Cost-effective sequencing of full-length cDNA clones powered by a de novo-reference hybrid assembly.
Kuroshu, Reginaldo M; Watanabe, Junichi; Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka; Kasahara, Masahiro
2010-05-07
Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence approximately 800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only approximately US$3 per clone, demonstrating a significant advantage over previous approaches.
Cost-Effective Sequencing of Full-Length cDNA Clones Powered by a De Novo-Reference Hybrid Assembly
Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka
2010-01-01
Background Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. Methodology We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence ∼800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. Conclusions The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only ∼US$3 per clone, demonstrating a significant advantage over previous approaches. PMID:20479877
LaPolla, R J; Mayne, K M; Davidson, N
1984-01-01
A mouse cDNA clone has been isolated that contains the complete coding region of a protein highly homologous to the delta subunit of the Torpedo acetylcholine receptor (AcChoR). The cDNA library was constructed in the vector lambda 10 from membrane-associated poly(A)+ RNA from BC3H-1 mouse cells. Surprisingly, the delta clone was selected by hybridization with cDNA encoding the gamma subunit of the Torpedo AcChoR. The nucleotide sequence of the mouse cDNA clone contains an open reading frame of 520 amino acids. This amino acid sequence exhibits 59% and 50% sequence homology to the Torpedo AcChoR delta and gamma subunits, respectively. However, the mouse nucleotide sequence has several stretches of high homology with the Torpedo gamma subunit cDNA, but not with delta. The mouse protein has the same general structural features as do the Torpedo subunits. It is encoded by a 3.3-kilobase mRNA. There is probably only one, but at most two, chromosomal genes coding for this or closely related sequences. Images PMID:6096870
Brain cDNA clone for human cholinesterase
DOE Office of Scientific and Technical Information (OSTI.GOV)
McTiernan, C.; Adkins, S.; Chatonnet, A.
1987-10-01
A cDNA library from human basal ganglia was screened with oligonucleotide probes corresponding to portions of the amino acid sequence of human serum cholinesterase. Five overlapping clones, representing 2.4 kilobases, were isolated. The sequenced cDNA contained 207 base pairs of coding sequence 5' to the amino terminus of the mature protein in which there were four ATG translation start sites in the same reading frame as the protein. Only the ATG coding for Met-(-28) lay within a favorable consensus sequence for functional initiators. There were 1722 base pairs of coding sequence corresponding to the protein found circulating in human serum.more » The amino acid sequence deduced from the cDNA exactly matched the 574 amino acid sequence of human serum cholinesterase, as previously determined by Edman degradation. Therefore, our clones represented cholinesterase rather than acetylcholinesterase. It was concluded that the amino acid sequences of cholinesterase from two different tissues, human brain and human serum, were identical. Hybridization of genomic DNA blots suggested that a single gene, or very few genes coded for cholinesterase.« less
CLONING AND CHARACTERIZATION OF CDNA ENCODING GIARDIA LAMBLIA d-GIARDIN
USDA-ARS?s Scientific Manuscript database
A cDNA coding for d-giardin was cloned from Giardia lamblia trophozoites in order to localize the protein and study its function in mediating surface attachment. Recombinant d-giardin antigen was produced in Escherichia coli as a poly-histidine fusion protein and was purified by affinity chromatogr...
Hu, Lin-Yong; Cui, Chen-Chen; Song, Yu-Jie; Wang, Xiang-Guo; Jin, Ya-Ping; Wang, Ai-Hua; Zhang, Yong
2012-07-01
cDNA is widely used in gene function elucidation and/or transgenics research but often suitable tissues or cells from which to isolate mRNA for reverse transcription are unavailable. Here, an alternative method for cDNA cloning is described and tested by cloning the cDNA of human LALBA (human alpha-lactalbumin) from genomic DNA. First, genomic DNA containing all of the coding exons was cloned from human peripheral blood and inserted into a eukaryotic expression vector. Next, by delivering the plasmids into either 293T or fibroblast cells, surrogate cells were constructed. Finally, the total RNA was extracted from the surrogate cells and cDNA was obtained by RT-PCR. The human LALBA cDNA that was obtained was compared with the corresponding mRNA published in GenBank. The comparison showed that the two sequences were identical. The novel method for cDNA cloning from surrogate eukaryotic cells described here uses well-established techniques that are feasible and simple to use. We anticipate that this alternative method will have widespread applications.
Evaluation of vector-primed cDNA library production from microgram quantities of total RNA.
Kuo, Jonathan; Inman, Jason; Brownstein, Michael; Usdin, Ted B
2004-12-15
cDNA sequences are important for defining the coding region of genes, and full-length cDNA clones have proven to be useful for investigation of the function of gene products. We produced cDNA libraries containing 3.5-5 x 10(5) primary transformants, starting with 5 mug of total RNA prepared from mouse pituitary, adrenal, thymus, and pineal tissue, using a vector-primed cDNA synthesis method. Of approximately 1000 clones sequenced, approximately 20% contained the full open reading frames (ORFs) of known transcripts, based on the presence of the initiating methionine residue codon. The libraries were complex, with 94, 91, 83 and 55% of the clones from the thymus, adrenal, pineal and pituitary libraries, respectively, represented only once. Twenty-five full-length clones, not yet represented in the Mammalian Gene Collection, were identified. Thus, we have produced useful cDNA libraries for the isolation of full-length cDNA clones that are not yet available in the public domain, and demonstrated the utility of a simple method for making high-quality libraries from small amounts of starting material.
Cloning and expression of a cDNA coding for catalase from zebrafish (Danio rerio).
Ken, C F; Lin, C T; Wu, J L; Shaw, J F
2000-06-01
A full-length complementary DNA (cDNA) clone encoding a catalase was amplified by the rapid amplication of cDNA ends-polymerase chain reaction (RACE-PCR) technique from zebrafish (Danio rerio) mRNA. Nucleotide sequence analysis of this cDNA clone revealed that it comprised a complete open reading frame coding for 526 amino acid residues and that it had a molecular mass of 59 654 Da. The deduced amino acid sequence showed high similarity with the sequences of catalase from swine (86.9%), mouse (85.8%), rat (85%), human (83.7%), fruit fly (75.6%), nematode (71.1%), and yeast (58.6%). The amino acid residues for secondary structures are apparently conserved as they are present in other mammal species. Furthermore, the coding region of zebrafish catalase was introduced into an expression vector, pET-20b(+), and transformed into Escherichia coli expression host BL21(DE3)pLysS. A 60-kDa active catalase protein was expressed and detected by Coomassie blue staining as well as activity staining on polyacrylamide gel followed electrophoresis.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Prody, C.A.; Zevin-Sonkin, D.; Gnatt, A.
1987-06-01
To study the primary structure and regulation of human cholinesterases, oligodeoxynucleotide probes were prepared according to a consensus peptide sequence present in the active site of both human serum pseudocholinesterase and Torpedo electric organ true acetylcholinesterase. Using these probes, the authors isolated several cDNA clones from lambdagt10 libraries of fetal brain and liver origins. These include 2.4-kilobase cDNA clones that code for a polypeptide containing a putative signal peptide and the N-terminal, active site, and C-terminal peptides of human BtChoEase, suggesting that they code either for BtChoEase itself or for a very similar but distinct fetal form of cholinesterase. Inmore » RNA blots of poly(A)/sup +/ RNA from the cholinesterase-producing fetal brain and liver, these cDNAs hybridized with a single 2.5-kilobase band. Blot hybridization to human genomic DNA revealed that these fetal BtChoEase cDNA clones hybridize with DNA fragments of the total length of 17.5 kilobases, and signal intensities indicated that these sequences are not present in many copies. Both the cDNA-encoded protein and its nucleotide sequence display striking homology to parallel sequences published for Torpedo AcChoEase. These finding demonstrate extensive homologies between the fetal BtChoEase encoded by these clones and other cholinesterases of various forms and species.« less
Cloning and Expression of cDNA for Rat Heme Oxygenase
NASA Astrophysics Data System (ADS)
Shibahara, Shigeki; Muller, Rita; Taguchi, Hayao; Yoshida, Tadashi
1985-12-01
Two cDNA clones for rat heme oxygenase have been isolated from a rat spleen cDNA library in λ gt11 by immunological screening using a specific polyclonal antibody. One of these clones has an insert of 1530 nucleotides that contains the entire protein-coding region. To confirm that the isolated cDNA encodes heme oxygenase, we transfected monkey kidney cells (COS-7) with the cDNA carried in a simian virus 40 vector. The heme oxygenase was highly expressed in endoplasmic reticulum of transfected cells. The nucleotide sequence of the cloned cDNA was determined and the primary structure of heme oxygenase was deduced. Heme oxygenase is composed of 289 amino acids and has one hydrophobic segment at its carboxyl terminus, which is probably important for the insertion of heme oxygenase into endoplasmic reticulum. The cloned cDNA was used to analyze the induction of heme oxygenase in rat liver by treatment with CoCl2 or with hemin. RNA blot analysis showed that both CoCl2 and hemin increased the amount of hybridizable mRNA, suggesting that these substances may act at the transcriptional level to increase the amount of heme oxygenase.
Prody, C A; Zevin-Sonkin, D; Gnatt, A; Goldberg, O; Soreq, H
1987-01-01
To study the primary structure and regulation of human cholinesterases, oligodeoxynucleotide probes were prepared according to a consensus peptide sequence present in the active site of both human serum pseudocholinesterase (BtChoEase; EC 3.1.1.8) and Torpedo electric organ "true" acetylcholinesterase (AcChoEase; EC 3.1.1.7). Using these probes, we isolated several cDNA clones from lambda gt10 libraries of fetal brain and liver origins. These include 2.4-kilobase cDNA clones that code for a polypeptide containing a putative signal peptide and the N-terminal, active site, and C-terminal peptides of human BtChoEase, suggesting that they code either for BtChoEase itself or for a very similar but distinct fetal form of cholinesterase. In RNA blots of poly(A)+ RNA from the cholinesterase-producing fetal brain and liver, these cDNAs hybridized with a single 2.5-kilobase band. Blot hybridization to human genomic DNA revealed that these fetal BtChoEase cDNA clones hybridize with DNA fragments of the total length of 17.5 kilobases, and signal intensities indicated that these sequences are not present in many copies. Both the cDNA-encoded protein and its nucleotide sequence display striking homology to parallel sequences published for Torpedo AcChoEase. These findings demonstrate extensive homologies between the fetal BtChoEase encoded by these clones and other cholinesterases of various forms and species. Images PMID:3035536
DOE Office of Scientific and Technical Information (OSTI.GOV)
Leong, JoAnn Ching
The nucleotide sequence of the IHNV glycoprotein gene has been determined from a cDNA clone containing the entire coding region. The glycoprotein cDNA clone contained a leader sequence of 48 bases, a coding region of 1524 nucleotides, and 39 bases at the 3 foot end. The entire cDNA clone contains 1609 nucleodites and encodes a protein of 508 amino acids. The deduced amino acid sequence gave a translated molecular weight of 56,795 daltons. A hydropathicity profile of the deduced amino acid sequence indicated that there were two major hydrophobic domains: one,at the N-terminus,delineating a signal peptide of 18 amino acidsmore » and the other, at the C-terminus,delineating the region of the transmembrane. Five possible sites of N-linked glyscoylation were identified. Although no nucleic acid homology existed between the IHNV glycoprotein gene and the glycoprotein genes of rabies and VSV, there was significant homology at the amino acid level between all three rhabdovirus glycoproteins.« less
Giardina, P; Cannio, R; Martirani, L; Marzullo, L; Palmieri, G; Sannia, G
1995-01-01
The gene (pox1) encoding a phenol oxidase from Pleurotus ostreatus, a lignin-degrading basidiomycete, was cloned and sequenced, and the corresponding pox1 cDNA was also synthesized and sequenced. The isolated gene consists of 2,592 bp, with the coding sequence being interrupted by 19 introns and flanked by an upstream region in which putative CAAT and TATA consensus sequences could be identified at positions -174 and -84, respectively. The isolation of a second cDNA (pox2 cDNA), showing 84% similarity, and of the corresponding truncated genomic clones demonstrated the existence of a multigene family coding for isoforms of laccase in P. ostreatus. PCR amplifications of specific regions on the DNA of isolated monokaryons proved that the two genes are not allelic forms. The POX1 amino acid sequence deduced was compared with those of other known laccases from different fungi. PMID:7793961
Cloning, sequencing, and expression of cDNA for human. beta. -glucuronidase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Oshima, A.; Kyle, J.W.; Miller, R.D.
1987-02-01
The authors report here the cDNA sequence for human placental ..beta..-glucuronidase (..beta..-D-glucuronoside glucuronosohydrolase, EC 3.2.1.31) and demonstrate expression of the human enzyme in transfected COS cells. They also sequenced a partial cDNA clone from human fibroblasts that contained a 153-base-pair deletion within the coding sequence and found a second type of cDNA clone from placenta that contained the same deletion. Nuclease S1 mapping studies demonstrated two types of mRNAs in human placenta that corresponded to the two types of cDNA clones isolated. The NH/sub 2/-terminal amino acid sequence determined for human spleen ..beta..-glucuronidase agreed with that inferred from the DNAmore » sequence of the two placental clones, beginning at amino acid 23, suggesting a cleaved signal sequence of 22 amino acids. When transfected into COS cells, plasmids containing either placental clone expressed an immunoprecipitable protein that contained N-linked oligosaccharides as evidenced by sensitivity to endoglycosidase F. However, only transfection with the clone containing the 153-base-pair segment led to expression of human ..beta..-glucuronidase activity. These studies provide the sequence for the full-length cDNA for human ..beta..-glucuronidase, demonstrate the existence of two populations of mRNA for ..beta..-glucuronidase in human placenta, only one of which specifies a catalytically active enzyme, and illustrate the importance of expression studies in verifying that a cDNA is functionally full-length.« less
Genomic clones for human cholinesterase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kott, M.; Venta, P.J.; Larsen, J.
1987-05-01
A human genomic library was prepared from peripheral white blood cells from a single donor by inserting an MboI partial digest into BamHI poly-linker sites of EMBL3. This library was screened using an oligolabeled human cholinesterase cDNA probe over 700 bp long. The latter probe was obtained from a human basal ganglia cDNA library. Of approximately 2 million clones screened with high stringency conditions several positive clones were identified; two have been plaque purified. One of these clones has been partially mapped using restriction enzymes known to cut within the coded region of the cDNA for human serum cholinesterase. Hybridizationmore » of the fragments and their sizes are as expected if the genomic clone is cholinesterase. Sequencing of the DNA fragments in M13 is in progress to verify the identify of the clone and the location of introns.« less
Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P
1988-02-01
Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators.
Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P
1988-01-01
Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators. Images PMID:3257578
Shafaghat, Farzaneh; Abbasi-Kenarsari, Hajar; Majidi, Jafar; Movassaghpour, Ali Akbar; Shanehbandi, Dariush; Kazemi, Tohid
2015-01-01
Purpose: Transmembrane CD34 glycoprotein is the most important marker for identification, isolation and enumeration of hematopoietic stem cells (HSCs). We aimed in this study to clone the cDNA coding for human CD34 from KG1a cell line and stably express in mouse fibroblast cell line NIH-3T3. Such artificial cell line could be useful as proper immunogen for production of mouse monoclonal antibodies. Methods: CD34 cDNA was cloned from KG1a cell line after total RNA extraction and cDNA synthesis. Pfu DNA polymerase-amplified specific band was ligated to pGEMT-easy TA-cloning vector and sub-cloned in pCMV6-Neo expression vector. After transfection of NIH-3T3 cells using 3 μg of recombinant construct and 6 μl of JetPEI transfection reagent, stable expression was obtained by selection of cells by G418 antibiotic and confirmed by surface flow cytometry. Results: 1158 bp specific band was aligned completely to reference sequence in NCBI database corresponding to long isoform of human CD34. Transient and stable expression of human CD34 on transfected NIH-3T3 mouse fibroblast cells was achieved (25% and 95%, respectively) as shown by flow cytometry. Conclusion: Cloning and stable expression of human CD34 cDNA was successfully performed and validated by standard flow cytometric analysis. Due to murine origin of NIH-3T3 cell line, CD34-expressing NIH-3T3 cells could be useful as immunogen in production of diagnostic monoclonal antibodies against human CD34. This approach could bypass the need for purification of recombinant proteins produced in eukaryotic expression systems. PMID:25789221
The cDNA-derived amino acid sequence of hemoglobin II from Lucina pectinata.
Torres-Mercado, Elineth; Renta, Jessicca Y; Rodríguez, Yolanda; López-Garriga, Juan; Cadilla, Carmen L
2003-11-01
Hemoglobin II from the clam Lucina pectinata is an oxygen-reactive protein with a unique structural organization in the heme pocket involving residues Gln65 (E7), Tyr30 (B10), Phe44 (CD1), and Phe69 (E11). We employed the reverse transcriptase-polymerase chain reaction (RT-PCR) and methods to synthesize various cDNA(HbII). An initial 300-bp cDNA clone was amplified from total RNA by RT-PCR using degenerate oligonucleotides. Gene-specific primers derived from the HbII-partial cDNA sequence were used to obtain the 5' and 3' ends of the cDNA by RACE. The length of the HbII cDNA, estimated from overlapping clones, was approximately 2114 bases. Northern blot analysis revealed that the mRNA size of HbII agrees with the estimated size using cDNA data. The coding region of the full-length HbII cDNA codes for 151 amino acids. The calculated molecular weight of HbII, including the heme group and acetylated N-terminal residue, is 17,654.07 Da.
Harper, J R; Prince, J T; Healy, P A; Stuart, J K; Nauman, S J; Stallcup, W B
1991-03-01
We have isolated cDNA clones coding for the human homologue of the neuronal cell adhesion molecule L1. The nucleotide sequence of the cDNA clones and the deduced primary amino acid sequence of the carboxy terminal portion of the human L1 are homologous to the corresponding sequences of mouse L1 and rat NILE glycoprotein, with an especially high sequences identity in the cytoplasmic regions of the proteins. There is also protein sequence homology with the cytoplasmic region of the Drosophila cell adhesion molecule, neuroglian. The conservation of the cytoplasmic domain argues for an important functional role for this portion of the molecule.
Simon, J W; Slabas, A R
1998-09-18
The GenBank database was searched using the E. coli malonyl CoA:ACP transacylase (MCAT) sequence, for plant protein/cDNA sequences corresponding to MCAT, a component of plant fatty acid synthetase (FAS), for which the plant cDNA has not been isolated. A 272-bp Zea mays EST sequence (GenBank accession number: AA030706) was identified which has strong homology to the E. coli MCAT. A PCR derived cDNA probe from Zea mays was used to screen a Brassica napus (rape) cDNA library. This resulted in the isolation of a 1200-bp cDNA clone which encodes an open reading frame corresponding to a protein of 351 amino acids. The protein shows 47% homology to the E. coli MCAT amino acid sequence in the coding region for the mature protein. Expression of a plasmid (pMCATrap2) containing the plant cDNA sequence in Fab D89, an E. coli mutant, in MCAT activity restores growth demonstrating functional complementation and direct function of the cloned cDNA. This is the first functional evidence supporting the identification of a plant cDNA for MCAT.
Molecular cloning of chitinase 33 (chit33) gene from Trichoderma atroviride
Matroudi, S.; Zamani, M.R.; Motallebi, M.
2008-01-01
In this study Trichoderma atroviride was selected as over producer of chitinase enzyme among 30 different isolates of Trichoderma sp. on the basis of chitinase specific activity. From this isolate the genomic and cDNA clones encoding chit33 have been isolated and sequenced. Comparison of genomic and cDNA sequences for defining gene structure indicates that this gene contains three short introns and also an open reading frame coding for a protein of 321 amino acids. The deduced amino acid sequence includes a 19 aa putative signal peptide. Homology between this sequence and other reported Trichoderma Chit33 proteins are discussed. The coding sequence of chit33 gene was cloned in pEt26b(+) expression vector and expressed in E. coli. PMID:24031242
DeWitt, D L; Smith, W L
1988-01-01
Prostaglandin G/H synthase (8,11,14-icosatrienoate, hydrogen-donor:oxygen oxidoreductase, EC 1.14.99.1) catalyzes the first step in the formation of prostaglandins and thromboxanes, the conversion of arachidonic acid to prostaglandin endoperoxides G and H. This enzyme is the site of action of nonsteroidal anti-inflammatory drugs. We have isolated a 2.7-kilobase complementary DNA (cDNA) encompassing the entire coding region of prostaglandin G/H synthase from sheep vesicular glands. This cDNA, cloned from a lambda gt 10 library prepared from poly(A)+ RNA of vesicular glands, hybridizes with a single 2.75-kilobase mRNA species. The cDNA clone was selected using oligonucleotide probes modeled from amino acid sequences of tryptic peptides prepared from the purified enzyme. The full-length cDNA encodes a protein of 600 amino acids, including a signal sequence of 24 amino acids. Identification of the cDNA as coding for prostaglandin G/H synthase is based on comparison of amino acid sequences of seven peptides comprising 103 amino acids with the amino acid sequence deduced from the nucleotide sequence of the cDNA. The molecular weight of the unglycosylated enzyme lacking the signal peptide is 65,621. The synthase is a glycoprotein, and there are three potential sites for N-glycosylation, two of them in the amino-terminal half of the molecule. The serine reported to be acetylated by aspirin is at position 530, near the carboxyl terminus. There is no significant similarity between the sequence of the synthase and that of any other protein in amino acid or nucleotide sequence libraries, and a heme binding site(s) is not apparent from the amino acid sequence. The availability of a full-length cDNA clone coding for prostaglandin G/H synthase should facilitate studies of the regulation of expression of this enzyme and the structural features important for catalysis and for interaction with anti-inflammatory drugs. Images PMID:3125548
Baxter, Laura L; Hsu, Benjamin J; Umayam, Lowell; Wolfsberg, Tyra G; Larson, Denise M; Frith, Martin C; Kawai, Jun; Hayashizaki, Yoshihide; Carninci, Piero; Pavan, William J
2007-06-01
As part of the RIKEN mouse encyclopedia project, two cDNA libraries were prepared from melanocyte-derived cell lines, using techniques of full-length clone selection and subtraction/normalization to enrich for rare transcripts. End sequencing showed that these libraries display over 83% complete coding sequence at the 5' end and 96-97% complete coding sequence at the 3' end. Evaluation of the libraries, derived from B16F10Y tumor cells and melan-c cells, revealed that they contain clones for a majority of the genes previously demonstrated to function in melanocyte biology. Analysis of genomic locations for transcripts revealed that the distribution of melanocyte genes is non-random throughout the genome. Three genomic regions identified that showed significant clustering of melanocyte-expressed genes contain one or more genes previously shown to regulate melanocyte development or function. A catalog of genes expressed in these libraries is presented, providing a valuable resource of cDNA clones and sequence information that can be used for identification of new genes important for melanocyte development, function, and disease.
de Oliveira, Ursula Castro; Assui, Alessandra; da Silva, Alvaro Rossan de Brandão Prieto; de Oliveira, Jane Silveira; Ho, Paulo Lee
2003-09-01
During the cloning of abundant cDNAs expressed in the Micrurus corallinus coral snake venom gland, several putative toxins, including a phospholipase A2 homologue cDNA (clone V2), were identified. The V2 cDNA clone codes for a potential coral snake toxin with a signal peptide of 27 amino acid residues plus a predicted mature protein with 119 amino acid residues. The deduced protein is highly similar to known phospholipases A2, with seven deduced S-S bridges at the same conserved positions. This protein was expressed in Escherichia coli as a His-tagged protein that allowed the rapid purification of the recombinant protein. This protein was used to generate antibodies, which recognized the recombinant protein in Western blot. This antiserum was used to screen a large number of venoms, showing a ubiquitous distribution of immunorelated proteins in all elapidic venoms but not in the viperidic Bothrops jararaca venom. This is the first description of a complete primary structure of a phospholipase A2 homologue deduced by cDNA cloning from a coral snake.
Cloning and sequence analysis of a cDNA clone coding for the mouse GM2 activator protein.
Bellachioma, G; Stirling, J L; Orlacchio, A; Beccari, T
1993-01-01
A cDNA (1.1 kb) containing the complete coding sequence for the mouse GM2 activator protein was isolated from a mouse macrophage library using a cDNA for the human protein as a probe. There was a single ATG located 12 bp from the 5' end of the cDNA clone followed by an open reading frame of 579 bp. Northern blot analysis of mouse macrophage RNA showed that there was a single band with a mobility corresponding to a size of 2.3 kb. We deduce from this that the mouse mRNA, in common with the mRNA for the human GM2 activator protein, has a long 3' untranslated sequence of approx. 1.7 kb. Alignment of the mouse and human deduced amino acid sequences showed 68% identity overall and 75% identity for the sequence on the C-terminal side of the first 31 residues, which in the human GM2 activator protein contains the signal peptide. Hydropathicity plots showed great similarity between the mouse and human sequences even in regions of low sequence similarity. There is a single N-glycosylation site in the mouse GM2 activator protein sequence (Asn151-Phe-Thr) which differs in its location from the single site reported in the human GM2 activator protein sequence (Asn63-Val-Thr). Images Figure 1 PMID:7689829
Deyashiki, Y; Ogasawara, A; Nakayama, T; Nakanishi, M; Miyabe, Y; Sato, K; Hara, A
1994-01-01
Human liver contains two dihydrodiol dehydrogenases, DD2 and DD4, associated with 3 alpha-hydroxysteroid dehydrogenase activity. We have raised polyclonal antibodies that cross-reacted with the two enzymes and isolated two 1.2 kb cDNA clones (C9 and C11) for the two enzymes from a human liver cDNA library using the antibodies. The clones of C9 and C11 contained coding sequences corresponding to 306 and 321 amino acid residues respectively, but lacked 5'-coding regions around the initiation codon. Sequence analyses of several peptides obtained by enzymic and chemical cleavages of the two purified enzymes verified that the C9 and C11 clones encoded DD2 and DD4 respectively, and further indicated that the sequence of DD2 had at least additional 16 residues upward from the N-terminal sequence deduced from the cDNA. There was 82% amino acid sequence identity between the two enzymes, indicating that the enzymes are genetic isoenzymes. A computer-based comparison of the cDNAs of the isoenzymes with the DNA sequence database revealed that the nucleotide and amino acid sequences of DD2 and DD4 are virtually identical with those of human bile-acid binder and human chlordecone reductase cDNAs respectively. Images Figure 1 PMID:8172617
Seto, P; Hirayu, H; Magnusson, R P; Gestautas, J; Portmann, L; DeGroot, L J; Rapoport, B
1987-01-01
The thyroid microsomal antigen (MSA) in autoimmune thyroid disease is a protein of approximately 107 kD. We screened a human thyroid cDNA library constructed in the expression vector lambda gt11 with anti-107-kD monoclonal antibodies. Of five clones obtained, the recombinant beta-galactosidase fusion protein from one clone (PM-5) was confirmed to react with the monoclonal antiserum. The complementary DNA (cDNA) insert from PM-5 (0.8 kb) was used as a probe on Northern blot analysis to estimate the size of the mRNA coding for the MSA. The 2.9-kb messenger RNA (mRNA) species observed was the same size as that coding for human thyroid peroxidase (TPO). The probe did not bind to human liver mRNA, indicating the thyroid-specific nature of the PM-5-related mRNA. The nucleotide sequence of PM-5 (842 bp) was determined and consisted of a single open reading frame. Comparison of the nucleotide sequence of PM-5 with that presently available for pig TPO indicates 84% homology. In conclusion, a cDNA clone representing part of the microsomal antigen has been isolated. Sequence homology with porcine TPO, as well as identity in the size of the mRNA species for both the microsomal antigen and TPO, indicate that the microsomal antigen is, at least in part, TPO. Images PMID:3654979
Cloning and expression of cDNA coding for bouganin.
den Hartog, Marcel T; Lubelli, Chiara; Boon, Louis; Heerkens, Sijmie; Ortiz Buijsse, Antonio P; de Boer, Mark; Stirpe, Fiorenzo
2002-03-01
Bouganin is a ribosome-inactivating protein that recently was isolated from Bougainvillea spectabilis Willd. In this work, the cloning and expression of the cDNA encoding for bouganin is described. From the cDNA, the amino-acid sequence was deduced, which correlated with the primary sequence data obtained by amino-acid sequencing on the native protein. Bouganin is synthesized as a pro-peptide consisting of 305 amino acids, the first 26 of which act as a leader signal while the 29 C-terminal amino acids are cleaved during processing of the molecule. The mature protein consists of 250 amino acids. Using the cDNA sequence encoding the mature protein of 250 amino acids, a recombinant protein was expressed, purified and characterized. The recombinant molecule had similar activity in a cell-free protein synthesis assay and had comparable toxicity on living cells as compared to the isolated native bouganin.
Nakajima, K; Hashimoto, T; Yamada, Y
1993-01-01
In the biosynthetic pathway of tropane alkaloids, tropinone reductase (EC 1.1.1.236) (TR)-I and TR-II, respectively, reduce a common substrate, tropinone, stereospecifically to the stereoisomeric alkamines tropine and pseudotropine (psi-tropine). cDNA clones coding for TR-I and TR-II, as well as a structurally related cDNA clone with an unknown function, were isolated from the solanaceous plant Datura stramonium. The cDNA clones for TR-I and TR-II encode polypeptides containing 273 and 260 amino acids, respectively, and when these clones were expressed in Escherichia coli, the recombinant TRs showed the same strict stereospecificity as that observed for the native TRs that had been isolated from plants. The deduced amino acid sequences of the two clones showed an overall identity of 64% in 260-amino acid residues and also shared significant similarities with enzymes in the short-chain, nonmetal dehydrogenase family. Genomic DNA-blot analysis detected the TR-encoding genes in three tropane alkaloid-producing solanaceous species but did not detect them in tobacco. We discuss how the two TRs may have evolved to catalyze the opposite stereospecific reductions. Images Fig. 4 Fig. 5 PMID:8415746
Human somatostatin I: sequence of the cDNA.
Shen, L P; Pictet, R L; Rutter, W J
1982-01-01
RNA has been isolated from a human pancreatic somatostatinoma and used to prepare a cDNA library. After prescreening, clones containing somatostatin I sequences were identified by hybridization with an anglerfish somatostatin I-cloned cDNA probe. From the nucleotide sequence of two of these clones, we have deduced an essentially full-length mRNA sequence, including the preprosomatostatin coding region, 105 nucleotides from the 5' untranslated region and the complete 150-nucleotide 3' untranslated region. The coding region predicts a 116-amino acid precursor protein (Mr, 12.727) that contains somatostatin-14 and -28 at its COOH terminus. The predicted amino acid sequence of human somatostatin-28 is identical to that of somatostatin-28 isolated from the porcine and ovine species. A comparison of the amino acid sequences of human and anglerfish preprosomatostatin I indicated that the COOH-terminal region encoding somatostatin-14 and the adjacent 6 amino acids are highly conserved, whereas the remainder of the molecule, including the signal peptide region, is more divergent. However, many of the amino acid differences found in the pro region of the human and anglerfish proteins are conservative changes. This suggests that the propeptides have a similar secondary structure, which in turn may imply a biological function for this region of the molecule. Images PMID:6126875
Cioffi, Anna Valentina; Ferrara, Diana; Cubellis, Maria Vittoria; Aniello, Francesco; Corrado, Marcella; Liguori, Francesca; Amoroso, Alessandro; Fucci, Laura; Branno, Margherita
2002-08-01
Analysis of the genome structure of the Paracentrotus lividus (sea urchin) DNA methyltransferase (DNA MTase) gene showed the presence of an open reading frame, named METEX, in intron 7 of the gene. METEX expression is developmentally regulated, showing no correlation with DNA MTase expression. In fact, DNA MTase transcripts are present at high concentrations in the early developmental stages, while METEX is expressed at late stages of development. Two METEX cDNA clones (Met1 and Met2) that are different in the 3' end have been isolated in a cDNA library screening. The putative translated protein from Met2 cDNA clone showed similarity with Escherichia coli endonuclease III on the basis of sequence and predictive three-dimensional structure. The protein, overexpressed in E. coli and purified, had functional properties similar to the endonuclease specific for apurinic/apyrimidinic (AP) sites on the basis of the lyase activity. Therefore the open reading frame, present in intron 7 of the P. lividus DNA MTase gene, codes for a functional AP endonuclease designated SuAP1.
Bozzoni, I; Beccari, E; Luo, Z X; Amaldi, F
1981-01-01
Poly-A+ mRNA from Xenopus laevis oocytes, partially enriched for r-protein coding capacity has been used as starting material for preparing a cDNA bank in plasmid pBR322. The clones containing sequences specific for r-proteins have been selected by translation of the complementary mRNAs. Clones for six different r-proteins have been identified and utilized as probes for studying their genomic organization. Two gene copies per haploid genome were found for r-proteins L1, L14, S19, and four-five for protein S1, S8 and L32. Moreover a population polymorphism has been observed for the genomic regions containing sequences for r-protein S1, S8 and L14. Images PMID:6112733
[Cloning of human CD45 gene and its expression in Hela cells].
Li, Jie; Xu, Tianyu; Wu, Lulin; Zhang, Liyun; Lu, Xiao; Zuo, Daming; Chen, Zhengliang
2015-11-01
To clone human CD45 gene PTPRC and establish Hela cells overexpressing recombinant human CD45 protein. The intact cDNA encoding human CD45 amplified using RT-PCR from the total RNA extracted from peripheral blood mononuclear cells (PBMCs) of a healthy donor was cloned into pMD-18T vector. The CD45 cDNA fragment amplified from the pMD-18T-CD45 by PCR was inserted to the coding region of the PcDNA3.1-3xflag vector, and the resultant recombinant expression vector PcDNA3.1-3xflag-CD45 was transfected into Hela cells. The expression of CD45 in Hela cells was detected by flow cytometry and Western blotting, and the phosphastase activity of CD45 was quantified using an alkaline phosphatase assay kit. The cDNA fragment of about 3 900 bp was amplified from human PBMCs and cloned into pMD-18T vector. The recombinant expression vector PcDNA3.1-3xflag-CD45 was constructed, whose restriction maps and sequence were consistent with those expected. The expression of CD45 in transfected Hela cells was detected by flow cytometry and Western blotting, and the expressed recombinant CD45 protein in Hela cells showed a phosphastase activity. The cDNA of human CD45 was successfully cloned and effectively expressed in Hela cells, which provides a basis for further exploration of the functions of CD45.
Réfega, Susana; Girard-Misguich, Fabienne; Bourdieu, Christiane; Péry, Pierre; Labbé, Marie
2003-04-02
Specific antibodies were produced ex vivo from intestinal culture of Eimeria tenella infected chickens. The specificity of these intestinal antibodies was tested against different parasite stages. These antibodies were used to immunoscreen first generation schizont and sporozoite cDNA libraries permitting the identification of new E. tenella antigens. We obtained a total of 119 cDNA clones which were subjected to sequence analysis. The sequences coding for the proteins inducing local immune responses were compared with nucleotide or protein databases and with expressed sequence tags (ESTs) databases. We identified new Eimeria genes coding for heat shock proteins, a ribosomal protein, a pyruvate kinase and a pyridoxine kinase. Specific features of other sequences are discussed.
NASA Technical Reports Server (NTRS)
Reddy, A. S.; Czernik, A. J.; An, G.; Poovaiah, B. W.
1992-01-01
We cloned and sequenced a plant cDNA that encodes U1 small nuclear ribonucleoprotein (snRNP) 70K protein. The plant U1 snRNP 70K protein cDNA is not full length and lacks the coding region for 68 amino acids in the amino-terminal region as compared to human U1 snRNP 70K protein. Comparison of the deduced amino acid sequence of the plant U1 snRNP 70K protein with the amino acid sequence of animal and yeast U1 snRNP 70K protein showed a high degree of homology. The plant U1 snRNP 70K protein is more closely related to the human counter part than to the yeast 70K protein. The carboxy-terminal half is less well conserved but, like the vertebrate 70K proteins, is rich in charged amino acids. Northern analysis with the RNA isolated from different parts of the plant indicates that the snRNP 70K gene is expressed in all of the parts tested. Southern blotting of genomic DNA using the cDNA indicates that the U1 snRNP 70K protein is coded by a single gene.
Cloning and High-Level Expression of α-Galactosidase cDNA from Penicillium purpurogenum
Shibuya, Hajime; Nagasaki, Hiroaki; Kaneko, Satoshi; Yoshida, Shigeki; Park, Gwi Gun; Kusakabe, Isao; Kobayashi, Hideyuki
1998-01-01
The cDNA coding for Penicillium purpurogenum α-galactosidase (αGal) was cloned and sequenced. The deduced amino acid sequence of the α-Gal cDNA showed that the mature enzyme consisted of 419 amino acid residues with a molecular mass of 46,334 Da. The derived amino acid sequence of the enzyme showed similarity to eukaryotic αGals from plants, animals, yeasts, and filamentous fungi. The highest similarity observed (57% identity) was to Trichoderma reesei AGLI. The cDNA was expressed in Saccharomyces cerevisiae under the control of the yeast GAL10 promoter. Almost all of the enzyme produced was secreted into the culture medium, and the expression level reached was approximately 0.2 g/liter. The recombinant enzyme purified to homogeneity was highly glycosylated, showed slightly higher specific activity, and exhibited properties almost identical to those of the native enzyme from P. purpurogenum in terms of the N-terminal amino acid sequence, thermoactivity, pH profile, and mode of action on galacto-oligosaccharides. PMID:9797312
Cloning and sequence analysis of Hemonchus contortus HC58cDNA.
Muleke, Charles I; Ruofeng, Yan; Lixin, Xu; Xinwen, Bo; Xiangrui, Li
2007-06-01
The complete coding sequence of Hemonchus contortus HC58cDNA was generated by rapid amplification of cDNA ends and polymerase chain reaction using primers based on the 5' and 3' ends of the parasite mRNA, accession no. AF305964. The HC58cDNA gene was 851 bp long, with open reading frame of 717 bp, precursors to 239 amino acids coding for approximately 27 kDa protein. Analysis of amino acid sequence revealed conserved residues of cysteine, histidine, asparagine, occluding loop pattern, hemoglobinase motif and glutamine of the oxyanion hole characteristic of cathepsin B like proteases (CBL). Comparison of the predicted amino acid sequences showed the protein shared 33.5-58.7% identity to cathepsin B homologues in the papain clan CA family (family C1). Phylogenetic analysis revealed close evolutionary proximity of the protein sequence to counterpart sequences in the CBL, suggesting that HC58cDNA was a member of the papain family.
FragIdent--automatic identification and characterisation of cDNA-fragments.
Seelow, Dominik; Goehler, Heike; Hoffmann, Katrin
2009-03-02
Many genetic studies and functional assays are based on cDNA fragments. After the generation of cDNA fragments from an mRNA sample, their content is at first unknown and must be assigned by sequencing reactions or hybridisation experiments. Even in characterised libraries, a considerable number of clones are wrongly annotated. Furthermore, mix-ups can happen in the laboratory. It is therefore essential to the relevance of experimental results to confirm or determine the identity of the employed cDNA fragments. However, the manual approach for the characterisation of these fragments using BLAST web interfaces is not suited for larger number of sequences and so far, no user-friendly software is publicly available. Here we present the development of FragIdent, an application for the automatic identification of open reading frames (ORFs) within cDNA-fragments. The software performs BLAST analyses to identify the genes represented by the sequences and suggests primers to complete the sequencing of the whole insert. Gene-specific information as well as the protein domains encoded by the cDNA fragment are retrieved from Internet-based databases and included in the output. The application features an intuitive graphical interface and is designed for researchers without any bioinformatics skills. It is suited for projects comprising up to several hundred different clones. We used FragIdent to identify 84 cDNA clones from a yeast two-hybrid experiment. Furthermore, we identified 131 protein domains within our analysed clones. The source code is freely available from our homepage at http://compbio.charite.de/genetik/FragIdent/.
Xu, Y L; Li, L; Wu, K; Peeters, A J; Gage, D A; Zeevaart, J A
1995-07-03
The biosynthesis of gibberellins (GAs) after GA12-aldehyde involves a series of oxidative steps that lead to the formation of bioactive GAs. Previously, a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing), EC 1.14.11.-] was isolated by immunoscreening a cDNA library from liquid endosperm of pumpkin (Cucurbita maxima L.) with antibodies against partially purified GA 20-oxidase. Here, we report isolation of a genomic clone for GA 20-oxidase from a genomic library of the long-day species Arabidopsis thaliana Heynh., strain Columbia, by using the pumpkin cDNA clone as a heterologous probe. This genomic clone contains a GA 20-oxidase gene that consists of three exons and two introns. The three exons are 1131-bp long and encode 377 amino acid residues. A cDNA clone corresponding to the putative GA 20-oxidase genomic sequence was constructed with the reverse transcription-PCR method, and the identity of the cDNA clone was confirmed by analyzing the capability of the fusion protein expressed in Escherichia coli to convert GA53 to GA44 and GA19 to GA20. The Arabidopsis GA 20-oxidase shares 55% identity and > 80% similarity with the pumpkin GA 20-oxidase at the derived amino acid level. Both GA 20-oxidases share high homology with other 2-oxoglutarate-dependent dioxygenases (2-ODDs), but the highest homology was found between the two GA 20-oxidases. Mapping results indicated tight linkage between the cloned GA 20-oxidase and the GA5 locus of Arabidopsis. The ga5 semidwarf mutant contains a G-->A point mutation that inserts a translational stop codon in the protein-coding sequence, thus confirming that the GA5 locus encodes GA 20-oxidase. Expression of the GA5 gene in Ara-bidopsis leaves was enhanced after plants were transferred from short to long days; it was reduced by GA4 treatment, suggesting end-product repression in the GA biosynthetic pathway.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xu, Yun-Ling; Li, Li; Wu, Keqiang
1995-07-03
The biosynthesis of gibberellins (GAs) after GA{sub 12}-aldehyde involves a series of oxidative steps that lead to the formation of bioactive GAs. Previously, a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing), EC 1.14.11-] was isolated by immunoscreening a cDNA library from liquid endosperm of pumpkin (Cucurbita maxima L.) with antibodies against partially purified GA 20-oxidase. Here, we report isolation of a genomic clone for GA 20-oxidase from a genomic library of the long-day species Arabidopsis thaliana Heynh., strain Columbia, by using the pumpkin cDNA clone as a heterologous probe. This genomic clone contains a GA 20-oxidasemore » gene that consists of three exons and two introns. The three exons are 1131-bp long and encode 377 amino acid residues. A cDNA clone corresponding to the putative GA 20-oxidase genomic sequence was constructed with the reverse transcription-PCR method, and the identity of the cDNA clone was confirmed by analyzing the capability of the fusion protein expressed in Escherichia coli to convert GA{sub 53} to GA{sub 44} and GA{sub 19} to GA{sub 20}. The Arabidopsis GA 20-oxidase shares 55% identity and >80% similarity with the pumpkin GA 20-oxidase at the derived amino acid level. Both GA 20-oxidases share high homology with other 2-oxoglutarate-dependent dioxygenases (2-ODDs), but the highest homology was found between the two GA 20-oxidases. Mapping results indicated tight linkage between the cloned GA 20-oxidase and the GA locus of Arabidopsis. The ga5 semidwarf mutant contains a G {yields} A point mutation that inserts a translational stop codon in the protein-coding sequence, thus confirming that the GA5 locus encodes GA 20-oxidase. Expression of the GA5 gene in Arabidopsis leaves was enhanced after plants were transferred from short to long days; it was reduced by GA{sub 4} treatment, suggesting end-product repression in the GA biosynthetic pathway. 28 refs., 6 figs.« less
Husain, S M; Shou, Y; Sorrentino, B P; Handgretinger, R
2006-10-01
Human prominin-1 (CD133 or AC133) is an important cell surface marker used to isolate primitive hematopoietic stem cells. The commercially available antibody to human prominin-1 does not recognize rhesus prominin-1. Therefore, we isolated, cloned and characterized the complementary DNA (cDNA) of rhesus prominin-1 gene and determined its coding potential. Following the nomenclature of prominin family of genes, we named this cDNA as rhesus prominin-1.s1. The amino acid sequence data of the putative rhesus prominin-1.s1 could be used in designing antigenic peptides to raise antibodies for use in isolation of pure populations of rhesus prominin-1(+) hematopoietic cells. To the best of our knowledge, there has been no previously published report about the isolation of a prominin-1 cDNA from rhesus monkey (Macaca mulatta).
Abdallah, M A; Pollenz, R S; Droog, F N; Nunamaker, R A; Tabachnick, W J; Murphy, K E
2000-12-01
Culicoides variipennis sonorensis is the primary vector of bluetongue viruses in North America. Glutathione S-transferases (GSTs) are enzymes that catalyze nucleophilic substitutions, converting reactive lipophilic molecules into soluble conjugates. Increased GST activity is associated with development of insecticide resistance. Described here is the isolation of the first cDNA encoding a C. variipennis GST. The clone consists of 720 translated bases encoding a protein with a M(r) of approximately 24,800 composed of 219 amino acids. The deduced amino acid sequence is similar (64%-74%) to class Delta (previously named Theta) GSTs from the dipteran genera Musca, Drosophila, Lucilia and Anopheles. The cDNA was subcloned into pET-11b, expressed in Epicurian coli BL21 (DE3) and has a specific activity of approximately 28,000 units/mg for the substrate 1-chloro-2,4-dinitrobenzene.
Muldoon, L. L.; Neuwelt, E. A.; Pagel, M. A.; Weiss, D. L.
1994-01-01
The Korat cat provides an animal model for type II GM2-gangliosidosis (Sandhoff disease) that may be suitable for tests of gene replacement therapy with the HEXB gene encoding the beta subunit of the beta-hexosaminidases. In the present report, we examined the brain and liver pathology of a typical Sandhoff-affected cat. We characterized the feline HEXB complementary DNA (cDNA) and determined the molecular defect in this feline model. cDNA libraries were produced from one normal and one affected animal, and cDNA clones homologous to human HEXB were sequenced. In the affected cDNA clone, the deletion of a cytosine residue at position +39 of the putative coding region results in a frame shift and a stop codon at base +191. This disease-related deletion was consistently detected by sequencing of cloned polymerase chain reaction amplified reverse transcribed messenger RNA from one more normal Korat and two additional affected animals. The defect was further demonstrated using single-strand conformational polymorphism analysis of the polymerase chain reaction products. In addition, alternative splicing of both normal and affected messenger RNAs was demonstrated. These results should facilitate the use of this animal model to assess gene therapy. Images Figure 1 Figure 3 Figure 4 Figure 5 PMID:8178934
Muldoon, L L; Neuwelt, E A; Pagel, M A; Weiss, D L
1994-05-01
The Korat cat provides an animal model for type II GM2-gangliosidosis (Sandhoff disease) that may be suitable for tests of gene replacement therapy with the HEXB gene encoding the beta subunit of the beta-hexosaminidases. In the present report, we examined the brain and liver pathology of a typical Sandhoff-affected cat. We characterized the feline HEXB complementary DNA (cDNA) and determined the molecular defect in this feline model. cDNA libraries were produced from one normal and one affected animal, and cDNA clones homologous to human HEXB were sequenced. In the affected cDNA clone, the deletion of a cytosine residue at position +39 of the putative coding region results in a frame shift and a stop codon at base +191. This disease-related deletion was consistently detected by sequencing of cloned polymerase chain reaction amplified reverse transcribed messenger RNA from one more normal Korat and two additional affected animals. The defect was further demonstrated using single-strand conformational polymorphism analysis of the polymerase chain reaction products. In addition, alternative splicing of both normal and affected messenger RNAs was demonstrated. These results should facilitate the use of this animal model to assess gene therapy.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Livi, G.P.; McHale, M.J.; Sathe, G.M.
1990-06-01
The authors have isolated cDNA clones representing cyclic AMP (cAMP)-specific phosphodiesterases (PDEases) from a human monocyte cDNA library. One cDNA clone (hPDE-1) defines a large open reading frame of ca. 2.1 kilobases, predicting a 686-amino-acid, ca. 77-kilodalton protein which contains significant homology to both rat brain and {ital Drosophila} cAMP PDEases, especially within an internal conserved domain of ca. 270 residues. Amino acid sequence divergence exists at the NH{sub 2} terminus and also within a 40- to 100-residue domain near the COOH-terminal end. hPDE-1 hybridizes to a major 4.8-kilobase mRNA transcript from both human monocytes and placenta. The coding regionmore » of hPDE-1 was engineered for expression in COS-1 cells, resulting in the overproduction of cAMP PDEase activity. The hPDE-1 recombinant gene product was identified as a low-{ital K{sub m}} cAMP phosphodiesterase on the basis of several biochemical properties including selective inhibition by the antidepressant drug rolipram. Known inhibitors of other PDEases (cGMP-specific PDEase, cGMP-inhibited PDEase) had little or no effect on the hPDE-1 recombinant gene product.« less
USDA-ARS?s Scientific Manuscript database
Codon bias deoptimization has been previously used to successfully attenuate human pathogens including polio, respiratory syncytial and influenza viruses. We have applied a similar technology to deoptimize the capsid coding region (P1 region) of the cDNA infectious clone of foot-and-mouth disease vi...
Phaneuf, D; Labelle, Y; Bérubé, D; Arden, K; Cavenee, W; Gagné, R; Tanguay, R M
1991-01-01
Type 1 hereditary tyrosinemia (HT) is an autosomal recessive disease characterized by a deficiency of the enzyme fumarylacetoacetate hydrolase (FAH; E.C.3.7.1.2). We have isolated human FAH cDNA clones by screening a liver cDNA expression library using specific antibodies and plaque hybridization with a rat FAH cDNA probe. A 1,477-bp cDNA was sequenced and shown to code for FAH by an in vitro transcription-translation assay and sequence homology with tryptic fragments of purified FAH. Transient expression of this FAH cDNA in transfected CV-1 mammalian cells resulted in the synthesis of an immunoreactive protein comigrating with purified human liver FAH on SDS-PAGE and having enzymatic activity as shown by the hydrolysis of the natural substrate fumarylacetoacetate. This indicates that the single polypeptide chain encoded by the FAH gene contains all the genetic information required for functional activity, suggesting that the dimer found in vivo is a homodimer. The human FAH cDNA was used as a probe to determine the gene's chromosomal localization using somatic cell hybrids and in situ hybridization. The human FAH gene maps to the long arm of chromosome 15 in the region q23-q25. Images Figure 1 Figure 3 Figure 4 Figure 6 Figure 8 PMID:1998338
Ross, G S; Wegrzyn, T; MacRae, E A; Redgwell, R J
1994-01-01
A beta-galactosidase was purified from cortical tissue of ripe apples (Malus domestica Borkh. cv Granny Smith) using a procedure involving affinity chromatography on lactosyl-Sepharose. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis indicated that two polypeptides of 44 and 32 kD were present in the fraction that showed activity against the synthetic substrate p-nitrophenol-beta-D-galactopyranoside. The enzyme preparation was incubated with polysaccharide extracts from apple cell walls containing beta-(1-->4)-linked galactans, and products of digestion were analyzed by gas chromatography. Small amounts of monomeric galactose were released during incubation, showing that the enzyme was active against native substrates. Amino acid sequence information was obtained from the purified protein, and this showed high homology with the anticipated polypeptide coded by the ethylene-regulated SR12 gene in carnation (K.G. Raghothama, K.A. Lawton, P.B. Goldborough, W.R. Woodson [1991] Plant Mol Biol 17: 61-71) and a harvest-related pTIP31 cDNA from asparagus (G. King, personal communication). Using the asparagus cDNA clone as a probe, an apple homolog (pABG1) was isolated. This clone contains a 2637-bp insert, including an open reading frame that codes for a polypeptide of 731 amino acids. Cleavage of an N-terminal signal sequence would leave a predicted polypeptide of 78.5 kD. Genomic DNA analysis and the isolation of other homologous apple clones suggest that pABG1 represents one member of an apple beta-galactosidase gene family. Northern analysis during fruit development and ripening showed accumulation of pABG1-homologous RNA during fruit ripening. Enzyme activity as measured in crude extracts increased during fruit development to a level that was maintained during ripening. PMID:7991682
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wilkins, T.A.
1993-06-01
This study investigates the molecular events of vacuole ontogeny in rapidly elongated cotton plant cells. Within the DNA coding region, the cotton and carrot cDNA clones exhibit 82.2% nucleotide sequence homology; at the amino acid level cotton and carrot catalytic subunits exhibited 95.7% identity and 2.1% amino acid similarity. When aligned with the analogous sequences from yeast, the cotton protein shared only 60.5% amino acid identity and 12.7% similarity. 10 refs., 1 tab.
Characterization of embryo-specific genes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Not Available
1989-01-01
The objective of the proposed research is to characterize the structure and function of a set of genes whose expression is regulated in embryo development, and that is not expressed in mature tissues -- the embryonic genes. In the last two years, using cDNA clones, we have isolated 22 cDNA clones, and characterized the expression pattern of their corresponding RNA. At least 4 cDNA clones detect RNAs of embryonic genes. These cDNA clones detect RNAs expressed in somatic as well as zygotic embryos of carrot. Using the cDNA clones, we screened the genomic library of carrot embryo DNA, and isolatedmore » genomic clones for three genes. The structure and function of two genes DC 8 and DC 59 have been characterized and are reported in this paper.« less
Isolation and characterization of cDNA clones for carrot extensin and a proline-rich 33-kDa protein
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chen, J.; Varner, J.E.
1985-07-01
Extensins are hydroxyproline-rich glycoproteins associated with most dicotyledonous plant cell walls. To isolate cDNA clones encoding extensin, the authors started by isolating poly(A) RNA from carrot root tissue, and then translating the RNA in vitro, in the presence of tritiated leucine or proline. A 33-kDa peptide was identified in the translation products as a putative extensin precursor. From a cDNA library constructed with poly(A) RNA from wounded carrots, one cDNA clone (pDC5) was identified that specifically hybridized to poly(A) RNA encoding this 33-kDa peptide. They isolated three cDNA clones (pDC11, pDC12, and pDC16) from another cDNA library using pCD5 asmore » a probe. DNA sequence data, RNA hybridization analysis, and hybrid released in vitro translation indicate that the cDNA clones pDC11 encodes extensin and that cDNA clones pDC12 and pDC16 encode the 33-kDa peptide, which as yet has an unknown identity and function. The assumption that the 33-kDa peptide was an extensin precursor was invalid. RNA hybridization analysis showed that RNA encoded by both clone types is accumulated upon wounding.« less
Freije, J M; Díez-Itza, I; Balbín, M; Sánchez, L M; Blasco, R; Tolivia, J; López-Otín, C
1994-06-17
A cDNA coding for a new human matrix metalloproteinase (MMP) has been cloned from a cDNA library derived from a breast tumor. The isolated cDNA contains an open reading frame coding for a polypeptide of 471 amino acids. The predicted protein sequence displays extensive similarity to the previously known MMPs and presents all the structural features characteristic of the members of this protein family, including the well conserved PRCGXPD motif, involved in the latency of the enzyme and the zinc-binding domain (HEXGHXXXXXHS). In addition, this novel human MMP contains in its amino acid sequence several residues specific to the collagenase subfamily (Tyr-214, Asp-235, and Gly-237) and lacks the 9-residue insertion present in the stromelysins. According to these structural characteristics, the MMP described herein has been tentatively called collagenase-3, since it represents the third member of this subfamily, composed at present of fibroblast and neutrophil collagenases. The collagenase-3 cDNA was expressed in a vaccinia virus system, and the recombinant protein was able to degrade fibrillar collagens, providing support to the hypothesis that the isolated cDNA codes for an authentic collagenase. Northern blot analysis of RNA from normal and pathological tissues demonstrated the existence in breast tumors of three different mRNA species, which seem to be the result of the utilization of different polyadenylation sites present in the 3'-noncoding region of the gene. By contrast, no collagenase-3 mRNA was detected either by Northern blot or RNA polymerase chain reaction analysis with RNA from other human tissues, including normal breast, mammary fibroadenomas, liver, placenta, ovary, uterus, prostate, and parotid gland. On the basis of the increased expression of collagenase-3 in breast carcinomas and the absence of detectable expression in normal tissues, a possible role for this metalloproteinase in the tumoral process is proposed.
Pollier, Jacob; González-Guzmán, Miguel; Ardiles-Diaz, Wilson; Geelen, Danny; Goossens, Alain
2011-01-01
cDNA-Amplified Fragment Length Polymorphism (cDNA-AFLP) is a commonly used technique for genome-wide expression analysis that does not require prior sequence knowledge. Typically, quantitative expression data and sequence information are obtained for a large number of differentially expressed gene tags. However, most of the gene tags do not correspond to full-length (FL) coding sequences, which is a prerequisite for subsequent functional analysis. A medium-throughput screening strategy, based on integration of polymerase chain reaction (PCR) and colony hybridization, was developed that allows in parallel screening of a cDNA library for FL clones corresponding to incomplete cDNAs. The method was applied to screen for the FL open reading frames of a selection of 163 cDNA-AFLP tags from three different medicinal plants, leading to the identification of 109 (67%) FL clones. Furthermore, the protocol allows for the use of multiple probes in a single hybridization event, thus significantly increasing the throughput when screening for rare transcripts. The presented strategy offers an efficient method for the conversion of incomplete expressed sequence tags (ESTs), such as cDNA-AFLP tags, to FL-coding sequences.
Morin, Ryan D.; Chang, Elbert; Petrescu, Anca; Liao, Nancy; Griffith, Malachi; Kirkpatrick, Robert; Butterfield, Yaron S.; Young, Alice C.; Stott, Jeffrey; Barber, Sarah; Babakaiff, Ryan; Dickson, Mark C.; Matsuo, Corey; Wong, David; Yang, George S.; Smailus, Duane E.; Wetherby, Keith D.; Kwong, Peggy N.; Grimwood, Jane; Brinkley, Charles P.; Brown-John, Mabel; Reddix-Dugue, Natalie D.; Mayo, Michael; Schmutz, Jeremy; Beland, Jaclyn; Park, Morgan; Gibson, Susan; Olson, Teika; Bouffard, Gerard G.; Tsai, Miranda; Featherstone, Ruth; Chand, Steve; Siddiqui, Asim S.; Jang, Wonhee; Lee, Ed; Klein, Steven L.; Blakesley, Robert W.; Zeeberg, Barry R.; Narasimhan, Sudarshan; Weinstein, John N.; Pennacchio, Christa Prange; Myers, Richard M.; Green, Eric D.; Wagner, Lukas; Gerhard, Daniela S.; Marra, Marco A.; Jones, Steven J.M.; Holt, Robert A.
2006-01-01
Sequencing of full-insert clones from full-length cDNA libraries from both Xenopus laevis and Xenopus tropicalis has been ongoing as part of the Xenopus Gene Collection Initiative. Here we present 10,967 full ORF verified cDNA clones (8049 from X. laevis and 2918 from X. tropicalis) as a community resource. Because the genome of X. laevis, but not X. tropicalis, has undergone allotetraploidization, comparison of coding sequences from these two clawed (pipid) frogs provides a unique angle for exploring the molecular evolution of duplicate genes. Within our clone set, we have identified 445 gene trios, each comprised of an allotetraploidization-derived X. laevis gene pair and their shared X. tropicalis ortholog. Pairwise dN/dS, comparisons within trios show strong evidence for purifying selection acting on all three members. However, dN/dS ratios between X. laevis gene pairs are elevated relative to their X. tropicalis ortholog. This difference is highly significant and indicates an overall relaxation of selective pressures on duplicated gene pairs. We have found that the paralogs that have been lost since the tetraploidization event are enriched for several molecular functions, but have found no such enrichment in the extant paralogs. Approximately 14% of the paralogous pairs analyzed here also show differential expression indicative of subfunctionalization. PMID:16672307
Infectious Maize rayado fino virus from cloned cDNA
USDA-ARS?s Scientific Manuscript database
Maize rayado fino virus (MRFV) is the type member of the marafiviruses within the family Tymoviridae. A cDNA clone from which infectious RNA can be transcribed was produced from a US isolate of MRFV (MRFV-US). Infectivity of transcripts derived from cDNA clones was demonstrated by infection of mai...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Umans, L.; Serneels, L.; Hilliker, C.
1994-08-01
The authors have cloned the mouse gene coding for {alpha}{sub 2}-macroglobulin in overlapping {lambda} clones and have analyzed its structure. The gene contains 36 exons, coding for the 4.8-kb cDNA that we cloned previously. Including putative control elements in the 5{prime} flanking region, the gene covers about 45 kb. A region of 3.8 kb, stretching from 835 bases upstream of the cDNA start site to exon 4, including all intervening sequences, was sequenced completely. The analysis demonstrated that the putative promoter region of the mouse A2M gene differed considerably from the known promoter sequences of the human A2M gene andmore » of the rat acute-phas A2M gene. Comparison of the exon-intron structure of all known genes of the A2M family confirmed that the rat acute phase A2M gene is more closely related to the human gene than to the mouse A2M gene. To generate mice with the A2M gene inactivated, an insertion type of construct containing 7.5 kb of genomic DNA of the mouse strain 129/J, encompassing exons 16 to 19, was synthesized. A hygromycin marker gene was embedded in intron 17. After electroporation, 198 hygromycin-resistant ES cell lines were isolated and analyzed by Southern blotting. Five ES cell lines were obtained with one allele of the mouse A2M gene targeted by this insertion construct, demonstrating that the position and the characteristics of the vector served the intended goal.« less
[Cloning and sequencing of KIR2DL1 framework gene cDNA and identification of a novel allele].
Sun, Ge; Wang, Chang; Zhen, Jianxin; Zhang, Guobin; Xu, Yunping; Deng, Zhihui
2016-10-01
To develop an assay for cDNA cloning and haplotype sequencing of KIR2DL1 framework gene and determine the genotype of an ethnic Han from southern China. Total RNA was isolated from peripheral blood sample, and complementary DNA (cDNA) transcript was synthesized by RT-PCR. The entire coding sequence of the KIR2DL1 framework gene was amplified with a pair of KIR2DL1-specific PCR primers. The PCR products with a length of approximately 1.2 kb were then subjected to cloning and haplotype sequencing. A specific target fragment of the KIR2DL1 framework gene was obtained. Following allele separation, a wild-type KIR2DL1*00302 allele and a novel variant allele, KIR2DL1*031, were identified. Sequence alignment with KIR2DL1 alleles from the IPD-KIR Database showed that the novel allele KIR2DL1*031 has differed from the closest allele KIR2DL1*00302 by a non-synonymous mutation at CDS nt 188A>G (codon 42 GAG>GGG) in exon 4, which has caused an amino acid change Glu42Gly. The sequence of the novel allele KIR2DL1*031 was submitted to GenBank under the accession number KP025960 and to the IPD-KIR Database under the submission number IWS40001982. A name KIR2DL1*031 has been officially assigned by the World Health Organization (WHO) Nomenclature Committee. An assay for cDNA cloning and haplotype sequencing of KIR2DL1 has been established, which has a broad applications in KIR studies at allelic level.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Du, L.; Desbarats, M.; Viel, J.
1996-08-15
The recently identified human PEX g ene apparently encodes for a neutral endopeptidase that is mutated in patients with X-linked hypophosphatemia. The 3{prime} and 5{prime} ends of the coding region of PEX have not been cloned, nor has the tissue expression of the gene been identified. Here we report the isolation and characterization of the complete open reading frame of the mouse Pex gene and the demonstration of its expression in bone. Mouse Pex cDNA is predicted to encode a protein of 749 amino acids with 95% identity to the available human PEX sequence and significant homology to members ofmore » the membrane-bound metalloendopeptidase family. Northern blot analysis revealed a 6.6-kb transcript in bone and in cultured osteoblasts from normal mice that was not detectable in samples from the Hyp mouse, the murine homolog of human X-linked hypophosphatemia. Pex transcripts were, however, detectable in Hyp bone by RT-PCR amplification. Of particular interest, a cDNA clone from rat incisor shows 93% sequence identity to the 5{prime} end of Pex cDNA, suggesting that Pex may be expressed in another calcified tissue, the tooth. The association of impaired mineralization of bone and teeth and disturbed renal phosphate reabsorption with altered expression of Pex suggests that the Pex gene product may play a critical role in these processes. 47 refs., 2 figs., 1 tab.« less
Beccari, T; Hoade, J; Orlacchio, A; Stirling, J L
1992-01-01
cDNAs encoding the mouse beta-N-acetylhexosaminidase alpha-subunit were isolated from a mouse testis library. The longest of these (1.7 kb) was sequenced and showed 83% similarity with the human alpha-subunit cDNA sequence. The 5' end of the coding sequence was obtained from a genomic DNA clone. Alignment of the human and mouse sequences showed that all three putative N-glycosylation sites are conserved, but that the mouse alpha-subunit has an additional site towards the C-terminus. All eight cysteines in the human sequence are conserved in the mouse. There are an additional two cysteines in the mouse alpha-subunit signal peptide. All amino acids affected in Tay-Sachs-disease mutations are conserved in the mouse. Images Fig. 1. PMID:1379046
NASA Astrophysics Data System (ADS)
Sun, S. M.; Slightom, J. L.; Hall, T. C.
