Chattopdhyay, Debasis; Parida, Swarup K.

2015-01-01

High experimental validation/genotyping success rate (94–96%) and intra-specific polymorphic potential (82–96%) of 1536 SNP and 472 SSR markers showing in silico polymorphism between desi ICC 4958 and kabuli ICC 12968 chickpea was obtained in a 190 mapping population (ICC 4958 × ICC 12968) and 92 diverse desi and kabuli genotypes. A high-density 2001 marker-based intra-specific genetic linkage map comprising of eight LGs constructed is comparatively much saturated (mean map-density: 0.94 cM) in contrast to existing intra-specific genetic maps in chickpea. Fifteen robust QTLs (PVE: 8.8–25.8% with LOD: 7.0–13.8) associated with pod and seed number/plant (PN and SN) and 100 seed weight (SW) were identified and mapped on 10 major genomic regions of eight LGs. One of 126.8 kb major genomic region harbouring a strong SW-associated robust QTL (Caq'SW1.1: 169.1–171.3 cM) has been delineated by integrating high-resolution QTL mapping with comprehensive marker-based comparative genome mapping and differential expression profiling. This identified one potential regulatory SNP (G/A) in the cis-acting element of candidate ERF (ethylene responsive factor) TF (transcription factor) gene governing seed weight in chickpea. The functionally relevant molecular tags identified have potential to be utilized for marker-assisted genetic improvement of chickpea. PMID:25786576

Development of a single nucleotide polymorphism barcode to genotype Plasmodium vivax infections.

PubMed

Baniecki, Mary Lynn; Faust, Aubrey L; Schaffner, Stephen F; Park, Daniel J; Galinsky, Kevin; Daniels, Rachel F; Hamilton, Elizabeth; Ferreira, Marcelo U; Karunaweera, Nadira D; Serre, David; Zimmerman, Peter A; Sá, Juliana M; Wellems, Thomas E; Musset, Lise; Legrand, Eric; Melnikov, Alexandre; Neafsey, Daniel E; Volkman, Sarah K; Wirth, Dyann F; Sabeti, Pardis C

2015-03-01

Plasmodium vivax, one of the five species of Plasmodium parasites that cause human malaria, is responsible for 25-40% of malaria cases worldwide. Malaria global elimination efforts will benefit from accurate and effective genotyping tools that will provide insight into the population genetics and diversity of this parasite. The recent sequencing of P. vivax isolates from South America, Africa, and Asia presents a new opportunity by uncovering thousands of novel single nucleotide polymorphisms (SNPs). Genotyping a selection of these SNPs provides a robust, low-cost method of identifying parasite infections through their unique genetic signature or barcode. Based on our experience in generating a SNP barcode for P. falciparum using High Resolution Melting (HRM), we have developed a similar tool for P. vivax. We selected globally polymorphic SNPs from available P. vivax genome sequence data that were located in putatively selectively neutral sites (i.e., intergenic, intronic, or 4-fold degenerate coding). From these candidate SNPs we defined a barcode consisting of 42 SNPs. We analyzed the performance of the 42-SNP barcode on 87 P. vivax clinical samples from parasite populations in South America (Brazil, French Guiana), Africa (Ethiopia) and Asia (Sri Lanka). We found that the P. vivax barcode is robust, as it requires only a small quantity of DNA (limit of detection 0.3 ng/μl) to yield reproducible genotype calls, and detects polymorphic genotypes with high sensitivity. The markers are informative across all clinical samples evaluated (average minor allele frequency > 0.1). Population genetic and statistical analyses show the barcode captures high degrees of population diversity and differentiates geographically distinct populations. Our 42-SNP barcode provides a robust, informative, and standardized genetic marker set that accurately identifies a genomic signature for P. vivax infections.

Development of a Single Nucleotide Polymorphism Barcode to Genotype Plasmodium vivax Infections

PubMed Central

Baniecki, Mary Lynn; Faust, Aubrey L.; Schaffner, Stephen F.; Park, Daniel J.; Galinsky, Kevin; Daniels, Rachel F.; Hamilton, Elizabeth; Ferreira, Marcelo U.; Karunaweera, Nadira D.; Serre, David; Zimmerman, Peter A.; Sá, Juliana M.; Wellems, Thomas E.; Musset, Lise; Legrand, Eric; Melnikov, Alexandre; Neafsey, Daniel E.; Volkman, Sarah K.; Wirth, Dyann F.; Sabeti, Pardis C.

2015-01-01

Plasmodium vivax, one of the five species of Plasmodium parasites that cause human malaria, is responsible for 25–40% of malaria cases worldwide. Malaria global elimination efforts will benefit from accurate and effective genotyping tools that will provide insight into the population genetics and diversity of this parasite. The recent sequencing of P. vivax isolates from South America, Africa, and Asia presents a new opportunity by uncovering thousands of novel single nucleotide polymorphisms (SNPs). Genotyping a selection of these SNPs provides a robust, low-cost method of identifying parasite infections through their unique genetic signature or barcode. Based on our experience in generating a SNP barcode for P. falciparum using High Resolution Melting (HRM), we have developed a similar tool for P. vivax. We selected globally polymorphic SNPs from available P. vivax genome sequence data that were located in putatively selectively neutral sites (i.e., intergenic, intronic, or 4-fold degenerate coding). From these candidate SNPs we defined a barcode consisting of 42 SNPs. We analyzed the performance of the 42-SNP barcode on 87 P. vivax clinical samples from parasite populations in South America (Brazil, French Guiana), Africa (Ethiopia) and Asia (Sri Lanka). We found that the P. vivax barcode is robust, as it requires only a small quantity of DNA (limit of detection 0.3 ng/μl) to yield reproducible genotype calls, and detects polymorphic genotypes with high sensitivity. The markers are informative across all clinical samples evaluated (average minor allele frequency > 0.1). Population genetic and statistical analyses show the barcode captures high degrees of population diversity and differentiates geographically distinct populations. Our 42-SNP barcode provides a robust, informative, and standardized genetic marker set that accurately identifies a genomic signature for P. vivax infections. PMID:25781890

Two functional serotonin polymorphisms moderate the effect of food reinforcement on BMI.

PubMed

Carr, Katelyn A; Lin, Henry; Fletcher, Kelly D; Sucheston, Lara; Singh, Prashant K; Salis, Robbert J; Erbe, Richard W; Faith, Myles S; Allison, David B; Stice, Eric; Epstein, Leonard H

2013-06-01

Food reinforcement, or the motivation to eat, has been associated with increased energy intake, greater body weight, and prospective weight gain. Much of the previous research on the reinforcing value of food has focused on the role of dopamine, but it may be worthwhile to examine genetic polymorphisms in the serotonin and opioid systems as these neurotransmitters have been shown to be related to reinforcement processes and to influence energy intake. We examined the relationship among 44 candidate genetic polymorphisms in the dopamine, serotonin, and opioid systems, as well as food reinforcement and body mass index (BMI) in a sample of 245 individuals. Polymorphisms in the monoamine oxidase A (MAOA-LPR) and serotonin receptor 2A genes (rs6314) moderated the effect of food reinforcement on BMI, accounting for an additional 5-10% variance and revealed a potential role of the single nucleotide polymorphism, rs6314, in the serotonin 2A receptor as a differential susceptibility factor for obesity. Differential susceptibility describes a factor that can confer either risk or protection depending on a second variable, such that rs6314 is predictive of both high and low BMI based on the level of food reinforcement, while the diathesis stress or dual-gain model only influences one end of the outcome measure. The interaction with MAOA-LPR better fits the diathesis stress model, with the 3.5R/4R allele conferring protection for individuals low in food reinforcement. These results provide new insight into genes theoretically involved in obesity, and support the hypothesis that genetics moderate the association between food reinforcement and BMI. PsycINFO Database Record (c) 2013 APA, all rights reserved.

Transcription Factor Binding Site Polymorphism in the Motilin Gene Associated with Left-Sided Displacement of the Abomasum in German Holstein Cattle

PubMed Central

Mömke, Stefanie; Sickinger, Marlene; Rehage, Jürgen; Doll, Klaus; Distl, Ottmar

2012-01-01

Left-sided displacement of the abomasum (LDA) is a common disease in many dairy cattle breeds. A genome-wide screen for QTL for LDA in German Holstein (GH) cows indicated motilin (MLN) as a candidate gene on bovine chromosome 23. Genomic DNA sequence analysis of MLN revealed a total of 32 polymorphisms. All informative polymorphisms used for association analyses in a random sample of 1,136 GH cows confirmed MLN as a candidate for LDA. A single nucleotide polymorphism (FN298674:g.90T>C) located within the first non-coding exon of bovine MLN affects a NKX2-5 transcription factor binding site and showed significant associations (ORallele = 0.64; −log10Pallele = 6.8, −log10Pgenotype = 7.0) with LDA. An expression study gave evidence of a significantly decreased MLN expression in cows carrying the mutant allele (C). In individuals heterozygous or homozygous for the mutation, MLN expression was decreased by 89% relative to the wildtype. FN298674:g.90T>C may therefore play a role in bovine LDA via the motility of the abomasum. This MLN SNP appears useful to reduce the incidence of LDA in German Holstein cattle and provides a first step towards a deeper understanding of the genetics of LDA. PMID:22536407

Reasoning over genetic variance information in cause-and-effect models of neurodegenerative diseases

PubMed Central

Naz, Mufassra; Kodamullil, Alpha Tom

2016-01-01

The work we present here is based on the recent extension of the syntax of the Biological Expression Language (BEL), which now allows for the representation of genetic variation information in cause-and-effect models. In our article, we describe, how genetic variation information can be used to identify candidate disease mechanisms in diseases with complex aetiology such as Alzheimer’s disease and Parkinson’s disease. In those diseases, we have to assume that many genetic variants contribute moderately to the overall dysregulation that in the case of neurodegenerative diseases has such a long incubation time until the first clinical symptoms are detectable. Owing to the multilevel nature of dysregulation events, systems biomedicine modelling approaches need to combine mechanistic information from various levels, including gene expression, microRNA (miRNA) expression, protein–protein interaction, genetic variation and pathway. OpenBEL, the open source version of BEL, has recently been extended to match this requirement, and we demonstrate in our article, how candidate mechanisms for early dysregulation events in Alzheimer’s disease can be identified based on an integrative mining approach that identifies ‘chains of causation’ that include single nucleotide polymorphism information in BEL models. PMID:26249223

Population-Based Resequencing of Experimentally Evolved Populations Reveals the Genetic Basis of Body Size Variation in Drosophila melanogaster

PubMed Central

Turner, Thomas L.; Stewart, Andrew D.; Fields, Andrew T.; Rice, William R.; Tarone, Aaron M.

2011-01-01

Body size is a classic quantitative trait with evolutionarily significant variation within many species. Locating the alleles responsible for this variation would help understand the maintenance of variation in body size in particular, as well as quantitative traits in general. However, successful genome-wide association of genotype and phenotype may require very large sample sizes if alleles have low population frequencies or modest effects. As a complementary approach, we propose that population-based resequencing of experimentally evolved populations allows for considerable power to map functional variation. Here, we use this technique to investigate the genetic basis of natural variation in body size in Drosophila melanogaster. Significant differentiation of hundreds of loci in replicate selection populations supports the hypothesis that the genetic basis of body size variation is very polygenic in D. melanogaster. Significantly differentiated variants are limited to single genes at some loci, allowing precise hypotheses to be formed regarding causal polymorphisms, while other significant regions are large and contain many genes. By using significantly associated polymorphisms as a priori candidates in follow-up studies, these data are expected to provide considerable power to determine the genetic basis of natural variation in body size. PMID:21437274

Evidence of natural selection acting on a polymorphic hybrid incompatibility locus in Mimulus.

PubMed

Sweigart, Andrea L; Flagel, Lex E

2015-02-01

As a common cause of reproductive isolation in diverse taxa, hybrid incompatibilities are fundamentally important to speciation. A key question is which evolutionary forces drive the initial substitutions within species that lead to hybrid dysfunction. Previously, we discovered a simple genetic incompatibility that causes nearly complete male sterility and partial female sterility in hybrids between the two closely related yellow monkeyflower species Mimulus guttatus and M. nasutus. In this report, we fine map the two major incompatibility loci-hybrid male sterility 1 (hms1) and hybrid male sterility 2 (hms2)-to small nuclear genomic regions (each <70 kb) that include strong candidate genes. With this improved genetic resolution, we also investigate the evolutionary dynamics of hms1 in a natural population of M. guttatus known to be polymorphic at this locus. Using classical genetic crosses and population genomics, we show that a 320-kb region containing the hms1 incompatibility allele has risen to intermediate frequency in this population by strong natural selection. This finding provides direct evidence that natural selection within plant species can lead to hybrid dysfunction between species. Copyright © 2015 by the Genetics Society of America.

A Gene-Oriented Haplotype Comparison Reveals Recently Selected Genomic Regions in Temperate and Tropical Maize Germplasm

PubMed Central

Zhang, Jie; Li, Yongxiang; Zheng, Jun; Zhang, Hongwei; Yang, Xiaohong; Wang, Jianhua; Wang, Guoying

2017-01-01

The extensive genetic variation present in maize (Zea mays) germplasm makes it possible to detect signatures of positive artificial selection that occurred during temperate and tropical maize improvement. Here we report an analysis of 532,815 polymorphisms from a maize association panel consisting of 368 diverse temperate and tropical inbred lines. We developed a gene-oriented approach adapting exonic polymorphisms to identify recently selected alleles by comparing haplotypes across the maize genome. This analysis revealed evidence of selection for more than 1100 genomic regions during recent improvement, and included regulatory genes and key genes with visible mutant phenotypes. We find that selected candidate target genes in temperate maize are enriched in biosynthetic processes, and further examination of these candidates highlights two cases, sucrose flux and oil storage, in which multiple genes in a common pathway can be cooperatively selected. Finally, based on available parallel gene expression data, we hypothesize that some genes were selected for regulatory variations, resulting in altered gene expression. PMID:28099470

Warfarin Anticoagulation Therapy in Caribbean Hispanics of Puerto Rico: A Candidate Gene Association Study.

PubMed

Claudio-Campos, Karla; Labastida, Aurora; Ramos, Alga; Gaedigk, Andrea; Renta-Torres, Jessicca; Padilla, Dariana; Rivera-Miranda, Giselle; Scott, Stuart A; Ruaño, Gualberto; Cadilla, Carmen L; Duconge-Soler, Jorge

2017-01-01

Existing algorithms account for ~50% of observed variance in warfarin dose requirements after including common polymorphisms. However, they do not perform as well in populations other than Caucasians, in part because some ethno-specific genetic variants are overlooked. The objective of the present study was to identify genetic polymorphisms that can explain variability in warfarin dose requirements among Caribbean Hispanics of Puerto Rico. Next-Generation Sequencing of candidate genes CYP2C9 and VKORC1 and genotyping by DMET® Plus Assay of cardiovascular patients were performed. We also aimed at characterizing the genomic structure and admixture pattern of this study cohort. Our study used the Extreme Discordant Phenotype approach to perform a case-control association analysis. The CYP2C9 variant rs2860905, which was found in all the major haplotypes occurring in the Puerto Rican population, showed stronger association with warfarin sensitivity (<4 mg/day) than common variants CYP2C9 * 2 and CYP2C9 * 3 . Although, CYP2C9 * 2 and CYP2C9 * 3 are separately contained within two of the haplotypes, 10 subjects with the sensitive phenotype were carriers of only the CYP2C9 rs2860905 variant. Other polymorphisms in CES2 and ABCB1 were found to be associated with warfarin resistance. Incorporation of rs 2860905 in a regression model ( R 2 = 0.63, MSE = 0.37) that also includes additional genetics (i.e., VKORC1 -1639 G>A; CYP2C9 rs1856908; ABCB1 c.IVS9-44A>G/ rs10276036; CES2 c.269-965A>G/ rs4783745) and non-genetic factors (i.e., hypertension, diabetes and age) showed better prediction of warfarin dose requirements than CYP2C9 * 2 and CYP2C9 * 3 combined (partial R 2 = 0.132 vs. 0.023 and 0.007, respectively, p < 0.001). The genetic background of Puerto Ricans in the study cohort showed a tri-hybrid admixture pattern, with a slightly higher than expected contribution of Native American ancestry (25%). The genomic diversity of Puerto Ricans is highlighted by the presence of four different major haplotype blocks in the CYP2C9 locus. Although, our findings need further replication, this study contributes to the field by identifying novel genetic variants that increase predictability of stable warfarin dosing among Caribbean Hispanics.

Using Drosophila melanogaster as a Model for Genotoxic Chemical Mutational Studies with a New Program, SnpSift

PubMed Central

Cingolani, Pablo; Patel, Viral M.; Coon, Melissa; Nguyen, Tung; Land, Susan J.; Ruden, Douglas M.; Lu, Xiangyi

2012-01-01

This paper describes a new program SnpSift for filtering differential DNA sequence variants between two or more experimental genomes after genotoxic chemical exposure. Here, we illustrate how SnpSift can be used to identify candidate phenotype-relevant variants including single nucleotide polymorphisms, multiple nucleotide polymorphisms, insertions, and deletions (InDels) in mutant strains isolated from genome-wide chemical mutagenesis of Drosophila melanogaster. First, the genomes of two independently isolated mutant fly strains that are allelic for a novel recessive male-sterile locus generated by genotoxic chemical exposure were sequenced using the Illumina next-generation DNA sequencer to obtain 20- to 29-fold coverage of the euchromatic sequences. The sequencing reads were processed and variants were called using standard bioinformatic tools. Next, SnpEff was used to annotate all sequence variants and their potential mutational effects on associated genes. Then, SnpSift was used to filter and select differential variants that potentially disrupt a common gene in the two allelic mutant strains. The potential causative DNA lesions were partially validated by capillary sequencing of polymerase chain reaction-amplified DNA in the genetic interval as defined by meiotic mapping and deletions that remove defined regions of the chromosome. Of the five candidate genes located in the genetic interval, the Pka-like gene CG12069 was found to carry a separate pre-mature stop codon mutation in each of the two allelic mutants whereas the other four candidate genes within the interval have wild-type sequences. The Pka-like gene is therefore a strong candidate gene for the male-sterile locus. These results demonstrate that combining SnpEff and SnpSift can expedite the identification of candidate phenotype-causative mutations in chemically mutagenized Drosophila strains. This technique can also be used to characterize the variety of mutations generated by genotoxic chemicals. PMID:22435069

Variation in the Oxytocin Receptor Gene Predicts Brain Region Specific Expression and Social Attachment

PubMed Central

King, Lanikea B.; Walum, Hasse; Inoue, Kiyoshi; Eyrich, Nicholas W.; Young, Larry J.

2015-01-01

Background Oxytocin (OXT) modulates several aspects of social behavior. Intranasal OXT is a leading candidate for treating social deficits in autism spectrum disorder (ASD) and common genetic variants in the human oxytocin receptor (OXTR) are associated with emotion recognition, relationship quality and ASD. Animal models have revealed that individual differences in Oxtr expression in the brain drive social behavior variation. Our understanding of how genetic variation contributes to brain OXTR expression is very limited. Methods We investigated Oxtr expression in monogamous prairie voles, which have a well characterized OXT system. We quantified brain region-specific levels of Oxtr mRNA and OXTR protein with established neuroanatomical methods. We used pyrosequencing to investigate allelic imbalance of Oxtr mRNA, a molecular signature of polymorphic genetic regulatory elements. We performed next-generation sequencing to discover variants in and near the Oxtr gene. We investigated social attachment using the partner preference test. Results Our allelic imbalance data demonstrates that genetic variants contribute to individual differences in Oxtr expression, but only in particular brain regions, including the nucleus accumbens (NAcc), where OXTR signaling facilitates social attachment. Next-generation sequencing identified one polymorphism in the Oxtr intron, near a putative cis-regulatory element, explaining 74% of the variance in striatal Oxtr expression specifically. Males homozygous for the high expressing allele display enhanced social attachment. Discussion Taken together, these findings provide convincing evidence for robust genetic influence on Oxtr expression and provide novel insights into how non-coding polymorphisms in the OXTR might influence individual differences in human social cognition and behavior PMID:26893121

Comparative Transcriptome of Wild Type and Selected Strains of the Microalgae Tisochrysis lutea Provides Insights into the Genetic Basis, Lipid Metabolism and the Life Cycle

PubMed Central

Carrier, Gregory; Garnier, Matthieu; Le Cunff, Loïc; Bougaran, Gaël; Probert, Ian; De Vargas, Colomban; Corre, Erwan; Cadoret, Jean-Paul; Saint-Jean, Bruno

2014-01-01

The applied exploitation of microalgae cultures has to date almost exclusively involved the use of wild type strains, deposited over decades in dedicated culture collections. Concomitantly, the concept of improving algae with selection programs for particular specific purposes is slowly emerging. Studying since a decade an economically and ecologically important haptophyte Tisochrysis lutea (Tiso), we took advantage of the availability of wild type (Tiso-Wt) and selected (Tiso-S2M2) strains to conduct a molecular variations study. This endeavour presented substantial challenges: the genome assembly was not yet available, the life cycle unknown and genetic diversity of Tiso-Wt poorly documented. This study brings the first molecular data in order to set up a selection strategy for that microalgae. Following high-throughput Illumina sequencing, transcriptomes of Tiso-Wt and Tiso-S2M2 were de novo assembled and annotated. Genetic diversity between both strains was analyzed and revealed a clear conservation, while a comparison of transcriptomes allowed identification of polymorphisms resulting from the selection program. Of 34,374 transcripts, 291 were differentially expressed and 165 contained positional polymorphisms (SNP, Indel). We focused on lipid over-accumulation of the Tiso-S2M2 strain and 8 candidate genes were identified by combining analysis of positional polymorphism, differential expression levels, selection signature and by study of putative gene function. Moreover, genetic analysis also suggests the existence of a sexual cycle and genetic recombination in Tisochrysis lutea. PMID:24489800

“Soldier's Heart”: A Genetic Basis for Elevated Cardiovascular Disease Risk Associated with Post-traumatic Stress Disorder

PubMed Central

Pollard, Harvey B.; Shivakumar, Chittari; Starr, Joshua; Eidelman, Ofer; Jacobowitz, David M.; Dalgard, Clifton L.; Srivastava, Meera; Wilkerson, Matthew D.; Stein, Murray B.; Ursano, Robert J.

2016-01-01

“Soldier's Heart,” is an American Civil War term linking post-traumatic stress disorder (PTSD) with increased propensity for cardiovascular disease (CVD). We have hypothesized that there might be a quantifiable genetic basis for this linkage. To test this hypothesis we identified a comprehensive set of candidate risk genes for PTSD, and tested whether any were also independent risk genes for CVD. A functional analysis algorithm was used to identify associated signaling networks. We identified 106 PTSD studies that report one or more polymorphic variants in 87 candidate genes in 83,463 subjects and controls. The top upstream drivers for these PTSD risk genes are predicted to be the glucocorticoid receptor (NR3C1) and Tumor Necrosis Factor alpha (TNFA). We find that 37 of the PTSD candidate risk genes are also candidate independent risk genes for CVD. The association between PTSD and CVD is significant by Fisher's Exact Test (P = 3 × 10−54). We also find 15 PTSD risk genes that are independently associated with Type 2 Diabetes Mellitus (T2DM; also significant by Fisher's Exact Test (P = 1.8 × 10−16). Our findings offer quantitative evidence for a genetic link between post-traumatic stress and cardiovascular disease, Computationally, the common mechanism for this linkage between PTSD and CVD is innate immunity and NFκB-mediated inflammation. PMID:27721742

"Soldier's Heart": A Genetic Basis for Elevated Cardiovascular Disease Risk Associated with Post-traumatic Stress Disorder.

PubMed

Pollard, Harvey B; Shivakumar, Chittari; Starr, Joshua; Eidelman, Ofer; Jacobowitz, David M; Dalgard, Clifton L; Srivastava, Meera; Wilkerson, Matthew D; Stein, Murray B; Ursano, Robert J

2016-01-01

"Soldier's Heart," is an American Civil War term linking post-traumatic stress disorder (PTSD) with increased propensity for cardiovascular disease (CVD). We have hypothesized that there might be a quantifiable genetic basis for this linkage. To test this hypothesis we identified a comprehensive set of candidate risk genes for PTSD, and tested whether any were also independent risk genes for CVD. A functional analysis algorithm was used to identify associated signaling networks. We identified 106 PTSD studies that report one or more polymorphic variants in 87 candidate genes in 83,463 subjects and controls. The top upstream drivers for these PTSD risk genes are predicted to be the glucocorticoid receptor (NR3C1) and Tumor Necrosis Factor alpha (TNFA). We find that 37 of the PTSD candidate risk genes are also candidate independent risk genes for CVD. The association between PTSD and CVD is significant by Fisher's Exact Test ( P = 3 × 10 -54 ). We also find 15 PTSD risk genes that are independently associated with Type 2 Diabetes Mellitus (T2DM; also significant by Fisher's Exact Test ( P = 1.8 × 10 -16 ). Our findings offer quantitative evidence for a genetic link between post-traumatic stress and cardiovascular disease, Computationally, the common mechanism for this linkage between PTSD and CVD is innate immunity and NFκB-mediated inflammation.

Evidence of Natural Selection Acting on a Polymorphic Hybrid Incompatibility Locus in Mimulus

PubMed Central

Sweigart, Andrea L.; Flagel, Lex E.

2015-01-01

As a common cause of reproductive isolation in diverse taxa, hybrid incompatibilities are fundamentally important to speciation. A key question is which evolutionary forces drive the initial substitutions within species that lead to hybrid dysfunction. Previously, we discovered a simple genetic incompatibility that causes nearly complete male sterility and partial female sterility in hybrids between the two closely related yellow monkeyflower species Mimulus guttatus and M. nasutus. In this report, we fine map the two major incompatibility loci—hybrid male sterility 1 (hms1) and hybrid male sterility 2 (hms2)—to small nuclear genomic regions (each <70 kb) that include strong candidate genes. With this improved genetic resolution, we also investigate the evolutionary dynamics of hms1 in a natural population of M. guttatus known to be polymorphic at this locus. Using classical genetic crosses and population genomics, we show that a 320-kb region containing the hms1 incompatibility allele has risen to intermediate frequency in this population by strong natural selection. This finding provides direct evidence that natural selection within plant species can lead to hybrid dysfunction between species. PMID:25428983

An Ultra-High-Density, Transcript-Based, Genetic Map of Lettuce

PubMed Central

Truco, Maria José; Ashrafi, Hamid; Kozik, Alexander; van Leeuwen, Hans; Bowers, John; Wo, Sebastian Reyes Chin; Stoffel, Kevin; Xu, Huaqin; Hill, Theresa; Van Deynze, Allen; Michelmore, Richard W.

2013-01-01

We have generated an ultra-high-density genetic map for lettuce, an economically important member of the Compositae, consisting of 12,842 unigenes (13,943 markers) mapped in 3696 genetic bins distributed over nine chromosomal linkage groups. Genomic DNA was hybridized to a custom Affymetrix oligonucleotide array containing 6.4 million features representing 35,628 unigenes of Lactuca spp. Segregation of single-position polymorphisms was analyzed using 213 F7:8 recombinant inbred lines that had been generated by crossing cultivated Lactuca sativa cv. Salinas and L. serriola acc. US96UC23, the wild progenitor species of L. sativa. The high level of replication of each allele in the recombinant inbred lines was exploited to identify single-position polymorphisms that were assigned to parental haplotypes. Marker information has been made available using GBrowse to facilitate access to the map. This map has been anchored to the previously published integrated map of lettuce providing candidate genes for multiple phenotypes. The high density of markers achieved in this ultradense map allowed syntenic studies between lettuce and Vitis vinifera as well as other plant species. PMID:23550116

An Ultra-High-Density, Transcript-Based, Genetic Map of Lettuce.

PubMed

Truco, Maria José; Ashrafi, Hamid; Kozik, Alexander; van Leeuwen, Hans; Bowers, John; Wo, Sebastian Reyes Chin; Stoffel, Kevin; Xu, Huaqin; Hill, Theresa; Van Deynze, Allen; Michelmore, Richard W

2013-04-09

We have generated an ultra-high-density genetic map for lettuce, an economically important member of the Compositae, consisting of 12,842 unigenes (13,943 markers) mapped in 3696 genetic bins distributed over nine chromosomal linkage groups. Genomic DNA was hybridized to a custom Affymetrix oligonucleotide array containing 6.4 million features representing 35,628 unigenes of Lactuca spp. Segregation of single-position polymorphisms was analyzed using 213 F 7:8 recombinant inbred lines that had been generated by crossing cultivated Lactuca sativa cv. Salinas and L. serriola acc. US96UC23, the wild progenitor species of L. sativa The high level of replication of each allele in the recombinant inbred lines was exploited to identify single-position polymorphisms that were assigned to parental haplotypes. Marker information has been made available using GBrowse to facilitate access to the map. This map has been anchored to the previously published integrated map of lettuce providing candidate genes for multiple phenotypes. The high density of markers achieved in this ultradense map allowed syntenic studies between lettuce and Vitis vinifera as well as other plant species. Copyright © 2013 Truco et al.

COL5A1: Genetic mapping and exclusion as candidate gene in families with nail-patella syndrome, tuberous sclerosis 1, hereditary hemorrhagic telangiectasia, and Ehlers-Danlos syndrome type II

DOE Office of Scientific and Technical Information (OSTI.GOV)

Greenspan, D.S.; Northrup, H.; Au, K.S.

1995-02-10

COL5A1, the gene for the {alpha}1 chain of type V collagen, has been considered a candidate gene for certain diseases based on chromosomal location and/or disease phenotype. We have employed 3{prime}-untranslated region RFLPs to exclude COL5A1 as a candidate gene in families with tuberous sclerosis 1, Ehlers-Danlos syndrome type H, and nail-patella syndrome. In addition, we describe a polymorphic simple sequence repeat (SSR) within a COL5A1 intron. This SSR is used to exclude COL5A1 as a candidate gene in hereditary hemorrhagic telangiectasia (Osler-Rendu-Weber disease) and to add COL5A1 to the existing map of {open_quotes}index{close_quotes} markers of chromosome 9 by evaluationmore » of the COL5A1 locus on the CEPH 40-family reference pedigree set. This genetic mapping places COL5A1 between markers D9S66 and D9S67. 14 refs., 1 fig., 2 tabs.« less

Peroxisome proliferator-activated receptor gamma co-activator 1 gene Gly482Ser polymorphism is associated with the response of low-density lipoprotein cholesterol concentrations to exercise training in elderly Japanese.

PubMed

Tobina, Takuro; Mori, Yukari; Doi, Yukiko; Nakayama, Fuki; Kiyonaga, Akira; Tanaka, Hiroaki

2017-09-01

Muscle peroxisome proliferator-activated receptor gamma co-activator 1 (PGC-1)α gene expression is influenced by the Gly482Ser gene polymorphism, which is a candidate genetic risk factor for diabetes mellitus and obesity. This study investigated the effects of PGC-1 gene Gly482Ser polymorphisms on alterations in glucose and lipid metabolism induced by exercise training. A 12-week intervention study was performed for 119 participants who were more than 65 years of age and completed exercise training at lactate threshold intensity. Total cholesterol and low-density lipoprotein cholesterol were significantly reduced in Gly/Gly but not in Gly/Ser and Ser/Ser participants after exercise. The Gly/Gly genotype of the PGC-1 gene Gly482Ser polymorphism influences the effects of moderate-intensity exercise training on low-density lipoprotein cholesterol and total cholesterol concentrations in older people.

An ADAM33 Polymorphism Associates with Progression of Preschool Wheeze into Childhood Asthma: A Prospective Case-Control Study with Replication in a Birth Cohort Study

PubMed Central

Klaassen, Ester M. M.; Penders, John; Jöbsis, Quirijn; van de Kant, Kim D. G.; Thijs, Carel; Mommers, Monique; van Schayck, Constant P.; van Eys, Guillaume; Koppelman, Gerard H.; Dompeling, Edward

2015-01-01

Background The influence of asthma candidate genes on the development from wheeze to asthma in young children still needs to be defined. Objective To link genetic variants in asthma candidate genes to progression of wheeze to persistent wheeze into childhood asthma. Materials and Methods In a prospective study, children with recurrent wheeze from the ADEM (Asthma DEtection and Monitoring) study were followed until the age of six. At that age a classification (transient wheeze or asthma) was based on symptoms, lung function and medication use. In 198 children the relationship between this classification and 30 polymorphisms in 16 asthma candidate genes was assessed by logistic regression. In case of an association based on a p<0.10, replication analysis was performed in an independent birth cohort study (KOALA study, n = 248 included for the present analysis). Results In the ADEM study, the minor alleles of ADAM33 rs511898 and rs528557 and the ORMDL3/GSDMB rs7216389 polymorphisms were negatively associated, whereas the minor alleles of IL4 rs2243250 and rs2070874 polymorphisms were positively associated with childhood asthma. When replicated in the KOALA study, ADAM33 rs528557 showed a negative association of the CG/GG-genotype with progression of recurrent wheeze into childhood asthma (0.50 (0.26-0.97) p = 0.04) and no association with preschool wheeze. Conclusion Polymorphisms in ADAM33, ORMDL3/GSDMB and IL4 were associated with childhood asthma in a group of children with recurrent wheeze. The replication of the negative association of the CG/GG-genotype of rs528557 ADAM33 with childhood asthma in an independent birth cohort study confirms that a compromised ADAM33 gene may be implicated in the progression of wheeze into childhood asthma. PMID:25768087

The genetic basis for variation in resistance to infection in the Drosophila melanogaster genetic reference panel

PubMed Central

Wang, Jonathan B.

2017-01-01

Individuals vary extensively in the way they respond to disease but the genetic basis of this variation is not fully understood. We found substantial individual variation in resistance and tolerance to the fungal pathogen Metarhizium anisopliae Ma549 using the Drosophila melanogaster Genetic Reference Panel (DGRP). In addition, we found that host defense to Ma549 was correlated with defense to the bacterium Pseudomonas aeruginosa Pa14, and several previously published DGRP phenotypes including oxidative stress sensitivity, starvation stress resistance, hemolymph glucose levels, and sleep indices. We identified polymorphisms associated with differences between lines in both their mean survival times and microenvironmental plasticity, suggesting that lines differ in their ability to adapt to variable pathogen exposures. The majority of polymorphisms increasing resistance to Ma549 were sex biased, located in non-coding regions, had moderately large effect and were rare, suggesting that there is a general cost to defense. Nevertheless, host defense was not negatively correlated with overall longevity and fecundity. In contrast to Ma549, minor alleles were concentrated in the most Pa14-susceptible as well as the most Pa14-resistant lines. A pathway based analysis revealed a network of Pa14 and Ma549-resistance genes that are functionally connected through processes that encompass phagocytosis and engulfment, cell mobility, intermediary metabolism, protein phosphorylation, axon guidance, response to DNA damage, and drug metabolism. Functional testing with insertional mutagenesis lines indicates that 12/13 candidate genes tested influence susceptibility to Ma549. Many candidate genes have homologs identified in studies of human disease, suggesting that genes affecting variation in susceptibility are conserved across species. PMID:28257468

Significant interactions between maternal PAH exposure and single nucleotide polymorphisms in candidate genes on B[ a ]P-DNA adducts in a cohort of non-smoking Polish mothers and newborns.

PubMed

Iyer, Shoba; Wang, Ya; Xiong, Wei; Tang, Deliang; Jedrychowski, Wieslaw; Chanock, Stephen; Wang, Shuang; Stigter, Laura; Mróz, Elzbieta; Perera, Frederica

2016-11-01

Polycyclic aromatic hydrocarbons (PAH) are a class of chemicals common in the environment. Certain PAH are carcinogenic, although the degree to which genetic variation influences susceptibility to carcinogenic PAH remains unclear. Also unknown is the influence of genetic variation on the procarcinogenic effect of in utero exposures to PAH. Benzo[ a ]pyrene (B[ a ]P) is a well-studied PAH that is classified as a known human carcinogen. Within our Polish cohort, we explored interactions between maternal exposure to airborne PAH during pregnancy and maternal and newborn single nucleotide polymorphisms (SNPs) in plausible B[ a ]P metabolism genes on B[ a ]P-DNA adducts in paired cord blood samples. The study subjects included non-smoking women ( n = 368) with available data on maternal PAH exposure, paired cord adducts, and genetic data who resided in Krakow, Poland. We selected eight common variants in maternal and newborn candidate genes related to B[ a ]P metabolism, detoxification, and repair for our analyses: CYP1A1 , CYP1A2 , CYP1B1 , GSTM1 , GSTT2 , NQO1 , and XRCC1 . We observed significant interactions between maternal PAH exposure and SNPs on cord B[ a ]P-DNA adducts in the following genes: maternal CYP1A1 and GSTT2 , and newborn CYP1A1 and CYP1B1 . These novel findings highlight differences in maternal and newborn genetic contributions to B[ a ]P-DNA adduct formation and have the potential to identify at-risk subpopulations who are susceptible to the carcinogenic potential of B[ a ]P. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Evaluation of Candidate Genes for Cholinesterase Activity in Farmworkers Exposed to Organophosphorus Pesticides: Association of Single Nucleotide Polymorphisms in BCHE

PubMed Central

Howard, Timothy D.; Hsu, Fang-Chi; Grzywacz, Joseph G.; Chen, Haiying; Quandt, Sara A.; Vallejos, Quirina M.; Whalley, Lara E.; Cui, Wei; Padilla, Stephanie; Arcury, Thomas A.

2010-01-01

Background Organophosphate pesticides act as cholinesterase inhibitors. For those with agricultural exposure to these chemicals, risk of potential exposure-related health effects may be modified by genetic variability in cholinesterase metabolism. Cholinesterase activity is a useful, indirect measurement of pesticide exposure, especially in high-risk individuals such as farmworkers. To understand fully the links between pesticide exposure and potential human disease, analyses must be able to consider genetic variability in pesticide metabolism. Objectives We studied participants in the Community Participatory Approach to Measuring Farmworker Pesticide Exposure (PACE3) study to determine whether cholinesterase levels are associated with single-nucleotide polymorphisms (SNPs) involved in pesticide metabolism. Methods Cholinesterase levels were measured from blood samples taken from 287 PACE3 participants at up to four time points during the 2007 growing season. We performed association tests of cholinesterase levels and 256 SNPs in 30 candidate genes potentially involved in pesticide metabolism. A false discovery rate (FDR) p-value was used to account for multiple testing. Results Thirty-five SNPs were associated (unadjusted p < 0.05) based on at least one of the genetic models tested (general, additive, dominant, and recessive). The strongest evidence of association with cholinesterase levels was observed with two SNPs, rs2668207 and rs2048493, in the butyrylcholinesterase (BCHE) gene (FDR adjusted p = 0.15 for both; unadjusted p = 0.00098 and 0.00068, respectively). In participants with at least one minor allele, cholinesterase levels were lower by 4.3–9.5% at all time points, consistent with an effect that is independent of pesticide exposure. Conclusions Common genetic variation in the BCHE gene may contribute to subtle changes in cholinesterase levels. PMID:20529763

Genetic structure of seven Mexican indigenous populations based on five polymarker loci.

PubMed

Buentello-Malo, Leonora; Peñaloza-Espinosa, Rosenda I; Loeza, Francisco; Salamanca-Gomez, Fabio; Cerda-Flores, Ricardo M

2003-01-01

This descriptive study investigates the genetic structure of seven Mexican indigenous populations (Mixteca Alta, Mixteca Baja, Otomies, Purepecha, Nahuas-Guerrero, Nahuas-Xochimilco, and Tzeltales) on the basis of five PCR-based polymorphic DNA loci: LDLR, GYPA, HBGG, D7S8, and GC. Genetic distance and diversity analyses indicate that these Mexican indigenous are similar and that more than 96% of the total gene diversity (H(T)) can be attributed to individual variation within populations. Mixteca-Alta, Mixteca-Baja, and Nahuas-Xochimilco show indications of higher admixture with European-derived persons. The demonstration of a relative genetic homogeneity of Mexican Indians for the markers studied suggests that this population is suitable for studying disease-marker associations in the search for candidate genes of complex diseases. Copyright 2002 Wiley-Liss, Inc.

A public platform for the verification of the phenotypic effect of candidate genes for resistance to aflatoxin accumulation and Aspergillus flavus infection in maize.

PubMed

Warburton, Marilyn L; Williams, William Paul; Hawkins, Leigh; Bridges, Susan; Gresham, Cathy; Harper, Jonathan; Ozkan, Seval; Mylroie, J Erik; Shan, Xueyan

2011-07-01

A public candidate gene testing pipeline for resistance to aflatoxin accumulation or Aspergillus flavus infection in maize is presented here. The pipeline consists of steps for identifying, testing, and verifying the association of selected maize gene sequences with resistance under field conditions. Resources include a database of genetic and protein sequences associated with the reduction in aflatoxin contamination from previous studies; eight diverse inbred maize lines for polymorphism identification within any maize gene sequence; four Quantitative Trait Loci (QTL) mapping populations and one association mapping panel, all phenotyped for aflatoxin accumulation resistance and associated phenotypes; and capacity for Insertion/Deletion (InDel) and SNP genotyping in the population(s) for mapping. To date, ten genes have been identified as possible candidate genes and put through the candidate gene testing pipeline, and results are presented here to demonstrate the utility of the pipeline.

Identification and validation of single nucleotide polymorphisms in growth- and maturation-related candidate genes in sole (Solea solea L.).

PubMed

Diopere, Eveline; Hellemans, Bart; Volckaert, Filip A M; Maes, Gregory E

2013-03-01

Genomic methodologies applied in evolutionary and fisheries research have been of great benefit to understand the marine ecosystem and the management of natural resources. Although single nucleotide polymorphisms (SNPs) are attractive for the study of local adaptation, spatial stock management and traceability, and investigating the effects of fisheries-induced selection, they have rarely been exploited in non-model organisms. This is partly due to difficulties in finding and validating SNPs in species with limited or no genomic resources. Complementary to random genome-scan approaches, a targeted candidate gene approach has the potential to unveil pre-selected functional diversity and provides more in depth information on the action of selection at specific genes. For example genes can be under selective pressure due to climate change and sustained periods of heavy fishing pressure. In this study, we applied a candidate gene approach in sole (Solea solea L.), an important member of the demersal ecosystem. As consumption flatfish it is heavy exploited and has experienced associated life-history changes over the last 60years. To discover novel genetic polymorphisms in or around genes linked to important life history traits in sole, we screened a total of 76 candidate genes related to growth and maturation using a targeted resequencing approach. We identified in total 86 putative SNPs in 22 genes and validated 29 SNPs using a multiplex single-base extension genotyping assay. We found 22 informative SNPs, of which two represent non-synonymous mutations, potentially of functional relevance. These novel markers should be rapidly and broadly applicable in analyses of natural sole populations, as a measure of the evolutionary signature of overfishing and for initiatives on marker assisted selection. Copyright © 2012 Elsevier B.V. All rights reserved.

Environmental Exposures, Genetic Polymorphisms and p53 Mutational Spectra in a Case-Control Study of Breast Cancer.

DTIC Science & Technology

1998-01-01

Further, preliminary clinical data suggest that serotonin reuptake inhibitors , such as fluoxetinc hydrochloride, may promote smoking cessation (15,16...benefits of serotonin reuptake inhibitors in smoking cessation (16) suggested that this gene may be a plausible candidate for predisposition to... used for random selection of women under age 65; women age 65 and over were randomly selected from the listing of the Health Care Finance

Genetic Markers of Toxicity From Capecitabine and Other Fluorouracil-Based Regimens: Investigation in the QUASAR2 Study, Systematic Review, and Meta-Analysis

PubMed Central

Rosmarin, Dan; Palles, Claire; Church, David; Domingo, Enric; Jones, Angela; Johnstone, Elaine; Wang, Haitao; Love, Sharon; Julier, Patrick; Scudder, Claire; Nicholson, George; Gonzalez-Neira, Anna; Martin, Miguel; Sargent, Daniel; Green, Erin; McLeod, Howard; Zanger, Ulrich M.; Schwab, Matthias; Braun, Michael; Seymour, Matthew; Thompson, Lindsay; Lacas, Benjamin; Boige, Valérie; Ribelles, Nuria; Afzal, Shoaib; Enghusen, Henrik; Jensen, Søren Astrup; Etienne-Grimaldi, Marie-Christine; Milano, Gérard; Wadelius, Mia; Glimelius, Bengt; Garmo, Hans; Gusella, Milena; Lecomte, Thierry; Laurent-Puig, Pierre; Martinez-Balibrea, Eva; Sharma, Rohini; Garcia-Foncillas, Jesus; Kleibl, Zdenek; Morel, Alain; Pignon, Jean-Pierre; Midgley, Rachel; Kerr, David; Tomlinson, Ian

2014-01-01

Purpose Fluourouracil (FU) is a mainstay of chemotherapy, although toxicities are common. Genetic biomarkers have been used to predict these adverse events, but their utility is uncertain. Patients and Methods We tested candidate polymorphisms identified from a systematic literature search for associations with capecitabine toxicity in 927 patients with colorectal cancer in the Quick and Simple and Reliable trial (QUASAR2). We then performed meta-analysis of QUASAR2 and 16 published studies (n = 4,855 patients) to examine the polymorphisms in various FU monotherapy and combination therapy regimens. Results Global capecitabine toxicity (grades 0/1/2 v grades 3/4/5) was associated with the rare, functional DPYD alleles 2846T>A and *2A (combined odds ratio, 5.51; P = .0013) and with the common TYMS polymorphisms 5′VNTR2R/3R and 3′UTR 6bp ins-del (combined odds ratio, 1.31; P = 9.4 × 10−6). There was weaker evidence that these polymorphisms predict toxicity from bolus and infusional FU monotherapy. No good evidence of association with toxicity was found for the remaining polymorphisms, including several currently included in predictive kits. No polymorphisms were associated with toxicity in combination regimens. Conclusion A panel of genetic biomarkers for capecitabine monotherapy toxicity would currently comprise only the four DPYD and TYMS variants above. We estimate this test could provide 26% sensitivity, 86% specificity, and 49% positive predictive value—better than most available commercial kits, but suboptimal for clinical use. The test panel might be extended to include additional, rare DPYD variants functionally equivalent to *2A and 2846A, though insufficient evidence supports its use in bolus, infusional, or combination FU. There remains a need to identify further markers of FU toxicity for all regimens. PMID:24590654

Genetic Variation and Recent Positive Selection in Worldwide Human Populations: Evidence from Nearly 1 Million SNPs

PubMed Central

Theunert, Christoph; Pugach, Irina; Li, Jing; Nandineni, Madhusudan R.; Gross, Arnd; Scholz, Markus; Stoneking, Mark

2009-01-01

Background Genome-wide scans of hundreds of thousands of single-nucleotide polymorphisms (SNPs) have resulted in the identification of new susceptibility variants to common diseases and are providing new insights into the genetic structure and relationships of human populations. Moreover, genome-wide data can be used to search for signals of recent positive selection, thereby providing new insights into the genetic adaptations that occurred as modern humans spread out of Africa and around the world. Methodology We genotyped approximately 500,000 SNPs in 255 individuals (5 individuals from each of 51 worldwide populations) from the Human Genome Diversity Panel (HGDP-CEPH). When merged with non-overlapping SNPs typed previously in 250 of these same individuals, the resulting data consist of over 950,000 SNPs. We then analyzed the genetic relationships and ancestry of individuals without assigning them to populations, and we also identified candidate regions of recent positive selection at both the population and regional (continental) level. Conclusions Our analyses both confirm and extend previous studies; in particular, we highlight the impact of various dispersals, and the role of substructure in Africa, on human genetic diversity. We also identified several novel candidate regions for recent positive selection, and a gene ontology (GO) analysis identified several GO groups that were significantly enriched for such candidate genes, including immunity and defense related genes, sensory perception genes, membrane proteins, signal receptors, lipid binding/metabolism genes, and genes involved in the nervous system. Among the novel candidate genes identified are two genes involved in the thyroid hormone pathway that show signals of selection in African Pygmies that may be related to their short stature. PMID:19924308

Neuropsychological performance measures as intermediate phenotypes for attention-deficit/hyperactivity disorder: A multiple mediation analysis

PubMed Central

KAMRADT, JACLYN M.; NIGG, JOEL T.; FRIDERICI, KAREN H.; NIKOLAS, MOLLY A.

2016-01-01

Genetic influences on dopaminergic neurotransmission have been implicated in attention-deficit hyperactivity disorder (ADHD) and are theorized to impact cognitive functioning via alterations in frontal–striatal circuitry. Neuropsychological functioning has been proposed to account for the potential associations between dopamine candidate genes and ADHD. However, to date, this mediation hypothesis has not been directly tested. Participants were 498 youth ages 6–17 years (mean M = 10.8 years, SD = 2.4 years, 55.0% male). All youth completed a multistage, multiple-informant assessment procedure to identify ADHD and non-ADHD cases, as well as a comprehensive neuropsychological battery. Youth provided a saliva sample for DNA analyses; the 480 base pair variable number of tandem repeat polymorphism of the dopamine active transporter 1 gene (DAT1) and the 120 base pair promoter polymorphism of the dopamine receptor D4 gene (DRD4) were genotyped. Multiple mediation analysis revealed significant indirect associations between DAT1 genotype and inattention, hyperactivity–impulsivity, and oppositionality, with specific indirect effects through response inhibition. The results highlight the role of neurocognitive task performance, particularly response inhibition, as a potential intermediate phenotype for ADHD, further elucidating the relationship between genetic polymorphisms and externalizing psychopathology. PMID:27049476

Identification and characterization of the highly polymorphic locus D14S739 in the Han Chinese population

PubMed Central

Shao, Chengchen; Zhang, Yaqi; Zhou, Yueqin; Zhu, Wei; Xu, Hongmei; Liu, Zhiping; Tang, Qiqun; Shen, Yiwen; Xie, Jianhui

2015-01-01

Aim To systemically select and evaluate short tandem repeats (STRs) on the chromosome 14 and obtain new STR loci as expanded genotyping markers for forensic application. Methods STRs on the chromosome 14 were filtered from Tandem Repeats Database and further selected based on their positions on the chromosome, repeat patterns of the core sequences, sequence homology of the flanking regions, and suitability of flanking regions in primer design. The STR locus with the highest heterozygosity and polymorphism information content (PIC) was selected for further analysis of genetic polymorphism, forensic parameters, and the core sequence. Results Among 26 STR loci selected as candidates, D14S739 had the highest heterozygosity (0.8691) and PIC (0.8432), and showed no deviation from the Hardy-Weinberg equilibrium. 14 alleles were observed, ranging in size from 21 to 34 tetranucleotide units in the core region of (GATA)9-18 (GACA)7-12 GACG (GACA)2 GATA. Paternity testing showed no mutations. Conclusion D14S739 is a highly informative STR locus and could be a suitable genetic marker for forensic applications in the Han Chinese population. PMID:26526885

Genetic Polymorphisms in Host Antiviral Genes: Associations with Humoral and Cellular Immunity to Measles Vaccine

PubMed Central

Haralambieva, Iana H.; Ovsyannikova, Inna G.; Umlauf, Benjamin J.; Vierkant, Robert A.; Pankratz, V. Shane; Jacobson, Robert M.; Poland, Gregory A.

2014-01-01

Host antiviral genes are important regulators of antiviral immunity and plausible genetic determinants of immune response heterogeneity after vaccination. We genotyped and analyzed 307 common candidate tagSNPs from 12 antiviral genes in a cohort of 745 schoolchildren immunized with two doses of measles-mumps-rubella vaccine. Associations between SNPs/haplotypes and measles virus-specific immune outcomes were assessed using linear regression methodologies in Caucasians and African-Americans. Genetic variants within the DDX58/RIG-I gene, including a coding polymorphism (rs3205166/Val800Val), were associated as single-SNPs (p≤0.017; although these SNPs did not remain significant after correction for false discovery rate/FDR) and in haplotype-level analysis, with measles-specific antibody variations in Caucasians (haplotype allele p-value=0.021; haplotype global p-value=0.076). Four DDX58 polymorphisms, in high LD, demonstrated also associations (after correction for FDR) with variations in both measles-specific IFN-γ and IL-2 secretion in Caucasians (p≤0.001, q=0.193). Two intronic OAS1 polymorphisms, including the functional OAS1 SNP rs10774671 (p=0.003), demonstrated evidence of association with a significant allele-dose-related increase in neutralizing antibody levels in African-Americans. Genotype and haplotype-level associations demonstrated the role of ADAR genetic variants, including a non-synonymous SNP (rs2229857/Arg384Lys; p=0.01), in regulating measles virus-specific IFN-γ Elispot responses in Caucasians (haplotype global p-value=0.017). After correction FDR, 15 single-SNP associations (11 SNPs in Caucasians and 4 SNPs in African-Americans) still remained significant at the q-value<0.20. In conclusion, our findings strongly point to genetic variants/genes, involved in antiviral sensing and antiviral control, as critical determinants, differentially modulating the adaptive immune responses to live attenuated measles vaccine in Caucasians and African-Americans. PMID:21939710

Genetic risk factors of systemic lupus erythematosus in the Malaysian population: a minireview.

PubMed

Chai, Hwa Chia; Phipps, Maude Elvira; Chua, Kek Heng

2012-01-01

SLE is an autoimmune disease that is not uncommon in Malaysia. In contrast to Malays and Indians, the Chinese seem to be most affected. SLE is characterized by deficiency of body's immune response that leads to production of autoantibodies and failure of immune complex clearance. This minireview attempts to summarize the association of several candidate genes with risk for SLE in the Malaysian population and discuss the genetic heterogeneity that exists locally in Asians and in comparison with SLE in Caucasians. Several groups of researchers have been actively investigating genes that are associated with SLE susceptibility in the Malaysian population by screening possible reported candidate genes across the SLE patients and healthy controls. These candidate genes include MHC genes and genes encoding complement components, TNF, FcγR, T-cell receptors, and interleukins. However, most of the polymorphisms investigated in these genes did not show significant associations with susceptibility to SLE in the Malaysian scenario, except for those occurring in MHC genes and genes coding for TNF-α, IL-1β, IL-1RN, and IL-6.

Genetic Risk Factors of Systemic Lupus Erythematosus in the Malaysian Population: A Minireview

PubMed Central

Chai, Hwa Chia; Phipps, Maude Elvira; Chua, Kek Heng

2012-01-01

SLE is an autoimmune disease that is not uncommon in Malaysia. In contrast to Malays and Indians, the Chinese seem to be most affected. SLE is characterized by deficiency of body's immune response that leads to production of autoantibodies and failure of immune complex clearance. This minireview attempts to summarize the association of several candidate genes with risk for SLE in the Malaysian population and discuss the genetic heterogeneity that exists locally in Asians and in comparison with SLE in Caucasians. Several groups of researchers have been actively investigating genes that are associated with SLE susceptibility in the Malaysian population by screening possible reported candidate genes across the SLE patients and healthy controls. These candidate genes include MHC genes and genes encoding complement components, TNF, FcγR, T-cell receptors, and interleukins. However, most of the polymorphisms investigated in these genes did not show significant associations with susceptibility to SLE in the Malaysian scenario, except for those occurring in MHC genes and genes coding for TNF-α, IL-1β, IL-1RN, and IL-6. PMID:21941582

Analysis of the Association between Catechol-O-Methyltransferase Val158Met and Male Sexual Orientation.

PubMed

Yu, Wei; Tu, Dan; Hong, Fuchang; Wang, Jing; Liu, Xiaoli; Cai, Yumao; Xu, Ruiwei; Zhao, Guanglu; Wang, Feng; Pan, Hong; Wu, Shinan; Feng, Tiejian; Wang, Binbin

2015-09-01

Male sexual orientation is thought to have a genetic component. However, previous studies have failed to generate positive results from among candidate genes. Catechol-O-methyltransferase (COMT), located on chromosome 22, has six exons, spans 27 kb, and encodes a protein of 271 amino acids. COMT has an important role in regulating the embryonic levels of catecholamine neurotransmitters (such as dopamine, norepinephrine, and epinephrine) and estrogens. COMT is also thought to be related to sexual orientation. This study aimed to investigate the relationship between the COMT Val158Met variant and male sexual orientation. We performed association analysis of the COMT gene single nucleotide polymorphism, Val158Met, in 409 homosexual cases and 387 heterosexual control Chinese men. COMT polymorphism status was determined using a polymerase chain reaction-based assay. Polymerase chain reaction was performed to genotype the COMT Val158Met polymorphism. The frequency differences of the genotype and alleles distribution between the male homosexual and control groups. Significant differences, both in genotype and alleles, between male homosexual individuals and controls indicated a genetic component related to male homosexuality. The Val allele recessive model could be an interrelated genetic model of the cause of male homosexuality. The COMT Val158Met variant might be associated with male sexual orientation and a recessive model was suggested. © 2015 International Society for Sexual Medicine.

Shared additive genetic influences on DSM-IV criteria for alcohol dependence in subjects of European ancestry.

PubMed

Palmer, Rohan H C; McGeary, John E; Heath, Andrew C; Keller, Matthew C; Brick, Leslie A; Knopik, Valerie S

2015-12-01

Genetic studies of alcohol dependence (AD) have identified several candidate loci and genes, but most observed effects are small and difficult to reproduce. A plausible explanation for inconsistent findings may be a violation of the assumption that genetic factors contributing to each of the seven DSM-IV criteria point to a single underlying dimension of risk. Given that recent twin studies suggest that the genetic architecture of AD is complex and probably involves multiple discrete genetic factors, the current study employed common single nucleotide polymorphisms in two multivariate genetic models to examine the assumption that the genetic risk underlying DSM-IV AD is unitary. AD symptoms and genome-wide single nucleotide polymorphism (SNP) data from 2596 individuals of European descent from the Study of Addiction: Genetics and Environment were analyzed using genomic-relatedness-matrix restricted maximum likelihood. DSM-IV AD symptom covariance was described using two multivariate genetic factor models. Common SNPs explained 30% (standard error=0.136, P=0.012) of the variance in AD diagnosis. Additive genetic effects varied across AD symptoms. The common pathway model approach suggested that symptoms could be described by a single latent variable that had a SNP heritability of 31% (0.130, P=0.008). Similarly, the exploratory genetic factor model approach suggested that the genetic variance/covariance across symptoms could be represented by a single genetic factor that accounted for at least 60% of the genetic variance in any one symptom. Additive genetic effects on DSM-IV alcohol dependence criteria overlap. The assumption of common genetic effects across alcohol dependence symptoms appears to be a valid assumption. © 2015 Society for the Study of Addiction.

Association genetics of coastal Douglas fir (Pseudotsuga menziesii var. menziesii, Pinaceae). I. Cold-hardiness related traits.

PubMed

Eckert, Andrew J; Bower, Andrew D; Wegrzyn, Jill L; Pande, Barnaly; Jermstad, Kathleen D; Krutovsky, Konstantin V; St Clair, J Bradley; Neale, David B

2009-08-01

Adaptation to cold is one of the greatest challenges to forest trees. This process is highly synchronized with environmental cues relating to photoperiod and temperature. Here, we use a candidate gene-based approach to search for genetic associations between 384 single-nucleotide polymorphism (SNP) markers from 117 candidate genes and 21 cold-hardiness related traits. A general linear model approach, including population structure estimates as covariates, was implemented for each marker-trait pair. We discovered 30 highly significant genetic associations [false discovery rate (FDR) Q < 0.10] across 12 candidate genes and 10 of the 21 traits. We also detected a set of 7 markers that had elevated levels of differentiation between sampling sites situated across the Cascade crest in northeastern Washington. Marker effects were small (r(2) < 0.05) and within the range of those published previously for forest trees. The derived SNP allele, as measured by a comparison to a recently diverged sister species, typically affected the phenotype in a way consistent with cold hardiness. The majority of markers were characterized as having largely nonadditive modes of gene action, especially underdominance in the case of cold-tolerance related phenotypes. We place these results in the context of trade-offs between the abilities to grow longer and to avoid fall cold damage, as well as putative epigenetic effects. These associations provide insight into the genetic components of complex traits in coastal Douglas fir, as well as highlight the need for landscape genetic approaches to the detection of adaptive genetic diversity.

Genome-Wide Association Mapping Combined with Reverse Genetics Identifies New Effectors of Low Water Potential-Induced Proline Accumulation in Arabidopsis1[W][OPEN

PubMed Central

Verslues, Paul E.; Lasky, Jesse R.; Juenger, Thomas E.; Liu, Tzu-Wen; Kumar, M. Nagaraj

2014-01-01

Arabidopsis (Arabidopsis thaliana) exhibits natural genetic variation in drought response, including varying levels of proline (Pro) accumulation under low water potential. As Pro accumulation is potentially important for stress tolerance and cellular redox control, we conducted a genome-wide association (GWAS) study of low water potential-induced Pro accumulation using a panel of natural accessions and publicly available single-nucleotide polymorphism (SNP) data sets. Candidate genomic regions were prioritized for subsequent study using metrics considering both the strength and spatial clustering of the association signal. These analyses found many candidate regions likely containing gene(s) influencing Pro accumulation. Reverse genetic analysis of several candidates identified new Pro effector genes, including thioredoxins and several genes encoding Universal Stress Protein A domain proteins. These new Pro effector genes further link Pro accumulation to cellular redox and energy status. Additional new Pro effector genes found include the mitochondrial protease LON1, ribosomal protein RPL24A, protein phosphatase 2A subunit A3, a MADS box protein, and a nucleoside triphosphate hydrolase. Several of these new Pro effector genes were from regions with multiple SNPs, each having moderate association with Pro accumulation. This pattern supports the use of summary approaches that incorporate clusters of SNP associations in addition to consideration of individual SNP probability values. Further GWAS-guided reverse genetics promises to find additional effectors of Pro accumulation. The combination of GWAS and reverse genetics to efficiently identify new effector genes may be especially applicable for traits difficult to analyze by other genetic screening methods. PMID:24218491

Pharmacogenetics of schizophrenia.

PubMed

Reynolds, Gavin P; Templeman, Lucy A; Godlewska, Beata R

2006-08-01

There is substantial unexplained interindividual variability in the drug treatment of schizophrenia. A substantial proportion of patients respond inadequately to antipsychotic drugs, and many experience limiting side effects. As genetic factors are likely to contribute to this variability, the pharmacogenetics of schizophrenia has attracted substantial effort. The approaches have mainly been limited to association studies of polymorphisms in candidate genes, which have been indicated by the pharmacology of antipsychotic drugs. Although some advances have been made, particularly in understanding the pharmacogenetics of some limiting side effects, genetic prediction of symptom response remains elusive. Nevertheless, with improvements in defining the response phenotype in carefully assessed and homogeneous subject groups, the near future is likely to see the identification of genetic predictors of outcome that may inform the choice of pharmacotherapy.

Novel candidate genes may be possible predisposing factors revealed by whole exome sequencing in familial esophageal squamous cell carcinoma.

PubMed

Forouzanfar, Narjes; Baranova, Ancha; Milanizadeh, Saman; Heravi-Moussavi, Alireza; Jebelli, Amir; Abbaszadegan, Mohammad Reza

2017-05-01

Esophageal squamous cell carcinoma is one of the deadliest of all the cancers. Its metastatic properties portend poor prognosis and high rate of recurrence. A more advanced method to identify new molecular biomarkers predicting disease prognosis can be whole exome sequencing. Here, we report the most effective genetic variants of the Notch signaling pathway in esophageal squamous cell carcinoma susceptibility by whole exome sequencing. We analyzed nine probands in unrelated familial esophageal squamous cell carcinoma pedigrees to identify candidate genes. Genomic DNA was extracted and whole exome sequencing performed to generate information about genetic variants in the coding regions. Bioinformatics software applications were utilized to exploit statistical algorithms to demonstrate protein structure and variants conservation. Polymorphic regions were excluded by false-positive investigations. Gene-gene interactions were analyzed for Notch signaling pathway candidates. We identified novel and damaging variants of the Notch signaling pathway through extensive pathway-oriented filtering and functional predictions, which led to the study of 27 candidate novel mutations in all nine patients. Detection of the trinucleotide repeat containing 6B gene mutation (a slice site alteration) in five of the nine probands, but not in any of the healthy samples, suggested that it may be a susceptibility factor for familial esophageal squamous cell carcinoma. Noticeably, 8 of 27 novel candidate gene mutations (e.g. epidermal growth factor, signal transducer and activator of transcription 3, MET) act in a cascade leading to cell survival and proliferation. Our results suggest that the trinucleotide repeat containing 6B mutation may be a candidate predisposing gene in esophageal squamous cell carcinoma. In addition, some of the Notch signaling pathway genetic mutations may act as key contributors to esophageal squamous cell carcinoma.

Polymorphisms in the AOX2 gene are associated with the rooting ability of olive cuttings.

PubMed

Hedayati, Vahideh; Mousavi, Amir; Razavi, Khadijeh; Cultrera, Nicolò; Alagna, Fiammetta; Mariotti, Roberto; Hosseini-Mazinani, Mehdi; Baldoni, Luciana

2015-07-01

Different rooting ability candidate genes were tested on an olive cross progeny. Our results demonstrated that only the AOX2 gene was strongly induced. OeAOX2 was fully characterised and correlated to phenotypical traits. The formation of adventitious roots is a key step in the vegetative propagation of trees crop species, and this ability is under strict genetic control. While numerous studies have been carried out to identify genes controlling adventitious root formation, only a few loci have been characterised. In this work, candidate genes that were putatively involved in rooting ability were identified in olive (Olea europaea L.) by similarity with orthologs identified in other plant species. The mRNA levels of these genes were analysed by real-time PCR during root induction in high- (HR) and low-rooting (LR) individuals. Interestingly, alternative oxidase 2 (AOX2), which was previously reported to be a functional marker for rooting in olive cuttings, showed a strong induction in HR individuals. From the OeAOX2 full-length gene, alleles and effective polymorphisms were distinguished and analysed in the cross progeny, which were segregated based on rooting. The results revealed a possible correlation between two single nucleotide polymorphisms of OeAOX2 gene and rooting ability.

Single-Nucleotide Polymorphisms Associated with Skin Naphthyl–Keratin Adduct Levels in Workers Exposed to Naphthalene

PubMed Central

Jiang, Rong; French, John E.; Stober, Vandy P.; Kang-Sickel, Juei-Chuan C.; Zou, Fei

2012-01-01

Background: Individual genetic variation that results in differences in systemic response to xenobiotic exposure is not accounted for as a predictor of outcome in current exposure assessment models. Objective: We developed a strategy to investigate individual differences in single-nucleotide polymorphisms (SNPs) as genetic markers associated with naphthyl–keratin adduct (NKA) levels measured in the skin of workers exposed to naphthalene. Methods: The SNP-association analysis was conducted in PLINK using candidate-gene analysis and genome-wide analysis. We identified significant SNP–NKA associations and investigated the potential impact of these SNPs along with personal and workplace factors on NKA levels using a multiple linear regression model and the Pratt index. Results: In candidate-gene analysis, a SNP (rs4852279) located near the CYP26B1 gene contributed to the 2-naphthyl–keratin adduct (2NKA) level. In the multiple linear regression model, the SNP rs4852279, dermal exposure, exposure time, task replacing foam, age, and ethnicity all were significant predictors of 2NKA level. In genome-wide analysis, no single SNP reached genome-wide significance for NKA levels (all p ≥ 1.05 × 10–5). Pathway and network analyses of SNPs associated with NKA levels were predicted to be involved in the regulation of cellular processes and homeostasis. Conclusions: These results provide evidence that a quantitative biomarker can be used as an intermediate phenotype when investigating the association between genetic markers and exposure–dose relationship in a small, well-characterized exposed worker population. PMID:22391508

Editor's Highlight: Genetic Targets of Acute Toluene Inhalation in Drosophila melanogaster.

PubMed

Bushnell, Philip J; Ward, William O; Morozova, Tatiana V; Oshiro, Wendy M; Lin, Mimi T; Judson, Richard S; Hester, Susan D; McKee, John M; Higuchi, Mark

2017-03-01

Interpretation and use of data from high-throughput assays for chemical toxicity require links between effects at molecular targets and adverse outcomes in whole animals. The well-characterized genome of Drosophila melanogaster provides a potential model system by which phenotypic responses to chemicals can be mapped to genes associated with those responses, which may in turn suggest adverse outcome pathways associated with those genes. To determine the utility of this approach, we used the Drosophila Genetics Reference Panel (DGRP), a collection of ∼200 homozygous lines of fruit flies whose genomes have been sequenced. We quantified toluene-induced suppression of motor activity in 123 lines of these flies during exposure to toluene, a volatile organic compound known to induce narcosis in mammals via its effects on neuronal ion channels. We then applied genome-wide association analyses on this effect of toluene using the DGRP web portal (http://dgrp2.gnets.ncsu.edu), which identified polymorphisms in candidate genes associated with the variation in response to toluene exposure. We tested ∼2 million variants and found 82 polymorphisms located in or near 66 candidate genes that were associated with phenotypic variation for sensitivity to toluene at P < 5 × 10-5, and human orthologs for 52 of these candidate Drosophila genes. None of these orthologs are known to be involved in canonical pathways for mammalian neuronal ion channels, including GABA, glutamate, dopamine, glycine, serotonin, and voltage sensitive calcium channels. Thus this analysis did not reveal a genetic signature consistent with processes previously shown to be involved in toluene-induced narcosis in mammals. The list of the human orthologs included Gene Ontology terms associated with signaling, nervous system development and embryonic morphogenesis; these orthologs may provide insight into potential new pathways that could mediate the narcotic effects of toluene. Published by Oxford University Press on behalf of the Society of Toxicology 2016. This work is written by US Government employees and is in the public domain in the US.

Arsenic-Induced Genotoxicity and Genetic Susceptibility to Arsenic-Related Pathologies

PubMed Central

Faita, Francesca; Cori, Liliana; Bianchi, Fabrizio; Andreassi, Maria Grazia

2013-01-01

The arsenic (As) exposure represents an important problem in many parts of the World. Indeed, it is estimated that over 100 million individuals are exposed to arsenic, mainly through a contamination of groundwaters. Chronic exposure to As is associated with adverse effects on human health such as cancers, cardiovascular diseases, neurological diseases and the rate of morbidity and mortality in populations exposed is alarming. The purpose of this review is to summarize the genotoxic effects of As in the cells as well as to discuss the importance of signaling and repair of arsenic-induced DNA damage. The current knowledge of specific polymorphisms in candidate genes that confer susceptibility to arsenic exposure is also reviewed. We also discuss the perspectives offered by the determination of biological markers of early effect on health, incorporating genetic polymorphisms, with biomarkers for exposure to better evaluate exposure-response clinical relationships as well as to develop novel preventative strategies for arsenic- health effects. PMID:23583964

Germline Mutations and Polymorphisms in the Origins of Cancers in Women

PubMed Central

Hirshfield, Kim M.; Rebbeck, Timothy R.; Levine, Arnold J.

