Science.gov

Sample records for cape province south

  1. Shaded Relief of South Africa, Northern Cape Province

    NASA Technical Reports Server (NTRS)

    2000-01-01

    Located north of the Swartberg Mountains in South Africa's Northern Cape Province, this topographic image shows a portion of the Great Karoo region. Karoo is an indigenous word for 'dry thirst land.' The semi-arid area is known for its unique variety of flora and fauna. The topography of the area, with a total relief of 200 meters (650 feet), reveals much about the geologic history of the area. The linear features seen in the image are near-vertical walls of once-molten rock, or dikes, that have intruded the bedrock. The dikes are more resistant to weathering and, therefore, form the linear wall-like features seen in the image. In relatively flat arid areas such as this, small changes in the topography can have large impacts on the water resources and the local ecosystem. These data can be used by biologists to study the distribution and range of the different plants and animals. Geologists can also use the data to study the geologic history of this area in more detail.

    This shaded relief image was generated using topographic data from the Shuttle Radar Topography Mission. A computer-generated artificial light source illuminates the elevation data to produce a pattern of light and shadows. Slopes facing the light appear bright, while those facing away are shaded. On flatter surfaces, the pattern of light and shadows can reveal subtle features in the terrain. Colors show the elevation as measured by SRTM. Colors range from green at the lowest elevations to reddish at the highest elevations. Shaded relief maps are commonly used in applications such as geologic mapping and land use planning.

    The Shuttle Radar Topography Mission (SRTM), launched on February 11, 2000, uses the same radar instrument that comprised the Spaceborne Imaging Radar-C/X-Band Synthetic Aperture Radar (SIR-C/X-SAR) that flew twice on the Space Shuttle Endeavour in 1994. The mission is designed to collect three-dimensional measurements of the Earth's surface. To collect the 3-D data

  2. Erosion-land use change-climate change nexus in the Eastern Cape Province, South Africa

    NASA Astrophysics Data System (ADS)

    Kakembo, Vincent

    2016-04-01

    Unlike many parts of the world where land recovery has been realised as a response to less dependence on land for a livelihood, soil erosion - mainly on abandoned cultivated and overgrazed communal lands in the Eastern Cape Province of South Africa - has intensified. Land abandonment is attributed by most elderly land users to drought that hit the area in the 1960s. The interaction among land-degradation drivers - ranging from soil properties, topography, land-use changes and vegetation to local climate - has given rise to a self-amplifying land degradation feedback loop that has perpetuated severe forms of soil erosion. This has rendered the degraded areas particularly vulnerable to climate change impacts on water. The perpetual degradation calls for developing a dedicated policy on the management and rehabilitation of eroded lands. Restoration approaches should entail promoting disconnectivity on eroded hillslopes. Communal farmers also have to be sensitised and empowered to take ownership of the land-restoration process.

  3. Deaths Rates in Public Hospitals of Eastern Cape Province of South Africa

    PubMed Central

    Buso, DL; Longo-Mbenza, B; Bovet, P; van den Borne, B; Okwe, A Nge; Mzingelwa, M

    2012-01-01

    Background: South Africa (SA) is experiencing a rapid epidemiologic transition as a consequence of political, economic and social changes. In this study we described, based on hospital data, the mortality patterns of Non communicable Diseases (NCD), Communicable Diseases (CD), the NCD/CD ratios, and the trends of deaths. Methods: We conducted a cross-sectional survey of all deaths occurring in several public hospitals in the Eastern Cape Province of SA between 2002 and 2006. Causes of deaths were coded according to the ICD 10 Edition. Results: A total of 107380 admissions responded to the inclusion criteria between 2002 and 2006. The crude death rate was 4.3% (n=4566) with a mean age of 46±21 years and a sex ratio of 3.1 men (n=3453): 1 woman (n=1113). Out of all deaths, there were 62.9% NCD (n=2872) vs. 37.1% CD (n=1694) with NCD/CD ratio of 1.7. The ratio NCD/CD deaths in men was 1.3 (n=1951/1502) vs. NCD/CD deaths in women of 1.9 (n=735/378). The peak of deaths was observed in winter season. The majority of NCD deaths were at age of 30–64 years, whereas the highest rate of CD deaths was at age< 30 years. The trend of deaths including the majority of NCD, increased from 2002 to 2006. There was a tendency of increase in tuberculosis deaths, but a tendency of decrease in HIV/AIDS deaths was from 2002 to 2006. Conclusion: Non-communicable diseases are the leading causes of deaths in rural Eastern Cape province of SA facing Post-epidemiologic transition stages. We recommend overarching priority actions for the response to the Non-communicable Diseases: policy change, prevention, treatment, international cooperation, research, monitoring, accountability, and re-orientation of health systems. PMID:23641386

  4. Trends in soil erosion and woody shrub encroachment in Ngqushwa district, Eastern Cape Province, South Africa.

    PubMed

    Manjoro, Munyaradzi; Kakembo, Vincent; Rowntree, Kate M

    2012-03-01

    Woody shrub encroachment severely impacts on the hydrological and erosion response of rangelands and abandoned cultivated lands. These processes have been widely investigated at various spatial scales, using mostly field experimentation. The present study used remote sensing to investigate spatial and temporal patterns of soil erosion and encroachment by a woody shrub species, Pteronia incana, in a catchment in Ngqushwa district, Eastern Cape Province, South Africa between 1998 and 2008. The extreme categories of soil erosion and shrub encroachment were mapped with higher accuracy than the intermediate ones, particularly where lower spatial resolution data were used. The results showed that soil erosion in the worst category increased simultaneously with dense woody shrub encroachment on the hill slopes. This trend is related to the spatial patterning of woody shrub vegetation that increases bare soil patches--leading to runoff connectivity and concentration of overland flow. The major changes in soil erosion and shrub encroachment analysed during the 10-year period took place in the 5-9° slope category and on the concave slope form. Multi-temporal analyses, based on remote sensing, can extend our understanding of the dynamics of soil erosion and woody shrub encroachment. They may help benchmark the processes and assist in upscaling field studies.

  5. Nematode parasites of some reptiles (Sauria: Testudines: Ophidia) from the northern and Western Cape Provinces, South Africa.

    PubMed

    McAllister, Chris T; Bursey, Charles R; Freed, Paul S

    2010-10-01

    One hundred and seven reptiles (11 families, 32 species) from the Northern and Western Cape Provinces of South Africa were examined for helminths. Twenty-three (22%) individual reptiles were found to harbor at least 1 species of nematode; 3 (7%) reptiles harbored multiple infections of 2 nematode species. Eight species within 5 families of Nematoda were found in the reptiles surveyed including 1 atractid, 1 diaphanocephalid, 1 heterakid, 3 pharyngodonids, and 2 physalopterans. Ten new host records are reported. A summary of the nematode parasites identified from South African reptiles is provided.

  6. Collaboration or renunciation? The role of traditional medicine in mental health care in Rwanda and Eastern Cape Province, South Africa.

    PubMed

    Schierenbeck, Isabell; Johansson, Peter; Andersson, Lena M; Krantz, Gunilla; Ntaganira, Joseph

    2016-10-07

    Traditional medicine (TM) and biomedicine represent parallel health systems in many developing countries; the latter dominating in public policies, while the former still retain considerable influence among the general public. This study investigates how mental health care professionals responsible for mental health care implementation comprehend and relate to the intersection between TM and biomedicine in the cases of Rwanda and the Eastern Cape Province, South Africa. The material is based on semi-structured interviews with mental health care stakeholders in Eastern Cape, South Africa and Rwanda. The findings confirm an impact of TM in the treatment of mental health issues in Rwanda and South Africa due to TM being more accessible than biomedical medicine, widespread traditional perceptions of mental illness in society, and the lack of knowledge of biomedical treatments. Furthermore, the respondents identified three strategies to manage the impact of TM; improved accessibility of biomedical facilities, outreach education about mental illness, and, in the Eastern Cape case, collaboration between traditional healers and biomedicine. The study points to the necessity to take TM into consideration as an important component of health systems and policies in the Global south.

  7. Risk Factors of Porcine Cysticercosis in the Eastern Cape Province, South Africa

    PubMed Central

    Krecek, Rosina Claudia; Mohammed, Hamish; Michael, Lynne Margaret; Schantz, Peter Mullineaux; Ntanjana, Lulama; Morey, Liesl; Werre, Stephen Rakem; Willingham, Arve Lee

    2012-01-01

    There is a high prevalence of Taenia solium taeniosis/cysticercosis in humans and pigs in the Eastern Cape Province (ECP) of South Africa. The objective of this study was to identify risk factors of porcine cysticercosis in select districts of the ECP. Data were collected in 2003 by interviewing 217 pig producers from the area. Blood samples were collected from 261 of their pigs, which were tested using two enzyme-linked immunosorbent assays (ELISA) for the presence of antibodies to cysticercosis. Frequencies of both owner- and pig-level characteristics were determined. For pig-level analysis, all bivariable and multivariable associations were determined using the surveylogistic procedure of the SAS/STAT® software to accommodate for the intraclass correlation that exists for clusters of pigs within one owner and for clusters of owners within a district. All tests for significance were performed at the α = 0.05 level, and adjusted odds ratios (aOR) and 95% confidence intervals (CI) were determined. Among the respondents, 48% of their households lacked a latrine, 98% slaughtered pigs at home, and 99% indicated that meat inspection services were not available. On bivariable analysis, there was a significant association between porcine infection and district (p = 0.003), breed (p = 0.041) and the absence of a latrine (p = 0.006). On multivariable analysis, the absence of a latrine was the only variable significantly associated with porcine infection (aOR = 1.89; 95% CI = 1.07, 3.35) (p = 0.028). The increased odds of porcine infection with households lacking a latrine contributes to our understanding of the transmission of this parasite in the ECP. Determining and addressing the risk factors for T. solium infection can potentially lower the very high prevalence in humans and pigs in this endemic area. PMID:22655065

  8. Microstratigraphic evidence of in situ fire in the Acheulean strata of Wonderwerk Cave, Northern Cape province, South Africa.

    PubMed

    Berna, Francesco; Goldberg, Paul; Horwitz, Liora Kolska; Brink, James; Holt, Sharon; Bamford, Marion; Chazan, Michael

    2012-05-15

    The ability to control fire was a crucial turning point in human evolution, but the question when hominins first developed this ability still remains. Here we show that micromorphological and Fourier transform infrared microspectroscopy (mFTIR) analyses of intact sediments at the site of Wonderwerk Cave, Northern Cape province, South Africa, provide unambiguous evidence--in the form of burned bone and ashed plant remains--that burning took place in the cave during the early Acheulean occupation, approximately 1.0 Ma. To the best of our knowledge, this is the earliest secure evidence for burning in an archaeological context.

  9. Western Cape Primary Care Assessment Tool (PCAT) study: Measuring primary care organisation and performance in the Western Cape Province, South Africa (2013)

    PubMed Central

    Sayed, Abdul-Rauf; le Grange, Cynthia; Bhagwan, Susheela; Manga, Nayna; Hellenberg, Derek

    2016-01-01

    Background Major health sector reform and the need for baseline measures of performance to determine impact. Aim Baseline audit of primary healthcare (PHC) performance. Setting Cape Town and Cape Winelands (rural) PHC facilities (PCFs) in Western Cape Province, South Africa. Method The South African cross-culturally validated ZA PCAT to audit PHC performance on 11 subdomains associated with improved health and reduced costs. Adult PCF users systematically sampled. All full-time doctors and nurse practitioners in PCFs sampled and all PCF managers in sub-districts sampled invited into the study. Results Data from 1432 users, 100 clinicians and 64 managers from 13 PCFs in 10 sub-districts analysed (figures show stakeholder percentages scoring subdomain performance ‘acceptable to good’). 11.5% users scored access ‘acceptable to good’; community orientation and comprehensive services provided 20.8% and 39.9%, respectively. Total PHC score for users 50.2%; for managers and practitioners 82.8% and 88.0%, respectively. Among practitioners access was lowest (33.3%); PHC team (98.0%) and comprehensive services available (100.0%) highest. Among managers, access (13.5%) and family centredness (45.6%) are lowest; PHC team (85.9%) and comprehensive services available (90.6%) highest. Managers scored access, family centredness and cultural competence significantly lower than practitioners. Users scored comprehensive services available, comprehensive services provided and community orientation significantly lower than practitioners and managers. Conclusion Gaps between users’ experience and providers’ assessments of PHC performance are identified. Features that need strengthening and alignment with best practice, provincial and national, and health policies are highlighted with implications for practitioner and manager training, health policy, and research. PMID:27247157

  10. Diversity and distribution of nematodes associated with terrestrial slugs in the Western Cape Province of South Africa.

    PubMed

    Ross, J L; Ivanova, E S; Sirgel, W F; Malan, A P; Wilson, M J

    2012-06-01

    A survey of nematodes associated with native and introduced species of terrestrial slugs was conducted in the Western Cape Province of South Africa, in order to gather new data regarding diversity and distribution. A total of 521 terrestrial slugs were collected from 35 localities throughout the Western Cape. All slugs were dissected and examined for the presence of internal nematodes. Extracted nematodes were identified using a combination of molecular (18S rRNA gene sequencing) and morphological techniques. Nematodes were found parasitizing slugs at 14 of the 35 sites examined, amounting to 40% of sample sites. Of all slugs, 6% were infected with nematodes. A total of seven species of nematode were identified in the province, including Agfa flexilis, Angiostoma sp., Phasmarhabditis sp. SA1, Phasmarhabditis sp. SA2, Caenorhabditis elegans, Panagrolaimus sp. and Rhabditis sp. Of these species, four were thought to be parasitic to slugs (A. flexilis, Angiostoma sp., Phasmarhabditis sp. SA1 and Phasmarhabditis sp. SA2), as opposed to forming necromenic or phoretic associations. Three new species of slug-parasitic nematode were identified during this study (Angiostoma sp., Phasmarhabditis sp. SA1 and Phasmarhabditis sp. SA2).

  11. Parasites of South African wildlife. XVI. Helminths of some antelope species from the Eastern and Western Cape Provinces.

    PubMed

    Boomker, J; Horak, I G; Watermeyer, R; Booyse, D G

    2000-03-01

    The numbers and species of helminths recovered from one black wildebeest, Connochaetes gnou, three eland, Taurotragus oryx, 18 mountain reedbuck, Redunca fulvorufula, one red hartebeest, AIcelaphus buselaphus and two springbok, Antidorcas marsupialis, in the Mountain Zebra National Park, Eastern Cape Province; two black wildebeest, two grey rhebuck, Pelea capreolus, two mountain reedbuck and four springbok in the Karoo National Park, Western Cape Province; two bontebok, Damaliscus pygargus dorcas, two eland, two gemsbok, Oryx gazella and two springbok in the West Coast National Park, Western Cape Province; and a single springbok on a farm near Bredasdorp, Western Cape Province, are recorded. Nematodes belonging to a total of 12 genera and 20 species were identified. A single cestode was also recovered. Sixteen new host associations are recorded for the nematodes and one for the cestode Moniezia benedeni. Nematodirus spathiger had the widest host spectrum and with the exception of black wildebeest, was collected from all the host species examined.

  12. Knowledge of High School Learners Regarding Substance Use within High School Premises in the Buffalo Flats of East London, Eastern Cape Province, South Africa

    ERIC Educational Resources Information Center

    Manu, Emmanuel; Maluleke, Xavela T.; Douglas, Mbuyiselo

    2017-01-01

    South Africa has a high rate of substance abuse among youths both in and out of school with East London in the Eastern Cape Province experiencing an increase in young people ages 20 years and below seeking treatment for substance abuse. The purpose of the study was to explore the knowledge of high school learners (grades 10 to 12) regarding…

  13. Establishing a Computerized Substance Abuse Surveillance System for District Social Workers in the Western Cape Province, South Africa: Methods, Successes and Challenges

    ERIC Educational Resources Information Center

    Burnhams, Nadine Harker; Myers, Bronwyn; Fakier, Nuraan; Parry, Charles; Carelse, Jermaine

    2011-01-01

    The provision of accurate, in-depth data on substance abuse trends and service needs has become increasingly important in light of the growing wave of substance abuse in South Africa and particularly in the Western Cape Province. This article describes the design and implementation of an electronic substance abuse surveillance system (SASS)…

  14. What are we measuring? Comparison of household food security indicators in the Eastern Cape Province, South Africa.

    PubMed

    Hendriks, Sheryl L; van der Merwe, Corné; Ngidi, Mjabuliseni S; Manyamba, Christopher; Mbele, Mondli; McIntyre, Angela M; Mkandawire, Elizabeth; Molefe, Queeneth N; Mphephu, Mulalo Q; Ngwane, Lithle

    2016-01-01

    The development of national food security information systems is constrained by a lack of guidance on which indicators to use. This paper compares food security indicators across two seasons (summer and winter) in one of the most deprived areas of the Eastern Cape province of South Africa. The results show that only anthropometric indicators are sensitive enough to differentiate levels of food insecurity. The lack of consistent classification across indicators means that surveys must use a combination of food consumption and experience of hunger measures backed up by anthropometric measures. Targeting interventions is difficult if the measures cannot be relied on. Further investigation is needed to identify a suite of appropriate indicators for a national information and surveillance system.

  15. Phytotherapeutic Information on Plants Used for the Treatment of Tuberculosis in Eastern Cape Province, South Africa

    PubMed Central

    Lawal, I. O.; Grierson, D. S.; Afolayan, A. J.

    2014-01-01

    The current rate of deforestation in Africa constitutes a serious danger to the future of medicinal plants on this continent. Conservation of these medicinal plants in the field and the scientific documentation of our knowledge about them are therefore crucial. An ethnobotanical survey of plants used for the treatment of tuberculosis (TB) was carried out in selected areas of the Eastern Cape, South Africa. These areas were Hala, Ncera, Sheshegu, and Gquamashe, all within the Nkonkobe Municipality. One hundred informants were interviewed. The survey included the identification of scientific and vernacular names of the plants used for treatment of TB as well as the methods of preparation and administration, the part used, dosage, and duration of treatment. The survey revealed 30 plants belonging to 21 families which are commonly used by traditional healers for the treatment of TB and associated diseases. Of these plants Clausena anisata, Haemanthus albiflos, and Artemisia afra were the most cited. The leaves were the most common part used in the medicinal preparations. Our findings are discussed in relation to the importance of the documentation of medicinal plants. PMID:24864158

  16. Environmental, ecological, and paleoanthropological implications of the late Pleistocene mammalian fauna from Equus Cave, northern Cape Province, South Africa

    NASA Astrophysics Data System (ADS)

    Klein, Richard G.; Cruz-Uribe, Kathryn; Beaumont, Peter B.

    1991-07-01

    The late Pleistocene deposits of Equus Cave, northern Cape Province, South Africa, have provided more than 30,000 taxonomically identifiable mammal bones from 48 species. Context, associations, and features of the bone assemblage implicate brown hyenas as the main accumulators. The fauna is significant mainly because (1) it supplements previous evidence that regional climate was cooler and possibly also somewhat moister during part(s) of the late Pleistocene, but deviated less from the historic norm than in areas farther south; (2) it shows that Bond's springbok, which became extinct in the early Holocene, differed from the surviving common springbok not only in important morphological respects but also in reproductive pattern; and (3) it sustains earlier suggestions that an abundance of carnivores, a paucity of small hard bones, and increase in the cranial/postcranial ratio with species size, and exclusively attritional mortality profiles are features that tend to differentiate assemblages accumulated by brown hyenas from those accumulated by people. In addition, pending firmer dating, the fragmentary human fossils from Equus Cave may support an exclusively African origin for anatomically modern humans.

  17. Ectoparasite burdens of the common mole-rat (Cryptomys hottentotus hottentotus) from the Cape Provinces of South Africa.

    PubMed

    Archer, Elizabeth K; Bennett, Nigel C; Ueckermann, Edward A; Lutermann, Heike

    2014-02-01

    The members of the African mole-rat family Bathyergidae are widely distributed across sub-Saharan Africa. Despite their well-studied biology and reproductive physiology, the current knowledge of their ectoparasite fauna is limited and ambiguous due to recent revisions of the bathyergid taxonomy. The common mole-rat (Cryptomys hottentotus hottentotus) is 1 of the most widely distributed species of these subterranean rodents. Ectoparasites were collected from 268 common mole-rats at 2 localities (Western and Northern Cape provinces) in South Africa over the course of 18 mo with the aim to document species richness, prevalence, and abundance of these ectoparasites. The aggregation of parasite species, sex bias within a species, and seasonal variation in ectoparasite burdens were investigated. A total of 4,830 individual parasites from 4 mite species (Androlaelaps scapularis, Androlaelaps capensis, Radfordia ensifera, and 1 undetermined chigger [family Trombiculidae]), 1 flea species (Cryptopsylla ingrami), and 1 louse species (Eulinognathus hilli) were collected. With the exception of R. ensifera and the chigger, all of these ectoparasites appear to be host specific either for the host species or the Bathyergidae. Aggregation indices indicated that with the exception of E. hilli, the distribution of all parasite species was highly aggregated among hosts and sex biased. Seasonal variation in prevalence, abundance, and species richness was apparent, with greater burdens in the rainy winter season. This is likely related to seasonal variation in abiotic factors but may also be affected by the timing of host reproduction and dispersal behavior.

  18. New geological estimates of Pliocene sea levels from the Western and Northern Cape Provinces, Republic of South Africa

    NASA Astrophysics Data System (ADS)

    Hearty, P. J.; O'Leary, M.; Raymo, M. E.; Rovere, A.; Inglis, J.; Roberts, D.; Bergh, E.

    2012-12-01

    The mid-late Pliocene warm period (MPWP) is the most recent geologic interval when global atmospheric CO2 reached ~400 ppmv. The MPWP is of great interest to paleoclimatologists and modelers because accurate geological data would help to explain the behavior of sea level (SL) and ice sheets in a past warmer climates. Our modern industrial Earth is rapidly approaching this ominous benchmark (395.77 ppmv 6/2012). The trailing continental margin and far-field sites of western and southern Republic of South Africa (RSA) yield abundant coastal imprints of Miocene to Pleistocene seastands. Existing literature identifies zone fossils, and a few unpublished Sr-isotope ages that correlate these shoreline deposits with Pliocene highstands. Younger Pleistocene SL benchmarks provide indications of the regional tectonic stability, with MIS 5e (125 ka) deposits widely correlated along RSA coasts at about +3 m asl. Precise elevations of geomorphic, sedimentary, and biological SL indicators were measured in Western and Northern Cape Provinces of RSA with decimeter accuracy using an OmniStar differential GPS. High-resolution SL indicators (within 0.5 m of paleo-SL) include abrasion platforms (Fig 1), marine terraces, sub-, inter-, and supratidal sedimentary structures, and in situ marine invertebrates such as shallow water oysters and intertidal barnacles. The coastal geomorphic expression of the MPWP is profound. For more than 0.5 Ma, we hypothesize that high frequency (20-40 ka), low amplitude oscillations of Pliocene SL acted as a shoreline "buzz saw", laterally incising older bedrock, forming extensive planation surfaces along the coastline. We propose these broad geomorphic features are diagnostic of this prolonged interval of low amplitude but consistent SL along relatively stable, non-sediment-dominated coastlines of the world. Although currently uncorrected for post-depositional effects including GIA and dynamic topography, our PLIOMAX team (www.pliomax.org) has documented

  19. Biogeography and molar morphology of Pleistocene African elephants: new evidence from Elandsfontein, Western Cape Province, South Africa

    NASA Astrophysics Data System (ADS)

    Smith, Kathlyn M.; Stynder, Deano D.

    2015-05-01

    Elandsfontein (EFT) is a Middle Pleistocene archaeological/paleontological site located in the Western Cape Province of South Africa. The largest herbivore in the assemblage is Loxodonta atlantica zulu, an extinct member of the genus that includes modern African elephants. No Elephas recki specimens were recovered at EFT, despite their common occurrence in other regions of Africa at the same time. Because E. recki and L. atlantica molars are similar in appearance, but the two species are traditionally viewed as dominating different regions of Africa during the Pleistocene, isolated molars may on occasions have been assessed to species level on the basis of geography rather than morphology. The last morphologic evaluation of EFT elephants was conducted in the 1970s, and revisiting this issue with new specimens provides added insight into the evolution of elephants in Africa. Reevaluating morphological characteristics of EFT elephant molars, through qualitative and quantitative description and comparison with Middle Pleistocene E. recki recki, L. atlantica atlantica, and L. atlantica zulu molar morphology, corroborates assessment of EFT elephants as L. a. zulu. Two recently discovered, previously undescribed molars from EFT show that molars of L. a. zulu exhibit greater variation in enamel thickness, lamellar frequency, and occlusal surface morphology than previously reported. An update of the Pleistocene biogeography of Loxodonta and Elephas indicates that fossil remains of both are often found at the same localities in eastern Africa. Their rare co-occurrences in the north and south, however, suggest geographic separation of the two genera in at least some regions of Africa, which may have been based on habitat preference.

  20. Poverty and Disability in Eastern and Western Cape Provinces, South Africa

    ERIC Educational Resources Information Center

    Loeb, Mitchell; Eide, Arne H.; Jelsma, Jennifer; Toni, Mzolisi ka; Maart, Soraya

    2008-01-01

    The impact of disability on the living conditions of people living in specifically resource-poor areas in South Africa has not previously been addressed. This paper presents a comparison of people with a disability and their non-disabled peers with respect to some key poverty indicators among a sample of Xhosa speaking individuals in resource-poor…

  1. Epidemiology of fetal alcohol syndrome in a South African community in the Western Cape Province.

    PubMed Central

    May, P A; Brooke, L; Gossage, J P; Croxford, J; Adnams, C; Jones, K L; Robinson, L; Viljoen, D

    2000-01-01

    OBJECTIVES: This study determined the characteristics of fetal alcohol syndrome in a South African community, and methodology was designed for the multidisciplinary study of fetal alcohol syndrome in developing societies. METHODS: An active case ascertainment, 2-tier methodology was used among 992 first-grade pupils. A case-control design, using measures of growth, development, dysmorphology, and maternal risk, delineated characteristics of children with fetal alcohol syndrome. RESULTS: A high rate of fetal alcohol syndrome was found in the schools--40.5 to 46.4 per 1000 children aged 5 to 9 years--and age-specific community rates (ages 6-7) were 39.2 to 42.9. These rates are 18 to 141 times greater than in the United States. Rural residents had significantly more fetal alcohol syndrome. After control for ethnic variation, children with fetal alcohol syndrome had traits similar to those elsewhere: poor growth and development, congruent dysmorphology, and lower intellectual functioning. CONCLUSIONS: This study documented the highest fetal alcohol syndrome rate to date in an overall community population. Fetal alcohol syndrome initiatives that incorporate innovative sampling and active case ascertainment methods can be used to obtain timely and accurate data among developing populations. PMID:11111264

  2. Realist evaluation of the antiretroviral treatment adherence club programme in selected primary healthcare facilities in the metropolitan area of Western Cape Province, South Africa: a study protocol

    PubMed Central

    Mukumbang, Ferdinand C; Van Belle, Sara; Marchal, Bruno; Van Wyk, Brian

    2016-01-01

    Introduction Suboptimal retention in care and poor treatment adherence are key challenges to antiretroviral therapy (ART) in sub-Saharan Africa. Community-based approaches to HIV service delivery are recommended to improve patient retention in care and ART adherence. The implementation of the adherence clubs in the Western Cape province of South Africa was with variable success in terms of implementation and outcomes. The need for operational guidelines for its implementation has been identified. Therefore, understanding the contexts and mechanisms for successful implementation of the adherence clubs is crucial to inform the roll-out to the rest of South Africa. The protocol outlines an evaluation of adherence club intervention in selected primary healthcare facilities in the metropolitan area of the Western Cape Province, using the realist approach. Methods and analysis In the first phase, an exploratory study design will be used. Document review and key informant interviews will be used to elicit the programme theory. In phase two, a multiple case study design will be used to describe the adherence clubs in five contrastive sites. Semistructured interviews will be conducted with purposively selected programme implementers and members of the clubs to assess the context and mechanisms of the adherence clubs. For the programme's primary outcomes, a longitudinal retrospective cohort analysis will be conducted using routine patient data. Data analysis will involve classifying emerging themes using the context-mechanism-outcome (CMO) configuration, and refining the primary CMO configurations to conjectured CMO configurations. Finally, we will compare the conjectured CMO configurations from the cases with the initial programme theory. The final CMOs obtained will be translated into middle range theories. Ethics and dissemination The study will be conducted according to the principles of the declaration of Helsinki (1964). Ethics clearance was obtained from the

  3. Protozoan Fauna and Abundance in Aeration Tanks of Three Municipal Wastewater Treatment Plants in the Eastern Cape Province of South Africa

    NASA Astrophysics Data System (ADS)

    Sibewu, M.; Momba, M. N. B.; Okoh, A. L.

    This study focuses on the assessment of the protozoan fauna and abundance in the mixed liquors of aeration tanks of the three municipal wastewater treatment plants located in Fort Beaufort, Dimbaza and East London in the Eastern Cape Province of South Africa and their implication to the production of effluents of good quality. The samples were collected between September and December 2005 and protozoa species were identified by direct microscopic observations at x400 magnification by comparison with existing protozoa gallery collections. A total of 68 protozoan genera made up of 44 ciliates, 16 flagellates and 8 others were identified in wastewater treatment plants. Although in all aerobic zones the average density of ciliates was 104 cells mL-1, which indicated that these plants were able to produce clear effluent of good quality, a better performance was found in Dimbaza and East London, which had total protozoan genera of 27 and 26, respectively.

  4. Knowledge and use of emergency contraception among women in the Western Cape province of South Africa: a cross-sectional study

    PubMed Central

    Myer, Landon; Mlobeli, Regina; Cooper, Di; Smit, Jennifer; Morroni, Chelsea

    2007-01-01

    Background Emergency contraception (EC) is widely available free of charge at public sector clinics in South Africa. At the same time, rates of teenage and unintended pregnancy in South Africa remain high, and there are few data on knowledge of EC in the general population in South Africa, as in other resource-limited settings. Methods We conducted a cross-sectional, interviewer-administered survey among 831 sexually active women at 26 randomly selected public sector clinics in the Western Cape province. Results Overall, 30% of the women had ever heard of EC when asked directly, after the method was described to them. Only 15% mentioned EC by name or description spontaneously. Knowledge of EC was independently associated with higher education, being married, and living in an urban setting. Four percent of women had ever used EC. Discussion These data suggest that knowledge of EC in this setting is more common among women of higher socioeconomic status living in urban areas. For EC to play a role in decreasing unintended pregnancy in South Africa, specific interventions are necessary to increase knowledge of the method, where to get it, and the appropriate time interval for its use before the need for EC arises. Future health promotion campaigns should target rural and low socioeconomic status communities. PMID:17850659

  5. Outsourcing vaccine logistics to the private sector: The evidence and lessons learned from the Western Cape Province in South-Africa.

    PubMed

    Lydon, Patrick; Raubenheimer, Ticky; Arnot-Krüger, Michelle; Zaffran, Michel

    2015-06-26

    With few exceptions, immunization supply chains in developing countries continue to face chronic difficulties in providing uninterrupted availability of potent vaccines up to service delivery levels, and in the most efficient manner possible. As these countries struggle to keep pace with an ever growing number of vaccines, more and more Ministries of Health are considering options of engaging the private sector to manage vaccine storage, handling and distribution on their behalf. Despite this emerging trend, there is limited evidence on the benefits or challenges of this option to improve public supply chain performance for national immunization programmes. To bridge this knowledge gap, this study aims to shed light on the value proposition of outsourcing by documenting the specific experience of the Western Cape Province of South Africa. The methodology for this review rested on conducting two key supply chain assessments which allowed juxtaposing the performance of the government managed segments of the vaccine supply chain against those managed by the private sector. In particular, measures of effective vaccine management best practice and temperature control in the cold chain were analysed. In addition, the costs of engaging the private sector were analysed to get a better understanding of the economics underpinning outsourcing vaccine logistics. The results from this analysis confirmed some of the theoretical benefits of outsourcing to the private sector. Yet, if the experience in the Western Cape can be deemed a successful one, there are several policy and practice implications that developing countries should be mindful of when considering engaging the private sector. While outsourcing can help improve the performance of the vaccine supply chain, it has the potential to do the reverse if done incorrectly. The findings and lessons learnt from the Western Cape experience can serve as a step towards understanding the role of the private sector in immunization

  6. Middle and Later Stone Age large mammal and tortoise remains from Die Kelders Cave 1, Western Cape Province, South Africa.

    PubMed

    Klein, R G; Cruz-Uribe, K

    2000-01-01

    Die Kelders Cave 1, South Africa, has provided more than 150,000 taxonomically identifiable mammal and tortoise bones from Middle Stone Age (MSA) and Later Stone Age (LSA) deposits. Cape dune mole-rats dominate the mammal sample, and they appear to have been accumulated mainly by people during the LSA occupation and mainly by eagle owls in the MSA. In sharp contrast to the LSA fauna, the MSA sample contains extralimital ungulates that imply relatively moist, grassy conditions. The large mean size of the MSA mole-rats also points to greater humidity, while the large size of the gray mongooses implies cooler temperatures. The sum supports luminescence and ESR dates that place the MSA occupation within the early part of the Last Glaciation (global isotope stage 4). The Die Kelders ungulate bones support those from Klasies River Mouth in suggesting that MSA people obtained dangerous terrestrial prey much less frequently than their LSA successors, probably because MSA people lacked the bow and arrow and other projectile weapons. The Die Kelders tortoise bones constrain the extent of climatic change, since their abundance indicates that warm, dry days remained common, at least seasonally. The tortoises tend to be much larger in the MSA layers than in the LSA ones, suggesting that MSA people collected tortoises less intensively, probably because MSA populations were relatively sparse.

  7. Paleoenvironmental and Human Behavioral Implications of the Boegoeberg 1 Late Pleistocene Hyena Den, Northern Cape Province, South Africa

    NASA Astrophysics Data System (ADS)

    Klein, Richard G.; Cruz-Uribe, Kathryn; Halkett, David; Hart, Tim; Parkington, John E.

    1999-11-01

    Boegoeberg 1 (BOG1) is located on the Atlantic coast of South Africa, 850 km north of Cape Town. The site is a shallow rock shelter in the side of a sand-choked gully that was emptied by diamond miners. Abundant coprolites, chewed bones, and partially digested bones implicate hyenas as the bone accumulators. The location of the site, quantity of bones, and composition of the fauna imply it was a brown hyena nursery den. The abundance of Cape fur seal bones shows that the hyenas had ready access to the coast. Radiocarbon dates place the site before 37,000 14C yr ago, while the large average size of the black-backed jackals and the presence of extralimital ungulates imply cool, moist conditions, probably during the early part of the last glaciation (isotope stage 4 or stage 3 before 37,000 14C yr ago) or perhaps during one of the cooler phases (isotope substages 5d or 5b) within the last interglaciation. Comparisons of the BOG1 seal bones to those from regional Middle Stone Age (MSA) and Later Stone Age (LSA) archeological sites suggest (1) that hyena and human seal accumulations can be distinguished by a tendency for vertebrae to be much more common in a hyena accumulation and (2) that hyena and LSA accumulations can be distinguished by a tendency for hyena-accumulated seals to represent a much wider range of individual seal ages. Differences in the way hyenas and people dismember, transport, and consume seal carcasses probably explain the contrast in skeletal part representation, while differences in season of occupation explain the contrast in seal age representation. Like modern brown hyenas, the BOG1 hyenas probably occupied the coast year-round, while the LSA people focused their coastal visits on the August-October interval when nine-to-eleven-month-old seals were abundant. The MSA sample from Klasies River Mouth Cave 1 resembles BOG1 in seal age composition, suggesting that unlike LSA people, MSA people obtained seals more or less throughout the year.

  8. ERTS-1 imagery as an aid to the understanding of the regional setting of base metal deposits in the North West Cape Province, South Africa. [mineral exploration

    NASA Technical Reports Server (NTRS)

    Viljoen, R. P.

    1974-01-01

    A number of base metal finds have recently focussed attention on the North Western Cape Province of South Africa as an area of great potential mineral wealth. From the point of view of competitive mineral exploration it was essential that an insight into the regional geological controls of the base metal mineralization of the area be obtained as rapidly as possible. Conventional methods of producing a suitable regional geological map were considered to be too time-consuming and ERTS-1 imagery was consequently examined. This imagery has made a significant contribution in the compilation of a suitable map on which to base further mineral exploration programmes. The time involved in the compilation of maps of this nature was found to be only a fraction of the time necessary for the production of similar maps using other methods. ERTS imagery is therefore considered to be valuable in producing accurate regional maps in areas where little or no geological data are available, or in areas of poor access. Furthermore, these images have great potential for rapidly defining the regional extent of metallogenic provinces.

  9. Small mammal utilization by Middle Stone Age humans at Die Kelders Cave 1 and Pinnacle Point Site 5-6, Western Cape Province, South Africa.

    PubMed

    Armstrong, Aaron

    2016-12-01

    Reported here are the results of a taphonomic analysis of the small mammals (between 0.75 kg and 4.5 kg adult body weight) and size 1 bovids (≤20 kg adult body weight) from the Middle Stone Age (MSA) sites of Die Kelders Cave 1 (DK1) and Pinnacle Point Site 5-6 (PP5-6), Western Cape Province, South Africa. This study provides a comprehensive taphonomic analysis of MSA small mammals with a focus on discerning the role of humans in their accumulation and the implications for human behavioral adaptations. Based on comparisons with control assemblages of known accumulation, it is evident that humans accumulated many of the Cape dune mole-rats, hares, and size 1 bovids at DK1. The patterning of cut-marked and burned mole-rat remains at DK1 provides evidence in the MSA for the systematic utilization of small mammals for their skins and as a protein source. Unlike DK1, small mammals and size 1 bovids constitute only a small portion of the PP5-6 mammals and they exhibit little evidence of human accumulation. Nocturnal and diurnal raptors accumulated most of the small fauna at PP5-6. The nominal presence of small mammals in the PP5-6 fauna is atypical of MSA sites in the Cape Floristic Region, where they are abundant and often constitute large portions of MSA archaeofaunas. DK1 humans maximized the environmental yield by exploiting low-quality resources, a strategy employed possibly in response to localized environmental conditions and to greater human population densities. In comparison, the MIS5-4 humans at PP5-6 did not exploit small mammals and instead focused on higher-quality resources like shellfish and large ungulates. Humans and predators accumulated few small mammals at PP5-6, suggesting that these taxa may have been less abundant near the site and/or that humans could afford to concentrate on high-quality resources, perhaps because of a higher-yield local environment. This study suggests that an adaptive response to the environmental conditions of MIS4 was

  10. Hepatitis E virus: Western Cape, South Africa

    PubMed Central

    Madden, Richie G; Wallace, Sebastian; Sonderup, Mark; Korsman, Stephen; Chivese, Tawanda; Gavine, Bronwyn; Edem, Aniefiok; Govender, Roxy; English, Nathan; Kaiyamo, Christy; Lutchman, Odelia; van der Eijk, Annemiek A; Pas, Suzan D; Webb, Glynn W; Palmer, Joanne; Goddard, Elizabeth; Wasserman, Sean; Dalton, Harry R; Spearman, C Wendy

    2016-01-01

    AIM To conduct a prospective assessment of anti-hepatitis E virus (HEV) IgG seroprevalence in the Western Cape Province of South Africa in conjunction with evaluating risk factors for exposure. METHODS Consenting participants attending clinics and wards of Groote Schuur, Red Cross Children’s Hospital and their affiliated teaching hospitals in Cape Town, South Africa, were sampled. Healthy adults attending blood donor clinics were also recruited. Patients with known liver disease were excluded and all major ethnic/race groups were included to broadly represent local demographics. Relevant demographic data was captured at the time of sampling using an interviewer-administered confidential questionnaire. Human immunodeficiency virus (HIV) status was self-disclosed. HEV IgG testing was performed using the Wantai® assay. RESULTS HEV is endemic in the region with a seroprevalence of 27.9% (n = 324/1161) 95%CI: 25.3%-30.5% (21.9% when age-adjusted) with no significant differences between ethnic groups or HIV status. Seroprevalence in children is low but rapidly increases in early adulthood. With univariate analysis, age ≥ 30 years old, pork and bacon/ham consumption suggested risk. In the multivariate analysis, the highest risk factor for HEV IgG seropositivity (OR = 7.679, 95%CI: 5.38-10.96, P < 0.001) was being 30 years or older followed by pork consumption (OR = 2.052, 95%CI: 1.39-3.03, P < 0.001). A recent clinical case demonstrates that HEV genotype 3 may be currently circulating in the Western Cape. CONCLUSION Hepatitis E seroprevalence was considerably higher than previously thought suggesting that hepatitis E warrants consideration in any patient presenting with an unexplained hepatitis in the Western Cape, irrespective of travel history, age or ethnicity. PMID:27956810

  11. Treatment Outcomes for Patients with Extensively Drug-Resistant Tuberculosis, KwaZulu-Natal and Eastern Cape Provinces, South Africa

    PubMed Central

    Cegielski, J. Peter; van der Walt, Martie L.

    2016-01-01

    We analyzed data for a retrospective cohort of patients treated for extensively drug-resistant tuberculosis in 2 provinces in South Africa and compared predictors of treatment outcome in HIV-positive patients who received or had not received antiretroviral drugs with those for HIV-negative patients. Overall, 220 (62.0%) of 355 patients were HIV positive. After 2 years, 34 (10.3%) of 330 patients with a known HIV status and known outcome had a favorable outcome. Multivariate analysis showed that predictors of favorable outcome were negative results for acid-fast bacilli by sputum microscopy at start of treatment and weight >50 kg. HIV-positive patients were more likely to have an unfavorable outcome. The strongest predictor of unfavorable outcome was weight <50 kg. Overall outcomes were poor. HIV status was not a predictor of favorable outcome, but HIV-positive patients were more likely to have an unfavorable outcome. These results underscore the need for timely and adequate treatment for tuberculosis and HIV infection. PMID:27538119

  12. A Survey of Music Education in the Primary Schools of South Africa's Cape Peninsula

    ERIC Educational Resources Information Center

    Herbst, Anri; Wet, Jacques de; Rijsdijk, Susan

    2005-01-01

    We investigated the state of music education in government primary schools in the Cape Peninsula (Western Cape Province, South Africa) as perceived by the general class teacher. Since the first democratic elections in South Africa (1994), the entire primary and secondary school education system has changed drastically in terms of content, and…

  13. Serum Oxidized LDL Levels in Type 2 Diabetic Patients with Retinopathy in Mthatha Region of the Eastern Cape Province of South Africa

    PubMed Central

    2016-01-01

    Oxidized low-density lipoprotein (ox-LDL) is a powerful natural prooxidant derived from native LDL by cell-mediated oxidation. Such oxidation occurs more easily in glycated LDL as observed in diabetes mellitus. We evaluated and compared selected biomarkers of oxidative stress and total antioxidant (TAO) levels in type 2 diabetes mellitus (T2DM) patients with and without retinopathy in the Mthatha region of the Eastern Cape Province, South Africa. The participants totaled to 140 and this number comprised 98 diabetic patients on treatment, stratified by diabetes (54) and diabetes with retinopathy (44). Forty-two nondiabetic healthy controls made up the 140. Fasting plasma glucose (FPG), glycosylated hemoglobin (HbA1c), lipid profile, serum ox-LDL, thiobarbituric acid reactive substances (TBARS), and TAO levels were measured. A statistically significant increase in FPG, HbA1c, TBARS, and ox-LDL and a significant decrease in TAO levels were seen in T2DM patients with retinopathy as compared to controls. A significant negative correlation was observed between TAO and ox-LDL levels in the diabetic group. In multiple linear regression analyses, duration of diabetes, triglyceride, TAO, and LDL cholesterol were found to be significantly associated with ox-LDL. In multiple logistic regression analyses, ox-LDL [OR 1.02 (1.01–1.03), P = 0.005] was the only risk factor and was significantly associated with the presence of retinopathy. PMID:27433285

  14. The Impact of Computer and Mathematics Software Usage on Performance of School Leavers in the Western Cape Province of South Africa: A Comparative Analysis

    ERIC Educational Resources Information Center

    Smith, Garth Spencer; Hardman, Joanne

    2014-01-01

    In this study the impact of computer immersion on performance of school leavers Senior Certificate mathematics scores was investigated across 31 schools in the EMDC East education district of Cape Town, South Africa by comparing performance between two groups: a control and an experimental group. The experimental group (14 high schools) had access…

  15. Two new water beetles from the South African Cape (Coleoptera, Hydraenidae).

    PubMed

    Bilton, David T

    2016-07-13

    Pterosthetops nitidus sp. nov. and Oomtelecopon namaqum sp. nov. are described from the Western and Northern Cape Provinces of South Africa respectively. Diagnostic notes are provided for each species, together with details of occupied microhabitats.

  16. Women in Educational Leadership: The Case of Hope High School in the Eastern Cape Province, South Africa

    ERIC Educational Resources Information Center

    Diko, Nolutho

    2014-01-01

    The Constitution of the Republic of South Africa, 1996 confers equality on all South African citizens regardless of race and gender. It has been reported that, under apartheid, gender inequality was a way of life and even social liberation movements observed it. Education is not exempt from gender inequality; the Department of Education in 2003…

  17. ICT applications as e-health solutions in rural healthcare in the Eastern Cape Province of South Africa.

    PubMed

    Ruxwana, Nkqubela L; Herselman, Marlien E; Conradie, D Pieter

    2010-01-01

    Information and Communication Technology (ICT) solutions (e.g. e-health, telemedicine, e-education) are often viewed as vehicles to bridge the digital divide between rural and urban healthcare centres and to resolve shortcomings in the rural health sector. This study focused on factors perceived to influence the uptake and use of ICTs as e-health solutions in selected rural Eastern Cape healthcare centres, and on structural variables relating to these facilities and processes. Attention was also given to two psychological variables that may underlie an individual&s acceptance and use of ICTs: usefulness and ease of use. Recommendations are made with regard to how ICTs can be used more effectively to improve health systems at fi ve rural healthcare centres where questionnaire and interview data were collected: St. Lucy&s Hospital, Nessie Knight Hospital, the Tsilitwa Clinic, the Madzikane Ka-Zulu Memorial Hospital and the Nelson Mandela General Hospital.

  18. Studies on the bacteriological qualities of the Buffalo River and three source water dams along its course in the Eastern Cape Province of South Africa.

    PubMed

    Chigor, Vincent N; Sibanda, Timothy; Okoh, Anthony I

    2013-06-01

    The Buffalo River and its dams are major surface water sources used for fresh produce irrigation, raw water abstraction and recreation in parts of the Eastern Cape Province in South Africa. Over a 12-month period (August 2010 to July 2011), we assessed the bacteriological qualities of water from the river and 3 source water dams along its course. Faecal indicator bacteria (FIB), including total coliform (TC), faecal coliform (FC) and enterococci (ENT) counts, were high and ranged as follows: 1.9 × 10(2)-3.8 × 10(7), 0-3.0 × 10(5) and 0-5.3 × 10(5) cfu/100 ml for TC, FC and ENT, respectively. Significantly (P<0.05) higher concentrations of FC and ENT were observed at the sampling sites located at the lower reaches of the river compared to the upper reaches, and at Bridle Drift Dam compared to the other two dams. FIB counts mostly exceeded the recommended maximum values suggested by national and international guidelines for safe fresh produce irrigation, domestic applications, full-contact recreation and livestock watering. These results show that the bacteriological qualities of the Buffalo River and dams were poor, and suggest that sewage was dumped into the Buffalo River during the study period. Urban runoffs and effluents of wastewater treatment plants appear to be important sources of faecal contamination in the river. We conclude that these water bodies represent significant public health hazards. Provision of adequate sanitary infrastructure will help prevent source water contamination, and public health education aimed at improving personal, household and community hygiene is imperative.

  19. A questionnaire survey on diseases and problems affecting sheep and goats in communal farming regions of the Eastern Cape province, South Africa.

    PubMed

    Bath, Gareth F; Penrith, Mary-Louise; Leask, Rhoda

    2016-08-31

    A questionnaire of 15 questions was completed by four categories of respondents with the aim of establishing the experience and opinions of these groups on the constraints including animal health problems for communal, small-scale sheep and goat farming in the Eastern Cape province of South Africa. The questionnaires were completed independently and categories were representative of the areas investigated. Analysis of responses was done by means, ranges, votes and clusters of responses. Comparisons between the responses of the four categories were made to identify similarities or contrasts. The results revealed that of non-veterinary concerns, stock theft was the major problem for these farms. Nutrition was a further major constraint. A third area of significant concern was the provision or availability of facilities like fences, water troughs, dips and sheds. Lack of marketing and business skills were also seen as important deficiencies to be rectified so as to promote profitable farming. Of the most important veterinary problems identified, the provision, availability, cost and care of drugs and vaccines were seen as major stumbling blocks to effective disease control, as well as lack of access to veterinary services. The most important diseases that constrain small-ruminant livestock farming in the farming systems investigated were sheep scab and other ectoparasites, heart water, enterotoxaemia, internal parasites and bluetongue. A lack of knowledge in key areas of small-stock farming was revealed and should be rectified by an effective training and support programme to improve the contribution of small-ruminant farming to livelihoods in these communities.

  20. Antibiotic Susceptibilities of Enterococcus Species Isolated from Hospital and Domestic Wastewater Effluents in Alice, Eastern Cape Province of South Africa

    PubMed Central

    Iweriebor, Benson Chuks; Gaqavu, Sisipho; Obi, Larry Chikwelu; Nwodo, Uchechukwu U.; Okoh, Anthony I.

    2015-01-01

    Background: Antimicrobial resistance in microorganisms are on the increase worldwide and are responsible for substantial cases of therapeutic failures. Resistance of species of Enterococcus to antibiotics is linked to their ability to acquire and disseminate antimicrobial resistance determinants in nature, and wastewater treatment plants (WWTPs) are considered to be one of the main reservoirs of such antibiotic resistant bacteria. We therefore determined the antimicrobial resistance and virulence profiles of some common Enterococcus spp that are known to be associated with human infections that were recovered from hospital wastewater and final effluent of the receiving wastewater treatment plant in Alice, Eastern Cape. Methods: Wastewater samples were simultaneously collected from two sites (Victoria hospital and final effluents of a municipal WWTP) in Alice at about one to two weeks interval during the months of July and August 2014. Samples were screened for the isolation of enterococci using standard microbiological methods. The isolates were profiled molecularly after targeted generic identification and speciation for the presence of virulence and antibiotic resistance genes. Results: Out of 66 presumptive isolates, 62 were confirmed to belong to the Enterococcus genusof which 30 were identified to be E. faecalis and 15 E. durans. The remaining isolates were not identified by the primers used in the screening procedure. Out of the six virulence genes that were targeted only three of them; ace, efaA, and gelE were detected. There was a very high phenotypic multiple resistance among the isolates and these were confirmed by genetic analyses. Conclusions: Analyses of the results obtained indicated that hospital wastewater may be one of the sources of antibiotic resistant bacteria to the receiving WWTP. Also, findings revealed that the final effluent discharged into the environment was contaminated with multi-resistant enterococci species thus posing a health hazard

  1. Characterization of the village goat production systems in the rural communities of the Eastern Cape, KwaZulu-Natal, Limpopo and North West Provinces of South Africa.

    PubMed

    Mdladla, Khanyisile; Dzomba, Edgar Farai; Muchadeyi, Farai Catherine

    2017-03-01

    Expansion of goat improvement programs requires exploration of the factors that influence the production system and breeding initiatives. Characterization of goat breeds or populations is crucial in providing information on prevalent goat types and their attributes and may suffice as a guideline on conservation, development, and selection for improved productivity. This study investigated the existing village goat production system and phenotypic diversity of the different village populations from four South African provinces. The study further investigated the use of phenotypic attributes to classify goats to breeds or populations. Data was collected from 142 households in 26 villages of the Eastern Cape (n = 2 villages), KwaZulu-Natal (n = 6 villages), Limpopo (n = 13 villages), and North West (n = 5 villages) provinces through a survey. Individual interviews and focus group discussions revealed that the mean goat herd size per household was least in Limpopo at 13.2 ± 12.40 and highest in Eastern Cape (34.18 ± 28.36). Flocks had more (p < 0.05) adults than kids, and the distribution of breeding animals was biased towards does and less bucks. Goats were kept mainly for meat, for selling, and for ritual ceremonies. The goat production system was mainly scavenging. Goat health was a major challenge across households and villages. Qualitative traits such coat, horn, ears, and wattle characteristics were recorded for populations of village goats (n = 319) and a feral Tankwa breed (n = 50). The dominant coat pattern was plain (74.53%) with black as the most common coat color (31.98%). Across breeds, a majority (88.08%) of the goats had horns, and 7.59% had wattles while 56.64% had beard. Adult goats (<3 years; n = 398) were further analyzed for five quantitative traits of chest girth, height, length, and pin bone and there were significant (p < 0.05) breed differences in all. A stepwise discriminatory procedure was used to

  2. Seasonal abundance and distribution of Vibrio species in the treated effluent of wastewater treatment facilities in suburban and urban communities of Eastern Cape Province, South Africa.

    PubMed

    Igbinosa, Etinosa O; Obi, Chikwelu L; Okoh, Anthony I

    2011-04-01

    We assessed the seasonal abundance and distribution of Vibrio species as well as some selected environmental parameters in the treated effluents of two wastewater treatment plants (WWTP), one each located in a suburban and urban community of Eastern Cape Province, South Africa. Vibrio population density ranged from 2.1 × 10(5) to 4.36 × 10(4) CFU/ml in the suburban community and from 2.80 × 10(5) to 1.80 × 10(5) CFU/ml in the urban community. Vibrio species associated with 180 μ, 60 μ, and 20 μ plankton sizes were observed at densities of 0-136 × 10(3) CFU/ml, 0-8.40 × 10(2) CFU/ml, and 0-6.80 × 10(2) CFU/ml, respectively at the suburban community's WWTP. In the urban community, observed densities of culturable Vibrio were 0-2.80 × 10(2) CFU/ml (180 μ), 0-6.60 × 10(2) CFU/ml (60 μm), and 0-1.80 × 10(3) CFU/ml (20 μm). The abundance of free-living Vibrio species ranged from 0 to 1.0 × 10(2) and 1.0 × 10(3) CFU/ml in the suburban and urban communities' WWTPs, respectively. Molecular confirmation of the presumptive Vibrio isolates revealed the presence of V. fluvialis (41.38%), V. vulnificus (34.48%), and V. parahaemolyticus (24.14%) in the suburban community effluents. In the urban community molecular confirmation revealed that the same species were present at slightly different percentages, V. fluvialis (40%), V. vulnificus (36%), and V. parahaemolyticus (24%). There was no significant correlation between Vibrio abundance and season, either as free-living or plankton-associated entities, but Vibrio species abundance was positively correlated with temperature (r=0.565; p<0.01), salinity, and dissolved oxygen (p<0.05). Turbidity and pH showed significant seasonal variation (p<0.05) across the seasons in both locations. This study underscores the potential of WWTPs to be sources of Vibrio pathogens in the watershed of suburban and urban communities in South Africa.

  3. 76 FR 18778 - Cape Cod National Seashore; South Wellfleet, MA; Cape Cod National Seashore Advisory Commission

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-04-05

    ... National Park Service Cape Cod National Seashore; South Wellfleet, MA; Cape Cod National Seashore Advisory..., 86 Stat. 770, 5 U.S.C. App 1, Section 10) of a meeting of the Cape Cod National Seashore Advisory Commission. DATES: The meeting of the Cape Cod National Seashore Advisory Commission will be held on May...

  4. 77 FR 9699 - Cape Cod National Seashore Advisory Commission; Cape Cod National Seashore, South Wellfleet, MA

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-02-17

    ... National Park Service Cape Cod National Seashore Advisory Commission; Cape Cod National Seashore, South... Stat. 770, 5 U.S.C. App 1, Section 10) of a meeting of the Cape Cod National Seashore Advisory Commission. DATES: The meeting of the Cape Cod National Seashore Advisory Commission will be held on March...

  5. 76 FR 8768 - Cape Cod National Seashore, South Wellfleet, MA; Cape Cod National Seashore Advisory Commission

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-02-15

    ... National Park Service Cape Cod National Seashore, South Wellfleet, MA; Cape Cod National Seashore Advisory... Stat. 770, 5 U.S.C. App 1, Section 10) of a meeting of the Cape Cod National Seashore Advisory Commission. DATES: The meeting of the Cape Cod National Seashore Advisory Commission will be held on March...

  6. 76 FR 44606 - Cape Cod National Seashore; South Wellfleet, MA; Cape Cod National Seashore Advisory Commission

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-07-26

    ... National Park Service Cape Cod National Seashore; South Wellfleet, MA; Cape Cod National Seashore Advisory.... 770, 5 U.S.C. App 1, Section 10) of a meeting of the Cape Cod National Seashore Advisory Commission. DATES: The meeting of the Cape Cod National Seashore Advisory Commission will be held on September...

  7. 76 FR 66082 - Cape Cod National Seashore, South Wellfleet, MA; Cape Cod National Seashore Advisory Commission

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-10-25

    ... National Park Service Cape Cod National Seashore, South Wellfleet, MA; Cape Cod National Seashore Advisory... Stat. 770, 5 U.S.C. App 1, Section 10) of a meeting of the Cape Cod National Seashore Advisory Commission. DATES: The meeting of the Cape Cod National Seashore Advisory Commission will be held on...

  8. 76 FR 81965 - Cape Cod National Seashore Advisory Commission; Cape Cod National Seashore, South Wellfleet, MA

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-12-29

    ... National Park Service Cape Cod National Seashore Advisory Commission; Cape Cod National Seashore, South... Stat. 770, 5 U.S.C. App 1, Section 10) of a meeting of the Cape Cod National Seashore Advisory Commission. DATES: The meeting of the Cape Cod National Seashore Advisory Commission will be held on...

  9. 75 FR 34479 - Cape Cod National Seashore; South Wellfleet, MA; Cape Cod National Seashore Advisory Commission

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-06-17

    ... National Park Service Cape Cod National Seashore; South Wellfleet, MA; Cape Cod National Seashore Advisory... Stat. 770, 5 U.S.C. App 1, Section 10) of a meeting of the Cape Cod National Seashore Advisory Commission. DATES: The meeting of the Cape Cod National Seashore Advisory Commission will be held on July...

  10. 75 FR 5622 - Cape Cod National Seashore, South Wellfleet, MA; Cape Cod National Seashore Advisory Commission

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-02-03

    ... Cape Cod National Seashore, South Wellfleet, MA; Cape Cod National Seashore Advisory Commission AGENCY.... App 1, Section 10) of a meeting of the Cape Cod National Seashore Advisory Commission. DATES: The meeting of the Cape Cod National Seashore Advisory Commission will be held on March 22, 2010 at 1...

  11. 75 FR 77900 - Cape Cod National Seashore, South Wellfleet, MA; Cape Cod National Seashore Advisory Commission

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-12-14

    ... National Park Service Cape Cod National Seashore, South Wellfleet, MA; Cape Cod National Seashore Advisory... Stat. 770, 5 U.S.C. App 1, Section 10) of a meeting of the Cape Cod National Seashore Advisory Commission. DATES: The meeting of the Cape Cod National Seashore Advisory Commission will be held on...

  12. 75 FR 48990 - Cape Cod National Seashore; South Wellfleet, MA; Cape Cod National Seashore Advisory Commission

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-08-12

    ... Cape Cod National Seashore; South Wellfleet, MA; Cape Cod National Seashore Advisory Commission AGENCY.... App 1, Section 10) of a meeting of the Cape Cod National Seashore Advisory Commission. DATES: The meeting of the Cape Cod National Seashore Advisory Commission will be held on September 13, 2010, at 1...

  13. 75 FR 63854 - Cape Cod National Seashore, South Wellfleet, MA; Cape Cod National Seashore Advisory Commission

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-10-18

    ... National Park Service Cape Cod National Seashore, South Wellfleet, MA; Cape Cod National Seashore Advisory... Stat. 770, 5 U.S.C. App 1, Section 10) of a meeting of the Cape Cod National Seashore Advisory Commission. DATES: The meeting of the Cape Cod National Seashore Advisory Commission will be held on...

  14. 75 FR 20380 - Cape Cod National Seashore; South Wellfleet, Massachusetts; Cape Cod National Seashore Advisory...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-04-19

    ... National Park Service Cape Cod National Seashore; South Wellfleet, Massachusetts; Cape Cod National... (Pub. L. 92-463, 86 Stat. 770, 5 U.S.C. App 1, Section 10) of a meeting of the Cape Cod National Seashore Advisory Commission. DATES: The meeting of the Cape Cod National Seashore Advisory Commission...

  15. Ethnoveterinary uses of medicinal plants: a survey of plants used in the ethnoveterinary control of gastro-intestinal parasites of goats in the Eastern Cape Province, South Africa.

    PubMed

    Maphosa, Viola; Masika, Patrick Julius

    2010-06-01

    Conventional drugs have become expensive and therefore unaffordable to resource-limited farmers, causing farmers to seek low cost alternatives, such as use of medicinal plants. In this study, a survey was conducted in order to document information on medicinal plants used by farmers in the control of internal parasites in goats in the Eastern Cape Province. Structured questionnaires and general conversation were used to collect the information from farmers and herbalists. The survey revealed 28 plant species from 20 families that are commonly used in the treatment of gastro-intestinal parasites in goats. The plant family Asphodelaceae was frequent in usage, comprising 21.4% of the plants, and the Aloe was the most utilized species (50%). Leaves were the most frequently used plant parts (45.9%), and decoctions constituted the majority of medicinal preparations (70%). Medicinal plants are generally used in combination with other plants, and/or non-plant substances, but a few plants are used on their own. These medicinal plant remedies are administered orally, mainly by use of bottles and this is done twice in summer at intervals of one month, only once in winter and when need arises thereafter. Some of the mentioned plants have been reported in literature to possess anthelmintic properties, while others possess activities ranging from anti-inflammatory, analgesic, antimicrobial, purgative, anti-edema to immuno-regulation. If their safety and efficacy could be confirmed, these plants could form an alternative cost effective strategy in managing helminthiasis in the province.

  16. VIEW OF NORTH ELEVATION, FACING SOUTH Cape Canaveral Air ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    VIEW OF NORTH ELEVATION, FACING SOUTH - Cape Canaveral Air Force Station, Launch Complex 34, Operations Support Building, Freedom Road, Southwest of Launch Stand CX-34, Cape Canaveral, Brevard County, FL

  17. VIEW OF SOUTH AND EAST ELEVATIONS, FACING NORTHWEST Cape ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    VIEW OF SOUTH AND EAST ELEVATIONS, FACING NORTHWEST - Cape Canaveral Air Force Station, Launch Complex 34, Operations Support Building, Freedom Road, Southwest of Launch Stand CX-34, Cape Canaveral, Brevard County, FL

  18. VIEW OF SOUTH AND WEST ELEVATIONS, FACING NORTHEAST Cape ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    VIEW OF SOUTH AND WEST ELEVATIONS, FACING NORTHEAST - Cape Canaveral Air Force Station, Launch Complex 34, Operations Support Building, Freedom Road, Southwest of Launch Stand CX-34, Cape Canaveral, Brevard County, FL

  19. VIEW OF SOUTH ELEVATION, FACING NORTH Cape Canaveral Air ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    VIEW OF SOUTH ELEVATION, FACING NORTH - Cape Canaveral Air Force Station, Launch Complex 34, Operations Support Building, Freedom Road, Southwest of Launch Stand CX-34, Cape Canaveral, Brevard County, FL

  20. Teacher Unionism and School Management: A Study of (Eastern Cape) Schools in South Africa

    ERIC Educational Resources Information Center

    Msila, Vuyisile

    2014-01-01

    This article reports on a study that was conducted in 10 urban schools, situated in the city of Port Elizabeth in the Eastern Cape Province of South Africa. The research explored the perceptions of school stakeholders with regard to the effects of power relations between teacher unions and school managers. It is assumed, within the context of this…

  1. Disempowerment and Psychological Distress in the Lives of Young People in Eastern Cape, South Africa

    ERIC Educational Resources Information Center

    Nduna, Mzikazi; Jewkes, Rachel

    2012-01-01

    A qualitative study was conducted in Butterworth, in the rural Eastern Cape Province of South Africa, to explore sources of distress for young people. Semi-structured, individual in-depth interviews were conducted with 16 men and 24 women aged 16-22 years. The findings revealed interconnections between structural factors such as death, poverty,…

  2. The cape triage score: a new triage system South Africa. Proposal from the cape triage group

    PubMed Central

    Gottschalk, S B; Wood, D; DeVries, S; Wallis, L A; Bruijns, S

    2006-01-01

    The Cape Triage Group (CTG) convened with the intention of producing a triage system for the Western Cape, and eventually South Africa. The group includes in-hospital and prehospital staff from varied backgrounds. The CTG triage protocol is termed the Cape Triage Score (CTG), and has been developed by a multi-disciplinary panel, through best available evidence and expert opinion. The CTS has been validated in several studies, and was launched across the Western Cape on 1 January 2006. The CTG would value feedback from readers of this journal, as part of the ongoing monitoring and evaluation process. PMID:16439753

  3. Towards Developing an Initial Programme Theory: Programme Designers and Managers Assumptions on the Antiretroviral Treatment Adherence Club Programme in Primary Health Care Facilities in the Metropolitan Area of Western Cape Province, South Africa

    PubMed Central

    Mukumbang, Ferdinand C.; van Belle, Sara; Marchal, Bruno; van Wyk, Brian

    2016-01-01

    Background The antiretroviral adherence club intervention was rolled out in primary health care facilities in the Western Cape province of South Africa to relieve clinic congestion, and improve retention in care, and treatment adherence in the face of growing patient loads. We adopted the realist evaluation approach to evaluate what aspects of antiretroviral club intervention works, for what sections of the patient population, and under which community and health systems contexts, to inform guidelines for scaling up of the intervention. In this article, we report on a step towards the development of a programme theory—the assumptions of programme designers and health service managers with regard to how and why the adherence club intervention is expected to achieve its goals and perceptions on how it has done so (or not). Methods We adopted an exploratory qualitative research design. We conducted a document review of 12 documents on the design and implementation of the adherence club intervention, and key informant interviews with 12 purposively selected programme designers and managers. Thematic content analysis was used to identify themes attributed to the programme actors, context, mechanisms, and outcomes. Using the context-mechanism-outcome configurational tool, we provided an explanatory focus of how the adherence club intervention is roll-out and works guided by the realist perspective. Results We classified the assumptions of the adherence club designers and managers into the rollout, implementation, and utilisation of the adherence club programme, constructed around the providers, management/operational staff, and patients, respectively. Two rival theories were identified at the patient-perspective level. We used these perspectives to develop an initial programme theory of the adherence club intervention, which will be tested in a later phase. Conclusion The perspectives of the programme designers and managers provided an important step towards developing

  4. Antibiotic susceptibility profiles of some Vibrio strains isolated from wastewater final effluents in a rural community of the Eastern Cape Province of South Africa

    PubMed Central

    2010-01-01

    Background To evaluate the antibiogram and antibiotic resistance genes of some Vibrio strains isolated from wastewater final effluents in a rural community of South Africa. V. vulnificus (18), V. metschnikovii (3), V. fluvialis (19) and V. parahaemolyticus (12) strains were isolated from final effluents of a wastewater treatment plant (WWTP) located in a rural community of South Africa. The disk diffusion method was used for the characterization of the antibiogram of the isolates. Polymerase chain reaction (PCR) was employed to evaluate the presence of established antibiotic resistance genes using specific primer sets. Results The Vibrio strains showed the typical multidrug-resistance phenotype of an SXT element. They were resistant to sulfamethoxazole (Sul), trimethoprim (Tmp), cotrimoxazole (Cot), chloramphenicol (Chl), streptomycin (Str), ampicillin (Amp), tetracycline (Tet) nalidixic acid (Nal), and gentamicin (Gen). The antibiotic resistance genes detected includes dfr18 and dfrA1 for trimethoprim; floR, tetA, strB, sul2 for chloramphenicol, tetracycline, streptomycin and sulfamethoxazole respectively. Some of these genes were only recently described from clinical isolates, demonstrating genetic exchange between clinical and environmental Vibrio species. Conclusions These results demonstrate that final effluents from wastewater treatment plants are potential reservoirs of various antibiotics resistance genes. Moreover, detection of resistance genes in Vibrio strains obtained from the wastewater final effluents suggests that these resistance determinants might be further disseminated in habitats downstream of the sewage plant, thus constituting a serious health risk to the communities reliant on the receiving waterbodies. PMID:20470419

  5. Foodborne pathogens recovered from ready-to-eat foods from roadside cafeterias and retail outlets in Alice, Eastern Cape Province, South Africa: public health implications.

    PubMed

    Nyenje, Mirriam E; Odjadjare, Collins E; Tanih, Nicoline F; Green, Ezekiel; Ndip, Roland N

    2012-08-01

    This study assessed the microbiological quality of various ready-to-eat foods sold in Alice, South Africa. Microbiological analysis was conducted on 252 samples which included vegetables, potatoes, rice, pies, beef and chicken stew. The isolates were identified using biochemical tests and the API 20E, API 20NE and API Listeria kits; results were analyzed using the one-way-ANOVA test. Bacterial growth was present in all the food types tested; high levels of total aerobic count were observed in vegetables, 6.8 ± 0.07 followed by rice, 6.7 ± 1.7 while pies had the lowest count (2.58 ± 0.24). Organisms isolated included: Listeria spp. (22%), Enterobacter spp. (18%), Aeromonas hydrophila (12%), Klebsiella oxytoca (8%), Proteus mirabilis (6.3%), Staphylococcus aureus (3.2%) and Pseudomonas luteola (2.4%). Interestingly, Salmonella spp. and Escherichia coli were not isolated in any of the samples. There was a statistically significant difference (p < 0.05) in the prevalence of foodborne pathogens from hygienic and unhygienic cafeterias. The results indicated that most of the ready-to-eat food samples examined in this study did not meet bacteriological quality standards, therefore posing potential risks to consumers. This should draw the attention of the relevant authorities to ensure that hygienic standards are improved to curtain foodborne infections.

  6. Factors that Influence Teenage Antenatal Care Utilization in John Taolo Gaetsewe (JTG) District of Northern Cape Province, South Africa: Underscoring the Need for Tackling Social Determinants of Health

    PubMed Central

    Worku, Eshetu Bekele; Woldesenbet, Selamawit Alemu

    2016-01-01

    Background and Objectives: In resource-limited settings, the uptake of antenatal care visits among women, especially teenage pregnant women, is disturbingly low. Factors that influence the uptake of ANC services among teenage women is largely understudied and poorly understood in John Taolo Gaetsewe (JTG), a predominantly rural and poor district of South Africa. The aim of this study was to determine the factors that influence uptake of ANC services among teenage mothers in JTG district. Methods: A cross-sectional health facility-based study utilising mixed method was conducted in all public health facilities (n=44) at JTG district. Mother-infant pairs (n=383) who brought their infants for six-week first DPT immunisation during the study period were enrolled in the study. Structured questionnaires were used to collect data on demographic, socio-economic and uptake of ANC indicators. Results: Out of 272 respondent mothers, 18.68% were adolescent mothers (13-19 years). The logistic regression analysis shows that mother’s age (OR=2.11; 95%CI = 1.04 - 4.27); distance to the nearest health facility (OR=3.38; 95%CI = 1.45-7.87); and client service satisfaction (OR=8.58; 95%CI =2.10-34.95 are significantly associated with poor uptake of ANC services. Conclusion and Global Health Implications: There is a need to improve the quality of adolescent reproductive health services tailored to their health and developmental needs. Moreover, addressing the social determinants of health that affect individual’s healthy life style and health seeking behavior is critical. PMID:28058200

  7. Incidence and Molecular Characterization of Hepatitis E Virus from Swine in Eastern Cape, South Africa

    PubMed Central

    Chuks Iweriebor, Benson; Nwodo, U. U.; Obi, Larry Chikwelu; Okoh, Anthony Ifeanyi

    2017-01-01

    Hepatitis E virus-mediated infection is a serious public health concern in economically developing nations of the world. Globally, four major genotypes of HEV have been documented. Hepatitis E has been suggested to be zoonotic owing to the increase of evidence through various studies. Thus far, this paper reports on prevalence of hepatitis E virus among swine herd in selected communal and commercial farms in the Eastern Cape Province of South Africa. A total of 160 faecal samples were collected from swine herds in Amathole and Chris Hani District Municipalities of Eastern Cape Province for the presence of HEV. Of the 160 faecal samples screened, only seven were positive (4.4%) for HEV. The nucleotide sequences analyses revealed the isolates as sharing 82% to 99% identities with other strains (KX896664, KX896665, KX896666, KX896667, KX896668, KX896669, and KX896670) from different regions of the world. We conclude that HEV is present among swine in the Eastern Cape Province, albeit in low incidence, and this does have public health implications. There is a need for maintenance of high hygienic standards in order to prevent human infections through swine faecal materials and appropriate cooking of pork is highly advised. PMID:28191016

  8. Beak and feather disease viruses circulating in Cape parrots (Poicepahlus robustus) in South Africa.

    PubMed

    Regnard, Guy L; Boyes, Rutledge S; Martin, Rowan O; Hitzeroth, Inga I; Rybicki, Edward P

    2015-01-01

    Captive and wild psittacines are vulnerable to the highly contagious psittacine beak and feather disease. The causative agent, beak and feather disease virus (BFDV), was recently detected in the largest remaining population of endangered Cape parrots (Poicepahlus robustus), which are endemic to South Africa. Full-length genomes were isolated and sequenced from 26 blood samples collected from wild and captive Cape parrots to determine possible origins of infection. All sequences had characteristic BFDV sequence motifs and were similar in length to those described in the literature. However, BFDV coat protein (CP) sequences from this study did not contain a previously identified bipartite nuclear localisation signal (NLS) within residues 39-56, which indicates that an alternate NLS is involved in shuttling the CP into the nucleus. Sequences from the wild population shared a high degree of similarity, irrespective of year or location, suggesting that the disease outbreak occurred close to the time when the samples were collected. Phylogenetic analysis of full-length genomes showed that the captive Cape parrot sequences cluster with those isolated from captive-bred budgerigars in KwaZulu-Natal Province, South Africa. Exposure to captive-bred Cape parrots from a breeding facility in KwaZulu-Natal is suggested as a possible source for the virus infection. Phylogenetic analysis of BFDV isolates from wild and captive Cape parrots indicated two separate infection events in different populations, which highlights the potential risk of introducing new strains of the virus into the wild population. The present study represents the first systematic investigation of BFDV virus diversity in the southern-most population of Cape parrots.

  9. Cape Town, South Africa, Anaglyph, Landsat Image over SRTM Elevation

    NASA Technical Reports Server (NTRS)

    2004-01-01

    Cape Town and the Cape of Good Hope, South Africa, appear on the left (west) of this anaglyph view generated from a Landsat satellite image and elevation data from the Shuttle Radar Topography Mission (SRTM). The city center is located between Table Bay (upper left) and Table Mountain (just to the south), a 1,086-meter (3,563-foot) tall sandstone and granite natural landmark.

    Cape Town enjoys a Mediterranean climate but must deal with the limited water supply characteristic of that climate. Until the 1890s the city relied upon streams and springs along the base of Table Mountain, then built a small reservoir atop Table Mountain to capture and store rainfall there (visible in this anaglyph when viewed at full resolution). Now the needs of a much larger population are met in part by much larger reservoirs such as seen well inland (upper right) at the Theewaterskloof Dam.

    False Bay is the large bay to the southeast (lower right) of Cape Town, just around the Cape of Good Hope. It is one of the largest bays along the entire South African coast, but nearby Cape Town has its harbor at Table Bay. False Bay got its name because mariners approaching Cape Town from the east would see the prominent bay and falsely assume it to be the entrance to Cape Town harbor. Similarly, people often mistake the Cape of Good Hope as the southernmost point of Africa. But the southernmost point is actually Cape Agulhas, located just to the southeast (lower right) of this scene.

    This anaglyph was created by draping a Landsat visible light image over an SRTM elevation model, and then generating two differing perspectives, one for each eye. When viewed through special glasses, the anaglyph is a vertically exaggerated view of the Earth's surface in its full three dimensions. Anaglyph glasses cover the left eye with a red filter and cover the right eye with a blue filter.

    Elevation data used in this image was acquired by the Shuttle Radar Topography Mission (SRTM) aboard

  10. Efficacy of SISTA South Africa on sexual behavior, HIV stigma and relationship control among isiXhosa women in the Western Cape Province, South Africa: Results of a Randomized Controlled Trial

    PubMed Central

    Wingood, Gina M.; Reddy, Priscilla; Lang, Delia L.; Saleh-Onoya, Dorina; Braxton, Nikia; Sifunda, Sibusiso; DiClemente, Ralph J

    2013-01-01

    Background The HIV epidemic has a devastating impact among South-African women. The current study evaluated the efficacy of SISTA South Africa, a culturally congruent HIV intervention for isiXhosa women in South Africa that was adapted from SISTA, an HIV intervention for African American women. Methods A randomized controlled trial recruited 342 isiXhosa women 18 – 35 years of age. Participants were randomized to the general health comparison or the SISTA South Africa intervention. Xhosa speaking peer health educators tailored the SISTA South Africa curriculum, while maintaining the core elements of the original SiSTA intervention. Participants completed assessments at baseline and 6 months follow-up. Results Relative to participants in the comparison, participants in the HIV intervention reduced the frequency of unprotected vaginal intercourse acts (adjusted mean difference = 1.06; p = .02), were more likely to report not desiring dry sex (AOR = .229; 95% CI = .10, .47; p = .0001) and, were more likely to perceive that their main sexual partner did not desire dry sex (AOR = .24; 95% CI = .11, .52; p = .0001). Additionally, women randomized to the intervention also reported an increase in HIV knowledge, greater relationship control and had more accepting attitudes towards HIV stigma. The HIV intervention did not reduce STI incidence. Conclusions This trial demonstrates that an HIV intervention which is adapted to enhance its gender and cultural relevance for rural isiXhosa women can reduce self-reported sexual risk behaviors and enhance mediators of HIV among this vulnerable population. PMID:23673889

  11. Initiating Realistic Programmes for Gifted Pupils in Secondary Schools in the Cape Province within the Boundaries of the Present Educational System, with Special Reference to the Problems Surrounding this Transitional Period.