1981-01-01
A plant gene coding for the major storage protein (phaseolin, G1-globulin) of the French bean was isolated from a genomic library constructed in the phage vector Charon 24A. Comparison of the nucleotide sequence of part of the gene with that of the cloned messenger RNA (cDNA) revealed the presence of three intervening sequences, all beginning with GTand ending with AG. The 5' and 3' boundaries of intervening sequences TVS-A (88 base pairs) and IVS-B (124 base pairs) are similar to those described for animal and viral genes, but the 3' boundary of IVS-C (129 base pairs) shows some differences. A sequence of 185 amino acids deduced from the cloned DMAs represents about 40% of a phaseolin polypeptide.
Travis, G H; Sutcliffe, J G
1988-01-01
To isolate cDNA clones of low-abundance mRNAs expressed in monkey cerebral cortex but absent from cerebellum, we developed an improved subtractive cDNA cloning procedure that requires only modest quantities of mRNA. Plasmid DNA from a monkey cerebellum cDNA library was hybridized in large excess to radiolabeled monkey cortex cDNA in a phenol emulsion-enhanced reaction. The unhybridized cortex cDNA was isolated by chromatography on hydroxyapatite and used to probe colonies from a monkey cortex cDNA library. Of 60,000 colonies screened, 163 clones were isolated and confirmed by colony hybridization or RNA blotting to represent mRNAs, ranging from 0.001% to 0.1% abundance, specific to or highly enriched in cerebral cortex relative to cerebellum. Clones of one medium-abundance mRNA were recovered almost quantitatively. Two of the lower-abundance mRNAs were expressed at levels reduced by a factor of 10 in Alzheimer disease relative to normal human cortex. One of these was identified as the monkey preprosomatostatin I mRNA. Images PMID:2894033
Construction of Infectious cDNA Clone of a Chrysanthemum stunt viroid Korean Isolate
Yoon, Ju-Yeon; Cho, In-Sook; Choi, Gug-Seoun; Choi, Seung-Kook
2014-01-01
Chrysanthemum stunt viroid (CSVd), a noncoding infectious RNA molecule, causes seriously economic losses of chrysanthemum for 3 or 4 years after its first infection. Monomeric cDNA clones of CSVd isolate SK1 (CSVd-SK1) were constructed in the plasmids pGEM-T easy vector and pUC19 vector. Linear positive-sense transcripts synthesized in vitro from the full-length monomeric cDNA clones of CSVd-SK1 could infect systemically tomato seedlings and chrysanthemum plants, suggesting that the linear CSVd RNA transcribed from the cDNA clones could be replicated as efficiently as circular CSVd in host species. However, direct inoculation of plasmid cDNA clones containing full-length monomeric cDNA of CSVd-SK1 failed to infect tomato and chrysanthemum and linear negative-sense transcripts from the plasmid DNAs were not infectious in the two plant species. The cDNA sequences of progeny viroid in systemically infected tomato and chrysanthemum showed a few substitutions at a specific nucleotide position, but there were no deletions and insertions in the sequences of the CSVd progeny from tomato and chrysanthemum plants. PMID:25288987
Rapid and efficient cDNA library screening by self-ligation of inverse PCR products (SLIP).
Hoskins, Roger A; Stapleton, Mark; George, Reed A; Yu, Charles; Wan, Kenneth H; Carlson, Joseph W; Celniker, Susan E
2005-12-02
cDNA cloning is a central technology in molecular biology. cDNA sequences are used to determine mRNA transcript structures, including splice junctions, open reading frames (ORFs) and 5'- and 3'-untranslated regions (UTRs). cDNA clones are valuable reagents for functional studies of genes and proteins. Expressed Sequence Tag (EST) sequencing is the method of choice for recovering cDNAs representing many of the transcripts encoded in a eukaryotic genome. However, EST sequencing samples a cDNA library at random, and it recovers transcripts with low expression levels inefficiently. We describe a PCR-based method for directed screening of plasmid cDNA libraries. We demonstrate its utility in a screen of libraries used in our Drosophila EST projects for 153 transcription factor genes that were not represented by full-length cDNA clones in our Drosophila Gene Collection. We recovered high-quality, full-length cDNAs for 72 genes and variously compromised clones for an additional 32 genes. The method can be used at any scale, from the isolation of cDNA clones for a particular gene of interest, to the improvement of large gene collections in model organisms and the human. Finally, we discuss the relative merits of directed cDNA library screening and RT-PCR approaches.
Liu, X; Gorovsky, M A
1996-01-01
A truncated cDNA clone encoding Tetrahymena thermophila histone H2A2 was isolated using synthetic degenerate oligonucleotide probes derived from H2A protein sequences of Tetrahymena pyriformis. The cDNA clone was used as a homologous probe to isolate a truncated genomic clone encoding H2A1. The remaining regions of the genes for H2A1 (HTA1) and H2A2 (HTA2) were then isolated using inverse PCR on circularized genomic DNA fragments. These partial clones were assembled into intact HTA1 and HTA2 clones. Nucleotide sequences of the two genes were highly homologous within the coding region but not in the noncoding regions. Comparison of the deduced amino acid sequences with protein sequences of T. pyriformis H2As showed only two and three differences respectively, in a total of 137 amino acids for H2A1, and 132 amino acids for H2A2, indicating the two genes arose before the divergence of these two species. The HTA2 gene contains a TAA triplet within the coding region, encoding a glutamine residue. In contrast with the T. thermophila HHO and HTA3 genes, no introns were identified within the two genes. The 5'- and 3'-ends of the histone H2A mRNAs; were determined by RNase protection and by PCR mapping using RACE and RLM-RACE methods. Both genes encode polyadenylated mRNAs and are highly expressed in vegetatively growing cells but only weakly expressed in starved cultures. With the inclusion of these two genes, T. thermophila is the first organism whose entire complement of known core and linker histones, including replication-dependent and basal variants, has been cloned and sequenced. PMID:8760889
Antimicrobial peptide evolution in the Asiatic honey bee Apis cerana.
Xu, Peng; Shi, Min; Chen, Xue-Xin
2009-01-01
The Asiatic honeybee, Apis cerana Fabricius, is an important honeybee species in Asian countries. It is still found in the wild, but is also one of the few bee species that can be domesticated. It has acquired some genetic advantages and significantly different biological characteristics compared with other Apis species. However, it has been less studied, and over the past two decades, has become a threatened species in China. We designed primers for the sequences of the four antimicrobial peptide cDNA gene families (abaecin, defensin, apidaecin, and hymenoptaecin) of the Western honeybee, Apis mellifera L. and identified all the antimicrobial peptide cDNA genes in the Asiatic honeybee for the first time. All the sequences were amplified by reverse transcriptase-polymerase chain reaction (RT-PCR). In all, 29 different defensin cDNA genes coding 7 different defensin peptides, 11 different abaecin cDNA genes coding 2 different abaecin peptides, 13 different apidaecin cDNA genes coding 4 apidaecin peptides and 34 different hymenoptaecin cDNA genes coding 13 different hymenoptaecin peptides were cloned and identified from the Asiatic honeybee adult workers. Detailed comparison of these four antimicrobial peptide gene families with those of the Western honeybee revealed that there are many similarities in the quantity and amino acid components of peptides in the abaecin, defensin and apidaecin families, while many more hymenoptaecin peptides are found in the Asiatic honeybee than those in the Western honeybee (13 versus 1). The results indicated that the Asiatic honeybee adult generated more variable antimicrobial peptides, especially hymenoptaecin peptides than the Western honeybee when stimulated by pathogens or injury. This suggests that, compared to the Western honeybee that has a longer history of domestication, selection on the Asiatic honeybee has favored the generation of more variable antimicrobial peptides as protection against pathogens.
Analysis of the antibody repertoire of lymphoma patients.
Huang, Shaoming; Preuss, Klaus-Dieter; Xie, Xiaoxun; Regitz, Evi; Pfreundschuh, Michael
2002-12-01
Cancer testis or cancer germline antigens (CGA) are promising vaccine candidates because they are expressed only in malignant but not in normal tissues, except for germ cells in the testis. Since non-Hodgkin's lymphomas (NHL) express the known CGA at low frequencies, we aimed at increasing the number of CGA with frequent expression in NHL by screening a cDNA expression library derived from normal testis for reactivity with high-titered IgG antibodies in the sera of lymphoma patients using SEREX, the serological identification of antigens by recombinant cDNA expression cloning. The analysis of 1.6x10(6) clones with the sera of 25 lymphoma patients revealed 42 clones which coded for 23 antigens, 12 of which had already been included in the SEREX databank. Four cDNA clones coded for unknown and 19 for known genes. Three antigens reacted only with the serum by which they had been detected, 9 antigens reacted with the sera of several NHL patients, but not with that of healthy controls, and 11 antigens reacted with both normal and NHL sera. Most of the antigens were ubiquitously expressed. Only HOM-NHL-6, HOM-NHL-8, HOM-NHL-21 and HOM-NHL-23 showed a restricted expression pattern. HOM-NHL-6 and HOM-NHL-8 were homologous to the previously described CGA NY-ESO-1 and HOM-TES-14/SCP-1, respectively. HOM-NHL-21 was expressed in rare cases of lymphomas, but not in normal tissues except for testis and brain, while HOM-NHL-23 appeared to be a testis-specific antigen. In summary, using the antibody repertoire of these 25 NHL patients, no new CGA were detected. The number of CGA detectable by the classical SEREX approach appears to be limited, and novel strategies are necessary to identify antigens that can serve as a vaccine target in a broad spectrum of NHL patients.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tanaka, Yoshiyuki; Matsuoka, Makoto; Yamanoto, Naoki
A cDNA clone for phenylalanine ammonia-lyase (PAL) induced in wounded sweet potato (Ipomoea batatas Lam.) root was obtained by immunoscreening a cDNA library. The protein produced in Escherichia coli cells containing the plasmid pPAL02 was indistinguishable from sweet potato PAL as judged by Ouchterlony double diffusion assays. The M{sub r} of its subunit was 77,000. The cells converted ({sup 14}C)-L-phenylalanine into ({sup 14}C)-t-cinnamic acid and PAL activity was detected in the homogenate of the cells. The activity was dependent on the presence of the pPAL02 plasmid DNA. The nucleotide sequence of the cDNA contained a 2,121-base pair (bp) open-reading framemore » capable of coding for a polypeptide with 707 amino acids (M{sub r} 77,137), a 22-bp 5{prime}-noncoding region and a 207-bp 3{prime}-noncoding region. The results suggest that the insert DNA fully encoded the amino acid sequence for sweet potato PAL that is induced by wounding. Comparison of the deduced amino acid sequence with that of a PAL cDNA fragment from Phaseolus vulgaris revealed 78.9% homology. The sequence from amino acid residues 258 to 494 was highly conserved, showing 90.7% homology.« less
Croteau, Rodney Bruce; Wildung, Mark Raymond; Crock, John E.
1999-01-01
A cDNA encoding (E)-.beta.-farnesene synthase from peppermint (Mentha piperita) has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID NO:1) is provided which codes for the expression of (E)-.beta.-farnesene synthase (SEQ ID NO:2), from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for (E)-.beta.-farnesene synthase, or for a base sequence sufficiently complementary to at least a portion of (E)-.beta.-farnesene synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding (E)-.beta.-farnesene synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant (E)-.beta.-farnesene synthase that may be used to facilitate its production, isolation and purification in significant amounts. Recombinant (E)-.beta.-farnesene synthase may be used to obtain expression or enhanced expression of (E)-.beta.-farnesene synthase in plants in order to enhance the production of (E)-.beta.-farnesene, or may be otherwise employed for the regulation or expression of (E)-.beta.-farnesene synthase, or the production of its product.
Croteau, Rodney Bruce; Crock, John E.
2005-01-25
A cDNA encoding (E)-.beta.-farnesene synthase from peppermint (Mentha piperita) has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID NO:1) is provided which codes for the expression of (E)-.beta.-farnesene synthase (SEQ ID NO:2), from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for (E)-.beta.-farnesene synthase, or for a base sequence sufficiently complementary to at least a portion of (E)-.beta.-farnesene synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding (E)-.beta.-farnesene synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant (E)-.beta.-famesene synthase that may be used to facilitate its production, isolation and purification in significant amounts. Recombinant (E)-.beta.-farnesene synthase may be used to obtain expression or enhanced expression of (E)-.beta.-famesene synthase in plants in order to enhance the production of (E)-.beta.-farnesene, or may be otherwise employed for the regulation or expression of (E)-.beta.-farnesene synthase, or the production of its product.
[cDNA library construction from panicle meristem of finger millet].
Radchuk, V; Pirko, Ia V; Isaenkov, S V; Emets, A I; Blium, Ia B
2014-01-01
The protocol for production of full-size cDNA using SuperScript Full-Length cDNA Library Construction Kit II (Invitrogen) was tested and high quality cDNA library from meristematic tissue of finger millet panicle (Eleusine coracana (L.) Gaertn) was created. The titer of obtained cDNA library comprised 3.01 x 10(5) CFU/ml in avarage. In average the length of cDNA insertion consisted about 1070 base pairs, the effectivity of cDNA fragment insertions--99.5%. The selective sequencing of cDNA clones from created library was performed. The sequences of cDNA clones were identified with usage of BLAST-search. The results of cDNA library analysis and selective sequencing represents prove good functionality and full length character of inserted cDNA clones. Obtained cDNA library from meristematic tissue of finger millet panicle represents good and valuable source for isolation and identification of key genes regulating metabolism and meristematic development and for mining of new molecular markers to conduct out high quality genetic investigations and molecular breeding as well.
Burgess, D; Penton, A; Dunsmuir, P; Dooner, H
1997-02-01
Three ADP-glucose pyrophosphorylase (ADPG-PPase) cDNA clones have been isolated and characterized from a pea cotyledon cDNA library. Two of these clones (Psagps1 and Psagps2) encode the small subunit of ADPG-PPase. The deduced amino acid sequences for these two clones are 95% identical. Expression of these two genes differs in that the Psagps2 gene shows comparatively higher expression in seeds relative to its expression in other tissues. Psagps2 expression also peaks midway through seed development at a time in which Psagps1 transcripts are still accumulating. The third cDNA isolated (Psagp11) encodes the large subunit of ADPG-PPase. It shows greater selectivity in expression than either of the small subunit clones. It is highly expressed in sink organs (seed, pod, and seed coat) and undetectable in leaves.
Staswick, P; Chrispeels, M J
1984-01-01
Phytohemagglutinin (PHA), the major lectin of the common bean Phaseolus vulgaris, is synthesized during the development of the seeds. In most cultivars PHA makes up 5-10% of the total seed protein, but certain cultivars do not contain PHA. In vivo labeling of a normal cultivar (Greensleeves) and a PHA-minus cultivar (Pinto 111) showed that PHA was not synthesized in the PHA-minus cultivar. To find out whether the lack of synthesis was due to the absence of mRNA for PHA, recombinant cDNA clones for PHA were obtained. Total poly(A)+ RNA was isolated from cotyledons of developing seeds of Greensleeves and used to direct cDNA synthesis. The double stranded cDNA was cloned in pUC8 and transformants of Escherichia coli screened with pPVL134, a recombinant plasmid which contains the complete coding sequence for a PHA-like protein. Two weakly hybridizing clones (pSC1 and pSC2) were selected. Hybrid selection experiments showed that these two clones selected mRNAs which could be translated into polypeptides identical in size to PHA and recognized by antibodies to PHA. The recombinant pPVL134 selected mRNA which translated into polypeptides which were slightly smaller than those of PHA, and poorly recognized by antibodies to PHA. The recombinant clones were used to demonstrate that the genes for PHA and for the PHA-like protein are under temporal control during seed development. The cultivar Pinto 111, which has no detectable PHA, also has greatly reduced levels of mRNA for PHA. However, the gene for the PHA-like protein encoded by pPVL134 is expressed to the same degree in the cultivars Greensleeves and Pinto 111.
Large-Scale Concatenation cDNA Sequencing
Yu, Wei; Andersson, Björn; Worley, Kim C.; Muzny, Donna M.; Ding, Yan; Liu, Wen; Ricafrente, Jennifer Y.; Wentland, Meredith A.; Lennon, Greg; Gibbs, Richard A.
1997-01-01
A total of 100 kb of DNA derived from 69 individual human brain cDNA clones of 0.7–2.0 kb were sequenced by concatenated cDNA sequencing (CCS), whereby multiple individual DNA fragments are sequenced simultaneously in a single shotgun library. The method yielded accurate sequences and a similar efficiency compared with other shotgun libraries constructed from single DNA fragments (>20 kb). Computer analyses were carried out on 65 cDNA clone sequences and their corresponding end sequences to examine both nucleic acid and amino acid sequence similarities in the databases. Thirty-seven clones revealed no DNA database matches, 12 clones generated exact matches (≥98% identity), and 16 clones generated nonexact matches (57%–97% identity) to either known human or other species genes. Of those 28 matched clones, 8 had corresponding end sequences that failed to identify similarities. In a protein similarity search, 27 clone sequences displayed significant matches, whereas only 20 of the end sequences had matches to known protein sequences. Our data indicate that full-length cDNA insert sequences provide significantly more nucleic acid and protein sequence similarity matches than expressed sequence tags (ESTs) for database searching. [All 65 cDNA clone sequences described in this paper have been submitted to the GenBank data library under accession nos. U79240–U79304.] PMID:9110174
Integrative Annotation of 21,037 Human Genes Validated by Full-Length cDNA Clones
Imanishi, Tadashi; Itoh, Takeshi; Suzuki, Yutaka; O'Donovan, Claire; Fukuchi, Satoshi; Koyanagi, Kanako O; Barrero, Roberto A; Tamura, Takuro; Yamaguchi-Kabata, Yumi; Tanino, Motohiko; Yura, Kei; Miyazaki, Satoru; Ikeo, Kazuho; Homma, Keiichi; Kasprzyk, Arek; Nishikawa, Tetsuo; Hirakawa, Mika; Thierry-Mieg, Jean; Thierry-Mieg, Danielle; Ashurst, Jennifer; Jia, Libin; Nakao, Mitsuteru; Thomas, Michael A; Mulder, Nicola; Karavidopoulou, Youla; Jin, Lihua; Kim, Sangsoo; Yasuda, Tomohiro; Lenhard, Boris; Eveno, Eric; Suzuki, Yoshiyuki; Yamasaki, Chisato; Takeda, Jun-ichi; Gough, Craig; Hilton, Phillip; Fujii, Yasuyuki; Sakai, Hiroaki; Tanaka, Susumu; Amid, Clara; Bellgard, Matthew; Bonaldo, Maria de Fatima; Bono, Hidemasa; Bromberg, Susan K; Brookes, Anthony J; Bruford, Elspeth; Carninci, Piero; Chelala, Claude; Couillault, Christine; de Souza, Sandro J.; Debily, Marie-Anne; Devignes, Marie-Dominique; Dubchak, Inna; Endo, Toshinori; Estreicher, Anne; Eyras, Eduardo; Fukami-Kobayashi, Kaoru; R. Gopinath, Gopal; Graudens, Esther; Hahn, Yoonsoo; Han, Michael; Han, Ze-Guang; Hanada, Kousuke; Hanaoka, Hideki; Harada, Erimi; Hashimoto, Katsuyuki; Hinz, Ursula; Hirai, Momoki; Hishiki, Teruyoshi; Hopkinson, Ian; Imbeaud, Sandrine; Inoko, Hidetoshi; Kanapin, Alexander; Kaneko, Yayoi; Kasukawa, Takeya; Kelso, Janet; Kersey, Paul; Kikuno, Reiko; Kimura, Kouichi; Korn, Bernhard; Kuryshev, Vladimir; Makalowska, Izabela; Makino, Takashi; Mano, Shuhei; Mariage-Samson, Regine; Mashima, Jun; Matsuda, Hideo; Mewes, Hans-Werner; Minoshima, Shinsei; Nagai, Keiichi; Nagasaki, Hideki; Nagata, Naoki; Nigam, Rajni; Ogasawara, Osamu; Ohara, Osamu; Ohtsubo, Masafumi; Okada, Norihiro; Okido, Toshihisa; Oota, Satoshi; Ota, Motonori; Ota, Toshio; Otsuki, Tetsuji; Piatier-Tonneau, Dominique; Poustka, Annemarie; Ren, Shuang-Xi; Saitou, Naruya; Sakai, Katsunaga; Sakamoto, Shigetaka; Sakate, Ryuichi; Schupp, Ingo; Servant, Florence; Sherry, Stephen; Shiba, Rie; Shimizu, Nobuyoshi; Shimoyama, Mary; Simpson, Andrew J; Soares, Bento; Steward, Charles; Suwa, Makiko; Suzuki, Mami; Takahashi, Aiko; Tamiya, Gen; Tanaka, Hiroshi; Taylor, Todd; Terwilliger, Joseph D; Unneberg, Per; Veeramachaneni, Vamsi; Watanabe, Shinya; Wilming, Laurens; Yasuda, Norikazu; Yoo, Hyang-Sook; Stodolsky, Marvin; Makalowski, Wojciech; Go, Mitiko; Nakai, Kenta; Takagi, Toshihisa; Kanehisa, Minoru; Sakaki, Yoshiyuki; Quackenbush, John; Okazaki, Yasushi; Hayashizaki, Yoshihide; Hide, Winston; Chakraborty, Ranajit; Nishikawa, Ken; Sugawara, Hideaki; Tateno, Yoshio; Chen, Zhu; Oishi, Michio; Tonellato, Peter; Apweiler, Rolf; Okubo, Kousaku; Wagner, Lukas; Wiemann, Stefan; Strausberg, Robert L; Isogai, Takao; Auffray, Charles; Nomura, Nobuo; Sugano, Sumio
2004-01-01
The human genome sequence defines our inherent biological potential; the realization of the biology encoded therein requires knowledge of the function of each gene. Currently, our knowledge in this area is still limited. Several lines of investigation have been used to elucidate the structure and function of the genes in the human genome. Even so, gene prediction remains a difficult task, as the varieties of transcripts of a gene may vary to a great extent. We thus performed an exhaustive integrative characterization of 41,118 full-length cDNAs that capture the gene transcripts as complete functional cassettes, providing an unequivocal report of structural and functional diversity at the gene level. Our international collaboration has validated 21,037 human gene candidates by analysis of high-quality full-length cDNA clones through curation using unified criteria. This led to the identification of 5,155 new gene candidates. It also manifested the most reliable way to control the quality of the cDNA clones. We have developed a human gene database, called the H-Invitational Database (H-InvDB; http://www.h-invitational.jp/). It provides the following: integrative annotation of human genes, description of gene structures, details of novel alternative splicing isoforms, non-protein-coding RNAs, functional domains, subcellular localizations, metabolic pathways, predictions of protein three-dimensional structure, mapping of known single nucleotide polymorphisms (SNPs), identification of polymorphic microsatellite repeats within human genes, and comparative results with mouse full-length cDNAs. The H-InvDB analysis has shown that up to 4% of the human genome sequence (National Center for Biotechnology Information build 34 assembly) may contain misassembled or missing regions. We found that 6.5% of the human gene candidates (1,377 loci) did not have a good protein-coding open reading frame, of which 296 loci are strong candidates for non-protein-coding RNA genes. In addition, among 72,027 uniquely mapped SNPs and insertions/deletions localized within human genes, 13,215 nonsynonymous SNPs, 315 nonsense SNPs, and 452 indels occurred in coding regions. Together with 25 polymorphic microsatellite repeats present in coding regions, they may alter protein structure, causing phenotypic effects or resulting in disease. The H-InvDB platform represents a substantial contribution to resources needed for the exploration of human biology and pathology. PMID:15103394
Construction of a cDNA microarray derived from the ascidian Ciona intestinalis.
Azumi, Kaoru; Takahashi, Hiroki; Miki, Yasufumi; Fujie, Manabu; Usami, Takeshi; Ishikawa, Hisayoshi; Kitayama, Atsusi; Satou, Yutaka; Ueno, Naoto; Satoh, Nori
2003-10-01
A cDNA microarray was constructed from a basal chordate, the ascidian Ciona intestinalis. The draft genome of Ciona has been read and inferred to contain approximately 16,000 protein-coding genes, and cDNAs for transcripts of 13,464 genes have been characterized and compiled as the "Ciona intestinalis Gene Collection Release I". In the present study, we constructed a cDNA microarray of these 13,464 Ciona genes. A preliminary experiment with Cy3- and Cy5-labeled probes showed extensive differential gene expression between fertilized eggs and larvae. In addition, there was a good correlation between results obtained by the present microarray analysis and those from previous EST analyses. This first microarray of a large collection of Ciona intestinalis cDNA clones should facilitate the analysis of global gene expression and gene networks during the embryogenesis of basal chordates.
Hurrelbrink, R J; Nestorowicz, A; McMinn, P C
1999-12-01
An infectious cDNA clone of Murray Valley encephalitis virus prototype strain 1-51 (MVE-1-51) was constructed by stably inserting genome-length cDNA into the low-copy-number plasmid vector pMC18. Designated pMVE-1-51, the clone consisted of genome-length cDNA of MVE-1-51 under the control of a T7 RNA polymerase promoter. The clone was constructed by using existing components of a cDNA library, in addition to cDNA of the 3' terminus derived by RT-PCR of poly(A)-tailed viral RNA. Upon comparison with other flavivirus sequences, the previously undetermined sequence of the 3' UTR was found to contain elements conserved throughout the genus FLAVIVIRUS: RNA transcribed from pMVE-1-51 and subsequently transfected into BHK-21 cells generated infectious virus. The plaque morphology, replication kinetics and antigenic profile of clone-derived virus (CDV-1-51) was similar to the parental virus in vitro. Furthermore, the virulence properties of CDV-1-51 and MVE-1-51 (LD(50) values and mortality profiles) were found to be identical in vivo in the mouse model. Through site-directed mutagenesis, the infectious clone should serve as a valuable tool for investigating the molecular determinants of virulence in MVE virus.
Human brain factor 1, a new member of the fork head gene family
DOE Office of Scientific and Technical Information (OSTI.GOV)
Murphy, D.B.; Wiese, S.; Burfeind, P.
1994-06-01
Analysis of cDNA clones that cross-hybridized with the fork head domain of the rat HNF-3 gene family revealed 10 cDNAs from human fetal brain and human testis cDNA libraries containing this highly conserved DNA-binding domain. Three of these cDNAs (HFK1, HFK2, and HFK3) were further analyzed. The cDNA HFK1 has a length of 2557 nucleotides and shows strong homology at the nucleotide level (91.2%) to brain factor 1 (BF-1) from rat. The HFK1 cDNA codes for a putative 476 amino acid protein. The homology to BF-1 from rat in the coding region at the amino acid level is 87.5%. Themore » fork head homologous region includes 111 amino acids starting at amino acid 160 and has a 97.5% homology to BF-1. Southern hybridization revealed that HFK1 is highly conserved among mammalian species and possibly birds. Northern analysis with total RNA from human tissues and poly(A)-rich RNA from mouse revealed a 3.2-kb transcript that is present in human and mouse fetal brain and in adult mouse brain. In situ hybridization with sections of mouse embryo and human fetal brain reveals that HFK1 expression is restricted to the neuronal cells in the telencepthalon, with strong expression being observed in the developing dentate gyrus and hippocampus. HFK1 was chromosomally localized by in situ hybridization to 14q12. The cDNA clones HFK2 and HFK3 were analyzed by restriction analysis and sequencing. HFK2 and HFK3 were found to be closely related but different from HFK1. Therefore, it would appear that HFK1, HFK2, HFK3, and BF-1 form a new fork head related subfamily. 33 refs., 6 figs.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hadano, S.; Ishida, Y.; Tomiyasu, H.
1994-09-01
To complete a transcription map of the 1 Mb region in human chromosome 4p16.3 containing the Huntington disease (HD) gene, the isolation of cDNA clones are being performed throughout. Our method relies on a direct screening of the cDNA libraries probed with single copy microclones from 3 YAC clones spanning 1 Mbp of the HD gene region. AC-DNAs were isolated by a preparative pulsed-field gel electrophoresis, amplified by both a single unique primer (SUP)-PCR and a linker ligation PCR, and 6 microclone-DNA libraries were generated. Then, 8,640 microclones from these libraries were independently amplified by PCR, and arrayed onto themore » membranes. 800-900 microclones that were not cross-hybridized with total human and yeast genomic DNA, TAC vector DNA, and ribosomal cDNA on a dot hybridization (putatively carrying single copy sequences) were pooled to make 9 probe pools. A total of {approximately}1.8x10{sup 7} plaques from the human brain cDNA libraries was screened with 9 pool-probes, and then 672 positive cDNA clones were obtained. So far, 597 cDNA clones were defined and arrayed onto a map of the 1 Mbp of the HD gene region by hybridization with HD region-specific cosmid contigs and YAC clones. Further characterization including a DNA sequencing and Northern blot analysis is currently underway.« less
Gritsun, T S; Gould, E A
1998-12-01
In less than 1 month we have constructed an infectious clone of attenuated tick-borne encephalitis virus (strain Vasilchenko) from 100 microl of unpurified virus suspension using long high fidelity PCR and a modified bacterial cloning system. Optimization of the 3' antisense primer concentration was essential to achieve PCR synthesis of an 11 kb cDNA copy of RNA from infectious virus. A novel system utilising two antisense primers, a 14-mer for reverse transcription and a 35-mer for long PCR, produced high yields of genomic length cDNA. Use of low copy number Able K cells and an incubation temperature of 28 degrees C increased the genetic stability of cloned cDNA. Clones containing 11 kb cDNA inserts produced colonies of reduced size, thus providing a positive selection system for full length clones. Sequencing of the infectious clone emphasised the improved fidelity of the method compared with conventional PCR and cloning methods. A simple and rapid strategy for genetic manipulation of the infectious clone is also described. These developments represent a significant advance in recombinant technology and should be applicable to positive stranded RNA viruses which cannot easily be purified or genetically manipulated.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Claffey, K.P.; Herrera, V.L.; Brecher, P.
1987-12-01
A fatty acid binding protein (FABP) as been identified and characterized in rat heart, but the function and regulation of this protein are unclear. In this study the cDNA for rat heart FABP was cloned from a lambda gt11 library. Sequencing of the cDNA showed an open reading frame coding for a protein with 133 amino acids and a calculated size of 14,776 daltons. Several differences were found between the sequence determined from the cDNA and that reported previously by protein sequencing techniques. Northern blot analysis using rat heart FABP cDNA as a probe established the presence of an abundantmore » mRNA in rat heart about 0.85 kilobases in length. This mRNA was detected, but was not abundant, in fetal heart tissue. Tissue distribution studies showed a similar mRNA species in red, but not white, skeletal muscle. In general, the mRNA tissue distribution was similar to that of the protein detected by Western immunoblot analysis, suggesting that heart FABP expression may be regulated at the transcriptional level. S1 nuclease mapping studies confirmed that the mRNA hybridized to rat heart FABP cDNA was identical in heart and red skeletal muscle throughout the entire open reading frame. The structural differences between heart FABP and other members of this multigene family may be related to the functional requirements of oxidative muscle for fatty acids as a fuel source.« less
Kimura, M; Kaneko, I; Komiyama, M; Takatsuki, A; Koshino, H; Yoneyama, K; Yamaguchi, I
1998-01-16
Trichothecene mycotoxins such as deoxynivalenol, 4,15-diacetoxyscirpenol, and T-2 toxin, are potent protein synthesis inhibitors for eukaryotic organisms. The 3-O-acetyl derivatives of these toxins were shown to reduce their in vitro activity significantly as assessed by assays using a rabbit reticulocyte translation system. The results suggested that the introduction of an O-acetyl group at the C-3 position in the biosynthetic pathway works as a resistance mechanism for Fusarium species that produce t-type trichothecenes (trichothecenes synthesized via the precursor trichotriol). A gene responsible for the 3-O-acetylation reaction, Tri101, has been successfully cloned from a Fusarium graminearum cDNA library that was designed to be expressed in Schizosaccharomyces pombe. Fission yeast transformants were selected for their ability to grow in the presence of T-2 toxin, and this strategy allowed isolation of 25 resistant clones, all of which contained a cDNA for Tri101. This is the first drug-inactivating O-acetyltransferase gene derived from antibiotic-producing organisms. The open reading frame of Tri101 codes for a polypeptide of 451 amino acid residues, which shows no similarity to any other proteins reported so far. TRI101 from recombinant Escherichia coli catalyzes O-acetylation of the trichothecene ring specifically at the C-3 position in an acetyl-CoA-dependent manner. By using the Tri101 cDNA as a probe, two least overlapping cosmid clones that cover a region of 70 kilobase pairs have been isolated from the genome of F. graminearum. Other trichothecene biosynthetic genes, Tri4, Tri5, and Tri6, were not clustered in the region covered by these cosmid clones. These new cosmid clones are considered to be located in other parts of the large biosynthetic gene cluster and might be useful for the study of trichothecene biosynthesis.
Morozumi, Takeya; Toki, Daisuke; Eguchi-Ogawa, Tomoko; Uenishi, Hirohide
2011-09-01
Large-scale cDNA-sequencing projects require an efficient strategy for mass sequencing. Here we describe a method for sequencing pooled cDNA clones using a combination of transposon insertion and Gateway technology. Our method reduces the number of shotgun clones that are unsuitable for reconstruction of cDNA sequences, and has the advantage of reducing the total costs of the sequencing project.
2004-01-01
The National Institutes of Health's Mammalian Gene Collection (MGC) project was designed to generate and sequence a publicly accessible cDNA resource containing a complete open reading frame (ORF) for every human and mouse gene. The project initially used a random strategy to select clones from a large number of cDNA libraries from diverse tissues. Candidate clones were chosen based on 5′-EST sequences, and then fully sequenced to high accuracy and analyzed by algorithms developed for this project. Currently, more than 11,000 human and 10,000 mouse genes are represented in MGC by at least one clone with a full ORF. The random selection approach is now reaching a saturation point, and a transition to protocols targeted at the missing transcripts is now required to complete the mouse and human collections. Comparison of the sequence of the MGC clones to reference genome sequences reveals that most cDNA clones are of very high sequence quality, although it is likely that some cDNAs may carry missense variants as a consequence of experimental artifact, such as PCR, cloning, or reverse transcriptase errors. Recently, a rat cDNA component was added to the project, and ongoing frog (Xenopus) and zebrafish (Danio) cDNA projects were expanded to take advantage of the high-throughput MGC pipeline. PMID:15489334
Ficarelli, A; Tassi, F; Restivo, F M
1999-03-01
We have isolated two full length cDNA clones encoding Nicotiana plumbaginifolia NADH-glutamate dehydrogenase. Both clones share amino acid boxes of homology corresponding to conserved GDH catalytic domains and putative mitochondrial targeting sequence. One clone shows a putative EF-hand loop. The level of the two transcripts is affected differently by carbon source.
Molecular cloning, characterization and mRNA expression of duck interleukin-17F
USDA-ARS?s Scientific Manuscript database
Interleukin-17F (IL-17F) is a proinflammatory cytokine that plays an important role in gut homeostasis. A full-length duck IL-17F (duIL-17F) cDNA with a 501-bp coding region was identified in ConA-activated splenic lymphocytes. duIL-17F is predicted to encode 166 amino acids, including a 26-amino ...
Watanabe, H; Narai, A; Shimizu, M
1999-06-01
A new protein that decreases transepithelial electrical resistance (TEER) in the human intestinal Caco-2 cell monolayer was found in a water-soluble fraction of the mushroom Flammulina velutipes. This protein, termed TEER-decreasing protein (TDP), is not cytotoxic and does not induce cell detachment, but rapidly increases the tight junctional permeability for water-soluble marker substances such as Lucifer Yellow CH (Mr 457) through the paracellular pathway. TDP was isolated and purified from the aqueous extract of F. velutipes by chromatographic means. Purified TDP was found to be a simple, nonglycosylated protein without intermolecular disulfide bonds, and the apparent molecular mass as estimated by SDS/PAGE and gel filtration is 30 kDa. It was revealed that the N-terminal amino-acid sequence of purified TDP is identical to the recently reported N-terminal sequence of flammutoxin, a membrane-perturbing hemolytic protein, for which the complete primary structure has not yet been reported [Tomita, T., Ishikawa, D., Noguchi, T., Katayama, E., and Hashimoto, Y. (1998) Biochem. J. 333, 24794-24799]. The cDNA coding for TDP was cloned by 5' and 3' rapid amplification of cDNA ends. The ORF encodes a protein with 272 amino-acid residues showing no homology to known proteins. Relevant studies using TDP cDNA will provide insight into the structure-function relationships of membrane pore-forming toxins.
Primary structure of stanniocalcin in two basal Actinopterygii.
Amemiya, Yutaka; Youson, John H
2004-01-15
The primary structure of stanniocalcin (STC), the principal product of the corpuscles of Stannius (CS) in ray-finned fishes, was deduced from STC cDNA clones for two species of holostean, the gar, Lepisosteus osseus and the bowfin, Amia calva. Overlapping partial cDNA clones were amplified by polymerase chain reaction (PCR) from single-strand cDNA of the CS. Excluding the poly(A) tail, the cDNAs of 1863 base pairs [bp] (gar) and 914 bp (bowfin) contained the 5' untranslated region followed by the coding region and the 3' untranslated region. Both the gar and bowfin STC cDNA encode a prehormone of 252 amino acids (aa) with a signal peptide of 32 aa and a mature protein of 220 aa. The deduced aa sequence of gar STC shows 87% identity with bowfin STC, 60-72% identity with most vertebrate STCs and 26% identity with mouse STC2. Phylogenetic analysis of the sequences support a view that the gar and bowfin form a monophyletic holostean clade. RT-PCR revealed in the gar and bowfin that, just as in mammals and rainbow trout, the expression of STC mRNA is widely spread in many tissues and organs. Since the gar and bowfin are representatives of the most ancient fishes known to possess CS, the corpuscular-derived STC molecule in fish has had a conserved evolution.
Paramyosin from the parasitic mite Sarcoptes scabiei: cDNA cloning and heterologous expression.
Mattsson, J G; Ljunggren, E L; Bergström, K
2001-05-01
The burrowing mite Sarcoptes scabiei is the causative agent of the highly contagious disease sarcoptic mange or scabies. So far, there is no in vitro propagation system for S. scabiei available, and mites used for various purposes must be isolated from infected hosts. Lack of parasite-derived material has limited the possibilities to study several aspects of scabies, including pathogenesis and immunity. It has also hampered the development of high performance serological assays. We have now constructed an S. scabiei cDNA expression library with mRNA purified from mites isolated from red foxes. Immunoscreening of the library enabled us to clone a full-length cDNA coding for a 102.5 kDa protein. Sequence similarity searches identified the protein as a paramyosin. Recombinant S. scabiei paramyosin expressed in Escherichia coli was recognized by sera from dogs and swine infected with S. scabiei. We also designed a small paramyosin construct of about 17 kDa that included the N-terminal part, an evolutionary variable part of the helical core, and the C-terminal part of the molecule. The miniaturized protein was efficiently expressed in E. coli and was recognized by sera from immunized rabbits. These data demonstrate that the cDNA library can assist in the isolation of important S. scabiei antigens and that recombinant proteins can be useful for the study of scabies.
Identification and characterization of novel reptile cathelicidins from elapid snakes.
Zhao, Hui; Gan, Tong-Xiang; Liu, Xiao-Dong; Jin, Yang; Lee, Wen-Hui; Shen, Ji-Hong; Zhang, Yun
2008-10-01
Three cDNA sequences coding for elapid cathelicidins were cloned from constructed venom gland cDNA libraries of Naja atra, Bungarus fasciatus and Ophiophagus hannah. The open reading frames of the cloned elapid cathelicidins were all composed of 576bp and coded for 191 amino acid residue protein precursors. Each of the deduced elapid cathelicidin has a 22 amino acid residue signal peptide, a conserved cathelin domain of 135 amino acid residues and a mature antimicrobial peptide of 34 amino acid residues. Unlike the highly divergent cathelicidins in mammals, the nucleotide and deduced protein sequences of the three cloned elapid cathelicidins were remarkably conserved. All the elapid mature cathelicidins were predicted to be cleaved at Valine157 by elastase. OH-CATH, the deduced mature cathelicidin from king cobra, was chemically synthesized and it showed strong antibacterial activity against various bacteria with minimal inhibitory concentration of 1-20microg/ml in the presence of 1% NaCl. Meanwhile, the synthetic peptide showed no haemolytic activity toward human red blood cells even at a high dose of 200microg/ml. Phylogenetic analysis of cathelicidins from vertebrate suggested that elapid and viperid cathelicidins were grouped together in the tree. Snake cathelicidins were evolutionary closely related to the neutrophilic granule proteins (NGPs) from mouse, rat and rabbit. Snake cathelicidins also showed a close relationship with avian fowlicidins (1-3) and chicken myeloid antimicrobial peptide 27. Elapid cathelicidins might be used as models for the development of novel therapeutic drugs.
René, P; Lenne, F; Ventura, M A; Bertagna, X; de Keyzer, Y
2000-01-04
In the pituitary, vasopressin triggers ACTH release through a specific receptor subtype, termed V3 or V1b. We cloned the V3 cDNA and showed that its expression was almost exclusive to pituitary corticotrophs and some corticotroph tumors. To study the determinants of this tissue specificity, we have now cloned the gene for the human (h) V3 receptor and characterized its structure. It is composed of two exons, spanning 10kb, with the coding region interrupted between transmembrane domains 6 and 7. We established that the transcription initiation site is located 498 nucleotides upstream of the initiator codon and showed that two polyadenylation sites may be used, while the most frequent is the most downstream. Sequence analysis of the promoter region showed no TATA box but identified consensus binding motifs for Sp1, CREB, and half sites of the estrogen receptor binding site. However comparison with another corticotroph-specific gene, proopiomelanocortin, did not identify common regulatory elements in the two promoters except for a short GC-rich region. Unexpectedly, hV3 gene analysis revealed that a formerly cloned 'artifactual' hV3 cDNA indeed corresponded to a spliced antisense transcript, overlapping the 5' part of the coding sequence in exon 1 and the promoter region. This transcript, hV3rev, was detected in normal pituitary and in many corticotroph tumors expressing hV3 sense mRNA and may therefore play a role in hV3 gene expression.
Molecular cloning of cDNAs for the nerve-cell specific phosphoprotein, synapsin I.
Kilimann, M W; DeGennaro, L J
1985-01-01
To provide access to synapsin I-specific DNA sequences, we have constructed cDNA clones complementary to synapsin I mRNA isolated from rat brain. Synapsin I mRNA was specifically enriched by immunoadsorption of polysomes prepared from the brains of 10-14 day old rats. Employing this enriched mRNA, a cDNA library was constructed in pBR322 and screened by differential colony hybridization with single-stranded cDNA probes made from synapsin I mRNA and total polysomal poly(A)+ RNA. This screening procedure proved to be highly selective. Five independent recombinant plasmids which exhibited distinctly stronger hybridization with the synapsin I probe were characterized further by restriction mapping. All of the cDNA inserts gave restriction enzyme digestion patterns which could be aligned. In addition, some of the cDNA inserts were shown to contain poly(dA) sequences. Final identification of synapsin I cDNA clones relied on the ability of the cDNA inserts to hybridize specifically to synapsin I mRNA. Several plasmids were tested by positive hybridization selection. They specifically selected synapsin I mRNA which was identified by in vitro translation and immunoprecipitation of the translation products. The established cDNA clones were used for a blot-hybridization analysis of synapsin I mRNA. A fragment (1600 bases) from the longest cDNA clone hybridized with two discrete RNA species 5800 and 4500 bases long, in polyadenylated RNA from rat brain and PC12 cells. No hybridization was detected to RNA from rat liver, skeletal muscle or cardiac muscle. Images Fig. 1. Fig. 2. Fig. 4. Fig. 5. PMID:3933975
Sequence verification as quality-control step for production of cDNA microarrays.
Taylor, E; Cogdell, D; Coombes, K; Hu, L; Ramdas, L; Tabor, A; Hamilton, S; Zhang, W
2001-07-01
To generate cDNA arrays in our core laboratory, we amplified about 2300 PCR products from a human, sequence-verified cDNA clone library. As a quality-control step, we sequenced the PCR products immediately before printing. The sequence information was used to search the GenBank database to confirm the identities. Although these clones were previously sequence verified by the company, we found that only 79% of the clones matched the original database after handling. Our experience strongly indicates the necessity to sequence verify the clones at the final stage before printing on microarray slides and to modify the gene list accordingly.
Tuo, Decai; Shen, Wentao; Yan, Pu; Li, Xiaoying; Zhou, Peng
2015-01-01
Papaya leaf distortion mosaic virus (PLDMV) is becoming a threat to papaya and transgenic papaya resistant to the related pathogen, papaya ringspot virus (PRSV). The generation of infectious viral clones is an essential step for reverse-genetics studies of viral gene function and cross-protection. In this study, a sequence- and ligation-independent cloning system, the In-Fusion® Cloning Kit (Clontech, Mountain View, CA, USA), was used to construct intron-less or intron-containing full-length cDNA clones of the isolate PLDMV-DF, with the simultaneous scarless assembly of multiple viral and intron fragments into a plasmid vector in a single reaction. The intron-containing full-length cDNA clone of PLDMV-DF was stably propagated in Escherichia coli. In vitro intron-containing transcripts were processed and spliced into biologically active intron-less transcripts following mechanical inoculation and then initiated systemic infections in Carica papaya L. seedlings, which developed similar symptoms to those caused by the wild-type virus. However, no infectivity was detected when the plants were inoculated with RNA transcripts from the intron-less construct because the instability of the viral cDNA clone in bacterial cells caused a non-sense or deletion mutation of the genomic sequence of PLDMV-DF. To our knowledge, this is the first report of the construction of an infectious full-length cDNA clone of PLDMV and the splicing of intron-containing transcripts following mechanical inoculation. In-Fusion cloning shortens the construction time from months to days. Therefore, it is a faster, more flexible, and more efficient method than the traditional multistep restriction enzyme-mediated subcloning procedure. PMID:26633465
Tuo, Decai; Shen, Wentao; Yan, Pu; Li, Xiaoying; Zhou, Peng
2015-12-01
Papaya leaf distortion mosaic virus (PLDMV) is becoming a threat to papaya and transgenic papaya resistant to the related pathogen, papaya ringspot virus (PRSV). The generation of infectious viral clones is an essential step for reverse-genetics studies of viral gene function and cross-protection. In this study, a sequence- and ligation-independent cloning system, the In-Fusion(®) Cloning Kit (Clontech, Mountain View, CA, USA), was used to construct intron-less or intron-containing full-length cDNA clones of the isolate PLDMV-DF, with the simultaneous scarless assembly of multiple viral and intron fragments into a plasmid vector in a single reaction. The intron-containing full-length cDNA clone of PLDMV-DF was stably propagated in Escherichia coli. In vitro intron-containing transcripts were processed and spliced into biologically active intron-less transcripts following mechanical inoculation and then initiated systemic infections in Carica papaya L. seedlings, which developed similar symptoms to those caused by the wild-type virus. However, no infectivity was detected when the plants were inoculated with RNA transcripts from the intron-less construct because the instability of the viral cDNA clone in bacterial cells caused a non-sense or deletion mutation of the genomic sequence of PLDMV-DF. To our knowledge, this is the first report of the construction of an infectious full-length cDNA clone of PLDMV and the splicing of intron-containing transcripts following mechanical inoculation. In-Fusion cloning shortens the construction time from months to days. Therefore, it is a faster, more flexible, and more efficient method than the traditional multistep restriction enzyme-mediated subcloning procedure.
A gene variation of 14-3-3 zeta isoform in rat hippocampus.
Murakami, K; Situ, S Y; Eshete, F
1996-11-14
A variant form of 14-3-3 zeta was isolated from the rat hippocampal cDNA library. The cloned cDNA is 1687 bp in length and it contains an entire ORF (nt = 63-797) with 245 amino acids that is characteristic to 14-3-3 zeta subtype. By comparing with reported sequences of 14-3-3 zeta, we found three nucleotide substitutions within the coding sequence in our clone; C<-->T transition at nt = 325 and G<-->C transversions at nt = 387 and 388. Both are missense mutations, leading ACG (Thr) to ATG (Met) and CGT (Arg) to GCT (Ala) conversions at residue 88 and 109, respectively. Our results show that at least three different genetic variants of 14-3-3 zeta are present in rat species which results in protein variations. Such mutation in the amino acid sequence is an important indication of the diverse functions of this protein and may also contribute to the recent contradictory observations regarding the role of the 14-3-3 zeta subtype.
[Construction of fetal mesenchymal stem cell cDNA subtractive library].
Yang, Li; Wang, Dong-Mei; Li, Liang; Bai, Ci-Xian; Cao, Hua; Li, Ting-Yu; Pei, Xue-Tao
2002-04-01
To identify differentially expressed genes between fetal mesenchymal stem cell (MSC) and adult MSC, especially specified genes expressed in fetal MSC, a cDNA subtractive library of fetal MSC was constructed using suppression subtractive hybridization (SSH) technique. At first, total RNA was isolated from fetal and adult MSC. Using SMART PCR synthesis method, single-strand and double-strand cDNAs were synthesized. After Rsa I digestion, fetal MSC cDNAs were divided into two groups and ligated to adaptor 1 and adaptor 2 respectively. Results showed that the amplified library contains 890 clones. Analysis of 890 clones with PCR demonstrated that 768 clones were positive. The positive rate is 86.3%. The size of inserted fragments in these positive clones was between 0.2 - 1 kb, with an average of 400 - 600 bp. SSH is a convenient and effective method for screening differentially expressed genes. The constructed cDNA subtractive library of fetal MSC cDNA lays solid foundation for screening and cloning new and specific function related genes of fetal MSC.
Isolation and characterization of a cDNA clone specific for avian vitellogenin II.
Protter, A A; Wang, S Y; Shelness, G S; Ostapchuk, P; Williams, D L
1982-01-01
A clone for vitellogenin, a major avian, estrogen responsive egg yolk protein, was isolated from the cDNA library of estrogen-induced rooster liver. Two forms of plasma vitellogenin, vitellogenin I (VTG I) and vitellogenin II (VTG II), distinguishable on the basis of their unique partial proteolysis maps, have been characterized and their corresponding hepatic precursor forms identified. We have used this criterion to specifically characterize which vitellogenin protein had been cloned. Partial proteolysis maps of BTG I and VTG II standards, synthesized in vivo, were compared to maps of protein synthesized in vitro using RNA hybrid-selected by the vitellogenin plasmid. Eight major digest fragments were found common to the in vitro synthesized vitellogenin and the VTG II standard while no fragments were observed to correspond to the VTG I map. A restriction map of the VTG II cDNA clone permits comparison to previously described cDNA and genomic vitellogenin clones. Images PMID:6182527
Nolden, T; Pfaff, F; Nemitz, S; Freuling, C M; Höper, D; Müller, T; Finke, Stefan
2016-04-05
Reverse genetics approaches are indispensable tools for proof of concepts in virus replication and pathogenesis. For negative strand RNA viruses (NSVs) the limited number of infectious cDNA clones represents a bottleneck as clones are often generated from cell culture adapted or attenuated viruses, with limited potential for pathogenesis research. We developed a system in which cDNA copies of complete NSV genomes were directly cloned into reverse genetics vectors by linear-to-linear RedE/T recombination. Rapid cloning of multiple rabies virus (RABV) full length genomes and identification of clones identical to field virus consensus sequence confirmed the approache's reliability. Recombinant viruses were recovered from field virus cDNA clones. Similar growth kinetics of parental and recombinant viruses, preservation of field virus characters in cell type specific replication and virulence in the mouse model were confirmed. Reduced titers after reporter gene insertion indicated that the low level of field virus replication is affected by gene insertions. The flexibility of the strategy was demonstrated by cloning multiple copies of an orthobunyavirus L genome segment. This important step in reverse genetics technology development opens novel avenues for the analysis of virus variability combined with phenotypical characterization of recombinant viruses at a clonal level.
Cloning of cDNA of major antigen of foot and mouth disease virus and expression in E. coli
NASA Astrophysics Data System (ADS)
Küpper, Hans; Keller, Walter; Kurz, Christina; Forss, Sonja; Schaller, Heinz
1981-02-01
Double-stranded DNA copies of the single-stranded genomic RNA of foot and mouth disease virus have been cloned into the Escherichia coli plasmid pBR322. A restriction map of the viral genome was established and aligned with the biochemical map of foot and mouth disease virus. The coding sequence for structural protein VP1, the major antigen of the virus, was identified and inserted into a plasmid vector where the expression of this sequence is under control of the phage λ PL promoter. In an appropriate host the synthesis of antigenic polypeptide can be demonstrated by radioimmunoassay.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gilchrist, Michael J.; Sobral, Daniel; Khoueiry, Pierre
Genome-wide resources, such as collections of cDNA clones encoding for complete proteins (full-ORF clones), are crucial tools for studying the evolution of gene function and genetic interactions. Non-model organisms, in particular marine organisms, provide a rich source of functional diversity. Marine organism genomes are, however, frequently highly polymorphic and encode proteins that diverge significantly from those of well-annotated model genomes. The construction of full-ORF clone collections from non-model organisms is hindered by the difficulty of predicting accurately the N-terminal ends of proteins, and distinguishing recent paralogs from highly polymorphic alleles. We also report a computational strategy that overcomes these difficulties,more » and allows for accurate gene level clustering of transcript data followed by the automated identification of full-ORFs with correct 5'- and 3'-ends. It is robust to polymorphism, includes paralog calling and does not require evolutionary proximity to well annotated model organisms. Here, we developed this pipeline for the ascidian Ciona intestinalis, a highly polymorphic member of the divergent sister group of the vertebrates, emerging as a powerful model organism to study chordate gene function, Gene Regulatory Networks and molecular mechanisms underlying human pathologies. Furthermore, using this pipeline we have generated the first full-ORF collection for a highly polymorphic marine invertebrate. It contains 19,163 full-ORF cDNA clones covering 60% of Ciona coding genes, and full-ORF orthologs for approximately half of curated human disease-associated genes.« less
Kapanadze, B; Kashuba, V; Baranova, A; Rasool, O; van Everdink, W; Liu, Y; Syomov, A; Corcoran, M; Poltaraus, A; Brodyansky, V; Syomova, N; Kazakov, A; Ibbotson, R; van den Berg, A; Gizatullin, R; Fedorova, L; Sulimova, G; Zelenin, A; Deaven, L; Lehrach, H; Grander, D; Buys, C; Oscier, D; Zabarovsky, E R; Einhorn, S; Yankovsky, N
1998-04-17
B-cell chronic lymphocytic leukemia (B-CLL) is a human hematological neoplastic disease often associated with the loss of a chromosome 13 region between RB1 gene and locus D13S25. A new tumor suppressor gene (TSG) may be located in the region. A cosmid contig has been constructed between the loci D13S1168 (WI9598) and D13S25 (H2-42), which corresponds to the minimal region shared by B-CLL associated deletions. The contig includes more than 200 LANL and ICRF cosmid clones covering 620 kb. Three cDNAs likely corresponding to three different genes have been found in the minimally deleted region, sequenced and mapped against the contigged cosmids. cDNA clone 10k4 as well as a chimeric clone 13g3, codes for a zinc-finger domain of the RING type and shares homology to some known genes involved in tumorigenesis (RET finger protein, BRCA1) and embryogenesis (MID1). We have termed the gene corresponding to 10k4/13g3 clones LEU5. This is the first gene with homology to known TSGs which has been found in the region of B-CLL rearrangements.
Takamitsu, Emi; Otsuka, Motoaki; Haebara, Tatsuki; Yano, Manami; Matsuzaki, Kanako; Kobuchi, Hirotsugu; Moriya, Koko; Utsumi, Toshihiko
2015-01-01
To identify physiologically important human N-myristoylated proteins, 90 cDNA clones predicted to encode human N-myristoylated proteins were selected from a human cDNA resource (4,369 Kazusa ORFeome project human cDNA clones) by two bioinformatic N-myristoylation prediction systems, NMT-The MYR Predictor and Myristoylator. After database searches to exclude known human N-myristoylated proteins, 37 cDNA clones were selected as potential human N-myristoylated proteins. The susceptibility of these cDNA clones to protein N-myristoylation was first evaluated using fusion proteins in which the N-terminal ten amino acid residues were fused to an epitope-tagged model protein. Then, protein N-myristoylation of the gene products of full-length cDNAs was evaluated by metabolic labeling experiments both in an insect cell-free protein synthesis system and in transfected human cells. As a result, the products of 13 cDNA clones (FBXL7, PPM1B, SAMM50, PLEKHN, AIFM3, C22orf42, STK32A, FAM131C, DRICH1, MCC1, HID1, P2RX5, STK32B) were found to be human N-myristoylated proteins. Analysis of the role of protein N-myristoylation on the intracellular localization of SAMM50, a mitochondrial outer membrane protein, revealed that protein N-myristoylation was required for proper targeting of SAMM50 to mitochondria. Thus, the strategy used in this study is useful for the identification of physiologically important human N-myristoylated proteins from human cDNA resources.
Takamitsu, Emi; Otsuka, Motoaki; Haebara, Tatsuki; Yano, Manami; Matsuzaki, Kanako; Kobuchi, Hirotsugu; Moriya, Koko; Utsumi, Toshihiko
2015-01-01
To identify physiologically important human N-myristoylated proteins, 90 cDNA clones predicted to encode human N-myristoylated proteins were selected from a human cDNA resource (4,369 Kazusa ORFeome project human cDNA clones) by two bioinformatic N-myristoylation prediction systems, NMT-The MYR Predictor and Myristoylator. After database searches to exclude known human N-myristoylated proteins, 37 cDNA clones were selected as potential human N-myristoylated proteins. The susceptibility of these cDNA clones to protein N-myristoylation was first evaluated using fusion proteins in which the N-terminal ten amino acid residues were fused to an epitope-tagged model protein. Then, protein N-myristoylation of the gene products of full-length cDNAs was evaluated by metabolic labeling experiments both in an insect cell-free protein synthesis system and in transfected human cells. As a result, the products of 13 cDNA clones (FBXL7, PPM1B, SAMM50, PLEKHN, AIFM3, C22orf42, STK32A, FAM131C, DRICH1, MCC1, HID1, P2RX5, STK32B) were found to be human N-myristoylated proteins. Analysis of the role of protein N-myristoylation on the intracellular localization of SAMM50, a mitochondrial outer membrane protein, revealed that protein N-myristoylation was required for proper targeting of SAMM50 to mitochondria. Thus, the strategy used in this study is useful for the identification of physiologically important human N-myristoylated proteins from human cDNA resources. PMID:26308446
Characterization of embryo-specific genes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sung, Z.R.
1988-01-01
The objective of the proposed research is to characterize the structure and function of a set of genes whose expression is regulated in embryo development, and that are not expressed in mature tissues -- the embryogenic genes. In order to isolate these genes, we immunized a rabbit with total extracts of somatic embryos of carrot, and enriched the anti-embryo antiserum for antibodies reacting with extracts of carrot somatic embryos. Using this enriched antiserum, we screened a lambda gt11 cDNA library constructed from embryo poly A{sup +} RNA, and isolated 10 cDNA clones that detect embryogenic mRNAs. Monospecific antibodies have beenmore » purified for proteins corresponding to each cDNA sequence. Four cDNA clones were further characterized in terms of the expression of their corresponding mRNA and protein in somatic embryos of carrot. In some cases, comparable gene sequences or products have been detected in somatic and zygotic embryos of other plant species. The characteristics of these 4 cDNA clones -- clone Nos. 8, 59, and 66 -- are described in this report. 3 figs.« less
Takai, T; Nishita, Y; Iguchi-Ariga, S M; Ariga, H
1994-01-01
We have previously reported the human cDNA encoding MSSP-1, a sequence-specific double- and single-stranded DNA binding protein [Negishi, Nishita, Saëgusa, Kakizaki, Galli, Kihara, Tamai, Miyajima, Iguchi-Ariga and Ariga (1994) Oncogene, 9, 1133-1143]. MSSP-1 binds to a DNA replication origin/transcriptional enhancer of the human c-myc gene and has turned out to be identical with Scr2, a human protein which complements the defect of cdc2 kinase in S.pombe [Kataoka and Nojima (1994) Nucleic Acid Res., 22, 2687-2693]. We have cloned the cDNA for MSSP-2, another member of the MSSP family of proteins. The MSSP-2 cDNA shares highly homologous sequences with MSSP-1 cDNA, except for the insertion of 48 bp coding 16 amino acids near the C-terminus. Like MSSP-1, MSSP-2 has RNP-1 consensus sequences. The results of the experiments using bacterially expressed MSSP-2, and its deletion mutants, as histidine fusion proteins suggested that the binding specificity of MSSP-2 to double- and single-stranded DNA is the same as that of MSSP-1, and that the RNP consensus sequences are required for the DNA binding of the protein. MSSP-2 stimulated the DNA replication of an SV40-derived plasmid containing the binding sequence for MSSP-1 or -2. MSSP-2 is hence suggested to play an important role in regulation of DNA replication. Images PMID:7838710
Woods, D E; Edge, M D; Colten, H R
1984-01-01
Complementary DNA (cDNA) clones corresponding to the major histocompatibility (MHC) class III antigen, complement protein C2, have been isolated from human liver cDNA libraries with the use of a complex mixture of synthetic oligonucleotides (17 mer) that contains 576 different oligonucleotide sequences. The C2 cDNA were used to identify a DNA restriction enzyme fragment length polymorphism that provides a genetic marker within the MHC that was not detectable at the protein level. An extensive search for genomic polymorphisms using a cDNA clone for another MHC class III gene, factor B, failed to reveal any DNA variants. The genomic variants detected with the C2 cDNA probe provide an additional genetic marker for analysis of MHC-linked diseases. Images PMID:6086718
Klahre, U; Hemmings-Mieszczak, M; Filipowicz, W
1995-06-01
We have previously characterized nuclear cDNA clones encoding two RNA binding proteins, CP-RBP30 and CP-RBP-31, which are targeted to chloroplasts in Nicotiana plumbaginifolia. In this report we describe the analysis of the 3'-untranslated regions (3'-UTRs) in 22 CP-RBP30 and 8 CP-RBP31 clones which reveals that mRNAs encoding both proteins have a very complex polyadenylation pattern. Fourteen distinct poly(A) sites were identified among CP-RBP30 clones and four sites among the CP-RBP31 clones. The authenticity of the sites was confirmed by RNase A/T1 mapping of N. plumbaginifolia RNA. CP-RBP30 provides an extreme example of the heterogeneity known to be a feature of mRNA polyadenylation in higher plants. Using PCR we have demonstrated that CP-RBP genes in N. plumbaginifolia and N. sylvestris, in addition to the previously described introns interrupting the coding region, contain an intron located in the 3' non-coding part of the gene. In the case of the CP-RBP31, we have identified one polyadenylation event occurring in this intron.
USDA-ARS?s Scientific Manuscript database
A trans-complemented CSF- JE chimeric viral replicon was constructed using an infectious cDNA clone of the CSF virus (CSFV) Alfort/187 strain. The E2 gene of CSFV Alfort/187 strain was deleted and the resultant plasmid pA187delE2 was inserted by a fragment containing the region coding for a truncate...
Ozawa, Tatsuhiko; Kondo, Masato; Isobe, Masaharu
2004-01-01
The 3' rapid amplification of cDNA ends (3' RACE) is widely used to isolate the cDNA of unknown 3' flanking sequences. However, the conventional 3' RACE often fails to amplify cDNA from a large transcript if there is a long distance between the 5' gene-specific primer and poly(A) stretch, since the conventional 3' RACE utilizes 3' oligo-dT-containing primer complementary to the poly(A) tail of mRNA at the first strand cDNA synthesis. To overcome this problem, we have developed an improved 3' RACE method suitable for the isolation of cDNA derived from very large transcripts. By using the oligonucleotide-containing random 9mer together with the GC-rich sequence for the suppression PCR technology at the first strand of cDNA synthesis, we have been able to amplify the cDNA from a very large transcript, such as the microtubule-actin crosslinking factor 1 (MACF1) gene, which codes a transcript of 20 kb in size. When there is no splicing variant, our highly specific amplification allows us to perform the direct sequencing of 3' RACE products without requiring cloning in bacterial hosts. Thus, this stepwise 3' RACE walking will help rapid characterization of the 3' structure of a gene, even when it encodes a very large transcript.