2010-01-01

Several female malignancies including breast, ovarian, and endometrial cancers can be characterized based on known somatic and germline mutations. Initiation and propagation of tumors reflect underlying genomic alterations such as mutations, polymorphisms, and copy number variations found in genes of multiple cellular pathways. The contributions of any single genetic variation or mutation in a population depend on its frequency and penetrance as well as tissue-specific functionality. Genome wide association studies, fluorescence in situ hybridization, comparative genomic hybridization, and candidate gene studies have enumerated genetic contributors to cancers in women. These include p53, BRCA1, BRCA2, STK11, PTEN, CHEK2, ATM, BRIP1, PALB2, FGFR2, TGFB1, MDM2, MDM4 as well as several other chromosomal loci. Based on the heterogeneity within a specific tumor type, a combination of genomic alterations defines the cancer subtype, biologic behavior, and in some cases, response to therapeutics. Consideration of tumor heterogeneity is therefore important in the critical analysis of gene associations in cancer. PMID:20111735

Genetic variation may influence obesity only under conditions of diet: analysis of three candidate genes.

PubMed

Aberle, Jens; Flitsch, Jörg; Beck, Nicola Alessia; Mann, Oliver; Busch, Philipp; Peitsmeier, Philipp; Beil, Frank Ulrich

2008-11-01

Under the hypothesis of obesity as a polygenetic disease numerous genes have been associated with an obese phenotype and metabolic co-morbidities. The cannabinoid receptor 1 (CB 1) is part of an underinvestigated system that participates in appetite control. Previous publications suggest that the endocannabinoid systems interact with the better understood leptin-melanocortin axis. Neuropeptide Y (NPY) is a player in the latter. Finally resistin has been shown to influence NPY expression in the brain. In a cohort of 1721 caucasion men and women with a BMI of 25kg/m(2) or more we therefore investigated three candidate polymorphisms at baseline and following 3 months low fat caloric restriction diet by polymerase chain reaction and restriction digestion: the 1359 G/A variant of the cannabinoid receptor 1 (CB1), the L7P variation in neuropeptide Y (NPY) and the -420C>G polymorphism in resistin. Comparing groups according to genotype for each gene separately revealed significant results at baseline only for the CB1 gene. However, upon dieting significant data was found for all 3 genes. Carriers of at least one A allele in CB1 lost more weight and reduced LDL cholesterol more than wildtype patients. LL homocygotes in NPY had a greater reduction in glucose, triglycerides, and LDL cholesterol whereas in resistin carriers of the G allele had a greater reduction in weight and triglycerides. Creating two groups defined by NPY and resistin genotype, respectively, with similar BMI values resulted in significant differences concerning weight loss and metabolic improvement. In conclusion, genetic polymorphisms associated with obesity may become relevant only under the condition of a low calory diet. The presence of a certain genotype may then be beneficial for obesity treatment.

Genetic polymorphisms in lung disease: bandwagon or breakthrough?

PubMed Central

Iannuzzi, Michael C; Maliarik, Mary; Rybicki, Benjamin

2002-01-01

The study of genetic polymorphisms has touched every aspect of pulmonary and critical care medicine. We review recent progress made using genetic polymorphisms to define pathophysiology, to identify persons at risk for pulmonary disease and to predict treatment response. Several pitfalls are commonly encountered in studying genetic polymorphisms, and this article points out criteria that should be applied to design high-quality genetic polymorphism studies. PMID:11980584

[Obesity studies in candidate genes].

PubMed

Ochoa, María del Carmen; Martí, Amelia; Martínez, J Alfredo

2004-04-17

There are more than 430 chromosomic regions with gene variants involved in body weight regulation and obesity development. Polymorphisms in genes related to energy expenditure--uncoupling proteins (UCPs), related to adipogenesis and insulin resistance--hormone-sensitive lipase (HLS), peroxisome proliferator-activated receptor gamma (PPAR gamma), beta adrenergic receptors (ADRB2,3), and alfa tumor necrosis factor (TNF-alpha), and related to food intake--ghrelin (GHRL)--appear to be associated with obesity phenotypes. Obesity risk depends on two factors: a) genetic variants in candidate genes, and b) biographical exposure to environmental risk factors. It is necessary to perform new studies, with appropriate control groups and designs, in order to reach relevant conclusions with regard to gene/environmental (diet, lifestyle) interactions.

Convergence of genome-wide association and candidate gene studies for alcoholism.

PubMed

Olfson, Emily; Bierut, Laura Jean

2012-12-01

Genome-wide association (GWA) studies have led to a paradigm shift in how researchers study the genetics underlying disease. Many GWA studies are now publicly available and can be used to examine whether or not previously proposed candidate genes are supported by GWA data. This approach is particularly important for the field of alcoholism because the contribution of many candidate genes remains controversial. Using the Human Genome Epidemiology (HuGE) Navigator, we selected candidate genes for alcoholism that have been frequently examined in scientific articles in the past decade. Specific candidate loci as well as all the reported single nucleotide polymorphisms (SNPs) in candidate genes were examined in the Study of Addiction: Genetics and Environment (SAGE), a GWA study comparing alcohol-dependent and nondependent subjects. Several commonly reported candidate loci, including rs1800497 in DRD2, rs698 in ADH1C, rs1799971 in OPRM1, and rs4680 in COMT, are not replicated in SAGE (p > 0.05). Among candidate loci available for analysis, only rs279858 in GABRA2 (p = 0.0052, OR = 1.16) demonstrated a modest association. Examination of all SNPs reported in SAGE in over 50 candidate genes revealed no SNPs with large frequency differences between cases and controls, and the lowest p-value of any SNP was 0.0006. We provide evidence that several extensively studied candidate loci do not have a strong contribution to risk of developing alcohol dependence in European and African ancestry populations. Owing to the lack of coverage, we were unable to rule out the contribution of other variants, and these genes and particular loci warrant further investigation. Our analysis demonstrates that publicly available GWA results can be used to better understand which if any of previously proposed candidate genes contribute to disease. Furthermore, we illustrate how examining the convergence of candidate gene and GWA studies can help elucidate the genetic architecture of alcoholism and more generally complex diseases. Copyright © 2012 by the Research Society on Alcoholism.

Investigating the genetics of Bti resistance using mRNA tag sequencing: application on laboratory strains and natural populations of the dengue vector Aedes aegypti

PubMed Central

Paris, Margot; Marcombe, Sebastien; Coissac, Eric; Corbel, Vincent; David, Jean-Philippe; Després, Laurence

2013-01-01

Mosquito control is often the main method used to reduce mosquito-transmitted diseases. In order to investigate the genetic basis of resistance to the bio-insecticide Bacillus thuringiensis subsp. israelensis (Bti), we used information on polymorphism obtained from cDNA tag sequences from pooled larvae of laboratory Bti-resistant and susceptible Aedes aegypti mosquito strains to identify and analyse 1520 single nucleotide polymorphisms (SNPs). Of the 372 SNPs tested, 99.2% were validated using DNA Illumina GoldenGate® array, with a strong correlation between the allelic frequencies inferred from the pooled and individual data (r = 0.85). A total of 11 genomic regions and five candidate genes were detected using a genome scan approach. One of these candidate genes showed significant departures from neutrality in the resistant strain at sequence level. Six natural populations from Martinique Island were sequenced for the 372 tested SNPs with a high transferability (87%), and association mapping analyses detected 14 loci associated with Bti resistance, including one located in a putative receptor for Cry11 toxins. Three of these loci were also significantly differentiated between the laboratory strains, suggesting that most of the genes associated with resistance might differ between the two environments. It also suggests that common selected regions might harbour key genes for Bti resistance. PMID:24187584

Discovering genetic variants in Crohn's disease by exploring genomic regions enriched of weak association signals.

PubMed

D'Addabbo, Annarita; Palmieri, Orazio; Maglietta, Rosalia; Latiano, Anna; Mukherjee, Sayan; Annese, Vito; Ancona, Nicola

2011-08-01

A meta-analysis has re-analysed previous genome-wide association scanning definitively confirming eleven genes and further identifying 21 new loci. However, the identified genes/loci still explain only the minority of genetic predisposition of Crohn's disease. To identify genes weakly involved in disease predisposition by analysing chromosomal regions enriched of single nucleotide polymorphisms with modest statistical association. We utilized the WTCCC data set evaluating 1748 CD and 2938 controls. The identification of candidate genes/loci was performed by a two-step procedure: first of all chromosomal regions enriched of weak association signals were localized; subsequently, weak signals clustered in gene regions were identified. The statistical significance was assessed by non parametric permutation tests. The cytoband enrichment analysis highlighted 44 regions (P≤0.05) enriched with single nucleotide polymorphisms significantly associated with the trait including 23 out of 31 previously confirmed and replicated genes. Importantly, we highlight further 20 novel chromosomal regions carrying approximately one hundred genes/loci with modest association. Amongst these we find compelling functional candidate genes such as MAPT, GRB2 and CREM, LCT, and IL12RB2. Our study suggests a different statistical perspective to discover genes weakly associated with a given trait, although further confirmatory functional studies are needed. Copyright © 2011 Editrice Gastroenterologica Italiana S.r.l. All rights reserved.

SLCO1B1 Polymorphisms are Associated With Drug Intolerance in Childhood Leukemia Maintenance Therapy.

PubMed

Eldem, İrem; Yavuz, Duygu; Cumaoğullari, Özge; İleri, Talia; Ünal İnce, Elif; Ertem, Mehmet; Doğanay Erdoğan, Beyza; Bindak, Recep; Özdağ, Hilal; Şatiroğlu-Tufan, N Lale; Uysal, L Zümrüt

2018-04-20

Therapy discontinuations and toxicities occur because of significant interindividual variations in 6-mercaptopurine (6-MP) and methotrexate (MTX) response during maintenance therapy of childhood acute lymphoblastic leukemia (ALL). 6-MP/MTX intolerance in some of the patients cannot be explained by thiopurine S-methyl transferase (TPMT) gene variants. In this study, we aimed to investigate candidate pharmacogenetic determinants of 6-MP and MTX intolerance in Turkish ALL children. In total, 48 children with ALL who had completed or were receiving maintenance therapy according to Children's Oncology Group (COG) protocols were enrolled. Fifteen single-nucleotide polymorphisms in 8 candidate genes that were related to drug toxicity or had a role in the 6-MP/MTX metabolism (TPMT, ITPA, MTHFR, IMPDH2, PACSIN2, SLCO1B1, ABCC4, and PYGL) were genotyped by competitive allele-specific PCR (KASP). Drug doses during maintenance therapy were modified according to the protocol. The median drug dose intensity was 50% (28% to 92%) for 6-MP and 58% (27% to 99%) for MTX in the first year of maintenance therapy, which were lower than that scheduled in all patients. Among the analyzed polymorphisms, variant alleles in SLCO1B1 rs4149056 and rs11045879 were found to be associated with lower 6-MP/MTX tolerance. SLCO1B1 rs4149056 and rs11045879 polymorphisms may be important genetic markers to individualize 6-MP/MTX doses.

Construction and forensic genetic characterization of 11 autosomal haplotypes consisting of 22 tri-allelic indels.

PubMed

Zhao, Xiaohong; Chen, Xiaogang; Zhao, Yuancun; Zhang, Shu; Gao, Zehua; Yang, Yiwen; Wang, Yufang; Zhang, Ji

2018-05-01

Insertion/deletion polymorphisms (indels), which combine the advantages of both short tandem repeats and single-nucleotide polymorphisms, are suitable for parentage testing. To overcome the limitations of the low polymorphism of di-allelic indels, we constructed a set of haplotypes with physically linked, multi-allelic indels. Candidate haplotypes were selected from the 1000 Genomes Project database, and were subject to the following criteria for inclusion: (i) each marker must have a minimum allele frequency (MAF) of ≥0.1 in the Han population of China; (ii) markers must exist in a non-coding region; (iii) the physical distance between a pair of candidate indels must be <500 bp; (iv) the allele length variation of each indel from 1 to 20 bp; (v) different haplotypes must be located on different chromosomes or chromosomal arms, or be more than 10 Mb apart if on the same chromosomal arm; and (vi) they must not be located across a recombination hotspot. A multiplex system with 11 haplotype markers, comprising 22 tri-allelic indel loci distributed over 10 chromosomes was developed. To validate the multiplex panel, we investigated the haplotype distribution in sets of two and three-generation pedigrees. The results demonstrated that the haplotypes consisting of multi-allelic indel markers exhibited higher polymorphism than a single indel locus, and thus provide Supplementary information for forensic kinship identification. Copyright © 2018 Elsevier B.V. All rights reserved.

Examining the role of common genetic variants on alcohol, tobacco, cannabis, and illicit drug dependence

PubMed Central

Palmer, RHC; Brick, L; Nugent, NR; Bidwell, LC; McGeary, JE; Knopik, VS; Keller, MC

2014-01-01

Background and Aims Twin and family studies suggest that genetic influences are shared across substances of abuse. However, despite evidence of heritability, genome-wide association and candidate gene studies have indicated numerous markers of limited effects, suggesting that much of the heritability remains missing. We estimated (1) the aggregate effect of common single nucleotide polymorphisms (SNPs) on multiple indicators of comorbid drug problems that are typically employed across community and population-based samples, and (2) the genetic covariance across these measures. Participants 2596 unrelated subjects from the “Study of Addiction: Genetics and Environment” provided information on alcohol, tobacco, cocaine, cannabis, and other illicit substance dependence. Phenotypic measures included: (1) a factor score based on DSM-IV drug dependence diagnoses (DD), (2) a factor score based on problem use (PU; i.e., 1+ DSM-IV symptoms), and (3) dependence vulnerability (DV; a ratio of DSM-IV symptoms to the number of substances used). Findings Univariate and bivariate Genome-wide complex trait analyses of this selected sample indicated that common SNPs explained 25-36% of the variance across measures, with DD and DV having the largest effects [h2SNP (CI)=0.36 (0.11-0.62) and 0.33(0.07-0.58), respectively; PU = 0.25 (-0.01-0.51)]. Genetic effects were shared across the three phenotypic measures of comorbid drug problems (rSNP; rDD-PU = 0.92 (0.76-1.00), rDD-DV = 0.97 (0.87-1.00), and rPU-DV = 0.96 (0.82-1.00)). Conclusion At least 20% of the variance in the generalized vulnerability to substance dependence is attributable to common single nucleotide polymorphisms. The additive effect of common single nucleotide polymorphisms is shared across important indicators of comorbid drug problems. PMID:25424661

Genetic architecture of wild soybean (Glycine soja) response to soybean cyst nematode (Heterodera glycines).

PubMed

Zhang, Hengyou; Song, Qijian; Griffin, Joshua D; Song, Bao-Hua

2017-12-01

The soybean cyst nematode (SCN) is one of the most destructive pathogens of soybean plants worldwide. Host-plant resistance is an environmentally friendly method to mitigate SCN damage. To date, the resistant soybean cultivars harbor limited genetic variation, and some are losing resistance. Thus, a better understanding of the genetic mechanisms of the SCN resistance, as well as developing diverse resistant soybean cultivars, is urgently needed. In this study, a genome-wide association study (GWAS) was conducted using 1032 wild soybean (Glycine soja) accessions with over 42,000 single-nucleotide polymorphisms (SNPs) to understand the genetic architecture of G. soja resistance to SCN race 1. Ten SNPs were significantly associated with the response to race 1. Three SNPs on chromosome 18 were localized within the previously identified quantitative trait loci (QTLs), and two of which were localized within a strong linkage disequilibrium block encompassing a nucleotide-binding (NB)-ARC disease resistance gene (Glyma.18G102600). Genes encoding methyltransferases, the calcium-dependent signaling protein, the leucine-rich repeat kinase family protein, and the NB-ARC disease resistance protein, were identified as promising candidate genes. The identified SNPs and candidate genes can not only shed light on the molecular mechanisms underlying SCN resistance, but also can facilitate soybean improvement employing wild genetic resources.

Lack of association between rheumatoid arthritis and genetic variants rs10889677, rs11209026 and rs2201841 of IL-23R gene.

PubMed

Paradowska-Gorycka, Agnieszka; Malinowski, Damian; Haladyj, Ewa; Olesinska, Marzena; Safranow, Krzysztof; Pawlik, Andrzej

2018-01-19

Rheumatoid arthritis (RA) is an autoimmune diseases, where different genetic variants in cytokine genes may play a pathogenic role. A GWAS in autoimmune diseases highlighted the IL-23R gene as a one of the susceptibility factors. We examined three candidate single nucleotide polymorphisms (SNPs) rs10889677, rs11209026 and rs2201841 of the IL-23R gene, as well as determined their possible association with RA in a Polish population. The IL-23R gene polymorphisms were genotyped for 422 RA patients and 348 healthy individuals using TaqMan SNP genotyping assay. The genotypes frequency did not deviate from HWE in each examined group. A comparison of the allele as well as genotype frequencies of the IL-23R polymorphisms under codominant, dominant and recessive genetic model revealed no significant differences between RA patients and healthy subjects. We also demonstrated that IL-23R rs2201841 and rs11209026 as well as rs11209026 and rs10889677 were in complete linkage disequilibrium (D'=1.0). Our genotype-phenotype analysis demonstrated that in carriers of rs10889677C and/or rs2201841A allele the RF, extra-articular manifestations and erosion were more frequent present than in patients with rs10889677A and/or rs2201841A allele, although this association was not significant. Present findings indicated that the autoimmune disease-associated genetic variants in IL-23R gene are not associated with RA in the Polish population. Copyright © 2017 Elsevier España, S.L.U. All rights reserved.

Financial and Psychological Risk Attitudes Associated with Two Single Nucleotide Polymorphisms in the Nicotine Receptor (CHRNA4) Gene

PubMed Central

Roe, Brian E.; Tilley, Michael R.; Gu, Howard H.; Beversdorf, David Q.; Sadee, Wolfgang; Haab, Timothy C.; Papp, Audrey C.

2009-01-01

With recent advances in understanding of the neuroscience of risk taking, attention is now turning to genetic factors that may contribute to individual heterogeneity in risk attitudes. In this paper we test for genetic associations with risk attitude measures derived from both the psychology and economics literature. To develop a long-term prospective study, we first evaluate both types of risk attitudes and find that the economic and psychological measures are poorly correlated, suggesting that different genetic factors may underlie human response to risk faced in different behavioral domains. We then examine polymorphisms in a spectrum of candidate genes that affect neurotransmitter systems influencing dopamine regulation or are thought to be associated with risk attitudes or impulsive disorders. Analysis of the genotyping data identified two single nucleotide polymorphisms (SNPs) in the gene encoding the alpha 4 nicotine receptor (CHRNA4, rs4603829 and rs4522666) that are significantly associated with harm avoidance, a risk attitude measurement drawn from the psychology literature. Novelty seeking, another risk attitude measure from the psychology literature, is associated with several COMT (catechol-O-methyl transferase) SNPs while economic risk attitude measures are associated with several VMAT2 (vesicular monoamine transporter) SNPs, but the significance of these associations did not withstand statistical adjustment for multiple testing and requires larger cohorts. These exploratory results provide a starting point for understanding the genetic basis of risk attitudes by considering the range of methods available for measuring risk attitudes and by searching beyond the traditional direct focus on dopamine and serotonin receptor and transporter genes. PMID:19693267

No association between apolipoprotein E or N-acetyltransferase 2 gene polymorphisms and age-related hearing loss.

PubMed

Dawes, Piers; Platt, Hazel; Horan, Michael; Ollier, William; Munro, Kevin; Pendleton, Neil; Payton, Antony

2015-01-01

Age-related hearing loss has a genetic component, but there have been limited genetic studies in this field. Both N-acetyltransferase 2 and apolipoprotein E genes have previously been associated. However, these studies have either used small sample sizes, examined a limited number of polymorphisms, or have produced conflicting results. Here we use a haplotype tagging approach to determine association with age-related hearing loss and investigate epistasis between these two genes. Candidate gene association study of a continuous phenotype. We investigated haplotype tagging single nucleotide polymorphisms in the N-acetyltransferase 2 gene and the presence/absence of the apolipoprotein E ε4 allele for association with age-related hearing loss in a cohort of 265 Caucasian elderly volunteers from Greater Manchester, United Kingdom. Hearing phenotypes were generated using principal component analysis of the hearing threshold levels for the better ear (severity, slope, and concavity). Genotype data for the N-acetyltransferase 2 gene was obtained from existing genome-wide association study data from the Illumina 610-Quadv1 chip. Apolipoprotein E genotyping was performed using Sequenom technology. Linear regression analysis was performed using Plink and Stata software. No significant associations (P value, > 0.05) were observed between the N-acetyltransferase 2 or apolipoprotein E gene polymorphisms and any hearing factor. No significant association was observed for epistasis analysis of apolipoprotein E ε4 and the N-acetyltransferase 2 single nucleotide polymorphism rs1799930 (NAT2*6A). We found no evidence to support that either N-acetyltransferase 2 or apolipoprotein E gene polymorphisms are associated with age-related hearing loss in a cohort of 265 elderly volunteers. © 2014 The American Laryngological, Rhinological and Otological Society, Inc.

Association of genetic risk scores with body mass index in Swiss psychiatric cohorts.

PubMed

Saigi-Morgui, Núria; Vandenberghe, Frederik; Delacrétaz, Aurélie; Quteineh, Lina; Gholamrezaee, Mehdi; Aubry, Jean-Michel; von Gunten, Armin; Kutalik, Zoltán; Conus, Philippe; Eap, Chin B

2016-05-01

Weight gain is associated with psychiatric disorders and/or with psychotropic drug treatments. We analyzed in three psychiatric cohorts under psychotropic treatment the association of weighted genetic risk scores (w-GRSs) with BMI by integrating BMI-related polymorphisms from the candidate-gene approach and Genome-Wide Association Studies (GWAS). w-GRS of 32 polymorphisms associated previously with BMI in general population GWAS and 20 polymorphisms associated with antipsychotics-induced weight gain were investigated in three independent psychiatric samples. w-GRS of 32 polymorphisms were significantly associated with BMI in the psychiatric sample 1 (n=425) and were replicated in another sample (n=177). Those at the percentile 95 (p95) of the score had 2.26 and 2.99 kg/m(2) higher predicted BMI compared with individuals at the percentile 5 (p5) in sample 1 and in sample 3 (P=0.009 and 0.04, respectively). When combining all samples together (n=750), a significant difference of 1.89 kg/m(2) predicted BMI was found between p95 and p5 individuals at 12 months of treatment. Stronger associations were found among men (difference: 2.91 kg/m(2) of predicted BMI between p95 and p5, P=0.0002), whereas no association was found among women. w-GRS of 20 polymorphisms was not associated with BMI. The w-GRS of 52 polymorphisms and the clinical variables (age, sex, treatment) explained 1.99 and 3.15%, respectively, of BMI variability. The present study replicated in psychiatric cohorts previously identified BMI risk variants obtained in GWAS analyses from population-based samples. Sex-specific analysis should be considered in further analysis.

Development of Cymbidium ensifolium genic-SSR markers and their utility in genetic diversity and population structure analysis in cymbidiums.

PubMed

Li, Xiaobai; Jin, Feng; Jin, Liang; Jackson, Aaron; Huang, Cheng; Li, Kehu; Shu, Xiaoli

2014-12-05

Cymbidium is a genus of 68 species in the orchid family, with extremely high ornamental value. Marker-assisted selection has proven to be an effective strategy in accelerating plant breeding for many plant species. Analysis of cymbidiums genetic background by molecular markers can be of great value in assisting parental selection and breeding strategy design, however, in plants such as cymbidiums limited genomic resources exist. In order to obtain efficient markers, we deep sequenced the C. ensifolium transcriptome to identify simple sequence repeats derived from gene regions (genic-SSR). The 7,936 genic-SSR markers were identified. A total of 80 genic-SSRs were selected, and primers were designed according to their flanking sequences. Of the 80 genic-SSR primer sets, 62 were amplified in C. ensifolium successfully, and 55 showed polymorphism when cross-tested among 9 Cymbidium species comprising 59 accessions. Unigenes containing the 62 genic-SSRs were searched against Non-redundant (Nr), Gene Ontology database (GO), eukaryotic orthologous groups (KOGs) and Kyoto Encyclopedia of Genes and Genomes (KEGG) database. The search resulted in 53 matching Nr sequences, of which 39 had GO terms, 18 were assigned to KOGs, and 15 were annotated with KEGG. Genetic diversity and population structure were analyzed based on 55 polymorphic genic-SSR data among 59 accessions. The genetic distance averaged 0.3911, ranging from 0.016 to 0.618. The polymorphic index content (PIC) of 55 polymorphic markers averaged 0.407, ranging from 0.033 to 0.863. A model-based clustering analysis revealed that five genetic groups existed in the collection. Accessions from the same species were typically grouped together; however, C. goeringii accessions did not always form a separate cluster, suggesting that C. goeringii accessions were polyphyletic. The genic-SSR identified in this study constitute a set of markers that can be applied across multiple Cymbidium species and used for the evaluation of genetic relationships as well as qualitative and quantitative trait mapping studies. Genic-SSR's coupled with the functional annotations provided by the unigenes will aid in mapping candidate genes of specific function.

Strong Impact of TGF-β1 Gene Polymorphisms on Breast Cancer Risk in Indian Women: A Case-Control and Population-Based Study

PubMed Central

Rajender, Singh; Tamang, Rakesh; Rajkumar, Raja; Saini, Karan Singh; Megu, Kaling; Goel, Madhu Mati; Surekha, Daminani; Rao, Digumarthi Raghunatha; Rao, Lakshmi; Ramachandra, Lingadakai; Kumar, Sandeep; Kumar, Surender; Vishnupriya, Satti; Satyamoorthy, Kapaettu; Negi, Mahendra Pal Singh; Thangaraj, Kumarasamy; Konwar, Rituraj

2013-01-01

Introduction TGF-β1 is a multi-functional cytokine that plays an important role in breast carcinogenesis. Critical role of TGF-β1 signaling in breast cancer progression is well documented. Some TGF-β1 polymorphisms influence its expression; however, their impact on breast cancer risk is not clear. Methods We analyzed 1222 samples in a candidate gene-based genetic association study on two distantly located and ethnically divergent case-control groups of Indian women, followed by a population-based genetic epidemiology study analyzing these polymorphisms in other Indian populations. The c.29C>T (Pro10Leu, rs1982073 or rs1800470) and c.74G>C (Arg25Pro, rs1800471) polymorphisms in the TGF-β1 gene were analyzed using direct DNA sequencing, and peripheral level of TGF-β1 were measured by ELISA. Results c.29C>T substitution increased breast cancer risk, irrespective of ethnicity and menopausal status. On the other hand, c.74G>C substitution reduced breast cancer risk significantly in the north Indian group (p = 0.0005) and only in the pre-menopausal women. The protective effect of c.74G>C polymorphism may be ethnicity-specific, as no association was seen in south Indian group. The polymorphic status of c.29C>T was comparable among Indo-Europeans, Dravidians, and Tibeto-Burmans. Interestingly, we found that Tibeto-Burmans lack polymorphism at c.74G>C locus as true for the Chinese populations. However, the Brahmins of Nepal (Indo-Europeans) showed polymorphism in 2.08% of alleles. Mean TGF-β1 was significantly elevated in patients in comparison to controls (p<0.001). Conclusion c.29C>T and c.74G>C polymorphisms in the TGF-β1 gene significantly affect breast cancer risk, which correlates with elevated TGF-β1 level in the patients. The c.29C>T locus is polymorphic across ethnically different populations, but c.74G>C locus is monomorphic in Tibeto-Burmans and polymorphic in other Indian populations. PMID:24146803

Gene(s) and individual feeding behavior: Exploring eco-evolutionary dynamics underlying left-right asymmetry in the scale-eating cichlid fish Perissodus microlepis.

PubMed

Raffini, Francesca; Fruciano, Carmelo; Meyer, Axel

2018-06-01

The scale-eating cichlid fish Perissodus microlepis is a textbook example of bilateral asymmetry due to its left or right-bending heads and of negative frequency-dependent selection, which is proposed to maintain this stable polymorphism. The mechanisms that underlie this asymmetry remain elusive. Several studies had initially postulated a simple genetic basis for this trait, but this explanation has been questioned, particularly by reports observing a unimodal distribution of mouth shapes. We hypothesize that this unimodal distribution might be due to a combination of genetic and phenotypically plastic components. Here, we expanded on previous work by investigating a formerly identified candidate SNP associated to mouth laterality, documenting inter-individual variation in feeding preference using stable isotope analyses, and testing their association with mouth asymmetry. Our results suggest that this polymorphism is influenced by both a polygenic basis and inter-individual non-genetic variation, possibly due to feeding experience, individual specialization, and intraspecific competition. We introduce a hypothesis potentially explaining the simultaneous maintenance of left, right, asymmetric and symmetric mouth phenotypes due to the interaction between diverse eco-evolutionary dynamics including niche construction and balancing selection. Future studies will have to further tease apart the relative contribution of genetic and environmental factors and their interactions in an integrated fashion.

DISSECTING THE GENETICS OF HUMAN HIGH MYOPIA: A MOLECULAR BIOLOGIC APPROACH

PubMed Central

Young, Terri L

2004-01-01

ABSTRACT Purpose Despite the plethora of experimental myopia animal studies that demonstrate biochemical factor changes in various eye tissues, and limited human studies utilizing pharmacologic agents to thwart axial elongation, we have little knowledge of the basic physiology that drives myopic development. Identifying the implicated genes for myopia susceptibility will provide a fundamental molecular understanding of how myopia occurs and may lead to directed physiologic (ie, pharmacologic, gene therapy) interventions. The purpose of this proposal is to describe the results of positional candidate gene screening of selected genes within the autosomal dominant high-grade myopia-2 locus (MYP2) on chromosome 18p11.31. Methods A physical map of a contracted MYP2 interval was compiled, and gene expression studies in ocular tissues using complementary DNA library screens, microarray matches, and reverse-transcription techniques aided in prioritizing gene selection for screening. The TGIF, EMLIN-2, MLCB, and CLUL1 genes were screened in DNA samples from unrelated controls and in high-myopia affected and unaffected family members from the original seven MYP2 pedigrees. All candidate genes were screened by direct base pair sequence analysis. Results Consistent segregation of a gene sequence alteration (polymorphism) with myopia was not demonstrated in any of the seven families. Novel single nucleotide polymorphisms were found. Conclusion The positional candidate genes TGIF, EMLIN-2, MLCB, and CLUL1 are not associated with MYP2-linked high-grade myopia. Base change polymorphisms discovered with base sequence screening of these genes were submitted to an Internet database. Other genes that also map within the interval are currently undergoing mutation screening. PMID:15747770

Genome-wide detection and characterization of positive selection in human populations.

PubMed

Sabeti, Pardis C; Varilly, Patrick; Fry, Ben; Lohmueller, Jason; Hostetter, Elizabeth; Cotsapas, Chris; Xie, Xiaohui; Byrne, Elizabeth H; McCarroll, Steven A; Gaudet, Rachelle; Schaffner, Stephen F; Lander, Eric S; Frazer, Kelly A; Ballinger, Dennis G; Cox, David R; Hinds, David A; Stuve, Laura L; Gibbs, Richard A; Belmont, John W; Boudreau, Andrew; Hardenbol, Paul; Leal, Suzanne M; Pasternak, Shiran; Wheeler, David A; Willis, Thomas D; Yu, Fuli; Yang, Huanming; Zeng, Changqing; Gao, Yang; Hu, Haoran; Hu, Weitao; Li, Chaohua; Lin, Wei; Liu, Siqi; Pan, Hao; Tang, Xiaoli; Wang, Jian; Wang, Wei; Yu, Jun; Zhang, Bo; Zhang, Qingrun; Zhao, Hongbin; Zhao, Hui; Zhou, Jun; Gabriel, Stacey B; Barry, Rachel; Blumenstiel, Brendan; Camargo, Amy; Defelice, Matthew; Faggart, Maura; Goyette, Mary; Gupta, Supriya; Moore, Jamie; Nguyen, Huy; Onofrio, Robert C; Parkin, Melissa; Roy, Jessica; Stahl, Erich; Winchester, Ellen; Ziaugra, Liuda; Altshuler, David; Shen, Yan; Yao, Zhijian; Huang, Wei; Chu, Xun; He, Yungang; Jin, Li; Liu, Yangfan; Shen, Yayun; Sun, Weiwei; Wang, Haifeng; Wang, Yi; Wang, Ying; Xiong, Xiaoyan; Xu, Liang; Waye, Mary M Y; Tsui, Stephen K W; Xue, Hong; Wong, J Tze-Fei; Galver, Luana M; Fan, Jian-Bing; Gunderson, Kevin; Murray, Sarah S; Oliphant, Arnold R; Chee, Mark S; Montpetit, Alexandre; Chagnon, Fanny; Ferretti, Vincent; Leboeuf, Martin; Olivier, Jean-François; Phillips, Michael S; Roumy, Stéphanie; Sallée, Clémentine; Verner, Andrei; Hudson, Thomas J; Kwok, Pui-Yan; Cai, Dongmei; Koboldt, Daniel C; Miller, Raymond D; Pawlikowska, Ludmila; Taillon-Miller, Patricia; Xiao, Ming; Tsui, Lap-Chee; Mak, William; Song, You Qiang; Tam, Paul K H; Nakamura, Yusuke; Kawaguchi, Takahisa; Kitamoto, Takuya; Morizono, Takashi; Nagashima, Atsushi; Ohnishi, Yozo; Sekine, Akihiro; Tanaka, Toshihiro; Tsunoda, Tatsuhiko; Deloukas, Panos; Bird, Christine P; Delgado, Marcos; Dermitzakis, Emmanouil T; Gwilliam, Rhian; Hunt, Sarah; Morrison, Jonathan; Powell, Don; Stranger, Barbara E; Whittaker, Pamela; Bentley, David R; Daly, Mark J; de Bakker, Paul I W; Barrett, Jeff; Chretien, Yves R; Maller, Julian; McCarroll, Steve; Patterson, Nick; Pe'er, Itsik; Price, Alkes; Purcell, Shaun; Richter, Daniel J; Sabeti, Pardis; Saxena, Richa; Schaffner, Stephen F; Sham, Pak C; Varilly, Patrick; Altshuler, David; Stein, Lincoln D; Krishnan, Lalitha; Smith, Albert Vernon; Tello-Ruiz, Marcela K; Thorisson, Gudmundur A; Chakravarti, Aravinda; Chen, Peter E; Cutler, David J; Kashuk, Carl S; Lin, Shin; Abecasis, Gonçalo R; Guan, Weihua; Li, Yun; Munro, Heather M; Qin, Zhaohui Steve; Thomas, Daryl J; McVean, Gilean; Auton, Adam; Bottolo, Leonardo; Cardin, Niall; Eyheramendy, Susana; Freeman, Colin; Marchini, Jonathan; Myers, Simon; Spencer, Chris; Stephens, Matthew; Donnelly, Peter; Cardon, Lon R; Clarke, Geraldine; Evans, David M; Morris, Andrew P; Weir, Bruce S; Tsunoda, Tatsuhiko; Johnson, Todd A; Mullikin, James C; Sherry, Stephen T; Feolo, Michael; Skol, Andrew; Zhang, Houcan; Zeng, Changqing; Zhao, Hui; Matsuda, Ichiro; Fukushima, Yoshimitsu; Macer, Darryl R; Suda, Eiko; Rotimi, Charles N; Adebamowo, Clement A; Ajayi, Ike; Aniagwu, Toyin; Marshall, Patricia A; Nkwodimmah, Chibuzor; Royal, Charmaine D M; Leppert, Mark F; Dixon, Missy; Peiffer, Andy; Qiu, Renzong; Kent, Alastair; Kato, Kazuto; Niikawa, Norio; Adewole, Isaac F; Knoppers, Bartha M; Foster, Morris W; Clayton, Ellen Wright; Watkin, Jessica; Gibbs, Richard A; Belmont, John W; Muzny, Donna; Nazareth, Lynne; Sodergren, Erica; Weinstock, George M; Wheeler, David A; Yakub, Imtaz; Gabriel, Stacey B; Onofrio, Robert C; Richter, Daniel J; Ziaugra, Liuda; Birren, Bruce W; Daly, Mark J; Altshuler, David; Wilson, Richard K; Fulton, Lucinda L; Rogers, Jane; Burton, John; Carter, Nigel P; Clee, Christopher M; Griffiths, Mark; Jones, Matthew C; McLay, Kirsten; Plumb, Robert W; Ross, Mark T; Sims, Sarah K; Willey, David L; Chen, Zhu; Han, Hua; Kang, Le; Godbout, Martin; Wallenburg, John C; L'Archevêque, Paul; Bellemare, Guy; Saeki, Koji; Wang, Hongguang; An, Daochang; Fu, Hongbo; Li, Qing; Wang, Zhen; Wang, Renwu; Holden, Arthur L; Brooks, Lisa D; McEwen, Jean E; Guyer, Mark S; Wang, Vivian Ota; Peterson, Jane L; Shi, Michael; Spiegel, Jack; Sung, Lawrence M; Zacharia, Lynn F; Collins, Francis S; Kennedy, Karen; Jamieson, Ruth; Stewart, John

2007-10-18

With the advent of dense maps of human genetic variation, it is now possible to detect positive natural selection across the human genome. Here we report an analysis of over 3 million polymorphisms from the International HapMap Project Phase 2 (HapMap2). We used 'long-range haplotype' methods, which were developed to identify alleles segregating in a population that have undergone recent selection, and we also developed new methods that are based on cross-population comparisons to discover alleles that have swept to near-fixation within a population. The analysis reveals more than 300 strong candidate regions. Focusing on the strongest 22 regions, we develop a heuristic for scrutinizing these regions to identify candidate targets of selection. In a complementary analysis, we identify 26 non-synonymous, coding, single nucleotide polymorphisms showing regional evidence of positive selection. Examination of these candidates highlights three cases in which two genes in a common biological process have apparently undergone positive selection in the same population:LARGE and DMD, both related to infection by the Lassa virus, in West Africa;SLC24A5 and SLC45A2, both involved in skin pigmentation, in Europe; and EDAR and EDA2R, both involved in development of hair follicles, in Asia.

5-HTTLPR, HTR1A, and HTR2A cumulative genetic score interacts with mood reactivity to predict mood-congruent gaze bias

PubMed Central

Disner, Seth G.; McGeary, John E.; Wells, Tony T.; Ellis, Alissa J.; Beevers, Christopher G.

2014-01-01

Genetic variation within the serotonin system has been associated with biased attention for affective stimuli and, less consistently, with vulnerability for Major Depressive Disorder. In particular, 5-HTTLPR, HTR1A (rs6295), and HTR2A (rs6311) polymorphisms have been linked with biased cognition. The current study developed a serotonergic cumulative genetic score (CGS) that quantified the number of risk alleles associated with these candidate polymorphisms to yield a single CGS. The CGS was then used to model genetic influence on the relationship between reactivity to a negative mood induction and negatively biased cognition. A passive viewing eye tracking task was administered to 170 healthy volunteers to assess sustained attention for positive, dysphoric, neutral, and threatening scenes. Participants were then induced into a sad mood and readministered the passive viewing task. Change in gaze bias, as a function of reactivity to mood induction, was the primary measure of cognitive vulnerability. Results suggest that, although none of the individual genes interacted with mood reactivity to predict change in gaze bias, individuals with higher serotonin CGS were significantly more likely to look towards dysphoric images and away from positive images as mood reactivity increased. These findings suggest that a CGS approach may better capture genetic influences on cognitive vulnerability, and reaffirms the need to examine multilocus approaches in genomic research. PMID:24643765

5-HTTLPR, HTR1A, and HTR2A cumulative genetic score interacts with mood reactivity to predict mood-congruent gaze bias.

PubMed

Disner, Seth G; McGeary, John E; Wells, Tony T; Ellis, Alissa J; Beevers, Christopher G

2014-12-01

Genetic variation within the serotonin system has been associated with biased attention for affective stimuli and, less consistently, with vulnerability for major depressive disorder. In particular, 5-HTTLPR, HTR1A (rs6295), and HTR2A (rs6311) polymorphisms have been linked with biased cognition. The present study developed a serotonergic cumulative genetic score (CGS) that quantified the number of risk alleles associated with these candidate polymorphisms to yield a single CGS. The CGS was then used to model genetic influence on the relationship between reactivity to a negative mood induction and negatively biased cognition. A passive-viewing eye-tracking task was administered to 170 healthy volunteers to assess sustained attention for positive, dysphoric, neutral, and threatening scenes. Participants were then induced into a sad mood and readministered the passive-viewing task. Change in gaze bias, as a function of reactivity to mood induction, was the primary measure of cognitive vulnerability. Results suggest that, although none of the individual genes interacted with mood reactivity to predict change in gaze bias, individuals with higher serotonin CGS were significantly more likely to look toward dysphoric images and away from positive images as mood reactivity increased. These findings suggest that a CGS approach may better capture genetic influences on cognitive vulnerability and reaffirm the need to examine multilocus approaches in genomic research.

The Influence of DAT1, COMT, and BDNF Genetic Polymorphisms on Total and Subregional Hippocampal Volumes in Early Onset Heavy Cannabis Users

PubMed Central

Batalla, Albert; Lorenzetti, Valentina; Chye, Yann; Yücel, Murat; Soriano-Mas, Carles; Bhattacharyya, Sagnik; Torrens, Marta; Crippa, José A.S.; Martín-Santos, Rocío

2018-01-01

Abstract Introduction: Hippocampal neuroanatomy is affected by genetic variations in dopaminergic candidate genes and environmental insults, such as early onset of chronic cannabis exposure. Here, we examine how hippocampal total and subregional volumes are affected by cannabis use and functional polymorphisms of dopamine-relevant genes, including the catechol-O-methyltransferase (COMT), dopamine transporter (DAT1), and the brain-derived neurotrophic factor (BDNF) genes. Material and Methods: We manually traced total hippocampal volumes and automatically segmented hippocampal subregions using high-resolution MRI images, and performed COMT, DAT1, and BDNF genotyping in 59 male Caucasian young adults aged 18–30 years. These included 30 chronic cannabis users with early-onset (regular use at <16 years) and 29 age-, education-, and intelligence-matched controls. Results: Cannabis use and dopaminergic gene polymorphism had both distinct and interactive effects on the hippocampus. We found emerging alterations of hippocampal total and specific subregional volumes in cannabis users relative to controls (i.e., CA1, CA2/3, and CA4), and associations between cannabis use levels and total and specific subregional volumes. Furthermore, total hippocampal volume and the fissure subregion were affected by cannabis×DAT1 polymorphism (i.e., 9/9R and in 10/10R alleles), reflecting high and low levels of dopamine availability. Conclusion: These findings suggest that cannabis exposure alters the normal relationship between DAT1 polymorphism and the anatomy of total and subregional hippocampal volumes, and that specific hippocampal subregions may be particularly affected. PMID:29404409

The Influence of DAT1, COMT, and BDNF Genetic Polymorphisms on Total and Subregional Hippocampal Volumes in Early Onset Heavy Cannabis Users.

PubMed

Batalla, Albert; Lorenzetti, Valentina; Chye, Yann; Yücel, Murat; Soriano-Mas, Carles; Bhattacharyya, Sagnik; Torrens, Marta; Crippa, José A S; Martín-Santos, Rocío

2018-01-01

Introduction: Hippocampal neuroanatomy is affected by genetic variations in dopaminergic candidate genes and environmental insults, such as early onset of chronic cannabis exposure. Here, we examine how hippocampal total and subregional volumes are affected by cannabis use and functional polymorphisms of dopamine-relevant genes, including the catechol-O-methyltransferase (COMT), dopamine transporter (DAT1), and the brain-derived neurotrophic factor (BDNF) genes. Material and Methods: We manually traced total hippocampal volumes and automatically segmented hippocampal subregions using high-resolution MRI images, and performed COMT, DAT1, and BDNF genotyping in 59 male Caucasian young adults aged 18-30 years. These included 30 chronic cannabis users with early-onset (regular use at <16 years) and 29 age-, education-, and intelligence-matched controls. Results: Cannabis use and dopaminergic gene polymorphism had both distinct and interactive effects on the hippocampus. We found emerging alterations of hippocampal total and specific subregional volumes in cannabis users relative to controls (i.e., CA1, CA2/3, and CA4), and associations between cannabis use levels and total and specific subregional volumes. Furthermore, total hippocampal volume and the fissure subregion were affected by cannabis×DAT1 polymorphism (i.e., 9/9R and in 10/10R alleles), reflecting high and low levels of dopamine availability. Conclusion: These findings suggest that cannabis exposure alters the normal relationship between DAT1 polymorphism and the anatomy of total and subregional hippocampal volumes, and that specific hippocampal subregions may be particularly affected.

Genetic mapping of the female mimic morph locus in the ruff

PubMed Central

2013-01-01

Background Ruffs (Aves: Philomachus pugnax) possess a genetic polymorphism for male mating behaviour resulting in three permanent alternative male reproductive morphs: (i) territorial ‘Independents’, (ii) non-territorial ‘Satellites’, and (iii) female-mimicking ‘Faeders’. Development into independent or satellite morphs has previously been shown to be due to a single-locus, two-allele autosomal Mendelian mode of inheritance at the Satellite locus. Here, we use linkage analysis to map the chromosomal location of the Faeder locus, which controls development into the Faeder morph, and draw further conclusions about candidate genes, assuming shared synteny with other birds. Results Segregation data on the Faeder locus were obtained from captive-bred pedigrees comprising 64 multi-generation families (N = 381). There was no evidence that the Faeder locus was linked to the Satellite locus, but it was linked with microsatellite marker Ppu020. Comparative mapping of ruff microsatellite markers against the chicken (Gallus gallus) and zebra finch (Taeniopygia guttata) genomes places the Ppu020 and Faeder loci on a region of chromosome 11 that includes the Melanocortin-1 receptor (MC1R) gene, which regulates colour polymorphisms in numerous birds and other vertebrates. Melanin-based colouration varies with life-history strategies in ruffs and other species, thus the MC1R gene is a strong candidate to play a role in alternative male morph determination. Conclusion Two unlinked loci appear to control behavioural development in ruffs. The Faeder locus is linked to Ppu020, which, assuming synteny, is located on avian chromosome 11. MC1R is a candidate gene involved in alternative male morph determination in ruffs. PMID:24256185

Genetic dissection of ozone tolerance in rice (Oryza sativa L.) by a genome-wide association study

PubMed Central

Ueda, Yoshiaki; Frimpong, Felix; Qi, Yitao; Matthus, Elsa; Wu, Linbo; Höller, Stefanie; Kraska, Thorsten; Frei, Michael

2015-01-01

Tropospheric ozone causes various negative effects on plants and affects the yield and quality of agricultural crops. Here, we report a genome-wide association study (GWAS) in rice (Oryza sativa L.) to determine candidate loci associated with ozone tolerance. A diversity panel consisting of 328 accessions representing all subgroups of O. sativa was exposed to ozone stress at 60 nl l–1 for 7h every day throughout the growth season, or to control conditions. Averaged over all genotypes, ozone significantly affected biomass-related traits (plant height –1.0%, shoot dry weight –15.9%, tiller number –8.3%, grain weight –9.3%, total panicle weight –19.7%, single panicle weight –5.5%) and biochemical/physiological traits (symptom formation, SPAD value –4.4%, foliar lignin content +3.4%). A wide range of genotypic variance in response to ozone stress were observed in all phenotypes. Association mapping based on more than 30 000 single-nucleotide polymorphism (SNP) markers yielded 16 significant markers throughout the genome by applying a significance threshold of P<0.0001. Furthermore, by determining linkage disequilibrium blocks associated with significant SNPs, we gained a total of 195 candidate genes for these traits. The following sequence analysis revealed a number of novel polymorphisms in two candidate genes for the formation of visible leaf symptoms, a RING and an EREBP gene, both of which are involved in cell death and stress defence reactions. This study demonstrated substantial natural variation of responses to ozone in rice and the possibility of using GWAS in elucidating the genetic factors underlying ozone tolerance. PMID:25371505

Major histocompatibility complex and other allergy-related candidate genes associated with insect bite hypersensitivity in Icelandic horses.

PubMed

Klumplerova, Marie; Vychodilova, Leona; Bobrova, Olga; Cvanova, Michaela; Futas, Jan; Janova, Eva; Vyskocil, Mirko; Vrtkova, Irena; Putnova, Lenka; Dusek, Ladislav; Marti, Eliane; Horin, Petr

2013-04-01

Insect bite hypersensitivity (IBH) is an allergic dermatitis of horses caused by bites of insects. IBH is a multifactorial disease with contribution of genetic and environmental factors. Candidate gene association analysis of IBH was performed in a group of 89 Icelandic horses all born in Iceland and imported to Europe. Horses were classified in IBH-affected and non-affected based on clinical signs and history of recurrent dermatitis, and on the results of an in vitro sulfidoleukotriene (sLT)-release assay with Culicoides nubeculosus and Simulium vittatum extract. Different genetic markers were tested for association with IBH by the Fisher's exact test. The effect of the major histocompatibility complex (MHC) gene region was studied by genotyping five microsatellites spanning the MHC region (COR112, COR113, COR114, UM011 and UMN-JH34-2), and exon 2 polymorphisms of the class II Eqca-DRA gene. Associations with Eqca-DRA and COR113 were identified (p < 0.05). In addition, a panel of 20 single nucleotide polymorphisms (SNPs) in 17 candidate allergy-related genes was tested. During the initial screen, no marker from the panel was significantly (p < 0.05) associated with IBH. Five SNPs associated with IBH at p < 0.10 were therefore used for analysis of combined genotypes. Out of them, SNPs located in the genes coding for the CD14 receptor (CD14), interleukin 23 receptor (IL23R), thymic stromal lymphopoietin (TSLP) and transforming growth factor beta 3 (TGFB3) molecules were associated with IBH as parts of complex genotypes. These results are supported by similar associations and by expression data from different horse populations and from human studies.

A Drosophila model for toxicogenomics: Genetic variation in susceptibility to heavy metal exposure

PubMed Central

Luoma, Sarah E.; St. Armour, Genevieve E.; Thakkar, Esha

2017-01-01

The genetic factors that give rise to variation in susceptibility to environmental toxins remain largely unexplored. Studies on genetic variation in susceptibility to environmental toxins are challenging in human populations, due to the variety of clinical symptoms and difficulty in determining which symptoms causally result from toxic exposure; uncontrolled environments, often with exposure to multiple toxicants; and difficulty in relating phenotypic effect size to toxic dose, especially when symptoms become manifest with a substantial time lag. Drosophila melanogaster is a powerful model that enables genome-wide studies for the identification of allelic variants that contribute to variation in susceptibility to environmental toxins, since the genetic background, environmental rearing conditions and toxic exposure can be precisely controlled. Here, we used extreme QTL mapping in an outbred population derived from the D. melanogaster Genetic Reference Panel to identify alleles associated with resistance to lead and/or cadmium, two ubiquitous environmental toxins that present serious health risks. We identified single nucleotide polymorphisms (SNPs) associated with variation in resistance to both heavy metals as well as SNPs associated with resistance specific to each of them. The effects of these SNPs were largely sex-specific. We applied mutational and RNAi analyses to 33 candidate genes and functionally validated 28 of them. We constructed networks of candidate genes as blueprints for orthologous networks of human genes. The latter not only provided functional contexts for known human targets of heavy metal toxicity, but also implicated novel candidate susceptibility genes. These studies validate Drosophila as a translational toxicogenomics gene discovery system. PMID:28732062

Genome-wide association study discovered genetic variation and candidate genes of fibre quality traits in Gossypium hirsutum L.

PubMed

Sun, Zhengwen; Wang, Xingfen; Liu, Zhengwen; Gu, Qishen; Zhang, Yan; Li, Zhikun; Ke, Huifeng; Yang, Jun; Wu, Jinhua; Wu, Liqiang; Zhang, Guiyin; Zhang, Caiying; Ma, Zhiying

2017-08-01

Genetic improvement of fibre quality is one of the main breeding goals for the upland cotton, Gossypium hirsutum, but there are difficulties with precise selection of traits. Therefore, it is important to improve the understanding of the genetic basis of phenotypic variation. In this study, we conducted phenotyping and genetic variation analyses of 719 diverse accessions of upland cotton based on multiple environment tests and a recently developed Cotton 63K Illumina Infinium SNP array and performed a genome-wide association study (GWAS) of fibre quality traits. A total of 10 511 polymorphic SNPs distributed in 26 chromosomes were screened across the cotton germplasms, and forty-six significant SNPs associated with five fibre quality traits were detected. These significant SNPs were scattered over 15 chromosomes and were involved in 612 unique candidate genes, many related to polysaccharide biosynthesis, signal transduction and protein translocation. Two major haplotypes for fibre length and strength were identified on chromosomes Dt11 and At07. Furthermore, by combining GWAS and transcriptome analysis, we identified 163 and 120 fibre developmental genes related to length and strength, respectively, of which a number of novel genes and 19 promising genes were screened. These results provide new insight into the genetic basis of fibre quality in G. hirsutum and provide candidate SNPs and genes to accelerate the improvement of upland cotton. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Relationship between genetic polymorphisms in the DRD5 gene and paranoid schizophrenia in northern Han Chinese.

PubMed

Zhao, Y; Ding, M; Pang, H; Xu, X M; Wang, B J

2014-03-12

Dopamine (DA) has been implicated in the pathophysiol-ogy of several psychiatric disorders, including schizophrenia. Thus, genes related to the dopaminergic (DAergic) system are good candidate genes for schizophrenia. One of receptors of the DA receptor system is dopa-mine receptor 5 (DRD5). Single nucleotide polymorphisms (SNPs) in the regulatory regions of DRD5 gene may affect gene expression, influence biosynthesis of DA and underlie various neuropsychiatric disorders re-lated to DA dysfunction. The present study explored the association of SNPs within the DRD5 gene with paranoid schizophrenia in Han Chinese. A total of 176 patients with schizophrenia and 206 healthy controls were genotyped for four DRD5 SNPs (rs77434921, rs2076907, rs6283, and rs1800762). Significant group differences were observed in the allele and genotype frequencies of rs77434921 and rs1800762 and in the frequen-cies of GC haplotypes corresponding to rs77434921-rs1800762. Our find-ings suggest that common genetic variations of DRD5 are likely to con-tribute to genetic susceptibility to paranoid schizophrenia in Han Chinese. Further studies in larger samples are needed to replicate this association.

Genetic Variants Associated with Hyperandrogenemia in PCOS Pathophysiology

PubMed Central

2018-01-01

Polycystic ovary syndrome is a multifactorial endocrine disorder whose pathophysiology baffles many researchers till today. This syndrome is typically characterized by anovulatory cycles and infertility, altered gonadotropin levels, obesity, and bulky multifollicular ovaries on ultrasound. Hyperandrogenism and insulin resistance are hallmark features of its complex pathophysiology. Hyperandrogenemia is a salient feature of PCOS and a major contributor to cosmetic anomalies including hirsutism, acne, and male pattern alopecia in affected women. Increased androgen levels may be intrinsic or aggravated by preexisting insulin resistance in women with PCOS. Studies have reported augmented ovarian steroidogenesis patterns attributed mainly to theca cell hypertrophy and altered expression of key enzymes in the steroidogenic pathway. Candidate gene studies have been performed in order to delineate the association of polymorphisms in genes, which encode enzymes in the intricate cascade of steroidogenesis or modulate the levels and action of circulating androgens, with risk of PCOS development and its related traits. However, inconsistent findings have impacted the emergence of a unanimously accepted genetic marker for PCOS susceptibility. In the current review, we have summarized the influence of polymorphisms in important androgen related genes in governing genetic predisposition to PCOS and its related metabolic and reproductive traits. PMID:29670770

Association analysis identifies 65 new breast cancer risk loci.

PubMed

Michailidou, Kyriaki; Lindström, Sara; Dennis, Joe; Beesley, Jonathan; Hui, Shirley; Kar, Siddhartha; Lemaçon, Audrey; Soucy, Penny; Glubb, Dylan; Rostamianfar, Asha; Bolla, Manjeet K; Wang, Qin; Tyrer, Jonathan; Dicks, Ed; Lee, Andrew; Wang, Zhaoming; Allen, Jamie; Keeman, Renske; Eilber, Ursula; French, Juliet D; Qing Chen, Xiao; Fachal, Laura; McCue, Karen; McCart Reed, Amy E; Ghoussaini, Maya; Carroll, Jason S; Jiang, Xia; Finucane, Hilary; Adams, Marcia; Adank, Muriel A; Ahsan, Habibul; Aittomäki, Kristiina; Anton-Culver, Hoda; Antonenkova, Natalia N; Arndt, Volker; Aronson, Kristan J; Arun, Banu; Auer, Paul L; Bacot, François; Barrdahl, Myrto; Baynes, Caroline; Beckmann, Matthias W; Behrens, Sabine; Benitez, Javier; Bermisheva, Marina; Bernstein, Leslie; Blomqvist, Carl; Bogdanova, Natalia V; Bojesen, Stig E; Bonanni, Bernardo; Børresen-Dale, Anne-Lise; Brand, Judith S; Brauch, Hiltrud; Brennan, Paul; Brenner, Hermann; Brinton, Louise; Broberg, Per; Brock, Ian W; Broeks, Annegien; Brooks-Wilson, Angela; Brucker, Sara Y; Brüning, Thomas; Burwinkel, Barbara; Butterbach, Katja; Cai, Qiuyin; Cai, Hui; Caldés, Trinidad; Canzian, Federico; Carracedo, Angel; Carter, Brian D; Castelao, Jose E; Chan, Tsun L; David Cheng, Ting-Yuan; Seng Chia, Kee; Choi, Ji-Yeob; Christiansen, Hans; Clarke, Christine L; Collée, Margriet; Conroy, Don M; Cordina-Duverger, Emilie; Cornelissen, Sten; Cox, David G; Cox, Angela; Cross, Simon S; Cunningham, Julie M; Czene, Kamila; Daly, Mary B; Devilee, Peter; Doheny, Kimberly F; Dörk, Thilo; Dos-Santos-Silva, Isabel; Dumont, Martine; Durcan, Lorraine; Dwek, Miriam; Eccles, Diana M; Ekici, Arif B; Eliassen, A Heather; Ellberg, Carolina; Elvira, Mingajeva; Engel, Christoph; Eriksson, Mikael; Fasching, Peter A; Figueroa, Jonine; Flesch-Janys, Dieter; Fletcher, Olivia; Flyger, Henrik; Fritschi, Lin; Gaborieau, Valerie; Gabrielson, Marike; Gago-Dominguez, Manuela; Gao, Yu-Tang; Gapstur, Susan M; García-Sáenz, José A; Gaudet, Mia M; Georgoulias, Vassilios; Giles, Graham G; Glendon, Gord; Goldberg, Mark S; Goldgar, David E; González-Neira, Anna; Grenaker Alnæs, Grethe I; Grip, Mervi; Gronwald, Jacek; Grundy, Anne; Guénel, Pascal; Haeberle, Lothar; Hahnen, Eric; Haiman, Christopher A; Håkansson, Niclas; Hamann, Ute; Hamel, Nathalie; Hankinson, Susan; Harrington, Patricia; Hart, Steven N; Hartikainen, Jaana M; Hartman, Mikael; Hein, Alexander; Heyworth, Jane; Hicks, Belynda; Hillemanns, Peter; Ho, Dona N; Hollestelle, Antoinette; Hooning, Maartje J; Hoover, Robert N; Hopper, John L; Hou, Ming-Feng; Hsiung, Chia-Ni; Huang, Guanmengqian; Humphreys, Keith; Ishiguro, Junko; Ito, Hidemi; Iwasaki, Motoki; Iwata, Hiroji; Jakubowska, Anna; Janni, Wolfgang; John, Esther M; Johnson, Nichola; Jones, Kristine; Jones, Michael; Jukkola-Vuorinen, Arja; Kaaks, Rudolf; Kabisch, Maria; Kaczmarek, Katarzyna; Kang, Daehee; Kasuga, Yoshio; Kerin, Michael J; Khan, Sofia; Khusnutdinova, Elza; Kiiski, Johanna I; Kim, Sung-Won; Knight, Julia A; Kosma, Veli-Matti; Kristensen, Vessela N; Krüger, Ute; Kwong, Ava; Lambrechts, Diether; Le Marchand, Loic; Lee, Eunjung; Lee, Min Hyuk; Lee, Jong Won; Neng Lee, Chuen; Lejbkowicz, Flavio; Li, Jingmei; Lilyquist, Jenna; Lindblom, Annika; Lissowska, Jolanta; Lo, Wing-Yee; Loibl, Sibylle; Long, Jirong; Lophatananon, Artitaya; Lubinski, Jan; Luccarini, Craig; Lux, Michael P; Ma, Edmond S K; MacInnis, Robert J; Maishman, Tom; Makalic, Enes; Malone, Kathleen E; Kostovska, Ivana Maleva; Mannermaa, Arto; Manoukian, Siranoush; Manson, JoAnn E; Margolin, Sara; Mariapun, Shivaani; Martinez, Maria Elena; Matsuo, Keitaro; Mavroudis, Dimitrios; McKay, James; McLean, Catriona; Meijers-Heijboer, Hanne; Meindl, Alfons; Menéndez, Primitiva; Menon, Usha; Meyer, Jeffery; Miao, Hui; Miller, Nicola; Taib, Nur Aishah Mohd; Muir, Kenneth; Mulligan, Anna Marie; Mulot, Claire; Neuhausen, Susan L; Nevanlinna, Heli; Neven, Patrick; Nielsen, Sune F; Noh, Dong-Young; Nordestgaard, Børge G; Norman, Aaron; Olopade, Olufunmilayo I; Olson, Janet E; Olsson, Håkan; Olswold, Curtis; Orr, Nick; Pankratz, V Shane; Park, Sue K; Park-Simon, Tjoung-Won; Lloyd, Rachel; Perez, Jose I A; Peterlongo, Paolo; Peto, Julian; Phillips, Kelly-Anne; Pinchev, Mila; Plaseska-Karanfilska, Dijana; Prentice, Ross; Presneau, Nadege; Prokofyeva, Darya; Pugh, Elizabeth; Pylkäs, Katri; Rack, Brigitte; Radice, Paolo; Rahman, Nazneen; Rennert, Gadi; Rennert, Hedy S; Rhenius, Valerie; Romero, Atocha; Romm, Jane; Ruddy, Kathryn J; Rüdiger, Thomas; Rudolph, Anja; Ruebner, Matthias; Rutgers, Emiel J T; Saloustros, Emmanouil; Sandler, Dale P; Sangrajrang, Suleeporn; Sawyer, Elinor J; Schmidt, Daniel F; Schmutzler, Rita K; Schneeweiss, Andreas; Schoemaker, Minouk J; Schumacher, Fredrick; Schürmann, Peter; Scott, Rodney J; Scott, Christopher; Seal, Sheila; Seynaeve, Caroline; Shah, Mitul; Sharma, Priyanka; Shen, Chen-Yang; Sheng, Grace; Sherman, Mark E; Shrubsole, Martha J; Shu, Xiao-Ou; Smeets, Ann; Sohn, Christof; Southey, Melissa C; Spinelli, John J; Stegmaier, Christa; Stewart-Brown, Sarah; Stone, Jennifer; Stram, Daniel O; Surowy, Harald; Swerdlow, Anthony; Tamimi, Rulla; Taylor, Jack A; Tengström, Maria; Teo, Soo H; Beth Terry, Mary; Tessier, Daniel C; Thanasitthichai, Somchai; Thöne, Kathrin; Tollenaar, Rob A E M; Tomlinson, Ian; Tong, Ling; Torres, Diana; Truong, Thérèse; Tseng, Chiu-Chen; Tsugane, Shoichiro; Ulmer, Hans-Ulrich; Ursin, Giske; Untch, Michael; Vachon, Celine; van Asperen, Christi J; Van Den Berg, David; van den Ouweland, Ans M W; van der Kolk, Lizet; van der Luijt, Rob B; Vincent, Daniel; Vollenweider, Jason; Waisfisz, Quinten; Wang-Gohrke, Shan; Weinberg, Clarice R; Wendt, Camilla; Whittemore, Alice S; Wildiers, Hans; Willett, Walter; Winqvist, Robert; Wolk, Alicja; Wu, Anna H; Xia, Lucy; Yamaji, Taiki; Yang, Xiaohong R; Har Yip, Cheng; Yoo, Keun-Young; Yu, Jyh-Cherng; Zheng, Wei; Zheng, Ying; Zhu, Bin; Ziogas, Argyrios; Ziv, Elad; Lakhani, Sunil R; Antoniou, Antonis C; Droit, Arnaud; Andrulis, Irene L; Amos, Christopher I; Couch, Fergus J; Pharoah, Paul D P; Chang-Claude, Jenny; Hall, Per; Hunter, David J; Milne, Roger L; García-Closas, Montserrat; Schmidt, Marjanka K; Chanock, Stephen J; Dunning, Alison M; Edwards, Stacey L; Bader, Gary D; Chenevix-Trench, Georgia; Simard, Jacques; Kraft, Peter; Easton, Douglas F

2017-11-02

Breast cancer risk is influenced by rare coding variants in susceptibility genes, such as BRCA1, and many common, mostly non-coding variants. However, much of the genetic contribution to breast cancer risk remains unknown. Here we report the results of a genome-wide association study of breast cancer in 122,977 cases and 105,974 controls of European ancestry and 14,068 cases and 13,104 controls of East Asian ancestry. We identified 65 new loci that are associated with overall breast cancer risk at P < 5 × 10 -8 . The majority of credible risk single-nucleotide polymorphisms in these loci fall in distal regulatory elements, and by integrating in silico data to predict target genes in breast cells at each locus, we demonstrate a strong overlap between candidate target genes and somatic driver genes in breast tumours. We also find that heritability of breast cancer due to all single-nucleotide polymorphisms in regulatory features was 2-5-fold enriched relative to the genome-wide average, with strong enrichment for particular transcription factor binding sites. These results provide further insight into genetic susceptibility to breast cancer and will improve the use of genetic risk scores for individualized screening and prevention.

Linkage Disequilibrium Mapping in Domestic Dog Breeds Narrows the Progressive Rod-Cone Degeneration (prcd) Interval and Identifies Ancestral Disease Transmitting Chromosome

PubMed Central

Goldstein, Orly; Zangerl, Barbara; Pearce-Kelling, Sue; Sidjanin, Duska J.; Kijas, James W.; Felix, Jeanette; Acland, Gregory M; Aguirre, Gustavo D.

2014-01-01

Canine progressive rod-cone degeneration (prcd) is a retinal disease previously mapped to a broad, gene-rich centromeric region of canine chromosome 9. As allelic disorders are present in multiple breeds, we used linkage disequilibrium (LD) to narrow the ∼6.4 Mb interval candidate region. Multiple dog breeds, each representing genetically isolated populations, were typed for SNPs and other polymorphisms identified from BACs. The candidate region was initially localized to a 1.5 Mb zero recombination interval between growth factor receptor-bound protein 2 (GRB2) and SEC14-like 1 (SEC14L). A fine-scale haplotype of the region was developed which reduced the LD interval to 106 Kb, and identified a conserved haplotype of 98 polymorphisms present in all prcd-affected chromosomes from 14 different dog breeds. The findings strongly suggest that a common ancestor transmitted the prcd disease allele to many of the modern dog breeds, and demonstrate the power of LD approach in the canine model. PMID:16859891

A Study on Genetic Variants of Fibroblast Growth Factor Receptor 2 (FGFR2) and the Risk of Breast Cancer from North India

PubMed Central

Siddiqui, Sarah; Chattopadhyay, Shilpi; Akhtar, Md. Salman; Najm, Mohammad Zeeshan; Deo, S. V. S.; Shukla, N. K.; Husain, Syed Akhtar

2014-01-01

Genome-Wide Association Studies (GWAS) have identified Fibroblast growth factor receptor 2 (FGFR2) as a candidate gene for breast cancer with single nucleotide polymorphisms (SNPs) located in intron 2 region as the susceptibility loci strongly associated with the risk. However, replicate studies have often failed to extrapolate the association to diverse ethnic regions. This hints towards the existing heterogeneity among different populations, arising due to differential linkage disequilibrium (LD) structures and frequencies of SNPs within the associated regions of the genome. It is therefore important to revisit the previously linked candidates in varied population groups to unravel the extent of heterogeneity. In an attempt to investigate the role of FGFR2 polymorphisms in susceptibility to the risk of breast cancer among North Indian women, we genotyped rs2981582, rs1219648, rs2981578 and rs7895676 polymorphisms in 368 breast cancer patients and 484 healthy controls by Polymerase chain reaction-Restriction fragment length polymorphism (PCR-RFLP) assay. We observed a statistically significant association with breast cancer risk for all the four genetic variants (P<0.05). In per-allele model for rs2981582, rs1219648, rs7895676 and in dominant model for rs2981578, association remained significant after bonferroni correction (P<0.0125). On performing stratified analysis, significant correlations with various clinicopathological as well as environmental and lifestyle characteristics were observed. It was evident that rs1219648 and rs2981578 interacted with exogenous hormone use and advanced clinical stage III (after Bonferroni correction, P<0.000694), respectively. Furthermore, combined analysis on these four loci revealed that compared to women with 0–1 risk loci, those with 2–4 risk loci had increased risk (OR = 1.645, 95%CI = 1.152–2.347, P = 0.006). In haplotype analysis, for rs2981578, rs2981582 and rs1219648, risk haplotype (GTG) was associated with a significantly increased risk compared to the common (ACA) haplotype (OR = 1.365, 95% CI = 1.086–1.717, P = 0.008). Our results suggest that intron 2 SNPs of FGFR2 may contribute to genetic susceptibility of breast cancer in North India population. PMID:25333473

Inflammatory gene polymorphisms and risk of postoperative myocardial infarction after cardiac surgery.

PubMed

Podgoreanu, M V; White, W D; Morris, R W; Mathew, J P; Stafford-Smith, M; Welsby, I J; Grocott, H P; Milano, C A; Newman, M F; Schwinn, D A

2006-07-04

The inflammatory response triggered by cardiac surgery with cardiopulmonary bypass (CPB) is a primary mechanism in the pathogenesis of postoperative myocardial infarction (PMI), a multifactorial disorder with significant inter-patient variability poorly predicted by clinical and procedural factors. We tested the hypothesis that candidate gene polymorphisms in inflammatory pathways contribute to risk of PMI after cardiac surgery. We genotyped 48 polymorphisms from 23 candidate genes in a prospective cohort of 434 patients undergoing elective cardiac surgery with CPB. PMI was defined as creatine kinase-MB isoenzyme level > or = 10x upper limit of normal at 24 hours postoperatively. A 2-step analysis strategy was used: marker selection, followed by model building. To minimize false-positive associations, we adjusted for multiple testing by permutation analysis, Bonferroni correction, and controlling the false discovery rate; 52 patients (12%) experienced PMI. After adjusting for multiple comparisons and clinical risk factors, 3 polymorphisms were found to be independent predictors of PMI (adjusted P<0.05; false discovery rate <10%). These gene variants encode the proinflammatory cytokine interleukin 6 (IL6 -572G>C; odds ratio [OR], 2.47), and 2 adhesion molecules: intercellular adhesion molecule-1 (ICAM1 Lys469Glu; OR, 1.88), and E-selectin (SELE 98G>T; OR, 0.16). The inclusion of genotypic information from these polymorphisms improved prediction models for PMI based on traditional risk factors alone (C-statistic 0.764 versus 0.703). Functional genetic variants in cytokine and leukocyte-endothelial interaction pathways are independently associated with severity of myonecrosis after cardiac surgery. This may aid in preoperative identification of high-risk cardiac surgical patients and development of novel cardioprotective strategies.

Association of MTHFR polymorphisms and chromosomal abnormalities in leukemia.