    ERIC Educational Resources Information Center

    Ungerer, E.

    The paper describes steps taken in initiating a program for gifted students undertaken in 11 secondary schools in Cape Province, South Africa. The development of an identification model was made difficult because the fixed South African educational system inhibits creativity and productive thinking abilities. Factors used to select students for…

  12. Alcohol use, working conditions, job benefits, and the legacy of the "Dop" system among farm workers in the Western Cape Province, South Africa: hope despite high levels of risky drinking.

    PubMed

    Gossage, J Phillip; Snell, Cudore L; Parry, Charles D H; Marais, Anna-Susan; Barnard, Ronel; de Vries, Marlene; Blankenship, Jason; Seedat, Soraya; Hasken, Julie M; May, Philip A

    2014-07-21

    This study describes alcohol consumption in five Western Cape Province communities. Cross-sectional data from a community household sample (n = 591) describe the alcohol use patterns of adult males and females, and farm workers vs. others. Data reveal that men were more likely to be current drinkers than women, 75.1% vs. 65.8% (p = 0.033); farm laborers were more likely to be current drinkers than individuals in other occupations 83.1% vs. 66.8% (p = 0.004). Group, binge drinking on weekends was the norm; men were more likely to be binge drinkers in the past week than women 59.8% vs. 48.8% (p = 0.086); farm workers were more likely to binge than others 75.0% vs. 47.5% (p < 0.001). The legacy of "Dop" contributes to current risky drinking behaviors. Farm owners or managers were interviewed on 11 farms, they described working conditions on their farms and how the legacy of "Dop" is reflected in the current use of alcohol by their workers. "Dop" was given to farm workers in the past on six of the 11 farms, but was discontinued for different reasons. There is zero tolerance for coming to work intoxicated; farm owners encourage responsible use of alcohol and assist farm workers in getting help for alcohol problems when necessary. The farm owners report some positive initiatives, were ahead of the movement to provide meaningful wages, and provide other important amenities. Further research is needed to assess whether progressive practices on some farms will reduce harmful alcohol use.

  13. Alcohol Use, Working Conditions, Job Benefits, and the Legacy of the “Dop” System among Farm Workers in the Western Cape Province, South Africa: Hope Despite High Levels of Risky Drinking

    PubMed Central

    Gossage, J. Phillip; Snell, Cudore L.; Parry, Charles D. H.; Marais, Anna-Susan; Barnard, Ronel; de Vries, Marlene; Blankenship, Jason; Seedat, Soraya; Hasken, Julie M.; May, Philip A.

    2014-01-01

    This study describes alcohol consumption in five Western Cape Province communities. Cross-sectional data from a community household sample (n = 591) describe the alcohol use patterns of adult males and females, and farm workers vs. others. Data reveal that men were more likely to be current drinkers than women, 75.1% vs. 65.8% (p = 0.033); farm laborers were more likely to be current drinkers than individuals in other occupations 83.1% vs. 66.8% (p = 0.004). Group, binge drinking on weekends was the norm; men were more likely to be binge drinkers in the past week than women 59.8% vs. 48.8% (p = 0.086); farm workers were more likely to binge than others 75.0% vs. 47.5% (p < 0.001). The legacy of “Dop” contributes to current risky drinking behaviors. Farm owners or managers were interviewed on 11 farms, they described working conditions on their farms and how the legacy of “Dop” is reflected in the current use of alcohol by their workers. “Dop” was given to farm workers in the past on six of the 11 farms, but was discontinued for different reasons. There is zero tolerance for coming to work intoxicated; farm owners encourage responsible use of alcohol and assist farm workers in getting help for alcohol problems when necessary. The farm owners report some positive initiatives, were ahead of the movement to provide meaningful wages, and provide other important amenities. Further research is needed to assess whether progressive practices on some farms will reduce harmful alcohol use. PMID:25050650

  14. Characteristics of Students Receiving Counselling Services at the University of Cape Town, South Africa.

    ERIC Educational Resources Information Center

    Flisher, Alan J.; De Beer, Jeremy P.; Bokhorst, Frank

    2002-01-01

    The aim of the study was to document the correlates of receiving counseling services at the University of Cape Town, South Africa. Results reveal that non-English speakers, humanities students, undergraduates, first-year students, students who were eligible to receive financial assistance, and students from outside Cape Town were significantly…

  15. E-Powering the People: South Africa's Smart Cape Access Project

    ERIC Educational Resources Information Center

    Valentine, Susan

    2004-01-01

    This document examines the launch of the Smart Cape Access Project in Cape Town, South Africa. In a city where more than 80 percent of the citizens do not have access to computers and fewer still can access the Internet, public officials set out to build a "smart city," where "informed people could connect to the world and to each other by the…

  16. A Principal's Perspective of School Integration: The First School To Integrate in Cape Town, South Africa.

    ERIC Educational Resources Information Center

    Wieder, Alan

    2001-01-01

    Presents the historical context of Cape Town, South Africa, and its struggles against apartheid and apartheid education. It offers a case study of Allen Powell, a white teacher and administrator who worked to integrate Plumstead High School, an act that defied South African commonplace and the views of most white South Africans. Analyzes Powell's…

  17. Intimate partner violence among adolescents in Cape Town, South Africa.

    PubMed

    Russell, Marcia; Cupp, Pamela K; Jewkes, Rachel K; Gevers, Anik; Mathews, Catherine; LeFleur-Bellerose, Chantel; Small, Jeon

    2014-06-01

    This study aimed to describe potentially preventable factors in intimate partner violence (IPV) perpetration and victimization among South African 8th grade students. Data were collected during a pilot evaluation of a classroom 8th grade curriculum on gender-based violence prevention in nine public schools in Cape Town through self-completed interviews with 549 8th grade students, 238 boys and 311 girls. Structural equation models (SEM) predicting IPV were constructed with variables a priori hypothesized to be associated. The majority of students (78.5 %) had had a partner in the past 3 months, and they reported high rates of IPV during that period (e.g., over 10 % of boys reported forcing a partner to have sex, and 39 % of girls reported physical IPV victimization). A trimmed version of the hypothesized SEM (CFI = .966; RMSEA = .051) indicated that disagreement with the ideology of male superiority and violence predicted lower risk of IPV (p < .001), whereas the frequency of using negative conflict resolution styles (e.g., walking off angrily, sending angry text messages, or refusing to talk to them) predicted high IPV risk (p < .001) and mediated the impact of heavy alcohol drinking on IPV (Sobel test, z = 3.16; p < .001). The model fit both girls and boys, but heavy drinking influenced negative styles of resolving conflict more strongly among girls than boys. Findings suggest that interventions to reduce IPV among South African adolescents should challenge attitudes supportive of male superiority and violence; encourage use of positive conflict resolution styles; and discourage heavy alcohol use among both boys and girls.

  18. Intimate Partner Violence among Adolescents in Cape Town, South Africa

    PubMed Central

    Russell, Marcia; Cupp, Pamela K.; Jewkes, Rachel K.; Gevers, Anik; Mathews, Catherine; LeFleur-Bellerose, Chantel; Small, Jeon

    2013-01-01

    GOAL To describe potentially preventable factors in intimate partner violence (IPV) perpetration and victimization among South African 8th grade students. METHOD Data were collected during a pilot evaluation of a classroom 8th grade curriculum on gender-based violence prevention in 9 public schools in Cape Town through self-completed interviews with 549 8th grade students, 238 boys and 311 girls. Structural equation models (SEM) predicting IPV were constructed with variables a priori hypothesized to be associated. RESULTS The majority of students (78.5%) had had a partner in the past three months, and they reported high rates of IPV during that period (e.g., over 10% of boys reported forcing a partner to have sex, and 39% of girls reported physical IPV victimization). A trimmed version of the hypothesized SEM (CFI =.966; RMSEA=.051) indicated that disagreement with the ideology of male superiority and violence predicted lower risk of IPV (p<.001), whereas the frequency of using negative conflict resolution styles (e.g., walking off angrily, sending angry text messages, or refusing to talk to them) predicted high IPV risk (p<.001) and mediated the impact of heavy alcohol drinking on IPV (Sobel test, z=3.16; p<.001). The model fit both girls and boys, but heavy drinking influenced negative styles of resolving conflict more strongly among girls than boys. CONCLUSIONS Findings suggest that interventions to reduce IPV among South African adolescents should challenge attitudes supportive of male superiority and violence; encourage use of positive conflict resolution styles; and discourage heavy alcohol use among both boys and girls. PMID:23743796

  19. New insights on the Karoo shale gas potential from borehole KZF-1 (Western Cape, South Africa)

    NASA Astrophysics Data System (ADS)

    Campbell, Stuart A.; Götz, Annette E.; Montenari, Michael

    2016-04-01

    A study on world shale reserves conducted by the Energy Information Agency (EIA) in 2013 concluded that there could be as much as 390 Tcf recoverable reserves of shale gas in the southern and south-western parts of the Karoo Basin. This would make it the 8th-largest shale gas resource in the world. However, the true extent and commercial viability is still unknown, due to the lack of exploration drilling and modern 3D seismic. Within the framework of the Karoo Research Initiative (KARIN), two deep boreholes were drilled in the Eastern and Western Cape provinces of South Africa. Here we report on new core material from borehole KZF-1 (Western Cape) which intersected the Permian black shales of the Ecca Group, the Whitehill Formation being the main target formation for future shale gas production. To determine the original source potential for shale gas we investigated the sedimentary environments in which the potential source rocks formed, addressing the research question of how much sedimentary organic matter the shales contained when they originally formed. Palynofacies indicates marginal marine conditions of a stratified basin setting with low marine phytoplankton percentages (acritarchs, prasinophytes), good AOM preservation, high terrestrial input, and a high spores:bisaccates ratio (kerogen type III). Stratigraphically, a deepening-upward trend is observed. Laterally, the basin configuration seems to be much more complex than previously assumed. Furthermore, palynological data confirms the correlation of marine black shales of the Prince Albert and Whitehill formations in the southern and south-western parts of the Karoo Basin with the terrestrial coals of the Vryheid Formation in the north-eastern part of the basin. TOC values (1-6%) classify the Karoo black shales as promising shale gas resources, especially with regard to the high thermal maturity (Ro >3). The recently drilled deep boreholes in the southern and south-western Karoo Basin, the first since the

  20. Two new species of Indigofera L. (Leguminosae) from the Sneeuberg Centre of Floristic Endemism, Great Escarpment (Eastern and Western Cape, South Africa).

    PubMed

    Clark, V Ralph; Schrire, Brian D; Barker, Nigel P

    2015-01-01

    Two new species of Indigofera L. (Leguminosae) are described from the Sneeuberg Centre of Floristic Endemism on the southern Great Escarpment, Eastern and Western Cape Provinces, South Africa. Both species are localised high-altitude endemics. Indigoferamagnifica Schrire & V.R. Clark is confined to the summit plateau of the Toorberg-Koudeveldberg-Meelberg west of Graaff-Reinet, and complements other western Sneeuberg endemics such as Ericapasserinoides (Bolus) E.G.H. Oliv. and Faurearecondita Rourke & V.R. Clark. Indigoferaasantasanensis Schrire & V.R. Clark is confined to a small area east of Graaff-Reinet, and complements several other eastern Sneeuberg endemics such as Euryopsexsudans B. Nord & V.R. Clark and Euryopsproteoides B. Nord. & V.R. Clark. Based on morphology, both new species belong to the Cape Clade of Indigofera, supporting a biogeographical link between the Cape Floristic Region and the Sneeuberg, as well as with the rest of the eastern Great Escarpment.

  1. 33 CFR 334.60 - Cape Cod Bay south of Wellfleet Harbor, Mass.; naval aircraft bombing target area.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 33 Navigation and Navigable Waters 3 2011-07-01 2011-07-01 false Cape Cod Bay south of Wellfleet... REGULATIONS § 334.60 Cape Cod Bay south of Wellfleet Harbor, Mass.; naval aircraft bombing target area. (a... bombing target hulk James Longstreet in Cape Cod Bay at latitude 41°49′46″, longitude 70°02′54″. (b)...

  2. 33 CFR 334.60 - Cape Cod Bay south of Wellfleet Harbor, Mass.; naval aircraft bombing target area.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 33 Navigation and Navigable Waters 3 2014-07-01 2014-07-01 false Cape Cod Bay south of Wellfleet... REGULATIONS § 334.60 Cape Cod Bay south of Wellfleet Harbor, Mass.; naval aircraft bombing target area. (a... bombing target hulk James Longstreet in Cape Cod Bay at latitude 41°49′46″, longitude 70°02′54″. (b)...

  3. 33 CFR 334.60 - Cape Cod Bay south of Wellfleet Harbor, Mass.; naval aircraft bombing target area.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 33 Navigation and Navigable Waters 3 2013-07-01 2013-07-01 false Cape Cod Bay south of Wellfleet... REGULATIONS § 334.60 Cape Cod Bay south of Wellfleet Harbor, Mass.; naval aircraft bombing target area. (a... bombing target hulk James Longstreet in Cape Cod Bay at latitude 41°49′46″, longitude 70°02′54″. (b)...

  4. 33 CFR 334.60 - Cape Cod Bay south of Wellfleet Harbor, Mass.; naval aircraft bombing target area.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 33 Navigation and Navigable Waters 3 2012-07-01 2012-07-01 false Cape Cod Bay south of Wellfleet... REGULATIONS § 334.60 Cape Cod Bay south of Wellfleet Harbor, Mass.; naval aircraft bombing target area. (a... bombing target hulk James Longstreet in Cape Cod Bay at latitude 41°49′46″, longitude 70°02′54″. (b)...

  5. Kalkkop crater, Eastern Cape: A new impact crater in South Africa

    NASA Technical Reports Server (NTRS)

    Reimold, W. U.; Leroux, F. G.; Koeberl, C.; Shirey, S. B.

    1993-01-01

    Reimold et al. suggested that the 640 m diameter Kalkkop crater, at 32 deg 43 min S/24 deg 34 min E in the Eastern Cape Province (South Africa), could possibly be of impact origin. This idea was based on the circularity of this structure, its regional uniqueness, lack of recent igneous activity in the region, and descriptions of drillcore indicating that the crater is not underlain by a salt dome and is partially filled with a breccia layer of a thickness which would agree with the dimensions expected for an impact structure of this size. Unfortunately the old drillcore was no longer available for detailed study, and in the absence of sufficient surface exposure only drilling could provide the evidence needed to solve the problem of the origin of Kalkkop. For this reason and to study the crater fill from a paleoenvironmental point of view, the S. African Geological Survey decided to sponsor a new research drilling project at the Kalkkop site. First petrographic and isotopic results from Kalkkop drill core studies confirming, without doubt, that this crater is of impact origin are presented.

  6. Body and fleece weights of woollen sheep in veld communal rangelands of the Eastern Cape Province.

    PubMed

    Mvinjelwa, Sivuyile Alex; Mapekula, Monde; Maphosa, Viola; Muchenje, Voster

    2014-08-01

    The objective of this study was to determine the live weight, body condition scores (BCS) and fleece weight of sheep in four smallholder farming communities of Eastern Cape Province, South Africa. Among the four communities studied, two (Roxeni and Tyabane) were in sweetveld and other two (Luzi I and Luzi II) were in a sourveld. Roxeni and Luzi communities were also engaged in the ram exchange project with the National Wool Growers Association (NWGA). Sixty crossbred ewes and 20 non-descript ewes aged 2 to 3 years were randomly selected from the four communities studied and were measured during their annual shearing in October. They were assessed for average greasy fleece weight per head, body condition score and live weight after shearing. Roxeni sheep were heavier (39.9 ± 1.10 kg) than Tyabane sheep (29.8 ± 1.10 kg). Sheep from Tyabane had the lightest (P <0.05) fleece weight (1.0 ± 1.10 kg) than Roxeni sheep (3.1 ± 1.10 kg). The 2-year-old ewes had similar (P ≥ 0.05) live weight to that of the 3-year-old ewes. However, the 3-year-old ewes had higher (3.3 ± 0.11) (P < 0.05) body condition scores than the 2-year-old ewes (2.8 ± 0.10). Two-year-old ewes also had lower (1.9 ± 0.11 kg) (P < 0.05) fleece weight than the 3-year-old ewes (2.3 ± 0.10 kg). It was concluded that sheep that were raised in the sweetveld had higher live and fleece weights than the ones that were raised on the sourveld. The communities that were engaged on ram exchange project had sheep with higher live weights, body condition score and fleece weight.

  7. Cape Cod

    Atmospheric Science Data Center

    2014-05-15

    article title:  Cape Cod, Massachusetts     View Larger ... Pilgrims landed, is located on the west side of Cape Cod Bay, shown in this Multi-angle Imaging SpectroRadiometer (MISR) ... Terra orbit 1708. South of the distinctively-shaped Cape Cod are Nantucket Island and Martha's Vineyard. Further west is Block Island, ...

  8. University Multilingualism: A Critical Narrative from the University of the Western Cape, South Africa

    ERIC Educational Resources Information Center

    Antia, Bassey E.

    2015-01-01

    This article offers a narrative of the University of the Western Cape, South Africa, from the prism of the duality of language as a co-modality (with people, protest, policy and practices) for constituting the institution in whole or in part and as a reflection of its co-modalities. For its framing, the narrative eclectically draws on language…

  9. Child Abuse Services at a Children's Hospital in Cape Town, South Africa.

    ERIC Educational Resources Information Center

    Argent, Andrew C.; And Others

    1995-01-01

    All child abuse-related patients (n=503) seen at 1 Cape Town (South Africa) hospital over a 1-year period were reviewed. Abuse was confirmed in 389 cases (160 physical abuse and 229 sexual abuse). Most (81 percent) of the young children were seen by residents with minimal pediatric training. Lack of staff speaking Xhosa (spoken by 134 of the…

  10. Disrespecting Teacher: The Decline in Social Standing of Teachers in Cape Town, South Africa

    ERIC Educational Resources Information Center

    Hammett, Daniel

    2008-01-01

    This paper examines the declining levels of respect for teachers in two communities in Cape Town, South Africa. Education has been identified as a key area of reform and redress, but a critical skills shortage and under-resourced schools are hindering progress. Data from current and former teachers illustrate how the social and institutional…

  11. Education, Ethnic Homogenization and Cultural Hybridization (Brussels, Belgium, and Cape Town, South Africa).

    ERIC Educational Resources Information Center

    Leman, Johan, Ed.

    1999-01-01

    The eight chapters of this theme issue examine the ways in which autochthonous communities regard the supply side of education. The supply side is segregational in nature, and immigrants themselves move toward ethnic homogenization. The focus is on urban minorities in Brussels (Belgium). Compares the situation in Cape Town (South Africa). (SLD)

  12. The Effects of Community Violence on Children in Cape Town, South Africa

    ERIC Educational Resources Information Center

    Shields, Nancy; Nadasen, Kathy; Pierce, Lois

    2008-01-01

    Objective: The primary objective of the study was to investigate the relationship between exposure to community violence (neighborhood, school, police, and gang violence) and psychological distress in a sample of children living in the Cape Town, South Africa area. Another objective was to identify variables that moderate and mediate the…

  13. Phylogeography of the Cape velvet worm (Onychophora: Peripatopsis capensis) reveals the impact of Pliocene/Pleistocene climatic oscillations on Afromontane forest in the Western Cape, South Africa.

    PubMed

    McDonald, D E; Daniels, S R

    2012-05-01

    Habitat specialists such as soft-bodied invertebrates characterized by low dispersal capability and sensitivity to dehydration can be employed to examine biome histories. In this study, the Cape velvet worm (Peripatopsis capensis) was used to examine the impacts of climatic oscillations on historical Afromontane forest in the Western Cape, South Africa. Divergence time estimates suggest that the P. capensis species complex diverged during the Pliocene epoch. This period was characterized by dramatic climatic and topographical change. Subsequently, forest expansion and contraction cycles led to diversification within P. capensis. Increased levels of genetic differentiation were observed along a west-to-south-easterly trajectory because the south-eastern parts of the Cape Fold Mountain chain harbour larger, more stable fragments of forest patches, have more pronounced habitat heterogeneity and have historically received higher levels of rainfall. These results suggest the presence of three putative species within P. capensis, which are geographically discreet and genetically distinct.

  14. New views of the Cape Fear slide in the U. S. East coast gas hydrate province

    NASA Astrophysics Data System (ADS)

    Wood, W.; Lindwall, D.; Gettrust, J.

    2003-04-01

    The Cape Fear slide is one of the largest slope failure features on the U.S. coast, beginning about 200 km southeast of Cape Fear, North Carolina. The failure area is about 37 km long and 10 to 12 km wide, resulting in a debris flow up to 70 km wide and 300 km long, and occurs in a large methane hydrate province, although evidence of a BSR below the slide is weak. All but the head wall of the slide lies below 2000 meters water depth, making detailed seismic imaging difficult. Recently, however, (summer 2002) several seismic transects across portions of the slide (including the diapir in the slide scar) were acquired with a deep-towed multichannel seismic system (DTAGS). The 48 channel, 420 m offset system operates at 220-1000 Hz, at a few hundred meters above the seafloor. The data reveal sedimentary layering within the slide which is laterally discontinuous, suggesting at least some post depositional faulting and possible conduits for fluid and methane migration.

  15. The influence of older classmates on adolescent sexual behavior in Cape Town, South Africa.

    PubMed

    Lam, David; Marteleto, Letícia J; Ranchhod, Vimal

    2013-06-01

    This study examines the influence of exposure to older within-grade peers on sexual behavior among students in urban South Africa. Data are drawn from the Cape Area Panel Study, a longitudinal survey of young people conducted in metropolitan Cape Town from 2002 to 2006. The combination of early sexual debut, high rates of school enrollment into the late teens, and grade repetition create an environment in which young people who progress through school ahead of many in their cohort interact with classmates who may be several years older. We construct a measure of cumulative exposure to classmates who are at least two years older and show that such exposure is statistically significantly associated with early sexual initiation among adolescent girls. This exposure also increases the age difference between these girls and their first sexual partner, and helps explain a significant proportion of the earlier sexual debut of African girls, compared with colored and white girls in Cape Town.

  16. Popular Education in Three Organisations in Cape Town, South Africa

    ERIC Educational Resources Information Center

    Endresen, Kristin

    2013-01-01

    In the past, non-formal education in South Africa was committed to supporting the Mass Democratic Movement (MDM) in opposition to apartheid. Such non-formal political education was concerned with education for democracy. Post 1994, South African adult education policy has exclusively concentrated on vocational training, shifting the focus away…

  17. 33 CFR 334.60 - Cape Cod Bay south of Wellfleet Harbor, Mass.; naval aircraft bombing target area.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... REGULATIONS § 334.60 Cape Cod Bay south of Wellfleet Harbor, Mass.; naval aircraft bombing target area. (a) The danger zone. A circular area with a radius of 1,000 yards having its center on the...

  18. Indicators of substance abuse treatment demand in Cape Town, South Africa (1997-2001).

    PubMed

    Myers, B; Parry, C D H; Plüddemann, M A

    2004-05-01

    Few studies have investigated the demand for substance abuse treatment in South Africa. This article uses data collected from specialist substance abuse treatment centres to describe substance abuse treatment demand and patterns of service utilisation in Cape Town for the period January 1997 to December 2001. Findings suggest that although treatment demand for alcohol-related problems remains high, treatment demand for substances other than alcohol has increased over time. Patterns of treatment service utilisation suggest that women and black South Africans remain underserved. The need for comprehensive and accessible substance abuse treatment services in Cape Town is highlighted and recommendations are made for improving access to treatment services, and undertaking comprehensive evaluations of existing treatment facilities.

  19. Cape Town, South Africa, Perspective View, Landsat Image over SRTM Elevation

    NASA Technical Reports Server (NTRS)

    2004-01-01

    Cape Town and the Cape of Good Hope, South Africa, appear in the foreground of this perspective view generated from a Landsat satellite image and elevation data from the Shuttle Radar Topography Mission (SRTM). The city center is located at Table Bay (at the lower left), adjacent to Table Mountain, a 1,086-meter (3,563-foot) tall sandstone and granite natural landmark.

    Cape Town enjoys a Mediterranean climate but must deal with the limited water supply characteristic of that climate. Until the 1890s the city relied upon streams and springs along the base of Table Mountain, then built a small reservoir atop Table Mountain to capture and store rainfall there. Now the needs of a much larger population are met in part by much larger reservoirs such as seen here far inland (mid-distance left) at the Theewaterskloof Dam.

    False Bay is the large bay to the south (right) of Cape Town, just around the Cape of Good Hope. It is one of the largest bays along the entire South African coast, but nearby Cape Town has its harbor at Table Bay. False Bay got its name because mariners approaching Cape Town from the east would see the prominent bay and falsely assume it to be the entrance to Cape Town harbor. Similarly, people often mistake the Cape of Good Hope as the southernmost point of Africa. But the southernmost point is actually Cape Agulhas, located just to the southeast (upper right) of this scene.

    This Landsat and SRTM perspective view uses a 2-times vertical exaggeration to enhance topographic expression. The back edges of the data sets form a false horizon and a false sky was added. Colors of the scene were enhanced by image processing but are the natural color band combination from the Landsat satellite.

    Elevation data used in this image was acquired by the Shuttle Radar Topography Mission (SRTM) aboard the Space Shuttle Endeavour, launched on February 11, 2000. SRTM used the same radar instrument that comprised the Spaceborne Imaging Radar

  20. Substance Use and Psychosocial Predictors of High School Dropout in Cape Town, South Africa

    ERIC Educational Resources Information Center

    Flisher, Alan J.; Townsend, Loraine; Chikobvu, Perpetual; Lombard, Carl F.; King, Gary

    2010-01-01

    The aims of this study were to examine whether use of tobacco, alcohol, and illicit drugs predicts dropout among secondary school students in Cape Town, South Africa. A self-report instrument was administered to 1,470 Grade 8 students. The proportion of students that dropped out of school between the onset of the study and 4 years later was 54.9%.…

  1. Foraging potential of underground storage organ plants in the southern Cape, South Africa.

    PubMed

    Singels, Elzanne; Potts, Alastair J; Cowling, Richard M; Marean, Curtis W; De Vynck, Jan; Esler, Karen J

    2016-12-01

    Underground storage organs (USOs) serve as a staple source of carbohydrates for many hunter-gatherer societies and they feature prominently in discussions of diets of early modern humans. While the way of life of hunter-gatherers in South Africa's Cape no longer exists, there is extensive ethnographic, historical, and archaeological evidence of hunter-gatherers' use of USOs. This is to be expected, given that the Cape supports the largest concentration of plant species with USOs globally. The southern Cape is the location of several Middle Stone Age sites that are highly significant to research on the origins of behaviourally modern humans, and this provided the context for our research. Here, we evaluate the foraging potential of USOs by identifying how abundant edible biomass is in the southern Cape, how easily it is gathered, and how nutritious it is. One hundred 5 × 5 m plots were assessed in terms of USO species and abundance. Nearly all of the sites sampled (83%) contained edible USOs and some had high concentrations of edible biomass. Extrapolating from these sites suggests that the edible USO biomass falls within the range of biomass observed in areas supporting extant hunter-gatherer communities. The nutritional content for six USO species was assessed; these contained between 40 and 228 calories/100 g. Furthermore, foraging events were staged to provide an indication of the potential return rates for the same six USOs. The target species grow near the soil surface, mostly in sandy soils, and were gathered with minimal effort. Some 50% of the foraging events conducted yielded enough calories to meet the daily requirements of a hunter-gatherer within two hours. In conclusion, we demonstrate that USOs are a readily available source of carbohydrates in the southern Cape landscape and, therefore, there is a strong possibility that USOs played a critical role in providing food for early humans.

  2. Health outcomes for children born to teen mothers in Cape Town, South Africa1

    PubMed Central

    Ardington, Cally; Leibbrandt, Murray

    2014-01-01

    This paper analyzes whether children born to teen mothers in Cape Town, South Africa are disadvantaged in terms of their health outcomes because their mother is a teen. Exploiting the longitudinal nature of the Cape Area Panel Study, we assess whether observable differences between teen mothers and slightly older mothers can explain why first-born children of teen mothers appear disadvantaged. Our balanced regressions indicate that observed characteristics cannot explain the full extent of disadvantage of being born to a teen mother, with children born to teen mothers continuing to have significantly worse child health outcomes, especially among coloured children. In particular, children born to teens are more likely to be underweight at birth and to be stunted with the disadvantage for coloured children four times the size for African children. PMID:26052156

  3. Health outcomes for children born to teen mothers in Cape Town, South Africa.

    PubMed

    Branson, Nicola; Ardington, Cally; Leibbrandt, Murray

    2015-04-01

    This paper analyzes whether children born to teen mothers in Cape Town, South Africa are disadvantaged in terms of their health outcomes because their mother is a teen. Exploiting the longitudinal nature of the Cape Area Panel Study, we assess whether observable differences between teen mothers and slightly older mothers can explain why first-born children of teen mothers appear disadvantaged. Our balanced regressions indicate that observed characteristics cannot explain the full extent of disadvantage of being born to a teen mother, with children born to teen mothers continuing to have significantly worse child health outcomes, especially among coloured children. In particular, children born to teens are more likely to be underweight at birth and to be stunted with the disadvantage for coloured children four times the size for African children.

  4. Stress, Substance Use and Sexual Risk Behaviors among Primary Care Patients in Cape Town, South Africa

    PubMed Central

    Avalos, Lyndsay Ammon; Mertens, Jennifer R.; Ward, Catherine L.; Flisher, Alan J.; Bresick, Graham F.; Weisner, Constance M.

    2009-01-01

    We assessed the relationship between stress, substance use and sexual risk behaviors in a primary care population in Cape Town, South Africa. A random sample of participants (and over-sampled 18–24 year olds) from 14 of the 49 clinics in Cape Town's public health sector using stratified random sampling (N=2,618), was selected. We evaluated current hazardous drug and alcohol use and three domains of stressors (Personal Threats, Lacking Basic Needs, and Interpersonal Problems). Several personal threat stressors and an interpersonal problem stressor were related to sexual risk behaviors. With stressors included in the model, hazardous alcohol use, but not hazardous drug use, was related to higher rates of sexual risk behaviors. Our findings suggest a positive screening for hazardous alcohol use should alert providers about possible sexual risk behaviors and vice versa. Additionally, it is important to address a broad scope of social problems and incorporate stress and substance use in HIV prevention campaigns. PMID:19205865

  5. Habitat type and nursery function for coastal marine fish species, with emphasis on the Eastern Cape region, South Africa

    NASA Astrophysics Data System (ADS)

    Whitfield, Alan K.; Pattrick, Paula

    2015-07-01

    A considerable amount of research has been undertaken to document and assess the nursery function of a variety of coastal habitats for marine fish species around the world. Most of these studies have focused on particular habitats and have generally been confined to a limited range of fish species associated with specific nursery areas. In this review we conduct a general assessment of the state of knowledge of coastal habitats in fulfilling the nursery-role concept for marine fishes, with particular emphasis on biotic and abiotic factors that influence nursery value. A primary aim was to synthesize information that can be used to drive sound conservation planning and provide a conceptual framework so that new marine protected areas (MPAs) incorporate the full range of nursery areas that are present within the coastal zone. We also use published data from a coastal section in the Eastern Cape Province, South Africa, to highlight the differential use of shallow aquatic habitats by a range of juvenile marine fish species within this region. Although the Eastern Cape case study does not assess the relative growth, food availability or predation in nursery and non-nursery areas within the coastal zone, it does document which habitats are important to the juveniles of dominant marine species within each area. These habitats, which range from intertidal pools, subtidal gulleys and surf zones to estuaries, do appear to perform a key role in the biological success of species assemblages, with the juveniles of particular marine fishes tending to favour specific nursery areas. According to a multivariate analysis of nursery habitat use within this region, marine species using estuaries tend to differ considerably from those using nearshore coastal waters, with a similar pattern likely to occur elsewhere in the world.

  6. Healthcare experiences of lesbian and bisexual women in Cape Town, South Africa.

    PubMed

    Smith, Riley

    2015-01-01

    Understanding the health needs and experiences of South African lesbian and bisexual women is imperative for implementing effective and inclusive public health strategies. Such understanding, however, is limited due to the exclusion of these women from most existing research on healthcare access in the region. This paper bridges that gap by investigating the healthcare experiences of lesbian and bisexual women in Cape Town. Data were gathered from 22 interviews with self-identified lesbian and bisexual community members and university students in the Cape Town area. Interviews explored obstacles women face in accessing affirming services, different experiences with public and private healthcare, fear of stigma/discrimination, availability of relevant sexual health information and suggestions to improve existing programmes. Findings suggest that South African lesbians and bisexual women may have a range of both positive and negative experiences in public and private health services, that they use protective strategies when 'coming out' and that they find that sexual health information pertinent to them is largely unavailable. These discussions contribute to a more inclusive understanding of the experiences of lesbian and bisexual women accessing healthcare and other services and help to inform providers, thereby enabling them to deliver more meaningful care to lesbian, gay, bisexual and transgender persons in South Africa.

  7. Topography as a driver of diversification in the Cape Floristic Region of South Africa.

    PubMed

    Verboom, G Anthony; Bergh, Nicola G; Haiden, Sarah A; Hoffmann, Vera; Britton, Matthew N

    2015-07-01

    The rugged topography of the Cape Floristic Region (CFR), South Africa, is frequently invoked to explain the spectacular radiation of the Cape flora, but the mechanisms involved remain unclear. Where recent authors emphasize the importance of elevation gradients as stimuli for ecological speciation, earlier workers stressed the role of topography as an isolating mechanism, particularly in montane lineages. Using six Cape plant lineages, we tested whether elevation niches are phylogenetically conserved. We then assessed whether high-elevation species are more consistently range-restricted than low-elevation species, and whether high-elevation sisters show stronger range exclusivity (allopatry) and weaker ecological and phenotypic differentiation, suggestive of nonecological speciation. Elevation niches tend to be phylogenetically conserved. Also, high-elevation species are more consistently range-restricted than low-elevation species, potentially explaining the generally stronger range exclusivity of high-elevation sisters. While the high-elevation zone is less homogeneous ecologically, more data are required to demonstrate that high-elevation sister species show generally weaker ecological and phenotypic differentiation. Topographic complexity promotes geographical isolation at high elevations, thereby providing opportunities for nonecological, vicariant speciation. While recognizing the need for additional data, we suggest that the upland and lowland floras of the CFR may differ with regard to predominant speciation mode.

  8. Two new species of Indigofera L. (Leguminosae) from the Sneeuberg Centre of Floristic Endemism, Great Escarpment (Eastern and Western Cape, South Africa)

    PubMed Central

    Clark, V. Ralph; Schrire, Brian D.; Barker, Nigel P.

    2015-01-01

    Abstract Two new species of Indigofera L. (Leguminosae) are described from the Sneeuberg Centre of Floristic Endemism on the southern Great Escarpment, Eastern and Western Cape Provinces, South Africa. Both species are localised high-altitude endemics. Indigofera magnifica Schrire & V.R. Clark is confined to the summit plateau of the Toorberg–Koudeveldberg–Meelberg west of Graaff-Reinet, and complements other western Sneeuberg endemics such as Erica passerinoides (Bolus) E.G.H. Oliv. and Faurea recondita Rourke & V.R. Clark. Indigofera asantasanensis Schrire & V.R. Clark is confined to a small area east of Graaff-Reinet, and complements several other eastern Sneeuberg endemics such as Euryops exsudans B. Nord & V.R. Clark and Euryops proteoides B. Nord. & V.R. Clark. Based on morphology, both new species belong to the Cape Clade of Indigofera, supporting a biogeographical link between the Cape Floristic Region and the Sneeuberg, as well as with the rest of the eastern Great Escarpment. PMID:25941448

  9. Highlights from Johannesburg, Gauteng Province, South Africa

    NASA Technical Reports Server (NTRS)

    2002-01-01

    the cooler highveld to the south. The large round feature near the north-west corner indicates an ancient volcanic crater in the Pilanesberg National Park. Many bright, buff-colored rectangular patches around Johannesburg are associated with mining activities, and at least two of these areas (situated 40 kilometers southeast of the city) hold large amounts of water. The Sterkfontein Caves (now included within the recently created 'Cradle of Humankind' World Heritage Site) are located about 35 kilometers northwest of Johannesburg. In the southern portion of the images, a section of the Vredefort Hills are apparent to the west, and to the east the Vaal River and a large water body contained by the Vaal Dam delineate the border between the Gauteng and Free State provinces.

    The Multi-angle Imaging SpectroRadiometer observes the daylit Earth continuously from pole to pole, and views almost the entire globe every 9 days. This image is a portion of the data acquired during Terra orbit 13266, and covers an area of about 190 kilometers x 221 kilometers. It utilizes data from blocks 111 to 112 within World Reference System-2 path 170.

    MISR was built and is managed by NASA's Jet Propulsion Laboratory, Pasadena, CA, for NASA's Office of Earth Science, Washington, DC. The Terra satellite is managed by NASA's Goddard Space Flight Center, Greenbelt, MD. JPL is a division of the California Institute of Technology.

  10. Applications of ichnology to hydrogeology, with examples from the Cape Fear Formation (Cretaceous), South Carolina

    SciTech Connect

    Martin, A.J. . Geosciences Program); Simones, G.C. )

    1992-01-01

    Ichnology, the study of modern and ancient traces left by organisms, has provided supplemental information to geologic subdisciplines such as sedimentology and stratigraphy. The major objective of the authors paper is to emphasize the valuable information that can be conveyed by trace fossils in the investigation of hydrogeologic units. Bioturbation has a net effect of mixing different types and layers of sediments, such as introducing clays into sands and vice versa. This mixing can decrease porosity and permeability of sandy units, thus changing potential aquifers into confining units. For example, a sandy fluvial deposit will contain distinctive nonmarine trace fossils, thus defining channel sands that may serve as permeable conduits for ground-water flow. In contrast, a sandy shelf deposit will contain marine trace fossils in a sand body geometry that will be markedly different from aquifers produced in nonmarine environments. Bioturbation also causes geochemical and diagenetic changes in sediments, causing irrigation of previously anoxic sediments and precipitation of ion oxides. The Cretaceous Cape Fear Formation of the Atlantic Coastal Plain, in the subsurface of South Carolina, is presented as an example of a hydrogeologic unit that has been reinterpreted using ichnologic data. Extensive bioturbation caused mixing of clays and sands in Cape Fear sediments, which resulted in the Cape Fear becoming a regional confining system. Trace fossil assemblages indicate a brackish water environment, perhaps estuarine, for the Cape Fear, as opposed to previous interpretations of fluvial and deltaic environments. Bioturbated zones also have significantly more oxidized iron than unbioturbated zones, highlighting potential effects on ground-water quality.

  11. Desertification of subtropical thicket in the Eastern Cape, South Africa: Are there alternatives?

    PubMed

    Kerley, G I; Knight, M H; de Kock, M

    1995-01-01

    The Eastern Cape Subtropical Thicket (ECST) froms the transition between forest, semiarid karroid shrublands, and grassland in the Eastern Cape, South Africa. Undegraded ECST forms an impenetrable, spiny thicket up to 3 m high consisting of a wealth of growth forms, including evergreen plants, succulent and deciduous shrubs, lianas, grasses, and geophytes. The thicket dynamics are not well understood, but elephants may have been important browsers and patch disturbance agents. These semiarid thickets have been subjected to intensive grazing by domestic ungulates, which have largely replaced indigenous herbivores over the last 2 centuries. Overgrazing has extensively degraded vegetation, resulting in the loss of phytomass and plant species and the replacement of perennials by annuals. Coupled with these changes are alterations of soil structure and secondary productivity. This rangeland degradation has largely been attributed to pastoralism with domestic herbivores. The impact of indigenous herbivores differs in scale, intensity, and nature from that of domestic ungulates. Further degradation of the ECST may be limited by alternative management strategies, including the use of wildlife for meat production and ecotourism. Producing meat from wildlife earns less income than from domestic herbivores but is ecologically sustainable. The financial benefits of game use can be improved by developing expertise, technology, and marketing. Ecotourism is not well developed in the Eastern Cape although the Addo Elephant National Park is a financial success and provides considerable employment benefits within an ecologically sustainable system. The density of black rhinoceros and elephant in these thickets is among the highest in Africa, with high population growth and the lowest poaching risk. The financial and ecological viability of ecotourism and the conservation status of these two species warrant expanding ecotourism in the Eastern Cape, thereby reducing the probability of

  12. Exploring the Factors Influencing the Adoption of Open Source Software in Western Cape Schools

    ERIC Educational Resources Information Center

    Johnston, Kevin; Begg, Shameemah; Tanner, Maureen

    2013-01-01

    Open Source Software (OSS) presents many benefits to both the private and the public sectors, and has proven to be a viable solution in schools. Although a policy mandating the use of OSS exists in the Western Cape province of South Africa, very few schools in the province have adopted OSS. The education system in South Africa is currently facing…

  13. Community health worker perspectives on a new primary health care initiative in the Eastern Cape of South Africa

    PubMed Central

    Rabkin, Miriam; Macheka, Tonderayi; Mutiti, Anthony; Mwansa-Kambafwile, Judith; Dlamini, Thomas; El-Sadr, Wafaa M.

    2017-01-01

    Background In 2010, South Africa’s National Department of Health launched a national primary health care (PHC) initiative to strengthen health promotion, disease prevention, and early disease detection. The strategy, called Re-engineering Primary Health Care (rPHC), aims to provide a preventive and health-promoting community-based PHC model. A key component of rPHC is the use of community-based outreach teams staffed by generalist community health workers (CHWs). Methods We conducted focus group discussions and surveys on the knowledge and attitudes of 91 CHWs working on community-based rPHC teams in the King Sabata Dalindyebo (KSD) sub-district of Eastern Cape Province. Results The CHWs we studied enjoyed their work and found it meaningful, as they saw themselves as agents of change. They also perceived weaknesses in the implementation of outreach team oversight, and desired field-based training and more supervision in the community. Conclusions There is a need to provide CHWs with basic resources like equipment, supplies and transport to improve their acceptability and credibility to the communities they serve. PMID:28301609

  14. Farmers' perceptions and knowledge of cattle adaptation to heat stress and tick resistance in the eastern cape, South Africa.

    PubMed

    Katiyatiya, C L F; Muchenje, V; Mushunje, A

    2014-11-01

    The objective of this study was to determine the perceptions and knowledge of farmers of heat stress and tick resistance in cattle. A cross-sectional survey was conducted and 110 farmers in four villages in the sour and sweet velds of the Eastern Cape Province, South Africa were interviewed. The associations among area (municipality), gender, age, level of education, employment and religion were computed using Chi-square tests. The majority of the respondents had on average 4 bulls, 4 cows, 4 heifers, 4 calves, and 4 oxen. Milk was considered as the major (28.3%) reason for keeping cattle. Most farmers owned non-descript (72.6%), and Nguni (45.3%) cattle because of their heat tolerance (54.7%), tick resistance (54.7%), and milking ability (28.2%) traits. Excessive panting (56.6%) and disease transmission (76%) were regarded as the major effects of heat stress and tick infestation in cattle, respectively. About 50% of the respondents agreed that hair length influences tick resistance and 47.17% considered coat colour when acquiring cattle. In the sampled areas, ticks were prevalent in the summer season (93%), and 77.36% of the respondents use acaricides every fortnight. Gall sickness was reported to be a major problem in the cattle herds by 36.79% of the respondents. Our results showed that farmers in the two municipalities had knowledge of cattle adaptation to heat stress and tick resistance.

  15. Prevalence, Causes and Socio-Economic Determinants of Vision Loss in Cape Town, South Africa

    PubMed Central

    Cockburn, Nicky; Steven, David; Lecuona, Karin; Joubert, Francois; Rogers, Graeme; Cook, Colin; Polack, Sarah

    2012-01-01

    Purpose To estimate the prevalence and causes of blindness and visual impairment in Cape Town, South Africa and to explore socio-economic and demographic predictors of vision loss in this setting. Methods A cross sectional population-based survey was conducted in Cape Town. Eighty-two clusters were selected using probability proportionate to size sampling. Within each cluster 35 or 40 people aged 50 years and above were selected using compact segment sampling. Visual acuity of participants was assessed and eyes with a visual acuity less than 6/18 were examined by an ophthalmologist to determine the cause of vision loss. Demographic data (age, gender and education) were collected and a socio-economic status (SES) index was created using principal components analysis. Results Out of 3100 eligible people, 2750 (89%) were examined. The sample prevalence of bilateral blindness (presenting visual acuity <3/60) was 1.4% (95% CI 0.9–1.8). Posterior segment diseases accounted for 65% of blindness and cataract was responsible for 27%. The prevalence of vision loss was highest among people over 80 years (odds ratio (OR) 6.9 95% CI 4.6–10.6), those in the poorest SES group (OR 3.9 95% CI 2.2–6.7) and people with no formal education (OR 5.4 95% CI 1.7–16.6). Cataract surgical coverage was 68% in the poorest SES tertile (68%) compared to 93% in the medium and 100% in the highest tertile. Conclusions The prevalence of blindness among people ≥50 years in Cape Town was lower than expected and the contribution of posterior segment diseases higher than previously reported in South Africa and Sub Saharan Africa. There were clear socio-economic disparities in prevalence of vision loss and cataract surgical coverage in this setting which need to be addressed in blindness prevention programs. PMID:22363476

  16. Poverty and psychological health among AIDS-orphaned children in Cape Town, South Africa.

    PubMed

    Cluver, Lucie; Gardner, Frances; Operario, Don

    2009-06-01

    This study examined associations between AIDS-orphanhood status, poverty indicators, and psychological problems (depression, anxiety, post-traumatic stress, peer problems, delinquency, conduct problems) among children and adolescents in townships surrounding Cape Town, South Africa. One thousand and twenty-five children and adolescents completed standardized and culturally sensitive cross-sectional surveys. Children orphaned by AIDS had more psychological problems including depression, peer problems, post-traumatic stress, and conduct problems. Specific poverty indicators including food security, access to social welfare grants, employment in the household and access to school were associated with better psychological health. Poverty indicators mediated associations of AIDS-orphanhood with psychological problems. Food security showed the most consistent association with reduced psychological problems. Poverty alleviation measures have the potential to improve psychological health for AIDS-orphaned children in South African townships.

  17. Racism and medical science in South Africa's Cape Colony in the mid- to late nineteenth century.

    PubMed

    Deacon, H

    2000-01-01

    Racism has been a particular focus of the history of Western medicine in colonial South Africa. Much of the research to date has paradoxically interpreted Western medicine as both a handmaiden of colonialism and as a racist gatekeeper to the benefits of Western medical science. This essay suggests that while these conclusions have some validity, the framework in which they have been devised is problematic. Not only is that framework contradictory in nature, it underplays differences within Western medicine, privileges the history of explicit and intentional racial discrimination in medicine, and encourages a separate analysis of racism in law, in the medical profession, and in medical theory and practice. Using the example of the Cape Colony in South Africa, this paper shows how legislation, class, institutional setting, and popular stereotypes could influence the form, timing, and degree of racism in the medical professional, and in medical theory and practice. It also argues for an analytical distinction between 'racist medicine' and 'medical racism.'

  18. Report of the 7th African Rotavirus Symposium, Cape Town, South Africa, 8th November 2012.

    PubMed

    Seheri, L M; Mwenda, J M; Page, N

    2014-11-12

    The 7th African Rotavirus Symposium was held in Cape Town, South Africa, on the 8th November 2012 as a Satellite Symposium at the First International African Vaccinology Conference. Over 150 delegates participated in this symposium including scientists, clinicians, health officials, policymakers and vaccine manufacturers from across Africa. Key topics discussed included rotavirus surveillance, rotavirus vaccine introduction, post rotavirus vaccine impact analysis and intussusception data and surveillance in Africa. The symposium provided early rotavirus vaccine adopter countries in Africa (South Africa, Ghana and Botswana) an opportunity to share up-to-date information on vaccine introduction, and allowed colleagues to share experiences in establishing routine rotavirus surveillance (Tanzania, Niger and Rwanda). Overall, the symposium highlighted the high burden of rotavirus in Africa, and the need to continue to strengthen efforts in preventing rotavirus diarrhoea in Africa.

  19. Seasonal availability of edible underground and aboveground carbohydrate resources to human foragers on the Cape south coast, South Africa

    PubMed Central

    Cowling, Richard M.; Potts, Alastair J.; Marean, Curtis W.

    2016-01-01

    The coastal environments of South Africa’s Cape Floristic Region (CFR) provide some of the earliest and most abundant evidence for the emergence of cognitively modern humans. In particular, the south coast of the CFR provided a uniquely diverse resource base for hunter-gatherers, which included marine shellfish, game, and carbohydrate-bearing plants, especially those with Underground Storage Organs (USOs). It has been hypothesized that these resources underpinned the continuity of human occupation in the region since the Middle Pleistocene. Very little research has been conducted on the foraging potential of carbohydrate resources in the CFR. This study focuses on the seasonal availability of plants with edible carbohydrates at six-weekly intervals over a two-year period in four vegetation types on South Africa’s Cape south coast. Different plant species were considered available to foragers if the edible carbohydrate was directly (i.e. above-ground edible portions) or indirectly (above-ground indications to below-ground edible portions) visible to an expert botanist familiar with this landscape. A total of 52 edible plant species were recorded across all vegetation types. Of these, 33 species were geophytes with edible USOs and 21 species had aboveground edible carbohydrates. Limestone Fynbos had the richest flora, followed by Strandveld, Renosterveld and lastly, Sand Fynbos. The availability of plant species differed across vegetation types and between survey years. The number of available USO species was highest for a six-month period from winter to early summer (Jul–Dec) across all vegetation types. Months of lowest species’ availability were in mid-summer to early autumn (Jan–Apr); the early winter (May–Jun) values were variable, being highest in Limestone Fynbos. However, even during the late summer carbohydrate “crunch,” 25 carbohydrate bearing species were visible across the four vegetation types. To establish a robust resource landscape

  20. Seasonal availability of edible underground and aboveground carbohydrate resources to human foragers on the Cape south coast, South Africa.

    PubMed

    De Vynck, Jan C; Cowling, Richard M; Potts, Alastair J; Marean, Curtis W

    2016-01-01

    The coastal environments of South Africa's Cape Floristic Region (CFR) provide some of the earliest and most abundant evidence for the emergence of cognitively modern humans. In particular, the south coast of the CFR provided a uniquely diverse resource base for hunter-gatherers, which included marine shellfish, game, and carbohydrate-bearing plants, especially those with Underground Storage Organs (USOs). It has been hypothesized that these resources underpinned the continuity of human occupation in the region since the Middle Pleistocene. Very little research has been conducted on the foraging potential of carbohydrate resources in the CFR. This study focuses on the seasonal availability of plants with edible carbohydrates at six-weekly intervals over a two-year period in four vegetation types on South Africa's Cape south coast. Different plant species were considered available to foragers if the edible carbohydrate was directly (i.e. above-ground edible portions) or indirectly (above-ground indications to below-ground edible portions) visible to an expert botanist familiar with this landscape. A total of 52 edible plant species were recorded across all vegetation types. Of these, 33 species were geophytes with edible USOs and 21 species had aboveground edible carbohydrates. Limestone Fynbos had the richest flora, followed by Strandveld, Renosterveld and lastly, Sand Fynbos. The availability of plant species differed across vegetation types and between survey years. The number of available USO species was highest for a six-month period from winter to early summer (Jul-Dec) across all vegetation types. Months of lowest species' availability were in mid-summer to early autumn (Jan-Apr); the early winter (May-Jun) values were variable, being highest in Limestone Fynbos. However, even during the late summer carbohydrate "crunch," 25 carbohydrate bearing species were visible across the four vegetation types. To establish a robust resource landscape will require

  1. Factors affecting treatment outcomes in drug-resistant tuberculosis cases in the Northern Cape, South Africa.

    PubMed

    Elliott, E; Draper, H R; Baitsiwe, P; Claassens, M M

    2014-09-21

    The Northern Cape Province has low cure rates (21%) for multidrug-resistant tuberculosis (TB). We audited the programme to identify factors affecting treatment outcomes. Cases admitted to two drug-resistant TB units from 2007 to 2009 had data extracted from clinical folders. Unfavourable treatment outcomes were found in 58% of the 272 cases. A multivariable regression analysis found that male sex was associated with unfavourable outcome (P = 0.009). Weight at diagnosis (P < 0.001) and oral drug adherence (P < 0.001) were also associated with an unfavourable outcome; however, injectable drug adherence was not (P = 0.395). Positive baseline smear and human immunodeficiency virus positive status were not associated with unfavourable outcome. Shorter, more patient-friendly regimens may go a long way to improving adherence and outcomes.

  2. Risk factors for incident HIV infection among antenatal mothers in rural Eastern Cape, South Africa

    PubMed Central

    Businge, Charles Bitamazire; Longo-Mbenza, Benjamin; Mathews, Verona

    2016-01-01

    Background The prevalence of HIV among antenatal clients in South Africa has remained at a very high rate of about 29% despite substantial decline in several sub-Saharan countries. There is a paucity of data on risk factors for incident HIV infection among antenatal mothers and women within the reproductive age bracket in local settings in the Eastern Cape, South Africa. Objective To establish the risk factors for incident HIV infection among antenatal clients aged 18–49 years attending public antenatal clinics in rural Eastern Cape, South Africa. Design This was an unmatched case–control study carried out in public health antenatal clinics of King Sabata District Municipality between January and March 2014. The cases comprised 100 clients with recent HIV infection; the controls were 200 HIV-negative antenatal clients. Socio-demographic, sexual, and behavioral data were collected using interviewer-administered questionnaires adapted from the standard DHS5 women's questionnaire. Multivariate logistic regression models were used to identify the independent risk factors for HIV infection. A p<0.05 was considered statistically significant. Results The independent risk factors for incident HIV infection were economic dependence on the partner, having older male partners especially among women aged ≤20 years, and sex under the influence of alcohol. Conclusions Therefore, effective prevention of HIV among antenatal mothers in KSDM must target the improvement of the economic status of women, thereby reducing economic dependence on their sexual partners; address the prevalent phenomenon of cross-generation sex among women aged <20 years; and regulate the brewing, marketing, and consumption of alcohol. PMID:26800877

  3. Dating violence and self-efficacy for delayed sex among adolescents in Cape Town, South Africa.

    PubMed

    Boafo, Isaac M; Dagbanu, Emmanuel A; Asante, Kwaku Oppong

    2014-06-01

    In South Africa, dating violence is known to be widespread among adolescents, and is therefore a major public health issue because of its association with sexual risk behaviours. The objective of the study was to examine the relationship between dating violence and self-efficacy for delayed sex among school-going adolescents in Cape Town, South Africa. The study is based on analyses of data from a school-based health education programme targeting sexual and reproductive health issues.The study involved 3,655 school-going adolescents aged between 12 and 17 in Cape Town, South Africa. The data was collected by means of a self-administered questionnaire composed of 153 items on sexual and reproductive health, dating violence as well as sociodemographic characteristics. The results indicated that males showed a higher percentage of both dating violence victimization and perpetration, as compared to females. It was also found that adolescents from lower socio-economic backgrounds were more likely to be the victims of dating violence as compared to those from a higher socio-economic background. Female learners showed higher levels of self-efficacy for delayed sex than their male counterparts. Although the result revealed that there was a significant association between self-efficacy for delayed sex and socio-economic status, this link decreased with age. It is concluded that educational programmes aimed solely at improving self-efficacy for delayed sex is insufficient. Such programmes must also aim at preventing dating violence and equipping adolescents with the skills to negotiate their way out of dating violence.

  4. Diversity and Contested Social Identities in Multilingual and Multicultural Contexts of the University of the Western Cape, South Africa

    ERIC Educational Resources Information Center

    Banda, Felix; Peck, Amiena

    2016-01-01

    We draw on Rampton's "Crossing: Language and Ethnicity Among Adolescents" (2014. 2nd ed. New York: Routledge) notion of "crossing" to explore contestations in ethnolinguistic, cultural and racial affiliations at the University of the Western Cape (UWC), a university built for "Coloureds" in apartheid South Africa, but…

  5. A Comparison of the Effects of Witnessing Community Violence and Direct Victimization among Children in Cape Town, South Africa

    ERIC Educational Resources Information Center

    Shields, Nancy; Nadasen, Kathy; Pierce, Lois

    2009-01-01

    This study is based on a sample of children from the Cape Town area in South Africa. The study compares the effects of witnessing school or neighborhood violence compared with being victimized in each context on psychological distress. The findings suggest that in the context of the school, victimization has a somewhat stronger effect on distress…

  6. Brief Report: Social and Neighbourhood Correlates of Adolescent Drunkenness--A Pilot Study in Cape Town, South Africa

    ERIC Educational Resources Information Center

    Parry, Charles D. H.; Morojele, Neo K.; Saban, Amina; Flisher, Alan J.

    2004-01-01

    Aim: To identify social and neighbourhood correlates of drunkenness among adolescents. Design: A cross-sectional, community study. Participants: A multi-stage cluster sampling strategy was used to select 90 adolescents aged 11-17 years from nine distinct communities in Cape Town, South Africa. The sample was stratified by race, income, and gender.…

  7. "Learning Service" in International Contexts: Partnership-Based Service-Learning and Research in Cape Town, South Africa

    ERIC Educational Resources Information Center

    McMillan, Janice; Stanton, Timothy K.

    2014-01-01

    In this paper we explore an approach to developing and implementing service-learning and community-based research in a study-abroad program in Cape Town, South Africa. Drawing on a notion of partnerships reflecting the values of accompaniment and transparency, and influenced by the importance of learning service, we outline an intentional, engaged…

  8. From Digital Divide to Digital Equity: Learners' ICT Competence in Four Primary Schools in Cape Town, South Africa

    ERIC Educational Resources Information Center

    Gudmundsdottir, G. B.

    2010-01-01

    This study explores factors influencing the digital divide in four schools in Cape Town, South Africa. Three of the schools are for disadvantaged learners whereas the fourth was previously for whites only. All the schools use ICT in their curriculum delivery and thereby support the emphasis of provincial educational authorities on ICT access for…

  9. Impacts of drought on grape yields in Western Cape, South Africa

    NASA Astrophysics Data System (ADS)

    Araujo, Julio A.; Abiodun, Babatunde J.; Crespo, Olivier

    2016-01-01

    Droughts remain a threat to grape yields in South Africa. Previous studies on the impacts of climate on grape yield in the country have focussed on the impact of rainfall and temperature separately; meanwhile, grape yields are affected by drought, which is a combination of rainfall and temperature influences. The present study investigates the impacts of drought on grape yields in the Western Cape (South Africa) at district and farm scales. The study used a new drought index that is based on simple water balance (Standardized Precipitation Evapotranspiration Index; hereafter, SPEI) to identify drought events and used a correlation analysis to identify the relationship between drought and grape yields. A crop simulation model (Agricultural Production Systems sIMulator, APSIM) was applied at the farm scale to investigate the role of irrigation in mitigating the impacts of drought on grape yield. The model gives a realistic simulation of grape yields. The Western Cape has experienced a series of severe droughts in the past few decades. The severe droughts occurred when a decrease in rainfall occurred simultaneously with an increase in temperature. El Niño Southern Oscillation (ENSO) appears to be an important driver of drought severity in the Western Cape, because most of the severe droughts occurred in El Niño years. At the district scale, the correlation between drought index and grape yield is weak ( r≈-0.5), but at the farm scale, it is strong ( r≈-0.9). This suggests that many farmers are able to mitigate the impacts of drought on grape yields through irrigation management. At the farm scale, where the impact of drought on grape yields is high, poor yield years coincide with moderate or severe drought periods. The APSIM simulation, which gives a realistic simulation of grape yields at the farm scale, suggests that grape yields become more sensitive to spring and summer droughts in the absence of irrigation. Results of this study may guide decision-making on

  10. Experiences of violence and association with decreased drug abstinence among women in Cape Town, South Africa.

    PubMed

    Reed, Elizabeth; Myers, Bronwyn; Novak, Scott P; Browne, Felicia A; Wechsberg, Wendee M

    2015-01-01

    Drug abuse is a contributing factor in women's HIV risk in low-income communities in Cape Town, South Africa. This study assessed whether experiencing violence is associated with reduced drug abstinence among adult women (n = 603) participating in a randomized field trial for an HIV prevention study in Cape Town. In relation to drug abstinence at 12-month follow-up, multivariable regression models were used to assess (1) baseline partner and non-partner victimization, and (2) victimization at 12-month follow-up among participants reporting baseline victimization. Baseline partner (AOR = 0.6; 95 % CI 0.4-0.9) and non-partner victimization (AOR = 0.6; 95 % CI 0.4-0.9) were associated with a reduced likelihood of drug abstinence at follow-up. Among participants who reported victimization at baseline, those no longer reporting victimization at follow-up did not differ significantly in drug abstinence compared with those who reported victimization at follow-up. The study findings highlight the lasting impact of victimization on women's drug use outcomes, persisting regardless of whether violence was no longer reported at follow-up. Overall, the findings support the need for the primary prevention of violence to address the cycle of violence, drug use, and HIV among women in this setting.

  11. Two new water beetles from the Hantamsberg, an inselberg in the Northern Cape of South Africa (Coleoptera, Hydraenidae).

    PubMed

    Bilton, David T

    2014-11-26

    Mesoceration hantam sp. nov. and Parhydraena faeni sp. nov., are described from the Hantamsberg plateau, an inselberg in the Northern Cape of South Africa. The new species are so far known only from temporary waters on the Hantamsberg summit, where they were both abundant. Sampling in these mountains also revealed an interesting accompanying water beetle fauna, including the northernmost known record of Hydropeplus montanus Omer-Cooper, a species characteristic of mountain fynbos further south in the region.

  12. Correlates of lifetime trauma exposure among pregnant women from Cape Town, South Africa.

    PubMed

    Myers, Bronwyn; Jones, Hendrée E; Doherty, Irene A; Kline, Tracy L; Key, Mary E; Johnson, Kim; Wechsberg, Wendee M

    2015-06-01

    A cross-sectional survey of 298 pregnant women from Cape Town, South Africa was conducted to examine socio-demographic, reproductive health, mental health, and relationship correlates of lifetime trauma exposure and whether these correlates vary as a function of age. Overall, 19.8% of participants reported trauma exposure. We found similarities and differences in correlates of trauma exposure among women in emerging adulthood and older women. Prior termination of pregnancy was associated with trauma exposure in both age groups. Difficulties in resolving arguments, lifetime substance use, and a prior sexually transmitted infection were associated with trauma exposure among women in emerging adulthood. In contrast, depression and awareness of substance abuse treatment programmes were associated with trauma exposure among older women. These findings highlight the need for interventions that prevent and treat trauma exposure among vulnerable women. Such interventions should be tailored to address the correlates of trauma exposure in each age group.

  13. Correlates of lifetime trauma exposure among pregnant women from Cape Town, South Africa

    PubMed Central

    Myers, Bronwyn; Jones, Hendrée E.; Doherty, Irene A.; Kline, Tracy L.; Key, Mary E.; Johnson, Kim; Wechsberg, Wendee M.

    2015-01-01

    A cross-sectional survey of 298 pregnant women from Cape Town, South Africa was conducted to examine socio-demographic, reproductive health, mental health, and relationship correlates of lifetime trauma exposure and whether these correlates vary as a function of age. Overall, 19.8% of participants reported trauma exposure. We found similarities and differences in correlates of trauma exposure among women in emerging adulthood and older women. Prior termination of pregnancy was associated with trauma exposure in both age groups. Difficulties in resolving arguments, lifetime substance use, and a prior sexually transmitted infection were associated with trauma exposure among women in emerging adulthood. In contrast, depression and awareness of substance abuse treatment programmes were associated with trauma exposure among older women. These findings highlight the need for interventions that prevent and treat trauma exposure among vulnerable women. Such interventions should be tailored to address the correlates of trauma exposure in each age group. PMID:27087804

  14. New species and new records of Pterosthetops: eumadicolous water beetles of the South African Cape (Coleoptera, Hydraenidae).

    PubMed

    Bilton, David T

    2014-06-05

    Pterosthetops is one of a number of hydraenid genera endemic to the Cape of South Africa, whose minute moss beetle fauna is amongst the most diverse on earth. Here seven species are described as new: Pterosthetops baini sp. nov., Pterosthetops coriaceus sp. nov., Pterosthetops indwei sp. nov., Ptersothetops pulcherrimus sp. nov., Pterosthetops swartbergensis sp. nov., Pterosthetops tuberculatus sp. nov. and Pterosthetops uitkyki sp. nov., all from mountains in the Western Cape region. New collection records are also provided for all five previously described members of the genus, together with a revised key. Pterosthetops appear to be specialist inhabitants of seepages over rock faces (hygropetric/madicolous habitats), rarely being found outside such situations.

  15. Mercury in the atmosphere and in rainwater at Cape Point, South Africa

    NASA Astrophysics Data System (ADS)

    Brunke, Ernst-Günther; Walters, Chavon; Mkololo, Thumeka; Martin, Lynwill; Labuschagne, Casper; Silwana, Bongiwe; Slemr, Franz; Weigelt, Andreas; Ebinghaus, Ralf; Somerset, Vernon

    2016-01-01

    Mercury measurements were concurrently made in air (Gaseous Elemental Mercury, i.e. GEM) as well as in precipitation samples (Total mercury, i.e. TotHg) over a seven year period (2007-2013) at Cape Point, South Africa, during the rainy seasons (May-October). Eighty-five rain events, almost exclusively associated with cold fronts, have been identified of which 75% reached the Cape Point observatory directly across the Atlantic Ocean from the south, while 19% moved in to the measuring site via the Cape Town metropolitan region. In statistic terms the GEM, TotHg, CO and 222Rn levels within the urban-marine events do not differ from those seen in the marine rain episodes. Over the 2007-2013 period, the May till Oct averages for GEM ranged from 0.913 ng m-3 to 1.108 ng m-3, while TotHg concentrations ranged from 0.03 to 52.5 ng L-1 (overall average: 9.91 ng L-1). A positive correlation (R2 = 0.49, n = 7) has been found between the average annual (May till October) GEM concentrations in air and TotHg concentration in rainwater suggesting a close relationship between the two species. The wetter years are normally associated with higher GEM and TotHg levels. Both GEM and TotHg annual means correlate positively with total annual (May till October) rain depths. If one or two outlier years are removed from the data set, the R2 values increase from 0.23 to 0.10 for GEM and TotHg to 0.97 (n = 5) and 0.89 (n = 5), respectively. The relationship between annual mean GEM and annual precipitation depth also holds for the period 1996-2004 (R2 = 0.6, n = 8) when GEM was measured manually (low resolution data). A positive correlation was also seen between annual average GEM concentrations and the El Niño Southern Oscillation (ENSO) Index (SOI), for the 1996-2004 period (R2 = 0.7, n = 8). For the 2007-2013 periods this relationship was also positive but less pronounced. The relationship between annual precipitation depth and annual SOI suggests that the inter-annual variations of GEM

  16. Mediators of interpersonal violence and drug addiction severity among methamphetamine users in Cape Town, South Africa.

    PubMed

    Hobkirk, Andréa L; Watt, Melissa H; Green, Kimberly T; Beckham, Jean C; Skinner, Donald; Meade, Christina S

    2015-03-01

    South Africa has high rates of interpersonal violence and a rapidly growing methamphetamine epidemic. Previous research has linked experiences of interpersonal violence to higher rates of substance use, and identified mental health constructs as potential mediators of this association. The aim of this study was to examine the relationship between interpersonal violence and addiction severity among active methamphetamine users in Cape Town, South Africa, and to explore symptoms of posttraumatic stress disorder (PTSD) and substance use coping as mediators of this relationship. A community sample of 360 methamphetamine users was recruited through respondent driven sampling and surveyed on their experiences of violence, mental health, coping, and drug use and severity. A series of one-way ANOVAs were conducted to examine the relationship of self-reported interpersonal violence with drug addiction severity, and multiple mediation analyses were used to determine if PTSD symptoms and substance use coping mediated this relationship. The majority (87%) of the sample reported experiencing at least one instance of interpersonal violence in their lifetime, and the number of violent experiences was associated with increased drug addiction severity. PTSD and substance use coping were significant mediators of this association. Only the indirect effect of substance use coping remained significant for the female sample when the mediation model was conducted separately for men and women. The findings point to the need for integrated treatments that address drug use and PTSD for methamphetamine users in South Africa and highlight the importance of coping interventions for women.

  17. Genetic and Morphological Characterization of Freshwater Shrimps (Caridina africana Kingsley, 1882) Reveals the Presence of Alien Shrimps in the Cape Floristic Region, South Africa.

    PubMed

    Mirimin, Luca; Kitchin, Natasha; Impson, Dean N; Clark, Paul F; Richard, Jasmine; Daniels, Savel R; Roodt-Wilding, Rouvay

    2015-01-01

    Morphological identification and molecular data (mtDNA COI) were used to resolve the taxonomic identity of a non-native freshwater shrimp in the Cape Floristic Region (CFR) of South Africa and to evaluate levels of genetic diversity and differentiation in the species' core natural distribution. The species was morphologically and genetically identified as Caridina africana Kingsley, 1882, whose main natural distribution is in the KwaZulu-Natal (KZN) Province, more than 1200 km from the point of new discovery. Subsequently, sequence data from natural populations occurring in seven rivers throughout KZN showed the presence of nuclear copies of the mtDNA COI gene (NUMTs) in 46 out of 140 individuals. Upon removal of sequences containing NUMTs, levels of genetic diversity were low in the alien population (possibly as a consequence of a bottleneck event), while varying levels of genetic diversity and differentiation were found in natural populations, indicating habitat heterogeneity, fragmentation and restricted gene flow between rivers. Following the present study, the alien shrimp has survived the Western Cape's winter and dispersed into a nearby tributary of the Eerste River System, hence posing an additional potential threat to endangered endemics. Understanding the biology of this alien species will aid detection and eradication procedures.

  18. Kribbella karoonensis sp. nov. and Kribbella swartbergensis sp. nov., isolated from soil from the Western Cape, South Africa.

    PubMed

    Kirby, Bronwyn M; Le Roes, Marilize; Meyers, Paul R

    2006-05-01

    Two novel nocardioform actinomycetes, strains Q41T and HMC25T, were isolated from soil samples collected in the Western Cape province, South Africa. Rapid genus identification revealed that the isolates belonged to the genus Kribbella (based on single-digestion restriction analysis of the 16S rRNA gene sequences with MboI, VspI, SphI, SnaBI, SalI and AgeI). Both isolates had ll-diaminopimelic acid and glycine in their cell-wall peptidoglycan, and contained mannose and ribose as whole-cell sugars. Strain HMC25T is able to grow at 45 degrees C and in the presence of NaCl (3 %), cephaloridine (10 microg ml(-1)) and gentamicin sulphate (10 microg ml(-1)). Strain Q41T grows in the presence of NaCl (2 %). Neither strain was able to grow under anaerobic conditions, whereas Kribbella flavida KACC 20248T, Kribbella jejuensis HD9T, Kribbella koreensis KACC 20250T and Kribbella sandramycini KACC 20249T exhibited weak but distinct growth under anaerobic conditions. Physiological test results and 16S rRNA gene sequence analysis allowed Q41T and HMC25T to be distinguished from other members of the genus with validly published names. Strains HMC25T (=NRRL B-24426T=DSM 17345T) and Q41T (=NRRL B-24425T=DSM 17344T) therefore represent the type strains of novel species, for which the names Kribbella swartbergensis sp. nov. and Kribbella karoonensis sp. nov., respectively, are proposed.

  19. Taxi 'sugar daddies' and taxi queens: male taxi driver attitudes regarding transactional relationships in the Western Cape, South Africa.

    PubMed

    Potgieter, Cheryl; Strebel, Anna; Shefer, Tamara; Wagner, Claire

    2012-11-01

    Media reports are emerging on the phenomenon of young girls who travel with older mini-bus taxi drivers, and who are thought to have sex with the drivers in exchange for gifts and money. The extent to which such relationships might facilitate unsafe sexual practices and increased risks for both the men and the young women, often referred to as taxi queens, remains an important question in the light of the current challenges of HIV/AIDS in sub-Saharan Africa. However, very little research has been undertaken on this issue, especially regarding the perceptions and experiences of taxi drivers. Thus this paper aims to provide some preliminary findings on taxi drivers' attitudes and beliefs about taxi queens and their relationships with taxi drivers. A 22-item questionnaire was administered to 223 male taxi drivers in two regions in the Western Cape Province, South Africa. Taxi drivers in this study largely saw the relationship between taxi drivers and the young girls who ride with them as providing status for both the girls and drivers, and there seemed to be recognition of the transactional nature of the relationship between taxi drivers and taxi queens. The stigmatisation of young girls who ride with taxi drivers was evident. Drivers had knowledge and awareness of the risks of unsafe sex and supported condom use, although there appeared to be some uncertainty and confusion about the likelihood of HIV infection between drivers and girls. While taxi drivers recognised the role of alcohol in relationships with young girls, they seemed to deny that the abuse of drugs was common. The study highlights a number of key areas that need to be explored with men in the taxi industry, in order to address risk behaviours for both taxi drivers and the girls who ride with them.

  20. Shale Gas characteristics of Permian black shales (Ecca group, Eastern Cape, South Africa)

    NASA Astrophysics Data System (ADS)

    Geel, Claire; Booth, Peter; Schulz, Hans-Martin; Horsfield, Brian; de Wit, Maarten

    2013-04-01

    This study involves a comprehensive and detailed lithological, sedimentalogical, structural and geochemical description of the lower Ecca Group in the Eastern Cape, South Africa. The Ecca group hosts a ~ 245 million year old organic-rich black shale, which has recently been the focus of interest of petroleum companies worldwide. The shale was deposited under anoxic conditions in a setting which formed as a consequence of retro-arc foreland basin development related to the Cape Fold Belt. This sedimentary/tectonic environment provided the conditions for deeply buried black shales to reach maturity levels for development in the gas window. The investigation site is called the Greystone Area and is situated north of Wolwefontein en route to Jansenville. The area has outcrops of the Dwyka, the Ecca and the lower Beaufort Groups. The outcrops were mapped extensively and the data was used in conjunction with GIS software to produce a detailed geological map. North-south cross sections were drawn to give indication of bed thicknesses and formation depths. Using the field work, data two boreholes were accurately sited on the northern limb of a shallow easterly plunging syncline. The first borehole reached 100m and the second was drilled to 292m depth (100m percussion and 192m core). The second borehole was drilled 200m south of the first, to penetrate the formations at a greater depth and to avoid surface weathering. Fresh core from the upper Dwyka Group, the Prince Albert Formation, the Whitehill Formation, Collingham Formation and part of the Ripon Formation were successfully extracted and a detailed stratigraphic log has been drawn up. The core was sampled during extraction and the samples were immediately sent to the GFZ in Potsdam, Germany, for geochemical analyses. As suspected the black shales of the the Whitehill Formation are high in organic carbon and have an average TOC value of 4.5%, whereas the Prince Albert and Collingham Formation are below 1%. Tmax values

  1. Juvenile idiopathic arthritis in two tertiary centres in the Western Cape, South Africa

    PubMed Central

    2012-01-01

    Background Juvenile idiopathic arthritis (JIA) is a disease that shows wide variations between differing populations. Since the recent international consensus on classification criteria, JIA has been widely described in many countries and population groups. There has been almost no data that describes JIA in an African, specifically Sub-Saharan African, setting. Therefore, the aim of this study is to describe disease characteristics, disease course, and functional disability in two tertiary centres in the Western Cape, South Africa and compare the findings to other JIA populations. Methods Eighty-six children were recruited during random clinic visits to rheumatology clinics at Tygerberg and Groote Schuur Hospital between April 2010 and April 2011. Children were diagnosed using International League of Associations for Rheumatology (ILAR) 2001 classification criteria. Consent was obtained and medical records examined. The Childhood Health Assessment Questionnaires (CHAQ) and visual analogue scales (VAS) for pain and general well-being were completed and all children were examined by a researcher in conjunction with a paediatric rheumatologist. HIV status as well as tuberculosis disease and treatment were investigated. Results A total of 86 children were enrolled. Eight children were excluded (2 HIV arthropathy, 1 TB arthritis, 1 SLE, 4 with insufficient data), leaving a total of 78 patients. There was an equal female to male ratio-39 males and 39 females. There were 6 systemic JIA patients (7.69%), 17 persistent oligoarthritis (21.79%), 4 extended oligoarthritis (5.12%), 11 polyarthritis rheumatoid factor (RF) positive (14.10%), 21 polyarthritis RF negative (26.9%), 1 psoriatic arthritis (1.28%), and 18 enthesitis-related arthritis (23%). The median CHAQ for the group was 0.5 (IQR 0.1-1.25), the median VAS for pain was 18 mm (IQR 4–42) and median VAS for general well-being was 25 mm (IQR 3–49). Enthesitis-related arthritis and polyarthritis disease subtypes in

  2. HIV Risk Behavior Among Methamphetamine Users Entering Substance Abuse Treatment in Cape Town, South Africa.

    PubMed

    Meade, Christina S; Lion, Ryan R; Cordero, Daniella M; Watt, Melissa H; Joska, John A; Gouse, Hetta; Burnhams, Warren

    2016-10-01

    South Africa is experiencing a growing methamphetamine problem, and there is concern that methamphetamine use may accelerate HIV transmission. There has been little research on the HIV prevention needs of methamphetamine users receiving substance abuse treatment in South Africa. This study assessed the prevalence and correlates of HIV risk behaviors among 269 methamphetamine users entering substance abuse treatment in two clinics in Cape Town. The prevalence of sexual risk behaviors was high among sexually active participants: 34 % multiple partners, 26 % unprotected intercourse with a casual partner, and 24 % sex trading for money/methamphetamine. The strongest predictor of all sexual risk behaviors was concurrent other drug use. Over half had not been HIV tested in the past year, and 25 % had never been tested, although attitudes toward HIV testing were overwhelmingly positive. This population of primarily heterosexual, non-injecting methamphetamine users is a high-risk group in need of targeted HIV prevention interventions. Substance abuse treatment is an ideal setting in which to reach methamphetamine users for HIV services.