Zhang, Xiao-Yan; Dong, Shu-Wei; Xiang, Hai-Ying; Chen, Xiang-Ru; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui
2015-02-02
Brassica yellows virus is a newly identified species in the genus of Polerovirus within the family Luteoviridae. Brassica yellows virus (BrYV) is prevalently distributed throughout Mainland China and South Korea, is an important virus infecting cruciferous crops. Based on six BrYV genomic sequences of isolates from oilseed rape, rutabaga, radish, and cabbage, three genotypes, BrYV-A, BrYV-B, and BrYV-C, exist, which mainly differ in the 5' terminal half of the genome. BrYV is an aphid-transmitted and phloem-limited virus. The use of infectious cDNA clones is an alternative means of infecting plants that allows reverse genetic studies to be performed. In this study, full-length cDNA clones of BrYV-A, recombinant BrYV5B3A, and BrYV-C were constructed under control of the cauliflower mosaic virus 35S promoter. An agrobacterium-mediated inoculation system of Nicotiana benthamiana was developed using these cDNA clones. Three days after infiltration with full-length BrYV cDNA clones, necrotic symptoms were observed in the inoculated leaves of N. benthamiana; however, no obvious symptoms appeared in the upper leaves. Reverse transcription-PCR (RT-PCR) and western blot detection of samples from the upper leaves showed that the maximum infection efficiency of BrYVs could reach 100%. The infectivity of the BrYV-A, BrYV-5B3A, and BrYV-C cDNA clones was further confirmed by northern hybridization. The system developed here will be useful for further studies of BrYV, such as host range, pathogenicity, viral gene functions, and plant-virus-vector interactions, and especially for discerning the differences among the three genotypes. Copyright © 2014 Elsevier B.V. All rights reserved.
Cloning and characterization of the human 5,10-methenyltetrahydrofolate synthetase-encoding cDNA.
Dayan, A; Bertrand, R; Beauchemin, M; Chahla, D; Mamo, A; Filion, M; Skup, D; Massie, B; Jolivet, J
1995-11-20
Methenyltetrahydrofolate synthetase (MTHFS) catalyses the obligatory initial metabolic step in the intracellular conversion of 5-formyltetrahydrofolate to other reduced folates. We have isolated and sequenced a human MTHFS cDNA which is 872-bp long and codes for a 203-amino-acid protein of 23,229 Da. Escherichia coli BL21(DE3), transfected with pET11c plasmids containing an open reading frame encoding MTHFS, showed a 100-fold increase in MTHFS activity in bacterial extracts after IPTG induction. Northern blot studies of human tissues determined that the MTHFS mRNA was expressed preferentially in the liver and Southern blot analysis of human genomic DNA suggested the presence of a single-copy gene.
Ferriols, Victor Marco Emmanuel N; Yaginuma, Ryoko; Adachi, Masao; Takada, Kentaro; Matsunaga, Shigeki; Okada, Shigeru
2015-05-21
The diatom Rhizosolenia setigera Brightwell produces highly branched isoprenoid (HBI) hydrocarbons that are ubiquitously present in marine environments. The hydrocarbon composition of R. setigera varies between C25 and C30 HBIs depending on the life cycle stage with regard to auxosporulation. To better understand how these hydrocarbons are biosynthesized, we characterized the farnesyl pyrophosphate (FPP) synthase (FPPS) enzyme of R. setigera. An isolated 1465-bp cDNA clone contained an open reading frame spanning 1299-bp encoding a protein with 432 amino acid residues. Expression of the RsFPPS cDNA coding region in Escherichia coli produced a protein that exhibited FPPS activity in vitro. A reduction in HBI content from diatoms treated with an FPPS inhibitor, risedronate, suggested that RsFPPS supplies precursors for HBI biosynthesis. Product analysis by gas chromatography-mass spectrometry also revealed that RsFPPS produced small amounts of the cis-isomers of geranyl pyrophosphate and FPP, candidate precursors for the cis-isomers of HBIs previously characterized. Furthermore, RsFPPS gene expression at various life stages of R. setigera in relation to auxosporulation were also analyzed. Herein, we present data on the possible role of RsFPPS in HBI biosynthesis, and it is to our knowledge the first instance that an FPPS was cloned and characterized from a diatom.
Villand, P; Aalen, R; Olsen, O A; Lüthi, E; Lönneborg, A; Kleczkowski, L A
1992-06-01
Several cDNAs encoding the small and large subunit of ADP-glucose pyrophosphorylase (AGP) were isolated from total RNA of the starchy endosperm, roots and leaves of barley by polymerase chain reaction (PCR). Sets of degenerate oligonucleotide primers, based on previously published conserved amino acid sequences of plant AGP, were used for synthesis and amplification of the cDNAs. For either the endosperm, roots and leaves, the restriction analysis of PCR products (ca. 550 nucleotides each) has revealed heterogeneity, suggesting presence of three transcripts for AGP in the endosperm and roots, and up to two AGP transcripts in the leaf tissue. Based on the derived amino acid sequences, two clones from the endosperm, beps and bepl, were identified as coding for the small and large subunit of AGP, respectively, while a leaf transcript (blpl) encoded the putative large subunit of AGP. There was about 50% identity between the endosperm clones, and both of them were about 60% identical to the leaf cDNA. Northern blot analysis has indicated that beps and bepl are expressed in both the endosperm and roots, while blpl is detectable only in leaves. Application of the PCR technique in studies on gene structure and gene expression of plant AGP is discussed.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lagrimini, L.M.
Since this manuscript was submitted we have conducted a more thorough physiological analysis of water relations in wild-type and peroxidase overproducing plants. These experiments include pressure bomb, plasmolysis, and membrane integrity analysis. We are also in the process of analyzing other phenotypes in peroxidase overproducer plants such as excessive browning of tissue, the rapid death of tissue in culture, and poor germination of seed. Transformed plants of Nicotiana tabacum and Nicotiana sylvestris were obtained which have peroxidase activity 3--7 fold lower than wild-type plants. This was done by introducing a chimeric gene composed of the CaMV 35S promoter and themore » 5' half of the tobacco anionic peroxidase cDNA in the antisense RNA configuration. A manuscript which describes this work is being written, and will be submitted for publication in January 1990. The anionic peroxidase gene has been cloned by hybridization to the cloned cDNA. The entire gene is contained on an 8.7kb fragment within a lambda phage clone. Several smaller DNA fragments have been subcloned, and some have been sequenced. One exon within the coding sequence has been sequenced, along with the partial sequence of two introns. Further sequencing is being carried-out to identify the promoter, which will be later joined to a reporter gene. 6 figs.« less
Dalla Valle, Luisa; Nardi, Alessia; Belvedere, Paola; Toni, Mattia; Alibardi, Lorenzo
2007-07-01
Beta-keratins of reptilian scales have been recently cloned and characterized in some lizards. Here we report for the first time the sequence of some beta-keratins from the snake Elaphe guttata. Five different cDNAs were obtained using 5'- and 3'-RACE analyses. Four sequences differ by only few nucleotides in the coding region, whereas the last cDNA shows, in this region, only 84% of identity. The gene corresponding to one of the cDNA sequences has a single intron present in the 5'-untranslated region. This genomic organization is similar to that of birds' beta-keratins. Cloning and Southern blotting analysis suggest that snake beta-keratins belong to a family of high-related genes as for geckos. PCR analysis suggests a head-to-tail orientation of genes in the same chromosome. In situ hybridization detected beta-keratin transcripts almost exclusively in differentiating oberhautchen and beta-cells of the snake epidermis in renewal phase. This is confirmed by Northern blotting that showed, in this phase, a high expression of two different transcripts whereas only the longer transcript is expressed at a much lower level in resting skin. The cDNA coding sequences encoded putative glycine-proline-serine rich proteins containing 137-139 amino acids, with apparent isoelectric point at 7.5 and 8.2. A central region, rich in proline, shows over 50% homology with avian scale, claw, and feather keratins. The prediction of secondary structure shows mainly a random coil conformation and few beta-strand regions in the central region, likely involved in the formation of a fibrous framework of beta-keratins. This region was possibly present in basic reptiles that originated reptiles and birds. Copyright 2007 Wiley-Liss, Inc.
Zhang, Yu; Yao, Youlin; Jiang, Siyuan; Lu, Yilu; Liu, Yunqiang; Tao, Dachang; Zhang, Sizhong; Ma, Yongxin
2015-04-01
To identify protein-protein interaction partners of PER1 (period circadian protein homolog 1), key component of the molecular oscillation system of the circadian rhythm in tumors using bacterial two-hybrid system technique. Human cervical carcinoma cell Hela library was adopted. Recombinant bait plasmid pBT-PER1 and pTRG cDNA plasmid library were cotransformed into the two-hybrid system reporter strain cultured in a special selective medium. Target clones were screened. After isolating the positive clones, the target clones were sequenced and analyzed. Fourteen protein coding genes were identified, 4 of which were found to contain whole coding regions of genes, which included optic atrophy 3 protein (OPA3) associated with mitochondrial dynamics and homo sapiens cutA divalent cation tolerance homolog of E. coli (CUTA) associated with copper metabolism. There were also cellular events related proteins and proteins which are involved in biochemical reaction and signal transduction-related proteins. Identification of potential interacting proteins with PER1 in tumors may provide us new insights into the functions of the circadian clock protein PER1 during tumorigenesis.
Cloning and expression of Tenebrio molitor antifreeze protein in Escherichia coli.
Yue, Chang-Wu; Zhang, Yi-Zheng
2009-03-01
A novel antifreeze protein cDNA was cloned by RT-PCR from the larva of the yellow mealworm Tenebrio molitor. The coding fragment of 339 bp encodes a protein of 112 amino acid residues and was fused to the expression vectors pET32a and pTWIN1. The resulted expression plasmids were transformed into Escherischia coli strains BL21 (DE3), ER2566, and Origami B (DE3), respectively. Several strategies were used for expression of the highly disulfide-bonded beta-helix-contained protein with the activity of antifreeze in different expression systems. A protocol for production of refolded and active T. molitor antifreeze protein in bacteria was obtained.
Yasuno, Rie; Wada, Hajime
1998-01-01
Lipoic acid is a coenzyme that is essential for the activity of enzyme complexes such as those of pyruvate dehydrogenase and glycine decarboxylase. We report here the isolation and characterization of LIP1 cDNA for lipoic acid synthase of Arabidopsis. The Arabidopsis LIP1 cDNA was isolated using an expressed sequence tag homologous to the lipoic acid synthase of Escherichia coli. This cDNA was shown to code for Arabidopsis lipoic acid synthase by its ability to complement a lipA mutant of E. coli defective in lipoic acid synthase. DNA-sequence analysis of the LIP1 cDNA revealed an open reading frame predicting a protein of 374 amino acids. Comparisons of the deduced amino acid sequence with those of E. coli and yeast lipoic acid synthase homologs showed a high degree of sequence similarity and the presence of a leader sequence presumably required for import into the mitochondria. Southern-hybridization analysis suggested that LIP1 is a single-copy gene in Arabidopsis. Western analysis with an antibody against lipoic acid synthase demonstrated that this enzyme is located in the mitochondrial compartment in Arabidopsis cells as a 43-kD polypeptide. PMID:9808738
Lu, L; Komada, M; Kitamura, N
1998-06-15
Hrs is a 115kDa zinc finger protein which is rapidly tyrosine phosphorylated in cells stimulated with various growth factors. We previously purified the protein from a mouse cell line and cloned its cDNA. In the present study, we cloned a human Hrs cDNA from a human placenta cDNA library by cross-hybridization, using the mouse cDNA as a probe, and determined its nucleotide sequence. The human Hrs cDNA encoded a 777-amino-acid protein whose sequence was 93% identical to that of mouse Hrs. Northern blot analysis showed that the Hrs mRNA was about 3.0kb long and was expressed in all the human adult and fetal tissues tested. In addition, we showed by genomic Southern blot analysis that the human Hrs gene was a single-copy gene with a size of about 20kb. Furthermore, the human Hrs gene was mapped to chromosome 17 by Southern blotting of genomic DNAs from human/rodent somatic cell hybrids. Copyright 1998 Elsevier Science B.V. All rights reserved.
Ahmad, Muhammad Khairi; Tabana, Yasser M; Ahmed, Mowaffaq Adam; Sandai, Doblin Anak; Mohamed, Rafeezul; Ismail, Ida Shazrina; Zulkiflie, Nurulisa; Yunus, Muhammad Amir
2017-12-01
A norovirus maintains its viability, infectivity and virulence by its ability to replicate. However, the biological mechanisms of the process remain to be explored. In this work, the NanoLuc™ Luciferase gene was used to develop a reporter-tagged replicon system to study norovirus replication. The NanoLuc™ Luciferase reporter protein was engineered to be expressed as a fusion protein for MNV-1 minor capsid protein, VP2. The foot-and-mouth disease virus 2A (FMDV2A) sequence was inserted between the 3'end of the reporter gene and the VP2 start sequence to allow co-translational 'cleavage' of fusion proteins during intracellular transcript expression. Amplification of the fusion gene was performed using a series of standard and overlapping polymerase chain reactions. The resulting amplicon was then cloned into three readily available backbones of MNV-1 cDNA clones. Restriction enzyme analysis indicated that the NanoLucTM Luciferase gene was successfully inserted into the parental MNV-1 cDNA clone. The insertion was further confirmed by using DNA sequencing. NanoLuc™ Luciferase-tagged MNV-1 cDNA clones were successfully engineered. Such clones can be exploited to develop robust experimental assays for in vitro assessments of viral RNA replication.
Bhattacharya, D; Steinkötter, J; Melkonian, M
1993-12-01
Centrin (= caltractin) is a ubiquitous, cytoskeletal protein which is a member of the EF-hand superfamily of calcium-binding proteins. A centrin-coding cDNA was isolated and characterized from the prasinophyte green alga Scherffelia dubia. Centrin PCR amplification primers were used to isolate partial, homologous cDNA sequences from the green algae Tetraselmis striata and Spermatozopsis similis. Annealing analyses suggested that centrin is a single-copy-coding region in T. striata and S. similis and other green algae studied. Centrin-coding regions from S. dubia, S. similis and T. striata encode four colinear EF-hand domains which putatively bind calcium. Phylogenetic analyses, including homologous sequences from Chlamydomonas reinhardtii and the land plant Atriplex nummularia, demonstrate that the domains of centrins are congruent and arose from the two-fold duplication of an ancestral EF hand with Domains 1+3 and Domains 2+4 clustering. The domains of centrins are also congruent with those of calmodulins demonstrating that, like calmodulin, centrin is an ancient protein which arose within the ancestor of all eukaryotes via gene duplication. Phylogenetic relationships inferred from centrin-coding region comparisons mirror results of small subunit ribosomal RNA sequence analyses suggesting that centrin-coding regions are useful evolutionary markers within the green algae.
Isolation of human hexosaminidase. cap alpha. cDNA and expression of. cap alpha. chains in E. coli
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wiktorowicz, J.E.; Whitman, J.M.
1986-05-01
Pooled antisera against homogeneous, glutaraldehyde cross-linked hexosaminidase (hex) A was adsorbed with E. coli lysate insolubilized on Sepharose 4B. Aliquots of a human liver lambdagtll cDNA library (50,000-100,000 pfu) were plated on E. coli Y1090. Expression of cloned cDNA, after sufficient plaque growth at 42/sup 0/, was accomplished by induction with isopropylthiogalactoside soaked nitrocellulose filters. Identification of hex cDNA clones was performed by incubation of the filters with purified antisera. Protein A labelled with I-125 was used to develop the reactive plaques. Positive plaques, identified by autoradiography, were picked, replated at a lower density, and rescreened. This was repeated severalmore » more times until all plaques yielded positive signals. Identification of the clones as containing ..cap alpha.. or ..beta.. cDNA was accomplished by replating the purified phage and rescreening the plaques with anti-hex B antiserum preadsorbed with E. coli lysate. According to this protocol several hex ..cap alpha.. clones have been identified. While these clones generate ..beta..-galactosidase: hex ..cap alpha.. fusion proteins, these findings suggest that in the future it may be possible to obtain large quantities of unmodified hex ..cap alpha.. and ..beta.. polypeptides from E. coli for the study of the structural and enzymatic properties of these polypeptides and for diagnostic purposes in the GM2 gangliosidoses.« less
Chiou, S J; Vanden Broeck, J; Janssen, I; Borovsky, D; Vandenbussche, F; Simonet, G; De Loof, A
1998-10-01
The cDNA coding for a Ser-protease-related protein (Scg-SPRP) was cloned from desert locust (Schistocerca gregaria) midgut. The derived amino acid sequence consists of 260 residues and shows strong sequence similarity to insect trypsin-like molecules. It is, however, likely that Scg-SPRP is not a proteolytically active enzyme and that it plays another physiologically relevant role, since two out of three residues which are indispensable for catalytic activity of Ser-proteases are replaced. Northern analysis revealed that the Scg-SPRP gene is expressed in midgut tissue and that this expression is strongly induced in adult female locusts. Moreover, the occurrence of the transcript (1.2 kb) fluctuates during the molting cycle and during the female reproductive cycle. Juvenile hormone (JH III) dependence of transcription was investigated by chemical allatectomy (precocene I) of adult females. This resulted in inhibition of vitellogenesis and in disappearance of the Scg-SPRP transcript. Expression of Scg-SPRP in precocene-treated locusts could be reinduced by additional treatment with JH III or with 20-OH-ecdysone.
Molecular cloning of a cDNA coding for GTP cyclohydrolase I from Dictyostelium discoideum.
Witter, K; Cahill, D J; Werner, T; Ziegler, I; Rödl, W; Bacher, A; Gütlich, M
1996-01-01
The GTP cyclohydrolase I (GTP-CH) gene of the cellular slime mould Dictyostelium discoideum has been cloned and sequenced. The 855 bp cDNA of this gene contains the open reading frame (ORF) encoding 232 amino acids with a predicted molecular mass of approx. 26 kDa. Southern blot analysis indicated the presence of a single gene for GTP-CH in Dictyostelium. PCR amplification of the ORF from chromosomal DNA and sequencing showed the existence of a 101 bp intron in the GTP-CH gene of Dictyostelium discoideum. The amino acid sequence has 47% and 49% positional identity to those of the human and yeast enzymes respectively. Most of the sequence variation between species is located in the N-terminal part of the protein. The overall identity with the E. coli protein is markedly lower. The enzyme was expressed in E. coli and purified as a 68 kDa fusion protein with the maltose-binding protein of E. coli. GTP-CH of Dictyostelium is heat-stable and showed maximal activity at 60 degrees C. The Km value for GTP is 50 microM. PMID:8870645
Zhang, Pan-Tao; Shan, Chao; Li, Xiao-Dan; Liu, Si-Qing; Deng, Cheng-Lin; Ye, Han-Qing; Shang, Bao-Di; Shi, Pei-Yong; Lv, Ming; Shen, Bei-Fen; Qin, Cheng-Feng; Zhang, Bo
2016-01-04
West Nile virus (WNV) is a neurotropic human pathogen that has caused increasing infected cases over recent years. There is currently no licensed vaccine or effective drug for prevention and treatment of WNV infection in humans. To facilitate antiviral drug discovery and neutralizing antibody detection, a WNV cDNA clone containing a luciferase reporter gene was constructed through incorporating Gaussia luciferase (Gluc) gene within the capsid-coding region of WNV genome. Transfection of BHK-21 cells with the cDNA clone-derived RNA generated luciferase reporter WNV (WNV-Gluc) and the stable WNV-Gluc with high titers (>10(7)PFU/ml) was obtained through plaque purification. Luciferase activity was used to effectively quantify the viral production of WNV-Gluc. Using the reporter virus WNV-Gluc, we developed a luciferase based assay in a 12-well format for evaluating neutralizing antibodies. The reporter virus could be a powerful tool for epidemiological investigation of WNV, vaccine evaluation, antiviral drug screening, and the study of WNV replication and pathogenesis. Copyright © 2015 Elsevier B.V. All rights reserved.
Schuster, W; Wissinger, B; Unseld, M; Brennicke, A
1990-01-01
A number of cytosines are altered to be recognized as uridines in transcripts of the nad3 locus in mitochondria of the higher plant Oenothera. Such nucleotide modifications can be found at 16 different sites within the nad3 coding region. Most of these alterations in the mRNA sequence change codon identities to specify amino acids better conserved in evolution. Individual cDNA clones differ in their degree of editing at five nucleotide positions, three of which are silent, while two lead to codon alterations specifying different amino acids. None of the cDNA clones analysed is maximally edited at all possible sites, suggesting slow processing or lowered stringency of editing at these nucleotides. Differentially edited transcripts could be editing intermediates or could code for differing polypeptides. Two edited nucleotides in an open reading frame located upstream of nad3 change two amino acids in the deduced polypeptide. Part of the well-conserved ribosomal protein gene rps12 also encoded downstream of nad3 in other plants, is lost in Oenothera mitochondria by recombination events. The functional rps12 protein must be imported from the cytoplasm since the deleted sequences of this gene are not found in the Oenothera mitochondrial genome. The pseudogene sequence is not edited at any nucleotide position. Images Fig. 3. Fig. 4. Fig. 7. PMID:1688531
Feng, X; Happ, G M
1996-11-14
The cDNA for Sp23, a structural protein of the spermatophore of Tenebrio molitor, had been previously cloned and characterized (Paesen, G.C., Schwartz, M.B., Peferoen, M., Weyda, F. and Happ, G.M. (1992a) Amino acid sequence of Sp23, a structure protein of the spermatophore of the mealworm beetle, Tenebrio molitor. J. Biol. Chem. 257, 18852-18857). Using the labeled cDNA for Sp23 as a probe to screen a library of genomic DNA from Tenebrio molitor, we isolated a genomic clone for Sp23. A 5373-base pair (bp) restriction fragment containing the Sp23 gene was sequenced. The coding region is separated by a 55-bp intron which is located close to the translation start site. Three putative ecdysone response elements (EcRE) are identified in the 5' flanking region of the Sp23 gene. Comparison of the flanking regions of the Sp23 gene with those of the D-protein gene expressed in the accessory glands of Tenebrio reveals similar sequences present in the flanking regions of the two genes. The genomic organization of the coding region of the Sp23 gene shares similarities with that of the D-protein gene, three Drosophila accessory gland genes and two Drosophila 20-OH ecdysone-responsive genes.
Poirier, John T; Reddy, P Seshidhar; Idamakanti, Neeraja; Li, Shawn S; Stump, Kristine L; Burroughs, Kevin D; Hallenbeck, Paul L; Rudin, Charles M
2012-12-01
Seneca Valley virus (SVV-001) is an oncolytic picornavirus with selective tropism for a subset of human cancers with neuroendocrine differentiation. To characterize further the specificity of SVV-001 and its patterns and kinetics of intratumoral spread, bacterial plasmids encoding a cDNA clone of the full-length wild-type virus and a derivative virus expressing GFP were generated. The full-length cDNA of the SVV-001 RNA genome was cloned into a bacterial plasmid under the control of the T7 core promoter sequence to create an infectious cDNA clone, pNTX-09. A GFP reporter virus cDNA clone, pNTX-11, was then generated by cloning a fusion protein of GFP and the 2A protein from foot-and-mouth disease virus immediately following the native SVV-001 2A sequence. Recombinant GFP-expressing reporter virus, SVV-GFP, was rescued from cells transfected with in vitro RNA transcripts from pNTX-11 and propagated in cell culture. The proliferation kinetics of SVV-001 and SVV-GFP were indistinguishable. The SVV-GFP reporter virus was used to determine that a subpopulation of permissive cells is present in small-cell lung cancer cell lines previously thought to lack permissivity to SVV-001. Finally, it was shown that SVV-GFP administered to tumour-bearing animals homes in to and infects tumours whilst having no detectable tropism for normal mouse tissues at 1×10(11) viral particles kg(-1), a dose equivalent to that administered in ongoing clinical trials. These infectious clones will be of substantial value in further characterizing the biology of this virus and as a backbone for the generation of additional oncolytic derivatives.
Yi, S Y; Hwang, B K
1998-10-31
Differential display techniques were used to isolate cDNA clones corresponding to genes which were expressed in soybean hypocotyls by Phytophthora sojae f.sp. glycines infection. With a partial cDNA clone C20CI4 from the differential display PCR as a probe, a new basic peroxidase cDNA clone, designated GMIPER1, was isolated from a cDNA library of soybean hypocotyls infected with P. sojae f.sp. glycines. Sequence analysis revealed that the peroxidase clone encodes a mature protein of 35,813 Da with a putative signal peptide of 27 amino acids in its N-terminus. The amino acid sequence of the soybean peroxidase GMIPER1 is between 54-75% identical to other plant peroxidases including a soybean seed coat peroxidase. Southern blot analysis indicated that multiple copies of sequences related to GMIPER1 exist in the soybean genome. The mRNAs corresponding to the GMIPER1 cDNA accumulated predominantly in the soybean hypocotyls infected with the incompatible race of P. sojae f.sp. glycines, but were expressed at low levels in the compatible interaction. Soybean GMIPER1 mRNAs were not expressed in hypocotyls, leaves, stems, and roots of soybean seedlings. However, treatments with ethephon, salicylic acid or methyl jasmonate induced the accumulation of the GMIPER1 mRNAs in the different organs of soybean. These results suggest that the GMIPER1 gene encoding a putative pathogen-induced peroxidase may play an important role in induced resistance of soybean to P. sojae f.sp. glycines and in response to various external stresses.
The TGA codons are present in the open reading frame of selenoprotein P cDNA
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hill, K.E.; Lloyd, R.S.; Read, R.
1991-03-11
The TGA codon in DNA has been shown to direct incorporation of selenocysteine into protein. Several proteins from bacteria and animals contain selenocysteine in their primary structures. Each of the cDNA clones of these selenoproteins contains one TGA codon in the open reading frame which corresponds to the selenocysteine in the protein. A cDNA clone for selenoprotein P (SeP), obtained from a {gamma}ZAP rat liver library, was sequenced by the dideoxy termination method. The correct reading frame was determined by comparison of the deduced amino acid sequence with the amino acid sequence of several peptides from SeP. Using SeP labelledmore » with {sup 75}Se in vivo, the selenocysteine content of the peptides was verified by the collection of carboxymethylated {sup 77}Se-selenocysteine as it eluted from the amino acid analyzer and determination of the radioactivity contained in the collected samples. Ten TGA codons are present in the open reading frame of the cDNA. Peptide fragmentation studies and the deduced sequence indicate that selenium-rich regions are located close to the carboxy terminus. Nine of the 10 selenocysteines are located in the terminal 26% of the sequence with four in the terminal 15 amino acids. The deduced sequence codes for a protein of 385 amino acids. Cleavage of the signal peptide gives the mature protein with 366 amino acids and a calculated mol wt of 41,052 Da. Searches of PIR and SWISSPROT protein databases revealed no similarity with glutathione peroxidase or other selenoproteins.« less
Sequencing of cDNA Clones from the Genetic Map of Tomato (Lycopersicon esculentum)
Ganal, Martin W.; Czihal, Rosemarie; Hannappel, Ulrich; Kloos, Dorothee-U.; Polley, Andreas; Ling, Hong-Qing
1998-01-01
The dense RFLP linkage map of tomato (Lycopersicon esculentum) contains >300 anonymous cDNA clones. Of those clones, 272 were partially or completely sequenced. The sequences were compared at the DNA and protein level to known genes in databases. For 57% of the clones, a significant match to previously described genes was found. The information will permit the conversion of those markers to STS markers and allow their use in PCR-based mapping experiments. Furthermore, it will facilitate the comparative mapping of genes across distantly related plant species by direct comparison of DNA sequences and map positions. [cDNA sequence data reported in this paper have been submitted to the EMBL database under accession nos. AA824695–AA825005 and the dbEST_Id database under accession nos. 1546519–1546862.] PMID:9724330
DOE Office of Scientific and Technical Information (OSTI.GOV)
Garcia, C.K.; Li, X.; Luna, J.
1994-09-15
Lactate and pyruvate are transported across cell membranes by monocarboxylate transporters (MCTs). Here, the authors use the recently cloned cDNA for hamster MCT1 to isolate cDNA and genomic clones for human MCT1. Comparison of the human and hamster amino acid sequences revealed that the proteins are 86% identical. The gene for human MCT1 (gene symbol, SLC16A1) was localized to human chromosome bands 1p13.2-p12 by PCR analysis of panels of human X rodent cell hybrid lines and by fluorescence chromosomal in situ hybridization. 9 refs., 2 figs.
cDNA cloning of rat and human medium chain acyl-CoA dehydrogenase (MCAD)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Matsubara, Y.; Kraus, J.P.; Rosenberg, L.E.
MCAD is one of three mitochondrial flavoenzymes which catalyze the first step in the ..beta..-oxidation of straight chain fatty acids. It is a tetramer with a subunit Mr of 45 kDa. MCAD is synthesized in the cytosol as a 49 kDa precursor polypeptide (pMCAD), imported into mitochondria, and cleaved to the mature form. Genetic deficiency of MCAD causes recurrent episodes of hypoglycemic coma accompanied by medium chain dicarboxylic aciduria. Employing a novel approach, the authors now report isolation of partial rat and human cDNA clones encoding pMCAD. mRNA encoding pMCAD was purified to near homogeneity by polysome immunoadsorption using polyclonalmore » monospecific antibody. Single-stranded (/sup 32/P)labeled cDNA probe was synthesized using the enriched mRNA as template, and was used to screen directly 16,000 colonies from a total rat liver cDNA library constructed in pBR322. One clone (600 bp) was detected by in situ hybridization. Hybrid-selected translation with this cDNA yielded a 49 kDa polypeptide indistinguishable in size from rat pMCAD and immunoprecipitable with anti-MCAD antibody. Using the rat cDNA as probe, 43,000 colonies from a human liver cDNA library were screened. Four identical positive clones (400 bp) were isolated and positively identified by hybrid-selected translation and immunoprecipitation. The sizes of rat and human mRNAs encoding pMCAD were 2.2 kb and 2.4 kb, respectively, as determined by Northern blotting.« less
Tissue Gene Expression Analysis Using Arrayed Normalized cDNA Libraries
Eickhoff, Holger; Schuchhardt, Johannes; Ivanov, Igor; Meier-Ewert, Sebastian; O'Brien, John; Malik, Arif; Tandon, Neeraj; Wolski, Eryk-Witold; Rohlfs, Elke; Nyarsik, Lajos; Reinhardt, Richard; Nietfeld, Wilfried; Lehrach, Hans
2000-01-01
We have used oligonucleotide-fingerprinting data on 60,000 cDNA clones from two different mouse embryonic stages to establish a normalized cDNA clone set. The normalized set of 5,376 clones represents different clusters and therefore, in almost all cases, different genes. The inserts of the cDNA clones were amplified by PCR and spotted on glass slides. The resulting arrays were hybridized with mRNA probes prepared from six different adult mouse tissues. Expression profiles were analyzed by hierarchical clustering techniques. We have chosen radioactive detection because it combines robustness with sensitivity and allows the comparison of multiple normalized experiments. Sensitive detection combined with highly effective clustering algorithms allowed the identification of tissue-specific expression profiles and the detection of genes specifically expressed in the tissues investigated. The obtained results are publicly available (http://www.rzpd.de) and can be used by other researchers as a digital expression reference. [The sequence data described in this paper have been submitted to the EMBL data library under accession nos. AL360374–AL36537.] PMID:10958641
Wang, L; Eriksson, S
2000-01-01
The subcellular localization of mitochondrial thymidine kinase (TK2) has been questioned, since no mitochondrial targeting sequences have been found in cloned human TK2 cDNAs. Here we report the cloning of mouse TK2 cDNA from a mouse full-length enriched cDNA library. The mouse TK2 cDNA codes for a protein of 270 amino acids, with a 40-amino-acid presumed N-terminal mitochondrial targeting signal. In vitro translation and translocation experiments with purified rat mitochondria confirmed that the N-terminal sequence directed import of the precursor TK2 into the mitochondrial matrix. A single 2.4 kb mRNA transcript was detected in most tissues examined, except in liver, where an additional shorter (1.0 kb) transcript was also observed. There was no correlation between the tissue distribution of TK2 activity and the expression of TK2 mRNA. Full-length mouse TK2 protein and two N-terminally truncated forms, one of which corresponds to the mitochondrial form of TK2 and a shorter form corresponding to the previously characterized recombinant human TK2, were expressed in Escherichia coli and affinity purified. All three forms of TK2 phosphorylated thymidine, deoxycytidine and 2'-deoxyuridine, but with different kinetic efficiencies. A number of cytostatic pyrimidine nucleoside analogues were also tested and shown to be good substrates for the various forms of TK2. The active form of full-length mouse TK2 was a dimer, as judged by Superdex 200 chromatography. These results enhance our understanding of the structure and function of TK2, and may help to explain the mitochondrial disorder, mitochondrial neurogastrointestinal encephalomyopathy. PMID:11023833
Dangoudoubiyam, Sriveny; Vemulapalli, Ramesh; Hancock, Kathy; Kazacos, Kevin R.
2010-01-01
Larva migrans caused by Baylisascaris procyonis is an important zoonotic disease. Current serological diagnostic assays for this disease depend on the use of the parasite's larval excretory-secretory (ES) antigens. In order to identify genes encoding ES antigens and to generate recombinant antigens for use in diagnostic assays, construction and immunoscreening of a B. procyonis third-stage larva cDNA expression library was performed and resulted in identification of a partial-length cDNA clone encoding an ES antigen, designated repeat antigen 1 (RAG1). The full-length rag1 cDNA contained a 753-bp open reading frame that encoded a protein of 250 amino acids with 12 tandem repeats of a 12-amino-acid long sequence. The rag1 genomic DNA revealed a single intron of 837 bp that separated the 753-bp coding sequence into two exons delimited by canonical splice sites. No nucleotide or amino acid sequences present in the GenBank databases had significant similarity with those of RAG1. We have cloned, expressed, and purified the recombinant RAG1 (rRAG1) and analyzed its diagnostic potential by enzyme-linked immunosorbent assay. Anti-Baylisascaris species-specific rabbit serum showed strong reactivity to rRAG1, while only minimal to no reactivity was observed with sera against the related ascarids Toxocara canis and Ascaris suum, strongly suggesting the specificity of rRAG1. On the basis of these results, the identified RAG1 appears to be a promising diagnostic antigen for the development of serological assays for specific detection of B. procyonis larva migrans. PMID:20926699
Ahmad, Muhammad Khairi; Tabana, Yasser M; Ahmed, Mowaffaq Adam; Sandai, Doblin Anak; Mohamed, Rafeezul; Ismail, Ida Shazrina; Zulkiflie, Nurulisa; Yunus, Muhammad Amir
2017-01-01
Background A norovirus maintains its viability, infectivity and virulence by its ability to replicate. However, the biological mechanisms of the process remain to be explored. In this work, the NanoLuc™ Luciferase gene was used to develop a reporter-tagged replicon system to study norovirus replication. Methods The NanoLuc™ Luciferase reporter protein was engineered to be expressed as a fusion protein for MNV-1 minor capsid protein, VP2. The foot-and-mouth disease virus 2A (FMDV2A) sequence was inserted between the 3′end of the reporter gene and the VP2 start sequence to allow co-translational ‘cleavage’ of fusion proteins during intracellular transcript expression. Amplification of the fusion gene was performed using a series of standard and overlapping polymerase chain reactions. The resulting amplicon was then cloned into three readily available backbones of MNV-1 cDNA clones. Results Restriction enzyme analysis indicated that the NanoLucTM Luciferase gene was successfully inserted into the parental MNV-1 cDNA clone. The insertion was further confirmed by using DNA sequencing. Conclusion NanoLuc™ Luciferase-tagged MNV-1 cDNA clones were successfully engineered. Such clones can be exploited to develop robust experimental assays for in vitro assessments of viral RNA replication. PMID:29379384
Eimeria tenella enolase and pyruvate kinase: a likely role in glycolysis and in others functions.
Labbé, Marie; Péroval, Marylène; Bourdieu, Christiane; Girard-Misguich, Fabienne; Péry, Pierre
2006-12-01
Two cDNA codings for glycolytic enzymes were cloned from a cDNA library constructed from the schizont stage of the avian parasite Eimeria tenella. Enolase and pyruvate kinase cDNA were fully sequenced and compared with sequences of enzymes from other organisms. Although these enzymes were already detected in the sporozoite stage, their expression was enhanced during the first schizogony in accordance with the anaerobic conditions of this part of the life cycle of the parasite. Under activating conditions, microscopic observations suggest that these glycolytic enzymes were relocalised inside sporozoites and moreover were in part secreted. The enzymes were also localised at the apex of the first generation of merozoites. Enolase was partly observed inside the nucleus of sporozoites and schizonts. Taken together, these results suggest that glycolytic enzymes not only have a function in glycolysis during anaerobic intracellular stages but may also participate in the invasion process and, for enolase, in the control of gene regulation.
A simplified approach to construct infectious cDNA clones of a tobamovirus in a binary vector.
Junqueira, Bruna Rayane Teodoro; Nicolini, Cícero; Lucinda, Natalia; Orílio, Anelise Franco; Nagata, Tatsuya
2014-03-01
Infectious cDNA clones of RNA viruses are important tools to study molecular processes such as replication and host-virus interactions. However, the cloning steps necessary for construction of cDNAs of viral RNA genomes in binary vectors are generally laborious. In this study, a simplified method of producing an agro-infectious Pepper mild mottle virus (PMMoV) clone is described in detail. Initially, the complete genome of PMMoV was amplified by a single-step RT-PCR, cloned, and subcloned into a small plasmid vector under the T7 RNA polymerase promoter to confirm the infectivity of the cDNA clone through transcript inoculation. The complete genome was then transferred to a binary vector using a single-step, overlap-extension PCR. The selected clones were agro-infiltrated to Nicotiana benthamiana plants and showed to be infectious, causing typical PMMoV symptoms. No differences in host responses were observed when the wild-type PMMoV isolate, the T7 RNA polymerase-derived transcripts and the agroinfiltration-derived viruses were inoculated to N. benthamiana, Capsicum chinense PI 159236 and Capsicum annuum plants. Copyright © 2013 Elsevier B.V. All rights reserved.
Geranyl diphosphate synthase large subunit, and methods of use
Croteau, Rodney B.; Burke, Charles C.; Wildung, Mark R.
2001-10-16
A cDNA encoding geranyl diphosphate synthase large subunit from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase large subunit). In another aspect, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase large subunit. In yet another aspect, the present invention provides isolated, recombinant geranyl diphosphate synthase protein comprising an isolated, recombinant geranyl diphosphate synthase large subunit protein and an isolated, recombinant geranyl diphosphate synthase small subunit protein. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase.
Seki, N; Muramatsu, M; Sugano, S; Suzuki, Y; Nakagawara, A; Ohhira, M; Hayashi, A; Hori, T; Saito, T
1998-01-01
Huntington disease (HD) is an inherited neurodegenerative disorder which is associated with CAG expansion in the coding region of the gene for huntingtin protein. Recently, a huntingtin interacting protein, HIP1, was isolated by the yeast two-hybrid system. Here we report the isolation of a cDNA clone for HIP1R (huntingtin interacting protein-1 related), which encodes a predicted protein product sharing a striking homology with HIP1. RT-PCR analysis showed that the messenger RNA was ubiquitously expressed in various human tissues. Based on PCR-assisted analysis of a radiation hybrid panel and fluorescence in situ hybridization, HIP1R was localized to the q24 region of chromosome 12.
Dean, Caroline; van den Elzen, Peter; Tamaki, Stanley; Dunsmuir, Pamela; Bedbrook, John
1985-01-01
Twenty-six λ phage clones with homology to coding sequences of the small subunit (SSU) of ribulose 1,5-bisphosphate carboxylase have been isolated from an EMBL3 λ phage bank of Petunia (Mitchell) DNA. Restriction mapping of the phage inserts shows that the clones were obtained from five nonoverlapping regions of petunia DNA that carry seven SSU genes. Comparison of the HindIII genomic fragments of petunia DNA with the HindIII restriction fragments of the isolated phage indicates that petunia nuclear DNA encodes eight SSU genes, seven of which are present in the phage clones. Two incomplete genes, which contain only the 3′ end of an SSU gene, were also found in the phage clones. We demonstrate that the eight SSU genes of petunia can be divided into three gene families based on homology to three petunia cDNA clones. Two gene families contain single SSU genes and the third contains six genes, four of which are closely linked within petunia nuclear DNA. Images PMID:16593584
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tomkinson, B.; Jonsson, A-K
1991-01-01
Tripeptidyl peptidase II is a high molecular weight serine exopeptidase, which has been purified from rat liver and human erythrocytes. Four clones, representing 4453 bp, or 90{percent} of the mRNA of the human enzyme, have been isolated from two different cDNA libraries. One clone, designated A2, was obtained after screening a human B-lymphocyte cDNA library with a degenerated oligonucleotide mixture. The B-lymphocyte cDNA library, obtained from human fibroblasts, were rescreened with a 147 bp fragment from the 5{prime} part of the A2 clone, whereby three different overlapping cDNA clones could be isolated. The deduced amino acid sequence, 1196 amino acidmore » residues, corresponding to the longest open rading frame of the assembled nucleotide sequence, was compared to sequences of current databases. This revealed a 56{percent} similarity between the bacterial enzyme subtilisin and the N-terminal part of tripeptidyl peptidase II. The enzyme was found to be represented by two different mRNAs of 4.2 and 5.0 kilobases, respectively, which probably result from the utilziation of two different polyadenylation sites. Futhermore, cDNA corresponding to both the N-terminal and C-terminal part of tripeptidyl peptidase II hybridized with genomic DNA from mouse, horse, calf, and hen, even under fairly high stringency conditions, indicating that tripeptidyl peptidase II is highly conserved.« less
NASA Astrophysics Data System (ADS)
Woon, J. S. K.; Murad, A. M. A.; Abu Bakar, F. D.
2015-09-01
A cellobiohydrolase B (CbhB) from Aspergillus niger ATCC 10574 was cloned and expressed in E. coli. CbhB has an open reading frame of 1611 bp encoding a putative polypeptide of 536 amino acids. Analysis of the encoded polypeptide predicted a molecular mass of 56.2 kDa, a cellulose binding module (CBM) and a catalytic module. In order to obtain the mRNA of cbhB, total RNA was extracted from A. niger cells induced by 1% Avicel. First strand cDNA was synthesized from total RNA via reverse transcription. The full length cDNA of cbhB was amplified by PCR and cloned into the cloning vector, pGEM-T Easy. A comparison between genomic DNA and cDNA sequences of cbhB revealed that the gene is intronless. Upon the removal of the signal peptide, the cDNA of cbhB was cloned into the expression vector pET-32b. However, the recombinant CbhB was expressed in Escherichia coli Origami DE3 as an insoluble protein. A homology model of CbhB predicted the presence of nine disulfide bonds in the protein structure which may have contributed to the improper folding of the protein and thus, resulting in inclusion bodies in E. coli.
Salton, S R
1991-09-01
A nervous system-specific mRNA that is rapidly induced in PC12 cells to a greater extent by nerve growth factor (NGF) than by epidermal growth factor treatment has been cloned. The polypeptide deduced from the nucleic acid sequence of the NGF33.1 cDNA clone contains regions of amino acid sequence identity with that predicted by the cDNA clone VGF, and further analysis suggests that both NGF33.1 and VGF cDNA clones very likely correspond to the same mRNA (VGF). In this report both the nucleic acid sequence that corresponds to VGF mRNA and the polypeptide predicted by the NGF33.1 cDNA clone are presented. Genomic Southern analysis and database comparison did not detect additional sequences with high homology to the VGF gene. Induction of VGF mRNA by depolarization and phorbol 12-myristate 13-acetate treatment was greater than by serum stimulation or protein kinase A pathway activation. These studies suggest that VGF mRNA is induced to the greatest extent by NGF treatment and that VGF is one of the most rapidly regulated neuronal mRNAs identified in PC12 cells.
The cDNA sequence of a neutral horseradish peroxidase.
Bartonek-Roxå, E; Eriksson, H; Mattiasson, B
1991-02-16
A cDNA clone encoding a horseradish (Armoracia rusticana) peroxidase has been isolated and characterized. The cDNA contains 1378 nucleotides excluding the poly(A) tail and the deduced protein contains 327 amino acids which includes a 28 amino acid leader sequence. The predicted amino acid sequence is nine amino acids shorter than the major isoenzyme belonging to the horseradish peroxidase C group (HRP-C) and the sequence shows 53.7% identity with this isoenzyme. The described clone encodes nine cysteines of which eight correspond well with the cysteines found in HRP-C. Five potential N-glycosylation sites with the general sequence Asn-X-Thr/Ser are present in the deduced sequence. Compared to the earlier described HRP-C this is three glycosylation sites less. The shorter sequence and fewer N-glycosylation sites give the native isoenzyme a molecular weight of several thousands less than the horseradish peroxidase C isoenzymes. Comparison with the net charge value of HRP-C indicates that the described cDNA clone encodes a peroxidase which has either the same or a slightly less basic pI value, depending on whether the encoded protein is N-terminally blocked or not. This excludes the possibility that HRP-n could belong to either the HRP-A, -D or -E groups. The low sequence identity (53.7%) with HRP-C indicates that the described clone does not belong to the HRP-C isoenzyme group and comparison of the total amino acid composition with the HRP-B group does not place the described clone within this isoenzyme group. Our conclusion is that the described cDNA clone encodes a neutral horseradish peroxidase which belongs to a new, not earlier described, horseradish peroxidase group.
1987-10-13
after multiple passages in vivo and in vitro. J. Gen. Virol. 67, 1741- 1744. Sabin , A.B. (1985). Oral poliovirus vaccine : history of its development...IN (N NEW APPROACHES TO ATTENUATED HEPATITIS A VACCINE DEVELOPMENT: Q) CLONING AND SEQUENCING OF CELL-CULTURE ADAPTED VIRAL cDNA I ANNUAL REPORT...6ll02Bsl0 A 055 11. TITLE (Include Security Classification) New Approaches to Attenuated Hepatitis A Vaccine Development: Cloning and Sequencing of Cell
Ferriols, Victor Marco Emmanuel N.; Yaginuma, Ryoko; Adachi, Masao; Takada, Kentaro; Matsunaga, Shigeki; Okada, Shigeru
2015-01-01
The diatom Rhizosolenia setigera Brightwell produces highly branched isoprenoid (HBI) hydrocarbons that are ubiquitously present in marine environments. The hydrocarbon composition of R. setigera varies between C25 and C30 HBIs depending on the life cycle stage with regard to auxosporulation. To better understand how these hydrocarbons are biosynthesized, we characterized the farnesyl pyrophosphate (FPP) synthase (FPPS) enzyme of R. setigera. An isolated 1465-bp cDNA clone contained an open reading frame spanning 1299-bp encoding a protein with 432 amino acid residues. Expression of the RsFPPS cDNA coding region in Escherichia coli produced a protein that exhibited FPPS activity in vitro. A reduction in HBI content from diatoms treated with an FPPS inhibitor, risedronate, suggested that RsFPPS supplies precursors for HBI biosynthesis. Product analysis by gas chromatography-mass spectrometry also revealed that RsFPPS produced small amounts of the cis-isomers of geranyl pyrophosphate and FPP, candidate precursors for the cis-isomers of HBIs previously characterized. Furthermore, RsFPPS gene expression at various life stages of R. setigera in relation to auxosporulation were also analyzed. Herein, we present data on the possible role of RsFPPS in HBI biosynthesis, and it is to our knowledge the first instance that an FPPS was cloned and characterized from a diatom. PMID:25996801
[Screening and identification of anoikis-resistant gene UBCH7 in esophageal cancer cells].
Yang, Yang; Wang, Bo-Shi; Wang, Xiao-Min; Zhang, Yu; Wang, Ming-Rong; Jia, Xue-Mei
2012-02-01
Anoikis is a kind of programmed cell death induced by loss of extracellular matrix (ECM) adhesion, which is one of key factors for homestasis. Resistance to anoikis is required for tumor cell metastasis. We have previously shown several anoikis-resistance genes in esophageal squamous cell carcinoma (ESCC). In order to find novel anoikis-resistant genes in ESCC, we constructed retroviral cDNA library using total RNA from ESCC cell lines. NIH 3T3 cells, which are sensitive to anoikis, were infected with the library constructed. The cells were cultured in soft agar, and the clones which can survive in detached states were selected. The cDNAs inserted into the anoikis-resistant NIH3T3 clones were amplified using retroviral specific primers. Sequencing analysis showed that a cDNA fragment inserted into the anoikis-resistant clone contains full coding sequence (ORF) of human UBCH7/UBE2L3 gene. By infection with retrovirus encoding UBCH7 ORF (pMSCV-UBCH7), forced expression of UBCH7 increased the anoikis-resistance of NIH3T3 cells. More importantly, knockdown of UBCH7 expression by siRNA transfection reduced the anoikis-resistant ability of esophageal cancer MLuC1 cells. The data suggest that UBCH7/UBE2L3 gene would be involved in anoikis-resistance in ESCC.
Hall, L; Laird, J E; Craig, R K
1984-01-01
Nucleotide sequence analysis of cloned guinea-pig casein B cDNA sequences has identified two casein B variants related to the bovine and rat alpha s1 caseins. Amino acid homology was largely confined to the known bovine or predicted rat phosphorylation sites and within the 'signal' precursor sequence. Comparison of the deduced nucleotide sequence of the guinea-pig and rat alpha s1 casein mRNA species showed greater sequence conservation in the non-coding than in the coding regions, suggesting a functional and possibly regulatory role for the non-coding regions of casein mRNA. The results provide insight into the evolution of the casein genes, and raise questions as to the role of conserved nucleotide sequences within the non-coding regions of mRNA species. Images Fig. 1. PMID:6548375
Gomez, Ana; Cardoso, Christiane; Genta, Fernando A; Terra, Walter R; Ferreira, Clélia
2013-08-01
The soluble midgut trehalase from Tenebrio molitor (TmTre1) was purified after several chromatographic steps, resulting in an enzyme with 58 kDa and pH optimum 5.3 (ionizing active groups in the free enzyme: pK(e1) = 3.8 ± 0.2 pK(e2) = 7.4 ± 0.2). The purified enzyme corresponds to the deduced amino acid sequence of a cloned cDNA (TmTre1-cDNA), because a single cDNA coding a soluble trehalase was found in the T. molitor midgut transcriptome. Furthermore, the mass of the protein predicted to be coded by TmTre1-cDNA agrees with that of the purified enzyme. TmTre1 has the essential catalytic groups Asp 315 and Glu 513 and the essential Arg residues R164, R217, R282. Carbodiimide inactivation of the purified enzyme at different pH values reveals an essential carboxyl group with pKa = 3.5 ± 0.3. Phenylglyoxal modified a single Arg residue with pKa = 7.5 ± 0.2, as observed in the soluble trehalase from Spodoptera frugiperda (SfTre1). Diethylpyrocarbonate modified a His residue that resulted in a less active enzyme with pK(e1) changed to 4.8 ± 0.2. In TmTre1 the modified His residue (putatively His 336) is more exposed than the His modified in SfTre1 (putatively His 210) and that affects the ionization of an Arg residue. The architecture of the active site of TmTre1 and SfTre1 is different, as shown by multiple inhibition analysis, the meaning of which demands further research. Trehalase sequences obtained from midgut transcriptomes (pyrosequencing and Illumina data) from 8 insects pertaining to 5 different orders were used in a cladogram, together with other representative sequences. The data suggest that the trehalase gene went duplication and divergence prior to the separation of the paraneopteran and holometabolan orders and that the soluble trehalase derived from the membrane-bound one by losing the C-terminal transmembrane loop. Copyright © 2013 Elsevier Ltd. All rights reserved.
Cui, Tian Tian; Bin, Yu; Yan, Jian Hong; Mei, Peng Ying; Li, Zhong An; Zhou, Chang Yong; Song, Zhen
2018-05-04
Yellow vein clearing disease (YVCD) causes significant economic losses in lemon and other species of citrus. Usually, citrus yellow vein clearing virus (CYVCV) is considered to be the causal agent of YVCD. However, mixed infection of CYVCV and Indian citrus ringspot virus (ICRSV) or other pathogens is often detected in citrus plants with YVCD. In this study, we re-examined the causal agent of YVCD to fulfill Koch's postulates. First, the full-length genome of CYVCV isolate AY (CYVCV-AY) was amplified by long-distance RT-PCR from a Eureka lemon [Citrus limon (L) Brum. f.] tree with typical YVCD symptoms. The genomic cDNAs were then cloned into a ternary Yeast-Escherichia coli-Agrobacterium tumefaciens shuttle vector, pCY, using transformation-associated recombination (TAR) strategy, and 15 full-length cDNA clones of CYVCV-AY were obtained. Subsequently, four of these clones were selected randomly and inoculated on Jincheng [C. sinensis (L) Osbeck] seedlings through Agrobacterium-mediated vacuum-infiltration, and it was found that 80 to 100% of inoculated plants were infected with CYVCV by RT-PCR at 20 to 40 days post inoculation (dpi) and by direct tissue blot immunoassay at 60 dpi. The progeny of CYVCV-AY from cDNA clones caused typical symptoms of YVCD such as yellow vein clearing, leaf distortion, and chlorosis, which were the same as that elicited by wild-type virus. Finally, the regeneration of CYVCV-AY genome was confirmed by long-distance RT-PCR in lemon trees inoculated with the infectious cDNA clone. These results proved that CYVCV was the primary causal agent of YVCD. This is the first report on the development of infectious cDNA clones of CYVCV, which lays the foundation for further studies on viral gene functions and virus-host interactions.
Friis, Thor Einar; Stephenson, Sally; Xiao, Yin; Whitehead, Jon
2014-01-01
The sheep (Ovis aries) is favored by many musculoskeletal tissue engineering groups as a large animal model because of its docile temperament and ease of husbandry. The size and weight of sheep are comparable to humans, which allows for the use of implants and fixation devices used in human clinical practice. The construction of a complimentary DNA (cDNA) library can capture the expression of genes in both a tissue- and time-specific manner. cDNA libraries have been a consistent source of gene discovery ever since the technology became commonplace more than three decades ago. Here, we describe the construction of a cDNA library using cells derived from sheep bones based on the pBluescript cDNA kit. Thirty clones were picked at random and sequenced. This led to the identification of a novel gene, C12orf29, which our initial experiments indicate is involved in skeletal biology. We also describe a polymerase chain reaction-based cDNA clone isolation method that allows the isolation of genes of interest from a cDNA library pool. The techniques outlined here can be applied in-house by smaller tissue engineering groups to generate tools for biomolecular research for large preclinical animal studies and highlights the power of standard cDNA library protocols to uncover novel genes. PMID:24447069
Characterization of a Novel Polerovirus Infecting Maize in China
Chen, Sha; Jiang, Guangzhuang; Wu, Jianxiang; Liu, Yong; Qian, Yajuan; Zhou, Xueping
2016-01-01
A novel virus, tentatively named Maize Yellow Mosaic Virus (MaYMV), was identified from the field-grown maize plants showing yellow mosaic symptoms on the leaves collected from the Yunnan Province of China by the deep sequencing of small RNAs. The complete 5642 nucleotide (nt)-long genome of the MaYMV shared the highest nucleotide sequence identity (73%) to Maize Yellow Dwarf Virus-RMV. Sequence comparisons and phylogenetic analyses suggested that MaYMV represents a new member of the genus Polerovirus in the family Luteoviridae. Furthermore, the P0 protein encoded by MaYMV was demonstrated to inhibit both local and systemic RNA silencing by co-infiltration assays using transgenic Nicotiana benthamiana line 16c carrying the GFP reporter gene, which further supported the identification of a new polerovirus. The biologically-active cDNA clone of MaYMV was generated by inserting the full-length cDNA of MaYMV into the binary vector pCB301. RT-PCR and Northern blot analyses showed that this clone was systemically infectious upon agro-inoculation into N. benthamiana. Subsequently, 13 different isolates of MaYMV from field-grown maize plants in different geographical locations of Yunnan and Guizhou provinces of China were sequenced. Analyses of their molecular variation indicate that the 3′ half of P3–P5 read-through protein coding region was the most variable, whereas the coat protein- (CP-) and movement protein- (MP-)coding regions were the most conserved. PMID:27136578
Characterization of a Novel Polerovirus Infecting Maize in China.
Chen, Sha; Jiang, Guangzhuang; Wu, Jianxiang; Liu, Yong; Qian, Yajuan; Zhou, Xueping
2016-04-28
A novel virus, tentatively named Maize Yellow Mosaic Virus (MaYMV), was identified from the field-grown maize plants showing yellow mosaic symptoms on the leaves collected from the Yunnan Province of China by the deep sequencing of small RNAs. The complete 5642 nucleotide (nt)-long genome of the MaYMV shared the highest nucleotide sequence identity (73%) to Maize Yellow Dwarf Virus-RMV. Sequence comparisons and phylogenetic analyses suggested that MaYMV represents a new member of the genus Polerovirus in the family Luteoviridae. Furthermore, the P0 protein encoded by MaYMV was demonstrated to inhibit both local and systemic RNA silencing by co-infiltration assays using transgenic Nicotiana benthamiana line 16c carrying the GFP reporter gene, which further supported the identification of a new polerovirus. The biologically-active cDNA clone of MaYMV was generated by inserting the full-length cDNA of MaYMV into the binary vector pCB301. RT-PCR and Northern blot analyses showed that this clone was systemically infectious upon agro-inoculation into N. benthamiana. Subsequently, 13 different isolates of MaYMV from field-grown maize plants in different geographical locations of Yunnan and Guizhou provinces of China were sequenced. Analyses of their molecular variation indicate that the 3' half of P3-P5 read-through protein coding region was the most variable, whereas the coat protein- (CP-) and movement protein- (MP-)coding regions were the most conserved.
Subramaniam, R; Reinold, S; Molitor, E K; Douglas, C J
1993-01-01
A heterologous probe encoding phenylalanine ammonia-lyase (PAL) was used to identify PAL clones in cDNA libraries made with RNA from young leaf tissue of two Populus deltoides x P. trichocarpa F1 hybrid clones. Sequence analysis of a 2.4-kb cDNA confirmed its identity as a full-length PAl clone. The predicted amino acid sequence is conserved in comparison with that of PAL genes from several other plants. Southern blot analysis of popular genomic DNA from parental and hybrid individuals, restriction site polymorphism in PAL cDNA clones, and sequence heterogeneity in the 3' ends of several cDNA clones suggested that PAL is encoded by at least two genes that can be distinguished by HindIII restriction site polymorphisms. Clones containing each type of PAL gene were isolated from a poplar genomic library. Analysis of the segregation of PAL-specific HindIII restriction fragment-length polymorphisms demonstrated the existence of two independently segregating PAL loci, one of which was mapped to a linkage group of the poplar genetic map. Developmentally regulated PAL expression in poplar was analyzed using RNA blots. Highest expression was observed in young stems, apical buds, and young leaves. Expression was lower in older stems and undetectable in mature leaves. Cellular localization of PAL expression by in situ hybridization showed very high levels of expression in subepidermal cells of leaves early during leaf development. In stems and petioles, expression was associated with subepidermal cells and vascular tissues. PMID:8108506
Tetteh, Kevin K. A.; Loukas, Alex; Tripp, Cindy; Maizels, Rick M.
1999-01-01
Larvae of Toxocara canis, a nematode parasite of dogs, infect humans, causing visceral and ocular larva migrans. In noncanid hosts, larvae neither grow nor differentiate but endure in a state of arrested development. Reasoning that parasite protein production is orientated to immune evasion, we undertook a random sequencing project from a larval cDNA library to characterize the most highly expressed transcripts. In all, 266 clones were sequenced, most from both 3′ and 5′ ends, and similarity searches against GenBank protein and dbEST nucleotide databases were conducted. Cluster analyses showed that 128 distinct gene products had been found, all but 3 of which represented newly identified genes. Ninety-five genes were represented by a single clone, but seven transcripts were present at high frequencies, each composing >2% of all clones sequenced. These high-abundance transcripts include a mucin and a C-type lectin, which are both major excretory-secretory antigens released by parasites. Four highly expressed novel gene transcripts, termed ant (abundant novel transcript) genes, were found. Together, these four genes comprised 18% of all cDNA clones isolated, but no similar sequences occur in the Caenorhabditis elegans genome. While the coding regions of the four genes are dissimilar, their 3′ untranslated tracts have significant homology in nucleotide sequence. The discovery of these abundant, parasite-specific genes of newly identified lectins and mucins, as well as a range of conserved and novel proteins, provides defined candidates for future analysis of the molecular basis of immune evasion by T. canis. PMID:10456930
Gilchrist, Michael J.; Sobral, Daniel; Khoueiry, Pierre; ...
2015-05-27
Genome-wide resources, such as collections of cDNA clones encoding for complete proteins (full-ORF clones), are crucial tools for studying the evolution of gene function and genetic interactions. Non-model organisms, in particular marine organisms, provide a rich source of functional diversity. Marine organism genomes are, however, frequently highly polymorphic and encode proteins that diverge significantly from those of well-annotated model genomes. The construction of full-ORF clone collections from non-model organisms is hindered by the difficulty of predicting accurately the N-terminal ends of proteins, and distinguishing recent paralogs from highly polymorphic alleles. We also report a computational strategy that overcomes these difficulties,more » and allows for accurate gene level clustering of transcript data followed by the automated identification of full-ORFs with correct 5'- and 3'-ends. It is robust to polymorphism, includes paralog calling and does not require evolutionary proximity to well annotated model organisms. Here, we developed this pipeline for the ascidian Ciona intestinalis, a highly polymorphic member of the divergent sister group of the vertebrates, emerging as a powerful model organism to study chordate gene function, Gene Regulatory Networks and molecular mechanisms underlying human pathologies. Furthermore, using this pipeline we have generated the first full-ORF collection for a highly polymorphic marine invertebrate. It contains 19,163 full-ORF cDNA clones covering 60% of Ciona coding genes, and full-ORF orthologs for approximately half of curated human disease-associated genes.« less
NASA Astrophysics Data System (ADS)
Kikuchi, Shoshi
2009-02-01
Completion of the high-precision genome sequence analysis of rice led to the collection of about 35,000 full-length cDNA clones and the determination of their complete sequences. Mapping of these full-length cDNA sequences has given us information on (1) the number of genes expressed in the rice genome; (2) the start and end positions and exon-intron structures of rice genes; (3) alternative transcripts; (4) possible encoded proteins; (5) non-protein-coding (np) RNAs; (6) the density of gene localization on the chromosome; (7) setting the parameters of gene prediction programs; and (8) the construction of a microarray system that monitors global gene expression. Manual curation for rice gene annotation by using mapping information on full-length cDNA and EST assemblies has revealed about 32,000 expressed genes in the rice genome. Analysis of major gene families, such as those encoding membrane transport proteins (pumps, ion channels, and secondary transporters), along with the evolution from bacteria to higher animals and plants, reveals how gene numbers have increased through adaptation to circumstances. Family-based gene annotation also gives us a new way of comparing organisms. Massive amounts of data on gene expression under many kinds of physiological conditions are being accumulated in rice oligoarrays (22K and 44K) based on full-length cDNA sequences. Cluster analyses of genes that have the same promoter cis-elements, that have similar expression profiles, or that encode enzymes in the same metabolic pathways or signal transduction cascades give us clues to understanding the networks of gene expression in rice. As a tool for that purpose, we recently developed "RiCES", a tool for searching for cis-elements in the promoter regions of clustered genes.
[Cloning and characterization of a novel rat gene RSD-7 differentially expressed in testis].
Zhang, Xiao-dong; Gou, Da-wei; Miao, Shi-ying; Zhang, Jian-chao; Zong, Shu-dong; Wang, Lin-fang
2003-06-01
To isolate and identify the differentially expressed genes in spermatogenesis for the understanding molecular mechanism of spermatogenesis. Screening of the cDNA library, Northern blot, expression and purification in E. coli with GST expression system, immunocytochemical staining of testis sections were used. (1) A cDNA fragment designated as RSD-7 was isolated from rat testis cDNA library. It was 1,238 bp in length, coding a protein of 232 amino acids with the GenBank accession number AF315467. The encoding protein of RSD-7 cDNA had a Ubiquitin-like domain. (2) Northern blot indicated that RSD-7 was uniquely expressed in rat testis, and in the testis RSD-7 emerged on the 30th postnatal day and expressed until 120th postnatal day. (3) Expression and purification of RSD-7 protein in E. coli with GST expression system and were used to obtain anti-RSD-7 antibody. (4) Immunolocalization of RSD-7 in rat testis revealed that it is expressed only in Sertoli cells. Transcription pattern of RSD-7 and localization of RSD-7 protein in testis have been made, which established the base for the functional study of RSD-7.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Feyereisen-Koener, J.M.
Double-stranded cDNA was prepared from infectious hematopoietic necrosis virus mRNA and cloned into the plasmid vector pUC8. A coprotein (G-protein) of infectious hematopoietic necrosis virus was selected by hybridization to a /sup 32/P-labeled probe. The restriction map and nucleotide sequence of the mRNA encoding the glycoprotein of infectious hematopoietic necrosis virus was determined using this full-length cDNA clone.