PubMed

Sinthuwiwat, Thivaratana; Poowasanpetch, Phanasit; Wongngamrungroj, Angsana; Soonklang, Kamonwan; Promso, Somying; Auewarakul, Chirayu; Tocharoentanaphol, Chintana

2012-01-01

Genetic variation in MTHFR gene might explain the interindividual differences in the reduction of DNA repaired and the increase of chromosome breakage and damage. Nowadays, chromosomal rearrangement is recognized as a major cause of lymphoid malignancies. In addition, the association of MTHFR polymorphisms with aneuploidy was found in several studies, making the MTHFR gene as a good candidate for leukemia etiology. Therefore, in this study, we investigated the common sequence variation, 677C>T and 1298A>C in the MTHFR gene of 350 fixed cell specimens archived after chromosome analysis. The distribution of the MTHFR polymorphisms frequency was compared in leukemic patients with structural chromosome abnormality and chromosome aneuploidy, as well as in those with no evidence of chromosome abnormalities. We observed a significant decrease in the distribution of T allele in 677C>T polymorphisms among patients with chromosomal abnormalities including both structural aberration and aneuploidy. The same significance result also found in patients with structural aberration when compare with the normal karyotype patients. Suggesting that polymorphism in the MTHFR gene was involved in chromosome abnormalities of leukemia. However, further investigation on the correlation with the specific types of chromosomal aberrations is needed.

Warfarin Anticoagulation Therapy in Caribbean Hispanics of Puerto Rico: A Candidate Gene Association Study

PubMed Central

Claudio-Campos, Karla; Labastida, Aurora; Ramos, Alga; Gaedigk, Andrea; Renta-Torres, Jessicca; Padilla, Dariana; Rivera-Miranda, Giselle; Scott, Stuart A.; Ruaño, Gualberto; Cadilla, Carmen L.; Duconge-Soler, Jorge

2017-01-01

Existing algorithms account for ~50% of observed variance in warfarin dose requirements after including common polymorphisms. However, they do not perform as well in populations other than Caucasians, in part because some ethno-specific genetic variants are overlooked. The objective of the present study was to identify genetic polymorphisms that can explain variability in warfarin dose requirements among Caribbean Hispanics of Puerto Rico. Next-Generation Sequencing of candidate genes CYP2C9 and VKORC1 and genotyping by DMET® Plus Assay of cardiovascular patients were performed. We also aimed at characterizing the genomic structure and admixture pattern of this study cohort. Our study used the Extreme Discordant Phenotype approach to perform a case-control association analysis. The CYP2C9 variant rs2860905, which was found in all the major haplotypes occurring in the Puerto Rican population, showed stronger association with warfarin sensitivity (<4 mg/day) than common variants CYP2C9*2 and CYP2C9*3. Although, CYP2C9*2 and CYP2C9*3 are separately contained within two of the haplotypes, 10 subjects with the sensitive phenotype were carriers of only the CYP2C9 rs2860905 variant. Other polymorphisms in CES2 and ABCB1 were found to be associated with warfarin resistance. Incorporation of rs2860905 in a regression model (R2 = 0.63, MSE = 0.37) that also includes additional genetics (i.e., VKORC1-1639 G>A; CYP2C9 rs1856908; ABCB1 c.IVS9-44A>G/ rs10276036; CES2 c.269-965A>G/ rs4783745) and non-genetic factors (i.e., hypertension, diabetes and age) showed better prediction of warfarin dose requirements than CYP2C9*2 and CYP2C9*3 combined (partial R2 = 0.132 vs. 0.023 and 0.007, respectively, p < 0.001). The genetic background of Puerto Ricans in the study cohort showed a tri-hybrid admixture pattern, with a slightly higher than expected contribution of Native American ancestry (25%). The genomic diversity of Puerto Ricans is highlighted by the presence of four different major haplotype blocks in the CYP2C9 locus. Although, our findings need further replication, this study contributes to the field by identifying novel genetic variants that increase predictability of stable warfarin dosing among Caribbean Hispanics. PMID:28638342

Polymorphism of the Pv200L Fragment of Merozoite Surface Protein-1 of Plasmodium vivax in Clinical Isolates from the Pacific Coast of Colombia

PubMed Central

Valderrama-Aguirre, Augusto; Zúñiga-Soto, Evelin; Mariño-Ramírez, Leonardo; Moreno, Luz Ángela; Escalante, Ananías A.; Arévalo-Herrera, Myriam; Herrera, Sócrates

2011-01-01

Merozoite surface protein 1 (MSP-1) is a polymorphic malaria protein with functional domains involved in parasite erythrocyte interaction. Plasmodium vivax MSP-1 has a fragment (Pv200L) that has been identified as a potential subunit vaccine because it is highly immunogenic and induces partial protection against infectious parasite challenge in vaccinated monkeys. To determine the extent of genetic polymorphism and its effect on the translated protein, we sequenced the Pv200L coding region from isolates of 26 P. vivax-infected patients in a malaria-endemic area of Colombia. The extent of nucleotide diversity (π) in these isolates (0.061 ± 0.004) was significantly lower (P ≤ 0.001) than that observed in Thai and Brazilian isolates; 0.083 ± 0.006 and 0.090 ± 0.006, respectively. We found two new alleles and several previously unidentified dimorphic substitutions and significant size polymorphism. The presence of highly conserved blocks in this fragment has important implications for the development of Pv200L as a subunit vaccine candidate. PMID:21292880

Biochemical and Genetic Markers in Aggressiveness and Recurrence of Prostate Cancer: Race-Specific Links to Inflammation and Insulin Resistance

DTIC Science & Technology

2013-07-01

as a statistical graphic, and Pearson product moment correlation coefficients as measures of the strength of linear association; 4) performing SNP ...determine if there are differences in single nucleotide polymorphisms ( SNPs ) in selected candidate genes implicated in metabolic syndrome, obesity, chronic...samples for the serum and SNP analyses. We have reached a target of 500 patients at the end of year 2; however, some of the patients turned out to be

Map making in the 21st century: charting breast cancer susceptibility pathways in rodent models.

PubMed

Blackburn, Anneke C; Jerry, D Joseph

2011-04-01

Genetic factors play an important role in determining risk and resistance to increased breast cancer. Recent technological advances have made it possible to analyze hundreds of thousands of single nucleotide polymorphisms in large-scale association studies in humans and have resulted in identification of alleles in over 20 genes that influence breast cancer risk. Despite these advances, the challenge remains in identifying what the functional polymorphisms are that confer the increased risk, and how these genetic variants interact with each other and with environmental factors. In rodents, the incidence of mammary tumors varies among strains, such that they can provide alternate ideas for candidate pathways involved in humans. Mapping studies in animals have unearthed numerous loci for breast cancer susceptibility that have been validated in human populations. In a reciprocal manner, knockin and knockout mice have been used to validate the tumorigenicity of risk alleles found in population studies. Rodent studies also underscore the complexity of interactions among alleles. The fact that genes affecting risk and resistance to mammary tumors in rodents depend greatly upon the carcinogenic challenge emphasizes the importance of gene x environment interactions. The challenge to rodent geneticists now is to capitalize on the ability to control the genetics and environment in rodent models of tumorigenesis to better understand the biology of breast cancer development, to identify those polymorphisms most relevant to human susceptibility and to identify compensatory pathways that can be targeted for improved prevention in women at highest risk of developing breast cancer.

Identification of polymorphism in exons 7 and 12 of lactoferrin gene and its association with incidence of clinical mastitis in Murrah buffalo.

PubMed

Dinesh, Krishanender; Verma, Archana; Das Gupta, Ishwar; Thakur, Yash Pal; Verma, Nishant; Arya, Ashwani

2015-04-01

Lactoferrin gene is one of the important candidate genes for mastitis resistance. The gene is located on chromosome BTA 22 and consists of 17 exons spanning over 34.5 kb of genomic DNA. The present study was undertaken with the objectives to identify allelic variants in exons 7 and 12 of lactoferrin gene and to analyze association between its genetic variants and incidence of clinical mastitis in Murrah buffalo. The amplification of exons 7 and 12 of lactoferrin gene yielded amplicons of 232- and 461-bp sizes. PCR-restriction fragment length polymorphism (RFLP) analysis of 232-bp amplicon using BccI restriction enzyme revealed three genotypes (AA, AB, and BB) with frequencies of 0.62, 0.22, and 0.16, respectively. The frequencies of two alleles, A and B, were estimated as 0.73 and 0.27. Hpy188I-RFLP for 461-bp amplicon revealed polymorphism with three genotypes, CC, CD, and DD, with respective frequencies of 0.06, 0.39, and 0.56, whereas frequencies for C and D alleles were 0.25 and 0.75. The chi-square (χ(2)) analysis revealed a significant association between incidence of clinical mastitis and genetic variants of exon 7, and animals of AA genotype of exon 7 were found to be least susceptible to mastitis. The findings indicate potential scope for incorporation of lactoferrin gene in selection and breeding of Murrah buffaloes for improved genetic resistance to mastitis.

Effects of UGT1A9 genetic polymorphisms on monohydroxylated derivative of oxcarbazepine concentrations and oxcarbazepine monotherapeutic efficacy in Chinese patients with epilepsy.

PubMed

Lu, Yao; Fang, Youxin; Wu, Xunyi; Ma, Chunlai; Wang, Yue; Xu, Lan

2017-03-01

The human UDP-glucuronosyltransferase which is genetically polymorphic catalyzes glucuronidations of various drugs. The interactions among UGT1A4, UGT1A6, UGT1A9, and UGT2B15 genetic polymorphisms, monohydroxylated derivative (MHD) of oxcarbazepine (OXC) plasma concentrations, and OXC monotherapeutic efficacy were explored in 124 Chinese patients with epilepsy receiving OXC monotherapy. MHD is the major active metabolite of OXC, and its plasma concentration was measured using high-performance liquid chromatography when patients reached their maintenance dose of OXC. Genomic DNA was extracted from whole blood and SNP genotyping performed using PCR followed by dideoxy chain termination sequencing. We followed the patients for at least 1 year to evaluate the OXC monotherapy efficacy. Patients were divided into two groups according to their therapeutic outcome: group 1, seizure free; group 2, not seizure free. The data were analyzed using T test, one-way analysis of variance (ANOVA), Kruskal-Wallis test, chi-square test, Fisher's exact test, correlation analysis, and multivariate regression analysis. T test analysis showed that MHD plasma concentrations were significantly different between the two groups (p = 0.002). One-way ANOVA followed by Bonferroni post hoc testing of four candidate SNPs revealed that carriers of the UGT1A9 variant allele I399 C > T (TT 13.28 ± 7.44 mg/L, TC 16.41 ± 6.53 mg/L) had significantly lower MHD plasma concentrations and poorer seizure control than noncarriers (CC 22.24 ± 8.49 mg/L, p < 0.05). In our study, we have demonstrated the effects of UGT1A9 genetic polymorphisms on MHD plasma concentrations and OXC therapeutic efficacy. Through MHD monitoring, we can predict OXC therapeutic efficacy, which may be useful for the personalization of OXC therapy in epileptic patients.

Association of regulatory TPH2 polymorphisms with higher reduction in depressive symptoms in children and adolescents treated with fluoxetine.

PubMed

Gassó, Patricia; Rodríguez, Natalia; Boloc, Daniel; Blázquez, Ana; Torres, Teresa; Gortat, Ana; Plana, Maria Teresa; Lafuente, Amalia; Mas, Sergi; Arnaiz, Joan Albert; Lázaro, Luisa

2017-07-03

Genetic variability related to the brain serotonergic system has a significant impact on both the susceptibility to psychiatric disorders, such as major depressive disorder (MDD), and the response to antidepressant drugs, such as fluoxetine. TPH2 is one of the most important serotonergic candidate genes in selective serotonin reuptake inhibitors (SSRIs) pharmacogenetic studies. The aim of the present study was to evaluate the influence of regulatory polymorphisms that are specifically located in human TPH2 transcription factor binding sites (TFBSs), and therefore could be functional by altering gene expression, on clinical improvement in children and adolescents treated with fluoxetine. The selection of SNPs was also based on their linkage disequilibrium with TPH2 rs4570625, a genetic variant with questionable functionality, which was previously associated with clinical response in our pediatric population. A total of 83 children and adolescents were clinically evaluated 12weeks after initiating antidepressant treatment with fluoxetine for the first time. Clinical improvement was assessed by reductions in depressive symptoms measured using the Children's Depression Inventory (CDI) scale. The polymorphisms rs11179002, rs60032326 and rs34517220 were, for the first time in the literature, significantly associated with higher clinical improvement. The strongest association was found for rs34517220. In particular, minor allele homozygotes showed higher score reductions on the CDI scale compared with the major allele carriers. Interestingly, this polymorphism is located in a human TPH2 TFBS for two relevant transcription factors in the serotoninergic neurons, Foxa1 and Foxa2, which together with the high level of significance found for this SNP, could indicate that rs34517220 is in fact the crucial functional genetic variant related to the fluoxetine response. These results provide new evidence for the role of regulatory genetic variants that could modulate human TPH2 expression in the SSRI antidepressant response. Copyright © 2017 Elsevier Inc. All rights reserved.

Polymorphisms in inflammation pathway genes and endometrial cancer risk

PubMed Central

Delahanty, Ryan J.; Xiang, Yong-Bing; Spurdle, Amanda; Beeghly-Fadiel, Alicia; Long, Jirong; Thompson, Deborah; Tomlinson, Ian; Yu, Herbert; Lambrechts, Diether; Dörk, Thilo; Goodman, Marc T.; Zheng, Ying; Salvesen, Helga B.; Bao, Ping-Ping; Amant, Frederic; Beckmann, Matthias W.; Coenegrachts, Lieve; Coosemans, An; Dubrowinskaja, Natalia; Dunning, Alison; Runnebaum, Ingo B.; Easton, Douglas; Ekici, Arif B.; Fasching, Peter A.; Halle, Mari K.; Hein, Alexander; Howarth, Kimberly; Gorman, Maggie; Kaydarova, Dylyara; Krakstad, Camilla; Lose, Felicity; Lu, Lingeng; Lurie, Galina; O’Mara, Tracy; Matsuno, Rayna K.; Pharoah, Paul; Risch, Harvey; Corssen, Madeleine; Trovik, Jone; Turmanov, Nurzhan; Wen, Wanqing; Lu, Wei; Cai, Qiuyin; Zheng, Wei; Shu, Xiao-Ou

2013-01-01

Background Experimental and epidemiological evidence have suggested that chronic inflammation may play a critical role in endometrial carcinogenesis. Methods To investigate this hypothesis, a two-stage study was carried out to evaluate single nucleotide polymorphisms (SNPs) in inflammatory pathway genes in association with endometrial cancer risk. In stage 1, 64 candidate pathway genes were identified and 4,542 directly genotyped or imputed SNPs were analyzed among 832 endometrial cancer cases and 2,049 controls, using data from the Shanghai Endometrial Cancer Genetics Study. Linkage disequilibrium of stage 1 SNPs significantly associated with endometrial cancer (P<0.05) indicated that the majority of associations could be linked to one of 24 distinct loci. One SNP from each of the 24 loci was then selected for follow-up genotyping. Of these, 21 SNPs were successfully designed and genotyped in stage 2, which consisted of ten additional studies including 6,604 endometrial cancer cases and 8,511 controls. Results Five of the 21 SNPs had significant allelic odds ratios and 95% confidence intervals as follows: FABP1, 0.92 (0.85-0.99); CXCL3, 1.16 (1.05-1.29); IL6, 1.08 (1.00-1.17); MSR1, 0.90 (0.82-0.98); and MMP9, 0.91 (0.87-0.97). Two of these polymorphisms were independently significant in the replication sample (rs352038 in CXCL3 and rs3918249 in MMP9). The association for the MMP9 polymorphism remained significant after Bonferroni correction and showed a significant association with endometrial cancer in both Asian- and European-ancestry samples. Conclusions These findings lend support to the hypothesis that genetic polymorphisms in genes involved in the inflammatory pathway may contribute to genetic susceptibility to endometrial cancer. Impact Statement This study adds to the growing evidence that inflammation plays an important role in endometrial carcinogenesis. PMID:23221126

Discovery and validation of vascular endothelial growth factor (VEGF) pathway polymorphisms in esophageal adenocarcinoma outcome.

PubMed

Eng, Lawson; Azad, Abul Kalam; Qiu, Xin; Kong, Qin Quinn; Cheng, Dangxiao; Ying, Nanjiao; Tse, Alvina; Kuang, Qin; Dodbiba, Lorin; Renouf, Daniel J; Marsh, Sharon; Savas, Sevtap; Mackay, Helen J; Knox, Jennifer J; Darling, Gail E; Wong, Rebecca K S; Xu, Wei; Liu, Geoffrey; Faluyi, Olusola O

2015-09-01

Polymorphisms in the vascular endothelial growth factor (VEGF)/angiogenesis pathway have been implicated previously in cancer risk, prognosis and response to therapy including in esophageal adenocarcinoma. Prior esophageal adenocarcinoma studies focused on using candidate polymorphisms, limiting the discovery of novel polymorphisms. Here, we applied the tagSNP (single nucleotide polymorphism) approach to identify new VEGF pathway polymorphisms associated with esophageal adenocarcinoma prognosis and validated them in an independent cohort of esophageal adenocarcinoma patients. In 231 esophageal adenocarcinoma patients of all stages/treatment plans, 58 genetic polymorphisms (18 KDR, 7 VEGFA and 33 FLT1) selected through tagging and assessment of predicted function were genotyped. Cox-proportional hazard models adjusted for important socio-demographic and clinico-pathological factors were applied to assess the association of genetic polymorphisms with overall survival (OS) and progression-free survival (PFS). Significantly associated polymorphisms were then validated in an independent cohort of 137 esophageal adenocarcinoma patients. Among the 231 discovery cohort patients, 86% were male, median diagnosis age was 64 years, 34% were metastatic at diagnosis and median OS and PFS were 20 and 12 months, respectively. KDR rs17709898 was found significantly associated with PFS (adjusted hazard ratio, aHR = 0.69, 95% confidence interval (CI): 0.53-0.90; P = 5.9E-3). FLT1 rs3794405 and rs678714 were significantly associated with OS (aHR = 1.44, 95% CI: 1.04-1.99; P = 0.03 and aHR = 1.50, 95% CI: 1.01-2.24; P = 0.045, respectively). No VEGFA polymorphisms were found significantly associated with either outcome. Upon validation, FLT1 rs3794405 remained strongly associated with OS (aHR = 1.59, 95% CI: 1.04-2.44; P = 0.03). FLT1 rs3794405 is significantly associated with OS in esophageal adenocarcinoma, whereby each variant allele confers a 45-60% increased risk of mortality. Validation and evaluation of this association in other cancer sites are warranted. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Genetic rescue of an endangered domestic animal through outcrossing with closely related breeds: A case study of the Norwegian Lundehund.

PubMed

Stronen, Astrid V; Salmela, Elina; Baldursdóttir, Birna K; Berg, Peer; Espelien, Ingvild S; Järvi, Kirsi; Jensen, Henrik; Kristensen, Torsten N; Melis, Claudia; Manenti, Tommaso; Lohi, Hannes; Pertoldi, Cino

2017-01-01

Genetic rescue, outcrossing with individuals from a related population, is used to augment genetic diversity in populations threatened by severe inbreeding and extinction. The endangered Norwegian Lundehund dog underwent at least two severe bottlenecks in the 1940s and 1960s that each left only five inbred dogs, and the approximately 1500 dogs remaining world-wide today appear to descend from only two individuals. The Lundehund has a high prevalence of a gastrointestinal disease, to which all remaining dogs may be predisposed. Outcrossing is currently performed with three Nordic Spitz breeds: Norwegian Buhund, Icelandic Sheepdog, and Norrbottenspets. Examination of single nucleotide polymorphism (SNP) genotypes based on 165K loci in 48 dogs from the four breeds revealed substantially lower genetic diversity for the Lundehund (HE 0.035) than for other breeds (HE 0.209-0.284). Analyses of genetic structure with > 15K linkage disequilibrium-pruned SNPs showed four distinct genetic clusters. Pairwise FST values between Lundehund and the candidate breeds were highest for Icelandic Sheepdog, followed by Buhund and Norrbottenspets. We assessed the presence of outlier loci among candidate breeds and examined flanking genome regions (1 megabase) for genes under possible selection to identify potential adaptive differences among breeds; outliers were observed in flanking regions of genes associated with key functions including the immune system, metabolism, cognition and physical development. We suggest crossbreeding with multiple breeds as the best strategy to increase genetic diversity for the Lundehund and to reduce the incidence of health problems. For this project, the three candidate breeds were first selected based on phenotypes and then subjected to genetic investigation. Because phenotypes are often paramount for domestic breed owners, such a strategy could provide a helpful approach for genetic rescue and restoration of other domestic populations at risk, by ensuring the involvement of owners, breeders and managers at the start of the project.

Effect of metabotropic glutamate receptor-3 variants on prefrontal brain activity in schizophrenia: An imaging genetics study using multi-channel near-infrared spectroscopy.

PubMed

Kinoshita, Akihide; Takizawa, Ryu; Koike, Shinsuke; Satomura, Yoshihiro; Kawasaki, Shingo; Kawakubo, Yuki; Marumo, Kohei; Tochigi, Mamoru; Sasaki, Tsukasa; Nishimura, Yukika; Kasai, Kiyoto

2015-10-01

The glutamatergic system is essential for learning and memory through its crucial role in neural development and synaptic plasticity. Genes associated with the glutamatergic system, including metabotropic glutamate receptor (mGluR or GRM) genes, have been implicated in the pathophysiology of schizophrenia. Few studies, however, have investigated a relationship between polymorphism of glutamate-related genes and cortical function in vivo in patients with schizophrenia. We thus explored an association between genetic variations in GRM3 and brain activation driven by a cognitive task in the prefrontal cortex in patients with schizophrenia. Thirty-one outpatients with schizophrenia and 48 healthy controls participated in this study. We measured four candidate single nucleotide polymorphisms (rs274622, rs2299225, rs1468412, and rs6465084) of GRM3, and activity in the prefrontal and temporal cortices during a category version of a verbal fluency task, using a 52-channel near-infrared spectroscopy instrument. The rs274622 C carriers with schizophrenia were associated with significantly smaller prefrontal activation than patients with TT genotype. This between-genotype difference tended to be confined to the patient group. GRM3 polymorphisms are associated with prefrontal activation during cognitive task in schizophrenia. Copyright © 2015 Elsevier Inc. All rights reserved.

RAD sequencing yields a high success rate for westslope cutthroat and rainbow trout species-diagnostic SNP assays

USGS Publications Warehouse

Stephen J. Amish,; Paul A. Hohenlohe,; Sally Painter,; Robb F. Leary,; Muhlfeld, Clint C.; Fred W. Allendorf,; Luikart, Gordon

2012-01-01

Hybridization with introduced rainbow trout threatens most native westslope cutthroat trout populations. Understanding the genetic effects of hybridization and introgression requires a large set of high-throughput, diagnostic genetic markers to inform conservation and management. Recently, we identified several thousand candidate single-nucleotide polymorphism (SNP) markers based on RAD sequencing of 11 westslope cutthroat trout and 13 rainbow trout individuals. Here, we used flanking sequence for 56 of these candidate SNP markers to design high-throughput genotyping assays. We validated the assays on a total of 92 individuals from 22 populations and seven hatchery strains. Forty-six assays (82%) amplified consistently and allowed easy identification of westslope cutthroat and rainbow trout alleles as well as heterozygote controls. The 46 SNPs will provide high power for early detection of population admixture and improved identification of hybrid and nonhybridized individuals. This technique shows promise as a very low-cost, reliable and relatively rapid method for developing and testing SNP markers for nonmodel organisms with limited genomic resources.

Insulin‐degrading enzyme is genetically associated with Alzheimer's disease in the Finnish population

PubMed Central

Vepsäläinen, Saila; Parkinson, Michele; Helisalmi, Seppo; Mannermaa, Arto; Soininen, Hilkka; Tanzi, Rudolph E; Bertram, Lars; Hiltunen, Mikko

2007-01-01

The gene for insulin‐degrading enzyme (IDE), which is located at chromosome 10q24, has been previously proposed as a candidate gene for late‐onset Alzheimer's disease (AD) based on its ability to degrade amyloid β‐protein. Genotyping of single nucleotide polymorphisms (SNPs) in the IDE gene in Finnish patients with AD and controls revealed SNPs rs4646953 and rs4646955 to be associated with AD, conferring an approximately two‐fold increased risk. Single locus findings were corroborated by the results obtained from haplotype analyses. This suggests that genetic alterations in or near the IDE gene may increase the risk for developing AD. PMID:17496198

The role of protozoa-driven selection in shaping human genetic variability.

PubMed

Pozzoli, Uberto; Fumagalli, Matteo; Cagliani, Rachele; Comi, Giacomo P; Bresolin, Nereo; Clerici, Mario; Sironi, Manuela

2010-03-01

Protozoa exert a strong selective pressure in humans. The selection signatures left by these pathogens can be exploited to identify genetic modulators of infection susceptibility. We show that protozoa diversity in different geographic locations is a good measure of protozoa-driven selective pressure; protozoa diversity captured selection signatures at known malaria resistance loci and identified several selected single nucleotide polymorphisms in immune and hemolytic anemia genes. A genome-wide search enabled us to identify 5180 variants mapping to 1145 genes that are subjected to protozoa-driven selective pressure. We provide a genome-wide estimate of protozoa-driven selective pressure and identify candidate susceptibility genes for protozoa-borne diseases. Copyright 2010 Elsevier Ltd. All rights reserved.

Identifying positive selection candidate loci for high-altitude adaptation in Andean populations

PubMed Central

2009-01-01

High-altitude environments (>2,500 m) provide scientists with a natural laboratory to study the physiological and genetic effects of low ambient oxygen tension on human populations. One approach to understanding how life at high altitude has affected human metabolism is to survey genome-wide datasets for signatures of natural selection. In this work, we report on a study to identify selection-nominated candidate genes involved in adaptation to hypoxia in one highland group, Andeans from the South American Altiplano. We analysed dense microarray genotype data using four test statistics that detect departures from neutrality. Using a candidate gene, single nucleotide polymorphism-based approach, we identified genes exhibiting preliminary evidence of recent genetic adaptation in this population. These included genes that are part of the hypoxia-inducible transcription factor (HIF) pathway, a biochemical pathway involved in oxygen homeostasis, as well as three other genomic regions previously not known to be associated with high-altitude phenotypes. In addition to identifying selection-nominated candidate genes, we also tested whether the HIF pathway shows evidence of natural selection. Our results indicate that the genes of this biochemical pathway as a group show no evidence of having evolved in response to hypoxia in Andeans. Results from particular HIF-targeted genes, however, suggest that genes in this pathway could play a role in Andean adaptation to high altitude, even if the pathway as a whole does not show higher relative rates of evolution. These data suggest a genetic role in high-altitude adaptation and provide a basis for genotype/phenotype association studies that are necessary to confirm the role of putative natural selection candidate genes and gene regions in adaptation to altitude. PMID:20038496

Molecular Genetic of Atopic dermatitis: An Update

PubMed Central

Al-Shobaili, Hani A.; Ahmed, Ahmed A.; Alnomair, Naief; Alobead, Zeiad Abdulaziz; Rasheed, Zafar

2016-01-01

Atopic dermatitis (AD) is a chronic multifactorial inflammatory skin disease. The pathogenesis of AD remains unclear, but the disease results from dysfunctions of skin barrier and immune response, where both genetic and environmental factors play a key role. Recent studies demonstrate the substantial evidences that show a strong genetic association with AD. As for example, AD patients have a positive family history and have a concordance rate in twins. Moreover, several candidate genes have now been suspected that play a central role in the genetic background of AD. In last decade advanced procedures similar to genome-wide association (GWA) and single nucleotide polymorphism (SNP) have been applied on different population and now it has been clarified that AD is significantly associated with genes of innate/adaptive immune systems, human leukocyte antigens (HLA), cytokines, chemokines, drug-metabolizing genes or various other genes. In this review, we will highlight the recent advancements in the molecular genetics of AD, especially on possible functional relevance of genetic variants discovered to date. PMID:27004062

Association studies of 23 positional/functional candidate genes on chromosome 10 in late-onset Alzheimer's disease.

PubMed

Morgan, A R; Turic, D; Jehu, L; Hamilton, G; Hollingworth, P; Moskvina, V; Jones, L; Lovestone, S; Brayne, C; Rubinsztein, D C; Lawlor, B; Gill, M; O'Donovan, M C; Owen, M J; Williams, J

2007-09-05

Late-onset Alzheimer's disease (LOAD) is a common neurodegenerative disorder, with a complex etiology. APOE is the only confirmed susceptibility gene for LOAD. Others remain yet to be found. Evidence from linkage studies suggests that a gene (or genes) conferring susceptibility for LOAD resides on chromosome 10. We studied 23 positional/functional candidate genes from our linkage region on chromosome 10 (APBB1IP, ALOX5, AD037, SLC18A3, DKK1, ZWINT, ANK3, UBE2D1, CDC2, SIRT1, JDP1, NET7, SUPV3L1, NEN3, SAR1, SGPL1, SEC24C, CAMK2G, PP3CB, SNCG, CH25H, PLCE1, ANXV111) in the MRC genetic resource for LOAD. These candidates were screened for sequence polymorphisms in a sample of 14 LOAD subjects and detected polymorphisms tested for association with LOAD in a three-stage design involving two stages of genotyping pooled DNA samples followed by a third stage in which markers showing evidence for association in the first stages were subjected to individual genotyping. One hundred and twenty polymorphisms were identified and tested in stage 1 (4 case + 4 control pools totaling 366 case and 366 control individuals). Single nucleotide polymorphisms (SNPs) showing evidence of association with LOAD were then studied in stage 2 (8 case + 4 control pools totaling 1,001 case and 1,001 control individuals). Five SNPs, in four genes, showed evidence for association (P < 0.1) at stage 2 and were individually genotyped in the complete dataset, comprising 1,160 LOAD cases and 1,389 normal controls. Two SNPs in SGPL1 demonstrated marginal evidence of association, with uncorrected P values of 0.042 and 0.056, suggesting that variation in SGPL1 may confer susceptibility to LOAD. Copyright 2007 Wiley-Liss, Inc.

Gender-specific association of ATP-binding cassette transporter 1 (ABCA1) polymorphisms with the risk of late-onset Alzheimer's disease.

PubMed

Sundar, Purnima Desai; Feingold, Eleanor; Minster, Ryan L; DeKosky, Steven T; Kamboh, M Ilyas

2007-06-01

Alzheimer's disease (AD) is a multifactorial neurodegenerative disorder caused by a complex interaction of genetic and environmental factors. Increasing evidence highlights a potential role for cholesterol in the pathophysiology of AD. The ABCA1 gene, located in close vicinity to the 9q linkage peaks identified by genome-wide AD linkage studies, plays an important role in cellular cholesterol efflux, and is likely a good candidate gene. However, results from published genetic association studies between ABCA1 and AD are ambiguous. In the present study, we examined the role of two ABCA1 polymorphisms, R219K (rs2230806) and G-17C (rs2740483) in modifying the risk of late-onset AD (LOAD) in a large American white cohort of 992 AD cases and 699 controls. We observed significant gender x R219K interaction (p=0.00008). Female carriers of the 219K allele showed a 1.75-fold increased risk of developing AD compared to non-219K carrier females (95% CI 1.34-2.29; p=0.00004). The overall two-site haplotype distribution was also significant between female AD cases and controls (p=0.017). The risk associated with the R219K polymorphism was independent of the recently reported significant association in the ubiquilin (UBQLN1) gene in this region on chromosome 9q. Our data suggest a gender-specific and APOE and UBQLN1 independent association between the ABCA1/R219K polymorphism and LOAD.

Neuropsychiatric Genetics of Happiness, Friendships, and Politics: Hypothesizing Homophily (“Birds of a Feather Flock Together”) as a Function of Reward Gene Polymorphisms

PubMed Central

Blum, Kenneth; Oscar-Berman, Marlene; Bowirrat, Abdalla; Giordano, John; Madigan, Margaret; Braverman, Eric R.; Barh, Debmayla; Hauser, Mary; Borsten, Joan; Simpatico, Thomas

2013-01-01

Mindful of the new evolutionary ideas related to an emerging scientific focus known as omics, we propose that spiritual, social, and political behaviors may be tied in part to inheritable reward gene polymorphisms, as has been demonstrated for the addictions. If so, analyses of gene polymorphisms may assist in predicting liberalism or conservatism in partisan attachments. For example, both drinking (alcohol) and obesity seem to cluster in large social networks and are influenced by friends having the same genotype, in particular the DRD2 A1 allele. Likewise, voting, voting turnout and attachment to a particular political ideology is differentially related to various reward genes (e.g., 5HTT, MOA, DRD2, and DRD4), possibly predicting liberalism or conservatism. Moreover, voters’ genetic information may predict presidential outcomes more than the actual issues at hand or the presidential candidates themselves. Thus, political discussions on TV, radio, or other media may be morphed by one’s reward gene polymorphisms and as such, may explain the prevalence of generations of die-hard republicans and equally entrenched democratic legacies. Indeed, even in politics, birds of a feather (homophily) flock together. We caution that our proposal should be viewed mindfully awaiting additional research before definitive statements or conclusions can be derived from the studies to date, and we encourage large scale studies to confirm these earlier reports. PMID:23336089

Analysis of the Transcriptome of Erigeron breviscapus Uncovers Putative Scutellarin and Chlorogenic Acids Biosynthetic Genes and Genetic Markers

PubMed Central

Zhang, Jia-Jin; Shu, Li-Ping; Zhang, Wei; Long, Guang-Qiang; Liu, Tao; Meng, Zheng-Gui; Chen, Jun-Wen; Yang, Sheng-Chao

2014-01-01

Background Erigeron breviscapus (Vant.) Hand-Mazz. is a famous medicinal plant. Scutellarin and chlorogenic acids are the primary active components in this herb. However, the mechanisms of biosynthesis and regulation for scutellarin and chlorogenic acids in E. breviscapus are considerably unknown. In addition, genomic information of this herb is also unavailable. Principal Findings Using Illumina sequencing on GAIIx platform, a total of 64,605,972 raw sequencing reads were generated and assembled into 73,092 non-redundant unigenes. Among them, 44,855 unigenes (61.37%) were annotated in the public databases Nr, Swiss-Prot, KEGG, and COG. The transcripts encoding the known enzymes involved in flavonoids and in chlorogenic acids biosynthesis were discovered in the Illumina dataset. Three candidate cytochrome P450 genes were discovered which might encode flavone 6-hydroase converting apigenin to scutellarein. Furthermore, 4 unigenes encoding the homologues of maize P1 (R2R3-MYB transcription factors) were defined, which might regulate the biosynthesis of scutellarin. Additionally, a total of 11,077 simple sequence repeat (SSR) were identified from 9,255 unigenes. Of SSRs, tri-nucleotide motifs were the most abundant motif. Thirty-six primer pairs for SSRs were randomly selected for validation of the amplification and polymorphism. The result revealed that 34 (94.40%) primer pairs were successfully amplified and 19 (52.78%) primer pairs exhibited polymorphisms. Conclusion Using next generation sequencing (NGS) technology, this study firstly provides abundant genomic data for E. breviscapus. The candidate genes involved in the biosynthesis and transcriptional regulation of scutellarin and chlorogenic acids were obtained in this study. Additionally, a plenty of genetic makers were generated by identification of SSRs, which is a powerful tool for molecular breeding and genetics applications in this herb. PMID:24956277

A 34K SNP genotyping array for Populus trichocarpa: design, application to the study of natural populations and transferability to other Populus species

DOE Office of Scientific and Technical Information (OSTI.GOV)

Geraldes, Armando; Hannemann, Jan; Grassa, Chris

2013-01-01

Genetic mapping of quantitative traits requires genotypic data for large numbers of markers in many individuals. Despite the declining costs of genotyping by sequencing, for most studies, the use of large SNP genotyping arrays still offers the most cost-effective solution for large-scale targeted genotyping. Here we report on the design and performance of a SNP genotyping array for Populus trichocarpa (black cottonwood). This genotyping array was designed with SNPs pre-ascertained in 34 wild accessions covering most of the species range. Due to the rapid decay of linkage disequilibrium in P. trichocarpa we adopted a candidate gene approach to the arraymore » design that resulted in the selection of 34,131 SNPs, the majority of which are located in, or within 2 kb, of 3,543 candidate genes. A subset of the SNPs (539) was selected based on patterns of variation among the SNP discovery accessions. We show that more than 95% of the loci produce high quality genotypes and that the genotyping error rate for these is likely below 2%, indicating that high-quality data are generated with this array. We demonstrate that even among small numbers of samples (n=10) from local populations over 84% of loci are polymorphic. We also tested the applicability of the array to other species in the genus and found that due to ascertainment bias the number of polymorphic loci decreases rapidly with genetic distance, with the largest numbers detected in other species in section Tacamahaca (P. balsamifera and P. angustifolia). Finally, we provide evidence for the utility of the array for intraspecific studies of genetic differentiation and for species assignment and the detection of natural hybrids.« less

SNPs in stress-responsive rice genes: validation, genotyping, functional relevance and population structure

PubMed Central

2012-01-01

Background Single nucleotide polymorphism (SNP) validation and large-scale genotyping are required to maximize the use of DNA sequence variation and determine the functional relevance of candidate genes for complex stress tolerance traits through genetic association in rice. We used the bead array platform-based Illumina GoldenGate assay to validate and genotype SNPs in a select set of stress-responsive genes to understand their functional relevance and study the population structure in rice. Results Of the 384 putative SNPs assayed, we successfully validated and genotyped 362 (94.3%). Of these 325 (84.6%) showed polymorphism among the 91 rice genotypes examined. Physical distribution, degree of allele sharing, admixtures and introgression, and amino acid replacement of SNPs in 263 abiotic and 62 biotic stress-responsive genes provided clues for identification and targeted mapping of trait-associated genomic regions. We assessed the functional and adaptive significance of validated SNPs in a set of contrasting drought tolerant upland and sensitive lowland rice genotypes by correlating their allelic variation with amino acid sequence alterations in catalytic domains and three-dimensional secondary protein structure encoded by stress-responsive genes. We found a strong genetic association among SNPs in the nine stress-responsive genes with upland and lowland ecological adaptation. Higher nucleotide diversity was observed in indica accessions compared with other rice sub-populations based on different population genetic parameters. The inferred ancestry of 16% among rice genotypes was derived from admixed populations with the maximum between upland aus and wild Oryza species. Conclusions SNPs validated in biotic and abiotic stress-responsive rice genes can be used in association analyses to identify candidate genes and develop functional markers for stress tolerance in rice. PMID:22921105

Selection for long and short sleep duration in Drosophila melanogaster reveals the complex genetic network underlying natural variation in sleep

PubMed Central

2017-01-01

Why do some individuals need more sleep than others? Forward mutagenesis screens in flies using engineered mutations have established a clear genetic component to sleep duration, revealing mutants that convey very long or short sleep. Whether such extreme long or short sleep could exist in natural populations was unknown. We applied artificial selection for high and low night sleep duration to an outbred population of Drosophila melanogaster for 13 generations. At the end of the selection procedure, night sleep duration diverged by 9.97 hours in the long and short sleeper populations, and 24-hour sleep was reduced to 3.3 hours in the short sleepers. Neither long nor short sleeper lifespan differed appreciably from controls, suggesting little physiological consequences to being an extreme long or short sleeper. Whole genome sequence data from seven generations of selection revealed several hundred thousand changes in allele frequencies at polymorphic loci across the genome. Combining the data from long and short sleeper populations across generations in a logistic regression implicated 126 polymorphisms in 80 candidate genes, and we confirmed three of these genes and a larger genomic region with mutant and chromosomal deficiency tests, respectively. Many of these genes could be connected in a single network based on previously known physical and genetic interactions. Candidate genes have known roles in several classic, highly conserved developmental and signaling pathways—EGFR, Wnt, Hippo, and MAPK. The involvement of highly pleiotropic pathway genes suggests that sleep duration in natural populations can be influenced by a wide variety of biological processes, which may be why the purpose of sleep has been so elusive. PMID:29240764

Most common single-nucleotide polymorphisms associated with rheumatoid arthritis in persons of European ancestry confer risk of rheumatoid arthritis in African Americans.

PubMed

Hughes, Laura B; Reynolds, Richard J; Brown, Elizabeth E; Kelley, James M; Thomson, Brian; Conn, Doyt L; Jonas, Beth L; Westfall, Andrew O; Padilla, Miguel A; Callahan, Leigh F; Smith, Edwin A; Brasington, Richard D; Edberg, Jeffrey C; Kimberly, Robert P; Moreland, Larry W; Plenge, Robert M; Bridges, S Louis

2010-12-01

Large-scale genetic association studies have identified >20 rheumatoid arthritis (RA) risk alleles among individuals of European ancestry. The influence of these risk alleles has not been comprehensively studied in African Americans. We therefore sought to examine whether these validated RA risk alleles are associated with RA risk in an African American population. Twenty-seven candidate single-nucleotide polymorphisms (SNPs) were genotyped in 556 autoantibody-positive African Americans with RA and 791 healthy African American control subjects. Odds ratios (ORs) and 95% confidence intervals (95% CIs) for each SNP were compared with previously published ORs for RA patients of European ancestry. We then calculated a composite genetic risk score (GRS) for each individual based on the sum of all risk alleles. Overlap of the ORs and 95% CIs between the European and African American populations was observed for 24 of the 27 candidate SNPs. Conversely, 3 of the 27 SNPs (CCR6 rs3093023, TAGAP rs394581, and TNFAIP3 rs6920220) demonstrated ORs in the opposite direction from those reported for RA patients of European ancestry. The GRS analysis indicated a small but highly significant probability that African American patients relative to control subjects were enriched for the risk alleles validated in European RA patients (P = 0.00005). The majority of RA risk alleles previously validated for RA patients of European ancestry showed similar ORs in our population of African Americans with RA. Furthermore, the aggregate GRS supports the hypothesis that these SNPs are risk alleles for RA in the African American population. Future large-scale genetic studies are needed to validate these risk alleles and identify novel RA risk alleles in African Americans. Copyright © 2010 by the American College of Rheumatology.

Genetic factors influencing bone mineral content in a black South African population.

PubMed

May, Andrew; Pettifor, John M; Norris, Shane A; Ramsay, Michèle; Lombard, Zané

2013-11-01

Bone mass differs according to ethnic classification, with individuals of African ancestry attaining the highest measurements across numerous skeletal sites. Elevated bone mass is even maintained in those individuals exposed to adverse environmental factors, suggesting a prominent genetic effect that may have clinical or therapeutic value. Using a candidate gene approach, we investigated associations of six candidate genes (ESR1, TNFRSF11A, TNFRSF11B, TNFSF11, SOST and SPP1) with bone mass at the hip and lumbar spine amongst pre-pubertal black South African children (mean age 10.6 years) who formed part of the longitudinal Birth to Twenty cohort. 151 black children were genotyped at 366 polymorphic loci, including 112 previously associated and 254 tagging single nucleotide polymorphisms (SNPs). Linear regression was used to highlight significant associations whilst adjusting for height, weight, sex and bone area. Twenty-seven markers (8 previously associated and 19 tag SNPs; P < 0.05) were found to be associated with either femoral neck (18) or lumbar spine (9) bone mineral content. These signals were derived from three genes, namely ESR1 (17), TNFRSF11B (9) and SPP1 (1). One marker (rs2485209) maintained its association with the femoral neck after correction for multiple testing (P = 0.038). When compared to results amongst Caucasian adults, we detected differences with respect to associated skeletal sites. Allele frequencies and linkage disequilibrium patterns were also significantly different between populations. Hence, our results support the existence of a strong genetic effect acting at the femoral neck in black South African children, whilst simultaneously highlighting possible causes that account for inter-ethnic bone mass diversity.

Selection for long and short sleep duration in Drosophila melanogaster reveals the complex genetic network underlying natural variation in sleep.

PubMed

Harbison, Susan T; Serrano Negron, Yazmin L; Hansen, Nancy F; Lobell, Amanda S

2017-12-01

Why do some individuals need more sleep than others? Forward mutagenesis screens in flies using engineered mutations have established a clear genetic component to sleep duration, revealing mutants that convey very long or short sleep. Whether such extreme long or short sleep could exist in natural populations was unknown. We applied artificial selection for high and low night sleep duration to an outbred population of Drosophila melanogaster for 13 generations. At the end of the selection procedure, night sleep duration diverged by 9.97 hours in the long and short sleeper populations, and 24-hour sleep was reduced to 3.3 hours in the short sleepers. Neither long nor short sleeper lifespan differed appreciably from controls, suggesting little physiological consequences to being an extreme long or short sleeper. Whole genome sequence data from seven generations of selection revealed several hundred thousand changes in allele frequencies at polymorphic loci across the genome. Combining the data from long and short sleeper populations across generations in a logistic regression implicated 126 polymorphisms in 80 candidate genes, and we confirmed three of these genes and a larger genomic region with mutant and chromosomal deficiency tests, respectively. Many of these genes could be connected in a single network based on previously known physical and genetic interactions. Candidate genes have known roles in several classic, highly conserved developmental and signaling pathways-EGFR, Wnt, Hippo, and MAPK. The involvement of highly pleiotropic pathway genes suggests that sleep duration in natural populations can be influenced by a wide variety of biological processes, which may be why the purpose of sleep has been so elusive.

Analysis of the transcriptome of Erigeron breviscapus uncovers putative scutellarin and chlorogenic acids biosynthetic genes and genetic markers.

PubMed

Jiang, Ni-Hao; Zhang, Guang-Hui; Zhang, Jia-Jin; Shu, Li-Ping; Zhang, Wei; Long, Guang-Qiang; Liu, Tao; Meng, Zheng-Gui; Chen, Jun-Wen; Yang, Sheng-Chao

2014-01-01

Erigeron breviscapus (Vant.) Hand-Mazz. is a famous medicinal plant. Scutellarin and chlorogenic acids are the primary active components in this herb. However, the mechanisms of biosynthesis and regulation for scutellarin and chlorogenic acids in E. breviscapus are considerably unknown. In addition, genomic information of this herb is also unavailable. Using Illumina sequencing on GAIIx platform, a total of 64,605,972 raw sequencing reads were generated and assembled into 73,092 non-redundant unigenes. Among them, 44,855 unigenes (61.37%) were annotated in the public databases Nr, Swiss-Prot, KEGG, and COG. The transcripts encoding the known enzymes involved in flavonoids and in chlorogenic acids biosynthesis were discovered in the Illumina dataset. Three candidate cytochrome P450 genes were discovered which might encode flavone 6-hydroase converting apigenin to scutellarein. Furthermore, 4 unigenes encoding the homologues of maize P1 (R2R3-MYB transcription factors) were defined, which might regulate the biosynthesis of scutellarin. Additionally, a total of 11,077 simple sequence repeat (SSR) were identified from 9,255 unigenes. Of SSRs, tri-nucleotide motifs were the most abundant motif. Thirty-six primer pairs for SSRs were randomly selected for validation of the amplification and polymorphism. The result revealed that 34 (94.40%) primer pairs were successfully amplified and 19 (52.78%) primer pairs exhibited polymorphisms. Using next generation sequencing (NGS) technology, this study firstly provides abundant genomic data for E. breviscapus. The candidate genes involved in the biosynthesis and transcriptional regulation of scutellarin and chlorogenic acids were obtained in this study. Additionally, a plenty of genetic makers were generated by identification of SSRs, which is a powerful tool for molecular breeding and genetics applications in this herb.

Heritability and molecular genetic basis of acoustic startle eye blink and affectively modulated startle response: A genome-wide association study

PubMed Central

VAIDYANATHAN, UMA; MALONE, STEPHEN M.; MILLER, MICHAEL B.; McGUE, MATT; IACONO, WILLIAM G.

2014-01-01

Acoustic startle responses have been studied extensively in relation to individual differences and psychopathology. We examined three indices of the blink response in a picture-viewing paradigm—overall startle magnitude across all picture types, and aversive and pleasant modulation scores—in 3,323 twins and parents. Biometric models and molecular genetic analyses showed that half the variance in overall startle was due to additive genetic effects. No single nucleotide polymorphism was genome-wide significant, but GRIK3 did produce a significant effect when examined as part of a candidate gene set. In contrast, emotion modulation scores showed little evidence of heritability in either biometric or molecular genetic analyses. However, in a genome-wide scan, PARP14 did produce a significant effect for aversive modulation. We conclude that, although overall startle retains potential as an endophenotype, emotion-modulated startle does not. PMID:25387708

Genetic variants of ghrelin in metabolic disorders.

PubMed

Ukkola, Olavi

2011-11-01

An increasing understanding of the role of genes in the development of obesity may reveal genetic variants that, in combination with conventional risk factors, may help to predict an individual's risk for developing metabolic disorders. Accumulating evidence indicates that ghrelin plays a role in regulating food intake and energy homeostasis and it is a reasonable candidate gene for obesity-related co-morbidities. In cross-sectional studies low total ghrelin concentrations and some genetic polymorphisms of ghrelin have been associated with obesity-associated diseases. The present review highlights many of the important problems in association studies of genetic variants and complex diseases. It is known that population-specific differences in reported associations exist. We therefore conclude that more studies on variants of ghrelin gene are needed to perform in different populations to get deeper understanding on the relationship of ghrelin gene and its variants to obesity. Copyright © 2011 Elsevier Inc. All rights reserved.

Community acquired pneumonia: genetic variants influencing systemic inflammation.

PubMed

Ferrer Agüero, J M; Millán, S; Rodríguez de Castro, F; Martín-Loeches, I; Solé Violán, J

2014-01-01

The inflammatory response depends on several factors, including pathogenicity and duration of the stimulus, and also on the balance between inflammatory and antiinflammatory response. Several studies have presented evidence of the importance of genetic factors in severe infections. The innate immune response prevents the invasion and spread of pathogens during the first hours after infection. Each of the different processes involved in innate immunity may be affected by genetic polymorphisms, which can result in susceptibility or resistance to infection. The results obtained in the different studies do not irrefutably prove the role or function of a gene in the pathogenesis of respiratory infections. However, they can generate new hypotheses, suggest new candidate genes based on their role in the inflammatory response, and constitute a first step in understanding the underlying genetic factors. Copyright © 2013 Elsevier España, S.L. and SEMICYUC. All rights reserved.

Indel-seq: a fast-forward genetics approach for identification of trait-associated putative candidate genomic regions and its application in pigeonpea (Cajanus cajan).

PubMed

Singh, Vikas K; Khan, Aamir W; Saxena, Rachit K; Sinha, Pallavi; Kale, Sandip M; Parupalli, Swathi; Kumar, Vinay; Chitikineni, Annapurna; Vechalapu, Suryanarayana; Sameer Kumar, Chanda Venkata; Sharma, Mamta; Ghanta, Anuradha; Yamini, Kalinati Narasimhan; Muniswamy, Sonnappa; Varshney, Rajeev K

2017-07-01

Identification of candidate genomic regions associated with target traits using conventional mapping methods is challenging and time-consuming. In recent years, a number of single nucleotide polymorphism (SNP)-based mapping approaches have been developed and used for identification of candidate/putative genomic regions. However, in the majority of these studies, insertion-deletion (Indel) were largely ignored. For efficient use of Indels in mapping target traits, we propose Indel-seq approach, which is a combination of whole-genome resequencing (WGRS) and bulked segregant analysis (BSA) and relies on the Indel frequencies in extreme bulks. Deployment of Indel-seq approach for identification of candidate genomic regions associated with fusarium wilt (FW) and sterility mosaic disease (SMD) resistance in pigeonpea has identified 16 Indels affecting 26 putative candidate genes. Of these 26 affected putative candidate genes, 24 genes showed effect in the upstream/downstream of the genic region and two genes showed effect in the genes. Validation of these 16 candidate Indels in other FW- and SMD-resistant and FW- and SMD-susceptible genotypes revealed a significant association of five Indels (three for FW and two for SMD resistance). Comparative analysis of Indel-seq with other genetic mapping approaches highlighted the importance of the approach in identification of significant genomic regions associated with target traits. Therefore, the Indel-seq approach can be used for quick and precise identification of candidate genomic regions for any target traits in any crop species. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Single nucleotide polymorphisms unravel hierarchical divergence and signatures of selection among Alaskan sockeye salmon (Oncorhynchus nerka) populations.

PubMed

Gomez-Uchida, Daniel; Seeb, James E; Smith, Matt J; Habicht, Christopher; Quinn, Thomas P; Seeb, Lisa W

2011-02-18

Disentangling the roles of geography and ecology driving population divergence and distinguishing adaptive from neutral evolution at the molecular level have been common goals among evolutionary and conservation biologists. Using single nucleotide polymorphism (SNP) multilocus genotypes for 31 sockeye salmon (Oncorhynchus nerka) populations from the Kvichak River, Alaska, we assessed the relative roles of geography (discrete boundaries or continuous distance) and ecology (spawning habitat and timing) driving genetic divergence in this species at varying spatial scales within the drainage. We also evaluated two outlier detection methods to characterize candidate SNPs responding to environmental selection, emphasizing which mechanism(s) may maintain the genetic variation of outlier loci. For the entire drainage, Mantel tests suggested a greater role of geographic distance on population divergence than differences in spawn timing when each variable was correlated with pairwise genetic distances. Clustering and hierarchical analyses of molecular variance indicated that the largest genetic differentiation occurred between populations from distinct lakes or subdrainages. Within one population-rich lake, however, Mantel tests suggested a greater role of spawn timing than geographic distance on population divergence when each variable was correlated with pairwise genetic distances. Variable spawn timing among populations was linked to specific spawning habitats as revealed by principal coordinate analyses. We additionally identified two outlier SNPs located in the major histocompatibility complex (MHC) class II that appeared robust to violations of demographic assumptions from an initial pool of eight candidates for selection. First, our results suggest that geography and ecology have influenced genetic divergence between Alaskan sockeye salmon populations in a hierarchical manner depending on the spatial scale. Second, we found consistent evidence for diversifying selection in two loci located in the MHC class II by means of outlier detection methods; yet, alternative scenarios for the evolution of these loci were also evaluated. Both conclusions argue that historical contingency and contemporary adaptation have likely driven differentiation between Kvichak River sockeye salmon populations, as revealed by a suite of SNPs. Our findings highlight the need for conservation of complex population structure, because it provides resilience in the face of environmental change, both natural and anthropogenic.

Single nucleotide polymorphisms unravel hierarchical divergence and signatures of selection among Alaskan sockeye salmon (Oncorhynchus nerka) populations

PubMed Central

2011-01-01

Background Disentangling the roles of geography and ecology driving population divergence and distinguishing adaptive from neutral evolution at the molecular level have been common goals among evolutionary and conservation biologists. Using single nucleotide polymorphism (SNP) multilocus genotypes for 31 sockeye salmon (Oncorhynchus nerka) populations from the Kvichak River, Alaska, we assessed the relative roles of geography (discrete boundaries or continuous distance) and ecology (spawning habitat and timing) driving genetic divergence in this species at varying spatial scales within the drainage. We also evaluated two outlier detection methods to characterize candidate SNPs responding to environmental selection, emphasizing which mechanism(s) may maintain the genetic variation of outlier loci. Results For the entire drainage, Mantel tests suggested a greater role of geographic distance on population divergence than differences in spawn timing when each variable was correlated with pairwise genetic distances. Clustering and hierarchical analyses of molecular variance indicated that the largest genetic differentiation occurred between populations from distinct lakes or subdrainages. Within one population-rich lake, however, Mantel tests suggested a greater role of spawn timing than geographic distance on population divergence when each variable was correlated with pairwise genetic distances. Variable spawn timing among populations was linked to specific spawning habitats as revealed by principal coordinate analyses. We additionally identified two outlier SNPs located in the major histocompatibility complex (MHC) class II that appeared robust to violations of demographic assumptions from an initial pool of eight candidates for selection. Conclusions First, our results suggest that geography and ecology have influenced genetic divergence between Alaskan sockeye salmon populations in a hierarchical manner depending on the spatial scale. Second, we found consistent evidence for diversifying selection in two loci located in the MHC class II by means of outlier detection methods; yet, alternative scenarios for the evolution of these loci were also evaluated. Both conclusions argue that historical contingency and contemporary adaptation have likely driven differentiation between Kvichak River sockeye salmon populations, as revealed by a suite of SNPs. Our findings highlight the need for conservation of complex population structure, because it provides resilience in the face of environmental change, both natural and anthropogenic. PMID:21332997

Association of MAP4K4 gene single nucleotide polymorphism with mastitis and milk traits in Chinese Holstein cattle.

PubMed

Bhattarai, Dinesh; Chen, Xing; Ur Rehman, Zia; Hao, Xingjie; Ullah, Farman; Dad, Rahim; Talpur, Hira Sajjad; Kadariya, Ishwari; Cui, Lu; Fan, Mingxia; Zhang, Shujun

2017-02-01

The objective of the studies presented in this Research Communication was to investigate the association of single nucleotide polymorphisms present in the MAP4K4 gene with different milk traits in dairy cows. Based on previous QTL fine mapping results on bovine chromosome 11, the MAP4K4 gene was selected as a candidate gene to evaluate its effect on somatic cell count and milk traits in ChineseHolstein cows. Milk production traits including milk yield, fat percentage, and protein percentage of each cow were collected using 305 d lactation records. Association between MAP4K4 genotype and different traits and Somatic Cell Score (SCS) was performed using General Linear Regression Model of R. Two SNPs at exon 18 (c.2061T > G and c.2196T > C) with genotype TT in both SNPs were found significantly higher for somatic SCS. We found the significant effect of exon 18 (c.2061T > G) on protein percentage, milk yield and SCS. We identified SNPs at different location of MAP4K4 gene of the cattle and several of them were significantly associated with the somatic cell score and other different milk traits. Thus, MAP4K4 gene could be a useful candidate gene for selection of dairy cattle against mastitis and the identified polymorphisms might potentially be strong genetic markers.

Type 2 diabetes mellitus: association study of five candidate genes in an Indian population of Guadeloupe, genetic contribution of FABP2 polymorphism.

PubMed

Boullu-Sanchis, S; Leprêtre, F; Hedelin, G; Donnet, J P; Schaffer, P; Froguel, P; Pinget, M

1999-06-01

We studied by PCR-RFLP 6 polymorphisms in these 5 candidate genes: Ala54Thr in the fatty acid binding protein 2 gene (FABP2), A to G substitution in the uncoupling protein type 1 gene (UCP1), Asp905Tyr in the protein phosphatase type 1 gene (PP1G), Trp64Arg in the human beta 3 adrenergic receptor gene (beta 3AR) and 2 RFLP sites of the vitamin D receptor (VDR) gene (VDRTaq1 and VDRApa1). This study was conducted among 89 cases and 100 controls matched according to age, gender and absence of first degree family link (11 triplets with 2 controls for 1 case and 78 pairs with 1 control for 1 case). Cases and controls were taken among a sample of 429 individuals selected for the study of the prevalence of diabetes in this ethnic group from Guadeloupe. By conditional logistic regression analysis, there was a significant relation (p = 0.02) between the Ala54Thr FABP2 polymorphism and Type 2 DM. Multivariate analysis discriminate the FABP2 polymorphism (p = 0.10), a triglyceridemia over 2 g/l (p < 10(-3)) and high blood pressure (p = 10(-2)) as variables associated with Type 2 DM in this population. These findings suggest that FABP2 does not represent a major gene for Type 2 DM in this migrant Indian population living in Guadeloupe, but seems to be related to the metabolic insulin resistance syndrome.

No evidence for the association between a polymorphism in the PCLO depression candidate gene with memory bias in remitted depressed patients and healthy individuals.

PubMed

Vrijsen, Janna N; Speckens, Anne; Arias-Vásquez, Alejandro; Franke, Barbara; Becker, Eni S; van Oostrom, Iris

2014-01-01

The PCLO rs2522833 candidate polymorphism for depression has been associated to monoaminergic neurotransmission. In healthy and currently depressed individuals, the polymorphism has been found to affect activation of brain areas during memory processing, but no direct association of PCLO with memory bias was found. We hypothesized that the absence of this association might have been obscured by current depressive symptoms or genetically driven individual differences in reactivity to stressful events. Experiencing stressful childhood events fosters dysfunctional assumptions that are related to cognitive biases, and may modulate the predisposition for depression via epigenetic effects. The association between PCLO and memory bias, as well as interaction between PCLO and childhood events was studied in patients remitted from depression (N = 299), as well as a sample of healthy individuals (N = 157). The participants performed an emotional verbal memory task after a sad mood induction. Childhood trauma and adversity were measured with a questionnaire. The Genotype main effect, and Genotype by Childhood Events interaction were analyzed for memory bias in both samples. PCLO risk allele carrying remitted depressed patients did not show more negatively biased memory than non-risk allele carriers, not even patients with stressful childhood events. A similar pattern of results was found in healthy individuals. Memory bias may not be strongly associated with the PCLO rs2522833 polymorphism. We did not find any support for the PCLO-childhood events interaction, but the power of our study was insufficient to exclude this possibility.

No Evidence for the Association between a Polymorphism in the PCLO Depression Candidate Gene with Memory Bias in Remitted Depressed Patients and Healthy Individuals

PubMed Central

Vrijsen, Janna N.; Speckens, Anne; Arias-Vásquez, Alejandro; Franke, Barbara; Becker, Eni S.; van Oostrom, Iris

2014-01-01

The PCLO rs2522833 candidate polymorphism for depression has been associated to monoaminergic neurotransmission. In healthy and currently depressed individuals, the polymorphism has been found to affect activation of brain areas during memory processing, but no direct association of PCLO with memory bias was found. We hypothesized that the absence of this association might have been obscured by current depressive symptoms or genetically driven individual differences in reactivity to stressful events. Experiencing stressful childhood events fosters dysfunctional assumptions that are related to cognitive biases, and may modulate the predisposition for depression via epigenetic effects. The association between PCLO and memory bias, as well as interaction between PCLO and childhood events was studied in patients remitted from depression (N = 299), as well as a sample of healthy individuals (N = 157). The participants performed an emotional verbal memory task after a sad mood induction. Childhood trauma and adversity were measured with a questionnaire. The Genotype main effect, and Genotype by Childhood Events interaction were analyzed for memory bias in both samples. PCLO risk allele carrying remitted depressed patients did not show more negatively biased memory than non-risk allele carriers, not even patients with stressful childhood events. A similar pattern of results was found in healthy individuals. Memory bias may not be strongly associated with the PCLO rs2522833 polymorphism. We did not find any support for the PCLO-childhood events interaction, but the power of our study was insufficient to exclude this possibility. PMID:25379724

Genetic association of APOB polymorphisms with variation in serum lipid profile among the Kuwait population.

PubMed

Al-Bustan, Suzanne A; Alnaqeeb, Majed A; Annice, Babitha G; Ebrahim, Ghada A; Refai, Thanaa M

2014-10-08

Several studies have identified APOB as a candidate gene predisposing individuals to dyslipidemia. Polymorphisms including the signal peptide (rs11279109), codon 2488 XbaI (rs1042031), codon 3611 MspI (rs693), codon 4154 EcoRI (rs1801701) and the 3' variable number of tandem repeats have been reported to be associated with dyslipidemia in several populations. With limited studies on Arabs, this study aimed to investigate the genetic association of APOB polymorphisms and assess the potential influence of minor and rare alleles on serum lipid levels in the Kuwaiti population. A total of 795 Kuwaiti subjects, documented with phenotypic data and fasting serum lipid levels, were genotyped for the five polymorphisms using PCR, PCR-RFLP and gene fragment analysis. Genotype and allele association with variation in serum lipid levels as well as haplotypes were analyzed using chi-square test, univariate and logistic regression analysis. Analysis of the genotype and allele frequencies distribution revealed a significant positive association between the APOB signal peptide and 3611 MspI polymorphisms with increased levels of triglycerides (statistical power of 80%). Haplotype analysis further supported the findings by showing that carriers of haplotypes (IX-M-E+M) had significantly lower mean (SD) TG levels (0.86 ± 0.07) as compared to non-carriers (1.01 ± 0.02). Significance was also observed with regards to positive family history of hypercholesterolemia. The results imply a "protective role" for two alleles (rs11279109 and rs1801701) in which logistic regression analysis showed a significant half-fold decrease in the risk for heterozygotes of rs11279109 and an 8.8 fold decrease in the risk for homozygous M-M- of rs1801701 of having lower TG levels (<1.70 mmol/L) in individuals. This suggests that genetic interaction between various polymorphisms at different gene loci act in linkage disequilibrium to affect serum TG levels. Apo B genotyping may be a useful adjunct for the identification of individuals at risk of developing dyslipidemia in order to provide them with lifestyle modifications and/or pharmacological intervention to mitigate the effects of gene interaction and environmental influence.

Candidate gene association study conditioning on individual ancestry in patients with type 2 diabetes and metabolic syndrome from Mexico City.

PubMed

Cruz, M; Valladares-Salgado, A; Garcia-Mena, J; Ross, K; Edwards, M; Angeles-Martinez, J; Ortega-Camarillo, C; de la Peña, J Escobedo; Burguete-Garcia, A I; Wacher-Rodarte, N; Ambriz, R; Rivera, R; D'artote, A L; Peralta, J; Parra, Esteban J; Kumate, J

2010-05-01

Type 2 diabetes (T2D) is influenced by diverse environmental and genetic risk factors. Metabolic syndrome (MS) increases the risk of cardiovascular disease and diabetes. We analysed 14 cases of polymorphisms located in 10 candidate loci, in a sample of patients with T2D and controls from Mexico City. We analysed the association of 14 polymorphisms located within 10 genes (TCF7L2, ENPP1, ADRB3, KCNJ11, LEPR, PPARgamma, FTO, CDKAL1, SIRT1 and HHEX) with T2D and MS. The analysis included 519 subjects with T2D defined according to the ADA criteria, 389 with MS defined according to the AHA/NHLBI criteria and 547 controls. Association was tested with the program ADMIXMAP including individual ancestry, age, sex, education and in some cases body mass index (BMI), in a logistic regression model. The two markers located within the TCF7L2 gene showed strong associations with T2D (rs7903146, T allele, odd ratio (OR) = 1.76, p = 0.001 and rs12255372, T allele, OR = 1.78, p = 0.002), but did not show significant association with MS. The non-synonymous rs4994 polymorphism of the ADRB3 gene was associated with T2D (Trp allele, OR = 0.62, p = 0.001) and MS (Trp allele, OR = 0.74, p = 0.018). Nominally significant associations were also observed between T2D and the SIRT1 rs3758391 SNP and MS and the HHEX rs5015480 polymorphism. Variants located within the gene TCF7L2 are strongly associated with T2D but not with MS, providing support to previous evidence indicating that polymorphisms at the TCF7L2 gene increase T2D risk. In contrast, the non-synonymous ADRB3 rs4994 polymorphism is associated with T2D and MS.

Opioid system genes in alcoholism: a case-control study in Croatian population.

PubMed

Cupic, B; Stefulj, J; Zapletal, E; Matosic, A; Bordukalo-Niksic, T; Cicin-Sain, L; Gabrilovac, J

2013-10-01

Due to their involvement in dependence pathways, opioid system genes represent strong candidates for association studies investigating alcoholism. In this study, single nucleotide polymorphisms within the genes for mu (OPRM1) and kappa (OPRK1) opioid receptors and precursors of their ligands - proopiomelanocortin (POMC), coding for beta-endorphin and prodynorphin (PDYN) coding for dynorphins, were analyzed in a case-control study that included 354 male alcohol-dependent and 357 male control subjects from Croatian population. Analysis of allele and genotype frequencies of the selected polymorphisms of the genes OPRM1/POMC and OPRK1/PDYN revealed no differences between the tested groups. The same was true when alcohol-dependent persons were subdivided according to the Cloninger's criteria into type-1 and type-2 groups, known to differ in the extent of genetic control. Thus, the data obtained suggest no association of the selected polymorphisms of the genes OPRM1/POMC and OPRK1/PDYN with alcoholism in Croatian population. Copyright © 2013 Elsevier Ltd. All rights reserved.

Interaction between childhood adversity and functional polymorphisms in the dopamine pathway on first-episode psychosis.

PubMed

Trotta, Antonella; Iyegbe, Conrad; Yiend, Jenny; Dazzan, Paola; David, Anthony S; Pariante, Carmine; Mondelli, Valeria; Colizzi, Marco; Murray, Robin M; Di Forti, Marta; Fisher, Helen L

2018-04-10

There is consistent evidence of a cumulative relationship between childhood adversity and psychosis, with number of adversities experienced increasing the probability of psychosis onset. It is possible that genetic factors moderate the association between childhood adversity and psychosis, potentially by influencing how an individual reacts biologically and/or psychologically following exposure to adversity, in such a way as to set them off on the path to psychosis. However, identifying the specific genetic variants involved and how they interact with childhood adversity remains challenging. We examined whether the association between cumulative exposure to childhood adversity and development of psychotic disorder was moderated by the COMT Val 158 Met, AKT1 rs2494732 or DRD2 rs1076560 polymorphisms, known to affect dopamine levels. Participants were 285 first-presentation psychosis cases and 256 geographically-matched controls drawn from the Genetics and Psychosis (GAP) study. Childhood adversity was assessed using the Childhood Experience of Care and Abuse Questionnaire (CECA.Q) and blood- and cheek-derived genotype data were collected. Our findings revealed no main effect of COMT Val 158 Met, AKT1 rs2494732 and DRD2 rs1076560 polymorphisms on psychosis case status or reports of childhood adversity. Individuals reporting a history of multiple adversities were more likely to be psychosis patients than controls, regardless of their genetic risk. There was no evidence of candidate genotype by childhood adversity interactions in relation to psychosis onset. These findings did not provide evidence of a possible role of COMT Val 158 Met, AKT1 rs2494732 or DRD2 rs1076560 genotypes in modifying the association between childhood adversity and onset of psychosis. Copyright © 2018 Elsevier B.V. All rights reserved.

Polymorphism discovery and allele frequency estimation using high-throughput DNA sequencing of target-enriched pooled DNA samples

PubMed Central

2012-01-01

Background The central role of the somatotrophic axis in animal post-natal growth, development and fertility is well established. Therefore, the identification of genetic variants affecting quantitative traits within this axis is an attractive goal. However, large sample numbers are a pre-requisite for the identification of genetic variants underlying complex traits and although technologies are improving rapidly, high-throughput sequencing of large numbers of complete individual genomes remains prohibitively expensive. Therefore using a pooled DNA approach coupled with target enrichment and high-throughput sequencing, the aim of this study was to identify polymorphisms and estimate allele frequency differences across 83 candidate genes of the somatotrophic axis, in 150 Holstein-Friesian dairy bulls divided into two groups divergent for genetic merit for fertility. Results In total, 4,135 SNPs and 893 indels were identified during the resequencing of the 83 candidate genes. Nineteen percent (n = 952) of variants were located within 5' and 3' UTRs. Seventy-two percent (n = 3,612) were intronic and 9% (n = 464) were exonic, including 65 indels and 236 SNPs resulting in non-synonymous substitutions (NSS). Significant (P < 0.01) mean allele frequency differentials between the low and high fertility groups were observed for 720 SNPs (58 NSS). Allele frequencies for 43 of the SNPs were also determined by genotyping the 150 individual animals (Sequenom® MassARRAY). No significant differences (P > 0.1) were observed between the two methods for any of the 43 SNPs across both pools (i.e., 86 tests in total). Conclusions The results of the current study support previous findings of the use of DNA sample pooling and high-throughput sequencing as a viable strategy for polymorphism discovery and allele frequency estimation. Using this approach we have characterised the genetic variation within genes of the somatotrophic axis and related pathways, central to mammalian post-natal growth and development and subsequent lactogenesis and fertility. We have identified a large number of variants segregating at significantly different frequencies between cattle groups divergent for calving interval plausibly harbouring causative variants contributing to heritable variation. To our knowledge, this is the first report describing sequencing of targeted genomic regions in any livestock species using groups with divergent phenotypes for an economically important trait. PMID:22235840

Development of microsatellite markers in Caryophyllaeus laticeps (Cestoda: Caryophyllidea), monozoic fish tapeworm, using next-generation sequencing approach.