  3. New constraints on historical dipole field decay: Four centuries of archaeointensity from Cape Town, South Africa.

    NASA Astrophysics Data System (ADS)

    Hare, V. J.; Gallet, Y.; Genevey, A.

    2015-12-01

    Current global geomagnetic field models suffer from strong bias towards Northern Hemisphere data. Absolute intensity measurements from the Southern Hemisphere are key to understanding the evolution of the field over the historical era, especially recent strengthening of non-dipole contributions, and the appearance of the South Atlantic Magnetic Anomaly (SAMA). I present the first archaeointensity data for locally-fired historical bricks from several well-dated sites (1660-2009 AD) in Cape Town, South Africa. These data constitute the first archaeomagnetic intensity variation curve for southern Africa for the past few centuries. The ages of the sites are tightly constrained by historical and archaeological considerations. Archaeointensity data obtained by the Thellier and Thellier method (modified by Coe), are corrected for both TRM anisotropy and cooling rate dependence of TRM acquisition. Analysis of magnetic mineralogy was performed to aid selection of fragments. Reliable archaeointensity determinations were obtained for 48 of 80 specimens, and 45 were retained in the final analysis. Intensity results vary from 24.3 ± 0.6 μT (modern brick) to 40.7 ± 0.8 μT (1660 AD), corresponding to Virtual Axial Dipole Moments (VADMs) between 6.1 ± 0.2 and 10.2 ± 0.2 נ1022 Am2. Results are generally not in agreement with current field models, but are coherent with other archaeomagnetic datasets from the Southern Hemisphere. The possible reasons for this are discussed, as well as implications for the historical evolution of the field.

  4. HIV prevalence and risk behaviours among foreign migrant women residing in Cape Town, South Africa.

    PubMed

    Townsend, Loraine; Giorgio, Maggie; Zembe, Yanga; Cheyip, Mireille; Mathews, Catherine

    2014-10-01

    HIV prevalence and risk behaviour among foreign migrants in South Africa has not been explored. This paper describes the effectiveness of respondent-driven sampling (RDS) to recruit foreign migrant women residing in Cape Town, reports HIV prevalence, and describes key characteristics among them. We conducted a biological and behavioural surveillance survey using RDS. After written informed consent, participants completed an audio computer assisted self-interview and provided a dried blood sample for HIV analysis. HIV prevalence was estimated to be 7 % (CI 4.9-9.5) among 935 women. HIV sero-positivity was associated with older age (p = 0.001), country of origin (p < 0.000), being unmarried (p < 0.000), having lived in South Africa for 3-5 years (p = 0.023), sexual debut at ≥15 years (p = 0.047), and having used a condom at last sex with a main partner (p = 0.007). Few women reported early sexual debut, or multiple sexual partners. RDS was successful in recruiting foreign migrant women.

  5. Changing land- and seascape environments at Cape Sable, a coastal wetland complex in south florida

    NASA Astrophysics Data System (ADS)

    Vlaswinkel, B.; Wanless, H.; Rankey, E.

    2003-04-01

    Cape Sable, a large coastal wetland complex at the southern tip of the Florida peninsula (U.S.), is currently undergoing dramatic changes in land- and seascape in response to historical sea level rise. The rise in sea level is progressively inundating a low marl ridge that has separated interior freshwater marshes of the Everglades from marine waters, leading to rapid widening of both natural tidal creeks and constructed canals. The linear rate of widening (0.7 to 1.2 meter per year since 1922) reflects a system out of equilibrium, in which the channels are seeking to accommodate the volume of water in the tidal prism. Rising sea level has enlarged the tidal prism by expanding the intertidal zone into former low-lying uplands. Opening of the channels has resulted in the creation and erosive widening of secondary channels into adjacent wetlands, further enlarging the tidal prism and tendency to widening. In the vicinity of some tidal inlets, the shoreline has eroded over 310 meters (since 1922; an overall rate of 4.6 m/yr), although erosion occur in steps in response to hurricanes (category 5 hurricanes in 1935, 1960 and 1992). In addition to changing channel morphology and beach erosion, rising sea level has shifted the mangrove/ freshwater marsh ecotone boundary inland significantly. Continued sea-level rise will inundate the marl ridge and accelerate erosion and breakup of the Cape Sable beach shoreline. The coastal red mangrove wetland could possibly keep pace with accelerated sea level rise, but hurricane setbacks negate this effect in south Florida. Category 4 and 5 hurricanes devastate the red mangrove forests and set into motion a phase of root-peat substrate decay and subsidence which has caused stepwise loss of both coastal and interior forests during the past 70 years of rapidly rising sea level. Changes in the coastal wetland environments of south Florida, in which critical habitats are imminently threatened, are driven by nonlinear processes that

  6. A new species of Yola Gozis, 1886 from the Western Cape of South Africa (Coleoptera: Dytiscidae: Bidessini).

    PubMed

    Bilton, David T

    2015-01-13

    Yola matsikammae sp. nov. is described from the Matsikammaberg, an inselberg on the northern edge of the fynbos biome of the Western Cape, South Africa. A key is provided to separate the new species from other southern African members of the Yola bicarinata group. Y. matsikammae sp. nov. bears a superficial resemblance to Sharphydrus species, particularly Sharphydrus brincki Bilton, 2013 with which it was found to co-occur. Comparative notes to separate these taxa are also included. 

  7. Are elderly pedestrians allowed enough time at pedestrian crossings in Cape Town, South Africa?

    PubMed

    Amosun, S L; Burgess, T; Groeneveldt, L; Hodgson, T

    2007-01-01

    A descriptive, cross-sectional analytical study was conducted to determine whether the recommended walking speed of 1.2 ms(-1) would allow elderly pedestrians to safely clear pedestrian crossings in Cape Town, South Africa. Male and female volunteers (n = 47), aged 65-93 years and resident in four homes for older persons, were recruited. Pedestrian clearance intervals at 40 traffic lights within 5-km radius of the selected homes were measured. The mean walking speed required at these traffic lights was 0.86 +/- 0.32 ms(1). The maximal walking speed over 12 m was measured without carrying any load and when carrying a predetermined weight of an average shopping bag. Participants' emotions associated with pedestrian road safety were also assessed through an interview. The mean maximal unloaded and loaded walking speeds were 1.36 +/- 0.31 ms(-1) (0.73-2.03 ms(-1)), and 1.36 +/- 0.33 ms(-1) (0.58-2.12 ms(-1)), respectively. Over 30% of the participants walked slower than the recommended walking speed of 1.2 ms(-1). Participants felt that traffic lights did not allow for sufficient time to cross roads (51.1%) and reported emotions of apprehension (44.7%), anxiety (17.0%), and fear (10.6%) when crossing. A review of traffic planning and public policy is recommended to ensure older pedestrians safely clear pedestrian crossings.

  8. A new redfin species, Pseudobarbus skeltoni (Cyprinidae, Teleostei), from the Cape Floristic Region, South Africa.

    PubMed

    Chakona, Albert; Swartz, Ernst R

    2013-01-01

    A new cyprinid species, Pseudobarbus skeltoni sp. nov, is described from material recently collected in the upper Riviersonderend River (a major tributary of the Breede River system) and the Krom River (a tributary of the Molenaars River in the upper Breede River) in the Cape Floristic Region of South Africa. The new species is readily distinguished from congeners, except P. burgi and P burchelli, by having two pairs of prominent oral barbels. Pseudobarbus skeltoni can be distinguished from P. burgi and P burchelli by the following combination of characters: distinctive terminal (vs. subterminal) mouth in adults; mouth inferior in sub-adults and young adults of P skeltoni but lower lips are unretracted (vs. retracted) and lack a distinct cartilaginous plate; snout prominent; more slender head (head depth 64.2% of HL, vs. 70.1% of HL in P. burchelli and 74.1% of HL in P. burgi); and a longer head relative to standard length (30.5 % vs. 26.8% in P. burchelli and 25.8% in P. burgi). The new species attains the largest size of any Pseudobarbus. The restricted distribution and the small remaining population sizes of P skeltoni indicate that this species is highly threatened and requires immediate conservation attention.

  9. The impact of organophosphate pesticides in orchards on earthworms in the Western Cape, South Africa.

    PubMed

    Reinecke, S A; Reinecke, A J

    2007-02-01

    Earthworm population density was measured in and adjacent to an orchard in an agricultural area in the Western Cape, South Africa. Worm densities were very low in orchards (22/m(2)) compared to adjacent uncultivated fields (152/m(2)) at a distance from the orchards. The possible effect of organophosphate pesticides on the earthworms was investigated. Background soil concentrations of chlorpyrifos prior to the start of the spraying season were low (0.2-2.7 microg/kg) but persistent for up to 6 months after the last spraying event, and the pesticide was, as a result of rainfall, transported to nontarget areas by runoff. Background concentrations of azinphos methyl were higher than those of chlorpyrifos (1.6-9.8 microg/kg) but not detectable 2 weeks after a spraying event. Azinphos methyl was mostly transported by wind (spray drift) to adjacent areas. A microcosm study indicated effects of chlorpyrifos on earthworms as determined by measuring biomass change and Cholinesterase inhibition. It is concluded that earthworms were affected detrimentally by the pesticides due to chronic (chlorpyrifos) and intermittent (azinphos methyl) exposure.

  10. Social and cultural contexts of concurrency in a township in Cape Town, South Africa.

    PubMed

    Mah, Timothy L; Maughan-Brown, Brendan

    2013-01-01

    Understanding the social and cultural context in which concurrent sexual partnerships exist is important, given recent interventions to reduce their prevalence. This qualitative study seeks to improve the understanding of concurrent partnerships and perceptions of the link between concurrency and HIV risk in a South African township in Cape Town. Small-group discussion and focus-group participants reported that concurrency was a common phenomenon in their township. The most commonly cited reasons for participating in concurrent partnerships were material and financial exchange or gain and sexual dissatisfaction with partners. Although participants believed that being in a concurrent relationship increases the risk of acquiring HIV, they did not believe this discourages many people from engaging in these behaviours. This study highlights that concurrency in this context may be a social norm that is resistant to change. The efficacy of current programmes aimed at reducing concurrency needs to be examined in this context. Our findings suggest that improving economic independence at the individual level and improving sexual satisfaction within partnerships may have some leverage for concurrency reduction. An alternative approach to strengthen combination HIV-prevention strategies could be to increase condom use with the additional/side partners, whose predominant role is often perceived in terms of sex, with messages centred on the notion that sex with additional partner(s) should not endanger the main partner.

  11. Family Ties and Young Fathers’ Engagement in Cape Town, South Africa

    PubMed Central

    Clark, Shelley; Cotton, Cassandra; Marteleto, Leticia J.

    2015-01-01

    Young South African fathers are often engaged in their children’s lives even if they do not live together. Using longitudinal data on children (n = 1,209) from the Cape Town area, the authors show that although only 26% of young fathers live with their children, 66% of nonresidential fathers maintain regular contact, and 61% provide financial support. The father–child relationship, however, is embedded in broader family ties. The type of father–mother relationship is strongly associated with whether fathers coreside with their children, but not with fathers’ contact with nonresidential children. Close mother and maternal grandmother bonds reduce the likelihood that fathers live with their children, whereas close ties between fathers and paternal grandmothers increase the chance that fathers visit nonresidential children. Family ties do not affect fathers’ financial contributions, which are driven by men’s current economic situation. These findings illustrate that father–child relationships are best understood in the context of interacting family systems. PMID:25774066

  12. Perceived vulnerability and HIV testing among youth in Cape Town, South Africa.

    PubMed

    Tenkorang, Eric Y

    2016-06-01

    The importance of perceived vulnerability to risk-reducing behaviors, including HIV testing, is fairly established, especially among youth in sub-Saharan Africa. Yet, the majority of studies that examined this important relationship used cross-sectional data that inherently assume that perceived vulnerability does not change. While these studies have been useful, the assumption of perceived vulnerability as time invariant is a major flaw and has largely limited the practical usefulness of this variable in AIDS prevention and programing. Using longitudinal data and applying random-effects logit models, this study makes a major contribution to scholarship by examining if changes in perceived vulnerability associate with a change to test for HIV among 857 young people in Cape Town, South Africa. Results show that female youth who changed their risk perceptions were more likely to also change to test for HIV, but the effects were completely attenuated after controlling for theoretically relevant variables. No significant relationships were observed for males. Also, females who were virgins at wave 2 but had sex between waves were significantly more likely to have changed to test for HIV. Of most importance was that sexual behavior eliminated the effects of change in risk perceptions suggesting that a change in perception may have occurred as a result of changes in sexual behavior. AIDS prevention programs must pay particular attention to helping youth become aware of their vulnerability to HIV risks, especially as these have implications for risk-reducing behaviors, especially for females who are burdened.

  13. HIV Prevalence and Risk Factors Among Male Foreign Migrants in Cape Town, South Africa.

    PubMed

    Giorgio, Margaret; Townsend, Loraine; Zembe, Yanga; Cheyip, Mireille; Guttmacher, Sally; Carter, Rebecca; Mathews, Cathy

    2017-03-01

    While migration has been shown to be a risk factor for HIV, variation in HIV prevalence by subgroups of migrants needs further exploration. This paper documents the HIV prevalence and key characteristics among male foreign migrants in Cape Town, South Africa and the effectiveness of respondent-driven sampling (RDS) to recruit this population. Participants in this cross-sectional study completed a behavioral risk-factor questionnaire and provided a dried blood sample for HIV analysis. Overall HIV prevalence was estimated to be 8.7 % (CI 5.4-11.8) but varied dramatically by country of origin. After adjusting for country of origin, HIV sero-positivity was positively associated with older age (p = 0.001), completing high school (p = 0.025), not having enough money for food (p = 0.036), alcohol use (p = 0.049), and engaging in transactional sex (p = 0.022). RDS was successful in recruiting foreign migrant men. A better understanding of the timing of HIV acquisition is needed to design targeted interventions for migrant men.

  14. Estimating the age of fire in the Cape flora of South Africa from an orchid phylogeny

    PubMed Central

    Bytebier, Benny; Antonelli, Alexandre; Bellstedt, Dirk U.; Linder, H. Peter

    2011-01-01

    Fire may have been a crucial component in the evolution of the Cape flora of South Africa, a region characterized by outstanding levels of species richness and endemism. However, there is, to date, no critical assessment of the age of the modern fire regime in this biome. Here, we exploit the presence of two obligate post-fire flowering clades in the orchid genus Disa, in conjunction with a robust, well-sampled and dated molecular phylogeny, to estimate the age by which fire must have been present. Our results indicate that summer drought (winter rainfall), the fire regime and the fynbos vegetation are several million years older than currently suggested. Summer drought and the fynbos vegetation are estimated to date back to at least the Early Miocene (ca 19.5 Ma). The current fire regime may have been established during a period of global cooling that followed the mid-Miocene Climatic Optimum (ca 15 Ma), which led to the expansion of open habitats and increased aridification. The first appearance of Disa species in the grassland biome, as well as in the subalpine habitat, is in striking agreement with reliable geological and palaeontological evidence of the age of these ecosystems, thus corroborating the efficacy of our methods. These results change our understanding of the historical mechanisms underlying botanical evolution in southern Africa, and confirm the potential of using molecular phylogenies to date events for which other information is lacking or inconclusive. PMID:20685712

  15. Host specificity and co-speciation in avian haemosporidia in the Western Cape, South Africa.

    PubMed

    Okanga, Sharon; Cumming, Graeme S; Hockey, Philip A R; Nupen, Lisa; Peters, Jeffrey L

    2014-01-01

    Host and pathogen ecology are often closely linked, with evolutionary processes often leading to the development of host specificity traits in some pathogens. Host specificity may range from 'generalist', where pathogens infect any available competent host; to 'specialist', where pathogens repeatedly infect specific host species or families. Avian malaria ecology in the region remains largely unexplored, despite the presence of vulnerable endemic avian species. We analysed the expression of host specificity in avian haemosporidia, by applying a previously developed host specificity index to lineages isolated from wetland passerines in the Western Cape, South Africa. Parasite lineages were isolated using PCR and identified when possible using matching lineages deposited in GenBank and in MalAvi. Parasitic clades were constructed from phylogenetic trees consisting of Plasmodium and Haemoproteus lineages. Isolated lineages matched some strains of Plasmodium relictum, P. elongatum, Haemoproteus sylvae and H. lanii. Plasmodium lineages infected a wide range of hosts from several avian families in a generalist pattern of infection. Plasmodium spp. also exhibited an infection trend according to host abundance rather than host species. By contrast, Haemoproteus lineages were typically restricted to one or two host species or families, and displayed higher host fidelity than Plasmodium spp. The findings confirm that a range of host specificity traits are exhibited by avian haemosporidia in the region. The traits show the potential to not only impact infection prevalence within specific host species, but also to affect patterns of infection at the community level.

  16. Routine programmatic delivery of isoniazid preventive therapy to children in Cape Town, South Africa

    PubMed Central

    Hesseling, A. C.; Beyers, N.; Enarson, D. A.; Rusen, I. D.; Lombard, C.; van Wyk, S. S.

    2013-01-01

    Setting: Fourteen primary health care facilities in Cape Town, South Africa. Objective: To determine the proportion and characteristics of infectious adult tuberculosis (TB) cases that identify children aged <5 years who qualify for isoniazid preventive therapy (IPT), and to determine the proportion of children who initiate and complete IPT. Design: A retrospective clinical record review conducted as a stratified cluster survey. Results: Of 1179 records of infectious adult cases, 33.3% had no documentation of contacts. Of the remaining 786 records, 525 contacts aged <5 years were identified, representing 0.7 child contacts per infectious adult case. Older age, male, human immunodeficiency virus (HIV) positive, smear-negative and retreatment TB cases were all associated with no documentation of contacts. Of the 525 child contacts identified, less than half were screened for TB, 141 initiated IPT and 19 completed it. Conclusion: Less than 67% of infectious TB case records had documentation of contacts. Younger, female, HIV-negative and new smear-positive TB cases were more likely to have had contacts identified. Less than 14% of children already initiated on IPT completed 6 months of treatment. PMID:26393029

  17. Host Specificity And Co-Speciation In Avian Haemosporidia In The Western Cape, South Africa

    PubMed Central

    Okanga, Sharon; Cumming, Graeme S.; Hockey, Philip A. R.; Nupen, Lisa; Peters, Jeffrey L.

    2014-01-01

    Host and pathogen ecology are often closely linked, with evolutionary processes often leading to the development of host specificity traits in some pathogens. Host specificity may range from ‘generalist’, where pathogens infect any available competent host; to ‘specialist’, where pathogens repeatedly infect specific host species or families. Avian malaria ecology in the region remains largely unexplored, despite the presence of vulnerable endemic avian species. We analysed the expression of host specificity in avian haemosporidia, by applying a previously developed host specificity index to lineages isolated from wetland passerines in the Western Cape, South Africa. Parasite lineages were isolated using PCR and identified when possible using matching lineages deposited in GenBank and in MalAvi. Parasitic clades were constructed from phylogenetic trees consisting of Plasmodium and Haemoproteus lineages. Isolated lineages matched some strains of Plasmodium relictum, P. elongatum, Haemoproteus sylvae and H. lanii. Plasmodium lineages infected a wide range of hosts from several avian families in a generalist pattern of infection. Plasmodium spp. also exhibited an infection trend according to host abundance rather than host species. By contrast, Haemoproteus lineages were typically restricted to one or two host species or families, and displayed higher host fidelity than Plasmodium spp. The findings confirm that a range of host specificity traits are exhibited by avian haemosporidia in the region. The traits show the potential to not only impact infection prevalence within specific host species, but also to affect patterns of infection at the community level. PMID:24498273

  18. Urban catchment management in a developing country: the Lotus River project, Cape Town, South Africa.

    PubMed

    Grobicki, A M

    2001-01-01

    This paper describes a 2-year pilot project undertaken in an urban catchment in Cape Town, South Africa. The impermeable area of the Lotus River catchment has doubled over 15 years, from 17% in 1983 to 34% in 1997. Following the abolition of urban influx control in 1990, informal settlements in the catchment grew rapidly and now house about 90,000 out of the catchment's total population of 380,000 people. The informal areas are still largely unserviced, despite a commitment from local government to speed up service delivery to the poorest areas of the city. Within the Lotus River project, hydrological and ecological assessments of the urban watercourses were undertaken, through physico-chemical and microbiological sampling programmes, macro-invertebrate counts, and vegetation sampling. All available information regarding the catchment was integrated within a GIS platform, including demographic and socio-economic data on the various communities, and hydrogeological information on the underlying aquifer obtained from earlier studies. The integrated nature of the project allows a number of conclusions and recommendations to be drawn, regarding the management of this particular catchment. However, important general lessons have also been learned which can be applied by local authorities responsible for urban catchments in developing countries. The necessity of providing the required institutional structures cannot be overemphasised.

  19. Cervical HPV Natural History Among Young Western Cape, South African Women: The Randomized Control EVRI Trial

    PubMed Central

    Sudenga, Staci L.; Torres, B. Nelson; Botha, Matthys H.; Zeier, Michele; Abrahamsen, Martha E.; Glashoff, Richard H.; Engelbrecht, Susan; der Loeff, Maarten F. Schim Van; der Laan, Louvina E. Van; Kipping, Siegfried; Taylor, Douglas; Giuliano, Anna R.

    2015-01-01

    Objective The objective of this analysis was to assess human papillomavirus (HPV) infection persistence and incidence 7-months post-enrollment by HPV vaccine study arm (vaccine or placebo). Methods HIV-negative, sexually active women aged 16-24 years in the Western Cape, South Africa, were enrolled in the EVRI Trial and were randomized to receive 4-valent HPV vaccine or placebo. Cervical specimens were collected at enrollment and at the 7-month visit and were genotyped for HPV. HPV prevalence, persistence, and incidence were calculated. Prevalence ratios and odds ratios were calculated to assess factors associated with a prevalent and incident HPV infection. Results HPV incidence rates were marginally higher for the placebo group (n=163) compared to the vaccine group (n=169). A large proportion of the prevalent high risk (HR-HPV) HPV types (49%) persisted over the 7-month period in both arms. Prevalent HR-HPV infection was significantly associated with a prevalent gonorrhea infection and detection of Herpes simplex type 2 antibodies. Incident HR-HPV infection was significantly associated with abnormal cervical cytology at enrollment and younger age. Conclusions Women living in geographic areas, such as southern Africa, at high-risk for HPV need to receive HPV vaccination at a very young age to maximally prevent infection and subsequent disease. PMID:26476151

  20. Farmers' perceptions of goat kid mortality under communal farming in Eastern Cape, South Africa.

    PubMed

    Slayi, Mhlangabezi; Maphosa, Viola; Fayemi, Olutope Peter; Mapfumo, Lizwell

    2014-10-01

    Rearing of goats under communal farming conditions is characterised by high kid mortality and low weaning percentages. A survey was conducted to determine farmers' perceptions on the causes of kid mortality during summer under the communal farming system in Nkonkobe Local Municipality in the Eastern Cape, South Africa. This was done by administering questionnaires to a total of 162 respondents in 14 villages around Nkonkobe Local Municipality. The study showed that majority of farmers (75 %) keep flock sizes of less than 10 goats and kids, and this indicates that goat production in Nkonkobe Local Municipality is suppressed. According to the farmers, diseases (89 %), endo-parasites (72 %) and ecto-parasites (68 %) were perceived as the major causes of kid mortality. Other causes reported include starvation (15 %), extreme weather conditions (28 %), abortion (7 %), theft (35 %), diarrhoea (43 %), accidents (10 %) and wounds (9 %). The low number of goats could be attributed to high mortalities. It was also found that all causes reported by farmers played a role in high kid mortality in Nkonkobe Local Municipality. However, the causes which require more emphasis to formulate extension support were tick-borne diseases and parasites. This study provided baseline information on possible causes of kid mortalities in Nkonkobe Local Municipality. There is, however, a need to conduct further studies to determine actual causes of high kid mortalities so as to develop preventive strategies that would minimize kid mortality for good economic returns.

  1. Estimating the age of fire in the Cape flora of South Africa from an orchid phylogeny.

    PubMed

    Bytebier, Benny; Antonelli, Alexandre; Bellstedt, Dirk U; Linder, H Peter

    2011-01-22

    Fire may have been a crucial component in the evolution of the Cape flora of South Africa, a region characterized by outstanding levels of species richness and endemism. However, there is, to date, no critical assessment of the age of the modern fire regime in this biome. Here, we exploit the presence of two obligate post-fire flowering clades in the orchid genus Disa, in conjunction with a robust, well-sampled and dated molecular phylogeny, to estimate the age by which fire must have been present. Our results indicate that summer drought (winter rainfall), the fire regime and the fynbos vegetation are several million years older than currently suggested. Summer drought and the fynbos vegetation are estimated to date back to at least the Early Miocene (ca 19.5 Ma). The current fire regime may have been established during a period of global cooling that followed the mid-Miocene Climatic Optimum (ca 15 Ma), which led to the expansion of open habitats and increased aridification. The first appearance of Disa species in the grassland biome, as well as in the subalpine habitat, is in striking agreement with reliable geological and palaeontological evidence of the age of these ecosystems, thus corroborating the efficacy of our methods. These results change our understanding of the historical mechanisms underlying botanical evolution in southern Africa, and confirm the potential of using molecular phylogenies to date events for which other information is lacking or inconclusive.

  2. Intentional injury and violence in Cape Town, South Africa: an epidemiological analysis of trauma admissions data

    PubMed Central

    Schuurman, Nadine; Cinnamon, Jonathan; Walker, Blake Byron; Fawcett, Vanessa; Nicol, Andrew; Hameed, Syed Morad; Matzopoulos, Richard

    2015-01-01

    Background Injury is a truly global health issue that has enormous societal and economic consequences in all countries. Interpersonal violence is now widely recognized as important global public health issues that can be addressed through evidence-based interventions. In South Africa, as in many low- and middle-income countries (LMIC), a lack of ongoing, systematic injury surveillance has limited the ability to characterize the burden of violence-related injury and to develop prevention programmes. Objective To describe the profile of trauma presenting to the trauma centre of Groote Schuur Hospital in Cape Town, South Africa – relating to interpersonal violence, using data collected from a newly implemented surveillance system. Particular emphasis was placed on temporal aspects of injury epidemiology, as well as age and sex differentiation. Design Data were collected prospectively using a standardized trauma admissions form for all patients presenting to the trauma centre. An epidemiological analysis was conducted on 16 months of data collected from June 2010 to October 2011. Results A total of 8445 patients were included in the analysis, in which the majority were violence-related. Specifically, 35% of records included violent trauma and, of those, 75% of victims were male. There was a clear temporal pattern: a greater proportion of intentional injuries occur during the night, while unintentional injury peaks late in the afternoon. In total, two-third of all intentional trauma is inflicted on the weekends, as is 60% of unintentional trauma. Where alcohol was recorded in the record, 72% of cases involved intentional injury. Sex was again a key factor as over 80% of all records involving alcohol or substance abuse were associated with males. The findings highlighted the association between violence, young males, substance use, and weekends. Conclusions This study provides the basis for evidence-based interventions to reduce the burden of intentional injury

  3. Intentional injury and violence in Cape Town, South Africa: an epidemiological analysis of trauma admissions data.

    PubMed

    Schuurman, Nadine; Cinnamon, Jonathan; Walker, Blake Byron; Fawcett, Vanessa; Nicol, Andrew; Hameed, Syed Morad; Matzopoulos, Richard

    2015-01-01

    Background Injury is a truly global health issue that has enormous societal and economic consequences in all countries. Interpersonal violence is now widely recognized as important global public health issues that can be addressed through evidence-based interventions. In South Africa, as in many low- and middle-income countries (LMIC), a lack of ongoing, systematic injury surveillance has limited the ability to characterize the burden of violence-related injury and to develop prevention programmes. Objective To describe the profile of trauma presenting to the trauma centre of Groote Schuur Hospital in Cape Town, South Africa - relating to interpersonal violence, using data collected from a newly implemented surveillance system. Particular emphasis was placed on temporal aspects of injury epidemiology, as well as age and sex differentiation. Design Data were collected prospectively using a standardized trauma admissions form for all patients presenting to the trauma centre. An epidemiological analysis was conducted on 16 months of data collected from June 2010 to October 2011. Results A total of 8445 patients were included in the analysis, in which the majority were violence-related. Specifically, 35% of records included violent trauma and, of those, 75% of victims were male. There was a clear temporal pattern: a greater proportion of intentional injuries occur during the night, while unintentional injury peaks late in the afternoon. In total, two-third of all intentional trauma is inflicted on the weekends, as is 60% of unintentional trauma. Where alcohol was recorded in the record, 72% of cases involved intentional injury. Sex was again a key factor as over 80% of all records involving alcohol or substance abuse were associated with males. The findings highlighted the association between violence, young males, substance use, and weekends. Conclusions This study provides the basis for evidence-based interventions to reduce the burden of intentional injury

  4. Developing a Strategic Approach to Social Responsiveness at the University of Cape Town, South Africa

    ERIC Educational Resources Information Center

    Favish, Judith; McMillan, Janice; Ngcelwane, Sonwabo V.

    2012-01-01

    Collaborative community-engaged scholarship has roots in many parts of the world, and engaged practitioners and researchers are increasingly finding each other and sharing resources globally. This article focuses on a "social responsiveness" initiative at the University of Cape Town. Its story, told here by three University of Cape Town…

  5. Nitrogen deposition in a southern hemisphere biodiversity hotspot within and surrounding Cape Town, South Africa

    NASA Astrophysics Data System (ADS)

    Angstmann, J. L.; Hall, S.; February, E.; West, A. G.; Allsopp, N.; Bond, W.

    2011-12-01

    Anthropogenic nitrogen (N) emissions have increased dramatically since the agricultural and industrial revolutions leading to N deposition in the northern hemisphere that is estimated to be an order of magnitude greater than preindustrial fluxes. N deposition rates of 5-15 kg N ha-1 yr-1 in Europe and N. America decrease plant species diversity, increase invasive species, and lead to eutrophication of surface waters. The southern hemisphere is home to over 50% of the world's biodiversity hotspots, including the 90,000 km2 Cape Floristic Region which houses 9,030 vascular plant species, 69% of which are endemic. However, to date, N deposition rates in the southern hemisphere are highly uncertain, with global models of N deposition based upon sparse datasets at best. Many terrestrial systems, such as fynbos shrublands, are adapted to low N availability and exhibit high species diversity and endemism, rendering them susceptible to ecological changes from N deposition. In this research, we quantified the spatial and temporal distribution of wet and dry N deposition across 30 protected fynbos ecosystems within the urban airshed of Cape Town, South Africa. We predicted that 1) total inorganic N deposition varies predictably along the urban-rural gradient (highest near the city centre), 2) N deposition varies seasonally, with higher fluxes in the winter months when atmospheric stability causes a build-up of N gases in and around the city, and 3) total inorganic N deposition will exceed the critical load of 10-15 kg N ha-1 yr-1 for Mediterranean shrublands, past which negative ecosystem effects have been shown to occur. Estimates of N deposition based on NO2 concentrations within the city suggest that total N deposition ranges from 8-13 kg N ha-1 yr-1 . However, we show that N deposition measured by ion-exchange resin collectors is far less than expected, averaging less than 2 kg N ha-1 yr-1 (range 0.5 - 5.5 kg N ha-1 yr-1 ), and is is dominated by NO3-, suggesting

  6. Coital frequency and condom use in monogamous and concurrent sexual relationships in Cape Town, South Africa

    PubMed Central

    Delva, Wim; Meng, Fei; Beauclair, Roxanne; Deprez, Nele; Temmerman, Marleen; Welte, Alex; Hens, Niel

    2013-01-01

    Introduction A decreased frequency of unprotected sex during episodes of concurrent relationships may dramatically reduce the role of concurrency in accelerating the spread of HIV. Such a decrease could be the result of coital dilution – the reduction in per-partner coital frequency from additional partners – and/or increased condom use during concurrency. To study the effect of concurrency on the frequency of unprotected sex, we examined sexual behaviour data from three communities with high HIV prevalence around Cape Town, South Africa. Methods We conducted a cross-sectional survey from June 2011 to February 2012 using audio computer-assisted self-interviewing to reconstruct one-year sexual histories, with a focus on coital frequency and condom use. Participants were randomly sampled from a previous TB and HIV prevalence survey. Mixed effects logistic and Poisson regression models were fitted to data from 527 sexually active adults reporting on 1210 relationship episodes to evaluate the effect of concurrency status on consistent condom use and coital frequency. Results The median of the per-partner weekly average coital frequency was 2 (IQR: 1–3), and consistent condom use was reported for 36% of the relationship episodes. Neither per-partner coital frequency nor consistent condom use changed significantly during episodes of concurrency (aIRR=1.05; 95% confidence interval (CI): 0.99–1.24 and aOR=1.01; 95% CI: 0.38–2.68, respectively). Being male, coloured, having a tertiary education, and having a relationship between 2 weeks and 9 months were associated with higher coital frequencies. Being coloured, and having a relationship lasting for more than 9 months, was associated with inconsistent condom use. Conclusions We found no evidence for coital dilution or for increased condom use during concurrent relationship episodes in three communities around Cape Town with high HIV prevalence. Given the low levels of self-reported consistent condom use, our

  7. Molecular detection of zoonotic tick-borne pathogens from ticks collected from ruminants in four South African provinces

    PubMed Central

    MTSHALI, Khethiwe; KHUMALO, Zamantungwa T. H.; NAKAO, Ryo; GRAB, Dennis J.; SUGIMOTO, Chihiro; THEKISOE, Oriel M. M.

    2015-01-01

    Ticks carry and transmit a remarkable array of pathogens including bacteria, protozoa and viruses, which may be of veterinary and/or of medical significance. With little to no information regarding the presence of tick-borne zoonotic pathogens or their known vectors in southern Africa, the aim of our study was to screen for Anaplasma phagocytophilum, Borrelia burgdorferi, Coxiella burnetii, Rickettsia species and Ehrlichia ruminantium in ticks collected and identified from ruminants in the Eastern Cape, Free State, KwaZulu-Natal and Mpumalanga Provinces of South Africa. The most abundant tick species identified in this study were Rhipicephalus evertsi evertsi (40%), Rhipicephalus species (35%), Amblyomma hebraeum (10%) and Rhipicephalus decoloratus (14%). A total of 1634 ticks were collected. DNA was extracted, and samples were subjected to PCR amplification and sequencing. The overall infection rates of ticks with the target pathogens in the four Provinces were as follows: A. phagocytophilum, 7%; C. burnetii, 7%; E. ruminantium, 28%; and Rickettsia spp., 27%. The presence of B. burgdorferi could not be confirmed. The findings of this study show that zoonotic pathogens are present in ticks in the studied South African provinces. This information will aid in the epidemiology of tick-borne zoonotic diseases in the country as well as in raising awareness about such diseases in the veterinary, medical and tourism sectors, as they may be the most affected. PMID:26227797

  8. Molecular detection of zoonotic tick-borne pathogens from ticks collected from ruminants in four South African provinces.

    PubMed

    Mtshali, Khethiwe; Khumalo, Zth; Nakao, Ryo; Grab, Dennis J; Sugimoto, Chihiro; Thekisoe, Omm

    2016-01-01

    Ticks carry and transmit a remarkable array of pathogens including bacteria, protozoa and viruses, which may be of veterinary and/or of medical significance. With little to no information regarding the presence of tick-borne zoonotic pathogens or their known vectors in southern Africa, the aim of our study was to screen for Anaplasma phagocytophilum, Borrelia burgdorferi, Coxiella burnetii, Rickettsia species and Ehrlichia ruminantium in ticks collected and identified from ruminants in the Eastern Cape, Free State, KwaZulu-Natal and Mpumalanga Provinces of South Africa. The most abundant tick species identified in this study were Rhipicephalus evertsi evertsi (40%), Rhipicephalus species (35%), Amblyomma hebraeum (10%) and Rhipicephalus decoloratus (14%). A total of 1634 ticks were collected. DNA was extracted, and samples were subjected to PCR amplification and sequencing. The overall infection rates of ticks with the target pathogens in the four Provinces were as follows: A. phagocytophilum, 7%; C. burnetii, 7%; E. ruminantium, 28%; and Rickettsia spp., 27%. The presence of B. burgdorferi could not be confirmed. The findings of this study show that zoonotic pathogens are present in ticks in the studied South African provinces. This information will aid in the epidemiology of tick-borne zoonotic diseases in the country as well as in raising awareness about such diseases in the veterinary, medical and tourism sectors, as they may be the most affected.

  9. Stigma, Culture, and HIV and AIDS in the Western Cape, South Africa: An Application of the PEN-3 Cultural Model for Community-Based Research

    PubMed Central

    Airhihenbuwa, Collins; Okoror, Titilayo; Shefer, Tammy; Brown, Darigg; Iwelunmor, Juliet; Smith, Ed; Adam, Mohamed; Simbayi, Leickness; Zungu, Nompumelelo; Dlakulu, Regina; Shisana, Olive

    2012-01-01

    HIV- and AIDS-related stigma has been reported to be a major factor contributing to the spread of HIV. In this study, the authors explore the meaning of stigma and its impact on HIV and AIDS in South African families and health care centers. They conducted focus group and key informant interviews among African and Colored populations in Khayelitsha, Gugulethu, and Mitchell’s Plain in the Western Cape province. The audio-recorded interviews were transcribed and coded using NVivo. Using the PEN-3 cultural model, the authors analyzed results showing that participants’ shared experiences ranged from positive/nonstigmatizing, to existential/unique to the contexts, to negative/stigmatizing. Families and health care centers were found to have both positive nonstigmatizing values and negative stigmatizing characteristics in addressing HIV/AIDS-related stigma. The authors conclude that a culture-centered analysis, relative to identity, is central to understanding the nature and contexts of HIV/AIDS-related stigma in South Africa. PMID:22505784

  10. Psoralea margaretiflora (Psoraleeae, Fabaceae): A new species from the Sneeuberg Centre of Floristic Endemism, Eastern Cape, South Africa

    PubMed Central

    Stirton, Charles H.; Clark, V. Ralph; Barker, Nigel P.; Muasya, A. Muthama

    2011-01-01

    Abstract A new species of Psoralea is described. Psoralea margaretiflora C.H. Stirton & V.R. Clark is endemic to the Sneeuberg Centre of Floristic Endemism, Eastern Cape, South Africa. This resprouter is characterised by its small greenish-white flowers with a small trifid purple nectar patch and translucent veins; 5(–7)-pinnate leaflets; multi-branching erect short seasonal flowering shoots; and tall habit of many stiff bare stems with the seasonal shoots massed at the apex. It is most similar to Psoralea oligophylla Eckl. & Zeyh., a widespread species found in the Eastern Cape. The reseeder Psoralea oligophylla differs in its lax virgate spreading habit with numerous long glaucous seasonal shoots; single stem, 1(–3)- glaucous leaflets; more numerous white flowers; and standard petals with a purple ring surrounding a bright yellow nectar patch. PMID:22171191

  11. Psoralea margaretiflora (Psoraleeae, Fabaceae): A new species from the Sneeuberg Centre of Floristic Endemism, Eastern Cape, South Africa.

    PubMed

    Stirton, Charles H; Clark, V Ralph; Barker, Nigel P; Muasya, A Muthama

    2011-01-01

    A new species of Psoralea is described. Psoralea margaretiflora C.H. Stirton & V.R. Clark is endemic to the Sneeuberg Centre of Floristic Endemism, Eastern Cape, South Africa. This resprouter is characterised by its small greenish-white flowers with a small trifid purple nectar patch and translucent veins; 5(-7)-pinnate leaflets; multi-branching erect short seasonal flowering shoots; and tall habit of many stiff bare stems with the seasonal shoots massed at the apex. It is most similar to Psoralea oligophylla Eckl. & Zeyh., a widespread species found in the Eastern Cape. The reseeder Psoralea oligophylla differs in its lax virgate spreading habit with numerous long glaucous seasonal shoots; single stem, 1(-3)- glaucous leaflets; more numerous white flowers; and standard petals with a purple ring surrounding a bright yellow nectar patch.

  12. Occurrence of blood parasites in seabirds admitted for rehabilitation in the Western Cape, South Africa, 2001-2013.

    PubMed

    Parsons, N J; Voogt, N M; Schaefer, A M; Peirce, M A; Vanstreels, R E T

    2017-01-15

    Blood parasites are generally uncommon in seabirds, and knowledge on their epidemiology is further limited by the fact that they often inhabit remote locations that are logistically difficult or expensive to study. We present a long term data set of blood smear examinations of 1909 seabirds belonging to 27 species that were admitted to a rehabilitation centre in Cape Town (Western Cape, South Africa) between 2001 and 2013. Blood parasites were detected in 59% of species (16/27) and 29% of individuals examined (551/1909). The following blood parasites were recorded: Babesia ugwidiensis, Babesia peircei, Babesia sp., Plasmodium sp., Leucocytozoon ugwidi, Hepatozoon albatrossi, Haemoproteus skuae and Spirochaetales. Several of the records are novel host-parasite associations, demonstrating the potential of rehabilitation centres for parasite and disease surveillance, particularly for species infrequently sampled from which no host-specific parasites have been described.

  13. Assessment of the impact of family physicians in the district health system of the Western Cape, South Africa

    PubMed Central

    Mash, Bob; Naledi, Tracey

    2014-01-01

    Background: In 2007, South Africa made family medicine a new speciality. Family physicians that have trained for this new speciality have been employed in the district health system since 2011. The aim of the present study was to explore the perceptions of district managers on the impact of family physicians on clinical processes, health system performance and health outcomes in the district health system (DHS) of the Western Cape. Methods: Nine in-depth interviews were performed: seven with district managers and two with the chief directors of the metropolitan and rural DHS. Interviews were recorded, transcribed and analysed using the ATLAS-ti and the framework method. Results: There was a positive impact on clinical processes for HIV/AIDS, TB, trauma, non-communicable chronic diseases, mental health, maternal and child health. Health system performance was positively impacted in terms of access, coordination, comprehensiveness and efficiency. An impact on health outcomes was anticipated. The impact was not uniform throughout the province due to different numbers of family physicians and different abilities to function optimally. There was also a perception that the positive impact attributed to family physicians was in the early stages of development. Unanticipated effects included concerns with their roles in management and training of students, as well as tensions with career medical officers. Conclusion: Early feedback from district managers suggests that where family physicians are employed and able to function optimally, they are making a significant impact on health system performance and the quality of clinical processes. In the longer term, this is likely to impact on health outcomes. Evaluation de l'impact des médecins de famille dans le système de santé du district du Western Cape, en Afrique du Sud. Contexte: En 2007, l'Afrique du Sud a institué une nouvelle spécialité, la médecine de famille. Les médecins de famille qui se sont sp

  14. Climatic controls on ecosystem resilience: Postfire regeneration in the Cape Floristic Region of South Africa.

    PubMed

    Wilson, Adam M; Latimer, Andrew M; Silander, John A

    2015-07-21

    Conservation of biodiversity and natural resources in a changing climate requires understanding what controls ecosystem resilience to disturbance. This understanding is especially important in the fire-prone Mediterranean systems of the world. The fire frequency in these systems is sensitive to climate, and recent climate change has resulted in more frequent fires over the last few decades. However, the sensitivity of postfire recovery and biomass/fuel load accumulation to climate is less well understood than fire frequency despite its importance in driving the fire regime. In this study, we develop a hierarchical statistical framework to model postfire ecosystem recovery using satellite-derived observations of vegetation as a function of stand age, topography, and climate. In the Cape Floristic Region (CFR) of South Africa, a fire-prone biodiversity hotspot, we found strong postfire recovery gradients associated with climate resulting in faster recovery in regions with higher soil fertility, minimum July (winter) temperature, and mean January (summer) precipitation. Projections using an ensemble of 11 downscaled Coupled Model Intercomparison Project Phase 5 (CMIP5) general circulation models (GCMs) suggest that warmer winter temperatures in 2080-2100 will encourage faster postfire recovery across the region, which could further increase fire frequency due to faster fuel accumulation. However, some models project decreasing precipitation in the western CFR, which would slow recovery rates there, likely reducing fire frequency through lack of fuel and potentially driving local biome shifts from fynbos shrubland to nonburning semidesert vegetation. This simple yet powerful approach to making inferences from large, remotely sensed datasets has potential for wide application to modeling ecosystem resilience in disturbance-prone ecosystems globally.

  15. Child pedestrian safety knowledge, behaviour and road injury in Cape Town, South Africa.

    PubMed

    Koekemoer, Karin; Van Gesselleen, Megan; Van Niekerk, Ashley; Govender, Rajen; Van As, Arjan Bastiaan

    2017-02-01

    Pedestrian injuries are a leading cause of death among South African children, and young children residing in low-income communities are more at risk, due to various factors such as inadequate road infrastructure, exposure to traffic due to reliance on walking as a means of transport, and lack of supervision. This study used a cross-sectional, non-randomized self-report survey to assess pedestrian safety knowledge, road-crossing behaviour and pedestrian injuries of primary school children in selected low-income settings in Cape Town. The survey focused on three primary schools that had joined the Safe Kids Worldwide Model School Zone Project and was administered to 536 children aged 6-15 years, in their home language of isiXhosa. Descriptive and bivariate analyses as well as multivariate regression analyses were conducted to investigate potential predictor variables for pedestrian collision severity and unsafe road-crossing behaviour. Walking was the sole form of travel for 81% of the children, with a large proportion regularly walking unsupervised. Children who walk to or from school alone were younger and reported riskier road-crossing behaviour, although children who walk accompanied tended to have higher pedestrian collision severity. "Negligent Behaviour" related to road-crossing was significantly associated with higher pedestrian collision severity, with predictors of "Negligent Behaviour" including the lack of pedestrian safety knowledge and greater exposure to traffic in terms of time spent walking. More than half of the reported pedestrian collisions involved a bicycle, and older boys (10-15 years) were most at risk of experiencing a severe pedestrian injury. The findings substantiate emerging evidence that children in low-income settings are at greater risk for child pedestrian injury, and emphasise the need for evidence-based safety promotion and injury prevention interventions in these settings.

  16. Climatic controls on ecosystem resilience: Postfire regeneration in the Cape Floristic Region of South Africa

    PubMed Central

    Wilson, Adam M.; Latimer, Andrew M.; Silander, John A.

    2015-01-01

    Conservation of biodiversity and natural resources in a changing climate requires understanding what controls ecosystem resilience to disturbance. This understanding is especially important in the fire-prone Mediterranean systems of the world. The fire frequency in these systems is sensitive to climate, and recent climate change has resulted in more frequent fires over the last few decades. However, the sensitivity of postfire recovery and biomass/fuel load accumulation to climate is less well understood than fire frequency despite its importance in driving the fire regime. In this study, we develop a hierarchical statistical framework to model postfire ecosystem recovery using satellite-derived observations of vegetation as a function of stand age, topography, and climate. In the Cape Floristic Region (CFR) of South Africa, a fire-prone biodiversity hotspot, we found strong postfire recovery gradients associated with climate resulting in faster recovery in regions with higher soil fertility, minimum July (winter) temperature, and mean January (summer) precipitation. Projections using an ensemble of 11 downscaled Coupled Model Intercomparison Project Phase 5 (CMIP5) general circulation models (GCMs) suggest that warmer winter temperatures in 2080–2100 will encourage faster postfire recovery across the region, which could further increase fire frequency due to faster fuel accumulation. However, some models project decreasing precipitation in the western CFR, which would slow recovery rates there, likely reducing fire frequency through lack of fuel and potentially driving local biome shifts from fynbos shrubland to nonburning semidesert vegetation. This simple yet powerful approach to making inferences from large, remotely sensed datasets has potential for wide application to modeling ecosystem resilience in disturbance-prone ecosystems globally. PMID:26150521

  17. Pricing landfill externalities: Emissions and disamenity costs in Cape Town, South Africa

    SciTech Connect

    Nahman, Anton

    2011-09-15

    Highlights: > The paper estimates landfill externalities associated with emissions, disamenities and transport. > Transport externalities vary from 24.22 to 31.42 Rands per tonne. > Costs of emissions (estimated using benefits transfer) vary from 0.07 to 28.91 Rands per tonne. > Disamenities (estimated using hedonic pricing) vary from 0.00 to 57.46 Rands per tonne. > Overall, external costs for urban landfills exceed those of a regional landfill. - Abstract: The external (environmental and social) costs of landfilling (e.g. emissions to air, soil and water; and 'disamenities' such as odours and pests) are difficult to quantify in monetary terms, and are therefore not generally reflected in waste disposal charges or taken into account in decision making regarding waste management options. This results in a bias against alternatives such as recycling, which may be more expensive than landfilling from a purely financial perspective, but preferable from an environmental and social perspective. There is therefore a need to quantify external costs in monetary terms, so that different disposal options can be compared on the basis of their overall costs to society (financial plus external costs). This study attempts to estimate the external costs of landfilling in the City of Cape Town for different scenarios, using the benefits transfer method (for emissions) and the hedonic pricing method (for disamenities). Both methods (in particular the process of transferring and adjusting estimates from one study site to another) are described in detail, allowing the procedures to be replicated elsewhere. The results show that external costs are currently R111 (in South African Rands, or approximately US$16) per tonne of waste, although these could decline under a scenario in which energy is recovered, or in which the existing urban landfills are replaced with a new regional landfill.

  18. Computer Applications in Information Systems. Proceedings of a Workshop (Cape Town, South Africa, November 26-27, 1985). Continuing Education Series Number 1.

    ERIC Educational Resources Information Center

    Bleimschein, Sue, Ed.

    Sixteen papers from a workshop on computer applications sponsored by the University of Cape Town (South Africa) School of Librarianship are presented in this volume: (1) "Introduction to the Use of Information Technology" (Sue Bleimschein); (2) "Searching Remote Databases" (Steve Rossouw); (3) "SABINET [South African Bibliographic and Information…

  19. The association between healed skeletal fractures indicative of interpersonal violence and alcoholic liver disease in a cadaver cohort from the Western Cape, South Africa.

    PubMed

    Geldenhuys, Elsje-Márie; Burger, Elsie H; Alblas, Amanda; Greyling, Linda M; Kotzé, Sanet H

    2016-05-01

    Interpersonal violence (IPV) and heavy alcohol consumption are major problems in the Western Cape Province of South Africa. Cranio-maxillofacial fractures, particularly nasal and zygomatic bone fractures, as well as isolated radial fractures (Colles fractures) and ulnar shaft fractures (parry fractures), are indicative of IPV, while alcoholic liver disease (ALD) is the consequence of chronic alcohol abuse. We therefore aim to investigate whether a significant association exists between the prevalence of cranio-maxillofacial fractures and parry fractures and ALD in a Western Cape population. Embalmed cadavers (n = 124) used for medical students' anatomy training at the Division of Anatomy and Histology, Faculty of Medicine and Health Sciences, Stellenbosch University were studied. The cadavers were dissected according to departmental protocol. The liver of each cadaver was investigated for macroscopic pathology lesions. Tissue samples were removed, processed to wax, and sectioned and stained with hematoxylin and eosin (H&E). All soft tissue was removed from the skulls, radii, and ulnae, which were then investigated for healed skeletal trauma. The results showed 37/124 (29.8%) cadavers had healed cranio-maxillofacial fractures and 24/124 (19.4%) cadavers had morphologic features of ALD. A total of 12/124 (9.7%) cadavers showed signs of both ALD and healed cranio-maxillofacial trauma. More males were affected than females, and left-sided facial fractures were statistically more common compared to the right side. This study illustrated a significant trend between alcohol abuse and cranio-maxillofacial fractures in individuals from communities with a low socio-economic status (SES) where IPV is a major problem.

  20. Anthropometric Measurements, Serum Reproductive Hormonal Levels and Sexual Development among Boys in the Rural Western Cape, South Africa

    PubMed Central

    Mao, Jun; Dalvie, Mohamed Aqiel

    2016-01-01

    Data on growth and sexual maturation among boys from the rural Western Cape in South Africa is limited. A cross-sectional study of 269 school boys was conducted testing for serum luteinizing hormone (LH), follicle stimulating hormone (FSH), testosterone, sex hormone binding globulin (SHBG) and estradiol (E2); height, weight and body mass index (BMI); sexual maturity (using Tanner Stages) and a questionnaire (demographic and medical history). The median age at pubertal onset (Tanner Stage 2) and Tanner Stage 5 was 11.6 and 14.7 years, respectively. The median testicular volume was 5.5 mL at Tanner Stage 2 increasing from 2.5 mL at Tanner Stage 1 to 14.7 mL at Tanner Stage 5. Height and weight measurements were <25th & 50th percentile references at Tanner Stages 1–3. Controlling for confounders, serum FSH and LH increased (p < 0.05) from Tanner Stage 1 to 4 (by 4.1 and 3 mL respectively), and serum testosterone and estradiol increased after Tanner Stage 2 (by 12.7 nmol/L and 59.5 pmol/L respectively). These results indicate some delays in pubertal development of boys in the rural Western Cape when compared to boys from other settings possibly due to nutritional, socio-economic and environmental exposures. Changes in serum hormone levels were consistent with other populations. Initiatives to improve nutrition amongst Western Cape rural communities are recommended. PMID:27916832

  1. Multichannel seismic profiles collected by the Teledyne Exploration Company in 1977 south of Cape Hatteras, North Carolina

    USGS Publications Warehouse

    Gilbert, Lewis E.; Dillon, William P.

    1981-01-01

    The U.S. Geological Survey (U.S.G.S.) collected approximately 3,700 km of multichannel-seismic reflection profiles (lines TD-1 – TD-6) south of Cape Hatteras on the continental margin (fig. 1). Those profiles were collected between August 15 and October 30, 1977, under U.S.G.S. contract number 14-08-0001-16209 by the Teledyne Exploration Company. The released data include copies of the original records, velocity scans, track charts, and field tapes.

  2. Knowledge about HIV and AIDS among Young South Africans in the Capricorn District, Limpopo Province

    ERIC Educational Resources Information Center

    Melwa, Irene T.; Oduntan, Olalekan A.

    2012-01-01

    Objective: To assess the basic knowledge about HIV and AIDS among young South Africans in the Capricorn District of Limpopo Province, South Africa. Design: A questionnaire-based cohort study, involving data collection from senior high school students. Setting: Randomly selected high schools in the Capricorn District, Limpopo Province, South…

  3. Cape of Good Hope

    Atmospheric Science Data Center

    2013-04-16

    article title:  Aerosol retrieval over Cape of Good Hope   ... Da image in the southern part of South Africa - the aerosol retrieval picks it up, and also the slightly clearer area in the middle. Also, ... MISR Science Teams Aug 23, 2000 - Aerosol retrieval over Cape of Good Hope. project:  MISR ...

  4. Methamphetamine Use and Sexual Risk Behavior among High School Students in Cape Town, South Africa

    ERIC Educational Resources Information Center

    Pluddemann, Andreas; Flisher, Alan J.; McKetin, Rebecca; Parry, Charles D.; Lombard, Carl J.

    2012-01-01

    Objective: To investigate whether methamphetamine use is associated with sexual risk behavior among adolescents. Method: A cross-sectional survey of 1,561 male and female high school students in Cape Town (mean age 14.9 years) was conducted using items from the Problem Oriented Screening Instrument for Teenagers (POSIT) HIV Risk Scale. Results:…

  5. Men (and women) as "sellers" of sex in alcohol-serving venues in Cape Town, South Africa.

    PubMed

    Pitpitan, Eileen V; Kalichman, Seth C; Eaton, Lisa A; Watt, Melissa H; Sikkema, Kathleen J; Skinner, Donald; Pieterse, Desiree; Cain, Demetria

    2014-06-01

    The relationship between transactional sex, HIV risk, and partner violence has been well documented in South Africa, but research has focused primarily on women and has not been conducted in high-risk social contexts. The aim of this study was to examine associations between transactional sex and HIV risk among women and men in alcohol-serving venues in Cape Town, South Africa. We surveyed 1,989 women and 2,468 men attending alcohol-serving venues in Cape Town, South Africa to assess transactional sex behavior (i.e., receiving money or goods in exchange for sex), alcohol and drug use, history of childhood abuse, current relationship violence, and sexual risk behaviors. Among both women and men, trading sex was related to higher alcohol use, greater likelihood of drug use, substance use in sexual contexts, and a greater likelihood of experiencing physical and sexual violence. Compared to other women, women who traded sex reported a greater proportion of condom-unprotected sex; this relationship was not found for men. Analyses showed that men were almost twice as more likely to report trading sex for items, including money or alcohol, than women (9.7 vs. 5.8 %). Overall, men who traded sex were similar to their female counterparts. Similar associations between trading sex and different risk behaviors were found among women and men with limited economic means and substance use problems. Future research should more closely study transactional sex in high-risk venues as it relates to violence and should examine men who trade sex as a potential bridge population between heterosexual women and men who have sex with men.

  6. An Investigation into the Impact of School Context on Achievement: A Situational Analysis of Five Western Cape Schools in South Africa

    ERIC Educational Resources Information Center

    Mushayikwa, Emmanuel

    2009-01-01

    The purpose of this study was to generate a snapshot profile of the teaching and learning environment in each of five schools in Cape Town, South Africa. The generated profile would in turn facilitate the identification of critical, localized and systemic factors that might be targeted by a whole school intervention programme to improve the…

  7. Complainants With Learning Disabilities In Sexual Abuse Cases: A 10-Year Review Of A Psycho-Legal Project In Cape Town, South Africa

    ERIC Educational Resources Information Center

    Dickman, Beverley Jo; Roux, Amanda Jane

    2005-01-01

    We describe a project established in 1990 to assist complainants with learning disabilities in sexual assault cases in Cape Town, South Africa. Complainants are prepared for court and psychologists advise investigating officers and prosecutors, and provide expert testimony. There has been an enormous increase in the utilization of the project by…

  8. Questioning the Pace and Pathway of E-Government Development in Africa: A Case Study of South Africa's Cape Gateway Project

    ERIC Educational Resources Information Center

    Maumbe, Blessing Mukabeta; Owei, Vesper; Alexander, Helen

    2008-01-01

    The paper examines e-government development in Africa. This study is based on the Cape Gateway project in South Africa, a leading e-government initiative on the continent. We observe that African countries have jumped on the e-government band wagon by looking mostly at the benefits without a clear risk assessment. We argue that African countries…

  9. Ecology and distribution of large branchiopods (Crustacea, Branchiopoda, Anostraca, Notostraca, Laevicaudata, Spinicaudata) of the Eastern Cape Karoo, South Africa

    PubMed Central

    Mabidi, Annah; Bird, Matthew S.; Perissinotto, Renzo; Rogers, D. Christopher

    2016-01-01

    Abstract A survey of the large branchiopod fauna of the Eastern Cape Karoo region of South Africa was undertaken to provide baseline biodiversity information in light of impending shale gas development activities in the region. Twenty-two waterbodies, including nine dams and thirteen natural depression wetlands, were sampled during November 2014 and April 2015. A total of 13 species belonging to four orders were collected, comprising five anostracans, one notostracan, six spinicaudatans and one laevicaudatan. Cyzicus australis was most common, occurring in 46% of the waterbodies. Species co-occurred in 87% of the waterbodies, with a maximum number of six species recorded from the same waterbody. Our new distribution records for Lynceus truncatus, Streptocephalus spinicaudatus and Streptocephalus indistinctus represent substantial expansions of the previously known ranges for these species. Tarkastad is now the westernmost record for Streptocephalus spinicaudatus, while Jansenville now constitutes the southernmost record for Streptocephalus indistinctus. Large branchiopod distribution data from previous Eastern Cape records were combined with our current data, demonstrating that a total of 23 large branchiopod species have been recorded from the region to date. As the Karoo is one of the few major shale basins in the world where the natural baseline is still largely intact, this survey forms a basis for future reference and surface water quality monitoring during the process of shale gas exploration/extraction. PMID:27853398

  10. Ecology and distribution of large branchiopods (Crustacea, Branchiopoda, Anostraca, Notostraca, Laevicaudata, Spinicaudata) of the Eastern Cape Karoo, South Africa.

    PubMed

    Mabidi, Annah; Bird, Matthew S; Perissinotto, Renzo; Rogers, D Christopher

    2016-01-01

    A survey of the large branchiopod fauna of the Eastern Cape Karoo region of South Africa was undertaken to provide baseline biodiversity information in light of impending shale gas development activities in the region. Twenty-two waterbodies, including nine dams and thirteen natural depression wetlands, were sampled during November 2014 and April 2015. A total of 13 species belonging to four orders were collected, comprising five anostracans, one notostracan, six spinicaudatans and one laevicaudatan. Cyzicus australis was most common, occurring in 46% of the waterbodies. Species co-occurred in 87% of the waterbodies, with a maximum number of six species recorded from the same waterbody. Our new distribution records for Lynceus truncatus, Streptocephalus spinicaudatus and Streptocephalus indistinctus represent substantial expansions of the previously known ranges for these species. Tarkastad is now the westernmost record for Streptocephalus spinicaudatus, while Jansenville now constitutes the southernmost record for Streptocephalus indistinctus. Large branchiopod distribution data from previous Eastern Cape records were combined with our current data, demonstrating that a total of 23 large branchiopod species have been recorded from the region to date. As the Karoo is one of the few major shale basins in the world where the natural baseline is still largely intact, this survey forms a basis for future reference and surface water quality monitoring during the process of shale gas exploration/extraction.

  11. Impact of Sexual Trauma on HIV Care Engagement: Perspectives of Female Patients with Trauma Histories in Cape Town, South Africa.

    PubMed

    Watt, Melissa H; Dennis, Alexis C; Choi, Karmel W; Ciya, Nonceba; Joska, John A; Robertson, Corne; Sikkema, Kathleen J

    2016-11-19

    South African women have disproportionately high rates of both sexual trauma and HIV. To understand how sexual trauma impacts HIV care engagement, we conducted in-depth qualitative interviews with 15 HIV-infected women with sexual trauma histories, recruited from a public clinic in Cape Town. Interviews explored trauma narratives, coping behaviors and care engagement, and transcripts were analyzed using a constant comparison method. Participants reported multiple and complex traumas across their lifetimes. Sexual trauma hindered HIV care engagement, especially immediately following HIV diagnosis, and there were indications that sexual trauma may interfere with future care engagement, via traumatic stress symptoms including avoidance. Disclosure of sexual trauma was limited; no women had disclosed to an HIV provider. Routine screening for sexual trauma in HIV care settings may help to identify individuals at risk of poor care engagement. Efficacious treatments are needed to address the psychological and behavioral sequelae of trauma.

  12. The Institution of a Standardized Investigation Protocol for Sudden Infant Death in the Eastern Metropole, Cape Town, South Africa(,)().

    PubMed

    Dempers, Johan J; Coldrey, Jean; Burger, Elsie H; Thompson, Vonita; Wadee, Shabbir A; Odendaal, Hein J; Sens, Mary Ann; Randall, Brad B; Folkerth, Rebecca D; Kinney, Hannah C

    2016-11-01

    The rate for the sudden infant death syndrome (SIDS) in Cape Town, South Africa, is estimated to be among the highest in the world (3.41/1000 live births). In several of these areas, including those of extreme poverty, only sporadic, nonstandardized infant autopsy, and death scene investigation (DSI) occurred. In this report, we detail a feasibility project comprising 18 autopsied infants with sudden and unexpected death whose causes of death were adjudicated according to the 1991 NICHD definitions (SIDS, n = 7; known cause of death, n = 7; and unclassified, n = 4). We instituted a standardized autopsy and infant DSI through a collaborative effort of local forensic pathology officers and clinical providers. The high standard of forensic investigation met international standards, identified preventable disease, and allowed for incorporation of research. We conclude that an effective infant autopsy and DSI protocol can be established in areas with both high sudden unexpected infant death, and elsewhere. (SUID)/SIDS risk and infrastructure challenges.

  13. "Taking care of business": alcohol as currency in transactional sexual relationships among players in Cape Town, South Africa.

    PubMed

    Townsend, Loraine; Ragnarsson, Anders; Mathews, Catherine; Johnston, Lisa Grazina; Ekström, Anna Mia; Thorson, Anna; Chopra, Mickey

    2011-01-01

    In this article we examine the dynamics of social relationships in which alcohol use and risky sexual behaviors cooccur. As part of a larger biological and behavioral HIV surveillance survey, 20 men who lived in an urban, informal settlement on the outskirts of Cape Town, South Africa participated in in-depth interviews. Interview transcripts were analyzed according to a latent content analysis. Findings highlight the latent association between alcohol and transactional sex, and enable an in-depth examination of the normative role that alcohol plays in the formation of casual sexual partnerships characterized by exchange. We build on an existing conceptual model that traces the potential pathways by which alcohol use and transactional sex are linked to sexual risk behaviors. The study findings point to the need for multilevel HIV risk-reduction interventions among men to reduce excessive alcohol use, risky sexual behaviors, and underlying perceptions of ideal masculinity.

  14. The influence of male circumcision for HIV prevention on sexual behaviour among traditionally circumcised men in Cape Town, South Africa.

    PubMed

    Eaton, L A; Cain, D N; Agrawal, A; Jooste, S; Udemans, N; Kalichman, S C

    2011-11-01

    We examined the relationship between HIV prevention beliefs related to male circumcision and sexual behaviour/sexually transmitted infection (STI) acquisition among traditionally circumcised men in Cape Town, South Africa. HIV-negative men (n = 304), circumcised for cultural/religious reasons, attending a health clinic in Cape Town, South Africa, completed cross-sectional surveys. Generalized linear models were used to analyse the relationships between unprotected vaginal sex acts, number of female sexual partners, STI diagnoses and male circumcision-related beliefs and risk perceptions. Men who were aware that circumcision offers protection against HIV (relative risk [RR] = 1.19, 95% confidence interval [CI] = 1.06-1.32, P < 0.01), endorsed risk compensation related to male circumcision (RR = 1.15, 95% CI = 1.11-1.12, P < 0.01) and perceived lower risk of HIV infection when circumcised (RR = 1.08, 95% CI = 1.04-1.12, P < 0.01) were more likely to report unprotected vaginal sex acts. Similar patterns were also identified when predicting number of female sexual partners. Men who were more likely to endorse risk compensation related to male circumcision were also more likely to be diagnosed with a chronic STI (odds ratio [OR] = 1.64, 95% CI = 1.06-2.53, P < 0.05). Our findings suggest that we must not overlook the effects of beliefs towards male circumcision for HIV prevention among men traditionally circumcised; doing so may undermine current efforts to reduce HIV transmission through male circumcision.

  15. Initial review and analysis of the direct environmental impacts of CSP in the northern Cape, South Africa

    NASA Astrophysics Data System (ADS)

    Rudman, Justine; Gauché, Paul; Esler, Karen J.

    2016-05-01

    The Integrated Resource Plan (IRP) of 2010 and the IRP Update provide the most recent guidance to the electricity generation future of South Africa (SA) and both plans include an increased proportion of renewable energy generation capacity. Given that SA has abundant renewable energy resource potential, this inclusion is welcome. Only 600 MW of the capacity allocated to concentrating solar power (CSP) has been committed to projects in the Northern Cape and represents roughly a fifth of the capacity that has been included in the IRP. Although CSP is particularly new in the electricity generation system of the country, the abundant solar resources of the region with annual DNI values of above 2900 kWh/m2 across the arid Savannah and Nama-Karoo biomes offer a promising future for the development of CSP in South Africa. These areas have largely been left untouched by technological development activities and thus renewable energy projects present a variety of possible direct and indirect environmental, social and economic impacts. Environmental Impact Assessments do focus on local impacts, but given that ecological processes often extend to regional- and landscape scales, understanding this scaled context is important to the alignment of development- and conservation priorities. Given the capacities allocated to CSP for the future of SA's electricity generation system, impacts on land, air, water and biodiversity which are associated with CSP are expected to increase in distribution and the understanding thereof deems valuable already from this early point in CSP's future in SA. We provide a review of direct impacts of CSP on the natural environment and an overview of the anticipated specific significance thereof in the Northern Cape.

  16. Health Systems Readiness to Manage the Hypertension Epidemic in Primary Health Care Facilities in the Western Cape, South Africa: A Study Protocol

    PubMed Central

    Yaya, Sanni; Labonté, Ronald

    2016-01-01

    the International Development Research Centre (IDRC). The study is currently in the data analysis phase and results are expected during the first half of 2016. Conclusions This investigation will highlight the detailed processes in place for the care of hypertensive patients in primary health care facilities, and thus also identify the challenges. It will also describe the drug supply chain management systems in place and identify their strengths and weaknesses. The findings, along with the estimates from modeling and simulation, will inform the health system minimum requirements to scale-up interventions to manage and control the hypertension epidemic in the Western Cape province of South Africa. PMID:26925539

  17. Gender-based violence, alcohol use, and sexual risk among female patrons of drinking venues in Cape Town, South Africa.

    PubMed

    Pitpitan, Eileen V; Kalichman, Seth C; Eaton, Lisa A; Cain, Demetria; Sikkema, Kathleen J; Skinner, Donald; Watt, Melissa H; Pieterse, Desiree

    2013-06-01

    Gender-based violence is a well-recognized risk factor for HIV infection among women. Alcohol use is associated with both gender-based violence and sexual risk behavior, but has not been examined as a correlate of both in a context of both high HIV risk and hazardous drinking. The purpose of this paper is to examine the association between recent abuse by a sex partner with alcohol and sexual risk behavior among female patrons of alcohol serving venues in South Africa. Specifically, the aim of this study is to determine whether sexual risk behaviors are associated with gender-based violence after controlling for levels of alcohol use. We surveyed 1,388 women attending informal drinking establishments in Cape Town, South Africa to assess recent history of gender-based violence, drinking, and sexual risk behaviors. Gender-based violence was associated with both drinking and sexual risk behaviors after controlling for demographics among the women. A hierarchical logistic regression analysis showed that after controlling for alcohol use sexual risk behavior remained significantly associated with gender-based violence, particularly with meeting a new sex partner at the bar, recent STI diagnosis, and engaging in transactional sex, but not protected intercourse or number of partners. In South Africa where heavy drinking is prevalent women may be at particular risk of physical abuse from intimate partners as well as higher sexual risk. Interventions that aim to reduce gender-based violence and sexual risk behaviors must directly work to reduce drinking behavior.

  18. HIV testing attitudes, AIDS stigma, and voluntary HIV counselling and testing in a black township in Cape Town, South Africa

    PubMed Central

    Kalichman, S; Simbayi, L

    2003-01-01

    Objectives: A cornerstone of HIV prevention in South Africa is voluntary HIV antibody counselling and testing (VCT), but only one in five South Africans aware of VCT have been tested. This study examined the relation between HIV testing history, attitudes towards testing, and AIDS stigmas. Methods: Men (n = 224) and women (n = 276) living in a black township in Cape Town completed venue intercept surveys; 98% were black, 74% age 35 or younger. Results: 47% of participants had been tested for HIV. Risks for exposure to HIV were high and comparable among people tested and not tested. Comparisons on attitudes toward VCT, controlling for demographics and survey venue, showed that individuals who had not been tested for HIV and those tested but who did not know their results held significantly more negative testing attitudes than individuals who were tested, particularly people who knew their test results. Compared to people who had been tested, individuals who were not tested for HIV demonstrated significantly greater AIDS related stigmas; ascribing greater shame, guilt, and social disapproval to people living with HIV. Knowing test results among those tested was not related to stigmatising beliefs. Conclusions: Efforts to promote VCT in South Africa require education about the benefits of testing and, perhaps more important, reductions in stigmatising attitudes towards people living with AIDS. Structural and social marketing interventions that aim to reduce AIDS stigmas will probably decrease resistance to seeking VCT. PMID:14663117

  19. Assessment of shale-gas resources of the Karoo Province, South Africa and Lesotho, Africa, 2016

    USGS Publications Warehouse

    Brownfield, Michael E.; Schenk, Christopher J.; Klett, Timothy R.; Pitman, Janet K.; Tennyson, Marilyn E.; Gaswirth, Stephanie B.; Le, Phuong A.; Leathers-Miller, Heidi M.; Mercier, Tracey J.; Finn, Thomas M.

    2016-07-08

    Using a geology-based assessment methodology, the U.S. Geological Survey estimated undiscovered, technically recoverable mean resource of 44.5 trillion cubic feet of shale gas in the Karoo Province of South Africa and Lesotho, Africa.

  20. Assessment of coalbed gas resources of the Central and South Sumatra Basin Provinces, Indonesia, 2016

    USGS Publications Warehouse

    Schenk, Christopher J.; Klett, Timothy R.; Tennyson, Marilyn E.; Mercier, Tracey J.; Brownfield, Michael E.; Pitman, Janet K.; Gaswirth, Stephanie B.; Finn, Thomas M.

    2016-12-09

    Using a geology-based assessment methodology, the U.S. Geological Survey estimated a mean of 20 trillion cubic feet of undiscovered, technically recoverable coalbed gas resource in the Central and South Sumatra Basin Provinces of Indonesia.

  1. IT Implementation in ITE in the Limpopo Province (South Africa): A Dream or Reality?

    ERIC Educational Resources Information Center

    Monobe, Ratau John

    2011-01-01

    This paper describes the results of a survey about the most critical issues facing the implementation of IT (information technology) ITE (initial teacher education) in all the HBUs (historically black universities) in the Limpopo Province of South Africa. Over 250 responses were received and both universities in the Limpopo Province were…

  2. Genome-wide analysis of the structure of the South African Coloured Population in the Western Cape.

    PubMed

    de Wit, Erika; Delport, Wayne; Rugamika, Chimusa E; Meintjes, Ayton; Möller, Marlo; van Helden, Paul D; Seoighe, Cathal; Hoal, Eileen G

    2010-08-01

    Admixed populations present unique opportunities to discover the genetic factors underlying many multifactorial diseases. The geographical position and complex history of South Africa has led to the establishment of the unique admixed population known as the South African Coloured. Not much is known about the genetic make-up of this population, and the historical record is patchy. We genotyped 959 individuals from the Western Cape area, self-identified as belonging to this population, using the Affymetrix 500k genotyping platform. This resulted in nearly 75,000 autosomal SNPs that could be compared with populations represented in the International HapMap Project and the Human Genome Diversity Project. Analysis by means of both the admixture and linkage models in STRUCTURE revealed that the major ancestral components of this population are predominantly Khoesan (32-43%), Bantu-speaking Africans (20-36%), European (21-28%) and a smaller Asian contribution (9-11%), depending on the model used. This is consistent with historical data. While of great historical and genealogical interest, this information is also essential for future admixture mapping of disease genes in this population.

  3. "Nothing Is Free": A Qualitative Study of Sex Trading Among Methamphetamine Users in Cape Town, South Africa.

    PubMed

    Watt, Melissa H; Kimani, Stephen M; Skinner, Donald; Meade, Christina S

    2016-05-01

    South Africa is facing an established epidemic of methamphetamine, known locally as "tik." Globally, methamphetamine has been linked to high rates of sexual risk behaviors, including sex trading. The goal of this study was to qualitatively examine the experiences of sex trading among methamphetamine users in Cape Town, South Africa. Individual in-depth interviews were conducted with 30 active methamphetamine users (17 men and 13 women) recruited from the community. Interviews were conducted in local languages using a semi-structured guide that included questions on sex trading experiences and perceptions of sex trading among methamphetamine users. Interviews were audio-recorded, transcribed, and analyzed using analytic memos and coding with constant comparison techniques. The data revealed that in a setting of high levels of addiction and poverty, sex was an important commodity for acquiring methamphetamine. Women were more likely to use sex to acquire methamphetamine, but men reported opportunistic cases of trading sex for methamphetamine. Four models of sex trading emerged: negotiated exchange, implicit exchange, relationships based on resources, and facilitating sex exchange for others. The expectation of sex trading created a context in which sexual violence against female methamphetamine users was common. Multiple sexual partners and inconsistent condom use in acts of sex trading put methamphetamine users at high risk of HIV. Interventions in this setting should address addiction, which is the primary driver of sex trading among methamphetamine users. Harm reduction interventions may include education about HIV and other sexually transmitted infections, availability of condoms and HIV testing, and sexual violence prevention.

  4. Community perceptions of risk factors for interpersonal violence in townships in Cape Town, South Africa: A focus group study.

    PubMed

    Makanga, Prestige Tatenda; Schuurman, Nadine; Randall, Ellen

    2015-12-27

    Interpersonal violence is a major contributor to the burden of disease globally, and in South Africa, it is the leading cause of injury. There is an emerging consensus that the development of actionable policy and effective prevention strategies for interpersonal violence requires an understanding of the contextual matters that elevate risk for interpersonal violence. The objective of this study was to explore community perceptions of risks for interpersonal violence in five townships in Cape Town, South Africa, with high rates of violence. Focus group discussions were conducted with community members to identify key factors in that contributed to being either a perpetrator or victim of interpersonal violence. The ecological framework was used to classify the risk factors as occurring at individual, relationship, community or society levels. Some of the risk factors identified included alcohol abuse, poverty, informality of settlements and cultural norms. Differences in how each of these risk factors are expressed and experienced in the five communities are also elucidated. This approach enabled the collection of contextual community-based data that can complement conventional surveillance data in the development of relevant community-level strategies for interpersonal violence prevention.