Horibata, Y; Okino, N; Ichinose, S; Omori, A; Ito, M
2000-10-06
Endoglycoceramidase (EC ) is an enzyme capable of cleaving the glycosidic linkage between oligosaccharides and ceramides in various glycosphingolipids. We report here the purification, characterization, and cDNA cloning of a novel endoglycoceramidase from the jellyfish, Cyanea nozakii. The purified enzyme showed a single protein band estimated to be 51 kDa on SDS-polyacrylamide gel electrophoresis. The enzyme showed a pH optimum of 3.0 and was activated by Triton X-100 and Lubrol PX but not by sodium taurodeoxycholate. This enzyme preferentially hydrolyzed gangliosides, especially GT1b and GQ1b, whereas neutral glycosphingolipids were somewhat resistant to hydrolysis by the enzyme. A full-length cDNA encoding the enzyme was cloned by 5'- and 3'-rapid amplification of cDNA ends using a partial amino acid sequence of the purified enzyme. The open reading frame of 1509 nucleotides encoded a polypeptide of 503 amino acids including a signal sequence of 25 residues and six potential N-glycosylation sites. Interestingly, the Asn-Glu-Pro sequence, which is the putative active site of Rhodococcus endoglycoceramidase, was conserved in the deduced amino acid sequences. This is the first report of the cloning of an endoglycoceramidase from a eukaryote.
Li, Shuang; Zhang, Lijiao; Wang, Yongyue; Wang, Shuxia; Sun, Haigang; Su, Wenliang; He, Weiyong; Han, Bo; Su, Jingliang
2013-01-01
Duck Tembusu virus (TMUV) is a recently identified pathogenic flavivirus that causes severe egg drop and encephalitis in Chinese ducks and geese. It has been found to be most closely related to the mosquito-origin Tembusu virus and chicken Sitiawan virus reported in Malaysia. However, the ecological characteristics and the pathogenesis of duck TMUV are largely unknown. We report the construction of full-length cDNA clone of duck TMUV strain JXSP. The virus genome was reverse transcribed, amplified as seven overlapping fragments and successively ligated into the low copy number vector pWSK29 under the control of a T7 promoter. Transfection of BHK-21 cells with the transcribed RNA from the full-length cDNA clone resulted in production of highly infectious progeny virus. In vitro growth characteristics in BHK-21 cells and virulence in ducklings and BALB/c mice were similar for the rescued and parental viruses. This stable infectious cDNA clone will be a valuable tool for studying the genetic determinants of duck TMUV. Copyright © 2012 Elsevier B.V. All rights reserved.
Identification of a G protein coupled receptor induced in activated T cells.
Kaplan, M H; Smith, D I; Sundick, R S
1993-07-15
Many genes are induced after T cell activation to make a cell competent for proliferation and ultimately, function. Many of these genes encode surface receptors for growth factors that signal a cell to proliferate. We have cloned a novel gene (clone 6H1) that codes for a member of the G protein-coupled receptor superfamily. This gene was isolated from a chicken activated T cell cDNA library by low level hybridization to mammalian IL-2 cDNA probes. The 308 amino acid open reading frame has seven hydrophobic, presumably transmembrane domains and a consensus site for interaction with G proteins. Tissue distribution studies suggest that gene expression is restricted to activated T cells. The message appears by 1 h after activation and is maintained for at least 45 h. Transcription of 6H1 is induced by a number of T cell stimuli and is inhibited by cyclosporin A, but not by cycloheximide. This is the first description of a member of this superfamily expressed specifically in activated T cells. The gene product may provide a link between T cell growth factors and G protein activation.
Sicot, F X; Mesnage, M; Masselot, M; Exposito, J Y; Garrone, R; Deutsch, J; Gaill, F
2000-09-29
The annelid Alvinella pompejana is probably the most heat-tolerant metazoan organism known. Previous results have shown that the level of thermal stability of its interstitial collagen is significantly greater than that of coastal annelids and of vent organisms, such as the vestimentiferan Riftia pachyptila, living in colder parts of the deep-sea hydrothermal environment. In order to investigate the molecular basis of this thermal behavior, we cloned and sequenced a large cDNA molecule coding the fibrillar collagen of Alvinella, including one half of the helical domain and the entire C-propeptide domain. For comparison, we also cloned the 3' part of the homologous cDNA from Riftia. Comparison of the corresponding helical domains of these two species, together with that of the previously sequenced domain of the coastal lugworm Arenicola marina, showed that the increase in proline content and in the number of stabilizing triplets correlate with the outstanding thermostability of the interstitial collagen of A. pompejana. Phylogenetic analysis showed that triple helical and the C-propeptide parts of the same collagen molecule evolve at different rates, in favor of an adaptive mechanism at the molecular level. Copyright 2000 Academic Press.
Mizrahi-Aviv, Ela; Mills, David; Benzioni, Aliza; Bar-Zvi, Dudy
2002-10-01
Salt stress results in a massive change in gene expression. An 837 bp cDNA designated ScRab was cloned from shoot cultures of the salt tolerant jojoba (Simmondsia chinesis). The cloned cDNA encodes a full length 200 amino acid long polypeptide that bears high homology to the Rab subfamily of small GTP binding proteins, particularly, the Rab5 subfamily. ScRab expression is reduced in shoots grown in the presence of salt compared to shoots from non-stressed cultures. His6-tagged ScRAB protein was expressed in E. coli, and purified to homogeneity. The purified protein bound radiolabelled GTP. The unlabelled guanine nucleotides GTP, GTP gamma S and GDP but not ATP, CTP or UTP competed with GTP binding.
Londraville, R L; Cramer, T D; Franck, J P; Tullis, A; Block, B A
2000-10-01
Complete cDNAs for the fast-twitch Ca2+ -ATPase isoform (SERCA 1) were cloned and sequenced from blue marlin (Makaira nigricans) extraocular muscle (EOM). Complete cDNAs for SERCA 1 were also cloned from fast-twitch skeletal muscle of the same species. The two sequences are identical over the coding region except for the last five codons on the carboxyl end; EOM SERCA 1 cDNA codes for 996 amino acids and the fast-twitch cDNAs code for 991 aa. Phylogenetic analysis revealed that EOM SERCA 1 clusters with an isoform of Ca2+ -ATPase normally expressed in early development of mammals (SERCA 1B). This is the first report of SERCA 1B in an adult vertebrate. RNA hybridization assays indicate that 1B expression is limited to extraocular muscles. Because EOM gives rise to the thermogenic heater organ in marlin, we investigated whether SERCA 1B may play a role in heat generation, or if 1B expression is common in EOM among vertebrates. Chicken also expresses SERCA 1B in EOM, but rat expresses SERCA 1A; because SERCA 1B is not specific to heater tissue we conclude it is unlikely that it plays a specific role in intracellular heat production. Comparative sequence analysis does reveal, however, several sites that may be the source of functional differences between fish and mammalian SERCAs.
Urade, Y; Oberdick, J; Molinar-Rode, R; Morgan, J I
1991-01-01
The cerebellum contains a hexadecapeptide, termed cerebellin, that is conserved in sequence from human to chicken. Three independent, overlapping cDNA clones have been isolated from a human cerebellum cDNA library that encode the cerebellin sequence. The longest clone codes for a protein of 193 amino acids that we term precerebellin. This protein has a significant similarity (31.3% identity, 52.2% similarity) to the globular (non-collagen-like) region of the B chain of human complement component C1q. The region of relatedness extends over approximately 145 amino acids located in the carboxyl terminus of both proteins. Unlike C1q B chain, no collagen-like motifs are present in the amino-terminal regions of precerebellin. The amino terminus of precerebellin contains three possible N-linked glycosylation sites. Although hydrophobic amino acids are clustered at the amino terminus, they do not conform to the classical signal-peptide motif, and no other obvious membrane-spanning domains are predicted from the cDNA sequence. The cDNA predicts that the cerebellin peptide is flanked by Val-Arg and Glu-Pro residues. Therefore, cerebellin is not liberated from precerebellin by the classical dibasic amino acid proteolytic-cleavage mechanism seen in many neuropeptide precursors. In Northern (RNA) blots, precerebellin transcripts, with four distinct sizes (1.8, 2.3, 2.7, and 3.0 kilobases), are abundant in cerebellum. These transcripts are present at either very low or undetectable levels in other brain areas and extraneural structures. A similar pattern of cerebellin precursor transcripts are seen in rat, mouse, and human cerebellum. Furthermore, a partial genomic fragment from mouse shows the same bands in Northern blots as the human cDNA clone. During rat development, precerebellin transcripts mirror the level of cerebellin peptide. Low levels of precerebellin mRNA are seen at birth. Levels increase modestly from postpartum day 1 to 8, then increase more dramatically between day 5 and 15, and eventually reach peak values between day 21 and 56. Because cerebellin-like immunoreactivity is associated with Purkinje cell postsynaptic structures, these data raise interesting possibilities concerning the function of the cerebellin precursor in synaptic physiology. Images PMID:1704129
Wang, H; Miao, S; Chen, D; Wang, L; Koide, S S
1999-10-06
The gene (HSD-1) coding a human sperm membrane protein (hSMP-1) was isolated from a human testis cDNA expression library using antibodies found in the serum of an infertile woman. HSD-1 was localized to a single locus on chromosome 9 and assigned to band 9p12-p13 by fluorescent in situ hybridization (FISH) mapping and DAPI (4,6-diamidino-2-phenylindole) banding, using rat/human somatic cell hybrids and metaphase chromosomes of human lymphocytes. In rescreening a testis lambdagt10 cDNA expression library, the full-length cDNA (HSD-1) and several truncated cDNAs with heterologous regions were isolated from positive clones. The heterology consisted of deletion, insertion and alteration of the 5'-end. These heterologous truncated fragments may be produced by alternative splicing of mRNAs. Two recombinant prokaryotic expression vectors were constructed with one of the heterologous fragment (clone #26) with and without the alternative 5'-end. Escherichia coli transfected with the construct containing the alternative 5'-end failed to produce the recombinant product, whereas those transfected with the vector lacking the 5'-end produced hSMP-1. DNASIS analysis of the structure of #26 mRNA suggests that the 5'-end has a stable secondary configuration that may maintain the mRNA in an inactivated state, whereby hindering its translation and preventing the expression of the gene.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Woon, J. S. K., E-mail: jameswoon@siswa.ukm.edu.my; Murad, A. M. A., E-mail: munir@ukm.edu.my; Abu Bakar, F. D., E-mail: fabyff@ukm.edu.my
A cellobiohydrolase B (CbhB) from Aspergillus niger ATCC 10574 was cloned and expressed in E. coli. CbhB has an open reading frame of 1611 bp encoding a putative polypeptide of 536 amino acids. Analysis of the encoded polypeptide predicted a molecular mass of 56.2 kDa, a cellulose binding module (CBM) and a catalytic module. In order to obtain the mRNA of cbhB, total RNA was extracted from A. niger cells induced by 1% Avicel. First strand cDNA was synthesized from total RNA via reverse transcription. The full length cDNA of cbhB was amplified by PCR and cloned into the cloning vector, pGEM-Tmore » Easy. A comparison between genomic DNA and cDNA sequences of cbhB revealed that the gene is intronless. Upon the removal of the signal peptide, the cDNA of cbhB was cloned into the expression vector pET-32b. However, the recombinant CbhB was expressed in Escherichia coli Origami DE3 as an insoluble protein. A homology model of CbhB predicted the presence of nine disulfide bonds in the protein structure which may have contributed to the improper folding of the protein and thus, resulting in inclusion bodies in E. coli.« less
Sikorav, J L; Duval, N; Anselmet, A; Bon, S; Krejci, E; Legay, C; Osterlund, M; Reimund, B; Massoulié, J
1988-01-01
In this paper, we show the existence of alternative splicing in the 3' region of the coding sequence of Torpedo acetylcholinesterase (AChE). We describe two cDNA structures which both diverge from the previously described coding sequence of the catalytic subunit of asymmetric (A) forms (Schumacher et al., 1986; Sikorav et al., 1987). They both contain a coding sequence followed by a non-coding sequence and a poly(A) stretch. Both of these structures were shown to exist in poly(A)+ RNAs, by S1 mapping experiments. The divergent region encoded by the first sequence corresponds to the precursor of the globular dimeric form (G2a), since it contains the expected C-terminal amino acids, Ala-Cys. These amino acids are followed by a 29 amino acid extension which contains a hydrophobic segment and must be replaced by a glycolipid in the mature protein. Analyses of intact G2a AChE showed that the common domain of the protein contains intersubunit disulphide bonds. The divergent region of the second type of cDNA consists of an adjacent genomic sequence, which is removed as an intron in A and Ga mRNAs, but may encode a distinct, less abundant catalytic subunit. The structures of the cDNA clones indicate that they are derived from minor mRNAs, shorter than the three major transcripts which have been described previously (14.5, 10.5 and 5.5 kb). Oligonucleotide probes specific for the asymmetric and globular terminal regions hybridize with the three major transcripts, indicating that their size is determined by 3'-untranslated regions which are not related to the differential splicing leading to A and Ga forms. Images PMID:3181125
Hirotani, M; Kuroda, R; Suzuki, H; Yoshikawa, T
2000-05-01
A cDNA encoding UDP-glucose: baicalein 7-O-glucosyltransferase (UBGT) was isolated from a cDNA library from hairy root cultures of Scutellaria baicalensis Georgi probed with a partial-length cDNA clone of a UDP-glucose: flavonoid 3-O-glucosyltransferase (UFGT) from grape (Vitis vinifera L.). The heterologous probe contained a glucosyltransferase consensus amino acid sequence which was also present in the Scutellaria cDNA clones. The complete nucleotide sequence of the 1688-bp cDNA insert was determined and the deduced amino acid sequences are presented. The nucleotide sequence analysis of UBGT revealed an open reading frame encoding a polypeptide of 476 amino acids with a calculated molecular mass of 53,094 Da. The reaction product for baicalein and UDP-glucose catalyzed by recombinant UBGT in Escherichia coli was identified as authentic baicalein 7-O-glucoside using high-performance liquid chromatography and proton nuclear magnetic resonance spectroscopy. The enzyme activities of recombinant UBGT expressed in E. coli were also detected towards flavonoids such as baicalein, wogonin, apigenin, scutellarein, 7,4'-dihydroxyflavone and kaempferol, and phenolic compounds. The accumulation of UBGT mRNA in hairy roots was in response to wounding or salicylic acid treatments.
HUNT: launch of a full-length cDNA database from the Helix Research Institute.
Yudate, H T; Suwa, M; Irie, R; Matsui, H; Nishikawa, T; Nakamura, Y; Yamaguchi, D; Peng, Z Z; Yamamoto, T; Nagai, K; Hayashi, K; Otsuki, T; Sugiyama, T; Ota, T; Suzuki, Y; Sugano, S; Isogai, T; Masuho, Y
2001-01-01
The Helix Research Institute (HRI) in Japan is releasing 4356 HUman Novel Transcripts and related information in the newly established HUNT database. The institute is a joint research project principally funded by the Japanese Ministry of International Trade and Industry, and the clones were sequenced in the governmental New Energy and Industrial Technology Development Organization (NEDO) Human cDNA Sequencing Project. The HUNT database contains an extensive amount of annotation from advanced analysis and represents an essential bioinformatics contribution towards understanding of the gene function. The HRI human cDNA clones were obtained from full-length enriched cDNA libraries constructed with the oligo-capping method and have resulted in novel full-length cDNA sequences. A large fraction has little similarity to any proteins of known function and to obtain clues about possible function we have developed original analysis procedures. Any putative function deduced here can be validated or refuted by complementary analysis results. The user can also extract information from specific categories like PROSITE patterns, PFAM domains, PSORT localization, transmembrane helices and clones with GENIUS structure assignments. The HUNT database can be accessed at http://www.hri.co.jp/HUNT.
Venuti, A; Di Russo, C; del Grosso, N; Patti, A M; Ruggeri, F; De Stasio, P R; Martiniello, M G; Pagnotti, P; Degener, A M; Midulla, M
1985-01-01
A fast-growing strain of human hepatitis A virus was selected and characterized. The virus has the unusual property of developing a strong cytopathic effect in tissue culture in 7 to 10 days. Sequences of the viral genome were cloned into recombinant plasmids with the double-stranded replicative form as a template for the reverse transcription of cDNA. Restriction analysis and direct sequencing indicate that this strain is different from that described by Ticehurst et al. (Proc. Natl. Acad. Sci. USA 80:5885-5889, 1983) in the region that presumptively codes for the major capsid protein VP1, but both isolates have conserved large areas of homology in the untranslated 5'-terminal sequences of the genome. Images PMID:2997478
cDNA Cloning of Fathead minnow (Pimephales promelas) Estrogen and Androgen Receptors for Use in Steroid Receptor Extrapolation Studies for Endocrine Disrupting Chemicals.
Wilson, V.S.1,, Korte, J.2, Hartig P. 1, Ankley, G.T.2, Gray, L.E., Jr 1, , and Welch, J.E.1. 1U.S...
Luis F. Larrondo; Marcela Avila; Loreto Salas; Dan Cullen; Rafael Vicuna
2003-01-01
Analysis of genomic clones encoding a putative laccase in homokaryon strains of Ceriporiopsis subvermispora led to the identification of an allelic variant of the previously described lcs-1 gene. A cDNA clone corresponding to this gene was expressed in Aspergillus nidulans and in Aspergillus niger. Enzyme assays and Western blots showed that both hosts secreted active...
Towards a transcription map spanning a 250 kb area within the DiGeorge syndrome chromosome region
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wong, W.; Emanuel, B.S.; Siegert, J.
1994-09-01
DiGeorge syndrome (DGS) and velocardiofacial syndrome (VCFS) are congenital anomalies affecting predominantly the thymus, parathyroid glands, heart and craniofacial development. Detection of 22q11.2 deletions in the majority of DGS and VCFS patients implicate 22q11 haploinsufficiency in the etiology of these disorders. The VCFS/DGS critical region lies within the proximal portion of a commonly deleted 1.2 Mb region in 22q11. A 250 kb cosmid contig covering this critical region and containing D22S74 (N25) has been established. From this contig, eleven cosmids with minimal overlap were biotinylated by nick translation, and hybridized to PCR-amplified cDNAs prepared from different tissues. The use ofmore » cDNAs from a variety of tissues increases the likelihood of identifying low abundance transcripts and tissue-specific expressed sequences. A DGCR-specific cDNA sublibrary consisting of 670 cDNA clones has been constructed. To date, 49 cDNA clones from this sub-library have been identified with single copy probes and cosmids containing putative CpG islands. Based on sequence analysis, 25 of the clones contain regions of homology to several cDNAs which map within the proximal contig. LAN is a novel partial cDNA isolated from a fetal brain library probed with one of the cosmids in the proximal contig. Using LAN as a probe, we have found 19 positive clones in the DGCR-specific cDNA sub-library (4 clones from fetal brain, 14 from adult skeletal muscle and one from fetal liver). Some of the LAN-positive clones extend the partial cDNA in the 5{prime} direction and will be useful in assembling a full length transcript. This resource will be used to develop a complete transcriptional map of the critical region in order to identify candidate gene(s) involved in the etiology of DGS/VCFS and to determine the relationship between the transcriptional and physical maps of 22q11.« less
Soares, Marcelo Bento; Bonaldo, Maria de Fatima
1998-01-01
This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods.
Soares, M.B.; Fatima Bonaldo, M. de
1998-12-08
This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods. 25 figs.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stapleton, Mark; Liao, Guochun; Brokstein, Peter
2002-08-12
Collections of full-length nonredundant cDNA clones are critical reagents for functional genomics. The first step toward these resources is the generation and single-pass sequencing of cDNA libraries that contain a high proportion of full-length clones. The first release of the Drosophila Gene Collection Release 1 (DGCr1) was produced from six libraries representing various tissues, developmental stages, and the cultured S2 cell line. Nearly 80,000 random 5prime expressed sequence tags (EST) from these libraries were collapsed into a nonredundant set of 5849 cDNAs, corresponding to {approx}40 percent of the 13,474 predicted genes in Drosophila. To obtain cDNA clones representing the remainingmore » genes, we have generated an additional 157,835 5prime ESTs from two previously existing and three new libraries. One new library is derived from adult testis, a tissue we previously did not exploit for gene discovery; two new cap-trapped normalized libraries are derived from 0-22hr embryos and adult heads. Taking advantage of the annotated D. melanogaster genome sequence, we clustered the ESTs by aligning them to the genome. Clusters that overlap genes not already represented by cDNA clones in the DGCr1 were analyzed further, and putative full-length clones were selected for inclusion in the new DGC. This second release of the DGC (DGCr2) contains 5061 additional clones, extending the collection to 10,910 cDNAs representing >70 percent of the predicted genes in Drosophila.« less
Reverse transcription polymerase chain reaction protocols for cloning small circular RNAs.
Navarro, B; Daròs, J A; Flores, R
1998-07-01
A protocol is described for general application for cloning small circular RNAs which requires only minimal amounts of template (approximately 50 ng) of unknown sequence. Both cDNA strands are synthesized with a 26-mer primer whose six 3'-terminal positions are totally degenerate in two consecutive reactions catalyzed by reverse transcriptase and DNA polymerase, respectively. The cDNAs are then PCR-amplified, using a 20-mer primer with the non-degenerate sequence of the previous primer, cloned and sequenced. This information permits the synthesis of one or more pairs of specific and adjacent primers for obtaining full-length cDNA clones by a protocol which is also described.
Xu, De-Quan; Zhang, Yi-Bing; Xiong, Yuan-Zhu; Gui, Jian-Fang; Jiang, Si-Wen; Su, Yu-Hong
2003-07-01
Using suppression subtractive hybridization (SSH) technique, forward and reverse subtracted cDNA libraries were constructed between Longissimus muscles from Meishan and Landrace pigs. A housekeeping gene, G3PDH, was used to estimate the efficiency of subtractive cDNA. In two cDNA libraries, G3PDH was subtracted very efficiently at appropriate 2(10) and 2(5) folds, respectively, indicating that some differentially expressed genes were also enriched at the same folds and the two subtractive cDNA libraries were very successful. A total of 709 and 673 positive clones were isolated from forward and reverse subtracted cDNA libraries, respectively. Analysis of PCR showed that most of all plasmids in the clones contained 150-750 bp inserts. The construction of subtractive cDNA libraries between muscle tissue from different pig breeds laid solid foundations for isolating and identifying the genes determining muscle growth and meat quality, which will be important to understand the mechanism of muscle growth, determination of meat quality and practice of molecular breeding.
A comprehensive list of cloned human DNA sequences
Schmidtke, Jörg; Cooper, David N.
1987-01-01
A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:3575113
A comprehensive list of cloned human DNA sequences
Schmidtke, Jörg; Cooper, David N.
1990-01-01
A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:2333227
A comprehensive list of cloned human DNA sequences
Schmidtke, Jörg; Cooper, David N.
1988-01-01
A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:3368330
A comprehensive list of cloned human DNA sequences
Schmidtke, Jörg; Cooper, David N.
1989-01-01
A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:2654889
Goetz, Frederick W; Norberg, Birgitta; McCauley, Linda A R; Iliev, Dimitar B
2004-03-01
The full-length cDNA for the cod (Gadus morhua) StAR was cloned by RT-PCR and library screening using ovarian RNA. From the library screening, 2 size classes of cDNA were obtained; a 1577 bp cDNA (cStAR1) and a 2851 bp cDNA (cStAR2). The cStAR1 cDNA presumably encodes a protein of 286 amino acids. The cStAR2 cDNA was composed of 6 separated sequences that contained all of the coding regions of cStAR1 when added together, but also contained 5 noncoding regions not observed in cStAR1. Polymerase chain reactions of cod genomic DNA produced products slightly larger than cStAR2. The sequence of these products were the same as cStAR2 but revealed one additional noncoding region (intron). Thus, the fish StAR gene contains the same number of exons (7) and introns (6) as observed in mammals, but is approximately half the size of the mammalian gene. Using Northern analysis and RT-PCR, cStAR1 expression was observed only in testes, ovaries and head kidneys. Polymerase chain reaction products were also observed using cDNA from steroidogenic tissues and primers designed to regions specific for cStAR2, indicating that cStAR2 is expressed in tissues and may account for the presence of larger transcripts observed on Northern blots.
The ATRX cDNA is prone to bacterial IS10 element insertions that alter its structure.
Valle-García, David; Griffiths, Lyra M; Dyer, Michael A; Bernstein, Emily; Recillas-Targa, Félix
2014-01-01
The SWI/SNF-like chromatin-remodeling protein ATRX has emerged as a key factor in the regulation of α-globin gene expression, incorporation of histone variants into the chromatin template and, more recently, as a frequently mutated gene across a wide spectrum of cancers. Therefore, the availability of a functional ATRX cDNA for expression studies is a valuable tool for the scientific community. We have identified two independent transposon insertions of a bacterial IS10 element into exon 8 of ATRX isoform 2 coding sequence in two different plasmids derived from a single source. We demonstrate that these insertion events are common and there is an insertion hotspot within the ATRX cDNA. Such IS10 insertions produce a truncated form of ATRX, which significantly compromises its nuclear localization. In turn, we describe ways to prevent IS10 insertion during propagation and cloning of ATRX-containing vectors, including optimal growth conditions, bacterial strains, and suggested sequencing strategies. Finally, we have generated an insertion-free plasmid that is available to the community for expression studies of ATRX.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hoefler, G.; Forstner, M.; Hulla, W.
1994-01-01
Enoyl-CoA hydratase:3-hydroxyacyl-CoA dehydrogenase bifunctional enzyme is one of the four enzymes of the peroxisomal, [beta]-oxidation pathway. Here, the authors report the full-length human cDNA sequence and the localization of the corresponding gene on chromosome 3q26.3-3q28. The cDNA sequence spans 3779 nucleotides with an open reading frame of 2169 nucleotides. The tripeptide SKL at the carboxy terminus, known to serve as a peroxisomal targeting signal, is present. DNA sequence comparison of the coding region showed an 80% homology between human and rat bifunctional enzyme cDNA. The 3[prime] noncoding sequence contains 117 nucleotides homologous to an Alu repeat. Based on sequence comparison,more » they propose that these nucleotides are a free left Alu arm with 86% homology to the Alu-J family. RNA analysis shows one band with highest intensity in liver and kidney. This cDNA will allow in-depth studies of molecular defects in patients with defective peroxisomal bifunctional enzyme. Moreover, it will also provide a means for studying the regulation of peroxisomal [beta]-oxidation in humans. 33 refs., 5 figs.« less
Highly abundant and stage-specific mRNAs in the obligate pathogen Bremia lactucae.
Judelson, H S; Michelmore, R W
1990-01-01
Germinating spores of the obligate pathogen Bremia lactucae (lettuce downy mildew) contain several unusually abundant species of mRNA. Thirty-nine cDNA clones corresponding to prevalent transcripts were isolated from a library synthesized using poly(A)+ RNA from germinating spores; these clones represented only five distinct classes. Each corresponding mRNA accounted for from 0.4 to 9 percent by mass of poly(A)+ RNA from germinating spores and together represented greater than 20 percent of the mRNA. The expression of the corresponding genes, and a gene encoding Hsp70, was analyzed in spores during germination and during growth in planta. The Hsp70 mRNA and mRNA from one abundant cDNA clone (ham34) were expressed constitutively. Two clones (ham9 and ham12) hybridized only to mRNA from spores and germinating spores. Two clones (ham37 and ham27) showed hybridization specific to germinating spores. Quantification of the number of genes homologous to each cDNA clone indicated that four clones corresponded to one or two copies per haploid genome, and one hybridized to an approximately 11-member family of genes. A sequence of the gene corresponding to ham34 was obtained to investigate its function and to identify sequences conferring high levels of gene expression for use in constructing vectors for the transformation of B. lactucae.
Aramrak, Attawan; Kidwell, Kimberlee K; Steber, Camille M; Burke, Ian C
2015-10-23
5-Enolpyruvylshikimate-3-phosphate synthase (EPSPS) is the sixth and penultimate enzyme in the shikimate biosynthesis pathway, and is the target of the herbicide glyphosate. The EPSPS genes of allohexaploid wheat (Triticum aestivum, AABBDD) have not been well characterized. Herein, the three homoeologous copies of the allohexaploid wheat EPSPS gene were cloned and characterized. Genomic and coding DNA sequences of EPSPS from the three related genomes of allohexaploid wheat were isolated using PCR and inverse PCR approaches from soft white spring "Louise'. Development of genome-specific primers allowed the mapping and expression analysis of TaEPSPS-7A1, TaEPSPS-7D1, and TaEPSPS-4A1 on chromosomes 7A, 7D, and 4A, respectively. Sequence alignments of cDNA sequences from wheat and wheat relatives served as a basis for phylogenetic analysis. The three genomic copies of wheat EPSPS differed by insertion/deletion and single nucleotide polymorphisms (SNPs), largely in intron sequences. RT-PCR analysis and cDNA cloning revealed that EPSPS is expressed from all three genomic copies. However, TaEPSPS-4A1 is expressed at much lower levels than TaEPSPS-7A1 and TaEPSPS-7D1 in wheat seedlings. Phylogenetic analysis of 1190-bp cDNA clones from wheat and wheat relatives revealed that: 1) TaEPSPS-7A1 is most similar to EPSPS from the tetraploid AB genome donor, T. turgidum (99.7 % identity); 2) TaEPSPS-7D1 most resembles EPSPS from the diploid D genome donor, Aegilops tauschii (100 % identity); and 3) TaEPSPS-4A1 resembles EPSPS from the diploid B genome relative, Ae. speltoides (97.7 % identity). Thus, EPSPS sequences in allohexaploid wheat are preserved from the most two recent ancestors. The wheat EPSPS genes are more closely related to Lolium multiflorum and Brachypodium distachyon than to Oryza sativa (rice). The three related EPSPS homoeologues of wheat exhibited conservation of the exon/intron structure and of coding region sequence, but contained significant sequence variation within intron regions. The genome-specific primers developed will enable future characterization of natural and induced variation in EPSPS sequence and expression. This can be useful in investigating new causes of glyphosate herbicide resistance.
1986-11-26
cloning at the SalI site of pUCI8 vector DNA, iii) by treatment with EcoRl DNA methylase, ligation to EcoRI and cloning at the EcoRl site of pUCI8...cDNA to synthetic Sail linker 10 2.3.10 Treatment of DEN-2 cDNA with EcoRi methylase, followed 10 by ligation to EcoRI linkers and digestion with...picked by the mini plasmid preparation method as described in Maniatis et al. (1982). The procedure followed involved briefly treatment with a
Luzio, J P; Brake, B; Banting, G; Howell, K E; Braghetta, P; Stanley, K K
1990-01-01
Organelle-specific integral membrane proteins were identified by a novel strategy which gives rise to monospecific antibodies to these proteins as well as to the cDNA clones encoding them. A cDNA expression library was screened with a polyclonal antiserum raised against Triton X-114-extracted organelle proteins and clones were then grouped using antibodies affinity-purified on individual fusion proteins. The identification, molecular cloning and sequencing are described of a type 1 membrane protein (TGN38) which is located specifically in the trans-Golgi network. Images Fig. 1. Fig. 3. PMID:2204342
Inferring Higher Functional Information for RIKEN Mouse Full-Length cDNA Clones With FACTS
Nagashima, Takeshi; Silva, Diego G.; Petrovsky, Nikolai; Socha, Luis A.; Suzuki, Harukazu; Saito, Rintaro; Kasukawa, Takeya; Kurochkin, Igor V.; Konagaya, Akihiko; Schönbach, Christian
2003-01-01
FACTS (Functional Association/Annotation of cDNA Clones from Text/Sequence Sources) is a semiautomated knowledge discovery and annotation system that integrates molecular function information derived from sequence analysis results (sequence inferred) with functional information extracted from text. Text-inferred information was extracted from keyword-based retrievals of MEDLINE abstracts and by matching of gene or protein names to OMIM, BIND, and DIP database entries. Using FACTS, we found that 47.5% of the 60,770 RIKEN mouse cDNA FANTOM2 clone annotations were informative for text searches. MEDLINE queries yielded molecular interaction-containing sentences for 23.1% of the clones. When disease MeSH and GO terms were matched with retrieved abstracts, 22.7% of clones were associated with potential diseases, and 32.5% with GO identifiers. A significant number (23.5%) of disease MeSH-associated clones were also found to have a hereditary disease association (OMIM Morbidmap). Inferred neoplastic and nervous system disease represented 49.6% and 36.0% of disease MeSH-associated clones, respectively. A comparison of sequence-based GO assignments with informative text-based GO assignments revealed that for 78.2% of clones, identical GO assignments were provided for that clone by either method, whereas for 21.8% of clones, the assignments differed. In contrast, for OMIM assignments, only 28.5% of clones had identical sequence-based and text-based OMIM assignments. Sequence, sentence, and term-based functional associations are included in the FACTS database (http://facts.gsc.riken.go.jp/), which permits results to be annotated and explored through web-accessible keyword and sequence search interfaces. The FACTS database will be a critical tool for investigating the functional complexity of the mouse transcriptome, cDNA-inferred interactome (molecular interactions), and pathome (pathologies). PMID:12819151
Regulation of pathogenicity in hop stunt viroid-related group II citrus viroids.
Reanwarakorn, K; Semancik, J S
1998-12-01
Nucleotide sequences were determined for two hop stunt viroid-related Group II citrus viroids characterized as either a cachexia disease non-pathogenic variant (CVd-IIa) or a pathogenic variant (CVd-IIb). Sequence identity between the two variants of 95.6% indicated a conserved genome with the principal region of nucleotide difference clustered in the variable (V) domain. Full-length viroid RT-PCR cDNA products were cloned into plasmid SP72. Viroid cDNA clones as well as derived RNA transcripts were transmissible to citron (Citrus medica L.) and Luffa aegyptiaca Mill. To determine the locus of cachexia pathogenicity as well as symptom expression in Luffa, chimeric viroid cDNA clones were constructed from segments of either the left terminal, pathogenic and conserved (T1-P-C) domains or the conserved, variable and right terminal (C-V-T2) domains of CVd-IIa or CVd-IIb in reciprocal exchanges. Symptoms induced by the various chimeric constructs on the two bioassay hosts reflected the differential response observed with CVd-IIa and -IIb. Constructs with the C-V-T2 domains region from clone-IIa induced severe symptoms on Luffa typical of CVd-IIa, but were non-symptomatic on mandarin as a bioassay host for the cachexia disease. Constructs with the same region (C-V-T2) from the clone-IIb genome induced only mild symptoms on Luffa, but produced a severe reaction on mandarin, as observed for CVd-IIb. Specific site-directed mutations were introduced into the V domain of the CVd-IIa clone to construct viroid cDNA clones with either partial or complete conversions to the CVd-IIb sequence. With the introduction of six site-specific changes into the V domain of the clone-IIa genome, cachexia pathogenicity was acquired as well as a moderation of severe symptoms on Luffa.
Liszewska, Frantz; Gaganidze, Dali; Sirko, Agnieszka
2005-01-01
We applied the yeast two-hybrid system for screening of a cDNA library of Nicotiana plumbaginifolia for clones encoding plant proteins interacting with two proteins of Escherichia coli: serine acetyltransferase (SAT, the product of cysE gene) and O-acetylserine (thiol)lyase A, also termed cysteine synthase (OASTL-A, the product of cysK gene). Two plant cDNA clones were identified when using the cysE gene as a bait. These clones encode a probable cytosolic isoform of OASTL and an organellar isoform of SAT, respectively, as indicated by evolutionary trees. The second clone, encoding SAT, was identified independently also as a "prey" when using cysK as a bait. Our results reveal the possibility of applying the two-hybrid system for cloning of plant cDNAs encoding enzymes of the cysteine synthase complex in the two-hybrid system. Additionally, using genome walking sequences located upstream of the sat1 cDNA were identified. Subsequently, in silico analyses were performed aiming towards identification of the potential signal peptide and possible location of the deduced mature protein encoded by sat1.
Liu, Zhong-Yuan; Wang, Yun; Lü, Guo-Dong; Wang, Xian-Lei; Zhang, Fu-Chun; Ma, Ji
2006-12-01
The partial cDNA sequence coding for the antifreeze proteins in the Tenebrio molitor was obtained by RT-PCR. Sequence analysis revealed nine putative cDNAs with a high degree of homology to Tenebrio molitor antifreeze proteins. The recombinant pGEX-4T-1-tmafp-XJ430 was introduced into E. coli BL21 to induce a GST fusion protein by IPTG. SDS-PAGE of the fusion protein demonstrated that the antifreeze protein migrated at a size of 38 kDa. The immunization was performed by intra-muscular injection of pCDNA3-tmafp-XJ430, and then antiserum was detected by ELISA. The titer of the antibody was 1:2,000. Western blotting analysis showed the antiserum was specific against the antifreeze protein. This finding could lead to further investigation of the properties and function of antifreeze proteins.
Song, Xiaomin; Wang, Jing; Wu, Fang; Li, Xu; Teng, Maikun; Gong, Weimin
2005-01-01
SPE10 is an antifungal protein isolated from the seeds of Pachyrrhizus erosus. cDNA encoding a 47 amino acid peptide was cloned by RT-PCR and the gene sequence proved SPE10 to be a new member of plant defensin family. The synthetic cDNA with codons preferred in yeast was cloned into the pPIC9 plasmid directly in-frame with the secretion signal alpha-mating factor, and highly expressed in methylotrophic Pichia pastoris. Activity assays showed the recombinant SPE10 inhibited specifically the growth of several pathogenic fungi as native SPE10. Circular dichroism and fluorescence spectroscopy analysis indicated that the native and recombinant protein should have same folding, though there are eight cystein residues in the sequence. Several evidence suggested SPE10 should be the first dimeric plant defensin reported so far.
Cloning of rat MLH1 and expression analysis of MSH2, MSH3, MSH6, and MLH1 during spermatogenesis.
Geeta Vani, R; Varghese, C M; Rao, M R
1999-12-15
The mismatch repair system has been highly conserved in various species. In eukaryotic cells, the Mut S and Mut L homologues play crucial roles in both DNA mismatch repair and meiotic recombination. A full-length rat cDNA clone for rat MLH1 has been constructed using the RT-PCR method. The cDNA has an open reading frame of 2274 nucleotides for a protein of 757 amino acids. We have also obtained partial cDNA clones for MSH3 and MSH6. Northern blot analysis of rat MLH1, MSH2, MSH3, and MSH6 in the testes of rats of different ages showed differential expression of these genes as a function of developmental maturation of the testes. The expression analysis suggests that MSH3 may have a more predominant role in the meiotic recombination process. Copyright 1999 Academic Press.
Heparosan-glucuronate 5-epimerase: Molecular cloning and characterization of a novel enzyme.
Mochizuki, Hideo; Yamagishi, Kiwamu; Suzuki, Kiyoshi; Kim, Yeong Shik; Kimata, Koji
2015-07-01
Iduronic acid (IdoA) is a critical component of heparan sulfate in its interaction with functional proteins. Heparosan-N-sulfate-glucuronate 5-epimerase (HNSG-5epi) converts d-glucuronic acid (GlcA) residues in N-sulfated heparosan (NS-heparosan), as an intermediate in heparan sulfate biosynthesis, to IdoA. In the present study, the authors discovered a different 5-epimerase, designated HG-5epi (heparosan-glucuronate 5-epimerase), that is involved in acharan sulfate biosynthesis and possesses novel substrate specificity. A candidate cDNA of HG-5epi was cloned from the cDNA library of Achatina fulica. The cloned cDNA contained a whole coding region that predicts a type II transmembrane protein composed of 601 amino acid residues. The amino acid sequence of HG-5epi is homologous to that of HNSG-5epi. Recombinant HG-5epi was expressed in insect cells and its enzymatic properties characterized. As expected, HG-5epi epimerizes GlcA residues in heparosan, but not in NS-heparosan. Conversion of IdoA to GlcA was also catalyzed by HG-5epi when completely desulfated N-acetylated heparin was used as the substrate, indicating a reversible reaction mechanism. At equilibrium of the epimerization, the proportion of IdoA in the reaction product reached up to 30% of total hexuronic acid. To our knowledge, this is the first report to describe an enzyme that catalyzes the epimerization of non-sulfated heparosan. This new enzyme may be applied to the study of synthetic heparan sulfate-related polysaccharides having certain biological and pharmacological activities. In addition, a new method using anion-exchange HPLC connected to a post-column fluorescent labeling system was developed for analyzing hexuronic acid isomers. © The Author 2015. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
The Dermatophagoides farinae group 22 allergen: cloning and expression in Escherichia coli.
Cui, Yu-bao; Cai, Hong-xing; Zhou, Ying; Wang, Nan; Yu, Li-li; Yang, Li; Zhang, Cheng-bo
2015-09-01
Dermatophagoides farinae (Hughes) (Acari: Pyroglyphidae) and other domestic mites produce allergens that affect people worldwide. Here, the complementary DNA (cDNA) coding for group 22 allergen of D. farinae (Der f 22) from China was cloned, sequenced, and expressed successfully. The cDNA encoding Der f 22 was synthesized by reverse transcription polymerase chain reaction (RT-PCR), then ligated to the pCold-TF for expression in Escherichia coli BL21 cells. The purified recombinant fusion protein was identified by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), Western-blotting, and tandem matrix-assisted laser desorption ionization time-of-flight (MALDI-TOF/TOF). The full-length cDNA comprised 468 nucleotides and was 99.57% (466/468) identical with the reference sequence (GenBank: DQ643992). After the plasmid pCold-TF-Der f 22 was transformed into E. coli BL21 and expressed with the induction of IPTG, SDS-PAGE showed a specific band for the recombinant fusion protein. The recombinant fusion protein, which was purified by chromatography, bound with a His-tagged antibody by Western blotting. MALDI-TOF/TOF mass spectrometry revealed that the structure of the recombinant protein was identical to the predicted Der f 22 structure. The hydrophilic protein contains a signal peptide of 20 amino acids, and the mature Der f 22 consists of 135 amino acid residues with a molecular weight of 14.7 kDa and theoretical isoelectric points (pI) of 6.38. Its secondary structure comprises an alpha helix (38.5%), beta-sheet (45.9%), random coils (11.85%), and beta-turns (11.1%). This work represents the first reported full-length sequence and successful cloning of Der f 22 from D. farinae in China; bioinformatics analysis can be used to further study the allergenicity and clinical utility of the recombinant Der f 22. © 2015 ARS-AAOA, LLC.
Peterbauer, T; Mucha, J; Mayer, U; Popp, M; Glössl, J; Richter, A
1999-12-01
Stachyose is the major soluble carbohydrate in seeds of a number of important crop species. It is synthesized from raffinose and galactinol by the action of stachyose synthase (EC 2.4.1.67). We report here on the identification of a cDNA encoding stachyose synthase from seeds of adzuki bean (Vigna angularis Ohwi et Ohashi). Based on internal amino acid sequences of the enzyme purified from adzuki bean, oligonucleotides were designed and used to amplify corresponding sequences from adzuki bean cDNA by RT-PCR, followed by rapid amplification of cDNA ends (RACE-PCR). The complete cDNA sequence comprised 3046 nucleotides and included an open reading frame which encoded a polypeptide of 857 amino acid residues. The entire coding region was amplified by PCR, engineered into the baculovirus expression vector pVL1393 and introduced into Spodoptera frugiperda (Sf21) insect cells for heterologous expression. The recombinant protein was immunologically reactive with polyclonal antibodies raised against stachyose synthase purified from adzuki bean and was shown to be a functional stachyose synthase with the same catalytic properties as its native counterpart. High levels of stachyose synthase mRNA were transiently accumulated midway through seed development, and the enzyme was also present in mature seeds and during germination.
Construction and biological activities of the first infectious cDNA clones of the genus Foveavirus
DOE Office of Scientific and Technical Information (OSTI.GOV)
Meng, Baozhong, E-mail: bmeng@uoguelph.ca; Venkataraman, Srividhya; Li, Caihong
Grapevine rupestris stem pitting-associated virus (GRSPaV, genus Foveavirus, family Betaflexiviridae) is one of the most prevalent viruses in grapevines and is associated with three distinct diseases: rupestris stem pitting, vein necrosis and Syrah decline. Little is known about the biology and pathological properties of GRSPaV. In this work, we engineered a full-length infectious cDNA clone for GRSPaV and a GFP-tagged variant, both under the transcriptional control of Cauliflower mosaic virus 35 S promoter. We demonstrated that these cDNA clones were infectious in grapevines and Nicotiana benthamiana through fluorescence microscopy, RT-PCR, Western blotting and immuno electron microscopy. Interestingly, GRSPaV does notmore » cause systemic infection in four of the most commonly used herbaceous plants, even in the presence of the movement proteins of two other viruses which are known to complement numerous movement-defective viruses. These infectious clones are the first of members of Foveavirus which would allow further investigations into mechanisms governing different aspects of replication for GRSPaV and perhaps related viruses.« less
Primary structure of the Aequorea victoria green-fluorescent protein.
Prasher, D C; Eckenrode, V K; Ward, W W; Prendergast, F G; Cormier, M J
1992-02-15
Many cnidarians utilize green-fluorescent proteins (GFPs) as energy-transfer acceptors in bioluminescence. GFPs fluoresce in vivo upon receiving energy from either a luciferase-oxyluciferin excited-state complex or a Ca(2+)-activated phosphoprotein. These highly fluorescent proteins are unique due to the chemical nature of their chromophore, which is comprised of modified amino acid (aa) residues within the polypeptide. This report describes the cloning and sequencing of both cDNA and genomic clones of GFP from the cnidarian, Aequorea victoria. The gfp10 cDNA encodes a 238-aa-residue polypeptide with a calculated Mr of 26,888. Comparison of A. victoria GFP genomic clones shows three different restriction enzyme patterns which suggests that at least three different genes are present in the A. victoria population at Friday Harbor, Washington. The gfp gene encoded by the lambda GFP2 genomic clone is comprised of at least three exons spread over 2.6 kb. The nucleotide sequences of the cDNA and the gene will aid in the elucidation of structure-function relationships in this unique class of proteins.
Characterization of transformation related genes in oral cancer cells.
Chang, D D; Park, N H; Denny, C T; Nelson, S F; Pe, M
1998-04-16
A cDNA representational difference analysis (cDNA-RDA) and an arrayed filter technique were used to characterize transformation-related genes in oral cancer. From an initial comparison of normal oral epithelial cells and a human papilloma virus (HPV)-immortalized oral epithelial cell line, we obtained 384 differentially expressed gene fragments and arrayed them on a filter. Two hundred and twelve redundant clones were identified by three rounds of back hybridization. Sequence analysis of the remaining clones revealed 99 unique clones corresponding to 69 genes. The expression of these transformation related gene fragments in three nontumorigenic HPV-immortalized oral epithelial cell lines and three oral cancer cell lines were simultaneously monitored using a cDNA array hybridization. Although there was a considerable cell line-to-cell line variability in the expression of these clones, a reliable prediction of their expression could be made from the cDNA array hybridization. Our study demonstrates the utility of combining cDNA-RDA and arrayed filters in high-throughput gene expression difference analysis. The differentially expressed genes identified in this study should be informative in studying oral epithelial cell carcinogenesis.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Schlagnhaufer, C.D.; Arteca, R.N.; Pell, E.J.
When potato plants (Solanum tuberosum L. cv Norland) are subjected to oxone stress ethylene is emitted. Increases in ethylene production are often the result of increased expression of the enzyme ACC synthase. We used the polymerase chain reaction (PCR) to clone a cDNA encoding an ozone-induced ACC synthase. After treating potato plants with 300 ppb ozone for 4 h, RNA was extracted using a guanidinium isothiocyanate method. Using degenerate oligonucleotides corresponding to several conserved regions of ACC synthase sequences reported from different plant tissues as primers, we were able to reverse transcribe the RNA and amplify a cDNA for ACCmore » synthase. The clone is 1098 bp in length encoding for 386 amino acids comprising [approximately]80% of the protein. Computer analysis of the deduced amino acid sequence showed that our clone is 50-70% homologous with ACC synthase genes cloned from other plant tissues. Using the cDNA as a probe in northern analysis we found that there is little or no expression in control tissue: however there is a large increase in the expression of the ACC synthase message in response to ozone treatment.« less
González-Carranza, Zinnia Haydé; Whitelaw, Catherine Ann; Swarup, Ranjan; Roberts, Jeremy Alan
2002-01-01
During leaf abscission in oilseed rape (Brassica napus), cell wall degradation is brought about by the action of several hydrolytic enzymes. One of these is thought to be polygalacturonase (PG). Degenerate primers were used to isolate a PG cDNA fragment by reverse transcriptase-polymerase chain reaction from RNA extracted from ethylene-promoted leaf abscission zones (AZs), and in turn a full-length clone (CAW471) from an oilseed rape AZ cDNA library. The highest homology of this cDNA (82%) was to an Arabidopsis sequence that was predicted to encode a PG protein. Analysis of expression revealed that CAW471 mRNA accumulated in the AZ of leaves and reached a peak 24 h after ethylene treatment. Ethylene-promoted leaf abscission in oilseed rape was not apparent until 42 h after exposure to the gas, reaching 50% at 48 h and 100% by 56 h. In floral organ abscission, expression of CAW471 correlated with cell separation. Genomic libraries from oilseed rape and Arabidopsis were screened with CAW471 and the respective genomic clones PGAZBRAN and PGAZAT isolated. Characterization of these PG genes revealed that they had substantial homology within both the coding regions and in the 5′-upstream sequences. Fusion of a 1,476-bp 5′-upstream sequence of PGAZAT to β-glucuronidase or green fluorescent protein and transformation of Arabidopsis revealed that this fragment was sufficient to drive expression of these reporter genes in the AZs at the base of the anther filaments, petals, and sepals. PMID:11842157
Yin, Yan-hui; Li, Bi-chun; Wei, Guang-hui; Zhu, Cai-ye; Li, Wei; Zhang, Ya-ni; Du, Li-xin; Cao, Wen-guang
2012-05-01
The aim of this study was to clone the heart-type fatty acid binding protein (H-FABP) gene of Xuhuai goat, to explore it bioinformatically, and analyze the subcellular localization using enhanced green fluorescent protein (EGFP). The results showed that the coding sequence (CDS) length of Xuhuai goat H-FABP gene was 402 bp, encoding 133 amino acids (GenBank accession number AY466498.1). The H-FABP cDNA coding sequence was compared with the corresponding region of human, chicken, brown rat, cow, wild boar, donkey, and zebrafish. The similarity were 89%, 76%, 85%, 84%, 93%, 91%, 70%, respectively. For the corresponding amino acid sequences, the similarity were 90%, 79%, 88%, 97%, 95%, 94%, 72%, respectively. This study did not find the signal peptide region in the H-FABP protein; it revealed that H-FABP protein might be a nonsecreted protein. H-FABP expression was detected in vitro by reverse transcription-polymerase chain reaction (RT-PCR), and the EGFP-H-FABP fusion protein was localized to the cytoplasm. The gene could also be transiently and permanently expressed in mice.
cDNA encoding a polypeptide including a hevein sequence
Raikhel, N.V.; Broekaert, W.F.; Namhai Chua; Kush, A.
1993-02-16
A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids.
Mutations Affecting Expression of the rosy Locus in Drosophila melanogaster
Lee, Chong Sung; Curtis, Daniel; McCarron, Margaret; Love, Carol; Gray, Mark; Bender, Welcome; Chovnick, Arthur
1987-01-01
The rosy locus in Drosophila melanogaster codes for the enzyme xanthine dehydrogenase (XDH). Previous studies defined a "control element" near the 5' end of the gene, where variant sites affected the amount of rosy mRNA and protein produced. We have determined the DNA sequence of this region from both genomic and cDNA clones, and from the ry+10 underproducer strain. This variant strain had many sequence differences, so that the site of the regulatory change could not be fixed. A mutagenesis was also undertaken to isolate new regulatory mutations. We induced 376 new mutations with 1-ethyl-1-nitrosourea (ENU) and screened them to isolate those that reduced the amount of XDH protein produced, but did not change the properties of the enzyme. Genetic mapping was used to find mutations located near the 5' end of the gene. DNA from each of seven mutants was cloned and sequenced through the 5' region. Mutant base changes were identified in all seven; they appear to affect splicing and translation of the rosy mRNA. In a related study (T. P. Keith et al. 1987), the genomic and cDNA sequences are extended through the 3' end of the gene; the combined sequences define the processing pattern of the rosy transcript and predict the amino acid sequence of XDH. PMID:3036645
Chromosomal localization and cDNA cloning of the human DBP and TEF genes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Khatib, Z.A.; Inaba, T.; Valentine, M.
1994-09-15
The authors have isolated cDNA and genomic clones and determined the human chromosome positions of two genes encoding transcription factors expressed in the liver and the pituitary gland: albumin D-site-binding protein (DBP) and thyrotroph embryonic factor (TEF). Both proteins have been identified as members of the PAR (proline and acidic amino acid-rich) subfamily of bZIP transcription factors in the rat, but human homologues have not been characterized. Using a fluorescence in situ hybridization technique, the DBP locus was assigned to chromosome 19q13, and TEF to chromosome 22q13. Each assignment was confirmed by means of human chromosome segregation in somatic cellmore » hybrids. Coding sequences of DBP and TEF, extending beyond the bZIP domain to the PAR region, were highly conserved in both human-human and interspecies comparisons. Conservation of the exon-intron boundaries of each bZIP domain-encoding exon suggested derivation from a common ancestral gene. DBP and TEF mRNAs were expressed in all tissues and cell lines examined, including brain, lung, liver, spleen, and kidney. Knowledge of the human chromosome locations of these PAR proteins will facilitate studies to assess their involvement in carcinogenesis and other fundamental biological processes. 37 refs., 5 figs., 1 tab.« less
Yockey, C E; Shimizu, N
1998-02-01
Members of the TEA/ATTS family of transcription factors have been found in most representative eukaryotic organisms. In vertebrates, the TEA family contains at least four members, which share overlapping DNA-binding specificity and have similar transcriptional activation properties. In this article, we describe the cDNA cloning and characterization of the murine TEA proteins DTEF-1 (mDTEF-1) and ETF. Using in situ hybridization analysis of mouse embryos, we found that mDTEF-1 and ETF transcript distributions substantially overlap. ETF is expressed throughout the embryo except in the myocardium early in development, whereas late in development, it is enriched in lung and neuroectoderm. Mouse DTEF-1 is expressed at a much lower level throughout development and is substantially enriched in ectoderm and skin, as well as in the developing pituitary at midgestation. Northern blot analysis of adult mouse tissue total RNA showed that both ETF and mDTEF-1 are abundant in uterus and lung relative to other tissues. Using gel mobility shift assays and GAL4-fusion protein analysis, we demonstrated that the full coding sequences of ETF and mDTEF-1 encode M-CAT/GT-IIC-binding proteins containing activation domains.
Ahmad Mazian, Mu'adz; Salleh, Abu Bakar; Basri, Mahiran; Rahman, Raja Noor Zaliha Raja Abd.
2014-01-01
Psychrophilic basidiomycete yeast, Glaciozyma antarctica strain PI12, was shown to be a protease-producer. Isolation of the PI12 protease gene from genomic and mRNA sequences allowed determination of 19 exons and 18 introns. Full-length cDNA of PI12 protease gene was amplified by rapid amplification of cDNA ends (RACE) strategy with an open reading frame (ORF) of 2892 bp, coded for 963 amino acids. PI12 protease showed low homology with the subtilisin-like protease from fungus Rhodosporidium toruloides (42% identity) and no homology to other psychrophilic proteases. The gene encoding mature PI12 protease was cloned into Pichia pastoris expression vector, pPIC9, and positioned under the induction of methanol-alcohol oxidase (AOX) promoter. The recombinant PI12 protease was efficiently secreted into the culture medium driven by the Saccharomyces cerevisiae α-factor signal sequence. The highest protease production (28.3 U/ml) was obtained from P. pastoris GS115 host (GpPro2) at 20°C after 72 hours of postinduction time with 0.5% (v/v) of methanol inducer. The expressed protein was detected by SDS-PAGE and activity staining with a molecular weight of 99 kDa. PMID:25093119
Pan, H C; Yang, H Q; Zhao, F X; Qian, X C
2014-08-28
The cDNA sequence of foot-specific peroxidase PPOD1 from the Chinese strain of Hydra magnipapillata was cloned by reverse transcription-polymerase chain reaction. The cDNA sequence contained a coding region with an 873-bp open reading frame, a 31-bp 5'-untranslated region, and a 36-bp 3'-untranslated region. The structure prediction results showed that PPOD1 contains 10.34% of α-helix, 38.62% of extended strand, 12.41% of β-turn, and 38.62% of random coil. The structural core was α-helix at the N terminus. The GenBank protein blast server showed that PPOD1 contains 2 fascin-like domains. In addition, high-level PPOD1 activity was only present in the ectodermal epithelial cells located on the edge of the adhesive face of the basal disc, and that these cells extended lamellipodia and filopodia when the basal disc was tightly attached to a glass slide. The fascin-like domains of Hydra PPOD1 might contribute to the bundling of the actin filament of these cells, and hence, the formation of filopodia. In conclusion, these cells might play an important role in strengthening the adsorbability of the basal disc to substrates.
Generation of a reliable full-length cDNA of infectiousTembusu virus using a PCR-based protocol.
Liang, Te; Liu, Xiaoxiao; Cui, Shulin; Qu, Shenghua; Wang, Dan; Liu, Ning; Wang, Fumin; Ning, Kang; Zhang, Bing; Zhang, Dabing
2016-02-02
Full-length cDNA of Tembusu virus (TMUV) cloned in a plasmid has been found instable in bacterial hosts. Using a PCR-based protocol, we generated a stable full-length cDNA of TMUV. Different cDNA fragments of TMUV were amplified by reverse transcription (RT)-PCR, and cloned into plasmids. Fragmented cDNAs were amplified and assembled by fusion PCR to produce a full-length cDNA using the recombinant plasmids as templates. Subsequently, a full-length RNA was transcribed from the full-length cDNA in vitro and transfected into BHK-21 cells; infectious viral particles were rescued successfully. Following several passages in BKH-21 cells, the rescued virus was compared with the parental virus by genetic marker checks, growth curve determinations and animal experiments. These assays clearly demonstrated the genetic and biological stabilities of the rescued virus. The present work will be useful for future investigations on the molecular mechanisms involved in replication and pathogenesis of TMUV. Copyright © 2015 Elsevier B.V. All rights reserved.
Tange, N; Jong-Young, L; Mikawa, N; Hirono, I; Aoki, T
1997-12-01
A cDNA clone of rainbow trout (Oncorhynchus mykiss) transferrin was obtained from a liver cDNA library. The 2537-bp cDNA sequence contained an open reading frame encoding 691 amino acids and the 5' and 3' noncoding regions. The amino acid sequences at the iron-binding sites and the two N-linked glycosylation sites, and the cysteine residues were consistent with known, conserved vertebrate transferrin cDNA sequences. Single N-linked glycosylation sites existed on the N- and C-lobe. The deduced amino acid sequence of the rainbow trout transferrin cDNA had 92.9% identities with transferrin of coho salmon (Oncorhynchus kisutch); 85%, Atlantic salmon (Salmo salar); 67.3%, medaka (Oryzias latipes); 61.3% Atlantic cod (Gadus morhua); and 59.7%, Japanese flounder (Paralichthys olivaceus). The long and accurate polymerase chain reaction (LA-PCR) was used to amplify approximately 6.5 kb of the transferrin gene from rainbow trout genomic DNA. Restriction fragment length polymorphisms (RFLPs) of the LA-PCR products revealed three digestion patterns in 22 samples.
A new approach for cloning hLIF cDNA from genomic DNA isolated from the oral mucous membrane.
Cui, Y H; Zhu, G Q; Chen, Q J; Wang, Y F; Yang, M M; Song, Y X; Wang, J G; Cao, B Y
2011-11-25
Complementary DNA (cDNA) is valuable for investigating protein structure and function in the study of life science, but it is difficult to obtain by traditional reverse transcription. We employed a novel strategy to clone human leukemia inhibitory factor (hLIF) gene cDNA from genomic DNA, which was directly isolated from the mucous membrane of mouth. The hLIF sequence, which is 609 bp long and is composed of three exons, can be acquired within a few hours by amplifying each exon and splicing all of them using overlap-PCR. This new approach developed is simple, time- and cost-effective, without RNA preparation or cDNA synthesis, and is not limited to the specific tissues for a particular gene and the expression level of the gene.
Reddy, M K; Nair, S; Tewari, K K; Mudgil, Y; Yadav, B S; Sopory, S K
1999-09-01
We have isolated and sequenced four overlapping cDNA clones to identify the full-length cDNA for topoisomerase II (PsTopII) from pea. Using degenerate primers, based on the conserved amino acid sequences of other eukaryotic type II topoisomerases, a 680 bp fragment was PCR-amplified with pea cDNA as template. This fragment was used as a probe to screen an oligo-dT-primed pea cDNA library. A partial cDNA clone was isolated that was truncated at the 3' end. RACE-PCR was employed to isolate the remaining portion of the gene. The total size of PsTopII is 4639 bp with an open reading frame of 4392 bp. The deduced amino acid sequence shows a strong homology to other eukaryotic topoisomerase II (topo II) at the N-terminus end. The topo II transcript was abundant in proliferative tissues. We also show that the level of topo II transcripts could be stimulated by exogenous application of growth factors that induced proliferation in vitro cultures. Light irradiation to etiolated tissue strongly stimulated the expression of topo II. These results suggest that topo II gene expression is up-regulated in response to light and hormones and correlates with cell proliferation. Besides, we have also isolated and analysed the 5'-flanking region of the pea TopII gene. This is first report on the isolation of a putative promoter for topoisomerase II from plants.
Marques, M Carmen; Alonso-Cantabrana, Hugo; Forment, Javier; Arribas, Raquel; Alamar, Santiago; Conejero, Vicente; Perez-Amador, Miguel A
2009-01-01
Background Interpretation of ever-increasing raw sequence information generated by modern genome sequencing technologies faces multiple challenges, such as gene function analysis and genome annotation. Indeed, nearly 40% of genes in plants encode proteins of unknown function. Functional characterization of these genes is one of the main challenges in modern biology. In this regard, the availability of full-length cDNA clones may fill in the gap created between sequence information and biological knowledge. Full-length cDNA clones facilitate functional analysis of the corresponding genes enabling manipulation of their expression in heterologous systems and the generation of a variety of tagged versions of the native protein. In addition, the development of full-length cDNA sequences has the power to improve the quality of genome annotation. Results We developed an integrated method to generate a new normalized EST collection enriched in full-length and rare transcripts of different citrus species from multiple tissues and developmental stages. We constructed a total of 15 cDNA libraries, from which we isolated 10,898 high-quality ESTs representing 6142 different genes. Percentages of redundancy and proportion of full-length clones range from 8 to 33, and 67 to 85, respectively, indicating good efficiency of the approach employed. The new EST collection adds 2113 new citrus ESTs, representing 1831 unigenes, to the collection of citrus genes available in the public databases. To facilitate functional analysis, cDNAs were introduced in a Gateway-based cloning vector for high-throughput functional analysis of genes in planta. Herein, we describe the technical methods used in the library construction, sequence analysis of clones and the overexpression of CitrSEP, a citrus homolog to the Arabidopsis SEP3 gene, in Arabidopsis as an example of a practical application of the engineered Gateway vector for functional analysis. Conclusion The new EST collection denotes an important step towards the identification of all genes in the citrus genome. Furthermore, public availability of the cDNA clones generated in this study, and not only their sequence, enables testing of the biological function of the genes represented in the collection. Expression of the citrus SEP3 homologue, CitrSEP, in Arabidopsis results in early flowering, along with other phenotypes resembling the over-expression of the Arabidopsis SEPALLATA genes. Our findings suggest that the members of the SEP gene family play similar roles in these quite distant plant species. PMID:19747386
Dmochowska-Boguta, Marta; Alaba, Sylwia; Yanushevska, Yuliya; Piechota, Urszula; Lasota, Elzbieta; Nadolska-Orczyk, Anna; Karlowski, Wojciech M; Orczyk, Waclaw
2015-10-05
Inoculation of wheat plants with Puccinia triticina (Pt) spores activates a wide range of host responses. Compatible Pt interaction with susceptible Thatcher plants supports all stages of the pathogen life cycle. Incompatible interaction with TcLr9 activates defense responses including oxidative burst and micronecrotic reactions associated with the pathogen's infection structures and leads to complete termination of pathogen development. These two contrasting host-pathogen interactions were a foundation for transcriptome analysis of incompatible wheat-Pt interaction. A suppression subtractive hybridization (SSH) library was constructed using cDNA from pathogen-inoculated susceptible Thatcher and resistant TcLr9 isogenic lines. cDNA represented steps of wheat-brown rust interactions: spore germination, haustorium mother cell (HMC) formation and micronecrotic reactions. All ESTs were clustered and validated by similarity search to wheat genome using BLASTn and sim4db tools. qRT-PCR was used to determine transcript levels of selected ESTs after inoculation in both lines. Out of 793 isolated cDNA clones, 183 were classified into 152 contigs. 89 cDNA clones and encoded proteins were functionally annotated and assigned to 5 Gene Ontology categories: catalytic activity 48 clones (54 %), binding 32 clones (36 %), transporter activity 6 clones (7 %), structural molecule activity 2 clones (2 %) and molecular transducer activity 1 clone (1 %). Detailed expression profiles of 8 selected clones were analyzed using the same plant-pathogen system. The strongest induction after pathogen infection and the biggest differences between resistant and susceptible interactions were detected for clones encoding wall-associated kinase (GenBank accession number JG969003), receptor with leucine-rich repeat domain (JG968955), putative serine/threonine protein kinase (JG968944), calcium-mediated signaling protein (JG968925) and 14-3-3 protein (JG968969). The SSH library represents transcripts regulated by pathogen infection during compatible and incompatible interactions of wheat with P. triticina. Annotation of selected clones confirms their putative roles in successive steps of plant-pathogen interactions. The transcripts can be categorized as defense-related due to their involvement in either basal defense or resistance through an R-gene mediated reaction. The possible involvement of selected clones in pathogen recognition and pathogen-induced signaling as well as resistance mechanisms such as cell wall enforcement, oxidative burst and micronecrotic reactions is discussed.