PubMed

Králová-Hromadová, Ivica; Minárik, Gabriel; Bazsalovicsová, Eva; Mikulíček, Peter; Oravcová, Alexandra; Pálková, Lenka; Hanzelová, Vladimíra

2015-02-01

Caryophyllaeus laticeps (Pallas 1781) (Cestoda: Caryophyllidea) is a monozoic tapeworm of cyprinid fishes with a distribution area that includes Europe, most of the Palaearctic Asia and northern Africa. Broad geographic distribution, wide range of definitive fish hosts and recently revealed high morphological plasticity of the parasite, which is not in an agreement with molecular findings, make this species to be an interesting model for population biology studies. Microsatellites (short tandem repeat (STR) markers), as predominant markers for population genetics, were designed for C. laticeps using a next-generation sequencing (NGS) approach. Out of 165 marker candidates, 61 yielded PCR products of the expected size and in 25 of the candidates a declared repetitive motif was confirmed by Sanger sequencing. After the fragment analysis, six loci were proved to be polymorphic and tested for heterozygosity, Hardy-Weinberg equilibrium and the presence of null alleles on 59 individuals coming from three geographically widely separated populations (Slovakia, Russia and UK). The number of alleles in particular loci and populations ranged from two to five. Significant deficit of heterozygotes and the presence of null alleles were found in one locus in all three populations. Other loci showed deviations from Hardy-Weinberg equilibrium and the presence of null alleles only in some populations. In spite of relatively low polymorphism and the potential presence of null alleles, newly developed microsatellites may be applied as suitable markers in population genetic studies of C. laticeps.

Genetic polymorphisms in 85 DNA repair genes and bladder cancer risk.

PubMed

Michiels, Stefan; Laplanche, Agnès; Boulet, Thomas; Dessen, Philippe; Guillonneau, Bertrand; Méjean, Arnaud; Desgrandchamps, François; Lathrop, Mark; Sarasin, Alain; Benhamou, Simone

2009-05-01

Several defense mechanisms have been developed and maintained during the evolution to protect human cells against damage produced from exogenous or endogenous sources. We examined the associations between bladder cancer and a panel of 652 polymorphisms from 85 genes involved in maintenance of genetic stability [base excision repair, nucleotide excision repair, double-strand break repair (DSBR) and mismatch repair, as well as DNA synthesis and cell cycle regulation pathways] in 201 incident bladder cancer cases and 326 hospital controls. Score statistics were used to test differences in haplotype frequencies between cases and controls in an unconditional logistic regression model. To account for multiple testing, we associated to each P-value the expected proportion of false discoveries (q-value). Haplotype analysis revealed significant associations (P < 0.01) between bladder cancer and two genes (POLB and FANCA) with an associated q-value of 24%. A permutation test was also used to determine whether, in each pathway analyzed, there are more variants whose allelic frequencies are different between cases and controls as compared with what would be expected by chance. Differences were found for cell cycle regulation (P = 0.02) and to a lesser extent for DSBR (P = 0.05) pathways. These results hint to a few potential candidate genes; however, our study was limited by the small sample size and therefore low statistical power to detect associations. It is anticipated that genome-wide association studies will open new perspectives for interpretation of the results of extensive candidate gene studies such as ours.

Integration of Experiments across Diverse Environments Identifies the Genetic Determinants of Variation in Sorghum bicolor Seed Element Composition.

PubMed

Shakoor, Nadia; Ziegler, Greg; Dilkes, Brian P; Brenton, Zachary; Boyles, Richard; Connolly, Erin L; Kresovich, Stephen; Baxter, Ivan

2016-04-01

Seedling establishment and seed nutritional quality require the sequestration of sufficient element nutrients. The identification of genes and alleles that modify element content in the grains of cereals, including sorghum (Sorghum bicolor), is fundamental to developing breeding and selection methods aimed at increasing bioavailable element content and improving crop growth. We have developed a high-throughput work flow for the simultaneous measurement of multiple elements in sorghum seeds. We measured seed element levels in the genotyped Sorghum Association Panel, representing all major cultivated sorghum races from diverse geographic and climatic regions, and mapped alleles contributing to seed element variation across three environments by genome-wide association. We observed significant phenotypic and genetic correlation between several elements across multiple years and diverse environments. The power of combining high-precision measurements with genome-wide association was demonstrated by implementing rank transformation and a multilocus mixed model to map alleles controlling 20 element traits, identifying 255 loci affecting the sorghum seed ionome. Sequence similarity to genes characterized in previous studies identified likely causative genes for the accumulation of zinc, manganese, nickel, calcium, and cadmium in sorghum seeds. In addition to strong candidates for these five elements, we provide a list of candidate loci for several other elements. Our approach enabled the identification of single-nucleotide polymorphisms in strong linkage disequilibrium with causative polymorphisms that can be evaluated in targeted selection strategies for plant breeding and improvement. © 2016 American Society of Plant Biologists. All Rights Reserved.

Pharmacogenomics of the human ABC transporter ABCG2: from functional evaluation to drug molecular design

NASA Astrophysics Data System (ADS)

Ishikawa, Toshihisa; Tamura, Ai; Saito, Hikaru; Wakabayashi, Kanako; Nakagawa, Hiroshi

2005-10-01

In the post-genome-sequencing era, emerging genomic technologies are shifting the paradigm for drug discovery and development. Nevertheless, drug discovery and development still remain high-risk and high-stakes ventures with long and costly timelines. Indeed, the attrition of drug candidates in preclinical and development stages is a major problem in drug design. For at least 30% of the candidates, this attrition is due to poor pharmacokinetics and toxicity. Thus, pharmaceutical companies have begun to seriously re-evaluate their current strategies of drug discovery and development. In that light, we propose that a transport mechanism-based design might help to create new, pharmacokinetically advantageous drugs, and as such should be considered an important component of drug design strategy. Performing enzyme- and/or cell-based drug transporter, interaction tests may greatly facilitate drug development and allow the prediction of drug-drug interactions. We recently developed methods for high-speed functional screening and quantitative structure-activity relationship analysis to study the substrate specificity of ABC transporters and to evaluate the effect of genetic polymorphisms on their function. These methods would provide a practical tool to screen synthetic and natural compounds, and these data can be applied to the molecular design of new drugs. In this review article, we present an overview on the genetic polymorphisms of human ABC transporter ABCG2 and new camptothecin analogues that can circumvent AGCG2-associated multidrug resistance of cancer.

An R2R3-type MYB transcription factor, GmMYB29, regulates isoflavone biosynthesis in soybean

PubMed Central

Liu, Shulin; Zhou, Xiaoqiong; Zhang, Huairen; Wang, Chun-e; Yang, Wenming; Tian, Zhixi; Cheng, Hao; Yu, Deyue

2017-01-01

Isoflavones comprise a group of secondary metabolites produced almost exclusively by plants in the legume family, including soybean [Glycine max (L.) Merr.]. They play vital roles in plant defense and have many beneficial effects on human health. Isoflavone content is a complex quantitative trait controlled by multiple genes, and the genetic mechanisms underlying isoflavone biosynthesis remain largely unknown. Via a genome-wide association study (GWAS), we identified 28 single nucleotide polymorphisms (SNPs) that are significantly associated with isoflavone concentrations in soybean. One of these 28 SNPs was located in the 5’-untranslated region (5’-UTR) of an R2R3-type MYB transcription factor, GmMYB29, and this gene was thus selected as a candidate gene for further analyses. A subcellular localization study confirmed that GmMYB29 was located in the nucleus. Transient reporter gene assays demonstrated that GmMYB29 activated the IFS2 (isoflavone synthase 2) and CHS8 (chalcone synthase 8) gene promoters. Overexpression and RNAi-mediated silencing of GmMYB29 in soybean hairy roots resulted in increased and decreased isoflavone content, respectively. Moreover, a candidate-gene association analysis revealed that 11 natural GmMYB29 polymorphisms were significantly associated with isoflavone contents, and regulation of GmMYB29 expression could partially contribute to the observed phenotypic variation. Taken together, these results provide important genetic insights into the molecular mechanisms underlying isoflavone biosynthesis in soybean. PMID:28489859

Genetic dissection and validation of candidate genes for flag leaf size in rice (Oryza sativa L.).

PubMed

Tang, Xinxin; Gong, Rong; Sun, Wenqiang; Zhang, Chaopu; Yu, Sibin

2018-04-01

Two major loci with functional candidate genes were identified and validated affecting flag leaf size, which offer desirable genes to improve leaf architecture and photosynthetic capacity in rice. Leaf size is a major determinant of plant architecture and yield potential in crops. However, the genetic and molecular mechanisms regulating leaf size remain largely elusive. In this study, quantitative trait loci (QTLs) for flag leaf length and flag leaf width in rice were detected with high-density single nucleotide polymorphism genotyping of a chromosomal segment substitution line (CSSL) population, in which each line carries one or a few chromosomal segments from the japonica cultivar Nipponbare in a common background of the indica variety Zhenshan 97. In total, 14 QTLs for flag leaf length and nine QTLs for flag leaf width were identified in the CSSL population. Among them, qFW4-2 for flag leaf width was mapped to a 37-kb interval, with the most likely candidate gene being the previously characterized NAL1. Another major QTL for both flag leaf width and length was delimited by substitution mapping to a small region of 13.5 kb that contains a single gene, Ghd7.1. Mutants of Ghd7.1 generated using CRISPR/CAS9 approach showed reduced leaf size. Allelic variation analyses also validated Ghd7.1 as a functional candidate gene for leaf size, photosynthetic capacity and other yield-related traits. These results provide useful genetic information for the improvement of leaf size and yield in rice breeding programs.

Serotonergic gene polymorphisms (5-HTTLPR, 5HTR1A, 5HTR2A), and population differences in aggression: traditional (Hadza and Datoga) and industrial (Russians) populations compared.

PubMed

Butovskaya, Marina L; Butovskaya, Polina R; Vasilyev, Vasiliy A; Sukhodolskaya, Jane M; Fekhredtinova, Dania I; Karelin, Dmitri V; Fedenok, Julia N; Mabulla, Audax Z P; Ryskov, Alexey P; Lazebny, Oleg E

2018-04-16

Current knowledge on genetic basis of aggressive behavior is still contradictory. This may be due to the fact that the majority of studies targeting associations between candidate genes and aggression are conducted on industrial societies and mainly dealing with various types of psychopathology and disorders. Because of that, our study was carried on healthy adult individuals of both sex (n = 853). Three populations were examined: two traditional (Hadza and Datoga) and one industrial (Russians), and the association of aggression with the following polymorphisms 5-HTTLPR, rs6295 (5HTR1A gene), and rs6311 (5HTR2A gene) were tested. Aggression was measured as total self-ratings on Buss-Perry Aggression Questionnaire. Distributions of allelic frequencies of 5-HTTLPR and 5HTR1A polymorphisms were significantly different among the three populations. Consequently, the association analyses for these two candidate genes were carried out separately for each population, while for the 5HTR2A polymorphism, it was conducted on the pooled data that made possible to introduce ethnic factor in the ANOVA model. The traditional biometrical approach revealed no sex differences in total aggression in all three samples. The three-way ANOVA (μ + 5-HTTLPR + 5HTR1A + 5HTR2A +ε) with measures of self-reported total aggression as dependent variable revealed significant effect of the second serotonin receptor gene polymorphism for the Hadza sample. For the Datoga, the interaction effect between 5-HTTLPR and 5HTR1A was significant. No significant effects of the used polymorphisms were obtained for Russians. The results of two-way ANOVA with ethnicity and the 5HTR2A polymorphism as main effects and their interactions revealed the highly significant effect of ethnicity, 5HTR2A polymorphism, and their interaction on total aggression. Our data provided obvious confirmation for the necessity to consider the population origin, as well as cultural background of tested individuals, while searching for associations between genes and behavior, and demonstrated the role of cultural attitudes towards the use of in-group aggression. Our data partly explained the reasons for disagreement in results of different teams, searching for candidate-gene associations with behavior without considerations of culturally desirable norms. Previous studies suggested that the 5HTR2A gene polymorphism associates with aggression and criminality. Our data extended these findings, demonstrating the role of rs6311 (5HTR2A gene) in aggression in adult healthy men and women from our samples. We found that G-allele carriers were rated higher on total aggression.

Genetic variation and effects of candidate-gene polymorphisms on coagulation properties, curd firmness modeling and acidity in milk from Brown Swiss cows.

PubMed

Cecchinato, A; Chessa, S; Ribeca, C; Cipolat-Gotet, C; Bobbo, T; Casellas, J; Bittante, G

2015-07-01

The aims of this study were to estimate the genetic variation of traditional milk coagulation properties (MCPs), milk acidity, curd firmness (CF) modeled on time t (CF(t) ; comprising: RCT(eq), rennet coagulation time estimated from the equation; CF(P), the asymptotic potential curd firmness; k(CF), the curd firming instant rate constant; and k(SR), the syneresis instant rate constant) and maximum CF traits (MCF; comprising CF(max), the maximum CF value; and tmax, the time of attainment). Furthermore, we investigated 96 single nucleotide polymorphisms (SNPs) from 54 candidate genes, testing their associations with the above-listed traits. Milk and blood samples were collected from 1271 cows (each sampled once) from 85 herds. Genotyping was performed using a custom Illumina VeraCode GoldenGate approach. A Bayesian linear animal model (including the effects of herd, days in milk, parity and additive polygenic effects) was used to estimate the genetic parameters of the studied traits. The same model with the addition of the SNP genotype effect was used for our association analysis. The heritability estimates of CF t and the MCF traits (RCT(eq)=0.258; k(CF)=0.230; CF(max)=0.191; t(max)=0.278) were similar to those obtained using traditional MCPs (0.187 to 0.267), except for the lower estimates for CF(P) (0.064) and k(SR) (0.077). A total of 13 of the 51 tested SNPs had relevant additive effects on at least one trait. We observed associations between MCPs and SNPs in the genes encoding ATP-binding cassette sub-family G member 2 (ABCG2), chemokine ligand 2 (CCL2), growth hormone 1 (GH1), prolactin (PRL) and toll-like receptor 2 (TLR2). Whereas, CF(t) and the MCF traits were associated with polymorphisms in the α-s1-casein (CSN1S1), β-casein (CSN2), GH1, oxidized low-density lipoprotein receptor 1 (OLR1), phospholipase C β1 (PLCB1), PRL and signal transducer and activator of transcription 5A (STAT5A) genes.

Association of genetic variation with systolic and diastolic blood pressure among African Americans: the Candidate Gene Association Resource study

PubMed Central

Fox, Ervin R.; Young, J. Hunter; Li, Yali; Dreisbach, Albert W.; Keating, Brendan J.; Musani, Solomon K.; Liu, Kiang; Morrison, Alanna C.; Ganesh, Santhi; Kutlar, Abdullah; Ramachandran, Vasan S.; Polak, Josef F.; Fabsitz, Richard R.; Dries, Daniel L.; Farlow, Deborah N.; Redline, Susan; Adeyemo, Adebowale; Hirschorn, Joel N.; Sun, Yan V.; Wyatt, Sharon B.; Penman, Alan D.; Palmas, Walter; Rotter, Jerome I.; Townsend, Raymond R.; Doumatey, Ayo P.; Tayo, Bamidele O.; Mosley, Thomas H.; Lyon, Helen N.; Kang, Sun J.; Rotimi, Charles N.; Cooper, Richard S.; Franceschini, Nora; Curb, J. David; Martin, Lisa W.; Eaton, Charles B.; Kardia, Sharon L.R.; Taylor, Herman A.; Caulfield, Mark J.; Ehret, Georg B.; Johnson, Toby; Chakravarti, Aravinda; Zhu, Xiaofeng; Levy, Daniel; Munroe, Patricia B.; Rice, Kenneth M.; Bochud, Murielle; Johnson, Andrew D.; Chasman, Daniel I.; Smith, Albert V.; Tobin, Martin D.; Verwoert, Germaine C.; Hwang, Shih-Jen; Pihur, Vasyl; Vollenweider, Peter; O'Reilly, Paul F.; Amin, Najaf; Bragg-Gresham, Jennifer L.; Teumer, Alexander; Glazer, Nicole L.; Launer, Lenore; Zhao, Jing Hua; Aulchenko, Yurii; Heath, Simon; Sõber, Siim; Parsa, Afshin; Luan, Jian'an; Arora, Pankaj; Dehghan, Abbas; Zhang, Feng; Lucas, Gavin; Hicks, Andrew A.; Jackson, Anne U.; Peden, John F.; Tanaka, Toshiko; Wild, Sarah H.; Rudan, Igor; Igl, Wilmar; Milaneschi, Yuri; Parker, Alex N.; Fava, Cristiano; Chambers, John C.; Kumari, Meena; JinGo, Min; van der Harst, Pim; Kao, Wen Hong Linda; Sjögren, Marketa; Vinay, D.G.; Alexander, Myriam; Tabara, Yasuharu; Shaw-Hawkins, Sue; Whincup, Peter H.; Liu, Yongmei; Shi, Gang; Kuusisto, Johanna; Seielstad, Mark; Sim, Xueling; Nguyen, Khanh-Dung Hoang; Lehtimäki, Terho; Matullo, Giuseppe; Wu, Ying; Gaunt, Tom R.; Charlotte Onland-Moret, N.; Cooper, Matthew N.; Platou, Carl G.P.; Org, Elin; Hardy, Rebecca; Dahgam, Santosh; Palmen, Jutta; Vitart, Veronique; Braund, Peter S.; Kuznetsova, Tatiana; Uiterwaal, Cuno S.P.M.; Campbell, Harry; Ludwig, Barbara; Tomaszewski, Maciej; Tzoulaki, Ioanna; Palmer, Nicholette D.; Aspelund, Thor; Garcia, Melissa; Chang, Yen-Pei C.; O'Connell, Jeffrey R.; Steinle, Nanette I.; Grobbee, Diederick E.; Arking, Dan E.; Hernandez, Dena; Najjar, Samer; McArdle, Wendy L.; Hadley, David; Brown, Morris J.; Connell, John M.; Hingorani, Aroon D.; Day, Ian N.M.; Lawlor, Debbie A.; Beilby, John P.; Lawrence, Robert W.; Clarke, Robert; Collins, Rory; Hopewell, Jemma C.; Ongen, Halit; Bis, Joshua C.; Kähönen, Mika; Viikari, Jorma; Adair, Linda S.; Lee, Nanette R.; Chen, Ming-Huei; Olden, Matthias; Pattaro, Cristian; Hoffman Bolton, Judith A.; Köttgen, Anna; Bergmann, Sven; Mooser, Vincent; Chaturvedi, Nish; Frayling, Timothy M.; Islam, Muhammad; Jafar, Tazeen H.; Erdmann, Jeanette; Kulkarni, Smita R.; Bornstein, Stefan R.; Grässler, Jürgen; Groop, Leif; Voight, Benjamin F.; Kettunen, Johannes; Howard, Philip; Taylor, Andrew; Guarrera, Simonetta; Ricceri, Fulvio; Emilsson, Valur; Plump, Andrew; Barroso, Inês; Khaw, Kay-Tee; Weder, Alan B.; Hunt, Steven C.; Bergman, Richard N.; Collins, Francis S.; Bonnycastle, Lori L.; Scott, Laura J.; Stringham, Heather M.; Peltonen, Leena; Perola, Markus; Vartiainen, Erkki; Brand, Stefan-Martin; Staessen, Jan A.; Wang, Thomas J.; Burton, Paul R.; SolerArtigas, Maria; Dong, Yanbin; Snieder, Harold; Wang, Xiaoling; Zhu, Haidong; Lohman, Kurt K.; Rudock, Megan E.; Heckbert, Susan R.; Smith, Nicholas L.; Wiggins, Kerri L.; Shriner, Daniel; Veldre, Gudrun; Viigimaa, Margus; Kinra, Sanjay; Prabhakaran, Dorairajan; Tripathy, Vikal; Langefeld, Carl D.; Rosengren, Annika; Thelle, Dag S.; MariaCorsi, Anna; Singleton, Andrew; Forrester, Terrence; Hilton, Gina; McKenzie, Colin A.; Salako, Tunde; Iwai, Naoharu; Kita, Yoshikuni; Ogihara, Toshio; Ohkubo, Takayoshi; Okamura, Tomonori; Ueshima, Hirotsugu; Umemura, Satoshi; Eyheramendy, Susana; Meitinger, Thomas; Wichmann, H.-Erich; Cho, Yoon Shin; Kim, Hyung-Lae; Lee, Jong-Young; Scott, James; Sehmi, Joban S.; Zhang, Weihua; Hedblad, Bo; Nilsson, Peter; Smith, George Davey; Wong, Andrew; Narisu, Narisu; Stančáková, Alena; Raffel, Leslie J.; Yao, Jie; Kathiresan, Sekar; O'Donnell, Chris; Schwartz, Steven M.; Arfan Ikram, M.; Longstreth, Will T.; Seshadri, Sudha; Shrine, Nick R.G.; Wain, Louise V.; Morken, Mario A.; Swift, Amy J.; Laitinen, Jaana; Prokopenko, Inga; Zitting, Paavo; Cooper, Jackie A.; Humphries, Steve E.; Danesh, John; Rasheed, Asif; Goel, Anuj; Hamsten, Anders; Watkins, Hugh; Bakker, Stephan J.L.; van Gilst, Wiek H.; Janipalli, Charles S.; Radha Mani, K.; Yajnik, Chittaranjan S.; Hofman, Albert; Mattace-Raso, Francesco U.S.; Oostra, Ben A.; Demirkan, Ayse; Isaacs, Aaron; Rivadeneira, Fernando; Lakatta, Edward G.; Orru, Marco; Scuteri, Angelo; Ala-Korpela, Mika; Kangas, Antti J.; Lyytikäinen, Leo-Pekka; Soininen, Pasi; Tukiainen, Taru; Würz, Peter; Twee-Hee Ong, Rick; Dörr, Marcus; Kroemer, Heyo K.; Völker, Uwe; Völzke, Henry; Galan, Pilar; Hercberg, Serge; Lathrop, Mark; Zelenika, Diana; Deloukas, Panos; Mangino, Massimo; Spector, Tim D.; Zhai, Guangju; Meschia, James F.; Nalls, Michael A.; Sharma, Pankaj; Terzic, Janos; Kranthi Kumar, M.J.; Denniff, Matthew; Zukowska-Szczechowska, Ewa; Wagenknecht, Lynne E.; Fowkes, Gerald R.; Charchar, Fadi J.; Schwarz, Peter E.H.; Hayward, Caroline; Guo, Xiuqing; Bots, Michiel L.; Brand, Eva; Samani, Nilesh J.; Polasek, Ozren; Talmud, Philippa J.; Nyberg, Fredrik; Kuh, Diana; Laan, Maris; Hveem, Kristian; Palmer, Lyle J.; van der Schouw, Yvonne T.; Casas, Juan P.; Mohlke, Karen L.; Vineis, Paolo; Raitakari, Olli; Wong, Tien Y.; Shyong Tai, E.; Laakso, Markku; Rao, Dabeeru C.; Harris, Tamara B.; Morris, Richard W.; Dominiczak, Anna F.; Kivimaki, Mika; Marmot, Michael G.; Miki, Tetsuro; Saleheen, Danish; Chandak, Giriraj R.; Coresh, Josef; Navis, Gerjan; Salomaa, Veikko; Han, Bok-Ghee; Kooner, Jaspal S.; Melander, Olle; Ridker, Paul M.; Bandinelli, Stefania; Gyllensten, Ulf B.; Wright, Alan F.; Wilson, James F.; Ferrucci, Luigi; Farrall, Martin; Tuomilehto, Jaakko; Pramstaller, Peter P.; Elosua, Roberto; Soranzo, Nicole; Sijbrands, Eric J.G.; Altshuler, David; Loos, Ruth J.F.; Shuldiner, Alan R.; Gieger, Christian; Meneton, Pierre; Uitterlinden, Andre G.; Wareham, Nicholas J.; Gudnason, Vilmundur; Rettig, Rainer; Uda, Manuela; Strachan, David P.; Witteman, Jacqueline C.M.; Hartikainen, Anna-Liisa; Beckmann, Jacques S.; Boerwinkle, Eric; Boehnke, Michael; Larson, Martin G.; Järvelin, Marjo-Riitta; Psaty, Bruce M.; Abecasis, Gonçalo R.; Elliott, Paul; van Duijn , Cornelia M.; Newton-Cheh, Christopher

2011-01-01

The prevalence of hypertension in African Americans (AAs) is higher than in other US groups; yet, few have performed genome-wide association studies (GWASs) in AA. Among people of European descent, GWASs have identified genetic variants at 13 loci that are associated with blood pressure. It is unknown if these variants confer susceptibility in people of African ancestry. Here, we examined genome-wide and candidate gene associations with systolic blood pressure (SBP) and diastolic blood pressure (DBP) using the Candidate Gene Association Resource (CARe) consortium consisting of 8591 AAs. Genotypes included genome-wide single-nucleotide polymorphism (SNP) data utilizing the Affymetrix 6.0 array with imputation to 2.5 million HapMap SNPs and candidate gene SNP data utilizing a 50K cardiovascular gene-centric array (ITMAT-Broad-CARe [IBC] array). For Affymetrix data, the strongest signal for DBP was rs10474346 (P= 3.6 × 10−8) located near GPR98 and ARRDC3. For SBP, the strongest signal was rs2258119 in C21orf91 (P= 4.7 × 10−8). The top IBC association for SBP was rs2012318 (P= 6.4 × 10−6) near SLC25A42 and for DBP was rs2523586 (P= 1.3 × 10−6) near HLA-B. None of the top variants replicated in additional AA (n = 11 882) or European-American (n = 69 899) cohorts. We replicated previously reported European-American blood pressure SNPs in our AA samples (SH2B3, P= 0.009; TBX3-TBX5, P= 0.03; and CSK-ULK3, P= 0.0004). These genetic loci represent the best evidence of genetic influences on SBP and DBP in AAs to date. More broadly, this work supports that notion that blood pressure among AAs is a trait with genetic underpinnings but also with significant complexity. PMID:21378095

Association of genetic variation with systolic and diastolic blood pressure among African Americans: the Candidate Gene Association Resource study.

PubMed

Fox, Ervin R; Young, J Hunter; Li, Yali; Dreisbach, Albert W; Keating, Brendan J; Musani, Solomon K; Liu, Kiang; Morrison, Alanna C; Ganesh, Santhi; Kutlar, Abdullah; Ramachandran, Vasan S; Polak, Josef F; Fabsitz, Richard R; Dries, Daniel L; Farlow, Deborah N; Redline, Susan; Adeyemo, Adebowale; Hirschorn, Joel N; Sun, Yan V; Wyatt, Sharon B; Penman, Alan D; Palmas, Walter; Rotter, Jerome I; Townsend, Raymond R; Doumatey, Ayo P; Tayo, Bamidele O; Mosley, Thomas H; Lyon, Helen N; Kang, Sun J; Rotimi, Charles N; Cooper, Richard S; Franceschini, Nora; Curb, J David; Martin, Lisa W; Eaton, Charles B; Kardia, Sharon L R; Taylor, Herman A; Caulfield, Mark J; Ehret, Georg B; Johnson, Toby; Chakravarti, Aravinda; Zhu, Xiaofeng; Levy, Daniel

2011-06-01

The prevalence of hypertension in African Americans (AAs) is higher than in other US groups; yet, few have performed genome-wide association studies (GWASs) in AA. Among people of European descent, GWASs have identified genetic variants at 13 loci that are associated with blood pressure. It is unknown if these variants confer susceptibility in people of African ancestry. Here, we examined genome-wide and candidate gene associations with systolic blood pressure (SBP) and diastolic blood pressure (DBP) using the Candidate Gene Association Resource (CARe) consortium consisting of 8591 AAs. Genotypes included genome-wide single-nucleotide polymorphism (SNP) data utilizing the Affymetrix 6.0 array with imputation to 2.5 million HapMap SNPs and candidate gene SNP data utilizing a 50K cardiovascular gene-centric array (ITMAT-Broad-CARe [IBC] array). For Affymetrix data, the strongest signal for DBP was rs10474346 (P= 3.6 × 10(-8)) located near GPR98 and ARRDC3. For SBP, the strongest signal was rs2258119 in C21orf91 (P= 4.7 × 10(-8)). The top IBC association for SBP was rs2012318 (P= 6.4 × 10(-6)) near SLC25A42 and for DBP was rs2523586 (P= 1.3 × 10(-6)) near HLA-B. None of the top variants replicated in additional AA (n = 11 882) or European-American (n = 69 899) cohorts. We replicated previously reported European-American blood pressure SNPs in our AA samples (SH2B3, P= 0.009; TBX3-TBX5, P= 0.03; and CSK-ULK3, P= 0.0004). These genetic loci represent the best evidence of genetic influences on SBP and DBP in AAs to date. More broadly, this work supports that notion that blood pressure among AAs is a trait with genetic underpinnings but also with significant complexity.

Genome-wide patterns of genetic distances reveal candidate Loci contributing to human population-specific traits.

PubMed

de Magalhães, João Pedro; Matsuda, Alex

2012-03-01

Modern humans originated in Africa before migrating across the world with founder effects and adaptations to new environments contributing to their present phenotypic diversity. Determining the genetic basis of differences between populations may provide clues about our evolutionary history and may have clinical implications. Herein, we develop a method to detect genes and biological processes in which populations most differ by calculating the genetic distance between modern populations and a hypothetical ancestral population. We apply our method to large-scale single nucleotide polymorphism (SNP) data from human populations of African, European and Asian origin. As expected, ancestral alleles were more conserved in the African populations and we found evidence of high divergence in genes previously suggested as targets of selection related to skin pigmentation, immune response, senses and dietary adaptations. Our genome-wide scan also reveals novel candidates for contributing to population-specific traits. These include genes related to neuronal development and behavior that may have been influenced by cultural processes. Moreover, in the African populations, we found a high divergence in genes related to UV protection and to the male reproductive system. Taken together, these results confirm and expand previous findings, providing new clues about the evolution and genetics of human phenotypic diversity. © 2011 The Authors Annals of Human Genetics © 2011 Blackwell Publishing Ltd/University College London.

Nogo Receptor 1 (RTN4R) as a Candidate Gene for Schizophrenia: Analysis Using Human and Mouse Genetic Approaches

PubMed Central

Hsu, Ruby; Woodroffe, Abigail; Lai, Wen-Sung; Cook, Melloni N.; Mukai, Jun; Dunning, Jonathan P.; Swanson, Douglas J.; Roos, J. Louw; Abecasis, Gonçalo R.; Karayiorgou, Maria; Gogos, Joseph A.

2007-01-01

Background NOGO Receptor 1 (RTN4R) regulates axonal growth, as well as axon regeneration after injury. The gene maps to the 22q11.2 schizophrenia susceptibility locus and is thus a strong functional and positional candidate gene. Methodology/Principal Findings We evaluate evidence for genetic association between common RTN4R polymorphisms and schizophrenia in a large family sample of Afrikaner origin and screen the exonic sequence of RTN4R for rare variants in an independent sample from the U.S. We also employ animal model studies to assay a panel of schizophrenia-related behavioral tasks in an Rtn4r-deficient mouse model. We found weak sex-specific evidence for association between common RTN4R polymorphisms and schizophrenia in the Afrikaner patients. In the U.S. sample, we identified two novel non-conservative RTN4R coding variants in two patients with schizophrenia that were absent in 600 control chromosomes. In our complementary mouse model studies, we identified a haploinsufficient effect of Rtn4r on locomotor activity, but normal performance in schizophrenia-related behavioral tasks. We also provide evidence that Rtn4r deficiency can modulate the long-term behavioral effects of transient postnatal N-methyl-D-aspartate (NMDA) receptor hypofunction. Conclusions Our results do not support a major role of RTN4R in susceptibility to schizophrenia or the cognitive and behavioral deficits observed in individuals with 22q11 microdeletions. However, they suggest that RTN4R may modulate the genetic risk or clinical expression of schizophrenia in a subset of patients and identify additional studies that will be necessary to clarify the role of RTN4R in psychiatric phenotypes. In addition, our results raise interesting issues about evaluating the significance of rare genetic variants in disease and their role in causation. PMID:18043741

Nogo Receptor 1 (RTN4R) as a candidate gene for schizophrenia: analysis using human and mouse genetic approaches.

PubMed

Hsu, Ruby; Woodroffe, Abigail; Lai, Wen-Sung; Cook, Melloni N; Mukai, Jun; Dunning, Jonathan P; Swanson, Douglas J; Roos, J Louw; Abecasis, Gonçalo R; Karayiorgou, Maria; Gogos, Joseph A

2007-11-28

NOGO Receptor 1 (RTN4R) regulates axonal growth, as well as axon regeneration after injury. The gene maps to the 22q11.2 schizophrenia susceptibility locus and is thus a strong functional and positional candidate gene. We evaluate evidence for genetic association between common RTN4R polymorphisms and schizophrenia in a large family sample of Afrikaner origin and screen the exonic sequence of RTN4R for rare variants in an independent sample from the U.S. We also employ animal model studies to assay a panel of schizophrenia-related behavioral tasks in an Rtn4r-deficient mouse model. We found weak sex-specific evidence for association between common RTN4R polymorphisms and schizophrenia in the Afrikaner patients. In the U.S. sample, we identified two novel non-conservative RTN4R coding variants in two patients with schizophrenia that were absent in 600 control chromosomes. In our complementary mouse model studies, we identified a haploinsufficient effect of Rtn4r on locomotor activity, but normal performance in schizophrenia-related behavioral tasks. We also provide evidence that Rtn4r deficiency can modulate the long-term behavioral effects of transient postnatal N-methyl-D-aspartate (NMDA) receptor hypofunction. Our results do not support a major role of RTN4R in susceptibility to schizophrenia or the cognitive and behavioral deficits observed in individuals with 22q11 microdeletions. However, they suggest that RTN4R may modulate the genetic risk or clinical expression of schizophrenia in a subset of patients and identify additional studies that will be necessary to clarify the role of RTN4R in psychiatric phenotypes. In addition, our results raise interesting issues about evaluating the significance of rare genetic variants in disease and their role in causation.

Scanning of selection signature provides a glimpse into important economic traits in goats (Capra hircus).

PubMed

Guan, Dailu; Luo, Nanjian; Tan, Xiaoshan; Zhao, Zhongquan; Huang, Yongfu; Na, Risu; Zhang, Jiahua; Zhao, Yongju

2016-10-31

Goats (Capra hircus) are one of the oldest livestock domesticated species, and have been used for their milk, meat, hair and skins over much of the world. Detection of selection footprints in genomic regions can provide potential insights for understanding the genetic mechanism of specific phenotypic traits and better guide in animal breeding. The study presented here has generated 192.747G raw data and identified more than 5.03 million single-nucleotide polymorphisms (SNPs) and 334,151 Indels (insertions and deletions). In addition, we identified 155 and 294 candidate regions harboring 86 and 97 genes based on allele frequency differences in Dazu black goats (DBG) and Inner Mongolia cashmere goats (IMCG), respectively. Populations differentiation reflected by Fst values detected 368 putative selective sweep regions including 164 genes. The top 1% regions of both low heterozygosity and high genetic differentiation contained 239 (135 genes) and 176 (106 genes) candidate regions in DBG and IMCG, respectively. These genes were related to reproductive and productive traits, such as "neurohypophyseal hormone activity" and "adipocytokine signaling pathway". These findings may be conducive to molecular breeding and the long-term preservation of the valuable genetic resources for this species.

[Detection of novel genetic markers of susceptibility to preeclampsia based on an analysis of the regulatory genes in the placental tissue].

PubMed

Serebrova, V N; Trifonova, E A; Gabidulina, T V; Bukharina, I Yu; Agarkova, T A; Evtushenko, I D; Maksimova, N R; Stepanov, V A

2016-01-01

Regulatory single nucleotide polymorphisms (rSNPs) are the least-studied group of SNP; however, they play an essential role in the development of human pathology by altering the level of candidate genes expression. In this work, we analyzed 29 rSNPs in 17 new candidate genes associated with preeclampsia (PE) according to the analysis of the transcriptome in placental tissue. Three ethnic groups have been studied (yakut, russian, and buryat). We have detected significant associations of PE with eight rSNPs in six differentially expressed genes, i.e., rs10423795 in the LHB gene; rs3771787 in the HK2 gene; rs72959687 in the INHA gene; rs12678229, rs2227262, and rs3802252 in the NDRG1 gene; rs34845949 in the SASH1 gene; and rs66707428 in the PPP1R12C gene. We used a new approach to detecting genetic markers of multifactorial diseases in the case of PE based on a combination of genomic, transcriptomic, and bioinformatic approaches. This approach proved its efficiency and may be applied to detecting new potential genetic markers in genes involved in disease pathogenesis, which reduces missing heritability in multifactorial diseases.

The genetics of feed conversion efficiency traits in a commercial broiler line

PubMed Central

Reyer, Henry; Hawken, Rachel; Murani, Eduard; Ponsuksili, Siriluck; Wimmers, Klaus

2015-01-01

Individual feed conversion efficiency (FCE) is a major trait that influences the usage of energy resources and the ecological footprint of livestock production. The underlying biological processes of FCE are complex and are influenced by factors as diverse as climate, feed properties, gut microbiota, and individual genetic predisposition. To gain an insight to the genetic relationships with FCE traits and to contribute to the improvement of FCE in commercial chicken lines, a genome-wide association study was conducted using a commercial broiler population (n = 859) tested for FCE and weight traits during the finisher period from 39 to 46 days of age. Both single-marker (generalized linear model) and multi-marker (Bayesian approach) analyses were applied to the dataset to detect genes associated with the variability in FCE. The separate analyses revealed 22 quantitative trait loci (QTL) regions on 13 different chromosomes; the integration of both approaches resulted in 7 overlapping QTL regions. The analyses pointed to acylglycerol kinase (AGK) and general transcription factor 2-I (GTF2I) as positional and functional candidate genes. Non-synonymous polymorphisms of both candidate genes revealed evidence for a functional importance of these genes by influencing different biological aspects of FCE. PMID:26552583

High-resolution genetic mapping of allelic variants associated with cell wall chemistry in Populus.

PubMed

Muchero, Wellington; Guo, Jianjun; DiFazio, Stephen P; Chen, Jin-Gui; Ranjan, Priya; Slavov, Gancho T; Gunter, Lee E; Jawdy, Sara; Bryan, Anthony C; Sykes, Robert; Ziebell, Angela; Klápště, Jaroslav; Porth, Ilga; Skyba, Oleksandr; Unda, Faride; El-Kassaby, Yousry A; Douglas, Carl J; Mansfield, Shawn D; Martin, Joel; Schackwitz, Wendy; Evans, Luke M; Czarnecki, Olaf; Tuskan, Gerald A

2015-01-23

QTL cloning for the discovery of genes underlying polygenic traits has historically been cumbersome in long-lived perennial plants like Populus. Linkage disequilibrium-based association mapping has been proposed as a cloning tool, and recent advances in high-throughput genotyping and whole-genome resequencing enable marker saturation to levels sufficient for association mapping with no a priori candidate gene selection. Here, multiyear and multienvironment evaluation of cell wall phenotypes was conducted in an interspecific P. trichocarpa x P. deltoides pseudo-backcross mapping pedigree and two partially overlapping populations of unrelated P. trichocarpa genotypes using pyrolysis molecular beam mass spectrometry, saccharification, and/ or traditional wet chemistry. QTL mapping was conducted using a high-density genetic map with 3,568 SNP markers. As a fine-mapping approach, chromosome-wide association mapping targeting a QTL hot-spot on linkage group XIV was performed in the two P. trichocarpa populations. Both populations were genotyped using the 34 K Populus Infinium SNP array and whole-genome resequencing of one of the populations facilitated marker-saturation of candidate intervals for gene identification. Five QTLs ranging in size from 0.6 to 1.8 Mb were mapped on linkage group XIV for lignin content, syringyl to guaiacyl (S/G) ratio, 5- and 6-carbon sugars using the mapping pedigree. Six candidate loci exhibiting significant associations with phenotypes were identified within QTL intervals. These associations were reproducible across multiple environments, two independent genotyping platforms, and different plant growth stages. cDNA sequencing for allelic variants of three of the six loci identified polymorphisms leading to variable length poly glutamine (PolyQ) stretch in a transcription factor annotated as an ANGUSTIFOLIA C-terminus Binding Protein (CtBP) and premature stop codons in a KANADI transcription factor as well as a protein kinase. Results from protoplast transient expression assays suggested that each of the polymorphisms conferred allelic differences in the activation of cellulose, hemicelluloses, and lignin pathway marker genes. This study illustrates the utility of complementary QTL and association mapping as tools for gene discovery with no a priori candidate gene selection. This proof of concept in a perennial organism opens up opportunities for discovery of novel genetic determinants of economically important but complex traits in plants.

Association of Pro12Ala Polymorphism of Peroxisome Proliferator-Activated Receptor gamma 2 (PPARγ2) Gene with Type 2 Diabetes Mellitus in Ethnic Kashmiri Population.

PubMed

Majid, Misbah; Masood, Akbar; Kadla, Showkat Ahmad; Hameed, Iqra; Ganai, Bashir A

2017-02-01

Type 2 diabetes mellitus (T2DM) is characterized by chronic hyperglycemia associated with insulin resistance and relative insulin deficiency. T2DM is believed to be attributable to the combined effect of genetic and environmental factors. Peroxisome proliferator-activated receptor gamma 2 (PPARγ2) is one of the main candidate genes that are implicated in T2DM. A common proline 12 alanine (Pro12Ala) polymorphism in PPARγ2 has been shown to be associated with T2DM. The aim of this work was to investigate the possible role of PPARγ2 gene polymorphism, as a genetic risk factor for T2DM. The study comprised 200 ethnic unrelated subjects (100 T2DM patients and 100 controls). PCR-RFLP technique was used for genotyping analysis. The frequency of the Pro allele was 79 and 91.5 % for controls and cases, respectively (P < 0.05; OR 3.2; 95 % CI 1.64-6.3). The Pro12Ala polymorphism was in Hardy-Weinberg equilibrium in both patients and controls (χ 2  = 0.13, P > 0.05). We found a significant association of Pro12Ala polymorphism of PPARγ2 gene with T2DM, however the genotypes showed statistically significant association only with few clinical parameters including body mass index, total cholesterol, and low-density lipoprotein (P < 0.05). The study signifies that Pro allele in PPARγ2 may be a genotypic risk factor that confers susceptibility to T2DM in ethnic Kashmiri population.

Association of the 98T ELAM-1 polymorphism with increased bleeding after cardiac surgery.

PubMed

Welsby, Ian J; Podgoreanu, Mihai V; Phillips-Bute, Barbara; Morris, Richard; Mathew, Joseph P; Smith, Peter K; Newman, Mark F; Schwinn, Debra A; Stafford-Smith, Mark

2010-06-01

Hemorrhage continues to be a major problem after cardiac surgery despite the routine use of antifibrinolytic drugs, with striking inter-patient variability poorly explained by already known risk factors. The authors tested the hypothesis that genetic polymorphisms of inflammatory mediators and cellular adhesion molecules are associated with bleeding after cardiac surgery. Prospective, observational study. Single, tertiary referral university heart center. Adult patients undergoing aortocoronary surgery with cardiopulmonary bypass. Patients (n = 759) had 10 mL of blood drawn preoperatively and genomic DNA isolated then genotyped for 17 polymorphisms in 7 candidate genes: tumor necrosis factor, interleukins 1beta and 6, interleukin 1 receptor antagonist, intercellular adhesion molecule-1 (ICAM-1), P-selectin and endothelial leucocyte adhesion molecule-1 (E-selectin). Multivariate analyses were used to relate clinical and genetic factors to bleeding and transfusion. The 98G/T polymorphism of the E-selectin gene was independently associated with bleeding after cardiac surgery (p = 0.002), after adjusting for significant clinical predictors (patient size and baseline hemoglobin concentration). There was a gene dose effect according to the number of minor alleles in the genotype; carriers of the minor allele bled 17% (GT) and 54% (TT) more than wild type (GG) genotypes, respectively (p = 0.01). Carriers of the minor allele also had longer activated partial thromboplastin times (p = 0.0023) and increased fresh frozen plasma transfusion (p = 0.03) compared with wild type. The authors found a dose-related association between the 98T E-selectin polymorphism and bleeding after cardiac surgery, independent of and additive to standard clinical risk factors. Copyright 2010 Elsevier Inc. All rights reserved.

A possible genetic association with chronic fatigue in primary Sjögren's syndrome: a candidate gene study.

PubMed

Norheim, Katrine Brække; Le Hellard, Stephanie; Nordmark, Gunnel; Harboe, Erna; Gøransson, Lasse; Brun, Johan G; Wahren-Herlenius, Marie; Jonsson, Roland; Omdal, Roald

2014-02-01

Fatigue is prevalent and disabling in primary Sjögren's syndrome (pSS). Results from studies in chronic fatigue syndrome (CFS) indicate that genetic variation may influence fatigue. The aim of this study was to investigate single nucleotide polymorphism (SNP) variations in pSS patients with high and low fatigue. A panel of 85 SNPs in 12 genes was selected based on previous studies in CFS. A total of 207 pSS patients and 376 healthy controls were genotyped. One-hundred and ninety-three patients and 70 SNPs in 11 genes were available for analysis after quality control. Patients were dichotomized based on fatigue visual analogue scale (VAS) scores, with VAS <50 denominated "low fatigue" (n = 53) and VAS ≥50 denominated "high fatigue" (n = 140). We detected signals of association with pSS for one SNP in SLC25A40 (unadjusted p = 0.007) and two SNPs in PKN1 (both p = 0.03) in our pSS case versus control analysis. The association with SLC25A40 was stronger when only pSS high fatigue patients were analysed versus controls (p = 0.002). One SNP in PKN1 displayed an association in the case-only analysis of pSS high fatigue versus pSS low fatigue (p = 0.005). This candidate gene study in pSS did reveal a trend for associations between genetic variation in candidate genes and fatigue. The results will need to be replicated. More research on genetic associations with fatigue is warranted, and future trials should include larger cohorts and multicentre collaborations with sharing of genetic material to increase the statistical power.

European genetic ancestry is associated with a decreased risk of lupus nephritis.

PubMed

Richman, Ilana B; Taylor, Kimberly E; Chung, Sharon A; Trupin, Laura; Petri, Michelle; Yelin, Edward; Graham, Robert R; Lee, Annette; Behrens, Timothy W; Gregersen, Peter K; Seldin, Michael F; Criswell, Lindsey A

2012-10-01

African Americans, East Asians, and Hispanics with systemic lupus erythematosus (SLE) are more likely to develop renal disease than are SLE patients of European descent. This study was undertaken to investigate whether European genetic ancestry protects against the development of lupus nephritis, with the aim of exploring the genetic and socioeconomic factors that might explain this effect. This was a cross-sectional study of SLE patients from a multiethnic case collection. Participants were genotyped for 126 single-nucleotide polymorphisms (SNPs) informative for ancestry. A subset of participants was also genotyped for 80 SNPs in 14 candidate genes for renal disease in SLE. Logistic regression was used to test the association between European ancestry and renal disease. Analyses were adjusted for continental ancestries, socioeconomic status (SES), and candidate genes. Participants (n = 1,906) had, on average, 62.4% European, 15.8% African, 11.5% East Asian, 6.5% Amerindian, and 3.8% South Asian ancestry. Among the participants, 656 (34%) had renal disease. A 10% increase in the proportion of European ancestry estimated in each participant was associated with a 15% reduction in the odds of having renal disease, after adjustment for disease duration and sex (odds ratio 0.85, 95% confidence interval 0.82-0.87; P = 1.9 × 10(-30) ). Adjustment for other genetic ancestries, measures of SES, or SNPs in the genes most associated with renal disease (IRF5 [rs4728142], BLK [rs2736340], STAT4 [rs3024912], and HLA-DRB1*0301 and DRB1*1501) did not substantively alter this relationship. European ancestry is protective against the development of renal disease in SLE, an effect that is independent of other genetic ancestries, candidate risk alleles, and socioeconomic factors. Copyright © 2012 by the American College of Rheumatology.

The genomic architecture and association genetics of adaptive characters using a candidate SNP approach in boreal black spruce

PubMed Central

2013-01-01

Background The genomic architecture of adaptive traits remains poorly understood in non-model plants. Various approaches can be used to bridge this gap, including the mapping of quantitative trait loci (QTL) in pedigrees, and genetic association studies in non-structured populations. Here we present results on the genomic architecture of adaptive traits in black spruce, which is a widely distributed conifer of the North American boreal forest. As an alternative to the usual candidate gene approach, a candidate SNP approach was developed for association testing. Results A genetic map containing 231 gene loci was used to identify QTL that were related to budset timing and to tree height assessed over multiple years and sites. Twenty-two unique genomic regions were identified, including 20 that were related to budset timing and 6 that were related to tree height. From results of outlier detection and bulk segregant analysis for adaptive traits using DNA pool sequencing of 434 genes, 52 candidate SNPs were identified and subsequently tested in genetic association studies for budset timing and tree height assessed over multiple years and sites. A total of 34 (65%) SNPs were significantly associated with budset timing, or tree height, or both. Although the percentages of explained variance (PVE) by individual SNPs were small, several significant SNPs were shared between sites and among years. Conclusions The sharing of genomic regions and significant SNPs between budset timing and tree height indicates pleiotropic effects. Significant QTLs and SNPs differed quite greatly among years, suggesting that different sets of genes for the same characters are involved at different stages in the tree’s life history. The functional diversity of genes carrying significant SNPs and low observed PVE further indicated that a large number of polymorphisms are involved in adaptive genetic variation. Accordingly, for undomesticated species such as black spruce with natural populations of large effective size and low linkage disequilibrium, efficient marker systems that are predictive of adaptation should require the survey of large numbers of SNPs. Candidate SNP approaches like the one developed in the present study could contribute to reducing these numbers. PMID:23724860

Genetic linkage map and QTL identification for adventitious rooting traits in red gum eucalypts.

PubMed

Sumathi, Murugan; Bachpai, Vijaya Kumar Waman; Mayavel, A; Dasgupta, Modhumita Ghosh; Nagarajan, Binai; Rajasugunasekar, D; Sivakumar, Veerasamy; Yasodha, Ramasamy

2018-05-01

The eucalypt species, Eucalyptus tereticornis and Eucalyptus camaldulensis , show tolerance to drought and salinity conditions, respectively, and are widely cultivated in arid and semiarid regions of tropical countries. In this study, genetic linkage map was developed for interspecific cross E. tereticornis  ×  E. camaldulensis using pseudo-testcross strategy with simple sequence repeats (SSRs), intersimple sequence repeats (ISSRs), and sequence-related amplified polymorphism (SRAP) markers. The consensus genetic map comprised totally 283 markers with 84 SSRs, 94 ISSRs, and 105 SRAP markers on 11 linkage groups spanning 1163.4 cM genetic distance. Blasting the SSR sequences against E. grandis sequences allowed an alignment of 64% and the average ratio of genetic-to-physical distance was 1.7 Mbp/cM, which strengths the evidence that high amount of synteny and colinearity exists among eucalypts genome. Blast searches also revealed that 37% of SSRs had homologies with genes, which could potentially be used in the variety of downstream applications including candidate gene polymorphism. Quantitative trait loci (QTL) analysis for adventitious rooting traits revealed six QTL for rooting percent and root length on five chromosomes with interval and composite interval mapping. All the QTL explained 12.0-14.7% of the phenotypic variance, showing the involvement of major effect QTL on adventitious rooting traits. Increasing the density of markers would facilitate the detection of more number of small-effect QTL and also underpinning the genes involved in rooting process.

Adaptation to climate through flowering phenology: a case study in Medicago truncatula.

PubMed

Burgarella, Concetta; Chantret, Nathalie; Gay, Laurène; Prosperi, Jean-Marie; Bonhomme, Maxime; Tiffin, Peter; Young, Nevin D; Ronfort, Joelle

2016-07-01

Local climatic conditions likely constitute an important selective pressure on genes underlying important fitness-related traits such as flowering time, and in many species, flowering phenology and climatic gradients strongly covary. To test whether climate shapes the genetic variation on flowering time genes and to identify candidate flowering genes involved in the adaptation to environmental heterogeneity, we used a large Medicago truncatula core collection to examine the association between nucleotide polymorphisms at 224 candidate genes and both climate variables and flowering phenotypes. Unlike genome-wide studies, candidate gene approaches are expected to enrich for the number of meaningful trait associations because they specifically target genes that are known to affect the trait of interest. We found that flowering time mediates adaptation to climatic conditions mainly by variation at genes located upstream in the flowering pathways, close to the environmental stimuli. Variables related to the annual precipitation regime reflected selective constraints on flowering time genes better than the other variables tested (temperature, altitude, latitude or longitude). By comparing phenotype and climate associations, we identified 12 flowering genes as the most promising candidates responsible for phenological adaptation to climate. Four of these genes were located in the known flowering time QTL region on chromosome 7. However, climate and flowering associations also highlighted largely distinct gene sets, suggesting different genetic architectures for adaptation to climate and flowering onset. © 2016 John Wiley & Sons Ltd.

Analysis of complex repeat sequences within the spinal muscular atrophy (SMA) candidate region in 5q13

DOE Office of Scientific and Technical Information (OSTI.GOV)

Davies, K.E.; Morrison, K.E.; Daniels, R.I.

1994-09-01

We previously reported that the 400 kb interval flanked the polymorphic loci D5S435 and D5S557 contains blocks of a chromosome 5 specific repeat. This interval also defines the SMA candidate region by genetic analysis of recombinant families. A YAC contig of 2-3 Mb encompassing this area has been constructed and a 5.5 kb conserved fragment, isolated from a YAC end clone within the above interval, was used to obtain cDNAs from both fetal and adult brain libraries. We describe the identification of cDNAs with stretches of high DNA sequence homology to exons of {beta} glucuronidase on human chromosome 7. Themore » cDNAs map both to the candidate region and to an area of 5p using FISH and deletion hybrid analysis. Hybridization to bacteriophage and cosmid clones from the YACs localizes the {beta} glucuronidase related sequences within the 400 kb region of the YAC contig. The cDNAs show a polymorphic pattern on hybridization to genomic BamH1 fragments in the size range of 10-250 kb. Further analysis using YAC fragmentation vectors is being used to determine how these {beta} glucuronidase related cDNAs are distributed within 5q13. Dinucleotide repeats within the region are being investigated to determine linkage disequilibrium with the disease locus.« less

Candidate gene association mapping of Sclerotinia stalk rot resistance in sunflower (Helianthus annuus L.) uncovers the importance of COI1 homologs.

PubMed

Talukder, Zahirul I; Hulke, Brent S; Qi, Lili; Scheffler, Brian E; Pegadaraju, Venkatramana; McPhee, Kevin; Gulya, Thomas J

2014-01-01

Functional markers for Sclerotinia basal stalk rot resistance in sunflower were obtained using gene-level information from the model species Arabidopsis thaliana. Sclerotinia stalk rot, caused by Sclerotinia sclerotiorum, is one of the most destructive diseases of sunflower (Helianthus annuus L.) worldwide. Markers for genes controlling resistance to S. sclerotiorum will enable efficient marker-assisted selection (MAS). We sequenced eight candidate genes homologous to Arabidopsis thaliana defense genes known to be associated with Sclerotinia disease resistance in a sunflower association mapping population evaluated for Sclerotinia stalk rot resistance. The total candidate gene sequence regions covered a concatenated length of 3,791 bp per individual. A total of 187 polymorphic sites were detected for all candidate gene sequences, 149 of which were single nucleotide polymorphisms (SNPs) and 38 were insertions/deletions. Eight SNPs in the coding regions led to changes in amino acid codons. Linkage disequilibrium decay throughout the candidate gene regions declined on average to an r (2) = 0.2 for genetic intervals of 120 bp, but extended up to 350 bp with r (2) = 0.1. A general linear model with modification to account for population structure was found the best fitting model for this population and was used for association mapping. Both HaCOI1-1 and HaCOI1-2 were found to be strongly associated with Sclerotinia stalk rot resistance and explained 7.4 % of phenotypic variation in this population. These SNP markers associated with Sclerotinia stalk rot resistance can potentially be applied to the selection of favorable genotypes, which will significantly improve the efficiency of MAS during the development of stalk rot resistant cultivars.

Replication and validation of genetic polymorphisms associated with survival after allogeneic blood or marrow transplant

PubMed Central

Karaesmen, Ezgi; Rizvi, Abbas A.; Preus, Leah M.; McCarthy, Philip L.; Pasquini, Marcelo C.; Onel, Kenan; Zhu, Xiaochun; Spellman, Stephen; Haiman, Christopher A.; Stram, Daniel O.; Pooler, Loreall; Sheng, Xin; Zhu, Qianqian; Yan, Li; Liu, Qian; Hu, Qiang; Webb, Amy; Brock, Guy; Clay-Gilmour, Alyssa I.; Battaglia, Sebastiano; Tritchler, David; Liu, Song; Hahn, Theresa

2017-01-01

Multiple candidate gene-association studies of non-HLA single-nucleotide polymorphisms (SNPs) and outcomes after blood or marrow transplant (BMT) have been conducted. We identified 70 publications reporting 45 SNPs in 36 genes significantly associated with disease-related mortality, progression-free survival, transplant-related mortality, and/or overall survival after BMT. Replication and validation of these SNP associations were performed using DISCOVeRY-BMT (Determining the Influence of Susceptibility COnveying Variants Related to one-Year mortality after BMT), a well-powered genome-wide association study consisting of 2 cohorts, totaling 2888 BMT recipients with acute myeloid leukemia, acute lymphoblastic leukemia, or myelodysplastic syndrome, and their HLA-matched unrelated donors, reported to the Center for International Blood and Marrow Transplant Research. Gene-based tests were used to assess the aggregate effect of SNPs on outcome. None of the previously reported significant SNPs replicated at P < .05 in DISCOVeRY-BMT. Validation analyses showed association with one previously reported donor SNP at P < .05 and survival; more associations would be anticipated by chance alone. No gene-based tests were significant at P < .05. Functional annotation with publicly available data shows these candidate SNPs most likely do not have biochemical function; only 13% of candidate SNPs correlate with gene expression or are predicted to impact transcription factor binding. Of these, half do not impact the candidate gene of interest; the other half correlate with expression of multiple genes. These findings emphasize the peril of pursing candidate approaches and the importance of adequately powered tests of unbiased genome-wide associations with BMT clinical outcomes given the ultimate goal of improving patient outcomes. PMID:28811306

Genome-wide scans of genetic variants for psychophysiological endophenotypes: a methodological overview.

PubMed

Iacono, William G; Malone, Stephen M; Vaidyanathan, Uma; Vrieze, Scott I

2014-12-01

This article provides an introductory overview of the investigative strategy employed to evaluate the genetic basis of 17 endophenotypes examined as part of a 20-year data collection effort from the Minnesota Center for Twin and Family Research. Included are characterization of the study samples, descriptive statistics for key properties of the psychophysiological measures, and rationale behind the steps taken in the molecular genetic study design. The statistical approach included (a) biometric analysis of twin and family data, (b) heritability analysis using 527,829 single nucleotide polymorphisms (SNPs), (c) genome-wide association analysis of these SNPs and 17,601 autosomal genes, (d) follow-up analyses of candidate SNPs and genes hypothesized to have an association with each endophenotype, (e) rare variant analysis of nonsynonymous SNPs in the exome, and (f) whole genome sequencing association analysis using 27 million genetic variants. These methods were used in the accompanying empirical articles comprising this special issue, Genome-Wide Scans of Genetic Variants for Psychophysiological Endophenotypes. Copyright © 2014 Society for Psychophysiological Research.

Genetic Diversity and Population Structure of Whitebark Pine (Pinus albicaulis Engelm.) in Western North America

PubMed Central

Liu, Jun-Jun; Sniezko, Richard; Murray, Michael; Wang, Ning; Chen, Hao; Zamany, Arezoo; Sturrock, Rona N.; Savin, Douglas; Kegley, Angelia

2016-01-01

Whitebark pine (WBP, Pinus albicaulis Engelm.) is an endangered conifer species due to heavy mortality from white pine blister rust (WPBR, caused by Cronartium ribicola) and mountain pine beetle (Dendroctonus ponderosae). Information about genetic diversity and population structure is of fundamental importance for its conservation and restoration. However, current knowledge on the genetic constitution and genomic variation is still limited for WBP. In this study, an integrated genomics approach was applied to characterize seed collections from WBP breeding programs in western North America. RNA-seq analysis was used for de novo assembly of the WBP needle transcriptome, which contains 97,447 protein-coding transcripts. Within the transcriptome, single nucleotide polymorphisms (SNPs) were discovered, and more than 22,000 of them were non-synonymous SNPs (ns-SNPs). Following the annotation of genes with ns-SNPs, 216 ns-SNPs within candidate genes with putative functions in disease resistance and plant defense were selected to design SNP arrays for high-throughput genotyping. Among these SNP loci, 71 were highly polymorphic, with sufficient variation to identify a unique genotype for each of the 371 individuals originating from British Columbia (Canada), Oregon and Washington (USA). A clear genetic differentiation was evident among seed families. Analyses of genetic spatial patterns revealed varying degrees of diversity and the existence of several genetic subgroups in the WBP breeding populations. Genetic components were associated with geographic variables and phenotypic rating of WPBR disease severity across landscapes, which may facilitate further identification of WBP genotypes and gene alleles contributing to local adaptation and quantitative resistance to WPBR. The WBP genomic resources developed here provide an invaluable tool for further studies and for exploitation and utilization of the genetic diversity preserved within this endangered conifer and other five-needle pines. PMID:27992468

Association between estrogen receptora gene (ESR1) PvuII (T/C) and XbaI (A/G) polymorphisms and premature ovarian failure risk: evidence from a meta-analysis.

PubMed

He, Meirong; Shu, Jingcheng; Huang, Xing; Tang, Hui

2015-02-01

Genetic factors are important in the pathogenesis of Premature ovarian failure (POF). Notably, estrogen receptor-a (ESR1) has been suggested as a possible candidate gene for POF; however, published studies of ESR1 gene polymorphisms have been hampered by small sample sizes and inconclusive or ambiguous results. The aim of this meta analysis is to investigate the associations between two novel common ESR1 polymorphisms (intron 1 polymorphisms PvuII-rs2234693: T.C and XbaI-rs9340799: A.G) and POF. A comprehensive search was conducted to identify all studies on the association of ESR1 gene polymorphisms with POF up to August 2014. Pooled odds ratio (OR) and corresponding 95 % confidence interval (CI) were calculated using fixed-or random-effects model in the meta-analysis. Three studies covering 1396 subjects were identified. Pooled data showed significant association between ESR1 gene PvuII polymorphism and risk of POF: [allele model: Cvs. T, OR = 0.735, 95%CI: 0.624 ~ 0.865, p = 0.001; co-dominant models: CCvs.TT, OR = 0.540, 95%CI: 0.382 ~ 0.764, p = 0.001, CTvs.TT, OR = 0.735, 95%CI: 0.555 ~ 0.972, p = 0.031; dominant model: CT + CCvs.TT, OR = 0.618, 95%CI: 0.396 ~ 0.966, p = 0.035; recessive model: CCvs.TT + CT, OR = 0.659, 95%CI: 0.502 ~ 0.864, p = 0.003]. Subgroup analyses showed a significant association in all models in Asian population, but no significant association in any model in European population. For the XbaI polymorphism, overall, no significant association was observed under any genetic models. However, under dominant model, ESR1 gene XbaI polymorphism is significantly association with risk of POF in Asian population. The present meta-analysis suggests that ESR1gene PvuII polymorphism is significantly associated with an increased risk of POF. And ESR1gene XbaI polymorphism is not association with risk of POF overall. However, under dominant model, ESR1gene XbaI polymorphism is significantly association with risk of POF in Asian population. Further large and well-designed studies are needed to confirm the association.

Sex, Drugs, and Rock ‘N’ Roll: Hypothesizing Common Mesolimbic Activation as a Function of Reward Gene Polymorphisms

PubMed Central

Blum, Kenneth; Werner, Tonia; Carnes, Stefanie; Carnes, Patrick; Bowirrat, Abdalla; Giordano, John; Marlene-Oscar-Berman; Gold, Mark

2014-01-01

The nucleus accumbens, a site within the ventral striatum, plays a prominent role in mediating the reinforcing effects of drugs of abuse, food, sex, and other addictions. Indeed, it is generally believed that this structure mandates motivated behaviors such as eating, drinking, and sexual activity, which are elicited by natural rewards and other strong incentive stimuli. This article focuses on sex addiction, but we hypothesize that there is a common underlying mechanism of action for the powerful effects that all addictions have on human motivation. That is, biological drives may have common molecular genetic antecedents, which if impaired, lead to aberrant behaviors. Based on abundant scientific support, we further hypothesize that dopaminergic genes, and possibly other candidate neurotransmitter-related gene polymorphisms, affect both hedonic and anhedonic behavioral outcomes. Genotyping studies already have linked gene polymorphic associations with alcohol and drug addictions and obesity, and we anticipate that future genotyping studies of sex addicts will provide evidence for polymorphic associations with specific clustering of sexual typologies based on clinical instrument assessments. We recommend that scientists and clinicians embark on research coupling the use of neuroimaging tools with dopaminergic agonistic agents to target specific gene polymorphisms systematically for normalizing hyper- or hypo-sexual behaviors. PMID:22641964

Sequence analysis of three canine adipokine genes revealed an association between TNF polymorphisms and obesity in Labrador dogs.

PubMed

Mankowska, M; Stachowiak, M; Graczyk, A; Ciazynska, P; Gogulski, M; Nizanski, W; Switonski, M

2016-04-01

Obesity is an emerging health problem in purebred dogs. Due to their crucial role in energy homeostasis control, genes encoding adipokines are considered candidate genes, and their variants may be associated with predisposition to obesity. Searching for polymorphism was carried out in three adipokine genes (TNF, RETN and IL6). The study was performed on 260 dogs, including lean (n = 109), overweight (n = 88) and obese (n = 63) dogs. The largest cohort was represented by Labrador Retrievers (n = 136). Altogether, 24 novel polymorphisms were identified: 12 in TNF (including one missense SNP), eight in RETN (including one missense SNP) and four in IL6. Distributions of five common SNPs (two in TNF, two in RETN and one in IL6) were further analyzed with regard to body condition score. Two SNPs in the non-coding parts of TNF (c.-40A>C and c.233+14G>A) were associated with obesity in Labrador dogs. The obtained results showed that the studied adipokine genes are highly polymorphic and two polymorphisms in the TNF gene may be considered as markers predisposing Labrador dogs to obesity. © 2015 Stichting International Foundation for Animal Genetics.

Imaging genetics and the neurobiological basis of individual differences in vulnerability to addiction.

PubMed

Sweitzer, Maggie M; Donny, Eric C; Hariri, Ahmad R

2012-06-01

Addictive disorders are heritable, but the search for candidate functional polymorphisms playing an etiological role in addiction is hindered by complexity of the phenotype and the variety of factors interacting to impact behavior. Advances in human genome sequencing and neuroimaging technology provide an unprecedented opportunity to explore the impact of functional genetic variants on variability in behaviorally relevant neural circuitry. Here, we present a model for merging these technologies to trace the links between genes, brain, and addictive behavior. We describe imaging genetics and discuss the utility of its application to addiction. We then review data pertaining to impulsivity and reward circuitry as an example of how genetic variation may lead to variation in behavioral phenotype. Finally, we present preliminary data relating the neural basis of reward processing to individual differences in nicotine dependence. Complex human behaviors such as addiction can be traced to their basic genetic building blocks by identifying intermediate behavioral phenotypes, associated neural circuitry, and underlying molecular signaling pathways. Impulsivity has been linked with variation in reward-related activation in the ventral striatum (VS), altered dopamine signaling, and functional polymorphisms of DRD2 and DAT1 genes. In smokers, changes in reward-related VS activation induced by smoking abstinence may be associated with severity of nicotine dependence. Variation in genes related to dopamine signaling may contribute to heterogeneity in VS sensitivity to reward and, ultimately, to addiction. These findings illustrate the utility of the imaging genetics approach for investigating the neurobiological basis for vulnerability to addiction. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Functional characterization of an oxytocin receptor gene variant (rs2268498) previously associated with social cognition by expression analysis in vitro and in human brain biopsy.

PubMed

Reuter, Martin; Montag, Christian; Altmann, Steffen; Bendlow, Fabian; Elger, Christian; Kirsch, Peter; Becker, Albert; Schoch-McGovern, Susanne; Simon, Matthias; Weber, Bernd; Felten, Andrea

2017-10-01

The oxytocin system plays a prominent role in social behavior across species, and numerous genetic studies in humans have reported associations between polymorphisms on the oxytocin receptor (OXTR) gene and phenotypes related to social cognition, affiliation, perspective taking, and sociability in healthy subjects and in patients with atypical social behavior, such as in autism spectrum disorders (ASD). Recently, the first study demonstrating altered agonist-induced OXTR internalization and recycling for the exonic variant rs35062132 emerged. Beside this, there has been no further demonstration of the functionality of the OXTR variants especially there does not exist any for the regulatory units. To address this gap in the literature, we tested the functionality of the promoter flanking single nucleotide polymorphism (SNP) rs2268498, which has proven an interesting candidate for predicting social behavior in recent association studies. Results of genetic expression analyses in human hippocampal tissue showed a twofold difference in messenger RNA transcription, dependent on the presence or absence of the C-allele. This finding was corroborated by cloning, i.e., in vitro reporter gene expression analysis after transfection of OXTR promoter plasmids into HEK-293 cells. Our results underline the importance of OXTR rs2268498 for genetic research in social behavior and ASD.

Association mapping reveals the genetic architecture of tomato response to water deficit: focus on major fruit quality traits

PubMed Central

Albert, Elise; Segura, Vincent; Gricourt, Justine; Bonnefoi, Julien; Derivot, Laurent; Causse, Mathilde

2016-01-01

Water scarcity constitutes a crucial constraint for agriculture productivity. High-throughput approaches in model plant species identified hundreds of genes potentially involved in survival under drought, but few having beneficial effects on quality and yield. Nonetheless, controlled water deficit may improve fruit quality through higher concentration of flavor compounds. The underlying genetic determinants are still poorly known. In this study, we phenotyped 141 highly diverse small fruit tomato accessions for 27 traits under two contrasting watering conditions. A subset of 55 accessions exhibited increased metabolite contents and maintained yield under water deficit. Using 6100 single nucleotide polymorphisms (SNPs), association mapping revealed 31, 41, and 44 quantitative trait loci (QTLs) under drought, control, and both conditions, respectively. Twenty-five additional QTLs were interactive between conditions, emphasizing the interest in accounting for QTLs by watering regime interactions in fruit quality improvement. Combining our results with the loci previously identified in a biparental progeny resulted in 11 common QTLs and contributed to a first detailed characterization of the genetic determinants of response to water deficit in tomato. Major QTLs for fruit quality traits were dissected and candidate genes were proposed using expression and polymorphism data. The outcomes provide a basis for fruit quality improvement under deficit irrigation while limiting yield losses. PMID:27856709

Patterns of genetic diversity in the polymorphic ground snake (Sonora semiannulata).