  5. Afriflu2--second international workshop on influenza vaccination in the African continent--8 November 2012, Cape Town (South Africa).

    PubMed

    Schoub, Barry D; Gessner, Bradford D; Ampofo, William; Cohen, Adam L; Steffen, Christoph A

    2013-08-02

    The second meeting of the Afriflu conferences took place in Cape Town, South Africa, with over 60 participants from 15 countries in Africa and also outside the continent. Significant progress in surveillance has been made in better understanding the illness burden of influenza on the continent, which limited evidence suggests is greater than that in the developed world. In southern Africa HIV and TB coinfections play a major role in increasing hospitalisation and mortality, while elsewhere in Africa other cofactors still need to be determined. There is currently no indigenous vaccine production in sub-Saharan Africa and only one facility, based in South Africa, capable of filling imported bulk. Innovative vaccine strategies will need to be explored, such as maternal immunisation, and also the possibility of other influenza vaccine options, such as live attenuated influenza vaccine for young children. Sustained indigenous vaccine production is essential for the continent to have vaccine security in the event of a pandemic even though establishing local production faces considerable challenges especially ensuring adequate markets on the continent. There is an urgent need to develop effective communication messages for decision makers as well as healthcare workers addressing the importance of influenza even in the face of the major competing health burdens of the continent.

  6. Ambient Air Pollution Exposure and Respiratory, Cardiovascular and Cerebrovascular Mortality in Cape Town, South Africa: 2001–2006

    PubMed Central

    Wichmann, Janine; Voyi, Kuku

    2012-01-01

    Little evidence is available on the strength of the association between ambient air pollution exposure and health effects in developing countries such as South Africa. The association between the 24-h average ambient PM10, SO2 and NO2 levels and daily respiratory (RD), cardiovascular (CVD) and cerebrovascular (CBD) mortality in Cape Town (2001–2006) was investigated with a case-crossover design. For models that included entire year data, an inter-quartile range (IQR) increase in PM10 (12 mg/m3) and NO2 (12 mg/m3) significantly increased CBD mortality by 4% and 8%, respectively. A significant increase of 3% in CVD mortality was observed per IQR increase in NO2 and SO2 (8 mg/m3). In the warm period, PM10 was significantly associated with RD and CVD mortality. NO2 had significant associations with CBD, RD and CVD mortality, whilst SO2 was associated with CVD mortality. None of the pollutants were associated with any of the three outcomes in the cold period. Susceptible groups depended on the cause-specific mortality and air pollutant. There is significant RD, CVD and CBD mortality risk associated with ambient air pollution exposure in South Africa, higher than reported in developed countries. PMID:23202828

  7. Pressed flowers: notions of indigenous and alien vegetation in South Africa's Western Cape, c. 1902-1945.

    PubMed

    Pooley, Simon

    2010-01-01

    In the early twentieth century, botanists in South Africa's Western Cape sought urgently to popularise and protect the region's unique indigenous Fynbos flora. Plants imported from the 1840s, some of which proved invasive, became a physical and symbolic focus for their advocacy. The botanists' efforts resonated with political attempts to forge a common white South African national identity that drew on notions of landscape and the indigenous flora for symbolism and that consciously exploited the politically integrative potential of the new science of ecology. Introduced by overseas-trained experts, ecological theory was, however, inappropriate for the local flora, and had unfortunate consequences for the scientifically-informed research and management particularly of the fire-maintained Fynbos. While botanists and conservationists were united in defending the local flora against invasive introduced plants, they drew distinctions between what was 'indigenous' and what was 'natural' that further complicated their attitudes to the local flora. These historical debates illuminate agendas and policies on introduced ('alien') and indigenous flora in the region today.

  8. A qualitative exploration of HIV-positive pregnant women's decision-making regarding abortion in Cape Town, South Africa.

    PubMed

    Orner, Phyllis; de Bruyn, Maria; Harries, Jane; Cooper, Diane

    2010-08-01

    HIV-positive women's abortion decisions were explored by: (i) investigating influencing factors; (ii) determining knowledge of abortion policy and public health services; and (iii) exploring abortion experiences. In-depth interviews were held with 24 HIV-positive women (15 had an abortion; 9 did not), recruited at public health facilities in Cape Town, South Africa. Negative perceptions towards HIV-positive pregnant women were reported. Women wanted abortions due to socio-economic hardship in conjunction with HIV-positive status. Respondents were generally aware that women in South Africa had a right to free abortions in public health facilities. Both positive and negative abortion experiences were described. Respondents reported no discrimination by providers due to their HIV-positive status. Most respondents reported not using contraceptives, while describing their pregnancies as 'unexpected'. The majority of women who had abortions wanted to avoid another one, and would encourage other HIV-positive women to try to avoid abortion. However, most felt abortions were acceptable for HIV-positive women in some circumstances. Data suggested that stigma and discrimination affect connections between abortion, pregnancy and HIV/AIDS, and that abortion may be more stigmatised than HIV/AIDS. Study results provide important insights, and any revision of reproductive health policy, services, counselling for abortion and HIV/AIDS care should address these issues.

  9. Sensation seeking, alcohol use, and sexual behaviors among sexually transmitted infection clinic patients in Cape Town, South Africa.

    PubMed

    Kalichman, Seth C; Simbayi, Leickness C; Jooste, Sean; Cain, Demetria; Cherry, Charsey

    2006-09-01

    Alcohol use is associated with risks for HIV/AIDS. The association between alcohol and sexual risk may be accounted for by sensation seeking personality. However, sensation seeking in relation to substance use and HIV risk has not been examined in Africa. In this study, 292 men and 219 women receiving sexually transmitted infection (STI) diagnostic and treatment services in Cape Town, South Africa, completed anonymous behavioral surveys. Structural modeling was used to test a model of alcohol use and sensation seeking in relation to sexual risk behaviors. Results showed that sensation seeking and alcohol use in sexual contexts were related to HIV risks, controlling for gender and marital status. The association between sensation seeking and HIV risk was partly accounted for by alcohol use in proximity to sex. In contrast to studies conducted in the United States, sensation seeking was not related to alcohol-sex outcome expectancies. These findings suggest that alcohol use is an important HIV transmission risk factor for many STI clinic patients and that interventions for individuals who are characterized as sensation seekers are urgently needed in South Africa.

  10. Relationship between Urinary Pesticide Residue Levels and Neurotoxic Symptoms among Women on Farms in the Western Cape, South Africa

    PubMed Central

    Motsoeneng, Portia M.; Dalvie, Mohamed A.

    2015-01-01

    Background: This cross-sectional study aimed to investigate the relationship between urinary pesticide residue levels and neurotoxic symptoms amongst women working on Western Cape farms in South Africa. Method: A total of 211 women were recruited from farms (n = 121) and neighbouring towns (n = 90). Participant assessment was via a Q16 questionnaire, reporting on pesticide exposures and measurement of urinary OP metabolite concentrations of dialkyl phosphates (DAP) and chlorpyriphos, 3,5,6-trichloropyridinol (TCPY) and of pyrethroid (PYR) metabolite concentrations (3- phenoxybenzoic acid (3PBA), 4-fluoro-3-phenoxybenzoic acid (4F3PBA), cis-2,2-dibromovinyl-2,2-dimethylcyclopropane-1-carboxylic acid (DBCA), and the cis- and trans isomers of 2,2-dichlorovinyl-2,2-dimethylcyclopropane-1-carboxylic acid. Results: Median urinary pesticide metabolites were slightly (6%–49%) elevated in the farm group compared to the town group, with 2 metabolites significantly higher and some lower in the farm group. The prevalence of all Q16 symptoms was higher amongst farm women compared to town women. Three Q16 symptoms (problems with buttoning, reading and notes) were significantly positively associated with three pyrethroid metabolites (cis- and trans-DCCA and DBCA), although associations may due to chance as multiple comparisons were made. The strongest association for a pyrethroid metabolite was between problems with buttoning and DBCA (odds ratio (OR) = 8.93, 95% confidence interval (CI):1.71–46.5. There was no association between Q16 symptoms and OP metabolites. Conclusions: Women farm residents and rural women from neighbouring towns in the Western Cape are exposed to OP and PYR pesticides. The study did not provide strong evidence that pesticides are associated with neurotoxic symptoms but associations found could be explored further. PMID:26042367

  11. The kick with the kite: an analysis of kite surfing related off shore rescue missions in Cape Town, South Africa

    PubMed Central

    Exadaktylos, A; Sclabas, G; Blake, I; Swemmer, K; McCormick, G; Erasmus, P; Muhm, M; Curatolo, M

    2005-01-01

    Methods: The observation period for this study started on October 1, 2003 and ended on May 1, 2004 and included 30 air rescue missions. Data and information were collected prospectively. Results: The Air Mercy Service in Cape Town Province responded to 30 requests for help. Twenty five accidents were attributed to inability to detach the kite from the harness. Injuries occurred in five incidents and included fractures of the upper arm, ribs and ankle, and lacerations and contusions to the head and neck. Two patients suffered from hypothermia and one experienced severe exhaustion. All surfers were rescued successfully and there were no fatal accidents. Discussion: The risk potential of this new sport is unclear. Dangerous situations can occur despite proper training and safety precautions due to unpredictable conditions and difficulties with equipment. Safety should be stressed. Surfers should sailing with a fellow kiter and should wear a life vest. More efforts must be taken to make this booming new water sport safer. PMID:15849279

  12. Molecular Characteristics and Antibiotic Resistance Profiles of Klebsiella Isolates in Mthatha, Eastern Cape Province, South Africa

    PubMed Central

    Obi, Larry; Morobe, Isaac; Bisi-Johnson, Mary

    2017-01-01

    The increase in the incidence of extended-spectrum β-lactamase- (ESBL-) producing Klebsiella species has become a serious problem worldwide, because of their incrimination in antibiotic resistance. The objective of this study is to investigate the resistance genes responsible for ESBL-producing Klebsiella species and carbapenemase-producing Klebsiella (CRE) isolated in Mthatha and to study their epidemiology. A prospective, descriptive study of 202 nonrepetitive samples from patients was obtained from Nelson Mandela Academic Hospital. The cultured Klebsiella isolates were subjected to antimicrobial susceptibility tests and the polymerase chain reaction of blaCTX-M, blaTEM, blaSHV, blaKPC, and blaNDM genes. Overall K. pneumoniae were the majority with 169 (83.7%) species isolates, followed by K. oxytoca with 29 (14.4%), while K. ozaenae and Raoultella ornithinolytica were 2 (0.9%) each. The prevalence of ESBL production in all Klebsiella species was 117 (57.9%). ESBL-genotypic resistance is driven in Mthatha by blaSHV 121 (77.1%) followed by blaTEM 105 (66.9%) and blaCTX-M at 89 (56.7%). The most common ESBL genotype combination among the Klebsiella was blaTEM + blaSHV + blaCTX-M at 79 (50.3%). There is a steady increase in the rate of ESBL genes in the last five years. PMID:28250772

  13. Antibiogram of Stenotrophomonas maltophilia Isolated From Nkonkobe Municipality, Eastern Cape Province, South Africa

    PubMed Central

    Adegoke, Anthony Ayodeji; Okoh, Anthony I.

    2014-01-01

    Background: Assessment of resistance genes is imperative, as they become disseminated to bacterial flora in plants and to the indigenous bacterial community, and thus ultimately contributes to the clinical problems of antibiotic resistant pathogens. Objectives: The research was to assess the antibiotic characteristics and incidence of sul3 genes of Stenotrophomonas maltophilia isolates recovered from rhizospheres plant in Nkonkobe Municipality. Materials and Methods: Identification and assessment of resistance genes (sul2 and sul3 genes) were carried out using polymerase chain reaction (PCR). Analytical profile index (API) was used for biochemical characterization for identification before the PCR. Antibiotic susceptibility test was carried out using the approved guidelines and standards of Clinical Laboratory Standard Institute (CLSI). Results: A total of 125 isolates were identified, composed of 120 (96%) from grass root rhizosphere and 5 (4%) from soil butternut root rhizosphere. In vitro antibiotic susceptibility tests showed varying resistances to meropenem (8.9%), cefuroxime (95.6 %), ampicillin-sulbactam (53.9%), ceftazidime (10.7%), cefepime (29.3 %), minocycline (2.2%), kanamycin (56.9%), ofloxacin (2.9%), levofloxacin (1.3%), moxifloxacin (2.8%), ciprofloxacin (24.3%), gatifloxacin (1.3%), polymyxin B (2.9 %), cotrimoxazole (26.1%), trimethoprim (98.6%) and aztreonam (58%). The isolates were susceptible to the fluoroquinolones (74.3-94.7%), polymycin (97.1%) and meropenem (88.1%). The newest sulphonamide resistance gene, sul3, was detected among the trimethoprim-sulfamethoxazole (cotrimoxazole)-resistant isolates, while the most frequent sulphonamide-resistant gene in animal source isolates, sul2, was not. Conclusions: The commensal S. maltophilia isolates in the Nkonkobe Municipality environment harbored the resistant gene sul3 as clinical counterparts, especially from the perspective of reservoirs of antibiotic resistance determinants. PMID:25789125

  14. Bacterial enteritis in ostrich (Struthio Camelus) chicks in the Western Cape Province, South Africa.

    PubMed

    Keokilwe, L; Olivier, A; Burger, W P; Joubert, H; Venter, E H; Morar-Leather, D

    2015-06-01

    Ostrich (Struthio camelus) chicks less than 3 mo age are observed to experience a high mortality rate that is often associated with enteritis. This study was undertaken to investigate the infectious bacteria implicated in ostrich chick enteritis. Postmortems were performed on 122 ostrich chicks aged from 1 d to 3 mo and intestinal samples were subjected to bacterial culture. Bacterial isolates were typed by PCR and serotyping. Escherichia coli (E. coli; 49%) was the most frequently isolated from the samples followed by Clostridium perfringens (C. perfringens; 20%), Enterococcus spp. (16%), and Salmonella spp. (7%). Of the E. coli, 39% were categorized as enteropathogenic E. coli, 4% enterotoxigenic E. coli, and no enterohaemorrhagic E. coli were found. The majority (93%) of C. perfringens was Type A and only 7% was Type E. C. perfringens Types B through D were not present. The netB gene that encodes NetB toxin was identified from 16% of the C. perfringens isolated. All the C. perfringens Type E harbored the netB gene and just 10% of the C. perfringens Type A had this gene. Three Salmonella serotypes were identified: Salmonella Muenchen (S. Muenchen; 80%), S. Hayindongo (13%), and S. Othmarschen (7%). The indication is that the cause of enteritis in ostrich chicks is bacterial-involving: enteropathogenic E. coli and enterotoxigenic E. coli; C. perfringens Types A and E (with the possible influence of netB gene); and S. Muenchen, S. Hayindongo, and S. Othmarschen.

  15. Contraceptive practices among women seeking termination of pregnancy in one public hospital in Eastern Cape, South Africa

    PubMed Central

    Oluwole, Ebenezer O.

    2016-01-01

    Background There is significantly high contraceptive knowledge in South Africa, but the uptake of contraceptives is average to low with resultant soaring of unplanned pregnancy and rising statistics of termination of pregnancy (TOP) services. This study aimed to establish the contraceptive practices among women in the South African population seeking TOP in one public hospital in Eastern Cape, South Africa. Methods A cross-sectional study was carried out among women seeking TOP in a women’s clinic. Self-administered questionnaires were used as data collection tool, and the data collected were entered into SPSS software for analysis, using descriptive statistics to calculate frequencies and percentages while chi-square test was used to determine the associations between the socio-demography and contraceptive practices of the participants. Results Majority of the women were aged between 20 and 29 years, had secondary education, unemployed, single and resided in townships. Contraceptive uptake prior to termination of pregnancy (CTOP) among them was 44.1%, but 85.8% had good contraceptives knowledge. Their contraceptive practices are determined by partner’s opinion, source and availability of contraceptives, previous CTOP, side effect of contraceptives and having children. Age group, educational level and employment status were found to be related to the contraceptive practices of the participants but were not statistically significant. Conclusion To reduce unplanned pregnancies and subsequent number of women seeking CTOP, the socio-economic factors associated with contraceptive practices as well as the programmes, policies and guidelines of contraceptives need to be improved on for any improvement on the factors determining contraceptive practices. PMID:27608676

  16. The MobiSan approach: informal settlements of Cape Town, South Africa.

    PubMed

    Naranjo, A; Castellano, D; Kraaijvanger, H; Meulman, B; Mels, A; Zeeman, G

    2010-01-01

    Pook se Bos informal settlement and the Cape Town Water & Sanitation Services Department are partnering on an urban sanitation project with a Dutch Consortium consisting of Lettinga Associates Foundation (LeAF), Landustrie Sneek and Vitens-Evides International. The aim of the project is to improve the basic sanitation services provided in informal settlements through the implementation of the MobiSan approach. The approach consists of a communal Urine-Diversion and Dehydration Toilet (UDDT) built in a former sea shipping container. The system is independent of water, electricity or sewerage connection and it is maintained by full-time community caretakers who also act as hygiene promoters. The project seeks to link sanitation services with hygiene promotion in informal settlements while enhancing user satisfaction and reducing costs in providing basic sanitation services. This paper describes the preliminary experiences and lessons learnt during the implementation and evaluation of the MobiSan prototype and discusses its potential for replication. The MobiSan has proved to be an appropriate option by means of dealing successfully with shallow groundwater table, land availability and high settlement densities. In addition it has been demonstrated to be cost-competitive in terms of operating cost compared to chemical toilets.

  17. Patients’ perceptions of the triage system in a primary healthcare facility, Cape Town, South Africa

    PubMed Central

    Adeniji, Adeloye Amoo

    2016-01-01

    Background In public healthcare facilities, where the patient numbers and the available resources are often disproportionate, triage is used to prioritise when patients are seen. Patients may not understand the triage process and have strong views on how to improve their experience. Aim This study explored the views of patients who had undergone triage in the emergency centre of a primary care facility. Setting Gugulethu Community Health Centre, Cape Town. Methods A purposive sample consisted of five women (one coded green, three orange, one yellow) and four men (one coded green and three yellow). A semi-structured qualitative interview was conducted in either Xhosa or English and the transcripts analysed using the framework method. Results All of the respondents complained of a lack of information and poor understanding of the triage process. Those coded green experienced the process as biased and unfair and reported that the triage nurse was rude and unprofessional. By contrast, those coded yellow or orange found the triage nurse to be helpful and professional. Most patients turned to support staff (e.g. security staff or cleaners) for assistance in dealing with the triage system. Most patients waited longer than the guidelines recommend and the green-coded patients complained about this issue. Conclusion Patients did not have a good experience of the triage system. Managers of the triage system need to design better strategies to improve patient acceptance and share information. The important role of support staff needs to be recognised and strengthened. PMID:27380788

  18. Towards Multilingual Higher Education in South Africa: The University of Cape Town's Experience

    ERIC Educational Resources Information Center

    Madiba, Mbulungeni

    2010-01-01

    South African universities are required by the Language Policy for Higher Education adopted by the government on 6 November 2002 to implement multilingualism in their learning and teaching programmes. Multilingualism is recommended in this policy as a means to ensure equity of access and success in higher education, in contrast to past colonial…

  19. The Prevalence of Motor Delay among HIV Infected Children Living in Cape Town, South Africa

    ERIC Educational Resources Information Center

    Ferguson, Gillian; Jelsma, Jennifer

    2009-01-01

    Children living with HIV often display delayed motor performance owing to HIV infection of the central nervous system, the effects of opportunistic infections and, indirectly, owing to their social environments. Although these problems have been well documented, the impact of the virus on the development of South African children is less well…

  20. Exploring the Changing Role of Learning Support Teachers in the Western Cape, South Africa

    ERIC Educational Resources Information Center

    Dreyer, Lorna M.

    2013-01-01

    The South African education system is continuously changing and adapting to address the challenges to provide access, equal and quality education in a new democratic dispensation. One such challenge is the way in which learning support is provided to learners who struggle in mainstream classrooms. The department of education opted for a systemic…

  1. A survey of the Cape Floristic Region of South Africa for the presence of cyst nematodes (Nematoda: Heteroderidae).

    PubMed

    Knoetze, Rinus; Swart, Antoinette

    2014-12-09

    A survey was performed to detect the presence of cyst nematodes in the Cape Floristic Region of South Africa. Soil was collected in the rhizosphere of the dominant plant species within blocks of indigenous vegetation and cysts were extracted from them. A total of 81 blocks of indigenous vegetation were sampled as described. Cysts were detected in 7 of these samples, representing 6 different vegetation types. One set of primers was used to amplify the ITS regions from these cysts, including the 5.8S ribosomal gene, as well as short parts of the 18S and 28S ribosomal genes. ITS-rDNA sequences from the indigenous isolates were aligned with selected sequences of other species from the Heteroderidae. Phylogenetic analyses to resolve the relationships between indigenous isolates and selected representatives of the Heteroderidae were conducted using the Maximum Parsimony method. The consensus tree resulting from alignment of the circumfenestrate cysts revealed that isolates SK18, WK1 and WK26 are included in a clade of Globodera species that parasitise non-solanaceous plants, forming a monophyletic group with G. millefolii, G. artemisiae, and an unidentified Globodera sp. from Portugal. In a tree resulting from the alignment of the Heterodera spp., isolates OK14 and WK2 are included in the Afenestrata group, forming a monophyletic group with H. orientalis.This survey unearthed at least four potentially new species of cyst nematodes, which may prove invaluable for the study of the evolution and biogeography of the group.

  2. Functional Traits in Parallel Evolutionary Radiations and Trait-Environment Associations in the Cape Floristic Region of South Africa.

    PubMed

    Mitchell, Nora; Moore, Timothy E; Mollmann, Hayley Kilroy; Carlson, Jane E; Mocko, Kerri; Martinez-Cabrera, Hugo; Adams, Christopher; Silander, John A; Jones, Cynthia S; Schlichting, Carl D; Holsinger, Kent E

    2015-04-01

    Evolutionary radiations with extreme levels of diversity present a unique opportunity to study the role of the environment in plant evolution. If environmental adaptation played an important role in such radiations, we expect to find associations between functional traits and key climatic variables. Similar trait-environment associations across clades may reflect common responses, while contradictory associations may suggest lineage-specific adaptations. Here, we explore trait-environment relationships in two evolutionary radiations in the fynbos biome of the highly biodiverse Cape Floristic Region (CFR) of South Africa. Protea and Pelargonium are morphologically and evolutionarily diverse genera that typify the CFR yet are substantially different in growth form and morphology. Our analytical approach employs a Bayesian multiple-response generalized linear mixed-effects model, taking into account covariation among traits and controlling for phylogenetic relationships. Of the pairwise trait-environment associations tested, 6 out of 24 were in the same direction and 2 out of 24 were in opposite directions, with the latter apparently reflecting alternative life-history strategies. These findings demonstrate that trait diversity within two plant lineages may reflect both parallel and idiosyncratic responses to the environment, rather than all taxa conforming to a global-scale pattern. Such insights are essential for understanding how trait-environment associations arise and how they influence species diversification.

  3. Completeness and accuracy of electronic recording of paediatric drug-resistant tuberculosis in Cape Town, South Africa

    PubMed Central

    Schaaf, H. S.; du Preez, K.; Seddon, J. A.; Garcia-Prats, A. J.; Zimri, K.; Dunbar, R.; Hesseling, A. C.

    2013-01-01

    Setting: Cape Town, South Africa. Objective: To assess the completeness and accuracy of electronic recording of drug-resistant tuberculosis (DR-TB) in children. Design: Retrospective cohort study. All children aged <15 years treated for DR-TB during 2012 were included, with clinical data collected from routine health services. Matching was performed between clinical data and an extracted data set from an electronic register for DR-TB (EDR.web), and data sources were compared. Results: Seventy-seven children were identified clinically, of whom only 49 (64%) were found in EDR.web. Most data in EDR.web were complete and accurate, but there were some internal inconsistencies for confirmed TB. Only 4.4% of all EDR.web entries were children. Conclusion: Only two thirds of children clinically treated for DR-TB were recorded in the electronic reporting system, suggesting under-reporting. We also found a lower than expected prevalence of childhood DR-TB, probably suggesting both under-diagnosis and under-recording of DR-TB in children. Clinicians at facility level should be able to access the electronic reporting system, and data transfer between clinical paper-based and electronic sources should be simplified. Cross-linking between electronic registers for drug-susceptible and DR-TB or consolidation of registers could improve the accuracy of recording. Improved recording and reporting of DR-TB in children is needed. PMID:26393032

  4. Language choice and sexual communication among Xhosa speakers in Cape Town, South Africa: implications for HIV prevention message development.

    PubMed

    Cain, Demetria; Schensul, Stephen; Mlobeli, Regina

    2011-06-01

    Communicating about sex is a vital component of human immunodeficiency virus (HIV) prevention and influences how HIV educators convey messages to communities and how couples negotiate safer sex practices. However, sexual communication inevitably confronts culturally based behavioral guidelines and linguistic taboos unique to diverse social contexts. The HIV interventionist needs to identify the appropriate language for sexual communication given the participants and the message. Ethnographic research can help facilitate the exploration of how sex terminology is chosen. A theoretical framework, developed to guide HIV interventionists, suggests that an individual's language choice for sexual communication is influenced by gender roles and power differentials. In-depth interviews, free listing and triadic comparisons were conducted with Xhosa men and women in Cape Town, South Africa, to determine the terms for male genitalia, female genitalia and sexual intercourse that are most appropriate for sexual communication. Results showed that sexual terms express cultural norms and role expectations where men should be powerful and resilient and women should be passive and virginal. For HIV prevention education, non-mother tongue (English and Zulu) terms were recommended as most appropriate because they are descriptive, but allow the speaker to communicate outside the restrictive limits of their mother tongue by reducing emotive cultural connotations.

  5. Costs and process of in-patient tuberculosis management at a central academic hospital, Cape Town, South Africa

    PubMed Central

    Marais, F.; Mehtar, S.; Baltussen, R. M. P. M.

    2012-01-01

    Setting: South Africa reports more cases of tuberculosis (TB) than any other country, but an up-to-date, precise estimate of the costs associated with diagnosing, treating and preventing TB at the in-patient level is not available. Objective: To determine the costs associated with TB management among in-patients and to study the use of personal protective equipment (PPE) at a central academic hospital in Cape Town. Design: Retrospective and partly prospective cost analysis of TB cases diagnosed between May 2008 and October 2009. Results: The average daily in-patient costs were US$238; the average length of stay was 9.7 days. Mean laboratory and medication costs per stay were respectively US$26.82 and US$8.68. PPE use per day cost US$0.99. The average total TB management costs were US$2373 per patient. PPE was not always properly used. Discussion: The costs of in-patient TB management are high compared to community-based treatment; the main reason for the high costs is the high number of in-patient days. An efficiency assessment is needed to reduce costs. Cost reduction per TB case prevented was approximately US$2373 per case. PPE use accounted for the lowest costs. Training is needed to improve PPE use. PMID:26392953

  6. Measuring evapotranspiration using an eddy covariance system over the Albany Thicket of the Eastern Cape, South Africa

    NASA Astrophysics Data System (ADS)

    Gwate, O.; Mantel, Sukhmani K.; Palmer, Anthony R.; Gibson, Lesley A.

    2016-10-01

    Determining water and carbon fluxes over a vegetated surface is important in a context of global environmental changes and the fluxes help in understanding ecosystem functioning. Pursuant to this, the study measured evapotranspiration (ET) using an eddy covariance (EC) system installed over an intact example of the Albany Thicket (AT) vegetation in the Eastern Cape, South Africa. Environmental constraints to ET were also assessed by examining the response of ET to biotic and abiotic factors. The EC system comprised of an open path Infrared Gas Analyser and Sonic anemometer and an attendant weather station to measure bi-meteorological variables. Post processing of eddy covariance data was conducted using EddyPro software. Quality assessment of fluxes was also performed and rejected and missing data were filled using the method of mean diurnal variations (MDV). Much of the variation in ET was accounted for by the leaf area index (LAI, p < 0.001, 41%) and soil moisture content (SWC, p < 0.001, 32%). Total measured ET during the experiment was greater than total rainfall received owing to the high water storage capacity of the vegetation and the possibility of vegetation accessing ground water. Most of the net radiation was consumed by sensible heat flux and this means that ET in the area is essentially water limited since abundant energy was available to drive turbulent transfers of energy. Understanding the environmental constraints to ET is crucial in predicting the ecosystem response to environmental forces such as climate change.

  7. Evaluation of a safer male circumcision training programme for traditional surgeons and nurses in the Eastern Cape, South Africa.

    PubMed

    Peltzer, Karl; Nqeketo, Ayanda; Petros, George; Kanta, Xola

    2008-06-18

    Training designed to improve circumcision knowledge, attitude and practice was delivered over 5 days to 34 traditional surgeons and 49 traditional nurses in the Eastern Cape, South Africa. Training included the following topics: initiation rites; statutory regulation of traditional male circumcision and initiation into Manhood (TCIM); structure and function of the male sex organs; procedure of safe circumcision, infection control; sexually transmitted infections (STIs); HIV/AIDS; infection control measures; aftercare of the initiate including after care of the circumcision wound and initiate as a whole; detection and early management of common complications of circumcision; nutrition and fluid management; code of conduct and ethics; and sexual health education. The evaluation of the training consisted of a prospective assessment of knowledge and attitude immediately prior to and after training. Significant improvement in knowledge and/or attitudes was observed in legal aspects, STI, HIV and environmental aspects, attitudes in terms of improved collaboration with biomedical health care providers, normal and abnormal anatomy and physiology, sexually transmitted infections and including HIV, circumcision practice and aftercare of initiates. We concluded that safer circumcision training can be successfully delivered to traditional surgeons and nurses.

  8. A framework for effective collaboration: a case study of collaboration in nursing education in the Western Cape, South Africa.

    PubMed

    Daniels, Felicity M; Khanyile, Thembisile D

    2013-09-01

    A fundamental purpose of mergers between higher education institutions (HEIs) in 2002 was to enable sharing of scarce resources between more advanced universities and those historically disadvantaged by the apartheid system of the South African Government. A common teaching platform for undergraduate nursing education in the Western Cape was established in 2005, in line with the transformation of the higher education system, as a collaborative initiative between three universities. In order to evaluate the common teaching platform, Stuffelbeam's context, input, process, product (CIPP) research model was employed. A sample of 108 participants was selected through stratified purposive sampling, and included three deputy vice-chancellors, three deans, three heads of department, 18 lecturers and 81 students. Semi-structured interviews were held with the staff members, whilst the students participated in focus group interviews. Open-ended questions informed by literature and the CIPP evaluation model were developed and used to guide the interviews. This enabled the researcher to obtain a rich description of the participants' experiences. The data were analysed inductively. The results revealed that the main purpose of collaboration was not achieved due to the lack of a common understanding of the concept of collaboration and its purpose; a lack of readiness to collaborate and a lack of sharing of resources. A framework for effective collaboration was developed based on the results.

  9. Language choice and sexual communication among Xhosa speakers in Cape Town, South Africa: implications for HIV prevention message development

    PubMed Central

    Cain, Demetria; Schensul, Stephen; Mlobeli, Regina

    2011-01-01

    Communicating about sex is a vital component of human immunodeficiency virus (HIV) prevention and influences how HIV educators convey messages to communities and how couples negotiate safer sex practices. However, sexual communication inevitably confronts culturally based behavioral guidelines and linguistic taboos unique to diverse social contexts. The HIV interventionist needs to identify the appropriate language for sexual communication given the participants and the message. Ethnographic research can help facilitate the exploration of how sex terminology is chosen. A theoretical framework, developed to guide HIV interventionists, suggests that an individual's language choice for sexual communication is influenced by gender roles and power differentials. In-depth interviews, free listing and triadic comparisons were conducted with Xhosa men and women in Cape Town, South Africa, to determine the terms for male genitalia, female genitalia and sexual intercourse that are most appropriate for sexual communication. Results showed that sexual terms express cultural norms and role expectations where men should be powerful and resilient and women should be passive and virginal. For HIV prevention education, non-mother tongue (English and Zulu) terms were recommended as most appropriate because they are descriptive, but allow the speaker to communicate outside the restrictive limits of their mother tongue by reducing emotive cultural connotations. PMID:21059802

  10. Cost-effectiveness of a package of interventions for expedited antiretroviral therapy initiation during pregnancy in Cape Town, South Africa.

    PubMed

    Zulliger, Rose; Black, Samantha; Holtgrave, David R; Ciaranello, Andrea L; Bekker, Linda-Gail; Myer, Landon

    2014-04-01

    Initiating antiretroviral therapy (ART) early in pregnancy is an important component of effective interventions to prevent the mother-to-child transmission of HIV (PMTCT). The rapid initiation of ART in pregnancy(RAP) program was a package of interventions to expedite ART initiation in pregnant women in Cape Town, South Africa. Retrospective cost-effectiveness, sensitivity and threshold analyses were conducted of the RAP program to determine the cost-utility thresholds for rapid initiation of ART in pregnancy. Costs were drawn from a detailed micro-costing of the program. The overall programmatic cost was US$880 per woman and the base case cost-effectiveness ratio was US$1,160 per quality-adjusted lifeyear (QALY) saved. In threshold analyses, the RAP program remained cost-effective if mother-to-child transmission was reduced by C0.33 %; if C1.76 QALY were saved with each averted perinatal infection; or if RAP-related costs were under US$4,020 per woman. The package of rapid initiation services was very cost-effective, as compared to standard services in this setting. Threshold analyses demonstrated that the intervention required minimal reductions in perinatal infections in order to be cost-effective. Interventions for the rapid initiation of ART in pregnancy hold considerable potential as a cost-effective use of limited resources for PMTCT in sub-Saharan Africa.

  11. Taphonomic and paleoecological change in the large mammal sequence from Boomplaas Cave, western Cape, South Africa.

    PubMed

    Faith, J Tyler

    2013-12-01

    Excavations conducted by H.J. Deacon in the 1970s at Boomplaas Cave (BPA) uncovered a stratified sequence of Middle Stone Age (MSA) and Later Stone Age (LSA) deposits spanning the last >65,000 years. This study provides the first comprehensive and integrated taphonomic and paleoecological analysis of the BPA large mammals, with a focus on its implications for understanding human adaptations and environmental changes in southern Africa's Cape Floristic Region (CFR), an area that features prominently in understanding modern human origins. Taphonomic data indicate a complex history of human, carnivore, and raptor accumulation of the large mammal assemblage. The anthropogenic signal is largely absent from the bottom of the sequence (>65,000 years ago), intermediate in MSA and LSA assemblages from ~50,000 to 20,000 years ago, and strong in LSA deposits post-dating the Last Glacial Maximum (LGM). When viewed in the broader CFR context, the inferred occupation history of BPA is consistent with the hypothesis that both MSA and LSA human populations were concentrated on the submerged coastline from ~60,000 to ~20,000 years ago. Intensive occupation following the LGM parallels an apparent increase in regional population densities, which may have been driven in part by rising sea levels. The BPA ungulate assemblage is characterized by the rise and decline of a taxonomically diverse grazing community, which peaks during the LGM. These changes are not correlated with taphonomic shifts, meaning that they are likely driven by environmental factors, namely the expansion and contraction of grassland habitats. Changes in ungulate diversity indicate that effective precipitation was highest during the LGM, corresponding with an intensified winter rainfall system. This is consistent with recent arguments that the LGM in this region may not have been extremely harsh and arid.

  12. An evaluation of University of Cape Town medical students’ community placements in South Africa

    PubMed Central

    Zweigenthal, Virginia; Irlam, James; London, Leslie; Keikelame, Johannah

    2012-01-01

    Abstract Background Fourth-year medical students at the University of Cape Town (UCT) work closely with stakeholders in community teaching sites to conduct community-based research projects and follow-up health promotion interventions during their Public Health training. Objectives This study evaluated the placements as a learning experience from the perspectives of past students and community stakeholders. Methods A total of 32 projects were randomly selected out of 232 projects undertaken during 2006, 2008 and 2009. Two students and a stakeholder involved with each project were sampled. A standardised survey was emailed to students and in-depth interviews were held with stakeholders. Results Fifty two per cent of 64 students and 57% of 25 stakeholders responded. Most students felt that the placements enhanced their academic experience and confidence in research skills, and were an effective form of learning. Perceived challenges included time constraints and, for a minority, inadequately prepared settings and stakeholders. Stakeholders felt that the placements empowered the communities and prepared students for the realities of working as a medical professional. They viewed students as a valuable resource and believed that student projects addressed important community myths and health problems. Recommendations from students and stakeholders included more time for the Public Health block, follow-up interventions for greater continuity, and better alignment of projects with stakeholder programmes. Conclusion The evaluation reveals both the importance and challenges of community placements and identifies areas of improvement. Despite the limited duration of the placements, they offered valuable community-based learning experiences for the students and worthwhile benefits for the communities.

  13. Detection of Transgenes in Local Maize Varieties of Small-Scale Farmers in Eastern Cape, South Africa

    PubMed Central

    Iversen, Marianne; Grønsberg, Idun M.; van den Berg, Johnnie; Fischer, Klara; Aheto, Denis Worlanyo; Bøhn, Thomas

    2014-01-01

    Small-scale subsistence farmers in South Africa have been introduced to genetically modified (GM) crops for more than a decade. Little is known about i) the extent of transgene introgression into locally recycled seed, ii) what short and long-term ecological and socioeconomic impacts such mixing of seeds might have, iii) how the farmers perceive GM crops, and iv) to what degree approval conditions are followed and controlled. This study conducted in the Eastern Cape, South Africa, aims primarily at addressing the first of these issues. We analysed for transgenes in 796 individual maize plants (leaves) and 20 seed batches collected in a village where GM insect resistant maize was previously promoted and grown as part of an governmental agricultural development program over a seven year period (2001–2008). Additionally, we surveyed the varieties of maize grown and the farmers’ practices of recycling and sharing of seed in the same community (26 farmers were interviewed). Recycling and sharing of seeds were common in the community and may contribute to spread and persistence of transgenes in maize on a local or regional level. By analysing DNA we found that the commonly used transgene promoter p35s occurred in one of the 796 leaf samples (0.0013%) and in five of the 20 seed samples (25%). Three of the 20 seed samples (15%) included herbicide tolerant maize (NK603) intentionally grown by the farmers from seed bought from local seed retailers or acquired through a currently running agricultural development program. The two remaining positive seed samples (10%) included genes for insect resistance (from MON810). In both cases the farmers were unaware of the transgenes present. In conclusion, we demonstrate that transgenes are mixed into seed storages of small-scale farming communities where recycling and sharing of seeds are common, i.e. spread beyond the control of the formal seed system. PMID:25551616

  14. Opportunities for technology-based HIV prevention programming among high school students in Cape Town, South Africa.

    PubMed

    Ybarra, Michele L; Mwaba, Kelvin; Prescott, Tonya L; Roman, Nicolette V; Rooi, Bronwyn; Bull, Sheana

    2014-01-01

    One in three new cases of HIV in South Africa is among adolescents. Given that adolescents are particularly affected, scalable, and cost-effective prevention programs are urgently needed. This study aims to identify opportunities to integrate technology into youth HIV prevention efforts. In 2012, 1107 8th-11th graders completed a paper-and-pencil survey. Respondents were enrolled in one of three public high schools in Langa, a lower income community in Cape Town, South Africa. Eighty-nine percent of respondents have used text messaging (SMS) and 86% have gone online. If an HIV prevention program was offered online, 66% of youth would be somewhat or extremely likely to access it; slightly fewer (55%) felt the same about SMS-based programming. In comparison, 85% said they would be somewhat or extremely likely to access a school-based HIV prevention program. Interest in Internet- (60%) and SMS-based (54%) HIV prevention programming was similar for youth who had a self-appraised risk of HIV compared to youth who appraised their risk to be lower, as it was for youth who were tired of hearing messages about HIV prevention. Technology use is common - even among high school students who live in lower income communities. At the same time, these data reveal that it is not uncommon for youth to be tired of hearing messages about HIV prevention, and many of the typical topics key to HIV prevention have low interest levels among youth. HIV prevention researchers need to be mindful of the extent of existing programming that youth are exposed to. Technology-based programming may be especially amenable to meeting these requirements because of its novelty especially in developing countries, and because interactive functionality can be easily integrated into the program design. Given the preference for school- and Internet-based programming, it seems that a hybrid approach is likely feasible and acceptable.

  15. The 1992 M=7 Cape Mendocino, California, earthquake: Coseismic deformation at the south end of the Cascadia megathrust

    USGS Publications Warehouse

    Murray, M.H.; Marshall, G.A.; Lisowski, M.; Stein, R.S.

    1996-01-01

    We invert geodetic measurements of coseismic surface displacements to determine a dislocation model for the April 25, 1992, M=7 Cape Mendocino, California, earthquake. The orientation of the model slip vector, which nearly parallels North America-Juan de Fuca relative plate convergence, and the location and orientation of the model fault relative to the offshore Cascadia megathrust, suggest that the 1992 Cape Mendocino earthquake is the first well-recorded event to relieve strain associated with the Cascadia subduction zone. We use data from three geodetic techniques: (1) the horizontal and vertical displacements of 13 monuments surveyed with the Global Positioning System, corrected for observed horizontal interseismic strain accumulation, (2) 88 section-elevation differences between leveling monuments, and (3) the uplift of 12 coastal sites observed from the die-off of intertidal marine organisms. Maximum observed displacements are 0.4 m of horizontal movement and 1.5 m of uplift along the coast. We use Monte Carlo techniques to estimate an optimal uniform slip rectangular fault geometry and its uncertainties. The optimal model using all the data resolves 4.9 m of slip on a 14 by 15 km fault that dips 28?? SE. The fault extends from 1.5 to 8.7 km in depth and the main-shock hypocenter is close to the downdip projection of the fault. The shallowly dipping fault plane is consistent with the observed aftershock locations, and the estimated geodetic moment is 3.1??1019 N m, 70% of the seismic moment. Other models that exclude leveling data collected in 1935 and 1942 are more consistent with seismological estimates of the fault geometry. If the earthquake is characteristic for this segment, the estimated horizontal slip vector compared with plate convergence rates suggests a recurrence interval of 140 years, with a 95% confidence range of 100-670 years. The coseismic uplift occurred in a region that also has high Quaternary uplift rates determined from marine terrace

  16. Poverty and human immunodeficiency virus in children: a view from the Western Cape, South Africa.

    PubMed

    Marais, Barend Jacobus; Esser, Monika; Godwin, Sarah; Rabie, Helena; Cotton, Mark Fredric

    2008-01-01

    Sub-Saharan Africa is the region affected worst by human immunodeficiency virus (HIV), with the most southern countries, including Botswana, Zimbabwe, Swaziland, and South Africa, carrying the highest disease burden. This geographic distribution represents a complex interaction among virological, political, social, cultural, and economic forces. In South Africa the HIV epidemic is seemingly unchecked, with 18% of the adult population infected. Although South Africa is a mid-developed country, there is a large chasm between the wealthy and the poor, with many living in moderate to extreme poverty. Poverty creates conditions that fuel the HIV epidemic while HIV exacerbates the multiple interlinking causes of poverty. Children are the most vulnerable members of society, severely affected by all components of the poverty cycle. Although improved health education and access to care will alleviate many problems, sustainable poverty alleviation should form an essential component of the response to AIDS. The formulation of the United Nations Millennium Developmental Goals is an important step in the right direction, but global and local political commitment is essential for success.

  17. Cape Cod

    Atmospheric Science Data Center

    2014-05-15

    article title:  Winter in Cape Cod     View Larger Image Cape Cod extends over 50 miles into the Atlantic Ocean. Its rugged coastline, ... February 18, 2001 - Snow and thin clouds over Cape Cod. project:  MISR category:  gallery ...

  18. Structural interpretation of the Steenkampskraal monazite deposit, Western Cape, South Africa

    NASA Astrophysics Data System (ADS)

    Basson, I. J.; Muntingh, J. A.; Jellicoe, B. C.; Anthonissen, C. J.

    2016-09-01

    The Steenkampskraal Monazite Mine was first established in 1952, to extract monazite ore for the production of thorium and rare earth element (REE) concentrate. Refurbishment of the mine in recent years has required the re-inspection and re-evaluation of the mineralized monazite zone (MMZ). This contribution presents a structural review of the MMZ and its emplacement, based on recent data and its setting at the southern extent of the Bushmanland Sub-province of the Namaqua-Natal Metamorphic Belt. New surface and underground mapping confirm that the MMZ is a moderately-dipping body within gneissic host rocks on the southern limb of a broad F3 antiform. Thickness variations, both down-dip and along-strike, are the result of D2 and D3 deformation. The MMZ has been locally transected and steepened by subsequent late-D3, "steep-structures", which are typical of the Okiep copper district, ∼150 km north of Steenkampskraal. Geochronological data suggest that the MMZ was intruded, emplaced or formed at 1046 ± 7.5 Ma, at the start of the D3 Klondikean Episode (1040-1020 Ma). Unlike the analogous copper-bearing Koperberg Suite in the Okiep Copper district, the MMZ was not intruded into Klondikean-aged steep structures, but was rather transected and steepened by these. Local steepening of the otherwise moderately-dipping to flat-lying MMZ makes it locally amenable to detection by soil sampling and radiometric surveys.

  19. Assessment of undiscovered oil and gas resources of the South Africa Coastal Province, Africa

    USGS Publications Warehouse

    Brownfield, Michael E.; Schenk, Christopher J.; Charpentier, Ronald R.; Klett, Timothy R.; Cook, Troy A.; Pollastro, Richard M.

    2012-01-01

    The South Africa Coastal Province along the South Africa coast recently was assessed for undiscovered, technically recoverable oil, natural gas, and natural gas liquids resources as part of the U.S. Geological Survey's (USGS) World Oil and Gas Assessment. Using a geology-based assessment methodology, the USGS estimated mean volumes of 2.13 billion barrels of oil, 35.96 trillion cubic feet of natural gas, and 1,115 million barrels of natural gas liquids.

  20. Filling the gap: a learning network for health an human rights in the Western Cape, South Africa.

    PubMed

    London, Leslie; Fick, Nicole; Tram, Khai Hoan; Stuttaford, Maria

    2012-06-15

    We draw on the experience of a Learning Network for Health and Human Rights (LN) involving collaboration between academic institutions and civil society organizations in the Western Cape, South Africa, aimed at identifying and disseminating best practice related to the right to health. The LN's work in materials development, participatory research, training and capacity-building for action, and advocacy for intervention illustrates important lessons for human rights practice. These include (i) the importance of active translation of knowledge and awareness into action for rights to be made real; (ii) the potential tension arising from civil society action, which might relieve the state of its obligations by delivering services that should be the state's responsibility-and hence the importance of emphasizing civil society's role in holding services accountable in terms of the right to health; (iii) the role of civil society organizations in filling a gap related to obligations to promote rights; (iv) the critical importance of networking and solidarity for building civil society capacity to act for health rights. Evidence from evaluation of the LN is presented to support the argument that civil society can play a key role in bridging a gap between formal state commitment to creating a human rights culture and realizing services and policies that enable the most vulnerable members of society to advance their health. Through access to information and the creation of spaces, both for participation and as a safe environment in which learning can be turned into practice, the agency of those most affected by rights violations can be redressed. We argue that civil society agency is critical to such action.

  1. Coastal lake sediments from the southern Cape, South Africa - Implications for sea level and climate variations during the Holocene

    NASA Astrophysics Data System (ADS)

    Wündsch, M.; Haberzettl, T.; Kirsten, K. L.; Meschner, S.; Frenzel, P.; Baade, J.; Daut, G.; Mäusbacher, R.; Kasper, T.; Quick, L. J.; Meadows, M. E.; Zabel, M.

    2015-12-01

    Within the RAIN project (Regional Archives for Integrated iNvestigations) interdisciplinary investigations on climate evolution and environmental change in southern Africa during the Late Quaternary are being conducted. For this purpose, spatial and temporal variations of the three major rainfall zones covering South Africa (winter-, summer- and year-round rainfall zone) are studied using both marine and terrestrial archives. Here we present results inferred from sediment records from lakes Groenvlei and Eilandvlei located on the southern Cape coast within the year-round rainfall zone. From Eilandvlei, a brackish lake that is connected to the Indian Ocean via an estuary, a 30.5 m sediment core was recovered. Reservoir-corrected radiocarbon ages reveal a continuous sedimentation and a maximum age of about 8,900 cal BP. This ultra-high-resolution record of environmental change during the Holocene represents a unique discovery for entire southern Africa. Geochemical data reveal different phases of marine and terrestrial sediment deposition throughout the covered time span. Hence, this record reflects changes in sea level, but also variations in terrestrial sediment transport and thus changing climatic conditions. The sediment core from Groenvlei, which today is isolated from the Indian Ocean, covers the past 4,200 cal BP. Sediments from this lake are predominantly composed of autochthonous carbonates. Mineralogical investigations reveal alternating deposition of calcite and aragonite/dolomite, pointing to variable Mg/Ca ratios and thus variations in lake water salinity. These changes can be linked to sea level variations as well as to changes in the precipitation/evaporation balance, and hence climate. Based on these results, the Groenvlei record reveals a decreasing marine influence and a trend from generally drier to wetter conditions within the last 4,200 yrs. Moreover, several layers of enhanced allochtonous input were detected in this record, which can be

  2. Costs of measures to control tuberculosis/HIV in public primary care facilities in Cape Town, South Africa.

    PubMed Central

    Hausler, Harry Peter; Sinanovic, Edina; Kumaranayake, Lilani; Naidoo, Pren; Schoeman, Hennie; Karpakis, Barbara; Godfrey-Faussett, Peter

    2006-01-01

    OBJECTIVE: To measure the costs and estimate the cost-effectiveness of the ProTEST package of tuberculosis/human immunodeficiency virus (TB/HIV) interventions in primary health care facilities in Cape Town, South Africa. METHODS: We collected annual cost data retrospectively using ingredients-based costing in three primary care facilities and estimated the cost per HIV infection averted and the cost per TB case prevented. FINDINGS: The range of costs per person for the ProTEST interventions in the three facilities were: US$ 7-11 for voluntary counselling and testing (VCT), US$ 81-166 for detecting a TB case, US$ 92-183 for completing isoniazid preventive therapy (IPT) and US$ 20-44 for completing six months of cotrimoxazole preventive therapy. The estimated cost per HIV infection averted by VCT was US$ 67-112. The cost per TB case prevented by VCT (through preventing HIV) was US$ 129-215, by intensified case finding was US$ 323-664 and by IPT was US$ 486-962. Sensitivity analysis showed that the use of chest X-rays for IPT screening decreases the cost-effectiveness of IPT in preventing TB cases by 36%. IPT screening with or without tuberculin purified protein derivative screening was almost equally cost-effective. CONCLUSION: We conclude that the ProTEST package is cost saving. Despite moderate adherence, linking prevention and care interventions for TB and HIV resulted in the estimated costs of preventing TB being less than previous estimates of costs of treating it. VCT was less expensive than previously reported in Africa. PMID:16878226

  3. Caregivers’ Experiences of Pathways to Care for Seriously Ill Children in Cape Town, South Africa: A Qualitative Investigation

    PubMed Central

    Jones, Caroline H. D.; Ward, Alison; Hodkinson, Peter W.; Reid, Stephen J.; Wallis, Lee A.; Harrison, Sian; Argent, Andrew C.

    2016-01-01

    Purpose Understanding caregivers’ experiences of care can identify barriers to timely and good quality care, and support the improvement of services. We aimed to explore caregivers’ experiences and perceptions of pathways to care, from first access through various levels of health service, for seriously ill and injured children in Cape Town, South Africa, in order to identify areas for improvement. Methods Semi-structured, qualitative interviews were conducted with primary caregivers of children who were admitted to paediatric intensive care or died in the health system prior to intensive care admission. Interviews explored caregivers’ experiences from when their child first became ill, through each level of health care to paediatric intensive care or death. A maximum variation sample of transcripts was purposively sampled from a larger cohort study based on demographic characteristics, child diagnosis, and outcome at 30 days; and analysed using the method of constant comparison. Results Of the 282 caregivers who were interviewed in the larger cohort study, 45 interviews were included in this qualitative analysis. Some caregivers employed ‘tactics’ to gain quicker access to care, including bypassing lower levels of care, and negotiating or demanding to see a healthcare professional ahead of other patients. It was sometimes unclear how to access emergency care within facilities; and non-medical personnel informally judged illness severity and helped or hindered quicker access. Caregivers commonly misconceived ambulances to be slow to arrive, and were concerned when ambulance transfers were seemingly not prioritised by illness severity. Communication was often good, but some caregivers experienced language difficulties and/or criticism. Conclusions Interventions to improve child health care could be based on: reorganising the reception of seriously ill children and making the emergency route within healthcare facilities clear; promoting caregivers’ use of

  4. Women's experiences with cervical cancer screening in a colposcopy referral clinic in Cape Town, South Africa: a qualitative analysis

    PubMed Central

    Momberg, Mariette; Botha, Matthys H; Van der Merwe, Frederick H; Moodley, Jennifer

    2017-01-01

    Objective The aim of this study was to explore and understand women's experience with cervical cancer screening and with the referral pathways for abnormal Papanicolau (Pap) smears. Design and setting Focus group discussions were conducted with first time colposcopy clinic attendees at a tertiary hospital colposcopy clinic in Cape Town, South Africa during November 2014. A thematic analysis was conducted to identify key themes. Initial coding categories were drawn from the interview guide. Participants 27 women participated in 4 focus group discussions. Results Participants mean age was 34 years, most did not complete secondary level education and were unemployed. Negative community opinions relating to Pap smears and colposcopy referral might deter women from seeking treatment. Having a gynaecological symptom was the most commonly cited reason for having a Pap smear. Fear of having a HIV test performed at the same time as Pap smear and low encouragement from peers, were factors identified as potential access barriers. Participants commented on insufficient or lack of information from primary providers on referral to the colposcopy clinic and concerns and apprehension during waiting periods between receiving results and the colposcopy appointment were discussed. Conclusions There is a strong and urgent need to improve current knowledge about cervical cancer and Pap smears and the necessity and benefits of timely access to screening programmes, results and treatment. Strategies such as community health education programmes and mass media interventions could be employed to disseminate cervical cancer information and address negative community perceptions. Better training and support mechanisms to equip healthcare providers with the skills to convey cervical cancer information to women are needed. The use of short message service (SMS) to deliver Pap smear results and provide patients with more information should be considered to improve waiting times for results

  5. Assessment of continuous oil and gas resources of the South Sumatra Basin Province, Indonesia, 2016

    USGS Publications Warehouse

    Schenk, Christopher J.; Tennyson, Marilyn E.; Klett, Timothy R.; Finn, Thomas M.; Mercier, Tracey J.; Gaswirth, Stephanie B.; Marra, Kristen R.; Le, Phuong A.; Hawkins, Sarah J.

    2016-12-09

    Using a geology-based assessment methodology, the U.S. Geological Survey estimated undiscovered, technically recoverable mean resources of 689 million barrels of continuous shale oil and 3.9 trillion cubic feet of shale gas in the South Sumatra Basin Province in Indonesia.

  6. Adult Education in the Limpopo Province of South Africa: Challenges for Policy Implementation

    ERIC Educational Resources Information Center

    Zeelen, J.; Rampedi, M.; de Jong, G.

    2011-01-01

    In this article we report and reflect on a study about the problems encountered in the implementation of adult education policies in the Limpopo province of South Africa. We used the model of intergovernmental policy implementation of Van Horn and Van Meter as a theoretical framework. We reflect on this study and link the findings with more recent…

  7. Seismicity and neotectonic uplift in the Augrabies Falls National Park, Namaqualand, Northern Cape, South Africa

    NASA Astrophysics Data System (ADS)

    Madi, Kakaba

    2016-10-01

    Gneissic rocks in the Augrabies Falls National Park are part of the Proterozoic Namaqua-Natal mobile belt. Finding neotectonic evidence in old terranes is always not an easy task. In South Africa, the mid-Miocene is believed to be the beginning of neotectonics. This study investigated the occurrence and recurrence of earthquake activity, occurrence of faulting, jointing, uplift, and potholes in the gneisses cropping out around the Augrabies Falls area that may account for neotectonics. A historic seismic event obtained from the United States Geological Survey (USGS), and seismic epicenters downloaded in October 2015 from IRIS earthquake browser and overlaid on a satellite image with digitised faults and lineaments, indicates that the area is seismically active and is a zone of seismic risk. Potholes occurring today on a dry surface at approximately 613 m above sea level are a direct consequence of the Griqualand-Transvaal neotectonic uplift, which generated a major fault along which water flows continuously. It is concluded that the Augrabies Falls National Park area is a zone of neotectonics. This zone should not be considered for the storage of nuclear wastes.

  8. HIV risk and prevention among men who have sex with men (MSM) in peri-urban townships in Cape Town, South Africa.

    PubMed

    Jobson, Geoffrey; de Swardt, Glenn; Rebe, Kevin; Struthers, Helen; McIntyre, James

    2013-05-01

    Current guidelines on HIV prevention for MSM emphasise the need for 'combination prevention' based on context-specific understandings of HIV risk. MSM in South Africa are a population with a high risk of HIV infection, however there is little research available on the drivers of this risk. In the context of a focus on combination prevention, this paper argues that effective HIV prevention for MSM in South Africa requires an understanding of the factors at multiple 'distances' from individuals that contribute to HIV risk. Based on qualitative research with MSM in Cape Town, South Africa, we situate HIV risk using a socio-ecological framework and identify factors at distal, proximal, and personal, levels that contribute to MSM's high risk of HIV infection. By understanding the interactions and linkages between risk environments and the risk situations in which HIV is transmitted, HIV prevention programmes will be more effectively able to address the multiple drivers of HIV risk in this population.

  9. Characterisation of Clostridium difficile strains isolated from Groote Schuur Hospital, Cape Town, South Africa.

    PubMed

    Kullin, B; Brock, T; Rajabally, N; Anwar, F; Vedantam, G; Reid, S; Abratt, V

    2016-10-01

    The C. difficile infection rate in South Africa is concerning. Many strains previously isolated from diarrhetic patients at Groote Schuur Hospital were ribotype 017. This study further characterised these strains with respect to their clonal relationships, antibiotic susceptibility, toxin production and various attributes impacting on pathogen colonisation. Multilocus variable-number tandem-repeat analysis (MLVA) was used to characterise all C. difficile isolates. Antibiotic susceptibility was determined by E-test and PCR-based analysis of the ermB, gyrA and gyrB genes. Auto-aggregation of cells was measured in broth, and biofilm formation observed in 24-well plates. Toxins were measured using the Wampole C DIFF TOX A/B II kit. Most isolates belonged to the ribotype 017 group. Identical MLVA types occurred in different wards over time, and several patients were infected with identical strains. All isolates were susceptible to vancomycin and metronidazole, but some ribotype 017 isolates showed reduced metronidazole susceptibility (≥2 mg l(-1)). Sixty-nine percent of ribotype 017 isolates were resistant to moxifloxacin, and 94 % to erythromycin, compared to 0 % and 17 % resistance, respectively, in non-ribotype 017 isolates. The ermB gene and mutations in the gyrA and/or gyrB genes were linked to erythromycin and moxifloxacin resistance, respectively. Ribotype 017 isolates auto-aggregated more strongly than other isolates and produced lower levels of the TcdB toxin than a reference strain. Certain strains produced strong biofilms. Patient-to-patient transfer and unique infection events could cause the predominance of ribotype 017 strains in the cohort. Multi-drug resistant strains are a potential reservoir for future infections.

  10. Strontium isotope investigation of ungulate movement patterns on the Pleistocene Paleo-Agulhas Plain of the Greater Cape Floristic Region, South Africa

    SciTech Connect

    Copeland, Sandi R.; Cawthra, Hayley C.; Fisher, Erich C.; Lee-Thorp, Julia A.; Cowling, Richard M.; le Roux, Petrus J.; Hodgkins, Jamie; Marean, Curtis W.

    2016-04-16

    Middle Stone Age sites located within the Greater Cape Floristic Region on the South African southern coast have material culture with early evidence for key modern human behaviors such as projectile weaponry, large animal hunting, and symbolic behavior. In order to interpret how and why these changes evolved, it is necessary to understand their ecological context as it has direct relevance to foraging behavior. During periods of lowered sea level, a largely flat and vast expanse of land existed south of the modern coastline, but it is now submerged by higher sea levels. This exposed area, the Paleo-Agulhas Plain, likely created an ecological context unlike anything in the region today, as evidenced by fossil assemblages dominated by migratory ungulates. One hypothesis is that the Paleo-Agulhas Plain supported a migration ecosystem of large grazers driven by summer rainfall, producing palatable forage during summer in the east, and winter rainfall, producing palatable forage during winter in the west. Furthermore, ungulates may have been moving from the coastal plain in the south to the interior north of the Cape Fold Mountains, as observed for elephants in historic times.

  11. Strontium isotope investigation of ungulate movement patterns on the Pleistocene Paleo-Agulhas Plain of the Greater Cape Floristic Region, South Africa

    DOE PAGES

    Copeland, Sandi R.; Cawthra, Hayley C.; Fisher, Erich C.; ...

    2016-04-16

    Middle Stone Age sites located within the Greater Cape Floristic Region on the South African southern coast have material culture with early evidence for key modern human behaviors such as projectile weaponry, large animal hunting, and symbolic behavior. In order to interpret how and why these changes evolved, it is necessary to understand their ecological context as it has direct relevance to foraging behavior. During periods of lowered sea level, a largely flat and vast expanse of land existed south of the modern coastline, but it is now submerged by higher sea levels. This exposed area, the Paleo-Agulhas Plain, likelymore » created an ecological context unlike anything in the region today, as evidenced by fossil assemblages dominated by migratory ungulates. One hypothesis is that the Paleo-Agulhas Plain supported a migration ecosystem of large grazers driven by summer rainfall, producing palatable forage during summer in the east, and winter rainfall, producing palatable forage during winter in the west. Furthermore, ungulates may have been moving from the coastal plain in the south to the interior north of the Cape Fold Mountains, as observed for elephants in historic times.« less

  12. Cranes and Crops: Investigating Farmer Tolerances toward Crop Damage by Threatened Blue Cranes ( Anthropoides paradiseus) in the Western Cape, South Africa

    NASA Astrophysics Data System (ADS)

    van Velden, Julia L.; Smith, Tanya; Ryan, Peter G.

    2016-12-01

    The Western Cape population of Blue Cranes ( Anthropoides paradiseus) in South Africa is of great importance as the largest population throughout its range. However, Blue Cranes are strongly associated with agricultural lands in the Western Cape, and therefore may come into conflict with farmers who perceive them as damaging to crops. We investigated the viability of this population by exploring farmer attitudes toward crane damage in two regions of the Western Cape, the Swartland and Overberg, using semi-structured interviews. Perceptions of cranes differed widely between regions: farmers in the Swartland perceived crane flocks to be particularly damaging to the feed crop sweet lupin (65 % of farmers reported some level of damage by cranes), and 40 % of these farmers perceived cranes as more problematic than other common bird pests. Farmers in the Overberg did not perceive cranes as highly damaging, although there was concern about cranes eating feed at sheep troughs. Farmers who had experienced large flocks on their farms and farmers who ranked cranes as more problematic than other bird pests more often perceived cranes to be damaging to their livelihoods. Biographical variables and crop profiles could not be related to the perception of damage, indicating the complexity of this human-wildlife conflict. Farmers' need for management alternatives was related to the perceived severity of damage. These results highlight the need for location-specific management solutions to crop damage by cranes, and contribute to the management of this vulnerable species.

  13. Strontium isotope investigation of ungulate movement patterns on the Pleistocene Paleo-Agulhas Plain of the Greater Cape Floristic Region, South Africa

    NASA Astrophysics Data System (ADS)

    Copeland, Sandi R.; Cawthra, Hayley C.; Fisher, Erich C.; Lee-Thorp, Julia A.; Cowling, Richard M.; le Roux, Petrus J.; Hodgkins, Jamie; Marean, Curtis W.

    2016-06-01

    Middle Stone Age sites located within the Greater Cape Floristic Region on the South African southern coast have material culture with early evidence for key modern human behaviors such as projectile weaponry, large animal hunting, and symbolic behavior. In order to interpret how and why these changes evolved, it is necessary to understand their ecological context as it has direct relevance to foraging behavior. During periods of lowered sea level, a largely flat and vast expanse of land existed south of the modern coastline, but it is now submerged by higher sea levels. This exposed area, the Paleo-Agulhas Plain, likely created an ecological context unlike anything in the region today, as evidenced by fossil assemblages dominated by migratory ungulates. One hypothesis is that the Paleo-Agulhas Plain supported a migration ecosystem of large grazers driven by summer rainfall, producing palatable forage during summer in the east, and winter rainfall, producing palatable forage during winter in the west. Alternatively, ungulates may have been moving from the coastal plain in the south to the interior north of the Cape Fold Mountains, as observed for elephants in historic times. In this study, we assess ungulate movement patterns with inter- and intra-tooth enamel samples for strontium isotopes in fossil fauna from Pinnacle Point sites PP13B and PP30. To accomplish our goals we created a bioavailable 87Sr/86Sr isoscape for the region by collecting plants at 171 sampling sites and developing a geospatial model. The strontium isotope results indicate that ungulates spent most of their time on the Paleo-Agulhas Plain and avoided dissected plain, foothill, and mountain habitats located more than about 15 km north of the modern coastline. The results clearly exclude a north-south (coastal-interior) movement or migration pattern, and cannot falsify the east-west movements hypothesized in the south coast migration ecosystem hypothesis.

  14. Seasonality and Trend Forecasting of Tuberculosis Prevalence Data in Eastern Cape, South Africa, Using a Hybrid Model

    PubMed Central

    Azeez, Adeboye; Obaromi, Davies; Odeyemi, Akinwumi; Ndege, James; Muntabayi, Ruffin

    2016-01-01

    Background: Tuberculosis (TB) is a deadly infectious disease caused by Mycobacteria tuberculosis. Tuberculosis as a chronic and highly infectious disease is prevalent in almost every part of the globe. More than 95% of TB mortality occurs in low/middle income countries. In 2014, approximately 10 million people were diagnosed with active TB and two million died from the disease. In this study, our aim is to compare the predictive powers of the seasonal autoregressive integrated moving average (SARIMA) and neural network auto-regression (SARIMA-NNAR) models of TB incidence and analyse its seasonality in South Africa. Methods: TB incidence cases data from January 2010 to December 2015 were extracted from the Eastern Cape Health facility report of the electronic Tuberculosis Register (ERT.Net). A SARIMA model and a combined model of SARIMA model and a neural network auto-regression (SARIMA-NNAR) model were used in analysing and predicting the TB data from 2010 to 2015. Simulation performance parameters of mean square error (MSE), root mean square error (RMSE), mean absolute error (MAE), mean percent error (MPE), mean absolute scaled error (MASE) and mean absolute percentage error (MAPE) were applied to assess the better performance of prediction between the models. Results: Though practically, both models could predict TB incidence, the combined model displayed better performance. For the combined model, the Akaike information criterion (AIC), second-order AIC (AICc) and Bayesian information criterion (BIC) are 288.56, 308.31 and 299.09 respectively, which were lower than the SARIMA model with corresponding values of 329.02, 327.20 and 341.99, respectively. The seasonality trend of TB incidence was forecast to have a slightly increased seasonal TB incidence trend from the SARIMA-NNAR model compared to the single model. Conclusions: The combined model indicated a better TB incidence forecasting with a lower AICc. The model also indicates the need for resolute

  15. Illegal yet developmentally normative: a descriptive analysis of young, urban adolescents’ dating and sexual behaviour in Cape Town, South Africa

    PubMed Central

    2013-01-01

    Background In South Africa, it is illegal for adolescents under age 16 years to engage in any sexual behaviour whether kissing, petting, or penetrative sex, regardless of consent. This cross-sectional study investigated the extent to which young adolescents engage in various sexual behaviours and the associations between dating status and sexual behaviours. Method Grade 8 adolescents (N = 474, ages 12–15 years, mean = 14.14 years) recruited from Cape Town schools completed surveys providing information about their sociodemographic backgrounds, dating experience, sexual behaviour, and substance use. Results Lower hierarchy sexual behaviours, such as kissing (71.4% of girls; 88.4% of boys), were more common than oral (3.9% of girls; 13.8% of boys), vaginal (9.3% of girls; 30.0% of boys), or anal (1.4% of girls; 10.5% of boys) sex. Currently dating girls and boys were more likely to engage in sexual behaviours including several risk behaviours in comparison to their currently non-dating counterparts. These risk behaviours included penetrative sex (21.1% of dating vs. 4.5% of non-dating girls; 49.4% of dating vs. 20.2% of non-dating boys), sex with co-occurring substance use (22.2% of dating vs. 0 non-dating girls; 32.1% of dating vs. 40% of non-dating boys), and no contraceptive use (26.1% of sexually experienced girls; 44.4% of sexually experienced boys). Among girls, there were significant associations between ever having penetrative sex and SES (OR = 2.592, p = 0.017) and never dating (OR = 0.330, p = 0.016). Among boys, there were significant associations between ever having penetrative sex and never dating (OR = 0.162, p = 0.008). Although the currently dating group of young adolescents appear to be a precocious group in terms of risk behaviour relative to the currently non-dating group, teenagers in both groups had experience in the full range of sexual behaviours. Conclusions Many young adolescents are engaging in a variety

  16. Opportunities for technology-based HIV prevention programming among high school students in Cape Town, South Africa

    PubMed Central

    Mwaba, Kelvin; Prescott, Tonya L.; Roman, Nicolette V.; Rooi, Bronwyn; Bull, Sheana

    2014-01-01

    One in three new cases of HIV in South Africa is among adolescents. Given that adolescents are particularly affected, scalable and cost-effective prevention programs are urgently needed. This study aims to identify opportunities to integrate technology into youth HIV prevention efforts. In 2012, 1,107 8th – 11th graders completed a paper-and-pencil survey. Respondents were enrolled in one of three public high schools in Langa. Because it is the closest black township to Cape Town, Langa has the highest density of people in the region. Eighty-nine percent of respondents have used text messaging (SMS) and 86% have gone online. If an HIV prevention program was offered online, 66% of youth would be somewhat or extremely likely to access it; slightly fewer (55%) felt the same about SMS-based programming. In comparison, 85% said they would be somewhat or extremely likely to access a school-based HIV prevention program. Interest in Internet-(60%) and SMS-based (54%) HIV prevention programming was similar for youth who had a self-appraised risk for HIV compared to youth who appraised their risk to be lower, as it was for youth who were tired of hearing messages about HIV prevention. Technology use is common – even among high school students who live in lower income communities. At the same time, these data reveal that it is not uncommon for youth to be tired of hearing messages about HIV prevention, and many of the typical topics key to HIV prevention have low interest levels among youth. HIV prevention researchers need to be mindful of the extent of existing programming that youth are exposed to. Technology-based programming may be especially amenable to meeting these requirements because of its novelty especially in developing countries, and because interactive functionality can be easily integrated into the program design. Given the preference for school- and Internet-based programming, it seems that a hybrid approach is likely feasible and acceptable. PMID:25022287

  17. Multidimensional GIS modeling of magnetic mineralogy as a proxy for fire use and spatial patterning: evidence from the Middle Stone Age bearing sea cave of Pinnacle Point 13B (Western Cape, South Africa).

    PubMed

    Herries, Andy I R; Fisher, Erich C

    2010-01-01

    This paper aims to identify the spatial patterning of burning and occupation within an early Middle Stone Age (MSA) sea cave in the Western Cape Province of South Africa by creating a multidimensional model of archaeomagnetic data recovered from all excavated units. Magnetic susceptibility and other mineral magnetic parameters are shown to provide an excellent proxy for the anthropogenic alteration and spread of burnt material into the surrounding unaltered cave deposits. The identification of combustion features and areas of occupation or different activities within the site can be determined because the movement of people throughout the cave mixes magnetically strong hearth material with magnetically weak unaltered sediments. This is also indicated by micromorphological analysis. The degree of enhancement is also shown to indicate the extent to which a deposit has been altered, and therefore, intensity of occupation, because multiple heatings of deposits are needed to form the concentrations of iron minerals occurring in some layers. This is further supported by a comparison with artifact density for the layers. Variation in the magnetic values between different areas of the site is noted with major occupation or fire building occurring in the front of the cave during earlier MIS 6 periods, while during later MIS 5 periods the entire cave is occupied intensively. The oldest, MIS 11 deposits at the rear of the cave indicate no evidence of enhancement and an apparent absence of any anthropogenic signature.

  18. Faunal assemblage composition and paleoenvironment of Plovers Lake, a Middle Stone Age locality in Gauteng Province, South Africa.

    PubMed

    de Ruiter, Darryl J; Brophy, Juliet K; Lewis, Patrick J; Churchill, Steven E; Berger, Lee R

    2008-12-01

    Plovers Lake is a dolomitic cave infill located approximately 45km northwest of Johannesburg in the Bloubank Valley, Gauteng Province, South Africa. Excavations between 2002-2004 revealed a rich and diverse fauna, a moderate-sized stone tool assemblage of Middle Stone Age (MSA) character, and human skeletal remains. Two principal depositional units are recognized: 1) a disturbed ex situ component that was likely displaced from 2) an otherwise relatively undisturbed in situ component from which the human skeletal material was recovered. The in situ depositional unit is bracketed by 2 flowstone layers, with U-series dates of 62.9 (+/-1.3)ka for the capping flowstone and 88.7 (+/-1.6)ka for the underlying flowstone. A single isochron ESR date of 75.6 (+/-5.6)ka corroborates the U-series dates. This paper presents an analysis of the mammalian, bird, and reptile faunas recovered from these two units. The two faunal assemblages show close correspondence in taphonomic, taxonomic, and ecological composition, supporting a common origin for both the ex situ and in situ components. Although human skeletal material, cut-marked bone, and stone tools have been recovered, these indications are too rare to consider Plovers Lake a human occupation site. Instead, a high abundance of carnivores, coprolites, and carnivore damaged bones point to brown hyenas as the principal, though not exclusive, bone accumulating agent. In the absence of a significant taphonomic bias relating to accumulating agent, Plovers Lake allows us to document an environment occupied by MSA humans, even if the humans were not resident in the cave itself. We reconstruct the paleoenvironment of Plovers Lake as predominantly grassland, though it was colder, moister, and more wooded than at present. Paleoclimatic conditions appear to have been as different from historic norms as those seen in several fossil localities in the Western Cape, pointing to greater environmental heterogeneity than has previously been

  19. The "Affective Place-Making" Practices of Girls at a High School in Cape Town, South Africa

    ERIC Educational Resources Information Center

    Rinquest, Elzahn; Fataar, Aslam

    2016-01-01

    This article focuses on the "affective place-making" practices of girls at a private high school on the outskirts of Cape Town. The article responds to the question: How do high school girls' affects and social bodies contribute to their place-making practices and to the type of place they make of their school? Our focus is on…

  20. Prevalence and predictors of problematic alcohol use, risky sexual practices and other negative consequences associated with alcohol use among safety and security employees in the Western Cape, South Africa

    PubMed Central

    2014-01-01

    Introduction Harmful alcohol use can compromise worker health and productivity. Persons employed in safety-sensitive occupations are particularly vulnerable to hazardous alcohol use and its associated risks. This study describes the patterns of harmful alcohol use, related HIV risks and risk factors for the harmful use of alcohol among a sample of employees in South Africa working in the safety and security sector. Methods A cross-sectional study that formed the baseline for a clustered randomized control trial was undertaken in 2011. A random sample of 325 employees employed within a safety and security sector of a local municipality in the Western Cape Province of South Africa participated in the study. Data were collected by means of an 18-page self-administered structured questionnaire and analyzed using SAS/STAT software version 9.2. For all significance testing, the F-statistic and p-values are reported. Results Three hundred and twenty-five employees were surveyed. Findings suggest that more than half (76.1%) of the 78.9% of participants who consumed alcohol engaged in binge drinking, with close to a quarter reporting a CAGE score greater than the cut-off of 2, indicating potentially hazardous drinking patterns. The study further found that employees who use alcohol are more likely to engage in risky sexual practices when under the influence. A favorable drinking climate (p < 0.001) and poor levels of group cohesion (p = 0.009) were significantly correlated to binge drinking. Conclusion This study identifies alcohol-related behaviors and associated risks in the context of safety-sensitive occupations at the workplace. It suggests that persons employed within such positions are at high risk for developing alcohol-related disorders and for contracting HIV. This study highlights the need for testing a comprehensive package of services designed to prevent hazardous alcohol use among safety and security employees. PMID:24593946

  1. Post break-up tectonic inversion across the southwestern cape of South Africa: New insights from apatite and zircon fission track thermochronometry

    NASA Astrophysics Data System (ADS)

    Wildman, Mark; Brown, Roderick; Watkins, Ron; Carter, Andrew; Gleadow, Andrew; Summerfield, Michael

    2015-07-01

    The south-west African margin is regarded as an example of a passive continental margin formed by continental rifting following a phase of lithospheric extension and thinning. Recent attention focused on this margin has included theoretical modelling studies of rift processes, plate kinematic studies of the opening geometry and timing, and empirical studies focused on documenting the crustal structure and offshore sedimentary record. Here, we examine the onshore geomorphic and tectonic response to rifting and breakup, with a specific focus on the SW Cape of South Africa. We present 75 new apatite and 8 new zircon fission track analyses from outcrop samples and onshore borehole profiles along the western margin of South Africa. The data are used to derive robust thermal histories that record two discrete phases of accelerated erosional cooling during the Early Cretaceous (150-130 Ma) and Late Cretaceous (100-80 Ma), respectively. Both periods of enhanced erosion are regional in extent, involved km-scale erosion, and extend well inland of the current escarpment zone, albeit with spatially variable intensity and style. The Late Cretaceous episode is also expressed more locally by tectonic reactivation and inversion of major faults causing km-scale differential displacement and erosion. The new AFT data do not exclude the possibility of modest surface uplift occurring during the Cenozoic, but they restrict the depth of regional Cenozoic erosion on the western margin to less than c. 1 km. The inferred pattern and chronology of erosion onshore is consistent with the key features and sediment accumulation patterns within the offshore Orange and Bredasdorp basins. It is suggested that the Late Cretaceous event was triggered by a combination of regional dynamic uplift augmented along the western margin and in the SW Cape by local tectonic forces arising from dextral displacement of the Falkland Plateau along the Falkland-Agulhas Fracture Zone.