Horse cDNA clones encoding two MHC class I genes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Barbis, D.P.; Maher, J.K.; Stanek, J.
1994-12-31
Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.
RICD: a rice indica cDNA database resource for rice functional genomics.
Lu, Tingting; Huang, Xuehui; Zhu, Chuanrang; Huang, Tao; Zhao, Qiang; Xie, Kabing; Xiong, Lizhong; Zhang, Qifa; Han, Bin
2008-11-26
The Oryza sativa L. indica subspecies is the most widely cultivated rice. During the last few years, we have collected over 20,000 putative full-length cDNAs and over 40,000 ESTs isolated from various cDNA libraries of two indica varieties Guangluai 4 and Minghui 63. A database of the rice indica cDNAs was therefore built to provide a comprehensive web data source for searching and retrieving the indica cDNA clones. Rice Indica cDNA Database (RICD) is an online MySQL-PHP driven database with a user-friendly web interface. It allows investigators to query the cDNA clones by keyword, genome position, nucleotide or protein sequence, and putative function. It also provides a series of information, including sequences, protein domain annotations, similarity search results, SNPs and InDels information, and hyperlinks to gene annotation in both The Rice Annotation Project Database (RAP-DB) and The TIGR Rice Genome Annotation Resource, expression atlas in RiceGE and variation report in Gramene of each cDNA. The online rice indica cDNA database provides cDNA resource with comprehensive information to researchers for functional analysis of indica subspecies and for comparative genomics. The RICD database is available through our website http://www.ncgr.ac.cn/ricd.
Isolation and expression of three gibberellin 20-oxidase cDNA clones from Arabidopsis.
Phillips, A L; Ward, D A; Uknes, S; Appleford, N E; Lange, T; Huttly, A K; Gaskin, P; Graebe, J E; Hedden, P
1995-07-01
Using degenerate oligonucleotide primers based on a pumpkin (Cucurbita maxima) gibberellin (GA) 20-oxidase sequence, six different fragments of dioxygenase genes were amplified by polymerase chain reaction from arabidopsis thaliana genomic DNA. One of these was used to isolate two different full-length cDNA clones, At2301 and At2353, from shoots of the GA-deficient Arabidopsis mutant ga1-2. A third, related clone, YAP169, was identified in the Database of Expressed Sequence Tags. The cDNA clones were expressed in Escherichia coli as fusion proteins, each of which oxidized GA12 at C-20 to GA15, GA24, and the C19 compound GA9, a precursor of bioactive GAs; the C20 tricarboxylic acid compound GA25 was formed as a minor product. The expression products also oxidized the 13-hydroxylated substrate GA53, but less effectively than GA12. The three cDNAs hybridized to mRNA species with tissue-specific patterns of accumulation, with At2301 being expressed in stems and inflorescences, At2353 in inflorescences and developing siliques, and YAP169 in siliques only. In the floral shoots of the ga1-2 mutant, transcript levels corresponding to each cDNA decreased dramatically after GA3 application, suggesting that GA biosynthesis may be controlled, at least in part, through down-regulation of the expression of the 20-oxidase genes.
Molecular cloning and expression of rat brain endopeptidase 3.4.24.16.
Dauch, P; Vincent, J P; Checler, F
1995-11-10
We have isolated by immunological screening of a lambda ZAPII cDNA library constructed from rat brain mRNAs a cDNA clone encoding endopeptidase 3.4.24.16. The longest open reading frame encodes a 704-amino acid protein with a theoretical molecular mass of 80,202 daltons and bears the consensus sequence of the zinc metalloprotease family. The sequence exhibits a 60.2% homology with those of another zinc metallopeptidase, endopeptidase 3.4.24.15. Northern blot analysis reveals two mRNA species of about 3 and 5 kilobases in rat brain, ileum, kidney, and testis. We have transiently transfected COS-7 cells with pcDNA3 containing the cloned cDNA and established the overexpression of a 70-75-kDa immunoreactive protein. This protein hydrolyzes QFS, a quenched fluorimetric substrate of endopeptidase 3.4.24.16, and cleaves neurotensin at a single peptide bond, leading to the formation of neurotensin (1-10) and neurotensin (11-13). QFS and neurotensin hydrolysis are potently inhibited by the selective endopeptidase 3.4.24.16 dipeptide blocker Pro-Ile and by dithiothreitol, while the enzymatic activity remains unaffected by phosphoramidon and captopril, the specific inhibitors of endopeptidase 3.4.24.11 and angiotensin-converting enzyme, respectively. Altogether, these physicochemical, biochemical, and immunological properties unambiguously identify endopeptidase 3.4.24.16 as the protein encoded by the isolated cDNA clone.
Gao, Ruimin; Niu, Shengniao; Dai, Weifang; Kitajima, Elliot; Wong, Sek-Man
2016-10-01
A Brazilian isolate of Hibiscus latent Fort Pierce virus (HLFPV-BR) was firstly found in a hibiscus plant in Limeira, SP, Brazil. RACE PCR was carried out to obtain the full-length sequences of HLFPV-BR which is 6453 nucleotides and has more than 99.15 % of complete genomic RNA nucleotide sequence identity with that of HLFPV Japanese isolate. The genomic structure of HLFPV-BR is similar to other tobamoviruses. It includes a 5' untranslated region (UTR), followed by open reading frames encoding for a 128-kDa protein and a 188-kDa readthrough protein, a 38-kDa movement protein, 18-kDa coat protein, and a 3' UTR. Interestingly, the unique feature of poly(A) tract is also found within its 3'-UTR. Furthermore, from the total RNA extracted from the local lesions of HLFPV-BR-infected Chenopodium quinoa leaves, a biologically active, full-length cDNA clone encompassing the genome of HLFPV-BR was amplified and placed adjacent to a T7 RNA polymerase promoter. The capped in vitro transcripts from the cloned cDNA were infectious when mechanically inoculated into C. quinoa and Nicotiana benthamiana plants. This is the first report of the presence of an isolate of HLFPV in Brazil and the successful synthesis of a biologically active HLFPV-BR full-length cDNA clone.
Gao, Lingchao; Sun, Ruhao; Liang, Yuanxue; Zhang, Mengdan; Zheng, Yusheng; Li, Dongdong
2014-10-01
Coconut (Cocos nucifera L.) is an economically tropical fruit tree with special fatty acid compositions. The stearoyl-acyl carrier protein (ACP) desaturase (SAD) plays a key role in the properties of the majority of cellular glycerolipids. In this paper, a full-length cDNA of a stearoyl-acyl carrier protein desaturase, designated CocoFAD, was isolated from cDNA library prepared from the endosperm of coconut (C. nucifera L.). An 1176 bp cDNA from overlapped PCR products containing ORF encoding a 391-amino acid (aa) protein was obtained. The coded protein was virtually identical and shared the homology to other Δ9-desaturase plant sequences (greater than 80% as similarity to that of Elaeis guineensis Jacq). The real-time fluorescent quantitative PCR result indicated that the yield of CocoFAD was the highest in the endosperm of 8-month-old coconut and leaf, and the yield was reduced to 50% of the highest level in the endosperm of 15-month-old coconut. The coding region showed heterologous expression in strain INVSc1 of yeast (Saccharomyces cerevisiae). GC-MS analysis showed that the levels of palmitoleic acid (16:1) and oleic acid (18:1) were improved significantly; meanwhile stearic acid (18:0) was reduced. These results indicated that the plastidial Δ9 desaturase from the endosperm of coconut was involved in the biosynthesis of hexadecenoic acid and octadecenoic acid, which was similar with other plants. These results may be valuable for understanding the mechanism of fatty acid metabolism and the genetic improvement of CocoFAD gene in palm plants in the future. Copyright © 2014 Elsevier B.V. All rights reserved.
Takeuchi, Y; Yoshikawa, M; Takeba, G; Tanaka, K; Shibata, D; Horino, O
1990-06-01
Soybean (Glycine max) beta-1,3-endoglucanase (EC 3.2. 1.39) is involved in one of the earliest plant-pathogen interactions that may lead to active disease resistance by releasing elicitor-active carbohydrates from the cell walls of fungal pathogens. Ethylene induced beta-1,3-endoglucanase activity to 2- to 3-fold higher levels in cotyledons of soybean seedlings. A specific polyclonal antiserum raised against purified soybean beta-1,3-endoglucanase was used to immunoprecipitate in vitro translation products, demonstrating that ethylene induction increased translatable beta-1,3-endoglucanase mRNA. Several cDNA clones for the endoglucanase gene were obtained by antibody screening of a lambda-gt11 expression library prepared from soybean cotyledons. Hybrid-select translation experiments indicated that the cloned cDNA encoded a 36-kilodalton precursor protein product that was specifically immunoprecipitated with beta-1,3-endoglucanase antiserum. Escherichia coli cells expressing the cloned cDNA also synthesized an immunologically positive protein. Nucleotide sequence of three independent clones revealed a single uninterrupted open reading frame of 1041 nucleotides, corresponding to a polypeptide of 347 residue long. The primary amino acid sequence of beta-1,3-endoglucanase as deduced from the nucleotide sequence was confirmed by direct amino acid sequencing of trypsin digests of the glucanase. The soybean beta-1,3-endoglucanase exhibited 53% amino acid homology to a beta-1,3-glucanase cloned from cultured tobacco cells and 48% homology to a beta-(1,3-1,4)-glucanase from barley. Utilizing the largest cloned cDNA (pEG488) as a hybridization probe, it was found that the increase in translatable beta-1,3-endoglucanase mRNA seen upon ethylene treatment of soybean seedlings was due to 50- to 100-fold increase in steady state mRNA levels, indicating that ethylene regulates gene expression of this enzyme important in disease resistance at the level of gene transcription.
Zhao, Wei; Li, Xin; Liu, Wen-Hui; Zhao, Jian; Jin, Yi-Ming; Sui, Ting-Ting
2014-09-01
Human epithelial colorectal adenocarcinoma (Caco-2) cells are widely used as an in vitro model of the human small intestinal mucosa. Caco-2 cells are host cells of the human astrovirus (HAstV) and other enteroviruses. High quality cDNA libraries are pertinent resources and critical tools for protein-protein interaction research, but are currently unavailable for Caco-2 cells. To construct a three-open reading frame, full length-expression cDNA library from the Caco-2 cell line for application to HAstV protein-protein interaction screening, total RNA was extracted from Caco-2 cells. The switching mechanism at the 5' end of the RNA transcript technique was used for cDNA synthesis. Double-stranded cDNA was digested by Sfi I and ligated to reconstruct a pGADT7-Sfi I three-frame vector. The ligation mixture was transformed into Escherichia coli HST08 premium electro cells by electroporation to construct the primary cDNA library. The library capacity was 1.0×10(6)clones. Gel electrophoresis results indicated that the fragments ranged from 0.5kb to 4.2kb. Randomly picked clones show that the recombination rate was 100%. The three-frame primary cDNA library plasmid mixture (5×10(5)cfu) was also transformed into E. coli HST08 premium electro cells, and all clones were harvested to amplify the cDNA library. To detect the sufficiency of the cDNA library, HAstV capsid protein as bait was screened and tested against the Caco-2 cDNA library by a yeast two-hybrid (Y2H) system. A total of 20 proteins were found to interact with the capsid protein. These results showed that a high-quality three-frame cDNA library from Caco-2 cells was successfully constructed. This library was efficient for the application to the Y2H system, and could be used for future research. Copyright © 2014 Elsevier B.V. All rights reserved.
Cloning and expression of a Ca(2+)-inhibitable adenylyl cyclase from NCB-20 cells.
Yoshimura, M; Cooper, D M
1992-01-01
A cDNA that encodes an adenylyl cyclase [ATP pyrophosphate-lyase (cyclizing), EC 4.6.1.1] has been cloned from NCB-20 cells, in which adenylyl cyclase activity is inhibited by Ca2+ at physiological concentrations. The cDNA clone (5.8 kilobases) was isolated by polymerase chain reaction (PCR) using degenerate primers designed by comparison of three adenylyl cyclase sequences (types I, II, and III) and subsequent library screening. Northern analysis revealed expression of mRNA (6.1 kilobases) corresponding to this cDNA in cardiac tissue, which is a prominent source of Ca(2+)-inhibitable adenylyl cyclase. The clone encodes a protein of 1165 amino acids, whose hydrophilicity profile was very similar to those of other mammalian adenylyl cyclases that have recently been cloned. A noticeable difference between this protein and other adenylyl cyclases was a lengthy aminoterminal region before the first transmembrane span. Transient expression of this cDNA in the human embryonic kidney cell line 293 revealed a 3-fold increase in cAMP production in response to forskolin compared with control transfected cells. In purified plasma membranes from transfected cells, increased adenylyl cyclase activity was also detected, which was susceptible to inhibition by submicromolar Ca2+. Thus, this adenylyl cyclase seems to represent the Ca(2+)-inhibitable form that is encountered in NCB-20 cells, cardiac tissue, and elsewhere. Its identification should permit a determination of the structural features that determine the mode of regulation of adenylyl cyclase by Ca2+. Images PMID:1379717
Hussey, Richard S; Huang, Guozhong; Allen, Rex
2011-01-01
Identifying parasitism genes encoding proteins secreted from a plant-parasitic nematode's esophageal gland cells and injected through its stylet into plant tissue is the key to understanding the molecular basis of nematode parasitism of plants. Parasitism genes have been cloned by directly microaspirating the cytoplasm from the esophageal gland cells of different parasitic stages of cyst or root-knot nematodes to provide mRNA to create a gland cell-specific cDNA library by long-distance reverse-transcriptase polymerase chain reaction. cDNA clones are sequenced and deduced protein sequences with a signal peptide for secretion are identified for high-throughput in situ hybridization to confirm gland-specific expression.
McPhaul, M; Berg, P
1986-01-01
The rat asialoglycoprotein receptor (ASGP-R) has been expressed in cultured rat hepatoma cells (HTC cells) after transfection with cloned cDNAs. Fluorescence-activated cell sorting of transfected cells was used to identify the functional cDNA clones and to isolate cells expressing the ASGP-R. Simultaneous or sequential transfections with two cloned cDNAs that encode related but distinctive polypeptide chains were needed to obtain ASGP-R activity; transfection with either cDNA alone failed to produce detectable ASGP-R. The affinity of transduced ASGP-R for asialo orosomucoid is less than that of the native rat ASGP-R, and the number of surface receptors in clones expressing ASGP-R is about one-fifth that found on rat hepatocytes. Images PMID:3466162
Cloning of human prourokinase cDNA without the signal peptide and expression in Escherichia coli.
Hu, B; Li, J; Yu, W; Fang, J
1993-01-01
Human prourokinase (pro-UK) cDNA without the signal peptide was obtained using synthetic oligonucleotide and DNA recombination techniques and was successfully expressed in E. coli. The plasmid pMMUK which contained pro-UK cDNA (including both the entire coding sequence and the sequence for signal peptide) was digested with Hind III and PstI, so that the N-terminal 371-bp fragment could be recovered. A 304-bp fragment was collected from the 371-bp fragment after partial digestion with Fnu4HI in order to remove the signal peptide sequence. An intermediate plasmid was formed after this 304-bp fragment and the synthetic oligonucleotide was ligated with pUC18. Correctness of the ligation was confirmed by enzyme digestion and sequencing. By joining the PstI-PstI fragment of pro-UK to the plasmid we obtained the final plasmid which contained the entire coding sequence of pro-UK without the signal peptide. The coding sequence with correct orientation was inserted into pBV220 under the control of the temperature-induced promoter PRPL, and mature pro-UK was expressed in E. coli at 42 degrees C. Both sonicated supernatant and inclusion bodies of the bacterial host JM101 showed positive results by ELISA and FAPA assays. After renaturation, the biological activity of the expressed product was increased from 500-1000IU/L to about 60,000IU/L. The bacterial pro-UK showed a molecular weight of about 47,000 daltons by Western blot analysis. It can be completely inhibited by UK antiserum but not by t-PA antiserum nor by normal rabbit serum.
Structure of the coding region and mRNA variants of the apyrase gene from pea (Pisum sativum)
NASA Technical Reports Server (NTRS)
Shibata, K.; Abe, S.; Davies, E.
2001-01-01
Partial amino acid sequences of a 49 kDa apyrase (ATP diphosphohydrolase, EC 3.6.1.5) from the cytoskeletal fraction of etiolated pea stems were used to derive oligonucleotide DNA primers to generate a cDNA fragment of pea apyrase mRNA by RT-PCR and these primers were used to screen a pea stem cDNA library. Two almost identical cDNAs differing in just 6 nucleotides within the coding regions were found, and these cDNA sequences were used to clone genomic fragments by PCR. Two nearly identical gene fragments containing 8 exons and 7 introns were obtained. One of them (H-type) encoded the mRNA sequence described by Hsieh et al. (1996) (DDBJ/EMBL/GenBank Z32743), while the other (S-type) differed by the same 6 nucleotides as the mRNAs, suggesting that these genes may be alleles. The six nucleotide differences between these two alleles were found solely in the first exon, and these mutation sites had two types of consensus sequences. These mRNAs were found with varying lengths of 3' untranslated regions (3'-UTR). There are some similarities between the 3'-UTR of these mRNAs and those of actin and actin binding proteins in plants. The putative roles of the 3'-UTR and alternative polyadenylation sites are discussed in relation to their possible role in targeting the mRNAs to different subcellular compartments.
Yi, S Y; Yu, S H; Choi, D
1999-06-30
Recent reports revealed that catalase has a role in the plant defense mechanism against a broad range of pathogens through being inhibited by salicylic acid (SA). During an effort to clone disease resistance-responsive genes, a cDNA encoding catalase (Ngcat1; Nicotiana glutinosa cat1) was isolated from a tobacco cDNA library. In N. glutinosa, catalase is encoded by a small gene family. The deduced amino acid sequence of the Ngcat1 cDNA has 98% homology with the cat1 gene of N. plumbaginifolia. The Ngcat1 expression is controlled by the circadian clock, and its mRNA level is the most abundant in leaves. Both the expression of Ngcat1 mRNA and its enzyme activity in the tobacco plant undergoing a hypersensitive response (HR) to TMV infection were repressed. The repression of the mRNA level was also observed following treatment with SA. These results imply that SA may act as an inhibitor of catalase transcription during the HR of tobacco. Cloning and expression of the Ngcat1 in tobacco following pathogen infection and SA treatment are presented.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Clines, G.; Lovett, M.
1994-09-01
Diastrophic dysplasia (DTD) is an autosomal recessive disorder of unknown pathogenesis that is characterized by abnormal skeletal and cartilage growth. Phenotypic characteristics of the disorder include short stature, scoliosis, and deformation of the first metacarpal. The diastrophic dysplasia gene has been localized to chromosome 5q31-33, within {approximately}60 kb of the colony stimulating factor 1 receptor gene (CSF1R). We have used direct cDNA selection to build a transcription map across {approximately}250 kb surrounding and including the CSF1R locus. cDNA pools from human placenta, activated T cells, cerebellum, Hela cells, fetal brain, chondrocytes, chondrosarcomas and osteosarcomas were multiplexed in these selections. Aftermore » two rounds of selection, an analysis revealed that {approximately}70% of the selected cDNAs were contained within the contig. DNA sequencing and cosmid mapping data from a collection of 310 clones revealed the presence of three new genes in this region that show no appreciable homologies on sequence database searches, as well as cDNA clones from the CSF1R and the PDGFRB loci (another of the known genes in the region). An additional cDNA was found with 100% homology to the gene encoding human ribosomal protein L7 (RPL7). This cDNA comprised {approximately}25% of all selected clones. However, further analysis of the genomic contig revealed the presence of an RPL7 processed pseudogene in very close proximity to the CSF1R and PDGFRB genes. The selection of processed pseudogenes is one previously anticipated artifact of selection metholodolgies, but has not been previously observed. Mutational analysis of the three new genes is underway in diastrophic dysplasia families, as is derivation of full length cDNA clones and the expansion of this detailed transcription map into a larger genomic contig.« less
Structure of the horseradish peroxidase isozyme C genes.
Fujiyama, K; Takemura, H; Shibayama, S; Kobayashi, K; Choi, J K; Shinmyo, A; Takano, M; Yamada, Y; Okada, H
1988-05-02
We have isolated, cloned and characterized three cDNAs and two genomic DNAs corresponding to the mRNAs and genes for the horseradish (Armoracia rusticana) peroxidase isoenzyme C (HPR C). The amino acid sequence of HRP C1, deduced from the nucleotide sequence of one of the cDNA clone, pSK1, contained the same primary sequence as that of the purified enzyme established by Welinder [FEBS Lett. 72, 19-23 (1976)] with additional sequences at the N and C terminal. All three inserts in the cDNA clones, pSK1, pSK2 and pSK3, coded the same size of peptide (308 amino acid residues) if these are processed in the same way, and the amino acid sequence were homologous to each other by 91-94%. Functional amino acids, including His40, His170, Tyr185 and Arg183 and S-S-bond-forming Cys, were conserved in the three isozymes, but a few N-glycosylation sites were not the same. Two HRP C isoenzyme genomic genes, prxC1 and prxC2, were tandem on the chromosomal DNA and each gene consisted of four exons and three introns. The positions in the exons interrupted by introns were the same in two genes. We observed a putative promoter sequence 5' upstream and a poly(A) signal 3' downstream in both genes. The gene product of prxC1 might be processed with a signal sequence of 30 amino acid residues at the N terminus and a peptide consisting of 15 amino acid residues at the C terminus.
Targeting a Complex Transcriptome: The Construction of the Mouse Full-Length cDNA Encyclopedia
Carninci, Piero; Waki, Kazunori; Shiraki, Toshiyuki; Konno, Hideaki; Shibata, Kazuhiro; Itoh, Masayoshi; Aizawa, Katsunori; Arakawa, Takahiro; Ishii, Yoshiyuki; Sasaki, Daisuke; Bono, Hidemasa; Kondo, Shinji; Sugahara, Yuichi; Saito, Rintaro; Osato, Naoki; Fukuda, Shiro; Sato, Kenjiro; Watahiki, Akira; Hirozane-Kishikawa, Tomoko; Nakamura, Mari; Shibata, Yuko; Yasunishi, Ayako; Kikuchi, Noriko; Yoshiki, Atsushi; Kusakabe, Moriaki; Gustincich, Stefano; Beisel, Kirk; Pavan, William; Aidinis, Vassilis; Nakagawara, Akira; Held, William A.; Iwata, Hiroo; Kono, Tomohiro; Nakauchi, Hiromitsu; Lyons, Paul; Wells, Christine; Hume, David A.; Fagiolini, Michela; Hensch, Takao K.; Brinkmeier, Michelle; Camper, Sally; Hirota, Junji; Mombaerts, Peter; Muramatsu, Masami; Okazaki, Yasushi; Kawai, Jun; Hayashizaki, Yoshihide
2003-01-01
We report the construction of the mouse full-length cDNA encyclopedia,the most extensive view of a complex transcriptome,on the basis of preparing and sequencing 246 libraries. Before cloning,cDNAs were enriched in full-length by Cap-Trapper,and in most cases,aggressively subtracted/normalized. We have produced 1,442,236 successful 3′-end sequences clustered into 171,144 groups, from which 60,770 clones were fully sequenced cDNAs annotated in the FANTOM-2 annotation. We have also produced 547,149 5′ end reads,which clustered into 124,258 groups. Altogether, these cDNAs were further grouped in 70,000 transcriptional units (TU),which represent the best coverage of a transcriptome so far. By monitoring the extent of normalization/subtraction, we define the tentative equivalent coverage (TEC),which was estimated to be equivalent to >12,000,000 ESTs derived from standard libraries. High coverage explains discrepancies between the very large numbers of clusters (and TUs) of this project,which also include non-protein-coding RNAs,and the lower gene number estimation of genome annotations. Altogether,5′-end clusters identify regions that are potential promoters for 8637 known genes and 5′-end clusters suggest the presence of almost 63,000 transcriptional starting points. An estimate of the frequency of polyadenylation signals suggests that at least half of the singletons in the EST set represent real mRNAs. Clones accounting for about half of the predicted TUs await further sequencing. The continued high-discovery rate suggests that the task of transcriptome discovery is not yet complete. PMID:12819125
Mukherjee, M; Hadar, R; Mukherjee, P K; Horwitz, B A
2003-01-01
To clone the beta-tubulins and to induce resistance to benzimidazoles in the biocontrol fungus Trichoderma virens through site-directed mutagenesis. Two beta-tubulin genes have been cloned using PCR amplification followed by the screening of a T. virens cDNA library. The full-length cDNA clones, coding for 445 and 446 amino acids, have been designated as T. virens tub1 and T. virens tub2. A sequence alignment of these two tubulins with tubulins from other filamentous fungi has shown the presence of some unique amino acid sequences not found in those positions in other beta-tubulins. Constitutive expression of the tub2 gene with a histidine to tyrosine substitution at position 6 (known to impart benomyl/methyl benzimadazol-2-yl carbamate resistance in other fungi), under the Pgpd promoter of Aspergillus nidulans, did not impart resistance to benomyl. The homologous expression of tub2 gene with a histidine to tyrosine mutation at position +6, which is known to impart benomyl tolerance in other fungi, does not impart resistance in T. virens. Unlike other Trichoderma spp., T. virens, has been difficult to mutate for benomyl tolerance. The present study, through site-directed mutagenesis, shows that a mutation known to impart benomyl tolerance in T. viride and other fungi does not impart resistance in this fungus. Understanding the mechanisms of this phenomenon will have a profound impact in plant-disease management, as many plant pathogenic fungi develop resistance to this group of fungicides forcing its withdrawal after a short period of use.
Molecular cloning of Kazal-type proteinase inhibitor of the shrimp Fenneropenaeus chinensis.
Kong, Hee Jeong; Cho, Hyun Kook; Park, Eun-Mi; Hong, Gyeong-Eun; Kim, Young-Ok; Nam, Bo-Hye; Kim, Woo-Jin; Lee, Sang-Jun; Han, Hyon Sob; Jang, In-Kwon; Lee, Chang Hoon; Cheong, Jaehun; Choi, Tae-Jin
2009-01-01
Proteinase inhibitors play important roles in host defence systems involving blood coagulation and pathogen digestion. We isolated and characterized a cDNA clone for a Kazal-type proteinase inhibitor (KPI) from a hemocyte cDNA library of the oriental white shrimp Fenneropenaeus chinensis. The KPI gene consists of three exons and two introns. KPI cDNA contains an open reading frame of 396 bp, a polyadenylation signal sequence AATAAA, and a poly (A) tail. KPI cDNA encodes a polypeptide of 131 amino acids with a putative signal peptide of 21 amino acids. The deduced amino acid sequence of KPI contains two homologous Kazal domains, each with six conserved cysteine residues. The mRNA of KPI is expressed in the hemocytes of healthy shrimp, and the higher expression of KPI transcript is observed in shrimp infected with the white spot syndrome virus (WSSV), suggesting a potential role for KPI in host defence mechanisms.
Huebner, K; Druck, T; Croce, C M; Thiesen, H J
1991-01-01
cDNA clones encoding zinc finger structures were isolated by screening Molt4 and Jurkat cDNA libraries with zinc finger consensus sequences. Candidate clones were partially sequenced to verify the presence of zinc finger-encoding regions; nonoverlapping cDNA clones were chosen on the basis of sequences and genomic hybridization pattern. Zinc finger structure-encoding clones, which were designated by the term "Kox" and a number from 1 to 32 and which were apparently unique (i.e., distinct from each other and distinct from those isolated by other laboratories), were chosen for mapping in the human genome. DNAs from rodent-human somatic cell hybrids retaining defined complements of human chromosomes were analyzed for the presence of each of the Kox genes. Correlation between the presence of specific human chromosome regions and specific Kox genes established the chromosomal locations. Multiple Kox loci were mapped to 7q (Kox 18 and 25 and a locus detected by both Kox 8 cDNA and Kox 27 cDNA), 8q24 5' to the myc locus (Kox 9 and 32), 10cen----q24 (Kox 2, 15, 19, 21, 30, and 31), 12q13-qter (Kox 1 and 20), 17p13 (Kox 11 and 26), and 19q (Kox 5, 6, 10, 22, 24, and 28). Single Kox loci were mapped to 7p22 (Kox 3), 18q12 (Kox 17), 19p (Kox 13), 22q11 between IG lambda and BCR-1 (locus detected by both Kox 8 cDNA and Kox 27 cDNA), and Xp (Kox 14). Several of the Kox loci map to regions in which other zinc finger structure-encoding loci have already been localized, indicating possible zinc finger gene clusters. In addition, Kox genes at 8q24, 17p13, and 22q11--and perhaps other Kox genes--are located near recurrent chromosomal translocation breakpoints. Others, such as those on 7p and 7q, may be near regions specifically active in T cells. Images Figure 4 Figure 5 Figure 2 Figure 3 PMID:2014798
Liu, Zhong-Yu; Yu, Jiu-Yang; Huang, Xing-Yao; Fan, Hang; Li, Xiao-Feng; Deng, Yong-Qiang; Ji, Xue; Cheng, Meng-Li; Ye, Qing; Zhao, Hui; Han, Jian-Feng; An, Xiao-Ping; Jiang, Tao; Zhang, Bo; Tong, Yi-Gang; Qin, Cheng-Feng
2017-11-01
Zika virus (ZIKV) has caused significant outbreaks and epidemics in the Americas recently, raising global concern due to its ability to cause microcephaly and other neurological complications. A stable and efficient infectious clone of ZIKV is urgently needed. However, the instability and toxicity of flavivirus cDNA clones in Escherichia coli hosts has hindered the development of ZIKV infectious clones. Here, using a novel self-splicing ribozyme-based strategy, we generated a stable infectious cDNA clone of a contemporary ZIKV strain imported from Venezuela to China in 2016. The constructed clone contained a modified version of the group II self-splicing intron P.li.LSUI2 near the junction between the E and NS1 genes, which were removed from the RNA transcripts by an easy-to-establish in vitro splicing reaction. Transfection of the spliced RNAs into BHK-21 cells led to the production of infectious progeny virus that resembled the parental virus. Finally, potential cis -acting RNA elements in ZIKV genomic RNA were identified based on this novel reverse genetics system, and the critical role of 5'-SLA promoter and 5'-3' cyclization sequences were characterized by a combination of different assays. Our results provide another stable and reliable reverse genetics system for ZIKV that will help study ZIKV infection and pathogenesis, and the novel self-splicing intron-based strategy could be further expanded for the construction of infectious clones from other emerging and reemerging flaviviruses. IMPORTANCE The ongoing Zika virus (ZIKV) outbreaks have drawn global concern due to the unexpected causal link to fetus microcephaly and other severe neurological complications. The infectious cDNA clones of ZIKV are critical for the research community to study the virus, understand the disease, and inform vaccine design and antiviral screening. A panel of existing technologies have been utilized to develop ZIKV infectious clones. Here, we successfully generated a stable infectious clone of a 2016 ZIKV strain using a novel self-splicing ribozyme-based technology that abolished the potential toxicity of ZIKV cDNA clones to the E. coli host. Moreover, two crucial cis -acting replication elements (5'-SLA and 5'-CS) of ZIKV were first identified using this novel reverse genetics system. This novel self-splicing ribozyme-based reverse genetics platform will be widely utilized in future ZIKV studies and provide insight for the development of infectious clones of other emerging viruses. Copyright © 2017 American Society for Microbiology.
Liu, Zhong-Yu; Yu, Jiu-Yang; Huang, Xing-Yao; Fan, Hang; Li, Xiao-Feng; Deng, Yong-Qiang; Ji, Xue; Cheng, Meng-Li; Ye, Qing; Zhao, Hui; Han, Jian-Feng; An, Xiao-Ping; Jiang, Tao; Zhang, Bo; Tong, Yi-Gang
2017-01-01
ABSTRACT Zika virus (ZIKV) has caused significant outbreaks and epidemics in the Americas recently, raising global concern due to its ability to cause microcephaly and other neurological complications. A stable and efficient infectious clone of ZIKV is urgently needed. However, the instability and toxicity of flavivirus cDNA clones in Escherichia coli hosts has hindered the development of ZIKV infectious clones. Here, using a novel self-splicing ribozyme-based strategy, we generated a stable infectious cDNA clone of a contemporary ZIKV strain imported from Venezuela to China in 2016. The constructed clone contained a modified version of the group II self-splicing intron P.li.LSUI2 near the junction between the E and NS1 genes, which were removed from the RNA transcripts by an easy-to-establish in vitro splicing reaction. Transfection of the spliced RNAs into BHK-21 cells led to the production of infectious progeny virus that resembled the parental virus. Finally, potential cis-acting RNA elements in ZIKV genomic RNA were identified based on this novel reverse genetics system, and the critical role of 5′-SLA promoter and 5′-3′ cyclization sequences were characterized by a combination of different assays. Our results provide another stable and reliable reverse genetics system for ZIKV that will help study ZIKV infection and pathogenesis, and the novel self-splicing intron-based strategy could be further expanded for the construction of infectious clones from other emerging and reemerging flaviviruses. IMPORTANCE The ongoing Zika virus (ZIKV) outbreaks have drawn global concern due to the unexpected causal link to fetus microcephaly and other severe neurological complications. The infectious cDNA clones of ZIKV are critical for the research community to study the virus, understand the disease, and inform vaccine design and antiviral screening. A panel of existing technologies have been utilized to develop ZIKV infectious clones. Here, we successfully generated a stable infectious clone of a 2016 ZIKV strain using a novel self-splicing ribozyme-based technology that abolished the potential toxicity of ZIKV cDNA clones to the E. coli host. Moreover, two crucial cis-acting replication elements (5′-SLA and 5′-CS) of ZIKV were first identified using this novel reverse genetics system. This novel self-splicing ribozyme-based reverse genetics platform will be widely utilized in future ZIKV studies and provide insight for the development of infectious clones of other emerging viruses. PMID:28814522
Peng, Jinbiao; Han, Hongxiao; Hong, Yang; Wang, Yan; Guo, Fanji; Shi, Yaojun; Fu, Zhiqiang; Liu, Jinming; Cheng, Guofeng; Lin, Jiaojiao
2010-03-01
The present study was intend to clone and express the cDNA encoding Cyclophilin B (CyPB) of Schistosoma japonicum, its preliminary biological function and further immunoprotective effect against schistosome infection in mice. RT-PCR technique was applied to amplify a full-length cDNA encoding protein Cyclophilin B (Sj CyPB) from schistosomula cDNA. The expression profiles of Sj CyPB were determined by Real-time PCR using the template cDNAs isolated from 7, 13, 18, 23, 32 and 42 days parasites. The cDNA containing the Open Reading Frame of CyPB was then subcloned into a pGEX-6P-1 vector and transformed into competent Escherichia coli BL21 for expressing. The recombinant protein was renaturated, purified and its antigenicity were detected by Western blotting, and the immunoprotective effect induced by recombinant Sj CyPB was evaluated in Balb/C mice. The cDNA containing the ORF of Sj CyPB was cloned with the length of 672 base pairs, encoding 223 amino acids. Real-time PCR analysis revealed that the gene had the highest expression in 18-day schistosomula, suggesting that Sj CyPB was schistosomula differentially expressed gene. The recombinant protein showed a good antigenicity detected by Western blotting. Animal experiment indicated that the vaccination of recombinant CyPB protein in mice led to 31.5% worm and 41.01% liver egg burden reduction, respectively, compared with those of the control. A full-length cDNA differentially expressed in schistosomula was obtained. The recombinant Sj CyPB protein could induce partial protection against schistosome infection.
Huh, T L; Ryu, J H; Huh, J W; Sung, H C; Oh, I U; Song, B J; Veech, R L
1993-01-01
Mitochondrial NADP(+)-specific isocitrate dehydrogenase (IDP) was co-purified with the pyruvate dehydrogenase complex from bovine kidney mitochondria. The determination of its N-terminal 16-amino-acid sequence revealed that it is highly similar to the IDP from yeast. A cDNA clone (1.8 kb long) encoding this protein was isolated from a bovine kidney lambda gt11 cDNA library using a synthetic oligodeoxynucleotide. The deduced protein sequence of this cDNA clone rendered a precursor protein of 452 amino-acid residues (50,830 Da) and a mature protein of 413 amino-acid residues (46,519 Da). It is 100% identical to the internal tryptic peptide sequences of the autologous form from pig heart and 62% similar to that from yeast. However, it shares little similarity with the mitochondrial NAD(+)-specific isoenzyme from yeast. Structural analyses of the deduced proteins of IDP isoenzymes from different species indicated that similarity exists in certain regions, which may represent the common domains for the active sites or coenzyme-binding sites. In Northern-blot analysis, one species of mRNA (about 2.2 kb for both bovine and human) was hybridized with a 32P-labelled cDNA probe. Southern-blot analysis of genomic DNAs verified simple patterns of hybridization with this cDNA. These results strongly indicate that the mitochondrial IDP may be derived from a single gene family which does not appear to be closely related to that of the NAD(+)-specific isoenzyme. Images Figure 1 Figure 3 Figure 4 Figure 5 PMID:8318002
Cai, Kexin; Wang, Jiawen; Wang, Min; Zhang, Hui; Wang, Siming; Zhao, Yu
2016-07-01
To establish an efficient expression system for a fusion protein GST-pgLTP (Lipid Transfer Protein) and to test its antifungal activity. The nucleotide sequence of LTP gene was obtained from Panax ginseng using RT-PCR. The ORF of the cDNA is 363 bp, codING for a protein OF 120 amino acids with a calculated MW of 12.09 kDa. The pgLTP gene with a His6-tag at the C-terminus was cloned into the pGEX-6p1 vector to generate a GST-fusion pgLTP protein construct that was expressed in Escherichia coli Rosetta. Following purification by Ni-NTA, the fusion protein exhibited antifungal activity against five fungi found in ginseng. The fusion protein GST-pgLTP has activity against a broad spectrum of phytopathogenic fungi, and can potentially be adapted for production to combat fungal diseases that affect P. ginseng.
Klein, B; Pawlowski, K; Höricke-Grandpierre, C; Schell, J; Töpfer, R
1992-05-01
A cDNA encoding beta-ketoacyl-ACP reductase (EC 1.1.1.100), an integral part of the fatty acid synthase type II, was cloned from Cuphea lanceolata. This cDNA of 1276 bp codes for a polypeptide of 320 amino acids with 63 N-terminal residues presumably representing a transit peptide and 257 residues corresponding to the mature protein of 27 kDa. The encoded protein shows strong homology with the amino-terminal sequence and two tryptic peptides from avocado mesocarp beta-ketoacyl-ACP reductase, and its total amino acid composition is highly similar to those of the beta-ketoacyl-ACP reductases of avocado and spinach. Amino acid sequence homologies to polyketide synthase, beta-ketoreductases and short-chain alcohol dehydrogenases are discussed. An engineered fusion protein lacking most of the transit peptide, which was produced in Escherichia coli, was isolated and proved to possess beta-ketoacyl-ACP reductase activity. Hybridization studies revealed that in C. lanceolata beta-ketoacyl-ACP reductase is encoded by a small family of at least two genes and that members of this family are expressed in roots, leaves, flowers and seeds.
cDNA cloning and characterization of Type I procollagen alpha1 chain in the skate Raja kenojei.
Hwang, Jae-Ho; Yokoyama, Yoshihiro; Mizuta, Shoshi; Yoshinaka, Reiji
2006-05-01
A full-length cDNA of the Type I procollagen alpha1 [pro-alpha1(I)] chain (4388 bp), coding for 1463 amino acid residues in the total length, was determined by RACE PCR using a cDNA library constructed from 4-week embryo of the skate Raja kenojei. The helical region of the skate pro-alpha1(I) chain consisted of 1014 amino acid residues - the same as other fibrillar collagen alpha chains from higher vertebrates. Comparison on denaturation temperatures of Type I collagens from the skate, rainbow trout (Oncorhynchus mykiss) and rat (Rattus norvegicus) revealed that the number of Gly-Pro-Pro and Gly-Gly in the alpha1(I) chains could be directly related to the thermal stability of the helix. The expression property of the skate pro-alpha1(I) chain mRNA and phylogenetic analysis with other vertebrate pro-alpha1(I) chains suggested that skate pro-alpha1(I) chain could be a precursor form of the skate Type I collagen alpha1 chain. The present study is the first evidence for the primary structure of full-length pro-alpha1(I) chain in an elasmobranch.
Characterization of a monoclonal antibody and a cDNA for polyubiquitin of Amoeba proteus.
Lee, S Y; Kim, H J; Yoo, S Y; Ahn, T I
1998-01-01
A monoclonal antibody was obtained that reacts with many different proteins (14-200 kDa) of Amoeba proteus. By indirect immunofluorescence microscopy we found the antigens to be dispersed throughout the cytoplasm but were more concentrated in the nucleus. The antibody cross-reacted with proteins of Tetrahymena, Xenopus embryo, and mouse macrophages. Using the antibody as a probe we cloned a cDNA of 1.2 kb coding for ubiquitin in five repeats. Amino acid sequences of ameba's polyubiquitin showed the most variations among the nineteen polyubiquitins of other organisms compared. The well-conserved 20Ser and 55Thr residues were replaced with Gly and Ser, respectively. The 28Ala residue found in most organisms was replaced with Gln or Glu in the amoeba. Amoebae contained two ubiquitin-mRNAs that could be detected by Northern blot analysis using the cDNA as a probe. In an analysis for specificity, the antibody reacted with polyubiquitin and ubiquitin-fusion proteins larger than 14 kDa but not with monomeric ubiquitin. The antibody is a useful probe in the detection and characterization of proteins ubiquitinated in response to cellular stresses.
Wu, Fang; Yan, Ming; Li, Yikun; Chang, Shaojie; Song, Xiaomin; Zhou, Zhaocai; Gong, Weimin
2003-12-19
SPE-16 is a new 16kDa protein that has been purified from the seeds of Pachyrrhizus erosus. It's N-terminal amino acid sequence shows significant sequence homology to pathogenesis-related class 10 proteins. cDNA encoding 150 amino acids was cloned by RT-PCR and the gene sequence proved SPE-16 to be a new member of PR-10 family. The cDNA was cloned into pET15b plasmid and expressed in Escherichia coli. The bacterially expressed SPE-16 also demonstrated ribonuclease-like activity in vitro. Site-directed mutation of three conserved amino acids E95A, E147A, Y150A, and a P-loop truncated form were constructed and their different effects on ribonuclease activities were observed. SPE-16 is also able to bind the fluorescent probe 8-anilino-1-naphthalenesulfonate (ANS) in the native state. The ANS anion is a much-utilized "hydrophobic probe" for proteins. This binding activity indicated another biological function of SPE-16.
Cloning and expression studies of the Dunaliella salina UDP-glucose dehydrogenase cDNA.
Qinghua, He; Dairong, Qiao; Qinglian, Zhang; Shunji, He; Yin, Li; Linhan, Bai; Zhirong, Yang; Yi, Cao
2005-06-01
The enzyme UDP-glucose dehydrogenase (EC 1.1.1.22) converts UDP-glucose to UDP-glucuronate. Plant UDP-glucose dehydrogenase (UGDH) is an important enzyme in the formation of hemicellulose and pectin, the components of primary cell walls. A cDNA, named DsUGDH, (GeneBank accession number: AY795899) corresponding to UGDH was cloned by RT-PCR approach from Dunaliella salina. The cDNA is 1941-bp long and has an open reading frame encoded a protein of 483 amino acids with a calculated molecular weight of 53 kDa. The derived amino acids sequence shows high homology with reported plants UGDHs, and has highly conserved amino acids motifs believed to be NAD binding site and catalytic site. Although UDP-glucose dehydrogenase is a comparatively well characterized enzyme, the cloning and characterization of the green alga Dunaliella salina UDP-glucose dehydrogenase gene is very important to understand the salt tolerance mechanism of Dunaliella salina. Northern analyses indicate that NaCl can induce the expression the DsUGDH.
Molecular cloning and characterization of Hymenolepis diminuta alpha-tubulin gene.
Mohajer-Maghari, Behrokh; Amini-Bavil-Olyaee, Samad; Webb, Rodney A; Coe, Imogen R
2007-02-01
To isolate a full-length alpha-tubulin cDNA from an eucestode, Hymenolepis diminuta, a lambda phage cDNA library was constructed. The alpha-tubulin gene was cloned, sequenced and characterized. The H. diminuta alpha-tubulin consisted of 450 amino acids. This protein contained putative sites for all posttranslational modifications as detyrosination/tyrosination at the carboxyl-terminal of protien, phosphorylation at residues R79 and K336, glycylation/glutamylation at residue G445 and acetylation at residue K40. Comparisons of H. diminuta alpha-tubulin with all full-length alpha-tubulin proteins revealed that H. diminuta alpha-tubulin possesses 10 distinctive residues, which are not found in any other alpha-tubulins. Phylogenetic analysis showed that H. diminuta alpha-tubulin has grouped in a separated branch adjacent eucestode and trematodes branch with 92% bootstrap value (1000 replicates). In conclusion, this is the first report of H. diminuta cDNA library construction, cloning and characterization of H. diminuta alpha-tubulin gene.
Oishi, M; Gohma, H; Lejukole, H Y; Taniguchi, Y; Yamada, T; Suzuki, K; Shinkai, H; Uenishi, H; Yasue, H; Sasaki, Y
2004-05-01
Expressed sequence tags (ESTs) generated based on characterization of clones isolated randomly from cDNA libraries are used to study gene expression profiles in specific tissues and to provide useful information for characterizing tissue physiology. In this study, two directionally cloned cDNA libraries were constructed from 60 day-old bovine whole fetus and fetal placenta. We have characterized 5357 and 1126 clones, and then identified 3464 and 795 unique sequences for the fetus and placenta cDNA libraries: 1851 and 504 showed homology to already identified genes, and 1613 and 291 showed no significant matches to any of the sequences in DNA databases, respectively. Further, we found 94 unique sequences overlapping in both the fetus and the placenta, leading to a catalog of 4165 genes expressed in 60 day-old fetus and placenta. The catalog is used to examine expression profile of genes in 60 day-old bovine fetus and placenta.
Stevens, Mark; Viganó, Felicita
2007-04-01
The full-length cDNA of Beet mild yellowing virus (Broom's Barn isolate) was sequenced and cloned into the vector pLitmus 29 (pBMYV-BBfl). The sequence of BMYV-BBfl (5721 bases) shared 96% and 98% nucleotide identity with the other complete sequences of BMYV (BMYV-2ITB, France and BMYV-IPP, Germany respectively). Full-length capped RNA transcripts of pBMYV-BBfl were synthesised and found to be biologically active in Arabidopsis thaliana protoplasts following electroporation or PEG inoculation when the protoplasts were subsequently analysed using serological and molecular methods. The BMYV sequence was modified by inserting DNA that encoded the jellyfish green fluorescent protein (GFP) into the P5 gene close to its 3' end. A. thaliana protoplasts electroporated with these RNA transcripts were biologically active and up to 2% of transfected protoplasts showed GFP-specific fluorescence. The exploitation of these cDNA clones for the study of the biology of beet poleroviruses is discussed.
cDNA cloning and analysis of betaine aldehyde dehydrogenase, a salt inducible enzyme in sugar beet
DOE Office of Scientific and Technical Information (OSTI.GOV)
McCue, K.F.; Hanson, A.D.
1990-05-01
Betaine accumulates and serves as a compatible osmolyte in some plants subjected to drought or salinity stress. The last enzyme in the betaine biosynthetic pathway is betaine aldehyde dehydrogenase (BADH). The activity of BADH increases in response to increasing salinity levels. This increase in activity corresponds to an increase in protein detectable by immunoblotting, and to an increase in the translatable BADH mRNA. BADH was cloned from a cDNA library constructed in {lambda}gt10 using poly(A){sup +} RNA from sugar beets salinized to 500 mM NaCl. cDNAs were size selected (>1kb) before ligation into the vector, and the library was screenedmore » with a spinach BADH cDNA probe. Three nearly full length clones obtained were confirmed as BADH by their nucleotide and deduced amino acid homology to spinach BADH. Clones averaged 1.8 kb and contained open reading frames of 500 amino acids at 80% identity with spinach BADH. RNA gel blot analysis of poly(A){sup +} RNA indicated that salinization to 500 mM NaCl resulted in a 5-fold increase of BADH mRNA level.« less
Simonin, F; Gavériaux-Ruff, C; Befort, K; Matthes, H; Lannes, B; Micheletti, G; Mattéi, M G; Charron, G; Bloch, B; Kieffer, B
1995-01-01
Using the mouse delta-opioid receptor cDNA as a probe, we have isolated genomic clones encoding the human mu- and kappa-opioid receptor genes. Their organization appears similar to that of the human delta receptor gene, with exon-intron boundaries located after putative transmembrane domains 1 and 4. The kappa gene was mapped at position q11-12 in human chromosome 8. A full-length cDNA encoding the human kappa-opioid receptor has been isolated. The cloned receptor expressed in COS cells presents a typical kappa 1 pharmacological profile and is negatively coupled to adenylate cyclase. The expression of kappa-opioid receptor mRNA in human brain, as estimated by reverse transcription-polymerase chain reaction, is consistent with the involvement of kappa-opioid receptors in pain perception, neuroendocrine physiology, affective behavior, and cognition. In situ hybridization studies performed on human fetal spinal cord demonstrate the presence of the transcript specifically in lamina II of the dorsal horn. Some divergences in structural, pharmacological, and anatomical properties are noted between the cloned human and rodent receptors. Images Fig. 3 Fig. 4 PMID:7624359
Nishi, Tatsuya; Onozato, Hiroyuki; Ohashi, Seiichi; Fukai, Katsuhiko; Yamada, Manabu; Morioka, Kazuki; Kanno, Toru
2016-06-01
A full-length infectious cDNA clone of the genome of a foot-and-mouth disease virus isolated from the 2010 epidemic in Japan was constructed and designated pSVL-f02. Transfection of Cos-7 or IBRS-2 cells with this clone allowed the recovery of infectious virus. The recovered virus had the same in vitro characterization as the parental virus with regard to antigenicity in neutralization and indirect immunofluorescence tests, plaque size and one-step growth. Pigs were experimentally infected with the parental virus or the recombinant virus recovered from pSVL-f02 transfected cells. There were no significant differences in clinical signs or antibody responses between the two groups, and virus isolation and viral RNA detection from clinical samples were similar. Virus recovered from transfected cells therefore retained the in vitro characteristics and the in vivo pathogenicity of their parental strain. This cDNA clone should be a valuable tool to analyze determinants of pathogenicity and mechanisms of virus replication, and to develop genetically engineered vaccines against foot-and-mouth disease virus. Copyright © 2016 Elsevier Ltd. All rights reserved.
Owen, Carolyn A.; Moukarzel, Romy; Huang, Xiao; Kassem, Mona A.; Eliasco, Eleonora; Aranda, Miguel A.; Coutts, Robert H. A.; Livieratos, Ioannis C.
2016-01-01
Cucurbit yellow stunting disorder virus (CYSDV), a bipartite whitefly-transmitted virus, constitutes a major threat to commercial cucurbit production worldwide. Here, construction of full-length CYSDV RNA1 and RNA2 cDNA clones allowed the in vitro synthesis of RNA transcripts able to replicate in cucumber protoplasts. CYSDV RNA1 proved competent for replication; transcription of both polarities of the genomic RNA was detectable 24 h post inoculation. Hybridization of total RNA extracted from transfected protoplasts or from naturally CYSDV-infected cucurbits revealed high-level transcription of the p22 subgenomic RNA species. Replication of CYSDV RNA2 following co-transfection with RNA1 was also observed, with similar transcription kinetics. A CYSDV RNA2 cDNA clone (T3CM8Δ) comprising the 5′- and 3′-UTRs plus the 3′-terminal gene, generated a 2.8 kb RNA able to replicate to high levels in protoplasts in the presence of CYSDV RNA1. The clone T3CM8Δ will facilitate reverse genetics studies of CYSDV gene function and RNA replication determinants. PMID:27314380
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ishida, Yoshikazu; Hadano, Shinji; Nagayama, Tomiko
1994-07-15
The authors have established an approach to the isolation of expressed DNA sequences from a defined region of the human chromosome. The method relies on the direct screening of cDNA libraries using pooled single-copy microclones generated by a laser chromosome microdissection in conjunction with a single unique primer polymerase chain reaction (SUP-PCR) procedure. They applied this method to the distal region of human chromosome 4p (4p15-4pter), which contains the Huntington disease (HD) and the Wolf-Hirschhorn syndrome (WHS) loci. Twenty-one nonoverlapping and region-specific cDNA clones encoding novel genes were isolated in this manner. Ten of 21 clones were subregionally assigned tomore » 4p16.1-4pter, and the remainder mapped to the region proximal to 4p16.1. Northern blot and reverse transcription followed by the PCR (RT-PCR) analysis revealed that 16 of these 21 clones detected transcripts in total RNA from human tissues. The method is applicable to other chromosomal regions and is a powerful approach to the isolation of region-specific cDNA clones. 44 refs., 3 figs., 3 tabs.« less
A novel peptide from the ACEI/BPP-CNP precursor in the venom of Crotalus durissus collilineatus.
Higuchi, Shigesada; Murayama, Nobuhiro; Saguchi, Ken-ichi; Ohi, Hiroaki; Fujita, Yoshiaki; da Silva, Nelson Jorge; de Siqueira, Rodrigo José Bezerra; Lahlou, Saad; Aird, Steven D
2006-10-01
In crotaline venoms, angiotensin-converting enzyme inhibitors [ACEIs, also known as bradykinin potentiating peptides (BPPs)], are products of a gene coding for an ACEI/BPP-C-type natriuretic peptide (CNP) precursor. In the genes from Bothrops jararaca and Gloydius blomhoffii, ACEI/BPP sequences are repeated. Sequencing of a cDNA clone from venom glands of Crotalus durissus collilineatus showed that two ACEIs/BPPs are located together at the N-terminus, but without repeats. An additional sequence for CNP was unexpectedly found at the C-terminus. Homologous genes for the ACEI/BPP-CNP precursor suggest that most crotaline venoms contain both ACEIs/BPPs and CNP. The sequence of ACEIs/BPPs is separated from the CNP sequence by a long spacer sequence. Previously, there was no evidence that this spacer actually coded any expressed peptides. Aird and Kaiser (1986, unpublished) previously isolated and sequenced a peptide of 11 residues (TPPAGPDVGPR) from Crotalus viridis viridis venom. In the present study, analysis of the cDNA clone from C. d. collilineatus revealed a nearly identical sequence in the ACEI/BPP-CNP spacer. Fractionation of the crude venom by reverse phase HPLC (C(18)), and analysis of the fractions by mass spectrometry (MS) indicated a component of 1020.5 Da. Amino acid sequencing by MS/MS confirmed that C. d. collilineatus venom contains the peptide TPPAGPDGGPR. Its high proline content and paired proline residues are typical of venom hypotensive peptides, although it lacks the usual N-terminal pyroglutamate. It has no demonstrable hypotensive activity when injected intravenously in rats; however, its occurrence in the venoms of dissimilar species suggests that its presence is not accidental. Evidence suggests that these novel toxins probably activate anaphylatoxin C3a receptors.
Suard, Y M; Tosi, M; Kraehenbuhl, J P
1982-01-01
Total cytoplasmic polyadenylated RNA from lactating rabbit mammary glands was analysed on methylmercury hydroxide-agarose gels. The size of the most abundant mRNA species ranged between 0.5 and 5.0 kb (kilobases), with major bands at 0.55, 0.84, 0.92, 1.18 and 2.4 kb and discrete minor bands of 1.5, 1.7, 3.0 and 3.9 kb. Translation in vitro of total mRNA with [3H]leucine or [35S]methionine as precursor yielded four major bands with apparent Mr values of 16 000, 25 000, 26 000 and 29 000. The four protein bands were identified by immunoprecipitation by using specific antisera as alpha-lactalbumin and x-, kappa- and alpha-caseins, respectively. Labelling with (35S]cysteine followed by immunoprecipitation with anti-transferrin or anti-alpha-lactalbumin sera allowed the identification of two whey proteins. Translated transferrin was resolved as an 80 000-dalton band and alpha-lactalbumin appeared as a 16 000-dalton protein. A library of recombinant plasmids containing cDNA (complementary DNA) sequences representing cytoplasmic polyadenylated RNA was used to isolate clones for the major rabbit caseins and alpha-lactalbumin. A preliminary characterization of these cDNA clones was achieved by colony hybridization with enriched RNA fractions as probes. Positive clones were identified by use of hybrid-promoted translation in vitro and immunoprecipitation of the translation products. The corresponding mRNA species were further identified by hybridizing RNA blots with radioactively labelled cDNA clones. We present the restriction map of alpha-casein and kappa-casein cDNA clones. Images Fig. 1. Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. PMID:6123313
Cloning of precursors for two MIH/VIH-related peptides in the prawn, Macrobrachium rosenbergii.
Yang, W J; Rao, K R
2001-11-30
Two cDNA clones (634 and 1366 bp) encoding MIH/VIH (molt-inhibiting hormone/vitellogenesis-inhibiting hormone)-related peptides were isolated and sequenced from a Macrobrachium rosenbergii eyestalk ganglia cDNA library. The clones contain a 360 and 339 bp open-reading frame, and their conceptually translated peptides consist of a 41 and 34 amino acid signal peptide, respectively, and a 78 amino acid residue mature peptide hormone. The amino acid sequences of the peptides exhibit higher identities with other known MIHs and VIH (44-69%) than with CHHs (28-33%). This is the first report describing the cloning and sequencing of two MIH/VIH-related peptides in a single crustacean species. Transcription of these mRNAs was detected in the eyestalk ganglia, but not in the thoracic ganglia, hepatopancreas, gut, gill, heart, or muscle.
Generation of Infectious Poliovirus with Altered Genetic Information from Cloned cDNA.
Bujaki, Erika
2016-01-01
The effect of specific genetic alterations on virus biology and phenotype can be studied by a great number of available assays. The following method describes the basic protocol to generate infectious poliovirus with altered genetic information from cloned cDNA in cultured cells.The example explained here involves generation of a recombinant poliovirus genome by simply replacing a portion of the 5' noncoding region with a synthetic gene by restriction cloning. The vector containing the full length poliovirus genome and the insert DNA with the known mutation(s) are cleaved for directional cloning, then ligated and transformed into competent bacteria. The recombinant plasmid DNA is then propagated in bacteria and transcribed to RNA in vitro before RNA transfection of cultured cells is performed. Finally, viral particles are recovered from the cell culture.
Chung, F Z; Lentes, K U; Gocayne, J; Fitzgerald, M; Robinson, D; Kerlavage, A R; Fraser, C M; Venter, J C
1987-01-26
Two cDNA clones, lambda-CLFV-108 and lambda-CLFV-119, encoding for the beta-adrenergic receptor, have been isolated from a human brain stem cDNA library. One human genomic clone, LCV-517 (20 kb), was characterized by restriction mapping and partial sequencing. The human brain beta-receptor consists of 413 amino acids with a calculated Mr of 46480. The gene contains three potential glucocorticoid receptor-binding sites. The beta-receptor expressed in human brain was homology with rodent (88%) and avian (52%) beta-receptors and with porcine muscarinic cholinergic receptors (31%), supporting our proposal [(1984) Proc. Natl. Acad. Sci. USA 81, 272 276] that adrenergic and muscarinic cholinergic receptors are structurally related. This represents the first cloning of a neurotransmitter receptor gene from human brain.
Medina-Suárez, R; Manning, K; Fletcher, J; Aked, J; Bird, C R; Seymour, G B
1997-01-01
mRNA was extracted from the pulp and peel of preclimacteric (d 0) bananas (Musa AAA group, cv Grand Nain) and those exposed to ethylene gas for 24 h and stored in air alone for a further 1 (d 2) and 4 d (d 5). Two-dimensional sodium dodecyl sulfate-polyacrylamide gel electrophoresis of in vitro translation products from the pulp and peel of these fruits revealed significant up-regulation of numerous transcripts during ripening. The majority of the changes were initiated by d 2, with the level of these messages increasing during the remainder of the ripening period. Pulp tissue from d 2 was used for the construction of a cDNA library. This library was differentially screened for ripening-related clones using cDNA from d-0 and d-2 pulp by a novel microtiter plate method. In the primary screen 250 up- and down-regulated clones were isolated. Of these, 59 differentially expressed clones were obtained from the secondary screen. All of these cDNAs were partially sequenced and grouped into families after database searches. Twenty-five nonredundant groups of pulp clones were identified. These encoded enzymes were involved in ethylene biosynthesis, respiration, starch metabolism, cell wall degradation, and several other key metabolic events. We describe the analysis of these clones and their possible involvement in ripening. PMID:9342865
Kimura, Tomohiro; Nakano, Toshiki; Yamaguchi, Toshiyasu; Sato, Minoru; Ogawa, Tomohisa; Muramoto, Koji; Yokoyama, Takehiko; Kan-No, Nobuhiro; Nagahisa, Eizou; Janssen, Frank; Grieshaber, Manfred K
2004-01-01
The complete complementary DNA sequences of genes presumably coding for opine dehydrogenases from Arabella iricolor (sandworm), Haliotis discus hannai (abalone), and Patinopecten yessoensis (scallop) were determined, and partial cDNA sequences were derived for Meretrix lusoria (Japanese hard clam) and Spisula sachalinensis (Sakhalin surf clam). The primers ODH-9F and ODH-11R proved useful for amplifying the sequences for opine dehydrogenases from the 4 mollusk species investigated in this study. The sequence of the sandworm was obtained using primers constructed from the amino acid sequence of tauropine dehydrogenase, the main opine dehydrogenase in A. iricolor. The complete cDNA sequence of A. iricolor, H. discus hannai, and P. yessoensis encode 397, 400, and 405 amino acids, respectively. All sequences were aligned and compared with published databank sequences of Loligo opalescens, Loligo vulgaris (squid), Sepia officinalis (cuttlefish), and Pecten maximus (scallop). As expected, a high level of homology was observed for the cDNA from closely related species, such as for cephalopods or scallops, whereas cDNA from the other species showed lower-level homologies. A similar trend was observed when the deduced amino acid sequences were compared. Furthermore, alignment of these sequences revealed some structural motifs that are possibly related to the binding sites of the substrates. The phylogenetic trees derived from the nucleotide and amino acid sequences were consistent with the classification of species resulting from classical taxonomic analyses.
Guanine nucleotide-binding regulatory proteins in retinal pigment epithelial cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jiang, Meisheng; Tran, V.T.; Fong, H.K.W.