PubMed

Cox, Christian L; Chippindale, Paul T

2014-08-01

We evaluated the genetic diversity of a snake species with color polymorphism to understand the evolutionary processes that drive genetic structure across a large geographic region. Specifically, we analyzed genetic structure of the highly polymorphic ground snake, Sonora semiannulata, (1) among populations, (2) among color morphs (3) at regional and local spatial scales, using an amplified fragment length polymorphism dataset and multiple population genetic analyses, including FST-based and clustering analytical techniques. Based upon these methods, we found that there was moderate to low genetic structure among populations. However, this diversity was not associated with geographic locality at either spatial scale. Similarly, we found no evidence for genetic divergence among color morphs at either spatial scale. These results suggest that despite dramatic color polymorphism, this phenotypic diversity is not a major driver of genetic diversity within or among populations of ground snakes. We suggest that there are two mechanisms that could explain existing genetic diversity in ground snakes: recent range expansion from a genetically diverse founder population and current or recent gene flow among populations. Our findings have further implications for the types of color polymorphism that may generate genetic diversity in snakes.

Global genetic diversity of the Plasmodium vivax transmission-blocking vaccine candidate Pvs48/45.

PubMed

Vallejo, Andres F; Martinez, Nora L; Tobon, Alejandra; Alger, Jackeline; Lacerda, Marcus V; Kajava, Andrey V; Arévalo-Herrera, Myriam; Herrera, Sócrates

2016-04-12

Plasmodium vivax 48/45 protein is expressed on the surface of gametocytes/gametes and plays a key role in gamete fusion during fertilization. This protein was recently expressed in Escherichia coli host as a recombinant product that was highly immunogenic in mice and monkeys and induced antibodies with high transmission-blocking activity, suggesting its potential as a P. vivax transmission-blocking vaccine candidate. To determine sequence polymorphism of natural parasite isolates and its potential influence on the protein structure, all pvs48/45 sequences reported in databases from around the world as well as those from low-transmission settings of Latin America were compared. Plasmodium vivax parasite isolates from malaria-endemic regions of Colombia, Brazil and Honduras (n = 60) were used to sequence the Pvs48/45 gene, and compared to those previously reported to GenBank and PlasmoDB (n = 222). Pvs48/45 gene haplotypes were analysed to determine the functional significance of genetic variation in protein structure and vaccine potential. Nine non-synonymous substitutions (E35K, Y196H, H211N, K250N, D335Y, E353Q, A376T, K390T, K418R) and three synonymous substitutions (I73, T149, C156) that define seven different haplotypes were found among the 282 isolates from nine countries when compared with the Sal I reference sequence. Nucleotide diversity (π) was 0.00173 for worldwide samples (range 0.00033-0.00216), resulting in relatively high diversity in Myanmar and Colombia, and low diversity in Mexico, Peru and South Korea. The two most frequent substitutions (E353Q: 41.9 %, K250N: 39.5 %) were predicted to be located in antigenic regions without affecting putative B cell epitopes or the tertiary protein structure. There is limited sequence polymorphism in pvs48/45 with noted geographical clustering among Asian and American isolates. The low genetic diversity of the protein does not influence the predicted antigenicity or protein structure and, therefore, supports its further development as transmission-blocking vaccine candidate.

Mapping the Schizophrenia Genes by Neuroimaging: The Opportunities and the Challenges

PubMed Central

2018-01-01

Schizophrenia (SZ) is a heritable brain disease originating from a complex interaction of genetic and environmental factors. The genes underpinning the neurobiology of SZ are largely unknown but recent data suggest strong evidence for genetic variations, such as single nucleotide polymorphisms, making the brain vulnerable to the risk of SZ. Structural and functional brain mapping of these genetic variations are essential for the development of agents and tools for better diagnosis, treatment and prevention of SZ. Addressing this, neuroimaging methods in combination with genetic analysis have been increasingly used for almost 20 years. So-called imaging genetics, the opportunities of this approach along with its limitations for SZ research will be outlined in this invited paper. While the problems such as reproducibility, genetic effect size, specificity and sensitivity exist, opportunities such as multivariate analysis, development of multisite consortia for large-scale data collection, emergence of non-candidate gene (hypothesis-free) approach of neuroimaging genetics are likely to contribute to a rapid progress for gene discovery besides to gene validation studies that are related to SZ. PMID:29324666

Biochemical Diagnosis in Substance and Non-substance Addiction.

PubMed

Shen, Wenwen; Liu, Huifeng; Xie, Xiaohu; Liu, Haixiong; Zhou, Wenhua

2017-01-01

An optimal biochemical marker for addiction would be some easily traced molecules in body specimens, which indicates indulgent addictive behaviors, or susceptibility to certain addictive stimuli. In this chapter, we discussed existing literature about possible biomarkers, and classified them into three categories: origin forms and metabolites of substances, markers from biochemical responses to certain addiction, and genetic and epigenetic biomarkers suggesting susceptibility to addiction. In every category, we examined studies concerning certain type of addiction one by one, with focuses mainly on opiates, psychostimulants, and pathological gambling. Several promising molecules were highlighted, including those of neurotrophic factors, inflammatory factors, and indicators of vascular injury, and genetic and epigenetic biomarkers such as serum miRNAs. DNA methylation signatures and signal nucleotide polymorphism of candidate gene underlying the addiction.

Fine mapping of the Darier's disease locus on chromosome 12q.

PubMed

Richard, G; Wright, A R; Harris, S; Doyle, S Z; Korge, B; Mazzanti, C; Tanaka, T; Harth, W; McBride, O W; Compton, J G; Bale, S J; DiGiovanna, J J

1994-11-01

Darier's disease (DD) is an autosomal dominant genodermatosis characterized by epidermal acantholysis and dyskeratosis. We have performed genetic linkage studies in 10 families with DD (34 affected) by analyzing 14 polymorphic microsatellite markers. Our results confirm recent reports mapping the DD gene to chromosome 12q23-q24.1. Haplotype analysis of recombinant chromosomes in our families, along with previously reported data, narrow the location of the DD gene to a 5 cM interval flanked by the loci D12S354 and D12S84/D12S105. This localization allowed exclusion of two known genes, PLA2A and PAH, as candidate loci for DD. Three other gene loci (PPP1C, PMCH, PMCA1), mapping in 12q21-q24, remain potential candidates.

Analysis of Over 10,000 Cases Finds No Association between Previously-Reported Candidate Polymorphisms and Ovarian Cancer Outcome

PubMed Central

White, Kristin L.; Vierkant, Robert A.; Fogarty, Zachary C.; Charbonneau, Bridget; Block, Matthew S.; Pharoah, Paul D.P.; Chenevix-Trench, Georgia; Rossing, Mary Anne; Cramer, Daniel W.; Pearce, C. Leigh; Schildkraut, Joellen M.; Menon, Usha; Kjaer, Susanne Kruger; Levine, Douglas A.; Gronwald, Jacek; Culver, Hoda Anton; Whittemore, Alice S.; Karlan, Beth Y.; Lambrechts, Diether; Wentzensen, Nicolas; Kupryjanczyk, Jolanta; Chang-Claude, Jenny; Bandera, Elisa V.; Hogdall, Estrid; Heitz, Florian; Kaye, Stanley B.; Fasching, Peter A.; Campbell, Ian; Goodman, Marc T.; Pejovic, Tanja; Bean, Yukie; Lurie, Galina; Eccles, Diana; Hein, Alexander; Beckmann, Matthias W.; Ekici, Arif B.; Paul, James; Brown, Robert; Flanagan, James; Harter, Philipp; du Bois, Andreas; Schwaab, Ira; Hogdall, Claus K.; Lundvall, Lene; Olson, Sara H.; Orlow, Irene; Paddock, Lisa E.; Rudolph, Anja; Eilber, Ursula; Dansonka-Mieszkowska, Agnieszka; Rzepecka, Iwona K.; Ziolkowska-Seta, Izabela; Brinton, Louise; Yang, Hannah; Garcia-Closas, Montserrat; Despierre, Evelyn; Lambrechts, Sandrina; Vergote, Ignace; Walsh, Christine; Lester, Jenny; Sieh, Weiva; McGuire, Valerie; Rothstein, Joseph H.; Ziogas, Argyrios; Lubiński, Jan; Cybulski, Cezary; Menkiszak, Janusz; Jensen, Allan; Gayther, Simon A.; Ramus, Susan J.; Gentry-Maharaj, Aleksandra; Berchuck, Andrew; Wu, Anna H.; Pike, Malcolm C.; Van Den Berg, David; Terry, Kathryn L.; Vitonis, Allison F.; Doherty, Jennifer A.; Johnatty, Sharon; deFazio, Anna; Song, Honglin; Tyrer, Jonathan; Sellers, Thomas A.; Phelan, Catherine M.; Kalli, Kimberly R.; Cunningham, Julie M.; Fridley, Brooke L.; Goode, Ellen L.

2013-01-01

Background Ovarian cancer is a leading cause of cancer-related death among women. In an effort to understand contributors to disease outcome, we evaluated single-nucleotide polymorphisms (SNPs) previously associated with ovarian cancer recurrence or survival, specifically in angiogenesis, inflammation, mitosis, and drug disposition genes. Methods Twenty-seven SNPs in VHL, HGF, IL18, PRKACB, ABCB1, CYP2C8, ERCC2, and ERCC1 previously associated with ovarian cancer outcome were genotyped in 10,084 invasive cases from 28 studies from the Ovarian Cancer Association Consortium with over 37,000 observed person-years and 4,478 deaths. Cox proportional hazards models were used to examine the association between candidate SNPs and ovarian cancer recurrence or survival with and without adjustment for key covariates. Results We observed no association between genotype and ovarian cancer recurrence or survival for any of the SNPs examined. Conclusions These results refute prior associations between these SNPs and ovarian cancer outcome and underscore the importance of maximally powered genetic association studies. Impact These variants should not be used in prognostic models. Alternate approaches to uncovering inherited prognostic factors, if they exist, are needed. PMID:23513043

Association study of IL10, IL1beta, and IL1RN and schizophrenia using tag SNPs from a comprehensive database: suggestive association with rs16944 at IL1beta.

PubMed

Shirts, Brian H; Wood, Joel; Yolken, Robert H; Nimgaonkar, Vishwajit L

2006-12-01

Genetic association studies of several candidate cytokine genes have been motivated by evidence of immune dysfunction among patients with schizophrenia. Intriguing but inconsistent associations have been reported with polymorphisms of three positional candidate genes, namely IL1beta, IL1RN, and IL10. We used comprehensive sequencing data from the Seattle SNPs database to select tag SNPs that represent all common polymorphisms in the Caucasian population at these loci. Associations with 28 tag SNPs were evaluated in 478 cases and 501 unscreened control individuals, while accounting for population sub-structure using the genomic control method. The samples were also stratified by gender, diagnostic category, and exposure to infectious agents. Significant association was not detected after correcting for multiple comparisons. However, meta-analysis of our data combined with previously published association studies of rs16944 (IL1beta -511) suggests that the C allele confers modest risk for schizophrenia among individuals reporting Caucasian ancestry, but not Asians (Caucasians, n=819 cases, 1292 controls; p=0.0013, OR=1.24, 95% CI 1.09, 1.41).

Cracking the genomic piggy bank: identifying secrets of the pig genome.

PubMed

Mote, B E; Rothschild, M F

2006-01-01

Though researchers are uncovering valuable information about the pig genome at unprecedented speed, the porcine genome community is barely scratching the surface as to understanding interactions of the biological code. The pig genetic linkage map has nearly 5,000 loci comprised of genes, microsatellites, and amplified fragment length polymorphism markers. Likewise, the physical map is becoming denser with nearly 6,000 markers. The long awaited sequencing efforts are providing multidimensional benefits with sequence available for comparative genomics and identifying single nucleotide polymorphisms for use in linkage and trait association studies. Scientists are using exotic and commercial breeds for quantitative trait loci scans. Additionally, candidate gene studies continue to identify chromosomal regions or genes associated with economically important traits such as growth rate, leanness, feed intake, meat quality, litter size, and disease resistance. The commercial pig industry is actively incorporating these markers in marker-assisted selection along with traditional performance information to improve said traits. Researchers are utilizing novel tools including pig microarrays along with advanced bioinformatics to identify new candidate genes, understand gene function, and piece together gene networks involved in important biological processes. Advances in pig genomics and implications to the pork industry as well as human health are reviewed.

Family-based association study of 5-HT(2A) receptor T102C polymorphism and suicidal behavior in Ashkenazi inpatient adolescents.

PubMed

Zalsman, Gil; Frisch, Amos; Baruch-Movshovits, Ruth; Sher, Leo; Michaelovsky, Elena; King, Robert A; Fischel, Tsvi; Hermesh, Haggai; Goldberg, Pablo; Gorlyn, Marianne; Misgav, Sagit; Apter, Alan; Tyano, Sam; Weizman, Abraham

2005-01-01

Suicidal behavior runs in families and is partially genetically determined. Since greater serotonin 5-HT(2A) receptor binding has been reported in postmortem brain and platelets of suicide victims, the 5-HT(2A) receptor gene polymorphism T102C became one of the candidate sites in the study of suicide and impulsive-aggressive traits. However, studies that examined the association of this polymorphism with suicidality have contradictory results. This study used a family-based method and one homogenous ethnic group to overcome ethnic stratification in order to test this association. Thirty families of inpatient adolescents from Jewish Ashkenazi origin, with a recent suicide attempt, were genotyped. All subjects were interviewed for clinical diagnosis, depressive and impulsive-aggressive traits and demographic data. Allele frequencies were assessed using the Haplotype Relative Risk method for trios. No difference was found in allelic distribution between transmitted and non-transmitted alleles. There was no significant association of genotype with any of the clinical traits These preliminary results suggest that the 5-HT(2A) T102C polymorphism is unlikely to be associated with suicidal behavior and related traits in adolescent suicide attempters.

Candidate genes for COPD in two large data sets.

PubMed

Bakke, P S; Zhu, G; Gulsvik, A; Kong, X; Agusti, A G N; Calverley, P M A; Donner, C F; Levy, R D; Make, B J; Paré, P D; Rennard, S I; Vestbo, J; Wouters, E F M; Anderson, W; Lomas, D A; Silverman, E K; Pillai, S G

2011-02-01

Lack of reproducibility of findings has been a criticism of genetic association studies on complex diseases, such as chronic obstructive pulmonary disease (COPD). We selected 257 polymorphisms of 16 genes with reported or potential relationships to COPD and genotyped these variants in a case-control study that included 953 COPD cases and 956 control subjects. We explored the association of these polymorphisms to three COPD phenotypes: a COPD binary phenotype and two quantitative traits (post-bronchodilator forced expiratory volume in 1 s (FEV₁) % predicted and FEV₁/forced vital capacity (FVC)). The polymorphisms significantly associated to these phenotypes in this first study were tested in a second, family-based study that included 635 pedigrees with 1,910 individuals. Significant associations to the binary COPD phenotype in both populations were seen for STAT1 (rs13010343) and NFKBIB/SIRT2 (rs2241704) (p<0.05). Single-nucleotide polymorphisms rs17467825 and rs1155563 of the GC gene were significantly associated with FEV₁ % predicted and FEV₁/FVC, respectively, in both populations (p<0.05). This study has replicated associations to COPD phenotypes in the STAT1, NFKBIB/SIRT2 and GC genes in two independent populations, the associations of the former two genes representing novel findings.

Population-based case-control study of DRD2 gene polymorphisms and alcoholism.

PubMed

Bhaskar, L V K S; Thangaraj, K; Non, A L; Singh, Lalji; Rao, V R

2010-10-01

Several independent lines of evidence for genetic contributions to vulnerability to alcoholism exist. Dopamine is thought to play a major role in the mechanism of reward and reinforcement in response to alcohol. D2 dopamine receptor (DRD2) gene has been among the stronger candidate genes implicated in alcoholism. In this study, alcohol use was assessed in 196 randomly selected Kota individuals of Nilgiri Hills, South India. Six DRD2 SNPs were assessed in 81 individuals with alcoholism and 151 controls to evaluate the association between single nucleotide polymorphisms (SNPs) and alcoholism. Of the three models (dominant, recessive, and additive) tested for association between alcoholism and DRD2 SNPs, only the additive model shows association for three loci (rs1116313, TaqID, and rs2734835). Of six studied polymorphisms, five are in strong linkage disequilibrium forming onesingle haplotype block. Though the global haplotype analysis with these five SNPs was not significant, haplotype analysis using all six SNPs yielded a global P value of .033, even after adjusting for age. These findings support the importance of dopamine receptor gene polymorphisms in alcoholism. Further studies to replicate these findings in different populations are needed to confirm these results.

A low-density SNP array for analyzing differential selection in freshwater and marine populations of threespine stickleback (Gasterosteus aculeatus).

PubMed

Ferchaud, Anne-Laure; Pedersen, Susanne H; Bekkevold, Dorte; Jian, Jianbo; Niu, Yongchao; Hansen, Michael M

2014-10-06

The threespine stickleback (Gasterosteus aculeatus) has become an important model species for studying both contemporary and parallel evolution. In particular, differential adaptation to freshwater and marine environments has led to high differentiation between freshwater and marine stickleback populations at the phenotypic trait of lateral plate morphology and the underlying candidate gene Ectodysplacin (EDA). Many studies have focused on this trait and candidate gene, although other genes involved in marine-freshwater adaptation may be equally important. In order to develop a resource for rapid and cost efficient analysis of genetic divergence between freshwater and marine sticklebacks, we generated a low-density SNP (Single Nucleotide Polymorphism) array encompassing markers of chromosome regions under putative directional selection, along with neutral markers for background. RAD (Restriction site Associated DNA) sequencing of sixty individuals representing two freshwater and one marine population led to the identification of 33,993 SNP markers. Ninety-six of these were chosen for the low-density SNP array, among which 70 represented SNPs under putatively directional selection in freshwater vs. marine environments, whereas 26 SNPs were assumed to be neutral. Annotation of these regions revealed several genes that are candidates for affecting stickleback phenotypic variation, some of which have been observed in previous studies whereas others are new. We have developed a cost-efficient low-density SNP array that allows for rapid screening of polymorphisms in threespine stickleback. The array provides a valuable tool for analyzing adaptive divergence between freshwater and marine stickleback populations beyond the well-established candidate gene Ectodysplacin (EDA).

Genetic influences on right ventricular systolic pressure (RVSP) in chronic obstructive pulmonary disease (COPD).

PubMed

Shaw, Janet G; Dent, Annette G; Passmore, Linda H; Burstow, Darryl J; Bowman, Rayleen V; Zimmerman, Paul V; Fong, Kwun M; Yang, Ian A

2012-06-13

Pulmonary hypertension (PH) is a complication of chronic obstructive pulmonary disease (COPD). This study examined genetic variations in mediators of vascular remodelling and their association with PH in patients with COPD. In patients with COPD, we genotyped 7 SNPs in 6 candidate PH genes (NOS3, ACE, EDN1, PTGIS, SLC6A4, VEGFA). We tested for association with right ventricular systolic pressure (RVSP), spirometry and gas transfer, and hypoxemia. In patients with COPD, we genotyped 7 SNPs in 6 candidate PH genes (NOS3, ACE, EDN1, PTGIS, SLC6A4, VEGFA). We tested for association with right ventricular systolic pressure (RVSP), spirometry and gas transfer, and hypoxemia. 580 COPD patients were recruited, 341 patients had a transthoracic echocardiogram, with RVSP measurable in 278 patients (mean age 69  years, mean FEV1 50% predicted, mean RVSP 44  mmHg, median history of 50 pack-years). Of the 7 tested SNPs, the NOS3-VNTR polymorphism was significantly associated with RVSP in a dose-dependent fashion for the risk allele: mean RVSP for a/a and a/b genotypes were 52.0 and 46.6  mmHg respectively, compared to 43.2  mmHg for b/b genotypes (P = 0.032). No associations were found between RVSP and other polymorphisms. ACE II or ID genotypes were associated with a lower FEV1% predicted than the ACE DD genotype (P = 0.028). The NOS3-298 TT genotype was associated with lower KCO % predicted than the NOS3-298 GG or GT genotype (P = 0.031). The NOS3-VNTR polymorphism was associated with RVSP in patients with COPD, supporting its involvement in the pathogenesis of PH in COPD. ACE and NOS3 genotypes were associated with COPD disease severity, but not with the presence of PH. Further study of these genes could lead to the development of prognostic and screening tools for PH in COPD.

Candidate-gene approach in posttraumatic stress disorder after urban violence: association analysis of the genes encoding serotonin transporter, dopamine transporter, and BDNF.

PubMed

Valente, Nina Leão Marques; Vallada, Homero; Cordeiro, Quirino; Miguita, Karen; Bressan, Rodrigo Affonseca; Andreoli, Sergio Baxter; Mari, Jair Jesus; Mello, Marcelo Feijó

2011-05-01

Posttraumatic stress disorder (PTSD) is a prevalent, disabling anxiety disorder marked by behavioral and physiologic alterations which commonly follows a chronic course. Exposure to a traumatic event constitutes a necessary, but not sufficient, factor. There is evidence from twin studies supporting a significant genetic predisposition to PTSD. However, the precise genetic loci still remain unclear. The objective of the present study was to identify, in a case-control study, whether the brain-derived neurotrophic factor (BDNF) val66met polymorphism (rs6265), the dopamine transporter (DAT1) three prime untranslated region (3'UTR) variable number of tandem repeats (VNTR), and the serotonin transporter (5-HTTPRL) short/long variants are associated with the development of PTSD in a group of victims of urban violence. All polymorphisms were genotyped in 65 PTSD patients as well as in 34 victims of violence without PTSD and in a community control group (n = 335). We did not find a statistical significant difference between the BDNF val66met and 5-HTTPRL polymorphism and the traumatic phenotype. However, a statistical association was found between DAT1 3'UTR VNTR nine repeats and PTSD (OR = 1.82; 95% CI, 1.20-2.76). This preliminary result confirms previous reports supporting a susceptibility role for allele 9 and PTSD.

Effect of polymorphisms in the CSN3 (κ-casein) gene on milk production traits in Chinese Holstein Cattle.

PubMed

Alim, M A; Dong, T; Xie, Y; Wu, X P; Zhang, Yi; Zhang, Shengli; Sun, D X

2014-11-01

This study was designed to evaluate significant associations between single nucleotide polymorphisms (SNPs) and milk composition and milk production traits in Chinese Holstein cows. Six SNPs were identified in the κ-casein gene using pooled DNA sequencing. The identified SNPs were genotyped by Matrix-assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF MS) methods from 507 individuals. Out of six, we identified three non-synonymous SNPs (g.10888T>C, g.10924C>A and g.10944A>G) that changed in the protein product. SIFT (Sorting_Intolerant_From_Tolerant) prediction score (0.01) demonstrated that protein changed Isoleucine > Threonine (g.10888T>C) will affect the phenotypes. Significant associations between identified SNPs and three yield traits (milk, protein and fat) and two composition traits (fat and protein percentages) were found whereas it did not reach significance for fat percentage in haplotypes association. Importantly, the significant SNPs in our results showed a large proportion of the phenotypic variation of milk protein yield and concentration. Our results suggest that CSN3 is an important candidate gene that influences milk production traits, and identified polymorphisms and haplotypes could be used as a genetic marker in programs of marker-assisted selection for the genetic improvement of milk production traits in dairy cattle.

Association of inflammatory gene polymorphisms with ischemic stroke in a Chinese Han population.

PubMed

Zhao, Nan; Liu, Xin; Wang, Yongqin; Liu, Xiaoqiu; Li, Jiana; Yu, Litian; Ma, Liyuan; Wang, Shuyu; Zhang, Hongye; Liu, Lisheng; Zhao, Jingbo; Wang, Xingyu

2012-07-06

Inflammatory mechanisms are important in stroke risk, and genetic variations in components of the inflammatory response have been implicated as risk factors for stroke. We tested the inflammatory gene polymorphisms and their association with ischemic stroke in a Chinese Han population. A total of 1,124 ischemic stroke cases and 1,163 controls were genotyped with inflammatory panel strips containing 51 selected inflammatory gene polymorphisms from 35 candidate genes. We tested the genotype-stroke association with logistic regression model. We found two single nucleotide polymorphisms (SNPs) in CCL11 were associated with ischemic stroke. After adjusting for multiple testing using false discovery rate (FDR) with a 0.20 cut-off point, CCL11 rs4795895 remained statistically significant. We further stratified the study population by their hypertension status. In the hypertensive group, CCR2 rs1799864, CCR5 rs1799987 and CCL11 rs4795895 were nominally associated with increased risk of stroke. In the non-hypertensive group, CCL11 rs3744508, LTC4S rs730012, FCER1B rs569108, TGFB1 rs1800469, LTA rs909253 and CCL11 rs4795895 were associated with ischemic stroke. After correction for multiple testing, CCR2 rs1799864 and CCR5 rs1799987 remained significant in the hypertensive group, and CCL11 rs3744508, LTC4S rs730012, FCER1B rs569108, TGFB1 rs1800469, LTA rs909253 remained significant in the non-hypertensive group. Our results indicate that inflammatory genetic variants are associated with increased risk of ischemic stroke in a Chinese Han population, particularly in non-hypertensive individuals.

Genetic diversity of transmission-blocking vaccine candidate Pvs48/45 in Plasmodium vivax populations in China.

PubMed

Feng, Hui; Gupta, Bhavna; Wang, Meilian; Zheng, Wenqi; Zheng, Li; Zhu, Xiaotong; Yang, Yimei; Fang, Qiang; Luo, Enjie; Fan, Qi; Tsuboi, Takafumi; Cao, Yaming; Cui, Liwang

2015-12-01

The male gamete fertilization factor P48/45 in malaria parasites is a prime transmission-blocking vaccine (TBV) candidate. Efforts to develop antimalarial vaccines are often thwarted by genetic diversity of the target antigens. Here we evaluated the genetic diversity of Pvs48/45 gene in global Plasmodium vivax populations. We determined 200 Pvs48/45 sequences collected from temperate and subtropical parasite populations in China. Population genetic and evolutionary analyses were performed to determine the levels of genetic diversity, potential signature of selection, and population differentiation. Analysis of the Pvs48/45 sequences from 200 P. vivax parasites collected in a temperate and a tropical region revealed a low level of genetic diversity (π = 0.0012) with 14 single nucleotide polymorphisms, of which 11 were nonsynonymous. Analysis of 344 Pvs48/45 sequences from nine worldwide P. vivax populations detected a total of 38 haplotypes, of which 13 haplotypes were present only once. Multiple tests for selection confirmed a signature of positive selection on Pvs48/45 with selection skewed to the second cysteine domain. Haplotype network analysis and Wright's fixation index showed large geographical differentiation with the presence of continent-or region-specific mutations in this gene. Pvs48/45 displays low levels of genetic diversity with the presence of region-specific mutations. Some of the mutations may be potential epitope targets based on their positions in the predicted structure, highlighting the need for future evaluation of these mutations in designing Pvs48/45-based TBV.

CHI3L1 polymorphisms associate with asthma in a Taiwanese population

PubMed Central

2014-01-01

Background A genome-wide association study uncovered Chitinase 3 like 1 (CHI3L1) as a candidate gene for asthma susceptibility. CHI3L1, which encodes the YKL-40 protein, is associated with asthma in Western European and American populations and with atopy in a Korean population. However, asthma-associated polymorphisms remain unknown for a Taiwanese population. Methods We enrolled 628 adult asthmatic patients and 1:1 age-sex matched community-based controls in southern Taiwan and performed a combined effect sizes analysis to test if CHI3L1 polymorphisms were related to genetic risks for asthma in the Asian population. Ten tagSNP polymorphisms for the CHI3L1 gene were selected from the HapMap database and genotyped using a TaqMan allelic discrimination assay. Results Adjusted odds ratios of the CHI3L1 rs1538372 CC genotype (aOR = 1.97, 95% CI: 1.23–3.14) and the rs10399931 GG genotype (aOR = 1.77, 95% CI: 1.13–2.77) were significantly associated with asthma in the Taiwanese populations. Predictive values of forced expiratory volume in the first second of the forced vital capacity (12.37%, P = 0.03) and of forced vital capacity (12.10%, P = 0.036) decreased in conjunction with an increase in YKL-40 levels among CHI3L1 rs1538372 CC carriers; these values were 16.1% (P = 0.004) and 14.5% (P = 0.011), respectively, among CHI3L1 rs10399931 GG carriers. Furthermore, steroid use by asthma patients did not affect serum YKL-40 levels, but both polymorphisms had significant effects on YKL-40 levels in asthma patients who used steroids. Conclusions Our findings suggest that the CHI3L1 polymorphisms rs1538372 and rs10399931 can be used as genetic markers for predicting asthma risk in the Taiwanese population. PMID:25056157

Evidence for adaptation from standing genetic variation on an antimicrobial peptide gene in the mussel Mytilus edulis.

PubMed

Gosset, Célia C; Do Nascimento, Joana; Augé, Marie-Thérèse; Bierne, Nicolas

2014-06-01

Genome scans of population differentiation identify candidate loci for adaptation but provide little information on how selection has influenced the genetic structure of these loci. Following a genome scan, we investigated the nature of the selection responsible for the outlying differentiation observed between populations of the marine mussel Mytilus edulis at a leucine/arginine polymorphism (L31R) in the antimicrobial peptide MGD2. We analysed DNA sequence polymorphisms, allele frequencies and population differentiation of polymorphisms closely linked to L31R, and pairwise and third-order linkage disequilibria. An outlying level of population differentiation was observed at L31R only, while no departure from panmixia was observed at linked loci surrounding L31R, as in most of the genome. Selection therefore seems to affect L31R directly. Three hypotheses can explain the lack of differentiation in the chromosomal region close to L31R: (i) hitchhiking has occurred but migration and recombination subsequently erased the signal, (ii) selection was weak enough and recombination strong enough to limit the hitchhiking effect to a very small chromosomal region or (iii) selection acted on a pre-existing polymorphism (i.e. standing variation) at linkage equilibrium with its background. Linkage equilibrium was observed between L31R and linked polymorphisms in every population analysed, as expected under the three hypotheses. However, linkage disequilibrium was observed in some populations between pairs of loci located upstream and downstream to L31R, generating a complex pattern of third-order linkage disequilibria which is best explained by the hypothesis of selection on a pre-existing polymorphism. We hypothesise that selection could be either balanced, maintaining alleles at different frequencies depending on the pathogen community encountered locally by mussels, or intermittent, resulting in sporadic fluctuations in allele frequency. © 2014 John Wiley & Sons Ltd.

Genetic variation in genes for the xenobiotic-metabolizing enzymes CYP1A1, EPHX1, GSTM1, GSTT1 and GSTP1 and susceptibility to colorectal cancer in Lynch syndrome

PubMed Central

Pande, Mala; Amos, Christopher I.; Osterwisch, Daniel R.; Chen, Jinyun; Lynch, Patrick M.; Broaddus, Russell; Frazier, Marsha L.

2011-01-01

Individuals with Lynch syndrome are predisposed to cancer due to an inherited DNA mismatch repair gene mutation. However, there is significant variability observed in disease expression, likely due to the influence of other environmental, lifestyle, or genetic factors. Polymorphisms in genes encoding xenobiotic-metabolizing enzymes may modify cancer risk by influencing the metabolism and clearance of potential carcinogens from the body. In this retrospective analysis, we examined key candidate gene polymorphisms in CYP1A1, EPHX1, GSTT1, GSTM1, and GSTP1 as modifiers of age at onset of colorectal cancer among 257 individuals with Lynch syndrome. We found that subjects heterozygous for CYP1A1 I462V (c.1384A>G) developed colorectal cancer 4 years earlier than those with the homozygous wild-type genotype (median ages 39 and 43 years, respectively; log-rank test P = 0.018). Furthermore, being heterozygous for the CYP1A1 polymorphisms, I462V and Msp1 (g.6235T>C), was associated with an increased risk for developing colorectal cancer [adjusted hazard ratio for AG relative to AA = 1.78, 95% CI = 1.16–2.74, P = 0.008; and hazard ratio for TC relative to TT = 1.53, 95% CI = 1.06–2.22, P = 0.02]. Since homozygous variants for both CYP1A1 polymorphisms were rare, risk estimates were imprecise. None of the other gene polymorphisms examined were associated with an earlier onset age for colorectal cancer. Our results suggest that the I462V and Msp1 polymorphisms in CYP1A1 may be an additional susceptibility factor for disease expression in Lynch syndrome since they modify the age of colorectal cancer onset by up to 4 years. PMID:18768509

Modeling Host Genetic Regulation of Influenza Pathogenesis in the Collaborative Cross

PubMed Central

Ferris, Martin T.; Aylor, David L.; Bottomly, Daniel; Whitmore, Alan C.; Aicher, Lauri D.; Bell, Timothy A.; Bradel-Tretheway, Birgit; Bryan, Janine T.; Buus, Ryan J.; Gralinski, Lisa E.; Haagmans, Bart L.; McMillan, Leonard; Miller, Darla R.; Rosenzweig, Elizabeth; Valdar, William; Wang, Jeremy; Churchill, Gary A.; Threadgill, David W.; McWeeney, Shannon K.; Katze, Michael G.; Pardo-Manuel de Villena, Fernando; Baric, Ralph S.; Heise, Mark T.

2013-01-01

Genetic variation contributes to host responses and outcomes following infection by influenza A virus or other viral infections. Yet narrow windows of disease symptoms and confounding environmental factors have made it difficult to identify polymorphic genes that contribute to differential disease outcomes in human populations. Therefore, to control for these confounding environmental variables in a system that models the levels of genetic diversity found in outbred populations such as humans, we used incipient lines of the highly genetically diverse Collaborative Cross (CC) recombinant inbred (RI) panel (the pre-CC population) to study how genetic variation impacts influenza associated disease across a genetically diverse population. A wide range of variation in influenza disease related phenotypes including virus replication, virus-induced inflammation, and weight loss was observed. Many of the disease associated phenotypes were correlated, with viral replication and virus-induced inflammation being predictors of virus-induced weight loss. Despite these correlations, pre-CC mice with unique and novel disease phenotype combinations were observed. We also identified sets of transcripts (modules) that were correlated with aspects of disease. In order to identify how host genetic polymorphisms contribute to the observed variation in disease, we conducted quantitative trait loci (QTL) mapping. We identified several QTL contributing to specific aspects of the host response including virus-induced weight loss, titer, pulmonary edema, neutrophil recruitment to the airways, and transcriptional expression. Existing whole-genome sequence data was applied to identify high priority candidate genes within QTL regions. A key host response QTL was located at the site of the known anti-influenza Mx1 gene. We sequenced the coding regions of Mx1 in the eight CC founder strains, and identified a novel Mx1 allele that showed reduced ability to inhibit viral replication, while maintaining protection from weight loss. PMID:23468633

A novel single nucleotide polymorphism in exon 7 of LPL gene and its association with carcass traits and visceral fat deposition in yak (Bos grunniens) steers.

PubMed

Ding, X Z; Liang, C N; Guo, X; Xing, C F; Bao, P J; Chu, M; Pei, J; Zhu, X S; Yan, P

2012-01-01

Lipoprotein lipase (LPL) is considered as a key enzyme in the lipid deposition and metabolism in tissues. It is assumed to be a major candidate gene for genetic markers in lipid deposition. Therefore, the polymorphisms of the LPL gene and associations with carcass traits and viscera fat content were examined in 398 individuals from five yak (Bos grunniens) breeds using PCR-SSCP analysis and DNA sequencing. A novel nucleotide polymorphism (SNP)-C→T (nt19913) was identified located in exon 7 in the coding region of the LPL gene, which replacement was responsible for a Phe-to-Ser substitution at amino acid. Two alleles (A and B) and three genotypes designed as AA, AB and BB were detected in the PCR products. The frequencies of allele A were 0.7928, 0.7421, 0.7357, 0.6900 and 0.7083 for Tianzhu white yak (WY), Gannan yak (GY), Qinghai-Plateau yak (PY), Xinjiang yak (XY) and Datong yak (DY), respectively. The SNP loci was in Hardy-Weinberg equilibrium in five yak populations (P>0.05). Polymorphism of LPL gene was shown to be associated with carcass traits and lipid deposition. Least squares analysis revealed that there was a significant effect on live-weight (LW) (P<0.01), average daily weight gain (ADG) and carcass weight (P<0.05). Individuals with genotype BB had lower mean values than those with genotype AA and AB for loin eye area and viscera fat weight (% of LW) in 25-36 months (P<0.05). The results indicated that LPL gene is a strong candidate gene that affects carcass traits and fat deposition in yak.

Shared heritability of attention-deficit/hyperactivity disorder and autism spectrum disorder.

PubMed

Rommelse, Nanda N J; Franke, Barbara; Geurts, Hilde M; Hartman, Catharina A; Buitelaar, Jan K

2010-03-01

Attention-deficit/hyperactivity disorder (ADHD) and autism spectrum disorder (ASD) are both highly heritable neurodevelopmental disorders. Evidence indicates both disorders co-occur with a high frequency, in 20-50% of children with ADHD meeting criteria for ASD and in 30-80% of ASD children meeting criteria for ADHD. This review will provide an overview on all available studies [family based, twin, candidate gene, linkage, and genome wide association (GWA) studies] shedding light on the role of shared genetic underpinnings of ADHD and ASD. It is concluded that family and twin studies do provide support for the hypothesis that ADHD and ASD originate from partly similar familial/genetic factors. Only a few candidate gene studies, linkage studies and GWA studies have specifically addressed this co-occurrence, pinpointing to some promising pleiotropic genes, loci and single nucleotide polymorphisms (SNPs), but the research field is in urgent need for better designed and powered studies to tackle this complex issue. We propose that future studies examining shared familial etiological factors for ADHD and ASD use a family-based design in which the same phenotypic (ADHD and ASD), candidate endophenotypic, and environmental measurements are obtained from all family members. Multivariate multi-level models are probably best suited for the statistical analysis.

Kernel Machine SNP-set Testing under Multiple Candidate Kernels

PubMed Central

Wu, Michael C.; Maity, Arnab; Lee, Seunggeun; Simmons, Elizabeth M.; Harmon, Quaker E.; Lin, Xinyi; Engel, Stephanie M.; Molldrem, Jeffrey J.; Armistead, Paul M.

2013-01-01

Joint testing for the cumulative effect of multiple single nucleotide polymorphisms grouped on the basis of prior biological knowledge has become a popular and powerful strategy for the analysis of large scale genetic association studies. The kernel machine (KM) testing framework is a useful approach that has been proposed for testing associations between multiple genetic variants and many different types of complex traits by comparing pairwise similarity in phenotype between subjects to pairwise similarity in genotype, with similarity in genotype defined via a kernel function. An advantage of the KM framework is its flexibility: choosing different kernel functions allows for different assumptions concerning the underlying model and can allow for improved power. In practice, it is difficult to know which kernel to use a priori since this depends on the unknown underlying trait architecture and selecting the kernel which gives the lowest p-value can lead to inflated type I error. Therefore, we propose practical strategies for KM testing when multiple candidate kernels are present based on constructing composite kernels and based on efficient perturbation procedures. We demonstrate through simulations and real data applications that the procedures protect the type I error rate and can lead to substantially improved power over poor choices of kernels and only modest differences in power versus using the best candidate kernel. PMID:23471868

Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

PubMed

Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

2015-10-01

The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

Genetic polymorphisms and weight loss in obesity: a randomised trial of hypo-energetic high- versus low-fat diets.

PubMed

Sørensen, Thorkild I A; Boutin, Philippe; Taylor, Moira A; Larsen, Lesli H; Verdich, Camilla; Petersen, Liselotte; Holst, Claus; Echwald, Søren M; Dina, Christian; Toubro, Søren; Petersen, Martin; Polak, Jan; Clément, Karine; Martínez, J Alfredo; Langin, Dominique; Oppert, Jean-Michel; Stich, Vladimir; Macdonald, Ian; Arner, Peter; Saris, Wim H M; Pedersen, Oluf; Astrup, Arne; Froguel, Philippe

2006-06-01

To study if genes with common single nucleotide polymorphisms (SNPs) associated with obesity-related phenotypes influence weight loss (WL) in obese individuals treated by a hypo-energetic low-fat or high-fat diet. Randomised, parallel, two-arm, open-label multi-centre trial. Eight clinical centres in seven European countries. 771 obese adult individuals. 10-wk dietary intervention to hypo-energetic (-600 kcal/d) diets with a targeted fat energy of 20%-25% or 40%-45%, completed in 648 participants. WL during the 10 wk in relation to genotypes of 42 SNPs in 26 candidate genes, probably associated with hypothalamic regulation of appetite, efficiency of energy expenditure, regulation of adipocyte differentiation and function, lipid and glucose metabolism, or production of adipocytokines, determined in 642 participants. Compared with the noncarriers of each of the SNPs, and after adjusting for gender, age, baseline weight and centre, heterozygotes showed WL differences that ranged from -0.6 to 0.8 kg, and homozygotes, from -0.7 to 3.1 kg. Genotype-dependent additional WL on low-fat diet ranged from 1.9 to -1.6 kg in heterozygotes, and from 3.8 kg to -2.1 kg in homozygotes relative to the noncarriers. Considering the multiple testing conducted, none of the associations was statistically significant. Polymorphisms in a panel of obesity-related candidate genes play a minor role, if any, in modulating weight changes induced by a moderate hypo-energetic low-fat or high-fat diet.

Fourteen-Genome Comparison Identifies DNA Markers for Severe-Disease-Associated Strains of Clostridium difficile▿†

PubMed Central

Forgetta, Vincenzo; Oughton, Matthew T.; Marquis, Pascale; Brukner, Ivan; Blanchette, Ruth; Haub, Kevin; Magrini, Vince; Mardis, Elaine R.; Gerding, Dale N.; Loo, Vivian G.; Miller, Mark A.; Mulvey, Michael R.; Rupnik, Maja; Dascal, Andre; Dewar, Ken

2011-01-01

Clostridium difficile is a common cause of infectious diarrhea in hospitalized patients. A severe and increased incidence of C. difficile infection (CDI) is associated predominantly with the NAP1 strain; however, the existence of other severe-disease-associated (SDA) strains and the extensive genetic diversity across C. difficile complicate reliable detection and diagnosis. Comparative genome analysis of 14 sequenced genomes, including those of a subset of NAP1 isolates, allowed the assessment of genetic diversity within and between strain types to identify DNA markers that are associated with severe disease. Comparative genome analysis of 14 isolates, including five publicly available strains, revealed that C. difficile has a core genome of 3.4 Mb, comprising ∼3,000 genes. Analysis of the core genome identified candidate DNA markers that were subsequently evaluated using a multistrain panel of 177 isolates, representing more than 50 pulsovars and 8 toxinotypes. A subset of 117 isolates from the panel had associated patient data that allowed assessment of an association between the DNA markers and severe CDI. We identified 20 candidate DNA markers for species-wide detection and 10,683 single nucleotide polymorphisms (SNPs) associated with the predominant SDA strain (NAP1). A species-wide detection candidate marker, the sspA gene, was found to be the same across 177 sequenced isolates and lacked significant similarity to those of other species. Candidate SNPs in genes CD1269 and CD1265 were found to associate more closely with disease severity than currently used diagnostic markers, as they were also present in the toxin A-negative and B-positive (A-B+) strain types. The genetic markers identified illustrate the potential of comparative genomics for the discovery of diagnostic DNA-based targets that are species specific or associated with multiple SDA strains. PMID:21508155

Genetic analyses of bolting in bulb onion (Allium cepa L.).

PubMed

Baldwin, Samantha; Revanna, Roopashree; Pither-Joyce, Meeghan; Shaw, Martin; Wright, Kathryn; Thomson, Susan; Moya, Leire; Lee, Robyn; Macknight, Richard; McCallum, John

2014-03-01

We present the first evidence for a QTL conditioning an adaptive trait in bulb onion, and the first linkage and population genetics analyses of candidate genes involved in photoperiod and vernalization physiology. Economic production of bulb onion (Allium cepa L.) requires adaptation to photoperiod and temperature such that a bulb is formed in the first year and a flowering umbel in the second. 'Bolting', or premature flowering before bulb maturation, is an undesirable trait strongly selected against by breeders during adaptation of germplasm. To identify genome regions associated with adaptive traits we conducted linkage mapping and population genetic analyses of candidate genes, and QTL analysis of bolting using a low-density linkage map. We performed tagged amplicon sequencing of ten candidate genes, including the FT-like gene family, in eight diverse populations to identify polymorphisms and seek evidence of differentiation. Low nucleotide diversity and negative estimates of Tajima's D were observed for most genes, consistent with purifying selection. Significant population differentiation was observed only in AcFT2 and AcSOC1. Selective genotyping in a large 'Nasik Red × CUDH2150' F2 family revealed genome regions on chromosomes 1, 3 and 6 associated (LOD > 3) with bolting. Validation genotyping of two F2 families grown in two environments confirmed that a QTL on chromosome 1, which we designate AcBlt1, consistently conditions bolting susceptibility in this cross. The chromosome 3 region, which coincides with a functionally characterised acid invertase, was not associated with bolting in other environments, but showed significant association with bulb sucrose content in this and other mapping pedigrees. These putative QTL and candidate genes were placed on the onion map, enabling future comparative studies of adaptive traits.

Genetic Structure in the Seabuckthorn Carpenter Moth (Holcocerus hippophaecolus) in China: The Role of Outbreak Events, Geographical and Host Factors

PubMed Central

Tao, Jing; Chen, Min; Zong, Shi-Xiang; Luo, You-Qing

2012-01-01

Understanding factors responsible for structuring genetic diversity is of fundamental importance in evolutionary biology. The seabuckthorn carpenter moth (Holcocerus hippophaecolus Hua) is a native species throughout the north of China and is considered the main threat to seabuckthorn, Hippophae rhamnoides L. We assessed the influence of outbreaks, environmental factors and host species in shaping the genetic variation and structure of H. hippophaecolus by using Amplified Fragment Length Polymorphism (AFLP) markers. We rejected the hypothesis that outbreak-associated genetic divergence exist, as evidenced by genetic clusters containing a combination of populations from historical outbreak areas, as well as non-outbreak areas. Although a small number of markers (4 of 933 loci) were identified as candidates under selection in response to population densities. H. hippophaecolus also did not follow an isolation-by-distance pattern. We rejected the hypothesis that outbreak and drought events were driving the genetic structure of H. hippophaecolus. Rather, the genetic structure appears to be influenced by various confounding bio-geographical factors. There were detectable genetic differences between H. hippophaecolus occupying different host trees from within the same geographic location. Host-associated genetic divergence should be confirmed by further investigation. PMID:22291983

The genetics of Alzheimer disease.

PubMed

Tanzi, Rudolph E

2012-10-01

Family history is the second strongest risk factor for Alzheimer disease (AD) following advanced age. Twin and family studies indicate that genetic factors are estimated to play a role in at least 80% of AD cases. The inheritance of AD exhibits a dichotomous pattern. On one hand, rare mutations in APP, PSEN1, and PSEN2 virtually guarantee early-onset (<60 years) familial AD, which represents ∼5% of AD. On the other hand, common gene polymorphisms, such as the ε4 and ε2 variants of the APOE gene, can influence susceptibility for ∼50% of the common late-onset AD. These four genes account for 30%-50% of the inheritability of AD. Genome-wide association studies have recently led to the identification of 11 additional AD candidate genes. This paper reviews the past, present, and future attempts to elucidate the complex and heterogeneous genetic underpinnings of AD.

The Genetics of Alzheimer Disease

PubMed Central

Tanzi, Rudolph E.

2012-01-01

Family history is the second strongest risk factor for Alzheimer disease (AD) following advanced age. Twin and family studies indicate that genetic factors are estimated to play a role in at least 80% of AD cases. The inheritance of AD exhibits a dichotomous pattern. On one hand, rare mutations in APP, PSEN1, and PSEN2 virtually guarantee early-onset (<60 years) familial AD, which represents ∼5% of AD. On the other hand, common gene polymorphisms, such as the ε4 and ε2 variants of the APOE gene, can influence susceptibility for ∼50% of the common late-onset AD. These four genes account for 30%–50% of the inheritability of AD. Genome-wide association studies have recently led to the identification of 11 additional AD candidate genes. This paper reviews the past, present, and future attempts to elucidate the complex and heterogeneous genetic underpinnings of AD. PMID:23028126

Copy Number Variants and Exome Sequencing Analysis in Six Pairs of Chinese Monozygotic Twins Discordant for Congenital Heart Disease.

PubMed

Xu, Yuejuan; Li, Tingting; Pu, Tian; Cao, Ruixue; Long, Fei; Chen, Sun; Sun, Kun; Xu, Rang

2017-12-01

Congenital heart disease (CHD) is one of the most common birth defects. More than 200 susceptibility loci have been identified for CHDs, yet a large part of the genetic risk factors remain unexplained. Monozygotic (MZ) twins are thought to be completely genetically identical; however, discordant phenotypes have been found in MZ twins. Recent studies have demonstrated genetic differences between MZ twins. We aimed to test whether copy number variants (CNVs) and/or genetic mutation differences play a role in the etiology of CHDs by using single nucleotide polymorphism (SNP) genotyping arrays and whole exome sequencing of twin pairs discordant for CHDs. Our goal was to identify mutations present only in the affected twins, which could identify novel candidates for CHD susceptibility loci. We present a comprehensive analysis for the CNVs and genetic mutation results of the selected individuals but detected no consistent differences within the twin pairs. Our study confirms that chromosomal structure or genetic mutation differences do not seem to play a role in the MZ twins discordant for CHD.

"Contrasting patterns of selection at Pinus pinaster Ait. Drought stress candidate genes as revealed by genetic differentiation analyses".

PubMed

Eveno, Emmanuelle; Collada, Carmen; Guevara, M Angeles; Léger, Valérie; Soto, Alvaro; Díaz, Luis; Léger, Patrick; González-Martínez, Santiago C; Cervera, M Teresa; Plomion, Christophe; Garnier-Géré, Pauline H

2008-02-01

The importance of natural selection for shaping adaptive trait differentiation among natural populations of allogamous tree species has long been recognized. Determining the molecular basis of local adaptation remains largely unresolved, and the respective roles of selection and demography in shaping population structure are actively debated. Using a multilocus scan that aims to detect outliers from simulated neutral expectations, we analyzed patterns of nucleotide diversity and genetic differentiation at 11 polymorphic candidate genes for drought stress tolerance in phenotypically contrasted Pinus pinaster Ait. populations across its geographical range. We compared 3 coalescent-based methods: 2 frequentist-like, including 1 approach specifically developed for biallelic single nucleotide polymorphisms (SNPs) here and 1 Bayesian. Five genes showed outlier patterns that were robust across methods at the haplotype level for 2 of them. Two genes presented higher F(ST) values than expected (PR-AGP4 and erd3), suggesting that they could have been affected by the action of diversifying selection among populations. In contrast, 3 genes presented lower F(ST) values than expected (dhn-1, dhn2, and lp3-1), which could represent signatures of homogenizing selection among populations. A smaller proportion of outliers were detected at the SNP level suggesting the potential functional significance of particular combinations of sites in drought-response candidate genes. The Bayesian method appeared robust to low sample sizes, flexible to assumptions regarding migration rates, and powerful for detecting selection at the haplotype level, but the frequentist-like method adapted to SNPs was more efficient for the identification of outlier SNPs showing low differentiation. Population-specific effects estimated in the Bayesian method also revealed populations with lower immigration rates, which could have led to favorable situations for local adaptation. Outlier patterns are discussed in relation to the different genes' putative involvement in drought tolerance responses, from published results in transcriptomics and association mapping in P. pinaster and other related species. These genes clearly constitute relevant candidates for future association studies in P. pinaster.

Antioxidant Defense Enzyme Genes and Asthma Susceptibility: Gender-Specific Effects and Heterogeneity in Gene-Gene Interactions between Pathogenetic Variants of the Disease

PubMed Central

Polonikov, Alexey V.; Ivanov, Vladimir P.; Bogomazov, Alexey D.; Freidin, Maxim B.; Illig, Thomas; Solodilova, Maria A.

2014-01-01

Oxidative stress resulting from an increased amount of reactive oxygen species and an imbalance between oxidants and antioxidants plays an important role in the pathogenesis of asthma. The present study tested the hypothesis that genetic susceptibility to allergic and nonallergic variants of asthma is determined by complex interactions between genes encoding antioxidant defense enzymes (ADE). We carried out a comprehensive analysis of the associations between adult asthma and 46 single nucleotide polymorphisms of 34 ADE genes and 12 other candidate genes of asthma in Russian population using set association analysis and multifactor dimensionality reduction approaches. We found for the first time epistatic interactions between ADE genes underlying asthma susceptibility and the genetic heterogeneity between allergic and nonallergic variants of the disease. We identified GSR (glutathione reductase) and PON2 (paraoxonase 2) as novel candidate genes for asthma susceptibility. We observed gender-specific effects of ADE genes on the risk of asthma. The results of the study demonstrate complexity and diversity of interactions between genes involved in oxidative stress underlying susceptibility to allergic and nonallergic asthma. PMID:24895604

Variants in Pharmacokinetic Transporters and Glycemic Response to Metformin: A Metgen Meta‐Analysis

PubMed Central

Dujic, T; Zhou, K; Yee, SW; van Leeuwen, N; de Keyser, CE; Javorský, M; Goswami, S; Zaharenko, L; Hougaard Christensen, MM; Out, M; Tavendale, R; Kubo, M; Hedderson, MM; van der Heijden, AA; Klimčáková, L; Pirags, V; Kooy, A; Brøsen, K; Klovins, J; Semiz, S; Tkáč, I; Stricker, BH; Palmer, CNA; 't Hart, LM; Giacomini, KM

2017-01-01

Therapeutic response to metformin, a first‐line drug for type 2 diabetes (T2D), is highly variable, in part likely due to genetic factors. To date, metformin pharmacogenetic studies have mainly focused on the impact of variants in metformin transporter genes, with inconsistent results. To clarify the significance of these variants in glycemic response to metformin in T2D, we performed a large‐scale meta‐analysis across the cohorts of the Metformin Genetics Consortium (MetGen). Nine candidate polymorphisms in five transporter genes (organic cation transporter [OCT]1, OCT2, multidrug and toxin extrusion transporter [MATE]1, MATE2‐K, and OCTN1) were analyzed in up to 7,968 individuals. None of the variants showed a significant effect on metformin response in the primary analysis, or in the exploratory secondary analyses, when patients were stratified according to possible confounding genotypes or prescribed a daily dose of metformin. Our results suggest that candidate transporter gene variants have little contribution to variability in glycemic response to metformin in T2D. PMID:27859023

Examination of AVPR1a as an autism susceptibility gene.

PubMed

Wassink, T H; Piven, J; Vieland, V J; Pietila, J; Goedken, R J; Folstein, S E; Sheffield, V C

2004-10-01

Impaired reciprocal social interaction is one of the core features of autism. While its determinants are complex, one biomolecular pathway that clearly influences social behavior is the arginine-vasopressin (AVP) system. The behavioral effects of AVP are mediated through the AVP receptor 1a (AVPR1a), making the AVPR1a gene a reasonable candidate for autism susceptibility. We tested the gene's contribution to autism by screening its exons in 125 independent autistic probands and genotyping two promoter polymorphisms in 65 autism affected sibling pair (ASP) families. While we found no nonconservative coding sequence changes, we did identify evidence of linkage and of linkage disequilibrium. These results were most pronounced in a subset of the ASP families with relatively less severe impairment of language. Thus, though we did not demonstrate a disease-causing variant in the coding sequence, numerous nontraditional disease-causing genetic abnormalities are known to exist that would escape detection by traditional gene screening methods. Given the emerging biological, animal model, and now genetic data, AVPR1a and genes in the AVP system remain strong candidates for involvement in autism susceptibility and deserve continued scrutiny.

Preliminary evidence for linkage to chromosome 1q31-32, 10q23.3, and 16p13.3 in a South African cohort with bipolar disorder.

PubMed

Savitz, Jonathan; Cupido, Cinda-Lee; Ramesar, Raj Kumar

2007-04-05

Although the genetic variants predisposing to the development of bipolar disorder (BPD) have yet to be conclusively identified, replicated reports of linkage to particular chromosomal regions have been encouraging. Here we carried out a non-parametric linkage analysis of nine of these candidate loci in a unique South African sample of 47 BPD pedigrees (N = 350). Three polymorphic markers per region of interest (3 x 9) were typed in a Caucasian cohort of Afrikaner and British origin. Statistically significant evidence for linkage was obtained at 1q31-32, 10q23.3, and 16p13.3 with maximum NPL scores of 2.52, 2.01, and 1.84, respectively. Our results add to the growing evidence that these chromosomal regions harbor genetic variants that play a role in the development of bipolar spectrum illness. Negative results were obtained for the remaining six candidate loci, possibly due to limited statistical power. (c) 2006 Wiley-Liss, Inc.

Population genomics reveals a candidate gene involved in bumble bee pigmentation.

PubMed

Pimsler, Meaghan L; Jackson, Jason M; Lozier, Jeffrey D

2017-05-01

Variation in bumble bee color patterns is well-documented within and between species. Identifying the genetic mechanisms underlying such variation may be useful in revealing evolutionary forces shaping rapid phenotypic diversification. The widespread North American species Bombus bifarius exhibits regional variation in abdominal color forms, ranging from red-banded to black-banded phenotypes and including geographically and phenotypically intermediate forms. Identifying genomic regions linked to this variation has been complicated by strong, near species level, genome-wide differentiation between red- and black-banded forms. Here, we instead focus on the closely related black-banded and intermediate forms that both belong to the subspecies B. bifarius nearcticus . We analyze an RNA sequencing (RNAseq) data set and identify a cluster of single nucleotide polymorphisms (SNPs) within one gene, Xanthine dehydrogenase/oxidase -like, that exhibit highly unusual differentiation compared to the rest of the sequenced genome. Homologs of this gene contribute to pigmentation in other insects, and results thus represent a strong candidate for investigating the genetic basis of pigment variation in B. bifarius and other bumble bee mimicry complexes.

Sporulation genes associated with sporulation efficiency in natural isolates of yeast.

PubMed

Tomar, Parul; Bhatia, Aatish; Ramdas, Shweta; Diao, Liyang; Bhanot, Gyan; Sinha, Himanshu

2013-01-01

Yeast sporulation efficiency is a quantitative trait and is known to vary among experimental populations and natural isolates. Some studies have uncovered the genetic basis of this variation and have identified the role of sporulation genes (IME1, RME1) and sporulation-associated genes (FKH2, PMS1, RAS2, RSF1, SWS2), as well as non-sporulation pathway genes (MKT1, TAO3) in maintaining this variation. However, these studies have been done mostly in experimental populations. Sporulation is a response to nutrient deprivation. Unlike laboratory strains, natural isolates have likely undergone multiple selections for quick adaptation to varying nutrient conditions. As a result, sporulation efficiency in natural isolates may have different genetic factors contributing to phenotypic variation. Using Saccharomyces cerevisiae strains in the genetically and environmentally diverse SGRP collection, we have identified genetic loci associated with sporulation efficiency variation in a set of sporulation and sporulation-associated genes. Using two independent methods for association mapping and correcting for population structure biases, our analysis identified two linked clusters containing 4 non-synonymous mutations in genes - HOS4, MCK1, SET3, and SPO74. Five regulatory polymorphisms in five genes such as MLS1 and CDC10 were also identified as putative candidates. Our results provide candidate genes contributing to phenotypic variation in the sporulation efficiency of natural isolates of yeast.

Sporulation Genes Associated with Sporulation Efficiency in Natural Isolates of Yeast

PubMed Central

Ramdas, Shweta; Diao, Liyang; Bhanot, Gyan; Sinha, Himanshu

2013-01-01

Yeast sporulation efficiency is a quantitative trait and is known to vary among experimental populations and natural isolates. Some studies have uncovered the genetic basis of this variation and have identified the role of sporulation genes (IME1, RME1) and sporulation-associated genes (FKH2, PMS1, RAS2, RSF1, SWS2), as well as non-sporulation pathway genes (MKT1, TAO3) in maintaining this variation. However, these studies have been done mostly in experimental populations. Sporulation is a response to nutrient deprivation. Unlike laboratory strains, natural isolates have likely undergone multiple selections for quick adaptation to varying nutrient conditions. As a result, sporulation efficiency in natural isolates may have different genetic factors contributing to phenotypic variation. Using Saccharomyces cerevisiae strains in the genetically and environmentally diverse SGRP collection, we have identified genetic loci associated with sporulation efficiency variation in a set of sporulation and sporulation-associated genes. Using two independent methods for association mapping and correcting for population structure biases, our analysis identified two linked clusters containing 4 non-synonymous mutations in genes – HOS4, MCK1, SET3, and SPO74. Five regulatory polymorphisms in five genes such as MLS1 and CDC10 were also identified as putative candidates. Our results provide candidate genes contributing to phenotypic variation in the sporulation efficiency of natural isolates of yeast. PMID:23874994

Lack of association between arterial stiffness and genetic variants by genome-wide association scan.

PubMed

Park, Sungha; Lee, Ji-Young; Kim, Byeong-Keuk; Lee, Sang-Hak; Chang, Hyuk-Jae; Choi, DongHoon; Jang, Yangsoo

2015-01-01

Arterial stiffness is an independent predictor of cardiovascular disease risk. However, whether genetic risk variants are associated with arterial stiffness measures, such as pulse-wave velocity (PWV), is largely unknown. Therefore, we performed a genome-wide association study (GWAS) to identify single-nucleotide polymorphisms (SNPs) associated with PWV in a Korea population. Study participants consisted of 402 patients in the Yonsei cardiovascular genome center cohort. Arterial stiffness was measured as brachial-ankle pulse-wave velocity (baPWV). Genotyping was performed in 402 subjects with the Axiom Genome-Wide ASI 1 Array Plate containing more than 600,000 SNP markers. The findings were tested for replication in independent subjects from a community-based cohort of 1206 individuals, using a Taqman assay to include two candidate SNPs. Associations with PWV were evaluated using an additive genetic model that included age, gender, systolic blood pressure and diastolic blood pressure as covariates. GWAS and replication analyses were conducted using the measured genotype method implemented in PLINK and SAS. We observed two candidate SNPs associated with baPWV in GWAS: rs7271920 (p = 7.15 × 10(-9)) and rs10125157 (p = 8.25 × 10(-7)). However, neither of these was significant in the replication cohort. In summary, we did not identify any common genetic variants associated with baPWV in cardiovascular patients.

An Examination of the Behavioral and Neuropsychological Correlates of Three ADHD Candidate Gene Polymorphisms (DRD4 7+, DBH TaqI A2, and DAT1 40bp VNTR) in Hyperactive and Normal Children Followed to Adulthood

PubMed Central

Barkley, Russell A.; Smith, Karen M.; Fischer, Mariellen; Navia, Bradford

2008-01-01

Several candidate gene polymorphisms have been implicated in attention deficit hyperactivity disorder (ADHD), including DAT1 40bp VNTR, DRD4 7+, and DBH TaqI A2 alleles. We used the Milwaukee longitudinal study of hyperactive (N=122) and normal (N=67) children to compare participants with and without these respective polymorphisms on ADHD-related behavioral ratings at childhood, 8 years later in adolescence, and 13+ years later into young adulthood. Neuropsychological tests were given at the adolescent and young adulthood follow-up. No differences were found between the DRD4-7+ and 7- repeat polymorphism. The DBH TaqI A2 allele, when homozygous, was associated with being more hyperactive in childhood, having more pervasive behavior problems at adolescence, and earning less money on a Card Playing Task in adulthood. At adolescence, poorer test scores were also found only in the hyperactive group with homozygous for this allele. The DAT1 40bp VNTR heterozygous 9/10 repeat, however, differed from the 10/10 repeat pair in many respects, having greater ADHD and externalizing symptoms at all three follow-ups, more cross-situational behavioral problems at both childhood and adolescence, poorer mother-teen relations at adolescence, and lower class rankings in high school. Participants with the 9/10 pair in the control group also had lower work performance, a lower grade point average in high school, greater teacher rated externalizing symptoms at adolescence, and greater omission errors on a continuous performance test in adulthood. The DAT1 40bp VNTR 9/10 polymorphism pairing appears to be reliably associated with greater symptoms of ADHD and externalizing behavior from childhood to adulthood, and with family, educational, and occupational impairments. We also present a contrary view on the appropriate endophenotypes for use in behavioral genetic research on ADHD. PMID:16741944

Polymorphisms in the Toll-Like Receptor and the IL-23/IL-17 Pathways Were Associated with Susceptibility to Inflammatory Bowel Disease in a Danish Cohort

PubMed Central

Bank, Steffen; Andersen, Paal Skytt; Burisch, Johan; Pedersen, Natalia; Roug, Stine; Galsgaard, Julied; Ydegaard Turino, Stine; Broder Brodersen, Jacob; Rashid, Shaista; Kaiser Rasmussen, Britt; Avlund, Sara; Bastholm Olesen, Thomas; Hoffmann, Hans Jürgen; Andersen Nexø, Bjørn; Sode, Jacob; Vogel, Ulla; Andersen, Vibeke

2015-01-01

Background The inflammatory bowel diseases (IBD), Crohn’s disease (CD) and ulcerative colitis (UC), result from the combined effects of susceptibility genes and environmental factors. Previous studies have shown that polymorphisms in the Toll-like receptor (TLR), the apoptosis, the IL-23/IL-17 and the interferon gamma (IFNG) pathways are associated with risk of both CD and UC. Methods Using a candidate gene approach, 21 functional single nucleotide polymorphisms (SNPs) in 15 genes were assessed in a clinical homogeneous group of severely diseased ethnic Danish patients consisting of 624 patients with CD, 411 patients with UC and 795 controls. The results were analysed using logistic regression. Results The polymorphisms TLR5 (rs5744174) and IL12B (rs6887695) were associated with risk of CD, and TLR1 (rs4833095) and IL18 (rs187238) were associated with risk of both CD and UC (p<0.05). After Bonferroni correction for multiple testing, the homozygous variant genotype of TLR1 743 T>C (rs4833095) was associated with increased risk CD (OR: 3.15, 95% CI: 1.59–6.26, p = 0.02) and CD and UC combined (OR: 2.96, 95% CI: 1.64–5.32, p = 0.005). Conclusion Our results suggest that genetically determined high activity of TLR1 and TLR5 was associated with increased risk of both CD and UC and CD, respectively. This supports that the host microbial composition or environmental factors in the gut are involved in risk of IBD. Furthermore, genetically determined high activity of the IL-23/IL-17 pathway was associated with increased risk of CD and UC. Overall, our results support that genetically determined high inflammatory response was associated with increased risk of both CD and UC. PMID:26698117

Association of GSK3B With Alzheimer Disease and Frontotemporal Dementia

PubMed Central

Schaffer, Barbara A. J.; Bertram, Lars; Miller, Bruce L.; Mullin, Kristina; Weintraub, Sandra; Johnson, Nancy; Bigio, Eileen H.; Mesulam, Marsel; Wiedau-Pazos, Martina; Jackson, George R.; Cummings, Jeffrey L.; Cantor, Rita M.; Levey, Allan I.; Tanzi, Rudolph E.; Geschwind, Daniel H.

2009-01-01

Background Deposits of abnormally hyperphosphorylated tau are a hallmark of several dementias, including Alzheimer disease (AD), and about 10% of familial frontotemporal dementia (FTD) cases are caused by mutations in the tau gene. As a known tau kinase, GSK3B is a promising candidate gene in the remaining cases of FTD and in AD, for which tau mutations have not been found. Objective To examine the promoter of GSK3B and all 12 exons, including the surrounding intronic sequence, in patients with FTD, patients with AD, and aged healthy subjects to identify single-nucleotide polymorphisms associated with disease. Design, Setting, and Participants Single-nucleotide polymorphism frequency was examined in a case-control cohort of 48 patients with probable AD, 102 patients with FTD, 38 patients with primary progressive aphasia, and 85 aged healthy subjects. Results were followed up in 2 independent AD family samples consisting of 437 multiplex families with AD (National Institute of Mental Health Genetics Initiative AD Study) or 150 sibships discordant for AD (Consortium on Alzheimer’s Genetics Study). Results Several rare sequence variants in GSK3B were identified in the case-control study. An intronic polymorphism (IVS2−68G>A) occurred at more than twice the frequency among patients with FTD (10.8%) and patients with AD (14.6%) than in aged healthy subjects (4.1%). The polymorphism showed association with disease in both follow-up samples independently, although only the Consortium on Alzheimer’s Genetics sample showed the same direction of association as the case-control sample. Conclusions To our knowledge, this is the first evidence that a gene known to be involved in tau phosphorylation, GSK3B, is associated with risk for primary neurodegenerative dementias. This supports previous work in animal models suggesting that such genes are therapeutic targets. PMID:18852354

Association of genetic polymorphisms of interleukins with gastric cancer and precancerous gastric lesions in a high-risk Chinese population.

PubMed

Wang, Yu-Mei; Li, Zhe-Xuan; Tang, Fu-Bing; Zhang, Yang; Zhou, Tong; Zhang, Lian; Ma, Jun-Ling; You, Wei-Cheng; Pan, Kai-Feng

2016-02-01

Helicobacter pylori (H. pylori) infection and cytokine-mediated inflammatory responses play important roles in gastric cancer (GC) pathogenesis. To investigate an association between genetic polymorphisms in interleukin (IL)-1β, IL-4R, IL-8, IL-10, IL-16, IL-18RAP, IL-22, and IL-32 and risks of GC and its precursors, a population-based study was conducted in Linqu County. Genotypes were determined by Sequenom MassARRAY platform in 132 GC cases and 1198 subjects with gastric lesions. The H. pylori status was determined by (13)C-urea breath test ((13)C-UBT) or enzyme-linked immunosorbent assay (ELISA). Among 11 candidate single nucleotide polymorphisms (SNPs), subjects carrying IL-18RAP rs917997 AA genotype were associated with risk of GC [adjusted odds ratio (OR) = 1.83, 95 % confidence interval (CI) 1.14-2.92] or chronic atrophic gastritis (CAG; OR = 1.55, 95 % CI 1.07-2.24). The risk of GC was also increased in subjects carrying IL-32 rs2015620 A allele (AA + AT; OR = 1.92, 95 % CI 1.09-3.39). Moreover, elevated risks of CAG (OR = 2.64, 95 % CI 1.89-3.69), intestinal metaplasia (IM; OR = 5.58, 95 % CI 3.86-8.05), and dysplasia (DYS; OR = 1.64, 95 % CI 1.18-2.26) were observed in subjects with IL-22 rs1179251 CC genotype. Stratified analysis indicated that risks of GC and its precursors were elevated in subjects with IL-32 rs2015620 A allele (AA + AT) or IL-22 rs1179251 CC genotype and H. pylori infection, and significant interactions between these two SNPs and H. pylori infection were found. These findings suggested that IL-18RAP rs917997, IL-32 rs2015620, IL-22 rs1179251, and interactions between these polymorphisms and H. pylori infection were associated with risks of gastric lesions. Genetic polymorphisms of interleukins may play crucial roles in H. pylori-induced gastric carcinogenesis.