  2. An Africanised Study of Astronomical History in the Northern Cape South Africa, for Purposes of Secondary and Higher Education Programmes

    NASA Astrophysics Data System (ADS)

    de Beer, K. J.; Hoffman, M. J.

    2007-07-01

    Dr M.J. Hoffman, Head of the Department Physics, University of the Free State (UFS), presented a paper at the Duineveld Secondary School in Upington, to enhance the idea of a natural observatory centre in the Northern Cape. Quite aptly, the National Institute for Higher Education: Northern Cape (NIHE) also invited a renowned African astronomer, Dr T Medupe, to address their graduation ceremony in 2005. However, Dr Albert Strydom, Programme Head of Tourism Management at the Central University for Technology, Free State (CUT), is very much aware of the delicate nature of this type of high scientific profile in Tourism Management. It is foreseen by Dr Kallie de Beer, Director of Distance Education, that teaching and learning in this field will predominantly be conducted via Open and Distance e-Learning (ODeL). Consequently, it is also important to understand the philosophy of ODeL within global and Africanized perspectives. Astronomy, in this case, offers excellent examples of Africanised science in practice to add scientific value to tourist packages in the Northern Cape. (www.saao.ac.za/assa/aahs).

  3. Relation of MAGSAT Anomalies to the Main Tectonic Provinces of South America

    NASA Technical Reports Server (NTRS)

    Lidiak, E. G.; Keller, G. R. (Principal Investigator); Yuan, D. W.; Longacre, M. B.

    1984-01-01

    Comparison of MAGSAT scalar magnetic anomaly data to the main tectonic provinces and boundaries of South America reveals a number of geologic correlations. South America is divisible into a broad platform of Precambrian shields and cratons separated by Phanerozoic basins, grabens and aulacogens to the east, the Phanerozoic Patagonian Platform to the south, and the Mesozoic to Cenozoic Andean Fold Belt and Caribbean Mountain System to the west and north. The continental shields are mainly more magnetic then continental basins and orogenic belts. Cratons, mainly covered by younger sedimentary rocks, are generally associated with magnetic gradients. Most of the anomalies associated with the Patagonian Platform are positive and have higher amplitudes eastward away from the Andean Fold Belt. The northern Andes are coincident with positive magnetic anomalies, whereas the central and southern Andes are associated mainly with negative anomalies.

  4. A multi-level analysis of risk perception, poverty and sexual risk-taking among young people in Cape Town, South Africa.

    PubMed

    Tenkorang, Eric Y; Maticka-Tyndale, Eleanor; Rajulton, Fernando

    2011-03-01

    Various studies have underscored the relevance of community-level factors to sexual behavior and HIV/AIDS prevention efforts in Africa. However, there is a paucity of research and theorizing in this area compared to the preponderance of prevention models that focus solely on individual-level factors. Using data from the Cape Area Panel Survey and hierarchical linear models, this study examines the effects of a combination of individual-level factors and community-level poverty on sexual behaviors. Male and female respondents who perceived themselves to be at great risk of HIV infection were less likely to indulge in risky sexual behaviors. For females, race and community-level poverty were confounded such that race mediated the effects of community-level poverty. Results from this study indicate that multiple rationalities affect sexual behaviors in Cape Town, South Africa and that there is a need to consider both the social embeddedness of sexual behaviors and the rational components of decision making when designing HIV/AIDS prevention programs.

  5. The Impact of Densification by Means of Informal Shacks in the Backyards of Low-Cost Houses on the Environment and Service Delivery in Cape Town, South Africa

    PubMed Central

    Govender, Thashlin; Barnes, Jo M.; Pieper, Clarissa H.

    2011-01-01

    This paper investigates the state-sponsored low cost housing provided to previously disadvantaged communities in the City of Cape Town. The strain imposed on municipal services by informal densification of unofficial backyard shacks was found to create unintended public health risks. Four subsidized low-cost housing communities were selected within the City of Cape Town in this cross-sectional survey. Data was obtained from 1080 persons with a response rate of 100%. Illegal electrical connections to backyard shacks that are made of flimsy materials posed increased fire risks. A high proportion of main house owners did not pay for water but sold water to backyard dwellers. The design of state-subsidised houses and the unplanned housing in the backyard added enormous pressure on the existing municipal infrastructure and the environment. Municipal water and sewerage systems and solid waste disposal cannot cope with the increased population density and poor sanitation behaviour of the inhabitants of these settlements. The low-cost housing program in South Africa requires improved management and prudent policies to cope with the densification of state-funded low-cost housing settlements. PMID:21695092

  6. Environmental monitoring of pesticide residues from farms at a neighbouring primary and pre-school in the Western Cape in South Africa.

    PubMed

    Dalvie, M A; Sosan, M B; Africa, A; Cairncross, E; London, L

    2014-01-01

    Concerns about pesticide drift from neighbouring vineyards affecting children attending school on a farm adjacent to an urban suburb of Cape Town, Western Cape in South Africa were investigated. The study involved a before-after design, measuring levels of environmental exposure before and during pesticide application activities on the neighbouring farms. Samples were collected in air, dust and grass cuttings at the preschool and primary school located on the farms during September-December in 2010 and tested for pesticides using multi-pesticide methods. Eleven different pesticides were detected in the various samples. Six of these chemicals (endosulfan, dimethomorph, penconazole, cyprodinil, boscalid and bromopropylate) were on the spraying schedules of the two farms neighbouring the schools and the timing and location of detection were generally consistent with farm application. Three pesticides detected (chlorpyrifos, cypermethrin, permethrin) are agents commonly used in household applications and one (pyriproxifen) is used in pet treatment agents. Kresoxim-methyl, the other pesticide detected, is likely to come from drift from other farms in the area. The concentration of pesticides was all lower than 0.1 μg/m(3) in air and 0.1 μg/kg in dust and grass apart from permethrin and cypermethrin. The findings confirm the presence of drift onto the school premises and concentrations found in this study were generally low in comparison to that detected in other studies. Regular monitoring to track the effectiveness of containment and mitigation measures that reduce drift is recommended.

  7. Challenges Experienced by District-Based Support Teams in the Execution of Their Functions in a Specific South African Province

    ERIC Educational Resources Information Center

    Makhalemele, Thabo; Nel, Mirna

    2016-01-01

    This article reports on the findings of an embedded mixed-method South African study that investigated the challenges experienced by District-Based Support Team (DBST) members in the sub-directorate of Inclusive Education of a South African province in the execution of their functions. A Likert-scale questionnaire and individual semi-structured…

  8. Heat effects of ambient apparent temperature on all-cause mortality in Cape Town, Durban and Johannesburg, South Africa: 2006-2010.

    PubMed

    Wichmann, Janine

    2017-06-01

    Due to climate change, an increase of 3-4°C in ambient temperature is projected along the South African coast and 6-7°C inland during the next 80years. The objective of this study was to investigate the association between daily ambient apparent temperature (Tapp) and daily all-cause non-accidental mortality (hereafter mortality) in Cape Town, Durban and Johannesburg during a 5-year study period (2006-2010). Susceptibility by sex and age groups (<15years, 15-64years and ≥65years) was also investigated. The associations were investigated with the time-stratified case-crossover epidemiological design. Models were controlled for PM10, public holidays and influenza epidemics. City-specific Tapp thresholds were determined using quasi-Poisson generalised additive models. The pooled estimates by sex and age groups were determined in meta-analyses. The city-specific Tapp thresholds were 18.6°C, 24.8°C and 18.7°C, respectively for Cape Town, Durban and Johannesburg. A 3.3%, 2.6% and 2.8% increase in mortality per IQR increase in Tapp (lag0-1) was observed in Cape Town, Durban and Johannesburg, respectively above the city-specific thresholds. The elderly were more at risk in Cape Town and Johannesburg. No difference in risk was observed for males and females in the three cities. In the meta-analysis an overall significant increase of 0.9% in mortality per 1°C increase in Tapp (lag0-1) was observed for all age groups combined in the three cities. For the ≥65year group a significant increase of 2.1% in mortality was observed. In conclusion, the risks for all age groups combined and the elderly are similar to those reported in studies from developed and developing countries. The results can be used in present-day early warning systems and in risk assessments to estimate the impact of increased Tapp in the country due to climate change. Future research should investigate the association between Tapp and cause-specific mortality and also morbidity.

  9. South Sumatra Basin Province, Indonesia; the Lahat/Talang Akar-Cenozoic total petroleum system

    USGS Publications Warehouse

    Bishop, Michele G.

    2000-01-01

    Oil and gas are produced from the onshore South Sumatra Basin Province. The province consists of Tertiary half-graben basins infilled with carbonate and clastic sedimentary rocks unconformably overlying pre-Tertiary metamorphic and igneous rocks. Eocene through lower Oligocene lacustrine shales and Oligocene through lower Miocene lacustrine and deltaic coaly shales are the mature source rocks. Reserves of 4.3 billion barrels of oil equivalent have been discovered in reservoirs that range from pre-Tertiary basement through upper Miocene sandstones and carbonates deposited as synrift strata and as marine shoreline, deltaic-fluvial, and deep-water strata. Carbonate and sandstone reservoirs produce oil and gas primarily from anticlinal traps of Plio-Pleistocene age. Stratigraphic trapping and faulting are important locally. Production is compartmentalized due to numerous intraformational seals. The regional marine shale seal, deposited by a maximum sea level highstand in early middle Miocene time, was faulted during post-depositional folding allowing migration of hydrocarbons to reservoirs above the seal. The province contains the Lahat/Talang Akar-Cenozoic total petroleum system with one assessment unit, South Sumatra.

  10. Individual- and Neighbourhood-Level Indicators of Subjective Well-Being in a Small and Poor Eastern Cape Township: The Effect of Health, Social Capital, Marital Status, and Income

    ERIC Educational Resources Information Center

    Cramm, J. M.; Moller, V.; Nieboer, A. P.

    2012-01-01

    Our study used multilevel regression analysis to identify individual- and neighbourhood-level factors that determine individual-level subjective well-being in Rhini, a deprived suburb of Grahamstown in the Eastern Cape province of South Africa. The Townsend index and Gini coefficient were used to investigate whether contextual neighbourhood-level…

  11. Stable isotope and 14C study of biogenic calcrete in a termite mound, Western Cape, South Africa, and its palaeoenvironmental significance

    NASA Astrophysics Data System (ADS)

    Potts, Alastair J.; Midgley, Jeremy J.; Harris, Chris

    2009-09-01

    Late Quaternary terrestrial climate records from the semi-arid zone of the Western Cape of South Africa are rare. However, palaeoenvironmental information may be inferred from ancient termite mounds of the region. Calcrete lenses in these mounds have δ 13C and δ 18O values that show systematic changes with radiocarbon dates, which range from 33,629-36,709 to 21,676-23,256 cal yr BP. These dates confirm that these heuweltjies had been present in the landscape since the last glacial period. The decrease in δ 13C and δ 18O from 33,629-36,709 to 21,676-23,256 cal yr BP indicates that climate information is recorded by the calcretes. It is suggested that a progressive decline in air temperature and an increase in moisture availability, and a decline in abundance of C 4 or CAM plants, occurred in the region during the time heuweltjie calcite precipitated.

  12. Techno-Cultural Characterization of the MIS 5 (c. 105 - 90 Ka) Lithic Industries at Blombos Cave, Southern Cape, South Africa.

    PubMed

    Douze, Katja; Wurz, Sarah; Henshilwood, Christopher Stuart

    2015-01-01

    Blombos Cave is well known as an important site for understanding the evolution of symbolically mediated behaviours among Homo sapiens during the Middle Stone Age, and during the Still Bay in particular. The lower part of the archaeological sequence (M3 phase) contains 12 layers dating to MIS 5 with ages ranging from 105 to 90 ka ago (MIS 5c to 5b) that provide new perspectives on the technological behaviour of these early humans. The new data obtained from our extensive technological analysis of the lithic material enriches our currently limited knowledge of this time period in the Cape region. By comparing our results with previously described lithic assemblages from sites south of the Orange River, we draw new insights on the extent of the techno-cultural ties between these sites and the M3 phase at Blombos Cave and highlight the importance of this phase within the Middle Stone Age cultural stratigraphy.

  13. The perceived benefit of the disability grant for persons living with HIV in an informal settlement community in the Western Cape, South Africa.

    PubMed

    Woolgar, Helen Louise; Mayers, Pat M

    2014-01-01

    For persons living with HIV (PLWH) in limited socioeconomic circumstances in South Africa, social grants for disability have contributed significantly to alleviate poverty, yet there is a risk that recipients may lose these grants once they are clinically stable on antiretroviral therapy (ART). Our qualitative research explored perceptions and experiences of PLWH on ART concerning the social grant for disability and its contribution to health. Three focus groups were conducted with 15 purposively selected participants who attended a primary care clinic in the Western Cape. A thematic data analysis approach revealed two themes: (a) disability grants as a means of survival and (b) disability grants and ART adherence. The disability grant was considered an essential source of income and, for some, the sole means of survival. Participants valued their health more than the income, however, and, despite the risk of losing the grant, remained adherent to ART.

  14. Rumen ciliates in the African (Cape) buffalo (Syncerus caffer caffer) living in the vicinity of the Orpen Gate entrance into Kruger National Park, South Africa.

    PubMed

    Booyse, Dirk G; Dehority, Burk A; Reininghaus, Björn

    2014-07-31

    Samples of rumen contents were obtained from 10 African (Cape) buffalo living in the vicinity of the Orpen Gate entrance into Kruger National Park in South Africa. Total number of ciliate protozoa per animal ranged from 3.15 to 23.25 x 103. Forty three different species and forms were observed, of which 35 are a new host record. The total number of species and forms per animal varied from 10 to 17. Eudiplodinium maggii occurred in all 10 animals, followed by Dasytricha ruminantium in nine animals. Diplodinium posterovesiculatum, Eudiplodinium magnodentatum and Ostracodinium mammosum were present in seven animals with all other species and forms occurring in five or less animals. 

  15. Techno-Cultural Characterization of the MIS 5 (c. 105 – 90 Ka) Lithic Industries at Blombos Cave, Southern Cape, South Africa

    PubMed Central

    Douze, Katja; Wurz, Sarah; Henshilwood, Christopher Stuart

    2015-01-01

    Blombos Cave is well known as an important site for understanding the evolution of symbolically mediated behaviours among Homo sapiens during the Middle Stone Age, and during the Still Bay in particular. The lower part of the archaeological sequence (M3 phase) contains 12 layers dating to MIS 5 with ages ranging from 105 to 90 ka ago (MIS 5c to 5b) that provide new perspectives on the technological behaviour of these early humans. The new data obtained from our extensive technological analysis of the lithic material enriches our currently limited knowledge of this time period in the Cape region. By comparing our results with previously described lithic assemblages from sites south of the Orange River, we draw new insights on the extent of the techno-cultural ties between these sites and the M3 phase at Blombos Cave and highlight the importance of this phase within the Middle Stone Age cultural stratigraphy. PMID:26580219

  16. The use of visual methods to explore how children construct and assign meaning to the “self” within two urban communities in the Western Cape, South Africa

    PubMed Central

    Benninger, Elizabeth; Savahl, Shazly

    2016-01-01

    This study aimed to explore how children construct and assign meaning to the “self” within two urban communities of Cape Town in South Africa. Using a child participation methodological framework data were collected using Photovoice and community maps with 54 participants between the ages of 9 and 12. Feelings of safety, social connectedness, and children's spaces were found to be central to the ways in which the participants constructed and assigned meaning to the “self.” The study provides implications for intervention programmes aimed at improving children's well-being to be inclusive of activities aimed at improving children's self-concept, including the construction of safe spaces for children to play, learn, and form meaningful relationships. PMID:27291161

  17. Lead exposure in adult males in urban Transvaal Province, South Africa during the apartheid era.

    PubMed

    Hess, Catherine A; Cooper, Matthew J; Smith, Martin J; Trueman, Clive N; Schutkowski, Holger

    2013-01-01

    Human exposure to lead is a substantial public health hazard worldwide and is particularly problematic in the Republic of South Africa given the country's late cessation of leaded petrol. Lead exposure is associated with a number of serious health issues and diseases including developmental and cognitive deficiency, hypertension and heart disease. Understanding the distribution of lifetime lead burden within a given population is critical for reducing exposure rates. Femoral bone from 101 deceased adult males living in urban Transvaal Province (now Gauteng Province), South Africa between 1960 and 1998 were analyzed for lead concentration by Inductively Coupled Plasma Mass Spectrometry (ICP-MS). Of the 72 black and 29 white individuals sampled, chronic lead exposure was apparent in nearly all individuals. White males showed significantly higher median bone lead concentration (ME = 10.04 µg·g(-1)), than black males (ME = 3.80 µg·g(-1)) despite higher socioeconomic status. Bone lead concentration covaries significantly, though weakly, with individual age. There was no significant temporal trend in bone lead concentration. These results indicate that long-term low to moderate lead exposure is the historical norm among South African males. Unexpectedly, this research indicates that white males in the sample population were more highly exposed to lead.

  18. Antioxidant and phytochemical properties of Carpobrotus edulis (L.) bolus leaf used for the management of common infections in HIV/AIDS patients in Eastern Cape Province

    PubMed Central

    2012-01-01

    Background Carpobrotus edulis (Mesembryanthemaceae), also known as igcukuma in Xhosa language is a medicinal plant used by the traditional healers to treat common infections in HIV/AIDS patients. Based on this information, we researched on the plant phytoconstituents, as well as its inhibitory effect using aqueous and three different organic solvent extracts in order to justify its therapeutic usage. Methods Antioxidant activity of the extracts were investigated spectrophotometrically against 1,1- diphenyl-2-picrylhydrazyl (DPPH), 2,2’-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) (ABTS) diammonium salt, hydrogen peroxide (H2O2), nitric oxide (NO), and ferric reducing power, Total phenols, flavonoids, flavonols, proanthocyanidins, tannins, alkaloids and saponins were also determined using the standard methods. Results Quantitative phytochemical analysis of the four solvent extracts revealed a high percentage of phenolics (55.7 ± 0.404%) in the acetone extract, with appreciable amount of proanthocyanidins (86.9 ± 0.005%) and alkaloids (4.5 ± 0.057%) in the aqueous extract, while tannin (48.9 ± 0.28%) and saponin (4.5 ± 0.262%) were major constituents of the ethanol extract. Flavonoids (0.12 ± 0.05%) and flavonols (0.12 ± 0.05%) were found at higher level in the hexane extract in comparison with the other extracts. The leaf extracts demonstrated strong hydrogen peroxide scavenging activity, with the exception of water and ethanol extracts. IC50 values of the aqueous and ethanolic extract against DPPH, ABTS, and NO were 0.018 and 0.016; 0.020 and 0.022; 0.05 and 0.023 mg/ml, respectively. The reducing power of the extract was found to be concentration dependent. Conclusion The inhibitory effect of the extracts on free radicals may justify the traditional use of this plant in the management of common diseases in HIV/AIDs patients in Eastern Cape Province. Overall, both aqueous and ethanol were found to be the best solvents for

  19. Nine-locus Y-STR profiles of Afrikaner Caucasian and mixed ancestry populations from Cape Town, South Africa.

    PubMed

    Ehrenreich, Liezle; Benjeddou, Mongi; Davison, Sean; D'Amato, Maria; Leat, Neil

    2008-07-01

    Samples were collected from 108 Afrikaner males and 114 males of mixed ancestry. The term mixed ancestry is being used to denote a complex community which was established with contributions from Asians, Caucasians and Indigenous populations and constitutes a significant proportion of the Cape Town metropolitan population. Allele and haplotype frequencies were determined for nine Y-STR loci (DYS19, DYS389-I, DYS389-II, DYS390, DYS391, DYS392, DYS393 and the duplicated locus DYS385). Unique haplotypes were obtained for 64 Afrikaner males and 90 males of mixed ancestry. Both population groups shared the same most common haplotype.

  20. Prospects for biological control of Cape-ivy with the Cape-ivy fly and the cape-ivy moth

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cape-ivy (Delairea odorata, Asteraceae), native to coastal floodplains and mountain riparian zones in eastern South Africa, is an invasive vine in coastal riparian, woodland and scrub habitats in California and southern Oregon. Cape-ivy smothers native vegetation and may impair water flow in coastal...

  1. Maps showing geology, oil and gas fields, and geological provinces of South America

    USGS Publications Warehouse

    Schenk, C. J.; Viger, R.J.; Anderson, C.P.

    1999-01-01

    This digitally compiled map includes geology, geologic provinces, and oil and gas fields of South America. The map is part of a worldwide series on CD-ROM by World Energy Project released of the U.S. Geological Survey . The goal of the project is to assess the undiscovered, technically recoverable oil and gas resources of the world and report these results by the year 2000. For data management purposes the world is divided into eight energy regions corresponding approximately to the economic regions of the world as defined by the U.S. Department of State. South America (Region 6) includes Argentina, Bolivia, Brazil, Chile, Columbia, Ecuador, Falkland Islands, French Guiana, Guyuna, Netherlands, Netherlands Antilles, Paraguay, Peru, Suriname, Trinidad and Tobago, Uruguay, and Venezuela.

  2. Knowledge and perceptions of risk for cardiovascular disease: Findings of a qualitative investigation from a low-income peri-urban community in the Western Cape, South Africa

    PubMed Central

    Steyn, Krisela; Everett-Murphy, Katherine; Gaziano, Thomas A.; Levitt, Naomi

    2015-01-01

    Background South Africa currently faces an increasing burden of cardiovascular disease. Although referred to clinics after community screening initiatives, few individuals who are identified to be at high risk for developing cardiovascular disease attend. Low health literacy and risk perception have been identified as possible causes. We investigated the knowledge and perceptions about risk for cardiovascular disease in a community. Method We conducted a series of focus group discussions with individuals from a low-income peri-urban community in the Western Cape, South Africa. Different methods of presenting risk were explored. The data were organised into themes and analysed to find associations between themes to provide explanations for our findings. Results Respondents’ knowledge of cardiovascular disease and its risk factors varied, but most were familiar with the terms used to describe cardiovascular disease. In contrast, understanding of the concept of risk was poor. Risk was perceived as a binary concept and evaluation of different narrative and visual methods of presenting risk was not possible. Conclusion Understanding cardiovascular disease and its risk factors requires a different set of skills from that needed to understand uncertainty and risk. The former requires knowledge of facts, whereas understanding of risk requires numerical and computational skills. Without a better understanding of risk, risk assessments for cardiovascular disease may fail in this community. PMID:26842511

  3. A social network typology and sexual risk-taking among men who have sex with men in Cape Town and Port Elizabeth, South Africa.

    PubMed

    de Voux, Alex; Baral, Stefan D; Bekker, Linda-Gail; Beyrer, Chris; Phaswana-Mafuya, Nancy; Siegler, Aaron J; Sullivan, Patrick S; Winskell, Kate; Stephenson, Rob

    2016-01-01

    Despite the high prevalence of HIV among men who have sex with men in South Africa, very little is known about their lived realities, including their social and sexual networks. Given the influence of social network structure on sexual risk behaviours, a better understanding of the social contexts of men who have sex with men is essential for informing the design of HIV programming and messaging. This study explored social network connectivity, an understudied network attribute, examining self-reported connectivity between friends, family and sex partners. Data were collected in Cape Town and Port Elizabeth, South Africa, from 78 men who have sex with men who participated in in-depth interviews that included a social network mapping component. Five social network types emerged from the content analysis of these social network maps based on the level of connectivity between family, friends and sex partners, and ranged from disconnected to densely connected networks. The ways in which participants reported sexual risk-taking differed across the five network types, revealing diversity in social network profiles. HIV programming and messaging for this population can greatly benefit from recognising the diversity in lived realities and social connections between men who have sex with men.

  4. 'One Man Can': shifts in fatherhood beliefs and parenting practices following a gender-transformative programme in Eastern Cape, South Africa.

    PubMed

    van den Berg, Wessel; Hendricks, Lynn; Hatcher, Abigail; Peacock, Dean; Godana, Patrick; Dworkin, Shari

    2013-02-01

    'One Man Can' (OMC) is a rights-based gender equality and health programme implemented by Sonke Gender Justice in South Africa. It has been featured as an example of best practice by the World Health Organization, UNAIDS, and the UN Population Fund, and translated into nearly a dozen languages and implemented all across Africa. South Africa has strong gender and HIV-related policies, but the highest documented level of men's violence against women in the world, and the largest number of people living with HIV. In this context, OMC seeks to improve men's relationships with their partners, children, and families, reduce the spread and impact of HIV and AIDS, and reduce violence against women, men, and children. To understand whether and how OMC workshops brought about changes in men's attitudes and practices related to parenting, an academic-non-government organisation partnership was carried out with the University of California at San Francisco, the University of Cape Town, and Sonke. The workshops appear to have contributed powerfully to improved parenting and more involved and responsible fathering. This article shares our findings in more detail and discusses the promises and challenges of gender-transformative work with men, underscoring the implications of this work for the health and well-being of women, children, and men.

  5. “Coming to Town”: The Impact of Urbanicity, Cigarette Advertising, and Network Norms on the Smoking Attitudes of Black Women in Cape Town, South Africa

    PubMed Central

    Williams, Chyvette T.; Marks, Amy Seidel

    2008-01-01

    This study was conducted to examine the effect of urban living on smoking attitudes among black African women in South Africa. We examine how urbanicity affects attitudes toward smoking and how it moderates the relationship between both advertising exposure and network norms on black women’s smoking attitudes. Respondents were 975 black women currently living in Cape Town townships, some of which were raised in rural villages or small towns. Respondents completed a cross-sectional survey, which included data on smoking attitudes, norms, and exposure to cigarette advertising. Multiple linear regression analysis was performed with smoking attitudes as the response variable, and urbanicity, cigarette advertising exposure, and network smoking norms as primary explanatory variables. Interactions were tested to determine whether urbanicity modified the effect of advertising exposure and network norms on smoking attitudes. Independent effects of urbanicity, exposure to cigarette advertising, and greater smoking prevalence within women’s networks were associated with more favorable smoking attitudes. In addition, urbanicity moderated the relationship between network smoking norms and smoking attitudes, but not cigarette advertising exposure and smoking attitudes. Urbanicity, cigarette advertising, and networks play important roles in women’s attitudes toward smoking, and potentially, smoking behavior. Overall, our results suggest that strong and creative anti-smoking efforts are needed to combat the potential for a smoking epidemic among an increasingly urbanized population of black women in South Africa and similar emerging markets. Additional research is warranted. PMID:18563573

  6. Feasibility and Acceptability of Screening and Brief Interventions to Address Alcohol and Other Drug Use among Patients Presenting for Emergency Services in Cape Town, South Africa

    PubMed Central

    Myers, Bronwyn; Stein, Dan J.; Mtukushe, Bulelwa; Sorsdahl, Katherine

    2012-01-01

    Despite evidence from high income countries, it is not known whether screening and brief interventions (SBI) for alcohol and other drug (AOD) use are feasible to implement in low and middle income countries. This paper describes the feasibility and acceptability of a peer-led SBI for AOD-using patients presenting with injuries at emergency services in Cape Town, South Africa. Data were extracted from program records on the number of eligible patients screened and the number of program refusals. A questionnaire examined preliminary responses to the intervention for 30 patients who had completed the program and 10 emergency personnel. Peer counselors were also interviewed to identify barriers to implementation. Of the 1458 patients screened, 21% (305) met inclusion criteria, of which 74% (225) were enrolled in the intervention. Of the 30 patients interviewed, most (83%) found the program useful. Emergency personnel were supportive of the program but felt that visibility and reach could improve. Peer counselors identified the need for better integration of the program into emergency services and for additional training and support. In conclusion, with limited additional resources, peer-led SBIs for AOD use are feasible to conduct in South African emergency services and are acceptable to patients and emergency personnel. PMID:23198159

  7. ‘One Man Can’: shifts in fatherhood beliefs and parenting practices following a gender-transformative programme in Eastern Cape, South Africa

    PubMed Central

    van den Berg, Wessel; Hendricks, Lynn; Hatcher, Abigail; Peacock, Dean; Godana, Patrick; Dworkin, Shari

    2013-01-01

    ‘One Man Can’ (OMC) is a rights-based gender equality and health programme implemented by Sonke Gender Justice in South Africa. It has been featured as an example of best practice by the World Health Organization, UNAIDS, and the UN Population Fund, and translated into nearly a dozen languages and implemented all across Africa. South Africa has strong gender and HIV-related policies, but the highest documented level of men’s violence against women in the world, and the largest number of people living with HIV. In this context, OMC seeks to improve men’s relationships with their partners, children, and families, reduce the spread and impact of HIV and AIDS, and reduce violence against women, men, and children. To understand whether and how OMC workshops brought about changes in men’s attitudes and practices related to parenting, an academic–non-government organisation partnership was carried out with the University of California at San Francisco, the University of Cape Town, and Sonke. The workshops appear to have contributed powerfully to improved parenting and more involved and responsible fathering. This article shares our findings in more detail and discusses the promises and challenges of gender-transformative work with men, underscoring the implications of this work for the health and well-being of women, children, and men. PMID:24000276

  8. "Coming to town": the impact of urbanicity, cigarette advertising, and network norms on the smoking attitudes of black women in Cape Town, South Africa.

    PubMed

    Williams, Chyvette T; Grier, Sonya A; Marks, Amy Seidel

    2008-07-01

    This study was conducted to examine the effect of urban living on smoking attitudes among black African women in South Africa. We examine how urbanicity affects attitudes toward smoking and how it moderates the relationship between both advertising exposure and network norms on black women's smoking attitudes. Respondents were 975 black women currently living in Cape Town townships, some of which were raised in rural villages or small towns. Respondents completed a cross-sectional survey, which included data on smoking attitudes, norms, and exposure to cigarette advertising. Multiple linear regression analysis was performed with smoking attitudes as the response variable, and urbanicity, cigarette advertising exposure, and network smoking norms as primary explanatory variables. Interactions were tested to determine whether urbanicity modified the effect of advertising exposure and network norms on smoking attitudes. Independent effects of urbanicity, exposure to cigarette advertising, and greater smoking prevalence within women's networks were associated with more favorable smoking attitudes. In addition, urbanicity moderated the relationship between network smoking norms and smoking attitudes, but not cigarette advertising exposure and smoking attitudes. Urbanicity, cigarette advertising, and networks play important roles in women's attitudes toward smoking, and potentially, smoking behavior. Overall, our results suggest that strong and creative anti-smoking efforts are needed to combat the potential for a smoking epidemic among an increasingly urbanized population of black women in South Africa and similar emerging markets. Additional research is warranted.

  9. A 700-year history of climate change and human impact on the southern Cape coast inferred from lake sediments of Eilandvlei, Wilderness Embayment, South Africa

    NASA Astrophysics Data System (ADS)

    Reinwarth, Bastian; Franz, Sarah; Baade, Jussi; Haberzettl, Torsten; Kasper, Thomas; Daut, Gerhard; Helmschrot, Jörg; Kirsten, Kelly; Quick, Lynne; Meadows, Michael E.; Mäusbacher, Roland

    2013-04-01

    The environment of the southern Cape coast, South Africa, is sensitive to climate fluctuations as it is influenced by different atmospheric and oceanic circulation systems. Paleoecological evidence of Holocene climate variations in this region is presently limited, due to climatic conditions not supporting the accumulation and preservation of suitable sedimentary deposits. Here, we present a lake sediment record spanning approximately the last 670 years from Eilandvlei, a brackish coastal lake situated mid-way between Cape Town and Port Elizabeth. The results from geochemical and sedimentological analyses point to an increase of minerogenic sediment input from the catchment starting ~AD 1400. Changes in the seasonal distribution of rainfall during the Little Ice Age (LIA) may have altered hydrological conditions and possibly caused a recession of afrotemperate forest vegetation, increased erosion rates and fluvial sediment transport. A rising mean lake level, possibly associated with relative sea level rise, may offer an additional explanation for the deposition of finer sediments at the coring site. After AD 1450, reduced burial flux of organic carbon, nitrogen, phosphorous and other elements associated with autochthonous sediment formation may have resulted from ecological changes in Eilandvlei whereby submerged macrophytes were potentially constrained to shallower waters. Enhanced sedimentation rates, increasing carbon, nitrogen, phosphorous and biogenic silica concentrations as well as high concentrations of indicators for allochthonous sediment input (e.g., aluminium, titanium, zirconium) point to increasing sediment and nutrient flux into Eilandvlei from the late 19th century onwards. The most likely factor involved in these recent changes would appear to be land-use change and other forms of human impact.

  10. Genetic polymorphisms of the organic cation transporter 1 gene (SLC22A1) within the Cape Admixed population of South Africa.

    PubMed

    Du Plessis, Morne; Pearce, Brendon; Jacobs, Clifford; Hoosain, Nisreen; Benjeddou, Mongi

    2015-03-01

    Human organic cation transporter 1 (hOCT1) is expressed primarily in hepatocytes and mediate the electrogenic transport of various endogenous and exogenous compounds, including clinically important drugs. Genetic polymorphisms in the gene coding for hOCT1, SLC22A1, are increasingly being recognized as a possible mechanism explaining the variable response of individual patients to clinical drugs which are substrates for this transporter. The aim of this study was to investigate the allele and genotype frequencies of single-nucleotide polymorphisms (SNPs) of SLC22A1 in the Cape Admixed population of South Africa. The genotypic and allelic distributions of nineteen nonsynonomous and one intronic SLC22A1 SNPs were determined in 100 healthy Cape Admixed participants, using a SNaPshot(®) multiplex assay. In addition, haplotype structure for SLC22A1 was inferred from the genotypic data. The minor allele frequencies for S14F, P341L, S189L, G220V, V519F, M440I, G465R and the rs622342 intronic variant were 1.0, 0.5, 1.0, 1.0, 1.5, 0.5, 0.5 and 18.0%, respectively. None of the participants carried the variant allele for R61C, C88R, P283L, R287G and G401S. In addition, no variant alleles were observed for A306T, A413V, M420V, I421F, C436F, V501E, and I542V in the population. Twelve haplotypes were inferred from the genotypic data. The frequencies for most common haplotypes CCTCGGCGCGCTAGAGCTGA, CCTCGGCGCGCTAGCGCTGA and CCTCGGCGCGCGAGCGCTGA were 80, 9.9, and 3.5%, respectively.

  11. Cape Verde

    NASA Technical Reports Server (NTRS)

    2007-01-01

    This Mars Exploration Rover Opportunity Pancam 'super resolution' mosaic of the approximately 6 m (20 foot) high cliff face of the Cape Verde promontory was taken by the rover from inside Victoria Crater, during the rover's descent into Duck Bay. Super-resolution is an imaging technique which utilizes information from multiple pictures of the same target in order to generate an image with a higher resolution than any of the individual images. Cape Verde is a geologically rich outcrop and is teaching scientists about how rocks at Victoria crater were modified since they were deposited long ago. This image complements super resolution mosaics obtained at Cape St. Mary and Cape St. Vincent and is consistent with the hypothesis that Victoria crater is located in the middle of what used to be an ancient sand dune field. Many rover team scientists are hoping to be able to eventually drive the rover closer to these layered rocks in the hopes of measuring their chemistry and mineralogy.

    This is a Mars Exploration Rover Opportunity Panoramic Camera image mosaic acquired on sols 1342 and 1356 (November 2 and 17, 2007), and was constructed from a mathematical combination of 64 different blue filter (480 nm) images.

  12. Surveillance of Transmitted HIV-1 Drug Resistance in Gauteng and KwaZulu-Natal Provinces, South Africa, 2005–2009

    PubMed Central

    Ledwaba, J.; Basson, A. E.; Moyes, J.; Cohen, C.; Singh, B.; Bertagnolio, S.; Jordan, M. R.; Puren, A.; Morris, L.

    2012-01-01

    Surveillance of human immunodeficiency virus type 1 transmitted drug resistance (TDR) was conducted among pregnant women in South Africa over a 5-year period after the initiation of a large national antiretroviral treatment program. Analysis of TDR data from 9 surveys conducted between 2005 and 2009 in 2 provinces of South Africa suggests that while TDR remains low (<5%) in Gauteng Province, it may be increasing in KwaZulu-Natal, with the most recent survey showing moderate (5%–15%) levels of resistance to the nonnucleoside reverse transcriptase inhibitor drug class. PMID:22544199

  13. Evaluation of the CAPE and CORE Programs for Sensory-Impaired Multi-Handicapped Children in the Province of Alberta. Final Report.

    ERIC Educational Resources Information Center

    Rutland Consulting Group Ltd.

    The report presents summaries of evaluations of the Coordinated Assessment and Program Planning for Education (CAPE) Program and the Coordinated Rehabilitation and Education (CORE) program for multi-handicapped sensory impaired and/or communication and behavior disordered children and their families in Alberta, Canada. Each program is evaluated…

  14. School Language Profiles: Valorizing Linguistic Resources in Heteroglossic Situations in South Africa

    ERIC Educational Resources Information Center

    Busch, Brigitta

    2010-01-01

    Although South Africa is committed to a policy of linguistic diversity, the language-in-education policy is still plagued by the racialization of language issues under apartheid and, more recently, by new challenges posed by internal African migration. Drawing on the experience of a school in the Western Cape Province, this paper explores the role…

  15. Wellness and Academic Outcomes among Disadvantaged Students in South Africa: An Exploratory Study

    ERIC Educational Resources Information Center

    Morris-Paxton, Angela A.; Van Lingen, Johanna M.; Elkonin, Diane

    2017-01-01

    Objective: The aim of this study was to measure possible impacts of a salutogenic lifestyle education programme on wellness and academic outcomes in a group of socioeconomically disadvantaged students in the first year of higher education. Setting: University in the Eastern Cape Province, South Africa. Methods: A mixed-methods approach was…

  16. Resilient or Resigned? Criminal Victimisation and Quality of Life in South Africa

    ERIC Educational Resources Information Center

    Moller, Valerie

    2005-01-01

    A victimisation study conducted among 3300 householders in South Africa's Nelson Mandela Metropolitan Municipality (NMMM) in the Eastern Cape Province aimed to inform a crime prevention strategy for the metropolitan area. The study found that the variables "fear of crime' measured in terms of perceived likelihood of victimisation--and concern…

  17. Grade-Appropriate Literacy and South African Grade Seven Learners' Classroom Writing in English

    ERIC Educational Resources Information Center

    Hendricks, Monica

    2009-01-01

    This paper reports on the writing of grade seven learners in English as an additional language at four differently resourced schools in the Eastern Cape Province, South Africa. Because grade seven is the start of the senior phase of schooling, it is vital that learners achieve grade-level competence in the language used as medium of instruction.…

  18. Plant responses to climate in the Cape Floristic Region of South Africa: evidence for adaptive differentiation in the Proteaceae.

    PubMed

    Carlson, Jane E; Holsinger, Kent E; Prunier, Rachel

    2011-01-01

    Local adaptation along environmental gradients may drive plant species radiation within the Cape Floristic Region (CFR), yet few studies examine the role of ecologically based divergent selection within CFR clades. In this study, we ask whether populations within the monophyletic white protea clade (Protea section Exsertae, Proteaceae) differ in key functional traits along environmental gradients and whether differences are consistent with local adaptation. Using seven taxa, we measured trait-environment associations and selection gradients across 35 populations of wild adults and their offspring grown in two common gardens. Focal traits were leaf size and shape, specific leaf area (SLA), stomatal density, growth, and photosynthetic rate. Analyses on wild and common garden plants revealed heritable trait differences that were associated with gradients in rainfall seasonality, drought stress, cold stress, and less frequently, soil fertility. Divergent selection between gardens generally matched trait-environment correlations and literature-based predictions, yet variation in selection regimes among wild populations generally did not. Thus, selection via seedling survival may promote gradient-wide differences in SLA and leaf area more than does selection via adult fecundity. By focusing on the traits, life stages, and environmental clines that drive divergent selection, our study uniquely demonstrates adaptive differentiation among plant populations in the CFR.

  19. Trends in vegetation degradation in relation to land tenure, rainfall, and population changes in Peddie district, Eastern Cape, South Africa.

    PubMed

    Kakembo, V

    2001-07-01

    Spatial and temporal variations in vegetation are examined in relation to land tenure, population increase, and rainfall variation in a part of Peddie district, Eastern Cape. Sequential aerial photographs between 1938 and 1988 are analyzed to determine trends in vegetation and population change in three different land-tenure units. The areal extent at each date of four distinct vegetation categories is determined using PC ARC/INFO GIS. Long-term annual rainfall trends for the area are analyzed and juxtaposed with vegetation changes. Extensive ground-truthing exercises are carried out to verify the present condition of vegetation condition in terms of cover and species composition. Differences in land-tenure systems are discerned as the dominant factor controlling variations in vegetation degradation. The study also reveals that neither population changes nor rainfall variations can explain the observed trends in vegetation degradation. Earlier injudicious land-use practices, sustained since the turn of the last century, may provide plausible explanations for the trends and present status of vegetation degradation in the area.

  20. Assessment of Undiscovered Oil and Gas Resources of the Williston Basin Province of North Dakota, Montana, and South Dakota, 2008

    USGS Publications Warehouse

    Anna, Lawrence O.; Pollastro, Richard M.; Gaswirth, Stephanie B.; Lewan, Michael D.; Lillis, Paul G.; Roberts, Laura N.R.; Schenk, Christopher J.; Charpentier, Ronald R.; Cook, Troy A.; Klett, Timothy R.

    2008-01-01

    Using a geology-based assessment method, the U.S. Geological Survey estimated mean undiscovered volumes of 3.8 billion barrels of undiscovered oil, 3.7 trillion cubic feet of associated/dissolved natural gas, and 0.2 billion barrels of undiscovered natural gas liquids in the Williston Basin Province, North Dakota, Montana, and South Dakota.

  1. Student Perceptions of Agricultural Education Programme Processes at Selected High Schools in KwaZulu-Natal Province, South Africa

    ERIC Educational Resources Information Center

    Kidane, T. T.; Worth, S. H.

    2014-01-01

    Purpose: This study investigates student perceptions of different aspects of Agricultural Education and Training (AET) programme processes that have been offered in secondary schools by the formal educational sector in the province of KwaZulu-Natal, South Africa. The study seeks to identify the existing shortcomings in the implementation of the…

  2. Provenance and reconnaissance study of detrital zircons of the Palaeozoic Cape Supergroup in South Africa: revealing the interaction of the Kalahari and Río de la Plata cratons

    NASA Astrophysics Data System (ADS)

    Fourie, Pieter H.; Zimmermann, Udo; Beukes, Nicolas J.; Naidoo, Thanusha; Kobayashi, Katsuro; Kosler, Jan; Nakamura, Eizo; Tait, Jenny; Theron, Johannes N.

    2011-04-01

    In order to facilitate the understanding of the geological evolution of the Kalahari Craton and its relation to South America, the provenance of the first large-scale cratonic cover sequence of the craton, namely the Ordovician to Carboniferous Cape Supergroup was studied through geochemical analyses of the siliciclastics, and age determinations of detrital zircon. The Cape Supergroup comprises mainly quartz-arenites and a Hirnantian tillite in the basal Table Mountain Group, subgreywackes and mudrocks in the overlying Bokkeveld Group, while siltstones, interbedded shales and quartz-arenites are typical for the Witteberg Group at the top of the Cape Supergroup. Palaeocurrent analyses indicate transport of sediment mainly from northerly directions, off the interior of the Kalahari Craton with subordinate transport from a westerly source in the southwestern part of the basin near Cape Town. Geochemical provenance data suggest mainly sources from passive to active continental margin settings. The reconnaissance study of detrital zircons reveals a major contribution of Mesoproterozoic sources throughout the basin, reflecting the dominance of the Namaqua-Natal Metamorphic Belt, situated immediately north of the preserved strata of Cape Supergroup, as a source with Archaean-aged zircons being extremely rare. We interpret the Namaqua-Natal Metamorphic Belt to have been a large morphological divide at the time of deposition of the Cape Supergroup that prevented input of detrital zircons from the interior early Archaean Kaapvaal cratonic block of the Kalahari Craton. Neoproterozoic and Cambrian zircons are abundant and reflect the basement geology of the outcrops of Cape strata. Exposures close to Cape Town must have received sediment from a cratonic fragment that was situated off the Kalahari Craton to the west and that has subsequently drifted away. This cratonic fragment predominantly supplied Meso- to Neoproterozoic, and Cambrian-aged zircon grains in addition to minor

  3. Lamniform Shark Teeth from the Late Cretaceous of Southernmost South America (Santa Cruz Province, Argentina)

    PubMed Central

    Schroeter, Elena R.; Egerton, Victoria M.; Ibiricu, Lucio M.; Lacovara, Kenneth J.

    2014-01-01

    Here we report multiple lamniform shark teeth recovered from fluvial sediments in the (Campanian-Maastrichtian) Cerro Fortaleza Formation, Santa Cruz Province, Argentina. This small tooth assemblage is compared to various lamniform sharks possessing similar dental morphologies, including Archaeolamna, Cretalamna, Dwardius, Dallasiella, and Cretodus. Although the teeth share numerous morphological features with the genus Archaeolamna, including a developed neck that maintains a relatively consistent width along the base of the crown, the small sample size and incomplete nature of these specimens precludes definitive taxonomic assignment. Regardless, the discovery of selachian teeth unique from those previously described for the region broadens the known diversity of Late Cretaceous South American sharks. Additionally, the discovery of the teeth in fluvial sandstone may indicate a euryhaline paleobiology in the lamniform taxon or taxa represented by this tooth assemblage. PMID:25141301

  4. Cost effectiveness of clinical associates: A case study for the Mpumalanga province in South Africa

    PubMed Central

    Hamm, Joris; van Bodegraven, Petra; Louw, Jakobus M.

    2016-01-01

    Background The National Department of Health of South Africa decided to start a programme to train mid-level healthcare workers, called clinical associates, as one of the measures to increase healthcare workers at district level in rural areas. Unfortunately, very little is known about the cost effectiveness of clinical associates. Aims To determine, on a provincial level, the cost effectiveness of training and employing clinical associates and medical practitioners compared to the standard strategy of training and employing only more medical practitioners. Methods A literature study was performed to answer several sub questions regarding the costs and effectiveness of clinical associates. The results were used to present a case study. Results The total cost for a province to pay for the full training of a clinical associate is R 300 850. The average employment cost per year is R196 329 and for medical practitioners these costs are R 730 985 and R 559 397, respectively. Effectiveness Clinical associates are likely to free up the time of a medical practitioner by 50–76%. They can provide the same quality of care as higher level workers, provided that they receive adequate training, support and supervision. Furthermore, they seem more willing to work in rural areas compared to medical practitioners. Conclusions The case study showed that training and employing clinical associates is potentially a cost-effective strategy for a province to meet the increasing demand for rural healthcare workers. This strategy will only succeed when clinical associates receive adequate training, support and supervision and if the province keeps investing in them. PMID:28155324

  5. Adherence barriers and facilitators for cervical screening amongst currently disadvantaged women in the greater Cape Town region of South Africa

    PubMed Central

    De Abreu, Chantelle; Horsfall, Hannah

    2013-01-01

    Abstract Background In South Africa cervical cancer is the second most commonly occurring cancer amongst women, and black African women have the highest risk of developing this disease. Unfortunately, the majority of South African women do not adhere to recommended regular cervical screening. Objectives The purpose of this research was to explore the perceptions, experiences and knowledge regarding cervical screening of disadvantaged women in two informal settlements in South African urban areas. Method The Health Belief Model (HBM) provided a theoretical framework for this study. Four focus groups (n = 21) were conducted, using questions derived from the HBM, and thematic analysis was used to analyse the data. The ages of the women who participated ranged from 21 to 53 years. Results The analysis revealed lack of knowledge about screening as a key structural barrier to treatment. Other structural barriers were: time, age at which free screening is available, and health education. The psychosocial barriers that were identified included: fear of the screening procedure and of the stigmatisation in attending screening. The presence of physical symptoms, the perception that screening provides symptom relief, HIV status, and the desire to know one's physical health status were identified as facilitators of cervical screening adherence. Conclusion This knowledge has the potential to inform healthcare policy and services in South Africa. As globalisation persists and individuals continue to immigrate or seek refugee status in foreign countries, increased understanding and knowledge is required for successful acculturation and integration. Developed countries may therefore also benefit from research findings in developing countries.

  6. Sedimentology of granite boulder conglomerates and associated clastics in the onshore section of the late Mesozoic Pletmos Basin (Western Cape, South Africa)

    NASA Astrophysics Data System (ADS)

    Bordy, Emese M.; America, Travis

    2016-07-01

    Along the southern margin of South Africa, intermountain rift successions, which comprise unusually large, rounded granite boulders and other coarse clastics, reveal an important geological history about the mid-Mesozoic extensional tectonics that lead to the break-up of Gondwana. These strata, mapped as part of the Mid to Upper Jurassic Enon Formation, allow the assessment of the nature, intensity and mode of sediment transport in onshore section of the Pletmos Basin, which is one of the late Mesozoic basins in southern Africa. Based on sedimentary facies analysis, palaeocurrent measurements and semi-quantitative palaeohydraulic calculations, the results suggest that the abundant coarse sediment was deposited by debris-flows and stream-flow floods on a proximal alluvial fan with high gradient alluvial channels. The floods were intense with mean flow velocity of ˜6 m3/s and peak discharge of ˜450 m3/s. While the role of climate in the sedimentation dynamics remains unknown, syn-sedimentary rift tectonics were likely significant and caused, north of the major boundary fault, the unroofing and denudation of the uplifted mountainous source areas, including the Late Ediacaran-Cambrian Maalgaten Granite Suite and the Siluro-Ordovician Table Mountain Group (Cape Supergroup).

  7. Child road traffic crash injuries at the Red Cross War Memorial Children's Hospital in Cape Town, South Africa in 1992, 2002 and 2012.

    PubMed

    Isaac, Kihurani N; Van Niekerk, Ashley; Van As, Arjan Bastiaan

    2015-01-01

    Road traffic crashes are a significant cause of the disease burden among children, with the highest mortality in low- and middle-income countries. This observational study explores such injuries in Cape Town, South Africa through an analysis of data for cases in 1992, 2002 and 2012 at the Red Cross War Memorial Children's Hospital, a referral paediatric hospital for children younger than 13 years. Descriptive and time trend analysis of demographic data as well as of the causes, severity and place of injury was conducted. Logistic regression and generalised linear models described factors influencing hospital admission. In the years 1992, 2002 and 2012, a total of 4690 patients presented with injuries sustained as a result of a road traffic crash. Nearly 50% (n = 2201) of them were between five and nine years of age, with 1.7 males for every female. Three-quarters of those who got injured were pedestrians while the second most commonly injured ones were unrestrained passengers. The majority had minor injuries (58%), but with notably higher proportions with moderate to severe injuries in the years 2002 and 2012. Forty per cent were admitted for inpatient treatment, with the highest proportion (50%) in 2002. Admission was related to mechanism and severity. The epidemiological factors assessed remain largely unchanged over the assessment points calling into question the impact of local safety strategies.

  8. An Approach to Developing a Prediction Model of Fertility Intent Among HIV-Positive Women and Men in Cape Town, South Africa: A Case Study.

    PubMed

    Bai, Dan; Leu, Cheng-Shiun; Mantell, Joanne E; Exner, Theresa M; Cooper, Diane; Hoffman, Susie; Kelvin, Elizabeth A; Myer, Landon; Constant, Debbie; Moodley, Jennifer

    2017-02-01

    As a 'case-study' to demonstrate an approach to establishing a fertility-intent prediction model, we used data collected from recently diagnosed HIV-positive women (N = 69) and men (N = 55) who reported inconsistent condom use and were enrolled in a sexual and reproductive health intervention in public sector HIV care clinics in Cape Town, South Africa. Three theoretically-driven prediction models showed reasonable sensitivity (0.70-1.00), specificity (0.66-0.94), and area under the receiver operating characteristic curve (0.79-0.89) for predicting fertility intent at the 6-month visit. A k-fold cross-validation approach was employed to reduce bias due to over-fitting of data in estimating sensitivity, specificity, and area under the curve. We discuss how the methods presented might be used in future studies to develop a clinical screening tool to identify HIV-positive individuals likely to have future fertility intent and who could therefore benefit from sexual and reproductive health counseling around fertility options.

  9. Is Younger Really Safer? A Qualitative Study of Perceived Risks and Benefits of Age-Disparate Relationships among Women in Cape Town, South Africa

    PubMed Central

    Beauclair, Roxanne; Delva, Wim

    2013-01-01

    Young women in age-asymmetric relationships may be at an elevated risk for acquisition of HIV, since relationships with older men are also correlated with other risk behaviors like less condom use. Qualitative studies have shown that women are motivated to participate in these relationships for money and emotional support. However, there is a paucity of research on women’s perceived risks of these relationships, particularly in South Africa. To this end, we conducted in-depth interviews with 23 women recruited from three urban communities in Cape Town. A thematic question guide was used to direct the interviews. Thematic content analysis was used to explore women’s perceived risks of age-disparate and non-age-disparate relationships, the benefits of dating older men, and risk perceptions that influence decisions around beginning or ending a relationship. A plurality of women thought that dating an older man does not bring any adverse consequences, although some thought that older men do not use condoms and may be involved in concurrent partnerships. Many women were less inclined to date same-age or younger men, because they were viewed as being disrespectful and abusive. This study points to the need for more awareness raising about the risks of age-disparate relationships. In addition to these initiatives, there is an urgent need to implement holistic approaches to relationship health, in order to curb intimate partner violence, improve gender equity and make non-age-disparate relationships more attractive. PMID:24260585

  10. "It's important to take your medication everyday okay?" An evaluation of counselling by lay counsellors for ARV adherence support in the Western Cape, South Africa.

    PubMed

    Dewing, S; Mathews, C; Schaay, N; Cloete, A; Louw, J; Simbayi, L

    2013-01-01

    There is growing interest in standard care programmes for antiretroviral (ARV) adherence support. In South Africa, individual counselling following ARV initiation is a main strategy for supporting adherence in the public sector. Egan's client-centred "Skilled Helper" counselling model is the predominant model used in HIV counselling in this context. This study evaluated counselling delivered by lay ARV adherence counsellors in Cape Town in terms of adherence to Egan's model. Thirty-eight transcripts of counselling sessions with non-adherent patients were analysed based on the methods of content analysis. These sessions were conducted by 30 counsellors. Generally counsellors' practice adhered neither to Egan's model nor a client-centred approach. Inconsistent with evidence-based approaches to counselling for ARV adherence support, counsellors mainly used information-giving and advice as strategies for addressing clients' non-adherence. Recommendations for improving practice are made. The question as to how appropriate strategies from developed countries are for this setting is also raised.

  11. Investigation into the bacterial pollution levels at various sites along the Diep and Plankenburg river systems, 3 Western Cape, South Africa.

    PubMed

    Alegbeleye, O O; Opeolu, B O; Jackson, V A

    2016-01-01

    This study sought to investigate and compare bacterial contamination levels at six different sites along the Diep and Plankenburg river systems in the Western Cape, South Africa. Surface water and sediment samples were collected monthly from the six selected sampling sites along both river courses between January 2014 and December 2014 and were evaluated for bacterial contaminants. Microbial isolation, characterisation and identification were done using conventional techniques (serial dilution, Gram staining, and biochemical testing) and molecular identification techniques (polymerase chain reaction and DNA sequencing). A total of 19 bacterial isolates belonging to the genera Raoultella, Bacillus, Pseudomonas, Klebsiella, Escherichia, Enterobacter, Exiguobacterium, Acinetobacter, Serratia, Aeromonas, Staphylococcus and Citrobacter were isolated from the surface water and sediment samples at the end of the survey. Higher microbial load was obtained from sediment samples compared to surface water samples. Seasonal variation was also observed in terms of microbial counts. Higher microbial counts were obtained during summer sampling time compared to winter sampling time. The most contaminated site was located on Plankenburg River with average bacterial counts ranging between 3.1 × 10(5)-6.9 × 10(8) CFU/ml and 3.9 × 10(6)-2.88 × 10(9) CFU/ml from surface water and sediment, respectively, recorded at this site during winter and summer. Although lower microbial counts were recorded along the Diep River course, most of the bacterial counts recorded along both rivers exceeded the acceptable maximum limits for river water.

  12. Introduction: Highlights of HeartWeek 2013 at the Sixth World Congress of Paediatric Cardiology and Cardiac Surgery in Cape Town South Africa.

    PubMed

    Jacobs, Jeffrey Phillip

    2013-12-01

    This December issue of Cardiology in the Young represents the 11th annual publication generated from the two meetings that compose "HeartWeek in Florida". "HeartWeek in Florida", the joint collaborative project sponsored by the Cardiac Center at the Children's Hospital of Philadelphia, Pennsylvania, together with Johns Hopkins All Children's Heart Institute of Saint Petersburg, Florida, averages over 1000 attendees every year and is now recognised as one of the major planks of continuing medical and nursing education for those working in the fields of diagnosis and treatment of cardiac disease in the foetus, neonate, infant, child,and adult. "HeartWeek in Florida" combines the International Symposium on Congenital Heart Disease,organised by All Children's Hospital and Johns Hopkins Medicine and entering its 14th year, with the Annual Postgraduate Course in Pediatric Cardiovascular Disease, organised by The Children's Hospital of Philadelphia and entering its 17th year.This December, 2013 issue of Cardiology in the Young highlights the sessions from HeartWeek 2013 that were held at The Sixth World Congress of Paediatric Cardiology and Cardiac Surgery in Cape Town, South Africa. We would like to acknowledge the tremendous contributions made to medicine by John Brown, and therefore we dedicate this HeartWeek 2013 issue of Cardiology in the Young to him.

  13. Seroprevalence of Chlamydia infection in pigs in Jiangxi province, South-Eastern China.

    PubMed

    Jiang, H H; Huang, S Y; Zhang, W B; Zhao, L; Xu, C M; Deng, S Z; Zhu, X Q

    2013-12-01

    Chlamydia are Gram-negative obligate bacteria that cause a wide range of diseases in humans and animals. To assess the risk of zoonosis posed by pigs, a total of 920 serum samples were collected from pigs in 11 administrative cities in Jiangxi province, south-eastern China, and the seroprevalence of Chlamydia antibodies was investigated by an indirect haemagglutination assay. The pathogen-specific antibodies were detected in 539 (58.59 %) pigs with seroprevalence ranging from 33.33 % (Jingdezhen) to 90.91 % (Pingxiang) among different cities (P<0.05). The highest prevalence was found in pregnant sows (80.89 %, 127/157), followed by breeding boars (79.37 %, 50/63), suckling sows (77.01 %, 67/87), fattening pigs (69.32 %, 61/88) and non-pregnant sows (62.5 %, 180/288). Piglets had the lowest prevalence of 22.78 % (54/237). The seroprevalence of Chlamydia infection among different categories of pigs was also significantly different (P<0.05). These results indicate that Chlamydia is highly prevalent in pigs in Jiangxi province and our results indicate that the presence of Chlamydia exposure in pigs may pose a potential threat to human health.

  14. Occurrence of Emerging Micropollutants in Water Systems in Gauteng, Mpumalanga, and North West Provinces, South Africa

    PubMed Central

    Wanda, Elijah M. M.; Nyoni, Hlengilizwe; Mamba, Bhekie B.; Msagati, Titus A. M.

    2017-01-01

    The ubiquitous occurrence of emerging micropollutants (EMPs) in water is an issue of growing environmental-health concern worldwide. However, there remains a paucity of data regarding their levels and occurrence in water. This study determined the occurrence of EMPs namely: carbamazepine (CBZ), galaxolide (HHCB), caffeine (CAF), tonalide (AHTN), 4-nonylphenol (NP), and bisphenol A (BPA) in water from Gauteng, Mpumalanga, and North West provinces, South Africa using comprehensive two-dimensional gas chromatography coupled to high resolution time-of-flight mass spectrometry (GCxGC-HRTOFMS). Kruskal-Wallis test and ANOVA were performed to determine temporal variations in occurrence of the EMPs. Principal component analysis (PCA) and Surfer Golden Graphics software for surface mapping were used to determine spatial variations in levels and occurrence of the EMPs. The mean levels ranged from 11.22 ± 18.8 ng/L for CAF to 158.49 ± 662 ng/L for HHCB. There was no evidence of statistically significant temporal variations in occurrence of EMPs in water. Nevertheless, their levels and occurrence vary spatially and are a function of two principal components (PCs, PC1 and PC2) which controlled 89.99% of the variance. BPA was the most widely distributed EMP, which was present in 62% of the water samples. The detected EMPs pose ecotoxicological risks in water samples, especially those from Mpumalanga province. PMID:28098799

  15. Concepts and treatment for diabetes among traditional and faith healers in the northern province, South Africa.

    PubMed

    Peltzer, K; Khoza, L B; Lekhuleni, M E; Madu, S N; Cherian, V I; Cherian, L

    2001-05-01

    The purpose of the study was to assess the concepts and treatment modalities for diabetes among traditional and faith healers in the Northern Province in South Africa. The sample consisted of 50 traditional healers (13 females and 37 males) and 50 faith healers (12 females and 38 males). They were interviewed on local terminology, clinical manifestations, causes, curability, and treatment for diabetes, help-seeking behaviour of diabetes patients, and the healers' sources of information about diabetes. Results indicate that all healers were familiar with "diabetes", however, not all of them had seen patients suffering from diabetes. The perceived causes of diabetes by both traditional and faith healers could be divided into (1) diet (especially too much of sugar), (2) heredity, (3) supernatural, and (4) psychological causes. Most traditional healers (92%) and faith healers (90%) indicated that diabetes is curable. Treatments used by the healers in this study included the use of prayer, diet, and herbs. The authors conclude that the concepts and treatment modalities for diabetes among traditional and faith healers should be taken note of by health workers while developing health education programmes in the Province.

  16. The potential for predicted climate shifts to impact genetic landscapes of lizards in the South African Cape Floristic Region.

    PubMed

    Tolley, Krystal A; Makokha, Jane Sakwa; Houniet, Darren T; Swart, Belinda L; Matthee, Conrad A

    2009-04-01

    The Cape Floristic Region (CFR) is well-known for its floral diversity, yet also contains a rich herpetofauna with >180 species, 28% of which are endemic. Recent studies conducted on CFR lizards indicated that phylogeographic patterns show some congruency, and that the western CFR shows higher overall diversity in the form of population and/or clade turnover. Here, we combine mitochondrial sequence data from two published (Bradypodion spp. and Agama atra) and one new dataset (Pedioplanis burchelli) to investigate whether geographic patterns of genetic diversity could be influenced by predicted climatic changes. We utilised Bayesian methodology and spatial genetic landscapes to establish broad-scale patterns and show that the western CFR is a contact zone for several clades in all three taxa, supporting the hypothesis of phylogeographic congruence. Current levels of gene flow are virtually zero between the western and eastern CFR. In the east, gene flow between populations is negligible at present but was probably stronger in the past given the present lack of strong genetic structure. Bioclimatic modelling predicted that climatically suitable areas within the CFR will decline for Bradypodion spp. and P. burchelli, with areas high in clade turnover loosing more climatically suitable areas than areas with low clade turnover. The models also predict that loss of climatic suitability may result in highly fragmented and patchy distributions, resulting in a greater loss of connectivity. In contrast, A. atra does not show significant climatic suitability losses overall, although it may experience localised losses (and gains). This species is not predicted to loose suitability in areas of high clade turnover. Thus, the incorporation of genetic data into climatic models has extended our knowledge on the vulnerability of these species given the predicted threat of landscape change.

  17. Predictors of poor adherence among people on antiretroviral treatment in Cape Town, South Africa: A case-control study

    PubMed Central

    Dewing, Sarah F; Mathews, Cathy; Lurie, Mark; Kagee, Ashraf; Padayachee, Trishanta; Lombard, Carl J

    2015-01-01

    A case-control study was conducted to describe the frequency with which structural- and individual-level barriers to adherence are experienced by people receiving antiretroviral (ARV) treatment and to determine predictors of nonadherence. Three hundred adherent and 300 non-adherent patients from 6 clinics in Cape Town completed the LifeWindows Information-Motivation-Behavioral Skills ART Adherence Questionnaire, the Substance Abuse and Mental Illness Symptoms Screener and the Structural Barriers to Clinic Attendance (SBCA) and Medication-taking (SBMT) scales. Overall, information-related barriers were reported most frequently followed by motivation and behaviour skill defects. Structural barriers were reported least frequently. Logistic regression analyses revealed that gender, behaviour skill deficit scores, SBCA scores and SBMT scores predicted non-adherence. Despite the experience of structural barriers being reported least frequently, structural barriers to medication-taking had the greatest impact on adherence (OR: 2.32, 95% CI: 1.73 to 3.12), followed by structural barriers to clinic attendance (OR: 2.06, 95% CI: 1.58 to 2.69) and behaviour skill deficits (OR: 1.34, 95% CI: 1.05 to 1.71). Our data indicate the need for policy directed at the creation of a health-enabling environment that would enhance the likelihood of adherence among antiretroviral therapy users. Specifically, patient empowerment strategies aimed at increasing treatment literacy and management skills should be strengthened. Attempts to reduce structural barriers to antiretroviral treatment adherence should be expanded to include increased access to mental health care services and nutrition support. PMID:25559444

  18. Depression, alcohol use, and stigma in younger versus older HIV-infected pregnant women initiating antiretroviral therapy in Cape Town, South Africa.

    PubMed

    Wong, Marcia; Myer, Landon; Zerbe, Allison; Phillips, Tamsin; Petro, Greg; Mellins, Claude A; Remien, Robert H; Shiau, Stephanie; Brittain, Kirsty; Abrams, Elaine J

    2017-02-01

    HIV-infected pregnant women in sub-Saharan Africa are at risk for depression and alcohol abuse. Young women may be more vulnerable, but little is known about the psychosocial functioning of this population. We compared younger (18-24 years old) and older (≥25 years old) HIV-infected pregnant women initiating antiretroviral therapy (ART) in Cape Town, South Africa. Women were assessed on a range of psychosocial measures, including the Alcohol Use Disorders Identification Test and the Edinburgh Postnatal Depression Scale (EPDS). Among 625 women initiating ART, 16 % reported risky alcohol use and 21 % alcohol-related harm; these percentages were similar across age groups. When younger women were stratified by age, 37 % of 18-21 years old versus 20 % of 22-24 years old reported alcohol-related harm (p = 0.02). Overall, 11 % of women had EPDS scores suggesting probable depression, and 6 % reported self-harming thoughts. Younger women reported more depressive symptoms. Report of self-harming thoughts was 11 % in younger and 4 % in older women (p = 0.002). In multivariable analysis, age remained significantly associated with depressive symptoms and report of self-harming thoughts. Level of HIV-related stigma and report of intimate partner violence modified the association between age and depressive symptoms. Young HIV-infected pregnant women in South Africa were more likely to report depressive symptoms and self-harming thoughts compared to older women, and the youngest women reported the highest levels of alcohol-related harm. HIV-related stigma and intimate partner violence may be moderating factors. These findings have implications for maternal and infant health, underscoring the urgent need for effective targeted interventions in this vulnerable population.

  19. An Economic Valuation Of The Water Footprint: A Case Study Of The Citrus Sector In The Lower Sundays River Valley, Eastern Cape, South Africa.

    NASA Astrophysics Data System (ADS)

    Munro, S. A.; Fraser, G. C. G.; Snowball, J. D.

    2014-12-01

    With the implementation of the South African National Water Act (NWA) currently underway, water intensive sectors, such as the irrigated agriculture sector, can expect reduced water allocations and an increase in water prices. Water footprints (WFs) are increasingly being recognised as a meaningful way by which to represent human appropriation of water resources. This study examines the green and blue WFs of a variety of citrus cultivars in the lower Sundays River Valley, Eastern Cape, South Africa. WFs were calculated across dry, humid and long-term average climates and comparisons were made to available global average benchmark WFs. An number of indicators were also explored including; water productivity (ton/m3), economic land productivity (R/ha) and economic water productivity (R/m3) across all three climatic years. Most applications of WF sustainability assessments have focused on examining physical water scarcity as a measure for determining environmental hotspots. This study, therefore, also calculates the marginal product value for the irrigation water using a non-parametric linear programming approach. Marginal product value of irrigation water is not only useful in assisting with water-allocation decision making, but also useful in demonstrating the effects of resource depletion and degradation, and is therefore a useful measure for determining economic water scarcity. The study highlights that both farmers and governments could reduce blue WF's through adopting measures to increase water efficiency and considering economic water and land productivity. It also demonstrates the importance of including both environmental and economic scarcity indicators into water management and planning strategies, and the importance of conducting WF assessments using more accurate, site specific data.

  20. Socio-economic status and self-reported tuberculosis: a multilevel analysis in a low-income township in the Eastern Cape, South Africa

    PubMed Central

    Cramm, Jane M.; Koolman, Xander; Møller, Valerie; Nieboer, Anna P.

    2011-01-01

    Few studies have investigated the interplay of multiple factors affecting the prevalence of tuberculosis in developing countries. The compositional and contextual factors that affect health and disease patterns must be fully understood to successfully control tuberculosis. Experience with tuberculosis in South Africa was examined at the household level (overcrowding, a leaky roof, social capital, unemployment, income) and at the neighbourhood level (Gini coefficient of inequality, unemployment rate, headcount poverty rate). A hierarchical random-effects model was used to assess household-level and neighbourhood-level effects on self-reported tuberculosis experience. Every tenth household in each of the 20 Rhini neighbourhoods was selected for inclusion in the sample. Eligible respondents were at least 18 years of age and had been residents of Rhini for at least six months of the previous year. A Kish grid was used to select one respondent from each targeted household, to ensure that all eligible persons in the household stood an equal chance of being included in the survey. We included 1,020 households within 20 neighbourhoods of Rhini, a suburb of Grahamstown in the Eastern Cape, South Africa. About one-third of respondents (n=329; 32%) reported that there had been a tuberculosis case within the household. Analyses revealed that overcrowding (P≤0.05) and roof leakage (P≤0.05) contributed significantly to the probability of a household tuberculosis experience experience, whereas higher social capital (P≤0.01) significantly reduced this probability. Overcrowding, roof leakage and the social environment affected tuberculosis prevalence in this economically disadvantaged community. Policy makers should consider the possible benefits of programs that deal with housing and social environments when addressing the spread of tuberculosis in economically poor districts. PMID:28299075

  1. Addiction and treatment experiences among active methamphetamine users recruited from a township community in Cape Town, South Africa: a mixed-methods study

    PubMed Central

    Meade, Christina S.; Towe, Sheri L.; Watt, Melissa H.; Lion, Ryan R.; Myers, Bronwyn; Skinner, Donald; Kimani, Stephen; Pieterse, Desiree

    2015-01-01

    Background Since 2000, there has been a dramatic increase in methamphetamine use in South Africa, but little is known about the experiences of out-of-treatment users. This mixed-methods study describes the substance use histories, addiction symptoms, and treatment experiences of a community-recruited sample of methamphetamine users in Cape Town. Methods Using respondent driven sampling, 360 methamphetamine users (44% female) completed structured clinical interviews to assess substance abuse and treatment history and computerized surveys to assess drug-related risks. A sub-sample of 30 participants completed in-depth interviews to qualitatively explore experiences with methamphetamine use and drug treatment. Results Participants had used methamphetamine for an average of 7.06 years (SD=3.64). They reported using methamphetamine on an average of 23.49 of the past 30 days (SD=8.90); 60% used daily. The majority (90%) met ICD-10 criteria for dependence, and many reported severe social, financial, and legal consequences. While only 10% had ever received drug treatment, 90% reported that they wanted treatment. In the qualitative interviews, participants reported multiple barriers to treatment, including beliefs that treatment is ineffective and relapse is inevitable in their social context. They also identified important motivators, including desires to be drug free and improve family functioning. Conclusion This study yields valuable information to more effectively respond to emerging methamphetamine epidemics in South Africa and other low- and middle-income countries. Interventions to increase uptake of evidence-based services must actively seek out drug users and build motivation for treatment, and offer continuing care services to prevent relapse. Community education campaigns are also needed. PMID:25977205

  2. Toxin A-negative toxin B-positive ribotype 017 Clostridium difficile is the dominant strain type in patients with diarrhoea attending tuberculosis hospitals in Cape Town, South Africa.

    PubMed

    Kullin, B; Wojno, J; Abratt, V; Reid, S J

    2017-01-01

    The molecular epidemiology of C. difficile strains causing disease in South Africa is currently unknown. Previously, multidrug resistant ribotype (RT)017 strains were those most commonly isolated from patients with diarrhoea attending Groote Schuur Hospital in Cape Town, South Africa. This larger study aimed to investigate the molecular epidemiology and antibiotic susceptibility profiles of C. difficile strains in the greater Cape Town and regional areas. C. difficile strains were isolated from patients with diarrhoea attending hospitals in the Western Cape region of South Africa that tested positive using the GeneXpert CDiff diagnostic test. Ribotyping and multilocus variable-number tandem-repeat analysis (MLVA) were used to type isolates, and their susceptibilities to several antibiotics were determined by gradient diffusion test strips. A total of 269 non-repeat C. difficile isolates were obtained. A large proportion of isolates (64.3 %) belonged to the RT017 group, many of which were clonally related when investigated by MLVA. RT017 strains were particularly prevalent in patients attending specialist tuberculosis (TB) hospitals. The majority of RT017 isolates were co-resistant to moxifloxacin and rifampicin, two antibiotics which are used intensively during anti-TB therapy. Non-RT017 strains were generally susceptible to both antibiotics. Resistance to erythromycin was observed for both groups of strains. RT017 C. difficile strains are the most commonly isolated strains from patients attending healthcare facilities in the greater Cape Town and regional areas. The presence of multidrug resistant RT017 strains in patients with diarrhoea attending local TB hospitals reflects a potential reservoir for future infections.

  3. Geocemical provinces of magmatism in the south-eastern part of the Pacific Ocean

    NASA Astrophysics Data System (ADS)

    Sushchevskaya, Nadezhda; Belyatsky, Boris; Teterin, Dmitry

    2010-05-01

    Comparison of geochemical signatures of island magmatism in the south-eastern part of the Pacific Ocean and tholeiites of the Bransfield and Powell rift zones revealed the similar character of the enrichment which reflects the melting of a close mantle source. But alkaline magmatism of the islands in the west of Antarctic and Marie Byrd Land differs from the enriched basalts of the northern province (Bransfield, Powell, BTJ) by showing more radiogenic Sr values and non-radiogenic Nd. The tectonic development of the South Ocean is characterized by its formation under stationary conditions of Antarctic continent. As a result of this, for the volcanic islands distributed at the western part of the Antarctic we observe no long mountain ridges typical for their development under conditions of the moving plate. Intraplate magmatism evolution was coincided with the extinction of the old subduction zones, formation of the new rift zones and separation of South America from Antarctic [Udintsev, Schenke, 2007; Teterin, 2008]. Such complicated geodynamics caused the possibility of formation of rupture cracks reaching the underlying metasomatizated mantle and decompression melting with further island formation. In Oligocene due to migration of asthenospheric flow from the west to east in the result of destruction of previously united continental blocks there was formed the Scotia Sea, South Sandwich island arc as well as Drake Passage. This caused the mechanical weakening of South Atlantic lithosphere and the starting at the end of Oligocene - beginning Miocene of the new plate border formation - American-Antarctic ridge, which propagated in the eastern direction till the Bouvet triple junction [Dubinin et al., 1999]. The close geochemical signatures of mantle source for islands basalts including the Bouvet Island and the enriched tholeiites of the western extremity of the SW Indian Ridge proves the development of a specific geochemical province enveloping the southeastern

  4. Pathology and immunohistochemistry of papillomavirus-associated cutaneous lesions in Cape mountain zebra, giraffe, sable antelope and African buffalo in South Africa.