1991-05-01
The expression of GTP-binding regulatory proteins (G proteins) in retinal pigment epithelial (RPE) cells was analyzed by RNA blot hybridization and cDNA amplification. Both adult and fetal human RPE cells contain mRNA for multiple G protein {alpha} subunits (G{alpha}) including G{sub s}{alpha}, G{sub i-1}{alpha}, G{sub i-2}{alpha}, G{sub i-3}{alpha}, and G{sub z}{alpha} (or G{sub x}{alpha}), where G{sub s} and G{sub i} are proteins that stimulate or inhibit adenylyl cyclase, respectively, and G{sub z} is a protein that may mediate pertussis toxin-insensitive events. Other G{alpha}-related mRNA transcripts were detected in fetal RPE cells by low-stringency hybridization to G{sub i-2}{alpha} and G{sub s}{alpha}more » protein-coding cDNA probes. The diversity of G proteins in RPE cells was further studied by cDNA amplification with reverse transcriptase and the polymerase chain reaction. This approach revealed that, besides the above mentioned members of the G{alpha} gene family, at least two other G{alpha} subunits are expressed in RPE cells. Human retinal cDNA clones that encode one of the additional G{alpha} subunits were isolated and characterized. The results indicate that this G{alpha} subunit belongs to a separate subfamily of G proteins that may be insensitive to inhibition by pertussis toxin.« less
Wickramasinghe, Gammadde Hewa Ishan Maduka; Rathnayake, Pilimathalawe Panditharathna Attanayake Mudiyanselage Samith Indika; Chandrasekharan, Naduviladath Vishvanath; Weerasinghe, Mahindagoda Siril Samantha; Wijesundera, Ravindra Lakshman Chundananda; Wijesundera, Wijepurage Sandhya Sulochana
2017-06-21
Cellulose, a linear polymer of β 1-4, linked glucose, is the most abundant renewable fraction of plant biomass (lignocellulose). It is synergistically converted to glucose by endoglucanase (EG) cellobiohydrolase (CBH) and β-glucosidase (BGL) of the cellulase complex. BGL plays a major role in the conversion of randomly cleaved cellooligosaccharides into glucose. As it is well known, Saccharomyces cerevisiae can efficiently convert glucose into ethanol under anaerobic conditions. Therefore, S.cerevisiae was genetically modified with the objective of heterologous extracellular expression of the BGLI gene of Trichoderma virens making it capable of utilizing cellobiose to produce ethanol. The cDNA and a genomic sequence of the BGLI gene of Trichoderma virens was cloned in the yeast expression vector pGAPZα and separately transformed to Saccharomyces cerevisiae. The size of the BGLI cDNA clone was 1363 bp and the genomic DNA clone contained an additional 76 bp single intron following the first exon. The gene was 90% similar to the DNA sequence and 99% similar to the deduced amino acid sequence of 1,4-β-D-glucosidase of T. atroviride (AC237343.1). The BGLI activity expressed by the recombinant genomic clone was 3.4 times greater (1.7 x 10 -3 IU ml -1 ) than that observed for the cDNA clone (5 x 10 -4 IU ml -1 ). Furthermore, the activity was similar to the activity of locally isolated Trichoderma virens (1.5 x 10 -3 IU ml -1 ). The estimated size of the protein was 52 kDA. In fermentation studies, the maximum ethanol production by the genomic and the cDNA clones were 0.36 g and 0.06 g /g of cellobiose respectively. Molecular docking results indicated that the bare protein and cellobiose-protein complex behave in a similar manner with considerable stability in aqueous medium. The deduced binding site and the binding affinity of the constructed homology model appeared to be reasonable. Moreover, it was identified that the five hydrogen bonds formed between the amino acid residues of BGLI and cellobiose are mainly involved in the integrity of enzyme-substrate association. The BGLI activity was remarkably higher in the genomic DNA clone compared to the cDNA clone. Cellobiose was successfully fermented into ethanol by the recombinant S.cerevisiae genomic DNA clone. It has the potential to be used in the industrial production of ethanol as it is capable of simultaneous saccharification and fermentation of cellobiose. Homology modeling, docking studies and molecular dynamics simulation studies will provide a realistic model for further studies in the modification of active site residues which could be followed by mutation studies to improve the catalytic action of BGLI.
Fearnley, I M; Finel, M; Skehel, J M; Walker, J E
1991-01-01
The 39 kDa and 42 kDa subunits of NADH:ubiquinone oxidoreductase from bovine heart mitochondria are nuclear-coded components of the hydrophobic protein fraction of the enzyme. Their amino acid sequences have been deduced from the sequences of overlapping cDNA clones. These clones were amplified from total bovine heart cDNA by means of the polymerase chain reaction, with the use of complex mixtures of oligonucleotide primers based upon fragments of protein sequence determined at the N-terminals of the proteins and at internal sites. The protein sequences of the 39 kDa and 42 kDa subunits are 345 and 320 amino acid residues long respectively, and their calculated molecular masses are 39,115 Da and 36,693 Da. Both proteins are predominantly hydrophilic, but each contains one or two hydrophobic segments that could possibly be folded into transmembrane alpha-helices. The bovine 39 kDa protein sequence is related to that of a 40 kDa subunit from complex I from Neurospora crassa mitochondria; otherwise, it is not related significantly to any known sequence, including redox proteins and two polypeptides involved in import of proteins into mitochondria, known as the mitochondrial processing peptidase and the processing-enhancing protein. Therefore the functions of the 39 kDa and 42 kDa subunits of complex I are unknown. The mitochondrial gene product, ND4, a hydrophobic component of complex I with an apparent molecular mass of about 39 kDa, has been identified in preparations of the enzyme. This subunit stains faintly with Coomassie Blue dye, and in many gel systems it is not resolved from the nuclearcoded 36 kDa subunit. Images Fig. 1. PMID:1832859
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mullinax, R.L.; Gross, E.A.; Amberg, J.R.
1990-10-01
The authors have applied a molecular biology approach to the identification of human monoclonal antibodies. Human peripheral blood lymphocyte mRNA was converted to cDNA and a select subset was amplified by the polymerase chain reaction. These products, containing coding sequences for numerous immunoglobulin heavy- and {kappa} light-chain variable and constant region domains, were inserted into modified bacteriophase {lambda} expression vectors and introduced into Escherichia coli by infection to yield a combinatorial immunoexpression library. Clones with binding activity to tetanus toxoid were identified by filter hybridization with radiolabeled antigen and appeared at a frequency of 0.2{percent} in the library. These humanmore » antigen binding fragments, consisting of a heavy-chain fragment covalently linked to a light chain, displayed high affinity of binding to tetanus toxoid with equilibrium constants in the nanomolar range but did not cross-react with other proteins tested. They estimate that this human immunoexpression library contains 20,000 clones with high affinity and specificity to our chosen antigen.« less
Solforosi, Laura; Mancini, Nicasio; Canducci, Filippo; Clementi, Nicola; Sautto, Giuseppe Andrea; Diotti, Roberta Antonia; Clementi, Massimo; Burioni, Roberto
2012-07-01
A novel phagemid vector, named pCM, was optimized for the cloning and display of antibody fragment (Fab) libraries on the surface of filamentous phage. This vector contains two long DNA "stuffer" fragments for easier differentiation of the correctly cut forms of the vector. Moreover, in pCM the fragment at the heavy-chain cloning site contains an acid phosphatase-encoding gene allowing an easy distinction of the Escherichia coli cells containing the unmodified form of the phagemid versus the heavy-chain fragment coding cDNA. In pCM transcription of heavy-chain Fd/gene III and light chain is driven by a single lacZ promoter. The light chain is directed to the periplasm by the ompA signal peptide, whereas the heavy-chain Fd/coat protein III is trafficked by the pelB signal peptide. The phagemid pCM was used to generate a human combinatorial phage display antibody library that allowed the selection of a monoclonal Fab fragment antibody directed against the nucleoprotein (NP) of Influenza A virus.
Complementary DNA libraries: an overview.
Ying, Shao-Yao
2004-07-01
The generation of complete and full-length cDNA libraries for potential functional assays of specific gene sequences is essential for most molecules in biotechnology and biomedical research. The field of cDNA library generation has changed rapidly in the past 10 yr. This review presents an overview of the method available for the basic information of generating cDNA libraries, including the definition of the cDNA library, different kinds of cDNA libraries, difference between methods for cDNA library generation using conventional approaches and a novel strategy, and the quality of cDNA libraries. It is anticipated that the high-quality cDNA libraries so generated would facilitate studies involving genechips and the microarray, differential display, subtractive hybridization, gene cloning, and peptide library generation.
Wolffe, E J; Gause, W C; Pelfrey, C M; Holland, S M; Steinberg, A D; August, J T
1990-01-05
We describe the isolation and sequencing of a cDNA encoding mouse Pgp-1. An oligonucleotide probe corresponding to the NH2-terminal sequence of the purified protein was synthesized by the polymerase chain reaction and used to screen a mouse macrophage lambda gt11 library. A cDNA clone with an insert of 1.2 kilobases was selected and sequenced. In Northern blot analysis, only cells expressing Pgp-1 contained mRNA species that hybridized with this Pgp-1 cDNA. The nucleotide sequence of the cDNA has a single open reading frame that yields a protein-coding sequence of 1076 base pairs followed by a 132-base pair 3'-untranslated sequence that includes a putative polyadenylation signal but no poly(A) tail. The translated sequence comprises a 13-amino acid signal peptide followed by a polypeptide core of 345 residues corresponding to an Mr of 37,800. Portions of the deduced amino acid sequence were identical to those obtained by amino acid sequence analysis from the purified glycoprotein, confirming that the cDNA encodes Pgp-1. The predicted structure of Pgp-1 includes an NH2-terminal extracellular domain (residues 14-265), a transmembrane domain (residues 266-286), and a cytoplasmic tail (residues 287-358). Portions of the mouse Pgp-1 sequence are highly similar to that of the human CD44 cell surface glycoprotein implicated in cell adhesion. The protein also shows sequence similarity to the proteoglycan tandem repeat sequences found in cartilage link protein and cartilage proteoglycan core protein which are thought to be involved in binding to hyaluronic acid.
Guo, Chun-Teng; McClean, Stephen; Shaw, Chris; Rao, Ping-Fan; Ye, Ming-Yu; Bjourson, Anthony J
2013-05-01
One novel Kunitz BPTI-like peptide designated as BBPTI-1, with chymotrypsin inhibitory activity was identified from the venom of Burmese Daboia russelii siamensis. It was purified by three steps of chromatography including gel filtration, cation exchange and reversed phase. A partial N-terminal sequence of BBPTI-1, HDRPKFCYLPADPGECLAHMRSF was obtained by automated Edman degradation and a Ki value of 4.77nM determined. Cloning of BBPTI-1 including the open reading frame and 3' untranslated region was achieved from cDNA libraries derived from lyophilized venom using a 3' RACE strategy. In addition a cDNA sequence, designated as BBPTI-5, was also obtained. Alignment of cDNA sequences showed that BBPTI-5 exhibited an identical sequence to BBPTI-1 cDNA except for an eight nucleotide deletion in the open reading frame. Gene variations that represented deletions in the BBPTI-5 cDNA resulted in a novel protease inhibitor analog. Amino acid sequence alignment revealed that deduced peptides derived from cloning of their respective precursor cDNAs from libraries showed high similarity and homology with other Kunitz BPTI proteinase inhibitors. BBPTI-1 and BBPTI-5 consist of 60 and 66 amino acid residues respectively, including six conserved cysteine residues. As these peptides have been reported to have influence on the processes of coagulation, fibrinolysis and inflammation, their potential application in biomedical contexts warrants further investigation. Copyright © 2013 Elsevier Inc. All rights reserved.
Jackson, S; Gascón, J; Carrera, E; Monte, E; Prat, S
1997-01-01
Differential screening of a potato leaf cDNA library with cDNA probes made from tuberizing and non-tuberizing Solanum demissum plants led to the identification of a clone that is upregulated in leaves and other tissues upon tuberization. This clone was also shown to have a high level of expression in green tomato fruit, its expression falling off as the fruit turns red. No sucrose or hormonal regulation of the expression of this clone was observed and it did not respond to wounding or heat stress. Clone 32B is 532 bp long and contains an open reading frame encoding a small protein of 98 amino acids. The deduced protein sequence has a putative signal peptide for ER transport and a 10 amino acid domain in the C-terminal region of the protein, both of which are also found in the cotton LEA5, Arabidopsis Di21 and the mungbean Arg2 proteins.
Shiraishi, H; Ishikura, S; Matsuura, K; Deyashiki, Y; Ninomiya, M; Sakai, S; Hara, A
1998-01-01
Human liver contains three isoforms (DD1, DD2 and DD4) of dihydrodiol dehydrogenase with 20alpha- or 3alpha-hydroxysteroid dehydrogenase activity; the dehydrogenases belong to the aldo-oxo reductase (AKR) superfamily. cDNA species encoding DD1 and DD4 have been identified. However, four cDNA species with more than 99% sequence identity have been cloned and are compatible with a partial amino acid sequence of DD2. In this study we have isolated a cDNA clone encoding DD2, which was confirmed by comparison of the properties of the recombinant and hepatic enzymes. This cDNA showed differences of one, two, four and five nucleotides from the previously reported four cDNA species for a dehydrogenase of human colon carcinoma HT29 cells, human prostatic 3alpha-hydroxysteroid dehydrogenase, a human liver 3alpha-hydroxysteroid dehydrogenase-like protein and chlordecone reductase-like protein respectively. Expression of mRNA species for the five similar cDNA species in 20 liver samples and 10 other different tissue samples was examined by reverse transcriptase-mediated PCR with specific primers followed by diagnostic restriction with endonucleases. All the tissues expressed only one mRNA species corresponding to the newly identified cDNA for DD2: mRNA transcripts corresponding to the other cDNA species were not detected. We suggest that the new cDNA is derived from the principal gene for DD2, which has been named AKR1C2 by a new nomenclature for the AKR superfamily. It is possible that some of the other cDNA species previously reported are rare allelic variants of this gene. PMID:9716498
Knutzon, D S; Lardizabal, K D; Nelsen, J S; Bleibaum, J L; Davies, H M; Metz, J G
1995-01-01
Immature coconut (Cocos nucifera) endosperm contains a 1-acyl-sn-glycerol-3-phosphate acyltransferase (LPAAT) activity that shows a preference for medium-chain-length fatty acyl-coenzyme A substrates (H.M. Davies, D.J. Hawkins, J.S. Nelsen [1995] Phytochemistry 39:989-996). Beginning with solubilized membrane preparations, we have used chromatographic separations to identify a polypeptide with an apparent molecular mass of 29 kD, whose presence in various column fractions correlates with the acyltransferase activity detected in those same fractions. Amino acid sequence data obtained from several peptides generated from this protein were used to isolate a full-length clone from a coconut endosperm cDNA library. Clone pCGN5503 contains a 1325-bp cDNA insert with an open reading frame encoding a 308-amino acid protein with a calculated molecular mass of 34.8 kD. Comparison of the deduced amino acid sequence of pCGN5503 to sequences in the data banks revealed significant homology to other putative LPAAT sequences. Expression of the coconut cDNA in Escherichia coli conferred upon those cells a novel LPAAT activity whose substrate activity profile matched that of the coconut enzyme. PMID:8552723
Winzer, T; Bairl, A; Linder, M; Linder, D; Werner, D; Müller, P
1999-03-01
A nodule-specific 53-kDa protein (GmNOD53b) of the symbiosome membrane from soybean was isolated and its LysC digestion products were microsequenced. cDNA clones of this novel nodulin, obtained from cDNA library screening with an RT-PCR (reverse-transcriptase polymerase chain reaction)-generated hybridization probe exhibited no homology to proteins identified so far. The expression of GmNOD53b coincides with the onset of nitrogen fixation. Therefore, it is a late nodulin. Among other changes, the GmNOD53b is significantly reduced in nodules infected with the Bradyrhizobium japonicum mutant 184 on the protein level as well as on the level of mRNA expression, compared with the wild-type infected nodules. The reduction of GmNOD53b mRNA is related to an inactivation of the sipF gene in B. japonicum 184, coding for a functionally active signal peptidase.
Genomic organization of the neurofibromatosis 1 gene (NF1)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Y.; O`Connell, P.; Huntsman Breidenbach, H.
Neurofibromatosis 1 maps to chromosome band 17q11.2, and the NF1 locus has been partially characterized. Even though the full-length NF1 cDNA has been sequenced, the complete genomic structure of the NF1 gene has not been elucidated. The 5{prime} end of NF1 is embedded in a CpG island containing a NotI restriction site, and the remainder of the gene lies in the adjacent 350-kb NotI fragment. In our efforts to develop a comprehensive screen for NF1 mutations, we have isolated genomic DNA clones that together harbor the entire NF1 cDNA sequence. We have identified all intron-exon boundaries of the coding regionmore » and established that it is composed of 59 exons. Furthermore, we have defined the 3{prime}-untranslated region (3{prime}-UTR) of the NF1 gene; it spans approximately 3.5 kb of genomic DNA sequence and is continuous with the stop codon. Oligonucleotide primer pairs synthesized from exon-flanking DNA sequences were used in the polymerase chain reaction with cloned, chromosome 17-specific genomic DNA as template to amplify NF1 exons 1 through 27b and the exon containing the 3{prime}-UTR separately. This information should be useful for implementing a comprehensive NF1 mutation screen using genomic DNA as template. 41 refs., 3 figs., 2 tabs.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jensen, B.A.; Hahn, M.E.
1995-12-31
The aryl hydrocarbon receptor (AhR) mediates the effects of many common and potentially toxic organic hydrocarbons, including some polychlorinated biphenyls and dioxins. Since small cetaceans often inhabit industrially polluted coastal waters, comparison of the molecular structure and function of this protein in cetaeans with other marine and mammalian species is important for evaluating the sensitivity of cetaceans to these pollutants. An AhR protein has been identified in beluga liver by photoaffinity labeling. In the present study, the authors sought to clone and sequence an AhR cDNA from beluga as a prelude to studying its structure and function, using reverse-transcription polymerasemore » chain reaction (RT-PCR) and degenerate primers, a 515 base pair fragment was amplified, cloned and sequenced, revealing homology to the PAS domain (ligand binding and dimerization region) of AhRs from terrestrial mammals. This portion of the putative beluga AhR has 82% amino acid and 81% nucleotide sequence identity to the mouse AhR, and 63% amino acid and 64% nucleotide sequence identity to an AhR from the marine fish Fundulus heteroclitus. A beluga cDNA library was synthesized and is currently being screened with the PCR-generated fragment to obtain the complete coding sequence. This is the first molecular evidence of AhR presence in cetaceans.« less
USDA-ARS?s Scientific Manuscript database
DORMANCY-ASSOCIATED MADS-BOX (DAM) genes are SHORT VEGETATIVE PHASE–Like MADS box transcription factors linked to endodormancy induction. We have cloned and characterized several cDNA and genomic clones of DAM genes from the model perennial weed leafy spurge (Euphorbia esula). We present evidence fo...
Orpinomyces cellulase CelE protein and coding sequences
Li, Xin-Liang; Ljungdahl, Lars G.; Chen, Huizhong
2000-08-29
A CDNA designated celE cloned from Orpinomyces PC-2 encodes a polypeptide (CelE) of 477 amino acids. CelE is highly homologous to CelB of Orpinomyces (72.3% identity) and Neocallimastix (67.9% identity), and like them, it has a non-catalytic repeated peptide domain (NCRPD) at the C-terminal end. The catalytic domain of CelE is homologous to glycosyl hydrolases of Family 5, found in several anaerobic bacteria. The gene of celE is devoid of introns. The recombinant proteins CelE and CelB of Orpinomyces PC-2 randomly hydrolyze carboxymethylcellulose and cello-oligosaccharides in the pattern of endoglucanases.
Cyborg lectins: novel leguminous lectins with unique specificities.
Yamamoto, K; Maruyama, I N; Osawa, T
2000-01-01
Bauhinia purpurea lectin (BPA) is one of the beta-galactose-binding leguminous lectins. Leguminous lectins contain a long metal-binding loop, part of which determines their carbohydrate-binding specificities. Random mutations were introduced into a portion of the cDNA coding BPA that corresponds to the carbohydrate-binding loop of the lectin. An library of the mutant lectin expressed on the surface of lambda foo phages was screened by the panning method. Several phage clones with an affinity for mannose or N-acetylglucosamine were isolated. These results indicate the possibility of making artificial lectins (so-called "cyborg lectins") with distinct and desired carbohydrate-binding specificities.
Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.
Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M
1991-02-15
The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.
Wu, Zhencai; Burns, Jacqueline K
2003-04-01
The genetics and expression of a lipid transfer protein (LTP) gene was examined during abscission of mature fruit of 'Valencia' orange. A cDNA encoding an LTP, CsLTP, was isolated from a cDNA subtraction library constructed from mature fruit abscission zones 48 h after application of a mature fruit-specific abscission agent, 5-chloro-3-methyl-4-nitro-pyrazole (CMN-pyrazole). A full-length cDNA clone of 652 nucleotides was isolated using 5' and 3' RACE followed by cDNA library screening and PCR amplification. The cDNA clone encoded a protein of 155 amino acid residues with a molecular mass and isoelectric point of 9.18 kDa and 9.12, respectively. A partial genomic clone of 505 nucleotides containing one intron of 101 base pairs was amplified from leaf genomic DNA. Southern blot hybridization demonstrated that at least two closely related CsLTP genes are present in 'Valencia' orange. Temporal expression patterns in mature fruit abscission zones were examined by northern hybridization. Increased expression of CsLTP mRNA was detected in RNA of mature fruit abscission zones 6, 24, 48, and 72 h after application of a non-specific abscission agent, ethephon. Low expression of CsLTP transcripts was observed after treatment of CMN-pyrazole until 24 h after application. After this time, expression markedly increased. The results suggest that CsLTP has a role in the abscission process, possibly by assisting transport of cutin monomers to the fracture plane of the abscission zone or through its anti-microbial activity by reducing the potential of microbial attack.
Elrobh, Mohamed S.; Alanazi, Mohammad S.; Khan, Wajahatullah; Abduljaleel, Zainularifeen; Al-Amri, Abdullah; Bazzi, Mohammad D.
2011-01-01
Heat shock proteins are ubiquitous, induced under a number of environmental and metabolic stresses, with highly conserved DNA sequences among mammalian species. Camelus dromedaries (the Arabian camel) domesticated under semi-desert environments, is well adapted to tolerate and survive against severe drought and high temperatures for extended periods. This is the first report of molecular cloning and characterization of full length cDNA of encoding a putative stress-induced heat shock HSPA6 protein (also called HSP70B′) from Arabian camel. A full-length cDNA (2417 bp) was obtained by rapid amplification of cDNA ends (RACE) and cloned in pET-b expression vector. The sequence analysis of HSPA6 gene showed 1932 bp-long open reading frame encoding 643 amino acids. The complete cDNA sequence of the Arabian camel HSPA6 gene was submitted to NCBI GeneBank (accession number HQ214118.1). The BLAST analysis indicated that C. dromedaries HSPA6 gene nucleotides shared high similarity (77–91%) with heat shock gene nucleotide of other mammals. The deduced 643 amino acid sequences (accession number ADO12067.1) showed that the predicted protein has an estimated molecular weight of 70.5 kDa with a predicted isoelectric point (pI) of 6.0. The comparative analyses of camel HSPA6 protein sequences with other mammalian heat shock proteins (HSPs) showed high identity (80–94%). Predicted camel HSPA6 protein structure using Protein 3D structural analysis high similarities with human and mouse HSPs. Taken together, this study indicates that the cDNA sequences of HSPA6 gene and its amino acid and protein structure from the Arabian camel are highly conserved and have similarities with other mammalian species. PMID:21845074
Seabream ghrelin: cDNA cloning, genomic organization and promoter studies.
Yeung, Chung-Man; Chan, Chi-Bun; Woo, Norman Y S; Cheng, Christopher H K
2006-05-01
Recent studies have indicated that ghrelin stimulates growth hormone release from the pituitary via the growth hormone secretagogue receptor (GHSR). We have previously isolated two GHSR subtypes from the pituitary of the black seabream Acanthopagrus schlegeli. In the present study, we have cloned and characterized ghrelin from the same fish species at both the cDNA and gene levels. The full-length seabream ghrelin cDNA, isolated from sea-bream stomach using a novel approach by exploiting a single conserved region in the coding region, was found to encode a prepropeptide of 107 amino acids, with the predicted mature ghrelin peptide consisting of 20 amino acids (GSSFLSPSQKPQNRGKSSRV). Embedded in this full-length cDNA is a putative fish orthologue of the recently reported mammalian obestatin peptide. The ghrelin gene in black seabream, obtained by genomic PCR, was found to encompass four exons and three introns, possessing the same structural organization as in tilapia and goldfish, but different from that in rainbow trout. In addition, a 2230-bp 5'-flanking region of the seabream ghrelin gene was obtained by genome walking. Sequence analysis revealed that, as in the case of the human ghrelin gene, there is neither a GC box nor a CAAT box present in the isolated 5'-flanking region. However, a number of putative transcription factor-binding sites different from the human counterpart were found in the 5'-flanking region of the seabream ghrelin gene, suggesting that different cis- and trans-acting elements are involved in controlling their gene expression. Functional activity of this 5'-flanking region was examined by cloning it into the pGL3-Basic vector upstream of the luciferase reporter gene and transfected into various cell lines. Positive promoter activity could only be recorded in the colon-derived Caco-2 cells, suggesting that the cloned 5'-flanking region represents the functional promoter of the seabream ghrelin gene, which exhibits tissue-specific promoter activity. Using reverse transcriptase PCR analysis, expression of ghrelin was detected only in the seabream stomach, but not in the other tissues examined, including the brain, gill, intestine, kidney, liver and spleen. This stomach-specific expression of ghrelin in seabream is subject to regulation, as administration of growth hormone or ipamorelin to the fish in vivo was demonstrated to enhance its expression. Reminiscent of the homologous upregulation found in the transcriptional control of the seabream GHSR gene, a similar homologous regulatory mechanism might also exist in controlling the expression of seabream ghrelin. The identification of both GHSR and ghrelin from a single fish species would facilitate our subsequent studies on the elucidation of the physiological functions of the ghrelin/GHSR system in teleost. The possible existence of obestatin in teleost opens up new research avenues on the somatotropic axis in fish.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vieira, P.; De Waal-Malefyt, R.; Dang, M.N.
1991-02-15
The authors demonstrated the existence of human cytokine synthesis inhibitory factor (DSIF) (interleukin 10 (IL-10)). cDNA clones encoding human IL-10 (hIL-10) were isolated from a tetanus toxin-specific human T-cell clone. Like mouse IL-10, hIL-10 exhibits strong DNA and amino acid sequence homology to an open reading frame in the Epstein-Barr virus, BDRFL. hIL-10 and the BCRFI product inhibit cytokine synthesis by activated human peripheral blood mononuclear cells and by a mouse Th1 clone. Both hIL-10 and mouse IL-10 sustain the viability of a mouse mast cell line in culture, but BCRFI lacks comparable activity in this way, suggesting that BCRFImore » may have conserved only a subset of hIL-10 activities.« less
An efficient and sensitive method for preparing cDNA libraries from scarce biological samples
Sterling, Catherine H.; Veksler-Lublinsky, Isana; Ambros, Victor
2015-01-01
The preparation and high-throughput sequencing of cDNA libraries from samples of small RNA is a powerful tool to quantify known small RNAs (such as microRNAs) and to discover novel RNA species. Interest in identifying the small RNA repertoire present in tissues and in biofluids has grown substantially with the findings that small RNAs can serve as indicators of biological conditions and disease states. Here we describe a novel and straightforward method to clone cDNA libraries from small quantities of input RNA. This method permits the generation of cDNA libraries from sub-picogram quantities of RNA robustly, efficiently and reproducibly. We demonstrate that the method provides a significant improvement in sensitivity compared to previous cloning methods while maintaining reproducible identification of diverse small RNA species. This method should have widespread applications in a variety of contexts, including biomarker discovery from scarce samples of human tissue or body fluids. PMID:25056322
Vesicular monoamine transporter-1 (VMAT-1) mRNA and immunoreactive proteins in mouse brain.
Ashe, Karen M; Chiu, Wan-Ling; Khalifa, Ahmed M; Nicolas, Antoine N; Brown, Bonnie L; De Martino, Randall R; Alexander, Clayton P; Waggener, Christopher T; Fischer-Stenger, Krista; Stewart, Jennifer K
2011-01-01
Vesicular monoamine transporter 1 (VMAT-1) mRNA and protein were examined (1) to determine whether adult mouse brain expresses full-length VMAT-1 mRNA that can be translated to functional transporter protein and (2) to compare immunoreactive VMAT-1 proteins in brain and adrenal. VMAT-1 mRNA was detected in mouse brain with RT-PCR. The cDNA was sequenced, cloned into an expression vector, transfected into COS-1 cells, and cell protein was assayed for VMAT-1 activity. Immunoreactive proteins were examined on western blots probed with four different antibodies to VMAT-1. Sequencing confirmed identity of the entire coding sequences of VMAT-1 cDNA from mouse medulla oblongata/pons and adrenal to a Gen-Bank reference sequence. Transfection of the brain cDNA into COS-1 cells resulted in transporter activity that was blocked by the VMAT inhibitor reserpine and a proton ionophore, but not by tetrabenazine, which has a high affinity for VMAT-2. Antibodies to either the C- or N- terminus of VMAT-1 detected two proteins (73 and 55 kD) in transfected COS-1 cells. The C-terminal antibodies detected both proteins in extracts of mouse medulla/pons, cortex, hypothalamus, and cerebellum but only the 73 kD protein and higher molecular weight immunoreactive proteins in mouse adrenal and rat PC12 cells, which are positive controls for rodent VMAT-1. These findings demonstrate that a functional VMAT-1 mRNA coding sequence is expressed in mouse brain and suggest processing of VMAT-1 protein differs in mouse adrenal and brain.
Jopcik, Martin; Moravcikova, Jana; Matusikova, Ildiko; Bauer, Miroslav; Rajninec, Miroslav; Libantova, Jana
2017-02-01
Chitinase gene from the carnivorous plant, Drosera rotundifolia , was cloned and functionally characterised. Plant chitinases are believed to play an important role in the developmental and physiological processes and in responses to biotic and abiotic stress. In addition, there is growing evidence that carnivorous plants can use them to digest insect prey. In this study, a full-length genomic clone consisting of the 1665-bp chitinase gene (gDrChit) and adjacent promoter region of the 698 bp in length were isolated from Drosera rotundifolia L. using degenerate PCR and a genome-walking approach. The corresponding coding sequence of chitinase gene (DrChit) was obtained following RNA isolation from the leaves of aseptically grown in vitro plants, cDNA synthesis with a gene-specific primer and PCR amplification. The open reading frame of cDNA clone consisted of 978 nucleotides and encoded 325 amino acid residues. Sequence analysis indicated that DrChit belongs to the class I group of plant chitinases. Phylogenetic analysis within the Caryophyllales class I chitinases demonstrated a significant evolutionary relatedness of DrChit with clade Ib, which contains the extracellular orthologues that play a role in carnivory. Comparative expression analysis revealed that the DrChit is expressed predominantly in tentacles and is up-regulated by treatment with inducers that mimick insect prey. Enzymatic activity of rDrChit protein expressed in Escherichia coli was confirmed and purified protein exhibited a long oligomer-specific endochitinase activity on glycol-chitin and FITC-chitin. The isolation and expression profile of a chitinase gene from D. rotundifolia has not been reported so far. The obtained results support the role of specific chitinases in digestive processes in carnivorous plant species.
Protein and gene structure of a blue laccase from Pleurotus ostreatus1.
Giardina, P; Palmieri, G; Scaloni, A; Fontanella, B; Faraco, V; Cennamo, G; Sannia, G
1999-01-01
A new laccase isoenzyme (POXA1b, where POX is phenol oxidase), produced by Pleurotus ostreatus in cultures supplemented with copper sulphate, has been purified and fully characterized. The main characteristics of this protein (molecular mass in native and denaturing conditions, pI and catalytic properties) are almost identical to the previously studied laccase POXA1w. However, POXA1b contains four copper atoms per molecule instead of one copper, two zinc and one iron atom per molecule of POXA1w. Furthermore, POXA1b shows an unusually high stability at alkaline pH. The gene and cDNA coding for POXA1b have been cloned and sequenced. The gene coding sequence contains 1599 bp, interrupted by 15 introns. Comparison of the structure of the poxa1b gene with the two previously studied P. ostreatus laccase genes (pox1 and poxc) suggests that these genes belong to two different subfamilies. The amino acid sequence of POXA1b deduced from the cDNA sequence has been almost completely verified by means of matrix-assisted laser desorption ionization MS. It has been demonstrated that three out of six putative glycosylation sites are post-translationally modified and the structure of the bound glycosidic moieties has been determined, whereas two other putative glycosylation sites are unmodified. PMID:10417329
cDNA library construction of two human Demodexspecies.
Niu, DongLing; Wang, RuiLing; Zhao, YaE; Yang, Rui; Hu, Li; Lei, YuYang; Dan, WeiChao
2017-06-01
The research of Demodex, a type of pathogen causing various dermatoses in animals and human beings, is lacking at RNA level. This study aims at extracting RNA and constructing cDNA library for Demodex. First, P. cuniculiand D. farinaewere mixed to establish homogenization method for RNA extraction. Second, D. folliculorumand D. breviswere collected and preserved in Trizol, which were mixed with D. farinaerespectively to extract RNA. Finally, cDNA library was constructed and its quality was assessed. The results indicated that for D. folliculorum& D. farinae, the recombination rate of cDNA library was 90.67% and the library titer was 7.50 × 104 pfu/ml. 17 of the 59 positive clones were predicted to be of D. folliculorum; For D. brevis& D. farinae, the recombination rate was 90.96% and the library titer was 7.85 x104 pfu/ml. 40 of the 59 positive clones were predicted to be of D. brevis. Further detection by specific primers demonstrated that mtDNA cox1, cox3and ATP6 detected from cDNA libraries had 96.52%-99.73% identities with the corresponding sequences in GenBank. In conclusion, the cDNA libraries constructed for Demodexmixed with D. farinaewere successful and could satisfy the requirements for functional genes detection.
Zhao, A; Guo, A; Liu, Z; Pape, L
1997-01-01
The coding sequences for a Schizosaccharomyces pombe sequence-specific DNA binding protein, Reb1p, have been cloned. The predicted S. pombe Reb1p is 24-29% identical to mouse TTF-1 (transcription termination factor-1) and Saccharomyces cerevisiae REB1 protein, both of which direct termination of RNA polymerase I catalyzed transcripts. The S.pombe Reb1 cDNA encodes a predicted polypeptide of 504 amino acids with a predicted molecular weight of 58.4 kDa. The S. pombe Reb1p is unusual in that the bipartite DNA binding motif identified originally in S.cerevisiae and Klyveromyces lactis REB1 proteins is uninterrupted and thus S.pombe Reb1p may contain the smallest natural REB1 homologous DNA binding domain. Its genomic coding sequences were shown to be interrupted by two introns. A recombinant histidine-tagged Reb1 protein bearing the rDNA binding domain has two homologous, sequence-specific binding sites in the S. pomber DNA intergenic spacer, located between 289 and 480 nt downstream of the end of the approximately 25S rRNA coding sequences. Each binding site is 13-14 bp downstream of two of the three proposed in vivo termination sites. The core of this 17 bp site, AGGTAAGGGTAATGCAC, is specifically protected by Reb1p in footprinting analysis. PMID:9016645
Tian, Wenzhi; Chua, Kevin; Strober, Warren; Chu, Charles C.
2002-01-01
BACKGROUND: Identification of differentially expressed genes between normal and diseased states is an area of intense current medical research that can lead to the discovery of new therapeutic targets. However, isolation of differentially expressed genes by subtraction often suffers from unreported contamination of the resulting subtraction library with clones containing DNA sequences not from the original RNA samples. MATERIALS AND METHODS: Subtraction using cDNA representational difference analysis (RDA) was performed on human B cells from normal or common variable immunodeficiency patients. The material remaining after the subtraction was cloned and individual clones were sequenced. The sequence of one clone with similarity to integrases (ILG1, integrase-like gene-1) was used to obtain the full length cDNA sequence and as a probe for the presence of this sequence in RNA or genomic DNA samples. RESULTS: After five rounds of cDNA RDA, 23.3% of the clones from the resulting subtraction library contained Escherichia coli DNA. In addition, three clones contained the sequence of a new integrase, ILG1. The full length cDNA sequence of ILG1 exhibits prokaryotic, but not eukaryotic, features. At the DNA level, ILG1 is not similar to any known gene. At the protein level, ILG1 has 58% similarity to integrases from the cryptic P4 bacteriophage family (S clade). The catalytic domain of ILG1 contains the conserved features found in site-specific recombinases. The critical residues that form the catalytic active site pocket are conserved, including the highly conserved R-H-R-Y hallmark of these recombinases. Interestingly, ILG1 was not present in the original B cell populations. By probing genomic DNA, ILG1 could only be detected in the E. coli TOP10F' strain used in our laboratory for molecular cloning, but not in any of its precursor strains, including TOP10. Furthermore, bacteria cultured from the mouth of the laboratory worker who performed cDNA RDA were also positive for ILG1. CONCLUSIONS: In the course of our studies using cDNA RDA, we have isolated and identified ILG1, a likely active site-specific recombinase and new member of the bacteriophage P4 family of integrases. This family of integrases is implicated in the horizontal DNA transfer of pathogenic genes between bacterial species, such as those found in pathogenic strains of E. coli, Shigella, Yersinia, and Vibrio cholera. Using ILG1 as a marker of our laboratory E. coli strain TOP10F', our evidence suggests that contaminating bacterial DNA in our subtraction experiment is due to this laboratory bacterial strain, which colonized exposed surfaces of the laboratory worker. Thus, identification of differentially expressed genes between normal and diseased states could be dramatically improved by using extra precaution to prevent bacterial contamination of samples. PMID:12393938
Ulvsbäck, M; Lindström, C; Weiber, H; Abrahamsson, P A; Lilja, H; Lundwall, A
1989-11-15
In order to study the gene expression of the seminal plasma protein beta-microseminoprotein, also known as PSP94 and beta-inhibin, clones encoding this protein were isolated from a cDNA library constructed in lambda gt11. Nucleotide sequencing confirmed the structure of a previously cloned cDNA. By northern blot analysis identical sized transcripts were demonstrated in the prostate, the respiratory (tracheal, bronchial and lung) tissues and the antrum part of the gastric mucosa. Thus, the protein is not primarily associated with male reproductive function. Although probably of no physiological significance, a slight structural similarity to the ovarian inhibin beta-chains was identified in the C-terminal half of the molecule.
Howland, Shanshan W; Poh, Chek-Meng; Rénia, Laurent
2011-09-01
Directional cloning of complementary DNA (cDNA) primed by oligo(dT) is commonly achieved by appending a restriction site to the primer, whereas the second strand is synthesized through the combined action of RNase H and Escherichia coli DNA polymerase I (PolI). Although random primers provide more uniform and complete coverage, directional cloning with the same strategy is highly inefficient. We report that phosphorothioate linkages protect the tail sequence appended to random primers from the 5'→3' exonuclease activity of PolI. We present a simple strategy for constructing a random-primed cDNA library using the efficient, size-independent, and seamless In-Fusion cloning method instead of restriction enzymes. Copyright © 2011 Elsevier Inc. All rights reserved.
Dai, W; Pan, H; Hassanain, H; Gupta, S L; Murphy, M J
1994-03-01
Using a combination of polymerase chain reaction and conventional cDNA library screening approaches, we have cloned and characterized a putative receptor tyrosine kinase termed tif. The extracellular domain of tif has an immunoglobulin-like loop and a fibronectin type III structure. The intracellular domain contains a tyrosine kinase domain. Compared with ryk, a ubiquitously expressed receptor tyrosine kinase, tif expression is tissue-specific with human ovary and testis containing the highest amount of tif mRNA. Many other tested human tissues such as heart, liver, pancreas and thymus do not contain detectable levels of tif mRNA. The molecular cloning and characterization of tif cDNA will facilitate the identification of a potential ligand(s) for the putative receptor and the study of its biological role.
Shpakovskiĭ, G V; Lebedenko, E N; Thuriaux, P
1997-02-01
The rpb10 cDNA of the fission yeast Schizosaccharomyces pombe, encoding one of the five small subunits common to all three nuclear DNA-dependent RNA polymerases, was isolated from an expression cDNA library by two independent approaches: PCR-based screening and direct suppression by means of heterospecific complementation of a temperature-sensitive mutant defective in the corresponding gene of Saccharomyces cerevisiae. The cloned Sz. pombe cDNA encodes a protein Rpb10 of 71 amino acids with an M of 8,275 Da, sharing 51 amino acids (71% identity) with the subunit ABC10 beta of RNA polymerases I-III from S. cerevisiae. All eukaryotic members of this protein family have the same general organization featuring two highly conserved motifs (RCFT/SCGK and RYCCRRM) around an atypical zinc finger and an additional invariant HVDLIEK motif toward the C-terminal end. The last motif is only characteristics for homologs from eukaryotes. In keeping with this remarkable structural conservation, the Sz. pombe cDNA also fully complemented a S. cerevisiae deletion mutant lacking subunit ABC10 beta (null allele rpb10-delta 1::HIS3).
The spermatogenic cell-specific variant of glyceraldehyde 3-phosphate dehydrogenase (GAPDS) has been cloned from a rat testis cDNA library and its pattern of expression determined. A 1417 nucleotide cDNA has been found to encode an enzyme with substantial homology to mouse GAPDS...
Problem-Solving Test: Expression Cloning of the Erythropoietin Receptor
ERIC Educational Resources Information Center
Szeberenyi, Jozsef
2008-01-01
Terms to be familiar with before you start to solve the test: cytokines, cytokine receptors, cDNA library, cDNA synthesis, poly(A)[superscript +] RNA, primer, template, reverse transcriptase, restriction endonucleases, cohesive ends, expression vector, promoter, Shine-Dalgarno sequence, poly(A) signal, DNA helicase, DNA ligase, topoisomerases,…
Itoh, M; Kanamori, Y; Takao, M; Eguchi, M
1999-02-01
A cDNA coding for soluble type alkaline phosphatase (sALP) of Bombyx mori was isolated. Deduced amino acid sequence showed high identities to various ALPs and partial similarities to ATPase of Manduca sexta. Using this cDNA sequence as a probe, the molecular basis of electrophoretic polymorphism in sALP and membrane-bound type ALP (mALP) was studied. As for mALP, the result suggested that post-translational modification was important for the proteins to express activity and to represent their extensive polymorphic nature, whereas the magnitude of activities was mainly regulated by transcription. On the other hand, sALP zymogram showed poor polymorphism, but one exception was the null mutant, in which the sALP gene was largely lost. Interestingly, the sALP gene was shown to be transcribed into two mRNAs of different sizes, 2.0 and 2.4 Kb. In addition to the null mutant of sALP, we found a null mutant for mALP. Both of these mutants seem phenotypically silent, suggesting that the functional differentiation between these isozymes is not perfect, so that they can still work mutually and complement each other as an indispensable enzyme for B. mori.
Yu, Haining; Gao, Jiuxiang; Lu, Yiling; Guang, Huijuan; Cai, Shasha; Zhang, Songyan; Wang, Yipeng
2013-11-01
Lysozymes are key proteins that play important roles in innate immune defense in many animal phyla by breaking down the bacterial cell-walls. In this study, we report the molecular cloning, sequence analysis and phylogeny of the first caudate amphibian g-lysozyme: a full-length spleen cDNA library from axolotl (Ambystoma mexicanum). A goose-type (g-lysozyme) EST was identified and the full-length cDNA was obtained using RACE-PCR. The axolotl g-lysozyme sequence represents an open reading frame for a putative signal peptide and the mature protein composed of 184 amino acids. The calculated molecular mass and the theoretical isoelectric point (pl) of this mature protein are 21523.0 Da and 4.37, respectively. Expression of g-lysozyme mRNA is predominantly found in skin, with lower levels in spleen, liver, muscle, and lung. Phylogenetic analysis revealed that caudate amphibian g-lysozyme had distinct evolution pattern for being juxtaposed with not only anura amphibian, but also with the fish, bird and mammal. Although the first complete cDNA sequence for caudate amphibian g-lysozyme is reported in the present study, clones encoding axolotl's other functional immune molecules in the full-length cDNA library will have to be further sequenced to gain insight into the fundamental aspects of antibacterial mechanisms in caudate.
Yang, Bing-Yan; Huo, Xiu-Ai; Li, Peng-Fei; Wang, Cui-Xia; Duan, Hui-Jun
2014-08-01
Full-length cDNAs are very important for genome annotation and functional analysis of genes. The number of full-length cDNAs from watermelon remains limited. Here we report first the construction of a full-length enriched cDNA library from Fusarium wilt stressed watermelon (Citrullus lanatus Thunb.) cultivar PI296341 root tissues using the SMART method. The titer of primary cDNA library and amplified library was 2.21 x 10(6) and 2.0 x 10(10) pfu/ml, respectively and the rate of recombinant was above 85%. The size of insert fragment ranged from 0.3 to 2.0 kb. In this study, we first cloned a gene named ClWRKY1, which was 1981 bp long and encoded a protein consisting of 394 amino acids. It contained two characteristic WRKY domains and two zinc finger motifs. Quantitative real-time PCR showed that ClWRKY1 expression levels reached maximum level at 12 h after inoculation with Fusarium oxysporum f. sp. niveum. The full-length cDNA library of watermelon root tissues is not only essential for the cloning of genes which are known, but also an initial key for the screening and cloning of new genes that might be involved in resistance to Fusarium wilt.
Yang, J; Yamamoto, M; Ishibashi, J; Taniai, K; Yamakawa, M
1998-08-01
An antibacterial protein, designated rhinocerosin, was purified to homogeneity from larvae of the coconut rhinoceros beetle, Oryctes rhinoceros immunized with Escherichia coli. Based on the amino acid sequence of the N-terminal region, a degenerate primer was synthesized and reverse-transcriptase PCR was performed to clone rhinocerosin cDNA. As a result, a 279-bp fragment was obtained. The complete nucleotide sequence was determined by sequencing the extended rhinocerosin cDNA clone by 5' rapid amplification of cDNA ends. The deduced amino acid sequence of the mature portion of rhinocerosin was composed of 72 amino acids without cystein residues and was shown to be rich in glycine (11.1%) and proline (11.1%) residues. Comparison of the deduced amino acid sequence of rhinocerosin with those of other antibacterial proteins indicated that it has 77.8% and 44.6% identity with holotricin 2 and coleoptrecin, respectively. Rhinocerosin had strong antibacterial activity against E. coli, Streptococcus pyogenes, Staphylococcus aureus but not against Pseudomonas aeruginosa. Results of reverse-transcriptase PCR analysis of gene expression in different tissues indicated that the rhinocerosin gene is strongly expressed in the fat body and the Malpighian tubule, and weakly expressed in hemocytes and midgut. In addition, gene expression was inducible by bacteria in the fat body, the Malpighian tubule and hemocyte but constitutive expression was observed in the midgut.
Tappaz, M; Bitoun, M; Reymond, I; Sergeant, A
1999-09-01
Cysteine sulfinate decarboxylase (CSD) is considered as the rate-limiting enzyme in the biosynthesis of taurine, a possible osmoregulator in brain. Through cloning and sequencing of RT-PCR and RACE-PCR products of rat brain mRNAs, a 2,396-bp cDNA sequence was obtained encoding a protein of 493 amino acids (calculated molecular mass, 55.2 kDa). The corresponding fusion protein showed a substrate specificity similar to that of the endogenous enzyme. The sequence of the encoded protein is identical to that encoded by liver CSD cDNA. Among other characterized amino acid decarboxylases, CSD shows the highest homology (54%) with either isoform of glutamic acid decarboxylase (GAD65 and GAD67). A single mRNA band, approximately 2.5 kb, was detected by northern blot in RNA extracts of brain, liver, and kidney. However, brain and liver CSD cDNA sequences differed in the 5' untranslated region. This indicates two forms of CSD mRNA. Analysis of PCR-amplified products of genomic DNA suggests that the brain form results from the use of a 3' alternative internal splicing site within an exon specifically found in liver CSD mRNA. Through selective RT-PCR the brain form was detected in brain only, whereas the liver form was found in liver and kidney. These results indicate a tissue-specific regulation of CSD genomic expression.
Myohara, Maroko; Niva, Cintia Carla; Lee, Jae Min
2006-08-01
To identify genes specifically activated during annelid regeneration, suppression subtractive hybridization was performed with cDNAs from regenerating and intact Enchytraeus japonensis, a terrestrial oligochaete that can regenerate a complete organism from small body fragments within 4-5 days. Filter array screening subsequently revealed that about 38% of the forward-subtracted cDNA clones contained genes that were upregulated during regeneration. Two hundred seventy-nine of these clones were sequenced and found to contain 165 different sequences (79 known and 86 unknown). Nine clones were fully sequenced and four of these sequences were matched to known genes for glutamine synthetase, glucosidase 1, retinal protein 4, and phosphoribosylaminoimidazole carboxylase, respectively. The remaining five clones encoded an unknown open-reading frame. The expression levels of these genes were highest during blastema formation. Our present results, therefore, demonstrate the great potential of annelids as a new experimental subject for the exploration of unknown genes that play critical roles in animal regeneration.
Cloning and purification of alpha-neurotoxins from king cobra (Ophiophagus hannah).
He, Ying-Ying; Lee, Wei-Hui; Zhang, Yun
2004-09-01
Thirteen complete and three partial cDNA sequences were cloned from the constructed king cobra (Ophiophagus hannah) venom gland cDNA library. Phylogenetic analysis of nucleotide sequences of king cobra with those from other snake venoms revealed that obtained cDNAs are highly homologous to snake venom alpha-neurotoxins. Alignment of deduced mature peptide sequences of the obtained clones with those of other reported alpha-neurotoxins from the king cobra venom indicates that our obtained 16 clones belong to long-chain neurotoxins (seven), short-chain neurotoxins (seven), weak toxin (one) and variant (one), respectively. Up to now, two out of 16 newly cloned king cobra alpha-neurotoxins have identical amino acid sequences with CM-11 and Oh-6A/6B, which have been characterized from the same venom. Furthermore, five long-chain alpha-neurotoxins and two short-chain alpha-neurotoxins were purified from crude venom and their N-terminal amino acid sequences were determined. The cDNAs encoding the putative precursors of the purified native peptide were also determined based on the N-terminal amino acid sequencing. The purified alpha-neurotoxins showed different lethal activities on mice.
Cloning and characterization of a Candida albicans maltase gene involved in sucrose utilization.
Geber, A; Williamson, P R; Rex, J H; Sweeney, E C; Bennett, J E
1992-01-01
In order to isolate the structural gene involved in sucrose utilization, we screened a sucrose-induced Candida albicans cDNA library for clones expressing alpha-glucosidase activity. The C. albicans maltase structural gene (CAMAL2) was isolated. No other clones expressing alpha-glucosidase activity. were detected. A genomic CAMAL2 clone was obtained by screening a size-selected genomic library with the cDNA clone. DNA sequence analysis reveals that CAMAL2 encodes a 570-amino-acid protein which shares 50% identity with the maltase structural gene (MAL62) of Saccharomyces carlsbergensis. The substrate specificity of the recombinant protein purified from Escherichia coli identifies the enzyme as a maltase. Northern (RNA) analysis reveals that transcription of CAMAL2 is induced by maltose and sucrose and repressed by glucose. These results suggest that assimilation of sucrose in C. albicans relies on an inducible maltase enzyme. The family of genes controlling sucrose utilization in C. albicans shares similarities with the MAL gene family of Saccharomyces cerevisiae and provides a model system for studying gene regulation in this pathogenic yeast. Images PMID:1400249
Molecular analysis of two cDNA clones encoding acidic class I chitinase in maize.
Wu, S; Kriz, A L; Widholm, J M
1994-01-01
The cloning and analysis of two different cDNA clones encoding putative maize (Zea mays L.) chitinases obtained by polymerase chain reaction (PCR) and cDNA library screening is described. The cDNA library was made from poly(A)+ RNA from leaves challenged with mercuric chloride for 2 d. The two clones, pCh2 and pCh11, appear to encode class I chitinase isoforms with cysteine-rich domains (not found in pCh11 due to the incomplete sequence) and proline-/glycine-rich or proline-rich hinge domains, respectively. The pCh11 clone resembles a previously reported maize seed chitinase; however, the deduced proteins were found to have acidic isoelectric points. Analysis of all monocot chitinase sequences available to date shows that not all class I chitinases possess the basic isoelectric points usually found in dicotyledonous plants and that monocot class II chitinases do not necessarily exhibit acidic isoelectric points. Based on sequence analysis, the pCh2 protein is apparently synthesized as a precursor polypeptide with a signal peptide. Although these two clones belong to class I chitinases, they share only about 70% amino acid homology in the catalytic domain region. Southern blot analysis showed that pCh2 may be encoded by a small gene family, whereas pCh11 was single copy. Northern blot analysis demonstrated that these genes are differentially regulated by mercuric chloride treatment. Mercuric chloride treatment caused rapid induction of pCh2 from 6 to 48 h, whereas pCh11 responded only slightly to the same treatment. During seed germination, embryos constitutively expressed both chitinase genes and the phytohormone abscisic acid had no effect on the expression. The fungus Aspergillus flavus was able to induce both genes to comparable levels in aleurone layers and embryos but not in endosperm tissue. Maize callus growth on the same plate with A. flavus for 1 week showed induction of the transcripts corresponding to pCh2 but not to pCh11. These studies indicate that the different chitinase isoforms in maize might have different functions in the plant, since they show differential expression patterns under different conditions. PMID:7972490
[Primary culture of cat intestinal epithelial cell and construction of its cDNA library].
Ye, L; Gui-Hua, Z; Kun, Y; Hong-Fa, W; Ting, X; Gong-Zhen, L; Wei-Xia, Z; Yong, C
2017-04-12
Objective To establish the primary cat intestinal epithelial cells (IECs) culture methods and construct the cDNA library for the following yeast two-hybrid experiment, so as to screen the virulence interaction factors among the final host. Methods The primary cat IECs were cultured by the tissue cultivation and combined digestion with collagenase XI and dispase I separately. Then the cat IECs cultured was identified with the morphological observation and cyto-keratin detection, by using goat anti-cyto-keratin monoclonal antibodies. The mRNA of cat IECs was isolated and used as the template to synthesize the first strand cDNA by SMART™ technology, and then the double-strand cDNAs were acquired by LD-PCR, which were subsequently cloned into the plasmid PGADT7-Rec to construct yeast two-hybrid cDNA library in the yeast strain Y187 by homologous recombination. Matchmaker™ Insert Check PCR was used to detect the size distribution of cDNA fragments after the capacity calculation of the cDNA library. Results The comparison of the two cultivation methods indicated that the combined digestion of collagenase XI and dispase I was more effective than the tissue cultivation. The cat IECs system of continuous culture was established and the cat IECs with high purity were harvested for constructing the yeast two-hybrid cDNA library. The library contained 1.1×10 6 independent clones. The titer was 2.8×10 9 cfu/ml. The size of inserted fragments was among 0.5-2.0 kb. Conclusion The yeast two-hybrid cDNA library of cat IECs meets the requirements of further screen research, and this study lays the foundation of screening the Toxoplasma gondii virulence interaction factors among the cDNA libraries of its final hosts.
Constructing and detecting a cDNA library for mites.
Hu, Li; Zhao, YaE; Cheng, Juan; Yang, YuanJun; Li, Chen; Lu, ZhaoHui
2015-10-01
RNA extraction and construction of complementary DNA (cDNA) library for mites have been quite challenging due to difficulties in acquiring tiny living mites and breaking their hard chitin. The present study is to explore a better method to construct cDNA library for mites that will lay the foundation on transcriptome and molecular pathogenesis research. We selected Psoroptes cuniculi as an experimental subject and took the following steps to construct and verify cDNA library. First, we combined liquid nitrogen grinding with TRIzol for total RNA extraction. Then, switching mechanism at 5' end of the RNA transcript (SMART) technique was used to construct full-length cDNA library. To evaluate the quality of cDNA library, the library titer and recombination rate were calculated. The reliability of cDNA library was detected by sequencing and analyzing positive clones and genes amplified by specific primers. The results showed that the RNA concentration was 836 ng/μl and the absorbance ratio at 260/280 nm was 1.82. The library titer was 5.31 × 10(5) plaque-forming unit (PFU)/ml and the recombination rate was 98.21%, indicating that the library was of good quality. In the 33 expressed sequence tags (ESTs) of P. cuniculi, two clones of 1656 and 1658 bp were almost identical with only three variable sites detected, which had an identity of 99.63% with that of Psoroptes ovis, indicating that the cDNA library was reliable. Further detection by specific primers demonstrated that the 553-bp Pso c II gene sequences of P. cuniculi had an identity of 98.56% with those of P. ovis, confirming that the cDNA library was not only reliable but also feasible.
Hao, Yan-Zhe; Hou, Wan-Ru; Hou, Yi-Ling; Du, Yu-Jie; Zhang, Tian; Peng, Zheng-Song
2009-11-01
RPS25 is a component of the 40S small ribosomal subunit encoded by RPS25 gene, which is specific to eukaryotes. Studies in reference to RPS25 gene from animals were handful. The Giant Panda (Ailuropoda melanoleuca), known as a "living fossil", are increasingly concerned by the world community. Studies on RPS25 of the Giant Panda could provide scientific data for inquiring into the hereditary traits of the gene and formulating the protective strategy for the Giant Panda. The cDNA of the RPS25 cloned from Giant Panda is 436 bp in size, containing an open reading frame of 378 bp encoding 125 amino acids. The length of the genomic sequence is 1,992 bp, which was found to possess four exons and three introns. Alignment analysis indicated that the nucleotide sequence of the coding sequence shows a high homology to those of Homo sapiens, Bos taurus, Mus musculus and Rattus norvegicus as determined by Blast analysis, 92.6, 94.4, 89.2 and 91.5%, respectively. Primary structure analysis revealed that the molecular weight of the putative RPS25 protein is 13.7421 kDa with a theoretical pI 10.12. Topology prediction showed there is one N-glycosylation site, one cAMP and cGMP-dependent protein kinase phosphorylation site, two Protein kinase C phosphorylation sites and one Tyrosine kinase phosphorylation site in the RPS25 protein of the Giant Panda. The RPS25 gene was overexpressed in E. coli BL21 and Western Blotting of the RPS25 protein was also done. The results indicated that the RPS25 gene can be really expressed in E. coli and the RPS25 protein fusioned with the N-terminally his-tagged form gave rise to the accumulation of an expected 17.4 kDa polypeptide. The cDNA and the genomic sequence of RPS25 were cloned successfully for the first time from the Giant Panda using RT-PCR technology and Touchdown-PCR, respectively, which were both sequenced and analyzed preliminarily; then the cDNA of the RPS25 gene was overexpressed in E. coli BL21 and immunoblotted, which is the first report on the RPS25 gene from the Giant Panda. The data will enrich and supplement the information about RPS25, which will contribute to the protection for gene resources and the discussion of the genetic polymorphism.
Frame-Insensitive Expression Cloning of Fluorescent Protein from Scolionema suvaense.
Horiuchi, Yuki; Laskaratou, Danai; Sliwa, Michel; Ruckebusch, Cyril; Hatori, Kuniyuki; Mizuno, Hideaki; Hotta, Jun-Ichi
2018-01-26
Expression cloning from cDNA is an important technique for acquiring genes encoding novel fluorescent proteins. However, the probability of in-frame cDNA insertion following the first start codon of the vector is normally only 1/3, which is a cause of low cloning efficiency. To overcome this issue, we developed a new expression plasmid vector, pRSET-TriEX, in which transcriptional slippage was induced by introducing a DNA sequence of (dT) 14 next to the first start codon of pRSET. The effectiveness of frame-insensitive cloning was validated by inserting the gene encoding eGFP with all three possible frames to the vector. After transformation with one of these plasmids, E. coli cells expressed eGFP with no significant difference in the expression level. The pRSET-TriEX vector was then used for expression cloning of a novel fluorescent protein from Scolionema suvaense . We screened 3658 E. coli colonies transformed with pRSET-TriEX containing Scolionema suvaense cDNA, and found one colony expressing a novel green fluorescent protein, ScSuFP. The highest score in protein sequence similarity was 42% with the chain c of multi-domain green fluorescent protein like protein "ember" from Anthoathecata sp. Variations in the N- and/or C-terminal sequence of ScSuFP compared to other fluorescent proteins indicate that the expression cloning, rather than the sequence similarity-based methods, was crucial for acquiring the gene encoding ScSuFP. The absorption maximum was at 498 nm, with an extinction efficiency of 1.17 × 10⁵ M -1 ·cm -1 . The emission maximum was at 511 nm and the fluorescence quantum yield was determined to be 0.6. Pseudo-native gel electrophoresis showed that the protein forms obligatory homodimers.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Reilly, D.S.; Nussbaum, R.L.
1994-09-01
The Lowe oculocerebrorenal syndrome (OCRL) is an X-linked disease characterized by congenital cataract, mental retardation, and renal tubular dysfunction. A candidate cDNA, OCRL-1, was identified by positional cloning and mutations in OCRL-1 have been detected in patients with Lowe syndrome. The OCRL-1 nucleotide sequence encodes a predicted protein of 968 amino acids and shares 51% amino acid identity with a human inositol polyphosphate-5-phosphatase. This suggests that the underlying defect in OCRL may be due to a defect in inositol phosphate metabolism. The isolation of OCRL-1 provides the opportunity to investigate its function through the use of animal model systems. Wemore » have isolated a partial cDNA clone encoding an OCRL-1 homologue, X-OCRL, from the South African clawed frog, Xenopus laevis. We used a portion of the human cDNA to screen a Xenopus laevis embryo cDNA library and isolated four positive clones. One clone, 42-5A, is a 650 bp insert with over 75% amino acid identity to the corresponding region of the human OCRL-1 sequence. 42-5A detects messenger RNA in adult Xenopus brain, stomach, small intestine, skin, muscle, lung, blood, and oviduct. X-OCRL messenger RNA is first detected during late gastrula and continues to be expressed throughout Xenopus development. In situ hybridization studies are underway to identify the cellular localization of X-OCRL expression in Xenopus embryos and adult tissues. We are especially interested in characterizing X-OCRL expression during formation of the amphibian lens since congenital cataracts are a constant feature of the human disease.« less
BIGEL analysis of gene expression in HL60 cells exposed to X rays or 60 Hz magnetic fields
NASA Technical Reports Server (NTRS)
Balcer-Kubiczek, E. K.; Zhang, X. F.; Han, L. H.; Harrison, G. H.; Davis, C. C.; Zhou, X. J.; Ioffe, V.; McCready, W. A.; Abraham, J. M.; Meltzer, S. J.
1998-01-01
We screened a panel of 1,920 randomly selected cDNAs to discover genes that are differentially expressed in HL60 cells exposed to 60 Hz magnetic fields (2 mT) or X rays (5 Gy) compared to unexposed cells. Identification of these clones was accomplished using our two-gel cDNA library screening method (BIGEL). Eighteen cDNAs differentially expressed in X-irradiated compared to control HL60 cells were recovered from a panel of 1,920 clones. Differential expression in experimental compared to control cells was confirmed independently by Northern blotting of paired total RNA samples hybridized to each of the 18 clone-specific cDNA probes. DNA sequencing revealed that 15 of the 18 cDNA clones produced matches with the database for genes related to cell growth, protein synthesis, energy metabolism, oxidative stress or apoptosis (including MYC, neuroleukin, copper zinc-dependent superoxide dismutase, TC4 RAS-like protein, peptide elongation factor 1alpha, BNIP3, GATA3, NF45, cytochrome c oxidase II and triosephosphate isomerase mRNAs). In contrast, BIGEL analysis of the same 1,920 cDNAs revealed no differences greater than 1.5-fold in expression levels in magnetic-field compared to sham-exposed cells. Magnetic-field-exposed and control samples were analyzed further for the presence of mRNA encoding X-ray-responsive genes by hybridization of the 18 specific cDNA probes to RNA from exposed and control HL60 cells. Our results suggest that differential gene expression is induced in approximately 1% of a random pool of cDNAs by ionizing radiation but not by 60 Hz magnetic fields under the present experimental conditions.
Shows, Kathryn H; Ward, Christy; Summers, Laura; Li, Lin; Ziegler, Gregory R; Hendrickx, Andrew G; Shiang, Rita
2006-02-01
Mutations in the human gene TCOF1 cause a mandibulofacial dysostosis known as Treacher Collins syndrome (TCS). An infant rhesus macaque (Macaca mulatta) that displayed the TCS phenotype was identified at the California National Primate Research Center. The TCOF1 coding region was cloned from a normal rhesus macaque and sequenced. The rhesus macaque homolog of TCOF1 is 91.6% identical in cDNA sequence and 93.8% identical in translated protein sequence compared to human TCOF1. Sequencing of TCOF1 in the TCS-affected rhesus macaque showed no mutations within the coding region or splice sites; however, real-time quantitative PCR showed an 87% reduction of spleen TCOF1 mRNA level in the TCS affected macaque when compared with normal macaque spleen.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kuhn, R.J.; Tada, H.; Ypma-Wong, M.F.