Merozoite surface protein-1 genetic diversity in Plasmodium malariae and Plasmodium brasilianum from Brazil.

PubMed

Guimarães, Lilian O; Wunderlich, Gerhard; Alves, João M P; Bueno, Marina G; Röhe, Fabio; Catão-Dias, José L; Neves, Amanda; Malafronte, Rosely S; Curado, Izilda; Domingues, Wilson; Kirchgatter, Karin

2015-11-16

The merozoite surface protein 1 (MSP1) gene encodes the major surface antigen of invasive forms of the Plasmodium erythrocytic stages and is considered a candidate vaccine antigen against malaria. Due to its polymorphisms, MSP1 is also useful for strain discrimination and consists of a good genetic marker. Sequence diversity in MSP1 has been analyzed in field isolates of three human parasites: P. falciparum, P. vivax, and P. ovale. However, the extent of variation in another human parasite, P. malariae, remains unknown. This parasite shows widespread, uneven distribution in tropical and subtropical regions throughout South America, Asia, and Africa. Interestingly, it is genetically indistinguishable from P. brasilianum, a parasite known to infect New World monkeys in Central and South America. Specific fragments (1 to 5) covering 60 % of the MSP1 gene (mainly the putatively polymorphic regions), were amplified by PCR in isolates of P. malariae and P. brasilianum from different geographic origin and hosts. Sequencing of the PCR-amplified products or cloned PCR fragments was performed and the sequences were used to construct a phylogenetic tree by the maximum likelihood method. Data were computed to give insights into the evolutionary and phylogenetic relationships of these parasites. Except for fragment 4, sequences from all other fragments consisted of unpublished sequences. The most polymorphic gene region was fragment 2, and in samples where this region lacks polymorphism, all other regions are also identical. The low variability of the P. malariae msp1 sequences of these isolates and the identification of the same haplotype in those collected many years apart at different locations is compatible with a low transmission rate. We also found greater diversity among P. brasilianum isolates compared with P. malariae ones. Lastly, the sequences were segregated according to their geographic origins and hosts, showing a strong genetic and geographic structure. Our data show that there is a low level of sequence diversity and a possible absence of allelic dimorphism of MSP1 in these parasites as opposed to other Plasmodium species. P. brasilianum strains apparently show greater divergence in comparison to P. malariae, thus P. malariae could derive from P. brasilianum, as it has been proposed.

Genetic association studies of glutamate, GABA and related genes in schizophrenia and bipolar disorder: a decade of advance.

PubMed

Cherlyn, Suat Ying Tan; Woon, Puay San; Liu, Jian Jun; Ong, Wei Yi; Tsai, Guo Chuan; Sim, Kang

2010-05-01

Schizophrenia (SZ) and bipolar disorder (BD) are debilitating neurobehavioural disorders likely influenced by genetic and non-genetic factors and which can be seen as complex disorders of synaptic neurotransmission. The glutamatergic and GABAergic neurotransmission systems have been implicated in both diseases and we have reviewed extensive literature over a decade for evidence to support the association of glutamate and GABA genes in SZ and BD. Candidate-gene based population and family association studies have implicated some ionotrophic glutamate receptor genes (GRIN1, GRIN2A, GRIN2B and GRIK3), metabotropic glutamate receptor genes (such as GRM3), the G72/G30 locus and GABAergic genes (e.g. GAD1 and GABRB2) in both illnesses to varying degrees, but further replication studies are needed to validate these results. There is at present no consensus on specific single nucleotide polymorphisms or haplotypes associated with the particular candidate gene loci in these illnesses. The genetic architecture of glutamate systems in bipolar disorder need to be better studied in view of recent data suggesting an overlap in the genetic aetiology of SZ and BD. There is a pressing need to integrate research platforms in genomics, epistatic models, proteomics, metabolomics, neuroimaging technology and translational studies in order to allow a more integrated understanding of glutamate and GABAergic signalling processes and aberrations in SZ and BD as well as their relationships with clinical presentations and treatment progress over time. (c) 2010 Elsevier Ltd. All rights reserved.

Detection of genomic signatures of recent selection in commercial broiler chickens.

PubMed

Fu, Weixuan; Lee, William R; Abasht, Behnam

2016-08-26

Identification of the genomic signatures of recent selection may help uncover causal polymorphisms controlling traits relevant to recent decades of selective breeding in livestock. In this study, we aimed at detecting signatures of recent selection in commercial broiler chickens using genotype information from single nucleotide polymorphisms (SNPs). A total of 565 chickens from five commercial purebred lines, including three broiler sire (male) lines and two broiler dam (female) lines, were genotyped using the 60K SNP Illumina iSelect chicken array. To detect genomic signatures of recent selection, we applied two methods based on population comparison, cross-population extended haplotype homozygosity (XP-EHH) and cross-population composite likelihood ratio (XP-CLR), and further analyzed the results to find genomic regions under recent selection in multiple purebred lines. A total of 321 candidate selection regions spanning approximately 1.45 % of the chicken genome in each line were detected by consensus of results of both XP-EHH and XP-CLR methods. To minimize false discovery due to genetic drift, only 42 of the candidate selection regions that were shared by 2 or more purebred lines were considered as high-confidence selection regions in the study. Of these 42 regions, 20 were 50 kb or less while 4 regions were larger than 0.5 Mb. In total, 91 genes could be found in the 42 regions, among which 19 regions contained only 1 or 2 genes, and 9 regions were located at gene deserts. Our results provide a genome-wide scan of recent selection signatures in five purebred lines of commercial broiler chickens. We found several candidate genes for recent selection in multiple lines, such as SOX6 (Sex Determining Region Y-Box 6) and cTR (Thyroid hormone receptor beta). These genes may have been under recent selection due to their essential roles in growth, development and reproduction in chickens. Furthermore, our results suggest that in some candidate regions, the same or opposite alleles have been under recent selection in multiple lines. Most of the candidate genes in the selection regions are novel, and as such they should be of great interest for future research into the genetic architecture of traits relevant to modern broiler breeding.

Genomic analysis of differentiation between soil types reveals candidate genes for local adaptation in Arabidopsis lyrata.

PubMed

Turner, Thomas L; von Wettberg, Eric J; Nuzhdin, Sergey V

2008-09-11

Serpentine soil, which is naturally high in heavy metal content and has low calcium to magnesium ratios, comprises a difficult environment for most plants. An impressive number of species are endemic to serpentine, and a wide range of non-endemic plant taxa have been shown to be locally adapted to these soils. Locating genomic polymorphisms which are differentiated between serpentine and non-serpentine populations would provide candidate loci for serpentine adaptation. We have used the Arabidopsis thaliana tiling array, which has 2.85 million probes throughout the genome, to measure genetic differentiation between populations of Arabidopsis lyrata growing on granitic soils and those growing on serpentinic soils. The significant overrepresentation of genes involved in ion transport and other functions provides a starting point for investigating the molecular basis of adaptation to soil ion content, water retention, and other ecologically and economically important variables. One gene in particular, calcium-exchanger 7, appears to be an excellent candidate gene for adaptation to low CaratioMg ratio in A. lyrata.

[Current trends in nutrigenomics of obesity].

PubMed

Lapik, I A; Gapparova, K M; Chekhonina, Yu G; Sorikina, E Yu; Borodina, S V

2016-01-01

One of the most general chronic illness in the world is obesity, which lead to progression of cardiovascular diseases, diabetes mellitus type 2, metabolic syndrome and other diseases. Slow body weight gain, that leads to overweight, is a long-term aftereffect of a long-term positive energy balance, which occurs as a result of physical activity reduction and calorie intake increasing. Trend in the reduction of physical activity and increasing the caloric value of food intake is probably the main reason of increasing patients with obesity, but it's necessary to mention that this tendency occurs because of genetic variation in population. The volume of scientific information, relevant to the problem of genetic predisposition testing to obesity, is highly increasing. This article provides an overview of recent data on the genetics of obesity and the role of genetic testing of candidate genes polymorphisms, as well as genes associated with carbohydrate and lipid metabolism disorders (FTO, ADRB2, ADRB3, PPARG and a number of others). The role of nutrigenomics in personalization of diet treatment for obesity.

COMBINE genetics study: the pharmacogenetics of alcoholism treatment response: genes and mechanisms.

PubMed

Goldman, David; Oroszi, Gabor; O'Malley, Stephanie; Anton, Raymond

2005-07-01

Partial efficacy of treatment and differences in adverse events across individuals are a challenge and an opportunity in the treatment of alcoholism. Individuation of therapy and understanding origins of differential treatment response may require identification of inherited functional variants of genes. The neurobiology of reward, executive cognitive function, anxiety and dysphoria have been identified as critical domains that may have a genetic basis that could predict treatment response. The COMBINE Study presents a unique opportunity to evaluate specific genetic loci (markers) that affect neurobiology central to addiction and extended withdrawal. The study also addresses variation in drug metabolism and action. Candidate genetic markers are selected for study based on functionality and abundance. COMT Vall58Met is a common (minor allele frequency 0.42), functional, catecholamine-metabolizing enzyme polymorphism with threefold relevance. Vall58Met alters executive cognitive function, stress and anxiety responses and brain endogenous opioid function. OPRM1 Asn40Asp is a common (minor allele frequency 0.10), functional polymorphism of the mu-opioid receptor, which may serve as a gatekeeper molecule in naltrexone's actions and was recently reported to affect naltrexone response. HTTLPR (minor allele frequency 0.40) alters serotonin transporter function to affect anxiety, dysphoria and obsessional behavior, which are assessed in COMBINE and may be related to relapse and addictive behavior. All genetic testing is consented through a separate human research protocol, and the testing is conducted nonclinically, confidentially and apart from the clinical record to protect human research participants who have volunteered for this aspect of COMBINE.

Genetic architecture of kernel composition in global sorghum germplasm.

PubMed

Rhodes, Davina H; Hoffmann, Leo; Rooney, William L; Herald, Thomas J; Bean, Scott; Boyles, Richard; Brenton, Zachary W; Kresovich, Stephen

2017-01-05

Sorghum [Sorghum bicolor (L.) Moench] is an important cereal crop for dryland areas in the United States and for small-holder farmers in Africa. Natural variation of sorghum grain composition (protein, fat, and starch) between accessions can be used for crop improvement, but the genetic controls are still unresolved. The goals of this study were to quantify natural variation of sorghum grain composition and to identify single-nucleotide polymorphisms (SNPs) associated with variation in grain composition concentrations. In this study, we quantified protein, fat, and starch in a global sorghum diversity panel using near-infrared spectroscopy (NIRS). Protein content ranged from 8.1 to 18.8%, fat content ranged from 1.0 to 4.3%, and starch content ranged from 61.7 to 71.1%. Durra and bicolor-durra sorghum from Ethiopia and India had the highest protein and fat and the lowest starch content, while kafir sorghum from USA, India, and South Africa had the lowest protein and the highest starch content. Genome-wide association studies (GWAS) identified quantitative trait loci (QTL) for sorghum protein, fat, and starch. Previously published RNAseq data was used to identify candidate genes within a GWAS QTL region. A putative alpha-amylase 3 gene, which has previously been shown to be associated with grain composition traits, was identified as a strong candidate for protein and fat variation. We identified promising sources of genetic material for manipulation of grain composition traits, and several loci and candidate genes that may control sorghum grain composition. This survey of grain composition in sorghum germplasm and identification of protein, fat, and starch QTL contributes to our understanding of the genetic basis of natural variation in sorghum grain nutritional traits.

Epigenetic Variance, Performing Cooperative Structure with Genetics, Is Associated with Leaf Shape Traits in Widely Distributed Populations of Ornamental Tree Prunus mume

PubMed Central

Ma, Kaifeng; Sun, Lidan; Cheng, Tangren; Pan, Huitang; Wang, Jia; Zhang, Qixiang

2018-01-01

Increasing evidence shows that epigenetics plays an important role in phenotypic variance. However, little is known about epigenetic variation in the important ornamental tree Prunus mume. We used amplified fragment length polymorphism (AFLP) and methylation-sensitive amplified polymorphism (MSAP) techniques, and association analysis and sequencing to investigate epigenetic variation and its relationships with genetic variance, environment factors, and traits. By performing leaf sampling, the relative total methylation level (29.80%) was detected in 96 accessions of P. mume. And the relative hemi-methylation level (15.77%) was higher than the relative full methylation level (14.03%). The epigenetic diversity (I∗ = 0.575, h∗ = 0.393) was higher than the genetic diversity (I = 0.484, h = 0.319). The cultivated population displayed greater epigenetic diversity than the wild populations in both southwest and southeast China. We found that epigenetic variance and genetic variance, and environmental factors performed cooperative structures, respectively. In particular, leaf length, width and area were positively correlated with relative full methylation level and total methylation level, indicating that the DNA methylation level played a role in trait variation. In total, 203 AFLP and 423 MSAP associated markers were detected and 68 of them were sequenced. Homologous analysis and functional prediction suggested that the candidate marker-linked genes were essential for leaf morphology development and metabolism, implying that these markers play critical roles in the establishment of leaf length, width, area, and ratio of length to width. PMID:29441078

Epigenetic Variance, Performing Cooperative Structure with Genetics, Is Associated with Leaf Shape Traits in Widely Distributed Populations of Ornamental Tree Prunus mume.

PubMed

Ma, Kaifeng; Sun, Lidan; Cheng, Tangren; Pan, Huitang; Wang, Jia; Zhang, Qixiang

2018-01-01

Increasing evidence shows that epigenetics plays an important role in phenotypic variance. However, little is known about epigenetic variation in the important ornamental tree Prunus mume . We used amplified fragment length polymorphism (AFLP) and methylation-sensitive amplified polymorphism (MSAP) techniques, and association analysis and sequencing to investigate epigenetic variation and its relationships with genetic variance, environment factors, and traits. By performing leaf sampling, the relative total methylation level (29.80%) was detected in 96 accessions of P . mume . And the relative hemi-methylation level (15.77%) was higher than the relative full methylation level (14.03%). The epigenetic diversity ( I ∗ = 0.575, h ∗ = 0.393) was higher than the genetic diversity ( I = 0.484, h = 0.319). The cultivated population displayed greater epigenetic diversity than the wild populations in both southwest and southeast China. We found that epigenetic variance and genetic variance, and environmental factors performed cooperative structures, respectively. In particular, leaf length, width and area were positively correlated with relative full methylation level and total methylation level, indicating that the DNA methylation level played a role in trait variation. In total, 203 AFLP and 423 MSAP associated markers were detected and 68 of them were sequenced. Homologous analysis and functional prediction suggested that the candidate marker-linked genes were essential for leaf morphology development and metabolism, implying that these markers play critical roles in the establishment of leaf length, width, area, and ratio of length to width.

Genetic Epidemiology of Type 2 Diabetes in Mexican Mestizos.

PubMed

García-Chapa, Eiralí Guadalupe; Leal-Ugarte, Evelia; Peralta-Leal, Valeria; Durán-González, Jorge; Meza-Espinoza, Juan Pablo

2017-01-01

There are currently about 415 million people with diabetes worldwide, a figure likely to increase to 642 million by 2040. In 2015, Mexico was the second Latin American country and sixth in the world in prevalence of this disorder with nearly 11.5 million of patients. Type 2 diabetes (T2D) is the main kind of diabetes and its etiology is complex with environmental and genetic factors involved. Indeed, polymorphisms in several genes have been associated with this disease worldwide. To estimate the genetic epidemiology of T2D in Mexican mestizos a systematic bibliographic search of published articles through PubMed, Scopus, Google Scholar, and Web of Science was conducted. Just case-control studies of candidate genes about T2D in Mexican mestizo inhabitants were included. Nineteen studies that met the inclusion criteria were found. In total, 68 polymorphisms of 41 genes were assessed; 26 of them were associated with T2D risk, which were located in ABCA1, ADRB3, CAPN10, CDC123/CAMK1D, CDKAL1, CDKN2A/2B, CRP, ELMO1, FTO, HHEX, IGF2BP2, IRS1, JAZF1, KCNQ1, LOC387761, LTA, NXPH1, SIRT1, SLC30A8, TCF7L2, and TNF-α genes. Overall, 21 of the 41 analyzed genes were associated with T2D in Mexican mestizos. Such a genetic heterogeneity compares with findings in other ethnic groups.

Neutral mutation as the source of genetic variation in life history traits.

PubMed

Brcić-Kostić, Krunoslav

2005-08-01

The mechanism underlying the maintenance of adaptive genetic variation is a long-standing question in evolutionary genetics. There are two concepts (mutation-selection balance and balancing selection) which are based on the phenotypic differences between alleles. Mutation - selection balance and balancing selection cannot properly explain the process of gene substitution, i.e. the molecular evolution of quantitative trait loci affecting fitness. I assume that such loci have non-essential functions (small effects on fitness), and that they have the potential to evolve into new functions and acquire new adaptations. Here I show that a high amount of neutral polymorphism at these loci can exist in real populations. Consistent with this, I propose a hypothesis for the maintenance of genetic variation in life history traits which can be efficient for the fixation of alleles with very small selective advantage. The hypothesis is based on neutral polymorphism at quantitative trait loci and both neutral and adaptive gene substitutions. The model of neutral - adaptive conversion (NAC) assumes that neutral alleles are not neutral indefinitely, and that in specific and very rare situations phenotypic (relative fitness) differences between them can appear. In this paper I focus on NAC due to phenotypic plasticity of neutral alleles. The important evolutionary consequence of NAC could be the increased adaptive potential of a population. Loci responsible for adaptation should be fast evolving genes with minimally discernible phenotypic effects, and the recent discovery of genes with such characteristics implicates them as suitable candidates for loci involved in adaptation.

Whole genome re-sequencing of date palms yields insights into diversification of a fruit tree crop.

PubMed

Hazzouri, Khaled M; Flowers, Jonathan M; Visser, Hendrik J; Khierallah, Hussam S M; Rosas, Ulises; Pham, Gina M; Meyer, Rachel S; Johansen, Caryn K; Fresquez, Zoë A; Masmoudi, Khaled; Haider, Nadia; El Kadri, Nabila; Idaghdour, Youssef; Malek, Joel A; Thirkhill, Deborah; Markhand, Ghulam S; Krueger, Robert R; Zaid, Abdelouahhab; Purugganan, Michael D

2015-11-09

Date palms (Phoenix dactylifera) are the most significant perennial crop in arid regions of the Middle East and North Africa. Here, we present a comprehensive catalogue of approximately seven million single nucleotide polymorphisms in date palms based on whole genome re-sequencing of a collection of 62 cultivars. Population structure analysis indicates a major genetic divide between North Africa and the Middle East/South Asian date palms, with evidence of admixture in cultivars from Egypt and Sudan. Genome-wide scans for selection suggest at least 56 genomic regions associated with selective sweeps that may underlie geographic adaptation. We report candidate mutations for trait variation, including nonsense polymorphisms and presence/absence variation in gene content in pathways for key agronomic traits. We also identify a copia-like retrotransposon insertion polymorphism in the R2R3 myb-like orthologue of the oil palm virescens gene associated with fruit colour variation. This analysis documents patterns of post-domestication diversification and provides a genomic resource for this economically important perennial tree crop.

Dopa decarboxylase (Ddc) affects variation in Drosophila longevity.

PubMed

De Luca, Maria; Roshina, Nataliya V; Geiger-Thornsberry, Gretchen L; Lyman, Richard F; Pasyukova, Elena G; Mackay, Trudy F C

2003-08-01

Mutational analyses in model organisms have shown that genes affecting metabolism and stress resistance regulate life span, but the genes responsible for variation in longevity in natural populations are largely unidentified. Previously, we mapped quantitative trait loci (QTLs) affecting variation in longevity between two Drosophila melanogaster strains. Here, we show that the longevity QTL in the 36E;38B cytogenetic interval on chromosome 2 contains multiple closely linked QTLs, including the Dopa decarboxylase (Ddc) locus. Complementation tests to mutations show that Ddc is a positional candidate gene for life span in these strains. Linkage disequilibrium (LD) mapping in a sample of 173 alleles from a single population shows that three common molecular polymorphisms in Ddc account for 15.5% of the genetic contribution to variance in life span from chromosome 2. The polymorphisms are in strong LD, and the effects of the haplotypes on longevity suggest that the polymorphisms are maintained by balancing selection. DDC catalyzes the final step in the synthesis of the neurotransmitters, dopamine and serotonin. Thus, these data implicate variation in the synthesis of bioamines as a factor contributing to natural variation in individual life span.

Whole genome re-sequencing of date palms yields insights into diversification of a fruit tree crop

PubMed Central

Hazzouri, Khaled M.; Flowers, Jonathan M.; Visser, Hendrik J.; Khierallah, Hussam S. M.; Rosas, Ulises; Pham, Gina M.; Meyer, Rachel S.; Johansen, Caryn K.; Fresquez, Zoë A.; Masmoudi, Khaled; Haider, Nadia; El Kadri, Nabila; Idaghdour, Youssef; Malek, Joel A.; Thirkhill, Deborah; Markhand, Ghulam S.; Krueger, Robert R.; Zaid, Abdelouahhab; Purugganan, Michael D.

2015-01-01

Date palms (Phoenix dactylifera) are the most significant perennial crop in arid regions of the Middle East and North Africa. Here, we present a comprehensive catalogue of approximately seven million single nucleotide polymorphisms in date palms based on whole genome re-sequencing of a collection of 62 cultivars. Population structure analysis indicates a major genetic divide between North Africa and the Middle East/South Asian date palms, with evidence of admixture in cultivars from Egypt and Sudan. Genome-wide scans for selection suggest at least 56 genomic regions associated with selective sweeps that may underlie geographic adaptation. We report candidate mutations for trait variation, including nonsense polymorphisms and presence/absence variation in gene content in pathways for key agronomic traits. We also identify a copia-like retrotransposon insertion polymorphism in the R2R3 myb-like orthologue of the oil palm virescens gene associated with fruit colour variation. This analysis documents patterns of post-domestication diversification and provides a genomic resource for this economically important perennial tree crop. PMID:26549859

The association of β-arrestin2 polymorphisms with response to antidepressant treatment in depressed patients.

PubMed

Petit, Anne-Cécile; El Asmar, Khalil; David, Denis J; Gardier, Alain M; Becquemont, Laurent; Fève, Bruno; Verstuyft, Céline; Corruble, Emmanuelle

2018-02-02

The study of genetic polymorphisms involved in antidepressants (AD) response is essential to provide a personalized medicine approach in the field of depression. β-arrestin 2 (ARRB2) is a candidate gene in the pharmacogenetics of AD as it is involved in the signaling cascade downstream of numerous neurotransmitter receptors. We investigated the association between five ARRB2 single nucleotide polymorphisms (SNPs): rs1045280, rs2036657, rs4790694, rs3786047 and rs452246, and response to AD treatment in a sample of 569 patients with a major depressive episode treated for 6months. We show that GG/GT patients for rs4522461 (n=534) and AA/AC patients for rs4790694 (n=244) have a lower response to AD than other genotype groups (HDRS score of 10.9 vs 8.0 after 6months, multivariate analysis: p=0.03; 12.2 vs 9.6, p=0.02, respectively). These data provide additional evidence that β-arrestin 2 is a regulator of intracellular signal transduction processes involved in AD treatment. Copyright © 2017 Elsevier Inc. All rights reserved.

CCR5 polymorphism and plague resistance in natural populations of the black rat in Madagascar.

PubMed

Tollenaere, C; Rahalison, L; Ranjalahy, M; Rahelinirina, S; Duplantier, J-M; Brouat, C

2008-12-01

Madagascar remains one of the world's largest plague foci. The black rat, Rattus rattus, is the main reservoir of plague in rural areas. This species is highly susceptible to plague in plague-free areas (low-altitude regions), whereas rats from the plague focus areas (central highlands) have evolved a disease-resistance polymorphism. We used the candidate gene CCR5 to investigate the genetic basis of plague resistance in R. rattus. We found a unique non-synonymous substitution (H184R) in a functionally important region of the gene. We then compared (i) CCR5 genotypes of dying and surviving plague-challenged rats and (ii) CCR5 allelic frequencies in plague focus and plague-free populations. Our results suggested a higher prevalence of the substitution in resistant animals compared to susceptible individuals, and a tendency for higher frequencies in plague focus areas compared to plague-free areas. Therefore, the CCR5 polymorphism may be involved in Malagasy black rat plague resistance. CCR5 and other undetermined plague resistance markers may provide useful biological information about host evolution and disease dynamics.

Genetic scores of smoking behaviour in a Chinese population.

PubMed

Yang, Shanshan; He, Yao; Wang, Jianhua; Wang, Yiyan; Wu, Lei; Zeng, Jing; Liu, Miao; Zhang, Di; Jiang, Bin; Li, Xiaoying

2016-03-07

This study sought to structure a genetic score for smoking behaviour in a Chinese population. Single-nucleotide polymorphisms (SNPs) from genome-wide association studies (GWAS) were evaluated in a community-representative sample (N = 3,553) of Beijing, China. The candidate SNPs were tested in four genetic models (dominance model, recessive model, heterogeneous codominant model and additive model), and 7 SNPs were selected to structure a genetic score. A total of 3,553 participants (1,477 males and 2,076 females) completed the survey. Using the unweighted score, we found that participants with a high genetic score had a 34% higher risk of trying smoking and a 43% higher risk of SI at ≤ 18 years of age after adjusting for age, gender, education, occupation, ethnicity, body mass index (BMI) and sports activity time. The unweighted genetic scores were chosen to best extrapolate and understand these results. Importantly, genetic score was significantly associated with smoking behaviour (smoking status and SI at ≤ 18 years of age). These results have the potential to guide relevant health education for individuals with high genetic scores and promote the process of smoking control to improve the health of the population.

Genetic polymorphisms, hormone levels, and hot flashes in midlife women.

PubMed

Schilling, Chrissy; Gallicchio, Lisa; Miller, Susan R; Langenberg, Patricia; Zacur, Howard; Flaws, Jodi A

2007-06-20

Hot flashes disrupt the lives of millions of women each year. Although hot flashes are a public health concern, little is known about risk factors that predispose women to hot flashes. Thus, the objective of this study was to examine whether sex steroid hormone levels and genetic polymorphisms in hormone biosynthesis and degradation enzymes are associated with the risk of hot flashes. In a cross-sectional study design, midlife women aged 45-54 years (n=639) were recruited from Baltimore and its surrounding counties. Participants completed a questionnaire and donated a blood sample for steroid hormone analysis and genotyping. The associations between genetic polymorphisms and hormone levels, as well as the associations between genetic polymorphisms, hormone levels, and hot flashes were examined using statistical models. A polymorphism in CYP1B1 was associated with lower dehydroepiandrosterone-sulfate (DHEA-S) and progesterone levels, while a polymorphism in CYP19 (aromatase) was associated with higher testosterone and DHEA-S levels. Lower progesterone and sex hormone binding globulin levels, lower free estradiol index, and a higher ratio of total androgens to total estrogens were associated with the experiencing of hot flashes. A polymorphism in CYP1B1 and a polymorphism in 3betaHSD were both associated with hot flashes. Some genetic polymorphisms may be associated with altered levels of hormones in midlife women. Further, selected genetic polymorphisms and altered hormone levels may be associated with the risk of hot flashes in midlife women.

Cross-Study Comparison Reveals Common Genomic, Network, and Functional Signatures of Desiccation Resistance in Drosophila melanogaster

PubMed Central

Telonis-Scott, Marina; Sgrò, Carla M.; Hoffmann, Ary A.; Griffin, Philippa C.

2016-01-01

Repeated attempts to map the genomic basis of complex traits often yield different outcomes because of the influence of genetic background, gene-by-environment interactions, and/or statistical limitations. However, where repeatability is low at the level of individual genes, overlap often occurs in gene ontology categories, genetic pathways, and interaction networks. Here we report on the genomic overlap for natural desiccation resistance from a Pool-genome-wide association study experiment and a selection experiment in flies collected from the same region in southeastern Australia in different years. We identified over 600 single nucleotide polymorphisms associated with desiccation resistance in flies derived from almost 1,000 wild-caught genotypes, a similar number of loci to that observed in our previous genomic study of selected lines, demonstrating the genetic complexity of this ecologically important trait. By harnessing the power of cross-study comparison, we narrowed the candidates from almost 400 genes in each study to a core set of 45 genes, enriched for stimulus, stress, and defense responses. In addition to gene-level overlap, there was higher order congruence at the network and functional levels, suggesting genetic redundancy in key stress sensing, stress response, immunity, signaling, and gene expression pathways. We also identified variants linked to different molecular aspects of desiccation physiology previously verified from functional experiments. Our approach provides insight into the genomic basis of a complex and ecologically important trait and predicts candidate genetic pathways to explore in multiple genetic backgrounds and related species within a functional framework. PMID:26733490

Genome-wide detection of intervals of genetic heterogeneity associated with complex traits

PubMed Central

Llinares-López, Felipe; Grimm, Dominik G.; Bodenham, Dean A.; Gieraths, Udo; Sugiyama, Mahito; Rowan, Beth; Borgwardt, Karsten

2015-01-01

Motivation: Genetic heterogeneity, the fact that several sequence variants give rise to the same phenotype, is a phenomenon that is of the utmost interest in the analysis of complex phenotypes. Current approaches for finding regions in the genome that exhibit genetic heterogeneity suffer from at least one of two shortcomings: (i) they require the definition of an exact interval in the genome that is to be tested for genetic heterogeneity, potentially missing intervals of high relevance, or (ii) they suffer from an enormous multiple hypothesis testing problem due to the large number of potential candidate intervals being tested, which results in either many false positives or a lack of power to detect true intervals. Results: Here, we present an approach that overcomes both problems: it allows one to automatically find all contiguous sequences of single nucleotide polymorphisms in the genome that are jointly associated with the phenotype. It also solves both the inherent computational efficiency problem and the statistical problem of multiple hypothesis testing, which are both caused by the huge number of candidate intervals. We demonstrate on Arabidopsis thaliana genome-wide association study data that our approach can discover regions that exhibit genetic heterogeneity and would be missed by single-locus mapping. Conclusions: Our novel approach can contribute to the genome-wide discovery of intervals that are involved in the genetic heterogeneity underlying complex phenotypes. Availability and implementation: The code can be obtained at: http://www.bsse.ethz.ch/mlcb/research/bioinformatics-and-computational-biology/sis.html. Contact: felipe.llinares@bsse.ethz.ch Supplementary information: Supplementary data are available at Bioinformatics online. PMID:26072488

Polymorphisms in the GHRL gene and their associations with traits of economic interest in beef cattle.

PubMed

Braz, C U; Camargo, G M F; Cardoso, D F; Gil, F M M; Fonseca, P D S; Cyrillo, J N S G; Mercadante, M E Z; Oliveira, H N; Tonhati, H

2015-12-28

The hormone ghrelin is produced in the stomach wall, has an orexigenic function, stimulates growth hormone secretion, and affects the energy balance of the animal. Therefore, the ghrelin gene (GHRL) is considered to be a good candidate marker for the identification of traits of great economic importance in cattle, such as those associated with feed intake, growth, and carcass quality. The use of molecular genetic markers associated with such traits permits the earlier and more accurate identification of superior animals, thus reducing the interval between generations, and increasing the genetic gain. Six SNPs were found in the GHRL gene, located in intron 3, intron 4, and exon 5. The positions of the SNPs on the gene and the substitutions were: g.2184A>G, g.2347T>C, g.4469T>C, g.4548A>G, g.4663T>C, and g.4729T>C (GenBank accession No. JX565585). After analysis of linkage disequilibrium, association tests were performed between four SNPs with the traits year weight for males, yearling weight for females, dry matter intake, loin eye area, and rump fat thickness (P ≤ 0.05). Therefore, GHRL is an important candidate gene that may be used to identify genetic variations that influence traits of economic importance in beef cattle.

No Association of BDNF, COMT, MAOA, SLC6A3, and SLC6A4 Genes and Depressive Symptoms in a Sample of Healthy Colombian Subjects.

PubMed

González-Giraldo, Yeimy; Camargo, Andrés; López-León, Sandra; Forero, Diego A

2015-01-01

Background. Major depressive disorder (MDD) is the second cause of years lived with disability around the world. A large number of studies have been carried out to identify genetic risk factors for MDD and related endophenotypes, mainly in populations of European and Asian descent, with conflicting results. The main aim of the current study was to analyze the possible association of five candidate genes and depressive symptoms in a Colombian sample of healthy subjects. Methods and Materials. The Spanish adaptation of the Hospital Anxiety and Depression Scale (HADS) was applied to one hundred eighty-eight healthy Colombian subjects. Five functional polymorphisms were genotyped using PCR-based assays: BDNF-Val66Met (rs6265), COMT-Val158Met (rs4680), SLC6A4-HTTLPR (rs4795541), MAOA-uVNTR, and SLC6A3-VNTR (rs28363170). Result. We did not find significant associations with scores of depressive symptoms, derived from the HADS, for any of the five candidate genes (nominal p values >0.05). In addition, we did not find evidence of significant gene-gene interactions. Conclusion. This work is one of the first studies of candidate genes for depressive symptoms in a Latin American sample. Study of additional genetic and epigenetic variants, taking into account other pathophysiological theories, will help to identify novel candidates for MDD in populations around the world.

No association of toll-like receptor 2 polymorphisms with Alzheimer's disease in Han Chinese.

PubMed

Yu, Jin-Tai; Sun, Yan-Ping; Ou, Jiang-Rong; Cui, Wei-Zhen; Zhang, Wei; Tan, Lan

2011-10-01

Toll-like receptor 2 (TLR2) represents a reasonable functional and positional candidate gene for Alzheimer's disease (AD) as it is located under the linkage region of AD on chromosome 4q, and is functionally involved in the microglia-mediated inflammatory response and amyloid β (Aβ) clearance. In the current study, 7 single nucleotide polymorphisms (SNPs) that span the TLR2 were selected and their associations with late-onset AD (LOAD) risk were assessed in a case-control sample comprising 785 individuals in a Han Chinese population. No significant differences in the frequency of TLR2 alleles, genotypes, and haplotypes in the AD cases were detected compared with the controls. TLR2 gene might not play a major role in the genetic predisposition to late-onset Alzheimer's disease in this population. Copyright © 2011 Elsevier Inc. All rights reserved.

Genetic diversity and natural selection of Plasmodium knowlesi merozoite surface protein 1 paralog gene in Malaysia.

PubMed

Ahmed, Md Atique; Fauzi, Muh; Han, Eun-Taek

2018-03-14

Human infections due to the monkey malaria parasite Plasmodium knowlesi is on the rise in most Southeast Asian countries specifically Malaysia. The C-terminal 19 kDa domain of PvMSP1P is a potential vaccine candidate, however, no study has been conducted in the orthologous gene of P. knowlesi. This study investigates level of polymorphisms, haplotypes and natural selection of full-length pkmsp1p in clinical samples from Malaysia. A total of 36 full-length pkmsp1p sequences along with the reference H-strain and 40 C-terminal pkmsp1p sequences from clinical isolates of Malaysia were downloaded from published genomes. Genetic diversity, polymorphism, haplotype and natural selection were determined using DnaSP 5.10 and MEGA 5.0 software. Genealogical relationships were determined using haplotype network tree in NETWORK software v5.0. Population genetic differentiation index (F ST ) and population structure of parasite was determined using Arlequin v3.5 and STRUCTURE v2.3.4 software. Comparison of 36 full-length pkmsp1p sequences along with the H-strain identified 339 SNPs (175 non-synonymous and 164 synonymous substitutions). The nucleotide diversity across the full-length gene was low compared to its ortholog pvmsp1p. The nucleotide diversity was higher toward the N-terminal domains (pkmsp1p-83 and 30) compared to the C-terminal domains (pkmsp1p-38, 33 and 19). Phylogenetic analysis of full-length genes identified 2 distinct clusters of P. knowlesi from Malaysian Borneo. The 40 pkmsp1p-19 sequences showed low polymorphisms with 16 polymorphisms leading to 18 haplotypes. In total there were 10 synonymous and 6 non-synonymous substitutions and 12 cysteine residues were intact within the two EGF domains. Evidence of strong purifying selection was observed within the full-length sequences as well in all the domains. Shared haplotypes of 40 pkmsp1p-19 were identified within Malaysian Borneo haplotypes. This study is the first to report on the genetic diversity and natural selection of pkmsp1p. A low level of genetic diversity and strong evidence of negative selection was detected and observed in all the domains of pkmsp1p of P. knowlesi indicating functional constrains. Shared haplotypes were identified within pkmsp1p-19 highlighting further evaluation using larger number of clinical samples from Malaysia.

Common genetic variants related to genomic integrity and risk of papillary thyroid cancer

PubMed Central

Neta, Gila; Brenner, Alina V.; Sturgis, Erich M.; Pfeiffer, Ruth M.; Hutchinson, Amy A.; Aschebrook-Kilfoy, Briseis; Yeager, Meredith; Xu, Li; Wheeler, William; Abend, Michael; Ron, Elaine; Tucker, Margaret A.; Chanock, Stephen J.; Sigurdson, Alice J.

2011-01-01

DNA damage is an important mechanism in carcinogenesis, so genes related to maintaining genomic integrity may influence papillary thyroid cancer (PTC) risk. Candidate gene studies targeting some of these genes have identified only a few polymorphisms associated with risk of PTC. Here, we expanded the scope of previous candidate studies by increasing the number and coverage of genes related to maintenance of genomic integrity. We evaluated 5077 tag single-nucleotide polymorphisms (SNPs) from 340 candidate gene regions hypothesized to be involved in DNA repair, epigenetics, tumor suppression, apoptosis, telomere function and cell cycle control and signaling pathways in a case–control study of 344 PTC cases and 452 matched controls. We estimated odds ratios for associations of single SNPs with PTC risk and combined P values for SNPs in the same gene region or pathway to obtain gene region-specific or pathway-specific P values using adaptive rank-truncated product methods. Nine SNPs had P values <0.0005, three of which were in HDAC4 and were inversely related to PTC risk. After multiple comparisons adjustment, no SNPs remained associated with PTC risk. Seven gene regions were associated with PTC risk at P < 0.01, including HUS1, ALKBH3, HDAC4, BAK1, FAF1_CDKN2C, DACT3 and FZD6. Our results suggest a possible role of genes involved in maintenance of genomic integrity in relation to risk of PTC. PMID:21642358

The importance of immune gene variability (MHC) in evolutionary ecology and conservation

PubMed Central

Sommer, Simone

2005-01-01

Genetic studies have typically inferred the effects of human impact by documenting patterns of genetic differentiation and levels of genetic diversity among potentially isolated populations using selective neutral markers such as mitochondrial control region sequences, microsatellites or single nucleotide polymorphism (SNPs). However, evolutionary relevant and adaptive processes within and between populations can only be reflected by coding genes. In vertebrates, growing evidence suggests that genetic diversity is particularly important at the level of the major histocompatibility complex (MHC). MHC variants influence many important biological traits, including immune recognition, susceptibility to infectious and autoimmune diseases, individual odours, mating preferences, kin recognition, cooperation and pregnancy outcome. These diverse functions and characteristics place genes of the MHC among the best candidates for studies of mechanisms and significance of molecular adaptation in vertebrates. MHC variability is believed to be maintained by pathogen-driven selection, mediated either through heterozygote advantage or frequency-dependent selection. Up to now, most of our knowledge has derived from studies in humans or from model organisms under experimental, laboratory conditions. Empirical support for selective mechanisms in free-ranging animal populations in their natural environment is rare. In this review, I first introduce general information about the structure and function of MHC genes, as well as current hypotheses and concepts concerning the role of selection in the maintenance of MHC polymorphism. The evolutionary forces acting on the genetic diversity in coding and non-coding markers are compared. Then, I summarise empirical support for the functional importance of MHC variability in parasite resistance with emphasis on the evidence derived from free-ranging animal populations investigated in their natural habitat. Finally, I discuss the importance of adaptive genetic variability with respect to human impact and conservation, and implications for future studies. PMID:16242022

A Polymorphism in the Retinol Binding Protein 4 Gene is Not Associated with Gestational Diabetes Mellitus in Several Different Ethnic Groups

PubMed Central

Urschitz, Johann; Sultan, Omar; Ward, Kenneth

2011-01-01

Objective Various Asian and Pacifific Islander groups have higher prevalence rates of type 2 diabetes and gestational diabetes. This increased incidence is likely to include genetic factors. Single nucleotide polymorphisms in the retinol binding protein 4 gene have been linked to the occurrence of type 2 diabetes. Hypothesizing a link between retinol binding protein 4 and gestational diabetes, we performed a candidate gene study to look for an association between an important retinol binding protein gene polymorphism (rs3758539) and gestational diabetes. Study Design Blood was collected from Caucasian, Asian, and Pacific Islander women diagnosed with gestational diabetes and from ethnically matched non-diabetic controls. DNA was extracted and real time PCR technology (TaqMan, Applied Biosystems) used to screen for the rs3758539 single nucleotide polymorphism located 5′ of exon 1 of the retinol binding protein 4 gene. Results Genotype and allele frequencies in the controls and gestational diabetes cases were tested using chi-square contingency tests. Genotype frequencies were in Hardy-Weinberg equilibrium. There was no association between the rs3758539 retinol binding protein 4 single nucleotide polymorphism and gestational diabetes in the Caucasian, Filipino, or Pacific Islander groups. Conclusion Interestingly, the rs3758539 retinol binding protein 4 single nucleotide polymorphism was not found to be associated with gestational diabetes. The absence of association suggests that gestational and type 2 diabetes may have more divergent molecular pathophysiology than previously suspected. PMID:21886308

[Association of estrogen receptor gene polymorphism with cerebral infarction, a case-control study].

PubMed

Zhang, Yan; Xie, Ruping; Wang, Yinhua; Chen, Dafang; Wang, Guoying; Xu, Xiping

2002-11-10

To explore the association between estrogen receptor (ER) gene PvuII and XbaI polymorphisms and cerebral infarction among Chinese Han people. Samples of peripheral blood white cell were extracted among 234 patients with cerebral infarction, aged 63.9 +/- 10.3, and 259 controls without cerebrovascular disease, aged 59.2 +/- 9.2, all of Chinese Han nationality. PCR-RFLP and genotyping of ER PvuII and XbaI polymorphisms were performed. Multiple Logistic regression analysis was made to explore the risk factors for cerebral infarction. After adjustment for major confounders including age, gender, smoking, alcohol drinking, education, history of hypertension, diabetes mellitus, coronary artery disease and hyperlipoidemia, multiple Logistic regression analysis showed that: (1) The Pp genotype of ER PvuII polymorphism increased the risk of cerebral infarction significantly (OR = 1.97, 95% CI: 1.21 - 3.21); (2) The ER XbaI polymorphism was not in association with cerebral infarction significantly; (3) The PPXx/Ppxx genotypes increased the risk of cerebral infarction significantly (OR = 1.67, 2.52 and 2.18 respectively, P < 0.05) before or after all subjects were stratified by the history of hypertension or hyperlipoidemia; and (4) The positive interaction between the ER PvuII polymorphism and the presence of hypertension or diabetes or hyperlipoidemia could increase the risk of cerebral infarction significantly. ER gene may be one of the genetic candidate genes for cerebral infarction among Chinese Han population.

Transposon Insertions, Structural Variations, and SNPs Contribute to the Evolution of the Melon Genome.

PubMed

Sanseverino, Walter; Hénaff, Elizabeth; Vives, Cristina; Pinosio, Sara; Burgos-Paz, William; Morgante, Michele; Ramos-Onsins, Sebastián E; Garcia-Mas, Jordi; Casacuberta, Josep Maria

2015-10-01

The availability of extensive databases of crop genome sequences should allow analysis of crop variability at an unprecedented scale, which should have an important impact in plant breeding. However, up to now the analysis of genetic variability at the whole-genome scale has been mainly restricted to single nucleotide polymorphisms (SNPs). This is a strong limitation as structural variation (SV) and transposon insertion polymorphisms are frequent in plant species and have had an important mutational role in crop domestication and breeding. Here, we present the first comprehensive analysis of melon genetic diversity, which includes a detailed analysis of SNPs, SV, and transposon insertion polymorphisms. The variability found among seven melon varieties representing the species diversity and including wild accessions and highly breed lines, is relatively high due in part to the marked divergence of some lineages. The diversity is distributed nonuniformly across the genome, being lower at the extremes of the chromosomes and higher in the pericentromeric regions, which is compatible with the effect of purifying selection and recombination forces over functional regions. Additionally, this variability is greatly reduced among elite varieties, probably due to selection during breeding. We have found some chromosomal regions showing a high differentiation of the elite varieties versus the rest, which could be considered as strongly selected candidate regions. Our data also suggest that transposons and SV may be at the origin of an important fraction of the variability in melon, which highlights the importance of analyzing all types of genetic variability to understand crop genome evolution. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Lack of association between atopic eczema and the genetic variants of interleukin-4 and the interleukin-4 receptor alpha chain gene: heterogeneity of genetic backgrounds on immunoglobulin E production in atopic eczema patients.

PubMed

Tanaka, K; Sugiura, H; Uehara, M; Hashimoto, Y; Donnelly, C; Montgomery, D S

2001-10-01

The genetic background of atopic eczema might be heterogeneous and there is a possibility that immunoglobulin (Ig)E responsiveness in patients with atopic eczema is controlled separately from the development of atopic eczema. Although both interleukin (IL)-4 and the IL-4 receptor alpha chain have an important role for IgE production and are therefore possible candidate genes for atopy, it has not been clarified whether these genes play any roles in atopic eczema patients who have normal IgE productivity. We aimed to assess whether the polymorphisms of the IL-4 gene and the IL-4 receptor alpha chain gene play any roles in atopic eczema patients, particularly in patients who have normal IgE productivity. We determined the genotype with regard to polymorphisms in the genes for IL-4 and the IL-4 receptor alpha chain (- 589C/T of IL-4; Ile50Val, Ala375Glu and Arg551Gln of IL-4 receptor alpha chain) in patients with atopic eczema using the fluorogenic 5' nuclease assay. IL-4 and the IL-4 receptor alpha chain genotypes were not significantly associated with either total patients with atopic eczema or atopic eczema patients who had normal IgE productivity. The distribution of genotypes of IL-4-589C/T differed by the serum IgE levels in patients with atopic eczema. These results suggest that the polymorphisms in the IL-4 gene and the IL-4 receptor alpha chain gene play no role in the development of atopic eczema in patients who have normal IgE productivity.

Genetic Association of Insulin-like Growth Factor-1 Polymorphisms with High-Grade Myopia in an International Family Cohort

PubMed Central

Metlapally, Ravikanth; Ki, Chang-Seok; Li, Yi-Ju; Tran-Viet, Khanh-Nhat; Abbott, Diana; Malecaze, Francois; Calvas, Patrick; Mackey, David A.; Rosenberg, Thomas; Paget, Sandrine; Guggenheim, Jeremy A.

2010-01-01

Purpose. Evidence from human myopia genetic mapping studies (MYP3 locus), modulated animal models, and observations of glycemic control in humans suggests that insulin-like growth factor (IGF)-1 plays a role in the control of eye growth. This study was conducted to determine whether IGF-1 polymorphisms are associated with myopia in a large, international dataset of Caucasian high-grade myopia pedigrees. Methods. Two hundred sixty-five multiplex families with 1391 subjects participated in the study. IGF-1 genotyping was performed with 13 selected tag single nucleotide polymorphisms (SNPs) using allelic discrimination assays. A family-based pedigree disequilibrium test (PDT) was performed to test for association. Myopia status was defined using sphere (SPH) or spherical equivalent (SE), and analyses assessed the association of (1) high-grade myopia (≤ −5.00 D), and (2) any myopia (≤ −0.50 D) with IGF-1 markers. Results were declared significant at P ≤ 0.0038 after Bonferroni correction. Q values that take into account multiple testing were also obtained. Results. In all, three SNPs—rs10860860, rs2946834, and rs6214—were present at P < 0.05. SNP rs6214 showed positive association with both the high-grade– and any-myopia groups (P = 2 × 10−3 and P = 2 × 10−3, respectively) after correction for multiple testing. Conclusions. The study supports a genetic association between IGF-1 and high-grade myopia. These findings are in line with recent evidence in an experimental myopia model showing that IGF-1 promotes ocular growth and axial myopia. IGF-1 may be a myopia candidate gene for further investigation. PMID:20435602

GENETIC ARCHITECTURE OF AMBULATORY BLOOD PRESSURE IN THE GENERAL POPULATION – INSIGHTS FROM CARDIOVASCULAR GENE-CENTRIC ARRAY

PubMed Central

Tomaszewski, Maciej; Debiec, Radoslaw; Braund, Peter S; Nelson, Christopher P; Hardwick, Robert; Christofidou, Paraskevi; Denniff, Matthew; Codd, Veryan; Rafelt, Suzanne; van der Harst, Pim; Waterworth, Dawn; Song, Kijoung; Vollenweider, Peter; Waeber, Gerard; Zukowska-Szczechowska, Ewa; Burton, Paul R; Mooser, Vincent; Charchar, Fadi J; Thompson, John R; Tobin, Martin D; Samani, Nilesh J

2010-01-01

Genetic determinants of blood pressure are poorly defined. We undertook a large-scale gene-centric analysis to identify loci and pathways associated with ambulatory systolic and diastolic blood pressure. We measured 24-hour ambulatory BP in 2020 individuals from 520 white European nuclear families (the GRAPHIC Study) and genotyped their DNA using the Illumina HumanCVD BeadChip array which contains approximately 50000 single nucleotide polymorphisms in >2000 cardiovascular candidate loci. We found a strong association between rs13306560 polymorphism in the promoter region of MTHFR and CLCN6 and mean 24-hour diastolic blood pressure - each minor allele copy of rs13306560 was associated with 2.6 mmHg lower mean 24-hour diastolic blood pressure (P=1.2×10−8). rs13306560 was also associated with clinic diastolic blood pressure in a combined analysis of 8129 subjects from the GRAPHIC Study, the CoLaus Study and the Silesian Cardiovascular Study (P=5.4×10−6). Additional analysis of associations between variants in Gene Ontology-defined pathways and mean 24-hour blood pressure in the GRAPHIC Study showed that cell survival control signalling cascades could play a role in blood pressure regulation. There was also a significant over-representation of rare variants (minor allele frequency <0.05) amongst polymorphisms showing at least nominal association with mean 24-hour blood pressure indicating that a considerable proportion of its heritability may be explained by uncommon alleles. Through a large scale gene-centric analysis of ambulatory blood pressure, we identified an association of a novel variant at the MTHFR/CLNC6 locus with diastolic blood pressure and provided new insights into the genetic architecture of blood pressure. PMID:21060006

TPH2 gene polymorphisms in the regulatory region are associated with paranoid schizophrenia in Northern Han Chinese.

PubMed

Xu, X M; Ding, M; Pang, H; Wang, B J

2014-03-12

In the last years, serotonin (5-HT) has been related with the pathophysiology of several psychiatric disorders, including schizophrenia. Thus, genes related to the serotonergic (5-HTergic) system are good candidate genes for schizophrenia. The rate-limiting enzyme of 5-HT synthesis is tryptophan hydroxylase 2 (TPH2). Single nucleotide polymorphisms (SNPs) in the regulatory regions of TPH2 gene may affect gene expression and biosynthesis of 5-HT triggering to various neuropsychiatric disorders related to 5-HT dysfunction. The present study explored the association of SNPs within the TPH2 gene with paranoid schizophrenia in Han Chinese. A total of 164 patients with schizophrenia and 244 healthy controls were genotyped for six TPH2 SNPs (rs4570625, rs11178997, rs11178998, rs41317118, rs17110747, and rs41317114). Significant group differences were observed in the allele and genotype frequencies of rs4570625 and in the frequencies of GTA and TTA haplotypes corresponding to rs4570625-rs11178997-rs11178998. Our findings suggest that common genetic variations of TPH2 are likely to contribute to genetic susceptibility to paranoid schizophrenia in Han Chinese. Further studies in larger samples are needed to replicate this association.

Association of the 5′-upstream regulatory region of the α7 nicotinic acetylcholine receptor subunit gene (CHRNA7) with schizophrenia

PubMed Central

Stephens, Sarah H.; Logel, Judith; Barton, Amanda; Franks, Alexis; Schultz, Jessica; Short, Margaret; Dickenson, Jane; James, Benjamin; Fingerlin, Tasha E.; Wagner, Brandie; Hodgkinson, Colin; Graw, Sharon; Ross, Randal G.; Freedman, Robert; Leonard, Sherry

2009-01-01

Background The α7 neuronal nicotinic acetylcholine receptor subunit gene (CHRNA7) is localized in a chromosomal region (15q14) linked to schizophrenia in multiple independent studies. CHRNA7 was selected as the best candidate gene in the region for a well-documented endophenotype of schizophrenia, the P50 sensory processing deficit, by genetic linkage and biochemical studies. Methods Subjects included Caucasian-Non Hispanic and African-American case-control subjects collected in Denver, and schizophrenic subjects from families in the NIMH Genetics Initiative on Schizophrenia. Thirty-five single nucleotide polymorphisms (SNPs) in the 5′-upstream regulatory region of CHRNA7 were genotyped for association with schizophrenia, and for smoking in schizophrenia. Results The rs3087454 SNP, located at position −1831 bp in the upstream regulatory region of CHRNA7, was significantly associated with schizophrenia in the case-control samples after multiple-testing correction (P = 0.0009, African American; P = 0.013, Caucasian-Non Hispanic); the association was supported in family members. There was nominal association of this SNP with smoking in schizophrenia. Conclusions The data support association of regulatory region polymorphisms in the CHRNA7 gene with schizophrenia. PMID:19181484

FABP4: a novel candidate gene for polycystic ovary syndrome.

PubMed

Wang, Jing; Tang, Jingwen; Wang, Binbin; Song, Junjie; Liu, Jingjing; Wei, Zhaolian; Zhang, Feng; Ma, Xu; Cao, Yunxia

2009-12-01

Polycystic ovary syndrome (PCOS) is a complex multifactorial disorder involving a number of genetic and environmental factors. Adipocyte-fatty acid-binding protein (FABP4) is an adipokine regulating systemic insulin sensitivity, lipid and glucose metabolism. In humans serum FABP4 levels correlate significantly with features of PCOS. Previous researches showed strong evidences that FABP4 impacted the developing of PCOS possibly through its protein alteration or transcription regulation. Thus, the present study is the first attempt to identify the possible genetic role of FABP4 gene in the development of PCOS. About 1000 bp of the promoter region and four exons of FABP4 gene of 178 PCOS patients and 171 healthy controls were directly sequenced. Three polymorphisms, rs16909225, rs3834363, and rs16909220, were identified, of which rs16909225 and rs16909220 were completely linked (r² = 1) and not associated with the development of PCOS, while the -2-bp/-2-bp genotype of rs3834363 was significantly higher in PCOS than in the controls (χ² = 7.39, df = 1, P = 0.007, OR = 1.80 95% CI: 1.18-2.75). The present study is the first to establish an association between FABP4 gene polymorphisms and the development of PCOS.

Genetic variants in Protocadherin-1, bronchial hyper-responsiveness, and asthma subphenotypes in German children.

PubMed

Toncheva, Antoaneta A; Suttner, Kathrin; Michel, Sven; Klopp, Norman; Illig, Thomas; Balschun, Tobias; Vogelberg, Christian; von Berg, Andrea; Bufe, Albrecht; Heinzmann, Andrea; Laub, Otto; Rietschel, Ernst; Simma, Burkhard; Frischer, Thomas; Genuneit, Jon; von Mutius, Erika; Kabesch, Michael

2012-11-01

Recently, Protocadherin-1 (PCDH1) was reported as a novel susceptibility gene for bronchial hyper-responsiveness (BHR) and asthma. PCDH1 is located on chromosome 5q31-33, in the vicinity of several known candidate genes for asthma and allergy. To exclude that the associations observed for PCDH1 originate from the nearby cytokine cluster, an extensive linkage disequilibrium (LD) analysis was performed. Effects of polymorphisms in PCDH1 on asthma, BHR, and related phenotypes were studied comprehensively. Genotype information was acquired from Illumina HumanHap300Chip genotyping, MALDI-TOF MS genotyping, and imputation. LD was assessed by Haploview 4.2 software. Associations were investigated in a population of 1454 individuals (763 asthmatics) from two German study populations [MAGICS and International Study of Asthma and Allergies in Childhood phase II (ISAAC II)] using logistic regression to model additive effects. No relevant LD between PCDH1 tagging polymorphisms and 98 single nucleotide polymorphisms within the cytokine cluster was detected. While BHR was not associated with PCDH1 polymorphisms, significant associations with subphenotypes of asthma were observed. Protocadherin-1 polymorphisms may specifically affect the development of non-atopic asthma in children. Functional studies are needed to further investigate the role of PCDH1 in BHR and asthma development. © 2012 John Wiley & Sons A/S. Published by Blackwell Publishing Ltd.

Association of Adiponectin rs1501299 and rs266729 Gene Polymorphisms With Nonalcoholic Fatty Liver Disease

PubMed Central

Hashemi, Mohammad; Hanafi Bojd, Hamideh; Eskandari Nasab, Ebrahim; Bahari, Ali; Hashemzehi, Noor Allah; Shafieipour, Sara; Narouie, Behzad; Taheri, Mohsen; Ghavami, Saeid

2013-01-01

Background Genetic and environmental factors are important for the development of nonalcoholic fatty liver disease (NAFLD). Adiponectin is a white and brown adipose tissue hormone, and have been found to play essential roles in the regulation of energy homoeostasis. Recent reports have identified a possible role of adiponectin in NAFLD via PPARγ pathway. Objectives The present study was designed to find out the impact of adiponectin rs1501299 (276G/T) and rs266729 (-11377C/G) gene polymorphisms in NAFLD. Patients and Methods Eighty-three patients with diagnosis of NAFLD, and 93 healthy subjects were included in the study. Tetra ARMS-PCR was designed to detect single nucleotide polymorphisms. Results A significant difference was found between NAFLD and control group regarding the rs266729 polymorphism (χ2 = 7.35, P = 0.025). The rs266729 polymorphism increased the risk of NAFLD in codominant (CC vs. CG: OR = 2.18, 95% CI = 1.16 - 4.12, P = 0.016) and dominant (CC vs. CG/GG: OR = 2.31, 95% CI = 1.25 - 4.27; P = 0.008) inheritance tested models. The G allele increased the risk of NAFLD (OR = 1.63, 95% CI = 1.03 - 2.57, P = 0.037) in comparison with C allele. No significant difference was found between the groups concerning adiponectin rs1501299 gene polymorphism (χ2 = 0.70, P = 0.697). Conclusions adiponectin rs266729 polymorphism might be a candidate gene, which determines the susceptibility to NAFLD. Larger studies are necessary to confirm these findings in various populations. PMID:23922565

Inverse Correlation of Population Similarity and Introduction Date for Invasive Ascidians

PubMed Central

Silva, Nathan; Smith, William C.

2008-01-01

The genomes of many marine invertebrates, including the purple sea urchin and the solitary ascidians Ciona intestinalis and Ciona savignyi, show exceptionally high levels of heterozygosity, implying that these populations are highly polymorphic. Analysis of the C. savignyi genome found little evidence to support an elevated mutation rate, but rather points to a large population size contributing to the polymorphism level. In the present study, the relative genetic polymorphism levels in sampled populations of ten different ascidian species were determined using a similarity index generated by AFLP analysis. The goal was to determine the range of polymorphism within the populations of different species, and to uncover factors that may contribute to the high level of polymorphism. We observe that, surprisingly, the levels of polymorphism within these species show a negative correlation with the reported age of invasive populations, and that closely related species show substantially different levels of genetic polymorphism. These findings show exceptions to the assumptions that invasive species start with a low level of genetic polymorphism that increases over time and that closely related species have similar levels of genetic polymorphism. PMID:18575620

Genome Wide Gene by Environment Interaction Analysis Identifies Common SNPs at 17q21.2 that Are Associated with Increased Body Mass Index Only among Asthmatics

DTIC Science & Technology

2015-12-16

polymorphisms (SNPs), a candidate gene association study was conducted to identify shared genetic variants between childhood asthma and obesity , but no SNP was...10):969– 76. doi: 10.1093/aje/kwh303 PMID: 15522853. 33. von Kries R, Hermann M, Grunert VP, von Mutius E. Is obesity a risk factor for childhood ...88PA, Case # 2014-4685, 7 Oct 2014. PLoS One. 2015; 10(12):e0144114. 14. ABSTRACT Asthmatics have an increased risk of being overweight/ obese

The genetic basis of adaptive pigmentation variation in Drosophila melanogaster.

PubMed

Pool, John E; Aquadro, Charles F

2007-07-01

In a broad survey of Drosophila melanogaster population samples, levels of abdominal pigmentation were found to be highly variable and geographically differentiated. A strong positive correlation was found between dark pigmentation and high altitude, suggesting adaptation to specific environments. DNA sequence polymorphism at the candidate gene ebony revealed a clear association with the pigmentation of homozygous third chromosome lines. The darkest lines sequenced had nearly identical haplotypes spanning 14.5 kb upstream of the protein-coding exons of ebony. Thus, natural selection may have elevated the frequency of an allele that confers dark abdominal pigmentation by influencing the regulation of ebony.

Genome-wide association study reveals a QTL and strong candidate genes for umbilical hernia in pigs on SSC14.

PubMed

Grindflek, Eli; Hansen, Marianne H S; Lien, Sigbjørn; van Son, Maren

2018-05-29

Umbilical hernia is one of the most prevalent congenital defect in pigs, causing economic losses and substantial animal welfare problems. Identification and implementation of genomic regions controlling umbilical hernia in breeding is of great interest to reduce incidences of hernia in commercial pig production. The aim of this study was to identify such regions and possibly identify causative variation affecting umbilical hernia in pigs. A case/control material consisting of 739 Norwegian Landrace pigs was collected and applied in a GWAS study with a genome-wide distributed panel of 60 K SNPs. Additionally candidate genes were sequenced to detect additional polymorphisms that were used for single SNP and haplotype association analyses in 453 of the pigs. The GWAS in this report detected a highly significant region affecting umbilical hernia around 50 Mb on SSC14 (P < 0.0001) explaining up to 8.6% of the phenotypic variance of the trait. The region is rather broad and includes 62 significant SNPs in high linkage disequilibrium with each other. Targeted sequencing of candidate genes within the region revealed polymorphisms within the Leukemia inhibitory factor (LIF) and Oncostatin M (OSM) that were significantly associated with umbilical hernia (P < 0.001). A highly significant QTL for umbilical hernia in Norwegian Landrace pigs was detected around 50 Mb on SSC14. Resequencing of candidate genes within the region revealed SNPs within LIF and OSM highly associated with the trait. However, because of extended LD within the region, studies in other populations and functional studies are needed to determine whether these variants are causal or not. Still without this knowledge, SNPs within the region can be used as genetic markers to reduce incidences of umbilical hernia in Norwegian Landrace pigs.

Evidence for progenitor–derivative speciation in sexually deceptive orchids

PubMed Central

Schlüter, Philipp M.; Ruas, Paulo M.; Kohl, Gudrun; Ruas, Claudete F.; Stuessy, Tod F.; Paulus, Hannes F.

2011-01-01

Background and Aims Sexually deceptive orchids of the genus Ophrys use mimicry of pollinator females to attract specific pollinators. Pollinator shifts may drive speciation in Ophrys, since novel pollinators may in principle act as isolating factors immediately. It is thus possible that evolution of novel species occurs rapidly and with a progenitor–derivative pattern. The aims of this study are to compare genetic structure and diversity among widespread and geographically restricted Ophrys taxa, to test whether genetic structure is associated with specific pollinators, and to investigate whether any widespread species may have acted as a progenitor for the evolution of more restricted taxa. Methods Genetic differentiation and diversity were investigated in O. leucadica and O. cinereophila, the two taxa of the Ophrys fusca sensu lato complex widespread in the Aegean, and three geographically restricted taxa from Rhodes, O. attaviria, O. parvula and O. persephonae, all differing in their specific pollinators. This was done using amplified fragment length polymorphism (AFLP) DNA fingerprinting, and sequencing of the low-copy nuclear gene LEAFY (LFY). Key Results All taxa were found to be separate genetic entities, with O. leucadica forming two geographic groups from the west and east of the Aegean. Genetic structure was significantly shaped by pollinators and geography, and comparison of sequence and AFLP data revealed ancestral polymorphisms shared among several taxa. Among the sampled taxa, O. leucadica harbours the greatest genetic differentiation and geographic structure, and the highest genetic diversity. Part of the genome of O. parvula, endemic to Rhodes, may be derived from O. leucadica. Conclusions Pollinators probably influence the genetic structure of the investigated Ophrys species. The genetic pattern identified is consistent with O. leucadica being the oldest of the sampled taxa, making O. leucadica a candidate progenitor species from which more restricted taxa such as O. parvula may have evolved. PMID:21890487

A fast boosting-based screening method for large-scale association study in complex traits with genetic heterogeneity.

PubMed

Wang, Lu-Yong; Fasulo, D

2006-01-01

Genome-wide association study for complex diseases will generate massive amount of single nucleotide polymorphisms (SNPs) data. Univariate statistical test (i.e. Fisher exact test) was used to single out non-associated SNPs. However, the disease-susceptible SNPs may have little marginal effects in population and are unlikely to retain after the univariate tests. Also, model-based methods are impractical for large-scale dataset. Moreover, genetic heterogeneity makes the traditional methods harder to identify the genetic causes of diseases. A more recent random forest method provides a more robust method for screening the SNPs in thousands scale. However, for more large-scale data, i.e., Affymetrix Human Mapping 100K GeneChip data, a faster screening method is required to screening SNPs in whole-genome large scale association analysis with genetic heterogeneity. We propose a boosting-based method for rapid screening in large-scale analysis of complex traits in the presence of genetic heterogeneity. It provides a relatively fast and fairly good tool for screening and limiting the candidate SNPs for further more complex computational modeling task.

Association mapping reveals the genetic architecture of tomato response to water deficit: focus on major fruit quality traits.

PubMed

Albert, Elise; Segura, Vincent; Gricourt, Justine; Bonnefoi, Julien; Derivot, Laurent; Causse, Mathilde

2016-12-01

Water scarcity constitutes a crucial constraint for agriculture productivity. High-throughput approaches in model plant species identified hundreds of genes potentially involved in survival under drought, but few having beneficial effects on quality and yield. Nonetheless, controlled water deficit may improve fruit quality through higher concentration of flavor compounds. The underlying genetic determinants are still poorly known. In this study, we phenotyped 141 highly diverse small fruit tomato accessions for 27 traits under two contrasting watering conditions. A subset of 55 accessions exhibited increased metabolite contents and maintained yield under water deficit. Using 6100 single nucleotide polymorphisms (SNPs), association mapping revealed 31, 41, and 44 quantitative trait loci (QTLs) under drought, control, and both conditions, respectively. Twenty-five additional QTLs were interactive between conditions, emphasizing the interest in accounting for QTLs by watering regime interactions in fruit quality improvement. Combining our results with the loci previously identified in a biparental progeny resulted in 11 common QTLs and contributed to a first detailed characterization of the genetic determinants of response to water deficit in tomato. Major QTLs for fruit quality traits were dissected and candidate genes were proposed using expression and polymorphism data. The outcomes provide a basis for fruit quality improvement under deficit irrigation while limiting yield losses. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Association between the SPRY1 gene polymorphism and obesity-related traits and osteoporosis in Korean women.

PubMed

Jin, Hyun-Seok; Kim, Bo-Young; Kim, Jeonghyun; Hong, Kyung-Won; Jung, Suk-Yul; Lee, Yun-Seok; Huh, Dam; Oh, Bermseok; Chung, Yoon-Sok; Jeong, Seon-Yong

2013-01-01

Emerging evidence has revealed a close relationship between obesity and osteoporosis. It was reported recently that conditional knockout of the Spry1 gene in mice adipocytes causes an increase in body fat and a decrease in bone mass, and that these phenotypes are rescued by Spry1 overexpression in adipose tissue. In this study, we investigated whether genetic variation in the human SPRY1 gene is associated with obesity-related phenotypes and/or osteoporosis in humans. We performed a candidate gene association analysis between the four single nucleotide polymorphisms (SNPs) and 14 imputed SNPs in the SPRY1 gene and obesity-related traits and osteoporosis in a Korean women cohort (3013 subjects). All four SPRY1 gene SNPs were significantly associated with either obesity-related traits or osteoporosis. The TGCC haplotype in the SRPY1 gene showed simultaneous association with an increased risk for obesity-related traits, percentage body fat (p=0.0087) and percentage abdominal fat (p=0.047), and osteoporosis (odds ratio=1.50; p=0.025) in the recessive genetic model. Our results support a previous finding in conditional Spry1 gene knockout mice and suggest that the SPRY1 gene is an important genetic factor for determining the risk of both obesity and osteoporosis in humans. Copyright © 2012 Elsevier Inc. All rights reserved.

Genetic association analysis identifies variants associated with disease progression in primary sclerosing cholangitis.

PubMed

Alberts, Rudi; de Vries, Elisabeth M G; Goode, Elizabeth C; Jiang, Xiaojun; Sampaziotis, Fotis; Rombouts, Krista; Böttcher, Katrin; Folseraas, Trine; Weismüller, Tobias J; Mason, Andrew L; Wang, Weiwei; Alexander, Graeme; Alvaro, Domenico; Bergquist, Annika; Björkström, Niklas K; Beuers, Ulrich; Björnsson, Einar; Boberg, Kirsten Muri; Bowlus, Christopher L; Bragazzi, Maria C; Carbone, Marco; Chazouillères, Olivier; Cheung, Angela; Dalekos, Georgios; Eaton, John; Eksteen, Bertus; Ellinghaus, David; Färkkilä, Martti; Festen, Eleonora A M; Floreani, Annarosa; Franceschet, Irene; Gotthardt, Daniel Nils; Hirschfield, Gideon M; Hoek, Bart van; Holm, Kristian; Hohenester, Simon; Hov, Johannes Roksund; Imhann, Floris; Invernizzi, Pietro; Juran, Brian D; Lenzen, Henrike; Lieb, Wolfgang; Liu, Jimmy Z; Marschall, Hanns-Ulrich; Marzioni, Marco; Melum, Espen; Milkiewicz, Piotr; Müller, Tobias; Pares, Albert; Rupp, Christian; Rust, Christian; Sandford, Richard N; Schramm, Christoph; Schreiber, Stefan; Schrumpf, Erik; Silverberg, Mark S; Srivastava, Brijesh; Sterneck, Martina; Teufel, Andreas; Vallier, Ludovic; Verheij, Joanne; Vila, Arnau Vich; Vries, Boudewijn de; Zachou, Kalliopi; Chapman, Roger W; Manns, Michael P; Pinzani, Massimo; Rushbrook, Simon M; Lazaridis, Konstantinos N; Franke, Andre; Anderson, Carl A; Karlsen, Tom H; Ponsioen, Cyriel Y; Weersma, Rinse K

2017-08-04

Primary sclerosing cholangitis (PSC) is a genetically complex, inflammatory bile duct disease of largely unknown aetiology often leading to liver transplantation or death. Little is known about the genetic contribution to the severity and progression of PSC. The aim of this study is to identify genetic variants associated with PSC disease progression and development of complications. We collected standardised PSC subphenotypes in a large cohort of 3402 patients with PSC. After quality control, we combined 130 422 single nucleotide polymorphisms of all patients-obtained using the Illumina immunochip-with their disease subphenotypes. Using logistic regression and Cox proportional hazards models, we identified genetic variants associated with binary and time-to-event PSC subphenotypes. We identified genetic variant rs853974 to be associated with liver transplant-free survival (p=6.07×10 -9 ). Kaplan-Meier survival analysis showed a 50.9% (95% CI 41.5% to 59.5%) transplant-free survival for homozygous AA allele carriers of rs853974 compared with 72.8% (95% CI 69.6% to 75.7%) for GG carriers at 10 years after PSC diagnosis. For the candidate gene in the region, RSPO3 , we demonstrated expression in key liver-resident effector cells, such as human and murine cholangiocytes and human hepatic stellate cells. We present a large international PSC cohort, and report genetic loci associated with PSC disease progression. For liver transplant-free survival, we identified a genome-wide significant signal and demonstrated expression of the candidate gene RSPO3 in key liver-resident effector cells. This warrants further assessments of the role of this potential key PSC modifier gene. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Genetic diversity of the merozoite surface protein-3 gene in Plasmodium falciparum populations in Thailand.