    PubMed

    Williams, J H; van Dyk, E; Nel, P J; Lane, E; Van Wilpe, E; Bengis, R G; de Klerk-Lorist, L M; van Heerden, J

    2011-06-01

    Skin lesions associated with papillomaviruses have been reported in many animal species and man. Bovine papillomavirus (BVP) affects mainly the epidermis, but also the dermis in several species including bovine, the best-known example being equine sarcoid, which is associated with BVP types 1 and 2. This publication describes and illustrates the macroscopic and histological appearance of BPV-associated papillomatous, fibropapillomatous or sarcoid-like lesions in Cape mountain zebra (Equus zebra zebra) from the Gariep Dam Nature Reserve, 2 giraffes (Giraffa camelopardalis) from the Kruger National Park, and a sable antelope (Hippotragus niger) from the Kimberley area of South Africa. An African buffalo (Syncerus caffer) cow from Kruger National Park also had papillomatous lesions but molecular characterisation of lesional virus was not done. Immunohistochemical staining using polyclonal rabbit antiserum to chemically disrupted BPV-1, which cross-reacts with the L1 capsid of most known papillomaviruses, was positive in cells of the stratum granulosum of lesions in Giraffe 1, the sable and the buffalo and negative in those of the zebra and Giraffe 2. Fibropapillomatous and sarcoid-like lesions from an adult bovine were used as positive control for the immunohistochemistry and are described and the immunohistochemistry illustrated for comparison. Macroscopically, both adult female giraffe had severely thickened multifocal to coalescing nodular and occasionally ulcerated lesions of the head, neck and trunk with local poorly-circumscribed invasion into the subcutis. Necropsy performed on the 2nd giraffe revealed neither internal metastases nor serious underlying disease. Giraffe 1 had scattered, and Giraffe 2 numerous, large, anaplastic, at times indistinctly multinucleated dermal fibroblasts with bizarre nuclei within the sarcoid-like lesions, which were BPV-1 positive in Giraffe 1 and BPV-1 and -2 positive in Giraffe 2 by RT-PCR. The sable antelope presented with a

  5. A review of the Pseudobarbus afer (Peters, 1864) species complex (Teleostei, Cyprinidae) in the eastern Cape Fold Ecoregion of South Africa

    PubMed Central

    Chakona, Albert; Skelton, Paul H.

    2017-01-01

    Abstract The Eastern Cape redfin, Pseudobarbus afer, has long been considered to be a single widespread and variable species occurring in multiple isolated river systems in the Cape Fold Ecoregion (CFE) at the southern tip of Africa. Mitochondrial cytochrome b and control region sequence data of individuals from populations currently assigned to Pseudobarbus afer across the species’ distribution range revealed existence of four deeply divergent taxonomic units: (i) the Mandela lineage confined to the Sundays, Swartkops and Baakens river systems, (ii) the Krom lineage endemic to the Krom River system, (iii) the St Francis lineage occurring in the Gamtoos and adjacent river systems, and (iv) the Forest lineage occurring in several coastal river systems from the Tsitsikamma to the Klein Brak River system. The Forest lineage is closely related to Pseudobarbus phlegethon from the Olifants River system on the west coast of South Africa, suggesting that it does not belong to Pseudobarbus afer s.l. Herein we focus on the three lineages within the Pseudobarbus afer s.l. complex and provide new diagnosis for Pseudobarbus afer s.s (Mandela lineage), revalidate Pseudobarbus senticeps (Krom lineage) as a distinct species, and describe a new species Pseudobarbus swartzi (St Francis lineage). The three species exhibit subtle differences, which explains why they were previously considered to represent a single variable and widespread species. Pseudobarbus senticeps differs from both Pseudobarbus afer and Pseudobarbus swartzi by having fewer (i.e. larger) scales (25–33, mode 29 lateral line scale series; 10–12, mode 11 circumpeduncular scales) and presence of a lateral stripe which terminates in a conspicuous triangular blotch at the base of the caudal fin. Long barbels which reach or surpass the vertical through the posterior edge of the eye further separate Pseudobarbus senticeps from Pseudobarbus afer s.s. which possesses simple short barbels which do not reach the

  6. Exploring repeat HIV testing among men who have sex with men in Cape Town and Port Elizabeth, South Africa

    PubMed Central

    Siegler, Aaron J.; Sullivan, Patrick S.; de Voux, Alex; Phaswana-Mafuya, Nancy; Bekker, Linda-Gail; Baral, Stefan D.; Winskell, Kate; Kose, Zamakayise; Wirtz, Andrea L.; Brown, Ben; Stephenson, Rob

    2014-01-01

    Despite the high prevalence of HIV among men who have sex with men (MSM) – and the general adult population – in South Africa, there is little data regarding the extent to which MSM seek repeat testing for HIV. This study explores reported histories of HIV testing, and the rationales for test seeking, among a purposive sample of 34 MSM in two urban areas of South Africa. MSM participated in activity-based in-depth interviews that included a timeline element to facilitate discussion. Repeat HIV testing was limited among participants, with three-quarters having two or fewer lifetime HIV tests, and over one-third of the sample having one or fewer lifetime tests. For most repeat-testers, the time gap between their HIV tests was greater than the one-year interval recommended by national guidelines. Analysis of the reasons for seeking HIV testing revealed several types of rationale. The reasons for a first HIV test were frequently one-time occurrences, such as a requirement prior to circumcision, or were motivations likely satisfied by a single HIV test. For MSM who reported repeat testing at more timely intervals, the most common rationale was seeking test results with a sex partner. Results indicate a need to shift HIV test promotion messaging and programming for MSM in South Africa away from a one-off model to one that frames HIV testing as a repeated, routine health maintenance behavior. PMID:25134823

  7. Exploring repeat HIV testing among men who have sex with men in Cape Town and Port Elizabeth, South Africa.

    PubMed

    Siegler, Aaron J; Sullivan, Patrick S; de Voux, Alex; Phaswana-Mafuya, Nancy; Bekker, Linda-Gail; Baral, Stefan D; Winskell, Kate; Kose, Zamakayise; Wirtz, Andrea L; Brown, Ben; Stephenson, Rob

    2015-01-01

    Despite the high prevalence of HIV among men who have sex with men (MSM) - and the general adult population - in South Africa, there is little data regarding the extent to which MSM seek repeat testing for HIV. This study explores reported histories of HIV testing, and the rationales for test seeking, among a purposive sample of 34 MSM in two urban areas of South Africa. MSM participated in activity-based in-depth interviews that included a timeline element to facilitate discussion. Repeat HIV testing was limited among participants, with three-quarters having two or fewer lifetime HIV tests, and over one-third of the sample having one or fewer lifetime tests. For most repeat testers, the time gap between their HIV tests was greater than the one-year interval recommended by national guidelines. Analysis of the reasons for seeking HIV testing revealed several types of rationale. The reasons for a first HIV test were frequently one-time occurrences, such as a requirement prior to circumcision, or motivations likely satisfied by a single HIV test. For MSM who reported repeat testing at more timely intervals, the most common rationale was seeking test results with a sex partner. Results indicate a need to shift HIV test promotion messaging and programming for MSM in South Africa away from a one-off model to one that frames HIV testing as a repeated, routine health maintenance behavior.

  8. The cultural and community-level acceptance of antiretroviral therapy (ART) among traditional healers in Eastern Cape, South Africa.

    PubMed

    Shuster, Justin M; Sterk, Claire E; Frew, Paula M; del Rio, Carlos

    2009-02-01

    The HIV/AIDS epidemic has profoundly impacted South Africa's healthcare system, greatly hampering its ability to scale-up the provision of antiretroviral therapy (ART). While one way to provide comprehensive care and prevention in sub-Saharan African countries has been through collaboration with traditional healers, long-term support specifically for ART has been low within this population. An exploratory, qualitative research project was conducted among 25 self-identified traditional healers between June and August of 2006 in the Lukhanji District of South Africa. By obtaining the opinions of traditional healers currently interested in biomedical approaches to HIV/AIDS care and prevention, this formative investigation identified a range of motivational factors that were believed to promote a deeper acceptance of and support for ART. These factors included cultural consistencies between traditional and biomedical medicine, education, as well as legal and financial incentives to collaborate. Through an incorporation of these factors into future HIV/AIDS treatment programs, South Africa and other sub-Saharan countries may dramatically strengthen their ability to provide ART in resource-poor settings.

  9. Trends in Adolescent Alcohol and Other Drug Use: Findings from Three Sentinel Sites in South Africa (1997-2001)

    ERIC Educational Resources Information Center

    Parry, Charles D. H.; Myers, Bronwyn; Morojele, Neo K.; Flisher, Alan J.; Bhana, Arvin; Donson, Hilton; Pluddemann, Andreas

    2004-01-01

    This paper aims to provide surveillance information about the extent and consequences of alcohol and other drug (AOD) use by adolescents for three sentinel sites in South Africa (Cape Town, Durban and Gauteng province). From 1997 to 2001, data were gathered from multiple sources, including specialist treatment centres, trauma units, school…

  10. Protosclerogibba australis gen. et sp. nov., new genus and species of sclerogibbid wasps (Hymenoptera: Sclerogibbidae) from South Africa.

    PubMed

    Olmi, Massimo; Marletta, Alessandro; Guglielmino, Adalgisa; Speranza, Stefano

    2016-03-01

    Protosclerogibba australis Olmi, Marletta, Guglielmino & Speranza, gen. et sp. nov. is described and illustrated from specimens collected in Kimberley (Northern Cape Province, South Africa). The female of the new taxon is the first micropterous sclerogibbid. Females of other extant Sclerogibbidae are always apterous, whereas fossil females can be apterous or macropterous.

  11. Assessment of undiscovered oil and gas resources of the Assam, Bombay, Cauvery, and Krishna-Godavari Provinces, South Asia, 2011

    USGS Publications Warehouse

    Klett, T.R.; Schenk, Christopher J.; Wandrey, Craig J.; Charpentier, Ronald R.; Cook, Troy A.; Brownfield, Michael E.; Pitman, Janet K.; Pollastro, Richard M.

    2012-01-01

    Using a geology-based assessment methodology, the U.S. Geological Survey estimated volumes of undiscovered, technically recoverable, conventional petroleum resources for the Assam, Bombay, Cauvery, and Krishna–Godavari Provinces, South Asia. The estimated mean volumes are as follows: (1) Assam Province, 273 million barrels of crude oil, 1,559 billion cubic feet of natural gas, and 43 million barrels of natural gas liquids; (2) Bombay Province, 1,854 million barrels of crude oil, 15,417 billion cubic feet of natural gas, and 498 million barrels of natural gas liquids; (3) Cauvery Province, 941 million barrels of crude oil, 25,208 billion cubic feet of natural gas, and 654 million barrels of natural gas liquids; and (4) Krishna–Godavari Province, 466 million barrels of crude oil, 37,168 billion cubic feet of natural gas, and 484 million barrels of natural gas liquids. The totals for the four provinces are 3,534 million barrels of crude oil, 79,352 billion cubic feet of natural gas, and 1,679 million barrels of natural gas liquids.

  12. Impact of Climate Change on Children’s Health in Limpopo Province, South Africa

    PubMed Central

    Thompson, Adeboyejo Aina; Matamale, Lirvhuwani; Kharidza, Shonisani Danisa

    2012-01-01

    This paper examines the impact of climate change on children’s health, in the Limpopo Province of South Africa. Twenty one years climatic data were collected to analyse climatic conditions in the province. The study also employs 12 years hospital records of clinically diagnosed climate-related ailments among children under 13 years to examine the incidence, spatio-temporal, age and sex variations of the diseases. Regression analysis was employed to examine the relationships between climatic parameters and incidence of diseases and also to predict distribution of disease by 2050. The results show that the most prevalent diseases were diarrhea (42.4%), followed by respiratory infection (31.3%), asthma (6.6%) and malaria (6.5%). The incidence varied within city, with the high density areas recording the highest proportion (76.7%), followed by the medium (9.4%) and low (2.5%) density residential areas. The most tropical location, Mussina, had the highest incidence of the most prevalent disease, diarrhea, with 59.4%. Mortality rate was higher for males (54.2%). Analysis of 21 years of climatic data show that maximum temperature is positively correlated with years in four cities with r coefficients of 0.50; 0.56, 0.48 and 0.02, thereby indicating local warming. Similarly rainfall decreased over time in all the cities, with r ranging from −0.02 for Bela Bela to r = 0.18 for Makhado. Results of the regression analysis show that 37.9% of disease incidence is accounted for by the combined influence of temperature and rainfall. PMID:22690167

  13. Generation, migration, and entrapment of Precambrian oils in the Eastern Flank Heavy Oil province, south Oman

    SciTech Connect

    Konert, G.; Van Den Brink, H.A. ); Visser, W. )

    1991-08-01

    The prolific Eastern Flank Heavy Oil province east of the South Oman Salt basin is unique because of the widespread occurrence of Precambrian source rocks from which the hydrocarbons originated. Fission-track analysis and burial studies suggest that most of these source rocks became mature and generated hydrocarbons in the Ordovician; subsequently, the source beds were uplifted and did not re-enter the oil window. Its uniqueness is also based on the all-important role played by Precambrian salt. The traps in Palaeozoic clastics were initially structured by halokinesis, and subsequently by salt dissolution. The latter process gradually removed the salt from the area is largely responsible for the present-day structure with palaeo-withdrawal basins inverted in present-day turtles. Present-day traps are mainly post-Late Jurassic in age, significantly post-dating the time of oil generation. Detailed field studies indicate that charge phases appear to correlate with periods of increased salt dissolution in the Late Jurassic-Early Cretaceous, Late Cretaceous, and Tertiary. Oil was probably stored in intermediate traps below and within the salt. It was gradually released upon progressive tilting of the basin flank; it migrated updip toward the basinward retreating salt edge, and subsequently (back) spilled into the stratigraphically younger traps. Also, removal of the top seal of intra-salt and sub-salt traps by salt dissolution allowed upward remigration. It follows that charge concepts in the Eastern Flank Heavy Oil province depend on defining salt-edge-related hydrocarbon release areas, rather than on kitchen modeling.

  14. Bioremediation of polycyclic aromatic hydrocarbon (PAH) compounds: (acenaphthene and fluorene) in water using indigenous bacterial species isolated from the Diep and Plankenburg rivers, Western Cape, South Africa.

    PubMed

    Alegbeleye, Oluwadara Oluwaseun; Opeolu, Beatrice Olutoyin; Jackson, Vanessa

    This study was conducted to investigate the occurrence of PAH degrading microorganisms in two river systems in the Western Cape, South Africa and their ability to degrade two PAH compounds: acenaphthene and fluorene. A total of 19 bacterial isolates were obtained from the Diep and Plankenburg rivers among which four were identified as acenaphthene and fluorene degrading isolates. In simulated batch scale experiments, the optimum temperature for efficient degradation of both compounds was determined in a shaking incubator after 14 days, testing at 25°C, 30°C, 35°C, 37°C, 38°C, 40°C and 45°C followed by experiments in a Stirred Tank Bioreactor using optimum temperature profiles from the batch experiment results. All experiments were run without the addition of supplements, bulking agents, biosurfactants or any other form of biostimulants. Results showed that Raoultella ornithinolytica, Serratia marcescens, Bacillus megaterium and Aeromonas hydrophila efficiently degraded both compounds at 37°C, 37°C, 30°C and 35°C respectively. The degradation of fluorene was more efficient and rapid compared to that of acenaphthene and degradation at Stirred Tank Bioreactor scale was more efficient for all treatments. Raoultella ornithinolytica, Serratia marcescens, Bacillus megaterium and Aeromonas hydrophila degraded a mean total of 98.60%, 95.70%, 90.20% and 99.90% acenaphthene, respectively and 99.90%, 97.90%, 98.40% and 99.50% fluorene, respectively. The PAH degrading microorganisms isolated during this study significantly reduced the concentrations of acenaphthene and fluorene and may be used on a larger, commercial scale to bioremediate PAH contaminated river systems.

  15. Suicidal ideation and behaviour among persons seeking HIV testing in peri-urban areas of Cape Town, South Africa: a lost opportunity for suicide prevention.

    PubMed

    Bantjes, Jason; Kagee, Ashraf; Saal, Wylene

    2016-12-28

    Suicidal ideation and behaviour (SIB) are among the psychiatric sequela of HIV/AIDS. Few studies have however examined the prevalence and correlates of SIB among persons seeking HIV testing. We set out to document the prevalence and correlates of SIB among people seeking HIV testing in peri-urban areas of Cape Town, South Africa (SA). A cross-sectional research design was used to recruit a sample (n = 500) of individuals seeking HIV testing. Self-report measures were used to assess two-week prevalence of SIB as well as life-time prevalence of suicide attempt. A structured clinical interview was used to assess common mental disorders (CMDs). Regression analysis was used to determine if CMD and socio-demographic variables predicted suicidal ideation. The mean age of the sample was 36 years, 51.6% were female and 46.6% were unemployed. The two-week prevalence of suicidal ideation was 24.27% while the two-week prevalence of suicide attempt and suicide plans was 2.8%. Suicidal ideation was not associated with age, gender, employment status, family income or household food insecurity. CMDs were significantly associated with suicidal ideation; individuals with depressive disorders were approximately 5.5 times more likely to report suicidal ideation, while those with generalised anxiety disorder, trauma-related disorders and alcohol use disorder were approximately 7, 4.7 and 2.8 times more likely to report suicidal ideation, respectively. Results suggest that persons seeking HIV testing may be a well-delineated group of persons at risk of suicide in this region of SA. Contact with the health care system during HIV testing provides an opportunity for targeted suicide prevention interventions in what appears to be a high risk group.

  16. Luminescence- and Infrared-Radiofluorescence dating of the Acheulean- to Middle Stone Age sedimentary sequence at Montagu Cave, Western Cape Provence, South Africa

    NASA Astrophysics Data System (ADS)

    Lauer, Tobias; Archer, Will; Sumner, Alexandra

    2016-04-01

    Montagu Cave is an archaeological site located on the edge of the Langeberg mountain range, about 160 km NE of Cape Town, in South Africa. The archaeological and sedimentary units at Montagu Cave comprise two Acheulean sequences which are separated from one another by a substantial archaeological hiatus. There is an additional Middle Stone Age sequence which overlies the Acheulean horizons, and contains layers attributed to the Howiesons Poort, as well as multiple other Middle Stone Age sub-stages. Hence, Montagu Cave provides a unique opportunity to investigate quite complex population level questions concerning the behavioral differences between modern and pre-modern populations in southern Africa. However, thus far, the chronological context of the sediment-layers at the site remains unclear. It is therefore critical to provide a resilient chronological framework for the timing of human activity at the site. This study concerns the potential of luminescence dating for the sedimentary sequence preserved at Montagu cave. The collected samples are tested on their quartz- and feldspar luminescence signal properties. Various optical dating techniques (quartz OSL; pIRIR290) will be applied, and the results of each compared in order to obtain information on the suitability of the material for luminescence dating, and to establish a chronological framework for this important archaeological site. Furthermore, the infrared-radiofluorescence (IR-RF) signal behavior will be tested on potassium feldspars, as IR-RF is a method being able to date back up to > 600 ka. IR-RF therefore has the potential to cover the expected time-frame of the sediments at Montagu-cave.

  17. Healthcare provider views on the health effects of biomass fuel collection and use in rural Eastern Cape, South Africa: an ethnographic study.

    PubMed

    Matinga, Margaret Njirambo; Annegarn, Harold J; Clancy, Joy S

    2013-11-01

    Policymakers at global level recognise that household biomass use in developing countries has significant health consequences. However, it is unclear how local-level health professionals perceive and respond to such health effects. This paper which is derived from the findings of a larger study on perceptions and responses to the harmful health effects of carrying heavy firewood loads and to smoke from cooking fires is based on a study conducted in South Africa among managers of health programmes and community nurses of Qaukeni and Mhlontlo municipalities in rural Eastern Cape. Interviews and participant observations were conducted in 2009 using ethnographic grounded theory approaches. In addition to a 10-month period of ethnographic fieldwork, ten programme managers and nurses in two villages were interviewed about health patterns in the villages that they serve, their perceptions of, and responses to the health effects of carrying heavy firewood loads, and inhalation of smoke from wood and dung cooking fires, their professional qualifications and experience, their own household energy use; and observations made as they served clinic clients. Results show that these programme managers and nurses perceive the health effects of carrying heavy loads of firewood and of cooking smoke as minor. Sometimes, nurses give women symptomatic relief for musculoskeletal pain resulting from carrying heavy loads. We posit that their perceptions are derived from customary neglect of work-related health and non-communicable diseases, cultural interpretations of womanhood, limited access to relevant information, and limited interactions between health and energy sector professionals. We conclude that culturally and gender-sensitive awareness programmes are needed for local-level health professionals to effectively address health effects of biomass collection and use. This paper provides new insights into overlooked differences between globally-driven initiatives to address health

  18. A Case Study of Landholder Attitudes and Behaviour Toward the Conservation of Renosterveld, a Critically Endangered Vegetation Type in Cape Floral Kingdom, South Africa

    NASA Astrophysics Data System (ADS)

    Winter, Susan J.; Prozesky, Heidi; Esler, Karen J.

    2007-07-01

    The attitudes and behaviours of private landholders toward the conservation of a highly transformed and critically endangered habitat, Overberg Coastal Renosterveld (OCR) (a grassy shrubland of the Cape Floral Region, South Africa) are described. Personal, semistructured interviews were conducted with landholders, representing 40 properties in the Overberg region, on topics such as management and utilisation of OCR, the depth of their knowledge of its conservation importance, what they perceive its value to be, and the extent of their willingness to conserve it. General attitudes toward conservation incentives and provincial conservation authorities were also investigated. Farmers more willing to conserve were younger, did not necessarily have a better education, and owned larger farms (>500 ha) with a greater amount of remnant renosterveld (>300 ha) than those less willing to conserve. Attitudes toward the OCR were largely negative, related to associated problem plants and animals and the fact that it is believed not to be economically advantageous to retain it. However, farmers are of the opinion that provision of incentives and increased extension support will provide practical positive inducements for conservation. Landholder education is paramount to prevent further transformation of critically endangered habitats. The success of private-conservation programs depends on the attitudes of landowners toward (1) the particular habitat or species to be conserved (which can vary depending on the type of land use practised and the associated benefits and disadvantages of that habitat type); (2) the conservation agency or extension officers responsible for that area; and (3) willingness of landowners to participate in a conservation program, which is influenced by landowner age, farm size, and the amount of natural habitat left to conserve.

  19. Rapid assessment of drug use and sexual HIV risk patterns among vulnerable drug-using populations in Cape Town, Durban and Pretoria, South Africa.

    PubMed

    Parry, Charles; Petersen, Petal; Carney, Tara; Dewing, Sarah; Needle, Richard

    2008-09-01

    This exploratory study examines the links between drug use and high-risk sexual practices and HIV in vulnerable drug-using populations in South Africa, including commercial sex workers (CSWs), men who have sex with men (MSM), injecting drug users (IDUs) and non-injecting drug users who are not CSWs or MSM (NIDUs). A rapid assessment ethnographic study was undertaken using observation, mapping, key informant interviews and focus groups in known 'hotspots' for drug use and sexual risk in Cape Town, Durban and Pretoria. Key informant (KI) and focus group interviews involved drug users and service providers. Purposeful snowball sampling and street intercepts were used to recruit drug users. Outcome measures included drug-related sexual HIV risk behaviour, and risk behaviour related to injection drug use, as well as issues related to service use. HIV testing of drug-using KIs was conducted using the SmartCheck Rapid HIV-1 Antibody Test. Non-injection drug use (mainly cannabis, methaqualone, crack cocaine and crystal methamphetamine) and injection drug use (mainly heroin) was occurring in these cities. Drug users report selling sex for money to buy drugs, and CSWs used drugs before, during and after sex. Most (70%) of the drug-using KIs offered HIV testing accepted and 28% were positive, with rates highest among CSWs and MSM. IDUs reported engaging in needle sharing and needle disposal practices that put them and others at risk for contracting HIV. There was a widespread lack of awareness about where to access HIV treatment and preventive services, and numerous barriers to accessing appropriate HIV and drug-intervention services were reported. Multiple risk behaviours of vulnerable populations and lack of access to HIV prevention services could accelerate the diffusion of HIV. Targeted interventions could play an important role in limiting the spread of HIV in and through these under-reached and vulnerable populations.

  20. Use of sediment source fingerprinting to assess the role of subsurface erosion in the supply of fine sediment in a degraded catchment in the Eastern Cape, South Africa.

    PubMed

    Manjoro, Munyaradzi; Rowntree, Kate; Kakembo, Vincent; Foster, Ian; Collins, Adrian L

    2016-08-04

    Sediment source fingerprinting has been successfully deployed to provide information on the surface and subsurface sources of sediment in many catchments around the world. However, there is still scope to re-examine some of the major assumptions of the technique with reference to the number of fingerprint properties used in the model, the number of model iterations and the potential uncertainties of using more than one sediment core collected from the same floodplain sink. We investigated the role of subsurface erosion in the supply of fine sediment to two sediment cores collected from a floodplain in a small degraded catchment in the Eastern Cape, South Africa. The results showed that increasing the number of individual fingerprint properties in the composite signature did not improve the model goodness-of-fit. This is still a much debated issue in sediment source fingerprinting. To test the goodness-of-fit further, the number of model repeat iterations was increased from 5000 to 30,000. However, this did not reduce uncertainty ranges in modelled source proportions nor improve the model goodness-of-fit. The estimated sediment source contributions were not consistent with the available published data on erosion processes in the study catchment. The temporal pattern of sediment source contributions predicted for the two sediment cores was very different despite the cores being collected in close proximity from the same floodplain. This highlights some of the potential limitations associated with using floodplain cores to reconstruct catchment erosion processes and associated sediment source contributions. For the source tracing approach in general, the findings here suggest the need for further investigations into uncertainties related to the number of fingerprint properties included in un-mixing models. The findings support the current widespread use of ≤5000 model repeat iterations for estimating the key sources of sediment samples.

  1. D Model of the Torres Syncline in the PARANÁ-ETENDEKA Province, South Atlantic Margin

    NASA Astrophysics Data System (ADS)

    Jerram, D. A.; Waichel, B. L.; Lima, E. F. D.; Rossetti, L. D. M. M.; Bueno, G. V.; Viana, A. R.; Barreto, C. J.

    2015-12-01

    The Paraná-Etendeka Volcanic Province (PEVP) is Early Cretaceous in age and precedes the fragmentation of the south Gondwana. These volcanic rocks cover an area in excess of 1,200,000 km2 and can reach a maximum thickness of 1,700 m. The PEVP is composed mainly of tholeiitic basalts and subordinately by andesites and rhyolites/quartz-latites. Recently new models considering physical characteristics of the lava flow stratigraphy on both sides, Africa and South America, have been built providing a new vision of the volcanic stratigraphy and flow morphologies inside the province. This work presents a 3D model of the volcanic sequence at theTorres Syncline (Brazil). The 3D model was build using the PETREL E&P Software Platform. Geological sections based on field data and Log data from Paraná Basin (Gama-ray and soniclogs) were used to build the model. The Torres Syncline is a tectonic structure located in southern Brazil with the main orientation NW-SE. In Torres Syncline the basal portion is characterized by pahoehoe lava flows in a compound braided architecture, followed by rubbly lavas in a tabular classic architecture, and in the upper portions silicic units interbedded with basaltic lavas. The central portion of the volcanic pile is characterized by thick tabular lavas with rubbly tops (25-50 m thick). These flows have an internal structure divided in four parts: a smooth vesicular base, aphanitic massive cores with irregular joints, upper vesicular portion and a rubbly top. This unit is thicker along of the Torres Syncline and represents the main phase of the volcanism. Silicic units occur in the upper parts of the PEVP stratigraphy and include lava domes interbedded with rubbly flows and thick tabular flows. The Torres Syncline and Huab constituted one Basin features single active structure in the Early Cretaceous and during the main rifting phase. The onset of the volcanism was characterized by low effusion rate eruptions over the paleoerg, forming pahoehoe

  2. Predictors of condom use and refusal among the population of Free State province in South Africa

    PubMed Central

    2012-01-01

    Background This study investigated the extent and predictors of condom use and condom refusal in the Free State province in South Africa. Methods Through a household survey conducted in the Free Sate province of South Africa, 5,837 adults were interviewed. Univariate and multivariate survey logistic regressions and classification trees (CT) were used for analysing two response variables ‘ever used condom’ and ‘ever refused condom’. Results Eighty-three per cent of the respondents had ever used condoms, of which 38% always used them; 61% used them during the last sexual intercourse and 9% had ever refused to use them. The univariate logistic regression models and CT analysis indicated that a strong predictor of condom use was its perceived need. In the CT analysis, this variable was followed in importance by ‘knowledge of correct use of condom’, condom availability, young age, being single and higher education. ‘Perceived need’ for condoms did not remain significant in the multivariate analysis after controlling for other variables. The strongest predictor of condom refusal, as shown by the CT, was shame associated with condoms followed by the presence of sexual risk behaviour, knowing one’s HIV status, older age and lacking knowledge of condoms (i.e., ability to prevent sexually transmitted diseases and pregnancy, availability, correct and consistent use and existence of female condoms). In the multivariate logistic regression, age was not significant for condom refusal while affordability and perceived need were additional significant variables. Conclusions The use of complementary modelling techniques such as CT in addition to logistic regressions adds to a better understanding of condom use and refusal. Further improvement in correct and consistent use of condoms will require targeted interventions. In addition to existing social marketing campaigns, tailored approaches should focus on establishing the perceived need for condom-use and

  3. Assessment of undiscovered oil and gas resources of the Williston Basin Province of North Dakota, Montana, and South Dakota, 2010

    USGS Publications Warehouse

    ,

    2011-01-01

    Using a geology-based assessment method, the U.S. Geological Survey estimated mean undiscovered volumes of 3.8 billion barrels of undiscovered oil, 3.7 trillion cubic feet of associated/dissolved natural gas, and 0.2 billion barrels of undiscovered natural gas liquids in the Williston Basin Province, North Dakota, Montana, and South Dakota. The U.S. Geological Survey (USGS) recently completed a comprehensive oil and gas assessment of the Williston Basin, which encompasses more than 90 million acres in parts of North Dakota, eastern Montana, and northern South Dakota. The assessment is based on the geologic elements of each total petroleum system (TPS) defined in the province, including hydrocarbon source rocks (source-rock maturation, hydrocarbon generation, and migration), reservoir rocks (sequence stratigraphy and petrophysical properties), and hydrocarbon traps (trap formation and timing). Using this geologic framework, the USGS defined 11 TPS and 19 Assessment Units (AU).

  4. The diets of ungulates from the hominid fossil-bearing site of Elandsfontein, Western Cape, South Africa

    NASA Astrophysics Data System (ADS)

    Stynder, Deano D.

    2009-01-01

    The dietary regimes of 15 ungulate species from the middle Pleistocene levels of the hominid-bearing locality of Elandsfontein, South Africa, are investigated using the mesowear technique. Previous studies, using taxonomic analogy, classified twelve of the studied species as grazers ( Redunca arundinum, Hippotragus gigas, Hippotragus leucophaeus, Antidorcas recki, Homoiceras antiquus, Damaliscus aff. lunatus, Connochaetes gnou laticornutus, Rabaticerus arambourgi, Damaliscus niro, Damaliscus sp. nov., an unnamed "spiral horn" antelope and Equus capensis), one as a mixed feeder ( Taurotragus oryx) and two as browsers ( Tragelaphus strepsiceros and Raphicerus melanotis). Although results from mesowear analysis sustain previous dietary classifications in the majority of cases, five species were reclassified. Three species previously classified as grazers, were reclassified as mixed feeders ( H. gigas, D. aff. lunatus and R. arambourgi), one previously classified as a grazer, was reclassified as a browser (the "spiral horn" antelope), and one previously classified as a mixed feeder, was reclassified as a browser ( T. oryx). While current results broadly support previous reconstructions of the Elandsfontein middle Pleistocene environment as one which included a substantial C 3 grassy component, the reclassifications suggest that trees, broad-leaved bush and fynbos were probably more prominent than what was previously thought.

  5. A mixed-method analysis of free-time involvement and motivation among adolescents in Cape Town, South Africa

    PubMed Central

    Palen, Lori-Ann; Caldwell, Linda L.; Smith, Edward A.; Gleeson, Sarah L.; Patrick, Megan E.

    2012-01-01

    Using focus group (N = 114) and survey (N = 946) data, this study employed Self-Determination Theory (SDT) as an organizing framework to examine free-time use and motivation among predominantly mixed-race adolescents from one area in South Africa. Adolescents reported participating in a broad range of activities, with socializing, media use, sports, risk behaviour, and performing arts being most frequently mentioned. All of the motivation types proposed by SDT were spontaneously mentioned by focus group participants. Free time was most strongly characterized by intrinsic motivations, such as competence, relatedness, and positive affect. Activities were also seen as a way to achieve outside goals. With few exceptions, multiple motivations were identified for the same activities, and specific motivations were reported across multiple activity types. The findings suggest that positive motivational experiences were not limited to a specific subset of activities. However, future longitudinal research on participation, motivation, and outcomes is needed to determine the developmental implications of different forms of free-time motivation. PMID:23055820

  6. Uppermost Permian to Lower Triassic Conodont Zonation from Enshi area, western Hubei Province, South China

    NASA Astrophysics Data System (ADS)

    Lyu, Z.; Zhao, L.; Chen, Z. Q.; Ma, D.; Yan, P.; Zhan, P.

    2015-12-01

    The Permian-Triassic transition witnessed the largest biotic turnover of Earth life during the Phanerozoic history. Ecosystems in sea and on land have also experienced the most protected restoration following the end-Permian mass extinction. These biocrises were also associated with climatic and environmental extremes through the latest Permian to Middle Triassic. In order to uncover the links among these extreme events, we need to establish high-resolution biochronostratigraphy, which offers precise timescales for reconstructing event sequences and probing the possible causes. Of these, conodont biostratigraphy is an operational tool in enhancing stratigraphic resolution. Although their ancestors and phylogeny remain unclear, conodonts are a rapid evolutionary lineage and extremely abundant in the Triassic marine carbonate successions. Here, we present recent study results of the Lower Triassic conodont zonation from the Ganxi and Jianshi areas, western Hubei Province, South China, which were situated on a carbonate ramp at the southern northern margin of the Upper Yangtze Platform. Therein, the uppermost Permian to Lower Triassic successions are well exposed and yield abundant conodonts. A total of nine conodont zones was established: (1) Clarkina yini-Clarkina zhangi Zone, (2) Hindeodus changxingensis Zone, (3) Hindeodus parvus Zone, (4) Isarcicella staeschei Zone, (5) Clarkina planata Zone, (6) Neoclarkina discrete Zone, (7) Neospathodus dieneri Zone, (8) Novispathodus waageni Zone, and (9) Triassospathodus homeri Zone. The Ns. dieneri M1, Ns. dieneri M2 and Ns. dieneri M3 subzones have also been distinguished from the Ns. dieneri Zone. Both Nv. waageni eowaageni subzones and Nv. waageni waageni subzones are also recognizable from the Nv. waageni Zone. The first occurrence of H. parvus marks the Permian-Triassic boundary(PTB), while the first occurrence of Nv. waageni eowaageni defines the Induan-Olenekian boundary. These conodont zones correlate well with

  7. The transport of atmospheric sulfur over Cape Town

    NASA Astrophysics Data System (ADS)

    Jenner, Samantha L.; Abiodun, Babatunde J.

    2013-11-01

    Cape Town, renowned for its natural beauty, is troubled by an unpleasant brown haze pollution, in which atmospheric sulfur plays a major role. This study investigates whether Cape Town is a net producer or recipient of anthropogenic sulfur pollution. In the study, two atmospheric chemistry-transport models (RegCM and WRF) are used to simulate atmospheric flow and chemistry transport over South Africa for two years (2001 and 2002). Both models reproduce the observed seasonal variability in the atmospheric flow and SO2 concentration over Cape Town. The models simulations agree on the seasonal pattern of SO2 over South Africa but disagree on that of SO4. The simulations show that ambient sulfur in Cape Town may be linked with pollutant emissions from the Mpumalanga Highveld, South Africa's most industrialized region. While part of atmospheric SO2 from the Highveld is transported at 700 hPa level toward the Indian Ocean (confirming previous studies), part is transported at low level from the Highveld toward Cape Town. In April, a band of high concentration SO2 extends between the Highveld and Cape Town, following the south coast. Extreme sulfur pollution events in Cape Town are associated with weak flow convergence or stagnant conditions over the city, both of which encourage the accumulation of pollution. However the study suggests that atmospheric sulfur is being advected from Mpumalanga Highveld to Cape Town and this may contribute to atmospheric pollution problems in Cape Town.

  8. Acceptability and challenges of rapid ART initiation among pregnant women in a pilot programme, Cape Town, South Africa.

    PubMed

    Black, Samantha; Zulliger, Rose; Marcus, Rebecca; Mark, Daniella; Myer, Landon; Bekker, Linda-Gail

    2014-01-01

    Maternal antiretroviral therapy (ART) is a critical intervention in the prevention-of-mother-to child transmission (PMTCT) of HIV. In South Africa, many HIV-infected pregnant women commence ART late in pregnancy, and as a result, the duration of ART prior to delivery is often insufficient to prevent vertical transmission. To address this, we designed an intervention for the rapid initiation of ART in pregnancy (RAP), where patient's ART preparation occurred during rather than before treatment commencement. Here we report on the acceptability and the challenges of the RAP programme. We conducted 7 key informant and 27 semi-structured interviews with RAP participants. Participants were purposefully selected based on ART-eligibility and stage in the pregnancy to post-partum continuum. Interviews were conducted in participants' home language by trained fieldworkers, with key informant interviews conducted by the study investigators. The data were analysed using a framework analysis approach. Rapid initiation in pregnancy was acceptable to the majority of programme participants and protection of the woman's unborn child was the primary motivation for starting treatment. The key barrier was the limited time to accept the dual challenges of being diagnosed HIV-positive and eligible for life-long ART. Truncated time also limited the opportunity for disclosure to others. Despite these and other barriers, most women found the benefits of rapid ART commencement outweighed the challenges, with 91% of women initiated onto ART starting the same day treatment eligibility was determined. Many participants and key informants identified the importance of counseling and the need to make an informed, independent choice on the timing of ART initiation, based on individual circumstances. Acceptance of ART-eligibility improved with time on the programme, however, as women's principal reason for initiating ART was protection of the unborn child, monitoring and supporting adherence during

  9. Does identity shape leadership and management practice? Experiences of PHC facility managers in Cape Town, South Africa.

    PubMed

    Daire, Judith; Gilson, Lucy

    2014-09-01

    In South Africa, as elsewhere, Primary Health Care (PHC) facilities are managed by professional nurses. Little is known about the dimensions and challenges of their job, or what influences their managerial practice. Drawing on leadership and organizational theory, this study explored what the job of being a PHC manager entails, and what factors influence their managerial practice. We specifically considered whether the appointment of professional nurses as facility managers leads to an identity transition, from nurse to manager. The overall intention was to generate ideas about how to support leadership development among PHC facility managers. Adopting case study methodology, the primary researcher facilitated in-depth discussions (about their personal history and managerial experiences) with eight participating facility managers from one geographical area. Other data were collected through in-depth interviews with key informants, document review and researcher field notes/journaling. Analysis involved data triangulation, respondent and peer review and cross-case analysis. The experiences show that the PHC facility manager's job is dominated by a range of tasks and procedures focused on clinical service management, but is expected to encompass action to address the population and public health needs of the surrounding community. Managing with and through others, and in a complex system, requiring self-management, are critical aspects of the job. A range of personal, professional and contextual factors influence managerial practice, including professional identity. The current largely facility-focused management practice reflects the strong nursing identity of managers and broader organizational influences. However, three of the eight managers appear to self-identify an emerging leadership identity and demonstrate related managerial practices. Nonetheless, there is currently limited support for an identity transition towards leadership in this context. Better

  10. Seasonal changes of macroinvertebrate communities in a Western cape river, South Africa, receiving nonpoint-source insecticide pollution.

    PubMed

    Bollmohr, Silke; Schulz, Ralf

    2009-04-01

    A field study was conducted at three different sites along the Lourens River (South Africa) to assess aquatic macroinvertebrate abundances and community structures in relation to seasonal changes in rainfall and particle-associated organophosphorous (OP) insecticide contamination. Redundancy analysis indicated OP insecticide contamination (azinphos-methyl and chlorpyrifos) as the only significant variable determining the community composition. Principal response curves indicated that the invertebrate community dynamics of the Lourens River at the most-contaminated site, Lourens River 3 (38 +/- 23.0 microg total OP/ kg suspended particles), differed significantly from the less-contaminated site, Lourens River 2 (8.0 +/- 4.9 microg total OP/kg in suspended particles) during the dry season (October-December; pesticide application period), whereas no difference was found during the wet season (July-September). Ephemeroptera abundances increased significantly (p = 0.0021) at the control site, Lourens River 1, from the wet to dry season, whereas abundances significantly decreased (p = 0.0011) at Lourens River 3. Two-by-three factorial analysis of variance demonstrated a significant interaction of site and season for the three most abundant mayfly taxa, Baetis sp., Demoreptus sp., and Castanophlebia sp., confirming a possible OP effect. Lourens River 3, however, differed significantly from the other two sites in flow, ortho-phosphate, and algae growth, which may partly explain the lower abundance of sensitive species. Apart from the OP contamination, only flow velocities showed significant differences between the wet and dry season at some sites. In conclusion, the present study suggests that particle-associated OPs affected community structure in the Lourens River at levels greater than 30 microg total OP/kg, whereas levels less then 10 microg total OP/kg yielded no significant effects.

  11. Does identity shape leadership and management practice? Experiences of PHC facility managers in Cape Town, South Africa

    PubMed Central

    Daire, Judith; Gilson, Lucy

    2014-01-01

    In South Africa, as elsewhere, Primary Health Care (PHC) facilities are managed by professional nurses. Little is known about the dimensions and challenges of their job, or what influences their managerial practice. Drawing on leadership and organizational theory, this study explored what the job of being a PHC manager entails, and what factors influence their managerial practice. We specifically considered whether the appointment of professional nurses as facility managers leads to an identity transition, from nurse to manager. The overall intention was to generate ideas about how to support leadership development among PHC facility managers. Adopting case study methodology, the primary researcher facilitated in-depth discussions (about their personal history and managerial experiences) with eight participating facility managers from one geographical area. Other data were collected through in-depth interviews with key informants, document review and researcher field notes/journaling. Analysis involved data triangulation, respondent and peer review and cross-case analysis. The experiences show that the PHC facility manager’s job is dominated by a range of tasks and procedures focused on clinical service management, but is expected to encompass action to address the population and public health needs of the surrounding community. Managing with and through others, and in a complex system, requiring self-management, are critical aspects of the job. A range of personal, professional and contextual factors influence managerial practice, including professional identity. The current largely facility-focused management practice reflects the strong nursing identity of managers and broader organizational influences. However, three of the eight managers appear to self-identify an emerging leadership identity and demonstrate related managerial practices. Nonetheless, there is currently limited support for an identity transition towards leadership in this context. Better

  12. The impact of patient demographics and comorbidities upon burns admitted to Tygerberg Hospital Burns Unit, Western Cape, South Africa.

    PubMed

    Cloake, T; Haigh, T; Cheshire, J; Walker, D

    2017-03-01

    In South Africa, burns are a major public health problem responsible for significant morbidity and long-term physical disability. This is, in part, due to a significant proportion of the urban population living in poorly constructed, combustible accommodation. The presence of co-morbid diseases such as diabetes and malignancy in patients with burns has been associated with a poorer outcome. The impact of other diseases such as HIV has yet to be defined. A retrospective data collection study analysed the 221 patients admitted to Tygerberg Hospital Burns Unit in 2011 and the first six months of 2013. Using hospital records, patient demographic data was collected alongside burn agent, ICU admission, complications, and patient outcome in terms of length of stay and mortality. The most common burn agent was hot liquid (45.7%). A significant proportion of patients were subject to intentional attacks (34.3%). Shack fires and flame accounted cumulatively for 85% of total inhalational burns, the highest rates of admission to ICU (85.5%), the highest rate of complications, as well as 92.3% of all total fatalities. HIV+ patients had a higher mortality (13.3% vs 5%, p=0.22) and a higher complication rate (46.7% vs 30%, p=0.21). There was no difference in length of stay between the HIV+ and HIV- cohort (12days vs. 15.5 days, p=0.916). Burns are a significant yet preventable cause of mortality and morbidity. The rising number of shack fires, responsible for extensive burns and resultant mortality is concerning and indicates urgent attention and action. HIV complicates the recovery from burn and is responsible for an increased rate of in hospital mortality.

  13. [Spatiotemporal differentiation of construction land expansion in a typical town of south Jiangsu Province].

    PubMed

    Zhou, Rui; Li, Yue-hui; Hu, Yuan-man; Su, Hai-long; Wang, Jin-nian

    2011-03-01

    Choosing Xinzhuang Town in south Jiangsu Province as study area, and by using 1980, 1991, 2001, and 2009 high-resolution remote sensing images and GIS spatial analysis technology, an integrated expansion degree index model was established based on the existing indicators of construction land expansion, and the general and spatiotemporal differentiation characteristics of construction land expansion in the Town in three time periods of 1980-2009 were quantitatively analyzed. In 1980-2009, with the acceleration of rural urbanization and industrialization, the area of construction land in the Town increased significantly by 19.24 km2, and especially in 2001-2009, the expanded area, expanded contribution rate, and expansion intensity reached the maximum. The construction land expansion had an obvious spatial differentiation characteristic. In 1980-1991, the newly increased construction land mainly concentrated in town area. After 1991, the focus of construction land gradually spread to the villages with developed industries. Most of the increased construction lands were converted from paddy field and dry land, accounting for 88.1% of the total increased area, while the contribution from other land types was relatively small.

  14. GOCE Gradient Tensor Characterization of the Coupled Parana (South America) and Etendeka (Africa) Magmatic Provinces

    NASA Astrophysics Data System (ADS)

    Mariani, Patrizia; Braitenberg, Carla

    2015-03-01

    The Paraná-Etendeka Large Igneous Province (LIP) at the conjugate plate margins of South America and Africa is investigated with GOCE gradients. The LIP is associated to Gondwana breakup, and is asymmetric between the two margins. The study intends to investigate how the lithosphere is affected by continental breakup and what caused the asymmetry, considering that successive spreading is symmetric. The gradients at satellite and surface height are modelled with other geophysical data as seismic profiling, seismic tomography and bore-hole logs. Densities and velocities are modelled with a petrologic model. The residual gravity gradients, reduced of crustal thickness variations and sediments, are continuously high along the Angola and Namibia margin. Inversion shows the high is due to a density increase about 6 km thick with the top at about 23 km depth, placing it above the Moho. It is probable that the densification be due to magmatic intrusions, increasing the volume of the LIP at the African side, which remained trapped in the crust and produced only small volumes of surface basalts. This is true also for the margin of Angola, which in literature is claimed to be void of magmatism along its margin.

  15. Hospital solid waste management practices in Limpopo Province, South Africa: A case study of two hospitals

    SciTech Connect

    Nemathaga, Felicia; Maringa, Sally; Chimuka, Luke

    2008-07-01

    The shortcomings in the management practices of hospital solid waste in Limpopo Province of South Africa were studied by looking at two hospitals as case studies. Apart from field surveys, the generated hospital waste was weighed to compute the generation rates and was followed through various management practices to the final disposal. The findings revealed a major policy implementation gap between the national government and the hospitals. While modern practices such as landfill and incineration are used, their daily operations were not carried according to minimum standards. Incinerator ash is openly dumped and wastes are burned on landfills instead of being covered with soil. The incinerators used are also not environmentally friendly as they use old technology. The findings further revealed that there is no proper separation of wastes according to their classification as demanded by the national government. The mean percentage composition of the waste was found in the following decreasing order: general waste (60.74%) > medical waste (30.32%) > sharps (8.94%). The mean generation rates were found to be 0.60 kg per patient per day.

  16. Infection control practices in public dental care services: findings from one South African Province.

    PubMed

    Mehtar, S; Shisana, O; Mosala, T; Dunbar, R

    2007-05-01

    Infection control practices which increase the risk of blood-borne virus transmission with associated dental practice in one South African province were studied. All 24 state dental clinics were observed for adequate provision to carry out good infection prevention and control (IPC) practice, 75 staff including dentists, nurses and dental assistants were interviewed to assess IPC knowledge and 23 dental procedures were observed. Significant findings were the difference between knowledge and practice, despite adequate provisions for safe infection control practice. The lack of protective eye wear during a dental procedure, not washing hands between patients, not disassembling an item prior to disinfection or sterilization, and not using a sterile drill for each patient were identified. A rapid method for detection of occult blood was used as a marker for inadequate IPC practice. Contaminated dental items of equipment just prior to patient use in 25% of equipment tested and 37% of surfaces and surrounding areas in the dental clinics and units were recorded. This study concludes that, despite provision for safe dental practice available in state dental clinics, there was a lack of knowledge application in clinical practice. The risk of blood-borne virus transmission in a population with high human immunodeficiency virus (HIV) prevalence cannot be ignored.

  17. Geometrical Sense Making: Findings of Analysis Based on the Characteristics of the van Hiele Theory among a Sample of South African Grade 10 Learners

    ERIC Educational Resources Information Center

    Alex, Jogymol K.; Mammen, Kuttickattu J.

    2016-01-01

    This paper reports on one part of a large study which attempted to identify the linguistic and hierarchical characteristics of van Hiele theory amongst grade 10 learners. The sample consisted of a total of 359 participants from five purposively selected schools from Mthatha District in the Eastern Cape Province of South Africa. The performance of…

  18. The Effect of Brief Interventions on the Drinking Behaviour of Pregnant Women in a High-Risk Rural South African Community: A Cluster Randomised Trial

    ERIC Educational Resources Information Center

    Marais, Sandra; Jordaan, Esme; Viljoen, Dennis; Olivier, Leana; de Waal, Johanna; Poole, Caroline

    2011-01-01

    The purpose of this paper is to assess the impact of a series of brief interventions (BIs) on anti-natal alcohol consumption of women from a disadvantaged and high-risk background attending state health clinics in a rural district, Western Cape Province, South Africa. A pragmatic cluster randomised trial design was followed. All pregnant women,…

  19. South Africa

    NASA Technical Reports Server (NTRS)

    2002-01-01

    This true-color image of South Africa was acquired on May 14, 2000, by NASA's Moderate-resolution Imaging Spectroradiometer, or MODIS. The image was produced using a combination of the sensor's 250-m and 500-m resolution visible wavelength bands. As part of the opening ceremony to begin the joint U.S.-South Africa SAFARI Field Experiment, NASA presented print copies of this image as GIFts to Dr. Ben Ngubane, Minister of Arts, Science and Technology, and Honorable Advocate Ngoaka Ramathlodi, Premier of the Northern Province, South Africa. The area shown in this image encompasses seven capital cities and a number of the region's distinctive geological features can be seen clearly. Toward the northern (top) central part of the image, the browns and tans comprise the Kalahari Desert of southern Botswana. The Tropic of Capricorn runs right through the heart of the Kalahari and the Botswanan capital city of Gaborone sits on the Limpopo River, southeast of the Kalahari. Along the western coastline of the continent is the country of Namibia, where the Namib Desert is framed against the sea by the Kaokoveld Mountains. The Namibian capital of Windhoek is obscured by clouds. Looking closely in the center of the image, the Orange River can be seen running from east to west, demarcating the boundary between Namibia and South Africa. On the southwestern corner of the continent is the hook-like Cape of Good Hope peninsula and Cape Town, the parliamentary capital of South Africa. Running west to east away from Cape Town are the Great Karroo Mountains. The shadow in this image conveys a sense of the very steep grade of the cliffs along the southern coast of South Africa. Port Elizabeth sits on the southeasternmost point of South Africa, and a large phytoplankton bloom can be seen in the water about 100 miles east of there. Moving northward along the east coast, the Drakensberg Mountains are visible. The two small nations of Lesotho and Swaziland are in this region, completely

  20. Irrigation Management Transfer and WUAs' dynamics: evidence from the South-Kazakhstan province

    NASA Astrophysics Data System (ADS)

    zinzani, andrea

    2014-05-01

    The importance of water resources management in the arid and semi-arid lands can not be overestimated being related with environmental, economical and socio-political issues. In Central Asia, due to the physical and climatic features, water control and irrigation have always played a strategic role in territorial and societal development. Since the collapse of the Soviet Union in Kazakhstan, as in the other Central Asian republics, significant changes in both the water and agricultural sector have emerged; water management shifted from a purely technical issue to a sociopolitical and economic one leading to several institutional and organizational changes. To address this transitional water management context and the related governance and technical issues, since the 1990s several development organizations and donor agencies (such as the World Bank, United Nations, USAID, and others), according to the international water community, have sought to streamline the Irrigation Management Transfer (IMT) and the establishment of the Water Users Associations (WUAs); this initiatives are sponsored and related to the IWRM framework, the water program globally supported by the Global Water Partnership and widely debated and questioned in the last years. This paper aims to discuss these transitional water management processes focusing on the meso-local level in the Arys valley, administratively included in the South-Kazakhstan province, ten years since the enactment of the law formalizing the WUAs. Three districts (Tyulkibas, Ordabasy and Otrar) were selected to analyse and understand the specific local transitional water institutional/organizational framework and to highlight the differences among them. The fieldwork was conducted in two different phases, April-May and November-December 2012. Within those periods, semi-structured interviews were carried out to the members of the state organizations (river basin agencies and district/province water departments) as well as the

  1. Evaluation of an operational malaria outbreak identification and response system in Mpumalanga Province, South Africa

    PubMed Central

    Coleman, Marlize; Coleman, Michael; Mabuza, Aaron M; Kok, Gerdalize; Coetzee, Maureen; Durrheim, David N

    2008-01-01

    Background and objective To evaluate the performance of a novel malaria outbreak identification system in the epidemic prone rural area of Mpumalanga Province, South Africa, for timely identification of malaria outbreaks and guiding integrated public health responses. Methods Using five years of historical notification data, two binomial thresholds were determined for each primary health care facility in the highest malaria risk area of Mpumalanga province. Whenever the thresholds were exceeded at health facility level (tier 1), primary health care staff notified the malaria control programme, which then confirmed adequate stocks of malaria treatment to manage potential increased cases. The cases were followed up at household level to verify the likely source of infection. The binomial thresholds were reviewed at village/town level (tier 2) to determine whether additional response measures were required. In addition, an automated electronic outbreak identification system at town/village level (tier 2) was integrated into the case notification database (tier 3) to ensure that unexpected increases in case notification were not missed. The performance of these binomial outbreak thresholds was evaluated against other currently recommended thresholds using retrospective data. The acceptability of the system at primary health care level was evaluated through structured interviews with health facility staff. Results Eighty four percent of health facilities reported outbreaks within 24 hours (n = 95), 92% (n = 104) within 48 hours and 100% (n = 113) within 72 hours. Appropriate response to all malaria outbreaks (n = 113, tier 1, n = 46, tier 2) were achieved within 24 hours. The system was positively viewed by all health facility staff. When compared to other epidemiological systems for a specified 12 month outbreak season (June 2003 to July 2004) the binomial exact thresholds produced one false weekly outbreak, the C-sum 12 weekly outbreaks and the mean + 2 SD nine false

  2. Sexual risk behavior, alcohol use, and social media use among secondary school students in informal settlements in Cape Town and Port Elizabeth, South Africa.

    PubMed

    Kaufman, Z A; Braunschweig, E N; Feeney, J; Dringus, S; Weiss, H; Delany-Moretlwe, S; Ross, D A

    2014-09-01

    South Africa's HIV prevalence among young people remains among the highest in the world. A cross-sectional study was carried out in 2012 to estimate prevalences of sexual risk behavior and hazardous alcohol use (HAU) (via the Alcohol Use Disorder Identification Test) as well as to investigate potential associations between these outcomes and social media use. In all, 4485 students (mean age 15.66 years, SD 1.39) at 46 secondary schools in informal settlements in Cape Town and Port Elizabeth completed mobile-phone-assisted, self-administered baseline questionnaires within a cluster-randomized trial. In all, 312 females (12.5 %) and 468 males (23.5 %) screened positive for HAU (AOR = 1.98, 95 % CI 1.69-2.34). 730 males (39.9 %) and 268 females (11.8 %) reported having had two or more partners in the last year (AOR = 3.46, 95 % CI 2.87-4.16). Among females, having a Facebook account was associated with reported multiple partnerships in the last year (AOR = 1.81, 95 % CI 1.19-2.74), age-disparate sex in the last year (AOR = 1.96, 95 % CI 1.16-3.32) and HAU (AOR = 1.97, 95 % CI 1.41-2.74). Using Mxit-a popular mobile instant messaging application-was associated with higher odds of reported multiple partnerships in the last year among both males (AOR = 1.70, 95 % CI 1.35-2.14) and females (AOR = 1.45, 95 % CI 1.07-1.96) and with HAU among both males (AOR = 1.47, 95 % CI 1.14-1.90) and females (AOR = 1.50, 95 % CI 1.18-1.90). Further longitudinal and qualitative research should explore in more depth the observed links between social media and risk behavior.

  3. Lung cancer, tobacco, and environmental factors in the African population of the Northern Province, South Africa

    PubMed Central

    Mzileni, O.; Sitas, F.; Steyn, K.; Carrara, H.; Bekker, P.

    1999-01-01

    DESIGN—Case-control study among incident African patients with cancer. Questionnaire assessment of exposure to tobacco, occupation, and place of birth.
SETTING—Northern Province, South Africa.
SUBJECTS—Between 1993 and 1995, 288 men and 60 women with lung cancer and 183 male and 197 female controls (consisting of patients newly diagnosed with cancers other than those known to be associated with smoking) were interviewed. Unmatched, unconditional logistic regression was used to calculate odds ratios (ORs) and 95% confidence intervals (95% CIs) of developing lung cancer in relation to a number of variables.
MAIN OUTCOME MEASURE—Risk of developing lung cancer related to exposure to tobacco, indoor pollution, dusty work environment, and residential exposure to asbestos.
RESULTS—There was a significant increase in the risk of developing lung cancer through smoking. In men, the ORs were 2.2 (95% CI = 1.0 to 4.6) in ex-smokers, 9.8 (95% CI = 5.9 to 16.4) in light smokers (0-14 g/day), and 12.0 (95% CI = 6.5 to 22.3) in heavy smokers. In women, the ORs were 5.8 (95% CI = 1.3 to 25.8) in ex-smokers and 5.5 (95% CI = 2.6 to 11.3) in current smokers. Work in a dusty industry showed an elevated risk (OR = 3.2, 95% CI = 1.8 to 5.8) for lung cancer only in men. Male residents of areas where asbestos was shipped for distribution (termed moderately polluted asbestos areas) had a 2.5-fold increase (95% CI = 1.0 to 4.4) in the risk (OR) of developing lung cancer, and residents of areas where asbestos was mined (termed heavily polluted asbestos areas) had a 2.8-fold increase in risk (95% CI = 0.7 to 10.4). Female residents of heavily polluted asbestos areas showed elevated risks of 5.4 (95% CI = 1.3 to 22.5) of developing lung cancer.
CONCLUSION—The data suggest that tobacco smoking is the most important risk factor for the development of lung cancer in this setting. Risks for lung cancer are reminiscent of those

  4. Early Triassic conodonts of Jiarong, Nanpanjiang Basin, southern Guizhou Province, South China

    NASA Astrophysics Data System (ADS)

    Chen, Yanlong; Jiang, Haishui; Lai, Xulong; Yan, Chunbo; Richoz, Sylvain; Liu, Xiaodan; Wang, Lina

    2015-06-01

    Jiarong (Huishui County, Guizhou Province, South China) is a key locality for the study of the Early Triassic recovery after the end-Permian mass extinction. The size reduction of conodonts at the Smithian/Spathian transition was first documented in Jiarong, and it is also a locality that contributes to the documentation of the Early Triassic paleo-seawater temperatures. In the Jiarong sections, thirteen conodont zones were identified for the Early Triassic; in ascending order, they are Hindeodus parvus Zone, Hindeodus sosioensis Zone, Clarkina krystyni Zone, Neoclarkina discreta Zone, Neospathodus cristagalli-Eurygnathodus costatus assemblage zone, Novispathodus waageni eowaageni Zone, Novispathodus waageni waageni Zone, Discretella discreta Zone, Pachycladina-Parachirognathus assemblage zone, Novispathodus pingdingshanensis Zone, Icriospathodus collinsoni Zone, Triassospathodus homeri Zone, Triassospathodus triangularis Zone. These conodont zones in the Jiarong sections improve the global correlation of Early Triassic sections and also provide better regional age constraints in an area that is important for studies of recovery from the extinction. Based on the first appearance of Nv. waageni eowaageni, the Induan/Olenekian boundary is recognized at 3.6 m above the base of the Jiarong III Section. The dominance of blade-shaped (segminate) conodonts was replaced by gondola-shaped (segminiplanate) conodonts twice; the first time was in the late Griesbachian, and the second time was in the early Spathian. The dominance of segminiplanate conodonts probably indicates that the deeper seawater environment became more oxygenated during the late Griesbachian and early Spathian for short time intervals, as it is believed that the Griesbachian segminiplanate conodonts favored deeper oxygenated water habitats. A new genus, Spathogondolella gen. nov., and a new species, Spathogondolella jiarongensis sp. nov., have been recognized.

  5. A change-detection application on the evolution of Kahak playa (South Khorasan province, Iran)

    NASA Astrophysics Data System (ADS)

    Rezaei Moghaddam, Mohammad Hossein; Saghafi, Mahdi

    2006-12-01

    Kahak salt playa in South Khorasan province of Iran, have special geomorphological characteristics by the presence of ephemeral saline lakes, wetlands, salt crusts, surface accumulations of salt and zones of patterned ground. Salt crusts in the soil surface are unique in the region and have laminated horizons in the playa soil. Soil-surface salt accumulations are dominated by NaCl and gypsum. It has been found that distribution of chemical soluble is not uniform across the playa landscape, and this result influences on the variety form of patterned ground. In this study, the percent changes in some of the chemical elements such as NaCl, gypsum and also brine extent have been calculated in the playa. Indicating changes in Kahak salt playa is the main aim of this study by using remote sensing and GIS techniques. In this paper, techniques such as spectral un-mixing, maximum likelihood classification, band rationing, fuzzy classification and correlation relationships are discussed. This contribution presents modeling of temporal and spatial changes of salinity and playa developing using combined approaches that incorporate different data-fusion and data-integration techniques for two periods of date. Furthermore, percent changes in the surface-patterned ground of the playa have been calculated using texture and pattern analysis of the PCA1. Results have revealed that, in the playa developing, chemical materials such as sodium, NaCl, gypsum and also brine extent are positively correlated with each other and the most increased changes are related to gypsum and the most decreased changes are related to the NaCl. Also changes in the amount of agricultural area in the playa-lakes margin, show low effects in the desertification process.

  6. Assessment of Heavy Metals in Municipal Sewage Sludge: A Case Study of Limpopo Province, South Africa

    PubMed Central

    Shamuyarira, Kudakwashe K.; Gumbo, Jabulani R.

    2014-01-01

    Heavy metals in high concentrations can cause health and environmental damage. Nanosilver is an emerging heavy metal which has a bright future of use in many applications. Here we report on the levels of silver and other heavy metals in municipal sewage sludge. Five towns in Limpopo province of South Africa were selected and the sludge from their wastewater treatment plants (WWTPs) was collected and analysed. The acid digested sewage sludge samples were analysed using Inductively Coupled Plasma-Optical Emission Spectroscopy (ICP-OES) and Inductively Coupled Plasma-Mass Spectrometry (ICP-MS) methods. The concentrations of silver found were low, but significant, in the range 0.22 to 21.93 mg/kg dry mass. The highest concentration of silver was found in Louis Trichardt town with a concentration of 21.93 ± 0.38 mg/kg dry mass while the lowest was Thohoyandou with a concentration of 6.13 ± 0.12 mg/kg dry mass. A control sludge sample from a pit latrine had trace levels of silver at 0.22 ± 0.01 mg/kg dry mass. The result showed that silver was indeed present in the wastewater sewage sludge and at present there is no DWAF guideline standard. The average Cd concentration was 3.10 mg/kg dry mass for Polokwane municipality. Polokwane and Louis Trichardt municipalities exhibited high levels of Pb, in excess DWAF guidelines, in sludge at 102.83 and 171.87 mg/kg respectfully. In all the WWTPs the zinc and copper concentrations were in excess of DWAF guidelines. The presence of heavy metals in the sewage sludge in excess of DWAF guidelines presents environmental hazards should the sludge be applied as a soil ameliorant. PMID:24595211

  7. Optimal feeding systems for small-scale dairy herds in the North West Province, South Africa.

    PubMed

    Manzana, N Patience; McCrindle, Cheryl M E; Sebei, P Julius; Prozesky, Leon

    2014-07-09

    Land redistribution was legislated in 1994; it was designed to resolve historical imbalances inland ownership in South Africa. Between 2002 and 2006, a longitudinal observational studywas conducted with 15 purposively selected small-scale dairy farmers in a land redistributionproject in Central North West Province. Four farmers left the project over the period. For thepurposes of this study, a small-scale dairy farm was defined as a farm that produces less than500 L of milk a day, irrespective of the number of cows or size of the farm. The study wasconducted in three phases. In the first phase, situational analysis using participatory ruralappraisal (PRA) and observation was used to outline the extent of the constraints and designappropriate interventions. Feeds that were used were tested and evaluated. In the secondphase, three different feeding systems were designed from the data obtained from PRA. Thesewere: (1) A semi-intensive farm-based ration using available crops, pastures and crop residueswith minimal rations purchased. (2) An intensive, zero-grazing dairy system using a totalmixed ration. (3) A traditional, extensive or dual-purpose system, where the calf drank fromthe cow until weaning and milking was done only once a day. In the third phase, adoptionwas monitored. By July 2006, all remaining farmers had changed to commercially formulatedrations or licks and the body condition score of the cows had improved. It was concluded thatveterinary extension based on PRA and a holistic systems approach was a good option forsuch complex problems. Mentoring by commercial dairy farmers, veterinary and extensionservices appeared to be viable. Further research should be done to optimise the traditionalmodel of dairy farming, as this was relatively profitable, had a lower risk and was less labourintensive.

  8. Assessment of learners’ exposure to health education and promotion at school in the Limpopo Province of South Africa

    PubMed Central

    Tosin, Oni. H.

    2016-01-01

    Background School participation and educational attainment among adolescents have been rising rapidly in the developing world. Thus, to attain Millennium Development Goal 6 (Combat HIV and/or AIDs, malaria and other diseases), it is crucial to seize the opportunity to educate and encourage teenagers about healthy choices and proper social behaviours that will continue into adulthood. Aim This study aimed to assess the exposure of rural secondary school learners to health education and promotion at schools in the Limpopo Province of South Africa. Setting This study was carried out at 10 secondary schools in Vhumbedzi educational circuit. Methodology The study adopted a cross-sectional quantitative approach. Data were collected from 338 randomly selected learners from 10 secondary schools that make up a rural Vhumbedzi circuit in the Limpopo province. A self-administered questionnaire was used to collect data. Results The findings showed that, 102 (66.07%) male and 121 (67.60%) female learners reported that they were taught about physical changes that occur during adolescence. In the same vein, most of the participants (n = 128, 84.39%) and (n = 152, 85.39%) males and females respectively claimed to have been taught about sexually transmitted diseases. Conclusion In this study the secondary schools in the Limpopo Province of South Africa are making efforts to uphold and expose their learners to health education and promotion at school. PMID:27380860

  9. Dynamics of Indian Ocean Slavery Revealed through Isotopic Data from the Colonial Era Cobern Street Burial Site, Cape Town, South Africa (1750-1827)

    PubMed Central

    Morris, Alan G.; Kars, Henk; Davies, Gareth R.

    2016-01-01

    The Dutch East India Company (VOC) intended the Cape of Good Hope to be a refreshment stop for ships travelling between the Netherlands and its eastern colonies. The indigenous Khoisan, however, did not constitute an adequate workforce, therefore the VOC imported slaves from East Africa, Madagascar and Asia to expand the workforce. Cape Town became a cosmopolitan settlement with different categories of people, amongst them a non-European underclass that consisted of slaves, exiles, convicts and free-blacks. This study integrated new strontium isotope data with carbon and nitrogen isotope results from an 18th-19th century burial ground at Cobern Street, Cape Town, to identify non-European forced migrants to the Cape. The aim of the study was to elucidate individual mobility patterns, the age at which the forced migration took place and, if possible, geographical provenance. Using three proxies, 87Sr/86Sr, δ13Cdentine and the presence of dental modifications, a majority (54.5%) of the individuals were found to be born non-locally. In addition, the 87Sr/86Sr data suggested that the non-locally born men came from more diverse geographic origins than the migrant women. Possible provenances were suggested for two individuals. These results contribute to an improved understanding of the dynamics of slave trading in the Indian Ocean world. PMID:27309532

  10. Dynamics of Indian Ocean Slavery Revealed through Isotopic Data from the Colonial Era Cobern Street Burial Site, Cape Town, South Africa (1750-1827).

    PubMed

    Kootker, Lisette M; Mbeki, Linda; Morris, Alan G; Kars, Henk; Davies, Gareth R

    2016-01-01

    The Dutch East India Company (VOC) intended the Cape of Good Hope to be a refreshment stop for ships travelling between the Netherlands and its eastern colonies. The indigenous Khoisan, however, did not constitute an adequate workforce, therefore the VOC imported slaves from East Africa, Madagascar and Asia to expand the workforce. Cape Town became a cosmopolitan settlement with different categories of people, amongst them a non-European underclass that consisted of slaves, exiles, convicts and free-blacks. This study integrated new strontium isotope data with carbon and nitrogen isotope results from an 18th-19th century burial ground at Cobern Street, Cape Town, to identify non-European forced migrants to the Cape. The aim of the study was to elucidate individual mobility patterns, the age at which the forced migration took place and, if possible, geographical provenance. Using three proxies, 87Sr/86Sr, δ13Cdentine and the presence of dental modifications, a majority (54.5%) of the individuals were found to be born non-locally. In addition, the 87Sr/86Sr data suggested that the non-locally born men came from more diverse geographic origins than the migrant women. Possible provenances were suggested for two individuals. These results contribute to an improved understanding of the dynamics of slave trading in the Indian Ocean world.

  11. Staff Attitudes and Services Provided by Community-Based Organizations for Alcohol and Other Drug Users in Cape Town, South Africa: Implications for Training and Education

    ERIC Educational Resources Information Center

    Pasche, Sonja; Myers, Bronwyn; Louw, Johann

    2008-01-01

    Aims: The aims of this study were: (i) to describe the nature of and the extent to which community-based organizations (CBOs) in Cape Town provide services to people who have alcohol and other drug (AOD) problems; (ii) to examine the relationship between CBOs' attitudes towards individuals with AOD problems and the types of services provided; and…

  12. Mesozoic gold mineralization in Hainan Province of South China: Genetic types, geological characteristics and geodynamic settings

    NASA Astrophysics Data System (ADS)

    Xu, Deru; Wang, Zhilin; Wu, Chuanjun; Zhou, Yueqiang; Shan, Qiang; Hou, Maozhou; Fu, Yangrong; Zhang, Xiaowen

    2017-04-01

    Numerous gold deposits and occurrences in Hainan Province of South China, predominantly of Mesozoic age account for more than 143 t of proven gold reserves. The Au mineralization occurs either along a group of NE-, NNW- and WNW-trending shear zones or within NW- to NNW-trending intraformational detachment faults which are closely related to folding, shearing and transpressional to transtensional deformation. Combined with the Mesozoic tectonics and associated magmatism, the ore geology, fluid inclusion geochemistry, C-H-O-S-(Pb) isotopes and geochronology consistently indicate that there are at least two gold deposit-types in Hainan Island, i.e., orogenic-type and intrusion-related. The predominant orogenic gold mineralization, which produces more than 95% of gold metal reserves in Hainan Island, formed in the Early Mesozoic (ca. 228-224 Ma). This ore deposit-type, represented by the Baolun, Gezhen, and Wangxia deposits, is generally hosted by metamorphosed volcaniclastic sedimentary rocks of the Paleo- to Mesoproterozoic, the Silurian and the Permian ages, and is closely associated with brittle-ductile shearing. These deposits, with native gold as main gold occurrence and low sulfide abundance (<5% by volume), are derived from the CO2-rich (mainly 4.8-16.8 mol%), near neutral (pH = ∼7), low-salinity (generally 3-10.5 wt.% NaCleq.), and intermediate-temperature ore fluids. In combination with the paleomagnetism, sedimentation, and petrographical and geochemical features of the Late Paleozoic to Early Mesozoic granitoids, the orogenic gold mineralization is considered to be formed in a post-collisional tectonic setting, in response to the Indosinian orogeny in South China triggered by the closure of the Paleotethys Ocean. Abundant Bi-As-Te-Mo-S phases, which grew synchronously with the gold minerals, suggest a possible involvement of magmatic fluids, especially for the large-scale, high-grade Baolun deposit. The Fuwen Au-dominated Au-Ag deposit, which is hosted by

  13. Barriers Associated with the Use of English in the Teaching of Technology in Grade 9 at Some Schools in Eastern Cape Province

    ERIC Educational Resources Information Center

    Makgato, Moses

    2015-01-01

    English is the language of learning and teaching in most schools in South Africa. The ability of teachers and students to understand and communicate with each other in English contributes to better performance in Science and Technology subjects. This article explores the challenges posed by the use of English in the teaching and learning of…

  14. What Are the Best and Worst Times in the Lives of South African Township Dwellers? A Content Analysis of the Self-Defined End-Anchors for Bernheim's ACSA Scale of Subjective Well-Being

    ERIC Educational Resources Information Center

    Moller, V.; Theuns, P.

    2013-01-01

    Bernheim's ACSA, a less conventional measure of subjective well-being originally developed for use in a clinical setting, was applied to a sample of black South African township dwellers (n = 1,020) in the Eastern Cape Province. The Anamnestic Comparative Self Assessment is an experiential self-anchoring scale with concrete anchors (Bernheim in…

  15. Transport of atmospheric NOx and HNO3 over Cape Town

    NASA Astrophysics Data System (ADS)

    Abiodun, B. J.; Ojumu, A. M.; Jenner, S.; Ojumu, T. V.

    2013-05-01

    Cape Town, the most popular tourist city in Africa, usually experiences air pollution with unpleasant odour in winter. Previous studies have associated the pollution with local emission of pollutants within the city. The present study examines the transport of atmospheric pollutants (NOx and HNO3) over South Africa and shows how the transport of pollutants from the Mpumalanga Highveld may contribute to the pollution in Cape Town. The study analysed observation data (2001-2008) from Cape Town air quality network and simulation data (2001-2004) from regional climate model (RegCM4) over southern Africa. The simulation accounts for the influence of complex topography, atmospheric condition, and atmospheric chemistry on emission and transport of pollutants over southern Africa. Flux budget analysis was used to examine whether Cape Town is a source or sink for NOx and HNO3 during the extreme pollution events. The results show that extreme pollution events over Cape Town are associated with the low-level (surface-850 hPa) transport of NOx from the Mpumalanga Highveld to Cape Town, and with a tongue of high concentration of HNO3 that extends from the Mpumalanga Highveld to Cape Town along the south coast of South Africa. The prevailing atmospheric conditions during the extreme pollution events feature an upper-level (700 hPa) anticyclonic flow over South Africa and a low-level col over Cape Town. The anticyclonic flow induces a strong subsidence motion, which prevents vertical mixing of the pollutants and caps high concentration of pollutants close to the surface as they are transported from the Mpumalanga Highveld toward Cape Town, while the col accumulates the pollutants over the city. This study shows that Cape Town can be a sink for the NOx and HNO3 during extreme pollution events and suggests that the accumulation of pollutants transported from other areas (e.g. Mpumalanga Highveld) may contribute substantially to the air pollution in Cape Town.

  16. Age and origin of cold climate landforms from the Eastern Cape Drakensberg, southern Africa: palaeoclimatic implications

    NASA Astrophysics Data System (ADS)

    Mills, Stephanie C.; Barrows, Timothy T.; Fifield, L. Keith

    2014-05-01

    Eastern Cape Province, South Africa. Journal of Quaternary Science 16, 365-374.

  17. Regional earthquake loss estimation in the Autonomous Province of Bolzano - South Tyrol (Italy)

    NASA Astrophysics Data System (ADS)

    Huttenlau, Matthias; Winter, Benjamin

    2013-04-01

    Beside storm events geophysical events cause a majority of natural hazard losses on a global scale. However, in alpine regions with a moderate earthquake risk potential like in the study area and thereupon connected consequences on the collective memory this source of risk is often neglected in contrast to gravitational and hydrological hazards processes. In this context, the comparative analysis of potential disasters and emergencies on a national level in Switzerland (Katarisk study) has shown that earthquakes are the most serious source of risk in general. In order to estimate the potential losses of earthquake events for different return periods and loss dimensions of extreme events the following study was conducted in the Autonomous Province of Bolzano - South Tyrol (Italy). The applied methodology follows the generally accepted risk concept based on the risk components hazard, elements at risk and vulnerability, whereby risk is not defined holistically (direct, indirect, tangible and intangible) but with the risk category losses on buildings and inventory as a general risk proxy. The hazard analysis is based on a regional macroseismic scenario approach. Thereby, the settlement centre of each community (116 communities) is defined as potential epicentre. For each epicentre four different epicentral scenarios (return periods of 98, 475, 975 and 2475 years) are calculated based on the simple but approved and generally accepted attenuation law according to Sponheuer (1960). The relevant input parameters to calculate the epicentral scenarios are (i) the macroseismic intensity and (ii) the focal depth. The considered macroseismic intensities are based on a probabilistic seismic hazard analysis (PSHA) of the Italian earthquake catalogue on a community level (Dipartimento della Protezione Civile). The relevant focal depth are considered as a mean within a defined buffer of the focal depths of the harmonized earthquake catalogues of Italy and Switzerland as well as

  18. Assessment of Permian coalbed gas resources of the Karoo Basin Province, South Africa and Lesotho, 2016

    USGS Publications Warehouse

    Schenk, Christopher J.; Brownfield, Michael E.; Tennyson, Marilyn E.; Klett, Timothy R.; Mercier, Tracey J.; Hawkins, Sarah J.; Gaswirth, Stephanie B.; Marra, Kristen R.; Finn, Thomas M.; Le, Phuong A.; Leathers-Miller, Heidi M.

    2017-02-21

    Using a geology-based assessment methodology, the U.S. Geological Survey estimated undiscovered, technically recoverable mean resources of 5.27 trillion cubic feet of coalbed gas in the Karoo Basin Province.