1988-01-01
By following a strategy of genetic analysis of poliovirus, the authors have constructed a synthetic mutagenesis cartridge spanning the genome-linked viral protein coding region and flanking cleavage sites in an infectious cDNA clone of the type I (Mahoney) genome. The insertion of new restriction sites within the infectious clone has allowed them to replace the wild-type sequences with short complementary pairs of synthetic oligonucleotides containing various mutations. A set of mutations have been made that create methionine codons within the genome-linked viral protein region. The resulting viruses have growth characteristics similar to wild type. Experiments that led to an alterationmore » of the tyrosine residue responsible for the linkage to RNA have resulted in nonviable virus. In one mutant, proteolytic processing assayed in vitro appeared unimpaired by the mutation. They suggest that the position of the tyrosine residue is important for genome-linked viral protein function(s).« less
Isolation and characterization of a water stress-specific genomic gene, pwsi 18, from rice.
Joshee, N; Kisaka, H; Kitagawa, Y
1998-01-01
One of the water stress-specific cDNA clones of rice characterised previously, wsi18, was selected for further study. The wsi18 gene can be induced by water stress conditions such as mannitol, NaCl, and dryness, but not by ABA, cold, or heat. A genomic clone for wsi18, pwsi18, contained about 1.7 kbp of the 5' upstream sequence, two introns, and the full coding sequence. The 5'-upstream sequence of pwsi18 contained putative cis-acting elements, namely an ABA-responsive element (ABRE), three G-boxes, three E-boxes, a MEF-2 sequence, four direct and two inverted repeats, and four sequences similar to DRE, which is involved in the dehydration response of Arabidopsis genes. The gusA reporter gene under the control of the pwsi18 promoter showed transient expression in response to water stress. Deletion of the downstream DRE-like sequence between the distal G-boxes-2 and -3 resulted in rather low GUS expression.
Characterization of myosin heavy chain and its gene in Amoeba proteus.
Oh, S W; Jeon, K W
1998-01-01
Monoclonal antibodies against the myosin heavy chain of Amoeba proteus were obtained and used to localize myosin inside amoebae and to clone cDNAs encoding myosin. Myosin was found throughout the amoeba cytoplasm but was more concentrated in the ectoplasmic regions as determined by indirect immunofluorescence microscopy. In symbiont-bearing xD amoebae, myosin was also found on the symbiosome membranes, as checked by indirect immunofluorescence microscopy and by immunoelectron microscopy. The open reading frame of a cloned myosin cDNA contained 6,414 nucleotides, coding for a polypeptide of 2,138 amino acids. While the amino-acid sequence of the globular head region of amoeba's myosin had a high degree of similarity with that of myosins from various organisms, the tail region building a coiled-coil structure did not show a significant sequence similarity. There appeared to be at least three different isoforms of myosins in amoebae, with closely related amino acids in the globular head region.
Cloning and expression of a small heat and salt tolerant protein (Hsp22) from Chaetomium globosum.
Aggarwal, Rashmi; Gupta, Sangeeta; Sharma, Sapna; Banerjee, Sagar; Singh, Priyanka
2012-11-01
The present study reports molecular characterization of small heat shock protein gene in Indian isolates of Chaetomium globosum, C. perlucidum, C. reflexum, C. cochlioides and C. cupreum. Six isolates of C. globosum and other species showed a band of 630bp using specific primers. Amplified cDNA product of C. globosum (Cg 1) cloned and sequenced showed 603bp open reading frame encoding 200 amino-acids. The protein sequence had a molecular mass of 22 kDa and was therefore, named Hsp22. BlastX analysis revealed that the gene codes for a protein homologous to previously characterized Hsp22.4 gene from C. globosum (AAR36902.1, XP 001229241.1) and shared 95% identity in amino acid sequence. It also showed varying degree of similarities with small Hsp protein from Neurospora spp. (60%), Myceliophthora sp. (59%), Glomerella sp. (50%), Hypocrea sp. (52%), and Fusarium spp. (51%). This gene was further cloned into pET28a (+) and transformed E. coli BL21 cells were induced by IPTG, and the expressed protein of 30 kDa was analyzed by SDS-PAGE. The IPTG induced transformants displayed significantly greater resistance to NaCl and Na2CO3 stresses.
ASSESSMENT OF CLONE IDENTITY AND SEQUENCE FIDELITY FOR 1189 IMAGE CDNA CLONES. (R827402)
The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...
Vijn, Irma; van Dijken, Anja; Lüscher, Marcel; Bos, Antoine; Smeets, Edward; Weisbeek, Peter; Wiemken, Andres; Smeekens, Sjef
1998-01-01
Sucrose (Suc):Suc 1-fructosyltransferase (1-SST) is the key enzyme in plant fructan biosynthesis, since it catalyzes de novo fructan synthesis from Suc. We have cloned 1-SST from onion (Allium cepa) by screening a cDNA library using acid invertase from tulip (Tulipa gesneriana) as a probe. Expression assays in tobacco (Nicotiana plumbaginifolia) protoplasts showed the formation of 1-kestose from Suc. In addition, an onion acid invertase clone was isolated from the same cDNA library. Protein extracts of tobacco protoplasts transformed with this clone showed extensive Suc-hydrolyzing activity. Conditions that induced fructan accumulation in onion leaves also induced 1-SST mRNA accumulation, whereas the acid invertase mRNA level decreased. Structurally different fructan molecules could be produced from Suc by a combined incubation of protein extract of protoplasts transformed with 1-SST and protein extract of protoplasts transformed with either the onion fructan:fructan 6G-fructosyltransferase or the barley Suc:fructan 6-fructosyltransferase. PMID:9701606
DOE Office of Scientific and Technical Information (OSTI.GOV)
Caberoy, Nora B.; Zhou, Yixiong; Alvarado, Gabriela
To efficiently elucidate the biological roles of phosphatidylserine (PS), we developed open-reading-frame (ORF) phage display to identify PS-binding proteins. The procedure of phage panning was optimized with a phage clone expressing MFG-E8, a well-known PS-binding protein. Three rounds of phage panning with ORF phage display cDNA library resulted in {approx}300-fold enrichment in PS-binding activity. A total of 17 PS-binding phage clones were identified. Unlike phage display with conventional cDNA libraries, all 17 PS-binding clones were ORFs encoding 13 real proteins. Sequence analysis revealed that all identified PS-specific phage clones had dimeric basic amino acid residues. GST fusion proteins were expressedmore » for 3 PS-binding proteins and verified for their binding activity to PS liposomes, but not phosphatidylcholine liposomes. These results elucidated previously unknown PS-binding proteins and demonstrated that ORF phage display is a versatile technology capable of efficiently identifying binding proteins for non-protein molecules like PS.« less
Parvari, R; Ziv, E; Lentner, F; Tel-Or, S; Burstein, Y; Schechter, I
1987-01-01
cDNA libraries of chicken spleen and Harder gland (a gland enriched with immunocytes) constructed in pBR322 were screened by differential hybridization and by mRNA hybrid-selected translation. Eleven L-chain cDNA clones were identified from which VL probes were prepared and each was annealed with kidney DNA restriction digests. All VL probes revealed the same set of bands, corresponding to about 15 germline VL genes of one subgroup. The nucleotide sequences of six VL clones showed greater than or equal to 85% homology, and the predicted amino acid sequences were identical or nearly identical to the major N-terminal sequence of L-chains in chicken serum. These findings, and the fact that the VL clones were randomly selected from normal lymphoid tissues, strongly indicate that the bulk of chicken L-chains is encoded by a few germline VL genes, probably much less than 15 since many of the VL genes are known to be pseudogenes. Therefore, it is likely that somatic mechanisms operating prior to specific triggering by antigen play a major role in the generation of antibody diversity in chicken. Analysis of the constant region locus (sequencing of CL gene and cDNAs) demonstrate a single CL isotype and suggest the presence of CL allotypes.
Bernstein, K E; Pavirani, A; Alexander, C; Jacobsen, F; Fitzmaurice, L; Mage, R
1983-01-01
Rabbits were infected by Trypanosoma equiperdum and the splenic mRNA was isolated. In vitro translation of this RNA and immunoprecipitation with anti-light chain, anti-heavy chain, anti-mu and anti-VH antibodies demonstrated that T. equiperdum infection elicits large quantities of splenic mRNA encoding mu and kappa chains. The mu and gamma heavy chains and the kappa light chains synthesized in the cell-free translation system were specifically immunoprecipitated by antisera to heavy chain VHa and light chain kappa b allotypes. In vitro labeling of spleen cells from trypanosome-infected animals demonstrated that the biosynthetically labeled IgM has a mu chain of higher molecular weight than the mu chain synthesized by in vitro translation, a difference that is largely abolished when cellular glycosylation is blocked with the antibiotic tunicamycin. Enrichment for heavy chain or light chain mRNA was achieved by fractionating mRNA from trypanosome-infected animals on a sucrose gradient. cDNA clones carrying mu heavy chain sequences were produced using a 'one tube' protocol and identified by cross species hybridization and hybridization selection. Infection of rabbits with T. equiperdum followed by sucrose gradient enrichment of splenic mRNA has provided sufficient quantities of mRNA encoding mu heavy chain suitable for cDNA cloning.
Molecular Cloning and Sequencing of Channel Catfish, Ictalurus punctatus, Cathepsin H and L cDNA
USDA-ARS?s Scientific Manuscript database
Cathepsin H and L, a lysosomal cysteine endopeptidase of the papain family, are ubiquitously expressed and involve in antigen processing. In this communication, the channel catfish cathepsin H and L transcripts were sequenced and analyzed. Total RNA from tissues was extracted and cDNA libraries we...
Mammalian cDNA Library from the NIH Mammalian Gene Collection (MGC) | Office of Cancer Genomics
The MGC provides the research community full-length clones for most of the defined (as of 2006) human and mouse genes, along with selected clones of cow and rat genes. Clones were designed to allow easy transfer of the ORF sequences into nearly any type of expression vector. MGC provides protein ‘expression-ready’ clones for each of the included human genes. MGC is part of the ORFeome Collaboration (OC).
Rapid amplification of 5' complementary DNA ends (5' RACE).
2005-08-01
This method is used to extend partial cDNA clones by amplifying the 5' sequences of the corresponding mRNAs 1-3. The technique requires knowledge of only a small region of sequence within the partial cDNA clone. During PCR, the thermostable DNA polymerase is directed to the appropriate target RNA by a single primer derived from the region of known sequence; the second primer required for PCR is complementary to a general feature of the target-in the case of 5' RACE, to a homopolymeric tail added (via terminal transferase) to the 3' termini of cDNAs transcribed from a preparation of mRNA. This synthetic tail provides a primer-binding site upstream of the unknown 5' sequence of the target mRNA. The products of the amplification reaction are cloned into a plasmid vector for sequencing and subsequent manipulation.
Isolation and characterization of cDNA clones for human erythrocyte beta-spectrin.
Prchal, J T; Morley, B J; Yoon, S H; Coetzer, T L; Palek, J; Conboy, J G; Kan, Y W
1987-01-01
Spectrin is an important structural component of the membrane skeleton that underlies and supports the erythrocyte plasma membrane. It is composed of nonidentical alpha (Mr 240,000) and beta (Mr 220,000) subunits, each of which contains multiple homologous 106-amino acid segments. We report here the isolation and characterization of a human erythroid-specific beta-spectrin cDNA clone that encodes parts of the beta-9 through beta-12 repeat segments. This cDNA was used as a hybridization probe to assign the beta-spectrin gene to human chromosome 14 and to begin molecular analysis of the gene and its mRNA transcripts. RNA transfer blot analysis showed that the reticulocyte beta-spectrin mRNA is 7.8 kilobases in length. Southern blot analysis of genomic DNA revealed the presence of restriction fragment length polymorphisms (RFLPs) within the beta-spectrin gene locus. The isolation of human spectrin cDNA probes and the identification of closely linked RFLPs will facilitate analysis of mutant spectrin genes causing congenital hemolytic anemias associated with quantitative and qualitative spectrin abnormalities. Images PMID:3478706
Kajiwara, S; Kakizono, T; Saito, T; Kondo, K; Ohtani, T; Nishio, N; Nagai, S; Misawa, N
1995-10-01
We succeeded in isolating a novel cDNA involved in astaxanthin biosynthesis from the green alga Haematococcus pluvialis, by an expression cloning method using an Escherichia coli transformant as a host that synthesizes beta-carotene due to the Erwinia uredovora carotenoid biosynthesis genes. The cloned cDNA was shown to encode a novel enzyme, beta-carotene ketolase (beta-carotene oxygenase), which converted beta-carotene to canthaxanthin via echinenone, through chromatographic and spectroscopic analysis of the pigments accumulated in an E. coli transformant. This indicates that the encoded enzyme is responsible for the direct conversion of methylene to keto groups, a mechanism that usually requires two different enzymatic reactions proceeding via a hydroxy intermediate. Northern blot analysis showed that the mRNA was synthesized only in the cyst cells of H. pluvialis. E. coli carrying the H. pluvialis cDNA and the E. uredovora genes required for zeaxanthin biosynthesis was also found to synthesize astaxanthin (3S, 3'S), which was identified after purification by a variety of spectroscopic methods.
A cDNA clone highly expressed in ripe banana fruit shows homology to pectate lyases.
Dominguez-Puigjaner, E; LLop, I; Vendrell, M; Prat, S
1997-07-01
A cDNA clone (Ban17), encoding a protein homologous to pectate lyase, has been isolated from a cDNA library from climacteric banana fruit by means of differential screening. Northern analysis showed that Ban17 mRNA is first detected in early climacteric fruit, reaches a steady-state maximum at the climacteric peak, and declines thereafter in overripe fruit. Accumulation of the Ban17 transcript can be induced in green banana fruit by exogenous application of ethylene. The demonstrates that expression of this gene is under hormonal control, its induction being regulated by the rapid increase in ethylene production at the onset of ripening. The deduced amino acid sequence derived from the Ban17 cDNA shares significant identity with pectate lyases from pollen and plant pathogenic bacteria of the genus Erwinia. Similarity to bacterial pectate lyases that were proven to break down the pectic substances of the plant cell wall suggest that Ban17 might play a role in the loss of mesocarp firmness during fruit ripening.
Guo, Mei; Lu, Fuping; Pu, Jun; Bai, Dongqing; Du, Lianxiang
2005-11-01
A cDNA encoding for laccase was isolated from the ligninolytic fungus Trametes versicolor by RNA-PCR. The cDNA corresponds to the gene Lcc1, which encodes a laccase isoenzyme of 498 amino acid residues preceded by a 22-residue signal peptide. The Lcc1 cDNA was cloned into the vectors pMETA and pMETalphaA and expressed in Pichia methanolica. The laccase activity obtained with the Saccharomyces cerevisiae alpha-factor signal peptide was found to be twofold higher than that obtained with the native secretion signal peptide. The extracellular laccase activity in recombinants with the alpha-factor signal peptide was 9.79 U ml(-1). The presence of 0.2 mM copper was necessary for optimal activity of laccase. The expression level was favoured by lower cultivation temperature. The identity of the recombinant protein was further confirmed by immunodetection using Western blot analysis. As expected, the molecular mass of the mature laccase was 64.0 kDa, similar to that of the native form.
Salinas, Alejandro; Vega, Marcela; Lienqueo, María Elena; Garcia, Alejandro; Carmona, Rene; Salazar, Oriana
2011-12-10
Total cDNA isolated from cellulolytic fungi cultured in cellulose was examined for the presence of sequences encoding for endoglucanases. Novel sequences encoding for glycoside hydrolases (GHs) were identified in Fusarium oxysporum, Ganoderma applanatum and Trametes versicolor. The cDNA encoding for partial sequences of GH family 61 cellulases from F. oxysporum and G. applanatum shares 58 and 68% identity with endoglucanases from Glomerella graminicola and Laccaria bicolor, respectively. A new GH family 5 endoglucanase from T. versicolor was also identified. The cDNA encoding for the mature protein was completely sequenced. This enzyme shares 96% identity with Trametes hirsuta endoglucanase and 22% with Trichoderma reesei endoglucanase II (EGII). The enzyme, named TvEG, has N-terminal family 1 carbohydrate binding module (CBM1). The full length cDNA was cloned into the pPICZαB vector and expressed as an active, extracellular enzyme in the methylotrophic yeast Pichia pastoris. Preliminary studies suggest that T. versicolor could be useful for lignocellulose degradation. Copyright © 2011 Elsevier Inc. All rights reserved.
Dialynas, D P; Murre, C; Quertermous, T; Boss, J M; Leiden, J M; Seidman, J G; Strominger, J L
1986-01-01
Complementary DNA (cDNA) encoding a human T-cell gamma chain has been cloned and sequenced. At the junction of the variable and joining regions, there is an apparent deletion of two nucleotides in the human cDNA sequence relative to the murine gamma-chain cDNA sequence, resulting simultaneously in the generation of an in-frame stop codon and in a translational frameshift. For this reason, the sequence presented here encodes an aberrantly rearranged human T-cell gamma chain. There are several surprising differences between the deduced human and murine gamma-chain amino acid sequences. These include poor homology in the variable region, poor homology in a discrete segment of the constant region precisely bounded by the expected junctions of exon CII, and the presence in the human sequence of five potential sites for N-linked glycosylation. Images PMID:3458221
Synthetic transcripts of double-stranded Birnavirus genome are infectious.
Mundt, E; Vakharia, V N
1996-01-01
We have developed a system for generation of infectious bursal disease virus (IBDV), a segmented double-stranded RNA virus of the Birnaviridae family, with the use of synthetic transcripts derived from cloned cDNA. Independent full-length cDNA clones were constructed that contained the entire coding and noncoding regions of RNA segments A and B of two distinguishable IBDV strains of serotype I. Segment A encodes all of the structural (VP2, VP4, and VP3) and nonstructural (VP5) proteins, whereas segment B encodes the RNA-dependent RNA polymerase (VP1). Synthetic RNAs of both segments were produced by in vitro transcription of linearized plasmids with T7 RNA polymerase. Transfection of Vero cells with combined plus-sense transcripts of both segments generated infectious virus as early as 36 hr after transfection. The infectivity and specificity of the recovered chimeric virus was ascertained by the appearance of cytopathic effect in chicken embryo cells, by immunofluorescence staining of infected Vero cells with rabbit anti-IBDV serum, and by nucleotide sequence analysis of the recovered virus, respectively. In addition, transfectant viruses containing genetically tagged sequences in either segment A or segment B of IBDV were generated to confirm the feasibility of this system. The development of a reverse genetics system for double-stranded RNA viruses will greatly facilitate studies of the regulation of viral gene expression, pathogenesis, and design of a new generation of live vaccines. Images Fig. 2 Fig. 3 Fig. 4 PMID:8855321
Huntriss, John; Lu, Jianping; Hemmings, Karen; Bayne, Rosemary; Anderson, Richard; Rutherford, Anthony; Balen, Adam; Elder, Kay; Picton, Helen M
2017-01-01
Gametocyte-specific factor 1 has been shown in other species to be required for the silencing of retrotransposons via the Piwi-interacting RNA (piRNA) pathway. In this study, we aimed to isolate and assess expression of transcripts of the gametocyte-specific factor 1 (GTSF1) gene in the human female germline and in preimplantation embryos. Complementary DNA (cDNA) libraries from human fetal ovaries and testes, human oocytes and preimplantation embryos and ovarian follicles isolated from an adult ovarian cortex biopsy were used to as templates for PCR, cloning and sequencing, and real time PCR experiments of GTSF1 expression. GTSF1 cDNA clones that covered the entire coding region were isolated from human oocytes and preimplantation embryos. GTSF1 mRNA expression was detected in archived cDNAs from staged human ovarian follicles, germinal vesicle (GV) stage oocytes, metaphase II oocytes, and morula and blastocyst stage preimplantation embryos. Within the adult female germline, expression was highest in GV oocytes. GTSF1 mRNA expression was also assessed in human fetal ovary and was observed to increase during gestation, from 8 to 21 weeks, during which time oogonia enter meiosis and primordial follicle formation first occurs. In human fetal testis, GTSF1 expression also increased from 8 to 19 weeks. To our knowledge, this report is the first to describe the expression of the human GTSF1 gene in human gametes and preimplantation embryos.
Characterization and mapping of the mouse NDP (Norrie disease) locus (Ndp).
Battinelli, E M; Boyd, Y; Craig, I W; Breakefield, X O; Chen, Z Y
1996-02-01
Norrie disease is a severe X-linked recessive neurological disorder characterized by congenital blindness with progressive loss of hearing. Over half of Norrie patients also manifest different degrees of mental retardation. The gene for Norrie disease (NDP) has recently been cloned and characterized. With the human NDP cDNA, mouse genomic phage libraries were screened for the homolog of the gene. Comparison between mouse and human genomic DNA blots hybridized with the NDP cDNA, as well as analysis of phage clones, shows that the mouse NDP gene is 29 kb in size (28 kb for the human gene). The organization in the two species is very similar. Both have three exons with similar-sized introns and identical exon-intron boundaries between exon 2 and 3. The mouse open reading frame is 393 bp and, like the human coding sequence, is encoded in exons 2 and 3. The absence of six nucleotides in the second mouse exon results in the encoded protein being two amino acids smaller than its human counterpart. The overall homology between the human and mouse NDP protein is 95% and is particularly high (99%) in exon 3, consistent with the apparent functional importance of this region. Analysis of transcription initiation sites suggests the presence of multiple start sites associated with expression of the mouse NDP gene. Pedigree analysis of an interspecific mouse backcross localizes the mouse NDP gene close to Maoa in the conserved segment, which runs from CYBB to PFC in both human and mouse.
Xu, Jiguo; Gao, Xinfeng; Li, Xing; Ye, Qiao; Jebessa, Endashaw; Abdalla, Bahareldin Ali; Nie, Qinghua
2017-06-01
Follicle-stimulating hormone (FSH) and its receptor play a key role in the follicular development and regulation of steroidogenesis in the ovary and spermatogenesis in the testis. The purpose of this study was to characterize themuscovy duck FSHR gene, identify SNPs and their association with egg production traits in muscovy ducks. Here, we cloned the complementary DNA (cDNA) sequence of FSHR, and examined the expression patterns of FSHR gene in adult female muscovy duck tissues. The cloned cDNA of the muscovy duck FSHR gene shared high similarity to those of pekin duck (Anas platyrhynchos) (95.7%) and chicken (93.2%). Three different muscovy duck FSHR transcripts were identified. Quantitative real-time PCR (RT-qPCR) results showed that the FSHR gene was expressed in all the 14 tested tissues, and the highest expression level was seen in the ovary. A total of 16 SNPs were identified, among which, four SNPs were located in the coding region of FSHR. The SNP C320T is significantly associated with egg production at 59 weeks of age (P < 0.05), whereas the SNP A227G is significantly associated with age at first egg stage (P < 0.05). These results suggest that the two SNPs (A227G and C320T) of FSHR gene are associated with egg production traits and could be potential markers that can be used for marker-assisted selection programmes to increase egg production in muscovy duck.
Varasteh, Abdol-Reza; Sankian, Mojtaba; Midoro-Horiuti, Terumi; Moghadam, Malihe; Shakeri, Mohamad Taghi; Brooks, Edward G.; Goldblum, Randall M.; Chapman, Martin D.; Pomés, Anna
2012-01-01
Background: The cultivation of saffron is expanding through the southeast of Iran, and allergy to saffron pollen occurs in workers involved in processing this plant. We aimed to clone, sequence and express a major allergen involved in saffron pollen allergy, and to compare the recombinant with the natural allergen. Methods: The N-terminal amino acid sequence of Cro s 1, an allergen from saffron pollen, was determined after immunoblotting. The cDNA encoding for this allergen was cloned by PCR utilizing a primer based on the N-terminal amino acid sequence. Recombinant Cro s 1 (rCro s 1) was expressed as a soluble protein in Pichia pastoris and purified to homogeneity by gel filtration. Inhibition of IgE binding to rCro s 1 by pollen extract was analyzed by ELISA. Section Title The allergen Cro s 1 was identified from saffron pollen extracts and cloned by PCR. Cro s 1 cDNA defined an acidic polypeptide with homology to pollen proteins from Chenopodium album and Ligastrum vulgaris. The rCro s 1 was expressed in P. pastoris at 28 mg/l. Saffron pollen extract inhibited the binding of patient serum IgE to rCro s 1. Conclusion: We identified and cloned the first Crocus sativus pollen allergen. rCro s 1 cDNA shows a very high homology with Che a 1, the major allergen of lamb's-quarter, Chenopodium album, Caryophyllales, pollen (97%). Cro s 1 is a useful tool for specific diagnosis and structural studies of occupational allergy to saffron. PMID:26989701
Differences in expression of retinal pigment epithelium mRNA between normal canines
2004-01-01
Abstract A reference database of differences in mRNA expression in normal healthy canine retinal pigment epithelium (RPE) has been established. This database identifies non-informative differences in mRNA expression that can be used in screening canine RPE for mutations associated with clinical effects on vision. Complementary DNA (cDNA) pools were prepared from mRNA harvested from RPE, amplified by PCR, and used in a subtractive hybridization protocol (representational differential analysis) to identify differences in RPE mRNA expression between canines. The effect of relatedness of the test canines on the frequency of occurrence of differences was evaluated by using 2 unrelated canines for comparison with 2 female sibling canines of blue heeler/bull terrier lineage. Differentially expressed cDNA species were cloned, sequenced, and identified by comparison to public database entries. The most frequently observed differentially expressed sequence from the unrelated canine comparison was cDNA with 21 base pairs (bp) identical to the human epithelial membrane protein 1 gene (present in 8 of 20 clones). Different clones from the same-sex sibling RPE contained repetitions of several short sequence motifs including the human epithelial membrane protein 1 (4 of 25 clones). Other prevalent differences between sibling RPE included sequences similar to a chicken genetic marker sequence motif (5 of 25), and 6 clones with homology to porcine major histocompatibility loci. In addition to identifying several repetitively occurring, noninformative, differentially expressed RPE mRNA species, the findings confirm that fewer differences occurred between siblings, highlighting the importance of using closely related subjects in representational difference analysis studies. PMID:15352545
Varasteh, Abdol-Reza; Sankian, Mojtaba; Midoro-Horiuti, Terumi; Moghadam, Malihe; Shakeri, Mohamad Taghi; Brooks, Edward G; Goldblum, Randall M; Chapman, Martin D; Pomés, Anna
2012-10-01
The cultivation of saffron is expanding through the southeast of Iran, and allergy to saffron pollen occurs in workers involved in processing this plant. We aimed to clone, sequence and express a major allergen involved in saffron pollen allergy, and to compare the recombinant with the natural allergen. The N-terminal amino acid sequence of Cro s 1, an allergen from saffron pollen, was determined after immunoblotting. The cDNA encoding for this allergen was cloned by PCR utilizing a primer based on the N-terminal amino acid sequence. Recombinant Cro s 1 (rCro s 1) was expressed as a soluble protein in Pichia pastoris and purified to homogeneity by gel filtration. Inhibition of IgE binding to rCro s 1 by pollen extract was analyzed by ELISA. The allergen Cro s 1 was identified from saffron pollen extracts and cloned by PCR. Cro s 1 cDNA defined an acidic polypeptide with homology to pollen proteins from Chenopodium album and Ligastrum vulgaris. The rCro s 1 was expressed in P. pastoris at 28 mg/l. Saffron pollen extract inhibited the binding of patient serum IgE to rCro s 1. We identified and cloned the first Crocus sativus pollen allergen. rCro s 1 cDNA shows a very high homology with Che a 1, the major allergen of lamb's-quarter, Chenopodium album, Caryophyllales, pollen (97%). Cro s 1 is a useful tool for specific diagnosis and structural studies of occupational allergy to saffron.
Yao, Q; Fischer, K P; Tyrrell, D L; Gutfreund, K S
2015-04-01
Programmed death ligand-1 (PD-L1) plays an important role in the attenuation of adaptive immune responses in higher vertebrates. Here, we describe the identification of the Pekin duck PD-L1 orthologue (duPD-L1) and its gene structure. The duPD-L1 cDNA encodes a 311-amino acid protein that has an amino acid identity of 78% and 42% with chicken and human PD-L1, respectively. Mapping of the duPD-L1 cDNA with duck genomic sequences revealed an exonic structure of its coding sequence similar to those of other vertebrates but lacked a noncoding exon 1. Homology modelling of the duPD-L1 extracellular domain was compatible with the tandem IgV-like and IgC-like IgSF domain structure of human PD-L1 (PDB ID: 3BIS). Residues known to be important for receptor binding of human PD-L1 were mostly conserved in duPD-L1 within the N-terminus and the G sheet, and partially conserved within the F sheet but not within sheets C and C'. DuPD-L1 mRNA was constitutively expressed in all tissues examined with highest expression levels in lung and spleen and very low levels of expression in muscle, kidney and brain. Mitogen stimulation of duck peripheral blood mononuclear cells transiently increased duPD-L1 mRNA expression. Our observations demonstrate evolutionary conservation of the exonic structure of its coding sequence, the extracellular domain structure and residues implicated in receptor binding, but the role of the longer cytoplasmic tail in avian PD-L1 proteins remains to be determined. © 2014 John Wiley & Sons Ltd.
Cloning of the cocaine-sensitive bovine dopamine transporter
DOE Office of Scientific and Technical Information (OSTI.GOV)
Usdin, T.B.; Chen, C.; Brownstein, M.J.
1991-12-15
A cDNA encoding the dopamine transporter from bovine brain substantia nigra was identified on the basis of its structural homology to other, recently cloned, neurotransmitter transporters. The sequence of the 693-amino acid protein is quite similar to those of the rat {gamma}-aminobutyric acid, human norepinephrine, and rat serotonin transporters. Dopamine transporter mRNA was detected by in situ hybridization in the substantia nigra but not in the locus coeruleus, raphe, caudate, or other brain areas. ({sup 3}H)Dopamine accumulation in tissue culture cells transfected with the cDNA was inhibited by amphetamine, cocaine, and specific inhibitors of dopamine transports, including GBR12909.
Ellard-Ivey, M; Hopkins, R B; White, T J; Lomax, T L
1999-01-01
We have isolated a full-length cDNA clone (CpCDPK1) encoding a calcium-dependent protein kinase (CDPK) gene from zucchini (Cucurbita pepo L.). The predicted amino acid sequence of the cDNA shows a remarkably high degree of similarity to members of the CDPK gene family from Arabidopsis thaliana, especially AtCPK1 and AtCPK2. Northern analysis of steady-state mRNA levels for CpCPK1 in etiolated and light-grown zucchini seedlings shows that the transcript is most abundant in etiolated hypocotyls and overall expression is suppressed by light. As described for other members of the CDPK gene family from different species, the CpCPK1 clone has a putative N-terminal myristoylation sequence. In this study, site-directed mutagenesis and an in vitro coupled transcription/translation system were used to demonstrate that the protein encoded by this cDNA is specifically myristoylated by a plant N-myristoyl transferase. This is the first demonstration of myristoylation of a CDPK protein which may contribute to the mechanism by which this protein is localized to the plasma membrane.
Cloning and expression of cyclophilin from Platanus orientalis pollens in Escherichia coli
Sankian, Mojtaba; Vahedi, Fatemeh; Pazouki, Nazanin; Moghadam, Malihe; Jabbari Azad, Farahzad; Varasteh, Abdol-Reza
2012-01-01
Background: Allergy is a clinical disorder affecting the human population with wide geographical distribution. Platanus orientalis (P. orientalis) trees are planted in many countries and their pollen causes allergic reactions. Cyclophilin has recently been identified as one of the most important allergens of P. orientalis pollen. We aimed to clone and purify this allergen in Escherichia coli for further studies and therapeutic and diagnostic purposes for allergy to P. orientalis. Methods: RNA was extracted from P. orientalis. A full-length fragment encoding cyclophilin was prepared by polymerase chain reaction amplification of the first-strand cDNA synthesized from P. orientalis RNA. The cDNA was inserted into the pET32b (+) vector, and the construct transformed into E. coli Top10 and BL21 cells. The expressed protein was purified by the CuSO4 method. Results: The cDNA for the cyclophilin of P. orientalis pollen was cloned, and a specific reactivity of recombinant cyclophin was confirmed by immunoblotting using sera from patients allergic to P. orientalis pollen. Conclusion: The recombinant cyclophilin has a potential for immunologic assays for evaluation of allergy to P. orientalis pollen. PMID:26989705
Fu, L; Hou, Y L; Ding, X; Du, Y J; Zhu, H Q; Zhang, N; Hou, W R
2016-08-30
The complementary DNA (cDNA) of the giant panda (Ailuropoda melanoleuca) ferritin light polypeptide (FTL) gene was successfully cloned using reverse transcription-polymerase chain reaction technology. We constructed a recombinant expression vector containing FTL cDNA and overexpressed it in Escherichia coli using pET28a plasmids. The expressed protein was then purified by nickel chelate affinity chromatography. The cloned cDNA fragment was 580 bp long and contained an open reading frame of 525 bp. The deduced protein sequence was composed of 175 amino acids and had an estimated molecular weight of 19.90 kDa, with an isoelectric point of 5.53. Topology prediction revealed one N-glycosylation site, two casein kinase II phosphorylation sites, one N-myristoylation site, two protein kinase C phosphorylation sites, and one cell attachment sequence. Alignment indicated that the nucleotide and deduced amino acid sequences are highly conserved across several mammals, including Homo sapiens, Cavia porcellus, Equus caballus, and Felis catus, among others. The FTL gene was readily expressed in E. coli, which gave rise to the accumulation of a polypeptide of the expected size (25.50 kDa, including an N-terminal polyhistidine tag).
Petersen, M; Sander, L; Child, R; van Onckelen, H; Ulvskov, P; Borkhardt, B
1996-06-01
Seven distinct partial cDNAs, similar in sequence to previously described polygalacturonases (PGs), were amplified from cDNA derived from rape pod wall, dehiscence zone and leaves by the polymerase chain reaction. Northern analysis showed that one clone, PG35-8, was expressed at low levels in the dehiscence zone during the first five weeks after anthesis but was very abundantly expressed at week 6. In contrast, no PG35-8-related RNA was detected in the pod wall. Our data suggest that there are temporal and spatial correlations between the breakdown of the middle lamella, of the dehiscence zone cells and the pattern of synthesis of PG35-8 transcripts which may indicate a role for this particular PG in rape pod dehiscence. PG35-8 was used to isolate five cDNA clones from a rape dehiscence zone cDNA library. Restriction enzyme analysis and partial sequencing revealed that they were derived from four highly homologous transcripts which are probably allelic forms of a single gene. One full-length clone, RDPG1, was completely sequenced. The predicted protein of RDPG1 showed its highest identity with PG from apple fruit with an identity of 52%.
Trejo, Sebastián A; López, Laura M I; Caffini, Néstor O; Natalucci, Claudia L; Canals, Francesc; Avilés, Francesc X
2009-07-01
Asclepain f is a papain-like protease previously isolated and characterized from latex of Asclepias fruticosa. This enzyme is a member of the C1 family of cysteine proteases that are synthesized as preproenzymes. The enzyme belongs to the alpha + beta class of proteins, with two disulfide bridges (Cys22-Cys63 and Cys56-Cys95) in the alpha domain, and another one (Cys150-Cys201) in the beta domain, as was determined by molecular modeling. A full-length 1,152 bp cDNA was cloned by RT-RACE-PCR from latex mRNA. The sequence was predicted as an open reading frame of 340 amino acid residues, of which 16 residues belong to the signal peptide, 113 to the propeptide and 211 to the mature enzyme. The full-length cDNA was ligated to pPICZalpha vector and expressed in Pichia pastoris. Recombinant asclepain f showed endopeptidase activity on pGlu-Phe-Leu-p-nitroanilide and was identified by PMF-MALDI-TOF MS. Asclepain f is the first peptidase cloned and expressed from mRNA isolated from plant latex, confirming the presence of the preprocysteine peptidase in the latex.
Purification, cDNA cloning, and regulation of lysophospholipase from rat liver.
Sugimoto, H; Hayashi, H; Yamashita, S
1996-03-29
A lysophospholipase was purified 506-fold from rat liver supernatant. The preparation gave a single 24-kDa protein band on SDS-polyacrylamide gel electrophoresis. The enzyme hydrolyzed lysophosphatidylcholine, lysophosphatidylethanolamine, lysophosphatidylinositol, lysophosphatidylserine, and 1-oleoyl-2-acetyl-sn-glycero-3-phosphocholine at pH 6-8. The purified enzyme was used for the preparation of antibody and peptide sequencing. A cDNA clone was isolated by screening a rat liver lambda gt11 cDNA library with the antibody, followed by the selection of further extended clones from a lambda gt10 library. The isolated cDNA was 2,362 base pairs in length and contained an open reading frame encoding 230 amino acids with a Mr of 24,708. The peptide sequences determined were found in the reading frame. When the cDNA was expressed in Escherichia coli cells as the beta-galactosidase fusion, lysophosphatidylcholine-hydrolyzing activity was markedly increased. The deduced amino acid sequence showed significant similarity to Pseudomonas fluorescence esterase A and Spirulina platensis esterase. The three sequences contained the GXSXG consensus at similar positions. The transcript was found in various tissues with the following order of abundance: spleen, heart, kidney, brain, lung, stomach, and testis = liver. In contrast, the enzyme protein was abundant in the following order: testis, liver, kidney, heart, stomach, lung, brain, and spleen. Thus the mRNA abundance disagreed with the level of the enzyme protein in liver, testis, and spleen. When HL-60 cells were induced to differentiate into granulocytes with dimethyl sulfoxide, the 24-kDa lysophospholipase protein increased significantly, but the mRNA abundance remained essentially unchanged. Thus a posttranscriptional control mechanism is present for the regulation of 24-kDa lysophospholipase.
Yang, Zhifan; Chen, Jun; Chen, Yongqin; Jiang, Sijing
2010-01-01
A full cDNA encoding an acetylcholinesterase (AChE, EC 3.1.1.7) was cloned and characterized from the brown planthopper, Nilaparvata lugens Stål (Hemiptera: Delphacidae). The complete cDNA (2467 bp) contains a 1938-bp open reading frame encoding 646 amino acid residues. The amino acid sequence of the AChE deduced from the cDNA consists of 30 residues for a putative signal peptide and 616 residues for the mature protein with a predicted molecular weight of 69,418. The three residues (Ser242, Glu371, and His485) that putatively form the catalytic triad and the six Cys that form intra-subunit disulfide bonds are completely conserved, and 10 out of the 14 aromatic residues lining the active site gorge of the AChE are also conserved. Northern blot analysis of poly(A)+ RNA showed an approximately 2.6-kb transcript, and Southern blot analysis revealed there likely was just a single copy of this gene in N. lugens. The deduced protein sequence is most similar to AChE of Nephotettix cincticeps with 83% amino acid identity. Phylogenetic analysis constructed with 45 AChEs from 30 species showed that the deduced N. lugens AChE formed a cluster with the other 8 insect AChE2s. Additionally, the hypervariable region and amino acids specific to insect AChE2 also existed in the AChE of N. lugens. The results revealed that the AChE cDNA cloned in this work belongs to insect AChE2 subgroup, which is orthologous to Drosophila AChE. Comparison of the AChEs between the susceptible and resistant strains revealed a point mutation, Gly185Ser, is likely responsible for the insensitivity of the AChE to methamidopho in the resistant strain.
Nucleic acid molecules encoding isopentenyl monophosphate kinase, and methods of use
Croteau, Rodney B.; Lange, Bernd M.
2001-01-01
A cDNA encoding isopentenyl monophosphate kinase (IPK) from peppermint (Mentha x piperita) has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID NO:1) is provided which codes for the expression of isopentenyl monophosphate kinase (SEQ ID NO:2), from peppermint (Mentha x piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for isopentenyl monophosphate kinase, or for a base sequence sufficiently complementary to at least a portion of isopentenyl monophosphate kinase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding isopentenyl monophosphate kinase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant isopentenyl monophosphate kinase that may be used to facilitate its production, isolation and purification in significant amounts. Recombinant isopentenyl monophosphate kinase may be used to obtain expression or enhanced expression of isopentenyl monophosphate kinase in plants in order to enhance the production of isopentenyl monophosphate kinase, or isoprenoids derived therefrom, or may be otherwise employed for the regulation or expression of isopentenyl monophosphate kinase, or the production of its products.
Huang, Shengbing; Song, Wei; Lin, Qishui
2005-08-01
A membrane-bound protein was purified from rat liver mitochondria. After being digested with V8 protease, two peptides containing identical 14 amino acid residue sequences were obtained. Using the 14 amino acid peptide derived DNA sequence as gene specific primer, the cDNA of correspondent gene 5'-terminal and 3'-terminal were obtained by RACE technique. The full-length cDNA that encoded a protein of 616 amino acids was thus cloned, which included the above mentioned peptide sequence. The full length cDNA was highly homologous to that of human ETF-QO, indicating that it may be the cDNA of rat ETF-QO. ETF-QO is an iron sulfur protein located in mitochondria inner membrane containing two kinds of redox center: FAD and [4Fe-4S] center. After comparing the sequence from the cDNA of the 616 amino acids protein with that of the mature protein of rat liver mitochondria, it was found that the N terminal 32 amino acid residues did not exist in the mature protein, indicating that the cDNA was that of ETF-QOp. When the cDNA was expressed in Saccharomyces cerevisiae with inducible vectors, the protein product was enriched in mitochondrial fraction and exhibited electron transfer activity (NBT reductase activity) of ETF-QO. Results demonstrated that the 32 amino acid peptide was a mitochondrial targeting peptide, and both FAD and iron-sulfur cluster were inserted properly into the expressed ETF-QO. ETF-QO had a high level expression in rat heart, liver and kidney. The fusion protein of GFP-ETF-QO co-localized with mitochondria in COS-7 cells.
Abolhassani, Mohsen; Roux, Kenneth H
2009-06-01
Tree nuts, including almond (prunus dulcis) are a source of food allergens often associated with life-threatening allergic reactions in susceptible individuals. Although the proteins in almonds have been biochemically characterized, relatively little has been reported regarding the identity of the allergens involved in almond sensitivity. The present study was undertaken to identify the allergens of the almond by cDNA library approach. cDNA library of almond seeds was constructed in Uni-Zap XR lamda vector and expressed in E. coli XL-1 blue. Plaques were immunoscreened with pooled sera of allergic patients. The cDNA clone reacting significantly with specific IgE antibodies was selected and subcloned and subsequently expressed in E. coli. The amino acids deducted from PCR product of clone showed homology to 60s acidic ribosomal protein of almond. The expressed protein was 11,450 Dalton without leader sequence. Immunoreactivity of the recombinant 60s ribosomal protein (r60sRP) was evaluated with dot blot analysis using pooled and individual sera of allergic patients. The data showed that r60sRP and almond extract (as positive control) possess the ability to bind the IgE antibodies. The results showed that expressed protein is an almond allergen.Whether this r60sRP represents a major allergen of almond needs to be further studied which requires a large number of sera from the almond atopic patients and also need to determine the IgE-reactive frequencies of each individual allergen.
Du, Yu-Jie; Hou, Yi-Ling; Hou, Wan-Ru
2013-02-01
The Giant Panda is an endangered and valuable gene pool in genetic, its important functional gene POLR2H encodes an essential shared peptide H of RNA polymerases. The genomic DNA and cDNA sequences were cloned successfully for the first time from the Giant Panda (Ailuropoda melanoleuca) adopting touchdown-PCR and reverse transcription polymerase chain reaction (RT-PCR), respectively. The length of the genomic sequence of the Giant Panda is 3,285 bp, including five exons and four introns. The cDNA fragment cloned is 509 bp in length, containing an open reading frame of 453 bp encoding 150 amino acids. Alignment analysis indicated that both the cDNA and its deduced amino acid sequence were highly conserved. Protein structure prediction showed that there was one protein kinase C phosphorylation site, four casein kinase II phosphorylation sites and one amidation site in the POLR2H protein, further shaping advanced protein structure. The cDNA cloned was expressed in Escherichia coli, which indicated that POLR2H fusion with the N-terminally His-tagged form brought about the accumulation of an expected 20.5 kDa polypeptide in line with the predicted protein. On the basis of what has already been achieved in this study, further deep-in research will be conducted, which has great value in theory and practical significance.
USDA-ARS?s Scientific Manuscript database
NADH dehydrogenase, the largest of the respiratory complexes, is the first enzyme of the mitochondrial electron transport chain. We have cloned and sequenced cDNA of NADH dehydrogenase gene from Ochlerotatus (Ochlerotatus) taeniorhynchus (Wiedemann) adult (GeneBank Accession number: FJ458415). The ...
Schwartz, R S; Rybicki, A C; Nagel, R L
1997-10-15
We report the cloning and sequencing from human reticulocytes of cDNA coding for the Cl- channel-associated protein, pICln. Human reticulocyte pICln (HRpICln) cDNA encodes a protein (predicted molecular mass 26293Da) identical with human non-pigmented ciliary epithelial cell pICln. By using full-length HRpICln cDNA (approx. 1.2 kb) to probe human lymphocyte metaphase-chromosome spreads, the location of the human ICln gene was mapped to 11q13 by fluorescence in situ hybridization analysis. Polyclonal antibodies to recombinant HRpICln detected bands at approx. 43 kDa and approx. 37 kDa in both normal (AA) and sickle (SS) red blood cell (RBC) ghost membranes. In SS ghosts, and in ghosts from a patient with autoimmune haemolytic anaemia with 9.8% reticulocytes, the amount of HRpICln was increased compared with AA ghosts, suggesting that the expression or membrane assembly of HRpICln is cell age-dependent. Laser scanning confocal fluorescent microscopy immunolocalized HRpICln largely to the RBC membrane. The increased staining intensity of HRpICln in a reticulocyte-enriched AA RBC density-separated fraction is consistent with a dependence of HRpICln membrane content on cell age. HRpICln and beta-actin form stable complexes in vivo, demonstrated with the yeast two-hybrid system. Low-ionic-strength extraction of ghost membranes, which results in the extraction of the spectrin-actin cytoskeleton, also results in the extraction of HRpICln, consistent with the possibility for the association of these proteins in RBCs in vivo. The results presented here establish the presence of the Cl- channel-associated protein, pICln, in human RBCs, and raises the possibility that this protein has a role in RBC Cl- transport and volume regulation in young RBCs. Moreover the association of RBC pICln with actin offers a model in which to test interactions between RBC ion channels and the cytoskeleton.
Wang, Li Ke; Niu, Xiao Wei; Lv, Yan Hui; Zhang, Tian Zhen; Guo, Wang Zhen
2010-10-01
Annexins constitute a family of multifunction and structurally related proteins. These proteins are ubiquitous in the plant kingdom, and are important calcium-dependent membrane-binding proteins that participate in the polar development of different plant regions such as rhizoids, root caps, and pollen tube tips. In this study, a novel cotton annexin gene (designated as GhFAnnx) was isolated from a fiber cDNA library of cotton (Gossypium hirsutum). The full-length cDNA of GhFAnnx comprises an open reading frame of 945 bp that encodes a 314-amino acid protein with a calculated molecular mass of 35.7 kDa and an isoelectric point of 6.49. Genomic GhFAnnx sequences from different cotton species, TM-1, Hai7124 and two diploid progenitor cottons, G. herbaceum (A-genome) and G. raimondii (D-genome) showed that at least two copies of the GhFAnnx gene, each with six exons and five introns in the coding region, were identified in the allotetraploid cotton genome. The GhFAnnx gene cloned from the cDNA library in this study was mapped to the chromosome 10 of the A-subgenome of the tetraploid cotton. Sequence alignment revealed that GhFAnnx contained four repeats of 70 amino acids. Semi-quantitative reverse transcriptase-polymerase chain reaction revealed that GhFAnnx is preferentially expressed in different developmental fibers but its expression is low in roots, stems, and leaves. Subcellular localization of GhFAnnx in onion epidermal cells and cotton fibers suggests that this protein is ubiquitous in the epidermal cells of onion, but assembles at the edge and the inner side of the apex of the cotton fiber tips with brilliant spots. In summary, GhFAnnx influences fiber development and is associated with the polar expansion of the cotton fiber during elongation stages.
Xu, Yipeng; Zheng, Guowan; Dong, Shengzhang; Liu, Guangfu; Yu, Xiaoping
2014-12-01
The golden apple snail, Pomacea canaliculata, has strong tolerance to high temperature, facilitating its invasion in East and Southeast Asia. In the present study, three cDNAs encoding heat shock proteins (PocaHSP60, PocaHSP70, PocaHSP90) in P. canaliculata were cloned and characterized. The PocaHSP60 cDNA was 2447 bp, containing an ORF encoding a polypeptide of 574 amino acids. The PocaHSP70 cDNA was 2644 bp, containing an ORF encoding a polypeptide of 643 amino acids. The PocaHSP90 cDNA was 2546 bp, containing an ORF encoding a polypeptide of 726 amino acids. Genomic DNA analysis showed that PocaHSP60 had 11 introns in the coding region and PocaHSP90 had 7 introns but PocaHSP70 had no one. The expression changes of these three PocaHSPs in the gill, digestive gland, kidney and foot muscle of P. canaliculata exposed to high and low temperature were investigated. The results of quantitative PCR and western blotting showed that the expression level of PocaHSP90 was much higher than PocaHSP60 and PocaHSP70 at room temperature, and PocaHSP70 expression level was the lowest among them. Afterheat shock, PocaHSP70 expression increased rapidly, much more significantly than PocaHSP90 expression, and the effect of heat shock on the expression of PocaHSP70 and PocaHSP90 in the different tissues of P. canaliculata was not the same. Unlike PocaHSP70 and PocaHSP90, PocaHSP60 expression seemed not to be affected by heat shock, because its expression was moderately induced only in the foot muscle. However, cool shock had little effect on the expression change of above three PocaHSPs. These results indicated that HSPs might be related to the thermal resistance of P. canaliculata.
Bricheux, G; Brugerolle, G
1997-08-01
The parasitic protozoan Trichomonas vaginalis is known to contain the ubiquitous and highly conserved protein actin. A genomic library and a cDNA library have been screened to identify and clone the actin gene(s) of T. vaginalis. The nucleotide sequence of one gene and its flanking regions have been determined. The open reading frame encodes a protein of 376 amino acids. The sequence is not interrupted by any introns and the promoter could be represented by a 10 bp motif close to a consensus motif also found upstream of most sequenced T. vaginalis genes. The five different clones isolated from the cDNA library have similar sequences and encode three actin proteins differing only by one or two amino acids. A phylogenetic analysis of 31 actin sequences by distance matrix and parsimony methods, using centractin as outgroup, gives congruent trees with Parabasala branching above Diplomonadida.
Parvari, R; Avivi, A; Lentner, F; Ziv, E; Tel-Or, S; Burstein, Y; Schechter, I
1988-03-01
cDNA clones encoding the variable and constant regions of chicken immunoglobulin (Ig) gamma-chains were obtained from spleen cDNA libraries. Southern blots of kidney DNA show that the variable region sequences of eight cDNA clones reveal the same set of bands corresponding to approximately 30 cross-hybridizing VH genes of one subgroup. Since the VH clones were randomly selected, it is likely that the bulk of chicken H-chains are encoded by a single VH subgroup. Nucleotide sequence determinations of two cDNA clones reveal VH, D, JH and the constant region. The VH segments are closely related to each other (83% homology) as expected for VH or the same subgroup. The JHs are 15 residues long and differ by one amino acid. The Ds differ markedly in sequence (20% homology) and size (10 and 20 residues). These findings strongly indicate multiple (at least two) D genes which by a combinatorial joining mechanism diversify the H-chains, a mechanism which is not operative in the chicken L-chain locus. The most notable among the chicken Igs is the so-called 7S IgG because its H-chain differs in many important aspects from any mammalian IgG. The sequence of the C gamma cDNA reported here resolves this issue. The chicken C gamma is 426 residues long with four CH domains (unlike mammalian C gamma which has three CH domains) and it shows 25% homology to the chicken C mu. The chicken C gamma is most related to the mammalian C epsilon in length, the presence of four CH domains and the distribution of cysteines in the CH1 and CH2 domains. We propose that the unique chicken C gamma is the ancestor of the mammalian C epsilon and C gamma subclasses, and discuss the evolution of the H-chain locus from that of chicken with presumably three genes (mu, gamma, alpha) to the mammalian loci with 8-10 H-chain genes.
2011-01-01
Background Common bean is an important legume crop with only a moderate number of short expressed sequence tags (ESTs) made with traditional methods. The goal of this research was to use full-length cDNA technology to develop ESTs that would overlap with the beginning of open reading frames and therefore be useful for gene annotation of genomic sequences. The library was also constructed to represent genes expressed under drought, low soil phosphorus and high soil aluminum toxicity. We also undertook comparisons of the full-length cDNA library to two previous non-full clone EST sets for common bean. Results Two full-length cDNA libraries were constructed: one for the drought tolerant Mesoamerican genotype BAT477 and the other one for the acid-soil tolerant Andean genotype G19833 which has been selected for genome sequencing. Plants were grown in three soil types using deep rooting cylinders subjected to drought and non-drought stress and tissues were collected from both roots and above ground parts. A total of 20,000 clones were selected robotically, half from each library. Then, nearly 10,000 clones from the G19833 library were sequenced with an average read length of 850 nucleotides. A total of 4,219 unigenes were identified consisting of 2,981 contigs and 1,238 singletons. These were functionally annotated with gene ontology terms and placed into KEGG pathways. Compared to other EST sequencing efforts in common bean, about half of the sequences were novel or represented the 5' ends of known genes. Conclusions The present full-length cDNA libraries add to the technological toolbox available for common bean and our sequencing of these clones substantially increases the number of unique EST sequences available for the common bean genome. All of this should be useful for both functional gene annotation, analysis of splice site variants and intron/exon boundary determination by comparison to soybean genes or with common bean whole-genome sequences. In addition the library has a large number of transcription factors and will be interesting for discovery and validation of drought or abiotic stress related genes in common bean. PMID:22118559
3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.
Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong
2008-09-01
We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.
Seo, H S; Kim, H Y; Jeong, J Y; Lee, S Y; Cho, M J; Bahk, J D
1995-03-01
A cDNA clone, RGA1, was isolated by using a GPA1 cDNA clone of Arabidopsis thaliana G protein alpha subunit as a probe from a rice (Oryza sativa L. IR-36) seedling cDNA library from roots and leaves. Sequence analysis of genomic clone reveals that the RGA1 gene has 14 exons and 13 introns, and encodes a polypeptide of 380 amino acid residues with a calculated molecular weight of 44.5 kDa. The encoded protein exhibits a considerable degree of amino acid sequence similarity to all the other known G protein alpha subunits. A putative TATA sequence (ATATGA), a potential CAAT box sequence (AGCAATAC), and a cis-acting element, CCACGTGG (ABRE), known to be involved in ABA induction are found in the promoter region. The RGA1 protein contains all the consensus regions of G protein alpha subunits except the cysteine residue near the C-terminus for ADP-ribosylation by pertussis toxin. The RGA1 polypeptide expressed in Escherichia coli was, however, ADP-ribosylated by 10 microM [adenylate-32P] NAD and activated cholera toxin. Southern analysis indicates that there are no other genes similar to the RGA1 gene in the rice genome. Northern analysis reveals that the RGA1 mRNA is 1.85 kb long and expressed in vegetative tissues, including leaves and roots, and that its expression is regulated by light.
Zhang, Quanwei; Gong, Jishang; Wang, Xueying; Wu, Xiaohu; Li, Yalan; Ma, Youji; Zhang, Yong; Zhao, Xingxu
2014-01-01
The IGF family is essential for normal embryonic and postnatal development and plays important roles in the immune system, myogenesis, bone metabolism and other physiological functions, which makes the study of its structure and biological characteristics important. Tianzhu white yak (Bos grunniens) domesticated under alpine hypoxia environments, is well adapted to survive and grow against severe hypoxia and cold temperatures for extended periods. In this study, a full coding sequence of the IGF2 gene of Tianzhu white yak was amplified by reverse transcription PCR and rapid-amplification of cDNA ends (RACE) for the first time. The cDNA sequence revealed an open reading frame of 450 nucleotides, encoding a protein with 179 amino acids. Its expression in different tissues was also studied by Real time PCR. Phylogenetic tree analysis indicated that yak IGF2 was similar to Bos taurus, and 3D structure showed high similarity with the human IGF2. The putative full CDS of yak IGF2 was amplified by PCR in five tissues, and cDNA sequence analysis showed high homology to bovine IGF2. Moreover the super secondary structure prediction showed a similar 3D structure with human IGF2. Its conservation in sequence and structure has facilitated research on IGF2 and its physiological function in yak. PMID:24394317
2008-06-26
Homo sapiens decorin variant C mRNA, complete cds. 2.117 PKNOX2 HUM408A08B Human fetal brain (TFujiwara) Homo sapiens cDNA clone GEN -408A08 5’, mRNA...mRNA, complete cds. 2.117 PKNOX2 HUM408A08B Human fetal brain (TFujiwara) Homo sapiens cDNA clone GEN -408A08 5’, mRNA sequence. 2.076 SEC23B...RAS oncogene family ; RAB33B, member RAS oncogene family 205300_s_at 0.37 U1SNRNPBP U11/U12 snRNP 35K 220728_at 0.349 218689_at 0.342 FANCF Fanconi
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zezza, D.J.; Stewart, S.E.; Steiner, L.A.
1992-12-15
Xenopus laevis Ig contain two distinct types of L chains, designated [rho] or L1 and [sigma] or L2. The authors have analyzed Xenopus genomic DNA by Southern blotting with cDNA probes specific for L1 V and C regions. Many fragments hybridized to the V probe, but only one or two fragments hybridized to the C probe. Corresponding C, J, and V gene segments were identified on clones isolated from a genomic library prepared from the same DNA. One clone contains a C gene segment separated from a J gene segment by an intron of 3.4 kb. The J and Cmore » gene segments are nearly identical in sequence to cDNA clones analyzed previously. The C segment is somewhat more similar and the J segment considerably more similar in sequence to the corresponding segments of mammalian [kappa] chains than to those of mammalian [lambda] chains. Upstream of the J segment is a typical recombination signal sequence with a spacer of 23 bp, as in J[kappa]. A second clone from the library contains four V gene segments, separated by 2.1 to 3.6 kb. Two of these, V1 and V3, have the expected structural and regulatory features of V genes, and are very similar in sequence to each other and to mammalian V[kappa]. A third gene segment, V2, resembles V1 and V3 in its coding region and nearby 5[prime]-flanking region, but diverges in sequence 5[prime] to position [minus]95 with loss of the octamer promoter element. The fourth V-like segment is similar to the others at the 3[prime]-end, but upstream of codon 64 bears no resemblance in sequence to any Ig V region. All four V segments have typical recombination signal sequences with 12-bp spacers at their 3[prime]-ends, as in V[kappa]. Taken together, the data suggest that Xenopus L1 L chain genes are members of the [kappa] gene family. 80 refs., 9 figs.« less
USDA-ARS?s Scientific Manuscript database
We cloned the full-length of the gene putatively encoding caffeic acid O-methyltransferase (COMT) from kenaf (Hibiscus cannabinus L.) using degenerate primers and the RACE (rapid amplification of cDNA ends) method. Kenaf is an herbaceous and rapidly growing dicotyledonous plant with great potential ...
Kawai, Jun; Hayashizaki, Yoshihide
2003-06-01
We propose herein a new method of DNA distribution, whereby DNA clones or PCR products are printed directly onto the pages of books and delivered to users along with relevant scientific information. DNA sheets, comprising water-soluble paper onto which DNA is spotted, can be bound into books. Readers can easily extract the DNA fragments from DNA sheets and amplify them using PCR. We show that DNA sheets can withstand various conditions that may be experienced during bookbinding and delivery, such as high temperatures and humidity. Almost all genes (95%-100% of randomly selected RIKEN mouse cDNA clones) were recovered successfully by use of PCR. Readers can start their experiments after a 2-h PCR amplification without waiting for the delivery of DNA clones. The DNA Book thus provides a novel method for delivering DNA in a timely and cost-effective manner. A sample DNA sheet (carrying RIKEN mouse cDNA clones encoding genes of enzymes for the TCA cycle) is included in this issue for field-testing. We would greatly appreciate it if readers could attempt to extract DNA and report the results and whether the DNA sheet was shipped to readers in good condition.
Laufer, Marlene; Mohammad, Hamza; Maiss, Edgar; Richert-Pöggeler, Katja; Dall'Ara, Mattia; Ratti, Claudio; Gilmer, David; Liebe, Sebastian; Varrelmann, Mark
2018-05-01
Two members of the Benyviridae family and genus Benyvirus, Beet soil-borne mosaic virus (BSBMV) and Beet necrotic yellow vein virus (BNYVV), possess identical genome organization, host range and high sequence similarity; they infect Beta vulgaris with variable symptom expression. In the US, mixed infections are described with limited information about viral interactions. Vectors suitable for agroinoculation of all genome components of both viruses were constructed by isothermal in vitro recombination. All 35S promoter-driven cDNA clones allowed production of recombinant viruses competent for Nicotiana benthamiana and Beta macrocarpa systemic infection and Polymyxa betae transmission and were compared to available BNYVV B-type clone. BNYVV and BSBMV RNA1 + 2 reassortants were viable and spread long-distance in N. benthamiana with symptoms dependent on the BNYVV type. Small genomic RNAs were exchangeable and systemically infected B. macrocarpa. These infectious clones represent a powerful tool for the identification of specific molecular host-pathogen determinants. Copyright © 2018 Elsevier Inc. All rights reserved.
Rogne, S; Myklebost, O; Høyheim, B; Olaisen, B; Gedde-Dahl, T
1989-02-01
We have cloned a cDNA probe for human apolipoprotein AII and used it to analyze linkage relationships on chromosome 1. We found no recombinations between APOA2 and the gene coding for the Duffy blood group antigens (FY) in the 19 meioses examined. Our maximal lod score is 4.2 at zero recombination rate. K. Berg (1987, Cytogenet. Cell Genet. 46:579) found a maximal score of 2.5 at recombination fraction 0.14 in 54 meioses. When results from both studies are combined, the most likely distance between FY and APOA2 is about 10% recombination with a combined lod score of 5.6 for both sexes.
Cloning and expression analysis of a small HSP26 gene of Pacific abalone (Haliotis discus hannai).
Park, Eun Mi; Kim, Young Ok; Nam, Bo Hye; Kong, Hee Jeong; Kim, Woo Jin; Lee, Sang Jun; Jee, Young Ju; Kong, In Soo; Choi, Tae Jin
2008-07-01
Heat shock proteins (HSPs) are evolutionally conserved from micro organism to mammals and play important roles in many biological processes including thermal tolerance. We isolated a homologue of small HSP26 (sHSP26) from a subtracted cDNA library of heat shock-treated abalone (Haliotis discus hannai). The abalone sHSP26 encompossed 793 nt, including a coding region of 501 nt. The deduced amino acid sequence of the abalone sHSP26 contained well conserved alpha-crystallin domain and showed overall identities of 27-31% with the other species' sHSP proteins. The abalone sHSP26 transcript was induced by heat shock treatment, but not by cold shock treatment.
USDA-ARS?s Scientific Manuscript database
Like IGF-I, progranulin (pgrn) is a growth factor involved in tumorigenesis and wound healing. We report here the identification and characterization of pgrn cDNA in tilapia and the regulation of its expression by growth hormone(GH). The tilapia pgrn cDNA was cloned by RT-PCR ampliWcation, using g...
Delbianco, Alice; Lanzoni, Chiara; Klein, Elodie; Rubies Autonell, Concepcion; Gilmer, David; Ratti, Claudio
2013-05-01
Agroinoculation is a quick and easy method for the infection of plants with viruses. This method involves the infiltration of tissue with a suspension of Agrobacterium tumefaciens carrying binary plasmids harbouring full-length cDNA copies of viral genome components. When transferred into host cells, transcription of the cDNA produces RNA copies of the viral genome that initiate infection. We produced full-length cDNA corresponding to Beet necrotic yellow vein virus (BNYVV) RNAs and derived replicon vectors expressing viral and fluorescent proteins in pJL89 binary plasmid under the control of the Cauliflower mosaic virus 35S promoter. We infected Nicotiana benthamiana and Beta macrocarpa plants with BNYVV by leaf agroinfiltration of combinations of agrobacteria carrying full-length cDNA clones of BNYVV RNAs. We validated the ability of agroclones to reproduce a complete viral cycle, from replication to cell-to-cell and systemic movement and, finally, plant-to-plant transmission by its plasmodiophorid vector. We also showed successful root agroinfection of B. vulgaris, a new tool for the assay of resistance to rhizomania, the sugar beet disease caused by BNYVV. © 2013 BSPP AND BLACKWELL PUBLISHING LTD.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cool, D.E.; Tonks, N.K.; Charbonneau, H.