PubMed

Pattaradilokrat, Sittiporn; Sawaswong, Vorthon; Simpalipan, Phumin; Kaewthamasorn, Morakot; Siripoon, Napaporn; Harnyuttanakorn, Pongchai

2016-10-21

An effective malaria vaccine is an urgently needed tool to fight against human malaria, the most deadly parasitic disease of humans. One promising candidate is the merozoite surface protein-3 (MSP-3) of Plasmodium falciparum. This antigenic protein, encoded by the merozoite surface protein (msp-3) gene, is polymorphic and classified according to size into the two allelic types of K1 and 3D7. A recent study revealed that both the K1 and 3D7 alleles co-circulated within P. falciparum populations in Thailand, but the extent of the sequence diversity and variation within each allelic type remains largely unknown. The msp-3 gene was sequenced from 59 P. falciparum samples collected from five endemic areas (Mae Hong Son, Kanchanaburi, Ranong, Trat and Ubon Ratchathani) in Thailand and analysed for nucleotide sequence diversity, haplotype diversity and deduced amino acid sequence diversity. The gene was also subject to population genetic analysis (F st ) and neutrality tests (Tajima's D, Fu and Li D* and Fu and Li' F* tests) to determine any signature of selection. The sequence analyses revealed eight unique DNA haplotypes and seven amino acid sequence variants, with a haplotype and nucleotide diversity of 0.828 and 0.049, respectively. Neutrality tests indicated that the polymorphism detected in the alanine heptad repeat region of MSP-3 was maintained by positive diversifying selection, suggesting its role as a potential target of protective immune responses and supporting its role as a vaccine candidate. Comparison of MSP-3 variants among parasite populations in Thailand, India and Nigeria also inferred a close genetic relationship between P. falciparum populations in Asia. This study revealed the extent of the msp-3 gene diversity in P. falciparum in Thailand, providing the fundamental basis for the better design of future blood stage malaria vaccines against P. falciparum.

Muscle strength is associated with vitamin D receptor gene variants.

PubMed

Bozsodi, Arpad; Boja, Sara; Szilagyi, Agnes; Somhegyi, Annamaria; Varga, Peter Pal; Lazary, Aron

2016-11-01

Vitamin D receptor (VDR) is an important candidate gene in muscle function. Scientific reports on the effect of its genetic variants on muscle strength are contradictory likely due to the inconsistent study designs. Hand grip strength (HGS) is a highly heritable phenotype of muscle strength but only limited studies are available on its genetic background. Association between VDR polymorphisms and HGS has been poorly investigated and previous reports are conflicting. We studied the effect of VDR gene variants on HGS in a sample of 706 schoolchildren. Genomic DNA was extracted from saliva samples and six candidate single nucleotide polymorphisms (SNPs) across the VDR gene were genotyped with Sequenom MassARRAY technique. HGS was measured with a digital dynamometer in both hands. Single marker and haplotype associations were adjusted for demographic parameters. Three SNPs, rs4516035 (A1012G; p = 0.009), rs1544410 (BsmI; p = 0.010), and rs731236 (TaqI; p = 0.038) and a 3' UTR haploblock constructed by three SNPs (Bsml-Taq1-rs10783215; p < 0.005) showed significantly associations with HGS of the dominant hand. In the non-dominant hand, the effects of the A1012G (p = 0.034) and the 3' UTR haploblock (p < 0.01) on HGS were also significant. Since the promoter SNP (A10112G) and the 3' UTR haplotype were proved to be associated with the expression and the stability of the VDR mRNA in earlier studies, VDR variants can be supposed to have a direct effect on muscle strength. The individual genetic patterns can also explain the inconsistency of the previously published clinical results on the association between vitamin D and muscle function. © 2016 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res 34:2031-2037, 2016. © 2016 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

Colorectal cancer-susceptibility single-nucleotide polymorphisms in Korean population.

PubMed

Hong, Sung Noh; Park, Changho; Kim, Jong-Il; Kim, Duk-Hwan; Kim, Hee Cheol; Chang, Dong Kyung; Rhee, Poong-Lyul; Kim, Jae J; Rhee, Jong Chul; Son, Hee Jung; Kim, Young-Ho

2015-05-01

Considering the significant racial and ethnic diversity in genetic variation, it is unclear whether the genome-wide association studies-identified colorectal cancer (CRC)-susceptibility single-nucleotide polymorphisms (SNPs) discovered in European populations are also relevant to the Korean population. However, studies on CRC-susceptibility SNPs in Koreans are limited. To investigate the racial and ethnic diversity of CRC-susceptibility genetic variants, we genotyped for the established European CRC-susceptibility SNPs in 198 CRC cases and 329 controls in Korea. To identify novel genetic variants using genome-wide screening in Korea, Illumina HumanHap 370K/610K BeadChips were performed on 105 CRC patients, and candidate CRC-susceptibility SNPs were selected. Subsequently, genotyping for replication was done in 189 CRC cases and 190 controls. Among the European CRC-susceptibility SNPs, rs4939827 in SMAD7 was associated with a significant decreased risk of Korean CRC (age-/gender-adjusted odds ratio [95% confidence interval]: additive model, 0.67 [95% CI, 0.47-0.95]; dominant model, 0.59 [95% CI, 0.39-0.91]). rs4779584 and rs10795668 were associated with CRC risk in females and males, respectively. Among candidate CRC-susceptibility SNPs selected from genome-wide screening, novel SNP, rs17051076, was found to be associated with a significantly increased risk of microsatellite instability-high CRC (age-/gender-adjusted odds ratio [95% confidence interval]: additive model, 4.25 [95% CI, 1.51-11.98]; dominant model, 3.52 [95% CI, 1.13-10.94]) in the replication study. rs4939827, rs4779584, and rs10795668 may contribute to the risk of CRC in the Korean population as well as in European populations. Novel rs17051076 could be associated with microsatellite instability-high CRC in Koreans. These associations support the ethnic diversity of CRC-susceptibility SNPs and should be taken into account in large-scale studies. © 2013 Journal of Gastroenterology and Hepatology Foundation and Wiley Publishing Asia Pty Ltd.

A gene-environment interaction analysis of plasma selenium with prevalent and incident diabetes: The Hortega study.

PubMed

Galan-Chilet, Inmaculada; Grau-Perez, Maria; De Marco, Griselda; Guallar, Eliseo; Martin-Escudero, Juan Carlos; Dominguez-Lucas, Alejandro; Gonzalez-Manzano, Isabel; Lopez-Izquierdo, Raul; Briongos-Figuero, Laisa Socorro; Redon, Josep; Chaves, Felipe Javier; Tellez-Plaza, Maria

2017-08-01

Selenium and single-nucleotide-polymorphisms in selenoprotein genes have been associated to diabetes. However, the interaction of selenium with genetic variation in diabetes and oxidative stress-related genes has not been evaluated as a potential determinant of diabetes risk. We evaluated the cross-sectional and prospective associations of plasma selenium concentrations with type 2 diabetes, and the interaction of selenium concentrations with genetic variation in candidate polymorphisms, in a representative sample of 1452 men and women aged 18-85 years from Spain. The geometric mean of plasma selenium levels in the study sample was 84.2µg/L. 120 participants had diabetes at baseline. Among diabetes-free participants who were not lost during the follow-up (N=1234), 75 developed diabetes over time. The multivariable adjusted odds ratios (95% confidence interval) for diabetes prevalence comparing the second and third to the first tertiles of plasma selenium levels were 1.80 (1.03, 3.14) and 1.97 (1.14, 3.41), respectively. The corresponding hazard ratios (95% CI) for diabetes incidence were 1.76 (0.96, 3.22) and 1.80 (0.98, 3.31), respectively. In addition, we observed significant interactions between selenium and polymorphisms in PPARGC1A, and in genes encoding mitochondrial proteins, such as BCS1L and SDHA, and suggestive interactions of selenium with other genes related to selenoproteins and redox metabolism. Plasma selenium was positively associated with prevalent and incident diabetes. While the statistical interactions of selenium with polymorphisms involved in regulation of redox and insulin signaling pathways provide biological plausibility to the positive associations of selenium with diabetes, further research is needed to elucidate the causal pathways underlying these associations. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

Contribution of myostatin gene polymorphisms to normal variation in lean mass, fat mass and peak BMD in Chinese male offspring.

PubMed

Yue, Hua; He, Jin-wei; Zhang, Hao; Wang, Chun; Hu, Wei-wei; Gu, Jie-mei; Ke, Yao-hua; Fu, Wen-zhen; Hu, Yun-qiu; Li, Miao; Liu, Yu-juan; Wu, Song-hua; Zhang, Zhen-lin

2012-05-01

Myostatin gene is a member of the transforming growth factor-β (TGF-β) family that negatively regulates skeletal muscle growth. Genetic polymorphisms in Myostatin were found to be associated with the peak bone mineral density (BMD) in Chinese women. The purpose of this study was to investigate whether myostatin played a role in the normal variation in peak BMD, lean mass (LM), and fat mass (FM) of Chinese men. Four hundred male-offspring nuclear families of Chinese Han ethnic group were recruited. Anthropometric measurements, including the peak BMD, body LM and FM were measured using dual-energy X-ray absorptiometry (DXA). The single nucleotide polymorphisms (SNPs) studied were tag-SNPs selected by sequencing. Both rs2293284 and +2278GA were genotyped using TaqMan assay, and rs3791783 was genotyped with PCR-restriction fragment length polymorphism (RFLP) analysis. The associations of the SNPs with anthropometric variations were analyzed using the quantitative transmission disequilibrium test (QTDT). Using QTDT to detect within-family associations, neither single SNP nor haplotype was found to be associated with peak BMD at any bone site. However, rs3791783 was found to be significantly associated with fat mass of the trunk (P<0.001). Moreover, for within-family associations, haplotypes AGG, AAA, and TGG were found to be significantly associated with the trunk fat mass (all P<0.001). Our results suggest that genetic variation within myostatin may play a role in regulating the variation in fat mass in Chinese males. Additionally, the myostatin gene may be a candidate that determines body fat mass in Chinese men.

The brain-derived neurotrophic factor Val66Met polymorphism is associated with reduced functional magnetic resonance imaging activity in the hippocampus and increased use of caudate nucleus-dependent strategies in a human virtual navigation task

PubMed Central

Banner, Harrison; Bhat, Venkataramana; Etchamendy, Nicole; Joober, Ridha; Bohbot, Véronique D

2011-01-01

Multiple memory systems are involved in parallel processing of spatial information during navigation. A series of studies have distinguished between hippocampus-dependent ‘spatial’ navigation, which relies on knowledge of the relationship between landmarks in one’s environment to build a cognitive map, and habit-based ‘response’ learning, which requires the memorization of a series of actions and is mediated by the caudate nucleus. Studies have demonstrated that people spontaneously use one of these two alternative navigational strategies with almost equal frequency to solve a given navigation task, and that strategy correlates with functional magnetic resonance imaging (fMRI) activity and grey matter density. Although there is evidence for experience modulating grey matter in the hippocampus, genetic contributions may also play an important role in the hippocampus and caudate nucleus. Recently, the Val66Met polymorphism of the brain-derived neurotrophic factor (BDNF) gene has emerged as a possible inhibitor of hippocampal function. We have investigated the role of the BDNF Val66Met polymorphism on virtual navigation behaviour and brain activation during an fMRI navigation task. Our results demonstrate a genetic contribution to spontaneous strategies, where ‘Met’ carriers use a response strategy more frequently than individuals homozygous for the ‘Val’ allele. Additionally, we found increased hippocampal activation in the Val group relative to the Met group during performance of a virtual navigation task. Our results support the idea that the BDNF gene with the Val66Met polymorphism is a novel candidate gene involved in determining spontaneous strategies during navigation behaviour. PMID:21255124

Association of lipoprotein lipase D9N polymorphism with myocardial infarction in type 2 diabetes: the genetics, outcomes, and lipids in type 2 diabetes (GOLD) study.

PubMed

Izar, Maria C; Helfenstein, Tatiana; Ihara, Silvia S; Relvas, Waldir G; Santos, Andreza O; Fischer, Simone C; Pinto, Leonor E; Lopes, Ieda E; Pomaro, Daniel R; Fonseca, Marilia I; Bodanese, Luis C; Moriguchi, Emilio H; Saraiva, Jose F; Introcaso, Luiz; Souza, Agnaldo D; Scartezini, Marileia; Torres, Kerginaldo P; Zagury, Leao; Jardim, Paulo C; Costa, Eduardo A; Tacito, Lucia H; Forti, Adriana; Magalhaes, Maria E; Chacra, Antonio R; Bertolami, Marcelo C; Loures-Vale, Andreia A; Barros, Marco A; Xavier, Hermes T; Lyra, Ruy; Argamanijan, Dikran; Guimaraes, Armenio; Novazzi, Jose P; Kasinski, Nelson; Afiune, Abrahao; Martinez, Tania L; Santos, Raul D; Nicolau, Jose C; Cesar, Luiz A; Povoa, Rui M; Carvalho, Antonio C; Han, Sang W; Fonseca, Francisco A

2009-05-01

The association of polymorphisms affecting lipid metabolism with the risk of myocardial infarction (MI) in type 2 diabetes mellitus was investigated. The Genetics, Outcomes and Lipids in type 2 Diabetes (GOLD) Study is a prospective, multicenter study, conducted on 990 patients presenting diabetes and MI (n=386), or diabetes without previous manifestation of stroke, peripheral or coronary arterial disease (n=604), recruited from 27 institutions in Brazil. APO A1 (A/G -75 and C/T +83) and APO C3 (C/G 3'UTR) non-coding sequences, CETP (Taq 1B), LPL (D9N), APO E (epsilon2, epsilon3, epsilon4,), PON-1 (Q192R), and two LCAT variants Arg(147)-->Trp and Tyr(171)-->Stop were tested by PCR-RFLP. There was a higher prevalence of LPL DN genotype (19% vs.12%, p=0.03) and a higher frequency of the N allele (11% vs. 7%) among subjects with MI when compared to controls, with an odds ratio of MI for carriers of 9N allele of 2.46 (95% CI=1.79-3.39, p<0.0001). This association was present in men and women, in non-smokers and in hypertensive patients. A logistic regression model including gender, duration of diabetes, systolic blood pressure, HDL-C, left ventricle hypertrophy and D9N polymorphism showed that the latter still remained significantly associated with MI (OR=1.50, 95% CI=1.02-2.25, p=0.049). These findings suggest that D9N polymorphism can be a useful risk marker for myocardial infarction and that further potential candidate genes should be screened for exploratory analysis and for future therapeutic intervention in diabetes.

Association of inflammatory gene polymorphisms with ischemic stroke in a Chinese Han population

PubMed Central

2012-01-01

Background Inflammatory mechanisms are important in stroke risk, and genetic variations in components of the inflammatory response have been implicated as risk factors for stroke. We tested the inflammatory gene polymorphisms and their association with ischemic stroke in a Chinese Han population. Methods A total of 1,124 ischemic stroke cases and 1,163 controls were genotyped with inflammatory panel strips containing 51 selected inflammatory gene polymorphisms from 35 candidate genes. We tested the genotype-stroke association with logistic regression model. Results We found two single nucleotide polymorphisms (SNPs) in CCL11 were associated with ischemic stroke. After adjusting for multiple testing using false discovery rate (FDR) with a 0.20 cut-off point, CCL11 rs4795895 remained statistically significant. We further stratified the study population by their hypertension status. In the hypertensive group, CCR2 rs1799864, CCR5 rs1799987 and CCL11 rs4795895 were nominally associated with increased risk of stroke. In the non-hypertensive group, CCL11 rs3744508, LTC4S rs730012, FCER1B rs569108, TGFB1 rs1800469, LTA rs909253 and CCL11 rs4795895 were associated with ischemic stroke. After correction for multiple testing, CCR2 rs1799864 and CCR5 rs1799987 remained significant in the hypertensive group, and CCL11 rs3744508, LTC4S rs730012, FCER1B rs569108, TGFB1 rs1800469, LTA rs909253 remained significant in the non-hypertensive group. Conclusions Our results indicate that inflammatory genetic variants are associated with increased risk of ischemic stroke in a Chinese Han population, particularly in non-hypertensive individuals. PMID:22769019

Genetic variation at the Th2 immune gene IL13 is associated with IgE-mediated paediatric food allergy.

PubMed

Ashley, S E; Tan, H-T T; Peters, R; Allen, K J; Vuillermin, P; Dharmage, S C; Tang, M L K; Koplin, J; Lowe, A; Ponsonby, A-L; Molloy, J; Matheson, M C; Saffery, R; Ellis, J A; Martino, D

2017-08-01

Food allergies pose a considerable world-wide public health burden with incidence as high as one in ten in 12-month-old infants. Few food allergy genetic risk variants have yet been identified. The Th2 immune gene IL13 is a highly plausible genetic candidate as it is central to the initiation of IgE class switching in B cells. Here, we sought to investigate whether genetic polymorphisms at IL13 are associated with the development of challenge-proven IgE-mediated food allergy. We genotyped nine IL13 "tag" single nucleotide polymorphisms (tag SNPs) in 367 challenge-proven food allergic cases, 199 food-sensitized tolerant cases and 156 non-food allergic controls from the HealthNuts study. 12-month-old infants were phenotyped using open oral food challenges. SNPs were tested using Cochran-Mantel-Haenszel test adjusted for ancestry strata. A replication study was conducted in an independent, co-located sample of four paediatric cohorts consisting of 203 food allergic cases and 330 non-food allergic controls. Replication sample phenotypes were defined by clinical history of reactivity, 95% PPV or challenge, and IL13 genotyping was performed. IL13 rs1295686 was associated with challenge-proven food allergy in the discovery sample (P=.003; OR=1.75; CI=1.20-2.53). This association was also detected in the replication sample (P=.03, OR=1.37, CI=1.03-1.82) and further supported by a meta-analysis (P=.0006, OR=1.50). However, we cannot rule out an association with food sensitization. Carriage of the rs1295686 variant A allele was also associated with elevated total plasma IgE. We show for the first time, in two independent cohorts, that IL13 polymorphism rs1295686 (in complete linkage disequilibrium with functional variant rs20541) is associated with challenge-proven food allergy. © 2017 John Wiley & Sons Ltd.

Gene Presence-Absence Polymorphism in Castrating Anther-Smut Fungi: Recent Gene Gains and Phylogeographic Structure.

PubMed

Hartmann, Fanny E; Rodríguez de la Vega, Ricardo C; Brandenburg, Jean-Tristan; Carpentier, Fantin; Giraud, Tatiana

2018-04-01

Gene presence-absence polymorphisms segregating within species are a significant source of genetic variation but have been little investigated to date in natural populations. In plant pathogens, the gain or loss of genes encoding proteins interacting directly with the host, such as secreted proteins, probably plays an important role in coevolution and local adaptation. We investigated gene presence-absence polymorphism in populations of two closely related species of castrating anther-smut fungi, Microbotryum lychnidis-dioicae (MvSl) and M. silenes-dioicae (MvSd), from across Europe, on the basis of Illumina genome sequencing data and high-quality genome references. We observed presence-absence polymorphism for 186 autosomal genes (2% of all genes) in MvSl, and only 51 autosomal genes in MvSd. Distinct genes displayed presence-absence polymorphism in the two species. Genes displaying presence-absence polymorphism were frequently located in subtelomeric and centromeric regions and close to repetitive elements, and comparison with outgroups indicated that most were present in a single species, being recently acquired through duplications in multiple-gene families. Gene presence-absence polymorphism in MvSl showed a phylogeographic structure corresponding to clusters detected based on SNPs. In addition, gene absence alleles were rare within species and skewed toward low-frequency variants. These findings are consistent with a deleterious or neutral effect for most gene presence-absence polymorphism. Some of the observed gene loss and gain events may however be adaptive, as suggested by the putative functions of the corresponding encoded proteins (e.g., secreted proteins) or their localization within previously identified selective sweeps. The adaptive roles in plant and anther-smut fungi interactions of candidate genes however need to be experimentally tested in future studies.

Gene Presence–Absence Polymorphism in Castrating Anther-Smut Fungi: Recent Gene Gains and Phylogeographic Structure

PubMed Central

Rodríguez de la Vega, Ricardo C; Brandenburg, Jean-Tristan; Carpentier, Fantin; Giraud, Tatiana

2018-01-01

Abstract Gene presence–absence polymorphisms segregating within species are a significant source of genetic variation but have been little investigated to date in natural populations. In plant pathogens, the gain or loss of genes encoding proteins interacting directly with the host, such as secreted proteins, probably plays an important role in coevolution and local adaptation. We investigated gene presence–absence polymorphism in populations of two closely related species of castrating anther-smut fungi, Microbotryum lychnidis-dioicae (MvSl) and M. silenes-dioicae (MvSd), from across Europe, on the basis of Illumina genome sequencing data and high-quality genome references. We observed presence–absence polymorphism for 186 autosomal genes (2% of all genes) in MvSl, and only 51 autosomal genes in MvSd. Distinct genes displayed presence–absence polymorphism in the two species. Genes displaying presence–absence polymorphism were frequently located in subtelomeric and centromeric regions and close to repetitive elements, and comparison with outgroups indicated that most were present in a single species, being recently acquired through duplications in multiple-gene families. Gene presence–absence polymorphism in MvSl showed a phylogeographic structure corresponding to clusters detected based on SNPs. In addition, gene absence alleles were rare within species and skewed toward low-frequency variants. These findings are consistent with a deleterious or neutral effect for most gene presence–absence polymorphism. Some of the observed gene loss and gain events may however be adaptive, as suggested by the putative functions of the corresponding encoded proteins (e.g., secreted proteins) or their localization within previously identified selective sweeps. The adaptive roles in plant and anther-smut fungi interactions of candidate genes however need to be experimentally tested in future studies. PMID:29722826

Androgen receptor repeat length polymorphism associated with male-to-female transsexualism.

PubMed

Hare, Lauren; Bernard, Pascal; Sánchez, Francisco J; Baird, Paul N; Vilain, Eric; Kennedy, Trudy; Harley, Vincent R

2009-01-01

There is a likely genetic component to transsexualism, and genes involved in sex steroidogenesis are good candidates. We explored the specific hypothesis that male-to-female transsexualism is associated with gene variants responsible for undermasculinization and/or feminization. Specifically, we assessed the role of disease-associated repeat length polymorphisms in the androgen receptor (AR), estrogen receptor beta (ERbeta), and aromatase (CYP19) genes. Subject-control analysis included 112 male-to-female transsexuals and 258 non-transsexual males. Associations and interactions were investigated between CAG repeat length in the AR gene, CA repeat length in the ERbeta gene, and TTTA repeat length in the CYP19 gene and male-to-female transsexualism. A significant association was identified between transsexualism and the AR allele, with transsexuals having longer AR repeat lengths than non-transsexual male control subjects (p=.04). No associations for transsexualism were evident in repeat lengths for CYP19 or ERbeta genes. Individuals were then classified as short or long for each gene polymorphism on the basis of control median polymorphism lengths in order to further elucidate possible combined effects. No interaction associations between the three genes and transsexualism were identified. This study provides evidence that male gender identity might be partly mediated through the androgen receptor.

Androgen Receptor Repeat Length Polymorphism Associated with Male-to-Female Transsexualism

PubMed Central

Hare, Lauren; Bernard, Pascal; Sánchez, Francisco J.; Baird, Paul N.; Vilain, Eric; Kennedy, Trudy; Harley, Vincent R.

2012-01-01

Background There is a likely genetic component to transsexualism, and genes involved in sex steroidogenesis are good candidates. We explored the specific hypothesis that male-to-female transsexualism is associated with gene variants responsible for undermasculinization and/or feminization. Specifically, we assessed the role of disease-associated repeat length polymorphisms in the androgen receptor (AR), estrogen receptor β (ERβ), and aromatase (CYP19) genes. Methods Subject-control analysis included 112 male-to-female transsexuals and 258 non-transsexual males. Associations and interactions were investigated between CAG repeat length in the AR gene, CA repeat length in the ERβ gene, and TTTA repeat length in the CYP19 gene and male-to-female transsexualism. Results A significant association was identified between transsexualism and the AR allele, with transsexuals having longer AR repeat lengths than non-transsexual male control subjects (p = .04). No associations for transsexualism were evident in repeat lengths for CYP19 or ERβ genes. Individuals were then classified as short or long for each gene polymorphism on the basis of control median polymorphism lengths in order to further elucidate possible combined effects. No interaction associations between the three genes and transsexualism were identified. Conclusions This study provides evidence that male gender identity might be partly mediated through the androgen receptor. PMID:18962445

E2 allele of the apolipoprotein E gene polymorphism is predictive for obesity status in Roma minority population of Croatia.

PubMed

Zeljko, Hrvojka Marija; Škarić-Jurić, Tatjana; Narančić, Nina Smolej; Tomas, Željka; Barešić, Ana; Salihović, Marijana Peričić; Starčević, Boris; Janićijević, Branka

2011-01-18

The Roma (Gypsies) are a transnational minority, founder population characterized by unique genetic background modeled by culturally determined endogamy. The present study explores whether the widely found cardiovascular diseases (CVD) risk effects of ACE I/D, APOE (ε2, ε3, ε4), eNOS-VNTR and LEP G2548A polymorphisms can be replicated in this specific population. The community-based study was carried on 208 adult Bayash Roma living in rural settlements of eastern and northern Croatia. Risk effect of four CVD candidate polymorphisms are related to the most prominent classical CVD risk phenotypes: obesity indicators (body mass index and waist circumference), hypertension and hyperlipidemia (triglycerides, HDL and LDL cholesterol). For all of them the standard risk cut-offs were applied. The extent to which the phenotypic status is related to genotype was assessed by logistic regression analysis. The strongest associations were found for ε2 allele of the APOE as a predictor of waist circumference (OR 3.301; 95%CI 1.254-8.688; p = 0.016) as well as for BMI (OR 3.547; 95%CI 1.471-8.557; p = 0.005). It is notable that ε3 allele of APOE gene turned out to be a protective genetic factor determining low lipid levels. The strength of the relation and the similarity of the results obtained for both tested indicators of obesity provide firm evidence that APOE plays an important role in obesity development in the Roma population.

Normal variation in fronto-occipital circuitry and cerebellar structure with an autism-associated polymorphism of CNTNAP2

PubMed Central

Tan, Geoffrey C.Y.; Doke, Thomas F.; Ashburner, John; Wood, Nicholas W.; Frackowiak, Richard S.J.

2010-01-01

Recent genetic studies have implicated a number of candidate genes in the pathogenesis of Autism Spectrum Disorder (ASD). Polymorphisms of CNTNAP2 (contactin-associated like protein-2), a member of the neurexin family, have already been implicated as a susceptibility gene for autism by at least 3 separate studies. We investigated variation in white and grey matter morphology using structural MRI and diffusion tensor imaging. We compared volumetric differences in white and grey matter and fractional anisotropy values in control subjects characterised by genotype at rs7794745, a single nucleotide polymorphism in CNTNAP2. Homozygotes for the risk allele showed significant reductions in grey and white matter volume and fractional anisotropy in several regions that have already been implicated in ASD, including the cerebellum, fusiform gyrus, occipital and frontal cortices. Male homozygotes for the risk alleles showed greater reductions in grey matter in the right frontal pole and in FA in the right rostral fronto-occipital fasciculus compared to their female counterparts who showed greater reductions in FA of the anterior thalamic radiation. Thus a risk allele for autism results in significant cerebral morphological variation, despite the absence of overt symptoms or behavioural abnormalities. The results are consistent with accumulating evidence of CNTNAP2's function in neuronal development. The finding suggests the possibility that the heterogeneous manifestations of ASD can be aetiologically characterised into distinct subtypes through genetic-morphological analysis. PMID:20176116

Whole-Exome Sequencing Study of Thyrotropin-Secreting Pituitary Adenomas.

PubMed

Sapkota, Santosh; Horiguchi, Kazuhiko; Tosaka, Masahiko; Yamada, Syozo; Yamada, Masanobu

2017-02-01

Thyrotropin (TSH)-secreting pituitary adenomas (TSHomas) are a rare cause of hyperthyroidism, and the genetic aberrations responsible remain unknown. To identify somatic genetic abnormalities in TSHomas. A single-nucleotide polymorphism (SNP) array analysis was performed on 8 TSHomas. Four tumors with no allelic losses or limited loss of heterozygosity were selected, and whole-exome sequencing was performed, including their corresponding blood samples. Somatic variants were confirmed by Sanger sequencing. A set of 8 tumors was also assessed to validate candidate genes. Twelve patients with sporadic TSHomas were examined. The overall performance of whole-exome sequencing was good, with an average coverage of each base in the targeted region of 97.6%. Six DNA variants were confirmed as candidate driver mutations, with an average of 1.5 somatic mutations per tumor. No mutations were recurrent. Two of these mutations were found in genes with an established role in malignant tumorigenesis (SMOX and SYTL3), and 4 had unknown roles (ZSCAN23, ASTN2, R3HDM2, and CWH43). Similarly, an SNP array analysis revealed frequent chromosomal regions of copy number gains, including recurrent gains at loci harboring 4 of these 6 genes. Several candidate somatic mutations and changes in copy numbers for TSHomas were identified. The results showed no recurrence of mutations in the tumors studied but a low number of mutations, thereby highlighting their benign nature. Further studies on a larger cohort of TSHomas, along with the use of epigenetic and transcriptomic approaches, may reveal the underlying genetic lesions. Copyright © 2017 by the Endocrine Society

Landscape genomic analysis of candidate genes for climate adaptation in a California endemic oak, Quercus lobata.

PubMed

Sork, Victoria L; Squire, Kevin; Gugger, Paul F; Steele, Stephanie E; Levy, Eric D; Eckert, Andrew J

2016-01-01

The ability of California tree populations to survive anthropogenic climate change will be shaped by the geographic structure of adaptive genetic variation. Our goal is to test whether climate-associated candidate genes show evidence of spatially divergent selection in natural populations of valley oak, Quercus lobata, as preliminary indication of local adaptation. Using DNA from 45 individuals from 13 localities across the species' range, we sequenced portions of 40 candidate genes related to budburst/flowering, growth, osmotic stress, and temperature stress. Using 195 single nucleotide polymorphisms (SNPs), we estimated genetic differentiation across populations and correlated allele frequencies with climate gradients using single-locus and multivariate models. The top 5% of FST estimates ranged from 0.25 to 0.68, yielding loci potentially under spatially divergent selection. Environmental analyses of SNP frequencies with climate gradients revealed three significantly correlated SNPs within budburst/flowering genes and two SNPs within temperature stress genes with mean annual precipitation, after controlling for multiple testing. A redundancy model showed a significant association between SNPs and climate variables and revealed a similar set of SNPs with high loadings on the first axis. In the RDA, climate accounted for 67% of the explained variation, when holding climate constant, in contrast to a putatively neutral SSR data set where climate accounted for only 33%. Population differentiation and geographic gradients of allele frequencies in climate-associated functional genes in Q. lobata provide initial evidence of adaptive genetic variation and background for predicting population response to climate change. © 2016 Botanical Society of America.

LEAP: biomarker inference through learning and evaluating association patterns.

PubMed

Jiang, Xia; Neapolitan, Richard E

2015-03-01

Single nucleotide polymorphism (SNP) high-dimensional datasets are available from Genome Wide Association Studies (GWAS). Such data provide researchers opportunities to investigate the complex genetic basis of diseases. Much of genetic risk might be due to undiscovered epistatic interactions, which are interactions in which combination of several genes affect disease. Research aimed at discovering interacting SNPs from GWAS datasets proceeded in two directions. First, tools were developed to evaluate candidate interactions. Second, algorithms were developed to search over the space of candidate interactions. Another problem when learning interacting SNPs, which has not received much attention, is evaluating how likely it is that the learned SNPs are associated with the disease. A complete system should provide this information as well. We develop such a system. Our system, called LEAP, includes a new heuristic search algorithm for learning interacting SNPs, and a Bayesian network based algorithm for computing the probability of their association. We evaluated the performance of LEAP using 100 1,000-SNP simulated datasets, each of which contains 15 SNPs involved in interactions. When learning interacting SNPs from these datasets, LEAP outperformed seven others methods. Furthermore, only SNPs involved in interactions were found to be probable. We also used LEAP to analyze real Alzheimer's disease and breast cancer GWAS datasets. We obtained interesting and new results from the Alzheimer's dataset, but limited results from the breast cancer dataset. We conclude that our results support that LEAP is a useful tool for extracting candidate interacting SNPs from high-dimensional datasets and determining their probability. © 2015 The Authors. *Genetic Epidemiology published by Wiley Periodicals, Inc.

Systematic review and meta-analysis of candidate gene association studies of lower urinary tract symptoms in men.

PubMed

Cartwright, Rufus; Mangera, Altaf; Tikkinen, Kari A O; Rajan, Prabhakar; Pesonen, Jori; Kirby, Anna C; Thiagamoorthy, Ganesh; Ambrose, Chris; Gonzalez-Maffe, Juan; Bennett, Phillip R; Palmer, Tom; Walley, Andrew; Järvelin, Marjo-Riitta; Khullar, Vik; Chapple, Chris

2014-10-01

Although family studies have shown that male lower urinary tract symptoms (LUTS) are highly heritable, no systematic review exists of genetic polymorphisms tested for association with LUTS. To systematically review and meta-analyze studies assessing candidate polymorphisms/genes tested for an association with LUTS, and to assess the strength, consistency, and potential for bias among pooled associations. A systematic search of the PubMed and HuGE databases as well as abstracts of major urologic meetings was performed through to January 2013. Case-control studies reporting genetic associations in men with LUTS were included. Reviewers independently and in duplicate screened titles, abstracts, and full texts to determine eligibility, abstracted data, and assessed the credibility of pooled associations according to the interim Venice criteria. Authors were contacted for clarifications if needed. Meta-analyses were performed for variants assessed in more than two studies. We identified 74 eligible studies containing data on 70 different genes. A total of 35 meta-analyses were performed with statistical significance in five (ACE, ELAC2, GSTM1, TERT, and VDR). The heterogeneity was high in three of these meta-analyses. The rs731236 variant of the vitamin D receptor had a protective effect for LUTS (odds ratio: 0.64; 95% confidence interval, 0.49-0.83) with moderate heterogeneity (I(2)=27.2%). No evidence for publication bias was identified. Limitations include wide-ranging phenotype definitions for LUTS and limited power in most meta-analyses to detect smaller effect sizes. Few putative genetic risk variants have been reliably replicated across populations. We found consistent evidence of a reduced risk of LUTS associated with the common rs731236 variant of the vitamin D receptor gene in our meta-analyses. Combining the results from all previous studies of genetic variants that may cause urinary symptoms in men, we found significant variants in five genes. Only one, a variant of the vitamin D receptor, was consistently protective across different populations. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.

Allelic association of sequence variants in the herpes virus entry mediator-B gene (PVRL2) with the severity of multiple sclerosis.

PubMed

Schmidt, S; Pericak-Vance, M A; Sawcer, S; Barcellos, L F; Hart, J; Sims, J; Prokop, A M; van der Walt, J; DeLoa, C; Lincoln, R R; Oksenberg, J R; Compston, A; Hauser, S L; Haines, J L; Gregory, S G

2006-07-01

Discrepant findings have been reported regarding an association of the apolipoprotein E (APOE) gene with the clinical course of multiple sclerosis (MS). To resolve these discrepancies, we examined common sequence variation in six candidate genes residing in a 380-kb genomic region surrounding and including the APOE locus for an association with MS severity. We genotyped at least three polymorphisms in each of six candidate genes in 1,540 Caucasian MS families (729 single-case and multiple-case families from the United States, 811 single-case families from the UK). By applying the quantitative transmission/disequilibrium test to a recently proposed MS severity score, the only statistically significant (P=0.003) association with MS severity was found for an intronic variant in the Herpes Virus Entry Mediator-B Gene PVRL2. Additional genotyping extended the association to a 16.6 kb block spanning intron 1 to intron 2 of the gene. Sequencing of PVRL2 failed to identify variants with an obvious functional role. In conclusion, the analysis of a very large data set suggests that genetic polymorphisms in PVRL2 may influence MS severity and supports the possibility that viral factors may contribute to the clinical course of MS, consistent with previous reports.

Characterization of the canine desmin (DES) gene and evaluation as a candidate gene for dilated cardiomyopathy in the Dobermann.

PubMed

Stabej, Polona; Imholz, Sandra; Versteeg, Serge A; Zijlstra, Carla; Stokhof, Arnold A; Domanjko-Petric, Aleksandra; Leegwater, Peter A J; van Oost, Bernard A

2004-10-13

Canine-dilated cardiomyopathy (DCM) in dogs is a disease of the myocardium associated with dilatation and impaired contraction of the ventricles and is suspected to have a genetic cause. A missense mutation in the desmin gene (DES) causes DCM in a human family. Human DCM closely resembles the canine disease. In the present study, we evaluated whether DES gene mutations are responsible for DCM in Dobermann dogs. We have isolated bacterial artificial chromosome clones (BACs) containing the canine DES gene and determined the chromosomal location by fluorescence in situ hybridization (FISH). Using data deposited in the NCBI trace archive and GenBank, the canine DES gene DNA sequence was assembled and seven single nucleotide polymorphisms (SNPs) were identified. From the canine DES gene BAC clones, a polymorphic microsatellite marker was isolated. The microsatellite marker and four informative desmin SNPs were typed in a Dobermann family with frequent DCM occurrence, but the disease phenotype did not associate with a desmin haplotype. We concluded that mutations in the DES gene do not play a role in Dobermann DCM. Availability of the microsatellite marker, SNPs and DNA sequence reported in this study enable fast evaluation of the DES gene as a DCM candidate gene in other dog breeds with DCM occurrence.

Identification of homogeneous genetic architecture of multiple genetically correlated traits by block clustering of genome-wide associations.

PubMed

Gupta, Mayetri; Cheung, Ching-Lung; Hsu, Yi-Hsiang; Demissie, Serkalem; Cupples, L Adrienne; Kiel, Douglas P; Karasik, David

2011-06-01

Genome-wide association studies (GWAS) using high-density genotyping platforms offer an unbiased strategy to identify new candidate genes for osteoporosis. It is imperative to be able to clearly distinguish signal from noise by focusing on the best phenotype in a genetic study. We performed GWAS of multiple phenotypes associated with fractures [bone mineral density (BMD), bone quantitative ultrasound (QUS), bone geometry, and muscle mass] with approximately 433,000 single-nucleotide polymorphisms (SNPs) and created a database of resulting associations. We performed analysis of GWAS data from 23 phenotypes by a novel modification of a block clustering algorithm followed by gene-set enrichment analysis. A data matrix of standardized regression coefficients was partitioned along both axes--SNPs and phenotypes. Each partition represents a distinct cluster of SNPs that have similar effects over a particular set of phenotypes. Application of this method to our data shows several SNP-phenotype connections. We found a strong cluster of association coefficients of high magnitude for 10 traits (BMD at several skeletal sites, ultrasound measures, cross-sectional bone area, and section modulus of femoral neck and shaft). These clustered traits were highly genetically correlated. Gene-set enrichment analyses indicated the augmentation of genes that cluster with the 10 osteoporosis-related traits in pathways such as aldosterone signaling in epithelial cells, role of osteoblasts, osteoclasts, and chondrocytes in rheumatoid arthritis, and Parkinson signaling. In addition to several known candidate genes, we also identified PRKCH and SCNN1B as potential candidate genes for multiple bone traits. In conclusion, our mining of GWAS results revealed the similarity of association results between bone strength phenotypes that may be attributed to pleiotropic effects of genes. This knowledge may prove helpful in identifying novel genes and pathways that underlie several correlated phenotypes, as well as in deciphering genetic and phenotypic modularity underlying osteoporosis risk. Copyright © 2011 American Society for Bone and Mineral Research.

Convergent functional genomics of schizophrenia: from comprehensive understanding to genetic risk prediction

PubMed Central

Ayalew, M; Le-Niculescu, H; Levey, D F; Jain, N; Changala, B; Patel, S D; Winiger, E; Breier, A; Shekhar, A; Amdur, R; Koller, D; Nurnberger, J I; Corvin, A; Geyer, M; Tsuang, M T; Salomon, D; Schork, N J; Fanous, A H; O'Donovan, M C; Niculescu, A B

2012-01-01

We have used a translational convergent functional genomics (CFG) approach to identify and prioritize genes involved in schizophrenia, by gene-level integration of genome-wide association study data with other genetic and gene expression studies in humans and animal models. Using this polyevidence scoring and pathway analyses, we identify top genes (DISC1, TCF4, MBP, MOBP, NCAM1, NRCAM, NDUFV2, RAB18, as well as ADCYAP1, BDNF, CNR1, COMT, DRD2, DTNBP1, GAD1, GRIA1, GRIN2B, HTR2A, NRG1, RELN, SNAP-25, TNIK), brain development, myelination, cell adhesion, glutamate receptor signaling, G-protein–coupled receptor signaling and cAMP-mediated signaling as key to pathophysiology and as targets for therapeutic intervention. Overall, the data are consistent with a model of disrupted connectivity in schizophrenia, resulting from the effects of neurodevelopmental environmental stress on a background of genetic vulnerability. In addition, we show how the top candidate genes identified by CFG can be used to generate a genetic risk prediction score (GRPS) to aid schizophrenia diagnostics, with predictive ability in independent cohorts. The GRPS also differentiates classic age of onset schizophrenia from early onset and late-onset disease. We also show, in three independent cohorts, two European American and one African American, increasing overlap, reproducibility and consistency of findings from single-nucleotide polymorphisms to genes, then genes prioritized by CFG, and ultimately at the level of biological pathways and mechanisms. Finally, we compared our top candidate genes for schizophrenia from this analysis with top candidate genes for bipolar disorder and anxiety disorders from previous CFG analyses conducted by us, as well as findings from the fields of autism and Alzheimer. Overall, our work maps the genomic and biological landscape for schizophrenia, providing leads towards a better understanding of illness, diagnostics and therapeutics. It also reveals the significant genetic overlap with other major psychiatric disorder domains, suggesting the need for improved nosology. PMID:22584867

Pharmacogenetics of risperidone therapy in autism: association analysis of eight candidate genes with drug efficacy and adverse drug reactions.

PubMed

Correia, C T; Almeida, J P; Santos, P E; Sequeira, A F; Marques, C E; Miguel, T S; Abreu, R L; Oliveira, G G; Vicente, A M

2010-10-01

Little has been reported on the factors, genetic or other, that underlie the variability in individual response, particularly for autism. In this study we simultaneously explored the effects of multiple candidate genes on clinical improvement and occurrence of adverse drug reactions, in 45 autistic patients who received monotherapy with risperidone up to 1 year. Candidate genes involved in the pharmacokinetics (CYP2D6 and ABCB1) and pharmacodynamics (HTR2A, HTR2C, DRD2, DRD3, HTR6) of the drug, and the brain-derived neurotrophic factor (BDNF) gene, were analysed. Using the generalized estimating equation method these genes were tested for association with drug efficacy, assessed with the Autism Treatment Evaluation Checklist, and with safety and tolerability measures, such as prolactin levels, body mass index (BMI), waist circumference and neurological adverse effects, including extrapyramidal movements. Our results confirm that risperidone therapy was very effective in reducing some autism symptoms and caused few serious adverse effects. After adjusting for confounding factors, the HTR2A c.-1438G>A, DRD3 Ser9Gly, HTR2C c.995G>A and ABCB1 1236C>T polymorphisms were predictors for clinical improvement with risperidone therapy. The HTR2A c.-1438G>A, HTR2C c.68G>C (p.C33S), HTR6 c.7154-2542C>T and BDNF c.196G>A (p.V66M) polymorphisms influenced prolactin elevation. HTR2C c.68G>C and CYP2D6 polymorphisms were associated with risperidone-induced increase in BMI or waist circumference. We thus identified for the first time several genes implicated in risperidone efficacy and safety in autism patients. Although association results require replication, given the small sample size, the study makes a preliminary contribution to the personalized therapy of risperidone in autism.

Genetic polymorphisms in the ESR1 gene and cerebral infarction risk: a meta-analysis.

PubMed

Gao, Hong-Hua; Gao, Lian-Bo; Wen, Jia-Mei

2014-09-01

A number of studies have documented that estrogen receptor α (ESR1) may play an important role in the development and progression of cerebral infarction, but many existing studies have yielded inconclusive results. This meta-analysis was performed to evaluate the relationships between ESR1 genetic polymorphisms and cerebral infarction risk. The PubMed, CISCOM, CINAHL, Web of Science, Google Scholar, EBSCO, Cochrane Library, and CBM databases were searched for relevant articles published before October 1, 2013, without any language restrictions. Meta-analysis was conducted using the STATA 12.0 software. Seven case-control studies were included with a total of 1471 patients with cerebral infarction and 4688 healthy control subjects. Two common single-nucleotide polymorphisms (SNPs) in the ESR1 gene (rs2234693 T>C and rs9340799 A>G) were assessed. Our meta-analysis results revealed that ESR1 genetic polymorphisms might increase the risk of cerebral infarction. Subgroup analysis by SNP type indicated that both rs2234693 and rs9340799 polymorphisms in the ESR1 gene were strongly associated with an increased risk of cerebral infarction. Further subgroup analysis by ethnicity showed significant associations between ESR1 genetic polymorphisms and increased risk of cerebral infarction among both Asians and Caucasians. In the stratified subgroup analysis by gender, the results suggested that ESR1 genetic polymorphisms were associated with an increased risk of cerebral infarction in the female population. However, there were no statistically significant associations between ESR1 genetic polymorphisms and cerebral infarction risk in the male population. Meta-regression analyses also confirmed that gender might be a main source of heterogeneity. Our findings indicate that ESR1 genetic polymorphisms may contribute to the development of cerebral infarction, especially in the female population.

Genetic Polymorphisms and Weight Loss in Obesity: A Randomised Trial of Hypo-Energetic High- versus Low-Fat Diets

PubMed Central

Sørensen, Thorkild I. A; Boutin, Philippe; Taylor, Moira A; Larsen, Lesli H; Verdich, Camilla; Petersen, Liselotte; Holst, Claus; Echwald, Søren M; Dina, Christian; Toubro, Søren; Petersen, Martin; Polak, Jan; Clément, Karine; Martínez, J. Alfredo; Langin, Dominique; Oppert, Jean-Michel; Stich, Vladimir; Macdonald, Ian; Arner, Peter; Saris, Wim H. M; Pedersen, Oluf; Astrup, Arne; Froguel, Philippe

2006-01-01

Objectives: To study if genes with common single nucleotide polymorphisms (SNPs) associated with obesity-related phenotypes influence weight loss (WL) in obese individuals treated by a hypo-energetic low-fat or high-fat diet. Design: Randomised, parallel, two-arm, open-label multi-centre trial. Setting: Eight clinical centres in seven European countries. Participants: 771 obese adult individuals. Interventions: 10-wk dietary intervention to hypo-energetic (−600 kcal/d) diets with a targeted fat energy of 20%–25% or 40%–45%, completed in 648 participants. Outcome Measures: WL during the 10 wk in relation to genotypes of 42 SNPs in 26 candidate genes, probably associated with hypothalamic regulation of appetite, efficiency of energy expenditure, regulation of adipocyte differentiation and function, lipid and glucose metabolism, or production of adipocytokines, determined in 642 participants. Results: Compared with the noncarriers of each of the SNPs, and after adjusting for gender, age, baseline weight and centre, heterozygotes showed WL differences that ranged from −0.6 to 0.8 kg, and homozygotes, from −0.7 to 3.1 kg. Genotype-dependent additional WL on low-fat diet ranged from 1.9 to −1.6 kg in heterozygotes, and from 3.8 kg to −2.1 kg in homozygotes relative to the noncarriers. Considering the multiple testing conducted, none of the associations was statistically significant. Conclusions: Polymorphisms in a panel of obesity-related candidate genes play a minor role, if any, in modulating weight changes induced by a moderate hypo-energetic low-fat or high-fat diet. PMID:16871334

Association Study of the β2-Adrenergic Receptor Gene Polymorphisms and Hypertension in the Northern Han Chinese

PubMed Central

Li, Yao; Liu, Ya; Wang, Zuoguang; Liu, Kuo; Wu, Hai; Niu, Qiuli; Gu, Wei; Guo, Yanhong; Li, Zhizhong; Wen, Shaojun

2011-01-01

Background The β2-adrenergic receptor (ADRB2) gene has been widely researched as a candidate gene for essential hypertension (EH), but no consensus has been reached in different ethnicities. The aim of the present study was to evaluate the possible association between the ADRB2 gene polymorphisms and the EH risk in the Northern Han Chinese population. Methodology/Principal Findings This study included 747 hypertensive subjects and 390 healthy volunteers as control subjects in the Northern Han Chinese. Genotyping was performed to identify the C-47T, A46G and C79G polymorphisms of the ADRB2 gene. G allelic frequency of A46G polymorphism was significantly higher in hypertensive subjects (P = 0.011, OR = 1.287, 95%CI [1.059–1.565]) than that in controls. Significant association could also be found in dominant genetic model (GG+AG vs. AA, P = 0.006, OR = 1.497, 95%CI [1.121–1.998]), in homozygote comparison (GG vs. AA, P = 0.025, OR = 1.568, 95%CI [1.059–2.322]), and in additive genetic model (GG vs. AG vs. AA, P = 0.012, OR = 1.282, 95%CI [1.056–1.555]). Subgroup analyses performed by gender suggested that this association could be found in male, but not in female. Stratification analyses by obesity showed that A46G polymorphism was related to the prevalence of hypertension in the obese population (GG vs. AG vs. AA, P<0.001, OR = 1.645, 95%CI [1.258–2.151]). Significant interaction was found between A46G genotypes and body mass index on EH risk. No significant association could be found between C-47T or C79G polymorphism and EH risk. Linkage disequilibrium was detected between the C-47T, A46G and C79G polymorphisms. Haplotype analyses observed that the T-47-A46-C79 haplotype was a protective haplotype for EH, while the T-47-G46-C79 haplotype increased the risk. Conclusions/Significances We revealed that the ADRB2 A46G polymorphism might increase the risk for EH in the Northern Han Chinese population. PMID:21483652

Polymorphisms in the Inflammatory Pathway Genes TLR2, TLR4, TLR9, LY96, NFKBIA, NFKB1, TNFA, TNFRSF1A, IL6R, IL10, IL23R, PTPN22, and PPARG Are Associated with Susceptibility of Inflammatory Bowel Disease in a Danish Cohort

PubMed Central

Bank, Steffen; Skytt Andersen, Paal; Burisch, Johan; Pedersen, Natalia; Roug, Stine; Galsgaard, Julie; Ydegaard Turino, Stine; Broder Brodersen, Jacob; Rashid, Shaista; Kaiser Rasmussen, Britt; Avlund, Sara; Bastholm Olesen, Thomas; Jürgen Hoffmann, Hans; Kragh Thomsen, Marianne; Østergaard Thomsen, Vibeke; Frydenberg, Morten; Andersen Nexø, Bjørn; Sode, Jacob; Vogel, Ulla; Andersen, Vibeke

2014-01-01

Background The inflammatory bowel diseases (IBD), Crohn's disease (CD) and ulcerative colitis (UC), result from the combined effects of susceptibility genes and environmental factors. Polymorphisms in genes regulating inflammation may explain part of the genetic heritage. Methods Using a candidate gene approach, 39 mainly functional single nucleotide polymorphisms (SNPs) in 26 genes regulating inflammation were assessed in a clinical homogeneous group of severely diseased patients consisting of 624 patients with CD, 411 patients with UC and 795 controls. The results were analysed using logistic regression. Results Sixteen polymorphisms in 13 genes involved in regulation of inflammation were associated with risk of CD and/or UC (p≤0.05). The polymorphisms TLR2 (rs1816702), NFKB1 (rs28362491), TNFRSF1A (rs4149570), IL6R (rs4537545), IL23R (rs11209026) and PTPN22 (rs2476601) were associated with risk of CD and the polymorphisms TLR2 (rs1816702), TLR4 (rs1554973 and rs12377632), TLR9 (rs352139), LY96 (rs11465996), NFKBIA (rs696), TNFA (rs1800629), TNFRSF1A (rs4149570), IL10 (rs3024505), IL23R (rs11209026), PTPN22 (rs2476601) and PPARG (rs1801282) were associated with risk of UC. When including all patients (IBD) the polymorphisms TLR2 (rs4696480 and rs1816702), TLR4 (rs1554973 and rs12377632), TLR9 (rs187084), TNFRSF1A (rs4149570), IL6R (rs4537545), IL10 (rs3024505), IL23R (rs11209026) and PTPN22 (rs2476601) were associated with risk. After Bonferroni correction for multiple testing, both the homozygous and the heterozygous variant genotypes of IL23R G>A(rs11209026) (ORCD,adj: 0.38, 95% CI: 0.21–0.67, p = 0.03; ORIBD,adj 0.43, 95% CI: 0.28–0.67, p = 0.007) and PTPN22 1858 G>A(rs2476601) (ORCD,unadj 0.54, 95% CI: 0.41–0.72, p = 7*10−4; ORIBD,unadj: 0.61, 95% CI: 0.48–0.77, p = 0.001) were associated with reduced risk of CD. Conclusion The biological effects of the studied polymorphisms suggest that genetically determined high inflammatory response was associated with increased risk of CD. The many SNPs found in TLRs suggest that the host microbial composition or environmental factors in the gut are involved in risk of IBD in genetically susceptible individuals. PMID:24971461

Genetic Correlates of Individual Differences in Sleep Behavior of Free-Living Great Tits (Parus major)

PubMed Central

Stuber, Erica F.; Baumgartner, Christine; Dingemanse, Niels J.; Kempenaers, Bart; Mueller, Jakob C.

2016-01-01

Within populations, free-living birds display considerable variation in observable sleep behaviors, reflecting dynamic interactions between individuals and their environment. Genes are expected to contribute to repeatable between-individual differences in sleep behaviors, which may be associated with individual fitness. We identified and genotyped polymorphisms in nine candidate genes for sleep, and measured five repeatable sleep behaviors in free-living great tits (Parus major), partly replicating a previous study in blue tits (Cyanistes caeruleus). Microsatellites in the CLOCK and NPAS2 clock genes exhibited an association with sleep duration relative to night length, and morning latency to exit the nest box, respectively. Furthermore, microsatellites in the NPSR1 and PCSK2 genes associated with relative sleep duration and proportion of time spent awake at night, respectively. Given the detection rate of associations in the same models run with random markers instead of candidate genes, we expected two associations to arise by chance. The detection of four associations between candidate genes and sleep, however, suggests that clock genes, a clock-related gene, or a gene involved in the melanocortin system, could play key roles in maintaining phenotypic variation in sleep behavior in avian populations. Knowledge of the genetic architecture underlying sleep behavior in the wild is important because it will enable ecologists to assess the evolution of sleep in response to selection. PMID:26739645

Cumulative Genetic Risk Predicts Platinum/Taxane-Induced Neurotoxicity

PubMed Central

McWhinney-Glass, Sarah; Winham, Stacey J.; Hertz, Daniel L.; Revollo, Jane Yen; Paul, Jim; He, Yijing; Brown, Robert; Motsinger-Reif, Alison A.; McLeod, Howard L.

2013-01-01

Purpose The combination of a platinum and taxane are standard of care for many cancers, but the utility is often limited due to debilitating neurotoxicity. We examined whether single nucleotide polymorphisms (SNPs) from annotated candidate genes will identify genetic risk for chemotherapy-induced neurotoxicity. Patients and Methods A candidate-gene association study was conducted to validate the relevance of 1261 SNPs within 60 candidate genes in 404 ovarian cancer patients receiving platinum/taxane chemotherapy on the SCOTROC1 trial. Statistically significant variants were then assessed for replication in a separate 404 patient replication cohort from SCOTROC1. Results Significant associations with chemotherapy-induced neurotoxicity were identified and replicated for four SNPs in SOX10, BCL2, OPRM1, and TRPV1. The Population Attributable Risk for each of the four SNPs ranged from 5–35%, with a cumulative risk of 62%. According to the multiplicative model, the odds of developing neurotoxicity increase by a factor of 1.64 for every risk genotype. Patients possessing 3 risk variants have an estimated odds ratio of 4.49 (2.36–8.54) compared to individuals with 0 risk variants. Neither the four SNPs nor the risk score were associated with progression free survival or overall survival. Conclusions This study demonstrates that SNPs in four genes have a significant cumulative association with increased risk for the development of chemotherapy-induced neurotoxicity, independent of patient survival. PMID:23963862

Analysis of 60 reported glioma risk SNPs replicates published GWAS findings but fails to replicate associations from published candidate-gene studies.

PubMed

Walsh, Kyle M; Anderson, Erik; Hansen, Helen M; Decker, Paul A; Kosel, Matt L; Kollmeyer, Thomas; Rice, Terri; Zheng, Shichun; Xiao, Yuanyuan; Chang, Jeffrey S; McCoy, Lucie S; Bracci, Paige M; Wiemels, Joe L; Pico, Alexander R; Smirnov, Ivan; Lachance, Daniel H; Sicotte, Hugues; Eckel-Passow, Jeanette E; Wiencke, John K; Jenkins, Robert B; Wrensch, Margaret R

2013-02-01

Genomewide association studies (GWAS) and candidate-gene studies have implicated single-nucleotide polymorphisms (SNPs) in at least 45 different genes as putative glioma risk factors. Attempts to validate these associations have yielded variable results and few genetic risk factors have been consistently replicated. We conducted a case-control study of Caucasian glioma cases and controls from the University of California San Francisco (810 cases, 512 controls) and the Mayo Clinic (852 cases, 789 controls) in an attempt to replicate previously reported genetic risk factors for glioma. Sixty SNPs selected from the literature (eight from GWAS and 52 from candidate-gene studies) were successfully genotyped on an Illumina custom genotyping panel. Eight SNPs in/near seven different genes (TERT, EGFR, CCDC26, CDKN2A, PHLDB1, RTEL1, TP53) were significantly associated with glioma risk in the combined dataset (P < 0.05), with all associations in the same direction as in previous reports. Several SNP associations showed considerable differences across histologic subtype. All eight successfully replicated associations were first identified by GWAS, although none of the putative risk SNPs from candidate-gene studies was associated in the full case-control sample (all P values > 0.05). Although several confirmed associations are located near genes long known to be involved in gliomagenesis (e.g., EGFR, CDKN2A, TP53), these associations were first discovered by the GWAS approach and are in noncoding regions. These results highlight that the deficiencies of the candidate-gene approach lay in selecting both appropriate genes and relevant SNPs within these genes. © 2012 WILEY PERIODICALS, INC.

Molecular and genetic ecotoxicologic approaches to aquatic environmental bioreporting.

PubMed Central

Beaty, B J; Black, W C; Carlson, J O; Clements, W H; DuTeau, N; Harrahy, E; Nuckols, J; Kenneth, E; Olson, K E; Rayms-Keller, A

1998-01-01

Molecular and population genetic ecotoxicologic approaches are being developed for the utilization of arthropods as bioreporters of heavy metal mixtures in the environment. The explosion of knowledge in molecular biology, molecular genetics, and biotechnology provides an unparalleled opportunity to use arthropods as bioreporter organisms. Interspecific differences in aquatic arthropod populations have been previously demonstrated in response to heavy metal insult in the Arkansas River (AR) California Gulch Superfund site (CGSS). Population genetic analyses were conducted on the mayfly Baetis tricaudatus. Genetic polymorphisms were detected in polymerase chain reaction amplified 16S mitochondrial rDNA (a selectively neutral gene) of B tricaudatus using single-strand conformation polymorphism analysis. Genetic differences may have resulted from impediments to gene flow in the population caused by mortality arising from exposure to heavy metal mixture pollution. In laboratory studies a candidate metal-responsive mucinlike gene, which is metal and dose specific, has been identified in Chironomus tentans and other potential AR-CGSS bioreporter species. Population genetic analyses using the mucinlike gene may provide insight into the role of this selectable gene in determining the breeding structure of B. tricaudatus in the AR-CGSS and may provide mechanistic insight into determinants of aquatic arthropod response to heavy metal insult. Metal-responsive (MR) genes and regulatory sequences are being isolated, characterized, and assayed for differential gene expression in response to heavy metal mixture pollution in the AR-CGSS. Identified promoter sequences can then be engineered into previously developed MR constructs to provide sensitive in vitro assays for environmental bioreporting of heavy metal mixtures. The results of the population genetic studies are being entered into an AR geographic information system that contains substantial biological, chemical, and geophysical information. Integrated spatial, structural, and temporal analyses of these parameters will provide invaluable information concerning environmental determinants that restrict or promote gene flow in bioreporter populations. Images Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 PMID:9860898

Sexual selection and genetic colour polymorphisms in animals.

PubMed

Wellenreuther, Maren; Svensson, Erik I; Hansson, Bengt

2014-11-01

Genetic colour polymorphisms are widespread across animals and often subjected to complex selection regimes. Traditionally, colour morphs were used as simple visual markers to measure allele frequency changes in nature, selection, population divergence and speciation. With advances in sequencing technology and analysis methods, several model systems are emerging where the molecular targets of selection are being described. Here, we discuss recent studies on the genetics of sexually selected colour polymorphisms, aiming at (i) reviewing the evidence of sexual selection on colour polymorphisms, (ii) highlighting the genetic architecture, molecular and developmental basis underlying phenotypic colour diversification and (iii) discuss how the maintenance of such polymorphisms might be facilitated or constrained by these. Studies of the genetic architecture of colour polymorphism point towards the importance of tight clustering of colour loci with other trait loci, such as in the case of inversions and supergene structures. Other interesting findings include linkage between colour loci and mate preferences or sex determination, and the role of introgression and regulatory variation in fuelling polymorphisms. We highlight that more studies are needed that explicitly integrate fitness consequences of sexual selection on colour with the underlying molecular targets of colour to gain insights into the evolutionary consequences of sexual selection on polymorphism maintenance. © 2014 John Wiley & Sons Ltd.

Predicting risk in space: Genetic markers for differential vulnerability to sleep restriction

NASA Astrophysics Data System (ADS)

Goel, Namni; Dinges, David F.

2012-08-01

Several laboratories have found large, highly reliable individual differences in the magnitude of cognitive performance, fatigue and sleepiness, and sleep homeostatic vulnerability to acute total sleep deprivation and to chronic sleep restriction in healthy adults. Such individual differences in neurobehavioral performance are also observed in space flight as a result of sleep loss. The reasons for these stable phenotypic differential vulnerabilities are unknown: such differences are not yet accounted for by demographic factors, IQ or sleep need, and moreover, psychometric scales do not predict those individuals cognitively vulnerable to sleep loss. The stable, trait-like (phenotypic) inter-individual differences observed in response to sleep loss—with intraclass correlation coefficients accounting for 58-92% of the variance in neurobehavioral measures—point to an underlying genetic component. To this end, we utilized multi-day highly controlled laboratory studies to investigate the role of various common candidate gene variants—each independently—in relation to cumulative neurobehavioral and sleep homeostatic responses to sleep restriction. These data suggest that common genetic variations (polymorphisms) involved in sleep-wake, circadian, and cognitive regulation may serve as markers for prediction of inter-individual differences in sleep homeostatic and neurobehavioral vulnerability to sleep restriction in healthy adults. Identification of genetic predictors of differential vulnerability to sleep restriction—as determined from candidate gene studies—will help identify astronauts most in need of fatigue countermeasures in space flight and inform medical standards for obtaining adequate sleep in space. This review summarizes individual differences in neurobehavioral vulnerability to sleep deprivation and ongoing genetic efforts to identify markers of such differences.

High-Density Association Study of 383 Candidate Genes for Volumetric BMD at the Femoral Neck and Lumbar Spine Among Older Men

PubMed Central

Yerges, Laura M.; Klei, Lambertus; Cauley, Jane A.; Roeder, Kathryn; Kammerer, Candace M.; Moffett, Susan P.; Ensrud, Kristine E.; Nestlerode, Cara S.; Marshall, Lynn M.; Hoffman, Andrew R.; Lewis, Cora; Lang, Thomas F.; Barrett-Connor, Elizabeth; Ferrell, Robert E.; Orwoll, Eric S.

2009-01-01

Genetics is a well-established but poorly understood determinant of BMD. Whereas some genetic variants may influence BMD throughout the body, others may be skeletal site specific. We initially screened for associations between 4608 tagging and potentially functional single nucleotide polymorphisms (SNPs) in 383 candidate genes and femoral neck and lumbar spine volumetric BMD (vBMD) measured from QCT scans among 862 community-dwelling white men ≥65 yr of age in the Osteoporotic Fractures in Men Study (MrOS). The most promising SNP associations (p < 0.01) were validated by genotyping an additional 1156 white men from MrOS. This analysis identified 8 SNPs in 6 genes (APC, DMP1, FGFR2, FLT1, HOXA, and PTN) that were associated with femoral neck vBMD and 13 SNPs in 7 genes (APC, BMPR1B, FOXC2, HOXA, IGFBP2, NFATC1, and SOST) that were associated with lumbar spine vBMD in both genotyping samples (p < 0.05). Although most associations were specific to one skeletal site, SNPs in the APC and HOXA gene regions were associated with both femoral neck and lumbar spine BMD. This analysis identifies several novel and robust genetic associations for volumetric BMD, and these findings in combination with other data suggest the presence of genetic loci for volumetric BMD that are at least to some extent skeletal-site specific. PMID:19453261

An ultra-high density linkage map and QTL mapping for sex and growth-related traits of common carp (Cyprinus carpio)

PubMed Central

Peng, Wenzhu; Xu, Jian; Zhang, Yan; Feng, Jianxin; Dong, Chuanju; Jiang, Likun; Feng, Jingyan; Chen, Baohua; Gong, Yiwen; Chen, Lin; Xu, Peng

2016-01-01

High density genetic linkage maps are essential for QTL fine mapping, comparative genomics and high quality genome sequence assembly. In this study, we constructed a high-density and high-resolution genetic linkage map with 28,194 SNP markers on 14,146 distinct loci for common carp based on high-throughput genotyping with the carp 250 K single nucleotide polymorphism (SNP) array in a mapping family. The genetic length of the consensus map was 10,595.94 cM with an average locus interval of 0.75 cM and an average marker interval of 0.38 cM. Comparative genomic analysis revealed high level of conserved syntenies between common carp and the closely related model species zebrafish and medaka. The genome scaffolds were anchored to the high-density linkage map, spanning 1,357 Mb of common carp reference genome. QTL mapping and association analysis identified 22 QTLs for growth-related traits and 7 QTLs for sex dimorphism. Candidate genes underlying growth-related traits were identified, including important regulators such as KISS2, IGF1, SMTLB, NPFFR1 and CPE. Candidate genes associated with sex dimorphism were also identified including 3KSR and DMRT2b. The high-density and high-resolution genetic linkage map provides an important tool for QTL fine mapping and positional cloning of economically important traits, and improving common carp genome assembly. PMID:27225429

In Silico Detection of Sequence Variations Modifying Transcriptional Regulation

PubMed Central

Andersen, Malin C; Engström, Pär G; Lithwick, Stuart; Arenillas, David; Eriksson, Per; Lenhard, Boris; Wasserman, Wyeth W; Odeberg, Jacob

2008-01-01

Identification of functional genetic variation associated with increased susceptibility to complex diseases can elucidate genes and underlying biochemical mechanisms linked to disease onset and progression. For genes linked to genetic diseases, most identified causal mutations alter an encoded protein sequence. Technological advances for measuring RNA abundance suggest that a significant number of undiscovered causal mutations may alter the regulation of gene transcription. However, it remains a challenge to separate causal genetic variations from linked neutral variations. Here we present an in silico driven approach to identify possible genetic variation in regulatory sequences. The approach combines phylogenetic footprinting and transcription factor binding site prediction to identify variation in candidate cis-regulatory elements. The bioinformatics approach has been tested on a set of SNPs that are reported to have a regulatory function, as well as background SNPs. In the absence of additional information about an analyzed gene, the poor specificity of binding site prediction is prohibitive to its application. However, when additional data is available that can give guidance on which transcription factor is involved in the regulation of the gene, the in silico binding site prediction improves the selection of candidate regulatory polymorphisms for further analyses. The bioinformatics software generated for the analysis has been implemented as a Web-based application system entitled RAVEN (regulatory analysis of variation in enhancers). The RAVEN system is available at http://www.cisreg.ca for all researchers interested in the detection and characterization of regulatory sequence variation. PMID:18208319

Fine-scale genetic mapping of a hybrid sterility factor between Drosophila simulans and D. mauritiana: the varied and elusive functions of "speciation genes".

PubMed

Araripe, Luciana O; Montenegro, Horácio; Lemos, Bernardo; Hartl, Daniel L

2010-12-14

Hybrid male sterility (HMS) is a usual outcome of hybridization between closely related animal species. It arises because interactions between alleles that are functional within one species may be disrupted in hybrids. The identification of genes leading to hybrid sterility is of great interest for understanding the evolutionary process of speciation. In the current work we used marked P-element insertions as dominant markers to efficiently locate one genetic factor causing a severe reduction in fertility in hybrid males of Drosophila simulans and D. mauritiana. Our mapping effort identified a region of 9 kb on chromosome 3, containing three complete and one partial coding sequences. Within this region, two annotated genes are suggested as candidates for the HMS factor, based on the comparative molecular characterization and public-source information. Gene Taf1 is partially contained in the region, but yet shows high polymorphism with four fixed non-synonymous substitutions between the two species. Its molecular functions involve sequence-specific DNA binding and transcription factor activity. Gene agt is a small, intronless gene, whose molecular function is annotated as methylated-DNA-protein-cysteine S-methyltransferase activity. High polymorphism and one fixed non-synonymous substitution suggest this is a fast evolving gene. The gene trees of both genes perfectly separate D. simulans and D. mauritiana into monophyletic groups. Analysis of gene expression using microarray revealed trends that were similar to those previously found in comparisons between whole-genome hybrids and parental species. The identification following confirmation of the HMS candidate gene will add another case study leading to understanding the evolutionary process of hybrid incompatibility.