  19. Health Care Capacity and Allocations Among South Africa's Provinces: Infrastructure–Inequality Traps After the End of Apartheid

    PubMed Central

    Basu, Sanjay; McKee, Martin

    2011-01-01

    Objectives. We assessed the determinants of health care funding allocations among South Africa's provinces and their effects on health care from 1996 through 2007. Methods. We performed multivariate regression of funding allocation data against measures of disease burden and health system infrastructure by province. Results. Disease burden was increasingly negatively correlated with funding allocations and explained less than one quarter of the variation in allocations among provinces. Nearly three quarters of the variation in allocations was explained by preexisting hospital infrastructure and health care workers. The density of private hospitals in the preceding year was associated with greater government allocations (bprivate = 0.12; 95% confidence interval [CI] = 0.08, 0.15), but public hospital density in the preceding year was not (bpublic = 0.05; 95% CI = −0.02, 0.11). Greater allocations were associated with a higher number of doctors (b = 0.54; 95% CI = 0.34, 0.75) but fewer nurses (b = −0.37; 95% CI = −0.72,−0.25) in the same year. Conclusions. Regions with a greater capacity to spend funds received more funding and created more infrastructure than those with greater health needs. Historical infrastructure inequalities may have created an infrastructure–inequality trap, in which the distribution of funds to those with greater “absorptive capacity” exacerbates inequalities. PMID:21148716

  20. Petrogenesis of early Jurassic basalts in southern Jiangxi Province, South China: Implications for the thermal state of the Mesozoic mantle beneath South China

    NASA Astrophysics Data System (ADS)

    Cen, Tao; Li, Wu-xian; Wang, Xuan-ce; Pang, Chong-jin; Li, Zheng-xiang; Xing, Guang-fu; Zhao, Xi-lin; Tao, Jihua

    2016-07-01

    Early Jurassic bimodal volcanic and intrusive rocks in southern South China show distinct associations and distribution patterns in comparison with those of the Middle Jurassic and Cretaceous rocks in the area. It is widely accepted that these rocks formed in an extensional setting, although the timing of the onset and the tectonic driver for extension are debated. Here, we present systematic LA-ICP-MS zircon U-Pb ages, whole-rock geochemistry and Sr-Nd isotope data for bimodal volcanic rocks from the Changpu Formation in the Changpu-Baimianshi and Dongkeng-Linjiang basins in southern Jiangxi Province, South China. Zircon U-Pb ages indicate that the bimodal volcanic rocks erupted at ca. 190 Ma, contemporaneous with the Fankeng basalts (~ 183 Ma). A compilation of geochronological results demonstrates that basin-scale basaltic eruptions occurred during the Early Jurassic within a relatively short interval (< 5 Ma). These Early Jurassic basalts have tholeiitic compositions and OIB-like trace element distribution patterns. Geochemical analyses show that the basalts were derived from depleted asthenospheric mantle, dominated by a volatile-free peridotite source. The calculated primary melt compositions suggest that the basalts formed at 1.9-2.1 GPa, with melting temperatures of 1378 °C-1405 °C and a mantle potential temperature (TP) ranging from 1383 °C to 1407 °C. The temperature range is somewhat hotter than normal mid-ocean-basalt (MORB) mantle but similar to an intra-plate continental mantle setting, such as the Basin and Range Province in western North America. This study provides an important constraint on the Early Jurassic mantle thermal state beneath South China.

  1. Composition, biomass and energetic content of biota in the vicinity of feeding bowhead whales (Balaena mysticetus) in the Cape Bathurst upwelling region (south eastern Beaufort Sea)

    NASA Astrophysics Data System (ADS)

    Walkusz, Wojciech; Williams, William J.; Harwood, Lois A.; Moore, Sue E.; Stewart, Barbara E.; Kwasniewski, Slawomir

    2012-11-01

    Bowhead whales (Balaena mysticetus) of the Bering-Chukchi-Beaufort population form annual late-summer feeding aggregations offshore of the eastern Tuktoyaktuk Peninsula and Cape Bathurst. This region is strongly influenced by episodic upwelling events. A systematic aerial survey (10% coverage) was flown over the eastern shelf on 2 August 2008, revealing large numbers of bowheads (est. 3500 individuals) in a clumped distribution over the continental shelf. Between 7 and 11 August 2008, zooplankton samples and hydrography were obtained from the vicinity of two bowhead feeding aggregations, one at the northeast edge of the continental shelf, and the second off the northeast shore of the Cape Bathurst. Dense aggregations of zooplankton were found in the lower part of the water column (below 40 m), on the shelf, in water with an upwelling signature. The zooplankton were largely resting phases of calanoid copepods (Calanus hyperboreus and C. glacialis) and collectively had twice the abundance, twice the biomass, three times the caloric density and thus six times the energy content of contemporaneous zooplankton samples from the western Canadian Beaufort Shelf. Although upwelling at Cape Bathurst is wind-driven and thus episodic in nature, its consistent delivery of zooplankton to the bowhead foraging area creates conditions attractive to bowhead whales, with an estimated 33% of the bowhead population present on the eastern portion of the shelf at the time of the August 2008 aerial survey.

  2. Phylogenetic relatedness limits co-occurrence at fine spatial scales: evidence from the schoenoid sedges (Cyperaceae: Schoeneae) of the Cape Floristic Region, South Africa.

    PubMed

    Slingsby, Jasper A; Verboom, G Anthony

    2006-07-01

    Species co-occurrence at fine spatial scales is expected to be nonrandom with respect to phylogeny because of the joint effects of evolutionary (trait convergence and conservatism) and ecological (competitive exclusion and habitat filtering) processes. We use data from 11 existing vegetation surveys to test whether co-occurrence in schoenoid sedge assemblages in the Cape Floristic Region shows significant phylogenetic structuring and to examine whether this changes with the phylogenetic scale of the analysis. We provide evidence for phylogenetic overdispersion in an alliance of closely related species (the reticulate-sheathed Tetraria clade) using both quantile regression analysis and a comparison between the mean observed and expected phylogenetic distances between co-occurring species. Similar patterns are not evident when the analyses are performed at a broader phylogenetic scale. Examination of six functional traits suggests a general pattern of trait conservatism within the reticulate-sheathed Tetraria clade, suggesting a potential role for interspecific competition in structuring co-occurrence within this group. We suggest that phylogenetic overdispersion of communities may be common throughout many of the Cape lineages, since interspecific interactions are likely intensified in lineages with large numbers of species restricted to a small geographic area, and we discuss the potential implications for patterns of diversity in the Cape.

  3. Positive practice environments influence job satisfaction of primary health care clinic nursing managers in two South African provinces

    PubMed Central

    2014-01-01

    Background Nurses constitute the majority of the health workforce in South Africa and they play a major role in providing primary health care (PHC) services. Job satisfaction influences nurse retention and successful implementation of health system reforms. This study was conducted in light of renewed government commitment to reforms at the PHC level, and to contribute to the development of solutions to the challenges faced by the South African nursing workforce. The objective of the study was to determine overall job satisfaction of PHC clinic nursing managers and the predictors of their job satisfaction in two South African provinces. Methods During 2012, a cross-sectional study was conducted in two South African provinces. Stratified random sampling was used to survey a total of 111 nursing managers working in PHC clinics. These managers completed a pre-tested Measure of Job Satisfaction questionnaire with subscales on personal satisfaction, workload, professional support, training, pay, career prospects and standards of care. Mean scores were used to measure overall job satisfaction and various subscales. Predictors of job satisfaction were determined through multiple logistic regression analysis. Results A total of 108 nursing managers completed the survey representing a 97% response rate. The mean age of respondents was 49 years (SD = 7.9) and the majority of them (92%) were female. Seventy-six percent had a PHC clinical training qualification. Overall mean job satisfaction scores were 142.80 (SD = 24.3) and 143.41 (SD = 25.6) for Gauteng and Free State provinces respectively out of a maximum possible score of 215. Predictors of job satisfaction were: working in a clinic of choice (RRR = 3.10 (95% CI: 1.11 to 8.62, P = 0.030)), being tired at work (RRR = 0.19 (95% CI: 0.08 to 0.50, P = 0.001)) and experience of verbal abuse (RRR = 0.18 (95% CI: 0.06 to 0.55, P = 0.001). Conclusion Allowing nurses greater choice of clinic

  4. Modeling the Complexities of Water and Hygiene in Limpopo Province South Africa

    NASA Astrophysics Data System (ADS)

    Mellor, J. E.; Smith, J. A.; Learmonth, G.; Netshandama, V.; Dillingham, R.

    2012-12-01

    Access to sustainable water and sanitation services is one of the biggest challenges the developing world faces as an increasing number of people inhabit those areas. Inadequate access to water and sanitation infrastructure often leads children to drink poor quality water which can result in early childhood diarrhea (ECD). Repeated episodes of ECD can cause serious problems such as growth stunting, cognitive impairment, and even death. Although researchers have long studied the connection between poor access to water and hygiene facilities and ECD, most studies have relied on intervention-control methods to study the effects of singular interventions. Such studies are time-consuming, costly, and fail to acknowledge that the causes and prevention strategies for ECD are numerous and complex. An alternate approach is to think of a community as a complex system in which the engineered, natural and social environments interact in ways that are not easily predicted. Such complex systems have no central or coordinating mechanism and may exhibit emergent behavior which can be counterintuitive and lead to valuable insights. The goal of this research is to develop a robust, quantitative understanding of the complex pathogen transmission chain that leads to ECD. To realize this goal, we have developed an Agent-Based Model (ABM) which simulates individual community member behavior. We have validated this transdisciplinary model with four years of field data from a community in Limpopo Province, South Africa. Our model incorporates data such as household water source preferences, collection habits, household- and source-water quality, water-source reliability and biological regrowth. Our outcome measures are household water quality, ECD incidences, and child growth stunting. This technique allows us to test hypotheses on the computer. Future researchers can implement promising interventions with our partner institution, the University of Venda, and the model can be refined as

  5. Cost and Impact of Voluntary Medical Male Circumcision in South Africa: Focusing the Program on Specific Age Groups and Provinces

    PubMed Central

    Kripke, Katharine; Thambinayagam, Ananthy; Pillay, Yogan; Loykissoonlal, Dayanund; Bonnecwe, Collen; Barron, Peter; Kiwango, Eva; Castor, Delivette

    2016-01-01

    Background In 2012, South Africa set a goal of circumcising 4.3 million men ages 15–49 by 2016. By the end of March 2014, 1.9 million men had received voluntary medical male circumcision (VMMC). In an effort to accelerate progress, South Africa undertook a modeling exercise to determine whether circumcising specific client age groups or geographic locations would be particularly impactful or cost-effective. Results will inform South Africa’s efforts to develop a national strategy and operational plan for VMMC. Methods and Findings The study team populated the Decision Makers’ Program Planning Tool, Version 2.0 (DMPPT 2.0) with HIV incidence projections from the Spectrum/AIDS Impact Module (AIM), as well as national and provincial population and HIV prevalence estimates. We derived baseline circumcision rates from the 2012 South African National HIV Prevalence, Incidence and Behaviour Survey. The model showed that circumcising men ages 20–34 offers the most immediate impact on HIV incidence and requires the fewest circumcisions per HIV infection averted. The greatest impact over a 15-year period is achieved by circumcising men ages 15–24. When the model assumes a unit cost increase with client age, men ages 15–29 emerge as the most cost-effective group. When we assume a constant cost for all ages, the most cost-effective age range is 15–34 years. Geographically, the program is cost saving in all provinces; differences in the VMMC program’s cost-effectiveness across provinces were obscured by uncertainty in HIV incidence projections. Conclusion The VMMC program’s impact and cost-effectiveness vary by age-targeting strategy. A strategy focusing on men ages 15–34 will maximize program benefits. However, because clients older than 25 access VMMC services at low rates, South Africa could consider promoting demand among men ages 25–34, without denying services to those in other age groups. Uncertainty in the provincial estimates makes them

  6. Beak and feather disease virus: correlation between viral load and clinical signs in wild Cape parrots (Poicepahlus robustus) in South Africa.

    PubMed

    Regnard, Guy L; Boyes, Rutledge S; Martin, Rowan O; Hitzeroth, Inga I; Rybicki, Edward P

    2015-01-01

    Psittacine beak and feather disease (PBFD), the most prevalent viral disease affecting psittacines, is caused by beak and feather disease virus (BFDV). This study assessed viral load using qPCR in a wild Cape parrot population affected by PBFD and compared it to overall physical condition based on clinical signs attributable to PBFD. A significant inverse correlation between viral load and overall physical condition was found, which confirmed that clinical signs may confidently be used to diagnose the relative severity of BFDV infections in wild populations. This is the first assessment of BFDV viral load in a wild psittacine population.

  7. Tracking data from nine free-roaming Cheetahs (Acinonyx jubatus) collared in the Thabazimbi area, Limpopo Province, South Africa

    PubMed Central

    Marnewick, Kelly; Roxburgh, Lizanne; Somers, Michael J.

    2017-01-01

    Abstract Background In partnership with the University of Pretoria, the Endangered Wildlife Trust’s Carnivore Conservation Programme collared six male and three female free-roaming Cheetahs (Acinonyx jubatus) in the Thabazimbi area in Limpopo Province, South Africa. This study was undertaken to determine the spatial ecology of free-roaming Cheetahs that occur outside of formal protected areas on private ranchland, where they frequently come into conflict with, and are sometimes killed by, private landowners. The data were collected between September 2003 and November 2008, resulting in a total of 3165 location points (65 points from VHF collars and 3100 from GPS collars) for nine individual Cheetahs. New information This dataset provides distribution information about this Vulnerable species occurring outside of protected areas within South Africa. The dataset has been published to the Global Biodiversity Information Facility (www.GBIF.org) and provides the largest dataset on Cheetahs thus far, and, although it is spatially limited to a relatively small region on the African continent, it is the first study of its kind within South Africa. Also of significance is that the fate of 6 of the 9 collared Cheetahs is known, all except one of which died of anthropogenic causes. PMID:28325981

  8. Cape of Good Hope

    Atmospheric Science Data Center

    2016-08-24

    article title:  Aerosol retrieval over Cape of Good Hope (Enlargement)     ... (MISR) image is an enlargement of the  aerosol retrieval over Cape of Good Hope, August 23, 2000 , showing a more detailed ... energy, so MISR's contribution is not only the aerosol retrieval necessary to do the correction, but the multi-angular integration. ...

  9. The Heart in Haart: Quality of Life of Patients Enrolled in the Public Sector Antiretroviral Treatment Programme in the Free State Province of South Africa

    ERIC Educational Resources Information Center

    Booysen, F. Le R.; Van Rensburg, H. C. J.; Bachmann, M.; Louwagie, G.; Fairall, L.

    2007-01-01

    This paper reports on the quality of life of patients enrolled in the public sector antiretroviral treatment programme in the Free State province of South Africa. Statistical analysis of cross-sectional data reveals that it is not access to treatment "per se" that enhances the quality of life of those who have come forward for ART.…

  10. New species of Anthostomella on fynbos, with a key to the genus in South Africa.

    PubMed

    Lee, Seonju; Crous, Pedro W

    2003-03-01

    A study of saprobic fungi occurring on the fynbos of the Western Cape Province of South Africa yielded four unknown Anthostomella species. A. proteae from Protea nitida, A. cynaroides from P. cynaroides, A. leucospermi from Leucospermum oleifolium, and A. brabeji from Brabejum stellatifolium are described as new. New records for South Africa include A. conorum from Leucadendron sp., Protea magnifica and P. neriifolia, and A. clypeata from Ischyrolepis subverticellata, Cannomois virgata, Restio egregius, and R. cfr confusus. A dichotomous key to the Anthostomella species in South Africa is also provided.

  11. Determination of the water quality index ratings of water in the Mpumalanga and North West provinces, South Africa

    NASA Astrophysics Data System (ADS)

    Wanda, Elijah M. M.; Mamba, Bhekie B.; Msagati, Titus A. M.

    2016-04-01

    This study reports on the water quality index (WQI) of wastewater and drinking water in the Mpumalanga and North West provinces of South Africa. The WQI is one of the most effective tools available to water sustainability researchers, because it provides an easily intelligible ranking of water quality on a rating scale from 0 to 100, based on the ascription of different weightings to several different parameters. In this study the WQI index ratings of wastewater and drinking water samples were computed according to the levels of pH, electrical conductivity (EC), biochemical oxygen demand (BOD), E. coli, temperature, turbidity and nutrients (nitrogen and phosphates) found in water samples collected from the two provinces between June and December, 2014. This study isolated three groups of WQ-rated waters, namely: fair (with a WQI range = 32.87-38.54%), medium (with a WQI range = 56.54-69.77%) and good (with a WQI range = 71.69-81.63%). More specifically, 23%, 23% and 54% of the sampled sites registered waters with fair, medium and good WQ ratings respectively. None of the sites sampled during the entire period of the project registered excellent or very good water quality ratings, which would ordinarily indicate that no treatment is required to make it fit for human consumption. Nevertheless, the results obtained by the Eerstehoek and Schoemansville water treatment plants in Mpumalanga and North West provinces, respectively, suggest that substantial improvement in the quality of water samples is possible, since the WQI values for all of the treated samples were higher than those for raw water. Presence of high levels of BOD, low levels of dissolved oxygen (DO), E. coli, nitrates and phosphates especially in raw water samples greatly affected their overall WQ ratings. It is recommended that a point-of-use system should be introduced to treat water intended for domestic purposes in the clean-water-deprived areas.

  12. Indoor household residual spraying program performance in Matabeleland South province, Zimbabwe: 2011 to 2012; a descriptive cross-sectional study

    PubMed Central

    Chimberengwa, Pugie Tawanda; Masuka, Nyasha; Gombe, Notion Tafara; Tshimanga, Mufuta; Takundwa, Lucia; Bangure, Donewell

    2015-01-01

    Introduction Matabeleland South launched the malaria pre-elimination campaign in 2012 but provincial spraying coverage has failed to attain 95% target, with some districts still encountering malaria outbreaks. A study was conducted to evaluate program performance against achieving malaria pre-elimination. Methods A descriptive cross sectional study was done in 5 districts carrying out IRS using the logical framework involving inputs, process, outputs and outcome evaluation. Health workers recruited into the study included direct program implementers, district and provincial program managers. An interviewer administered questionnaire, checklists, key informant interviewer guide and desk review of records were used to collect data. Results We enrolled 37 primary respondents and 5 key informants. Pre-elimination, Epidemic Preparedness and Response plans were absent in all districts. Shortages of inputs were reported by 97% of respondents, with districts receiving 80% of requested budget. Insecticides were procured centrally at national level. Spraying started late and districts failed to spray all targeted households by end of December. The province is using makeshift camps with inappropriate evaporation ponds where liquid DDT waste is not safely accounted for. The provincial IHRS coverage for 2011 was 84%. Challenges cited included; food shortages for spraymen, late delivery of inputs and poor state of IHRS equipment. Conclusion The province has failed to achieve Malaria pre-elimination IRS coverage targets for 2011/12 season. Financial and logistical challenges led to delays in supply of program inputs, recruitment and training of sprayers. The Province should establish camping infrastructure with standard evaporation ponds to minimise contamination of the environment. PMID:26015847

  13. Views of teenagers on termination of pregnancy at Muyexe high school in Mopani District, Limpopo Province, South Africa

    PubMed Central

    Lebese, Tsakani R.; Maputle, Sonto M.; Mulaudzi, Lindiwe

    2016-01-01

    Background Teenage pregnancy is a global social health concern especially because of the HIV and AIDS pandemic, sexually transmitted infections, high rate of termination of pregnancy (TOP), adolescents’ parenthood and decreased level of contraceptives. Aim To explore the views of teenagers on the TOP at Muyexe high school in a rural village of Mopani District, Limpopo Province. Setting Muyexe high school in a rural village of Mopani District, Limpopo Province, in South Africa. Methodology A qualitative method using explorative and descriptive designs was used to find in-depth description and understanding of teenagers’ views on TOP. The target population was girls aged 15–19 years at Muyexe high school in Mopani District. Non-probability, convenient sampling was used to select high school teenage girls who had undergone TOP for the study. Data were collected using individual self-report technique (interview). Tesch’s eight steps of qualitative data analysis were used. Measures to ensure trustworthiness and ethical considerations were observed. Results Two major themes were revealed: (1) Views of teenagers regarding TOP (poverty, relationship problems and single parenthood, negative impact on the teen’s life while attending school) and (2) teenager’s fears regarding pregnancy (stigma, fear of parents and friends, rape and incest and fear of giving birth). Conclusion Majority of participants had knowledge about TOP; some had experiences about TOP while others held inadequate knowledge. Recommendations were based on the findings by teaching dangers of TOP and various contraceptive methods to prevent unwanted pregnancies and TOP. PMID:27380849

  14. Predictability of Malaria Transmission Intensity in the Mpumalanga Province, South Africa, Using Land Surface Climatology and Autoregressive Analysis

    NASA Technical Reports Server (NTRS)

    Grass, David; Jasinski, Michael F.; Govere, John

    2003-01-01

    There has been increasing effort in recent years to employ satellite remotely sensed data to identify and map vector habitat and malaria transmission risk in data sparse environments. In the current investigation, available satellite and other land surface climatology data products are employed in short-term forecasting of infection rates in the Mpumalanga Province of South Africa, using a multivariate autoregressive approach. The climatology variables include precipitation, air temperature and other land surface states computed by the Off-line Land-Surface Global Assimilation System (OLGA) including soil moisture and surface evaporation. Satellite data products include the Normalized Difference Vegetation Index (NDVI) and other forcing data used in the Goddard Earth Observing System (GEOS-1) model. Predictions are compared to long- term monthly records of clinical and microscopic diagnoses. The approach addresses the high degree of short-term autocorrelation in the disease and weather time series. The resulting model is able to predict 11 of the 13 months that were classified as high risk during the validation period, indicating the utility of applying antecedent climatic variables to the prediction of malaria incidence for the Mpumalanga Province.

  15. Herbal medicines used by Bapedi traditional healers to treat reproductive ailments in the Limpopo Province, South Africa.

    PubMed

    Semenya, Ss; Maroyi, A; Potgieter, Mj; Erasmus, Ljc

    2013-01-01

    The current study focussed on documenting the ethnobotanical knowledge of herbal medicines used by the Bapedi traditional healers to treat reproductive ailments in the Limpopo Province, South Africa. Fifty one healers from 17 municipalities covering Capricorn, Sekhukhune and Waterberg districts of the Limpopo Province were interviewed between January and July 2011. Semi-structured interviews, observations and guided field surveys with the healers were employed. Thirty-six medicinal plant species belonging to 35 genera and 20 families were documented. The most used species were Zanthoxylum humile (25.5%), Catha edulis (21.6%), Ozoroa sphaerocarpa (15.7%), Hypoxis hemerocallidea (13.7%), Hypoxis obtusa (11.7%), Gomphocarpus fruticosus subsp. fruticosus and Gymnosporia senegalensis (9.8% each). The dominant growth forms among the reported medicinal plants were herbs (39%), followed by shrubs and trees with 33% and 28%, respectively. The preferred plant parts were roots (63.9%), followed by bark (13.9%), whole plant (11.1%), tubers (8.3%), bulbs (5.6%), fruits, leaves, stems and twigs (2.8% each). The majority of the species were used to treat gender specific reproductive ailments; while a minority were used for treating reproductive ailments of both genders. Twenty-two species (61.1%) are supported by reports of similar uses in other countries or have proven biological activity. This study illustrates that Bapedi traditional healers possess remarkable knowledge on medicinal plants used for treating and managing reproductive ailments.

  16. Climatic and tectonic controls on Late Triassic to Middle Jurassic sedimentation in northeastern Guangdong Province, South China

    NASA Astrophysics Data System (ADS)

    Pang, Chong-Jin; Li, Zheng-Xiang; Xu, Yi-Gang; Wen, Shu-Nv; Krapež, Bryan

    2016-05-01

    Stratigraphic analyses document climatic and tectonic controls on the filling of a Late Triassic to early Middle Jurassic (T3-J2) basin that developed on top of a young orogenic belt in southeastern South China. About 2700 m of Carnian to Bajocian sedimentary rocks is documented in the Meizhou region, Guangdong Province. The Carnian to Rhaetian sequence is characterized by deltaic facies that are succeeded by Hettangian fluvial, shallow marine and volcaniclastic facies, and by Sinemurian to early Toarcian interdistributary bay and floodplain facies. The late Toarcian to Bajocian sequence comprises proximal alluvial to lacustrine facies that changed upwards to fluvial facies. Fossil assemblages indicate that climatic conditions changed from tropical/subtropical warm humid, to temperate humid, and then to hot arid through the Late Triassic to the Middle Jurassic. Climatically induced changes (e.g., in precipitation, vegetation and erosion) exerted a strong influence on sediment supply, whereas tectonics played a dominant role in stratigraphic evolution, accommodation generation, sedimentation pattern and volcanism. Tectonostratigraphic analysis shows that the T3-J2 basin was initiated on an orogenic belt during late-stage orogeny, and evolved into shallow-marine and volcanic environments and then back to terrestrial facies during the post-orogenic stage. This was followed by regional uplift and the development of a basin-and-range province. The order of these events is similar to that of the central Rocky Mountains, western North America during the Palaeogene. The Mesozoic basin of South China and the Eocene basins of the central Rocky Mountains highlight the importance of subduction-related subsidence above young and broad orogens.

  17. Ethnopharmacological survey of plants used in the traditional treatment of hypertension and diabetes in south-eastern Morocco (Errachidia province).

    PubMed

    Tahraoui, A; El-Hilaly, J; Israili, Z H; Lyoussi, B

    2007-03-01

    This survey was undertaken in the Errachidia province in south-eastern Morocco in order to inventory the main medicinal plants used in folk medicine to treat arterial hypertension and diabetes mellitus. Four hundred individuals who knew about and/or had used the medicinal plants for the indicated diseases, including some herbal healers, were interviewed throughout different regions of the province. The inventory of medicinal plants is summarized in a synoptic table, which contains the scientific, vernacular and common name of the plant, its ecological distribution, the part of the plant and the preparation used and the therapeutic indication. Extensive investigations have brought to light 64 medicinal plants belonging to 33 families; of these, 45 are used for diabetes, 36 for hypertension, and 18 for both diseases. Of these plants, 34% grow in the wild, 44% are cultivated, and 22% are not indigenous to the area and are brought from other parts of Morocco or from outside the country. The survey shows that 78% of the patients regularly use these medicinal plants. In this region, the most frequently used plants to treat diabetes include Ajuga iva, Allium cepa, Artemisia herba-alba, Carum carvi, Lepidium sativum, Nigella sativa, Olea europaea, Peganum harmala, Phoenix dactylifera, Rosmarinus officinalis, and Zygophyllum gaetulum, and those to treat hypertension include Ajuga iva, Allium cepa, Allium sativum, Artemisia herba-alba Asso, Carum carvi, Nigella sativa, Olea europea, Rosmarinus officinalis, Origanum majorana, Peganum harmala, and Phoenix dactylifera. The local people recognize the toxic plants and are very careful in using such plants, which are Citrullus colocynthis, Datura stramonium, Nerium oleander, Nigella sativa, Peganum harmala and Zygophyllum gaetulum. Our survey shows that traditional medicine in the south-eastern Moroccan population has not only survived but has thrived in the transcultural environment and intermixture of many ethnic traditions and

  18. The utilization and management of plant resources in rural areas of the Limpopo Province, South Africa

    PubMed Central

    2013-01-01

    Background Most rural people in the Limpopo Province depend on plant resources to meet their livelihood needs. However, there is insufficient recorded information regarding their use and management. The current study therefore was carried out in selected villages of the Limpopo Province, to close this knowledge gap. Methods Information was collected from 60 people residing in two villages, using a semi-structured questionnaire, supplemented with field observations. Results A total of 47 wild plant species (95% indigenous and 5% exotics) from 27 families, mostly from the Fabaceae (17%), Anacardiaceae (9%), and Combretaceae (9%) were documented. These species were used primarily for firewood (40%), food (36%) and medicine (29%). Significantly used species included Sclerocarya birrea (85%), Combretum kraussii (35%) and Harpephyllum caffrum (35%). Local traditional rules and regulations including taboos, social beliefs and fines are in place to aid in the management of communal resources. However, a significant number (67%) of participants mentioned that they were not pleased with these rules and regulations. Conclusion The current study concluded that plant resources still play an important role in the surveyed rural areas of the Limpopo Province. Furthermore, for sustainable utilization and long-term conservation of plants in these areas the government should assist communities in the management of their plant resources. PMID:23590903

  19. The Santa Cruz - Tarija Province of Central South America: Los Monos - Machareti(!) Petroleum System

    USGS Publications Warehouse

    Lindquist, Sandra J.

    1999-01-01

    The Los Monos - Machareti(!) total petroleum system is in the Santa Cruz - Tarija Province of Bolivia, Argentina and Paraguay. Province history is that of a Paleozoic, intracratonic, siliciclastic rift basin that evolved into a Miocene (Andean) foreland fold and thrust belt. Existing fields are typified by alternating reservoir and seal rocks in post-Ordovician sandstones and shales on anticlines. Thick Devonian and Silurian shale source rocks, depositionally and erosionally confined to this province, at a minimum have generated 4.1 BBOE known ultimate recoverable reserves (as of 1995, 77% gas, 15% condensate, 8% oil) into dominantly Carboniferous reservoirs with average 20% porosity and 156 md permeability. Major detachment surfaces within the source rocks contributed to the thin-skinned and laterally continuous nature of the deformation. Tertiary foreland burial adequate for significant source maturation coincided with the formation of compressional traps. Further hydrocarbon discovery in the fold and thrust belt is expected. In the foreland basin, higher thermal gradients and variable burial history - combined with the presence of unconformity and onlap wedges - create potential there for stratigraphic traps and pre-Andean, block-fault and forced-fold traps.

  20. Outcomes of a community-based HIV-prevention pilot programme for township men who have sex with men in Cape Town, South Africa

    PubMed Central

    Batist, Elizabeth; Brown, Benjamin; Scheibe, Andrew; Baral, Stefan D; Bekker, Linda-Gail

    2013-01-01

    Introduction Men who have sex with men (MSM) in Cape Town's townships remain in need of targeted HIV-prevention services. In 2012, a pilot community-based HIV-prevention programme was implemented that aimed to reach MSM in five Cape Town townships, disseminate HIV-prevention information and supplies, and promote the use of condoms and HIV services. Methods Convenience sampling was used to recruit self-identified MSM who were 18 years old or older in five Cape Town townships. The six-month pilot programme trained five community leaders who, along with staff, provided HIV-prevention information and supplies to MSM through small-group meetings, community-based social activities and inter-community events. After the completion of the pilot programme, in-depth interviews and focus group discussions (FGDs) were conducted with a subset of conveniently sampled participants and with each of the community leaders. Qualitative data were then analyzed thematically. Results Overall, 98 mostly gay-identified black MSM consented to participate, 57 community-based activities were facilitated and 9 inter-community events were conducted. Following their enrolment, 60% (59/98) of participants attended at least one pilot activity. Of those participants, 47% (28/59) attended at least half of the scheduled activities. A total of 36 participants took part in FGDs, and five in-depth interviews were completed with community leaders. Participants reported gaining access to MSM-specific HIV-prevention information, condoms and water-based lubricant through the small-group meetings. Some participants described how their feelings of loneliness, social isolation, self-esteem and self-efficacy were improved after taking part. Conclusions The social activities and group meetings were viable strategies for disseminating HIV-prevention information, condoms and water-based lubricant to MSM in this setting. Many MSM were also able to receive social support, reduce social isolation and improve their

  1. Changes in malaria morbidity and mortality in Mpumalanga Province, South Africa (2001- 2009): a retrospective study

    PubMed Central

    2012-01-01

    Background Malaria remains a serious epidemic threat in Mpumalanga Province. In order to appropriately target interventions to achieve substantial reduction in the burden of malaria and ultimately eliminate the disease, there is a need to track progress of malaria control efforts by assessing the time trends and evaluating the impact of current control interventions. This study aimed to assess the changes in the burden of malaria in Mpumalanga Province during the past eight malaria seasons (2001/02 to 2008/09) and whether indoor residual spraying (IRS) and climate variability had an effect on these changes. Methods This is a descriptive retrospective study based on the analysis of secondary malaria surveillance data (cases and deaths) in Mpumalanga Province. Data were extracted from the Integrated Malaria Information System. Time series model (Autoregressive Integrated Moving Average) was used to assess the association between climate and malaria. Results Within the study period, a total of 35,191 cases and 164 deaths due to malaria were notified in Mpumalanga Province. There was a significant decrease in the incidence of malaria from 385 in 2001/02 to 50 cases per 100,000 population in 2008/09 (P < 0.005). The incidence and case fatality (CFR) rates for the study period were 134 cases per 100,000 and 0.54%, respectively. Mortality due to malaria was lower in infants and children (CFR < 0.5%) and higher in those >65 years, with the mean CFR of 2.1% as compared to the national target of 0.5%. A distinct seasonal transmission pattern was found to be significantly related to changes in rainfall patterns (P = 0.007). A notable decline in malaria case notification was observed following apparent scale-up of IRS coverage from 2006/07 to 2008/09 malaria seasons. Conclusions Mpumalanga Province has achieved the goal of reducing malaria morbidity and mortality by over 70%, partly as a result of scale-up of IRS intervention in combination with other control strategies. These

  2. On some sea cucumbers (Echinodermata: Holothuroidea) from off the south and west coasts of South Africa collected by the South African Environmental and Observation Network (SAEON).

    PubMed

    Thandar, Ahmed S; Rambaran, Ryan

    2015-08-07

    Twenty four specimens of holothuroids recently received from the South African Environmental and Observation Network (SAEON), collected from off the south and west coasts of South Africa, are herein recorded and/or described. The specimens comprise eight nominal and one indeterminate species and represent both shallow-water and deep-sea forms, distributed from Plettenberg Bay to just north of Lambert's Bay in the Western Cape Province. There are no new species but two new records for the South African region and extensions of horizontal and bathymetric distributions of the other species. Additions to the South African fauna are Zygothuria lactea (Théel, 1886) and Synallactes cf. challengeri (Théel, 1886). The paper also contains the first definite record of Thyone venusta Selenka, 1868, originally described from the Red Sea. Distribution ranges of the following species have been altered Synallactes viridilimus Cherbonnier, 1952; S. mollis Cherbonnier, 1952 and Psuedostichopus langeae Thandar, 2009.

  3. Description of adult and third instar larva of Trichostetha curlei sp. n. (Coleoptera, Scarabaeidae, Cetoniinae) from the Cape region of South Africa

    PubMed Central

    Perissinotto, Renzo; Šípek, Petr; Ball, Jonathan B.

    2014-01-01

    Abstract A new high altitude montane species of Trichostetha Burmeister, 1842 is described from the Elandsberg range of the Western Cape interior. This represents the 14th species of the genus and the first to be reported with a description of its larva. It is a significant addition to the growing number of species that exhibit no adult feeding behaviour and a short period of activity restricted to the onset of summer. Larvae dwell in rock crevices, feeding on decomposing plant matter. The genus Trichostetha is heterogeneous and the complex variability observed in some species, especially T. capensis (Linnaeus, 1767), requires the re-instatement of taxa that were recently synonymised. Thus, T. bicolor Péringuey, 1907 is here re-proposed as a separate species and T. capensis hottentotta (Gory & Percheron, 1833) as a separate subspecies. Conversely, T. alutacea Allard, 1994 is recognised as a dark variety of T. signata (Fabricius, 1775) and is, consequently, synonymised with this species. PMID:25161367

  4. 76 FR 63563 - Snapper-Grouper Fishery of the South Atlantic; Closure of the 2011-2012 Recreational Sector for...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-10-13

    .... lat., the latitude of Cape Hatteras Light, North Carolina. NMFS has determined that the recreational... 35[deg]15.19' N. lat., the latitude of Cape Hatteras Light, North Carolina, south. From Cape...

  5. Tropospheric ozone and its regional transport over Cape Town

    NASA Astrophysics Data System (ADS)

    Nzotungicimpaye, Claude-Michel; Abiodun, Babatunde J.; Steyn, Douw G.

    2014-04-01

    As part of efforts to understand the sources of air pollution in Cape Town, this study investigates the local variation of tropospheric ozone (O3) and identifies possible advection paths of O3 pollution from a remote source to Cape Town. Measurements of O3 and wind from three sites in the Cape Town area were analyzed to study the local variations of O3. At each site, the diurnal variation of O3 is found to be mainly driven by photochemical production while the seasonal variation of O3 is mostly driven by wind conditions. The highest concentration of O3 is observed at the remote site (Cape Point) while lowest O3 concentration is observed at the sub-urban site (Goodwood), where there are chemical sinks of O3 such as NOx. Atmospheric pollution over southern Africa was simulated to study the regional transport of O3. The simulations show that extreme O3 levels in Cape Town can be caused by air pollution transported from the industrial Highveld of South Africa, in the lower troposphere. Such extreme O3 pollution events over Cape Town are simulated to occur in January (14%), March (44%), April (28%) and September (14%). Lagrangian trajectories suggest four paths by which air parcels can be transported from the industrial Highveld to Cape Town: a north-easterly path which is the most frequent route, a tropical deviation route, a deviation along the south coastline and an oceanic deviation path which is the less frequent route. The major advection paths associated with poor air quality in Cape Town are the north-easterly route and the path along the south coastline of the country. Hence the study suggests that emissions in the industrial Highveld may contribute to O3 concentration in the Cape Town area.

  6. Research of water resources allocation of South-to-North Water Diversion East Route Project in Jiangsu Province ,Eastern China

    NASA Astrophysics Data System (ADS)

    Zeng, C.

    2015-12-01

    Optimized allocation of water resources is the important means of solving regional water shortage and can improve the utilization of water resources. Water resources allocation in the large-scale water diversion project area is the current research focus. This research takes the east route of the South-to-North Water Transfer Project in Jiangsu province as the research area, based on the hydrological model, agricultural irrigation quota model, and water project scheduling model, a water resources allocation model was constructed. The research carried on generalized regional water supply network, simulated the water supply, water demand and water deficit in agriculture, industry, life, ecology and lock under the status quo and planning engineering conditions. According to the results, the east route of the South-to-North Water Transfer Project is helpful to improve regional water shortage situation. The results showed that pump output increase by 2.8 billion cubic meters of water. On the conditions of P = 95%, 75% and 50%, compared with the benchmark year, water demand increases slightly due to the need of social and economic development in planning years, and water supply increased significantly because of new diversion ability. Water deficit are greatly reduced by 74.9% especially in the commonly drought condition because of the new project operation and optimized allocation of water resources.

  7. Using diaries to explore the work experiences of primary health care nursing managers in two South African provinces

    PubMed Central

    Munyewende, Pascalia O.; Rispel, Laetitia C.

    2014-01-01

    Background South Africa is on the brink of another wave of major health system reforms that underscore the centrality of primary health care (PHC). Nursing managers will play a critical role in these reforms. Objective The aim of the study was to explore the work experiences of PHC clinic nursing managers through the use of reflective diaries, a method hitherto under-utilised in health systems research in low- and middle-income countries. Design During 2012, a sub-set of 22 PHC nursing managers was selected randomly from a larger nurses’ survey in two South African provinces. After informed consent, participants were requested to keep individual diaries for a period of 6 weeks, using a clear set of diary entry guidelines. Reminders consisted of weekly short message service reminders and telephone calls. Diary entries were analysed using thematic content analysis. A diary feedback meeting was held with all the participants to validate the findings. Results Fifteen diaries were received, representing a 68% response rate. The majority of respondents (14/15) were female, each with between 5 and 15 years of nursing experience. Most participants made their diary entries at home. Diaries proved to be cathartic for individual nursing managers. Although inter-related and not mutually exclusive, the main themes that emerged from the diary analysis were health system deficiencies; human resource challenges; unsupportive management environment; leadership and governance; and the emotional impact of clinic management. Conclusions Diaries are an innovative method of capturing the work experiences of managers at the PHC level, as they allow for confidentiality and anonymity, often not possible with other qualitative research methods. The expressed concerns of nursing managers must be addressed to ensure the success of South Africa's health sector reforms, particularly at the PHC level. PMID:25537937

  8. A new invasive weed-feeding species of Polypedilum (Pentapedilum) Kieffer from South Africa (Diptera: Chironomidae, Chironominae).

    PubMed

    Andersen, Trond; González, Orestes C Bello; Baars, Jan-Robert; Earle, William

    2015-08-19

    Polypedilum (Pentapedilum) tuburcinatum Andersen et Bello González sp. n. is described and figured as male, female, pupa and larva based on material collected in the Eastern Cape Province in South Africa, imported into quarantine in Ireland and reared in the laboratory. The species feeds on the aquatic weed Lagarosiphon major (Ridl.) Moss ex Wager and is regarded as a promising candidate agent for biological control of this invasive weed.

  9. Thermal history and differential exhumation across the Eastern Musgrave Province, South Australia: Insights from low-temperature thermochronology

    NASA Astrophysics Data System (ADS)

    Glorie, Stijn; Agostino, Kate; Dutch, Rian; Pawley, Mark; Hall, James; Danišík, Martin; Evans, Noreen J.; Collins, Alan S.

    2017-04-01

    Multi-method geo- and thermochronological data obtained for Palaeo- and Mesoproterozoic granitoids traversing the main structural architecture of the eastern Musgrave Province within South Australia reveal multiphase cooling histories. Apatite U-Pb dating on six samples yield consistent ages of 1075-1025 Ma, suggesting a thermal reset coinciding with mantle-derived magmatism of the greater Warakurna Large Igneous Province ( 1080-1040 Ma). Apatite fission track (AFT) analysis indicate that four discrete thermal events affected the study area, inducing cooling through the AFT partial annealing zone ( 60-120 °C), supported by apatite and zircon (U-Th-Sm)/He data. Late Neoproterozoic cooling from deep crustal levels to temperatures < 200 °C was discerned, which is thought to be related to exhumation and denudation during the Petermann Orogeny. Subsequent cooling events at 450-400 Ma (Silurian-Devonian) and 310-290 Ma (Late Carboniferous) are interpreted to represent exhumation associated with the Alice Springs Orogeny. The latter event exhumed the sampled plutons to shallow crustal depths. An additional Triassic - early Jurassic thermal event, likely recording elevated geothermal gradients at that time, was observed throughout the study area, however, more data is needed to further support this interpretation. The high sample density across the structural architecture of the study area furthermore reveals patterns of fault reactivation and resulting differential exhumation, indicating shallower exhumation levels in the centre and deeper exhumation towards the margins of the sampled transect. The observed differential exhumation patterns match with existing seismic data and fit a model of an inverted graben system for the Phanerozoic evolution of the eastern Musgraves. The results highlight a complex Phanerozoic thermal history for the eastern Musgraves and help to elucidate the poorly appreciated tectonic evolution of inland Australia. This study further demonstrates

  10. Emtonjeni-A Structural Intervention to Integrate Sexual and Reproductive Health into Public Sector HIV Care in Cape Town, South Africa: Results of a Phase II Study.

    PubMed

    Mantell, J E; Cooper, D; Exner, T M; Moodley, J; Hoffman, S; Myer, L; Leu, C-S; Bai, D; Kelvin, E A; Jennings, K; Stein, Z A; Constant, D; Zweigenthal, V; Cishe, N; Nywagi, N

    2017-03-01

    Integration of sexual and reproductive health within HIV care services is a promising strategy for increasing access to family planning and STI services and reducing unwanted pregnancies, perinatal HIV transmission and maternal and infant mortality among people living with HIV and their partners. We conducted a Phase II randomized futility trial of a multi-level intervention to increase adherence to safer sex guidelines among those wishing to avoid pregnancy and adherence to safer conception guidelines among those seeking conception in newly-diagnosed HIV-positive persons in four public-sector HIV clinics in Cape Town. Clinics were pair-matched and the two clinics within each pair were randomized to either a three-session provider-delivered enhanced intervention (EI) (onsite contraceptive services and brief milieu intervention for staff) or standard-of-care (SOC) provider-delivered intervention. The futility analysis showed that we cannot rule out the possibility that the EI intervention has a 10 % point or greater success rate in improving adherence to safer sex/safer conception guidelines than does SOC (p = 0.573), indicating that the intervention holds merit, and a larger-scale confirmatory study showing whether the EI is superior to SOC has merit.

  11. Racial differences in seroprevalence of HAV and HEV in blood donors in the Western Cape, South Africa: a clue to the predominant HEV genotype?

    PubMed

    Lopes, T; Cable, R; Pistorius, C; Maponga, T; Ijaz, S; Preiser, W; Tedder, R; Andersson, M I

    2017-03-30

    Hepatitis E virus (HEV) infection is a major cause of acute hepatitis worldwide. This infection causes major water-borne outbreaks in low- and middle-income countries, whilst in industrialised countries this infection is zoonotic. These differences in epidemiology are related to different HEV genotypes. HEV genotype 3 is a zoonotic infection, whilst genotype 2 causes large outbreaks. This study determined the seroprevalence of HEV in blood donors from the Western Cape. Anti-hepatitis A virus (anti-HAV) antibody was detected in 184/300 (61%) donors. Antibody to HEV (anti-HEV) was detected in 78 of 300 donors (26%). It was highest in mixed race donors (62/100), followed by white donors (23/100) and lowest in black donors (19/100) P = 0.019. Since it is thought that genotypes 1 and 2 predominate both viruses would be acquired by the oro-faecal route, it is surprising that HEV seroprevalence does not mirror that of HAV. We postulate that this may reflect differences in socio-economic status and consumption of dietary meat. So the marked divergence between HEV and HAV seroprevalence may be the result of different routes of transmission. Further data are needed to explore the risk factors associated with HEV infection.

  12. 'When you visit a man you should prepare yourself': male community care worker approaches to working with men living with HIV in Cape Town, South Africa.

    PubMed

    Gittings, Lesley

    2016-08-01

    Caring is typically constructed as a feminised practice, resulting in women shouldering the burden of care-related work. Health-seeking behaviours are also constructed as feminine and men have poorer health outcomes globally. Employing men as carers may not only improve the health of the men they assist but also be transformative with regards to gendered constructions of caring. Using semi-structured interviews and observational home visits, this study explored the techniques that community care workers employ when working with male clients. The empirical analysis draws on the perspectives of eight care workers and three of their male clients from the Cape Town area. Interviews reveal how care workers and clients perform and negotiate masculinities as they navigate hegemonic masculine norms that require men to act tough, suppress emotions and deny weakness and sickness. Both parties bump up against ideals of what it means to be a man as they strive to provide care and receive support. Community care workers avoid rupturing client performances of hegemonic masculinities which inhibit confession and support. To do this, they use techniques of indirectly broaching sensitive subjects, acting in a friendly way and being clear about the intention of their work.

  13. Using Remote Sensing and GIS Techniques to Detect Changes to the Prince Alfred Hamlet Conservation Area in the Western Cape, South Africa

    NASA Astrophysics Data System (ADS)

    Duncan, P.; Lewarne, M.

    2016-06-01

    Understanding and identifying the spatial-temporal changes in the natural environment is crucial for monitoring and evaluating conservation efforts, as well as understanding the impact of human activities on natural resources, informing responsible land management, and promoting better decision-making. Conservation areas are often under pressure from expanding farming and related industry, invasive alien vegetation, and an ever-increasing human settlement footprint. This study focuses on detecting changes to the Prince Alfred Hamlet commonage, near Ceres in the Cape Floral Kingdom. It was chosen for its high conservation value and significance as a critical water source area. The study area includes a fast-growing human settlement footprint in a highly productive farming landscape. There are conflicting development needs as well as risks to agricultural production, and both of these threaten the integrity of the ecosystems which supply underlying services to both demands on the land. Using a multi-disciplinary approach and high-resolution satellite imagery, land use and land cover changes can be detected and classified, and the results used to support the conservation of biodiversity and wildlife, and protect our natural resources. The aim of this research is to study the efficacy of using remote sensing and GIS techniques to detect changes to critical conservation areas where disturbances can be understood, and therefore better managed and mitigated before these areas are degraded beyond repair.

  14. The Epidemiology of Meningitis among Adults in a South African Province with a High HIV Prevalence, 2009-2012

    PubMed Central

    Britz, Erika; Perovic, Olga; von Mollendorf, Claire; von Gottberg, Anne; Iyaloo, Samantha; Quan, Vanessa; Chetty, Verushka; Sriruttan, Charlotte; Ismail, Nazir A.; Nanoo, Ananta; Musekiwa, Alfred; Reddy, Carl; Viljoen, Karien; Cohen, Cheryl; Govender, Nelesh P.

    2016-01-01

    Introduction Meningitis is a major cause of mortality in southern Africa. We aimed to describe the aetiologies and frequencies of laboratory-confirmed fungal and bacterial meningitis among adults in a South African province with an 11% HIV prevalence, over 4 years. Methods We conducted a retrospective, observational study of secondary laboratory data, extracted on all cerebrospinal fluid (CSF) specimens submitted to public-sector laboratories in Gauteng province from 2009 through 2012. We calculated cause-specific incidence rates in the general and HIV-infected populations and used Poisson regression to determine if trends were significant. Results We identified 11,891 (10.7%) incident cases of meningitis from 110,885 CSF specimens. Cryptococcal meningitis, tuberculous meningitis and pneumococcal meningitis accounted for 62.3% (n = 7,406), 24.6% (n = 2,928) and 10.1% (n = 1,197) of cases over the four-year period. The overall incidence (cases per 100,000 persons) of cryptococcal meningitis declined by 23% from 24.4 in 2009 to 18.7 in 2012 (p <0.001) and decreased by 19% among HIV-infected persons from 178.2 to 144.7 (p <0.001). Tuberculous meningitis decreased by 40% from 11.3 in 2009 to 6.8 in 2012 (p <0.001) and decreased by 36% among HIV-infected persons from 54.4 to 34.9 (p <0.001). Pneumococcal meningitis decreased by 41% from 4.2 in 2009 to 2.5 in 2012 (p <0.001) and decreased by 38% among HIV-infected persons from 28.0 to 17.5 (p <0.001). Among cases of other bacterial meningitis (248/11,891, 2.1%), Neisseria meningitidis (n = 93), Escherichia coli (n = 72) and Haemophilus influenzae (n = 20) were the most common organisms identified. Conclusions In this high HIV-prevalence province, cryptococcal meningitis was the leading cause of laboratory-confirmed meningitis among adults. Over a 4-year period, there was a significant decrease in incidence of cryptococcal, tuberculous and pneumococcal meningitis. This coincided with expansion of the national

  15. The Cenozoic lithospheric mantle beneath the interior of South China Block: Constraints from mantle xenoliths in Guangxi Province

    NASA Astrophysics Data System (ADS)

    Li, Xi-Yao; Zheng, Jian-Ping; Sun, Min; Pan, Shao-Kui; Wang, Wei; Xia, Qun-Ke

    2014-12-01

    In contrast to the coastal regions of the South China Block (SCB), little is known about the subcontinental lithospheric mantle beneath the interior of the SCB. Mantle xenoliths entrained in Cenozoic basalts in the eastern and central Guangxi Province, the interior of the SCB, includes spinel harzburgites, clinopyroxene-poor lherzolites, lherzolites and olivine websterites. The mineral chemistry of the harzburgites and clinopyroxene-poor lherzolites is moderately refractory [Mg# value of olivine (Mg#Ol) = 90.2-91.3], whereas other lherzolite is more fertile (Mg#Ol = 89.3). Zoned olivines (Mg#Ol = 83.7-88.8) in the harzburgites and zoned olivine xenocrysts (Mg#Ol = 75.2-82) in the basalts reflect disequilibrium between olivines and the basaltic host melts during magma ascent. An olivine websterite (Mg#Ol = 87.5) is similar to the lherzolite in mineral chemistry. The REE patterns of clinopyroxenes in these xenoliths vary from LREE-depleted, to flat, to LREE-enriched patterns, and commonly exhibit positive Sr anomalies and negative Nb, Zr and Ti anomalies. The peridotitic xenoliths mostly experienced moderate to high degree of melt extraction (F = 10-20%) and were modified by silicate metasomatism. We thus suggest that the harzburgites and clinopyroxene-poor lherzolites with high Mg#Ol values represent ancient (Proterozoic) lithospheric mantle, preserved beneath the Guangxi Province. In contrast, the minor, fertile (low-Mg#Ol) lherzolites represent lithospheric mantle accreted during the Phanerozoic, and a small amount of pyroxenite was produced via interaction between peridotite and silicate-rich melts. The mantle-accretion process that occurred beneath the SCB during the Mesozoic to Cenozoic time extended into Guangxi Province. The lithospheric mantle beneath the interior of the SCB is heterogeneous, featuring various types of peridotite and co-existing pyroxenite. This heterogeneity also indicates that the lithospheric mantle beneath the regions affected by

  16. Bapedi traditional healers in the Limpopo Province, South Africa: Their socio-cultural profile and traditional healing practice

    PubMed Central

    2014-01-01

    Background Bapedi traditional healers play a vital role in the primary health care of rural inhabitants in the Limpopo Province, South Africa. However, literature profiling their social and demographic variables, as well as their traditional healing practices is lacking. Methods Convenience sampling were used to identify and select two traditional healers from 17 municipalities (resulting in 34 healers being used in this pilot survey) of the Limpopo Province in South Africa. Information on the social and demographic variables, and traditional healing practices of these healers was gathered from January 2013 to July 2013, using a semi-structured questionnaire, supplemented by field surveys for plant identification and collection used in the preparation of remedies. Results Males constituted nearly two-thirds of the participants. Forty eight percent of them became healers through the mentoring of another healer, while 38% acquired their traditional healing knowledge from parents and 14% from grandparents. In contrast to this, 62% of the females obtained theirs from their parents, 30% from fellow traditional healers, and 8% from grandparents. A total of 154 plant species were indicated as used by healers in the treatment of 52 health-related problems. A vast majority (89%) of these practitioners reported that prepared herbal remedies do expire, which is a temperature-dependent process. Determinations of the efficacy of remedies by most healers (67%) were via consultation with ancestors (90%). This study also found that none of the interviewees had any knowledge of provincial or national environmental legislation. Conclusions The current study has shown that Bapedi traditional healers could play a leading role in both the preservation of indigenous knowledge and the primary health care sector. However, of concern is the traditional methods (via consulting ancestors) employed by most of these healers in determining efficacy of remedies, thus indicating a need for a

  17. Comparative analysis of plant use in peri-urban domestic gardens of the Limpopo Province, South Africa

    PubMed Central

    2014-01-01

    Background Relatively little has been researched or published on the importance of peri-urban domestic gardens as part of a household livelihood strategy in South Africa. Due to lack of comprehensive data on peri-urban domestic gardens, their potential value as luxury green space, provision of food, income and ecosystem services to the fast growing urban population in South Africa is not clearly known. The aim of this study was to document differences and similarities in plant use and diversity in domestic gardens of two peri-urban communities in the Limpopo Province that differ in proximity to an urban area. Methods Data on plant use categories of 62 domestic gardens in the peri-urban areas of the Limpopo Province were collected in Seshego and Lebowakgomo. Semi-structured interviews, observation and guided field walks with 62 participants were employed between May and October 2012. Results A total of 126 plant species were recorded for both Seshego and Lebowakgomo. Domestic gardens in the more remote areas of Lebowakgomo were characterized by higher percentage of food plants (47 species, 83.8% of the total food plants recorded) and medicinal plants (31 species, 83.7%). Lebowakgomo domestic gardens were also characterized by higher numbers of indigenous plants (76.7%) showing similarities to the natural surrounding vegetation in terms of plant species. On the contrary, domestic gardens of Seshego on the periphery of the city centre were characterized by higher percentage of exotic species (81.8%) and ornamental plants (73%), with food plants playing a supplementary role. Comparison of the two areas demonstrated a remarkable difference in plant use and composition. Conclusions This study revealed that there are differences in utilization of plant resources between households on the edge of an urban centre and those in the more remote areas. Food and medicinal plants play an important role in remote areas; while ornamental plants play an important role in urban

  18. An evaluation of the competencies of primary health care clinic nursing managers in two South African provinces

    PubMed Central

    Munyewende, Pascalia O.; Levin, Jonathan; Rispel, Laetitia C.

    2016-01-01

    Background Managerial competencies to enhance individual and organisational performance have gained currency in global efforts to strengthen health systems. Competent managers are essential in the implementation of primary health care (PHC) reforms that aim to achieve universal health coverage. Objective To evaluate the competencies of PHC clinic nursing managers in two South African provinces. Design A cross-sectional study was conducted in two South African provinces. Using stratified random sampling, 111 PHC clinic nursing managers were selected. All supervisors (n=104) and subordinate nurses (n=383) were invited to participate in the survey on the day of data collection. Following informed consent, the nursing managers, their supervisors, and subordinate nurses completed a 40-item, 360-degree competency assessment questionnaire, with six domains: communication, leadership and management, staff management, financial management, planning and priority setting, and problem-solving. Standard deviations, medians, and inter-quartile ranges (IQRs) were computed separately for PHC nursing managers, supervisors, and subordinate nurses for competencies in the six domains. The Tinsley and Weiss index was used to assess agreement between each of the three possible pairs of raters. Results A 95.4% response rate was obtained, with 105 nursing managers in Gauteng and Free State completing the questionnaires. There was a lack of agreement about nursing managers’ competencies among the three groups of raters. Overall, clinic nursing managers rated themselves high on the five domains of communication (8.6), leadership and management (8.67), staff management (8.75), planning and priority setting (8.6), and problem-solving (8.83). The exception was financial management with a median score of 7.94 (IQR 6.33–9.11). Compared to the PHC clinic managers, the supervisors and subordinate nurses gave PHC nursing managers lower ratings on all six competency domains, with the lowest

  19. An evaluation of the competencies of primary health care clinic nursing managers in two South African provinces.

    PubMed

    Munyewende, Pascalia O; Levin, Jonathan; Rispel, Laetitia C

    2016-01-01

    Background Managerial competencies to enhance individual and organisational performance have gained currency in global efforts to strengthen health systems. Competent managers are essential in the implementation of primary health care (PHC) reforms that aim to achieve universal health coverage. Objective To evaluate the competencies of PHC clinic nursing managers in two South African provinces. Design A cross-sectional study was conducted in two South African provinces. Using stratified random sampling, 111 PHC clinic nursing managers were selected. All supervisors (n=104) and subordinate nurses (n=383) were invited to participate in the survey on the day of data collection. Following informed consent, the nursing managers, their supervisors, and subordinate nurses completed a 40-item, 360-degree competency assessment questionnaire, with six domains: communication, leadership and management, staff management, financial management, planning and priority setting, and problem-solving. Standard deviations, medians, and inter-quartile ranges (IQRs) were computed separately for PHC nursing managers, supervisors, and subordinate nurses for competencies in the six domains. The Tinsley and Weiss index was used to assess agreement between each of the three possible pairs of raters. Results A 95.4% response rate was obtained, with 105 nursing managers in Gauteng and Free State completing the questionnaires. There was a lack of agreement about nursing managers' competencies among the three groups of raters. Overall, clinic nursing managers rated themselves high on the five domains of communication (8.6), leadership and management (8.67), staff management (8.75), planning and priority setting (8.6), and problem-solving (8.83). The exception was financial management with a median score of 7.94 (IQR 6.33-9.11). Compared to the PHC clinic managers, the supervisors and subordinate nurses gave PHC nursing managers lower ratings on all six competency domains, with the lowest rating

  20. Panorama from 'Cape Verde'

    NASA Technical Reports Server (NTRS)

    2007-01-01

    NASA's Mars Exploration Rover Opportunity captured this vista of 'Victoria Crater' from the viewpoint of 'Cape Verde,' one of the promontories that are part of the scalloped rim of the crater. Opportunity drove onto Cape Verde shortly after arriving at the rim of Victoria in September 2006. The view combines hundreds of exposures taken by the rover's panoramic camera (Pancam). The camera began taking the component images during Opportunity's 970th Martian day, or sol, on Mars (Oct. 16, 2006). Work on the panorama continued through the solar conjunction period, when Mars was nearly behind the sun from Earth's perspective and communications were minimized. Acquisition of images for this panorama was completed on Opportunity's 991st sol (Nov. 7, 2006).

    The top of Cape Verde is in the immediate foreground at the center of the image. To the left and right are two of the more gradually sloped bays that alternate with the cliff-faced capes or promontories around the rim of the crater. 'Duck Bay,' where Opportunity first reached the rim, is to the right. Beyond Duck Bay counterclockwise around the rim, the next promontory is 'Cabo Frio,' about 150 meters (500 feet) from the rover. On the left side of the panorama is 'Cape St. Mary,' the next promontory clockwise from Cape Verde and about 40 meters (130 feet) from the rover. The vantage point atop Cape Verde offered a good view of the rock layers in the cliff face of Cape St. Mary, which is about 15 meters or 50 feet tall. By about two weeks after the Pancam finished collecting the images for this panorama, Opportunity had driven to Cape St. Mary and was photographing Cape Verde's rock layers.

    The far side of the crater lies about 800 meters (half a mile) away, toward the southeast.

    This approximately true-color view combines images taken through three of the Pancam's filters, admitting light with wavelengths centered at 750 nanometers (near infrared), 530 nanometers (green) and 430 nanometers (violet).

  1. Tectonic/climatic control on sediment provenance in the Cape Roberts Project core record (southern Victoria Land, Antarctica): A pulsing late Oligocene/early Miocene signal from south revealed by detrital thermochronology

    NASA Astrophysics Data System (ADS)

    Olivetti, V.; Balestrieri, M. L.; Rossetti, F.; Talarico, F. M.

    2012-04-01

    , three peaks are detected reflecting different bedrock provenance areas. Two peaks older than 40 Ma (P2 and P3) are compatible with thermochronological data from TAM bedrock that underwent a stepwise denudation in Cretaceous times. A Peak younger than 40 Ma (P1) has been detected occasionally, recording the signal of a source area exhumed during late Oligocene /early Miocene with a constant denudation rate of 0.4 mm/yr (constant lag-time up-section), but absent in the onshore portion of the proximal TAM. Indeed, when compared with AFT data from ANDRILL cores, the relatively young P1 ages, suggest that part of sediments in the Cape Robert Rift basin have a provenance from source regions probably located far away in the south (i.e. Skelton-Byrd glaciers region) where bedrock experienced compatible thermal histories. This provenance would imply glacial systems with main flow patterns from south to the north, therefore orthogonal to the orientation of present-day drainage. We thus infer that the post-Eocene glacial and erosional history of the TAM front was significantly controlled by the N-S-trending transtensional regime that affected the western Ross Sea margin during transition from orthogonal to oblique rifting in the region. The appearance and disappearance of P1 along the drill-cored stratigraphic succession seems to be linked to the oscillation in the extent of the ice sheet.

  2. Intracanyon basalt lavas of the Debed River (northern Armenia), part of a Pliocene-Pleistocene continental flood basalt province in the South Caucasus

    NASA Astrophysics Data System (ADS)

    Sheth, Hetu; Meliksetian, Khachatur; Gevorgyan, Hripsime; Israyelyan, Arsen; Navasardyan, Gevorg

    2015-03-01

    Late Pliocene to Early Pleistocene (~ 3.25-2.05 Ma), 200-400 m thick basalt lavas outcrop in the South Caucasus region, including the Kars-Erzurum Plateau (northeastern Turkey), the Javakheti Plateau (Georgia-Armenia), and the Lori Plateau (northern Armenia). These fissure-fed, rapidly erupted fluid lavas filled pre-existing river valleys over many tens of kilometres. The basalts exposed in the Debed River canyon, northern Armenia, are ~ 200 m thick and of three morphological types: (1) basal pillow basalts and hyaloclastites, overlain by (2) columnar-jointed pahoehoe sheet flows, in turn overlain by (3) slabby pahoehoe and rubbly pahoehoe flows. The lower and middle lavas show evidence for damming of river drainage, like many lavas of the Columbia River flood basalt province, Scotland, Ireland, and Iceland. There is also evidence for syn-volcanic faulting of the early lavas. Related basalts also outcrop in the Gegham Uplands and the Hrazdan River basin in Armenia. This 3.25-2.05 Ma South Caucasus basalt province, covering parts of Turkey, Georgia and Armenia, has an estimated areal extent of ~ 15,000 km2 and volume of ~ 2250 km3. Because its main geological features are remarkably like those of many continental flood basalt (CFB) provinces, we consider it a true, albeit small, CFB province. It is the smallest and youngest CFB in the world. An analogue closely similar in major features is the Late Miocene Altos de Jalisco CFB province in the western Trans-Mexican Volcanic Belt. Both provinces formed during lithospheric pull-apart and transtensional faulting. Their broader significance is in showing flood basalt size distribution to be a continuum without natural breaks, with implications for geodynamic models.

  3. Public-sector ART in the Free State Province, South Africa: community support as an important determinant of outcome.

    PubMed

    Wouters, Edwin; Van Damme, Wim; Van Loon, Francis; van Rensburg, Dingie; Meulemans, Herman

    2009-10-01

    The treatment outcomes for large-scale public antiretroviral therapy (ART) programs in developing countries, although promising, are still preliminary. The scaling-up of ART in resource-limited settings is inevitably hampered by human resource shortages. Therefore, community support for ART patients may play an important role in achieving favorable treatment outcomes. This study aimed to extend the current literature by investigating how immunological and virological responses to ART, measured at three points in time (after six, 12, and 24 months of ART), are influenced by patient characteristics (age, sex), health literacy (educational level and knowledge about HIV/AIDS), baseline CD4 cell count, baseline viral load, and three forms of community support (treatment buddy, community health worker [CHW], and HIV/AIDS support group). Cross-lagged regression analysis was used to test these relationships in a sample of 268 patients enrolled in the public-sector ART program of the Free State Province of South Africa (2004-2007). After 24 months of ART, 76.4% of patients were classified as treatment successes (viral load < 400 copies/mL, CD4 > or = 200 cells/microL), compared with 64.1% at 12 months and 46.1% at six months. When we examined the predictors of ART success, baseline health and all three community support initiatives had a positive effect on ART outcomes after six months, whereas patient characteristics had little effect. Six months later, patients with the support of a treatment buddy, CHW, or support group had better ART outcomes, whereas the impact of baseline health had diminished. After two years of treatment, community support again emerged as the most important predictor of treatment success. This study confirms that the ART provided by South African public-sector health services is effective. These results provide evidence from the field that communities can be mobilized to sustain these favorable outcomes under conditions of limited human resources

  4. Participatory rural appraisal to investigate constraints in reporting cattle mortalities in the Odi district of North West Province, south Africa.

    PubMed

    Makgatho, C N; McCrindle, C M E; Owen, J H

    2005-12-01

    Mortalities in cattle can have severe financial implications for small scale and communal farmers in South Africa. They could also be a measurable indicator for surveillance of animal diseases, such as those listed by the Office International des Epizooties (OIE), or diseases included in the regulations of the South African Animal Diseases Act, 1984 (Act 35 of 1984). In order to prevent further mortalities and for accurate surveillance and monitoring of diseases, it is important that farmers participate in the determination of causes of mortality in their cattle. This paper reports on constraints of the reporting diseases to the state veterinary services, the study area being Odi district, in the North West Province. The method that was followed was based on participatory rural appraisal. The selected cattle owners participated in every phase. They were the ones who first spoke to veterinary services about ways to decrease the diseases and mortalities of their cattle. A questionnaire to verify the facts complemented the survey. A total number of 60 farmers were randomly selected from 12 villages. One farmer withdrew, leaving 59 farmers. Most of the farmers in the study were men ( n = 55). The area of study was communal and the farming system traditional and extensive. It was suspected that there was a communication problem and this was proven by the results of the research, as 23 farmers were not even aware that mortalities have to be reported by law. The real problem was that causes of death were not being diagnosed because farmers were not aware that a necropsy could give information on the causes of death. Farmers were keen to receive training in elementary necropsy techniques so as to be able to discuss the cause of death of cattle with the state veterinarian.

  5. Food fortification knowledge in women of child-bearing age at Nkowankowa township in Mopani District, Limpopo Province, South Africa

    PubMed Central

    Mbhatsani, Vanessa; Shilote, Kulani O.

    2016-01-01

    Background Globally, there is evidence that three micronutrients deficiencies are of public health concern among children. They are vitamin A, iodine and iron deficiencies. Communities particularly affected are those in situations where poverty, unemployment, civil unrest, war and exploitation remain endemic. Malnutrition is an impediment to productivity, economic growth and poverty eradication. It is estimated that 32% of the global burden would be removed by eliminating malnutrition, including micronutrients deficiencies. Setting The study was carried out in NkowaNkowa township of Mopani District, Limpopo Province, South Africa. Aim The main objective was to determine the women’s knowledge on food fortification. Methods The study design was descriptive. The snowballing method was used to identify women of child-bearing age. Data were collected from 120 participants using a questionnaire. The questionnaire consisted of socio-demographic, general questions on women’s knowledge on food fortification. The questionnaire was administered by the researcher using the local language Xitsonga. Results The findings of the study revealed that a majority of 204 (57.0%) of the participants were able to define food fortification correctly while 257 (72.0%) of the participants knew which foods are fortified as well as the benefits of a food fortification programme. The majority (252 [70.0%]) of the participants knew that maize meal is one of the food vehicle used for fortification in South Africa. Conclusion Most of the questions were answered correctly by more than 50.0% of the participants. The researcher deduced that the study participants are knowledgeable about food fortification based on the response given in relation to the programme. PMID:27542291

  6. Holocene sedimentation in the shallow nearshore zone off Nauset Inlet, Cape Cod, Massachusetts

    USGS Publications Warehouse

    Aubrey, D.G.; Twichell, D.C.; Pfirman, S.L.

    1982-01-01

    Present conditions and sedimentary evolution of the shallow offshore region near Nauset Inlet on Cape Cod, Massachusetts were clarified using high-resolution seismic-reflection profiles, sidescan-sonar records, surface grab samples and current meter measurements. The study area contains three provinces: (1) a nearshore province (shallower than 18 m) with a relatively steep slope (0.6??) and a cover of medium sand; (2) a northern offshore province covered with coarse sand, gravel, and boulders, interpreted to be glacial drift; and (3) a southern offshore province with a gentle seaward-dipping slope (0.3??) and a surface sediment of coarse sand. The glacial drift exposed in the northern offshore province can be traced southward under the coarse sand province. The overlying fill is comprised of either outwash sediment derived from the Pleistocene South Channel ice lobe to the east or Holocene-aged marine sediments eroded from seacliffs to the north. Latest Holocene sediment appears to be limited to the zone shoreward of 18 m where the medium sand occurs. Near-bottom mean flows (measured over two winter months in 10 m water depth) average 6 cm sec-1 to the south. Mean flows exceeded 20 cm sec-1 approx. 23% of the time. Ninety percent of the flows exceeding 20 cm sec-1 were directed to the south, reflecting the dominant atmospheric forcing during these winter months. Waves had an average variance of 650 cm2 with variance exceeding 5000 cm2, 3% of the time, indicating moderate wave activity. Present processes are actively reshaping the nearshore province, which is characterized by many east to northeast-trending shore-oblique channels that do not extend seaward of the 18-m contour. Coarse sand in the floors of these channels suggests they may be erosional features, and the presence of megaripples oriented perpendicular to the channel axes indicates active transport in these channels. Megaripple orientation and the current and wave regime of the study area support a rip

  7. Assessment of undiscovered oil resources in the Bakken and Three Forks Formations, Williston Basin Province, Montana, North Dakota, and South Dakota, 2013

    USGS Publications Warehouse

    Gaswirth, Stephanie B.; Marra, Kristen R.; Cook, Troy A.; Charpentier, Ronald R.; Gautier, Donald L.; Higley, Debra K.; Klett, Timothy R.; Lewan, Michael D.; Lillis, Paul G.; Schenk, Christopher J.; Tennyson, Marilyn E.; Whidden, Katherine J.

    2013-01-01

    Using a geology-based assessment methodology, the U.S. Geological Survey estimated mean undiscovered volumes of 7.4 billion barrels of oil, 6.7 trillion cubic feet of associated/dissolved natural gas, and 0.53 billion barrels of natural gas liquids in the Bakken and Three Forks Formations in the Williston Basin Province of Montana, North Dakota, and South Dakota.

  8. Two new species and one newly recorded species of the genus Kamaka (Crustacea: Amphipoda) from the Hainan Province, South China Sea.

    PubMed

    Ren, Xian-qiu; Sha, Zhong-li

    2013-01-01

    A total of 5 species of the genus Kamaka (Crustacea: Amphipoda) are identified from Hainan Province, South China Sea. In those, one species, Kamaka excavata Ariyama, 2007, is recorded for the first time in Chinese waters. Two new species, Kamaka corophina sp. n. and Kamaka foliacea sp. n., are described. A key to the Chinese species is provided. They were collected from littoral zone, mud flat in seaweed of mangrove side, brackish water and seawater, sifted out with sieve.

  9. Influence of physico-chemistry and mineralogy on the occurrence of geohelminths in geophagic soils from selected communities in the Eastern Cape, South Africa, and their possible implication on human health.

    PubMed

    Sumbele, Irene U; Ngole, Veronica Mpode; Ekosse, Georges-Ivo E

    2014-01-01

    Geophagic soils from selected communities in Eastern Cape, South Africa were characterised to determine their properties and geohelminth content. The soils were coarse-textured with cation exchange capacity values ranging from 6.35 to 18.94 cmol (+)/kg. Quartz was the dominant mineral in the samples with SiO2, Al2O3, and Fe2O3(t) having the highest concentrations among major element oxides. The soil properties, mineralogical composition, and low amounts of particle binding substances may favour the survival of geohelminth ova in the soils. Seven of the samples contained at least one of the following geohelminths: Ascaris lumbricoides, Trichuris trichiura, Necator americanus, Ancylostoma duodenale and Strongyloides stercoralis. The presence of these geohelminths in the soils was attributed to agricultural and sanitary practices inherent in the communities and the soil properties. Communities need to be sensitised on the importance of safe sanitary and animal husbandry practices to reduce the prevalence of helminth infection among geophagists.

  10. Electrocotyle whittingtoni n. gen., n. sp. (Monogenea: Monocotylidae: Heterocotylinae) from the gills of a captive onefin electric ray, Narke capensis (Narkidae) at Two Oceans Aquarium, Cape Town, South Africa.

    PubMed

    Vaughan, David B; Chisholm, Leslie A; Hansen, Haakon

    2016-09-01

    Electrocotyle whittingtoni n. gen., n. sp. (Monogenea: Monocotylidae) is described from the gills of a captive female onefin electric ray, Narke capensis, collected for exhibition at Two Oceans Aquarium in Cape Town, South Africa. Electrocotyle n. gen. is most similar to the heterocotyline genera Heterocotyle and Potamotrygonocotyle but could not be accommodated easily in either of these groups. The new genus is characterised by a haptor with one central and eight peripheral loculi, four unsclerotised structures on the dorsal surface of the haptor, a single unsclerotised non-sinous ridge on the ventral surface of the haptoral septa, large hamuli with a long handle and reduced guard, a vagina with sclerotised walls, and tetrahedral eggs. Molecular phylogenetic analyses based on 28S sequences strongly support the separate genus status of Electrocotyle n. gen and thus support our morphological conclusion. The Heterocotylinae is amended to accommodate the new genus, and the new species is fully described and illustrated herein. This is the first record of a monocotylid from the Narkidae. Electrocotyle whittingtoni n. gen. n. sp. is considered potentially pathogenic given its negative impact on the health of its captive host kept in the quarantine facility at Two Oceans Aquarium.

  11. Hepatitis B vaccination coverage in healthcare workers in Gauteng Province, South Africa.

    PubMed

    Burnett, Rosemary J; François, Guido; Mphahlele, M Jeffrey; Mureithi, John G; Africa, Patricia N; Satekge, Mpho M; Mokonoto, D Maggie; Meheus, André; van Sprundel, Marc

    2011-06-06

    Hepatitis B (HB) virus (HBV) is highly endemic and HBV infection is a major public health problem in sub-Saharan Africa. Percutaneous/parenteral transmission is an important mode of spread of HBV in the healthcare setting, thus healthcare workers (HCWs) and their patients are at risk for acquiring HBV infections. This study was conducted on three HCW populations in Gauteng Province during 2009, in order to (1) determine HB vaccination coverage of HCWs, and (2) investigate demographic predictors of vaccination uptake. Being a doctor was a statistically significant predictor of vaccination uptake (odds ratio [OR]: 3.2; 95% confidence interval [CI]: 1.48-6.72; p-value: 0.003), while working in the private sector was also statistically significantly associated with vaccination uptake (OR: 1.73; 95% CI: 1.01-2.98; chi-square p-value: 0.035). The majority (67.9% [491/723]) of HCWs had received at least 1 dose of vaccine, but where data on number of doses was available, only 19.9% (94/472) were fully vaccinated. In conclusion, there is a need to increase HB vaccination uptake in Gauteng HCWs through a policy that is properly implemented and routinely monitored and evaluated, and this policy must ensure that all three doses of vaccine are administered.

  12. Polybrominated diphenyl ethers (PBDEs) and 2,2',4,4',5,5'-hexabromobiphenyl (BB-153) in landfill leachate in Cape Town, South Africa.

    PubMed

    Daso, Adegbenro P; Fatoki, Olalekan S; Odendaal, James P; Olujimi, Olanrewaju O

    2013-01-01

    An assessment of the concentrations of selected polybrominated diphenyl ether (PBDE) congeners as well as BB 153 in leachate samples collected from three landfill sites within the city of Cape Town was conducted. A liquid-liquid extraction technique was employed for the isolation of all the target compounds from the leachate samples. Extracts obtained were further subjected to multi-layer column chromatography employing different forms of silica gel. The prepared samples were analysed using a high capillary gas chromatograph equipped with a micro-electron capture detector (GC-μECD). The overall mean concentrations of the total PBDEs, including BDE 209 ranged between 5.65 and 2,240, 0.28-20.5 and 1.66-1,170 ng/l for Bellville, Coastal Park, and Vissershok landfill sites, respectively. The mean concentrations of BB 153, which were generally low in most of the samples analysed, were 70.4, 7.14 and 8.16 ng/l for Bellville, Coastal Park and Vissershok sites, respectively. The influence of precipitation on the characteristics and quantity of leachate produced from the landfill sites investigated was most pronounced during the August/September sampling regime. Generally, the trend observed in this study clearly indicated a wide variation in the levels of these contaminants in all the landfill sites studied from one sampling period to the other. However, the principal component analysis revealed that the release of these contaminants might be associated with two or three possible sources. This study further confirmed the relevance of landfill leachate as an important source of PBDE contamination of the environment, especially the groundwater and surface water sources.

  13. Preliminary Phytochemical Screening and Biological Activities of Bulbine abyssinica Used in the Folk Medicine in the Eastern Cape Province, South Africa.

    PubMed

    Kibiti, Cromwell Mwiti; Afolayan, Anthony Jide

    2015-01-01

    Bulbine abyssinica A. Rich. is used in traditional medicine to treat rheumatism, dysentery, bilharzia, cracked lips, back pain, infertility, diabetes mellitus, and gastrointestinal, vaginal, and bladder infections. Therefore, preliminary phytochemical screening, antioxidant, anti-inflammatory, and antibacterial properties of the whole plant (acetone and aqueous extracts) were determined using standard procedures. The in vitro antioxidant model assays revealed that the plant possesses free radical scavenging potential varying with free radical species. The species showed significant protein denaturation inhibitory activity with good protection against erythrocyte membrane lysis indicating anti-inflammatory potential. The results also showed that the species was active against the growth of all the selected eight diabetic status opportunistic bacteria except one. Moreover, the species is characterized by appreciable amounts of total phenols, flavonoids, flavanols, proanthocyanidins, and alkaloids. Traces amounts of saponins and tannins were also observed. Amongst the identified phytochemicals present, empirical searches identified them being antioxidant, anti-inflammatory, and antimicrobial agents. The identification of these phytochemical constituents with their known pharmacological properties indicates that this plant is a good source of the free radical scavenging, anti-inflammatory, and antimicrobial agents. These findings also account for the multipharmacological use of B. abyssinica in fork medicine.

  14. Preliminary Phytochemical Screening and Biological Activities of Bulbine abyssinica Used in the Folk Medicine in the Eastern Cape Province, South Africa

    PubMed Central

    Kibiti, Cromwell Mwiti; Afolayan, Anthony Jide

    2015-01-01

    Bulbine abyssinica A. Rich. is used in traditional medicine to treat rheumatism, dysentery, bilharzia, cracked lips, back pain, infertility, diabetes mellitus, and gastrointestinal, vaginal, and bladder infections. Therefore, preliminary phytochemical screening, antioxidant, anti-inflammatory, and antibacterial properties of the whole plant (acetone and aqueous extracts) were determined using standard procedures. The in vitro antioxidant model assays revealed that the plant possesses free radical scavenging potential varying with free radical species. The species showed significant protein denaturation inhibitory activity with good protection against erythrocyte membrane lysis indicating anti-inflammatory potential. The results also showed that the species was active against the growth of all the selected eight diabetic status opportunistic bacteria except one. Moreover, the species is characterized by appreciable amounts of total phenols, flavonoids, flavanols, proanthocyanidins, and alkaloids. Traces amounts of saponins and tannins were also observed. Amongst the identified phytochemicals present, empirical searches identified them being antioxidant, anti-inflammatory, and antimicrobial agents. The identification of these phytochemical constituents with their known pharmacological properties indicates that this plant is a good source of the free radical scavenging, anti-inflammatory, and antimicrobial agents. These findings also account for the multipharmacological use of B. abyssinica in fork medicine. PMID:26579202

  15. Assessment of the Incidence of Enteric Adenovirus Species and Serotypes in Surface Waters in the Eastern Cape Province of South Africa: Tyume River as a Case Study

    PubMed Central

    Sibanda, Timothy; Okoh, Anthony I.

    2012-01-01

    TaqMan real-time PCR was used for the detection and quantitation of adenoviruses in Tyume River water samples over a 12-month period. A total of 72 samples were analysed, and 22 samples were positive for adenovirus. Of the positive samples, 18 were collected from downstream sampling points. Among the downstream sampling points, adenovirus detection rate increased with distance downstream, being 28%, 33%, and 39% for Alice, Drayini, and Manqulweni, respectively. The Alice sampling site had the highest concentrations of adenovirus ranging between 6.54 × 103 genome copies/L and 8.49 × 104 genome copies/L. The observed trend could have been expected considering the level of anthropogenic activities in areas along the lower stretch of Tyume River, with the major one being the effluent of treated and semi treated sewage from wastewater treatment facilities. Adenovirus detection was sporadic at most sampling sites. Multiplex conventional PCR was used for the detection of clinically important adenovirus species B, C, and F and their serotypes. Species C and F adenoviruses were detected in 77% and 18% of the samples, respectively. Most adenovirus positive samples were obtained from areas of increased population densities. The presence of adenoviruses may confirm the risk of its transmission to the human population. PMID:23226986

  16. An Assessment of Radiological Hazards from Gold Mine Tailings in the Province of Gauteng in South Africa

    PubMed Central

    Kamunda, Caspah; Mathuthu, Manny; Madhuku, Morgan

    2016-01-01

    Radiological hazards associated with exposure to Naturally Occurring Radionuclides Materials from gold mine tailings in the province of Gauteng in South Africa were evaluated. A comparison was made with soil samples from a control area. In this study, gamma spectroscopy was used to measure the activity concentrations of these radionuclides in 56 soil samples from the mine tailings and 10 soil samples from the control area. The average activity concentrations in Bq∙kg−1 for Uranium-238, Thorium-232, and Potassium-40 from the mine tailings were found to be 785.3 ± 13.7, 43.9 ± 1.0 and 427.0 ± 13.1, respectively. On the other hand, the average activity concentrations in Bq∙kg−1 for Uranium-238, Thorium-232, and Potassium-40 from the control area were found to be 17.0.1 ± 0.4, 22.2 ± 0.5 and 496.8 ± 15.2, respectively. Radiological hazard parameters calculated from these activity concentrations were higher than recommended safe limits. In particular, calculated average values for the external hazard (Hex) and the internal hazard (Hin) from the mine tailings were found to be 2.4 and 4.5. Both these values were higher than unity, posing a significant health risk to the population in the area. PMID:26797624

  17. Prevalence of gastrointestinal helminths and anthelmintic resistance on small-scale farms in Gauteng Province, South Africa.

    PubMed

    Tsotetsi, Ana Mbokeleng; Njiro, Stephen; Katsande, Tendai Charles; Moyo, Gugulethu; Baloyi, Faculty; Mpofu, Jaison

    2013-03-01

    The present study was conducted to determine the prevalence and distribution of gastrointestinal helminths, to detect the presence of anthelmintic resistance in livestock from small-scale farms and to determine the level of helminthosis awareness among small-scale farmers in Gauteng Province, South Africa. Blood and faecal samples were collected from cattle (n = 314), sheep (n = 256) and goats (n = 311). Faecal egg counts and cultures were done, helminth genera identified and packed cell volume was assessed to detect anaemia. A faecal egg count reduction test was used to determine anthelmintic resistance against albendazole (7.5 mg/kg), levamisole (5 mg/kg) and ivermectin (0.2 mg/kg) on five small ruminant farms. A high prevalence of both nematodes and trematodes was observed; however, only 1 % of cattle had high nematode egg counts compared to goats (30 %) and sheep (32 %). Only 5 % of the animals were anaemic. Haemonchus and Calicophoron were the most dominant helminth genera in the studied ruminants. Anthelmintic resistance was detected against the three tested drugs on all the screened farms, except against albendazole and levamisole in sheep from Hammanskraal and Nigel, respectively. About 88 % of interviewed farmers were aware of veterinary helminthosis, 67 % treated against helminths and 83 % provided their livestock with nutritional supplements. This study showed that a high prevalence of helminthosis and anthelmintic resistance does occur in the study area, thus relevant strategic interventions are recommended.

  18. Validation of Antimycobacterial Plants Used by Traditional Healers in Three Districts of the Limpopo Province (South Africa)

    PubMed Central

    Masoko, Peter; Nxumalo, Kulani Mashudu

    2013-01-01

    The aim of the study was to scientifically evaluate the antimycobacterial activity of selected indigenous medicinal plants from the Limpopo Province used for the treatment of humans with symptoms of Mycobacterium tuberculosis. The leaves of five plant species (Apodytes dimidiata, Artemisia, Combretum hereroense, Lippia javanica, and Zanthoxylum capense) were collected from the Lowveld National Botanical Garden in Nelspruit, South Africa. The dried leaves were powdered and extracted using hexane, dichloromethane, acetone, and methanol. Antimycobacterial activity was evaluated using microdilution assay and bioautography and ρ-iodonitrotetrazolium violet (INT) as indicator. Antioxidant activities were determined by 2,2-diphenyl-1-picrylhydrazyl (DPPH). Phytochemical content of extracts was further evaluated. The acetone extracts of L. javanica displayed antioxidant activity on BEA chromatogram. T Acetone extracts of A. afra had MIC value of 0.39 mg/mL against Mycobacterium smegmatis ATCC 1441. Acetone extracts of C. hereroense and L. javanica had MIC value of 0.47 mg/mL. Four bands that inhibited the growth of M. smegmatis were observed at Rf values of 0.12, 0.63, and 0.87 on BEA and 0.73 on EMW. The plant species A. dimidiata, A. afra, C. hereroense, and L. javanica in this study demonstrated their potential as sources of anti-TB drug leads. PMID:23956776

  19. Metropolitan urban hotspots of chronic sleep deprivation: evidence from a community health survey in Gyeongbuk Province, South Korea.

    PubMed

    Um, Sun-Bi; Um, Jung-Sup

    2015-11-04

    The geographic concentration of chronic sleep deprivation (CSD) remains largely unexplored. This paper examined the community-specific spatial pattern of the prevalence of CSD and the presence of clustered spatial hotspots among the Korean elderly population in Gyeongbuk Province, South Korea, revealing CSD hotspots and underscoring the importance of geography-focused prevention strategies. The study analysed cross-sectional data collected from 9847 elderly individuals aged 60 years and older who participated in a Korean Community Health Survey conducted in 2012. To assess the level of spatial dependence, an exploratory spatial data analysis was conducted using Global Moran's I statistic and the local indicator of spatial association. The results revealed marked geographic variations in CSD prevalence ranging from 33.4 to 73.4%, with higher values in the metropolitan urban areas and lower in the rural areas. Almost half of the community residents [both men (44.1%) and women (53.5%)] slept 6 h or less per 24 h. The average CSD prevalence (53.6% men and 65.1% women) in the hotspots was about 13.0% higher than that in other areas (42.6% for men and 51.1% for women). To our knowledge, this is the first study to generate a CSD hotspot map that includes data on sleep deprivation across metropolitan district levels. This study demonstrates that not only is sleep deprivation distributed differentially across communities but these differences may be explained by urbanisation.

  20. Toxic heavy metals in sediments, seawater, and molluscs in the eastern and western coastal waters of Guangdong Province, South China.

    PubMed

    Zhang, Ling; Shi, Zhen; Zhang, Jingping; Jiang, Zhijian; Wang, Fei; Huang, Xiaoping

    2016-05-01

    Heavy metal concentrations and distribution were studied in sediments, seawater, and molluscs, and the possible heavy metal sources in the coastal waters of Guangdong Province, South China were discussed. The results showed that the concentrations of Cu, Pb, Zn, and Cr in sediments in eastern coastal waters were generally higher than those in the western coastal waters. However, concentrations of most metals in seawater and molluscs in western waters were higher than in the eastern waters, which was tightly related to the local economics and urbanization development, especially, the different industrial structure in two regions. The main heavy metal sources were attributed to the industrial and agricultural effluent, domestic sewage, and even waste gas. Furthermore, heavy metal contamination assessment indicated that high contamination levels of Cd, Zn, and Pb occurred in sediments in local areas, especially in the bays and harbors. The metal accumulation levels by molluscs ranked following the order of Cd > Cu > As > Zn > Pb > Cr, and the ecological risks introduced by heavy metals in different areas were in the order of Zhanjiang > Yangmao > Shantou > Shanhui.

  1. Status of Exudative Pleural Effusion in Adults of South Khorasan Province, Northeast Iran: Pleural Tuberculosis Tending toward Elderly

    PubMed Central

    Mortazavi-Moghaddam, Sayyed Gholam Reza; Sharifzadeh, Gholam Reza; Rezvani, Mohammad Reza

    2016-01-01

    The causes and situation of exudative pleural effusion vary from one area to another. A cross-sectional study was conducted on 327 patients with exudative pleural effusion in South Khorasan province (Iran). The patients were older than 12 years and comprised 172 (52.6%) males and 155 (47.4%) females. The study commenced in 2007 with seven years duration. The Light’s criteria were used to define exudative effusion. Procedures including pleural fluid analysis, microbiological study, pleural biopsy, and systemic investigations were conducted to determine the special cause of pleural effusion. The mean age of the patients was 63.4±18.4 years. Malignancies, tuberculosis, and parapneumonia pleural exudation were diagnosed in 125 (38.2%), 48 (14.7%), and 45 (13.8%) cases, respectively. Among malignant effusions, metastasis from lung cancer made 48 (38.4%) of the cases. The origin of metastasis was not determined in 44 (35.2%) patients. The mean age of patients was not significantly different between malignant (66.9±14.3 years) and tuberculosis (63.9±19.7 years) cases (P=0.16). The older age of tuberculosis patients could be a new discussion point on the overall impression created on the subject of tuberculosis pleural exudation (TB-PLE) occurring in young people. PMID:27365554

  2. The transport of atmospheric NOx and HNO3 over Cape Town

    NASA Astrophysics Data System (ADS)

    Abiodun, B. J.; Ojumu, A. M.; Jenner, S.; Ojumu, T. V.

    2014-01-01

    Cape Town, the most popular tourist city in Africa, usually experiences air pollution with unpleasant odour in winter. Previous studies have associated the pollution with local emission of pollutants within the city. The present study examines the transport of atmospheric pollutants (NOx and HNO3) over South Africa and shows how the transport of pollutants from the Mpumalanga Highveld, a major South African industrial area, may contribute to the pollution in Cape Town. The study analysed observation data (2001-2008) from the Cape Town air-quality network and simulation data (2001-2004) from a regional climate model (RegCM) over southern Africa. The simulation accounts for the influence of complex topography, atmospheric conditions, and atmospheric chemistry on emission and transport of pollutants over southern Africa. Flux budget analysis was used to examine whether Cape Town is a source or sink for NOx and HNO3 during the extreme pollution events. The results show that extreme pollution events in Cape Town are associated with the lower level (surface - 850 hPa) transport of NOx from the Mpumalanga Highveld to Cape Town, and with a tongue of high concentration of HNO3 that extends from the Mpumalanga Highveld to Cape Town along the south coast of South Africa. The prevailing atmospheric conditions during the extreme pollution events feature an upper-level (700 hPa) anticyclone over South Africa and a lower-level col over Cape Town. The anticyclone induces a strong subsidence motion, which prevents vertical mixing of the pollutants and caps high concentration of pollutants close to the surface as they are transported from the Mpumalanga Highveld toward Cape Town. The col accumulates the pollutants over the city. This study shows that Cape Town can be a sink for the NOx and HNO3 during extreme pollution events and suggests that the accumulation of pollutants transported from other areas (e.g. the Mpumalanga Highveld) may contribute to the air pollution in Cape Town.

  3. Tectonic discrimination of chromian spinels, olivines and pyroxenes in the Northeastern Jiangxi Province ophiolite, South China

    NASA Astrophysics Data System (ADS)

    Guo, Guolin; Liu, Xiaodong; Yang, Jingsui; Pan, Jiayong; Fan, Xiujun; Zhou, Wenting; Duan, Gehong

    2016-11-01

    The peridotites of the Northeastern Jiangxi Province Ophiolite (NJO), including dunite, harzburgite and clinopyroxene-bearing harzburgite, are strongly altered under serpentinization, except for minor aggregations of partially-altered olivines, chromian spinels and pyroxenes. The forsterite content of olivines in dunites (Fo 93.6) is slightly higher than in harzburgites (Fo 91.4). Chromian spinels in harzburgites and dunites are very refractory, with restricted chemical compositions of high-Cr varieties. The unaltered cores of chromian spinels have low Al2O3 and TiO2 content, and display a large range of Mg# (100× [Mg/(Mg + Fe)], 41-64) and Cr# (100× [Cr/(Cr + Al)], 53-83) values, suggesting that the peridotites originated from a highly-depleted mantle. The spinels plotted in "olivine-spinel mantle array" (OSMA) diagram and Cr# versus. Mg# diagram both indicate the peridotite of NJO experienced a >25 % partial melting. The positive correlation between the Cr# and the TiO2 content probably resulted from the reaction between boninitic melt and mantle peridotite, as a consequence of melt-mantle interaction within the arc setting. The oxygen fugacity (ƒO2), calculated using chromian spinel-olivine pairs, indicates that the peridotites in the NJO were formed under relatively low oxidizing conditions quite different from those commonly found in supra-subductions zones (SSZ). This might be explained by the reaction between fore-arc magmas and residual mantle in a back-arc oceanic basin during a rapid subduction process. The Neoproterozoic subduction between the Yangtze and Cathaysia blocks was therefore probably rapid, and the addition of water and other volatiles to the mantle wedge beneath the island arc would have enhanced melting, leading to the production of highly depleted boninitic melts.

  4. Lagrangian circulation study near Cape Henry, Virginia. [Chesapeake Bay

    NASA Technical Reports Server (NTRS)

    Johnson, R. E.

    1981-01-01

    A study of the circulation near Cape Henry, Virginia, was made using surface and seabed drifters and radar tracked surface buoys coupled to subsurface drag plates. Drifter releases were conducted on a line normal to the beach just south of Cape Henry. Surface drifter recoveries were few; wind effects were strongly noted. Seabed drifter recoveries all exhibited onshore motion into Chesapeake Bay. Strong winds also affected seabed recoveries, tending to move them farther before recovery. Buoy trajectories in the vicinity of Cape Henry appeared to be of an irrotational nature, showing a clockwise rotary tide motion. Nearest the cape, the buoy motion elongated to almost parallel depth contours around the cape. Buoy motion under the action of strong winds showed that currents to at least the depth of the drag plates substantially are altered from those of low wind conditions near the Bay mouth. Only partial evidence could be found to support the presence of a clockwise nontidal eddy at Virginia Beach, south of Cape Henry.

  5. A Cross Sectional Analysis of Gonococcal and Chlamydial Infections among Men-Who-Have-Sex-with-Men in Cape Town, South Africa

    PubMed Central

    Kamkuemah, Monika

    2015-01-01

    Background Men-who-have-sex-with-men (MSM) are at high risk of HIV and sexually transmitted infection (STI) transmission. Asymptomatic STIs are common in MSM and remain undiagnosed and untreated where syndromic management is advocated. Untreated STIs could be contributing to high HIV rates. This study investigated symptomatic (SSTI) and asymptomatic STIs (ASTIs) in MSM in Cape Town. Methods MSM, 18 years and above, were enrolled into this study. Participants underwent clinical and microbiological screening for STIs. Urine, oro-pharyngeal and anal swab specimens were collected for STI analysis, and blood for HIV and syphilis screening. A psychosocial and sexual questionnaire was completed. STI specimens were analysed for Neisseria gonorrhoeae (NG) and Chlamydia trachomatis (CT) infection. Results 200 MSM were recruited with a median age of 32 years (IQR 26–39.5). Their median number of sex partners within the last year was 5 (IQR 2–20). 155/200 (78%) reported only male sex partners while 45/200 (23%) reported sex with men and women. 77/200 (39%) reported transactional sex. At enrolment, 88/200 (44%) were HIV positive and 8/112 (7%) initially HIV-negative participants seroconverted during the study. Overall, 47/200 (24%) screened positive for either NG or CT. There were 32 MSM (16%) infected with NG and 7 (3.5%) of these men had NG infections at two anatomical sites (39 NG positive results in total). Likewise, there were 23 MSM (12%) infected with CT and all these men had infections at only one site. Eight of the 47 men (17%) were infected with both NG and CT. ASTI was more common than SSTI irrespective of anatomical site, 38 /200 (19%) versus 9/200 (5%) respectively (p<0.001). The anus was most commonly affected, followed by the oro-pharynx and then urethra. Asymptomatic infection was associated with transgender identity (OR 4.09 CI 1.60–5.62), ≥5 male sex partners in the last year (OR 2.50 CI 1.16–5.62) and transactional sex (OR 2.33 CI 1.13–4.79) but

  6. Bayesian gravimetric inversion for local crustal model refinement in the Guangdong province, South China

    NASA Astrophysics Data System (ADS)

    Rossi, Lorenzo; Reguzzoni, Mirko; Sampietro, Daniele

    2015-04-01

    The knowledge of the Earth crustal structure is a fundamental subject for many geophysical applications. As a first approximation, the crust composition can be subdivided into sediments and crystalline crust; the latter, in the case of the continental crust, can be further subdivided into upper, middle and lower crust, as it is done for example in the CRUST1.0 global model. Gravimetric inversion methods, in order to guarantee the uniqueness of the solution of the inverse problem, are generally used to infer only one boundary between two layers, e.g. the crustal thickness (i.e. the Moho depth). Here a method based on a Bayesian approach is proposed to refine an already existing crustal model by combining gravimetric observations and some a priori conditions on the crustal structure. Basically the method consists in subdividing the crustal volume under investigation into voxels and in estimating a label and a mass density for each voxel in such a way that the resulting gravimetric signal is consistent with the observed one and the a priori conditions are satisfied. The label characterizes the material type of each voxel, e.g. sediments, oceanic crust, upper crust, etc. The estimation procedure is based on a simulated annealing driven by a Gibbs sampler at each iterative step. Moreover, the proposed solution allows to easily integrate seismic profiles available in the study area to further constrain the result of the gravimetric inversion. In this work the method is applied to refine the crustal model beneath the Guangdong province in the Southern China. This region has been selected for its complex geological structure (e.g. both continental and oceanic crust are present) and for the plan of building here a massive detector of neutrino and geo-neutrino flux. For the latter experiment, an accurate knowledge of the underlying crustal structure is required. The gravity signal to be inverted, at a ground level and at a medium-high spatial resolution, comes from a recent

  7. Reasons for the low bacteriological coverage of tuberculosis reported in Mpumalanga Province, South Africa.

    PubMed

    Mngomezulu, N; Cameron, D; Olorunju, S; Luthuli, T; Dunbar, R; Naidoo, P

    2015-06-21

    Contexte : Hôpitaux publics et centres de santé primaire de la province de Mpumalanga en Afrique du Sud.Objectif : Déterminer si le défaut de respecter les directives de diagnostic de la tuberculose (TB) (c'est-à-dire soumettre des crachats à la microscopie de frottis) a contribué à la faible couverture bactériologique rapportée en 2008.Méthodes : Nous avons revu les dossiers cliniques des nouveaux cas de TB pulmonaire dans 30 de 118 structures sélectionnées au hasard qui ont atteint la couverture bacteriologique visée de 80% et 30 de 87 structures qui ne l'ont pas atteinte. Les données des cas suivis dans les hôpitaux et les dispensaires ont été résumées sur des formulaires, saisies en informatique et comparées aux données du registre électronique de la TB (ETR). Nous avons évalué l'âge, le sexe, l'infection au virus de l'immunodéficience humaine (VIH) et le type de structure en tant que facteurs de confusion de l'enregistrement des frottis.Résultats : L'âge, le sexe et l'infection VIH n'ont pas influencé l'enregistrement des frottis. Dans les hôpitaux, 61,8% des cas de TB pulmonaire ont eu des résultats de frottis de crachats dans leurs dossiers cliniques comparés à 93,6% dans les dispensaires (P < 0,001). Sur les 711 cas (30,3%) qui n'avaient pas de résultats de frottis dans le ETR, 342 (48,1%) avaient des résultats de frottis dans leurs dossiers cliniques.Conclusion : La faible couverture bactériologique constatée est due à la fois à des pratiques cliniques médiocres (surtout dans les hôpitaux) et à une maintenance insuffisante des dossiers. Ces deux problèmes doivent être résolus afin d'améliorer la prise en charge des patients et la gestion du programme.

  8. Discourse, Differentiation, and Agency: Muslim Community Schools in Postapartheid Cape Town

    ERIC Educational Resources Information Center

    Fataar, Aslam

    2005-01-01

    This article explores the establishment of schools set up by Muslim communities in Cape Town, South Africa, after 1994. Twelve schools have been set up across the city: four primary schools, three high schools, four schools that have grades 1-12, and one school that has grades 1-3 and 8-10. They are registered with the Western Cape Education…

  9. Vegetation mapping of the Mond Protected Area of Bushehr Province (south-west Iran).

    PubMed

    Mehrabian, Ahmadreza; Naqinezhad, Alireza; Mahiny, Abdolrassoul Salman; Mostafavi, Hossein; Liaghati, Homan; Kouchekzadeh, Mohsen

    2009-03-01

    Arid regions of the world occupy up to 35% of the earth's surface, the basis of various definitions of climatic conditions, vegetation types or potential for food production. Due to their high ecological value, monitoring of arid regions is necessary and modern vegetation studies can help in the conservation and management of these areas. The use of remote sensing for mapping of desert vegetation is difficult due to mixing of the spectral reflectance of bright desert soils with the weak spectral response of sparse vegetation. We studied the vegetation types in the semiarid to arid region of Mond Protected Area, south-west Iran, based on unsupervised classification of the Spot XS bands and then produced updated maps. Sixteen map units covering 12 vegetation types were recognized in the area based on both field works and satellite mapping. Halocnemum strobilaceum and Suaeda fruticosa vegetation types were the dominant types and Ephedra foliata, Salicornia europaea-Suaeda heterophylla vegetation types were the smallest. Vegetation coverage decreased sharply with the increase in salinity towards the coastal areas of the Persian Gulf. The highest vegetation coverage belonged to the riparian vegetation along the Mond River, which represents the northern boundary of the protected area. The location of vegetation types was studied on the separate soil and habitat diversity maps of the study area, which helped in final refinements of the vegetation map produced.

  10. Women as whole blood donors: offers, donations and deferrals in the province of Huelva, south-western Spain

    PubMed Central

    Madrona, Dalmiro Prados; Herrera, María Dolores Fernández; Jiménez, Dalmiro Prados; Giraldo, Sonsoles Gómez; Campos, Rita Robles

    2014-01-01

    Background Women seem more willing to donate blood than men despite the limitations that affect their donation rate. The aim of our study was to determine the role of women in altruistic donation of blood in Huelva, a province in south-western Spain. Materials and methods We registered 87,601 offers to donate whole blood between January 1st, 2005 and December 31st, 2009. We statistically analysed variables such as sex, age, offers, deferrals and donations, problems in venous access, vasovagal reactions, weight and blood pressure to establish their significance according to donor gender. Results With regards to gender, 52.3% of donors were women and 47.7% men. Of the 87,601 offers to donate blood, 46.5% were from females and 53.5% from males. More females than males made their first donation during the study period. However, 43.9 % of donations were from women, whereas 56.1% were from men. Overall 8.7% of offers were deferred, 62.7% of which due to a low haemoglobin concentration, which was the most frequent cause of deferral in women. Difficulties in venous access and vasovagal reactions were also more frequent in female donors than in male donors. By the end of the study period, donor fidelity was 58.6% for men and 48.6% for women. Discussion In the province of Huelva, women are more altruistically inclined than men to give blood, with the percentages of donors and first-time donors being higher among females. However, there are restrictions to women giving blood, especially low haemoglobin concentration, which reduce the number of female blood donations. Women also have more difficulty when blood is withdrawn and are more susceptible to vasovagal reactions, which negatively affect their experience as donors. Measures should be taken to reduce these barriers to encourage women to continue to offer to donate blood, thereby ensuring that they become regular donors, which is a key factor in guaranteeing an adequate supply of blood within the region of Andalusia. PMID

  11. Affects of mining activities on Cd pollution to the paddy soils and rice grain in Hunan province, Central South China.

    PubMed

    Du, Yan; Hu, Xue-Feng; Wu, Xiao-Hong; Shu, Ying; Jiang, Ying; Yan, Xiao-Juan

    2013-12-01

    Located in Central South China, Hunan province is rich in mineral resources. To study the influence of mining on Cd pollution to local agricultural eco-system, the paddy soils and rice grain of Y county in northern Hunan province were intensively monitored. The results were as follows: (1) Total Cd (T-Cd) content in the soils of the county ranges from 0.13 to 6.02 mg kg(-1), with a mean of 0.64 mg kg(-1), of which 57.5% exceed the allowable limit specified by the China Soil Environmental Quality Standards. T-Cd in the soils varies largely, with the coefficient of variation reaching 146.4%. The spatial distribution of T-Cd in the soils quite matches with that of mining and industries. The content of HCl-extractable Cd (HCl-Cd) in the soils ranges from 0.02 to 2.17 mg kg(-1), with a mean of 0.24 mg kg(-1). A significant positive correlation exists between T-Cd and HCl-Cd in the soils (r = 0.770, ρ < 0.01). (2) Cd content in the rice produced in Y county ranges from 0.01 to 2.77 mg kg(-1), with a mean of 0.46 mg kg(-1). The rate of rice with Cd exceeding the allowable limit specified by the Chinese Grain Security Standards reaches 59.6%; that with Cd exceeding 1 mg kg(-1), called as "Cd rice," reaches 11.1%. (3) Cd content in the rice of Y county is positively significantly correlated with HCl-Cd (r = 0.177, ρ < 0.05) but not significantly with T-Cd in the soils (r = 0.091, ρ > 0.05), which suggests that the amount of Cd accumulating in the rice is more affected by its availability in the soils, rather than the total content. (4) The dietary intake of Cd via rice consumption in Y county is estimated to be 179.9 μg day(-1) person(-1) on average, which is far beyond the allowable limit specified by FAO/WHO and the target hazard quotients of Cd much higher than 1, suggesting the high risk on human health from Cd exposure.

  12. Long-run relative importance of temperature as the main driver to malaria transmission in Limpopo Province, South Africa: a simple econometric approach.

    PubMed

    Komen, Kibii; Olwoch, Jane; Rautenbach, Hannes; Botai, Joel; Adebayo, Adetunji

    2015-03-01

    Malaria in Limpopo Province of South Africa is shifting and now observed in originally non-malaria districts, and it is unclear whether climate change drives this shift. This study examines the distribution of malaria at district level in the province, determines direction and strength of the linear relationship and causality between malaria with the meteorological variables (rainfall and temperature) and ascertains their short- and long-run variations. Spatio-temporal method, Correlation analysis and econometric methods are applied. Time series monthly meteorological data (1998-2007) were obtained from South Africa Weather Services, while clinical malaria data came from Malaria Control Centre in Tzaneen (Limpopo Province) and South African Department of Health. We find that malaria changes and pressures vary in different districts with a strong positive correlation between temperature with malaria, r = 0.5212, and a weak positive relationship for rainfall, r = 0.2810. Strong unidirectional causality runs from rainfall and temperature to malaria cases (and not vice versa): F (1, 117) = 3.89, ρ = 0.0232 and F (1, 117) = 20.08, P < 0.001 and between rainfall and temperature, a bi-directional causality exists: F (1, 117) = 19.80; F (1,117) = 17.14, P < 0.001, respectively, meaning that rainfall affects temperature and vice versa. Results show evidence of strong existence of a long-run relationship between climate variables and malaria, with temperature maintaining very high level of significance than rainfall. Temperature, therefore, is more important in influencing malaria transmission in Limpopo Province.

  13. The Cape Observatory: all Categories of Heritage

    NASA Astrophysics Data System (ADS)

    Glass, Ian S.

    2012-09-01

    In this presentation I will give an outline of the various types of heritage related to the Royal Observatory, Cape of Good Hope, established in 1820 and now the headquarters campus of the South African Astronomical Observatory, located quite close to downtown Cape Town. In terms of tangible, fixed heritage, the campus itself, the domes and the various other buildings are obviously relevant. This category includes the Classical Revival Main Building of 1828 and the McClean dome of 1895 by the leading colonial architect Herbert Baker as well as many other buildings and even the graves of two directors. Tangible movable items include, in principle, the telescopes, the accessory instruments and many pieces of apparatus that have been preserved. In addition, extensive collections of antique paintings, drawings, furniture and books add to the site's cultural significance. Many of the Observatory's archives are still kept locally. The intangible heritage of the Observatory consists for example of its history, its major discoveries, its interaction with the City, its central role in the history of science in South Africa and its appeal as a living cultural institution. Especially notable were the observations by Henderson (ca 1831) leading to the distance of a Cen and the early sky survey known as the Cape Photographic Durchmusterung.

  14. Seismic stratigraphy or Cape Sorell Basin, Tasmania

    SciTech Connect

    Bellow, T.L.

    1990-05-01

    Because large new exploration areas have become scarce, the Cape Sorell basin has become an increasingly attractive frontier area. Cape Sorell basin, located along the western passive continental margin of Tasmania formed as a result of the breakup of eastern Gondwanaland 95{plus minus}5 Ma. An extensional fault system trending west-northwest with dip-slip movement down to the south-southwest forms the northern boundary and a second fault system trending north-northwest with oblique slip down to the south-southwest creates the basin. Second order extensional faults within the basin have created wrench-type flower structures, which are potential migration pathways for hydrocarbons. Nine distinct depositional sequences identified within the Cape Sorell basin record the evolution of this passive continental margin. Late Cretaceous-early Paleocene sequences were deposited as the rifting ceased and clastic progradation over the rift terrain began. Relative lowering of sea level occurred during the Paleocene, resulting in extensive channeling of the Late Cretaceous-early Paleocene sequences. A subsequent rise in relative sea level resulted in canyon-fill deposition during the early Paleocene to early Eocene. During the Eocene, sedimentation sufficiently increased to produce a downlapping sediment progradation characterized by deltaic depositional environment. Although interrupted several times by changes in relative sea level and shifting sediment sources, deltaic deposition continued until the late Oligocene. As the rate of clastic sedimentation slowed, carbonate shelf deposition began and has typified the basin since late the Oligocene.

  15. DETAIL VIEW OF ORBITER PAYLOAD DATA PANELS, SOUTH HALF OF ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    DETAIL VIEW OF ORBITER PAYLOAD DATA PANELS, SOUTH HALF OF ROOM 10A - Cape Canaveral Air Force Station, Launch Complex 39, Mobile Launcher Platforms, Launcher Road, East of Kennedy Parkway North, Cape Canaveral, Brevard County, FL

  16. 11. Fog signal house, view northnorthwest, east and south sides ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    11. Fog signal house, view north-northwest, east and south sides - Cape Elizabeth Light Station, Near Two Lights State Park at end of Two Lights Road, off State Highway 77, Cape Elizabeth, Cumberland County, ME

  17. 15. SOUTH SIDE OF LAUNCH DECK SHOWING NEW AUXILIARY FLAME ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    15. SOUTH SIDE OF LAUNCH DECK SHOWING NEW AUXILIARY FLAME DUCTS UNDER CONSTRUCTION, UMBILICAL MAST AT RIGHT; VIEW TO NORTHEAST. - Cape Canaveral Air Station, Launch Complex 17, Facility 28402, East end of Lighthouse Road, Cape Canaveral, Brevard County, FL

  18. VIEW OF EASTERN PARTITION OF FRONT BAY ROOM, FACING SOUTH ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    VIEW OF EASTERN PARTITION OF FRONT BAY ROOM, FACING SOUTH - Cape Canaveral Air Force Station, Launch Complex 34, Operations Support Building, Freedom Road, Southwest of Launch Stand CX-34, Cape Canaveral, Brevard County, FL

  19. VIEW OF WESTERN PARTITION OF FRONT BAY ROOM, FACING SOUTH ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    VIEW OF WESTERN PARTITION OF FRONT BAY ROOM, FACING SOUTH - Cape Canaveral Air Force Station, Launch Complex 34, Operations Support Building, Freedom Road, Southwest of Launch Stand CX-34, Cape Canaveral, Brevard County, FL

  20. The Influence of Second-Hand Cigarette Smoke Exposure during Childhood and Active Cigarette Smoking on Crohn’s Disease Phenotype Defined by the Montreal Classification Scheme in a Western Cape Population, South Africa

    PubMed Central

    Chivese, Tawanda; Esterhuizen, Tonya M.; Basson, Abigail Raffner

    2015-01-01

    Background Smoking may worsen the disease outcomes in patients with Crohn’s disease (CD), however the effect of exposure to second-hand cigarette smoke during childhood is unclear. In South Africa, no such literature exists. The aim of this study was to investigate whether disease phenotype, at time of diagnosis of CD, was associated with exposure to second-hand cigarette during childhood and active cigarette smoking habits. Methods A cross sectional examination of all consecutive CD patients seen during the period September 2011-January 2013 at 2 large inflammatory bowel disease centers in the Western Cape, South Africa was performed. Data were collected via review of patient case notes, interviewer-administered questionnaire and clinical examination by the attending gastroenterologist. Disease phenotype (behavior and location) was evaluated at time of diagnosis, according to the Montreal Classification scheme. In addition, disease behavior was stratified as ‘complicated’ or ‘uncomplicated’, using predefined definitions. Passive cigarette smoke exposure was evaluated during 3 age intervals: 0–5, 6–10, and 11–18 years. Results One hundred and ninety four CD patients were identified. Cigarette smoking during the 6 months prior to, or at time of diagnosis was significantly associated with ileo-colonic (L3) disease (RRR = 3.63; 95%CI, 1.32–9.98, p = 0.012) and ileal (L1) disease (RRR = 3.54; 95%CI, 1.06–11.83, p = 0.040) compared with colonic disease. In smokers, childhood passive cigarette smoke exposure during the 0–5 years age interval was significantly associated with ileo-colonic CD location (RRR = 21.3; 95%CI, 1.16–391.55, p = 0.040). No significant association between smoking habits and disease behavior at diagnosis, whether defined by the Montreal scheme, or stratified as ‘complicated’ vs ‘uncomplicated’, was observed. Conclusion Smoking habits were associated with ileo-colonic (L3) and ileal (L1) disease at time of diagnosis in

  1. The Relationship Between Social Support, HIV Serostatus, and Perceived Likelihood of Being HIV Positive Among Self-Settled Female, Foreign Migrants in Cape Town, South Africa.

    PubMed

    Giorgio, Margaret; Townsend, Loraine; Zembe, Yanga; Cheyip, Mireille; Guttmacher, Sally; Kapadia, Farzana; Mathews, Cathy

    2016-10-19

    Female cross-border migrants experience elevated risks for HIV, and migrants in South Africa may face additional risks due to the country's underlying HIV prevalence. These risks may be mitigated by the receipt of social support. A behavioral risk-factor survey was administered using respondent-driven sampling. Multivariable regression models assessed the relationships between social support and two HIV outcomes: HIV serostatus and perceived HIV status. Low social support was not significantly associated with HIV status (aOR = 1.03, 95 % CI 0.43-2.46), but was significantly related to a perception of being HIV positive (aPR = 1.36, 95 % CI 1.04-1.78). Age, marital status, and education level were significantly associated with HIV serostatus. Illegal border-crossing, length of time in South Africa, anal sex, and transactional sex were significantly associated with aperception of being HIV positive. Future research should investigate how HIV risks and the receipt of social support change throughout the migration process.

  2. Research on remote sensing assessment technology for porphyry copper in south of Arequipa province of Peru

    NASA Astrophysics Data System (ADS)

    Yang, Rihong; Li, Zhizhong; Cheng, Xiufa; Zhao, Yuling

    2014-05-01

    The study area is located in the middle section of Andean metallogenic zone. Excellent mineralization geological conditions make it the most principal Porphyry Copper Deposits (PCDs) distribution area in southern Peru and there are several super-large PCDs for hundreds of kilometers in every direction. The regional metallogenic regularity of this area is controlled by the NNW fault parallel to the trench on the west of the South American continent. Small porphyry rocks are very common in this area (circular structure pattern in remote sensing image) with typical zoned alteration of PCD - potassic alteration, argillic alteration, phyllic alteration and propylitization (most exposed) from inside to the outside on the surface. These geologic features can be recognized and extracted by using remote sensing image data. Accordingly, the reflectivity curve of main altered minerals of the typical alteration zones of PCD was rebuilt which was corresponded to B1-B9 of ASTER satellite data, based on the altered mineral assemblages and their spectral characteristics of the typical alteration zones of PCD, and ASTER data's ability of identifying minerals with argillic alteration and carbonatite alteration. Based on the standard spectral data of USGS, We found that the information of argillic-and phyllic- altered minerals assemblages in the typical alteration zones can be extracted in the principal components analysis pattern based on ASTER B1467 while the information of propylitization altered minerals in the principal components analysis pattern based on ASTER B1348 with larger reflectivity of B9 than B8, after comparing and analyzing comprehensively the spectral curve characteristics of main altered minerals. In this method, altered minerals assemblages of argillic-and phyllic- altered zone and propylitization altered zone in this study area was extracted, and the results agree well with the distribution of known PCD. Meanwhile, remote sensing geological interpretation has

  3. Weathering characteristics of the Lower Paleozoic black shale in northwestern Guizhou Province, south China

    NASA Astrophysics Data System (ADS)

    Liu, Yang; Zhang, Jinchuan; Tang, Xuan; Yang, Chao; Tang, Shuai

    2016-07-01

    The northwestern Guizhou in the Yangtze Craton of south China has a tremendous potential of shale gas resource. In this paper, we present results from major and trace elements, total organic carbon, mineralogical composition analysis and petrophysical parameters to characterise shale weathering features. Further, the differences of black shale between underground and outcrops have also been presented to examine the changes of black shale after weathering. Our results show that the trace elements of shale have varying degrees of loss in the weathering leaching process, both in Niutitang shale and Longmaxi shale, the loss of B, V, Ni, Cu, Zn and Ba is obvious, but the element migration quantity in the former is greater than in the latter. Decomposition of minerals such as pyrite, feldspar and calcite result in the leaching of Na, Ca, Mg and Fe. The loss rate of total organic carbon (TOC) in black shales ranges from 18% to 70% with an average of 43%; moreover, the loss of organic carbon in samples with high TOC content is larger than in those samples with low TOC content. Results following the testing of porosity and permeability show that porosity increases significantly after weathering but permeability changes little. Furthermore, the increment of porosity is greater in the Niutitang shale (with more sulphide minerals) than in the Longmaxi shale, suggesting that the oxidation of sulphide minerals may have led to the formation of an acidic environment, causing the other minerals in the black shale to weather more quickly, thus resulting in increased porosity. The content of clay minerals in the core samples is slightly lesser than the outcrop samples, but the TOC content in the core samples is greater and has a larger specific surface area. This suggest that the TOC content played a decisive role on the specific surface area of shale. In addition, changes in the black shale caused by the weathering process mainly depend on the mineral composition and the TOC content

  4. Evaluating computerized health information systems: hardware, software and human ware: experiences from the Northern Province, South Africa.

    PubMed

    Herbst, K; Littlejohns, P; Rawlinson, J; Collinson, M; Wyatt, J C

    1999-09-01

    Despite enormous investment world-wide in computerized health information systems their overall benefits and costs have rarely been fully assessed. A major new initiative in South Africa provides the opportunity to evaluate the introduction of information technology from a global perspective and assess its impact on public health. The Northern Province is implementing a comprehensive integrated hospital information system (HIS) in all of its 42 hospitals. These include two mental health institutions, eight regional hospitals (two acting as a tertiary complex with teaching responsibilities) and 32 district hospitals. The overall goal of the HIS is to improve the efficiency and effectiveness of health (and welfare) services through the creation and use of information, for clinical, administrative and monitoring purposes. This multi-site implementation is being undertaken as a single project at a cost of R130 million (which represents 2.5 per cent of the health and welfare budget on an annual basis). The implementation process commenced on 1 September 1998 with the introduction of the system into Mankweng Hospital as the pilot site and is to be completed in the year 2001. An evaluation programme has been designed to maximize the likelihood of success of the implementation phase (formative evaluation) as well as providing an overall assessment of its benefits and costs (summative evaluation). The evaluation was designed as a form of health technology assessment; the system will have to prove its worth (in terms of cost-effectiveness) relative to other interventions. This is more extensive than the traditional form of technical assessment of hardware and software functionality, and moves into assessing the day-to-day utility of the system, the clinical and managerial environment in which it is situated (humanware), and ultimately its effects on the quality of patient care and public health. In keeping with new South African legislation the evaluation process sought to

  5. Association between iron status and white blood cell counts in African schoolchildren of the North-West Province, South Africa.

    PubMed

    Onabanjo, Oluseye O; Jerling, Johann C; Covic, Namukolo; Van Graan, Averalda; Taljaard, Christine; Mamabolo, Ramoteme L

    2012-09-01

    Iron deficiency with or without anemia is associated with increased susceptibility to infection owing to impaired immune function; this study aimed to examine the associations between markers of iron status and white blood cell counts in African schoolchildren. This cross-sectional study is part of the larger BeForMi study done in the North-West province of South Africa. A total of 556 African schoolchildren (aged 7-10 years) were recruited from the three schools participating in the BeForMi multiple micronutrient intervention study. Demographic information of the children was obtained from their parents/caregivers/guardians in the language of choice using validated questionnaires. Anthropometric indices (weight and height), iron status parameters, hematological parameters (hemoglobin (Hb), red blood cell count (RBC), total and differential white blood cell counts) were measured using standard procedures. No significant gender differences were observed in most of the iron markers and hematological parameters except in C-reactive protein (CRP) (p=0.004) and eosinophils (p=0.042) which were higher in boys while RBC (p=0.018) and Hb (p=0.023) levels were higher in girls. No relationships were observed between the different iron markers and differential white blood cell counts. A positive correlation was observed between serum ferritin (SF) and CRP in girls only (r=0.336, p<0.01), and a positive correlation between SF and mean cell volume (MCV) in boys only (r=0.197, p<0.01). In both genders, no correlations were observed between the different iron markers and the differential white blood cell counts. The study revealed no associations between iron status and differential white blood cell counts in children that participated in the BeForMi study calling for more studies to be done in the area of the significance of iron supplementation in healthy children.

  6. Informing Comprehensive HIV Prevention: A Situational Analysis of the HIV Prevention and Care Context, North West Province South Africa

    PubMed Central

    Lippman, Sheri A.; Treves-Kagan, Sarah; Gilvydis, Jennifer M.; Naidoo, Evasen; Khumalo-Sakutukwa, Gertrude; Darbes, Lynae; Raphela, Elsie; Ntswane, Lebogang; Barnhart, Scott

    2014-01-01

    Objective Building a successful combination prevention program requires understanding the community’s local epidemiological profile, the social community norms that shape vulnerability to HIV and access to care, and the available community resources. We carried out a situational analysis in order to shape a comprehensive HIV prevention program that address local barriers to care at multiple contextual levels in the North West Province of South Africa. Method The situational analysis was conducted in two sub-districts in 2012 and guided by an adaptation of WHO’s Strategic Approach, a predominantly qualitative method, including observation of service delivery points and in-depth interviews and focus groups with local leaders, providers, and community members, in order to recommend context-specific HIV prevention strategies. Analysis began during fieldwork with nightly discussions of findings and continued with coding original textual data from the fieldwork notebooks and a select number of recorded interviews. Results We conducted over 200 individual and group interviews and gleaned four principal social barriers to HIV prevention and care, including: HIV fatalism, traditional gender norms, HIV-related stigma, and challenges with communication around HIV, all of which fuel the HIV epidemic. At the different levels of response needed to stem the epidemic, we found evidence of national policies and programs that are mitigating the social risk factors but little community-based responses that address social risk factors to HIV. Conclusions Understanding social and structural barriers to care helped shape our comprehensive HIV prevention program, which address the four ‘themes’ identified into each component of the program. Activities are underway to engage communities, offer community-based testing in high transmission areas, community stigma reduction, and a positive health, dignity and prevention program for stigma reduction and improve communication skills

  7. Lower Triassic stromatolites in Luodian County, Guizhou Province, South China: evidence for the protracted devastation of the marine environments.

    PubMed

    Ezaki, Y; Liu, J B; Adachi, N

    2012-01-01

    Stromatolites are one of the oldest and most intriguing organosedimentary deposits. In contrast to stromatolites of the Precambrian to Early Ordovician, Phanerozoic equivalents occurred episodically under specific conditions. A group of previously undescribed stromatolites in composition occur in the Lower Triassic (Olenekian) at the Dajiang section in the Luodian region of Guizhou Province, South China. We described the textures of these stromatolites with the aim of determining the genetic mechanisms and revealing the nature of interactions between micro-organisms and marine environments. Mesoscopic features show that the stromatolites consist of several sets of stacked slices, and that they are embedded in alternating beds of fine and coarse microsphere packstones that include aggregates of microspheres, forming grapestones and lumps. Microscopically, the stromatolites consist of spar- and dolomite-infilled microspheres (average diameter, 100 μm), micrites, peloids, small-sized pyrite framboids (average diameter, 5.8 μm) and fenestrae. Micrite-dominant intercalations accentuate laminated textures at a mesoscopic level and are laterally continuous with micrite-rich parts in surrounding interstromatolites, indicating the simultaneous, widespread deposition of these layers. The microspheres and associated micrites were the products of in situ microbial activity, probably sulphate-reducing or anoxygenic phototrophic bacteria, which led to the formation of these unusual stromatolites. Even during a protracted period of harsh marine conditions, the micrite-rich carpets were deposited intermittently on the stromatolites and their surroundings under severely anoxic/sulphidic conditions. The presence of Early Triassic stromatolites and their subtle but important vertical variations in texture provide a record of temporal changes in marine conditions during geobiologically critical intervals.

  8. Prevalence of human papillomavirus and its genotype among 1336 invasive cervical cancer patients in Hunan province, central south China.

    PubMed

    Wang, Linqian; Wu, Baiping; Li, Junjun; Chen, Liyu

    2015-03-01

    Existing data on the genotype distribution of human papillomavirus (HPV) are limited in Hunan province, central south China. To evaluate the prevalence of HPV infection and its genotype among women with invasive cervical cancer in Hunan, a total of 1,336 patients were included in this study between July 2012 and June 2013. Eighteen high-risk and eight low-risk genotypes of HPV were detected by Luminex xMAP technology. The results show that HPV prevalence in invasive cervical cancer in Hunan was 75.7%. A single HPV infection was found in 82.3% of the HPV-positive samples, and 91.8% of the cases had high-risk HPV infection. The most common HPV type was HPV 16 (50.6%), followed by HPV 58 (12.4%), HPV 52 (10.9%), HPV 18 (7.3%), HPV 33 (5.5%), HPV 59 (4.2%), HPV 39 (4.0%), HPV 61 (3.4%), HPV 31 (3.3%), and HPV 56 (3.2%). A single infection with HPV 16 was detected in 42.5% of the samples, which was significantly more frequent than any other HPV type in this population. Dual-infection with HPV 16 and HPV 52 were relatively common. The available vaccines for HPV 16 and 18 are therefore expected to have a substantial impact on reducing the burden of cervical cancer in China, even though HPV 18 showed a lower frequency. In addition to HPV 16 and 18, other HPV types including 58, 52, and 33, should be targeted in the next generation HPV vaccines.

  9. An improved model for provision of rural community-based health rehabilitation services in Vhembe District, Limpopo Province of South Africa

    PubMed Central

    Netshandama, Vhonani O.; Francis, Joseph

    2016-01-01

    Background In 1991, Riakona Community Rehabilitation Programme initiated community-based rehabilitation (CBR) in the Vhembe District of Limpopo Province. Subsequently, the South African government adopted the programme. Aim The aim of the study was to suggest an improvement in the model of providing CBR services. Setting The study was conducted in six rehabilitation centres located in hospitals in the Vhembe District in Limpopo Province of South Africa. Method A mixed-mode research design with qualitative and quantitative elements was used to conduct the study. Content analysis, the chi-square test for Goodness of Fit and the Kruskal–Wallis and Mann–Whitney non-parametric tests were conducted. Results The key determinants of client satisfaction with the services that the community rehabilitation workers rendered included provision of assistive devices and the adoption of a holistic approach to their work. Overall, satisfaction per domain for each one of the five domains of satisfaction scored less than 90%. More than 80% of clients were satisfied with empathy (83%) and assurance (80%) domains. Tangibles, reliability and responsiveness domains had scores of 78%, 72% and 67%, respectively. These results, together with the reasoning map of conceptual framework description, were used as the building blocks of the CBR model. Conclusion The improved CBR model is useful for putting the programme into practice. This is particularly so for the CBR managers in the districts of the Limpopo Province. PMID:27380835

  10. Environmental change at the southern Cape coast of South Africa as inferred from a high-resolution Holocene sediment record from Eilandvlei

    NASA Astrophysics Data System (ADS)

    Wündsch, Michael; Haberzettl, Torsten; Meadows, Michael E.; Kirsten, Kelly L.; Meschner, Stephanie; Frenzel, Peter; Baade, Jussi; Daut, Gerhard; Mäusbacher, Roland; Kasper, Thomas; Quick, Lynne J.; Cawthra, Hayley C.; Zabel, Matthias

    2016-04-01

    The RAIN project (Regional Archives for Integrated iNvestigations), funded by the German Federal Ministry of Education and Research (BMBF), focuses on closely integrated investigations of terrestrial and marine geoarchives from southern Africa in order to assess environmental changes during the late Quaternary. For this purpose, various marine and terrestrial sediment records from the three major rainfall zones of South Africa (winter-, summer- and year-round rainfall zone) were recovered and analysed applying a wide range of methods (e.g., sedimentology, seismic stratigraphy, geochronology, organic and inorganic geochemistry, mineralogy, stable isotopes, micropalaeontology, palynology). In this contribution, we present results and interpretations obtained from a 30.5 m sediment core retrieved from the coastal lake Eilandvlei located within the year-round rainfall zone. Geochemical investigations (Ca, Sr, total inorganic carbon) indicate major changes in the sediment carbonate contents which were linked to variations in the marine influence received at the site throughout the covered period. The interpretation of carbonates reflecting a varying marine influence is corroborated by micropalaeontological analyses (viz. ostracod and diatom assemblages) which reveal strong similarities with the geochemical data. In order to establish a reliable radiocarbon (14C) chronology for this record, it is of particular importance to consider the impact of 14C-depleted ("old") marine carbon contained in the measured samples causing reservoir effects. Therefore, two marine molluscan shells collected alive before AD 1950 ("pre-bomb") were analysed to determine the regional marine reservoir offset (ΔR). The obtained ΔR values of 134 ± 38 and 161 ± 38 14C yrs represent the first data available for the south coast of South Africa. However, the application of the resulting average ΔR = 148 ± 54 14C yrs for the calibration of the entire Eilandvlei record underestimates the

  11. Li isotope geochemical study on weathering of granite in Longnan, Jiangxi Province, South China

    NASA Astrophysics Data System (ADS)

    Liu, W.; Xu, Z.; Zhao, T.; Yu, C.; Zhou, L.

    2015-12-01

    Li isotopes have been demonstrated to be a powerful tool in silicate weathering research from the continental scale to that of catchments and weathering profiles. In this study, we focus on Li isotopic behavior during granite weathering and pedogenic processes. Study profiles are developed on a granite intrusion in Longnan, South China, under a subtropical monsoon climate. Two soil profiles (JLN-S4 on the ridgetop and JLN-S3 on the midslope; both 120cm deep) and one weathering profiles (JLN-S1 on the toe slope; 1100cm deep) along a hill slope were selected to represent the granite weathering process in near surface condition. Bulk samples of these profiles were analyzed for major element and Li content, and δ7Li value. CIA (chemical index of alteration) values were determined. The uppermost soil profile (JLN-S4) samples have CIA values between 97.6 and 98.3, with δ7Li values from -2.50 to -3.90‰; JLN-S3 profile samples have lower CIA values varing from 94.4 to 96.1 and δ7Li values from -0.73‰ to -1.55‰. The weathering profile JLN-S1 at the toe slope has a generally increasing CIA values (in the range of 57.8~92.4) upward in the profile. The δ7Li values variation with CIA in JLN-S1, shows a two staged relationship: δ7Li increasing from -14.92‰ to 0.66‰ when CIA increases from 57.8 to 74.6 as the first stage (from the bottom to 370cm depth), and no obvious relationship between CIA andδ7Li(-4.74~3.62‰) was observed in the second stage (CIA higher than 74.6, 370cm depth above). Li contents in JLN-S4 vary between 3.84 and 15.03 μg/g, in JLN-S3 between 1.43~8.03 μg/g, and in JLN-S1 between 6.95~22.27μg/g. In the first stage defined by δ7Li and CIA relationship, Li contents decrease with increasing CIA. However, in the second stage, Li abundance decreases upward at the beginning and turns into an increacing tendency (at 175cm depth) to the surface. Two granite bedrock samples have δ7Li value of -0.23 and 0.39‰, and Li contents of 38.58 and 34

  12. Phylogenetic Exploration of Nosocomial Transmission Chains of 2009 Influenza A/H1N1 among Children Admitted at Red Cross War Memorial Children's Hospital, Cape Town, South Africa in 2011.

    PubMed

    Valley-Omar, Ziyaad; Nindo, Fredrick; Mudau, Maanda; Hsiao, Marvin; Martin, Darren Patrick

    2015-01-01

    Traditional modes of investigating influenza nosocomial transmission have entailed a combination of confirmatory molecular diagnostic testing and epidemiological investigation. Common hospital-acquired infections like influenza require a discerning ability to distinguish between viral isolates to accurately identify patient transmission chains. We assessed whether influenza hemagglutinin sequence phylogenies can be used to enrich epidemiological data when investigating the extent of nosocomial transmission over a four-month period within a paediatric Hospital in Cape Town South Africa. Possible transmission chains/channels were initially determined through basic patient admission data combined with Maximum likelihood and time-scaled Bayesian phylogenetic analyses. These analyses suggested that most instances of potential hospital-acquired infections resulted from multiple introductions of Influenza A into the hospital, which included instances where virus hemagglutinin sequences were identical between different patients. Furthermore, a general inability to establish epidemiological transmission linkage of patients/viral isolates implied that identified isolates could have originated from asymptomatic hospital patients, visitors or hospital staff. In contrast, a traditional epidemiological investigation that used no viral phylogenetic analyses, based on patient co-admission into specific wards during a particular time-frame, suggested that multiple hospital acquired infection instances may have stemmed from a limited number of identifiable index viral isolates/patients. This traditional epidemiological analysis by itself could incorrectly suggest linkage between unrelated cases, underestimate the number of unique infections and may overlook the possible diffuse nature of hospital transmission, which was suggested by sequencing data to be caused by multiple unique introductions of influenza A isolates into individual hospital wards. We have demonstrated a functional

  13. Phylogenetic Exploration of Nosocomial Transmission Chains of 2009 Influenza A/H1N1 among Children Admitted at Red Cross War Memorial Children’s Hospital, Cape Town, South Africa in 2011

    PubMed Central

    Hsiao, Marvin; Martin, Darren Patrick

    2015-01-01

    Traditional modes of investigating influenza nosocomial transmission have entailed a combination of confirmatory molecular diagnostic testing and epidemiological investigation. Common hospital-acquired infections like influenza require a discerning ability to distinguish between viral isolates to accurately identify patient transmission chains. We assessed whether influenza hemagglutinin sequence phylogenies can be used to enrich epidemiological data when investigating the extent of nosocomial transmission over a four-month period within a paediatric Hospital in Cape Town South Africa. Possible transmission chains/channels were initially determined through basic patient admission data combined with Maximum likelihood and time-scaled Bayesian phylogenetic analyses. These analyses suggested that most instances of potential hospital-acquired infections resulted from multiple introductions of Influenza A into the hospital, which included instances where virus hemagglutinin sequences were identical between different patients. Furthermore, a general inability to establish epidemiological transmission linkage of patients/viral isolates implied that identified isolates could have originated from asymptomatic hospital patients, visitors or hospital staff. In contrast, a traditional epidemiological investigation that used no viral phylogenetic analyses, based on patient co-admission into specific wards during a particular time-frame, suggested that multiple hospital acquired infection instances may have stemmed from a limited number of identifiable index viral isolates/patients. This traditional epidemiological analysis by itself could incorrectly suggest linkage between unrelated cases, underestimate the number of unique infections and may overlook the possible diffuse nature of hospital transmission, which was suggested by sequencing data to be caused by multiple unique introductions of influenza A isolates into individual hospital wards. We have demonstrated a functional

  14. Symbiotic functioning, structural adaptation, and subcellular organization of root nodules from Psoralea pinnata (L.) plants grown naturally under wetland and upland conditions in the Cape Fynbos of South Africa.

    PubMed

    Kanu, Sheku A; Dakora, Felix D

    2017-01-01

    In the Cape Fynbos of South Africa, Psoralea pinnata (L.) plants occur naturally in both wetland and well-drained soils and yet effectively fix N2 under the two contrasting conditions. In this study, nodule structure and functioning in P. pinnata plants from the two habitats were evaluated using light and transmission electron microscopy (TEM), as well as the (15)N natural abundance technique. The results showed that, structurally, fully developed P. pinnata nodules were spherical in shape with six components (namely, lenticels, periderm, outer cortex, middle cortex, inner cortex, and a central bacteria-infected medulla region). Morphometric analysis revealed 44 and 84 % increase in cell area and volume of wetland nodules compared to those from upland. The percentage area of nodules occupied by the middle cortex in wetland nodules was twice that of upland nodules. As a result, the size of the medulla region in wetland nodules was significantly reduced compared to upland nodules. Additionally, the average area of medulla occupied by intercellular air spaces in wetland nodules was about five times that of upland nodules (about 431 % increase in wetland over upland nodules). TEM data also showed more bacteroids in symbiosomes of upland nodules when compared to wetland nodules. However, isotopic analysis of above-ground plant parts revealed no differences in symbiotic parameters such as N concentration, ∂(15)N and %Ndfa between wetland and upland P. pinnata plants. These results suggest that, under limiting O2 conditions especially in wetlands, nodules make structural and functional adjustments to meet the O2 demands of N2-fixing bacteroids.

  15. Development and evaluation of clear-water pier and contraction scour envelope curves in the Coastal Plain and Piedmont Provinces of South Carolina

    USGS Publications Warehouse

    Benedict, Stephen T.; Caldwell, Andral W.

    2016-01-01

    The U.S. Geological Survey in cooperation with the South Carolina Department of Transportation collected clear-water pier- and contraction-scour data at 116 bridges in the Coastal Plain and Piedmont Physiographic Provinces of South Carolina. Pier-scour depths collected in both provinces ranged from 0 to 8.0 feet. Contraction-scour depths collected in the Coastal Plain ranged from 0 to 3.9 feet. Using hydraulic data estimated with a one-dimensional flow model, predicted clear-water scour depths were computed with scour equations from the Federal Highway Administration Hydraulic Engineering Circular 18 and compared with measured scour. This comparison indicated that predicted clear-water scour depths, in general, exceeded measured scour depths and at times were excessive. Predicted clear-water contraction scour, however, was underpredicted approximately 30 percent of the time by as much as 7.1 feet. The investigation focused on clear-water pier scour, comparing trends in the laboratory and field data. This comparison indicated that the range of dimensionless variables (relative depth, flow intensity, relative grain size) used in laboratory investigations of pier scour, were similar to the range for field data in South Carolina, further indicating that laboratory relations may have some applicability to field conditions in South Carolina. Variables determined to be important in developing pier scour in laboratory studies were investigated to understand their influence on the South Carolina field data, and many of these variables appeared to be insignificant under field conditions in South Carolina. The strongest explanatory variables were pier width and approach velocity. Envelope curves developed from the field data are useful tools for evaluating reasonable ranges of clear-water pier and contraction scour in South Carolina. A modified version of the Hydraulic Engineering Circular 18 pier-scour equation also was developed as a tool for evaluating clearwater pier

  16. Narrative Methods and Sociocultural Linguistic Approaches in Facilitating In-depth Understanding of HIV Disclosure in a Cohort of Women and Men in Cape Town, South Africa

    PubMed Central

    Cooper, Diane; Mantell, Joanne E.; Nywagi, Ntobeko; Cishe, Nomazizi; Austin-Evelyn, Katherine

    2016-01-01

    The South African National Department of Health has rapidly extended free public-sector antiretroviral treatment for people living with HIV from 2007. Approximately 6 million people are living with HIV in South Africa, with 3.1 million currently on treatment. HIV disclosure stigma has been reduced in high prevalence, generalized epidemic settings, but some remains, including in research interviews. This paper documents the unexpected reactions of people living with HIV to interviewers. It highlights shifts over time from discussing daily events with researchers to later expressing distress and then relief at having an uninvolved, sympathetic person with whom to discuss HIV disclosure. While there are commonalities, women and men had gendered responses to interviewers. These are apparent in men’s uncharacteristic emotional responses and women’s shyness in revealing gendered aspects of HIV acquisition. Both women and men expressed stress at not being allowed or able to fulfill dominant expected masculine or feminine roles. The findings underline the role of research interviewers in study participants confiding and fully expressing their feelings. This greater confidence occurred in follow-up interviews with researchers in busy health facilities, where time of health-care providers is limited. It underlines the methodological value of narrative inquiries with research cohorts. These allowed richer data than cross-sectional interviews. They shaped the questions asked and the process of interview. They revealed participants’ increasing level of agency in expressing feelings that they find important. This research contributes to highlighting pivotal, relational aspects in research between empathetic, experienced researchers and study participants and how participant–researcher relationships progress over time. It highlights ethical dilemmas in roles of researchers as opposed to counselors, raising questions of possible blurring of lines between research and

  17. Narrative Methods and Sociocultural Linguistic Approaches in Facilitating In-depth Understanding of HIV Disclosure in a Cohort of Women and Men in Cape Town, South Africa.

    PubMed

    Cooper, Diane; Mantell, Joanne E; Nywagi, Ntobeko; Cishe, Nomazizi; Austin-Evelyn, Katherine

    2016-01-01

    The South African National Department of Health has rapidly extended free public-sector antiretroviral treatment for people living with HIV from 2007. Approximately 6 million people are living with HIV in South Africa, with 3.1 million currently on treatment. HIV disclosure stigma has been reduced in high prevalence, generalized epidemic settings, but some remains, including in research interviews. This paper documents the unexpected reactions of people living with HIV to interviewers. It highlights shifts over time from discussing daily events with researchers to later expressing distress and then relief at having an uninvolved, sympathetic person with whom to discuss HIV disclosure. While there are commonalities, women and men had gendered responses to interviewers. These are apparent in men's uncharacteristic emotional responses and women's shyness in revealing gendered aspects of HIV acquisition. Both women and men expressed stress at not being allowed or able to fulfill dominant expected masculine or feminine roles. The findings underline the role of research interviewers in study participants confiding and fully expressing their feelings. This greater confidence occurred in follow-up interviews with researchers in busy health facilities, where time of health-care providers is limited. It underlines the methodological value of narrative inquiries with research cohorts. These allowed richer data than cross-sectional interviews. They shaped the questions asked and the process of interview. They revealed participants' increasing level of agency in expressing feelings that they find important. This research contributes to highlighting pivotal, relational aspects in research between empathetic, experienced researchers and study participants and how participant-researcher relationships progress over time. It highlights ethical dilemmas in roles of researchers as opposed to counselors, raising questions of possible blurring of lines between research and service roles

  18. Profile of Community Mental Health Service Needs in the Moretele District (North-West Province) in South Africa.

    PubMed

    Modiba, Precious; Schneider, Helen; Porteus, Kimberly; Gunnarson, Veronica

    2001-12-01

    BACKGROUND: The emergence of democracy in South Africa led to a need to transform all public structures, including the health care system. The aim has been to transform these structures in order to bring them in line with the new culture of human rights. Transformation of the whole health care system is motivated by a number of key objectives, which include achieving equity in resource allocation and health service delivery, developing primary health care infrastructure and decentralising services to promote community participation. AIMS OF THE STUDY: In the context of de-institutionalising mental health services in South Africa, this study aimed to investigate community mental health service needs of mental health service users and that of their families in the Moretele district, North-West province, South Africa. METHODS: The study was conducted in three clinics situated in three different communities in the Moretele district. Data collection consisted of : 147 clinical record reviews, 105 interviews with patients followed by a joint interview with a family member, 83 interviews with caregivers and eight interviews with community key informants (traditional healers, a civic leader, a councillor, a retired teacher, and a physician). RESULTS: The majority of service users were males (54%). The mean age was 41 years and 63% had completed primary schooling.Patients were recorded as having only one of two primary diagnoses, namely schizophrenia (57%) or epilepsy (41%). However, a review of prescribed drugs and caregiver interviews showed that there was a presence of mood disorders among service users. The local hospital was service users primary entry point into the mental health care system, followed by traditional healers (30%). Interviews with service users, service providers and caregivers reveal limited knowledge of patient illness. Nevertheless, service users who had epilepsy were more likely to provide details of their illness than those with mental illness

  19. National Assessment of Oil and Gas Project: Petroleum Systems and Assessment of Undiscovered Oil and Gas in the Denver Basin Province, Colorado, Kansas, Nebraska, South Dakota, and Wyoming - USGS Province 39

    USGS Publications Warehouse

    Higley, Debra K.

    2007-01-01

    INTRODUCTION The purpose of the U.S. Geological Survey's (USGS) National Oil and Gas Assessment is to develop geologically based hypotheses regarding the potential for additions to oil and gas reserves in priority areas of the United States. The USGS recently completed an assessment of undiscovered oil and gas resources of the Denver Basin Province (USGS Province 39), Colorado, Kansas, Nebraska, South Dakota, and Wyoming. Petroleum is produced in the province from sandstone, shale, and limestone reservoirs that range from Pennsylvanian to Upper Cretaceous in age. This assessment is based on geologic principles and uses the total petroleum system concept. The geologic elements of a total petroleum system include hydrocarbon source rocks (source rock maturation, hydrocarbon generation and migration), reservoir rocks (sequence stratigraphy and petrophysical properties), and hydrocarbon traps (trap formation and timing). The USGS used this geologic framework to define seven total petroleum systems and twelve assessment units. Nine of these assessment units were quantitatively assessed for undiscovered oil and gas resources. Gas was not assessed for two coal bed methane assessment units due to lack of information and limited potential; oil resources were not assessed for the Fractured Pierre Shale Assessment Unit due to its mature development status.

  20. Local Wood Demand, Land Cover Change and the State of Albany Thicket on an Urban Commonage in the Eastern Cape, South Africa

    NASA Astrophysics Data System (ADS)

    Stickler, M. M.; Shackleton, C. M.

    2015-02-01

    Understanding the rates and causes of land-use change is crucial in identifying solutions, especially in sensitive landscapes and ecosystems, as well as in places undergoing rapid political, socioeconomic or ecological change. Despite considerable concern at the rate of transformation and degradation of the biodiversity-rich Albany Thicket biome in South Africa, most knowledge is gleaned from private commercial lands and state conservation areas. In comparison, there is limited work in communal areas where land uses include biomass extraction, especially for firewood and construction timber. We used aerial photographs to analyze land use and cover change in the high- and low-use zones of an urban commonage and an adjacent protected area over almost six decades, which included a major political transition. Field sampling was undertaken to characterize the current state of the vegetation and soils of the commonage and protected area and to determine the supply and demand for firewood and construction timber. Between the 1950s and 1980s, there was a clear increase in woody vegetation cover, which was reversed after the political transition in the mid-1990s. However, current woody plant standing stocks and sustainable annual production rates are well above current firewood demand, suggesting other probable causes for the decline in woody plant cover. The fragmentation of woody plant cover is paralleled by increases in grassy areas and bare ground, an increase in soil compaction, and decreases in soil moisture, carbon, and nutrients.

  1. Perceptions of Community Members and Healthcare Workers on Male Involvement in Prevention of Mother-To-Child Transmission Services in Khayelitsha, Cape Town, South Africa

    PubMed Central

    Ladur, Alice Norah; Colvin, Christopher J.; Stinson, Kathryn

    2015-01-01

    Involving male partners of pregnant women accessing PMTCT programs has the potential to improve health outcomes for women and children. This study explored community members’ (men and women) and healthcare workers’ perceptions of male involvement in the prevention of mother-to-child transmission of HIV in Khayelitsha, South Africa. Two focus group discussions were held with 25 men of unknown HIV status and one focus group discussion held with 12 HIV-positive women in the community. In depth interviews were conducted with four HIV-positive couples and five service providers purposely sampled from the community and a health facility, respectively. Both men and women interviewed in this study were receptive towards male involvement in PMTCT. However, men were reluctant to engage with health services due to stigma and negative attitudes from nurses. This study also found HIV testing, disclosure and direct health worker engagement with men increases male involvement in PMTCT. Using men in the media and community to reach out to fellow men with prevention messages tailored to suit specific audiences may reduce perceptions of antenatal care as being a woman`s domain. PMID:26218065

  2. Anti-retroviral Therapy Based HIV Prevention Among a Sample of Men Who Have Sex with Men in Cape Town, South Africa: Use of Post-exposure Prophylaxis and Knowledge on Pre-exposure Prophylaxis.

    PubMed

    Hugo, J M; Stall, R D; Rebe, K; Egan, J E; De Swardt, G; Struthers, H; McIntyre, J A

    2016-12-01

    Men who have Sex with Men (MSM) have been affected disproportionately by the global HIV pandemic. Rates of consistent condom-use are low and there is a need for further biomedical prevention interventions to prevent new HIV infections. Post exposure prophylaxis (PEP) can reduce the risk of HIV, but uptake among MSM is low. Pre-exposure prophylaxis (PrEP), an innovative anti-retroviral-based HIV prevention tool might be an appropriate intervention for MSM who have recently accessed PEP that involves HIV negative individuals taking daily tenofovir+emtricitabine for HIV prevention. 44 MSM, attending a primary health-care level MSM-focused sexual health clinic in Cape Town, South Africa, who had initiated PEP were enrolled in this study. Participants were followed up after 2, 4 and 12 weeks. Self-administered electronic surveys were completed at the initial, 4 and 12 week visit. Barriers and facilitators to accessing PEP and remaining adherent were examined, as was knowledge about PrEP. Thirty-two participants (80 %) were <40 years of age (range 20-65 years). 35 % of the participants reported their reason for requiring PEP as condomless receptive anal intercourse. A further 20 % required PEP following condomless penetrative anal intercourse; 27.5 % required PEP due to a broken condom during receptive anal sex and 2 participants during insertive anal sex. Three participants did not complete 28 days of PEP or were lost to follow up. Over half (58.5 %) of the participants reported being completely adherent to their regime; under a third (31.7 %) reported missing one PEP dose; and 9.8 % reported missing more than one dose. 36/40 (90 %) had heard of PrEP and 30/40 (75 %) indicated that they would use PrEP if it were accessible to them. That we enrolled 44 MSM who accessed PEP from a Department of Health affiliated clinic over 12 months, speaks to the low uptake by MSM of PEP services in South Africa. Adherence was high and demonstrates that adherence

  3. Experimental Dune Restoration and Stabilization, Nauset Beach, Cape Cod, Massachusetts.

    DTIC Science & Technology

    1980-08-01

    AREA ......... .................. 9 1. Geography and Geomorphology ........ ................ 9 2. Climate ........... .......................... ... 11...By 1969, the south spit was approximately 853 meters long, and the inlet was migrating northward. 2. Climate . The Cape’s proximity with the marine...environment produces a moderate climate . Precipitation occurs more than 90 days per year, averages about 100 centimeters, and is evenly distributed

  4. 33 CFR 80.525 - Cape Lookout, NC to Cape Fear, NC.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 33 Navigation and Navigable Waters 1 2012-07-01 2012-07-01 false Cape Lookout, NC to Cape Fear, NC... INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Fifth District § 80.525 Cape Lookout, NC to Cape Fear... southeast side of the Inlet. (g) Except as provided elsewhere in this section from Cape Lookout to Cape...

  5. 33 CFR 80.525 - Cape Lookout, NC to Cape Fear, NC.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 33 Navigation and Navigable Waters 1 2013-07-01 2013-07-01 false Cape Lookout, NC to Cape Fear, NC... INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Fifth District § 80.525 Cape Lookout, NC to Cape Fear...) Except as provided elsewhere in this section from Cape Lookout to Cape Fear, lines drawn parallel...

  6. 33 CFR 80.525 - Cape Lookout, NC to Cape Fear, NC.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 33 Navigation and Navigable Waters 1 2014-07-01 2014-07-01 false Cape Lookout, NC to Cape Fear, NC... INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Fifth District § 80.525 Cape Lookout, NC to Cape Fear...) Except as provided elsewhere in this section from Cape Lookout to Cape Fear, lines drawn parallel...

  7. 33 CFR 80.525 - Cape Lookout, NC to Cape Fear, NC.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 33 Navigation and Navigable Waters 1 2011-07-01 2011-07-01 false Cape Lookout, NC to Cape Fear, NC... INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Fifth District § 80.525 Cape Lookout, NC to Cape Fear... southeast side of the Inlet. (g) Except as provided elsewhere in this section from Cape Lookout to Cape...

  8. 33 CFR 80.525 - Cape Lookout, NC to Cape Fear, NC.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Cape Lookout, NC to Cape Fear, NC... INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Fifth District § 80.525 Cape Lookout, NC to Cape Fear... southeast side of the Inlet. (g) Except as provided elsewhere in this section from Cape Lookout to Cape...

  9. EMAP-VIRGINIAN PROVINCE FOUR YEAR ASSESSMENT (1990-1993)<