Hypothesis-driven research for G × E interactions: the relationship between oxytocin, parental divorce during adolescence, and depression in young adulthood.

PubMed

Windle, Michael; Mrug, Sylvie

2015-01-01

Research in molecular genetics has generally focused on genome-wide association studies (GWAS) and exploratory candidate gene and candidate gene-environment (G × E) studies. In this article it is proposed that hypothesis-driven and biologically informed research provides a complementary approach to GWAS to advance pressing research questions about G × E relations that are of public health relevance. Prior research studies and developmental and evolutionary theory were used to guide hypothesis testing of G × E relationships in this study. The study investigated whether the oxytocin polymorphism, rs53576, moderated the relationship between parental divorce during adolescence and depression symptoms in young adulthood. Oxytocin is a neuropeptide that has been related to the regulation of complex social cognition and behaviors such as empathy, attachment, and nurturance. We hypothesized that the GG polymorphism would be associated with more depressive symptoms following parental divorce, and that this effect would be stronger in females than males. The sample consisted of 340 individuals who participated in a longitudinal study with data used both from adolescence and young adulthood. Findings using prospective follow-up and autoregressive change models supported the hypothesized relationships. Young adult females who had experienced parental divorce during adolescence and had the GG oxytocin genotype reported almost twice as many depressive symptoms relative to young adult females who also experienced parental divorce during adolescence but had the AA or AG genotype. This pattern was not indicated among males. Findings were discussed with regard to how molecular genetic factors in combination with environmental stressors, such parental divorce, framed within a developmental framework may facilitate the future study of G × E relationships in the parental divorce-child adjustment literature and contribute to a prevention science perspective.

Hypothesis-driven research for G × E interactions: the relationship between oxytocin, parental divorce during adolescence, and depression in young adulthood

PubMed Central

Windle, Michael; Mrug, Sylvie

2015-01-01

Research in molecular genetics has generally focused on genome-wide association studies (GWAS) and exploratory candidate gene and candidate gene–environment (G × E) studies. In this article it is proposed that hypothesis-driven and biologically informed research provides a complementary approach to GWAS to advance pressing research questions about G × E relations that are of public health relevance. Prior research studies and developmental and evolutionary theory were used to guide hypothesis testing of G × E relationships in this study. The study investigated whether the oxytocin polymorphism, rs53576, moderated the relationship between parental divorce during adolescence and depression symptoms in young adulthood. Oxytocin is a neuropeptide that has been related to the regulation of complex social cognition and behaviors such as empathy, attachment, and nurturance. We hypothesized that the GG polymorphism would be associated with more depressive symptoms following parental divorce, and that this effect would be stronger in females than males. The sample consisted of 340 individuals who participated in a longitudinal study with data used both from adolescence and young adulthood. Findings using prospective follow-up and autoregressive change models supported the hypothesized relationships. Young adult females who had experienced parental divorce during adolescence and had the GG oxytocin genotype reported almost twice as many depressive symptoms relative to young adult females who also experienced parental divorce during adolescence but had the AA or AG genotype. This pattern was not indicated among males. Findings were discussed with regard to how molecular genetic factors in combination with environmental stressors, such parental divorce, framed within a developmental framework may facilitate the future study of G × E relationships in the parental divorce-child adjustment literature and contribute to a prevention science perspective. PMID:26441708

Expression Levels of LCORL Are Associated with Body Size in Horses

PubMed Central

Metzger, Julia; Schrimpf, Rahel; Philipp, Ute; Distl, Ottmar

2013-01-01

Body size is an important characteristic for horses of various breeds and essential for the classification of ponies concerning the limit value of 148 cm (58.27 inches) height at the withers. Genome-wide association analyses revealed the highest associated quantitative trait locus for height at the withers on horse chromosome (ECA) 3 upstream of the candidate gene LCORL. Using 214 Hanoverian horses genotyped on the Illumina equine SNP50 BeadChip and 42 different horse breeds across all size ranges, we confirmed the highly associated single nucleotide polymorphism BIEC2-808543 (−log10P = 8.3) and the adjacent gene LCORL as the most promising candidate for body size. We investigated the relative expression levels of LCORL and its two neighbouring genes NCAPG and DCAF16 using quantitative real-time PCR (RT-qPCR). We could demonstrate a significant association of the relative LCORL expression levels with the size of the horses and the BIEC2-808543 genotypes within and across horse breeds. In heterozygous C/T-horses expression levels of LCORL were significantly decreased by 40% and in homozygous C/C-horses by 56% relative to the smaller T/T-horses. Bioinformatic analyses indicated that this SNP T>C mutation is disrupting a putative binding site of the transcription factor TFIID which is important for the transcription process of genes involved in skeletal bone development. Thus, our findings suggest that expression levels of LCORL play a key role for body size within and across horse breeds and regulation of the expression of LCORL is associated with genetic variants of BIEC2-808543. This is the first functional study for a body size regulating polymorphism in horses and a further step to unravel the mechanisms for understanding the genetic regulation of body size in horses. PMID:23418579

Genetic Polymorphisms in the Hypothalamic Pathway in Relation to Subsequent Weight Change – The DiOGenes Study

PubMed Central

Ängquist, Lars; Hansen, Rikke D.; van der A, Daphne L.; Holst, Claus; Tjønneland, Anne; Overvad, Kim; Jakobsen, Marianne Uhre; Boeing, Heiner; Meidtner, Karina; Palli, Domenico; Masala, Giovanna; Bouatia-Naji, Nabila; Saris, Wim H. M.; Feskens, Edith J. M.; J.Wareham, Nicolas; Sørensen, Thorkild I. A.; Loos, Ruth J. F.

2011-01-01

Background Single nucleotide polymorphisms (SNPs) in genes encoding the components involved in the hypothalamic pathway may influence weight gain and dietary factors may modify their effects. Aim We conducted a case-cohort study to investigate the associations of SNPs in candidate genes with weight change during an average of 6.8 years of follow-up and to examine the potential effect modification by glycemic index (GI) and protein intake. Methods and Findings Participants, aged 20–60 years at baseline, came from five European countries. Cases (‘weight gainers’) were selected from the total eligible cohort (n = 50,293) as those with the greatest unexplained annual weight gain (n = 5,584). A random subcohort (n = 6,566) was drawn with the intention to obtain an equal number of cases and noncases (n = 5,507). We genotyped 134 SNPs that captured all common genetic variation across the 15 candidate genes; 123 met the quality control criteria. Each SNP was tested for association with the risk of being a ‘weight gainer’ (logistic regression models) in the case-noncase data and with weight gain (linear regression models) in the random subcohort data. After accounting for multiple testing, none of the SNPs was significantly associated with weight change. Furthermore, we observed no significant effect modification by dietary factors, except for SNP rs7180849 in the neuromedin β gene (NMB). Carriers of the minor allele had a more pronounced weight gain at a higher GI (P = 2×10−7). Conclusions We found no evidence of association between SNPs in the studied hypothalamic genes with weight change. The interaction between GI and NMB SNP rs7180849 needs further confirmation. PMID:21390334

The Conserved and Unique Genetic Architecture of Kernel Size and Weight in Maize and Rice1[OPEN

PubMed Central

Lan, Liu; Wang, Hongze; Xu, Yuancheng; Yang, Xiaohong; Li, Wenqiang; Tong, Hao; Xiao, Yingjie; Pan, Qingchun; Qiao, Feng; Raihan, Mohammad Sharif; Liu, Haijun; Yang, Ning; Wang, Xiaqing; Deng, Min; Jin, Minliang; Zhao, Lijun; Luo, Xin; Zhan, Wei; Liu, Nannan; Wang, Hong; Chen, Gengshen

2017-01-01

Maize (Zea mays) is a major staple crop. Maize kernel size and weight are important contributors to its yield. Here, we measured kernel length, kernel width, kernel thickness, hundred kernel weight, and kernel test weight in 10 recombinant inbred line populations and dissected their genetic architecture using three statistical models. In total, 729 quantitative trait loci (QTLs) were identified, many of which were identified in all three models, including 22 major QTLs that each can explain more than 10% of phenotypic variation. To provide candidate genes for these QTLs, we identified 30 maize genes that are orthologs of 18 rice (Oryza sativa) genes reported to affect rice seed size or weight. Interestingly, 24 of these 30 genes are located in the identified QTLs or within 1 Mb of the significant single-nucleotide polymorphisms. We further confirmed the effects of five genes on maize kernel size/weight in an independent association mapping panel with 540 lines by candidate gene association analysis. Lastly, the function of ZmINCW1, a homolog of rice GRAIN INCOMPLETE FILLING1 that affects seed size and weight, was characterized in detail. ZmINCW1 is close to QTL peaks for kernel size/weight (less than 1 Mb) and contains significant single-nucleotide polymorphisms affecting kernel size/weight in the association panel. Overexpression of this gene can rescue the reduced weight of the Arabidopsis (Arabidopsis thaliana) homozygous mutant line in the AtcwINV2 gene (Arabidopsis ortholog of ZmINCW1). These results indicate that the molecular mechanisms affecting seed development are conserved in maize, rice, and possibly Arabidopsis. PMID:28811335

The Conserved and Unique Genetic Architecture of Kernel Size and Weight in Maize and Rice.

PubMed

Liu, Jie; Huang, Juan; Guo, Huan; Lan, Liu; Wang, Hongze; Xu, Yuancheng; Yang, Xiaohong; Li, Wenqiang; Tong, Hao; Xiao, Yingjie; Pan, Qingchun; Qiao, Feng; Raihan, Mohammad Sharif; Liu, Haijun; Zhang, Xuehai; Yang, Ning; Wang, Xiaqing; Deng, Min; Jin, Minliang; Zhao, Lijun; Luo, Xin; Zhou, Yang; Li, Xiang; Zhan, Wei; Liu, Nannan; Wang, Hong; Chen, Gengshen; Li, Qing; Yan, Jianbing

2017-10-01

Maize ( Zea mays ) is a major staple crop. Maize kernel size and weight are important contributors to its yield. Here, we measured kernel length, kernel width, kernel thickness, hundred kernel weight, and kernel test weight in 10 recombinant inbred line populations and dissected their genetic architecture using three statistical models. In total, 729 quantitative trait loci (QTLs) were identified, many of which were identified in all three models, including 22 major QTLs that each can explain more than 10% of phenotypic variation. To provide candidate genes for these QTLs, we identified 30 maize genes that are orthologs of 18 rice ( Oryza sativa ) genes reported to affect rice seed size or weight. Interestingly, 24 of these 30 genes are located in the identified QTLs or within 1 Mb of the significant single-nucleotide polymorphisms. We further confirmed the effects of five genes on maize kernel size/weight in an independent association mapping panel with 540 lines by candidate gene association analysis. Lastly, the function of ZmINCW1 , a homolog of rice GRAIN INCOMPLETE FILLING1 that affects seed size and weight, was characterized in detail. ZmINCW1 is close to QTL peaks for kernel size/weight (less than 1 Mb) and contains significant single-nucleotide polymorphisms affecting kernel size/weight in the association panel. Overexpression of this gene can rescue the reduced weight of the Arabidopsis ( Arabidopsis thaliana ) homozygous mutant line in the AtcwINV2 gene (Arabidopsis ortholog of ZmINCW1 ). These results indicate that the molecular mechanisms affecting seed development are conserved in maize, rice, and possibly Arabidopsis. © 2017 American Society of Plant Biologists. All Rights Reserved.

Major Quantitative Trait Loci and Putative Candidate Genes for Powdery Mildew Resistance and Fruit-Related Traits Revealed by an Intraspecific Genetic Map for Watermelon (Citrullus lanatus var. lanatus).

PubMed

Kim, Kwang-Hwan; Hwang, Ji-Hyun; Han, Dong-Yeup; Park, Minkyu; Kim, Seungill; Choi, Doil; Kim, Yongjae; Lee, Gung Pyo; Kim, Sun-Tae; Park, Young-Hoon

2015-01-01

An intraspecific genetic map for watermelon was constructed using an F2 population derived from 'Arka Manik' × 'TS34' and transcript sequence variants and quantitative trait loci (QTL) for resistance to powdery mildew (PMR), seed size (SS), and fruit shape (FS) were analyzed. The map consists of 14 linkage groups (LGs) defined by 174 cleaved amplified polymorphic sequences (CAPS), 2 derived-cleaved amplified polymorphic sequence markers, 20 sequence-characterized amplified regions, and 8 expressed sequence tag-simple sequence repeat markers spanning 1,404.3 cM, with a mean marker interval of 6.9 cM and an average of 14.6 markers per LG. Genetic inheritance and QTL analyses indicated that each of the PMR, SS, and FS traits is controlled by an incompletely dominant effect of major QTLs designated as pmr2.1, ss2.1, and fsi3.1, respectively. The pmr2.1, detected on chromosome 2 (Chr02), explained 80.0% of the phenotypic variation (LOD = 30.76). This QTL was flanked by two CAPS markers, wsb2-24 (4.00 cM) and wsb2-39 (13.97 cM). The ss2.1, located close to pmr2.1 and CAPS marker wsb2-13 (1.00 cM) on Chr02, explained 92.3% of the phenotypic variation (LOD = 68.78). The fsi3.1, detected on Chr03, explained 79.7% of the phenotypic variation (LOD = 31.37) and was flanked by two CAPS, wsb3-24 (1.91 cM) and wsb3-9 (7.00 cM). Candidate gene-based CAPS markers were developed from the disease resistance and fruit shape gene homologs located on Chr.02 and Chr03 and were mapped on the intraspecific map. Colocalization of these markers with the major QTLs indicated that watermelon orthologs of a nucleotide-binding site-leucine-rich repeat class gene containing an RPW8 domain and a member of SUN containing the IQ67 domain are candidate genes for pmr2.1 and fsi3.1, respectively. The results presented herein provide useful information for marker-assisted breeding and gene cloning for PMR and fruit-related traits.

Major Quantitative Trait Loci and Putative Candidate Genes for Powdery Mildew Resistance and Fruit-Related Traits Revealed by an Intraspecific Genetic Map for Watermelon (Citrullus lanatus var. lanatus)

PubMed Central

Kim, Kwang-Hwan; Hwang, Ji-Hyun; Han, Dong-Yeup; Park, Minkyu; Kim, Seungill; Choi, Doil; Kim, Yongjae; Lee, Gung Pyo; Kim, Sun-Tae; Park, Young-Hoon

2015-01-01

An intraspecific genetic map for watermelon was constructed using an F2 population derived from ‘Arka Manik’ × ‘TS34’ and transcript sequence variants and quantitative trait loci (QTL) for resistance to powdery mildew (PMR), seed size (SS), and fruit shape (FS) were analyzed. The map consists of 14 linkage groups (LGs) defined by 174 cleaved amplified polymorphic sequences (CAPS), 2 derived-cleaved amplified polymorphic sequence markers, 20 sequence-characterized amplified regions, and 8 expressed sequence tag-simple sequence repeat markers spanning 1,404.3 cM, with a mean marker interval of 6.9 cM and an average of 14.6 markers per LG. Genetic inheritance and QTL analyses indicated that each of the PMR, SS, and FS traits is controlled by an incompletely dominant effect of major QTLs designated as pmr2.1, ss2.1, and fsi3.1, respectively. The pmr2.1, detected on chromosome 2 (Chr02), explained 80.0% of the phenotypic variation (LOD = 30.76). This QTL was flanked by two CAPS markers, wsb2-24 (4.00 cM) and wsb2-39 (13.97 cM). The ss2.1, located close to pmr2.1 and CAPS marker wsb2-13 (1.00 cM) on Chr02, explained 92.3% of the phenotypic variation (LOD = 68.78). The fsi3.1, detected on Chr03, explained 79.7% of the phenotypic variation (LOD = 31.37) and was flanked by two CAPS, wsb3-24 (1.91 cM) and wsb3-9 (7.00 cM). Candidate gene-based CAPS markers were developed from the disease resistance and fruit shape gene homologs located on Chr.02 and Chr03 and were mapped on the intraspecific map. Colocalization of these markers with the major QTLs indicated that watermelon orthologs of a nucleotide-binding site-leucine-rich repeat class gene containing an RPW8 domain and a member of SUN containing the IQ67 domain are candidate genes for pmr2.1 and fsi3.1, respectively. The results presented herein provide useful information for marker-assisted breeding and gene cloning for PMR and fruit-related traits. PMID:26700647

Application of a novel combination of near-infrared spectroscopy and a humidity-controlled 96-well plate to the characterization of the polymorphism of imidafenacin.

PubMed

Uchida, Hiroshi; Yoshinaga, Tokuji; Mori, Hirotoshi; Otsuka, Makoto

2010-11-01

This study aimed to apply a currently available chemometric near-infrared spectroscopy technique to the characterization of the polymorphic properties of drug candidates. The technique requires only small quantities of samples and is therefore applicable to drugs in the early stages of development. The combination of near-infrared spectroscopy and a patented 96-well plate divided into 32 individual, humidity-controlled, three-well compartments was used in the characterization of a hygroscopic drug, imidafenacin, which has two polymorphs and one pseudo-polymorph. Characterization was also conducted with powder X-ray diffraction and thermal analysis. The results were compared with those from routinely used conventional analyses. Both the microanalysis and conventional analysis successfully characterised the substance (transformation and relative stability among the two polymorphs and a pseudo-polymorph) depending on the storage conditions. Near-infrared spectroscopic analyses utilizing a humidity-controlled 96-well plate required only small amounts of the sample for characterization under the various conditions of relative humidity. Near-infrared microanalysis can be applied to polymorphic studies of small quantities of a drug candidate. The results also suggest that the method will predict the behaviors of a hygroscopic candidate in solid pharmaceutical preparations at the early stages of drug development. © 2010 The Authors. JPP © 2010 Royal Pharmaceutical Society of Great Britain.

Comparative analyses of genetic/epigenetic diversities and structures in a wild barley species (Hordeum brevisubulatum) using MSAP, SSAP and AFLP.

PubMed

Shan, X H; Li, Y D; Liu, X M; Wu, Y; Zhang, M Z; Guo, W L; Liu, B; Yuan, Y P

2012-08-17

We analyzed genetic diversity and population genetic structure of four artificial populations of wild barley (Hordeum brevisubulatum); 96 plants collected from the Songnen Prairie in northeastern China were analyzed using amplified fragment length polymorphism (AFLP), specific-sequence amplified polymorphism (SSAP) and methylation-sensitive amplified polymorphism (MSAP) markers. Indices of (epi-)genetic diversity, (epi-)genetic distance, gene flow, genotype frequency, cluster analysis, PCA analysis and AMOVA analysis generated from MSAP, AFLP and SSAP markers had the same trend. We found a high level of correlation in the artificial populations between MSAP, SSAP and AFLP markers by the Mantel test (r > 0.8). This is incongruent with previous findings showing that there is virtually no correlation between DNA methylation polymorphism and classical genetic variation; the high level of genetic polymorphism could be a result of epigenetic regulation. We compared our results with data from natural populations. The population diversity of the artificial populations was lower. However, different from what was found using AFLP and SSAP, based on MSAP results the methylation polymorphism of the artificial populations was not significantly reduced. This leads us to suggest that the DNA methylation pattern change in H. brevisubulatum populations is not only related to DNA sequence variation, but is also regulated by other controlling systems.

GSTM1, GSTP1, and GSTT1 genetic variability in Turkish and worldwide populations.

PubMed

Karaca, Sefayet; Karaca, Mehmet; Cesuroglu, Tomris; Erge, Sema; Polimanti, Renato

2015-01-01

Glutathione S-transferase (GST) variants have been widely investigated to better understand their role in several pathologic conditions. To our knowledge, no data about these genetic polymorphisms within the Turkish population are currently available. The aim of this study was to analyze GSTM1 positive/null, GSTT1 positive/null, GSTP1*I105V (rs1695), and GSTP1*A114V (rs1138272) variants in the general Turkish population, to provide information about its genetic diversity, and predisposition to GST-related diseases. Genotyping was performed in 500 Turkish individuals using the Sequenom MassARRAY platform. A comparative analysis was executed using the data from the HapMap and Human Genome Diversity Projects (HGDP). Sequence variation was deeply explored using the Phase 1 data of the 1,000 Genomes Project. The variability of GSTM1, GSTT1, and GSTP1 polymorphisms in the Turkish population was similar to that observed in Central Asian, European, and Middle Eastern populations. The high linkage disequilibrium between GSTP1*I105V and GSTP1*A114V in these populations may have a confounding effect on GSTP1 genetic association studies. In analyzing GSTM1, GSTT1, and GSTP1 sequence variation, we observed other common functional variants that may be candidates for associated studies of diseases related to GST genes (e.g., cancer, cardiovascular disease, and allergy). This study provides novel data about GSTM1 positive/null, GSTT1 positive/null, GSTP1*I105V, and GSTP1*A114V variants in the Turkish population, and other functional variants that may affect GSTM1, GSTT1, and GSTP1 functions among worldwide populations. This information can assist in the design of future genetic association studies investigating oxidative stress-related diseases. © 2014 Wiley Periodicals, Inc.

GRECOS Project (Genotyping Recurrence Risk of Stroke): The Use of Genetics to Predict the Vascular Recurrence After Stroke.

PubMed

Fernández-Cadenas, Israel; Mendióroz, Maite; Giralt, Dolors; Nafria, Cristina; Garcia, Elena; Carrera, Caty; Gallego-Fabrega, Cristina; Domingues-Montanari, Sophie; Delgado, Pilar; Ribó, Marc; Castellanos, Mar; Martínez, Sergi; Freijo, Marimar; Jiménez-Conde, Jordi; Rubiera, Marta; Alvarez-Sabín, José; Molina, Carlos A; Font, Maria Angels; Grau Olivares, Marta; Palomeras, Ernest; Perez de la Ossa, Natalia; Martinez-Zabaleta, Maite; Masjuan, Jaime; Moniche, Francisco; Canovas, David; Piñana, Carlos; Purroy, Francisco; Cocho, Dolores; Navas, Inma; Tejero, Carlos; Aymerich, Nuria; Cullell, Natalia; Muiño, Elena; Serena, Joaquín; Rubio, Francisco; Davalos, Antoni; Roquer, Jaume; Arenillas, Juan Francisco; Martí-Fábregas, Joan; Keene, Keith; Chen, Wei-Min; Worrall, Bradford; Sale, Michele; Arboix, Adrià; Krupinski, Jerzy; Montaner, Joan

2017-05-01

Vascular recurrence occurs in 11% of patients during the first year after ischemic stroke (IS) or transient ischemic attack. Clinical scores do not predict the whole vascular recurrence risk; therefore, we aimed to find genetic variants associated with recurrence that might improve the clinical predictive models in IS. We analyzed 256 polymorphisms from 115 candidate genes in 3 patient cohorts comprising 4482 IS or transient ischemic attack patients. The discovery cohort was prospectively recruited and included 1494 patients, 6.2% of them developed a new IS during the first year of follow-up. Replication analysis was performed in 2988 patients using SNPlex or HumanOmni1-Quad technology. We generated a predictive model using Cox regression (GRECOS score [Genotyping Reurrence Risk of Stroke]) and generated risk groups using a classification tree method. The analyses revealed that rs1800801 in the MGP gene (hazard ratio, 1.33; P =9×10 - 03 ), a gene related to artery calcification, was associated with new IS during the first year of follow-up. This polymorphism was replicated in a Spanish cohort (n=1.305); however, it was not significantly associated in a North American cohort (n=1.683). The GRECOS score predicted new IS ( P =3.2×10 - 09 ) and could classify patients, from low risk of stroke recurrence (1.9%) to high risk (12.6%). Moreover, the addition of genetic risk factors to the GRECOS score improves the prediction compared with previous Stroke Prognosis Instrument-II score ( P =0.03). The use of genetics could be useful to estimate vascular recurrence risk after IS. Genetic variability in the MGP gene was associated with vascular recurrence in the Spanish population. © 2017 American Heart Association, Inc.

GRECOS project. The use of genetics to predict the vascular recurrence after stroke

PubMed Central

Fernández-Cadenas, Israel; Mendióroz, Maite; Giralt, Dolors; Nafria, Cristina; Garcia, Elena; Carrera, Caty; Gallego-Fabrega, Cristina; Domingues-Montanari, Sophie; Delgado, Pilar; Ribó, Marc; Castellanos, Mar; Martínez, Sergi; Freijo, Mari Mar; Jiménez-Conde, Jordi; Rubiera, Marta; Alvarez-Sabín, José; Molina, Carlos A.; Font, Maria Angels; Olivares, Marta Grau; Palomeras, Ernest; de la Ossa, Natalia Perez; Martinez-Zabaleta, Maite; Masjuan, Jaime; Moniche, Francisco; Canovas, David; Piñana, Carlos; Purroy, Francisco; Cocho, Dolores; Navas, Inma; Tejero, Carlos; Aymerich, Nuria; Cullell, Natalia; Muiño, Elena; Serena, Joaquín; Rubio, Francisco; Davalos, Antoni; Roquer, Jaume; Arenillas, Juan Francisco; Martí-Fábregas, Joan; Keene, Keith; Chen, Wei-Min; Worrall, Bradford; Sale, Michele; Arboix, Adrià; Krupinski, Jerzy; Montaner, Joan

2017-01-01

Background and Purpose Vascular recurrence occurs in 11% of patients during the first year after ischemic stroke (IS) or transient ischemic attack (TIA). Clinical scores do not predict the whole vascular recurrence risk, therefore we aimed to find genetic variants associated with recurrence that might improve the clinical predictive models in IS. Methods We analyzed 256 polymorphisms from 115 candidate genes in three patient cohorts comprising 4,482 IS or TIA patients. The discovery cohort was prospectively recruited and included 1,494 patients, 6.2% of them developed a new IS during the first year of follow-up. Replication analysis was performed in 2,988 patients using SNPlex or HumanOmni1-Quad technology. We generated a predictive model using Cox regression (GRECOS score), and generated risk groups using a classification tree method. Results The analyses revealed that rs1800801 in the MGP gene (HR: 1.33, p= 9×10−03), a gene related to artery calcification, was associated with new IS during the first year of follow-up. This polymorphism was replicated in a Spanish cohort (n=1.305), however it was not significantly associated in a North American cohort (n=1.683). The GRECOS score predicted new IS (p= 3.2×10−09) and could classify patients, from low risk of stroke recurrence (1.9%) to high risk (12.6%). Moreover, the addition of genetic risk factors to the GRECOS score improves the prediction compared to previous SPI-II score (p=0.03). Conclusions The use of genetics could be useful to estimate vascular recurrence risk after IS. Genetic variability in the MGP gene was associated with vascular recurrence in the Spanish population. PMID:28411264

ILDgenDB: integrated genetic knowledge resource for interstitial lung diseases (ILDs).

PubMed

Mishra, Smriti; Shah, Mohammad I; Sarkar, Malay; Asati, Nimisha; Rout, Chittaranjan

2018-01-01

Interstitial lung diseases (ILDs) are a diverse group of ∼200 acute and chronic pulmonary disorders that are characterized by variable amounts of inflammation, fibrosis and architectural distortion with substantial morbidity and mortality. Inaccurate and delayed diagnoses increase the risk, especially in developing countries. Studies have indicated the significant roles of genetic elements in ILDs pathogenesis. Therefore, the first genetic knowledge resource, ILDgenDB, has been developed with an objective to provide ILDs genetic data and their integrated analyses for the better understanding of disease pathogenesis and identification of diagnostics-based biomarkers. This resource contains literature-curated disease candidate genes (DCGs) enriched with various regulatory elements that have been generated using an integrated bioinformatics workflow of databases searches, literature-mining and DCGs-microRNA (miRNAs)-single nucleotide polymorphisms (SNPs) association analyses. To provide statistical significance to disease-gene association, ILD-specificity index and hypergeomatric test scores were also incorporated. Association analyses of miRNAs, SNPs and pathways responsible for the pathogenesis of different sub-classes of ILDs were also incorporated. Manually verified 299 DCGs and their significant associations with 1932 SNPs, 2966 miRNAs and 9170 miR-polymorphisms were also provided. Furthermore, 216 literature-mined and proposed biomarkers were identified. The ILDgenDB resource provides user-friendly browsing and extensive query-based information retrieval systems. Additionally, this resource also facilitates graphical view of predicted DCGs-SNPs/miRNAs and literature associated DCGs-ILDs interactions for each ILD to facilitate efficient data interpretation. Outcomes of analyses suggested the significant involvement of immune system and defense mechanisms in ILDs pathogenesis. This resource may potentially facilitate genetic-based disease monitoring and diagnosis.Database URL: http://14.139.240.55/ildgendb/index.php.

Integration of QTL and bioinformatic tools to identify candidate genes for triglycerides in mice[S

PubMed Central

Leduc, Magalie S.; Hageman, Rachael S.; Verdugo, Ricardo A.; Tsaih, Shirng-Wern; Walsh, Kenneth; Churchill, Gary A.; Paigen, Beverly

2011-01-01

To identify genetic loci influencing lipid levels, we performed quantitative trait loci (QTL) analysis between inbred mouse strains MRL/MpJ and SM/J, measuring triglyceride levels at 8 weeks of age in F2 mice fed a chow diet. We identified one significant QTL on chromosome (Chr) 15 and three suggestive QTL on Chrs 2, 7, and 17. We also carried out microarray analysis on the livers of parental strains of 282 F2 mice and used these data to find cis-regulated expression QTL. We then narrowed the list of candidate genes under significant QTL using a “toolbox” of bioinformatic resources, including haplotype analysis; parental strain comparison for gene expression differences and nonsynonymous coding single nucleotide polymorphisms (SNP); cis-regulated eQTL in livers of F2 mice; correlation between gene expression and phenotype; and conditioning of expression on the phenotype. We suggest Slc25a7 as a candidate gene for the Chr 7 QTL and, based on expression differences, five genes (Polr3 h, Cyp2d22, Cyp2d26, Tspo, and Ttll12) as candidate genes for Chr 15 QTL. This study shows how bioinformatics can be used effectively to reduce candidate gene lists for QTL related to complex traits. PMID:21622629

The contribution of diet and genotype to iron status in women: a classical twin study.

PubMed

Fairweather-Tait, Susan J; Guile, Geoffrey R; Valdes, Ana M; Wawer, Anna A; Hurst, Rachel; Skinner, Jane; Macgregor, Alexander J

2013-01-01

This is the first published report examining the combined effect of diet and genotype on body iron content using a classical twin study design. The aim of this study was to determine the relative contribution of genetic and environmental factors in determining iron status. The population was comprised of 200 BMI- and age-matched pairs of MZ and DZ healthy twins, characterised for habitual diet and 15 iron-related candidate genetic markers. Variance components analysis demonstrated that the heritability of serum ferritin (SF) and soluble transferrin receptor was 44% and 54% respectively. Measured single nucleotide polymorphisms explained 5% and selected dietary factors 6% of the variance in iron status; there was a negative association between calcium intake and body iron (p = 0.02) and SF (p = 0.04).

Role of Pharmacogenetics in Hematopoietic Stem Cell Transplantation Outcome in Children

PubMed Central

Franca, Raffaella; Stocco, Gabriele; Favretto, Diego; Giurici, Nagua; Decorti, Giuliana; Rabusin, Marco

2015-01-01

Hematopoietic stem cell transplantation (HSCT) is an established therapeutic procedure for several congenital and acquired disorders, both malignant and nonmalignant. Despite the great improvements in HSCT clinical practices over the last few decades, complications, such as graft vs. host disease (GVHD) and sinusoidal obstructive syndrome (SOS), are still largely unpredictable and remain the major causes of morbidity and mortality. Both donor and patient genetic background might influence the success of bone marrow transplantation and could at least partially explain the inter-individual variability in HSCT outcome. This review summarizes some of the recent studies on candidate gene polymorphisms in HSCT, with particular reference to pediatric cohorts. The interest is especially focused on pharmacogenetic variants affecting myeloablative and immunosuppressive drugs, although genetic traits involved in SOS susceptibility and transplant-related mortality are also reviewed. PMID:26266406

PD-L1 gene polymorphisms and low serum level of PD-L1 protein are associated to type 1 diabetes in Chile.

PubMed

Pizarro, Carolina; García-Díaz, Diego F; Codner, Ethel; Salas-Pérez, Francisca; Carrasco, Elena; Pérez-Bravo, Francisco

2014-11-01

Type 1 diabetes (T1D) has a complex etiology in which genetic and environmental factors are involved, whose interactions have not yet been completely clarified. In this context, the role in PD-1 pathway and its ligands 1 and 2 (PD-L1 and PD-L2) have been proposed as candidates in several autoimmune diseases. The aim of this work was to determine the allele and haplotype frequency of six gene polymorphisms of PD-ligands (PD-L1 and PD-L2) in Chilean T1D patients and their effect on serum levels of PD-L1 and autoantibody profile (GAD65 and IA2). This study cohort comprised 205 T1D patients and 205 normal children. We performed genotypic analysis of PD-L1 and PD-L2 genes by TaqMan method. Determination of anti-GAD65 and anti-IA-2 autoantibodies was performed by ELISA. The PD-L1 serum levels were measured. The allelic distribution of PD-L1 variants (rs2297137 and rs4143815) showed differences between T1D patients and controls (p = 0.035 and p = 0.022, respectively). No differences were detected among the PD-L2 polymorphisms, and only the rs16923189 showed genetic variation. T1D patients showed decreased serum levels of PD-L1 compared to controls: 1.42 [0.23-7.45] ng/mL versus 3.35 [0.49-5.89] ng/mL (p < 0.025). In addition, the CGG haplotype in PD-L1 associated with T1D (constructed from rs822342, rs2297137 and rs4143815 polymorphisms) showed an OR = 1.44 [1.08 to 1.93]. Finally, no association of these genetic variants was observed with serum concentrations of PD ligands or auto-antibody profile, although a correlation between PD-L1 ligand serum concentration and the age at disease onset was detected. Two polymorphism of PD-L1 are presented in different allelic variants between T1D and healthy subjects, also PDL-1 serum levels are significantly lowered in diabetics patients. Moreover, the age of onset of the disease determine differences between serum ligand levels in diabetics, being lower in younger. These results points to a possible establishment of PDL-1 as a genetic and biochemical marker for T1D onset, at least in Chilean population. Copyright © 2014 John Wiley & Sons, Ltd.

An integrative study of the genetic, social and environmental determinants of chronic kidney disease characterized by tubulointerstitial damages in the North Central Region of Sri Lanka.

PubMed

Nanayakkara, Shanika; Senevirathna, S T M L D; Abeysekera, Tilak; Chandrajith, Rohana; Ratnatunga, Neelakanthi; Gunarathne, E D L; Yan, Junxia; Hitomi, Toshiaki; Muso, Eri; Komiya, Toshiyuki; Harada, Kouji H; Liu, Wanyang; Kobayashi, Hatasu; Okuda, Hiroko; Sawatari, Hideyuki; Matsuda, Fumihiko; Yamada, Ryo; Watanabe, Takao; Miyataka, Hideki; Himeno, Seiichiro; Koizumi, Akio

2014-01-01

Previous investigations on chronic kidney disease of unknown etiology characterized by tubulointerstitial damages (CKDu) in the North Central Region (NCR) of Sri Lanka have supported the involvement of social, environmental and genetic factors in its pathogenesis. We conducted a social-environmental-and-genetic epidemiology study on a male population in NCR to investigate the genetic and environmental contributors. We recruited 311 case-series patients and 504 control candidates. Of the 504 control candidates, 218 (43%) were eliminated because of the presence of hypertension, proteinuria, high HbA1c, high serum creatinine or high alpha-1 microglobulin in urine. None of 18 metals measured (μg//) in urine, including Cd, As and Pb, showed significantly higher concentrations in cases compared with controls. As speciation results showed that 75-80% of total urinary As was in the form of arsenobetaine, which is non-toxic to humans. None of the metal concentrations in drinking water samples exceeded guideline values. A genome-wide association study (GWAS) was conducted to determine the genetic contributors. The GWAS yielded a genome-wide significant association with CKDu for a single nucleotide polymorphism (SNP; rs6066043; p=5.23 × 10(-9) in quantitative trait locus analysis; p=3.73 × 10(-9) in dichotomous analysis) in SLC13A3 (sodium-dependent dicarboxylate transporter member 3). The population attributable fraction and odds ratio for this SNP were 50% and 2.13. Genetic susceptibility was identified as the major risk factor for CKDu. However, 43% of the apparently healthy male population suffers from non-communicable diseases, suggesting their possible influence on CKDu progression.

Re-sequencing of the APOAI promoter region and the genetic association of the -75G > A polymorphism with increased cholesterol and low density lipoprotein levels among a sample of the Kuwaiti population

PubMed Central

2013-01-01

Background APOAI, a member of the APOAI/CIII/IV/V gene cluster on chromosome 11q23-24, encodes a major protein component of HDL that has been associated with serum lipid levels. The aim of this study was to determine the genetic association of polymorphisms in the APOAI promoter region with plasma lipid levels in a cohort of healthy Kuwaiti volunteers. Methods A 435 bp region of the APOAI promoter was analyzed by re-sequencing in 549 Kuwaiti samples. DNA was extracted from blood taken from 549 healthy Kuwaiti volunteers who had fasted for the previous 12 h. Univariate and multivariate analysis was used to determine allele association with serum lipid levels. Results The target sequence included a partial segment of the promoter region, 5’UTR and exon 1 located between nucleotides −141 to +294 upstream of the APOAI gene on chromosome 11. No novel single nucleotide polymorphisms (SNPs) were observed. The sequences obtained were deposited with the NCBI GenBank with accession number [GenBank: JX438706]. The allelic frequencies for the three SNPs were as follows: APOAI rs670G = 0.807; rs5069C = 0.964; rs1799837G = 0.997 and found to be in HWE. A significant association (p < 0.05) was observed for the APOAI rs670 polymorphism with increased serum LDL-C. Multivariate analysis showed that APOAI rs670 was an independent predictive factor when controlling for age, sex and BMI for both LDL-C (OR: 1.66, p = 0.014) and TC (OR: 1.77, p = 0.006) levels. Conclusion This study is the first to report sequence analysis of the APOAI promoter in an Arab population. The unexpected positive association found between the APOAI rs670 polymorphism and increased levels of LDL-C and TC may be due to linkage disequilibrium with other polymorphisms in candidate and neighboring genes known to be associated with lipid metabolism and transport. PMID:24028463

Re-sequencing of the APOAI promoter region and the genetic association of the -75G > A polymorphism with increased cholesterol and low density lipoprotein levels among a sample of the Kuwaiti population.

PubMed

Al-Bustan, Suzanne A; Al-Serri, Ahmad E; Annice, Babitha G; Alnaqeeb, Majed A; Ebrahim, Ghada A

2013-09-12

APOAI, a member of the APOAI/CIII/IV/V gene cluster on chromosome 11q23-24, encodes a major protein component of HDL that has been associated with serum lipid levels. The aim of this study was to determine the genetic association of polymorphisms in the APOAI promoter region with plasma lipid levels in a cohort of healthy Kuwaiti volunteers. A 435 bp region of the APOAI promoter was analyzed by re-sequencing in 549 Kuwaiti samples. DNA was extracted from blood taken from 549 healthy Kuwaiti volunteers who had fasted for the previous 12 h. Univariate and multivariate analysis was used to determine allele association with serum lipid levels. The target sequence included a partial segment of the promoter region, 5'UTR and exon 1 located between nucleotides -141 to +294 upstream of the APOAI gene on chromosome 11. No novel single nucleotide polymorphisms (SNPs) were observed. The sequences obtained were deposited with the NCBI GenBank with accession number [GenBank: JX438706]. The allelic frequencies for the three SNPs were as follows: APOAI rs670G = 0.807; rs5069C = 0.964; rs1799837G = 0.997 and found to be in HWE. A significant association (p < 0.05) was observed for the APOAI rs670 polymorphism with increased serum LDL-C. Multivariate analysis showed that APOAI rs670 was an independent predictive factor when controlling for age, sex and BMI for both LDL-C (OR: 1.66, p = 0.014) and TC (OR: 1.77, p = 0.006) levels. This study is the first to report sequence analysis of the APOAI promoter in an Arab population. The unexpected positive association found between the APOAI rs670 polymorphism and increased levels of LDL-C and TC may be due to linkage disequilibrium with other polymorphisms in candidate and neighboring genes known to be associated with lipid metabolism and transport.

Genetic Control of Plasticity in Root Morphology and Anatomy of Rice in Response to Water Deficit1[OPEN

PubMed Central

Tamilselvan, Anandhan; Lawas, Lovely M.F.; Quinones, Cherryl; Bahuguna, Rajeev N.; Dingkuhn, Michael

2017-01-01

Elucidating the genetic control of rooting behavior under water-deficit stress is essential to breed climate-robust rice (Oryza sativa) cultivars. Using a diverse panel of 274 indica genotypes grown under control and water-deficit conditions during vegetative growth, we phenotyped 35 traits, mostly related to root morphology and anatomy, involving 45,000 root-scanning images and nearly 25,000 cross sections from the root-shoot junction. The phenotypic plasticity of these traits was quantified as the relative change in trait value under water-deficit compared with control conditions. We then carried out a genome-wide association analysis on these traits and their plasticity, using 45,608 high-quality single-nucleotide polymorphisms. One hundred four significant loci were detected for these traits under control conditions, 106 were detected under water-deficit stress, and 76 were detected for trait plasticity. We predicted 296 (control), 284 (water-deficit stress), and 233 (plasticity) a priori candidate genes within linkage disequilibrium blocks for these loci. We identified key a priori candidate genes regulating root growth and development and relevant alleles that, upon validation, can help improve rice adaptation to water-deficit stress. PMID:28600346

Type 2 diabetes susceptibility genes on chromosome 1q21-24.

PubMed

Hasstedt, S J; Chu, W S; Das, S K; Wang, H; Elbein, S C

2008-03-01

Type 2 diabetes (T2D) has been linked to chromosome 1q21-24 in multiple samples, including a Utah family sample. Variants in 13 of the numerous candidate genes in the 1q region were tested for association with T2D in a Utah case-control sample. The most promising, 19 variants in 6 candidates, were genotyped on the Utah family sample. Herein, we tested the 19 variants individually and in pairs for an effect on T2D risk in family members using a logistic regression model that accounted for gender, age, and BMI and attributed residual genetic effects to a polygenic component. Seven variants increased risk significantly through 5 pairs of interactions. The significant variant pairs were apolipoprotein A-II (APOA2) rs6413453 interacting with calsequestrin 1 (CASQ1) rs617698, dual specificity phosphatase 12 (DUSP12) rs1503814, and retinoid X receptor gamma (RXRG) rs10918169, a poly-T insertion-deletion polymorphism in liver pyruvate kinase (PKLR) interacting with APOA2 rs12143180, and DUSP12 rs1027702 interacting with RXRG rs10918169. Genotypes of these 5 variant pairs accounted for 25.8% of the genetic variance in T2D in these pedigrees.

Meta-analysis of shared genetic architecture across ten pediatric autoimmune diseases

PubMed Central

Li, Yun R; Li, Jin; Zhao, Sihai D; Bradfield, Jonathan P; Mentch, Frank D; Maggadottir, S Melkorka; Hou, Cuiping; Abrams, Debra J; Chang, Diana; Gao, Feng; Guo, Yiran; Wei, Zhi; Connolly, John J; Cardinale, Christopher J; Bakay, Marina; Glessner, Joseph T; Li, Dong; Kao, Charlly; Thomas, Kelly A; Qiu, Haijun; Chiavacci, Rosetta M; Kim, Cecilia E; Wang, Fengxiang; Snyder, James; Richie, Marylyn D; Flatø, Berit; Førre, Øystein; Denson, Lee A; Thompson, Susan D; Becker, Mara L; Guthery, Stephen L; Latiano, Anna; Perez, Elena; Resnick, Elena; Russell, Richard K; Wilson, David C; Silverberg, Mark S; Annese, Vito; Lie, Benedicte A; Punaro, Marilynn; Dubinsky, Marla C; Monos, Dimitri S; Strisciuglio, Caterina; Staiano, Annamaria; Miele, Erasmo; Kugathasan, Subra; Ellis, Justine A; Munro, Jane E; Sullivan, Kathleen E; Wise, Carol A; Chapel, Helen; Cunningham-Rundles, Charlotte; Grant, Struan F A; Orange, Jordan S; Sleiman, Patrick M A; Behrens, Edward M; Griffiths, Anne M; Satsangi, Jack; Finkel, Terri H; Keinan, Alon; Prak, Eline T Luning; Polychronakos, Constantin; Baldassano, Robert N; Li, Hongzhe; Keating, Brendan J; Hakonarson, Hakon

2016-01-01

Genome-wide association studies (GWASs) have identified hundreds of susceptibility genes, including shared associations across clinically distinct autoimmune diseases. We performed an inverse χ2 meta-analysis across ten pediatric-age-of-onset autoimmune diseases (pAIDs) in a case-control study including more than 6,035 cases and 10,718 shared population-based controls. We identified 27 genome-wide significant loci associated with one or more pAIDs, mapping to in silico–replicated autoimmune-associated genes (including IL2RA) and new candidate loci with established immunoregulatory functions such as ADGRL2, TENM3, ANKRD30A, ADCY7 and CD40LG. The pAID-associated single-nucleotide polymorphisms (SNPs) were functionally enriched for deoxyribonuclease (DNase)-hypersensitivity sites, expression quantitative trait loci (eQTLs), microRNA (miRNA)-binding sites and coding variants. We also identified biologically correlated, pAID-associated candidate gene sets on the basis of immune cell expression profiling and found evidence of genetic sharing. Network and protein-interaction analyses demonstrated converging roles for the signaling pathways of type 1, 2 and 17 helper T cells (TH1, TH2 and TH17), JAK-STAT, interferon and interleukin in multiple autoimmune diseases. PMID:26301688

SNPServer: a real-time SNP discovery tool.

PubMed

Savage, David; Batley, Jacqueline; Erwin, Tim; Logan, Erica; Love, Christopher G; Lim, Geraldine A C; Mongin, Emmanuel; Barker, Gary; Spangenberg, German C; Edwards, David

2005-07-01

SNPServer is a real-time flexible tool for the discovery of SNPs (single nucleotide polymorphisms) within DNA sequence data. The program uses BLAST, to identify related sequences, and CAP3, to cluster and align these sequences. The alignments are parsed to the SNP discovery software autoSNP, a program that detects SNPs and insertion/deletion polymorphisms (indels). Alternatively, lists of related sequences or pre-assembled sequences may be entered for SNP discovery. SNPServer and autoSNP use redundancy to differentiate between candidate SNPs and sequence errors. For each candidate SNP, two measures of confidence are calculated, the redundancy of the polymorphism at a SNP locus and the co-segregation of the candidate SNP with other SNPs in the alignment. SNPServer is available at http://hornbill.cspp.latrobe.edu.au/snpdiscovery.html.

Turner syndrome and genetic polymorphism: a systematic review

PubMed Central

de Marqui, Alessandra Bernadete Trovó

2015-01-01

Objective: To present the main results of the literature on genetic polymorphisms in Turner syndrome and their association with the clinical signs and the etiology of this chromosomal disorder. Data sources: The review was conducted in the PubMed database without any time limit, using the terms Turner syndrome and genetic polymorphism. A total of 116 articles were found, and based on the established inclusion and exclusion criteria 17 were selected for the review. Data synthesis: The polymorphisms investigated in patients with Turner syndrome were associated with growth deficit, causing short stature, low bone mineral density, autoimmunity and cardiac abnormalities, which are frequently found in patients with Turner syndrome. The role of single nucleotide polymorphisms in the etiology of Turner syndrome, i.e., in chromosomal nondisjunction, was also confirmed. Conclusions: Genetic polymorphisms appear to be associated with Turner syndrome. However, in view of the small number of published studies and their contradictory findings, further studies in different populations are needed in order to clarify the role of genetic variants in the clinical signs and etiology of the Turner syndrome. PMID:25765448

Genetics of cortisol secretion and depressive symptoms: a candidate gene and genome wide association approach.

PubMed

Velders, Fleur P; Kuningas, Maris; Kumari, Meena; Dekker, Marieke J; Uitterlinden, Andre G; Kirschbaum, Clemens; Hek, Karin; Hofman, Albert; Verhulst, Frank C; Kivimaki, Mika; Van Duijn, Cornelia M; Walker, Brian R; Tiemeier, Henning

2011-08-01

Depressive patients often have altered cortisol secretion, but few studies have investigated genetic variants in relation to both cortisol secretion and depression. To identify genes related to both these conditions, we: (1) tested the association of single nucleotide polymorphisms (SNPs) in hypothalamic-pituitary-adrenal-axis (HPA-axis) candidate genes with a summary measure of total cortisol secretion during the day (cortisol(AUC)), (2) performed a genome wide association study (GWAS) of cortisol(AUC), and (3) tested the association of identified cortisol-related SNPs with depressive symptoms. We analyzed data on candidate SNPs for the HPA-axis, genome-wide scans, cortisol secretion (n=1711) and depressive symptoms (the Centre for Epidemiology Studies Depression Scale, CES-D) (n=2928) in elderly persons of the Rotterdam Study. We used data from the Whitehall II study (n=2836) to replicate the GWAS findings. Of the 1456 SNPs in 33 candidate genes, minor alleles of 4 SNPs (rs9470080, rs9394309, rs7748266 and rs1360780) in the FKBP5 gene were associated with a decreased cortisol(AUC) (p<1×10(-4) after correction for multiple testing using permutations). These SNPs were also associated with an increased risk of depressive symptoms (rs9470080: OR 1.19 (95%CI 1.0; 1.4)). The GWAS for cortisol yielded 2 SNPs with p-values of 1×10(-06) (rs8062512, rs2252459), but these associations could not be replicated. These results suggest that variation in the FKBP5 gene is associated with both cortisol(AUC) and the likelihood of depressive symptoms. Copyright © 2011 Elsevier Ltd. All rights reserved.

DNA polymorphism analysis of candidate genes for type 2 diabetes mellitus in a Mexican ethnic group.

PubMed

Flores-Martínez, S E; Islas-Andrade, S; Machorro-Lazo, M V; Revilla, M C; Juárez, R E; Mújica-López, K I; Morán-Moguel, M C; López-Cardona, M G; Sánchez-Corona, J

2004-01-01

Type 2 diabetes mellitus is a complex metabolic disorder resulting from the action and interaction of many genetic and environmental factors. It has been reported that polymorphisms in genes involved in the metabolism of glucose are associated with the susceptibility to develop type 2 diabetes mellitus. Although the risk of developing type 2 diabetes mellitus increases with age, as well as with obesity and hypertension, its prevalence and incidence are different among geographical regions and ethnic groups. In Mexico, a higher prevalence and incidence has been described in the south of the country, and differences between urban and rural communities have been observed. We studied 73 individuals from Santiago Jamiltepec, a small indigenous community from Oaxaca State, Mexico. This population has shown a high prevalence of type 2 diabetes mellitus, and the aim of this study was to analyze the relationship between the Pst I (insulin gene), Nsi I (insulin receptor gene) and Gly972Arg (insulin receptor substrate 1 gene) polymorphisms and type 2 diabetes mellitus, obesity and hypertension in this population. Clinical evaluation consisted of BMI and blood pressure measurements, and biochemical assays consisted of determination of fasting plasma insulin and glucose levels. PCR and restriction enzyme digestion analysis were applied to genomic DNA to identify the three polymorphisms. From statistical analysis carried out here, individually, the Pst I, Nsi I and Gly972Arg polymorphisms were not associated with the type 2 diabetes, obese or hypertensive phenotypes in this population. Nevertheless, there was an association between the Nsi I and Pst I polymorphisms and increased serum insulin levels.

Human 8-oxoguanine DNA glycosylase gene polymorphism (Ser326Cys) and cancer risk: updated meta-analysis

PubMed Central

Park, Hae Jeong; Chung, Joo-Ho; Ban, Ju Yeon

2017-01-01

Genetic polymorphism of human 8-oxoguanine glycosylase 1 (hOGG1) has been reported to have a relationship with the risk of the development of various cancers. Many studies have described the influence of Ser326Cys polymorphism of the hOGG1 gene on cancer susceptibility. However, the results have remained inconclusive and controversial. Therefore, we performed a meta-analysis to more precisely determine the relationship between the hOGG1 polymorphism and the development of cancer. Electronic databases including PubMed, Embase, Google Scholar, and the Korean Studies Information Service System (KISS) were searched. The odds ratio (OR), 95% confidence interval (CI), and p value were calculated to assess the strength of the association with the risk of cancer using Comprehensive Meta-analysis software (Corporation, NJ, USA). The 127 studies including 38,757 cancer patients and 50,177 control subjects were analyzed for the meta-analysis. Our meta-analysis revealed that G allele of Ser326Cys polymorphism of the hOGG1 gene statistically increased the susceptibility of cancer (all population, OR = 1.092, 95% CI = 1.051-1.134, p < 0.001; in Asian, OR = 1.095, 95% CI = 1.048-1.145, p < 0.001; in Caucasian, OR = 1.097, 95% CI = 1.033-1.179, p = 0.002). Also, other genotype models showed significant association with cancer (p < 0.05, respectively). The present meta-analysis concluded that the G allele was associated with an increased risk of cancer. It suggested that the hOGG1 polymorphism may be a candidate marker of cancer. PMID:28415770

Nutrigenomics in cardiovascular disease: implications for the future.

PubMed

Engler, Mary B

2009-12-01

Cardiovascular disease (CVD), the leading cause of morbidity and mortality worldwide, is a complex multifactorial disease which is influenced by environmental and genetic factors. There is substantial evidence on the relationship between diet and CVD risk. An understanding of how genetic variation interacts with the diet to influence CVD risk is a rapidly evolving area of research. Since diet is the mainstay of risk factor modification, it is important to consider potential genetic influences on CVD risk. Nutrigenomics is the study of the interaction between diet and an individual's genetic makeup. Single nucleotide polymorphisms are the key factors in human genetic variation and provide a molecular basis for phenotypic differences between individuals. Whole genome and candidate gene association studies are two main approaches used in cardiovascular genetics to identify disease-causing genes. Recent nutrigenomics studies show the influence of genotype on the responsiveness to dietary factors or nutrients that may reduce CVD risk. Nutrigenomics research is expected to provide the scientific evidence for genotype-based personalized nutrition to promote health and prevent chronic disease, including CVD. It is imperative that healthcare providers, including cardiovascular nurses, are trained in genetics to foster delivery of competent genetic- and genomic-focused care and to facilitate incorporation of this new knowledge into current clinical practice, education, and research.

Identification of rs7350481 at chromosome 11q23.3 as a novel susceptibility locus for metabolic syndrome in Japanese individuals by an exome-wide association study.

PubMed

Yamada, Yoshiji; Sakuma, Jun; Takeuchi, Ichiro; Yasukochi, Yoshiki; Kato, Kimihiko; Oguri, Mitsutoshi; Fujimaki, Tetsuo; Horibe, Hideki; Muramatsu, Masaaki; Sawabe, Motoji; Fujiwara, Yoshinori; Taniguchi, Yu; Obuchi, Shuichi; Kawai, Hisashi; Shinkai, Shoji; Mori, Seijiro; Arai, Tomio; Tanaka, Masashi

2017-06-13

We have performed exome-wide association studies to identify genetic variants that influence body mass index or confer susceptibility to obesity or metabolic syndrome in Japanese. The exome-wide association study for body mass index included 12,890 subjects, and those for obesity and metabolic syndrome included 12,968 subjects (3954 individuals with obesity, 9014 controls) and 6817 subjects (3998 individuals with MetS, 2819 controls), respectively. Exome-wide association studies were performed with Illumina HumanExome-12 DNA Analysis BeadChip or Infinium Exome-24 BeadChip arrays. The relation of genotypes of single nucleotide polymorphisms to body mass index was examined by linear regression analysis, and that of allele frequencies of single nucleotide polymorphisms to obesity or metabolic syndrome was evaluated with Fisher's exact test. The exome-wide association studies identified six, 11, and 40 single nucleotide polymorphisms as being significantly associated with body mass index, obesity (P <1.21 × 10-6), or metabolic syndrome (P <1.20 × 10-6), respectively. Subsequent multivariable logistic regression analysis with adjustment for age and sex revealed that three and five single nucleotide polymorphisms were related (P < 0.05) to obesity or metabolic syndrome, respectively, with one of these latter polymorphisms-rs7350481 (C/T) at chromosome 11q23.3-also being significantly (P < 3.13 × 10-4) associated with metabolic syndrome. The polymorphism rs7350481 may thus be a novel susceptibility locus for metabolic syndrome in Japanese. In addition, single nucleotide polymorphisms in three genes (CROT, TSC1, RIN3) and at four loci (ANKK1, ZNF804B, CSRNP3, 17p11.2) were implicated as candidate determinants of obesity and metabolic syndrome, respectively.

Single-nucleotide polymorphisms studied for associations with urinary toxicity from (125)I prostate brachytherapy implants.

PubMed

Usmani, Nawaid; Leong, Nelson; Martell, Kevin; Lan, Lanna; Ghosh, Sunita; Pervez, Nadeem; Pedersen, John; Yee, Don; Murtha, Albert; Amanie, John; Sloboda, Ron; Murray, David; Parliament, Matthew

2014-01-01

To identify clinical, dosimetric, and genetic factors that are associated with late urinary toxicity after a (125)I prostate brachytherapy implant. Genomic DNA from 296 men treated with (125)I prostate brachytherapy monotherapy was extracted from saliva samples for this study. A retrospective database was compiled including clinical, dosimetric, and toxicity data for this cohort of patients. Fourteen candidate single-nucleotide polymorphism (SNPs) from 13 genes (TP53, ERCC2, GSTP1, NOS, TGFβ1, MSH6, RAD51, ATM, LIG4, XRCC1, XRCC3, GSTA1, and SOD2) were tested in this cohort for correlations with toxicity. This study identified 217 men with at least 2 years of followup. Of these, 39 patients developed Grade ≥2 late urinary complications with a transurethral resection of prostate, urethral stricture, gross hematuria, or a sustained increase in their International Prostate Symptom Score. The only clinical or dosimetric factor that was associated with late urinary toxicity was age (p = 0.02). None of the 14 SNPs tested in this study were associated with late urinary toxicity in the univariate analysis. This study identified age as the only variable being associated with late urinary toxicity. However, the small sample size and the candidate gene approach used in this study mean that further investigations are essential. Genome-wide association studies are emerging as the preferred approach for future radiogenomic studies to overcome the limitations from a candidate gene approach. Crown Copyright © 2014. Published by Elsevier Inc. All rights reserved.

Association between kidney function and genetic polymorphisms in atherosclerotic and chronic kidney diseases: A cross-sectional study in Japanese male workers

PubMed Central

Nakatochi, Masahiro; Yasuda, Yoshinari; Honda, Hiroyuki; Kuwatsuka, Yachiyo; Kato, Sawako; Kikuchi, Kyoko; Kondo, Takaaki; Iwata, Masamitsu; Nakashima, Toru; Yasui, Hiroshi; Takamatsu, Hideki; Okajima, Hiroshi; Yoshida, Yasuko; Maruyama, Shoichi

2017-01-01

Background Several single nucleotide polymorphisms (SNPs) have been implicated in the predisposition to chronic kidney disease (CKD). Atherosclerotic disease is deeply involved in the incidence of CKD; however, whether SNPs related to arteriosclerosis are involved in CKD remains unclear. This study aimed to identify SNPs associated with CKD and to examine whether risk allele accumulation is associated with CKD. Methods We conducted a cross-sectional study using data of 4814 male workers to examine the association between estimated glomerular filtration rate (eGFR) and 59 candidate polymorphisms (17 CKD, 42 atherosclerotic diseases). We defined the genetic risk score (GRS) as the total number of risk alleles that showed a significant association in this analysis and examined the relationship with CKD (eGFR < 60 ml/min/1.73m2). Multivariate logistic regression, discrimination by area under the receiver operating characteristic curve, integrated discrimination improvement (IDI), and category-free net reclassification improvement (cNRI) were evaluated. Results In total, 432 participants were categorized as having CKD. We found eight candidate SNPs with P value < 0.05 (CX3CR1 rs3732379, SHROOM3 rs17319721, MTP rs1800591, PIP5K1B rs4744712, APOA5 rs662799, BRAP rs3782886, SPATA5L1 rs2467853, and MCP1 rs1024611) in the multivariate linear regression adjusted for age, body mass index, systolic blood pressure, and fasting blood glucose. Among these eight SNPs, BRAP rs3782886 and SPATA5L1 rs2467853 were significantly associated with eGFR (false discovery rate < 0.05). GRS was significantly associated with CKD (odds ratio, 1.17; 95% confidence interval, 1.09–1.26). C-statisics improved from 0.775 to 0.780 but showed no statistical significance. However, adding GRS significantly improved IDI and cNRI (0.0057, P = 0.0028, and 0.212, P < 0.001, respectively). Conclusions After adjustment for clinical factors, kidney function was associated with BRAP rs3782886 and SPATA5L1 rs2467853 and the GRS for CKD that we developed was associated CKD. PMID:29016630

Association between kidney function and genetic polymorphisms in atherosclerotic and chronic kidney diseases: A cross-sectional study in Japanese male workers.

PubMed

Kubo, Yoko; Imaizumi, Takahiro; Ando, Masahiko; Nakatochi, Masahiro; Yasuda, Yoshinari; Honda, Hiroyuki; Kuwatsuka, Yachiyo; Kato, Sawako; Kikuchi, Kyoko; Kondo, Takaaki; Iwata, Masamitsu; Nakashima, Toru; Yasui, Hiroshi; Takamatsu, Hideki; Okajima, Hiroshi; Yoshida, Yasuko; Maruyama, Shoichi

2017-01-01

Several single nucleotide polymorphisms (SNPs) have been implicated in the predisposition to chronic kidney disease (CKD). Atherosclerotic disease is deeply involved in the incidence of CKD; however, whether SNPs related to arteriosclerosis are involved in CKD remains unclear. This study aimed to identify SNPs associated with CKD and to examine whether risk allele accumulation is associated with CKD. We conducted a cross-sectional study using data of 4814 male workers to examine the association between estimated glomerular filtration rate (eGFR) and 59 candidate polymorphisms (17 CKD, 42 atherosclerotic diseases). We defined the genetic risk score (GRS) as the total number of risk alleles that showed a significant association in this analysis and examined the relationship with CKD (eGFR < 60 ml/min/1.73m2). Multivariate logistic regression, discrimination by area under the receiver operating characteristic curve, integrated discrimination improvement (IDI), and category-free net reclassification improvement (cNRI) were evaluated. In total, 432 participants were categorized as having CKD. We found eight candidate SNPs with P value < 0.05 (CX3CR1 rs3732379, SHROOM3 rs17319721, MTP rs1800591, PIP5K1B rs4744712, APOA5 rs662799, BRAP rs3782886, SPATA5L1 rs2467853, and MCP1 rs1024611) in the multivariate linear regression adjusted for age, body mass index, systolic blood pressure, and fasting blood glucose. Among these eight SNPs, BRAP rs3782886 and SPATA5L1 rs2467853 were significantly associated with eGFR (false discovery rate < 0.05). GRS was significantly associated with CKD (odds ratio, 1.17; 95% confidence interval, 1.09-1.26). C-statisics improved from 0.775 to 0.780 but showed no statistical significance. However, adding GRS significantly improved IDI and cNRI (0.0057, P = 0.0028, and 0.212, P < 0.001, respectively). After adjustment for clinical factors, kidney function was associated with BRAP rs3782886 and SPATA5L1 rs2467853 and the GRS for CKD that we developed was associated CKD.

Genome supranucleosomal organization and genetic susceptibility to diseases

NASA Astrophysics Data System (ADS)

Jablonski, K. P.; Fretter, C.; Carron, L.; Forné, T.; Hütt, M.-T.; Lesne, A.

2017-09-01

The notion of disease-associated single-nucleotide polymorphisms (da-SNP), as determined in genome-wide association studies (GWAS), is relevant for many complex pathologies, including cancers. It appeared that da-SNPs are not only markers of causal genetic variation but may contribute to the disease development through an influence on gene expression levels. We argue that understanding this possible functional role of da-SNPs requires to consider their embedding in the tridimensional (3D) multi-scale organization of the human genome. We then focus on the potential impact of da-SNPs on chromatin loops and recently observed topologically associating domains (TADs). We show that for some diseases and cancer types, da-SNPs are over-represented in the borders of these topological domains, in a way that cannot be explained by an increased exon density. This analysis of the distribution of da-SNPs within the 3D genome organization suggests candidate loci for further experimental investigation of the mechanisms underlying genetic susceptibility to diseases, in particular cancer.

Genetic and geochemical signatures to prevent frauds and counterfeit of high-quality asparagus and pistachio.

PubMed

Zannella, Carmela; Carucci, Francesca; Aversano, Riccardo; Prohaska, Thomas; Vingiani, Simona; Carputo, Domenico; Adamo, Paola

2017-12-15

A fingerprinting strategy based on genetic (simple sequence repeat) and geochemical (multielement and 87 Sr/ 86 Sr ratio) analysis was tested to prove the geographical origin of high-quality Italian products "White Asparagus from Bassano del Grappa" and "Green Pistachio from Bronte". Genetic analysis generated many polymorphic alleles and different specific amplified fragments in both agriproducts. In addition, a core set of markers was defined. According to variability within production soils and products, potential candidate elements linking asparagus (Zn, P, Cr, Mg, B, K) and pistachio (Mn, P, Cr, Mg, Ti, B, K, Sc, S) to the production areas were identified. The Sr isotopic signature was an excellent marker when Italian asparagus was compared with literature data for Hungarian and Peruvian asparagus. This work reinforces the use of Sr isotope composition in the soil bioavailable fraction, as assessed by 1mol/L NH 4 NO 3 , to distinguish white asparagus and pistachio originating from different geographical areas. Copyright © 2017 Elsevier Ltd. All rights reserved.

Genetic Influences on Preterm Birth in Argentina

PubMed Central

Mann, Paul C.; Cooper, Margaret E.; Ryckman, Kelli K.; Comas, Belén; Gili, Juan; Crumley, Suzanne; Bream, Elise N.A.; Byers, Heather M.; Piester, Travis; Schaefer, Amanda; Christine, Paul J.; Lawrence, Amy; Schaa, Kendra L.; Kelsey, Keegan J.P.; Berends, Susan K.; Gadow, Enrique; Cosentino, Viviana; Castilla, Eduardo E.; Camelo, Jorge López; Saleme, Cesar; Day, Lori J.; England, Sarah K.; Marazita, Mary L.; Dagle, John M.; Murray, Jeffrey C.

2013-01-01

Objective To investigate genetic etiologies of preterm birth (PTB) in Argentina through evaluation of single-nucleotide polymorphisms (SNP) in candidate genes and population genetic admixture. Study Design Genotyping was performed in 389 families. Maternal, paternal, and fetal effects were studied separately. Mitochondrial DNA (mtDNA) was sequenced in 50 males and 50 females. Y-chromosome anthropological markers were evaluated in 50 males. Results Fetal association with PTB was found in the progesterone receptor (PGR, rs1942836; p= 0.004). Maternal association with PTB was found in small conductance calcium activated potassium channel isoform 3 (KCNN3, rs883319; p= 0.01). Gestational age associated with PTB in PGR rs1942836 at 32 –36 weeks (p= 0.0004). MtDNA sequencing determined 88 individuals had Amerindian consistent haplogroups. Two individuals had Amerindian Y-chromosome consistent haplotypes. Conclusions This study replicates single locus fetal associations with PTB in PGR, maternal association in KCNN3, and demonstrates possible effects for divergent racial admixture on PTB. PMID:23018797

Genetic architecture of natural variation in cuticular hydrocarbon composition in Drosophila melanogaster.

PubMed

Dembeck, Lauren M; Böröczky, Katalin; Huang, Wen; Schal, Coby; Anholt, Robert R H; Mackay, Trudy F C

2015-11-14

Insect cuticular hydrocarbons (CHCs) prevent desiccation and serve as chemical signals that mediate social interactions. Drosophila melanogaster CHCs have been studied extensively, but the genetic basis for individual variation in CHC composition is largely unknown. We quantified variation in CHC profiles in the D. melanogaster Genetic Reference Panel (DGRP) and identified novel CHCs. We used principal component (PC) analysis to extract PCs that explain the majority of CHC variation and identified polymorphisms in or near 305 and 173 genes in females and males, respectively, associated with variation in these PCs. In addition, 17 DGRP lines contain the functional Desat2 allele characteristic of African and Caribbean D. melanogaster females (more 5,9-C27:2 and less 7,11-C27:2, female sex pheromone isomers). Disruption of expression of 24 candidate genes affected CHC composition in at least one sex. These genes are associated with fatty acid metabolism and represent mechanistic targets for individual variation in CHC composition.

Genetic linkage studies in familial partial epilepsy: Exclusion of the human chromosome regions syntenic to the El-1 mouse locus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lopes-Cendes, I.; Mulley, J.C.; Andermann, E.

1994-09-01

Recently, six families with a familial form of partial epilepsy were described. All pedigrees showed autosomal dominant inheritance with incomplete penetrance. Affected individuals present with predominantly nocturnal seizures with frontal lobe semiology. In 1959, a genetic mouse model for partial epilepsy, the El mouse, was reported. In the El mouse, a major seizure susceptibility gene, El-1, segregates in an autosomal dominant fashion and has been localized to a region distal to the centromere of mouse chromosome 9. Comparative genetic maps between man and mouse have been used for prediction of localization of several human disease genes. Because the region ofmore » mouse chromosome 9 that is the most likely to contain the El-1 locus is syntenic to regions on human chromosomes 3q21-p22, 3q21-q23.3, 6q12 and 15q24, we adopted the candidate gene approach as an initial linkage strategy. Twenty-two polymorphic microsatellite markers covering these regions were used for genotyping individuals in the three larger families ascertained, two of which are Australian and one French-Canadian. Negative two-point lod scores were obtained separately for each family. The analysis of all three families combined significantly excludes the candidate regions on chromosomes 3, 6 and 15.« less

A review of pharmacogenetic studies of substance-related disorders*

PubMed Central

Jones, Jermaine D.; Comer, Sandra D.

2015-01-01

Background Substance-related disorders (SRDs) are a major cause of morbidity and mortality worldwide. Family, twin, and adoption studies have demonstrated the substantial heritability of SRDs. To determine the impact of genetic variation on risk for SRD and the response to treatment, researchers have conducted a number of secondary data analyses and quasi-experimental studies that target one or more candidate gene variants. Methods This review examines studies in which candidate polymorphisms were examined as mediator variables to identify pharmacogenetic effects on subjective responses to drug administration or cues or outcomes of medication trials for SRDs. Efforts to use a meta-analytic approach to quantify these effects are premature because the number of available studies using similar methods and outcomes is limited, so the present review is qualitative. Results Findings from these studies provide preliminary evidence of clinically relevant pharmacogenetic effects. However, independent replication of these findings has been sparse. Conclusions Although this growing body of literature has produced conflicting results, improved statistical controls may help to clarify the findings. Additionally, the use of empirically derived sub-phenotypes (i.e., which serve to differentiate distinct groups of affected individuals) may also help to identify genetic mediators of pharmacologic response in relation to SRDs. The identification of genetic mediators can inform clinical care both by identifying risk factors for SRDs and predicting adverse events and therapeutic outcomes associated with specific pharmacotherapies. PMID:25819021