1989-07-01
A human peripheral T-cell cDNA library was screened with two labeled synthetic oligonucleotides encoding regions of a human placenta protein-tyrosine-phosphatase. One positive clone was isolated and the nucleotide sequence was determined. It contained 1,305 base pairs of open reading frame followed by a TAA stop codon and 978 base pairs of 3{prime} untranslated end, although a poly(A){sup +} tail was not found. An initiator methionine residue was predicted at position 61, which would result in a protein of 415 amino acid residues. This was supported by the synthesis of a M{sub r} 48,000 protein in an in vitro reticulocyte lysatemore » translation system using RNA transcribed from the cloned cDNA and T7 RNA polymerase. The deduced amino acid sequence was compared to other known proteins revealing 65% identity to the low M{sub r} PTPase 1B isolated from placenta. In view of the high degree of similarity, the T-cell cDNA likely encodes a newly discovered protein-tyrosine-phosphatase, thus expanding this family of genes.« less
Lu, W; Wainwright, G; Olohan, L A; Webster, S G; Rees, H H; Turner, P C
2001-10-31
Synthesis of ecdysteroids (molting hormones) by crustacean Y-organs is regulated by a neuropeptide, molt-inhibiting hormone (MIH), produced in eyestalk neural ganglia. We report here the molecular cloning of a cDNA encoding MIH of the edible crab, Cancer pagurus. Full-length MIH cDNA was obtained by using reverse transcription-polymerase chain reaction (RT-PCR) with degenerate oligonucleotides based upon the amino acid sequence of MIH, in conjunction with 5'- and 3'-RACE. Full-length clones of MIH cDNA were obtained that encoded a 35 amino acid putative signal peptide and the mature 78 amino acid peptide. Of various tissues examined by Northern blot analysis, the X-organ was the sole major site of expression of the MIH gene. However, a nested-PCR approach using non-degenerate MIH-specific primers indicated the presence of MIH transcripts in other tissues. Southern blot analysis indicated a simple gene arrangement with at least two copies of the MIH gene in the genome of C. pagurus. Additional Southern blotting experiments detected MIH-hybridizing bands in another Cancer species, Cancer antennarius and another crab species, Carcinus maenas.
Study of the Met Tyrosine Kinase in the Pathogenesis of Breast Cancer.
1998-10-01
cDNA clones appeared to encode for open reading frames, however, and neither clone showed any homology to the protein Gab1 , which is a signal...domain, and tissue characterization using specific antibodies , will hopefully determine whether these clones represent important c-met targets. In...Behrens J, Birchmeier W. Interaction between Gab1 and the c-met receptor tyrosine kinase is responsible for epithelial morphogenesis. Nature 1996;384:173
Zhao, Xueyan; Yang, Qiang; Zhao, Kewei; Jiang, Chao; Ren, Dongren; Xu, Pan; He, Xiaofang; Liao, Rongrong; Jiang, Kai; Ma, Junwu; Xiao, Shijun; Ren, Jun; Xing, Yuyun
2016-07-01
In the last few decades, transgenic animal technology has witnessed an increasingly wide application in animal breeding. Reproductive traits are economically important to the pig industry. It has been shown that the bone morphogenetic protein receptor type IB (BMPR1B) A746G polymorphism is responsible for the fertility in sheep. However, this causal mutation exits exclusively in sheep and goat. In this study, we attempted to create transgenic pigs by introducing this mutation with the aim to improve reproductive traits in pigs. We successfully constructed a vector containing porcine BMPR1B coding sequence (CDS) with the mutant G allele of A746G mutation. In total, we obtained 24 cloned male piglets using handmade cloning (HMC) technique, and 12 individuals survived till maturation. A set of polymerase chain reactions indicated that 11 of 12 matured boars were transgene-positive individuals, and that the transgenic vector was most likely disrupted during cloning. Of 11 positive pigs, one (No. 11) lost a part of the terminator region but had the intact promoter and the CDS regions. cDNA sequencing showed that the introduced allele (746G) was expressed in multiple tissues of transgene-positive offspring of No.11. Western blot analysis revealed that BMPR1B protein expression in multiple tissues of transgene-positive F1 piglets was 0.5 to 2-fold higher than that in the transgene-negative siblings. The No. 11 boar showed normal litter size performance as normal pigs from the same breed. Transgene-positive F1 boars produced by No. 11 had higher semen volume, sperm concentration and total sperm per ejaculate than the negative siblings, although the differences did not reached statistical significance. Transgene-positive F1 sows had similar litter size performance to the negative siblings, and more data are needed to adequately assess the litter size performance. In conclusion, we obtained 24 cloned transgenic pigs with the modified porcine BMPR1B CDS using HMC. cDNA sequencing and western blot indicated that the exogenous BMPR1B CDS was successfully expressed in host pigs. The transgenic pigs showed normal litter size performance. However, no significant differences in litter size were found between transgene-positive and negative sows. Our study provides new insight into producing cloned transgenic livestock related to reproductive traits.
cDNA encoding a polypeptide including a hevein sequence
Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil
1993-02-16
A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a pu GOVERNMENT RIGHTS This application was funded under Department of Energy Contract DE-AC02-76ER01338. The U.S. Government has certain rights under this application and any patent issuing thereon.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, Seoung Hoon; Kim, Taesoo; Park, Eui-Soon
2008-05-02
Bone homeostasis is tightly regulated by the balanced actions of osteoblasts (OBs) and osteoclasts (OCs). We previously analyzed the gene expression profile of OC differentiation using a cDNA microarray, and identified a novel osteoclastogenic gene candidate, clone OCL-1-E7 [J. Rho, C.R. Altmann, N.D. Socci, L. Merkov, N. Kim, H. So, O. Lee, M. Takami, A.H. Brivanlou, Y. Choi, Gene expression profiling of osteoclast differentiation by combined suppression subtractive hybridization (SSH) and cDNA microarray analysis, DNA Cell Biol. 21 (2002) 541-549]. In this study, we have isolated full-length cDNAs corresponding to this clone from mice and humans to determine the functionalmore » roles of this gene in osteoclastogenesis. The full-length cDNA of OCL-1-E7 encodes 12 membrane-spanning domains that are typical of isoforms of the Na{sup +}/H{sup +} exchangers (NHEs), indicating that this clone is a novel member of the NHE family (hereafter referred to as NHE10). Here, we show that NHE10 is highly expressed in OCs in response to receptor activator of nuclear factor-{kappa}B ligand signaling and is required for OC differentiation and survival.« less
Zhu, Yue; Peng, Qingzhong; Li, Kegang; Xie, De-Yu
2018-04-10
Vitis bellula is a new grape crop in southern China. Berries of this species are rich in antioxidative anthocyanins and proanthocyanidins. This study reports cloning and functional characterization of a cDNA encoding a V. bellula dihydroflavonol reductase (VbDFR) involved in the biosynthesis of anthocyanins and proanthocyanidins. A cDNA including 1014 bp was cloned from young leaves and its open reading frame (ORF) was deduced encoding 337 amino acids, highly similar to V. vinifera DFR (VvDFR). Green florescence protein fusion and confocal microscopy analysis determined the cytosolic localization of VbDFR in plant cells. A soluble recombinant VbDFR was induced and purified from E. coli for enzyme assay. In the presence of NADPH, the recombinant enzyme catalyzed dihydrokaempferol (DHK) and dihydroquercetin (DHQ) to their corresponding leucoanthocyanidins. The VbDFR cDNA was introduced into tobacco plants via Agrobacterium -mediated transformation. The overexpression of VbDFR increased anthocyanin production in flowers. Anthocyanin hydrolysis and chromatographic analysis revealed that transgenic flowers produced pelargonidin and delphinidin, which were not detected in control flowers. These data demonstrated that the overexpression of VbDFR produced new tobacco anthocyanidins. In summary, all data demonstrate that VbDFR is a useful gene to provide three types of substrates for metabolic engineering of anthocyanins and proanthocyanidins in grape crops and other crops.
Li, Lishu; Ikezono, Tetsuo; Sekine, Kuwon; Shindo, Susumu; Matsumura, Tomohiro; Pawankar, Ruby; Ichimiya, Issei; Yagi, Toshiaki
2010-08-01
We have cloned guinea pig Coch cDNA and the sequence information will be useful for future molecular study combined with physiological experiments. Proper Coch gene expression appears to be dependent on the unique extracellular micro-environment of the inner ear in vivo. These results provide insight into the Coch gene expression and its regulation. To characterize the guinea pig Coch gene, we performed molecular cloning and expression analysis in the inner ear and cultured fibrocytes of the spiral ligament. The Coch cDNA was isolated using RACE. Cochlin isofoms were studied by Western blot using three different types of mammalian inner ear. The cochlear fibrocytes were cultured and characterized by immunostaining. Coch gene expression in the fibrocytes was investigated and the influence of cytokine stimulation was evaluated. The full-length 1991 bp Coch cDNA that encodes a 553 amino acid protein was isolated. The sequence had significant homology with other mammals, and the sizes of the Cochlin isoforms were identical. In the cultured fibrocytes, Coch mRNA was expressed in a very small amount and the isoform production was different, compared with the results in vivo. Cytokine stimulation did not alter the level of mRNA expression or isoform formation.
Molecular genetics of X-linked retinitis pigmentosa: Progress towards cloning the RP3 gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fujita, R.; Yan, D.; McHenry, C.
1994-09-01
Our goal is to identify the X-linked retinitis pigmentosa (XLRP) gene RP3. The location of RP3 is genetically delimited to a region of 1 Mb, distal to DXS140, CYBB and tctex-1-like gene and proximal to the gene OTC. It is currently thought that RP3 is within 40 kb of the proximal deletion breakpoint of a patient BB. However, a more proximal location of the gene, closer to OTC, is not ruled out. We initiated the isolation of the genomic region between DXS140 to OTC in YACs. One of the clones from DXS140 region (55B) is 460 kb and spans aboutmore » 200 kb at each side of BB patient`s proximal breakpoint. It contains CYBB, tctex-1-like genes and two additional CpG islands. The 55B clone has been covered by cosmid and phage subclones. Another YAC clone from the OTC region (OTCC) spans about 1 Mb and contains at least 5 CpG islands. In situ hybridization performed with OTCC showed its location in Xp21; however, several derivative cosmids map to chromosome 7, indicating that it is a chimeric YAC. No overlap is evident between 55B and OTCC. We have isolated the YAC end-sequences and isolation of clones to close the gap is in progress. Cosmids are being used for screening eye tissue cDNA libraries, mainly from retina. Screening is done by hybridization to replica filters or by cDNA enrichment methods. Several cDNA clones have been isolated and are being characterized. Exon-amplification is also being used with the cosmids and phages. Genetic analysis is being performed to determine RP3 patients from clinically indistinguishable RP2, located in Xp11.23-p11.4, and to reduce the genetic distance of current flanking markers. For this we are analyzing a number of XLRP families with established markers in the region and with new microsatellites.« less
Lassner, M W; Lardizabal, K; Metz, J G
1996-01-01
beta-Ketoacyl-coenzyme A (CoA) synthase (KCS) catalyzes the condensation of malonyl-CoA with long-chain acyl-CoA. This reaction is the initial step of the microsomal fatty acyl-CoA elongation pathway responsible for formation of very long chain fatty acids (VLCFAs, or fatty acids with chain lengths > 18 carbons). Manipulation of this pathway is significant for agriculture, because it is the basis of conversion of high erucic acid rapeseed into canola. High erucic acid rapeseed oil, used as an industrial feedstock, is rich in VLCFAs, whereas the edible oil extracted from canola is essentially devoid of VLCFAs. Here, we report the cloning of a cDNA from developing jojoba embryos involved in microsomal fatty acid elongation. The jojoba cDNA is homologous to the recently cloned Arabidopsis FATTY ACID ELONGATION1 (FAE1) gene that has been suggested to encode KCS. We characterize the jojoba enzyme and present biochemical data indicating that the jojoba cDNA does indeed encode KCS. Transformation of low erucic acid rapeseed with the jojoba cDNA restored KCS activity to developing embryos and altered the transgenic seed oil composition to contain high levels of VLCFAs. The data reveal the key role KCS plays in determining the chain lengths of fatty acids found in seed oils. PMID:8742713
Lassner, M W; Lardizabal, K; Metz, J G
1996-02-01
beta-Ketoacyl-coenzyme A (CoA) synthase (KCS) catalyzes the condensation of malonyl-CoA with long-chain acyl-CoA. This reaction is the initial step of the microsomal fatty acyl-CoA elongation pathway responsible for formation of very long chain fatty acids (VLCFAs, or fatty acids with chain lengths > 18 carbons). Manipulation of this pathway is significant for agriculture, because it is the basis of conversion of high erucic acid rapeseed into canola. High erucic acid rapeseed oil, used as an industrial feedstock, is rich in VLCFAs, whereas the edible oil extracted from canola is essentially devoid of VLCFAs. Here, we report the cloning of a cDNA from developing jojoba embryos involved in microsomal fatty acid elongation. The jojoba cDNA is homologous to the recently cloned Arabidopsis FATTY ACID ELONGATION1 (FAE1) gene that has been suggested to encode KCS. We characterize the jojoba enzyme and present biochemical data indicating that the jojoba cDNA does indeed encode KCS. Transformation of low erucic acid rapeseed with the jojoba cDNA restored KCS activity to developing embryos and altered the transgenic seed oil composition to contain high levels of VLCFAs. The data reveal the key role KCS plays in determining the chain lengths of fatty acids found in seed oils.
Di Gennaro, Simone; Ficca, Anna G; Panichi, Daniela; Poerio, Elia
2005-04-01
A cDNA encoding the proteinase inhibitor WSCI (wheat subtilisin/chymotrypsin inhibitor) was isolated by RT-PCR. Degenerate oligonucleotide primers were designed based on the amino acid sequence of WSCI and on the nucleotide sequence of the two homologous inhibitors (CI-2A and CI-2B) isolated from barley. For large-scale production, wsci cDNA was cloned into the E. coli vector pGEX-2T. The fusion protein GST-WSCI was efficiently produced in the bacterial expression system and, as the native inhibitor, was capable of inhibiting bacterial subtilisin, mammalian chymotrypsins and chymotrypsin-like activities present in crude extracts of a number of insect larvae ( Helicoverpa armigera , Plodia interpunctella and Tenebrio molitor ). The recombinant protein produced was also able to interfere with chymotrypsin-like activity isolated from immature wheat caryopses. These findings support a physiological role for this inhibitor during grain maturation.
Inamine, Saki; Onaga, Shoko; Ohnuma, Takayuki; Fukamizo, Tamo; Taira, Toki
2015-01-01
Chitinase-A (EaChiA), molecular mass 36 kDa, was purified from the vegetative stems of a horsetail (Equisetum arvense) using a series of column chromatography. The N-terminal amino acid sequence of EaChiA was similar to the lysin motif (LysM). A cDNA encoding EaChiA was cloned by rapid amplification of cDNA ends and polymerase chain reaction. It consisted of 1320 nucleotides and encoded an open reading frame of 361 amino acid residues. The deduced amino acid sequence indicated that EaChiA is composed of a N-terminal LysM domain and a C-terminal plant class IIIb chitinase catalytic domain, belonging to the glycoside hydrolase family 18, linked by proline-rich regions. EaChiA has strong chitin-binding activity, however, no antifungal activity. This is the first report of a chitinase from Equisetopsida, a class of fern plants, and the second report of a LysM-containing chitinase from a plant.
ORF phage display to identify cellular proteins with different functions.
Li, Wei
2012-09-01
Open reading frame (ORF) phage display is a new branch of phage display aimed at improving its efficiency to identify cellular proteins with specific binding or functional activities. Despite the success of phage display with antibody libraries and random peptide libraries, phage display with cDNA libraries of cellular proteins identifies a high percentage of non-ORF clones encoding unnatural short peptides with minimal biological implications. This is mainly because of the uncontrollable reading frames of cellular proteins in conventional cDNA libraries. ORF phage display solves this problem by eliminating non-ORF clones to generate ORF cDNA libraries. Here I summarize the procedures of ORF phage display, discuss the factors influencing its efficiency, present examples of its versatile applications, and highlight evidence of its capability of identifying biologically relevant cellular proteins. ORF phage display coupled with different selection strategies is capable of delineating diverse functions of cellular proteins with unique advantages. Copyright © 2012 Elsevier Inc. All rights reserved.
Cloning of habutobin cDNA and antithrombotic activity of recombinant protein
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sunagawa, Masanori; Nakamura, Mariko; Kosugi, Tadayoshi
2007-11-03
The habutobin cDNA was cloned from total RNA extracted from venom glands of Trimeresurus flavoviridis (the habu snake). The conceptual translation of 1539 bp of habutobin cDNA consists of 236 amino acids and its molecular weight is 25.7 kDa. Histidine (His)-tagged recombinant habutobin fusion protein, pET-r-habutobin and AcNPV-r-habutobin, was purified by bacterial system and baculoviral system, respectively. After refolding pET-r-habutobin, there were two protein bands at about 32 kDa and 65 kDa, indicating that habutobin might be produced as a monomer protein and processed to form two concatenated protein. Purified AcNPV-r-habutobin dose-dependently increased fibrin forming activity and inhibited collagen-induced aggregationmore » of rabbit washed platelets. Thus, AcNPV-r-habutobin produced by baculoviral system is very useful for study on structure-function relationship, which is necessary for developing an antithrombotic drug from habutobin.« less
Wang, Jian-Hua; Chen, Shi-Shu
2002-07-01
To clone gastric adenocarcinoma metastasis related genes, RF-1 cell line (primary tumor of a gastric adenocarcinoma patient ) and RF-48 cell line (its metastatic counterpart) were used as a model for studying the molecular mechanism of tumor metastasis. Two fluorescent cDNA probes, labeled with Cy3 and Cy5 dyes, were prepared from RF-1 and RF-48 mRNA samples by reverse transcription method. The two color probes were then mixed and hybridized to the cDNA chip constructed by double-dots of 4 096 human genes, and scanned at two wavelengths. The experiment was repeated for 2 times. Differential expression genes from the above two cells were analyzed using the computer. 138 in all genes (3.4%) revealed differential expression in RF-48 cells compared with RF-1 cells: 81(2.1%) genes revealed apparent up-regulation, and 56(1.3%) genes revealed down-regulation. 45 genes involved in gastric adenocarcinoma metastasis were cloned using fluorescent differential display-PCR (FDD-PCR), including 3 novel genes. There were 7 differential expression genes that agreed with each other in two detection methods. The possible roles of some differential expressed genes, which maybe involved in the mechanism of tumor metastasis, were discussed. cDNA chip was used to analyze gene expression in a high-throughput and large scale manner, in combination with FDD-PCR for cloning unknown novel genes. In conclusion, some genes related to metastasis were preliminarily scanned, which would contribute to disclose the molecular mechanism of gastric adenocarcinoma metastasis.
Dong, J G; Kim, W T; Yip, W K; Thompson, G A; Li, L; Bennett, A B; Yang, S F
1991-08-01
1-Aminocyclopropane-1-carboxylate (ACC) synthase (EC 4.4.1.14) purified from apple (Malus sylvestris Mill.) fruit was subjected to trypsin digestion. Following separation by reversed-phase high-pressure liquid chromatography, ten tryptic peptides were sequenced. Based on the sequences of three tryptic peptides, three sets of mixed oligonucleotide probes were synthesized and used to screen a plasmid cDNA library prepared from poly(A)(+) RNA of ripe apple fruit. A 1.5-kb (kilobase) cDNA clone which hybridized to all three probes were isolated. The clone contained an open reading frame of 1214 base pairs (bp) encoding a sequence of 404 amino acids. While the polyadenine tail at the 3'-end was intact, it lacked a portion of sequence at the 5'-end. Using the RNA-based polymerase chain reaction, an additional sequence of 148 bp was obtained at the 5'-end. Thus, 1362 bp were sequenced and they encode 454 amino acids. The deduced amino-acid sequence contained peptide sequences corresponding to all ten tryptic fragments, confirming the identity of the cDNA clone. Comparison of the deduced amino-acid sequence between ACC synthase from apple fruit and those from tomato (Lycopersicon esculentum Mill.) and winter squash (Cucurbita maxima Duch.) fruits demonstrated the presence of seven highly conserved regions, including the previously identified region for the active site. The size of the translation product of ACC-synthase mRNA was similar to that of the mature protein on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), indicating that apple ACC-synthase undergoes only minor, if any, post-translational proteolytic processing. Analysis of ACC-synthase mRNA by in-vitro translation-immunoprecipitation, and by Northern blotting indicates that the ACC-synthase mRNA was undetectable in unripe fruit, but was accumulated massively during the ripening proccess. These data demonstrate that the expression of the ACC-synthase gene is developmentally regulated.
Lange, T; Hedden, P; Graebe, J E
1994-01-01
In the biosynthetic pathway to the gibberellins (GAs), carbon-20 is removed by oxidation to give the C19-GAs, which include the biologically active plant hormones. We report the isolation of a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing) EC 1.14.11.-] by screening a cDNA library from developing cotyledons of pumpkin (Cucurbita maxima L.) for expression of this enzyme. When mRNA from either the cotyledons or the endosperm was translated in vitro using rabbit reticulocyte lysates, the products contained GA12 20-oxidase activity. A polyclonal antiserum was raised against the amino acid sequence of a peptide released by tryptic digestion of purified GA 20-oxidase from the endosperm. A cDNA expression library in lambda gt11 was prepared from cotyledon mRNA and screened with the antiserum. The identity of positive clones was confirmed by the demonstration of GA12 20-oxidase activity in single bacteriophage plaques. Recombinant protein from a selected clone catalyzed the three-step conversions of GA12 to GA25 and of GA53 to GA17, as well as the formation of the C19-GAs, GA1, GA9, and GA20, from their respective aldehyde precursors, GA23, GA24, and GA19. The nucleotide sequence of the cDNA insert contains an open reading frame of 1158 nt encoding a protein of 386 amino acid residues. The predicted M(r) (43,321) and pI (5.3) are similar to those determined experimentally for the native GA 20-oxidase. Furthermore, the derived amino acid sequence includes sequences obtained from the N terminus and two tryptic peptides from the native enzyme. It also contains regions that are highly conserved in a group of non-heme Fe-containing dioxygenases. Images PMID:8078921
Zhu, Shengming; Wang, Yanping; Zheng, Hong; Cheng, Jingqiu; Lu, Yanrong; Zeng, Yangzhi; Wang, Yu; Wang, Zhu
2009-04-01
This study sought to clone Chinese Banna minipig inbred-line (BMI) alpha1,3-galactosyltransferase (alpha1,3-GT) gene and construct its recombinant eukaryotic expression vector. Total RNA was isolated from BMI liver. Full length cDNA of alpha1,3-GT gene was amplified by RT-PCR and cloned into pMD18-T vector to sequence. Subsequently, alpha1,3-GT gene was inserted into pEGFP-N1 to construct eukaryotic expression vector pEGFP-N1-GT. Then the reconstructed plasmid pEGFP-N1-GT was transiently transfected into human lung cancer cell line A549. The expression of alpha1,3-GT mRNA in transfected cells was detected by RT-PCR. FITC-BS-IB4 lectin was used in the direct immunofluorescence method, which was performed to observe the alpha-Gal synthesis function of BMI alpha1,3-GT in transfected cells. The results showed that full length of BMI alpha1,3-GT cDNA was 1116 bp. BMI alpha1,3-GT cDNA sequence was highly homogenous with those of mouse and bovine, and was exactly the same as the complete sequence of those of swine, pEGFP-N1-GT was confirmed by enzyme digestion and PCR. The expression of alpha1,3-GT mRNA was detected in A549 cells transfected by pEGFP-N1-GT. The expression of alpha-Gal was observed on the membrane of A549 cells transfected by pEGFP-N1-GT. Successful cloning of BMI alpha1,3-GT cDNA and construction of its eukaryotic expression vector have established a foundation for further research and application of BMI alpha1,3-GT in the fields of xenotransplantation and immunological therapy of cancer.
Towards the isolation of the idiopathic hemochromatosis disease gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chorney, M.J.; Venditti, C.P.; Harris, J.M.
1994-09-01
Despite the existence of many useful reagents which exist to aid in the positional cloning of the idiopathic hermochromatosis disease gene (HFE), the nature and precise location of this common genetic disease has remained elusive. Our group has pursued an MHC-based positional cloning approach which has centered on the precise physical definition of HLA-A variant chromosomes. Using deletion breakpoint locations in combination with genetic data derived from the Brittany founder population, we have used cDNA selection techniques to isolate new members of distinct multigene families which reside in the HFE critical region (distal to the HLA-A9 breakpoint/proximal to HLA-F). Wemore » have also initiated an independent set of cytogenetic and physical mapping studies to position the marker D6S105 with respect to the telomeric end of the class I subregion. Toward this end, we have performed double labelling FISH experiments which have allowed the localization of D6S105-containing YACs with respect to the HLA-A subregion and to the major G-bands which contain these loci. We have also derived single-copy probes, cosmids and cDNA clones from the region which have been used to create a physical map around D6S105. The combination of the cytogenetic and physical mapping data indicate that D6S105 is at least 2 Mb from HLA-A and that the distal limit of the MHC class I region may extend much further into the the euchromatic region of 6p21.3 than previously expected. A mega-YAC walk is now in progress to link the two loci. Finally, we have identified and characterized a family which is segregating a balanced inversion in phase with HFE. The breakpoint locations of this mutant chromosome may be important in the precise positioning of the HFE gene and attempts to define coding sequences in the proximity of this rearrangement are underway.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nitsche, E.M.; Moquin, A.; Adams, P.S.
1996-05-03
Male sexual differentiation is a process that involves androgen action via the androgen receptor. Defects in the androgen receptor, many resulting from point mutations in the androgen receptor gene, lead to varying degrees of impaired masculinization in chromosomally male individuals. To date no specific androgen regulated morphogens involved in this process have been identified and no marker genes are known that would help to predict further virilization in infants with partial androgen insensitivity. In the present study we first show data on androgen regulated gene expression investigated by differential display reverse transcription PCR (dd RT PCR) on total RNA frommore » human neonatal genital skin fibroblasts cultured in the presence or absence of 100 nM testosterone. Using three different primer combinations, 54 cDNAs appeared to be regulated by androgens. Most of these sequences show the characteristics of expressed mRNAs but showed no homology to sequences in the database. However 15 clones with significant homology to previously cloned sequences were identified. Seven cDNAs appear to be induced by androgen withdrawal. Of these, five are similar to ETS (expression tagged sequences) from unknown genes; the other two show significant homology to the cDNAs of ubiquitin and human guanylate binding protein 2 (GBP-2). In addition, we have identified 8 cDNA clones which show homologies to other sequences in the database and appear to be upregulated in the presence of testosterone. Three differential expressed sequences show significant homology to the cDNAs of L-plastin and one to the cDNA of testican. This latter gene codes for a proteoglycan involved in cell social behavior and therefore of special interest in this context. The results of this study are of interest in further investigation of normal and disturbed androgen-dependent gene expression. 49 refs., 2 figs., 5 tabs.« less
NASA Astrophysics Data System (ADS)
Gao, Jialong; Ishizaki, Shoichiro; Nagashima, Yuji
2016-03-01
Cadmium (Cd) is known to influence the oxidative status of marine organisms and can induce the formation of reactive oxygen species (ROS). Catalase (CAT) is one of the important enzymes involved in scavenging high levels of ROS. In present study, we cloned CAT cDNA and investigated the response of this enzyme at the transcriptional level in the Japanese scallop Mizuhopecten yessoensis exposed to Cd. The full-length CAT cDNA (MyCAT) of 1,870 nucleotides including a 57 bp 5'-UTR, a coding sequence of 1,500 bp and a 313 bp 3'-UTR were identified from the scallop. The deduced amino acid sequence of MyCAT corresponds to 499 amino acids with predicted molecular weight of 56.48 kDa and contains highly conserved motifs of the proximal heme-binding site RLFSYSTH, proximal active signature FNRERIPERVVHAKGGG and three catalytic amino acid residues His72, Asn145, and Tyr355. Its significant homology to CATs from multiple alignments revealed that MyCAT had a high identity with CATs from other mollusks. CAT mRNA expression analysis revealed that expression level was highest in the digestive gland ( p < 0.01) but weak in muscle. Following exposure to 200 and 400 µg/l of Cd, a high amount of Cd was found to have accumulated in the digestive gland and CAT mRNA expression had significantly increased in this organ among 7-day exposed scallops ( p < 0.001). The result demonstrated that antioxidant enzymes such as CAT play important roles in counteracting Cd stress in M. yessoensis.
Pu, L; Zhang, L C; Zhang, J S; Song, X; Wang, L G; Liang, J; Zhang, Y B; Liu, X; Yan, H; Zhang, T; Yue, J W; Li, N; Wu, Q Q; Wang, L X
2016-08-12
Mitogen-activated protein kinase kinase kinase 5 (MAP3K5) is essential for apoptosis, proliferation, differentiation, and immune responses, and is a candidate marker for residual feed intake (RFI) in pig. We cloned the full-length cDNA sequence of porcine MAP3K5 by rapid-amplification of cDNA ends. The 5451-bp gene contains a 5'-untranslated region (UTR) (718 bp), a coding region (3738 bp), and a 3'-UTR (995 bp), and encodes a peptide of 1245 amino acids, which shares 97, 99, 97, 93, 91, and 84% sequence identity with cattle, sheep, human, mouse, chicken, and zebrafish MAP3K5, respectively. The deduced MAP3K5 protein sequence contains two conserved domains: a DUF4071 domain and a protein kinase domain. Phylogenetic analysis showed that porcine MAP3K5 forms a separate branch to vicugna and camel MAP3K5. Tissue expression analysis using real-time quantitative polymerase chain reaction (qRT-PCR) revealed that MAP3K5 was expressed in the heart, liver, spleen, lung, kidney, muscle, fat, pancrea, ileum, and stomach tissues. Copy number variation was detected for porcine MAP3K5 and validated by qRT-PCR. Furthermore, a significant increase in average copy number was detected in the low RFI group when compared to the high RFI group in a Duroc pig population. These results provide useful information regarding the influence of MAP3K5 on RFI in pigs.
2014-01-01
Background Trichomonas vaginalis, a flagellated protozoan, is the agent responsible for trichomoniasis, the most common nonviral sexually transmitted infection worldwide. A reported 200 million cases are documented each year with far more cases going unreported. However, T. vaginalis is disproportionality under studied, especially considering its basic metabolism. It has been reported that T. vaginalis does not grow on sucrose. Nevertheless, the T. vaginalis genome contains some 11 putative sucrose transporters and a putative β-fructofuranosidase (invertase). Thus, the machinery for both uptake and cleavage of sucrose appears to be present. Results We amplified the β-fructofuranosidase from T. vaginalis cDNA and cloned it into an Escherichia coli expression system. The expressed, purified protein was found to behave similarly to other known β-fructofuranosidases. The enzyme exhibited maximum activity at pH close to 5.0, with activity falling off rapidly at increased or decreased pH. It had a similar Km and Vmax to previously characterized enzymes using sucrose as a substrate, was also active towards raffinose, but had no detectable activity towards inulin. Conclusions T. vaginalis has the coding capacity to produce an active β-fructofuranosidase capable of hydrolyzing di- and trisaccharides containing a terminal, non-reducing fructose residue. Since we cloned this enzyme from cDNA, we know that the gene in question is transcribed. Furthermore, we could detect β-fructofuranosidase activity in T. vaginalis cell lysates. Therefore, the inability of the organism to utilize sucrose as a carbon source cannot be explained by an inability to degrade sucrose. PMID:24972630
Dirkx, Michael; Boyer, Michael P; Pradhan, Prajakta; Brittingham, Andrew; Wilson, Wayne A
2014-06-28
Trichomonas vaginalis, a flagellated protozoan, is the agent responsible for trichomoniasis, the most common nonviral sexually transmitted infection worldwide. A reported 200 million cases are documented each year with far more cases going unreported. However, T. vaginalis is disproportionality under studied, especially considering its basic metabolism. It has been reported that T. vaginalis does not grow on sucrose. Nevertheless, the T. vaginalis genome contains some 11 putative sucrose transporters and a putative β-fructofuranosidase (invertase). Thus, the machinery for both uptake and cleavage of sucrose appears to be present. We amplified the β-fructofuranosidase from T. vaginalis cDNA and cloned it into an Escherichia coli expression system. The expressed, purified protein was found to behave similarly to other known β-fructofuranosidases. The enzyme exhibited maximum activity at pH close to 5.0, with activity falling off rapidly at increased or decreased pH. It had a similar K(m) and V(max) to previously characterized enzymes using sucrose as a substrate, was also active towards raffinose, but had no detectable activity towards inulin. T. vaginalis has the coding capacity to produce an active β-fructofuranosidase capable of hydrolyzing di- and trisaccharides containing a terminal, non-reducing fructose residue. Since we cloned this enzyme from cDNA, we know that the gene in question is transcribed. Furthermore, we could detect β-fructofuranosidase activity in T. vaginalis cell lysates. Therefore, the inability of the organism to utilize sucrose as a carbon source cannot be explained by an inability to degrade sucrose.
Subtraction of cap-trapped full-length cDNA libraries to select rare transcripts.
Hirozane-Kishikawa, Tomoko; Shiraki, Toshiyuki; Waki, Kazunori; Nakamura, Mari; Arakawa, Takahiro; Kawai, Jun; Fagiolini, Michela; Hensch, Takao K; Hayashizaki, Yoshihide; Carninci, Piero
2003-09-01
The normalization and subtraction of highly expressed cDNAs from relatively large tissues before cloning dramatically enhanced the gene discovery by sequencing for the mouse full-length cDNA encyclopedia, but these methods have not been suitable for limited RNA materials. To normalize and subtract full-length cDNA libraries derived from limited quantities of total RNA, here we report a method to subtract plasmid libraries excised from size-unbiased amplified lambda phage cDNA libraries that avoids heavily biasing steps such as PCR and plasmid library amplification. The proportion of full-length cDNAs and the gene discovery rate are high, and library diversity can be validated by in silico randomization.
Sunderasan, E; Bahari, A; Arif, S A M; Zainal, Z; Hamilton, R G; Yeang, H Y
2005-11-01
Hev b 4 is an allergenic natural rubber latex (NRL) protein complex that is reactive in skin prick tests and in vitro immunoassays. On SDS-polyacrylamide gel electrophoresis (SDS-PAGE), Hev b 4 is discerned predominantly at 53-55 kDa together with a 57 kDa minor component previously identified as a cyanogenic glucosidase. Of the 13 NRL allergens recognized by the International Union of Immunological Societies, the 53-55 kDa Hev b 4 major protein is the only candidate that lacks complete cDNA and protein sequence information. We sought to clone the transcript encoding the Hev b 4 major protein, and characterize the native protein and its recombinant form in relation to IgE binding. The 5'/3' rapid amplification of cDNA ends method was employed to obtain the complete cDNA of the Hev b 4 major protein. A recombinant form of the protein was over-expressed in Escherichia coli. The native Hev b 4 major protein was deglycosylated by trifluoromethane sulphonic acid. Western immunoblots of the native, deglycosylated and recombinant proteins were performed using both polyclonal antibodies and sera from latex-allergic patients. The cDNA encoding the Hev b 4 major protein was cloned. Its open reading frame matched lecithinases in the conserved domain database and contained 10 predicted glycosylation sites. Detection of glycans on the Hev b 4 lecithinase homologue confirmed it to be a glycoprotein. The deglycosylated lecithinase homologue was discerned at 40 kDa on SDS-PAGE, this being comparable to the 38.53 kDa mass predicted by its cDNA. Deglycosylation of the lecithinase homologue resulted in the loss of IgE recognition, although reactivity to polyclonal rabbit anti-Hev b 4 was retained. IgE from latex-allergic patients also failed to recognize the non-glycosylated E. coli recombinant lecithinase homologue. The IgE epitopes of the Hev b 4 lecithinase homologue reside mainly in its carbohydrate moiety, which also account for the discrepancy between the observed molecular weight of the protein and the value calculated from its cDNA.
USDA-ARS?s Scientific Manuscript database
Genomic and cDNA sequences corresponding to a ferredoxin-sulfite reductase (SiR) have been cloned from bulb onion (Allium cepa L.) and the expression of the gene and activity of the enzyme characterised with respect to sulfur (S) supply. Cloning, mapping and expression studies revealed that onion ha...
USDA-ARS?s Scientific Manuscript database
The molecular biological techniques for plasmid-based assembly and cloning of gene open reading frames are essential for elucidating the function of the proteins encoded by the genes. These techniques involve the production of full-length cDNA libraries as a source of plasmid-based clones to expres...
Lata, Charu; Bhutty, Sarita; Bahadur, Ranjit Prasad; Majee, Manoj; Prasad, Manoj
2011-06-01
The DREB genes code for important plant transcription factors involved in the abiotic stress response and signal transduction. Characterization of DREB genes and development of functional markers for effective alleles is important for marker-assisted selection in foxtail millet. Here the characterization of a cDNA (SiDREB2) encoding a putative dehydration-responsive element-binding protein 2 from foxtail millet and the development of an allele-specific marker (ASM) for dehydration tolerance is reported. A cDNA clone (GenBank accession no. GT090998) coding for a putative DREB2 protein was isolated as a differentially expressed gene from a 6 h dehydration stress SSH library. A 5' RACE (rapid amplification of cDNA ends) was carried out to obtain the full-length cDNA, and sequence analysis showed that SiDREB2 encoded a polypeptide of 234 amino acids with a predicted mol. wt of 25.72 kDa and a theoretical pI of 5.14. A theoretical model of the tertiary structure shows that it has a highly conserved GCC-box-binding N-terminal domain, and an acidic C-terminus that acts as an activation domain for transcription. Based on its similarity to AP2 domains, SiDREB2 was classified into the A-2 subgroup of the DREB subfamily. Quantitative real-time PCR analysis showed significant up-regulation of SiDREB2 by dehydration (polyethylene glycol) and salinity (NaCl), while its expression was less affected by other stresses. A synonymous single nucleotide polymorphism (SNP) associated with dehydration tolerance was detected at the 558th base pair (an A/G transition) in the SiDREB2 gene in a core set of 45 foxtail millet accessions used. Based on the identified SNP, three primers were designed to develop an ASM for dehydration tolerance. The ASM produced a 261 bp fragment in all the tolerant accessions and produced no amplification in the sensitive accessions. The use of this ASM might be faster, cheaper, and more reproducible than other SNP genotyping methods, and thus will enable marker-aided breeding of foxtail millet for dehydration tolerance.
Molecular cloning and nucleotide sequence of CYP6BF1 from the diamondback moth, Plutella xylostella
Li, Hongshan; Dai, Huaguo; Wei, Hui
2005-01-01
A novel cDNA clong encoding a cytochrome P450 was screened from the insecticide-susceptible strain of Plutella xylostella (L.) (Lepidoptera:Yponomeutidae). The nucleotide sequence of the clone, designated CYP6BF1, was determined. This is the first full-length sequence of the CYP6 family from Plutella xylostella (L.). The cDNA is 1661bp in length and contains an open reading frame from base pairs 26 to 1570, encoding a protein of 514 amino acid residues. It is similar to the other insect P450s in gene family 6, including CYP6AE1 from Depressaria pastinacella, (46%). The GenBank accession number is AY971374. PMID:17119627
Molecular cloning and characterization of arginine kinase gene of Toxocara canis.
Sahu, Shivani; Samanta, S; Harish, D R; Sudhakar, N R; Raina, O K; Shantaveer, S B; Madhu, D N; Kumar, Ashok
2015-06-01
Toxocara canis is an important gastrointestinal nematode of dogs and also a causative agent of visceral larva migrans in humans. Arginine kinase (AK) gene is one of the important biomolecule of phosphagen kinase of T. canis which is emerging as an exciting novel diagnostic target in toxocarosis. The present study was carried out to clone and characterize AK gene of T. canis for future utilization as a diagnostic molecule. Total RNA was extracted from intact adult worms and reverse transcription was done with oligo dT primers to obtain complementary DNA (cDNA). Polymerase chain reaction (PCR) was carried out using cDNA as template with specific primers which amplified a product of 1,202 bp. The amplicon was cloned into pDrive cloning vector and clone was confirmed by colony PCR and restriction endonuclease analysis. Sequence analysis of the gene showed 99.8 and 77.9 % homology with the published AK gene of T. canis (EF015466.1) and Ascaris suum respectively. Structural analysis shown that the mature AK protein consist of 400 amino acids with a molecular wt of 45360.73 Da. Further expression studies are required for producing the recombinant protein for its evaluation in the diagnosis of T. canis infection in humans as well as in adult dogs.
Gong, Mingbo; Tang, Chaoxi; Zhu, Changxiong
2014-11-01
A primary cDNA library of Penicillium oxalicum I1 was constructed using the switching mechanism at the 5' end of the RNA transcript (SMART) technique. A total of 106 clones showed halos in tricalcium phosphate (TCP) medium, and clone I-40 showed clear halos. The full-length cDNA of clone I-40 was 1355 bp with a complete open reading frame (ORF) of 1032 bp, encoding a protein of 343 amino acids. Multiple alignment analysis revealed a high degree of homology between the ORF of clone I-40 and delta-1-pyrroline-5-carboxylate dehydrogenase (P5CDH) of other fungi. The ORF expression vector was constructed and transformed into Escherichia coli DH5α. The transformant (ORF-1) with the P5CDH gene secreted organic acid in medium with TCP as the sole source of phosphate. Acetic acid and α-ketoglutarate were secreted in 4 and 24 h, respectively. ORF-1 decreased the pH of the medium from 6.62 to 3.45 and released soluble phosphate at 0.172 mg·mL(-1) in 28 h. Expression of the P. oxalicum I1 p5cdh gene in E. coli could enhance organic acid secretion and phosphate-solubilizing ability.
The structure of the human interferon alpha/beta receptor gene.
Lutfalla, G; Gardiner, K; Proudhon, D; Vielh, E; Uzé, G
1992-02-05
Using the cDNA coding for the human interferon alpha/beta receptor (IFNAR), the IFNAR gene has been physically mapped relative to the other loci of the chromosome 21q22.1 region. 32,906 base pairs covering the IFNAR gene have been cloned and sequenced. Primer extension and solution hybridization-ribonuclease protection have been used to determine that the transcription of the gene is initiated in a broad region of 20 base pairs. Some aspects of the polymorphism of the gene, including noncoding sequences, have been analyzed; some are allelic differences in the coding sequence that induce amino acid variations in the resulting protein. The exon structure of the IFNAR gene and of that of the available genes for the receptors of the cytokine/growth hormone/prolactin/interferon receptor family have been compared with the predictions for the secondary structure of those receptors. From this analysis, we postulate a common origin and propose an hypothesis for the divergence from the immunoglobulin superfamily.
Zhang, Chun-Rong; Yang, Quan; Chen, Hu-Biao; Pang, Yu-Xin; Tang, Xiao-Min; Cheng, Xuan-Xuan; Wu, Wen-Ya; Chen, Shi-Min
2012-11-01
The rhizome of Alpinia officinarum is a widely used Chinese herbal medicine. The essential oil in A. officinarum rhizome is mainly composed of 1, 8-cineole and other monoterpenes, as the major bioactive ingredients. In plants, monoterpenes are synthesized through the methylerythritol phosphate (MEP) pathway in the plastids, and 1-deoxy-D-xylulose 5-phosphate reductoisomerase (DXR) is an enzyme catalyzing a committed step of the MEP pathway. In the present study, the full-length cDNA encoding DXR was cloned from the rhizome of A. officinarum, using homology-based RT-PCR and rapid amplification of cDNA ends (RACE) techniques. The new cDNA was designated as AoDXR and submitted to GenBank to be assigned with an accession number HQ874658. The full-length cDNA of AoDXR was 1 670 bp containing a 1 419 bp open reading frame encoding a polypeptide of 472 amino acids with a calculated molecular mass of 51.48 kDa and an isoelectric point of 6.15. Bioinformatic analyses revealed that AoDXR showed extensive homology with DXRs from other plant species and contained a conserved plastids transit peptide, a Pro-rich region and two highly conserved NADPH-binding motifs in its N-terminal region characterized by all plant DXRs. The phylogenetic analysis revealed that AoDXR belonged to angiosperm DXRs. The structural modeling of AoDXR showed that AoDXR had the typical V-shaped structure of DXR proteins. The tissue expression pattern analysis indicated that AoDXR expressed strongly in leaves, weak in rhizomes of A. officinarum. Exogenous methyl jasmonate (MeJA) could enhance the expression of AoDXR and the production of 1, 8-cineole in A. officinarum rhizomes. The cloning and characterization of AoDXR will be helpful to reveal the molecular regulation mechanism of monoterpene biosynthesis in A. officinarum and provides a candidate gene for metabolic engineering in improving the medicinal quality of A. officinarum rhizome.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Finlay, C.A.; Hinds, P.W.; Tan, T.H.
1988-02-01
The 11-4 p53 cDNA clone failed to transform primary rat fibroblasts when cotransfected with the ras oncogene. Two linker insertion mutations at amino acid 158 or 215 (of 390 amino acids) activated this p53 cDNA for transformation with ras. These mutant cDNAs produced a p53 protein that lacked an epitope, recognized by monoclonal antibody PAb246 (localized at amino acids 88 to 110 in the protein) and preferentially bound to a heat shock protein, hsc70. In rat cells transformed by a genomic p53 clone plus ras, two populations of p53 proteins were detected, PAb246/sup +/ and PAb246/sup -/, which did ormore » did not bind to this monoclonal antibody, respectively. The PAb246/sup -/ p53 preferentially associated with hsc70, and this protein has a half-life 4- to 20-fold longer than free p53 (PAb246/sup +/). These data suggest a possible functional role for hsc70 in the transformation process. cDNAs for p53 derived from methylcholanthrene-transformed cells transform rat cells in cooperation with the ras oncogene and produce a protein that bound with the heat shock proteins. Recombinant clones produced between a Meth A cDNA and 11-4 were tested for the ability to transform rat cells. A single amino acid substitution at residue 132 was sufficient to activate the 11-4 p53 cDNA for transformation. These studies have identified a region between amino acids 132 and 215 in the p53 protein which, when mutated, can activate the p53 cDNA. These results also call into question what the correct p53 wild-type sequence is and whether a wild-type p53 gene can transform cells in culture.« less
Laursen, J R; di Liu, H; Wu, X J; Yoshino, T P
1997-11-01
Sublethal heat-shock of cells of the Bge (Biomphalaria glabrata embryonic) snail cell line resulted in increased or new expression of metabolically labeled polypeptides of approximately 21.5, 41, 70, and 74 kDa molecular mass. Regulation of this response appeared to be at the transcriptional level since a similar protein banding pattern was seen upon SDS-PAGE/fluorographic analysis of polypeptides produced by in vitro translation of total RNA from cells subjected to heat shock. Using a yeast (Saccharomyces cerevisiae) 70-kDa heat-shock protein (HSP70) probe to screen a cDNA library from heat-treated Bge cells, we isolated a full-length cDNA clone encoding a putative Bge HSP70. The cDNA was 2453 bp in length and contained an open reading frame of 1908 bp encoding a 636-amino-acid polypeptide with calculated molecular mass of 70,740 Da. Comparison of a conserved region of 209 amino acid residues revealed > 80% identity between the deduced amino acid sequence of Bge HSP70 and that of yeast (81%), the human blood fluke Schistosoma mansoni (for which B. glabrata serves as intermediate host) (81%), Drosophila (81%), human (84%), and the marine gastropod Aplysia californica (88%, 90%). In addition to the extensive sharing of sequence homology, the identification of several eukaryotic HSP70 signature sequences and an N-linked glycosylation site characteristic of cytoplasmic HSPs strongly support the identity of the Bge cDNA as encoding an authentic HSP70. Results of a Northern blot analysis, using Bge HSP70 clone-specific probes, indicated that gene expression was heat inducible and not constitutively expressed. This is the first reported sequence of an inducible HSP70 from cells originating from a freshwater gastropod and provides a first step in the development of a genetic transformation system for molluscs of medical importance.
Yang, Zhifan; Chen, Jun; Chen, Yongqin; Jiang, Sijing
2010-01-01
A full cDNA encoding an acetylcholinesterase (AChE, EC 3.1.1.7) was cloned and characterized from the brown planthopper, Nilaparvata lugens Stål (Hemiptera: Delphacidae). The complete cDNA (2467 bp) contains a 1938-bp open reading frame encoding 646 amino acid residues. The amino acid sequence of the AChE deduced from the cDNA consists of 30 residues for a putative signal peptide and 616 residues for the mature protein with a predicted molecular weight of 69,418. The three residues (Ser242, Glu371, and His485) that putatively form the catalytic triad and the six Cys that form intra-subunit disulfide bonds are completely conserved, and 10 out of the 14 aromatic residues lining the active site gorge of the AChE are also conserved. Northern blot analysis of poly(A)+ RNA showed an approximately 2.6-kb transcript, and Southern blot analysis revealed there likely was just a single copy of this gene in N. lugens. The deduced protein sequence is most similar to AChE of Nephotettix cincticeps with 83% amino acid identity. Phylogenetic analysis constructed with 45 AChEs from 30 species showed that the deduced N. lugens AChE formed a cluster with the other 8 insect AChE2s. Additionally, the hypervariable region and amino acids specific to insect AChE2 also existed in the AChE of N. lugens. The results revealed that the AChE cDNA cloned in this work belongs to insect AChE2 subgroup, which is orthologous to Drosophila AChE. Comparison of the AChEs between the susceptible and resistant strains revealed a point mutation, Gly185Ser, is likely responsible for the insensitivity of the AChE to methamidopho in the resistant strain. PMID:20874389
Isolation and cloning of a metalloproteinase from king cobra snake venom.
Guo, Xiao-Xi; Zeng, Lin; Lee, Wen-Hui; Zhang, Yun; Jin, Yang
2007-06-01
A 50 kDa fibrinogenolytic protease, ohagin, from the venom of Ophiophagus hannah was isolated by a combination of gel filtration, ion-exchange and heparin affinity chromatography. Ohagin specifically degraded the alpha-chain of human fibrinogen and the proteolytic activity was completely abolished by EDTA, but not by PMSF, suggesting it is a metalloproteinase. It dose-dependently inhibited platelet aggregation induced by ADP, TMVA and stejnulxin. The full sequence of ohagin was deduced by cDNA cloning and confirmed by protein sequencing and peptide mass fingerprinting. The full-length cDNA sequence of ohagin encodes an open reading frame of 611 amino acids that includes signal peptide, proprotein and mature protein comprising metalloproteinase, disintegrin-like and cysteine-rich domains, suggesting it belongs to P-III class metalloproteinase. In addition, P-III class metalloproteinases from the venom glands of Naja atra, Bungarus multicinctus and Bungarus fasciatus were also cloned in this study. Sequence analysis and phylogenetic analysis indicated that metalloproteinases from elapid snake venoms form a new subgroup of P-III SVMPs.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xie, Enzhong; Zhu, Lingyu; Zhao, Lingyun
1996-08-01
The complete 4775-nt cDNA encoding the human serotonin 5-HT{sub 2C} receptor (5-HT{sub 2C}R), a G-protein-coupled receptor, has been isolated. It contains a 1377-nt coding region flanked by a 728-nt 5{prime}-untranslated region and a 2670-nt 3{prime}-untranslated region. By using the cloned 5-HT{sub 2C}R cDNA probe, the complete human gene for this receptor has been isolated and shown to contain six exons and five introns spanning at least 230 kb of DNA. The coding region of the human 5-HT{sub 2C}R gene is interrupted by three introns, and the positions of the intron/exon junctions are conserved between the human and the rodent genes.more » In addition, an alternatively spliced 5-HT{sub 2C}R RNA that contains a 95-nt deletion in the region coding for the second intracellular loop and the fourth transmembrane domain of the receptor has been identified. This deletion leads to a frameshift and premature termination so that the short isoform RNA encodes a putative protein of 248 amino acids. The ratio for the short isoform over the 5-HT{sub 2C}R RNA was found to be higher in choroid plexus tumor than in normal brain tissue, suggesting the possibility of differential regulation of the 5-HT{sub 2C}R gene in different neural tissues or during tumorigenesis. Transcription of the human 5-HT{sub 2C}R gene was found to be initiated at multiple sites. No classical TATA-box sequence was found at the appropriate location, and the 5{prime}-flanking sequence contains many potential transcription factor-binding sites. A 7.3-kb 5{prime}-flanking 5-HT{sub 2C}R DNA directed the efficient expression of a luciferase reported gene in SK-N-SH and IMR32 neuroblastoma cells, indicating that is contains a functional promoter. 69 refs., 8 figs., 1 tab.« less
dos Reis, Sávio Pinho; Tavares, Liliane de Souza Conceição; Costa, Carinne de Nazaré Monteiro; Brígida, Aílton Borges Santa; de Souza, Cláudia Regina Batista
2012-06-01
Cassava (Manihot esculenta Crantz) is one of the world's most important food crops. It is cultivated mainly in developing countries of tropics, since its root is a major source of calories for low-income people due to its high productivity and resistance to many abiotic and biotic factors. A previous study has identified a partial cDNA sequence coding for a putative RING zinc finger in cassava storage root. The RING zinc finger protein is a specialized type of zinc finger protein found in many organisms. Here, we isolated the full-length cDNA sequence coding for M. esculenta RZF (MeRZF) protein by a combination of 5' and 3' RACE assays. BLAST analysis showed that its deduced amino acid sequence has a high level of similarity to plant proteins of RZF family. MeRZF protein contains a signature sequence motif for a RING zinc finger at its C-terminal region. In addition, this protein showed a histidine residue at the fifth coordination site, likely belonging to the RING-H2 subgroup, as confirmed by our phylogenetic analysis. There is also a transmembrane domain in its N-terminal region. Finally, semi-quantitative RT-PCR assays showed that MeRZF expression is increased in detached leaves treated with sodium chloride. Here, we report the first evidence of a RING zinc finger gene of cassava showing potential role in response to salt stress.
An atypical topoisomerase II sequence from the slime mold Physarum polycephalum.
Hugodot, Yannick; Dutertre, Murielle; Duguet, Michel
2004-01-21
We have determined the complete nucleotide sequence of the cDNA encoding DNA topoisomerase II from Physarum polycephalum. Using degenerate primers, based on the conserved amino acid sequences of other eukaryotic enzymes, a 250-bp fragment was polymerase chain reaction (PCR) amplified. This fragment was used as a probe to screen a Physarum cDNA library. A partial cDNA clone was isolated that was truncated at the 3' end. Rapid amplification of cDNA ends (RACE)-PCR was employed to isolate the remaining portion of the gene. The complete sequence of 4613 bp contains an open reading frame of 4494 bp that codes for 1498 amino acid residues with a theoretical molecular weight of 167 kDa. The predicted amino acid sequence shares similarity with those of other eukaryotes and shows the highest degree of identity with the enzyme of Dictyostelium discoideum. However, the enzyme of P. polycephalum contains an atypical amino-terminal domain very rich in serine and proline, whose function is unknown. Remarkably, both a mitochondrial targeting sequence and a nuclear localization signal were predicted respectively in the amino and carboxy-terminus of the protein, as in the case of human topoisomerase III alpha. At the Physarum genomic level, the topoisomerase II gene encompasses a region of about 16 kbp suggesting a large proportion of intronic sequences, an unusual situation for a gene of a lower eukaryote, often free of introns. Finally, expression of topoisomerase II mRNA does not appear significantly dependent on the plasmodium cycle stage, possibly due to the lack of G1 phase or (and) to a mitochondrial localization of the enzyme.
Differential cDNA cloning by enzymatic degrading subtraction (EDS).
Zeng, J; Gorski, R A; Hamer, D
1994-01-01
We describe a new method, called enzymatic degrading subtraction (EDS), for the construction of subtractive libraries from PCR amplified cDNA. The novel features of this method are that i) the tester DNA is blocked by thionucleotide incorporation; ii) the rate of hybridization is accelerated by phenol-emulsion reassociation; and iii) the driver cDNA and hybrid molecules are enzymatically removed by digestion with exonucleases III and VII rather than by physical partitioning. We demonstrate the utility of EDS by constructing a subtractive library enriched for cDNAs expressed in adult but not in embryonic rat brains. Images PMID:7971268
Cloning, sequencing and expression in MEL cells of a cDNA encoding the mouse ribosomal protein S5.
Vanegas, N; Castañeda, V; Santamaría, D; Hernández, P; Schvartzman, J B; Krimer, D B
1997-06-05
We describe the isolation and characterization of a cDNA encoding the mouse S5 ribosomal protein. It was isolated from a MEL (murine erythroleukemia) cell cDNA library by differential hybridization as a down regulated sequence during HMBA-induced differentiation. Northern series analysis showed that S5 mRNA expression is reduced 5-fold throughout the differentiation process. The mouse S5 mRNA is 760 bp long and encodes for a 204 amino acid protein with 94% homology with the human and rat S5.
Dunham, S P; Onions, D E
2001-06-21
A cDNA encoding feline granulocyte colony stimulating factor (fG-CSF) was cloned from alveolar macrophages using the reverse transcriptase-polymerase chain reaction. The cDNA is 949 bp in length and encodes a predicted mature protein of 174 amino acids. Recombinant fG-CSF was expressed as a glutathione S-transferase fusion and purified by affinity chromatography. Biological activity of the recombinant protein was demonstrated using the murine myeloblastic cell line GNFS-60, which showed an ED50 for fG-CSF of approximately 2 ng/ml. Copyright 2001 Academic Press.
Organization of the murine Cd22 locus
DOE Office of Scientific and Technical Information (OSTI.GOV)
Law, Che-Leung; Torres, R.M.; Sundeberg, H.A.
1993-07-01
Murine CD22 (mCD22) is a B cell-associated adhesion protein with seven extracellular Ig-like domains that has 62% amino acid identify to its human homologue. Southern analysis on genomic DNA isolated from tissues and cell lines from several mouse strains using mCD22 cDNA demonstrated that the Cd22 locus encoding mCD22 is a single copy gene of [le]30 kb. Digestion of genomic DNA preparations with four restriction endonucleases revealed the presence of restriction fragment length polymorphisms (RFLP) in BALB/c, C57BL/6, and C3H strains vs DBA/2j, NZB, and NZC strains, suggesting the presence of two or more Cd22 alleles. Using a mCD22 cDNAmore » clone derived from the BALB/c strain, the authors isolated genomic clones from a DBA/2 genomic library that contained all the exons necessary to encode the full length mCD22 cDNA. Fifteen exons, including exon 3 that encodes the translation start codon, were identified. Each extracellular Ig-like domain of mCD22 is encoded by a single exon. A comparison between the nucleotide sequences of the BALB/c CD22 cDNA and the exons of the DBA/2j CD22 genomic clones revealed an 18-nucleotide deletion in exon 4 (encoding the most distal Ig-like domain 1 of mCD22) of the DBA/2j genomic sequence in addition to a number of substitutions, insertions, and deletions in other exons. These nucleotide differences were also present in a cDNA clone isolated from total RNA of LPS-activated DBA/2j splenocytes mosome 7, a region sytenic to human chromosome 19q, close to the previously reported loci, Lyb-8 and Mag (a homologue of Cd22). An antibody (CY34) against the Lyb-8.2 B cell marker reacted with a BHK transfectant expressing the full length mCd22 cDNA, thus demonstrating that Lyb-8 and Cd22 loci are identical. Furthermore, a rat anti-mCD22 mAb, NIM-R6, bound to slgM[sup +] DBA/2j B cells, confirming the expression of a CD22 protein by the Cd22[sup a]/lyb-8[sup a] allele. 63 refs., 7 figs., 1 tab.« less
In silico Analysis of 2085 Clones from a Normalized Rat Vestibular Periphery 3′ cDNA Library
Roche, Joseph P.; Cioffi, Joseph A.; Kwitek, Anne E.; Erbe, Christy B.; Popper, Paul
2005-01-01
The inserts from 2400 cDNA clones isolated from a normalized Rattus norvegicus vestibular periphery cDNA library were sequenced and characterized. The Wackym-Soares vestibular 3′ cDNA library was constructed from the saccular and utricular maculae, the ampullae of all three semicircular canals and Scarpa's ganglia containing the somata of the primary afferent neurons, microdissected from 104 male and female rats. The inserts from 2400 randomly selected clones were sequenced from the 5′ end. Each sequence was analyzed using the BLAST algorithm compared to the Genbank nonredundant, rat genome, mouse genome and human genome databases to search for high homology alignments. Of the initial 2400 clones, 315 (13%) were found to be of poor quality and did not yield useful information, and therefore were eliminated from the analysis. Of the remaining 2085 sequences, 918 (44%) were found to represent 758 unique genes having useful annotations that were identified in databases within the public domain or in the published literature; these sequences were designated as known characterized sequences. 1141 sequences (55%) aligned with 1011 unique sequences had no useful annotations and were designated as known but uncharacterized sequences. Of the remaining 26 sequences (1%), 24 aligned with rat genomic sequences, but none matched previously described rat expressed sequence tags or mRNAs. No significant alignment to the rat or human genomic sequences could be found for the remaining 2 sequences. Of the 2085 sequences analyzed, 86% were singletons. The known, characterized sequences were analyzed with the FatiGO online data-mining tool (http://fatigo.bioinfo.cnio.es/) to identify level 5 biological process gene ontology (GO) terms for each alignment and to group alignments with similar or identical GO terms. Numerous genes were identified that have not been previously shown to be expressed in the vestibular system. Further characterization of the novel cDNA sequences may lead to the identification of genes with vestibular-specific functions. Continued analysis of the rat vestibular periphery transcriptome should provide new insights into vestibular function and generate new hypotheses. Physiological studies are necessary to further elucidate the roles of the identified genes and novel sequences in vestibular function. PMID:16103642
Hadji Sfaxi, Imen; Ezzine, Aymen; Coquet, Laurent; Cosette, Pascal; Jouenne, Thierry; Marzouki, M Nejib
2012-09-01
Superoxide dismutases (SODs; EC 1.15.1.1) are key enzymes in the cells protection against oxidant agents. Thus, SODs play a major role in the protection of aerobic organisms against oxygen-mediated damages. Three SOD isoforms were previously identified by zymogram staining from Allium sativum bulbs. The purified Cu, Zn-SOD2 shows an antagonist effect to an anticancer drug and alleviate cytotoxicity inside tumor cells lines B16F0 (mouse melanoma cells) and PAE (porcine aortic endothelial cells). To extend the characterization of Allium SODs and their corresponding genes, a proteomic approach was applied involving two-dimensional gel electrophoresis and LC-MS/MS analyses. From peptide sequence data obtained by mass spectrometry and sequences homologies, primers were defined and a cDNA fragment of 456 bp was amplified by RT-PCR. The cDNA nucleotide sequence analysis revealed an open reading frame coding for 152 residues. The deduced amino acid sequence showed high identity (82-87%) with sequences of Cu, Zn-SODs from other plant species. Molecular analysis was achieved by a protein 3D structural model.
Epitopes of human testis-specific lactate dehydrogenase deduced from a cDNA sequence
DOE Office of Scientific and Technical Information (OSTI.GOV)
Millan, J.L.; Driscoll, C.E.; LeVan, K.M.
The sequence and structure of human testis-specific L-lactate dehydrogenase (LDHC/sub 4/, LDHX; (L)-lactate:NAD/sup +/ oxidoreductase, EC 1.1.1.27) has been derived from analysis of a complementary DNA (cDNA) clone comprising the complete protein coding region of the enzyme. From the deduced amino acid sequence, human LDHC/sub 4/ is as different from rodent LDHC/sub 4/ (73% homology) as it is from human LDHA/sub 4/ (76% homology) and porcine LDHB/sub 4/ (68% homology). Subunit homologies are consistent with the conclusion that the LDHC gene arose by at least two independent duplication events. Furthermore, the lower degree of homology between mouse and human LDHC/submore » 4/ and the appearance of this isozyme late in evolution suggests a higher rate of mutation in the mammalian LDHC genes than in the LDHA and -B genes. Comparison of exposed amino acid residues of discrete anti-genic determinants of mouse and human LDHC/sub 4/ reveals significant differences. Knowledge of the human LDHC/sub 4/ sequence will help design human-specific peptides useful in the development of a contraceptive vaccine.« less
Deyashiki, Y; Tamada, Y; Miyabe, Y; Nakanishi, M; Matsuura, K; Hara, A
1995-08-01
Human liver cytosol contains multiple forms of 3 alpha-hydroxysteroid dehydrogenase and dihydrodiol dehydrogenase with hydroxysteroid dehydrogenase activity, and multiple cDNAs for the enzymes have been cloned from human liver cDNA libraries. To understand the relationship of the multiple enzyme froms to the genes, a cDNA, which has been reported to code for an isoenzyme of human liver 3 alpha-hydroxysteroid/dihydrodiol dehydrogenase, was expressed in Escherichia coli. The recombinant enzyme showed structural and functional properties almost identical to those of the isoenzyme purified from human liver. In addition, the recombinant isoenzyme efficiently reduced 5 alpha-dihydrotestosterone and 5 beta-dihydrocortisone, the known substrates of human liver 3 alpha-hydroxysteroid dehydrogenase and chlordecone reductase previously purified, which suggests that these human liver enzymes are identical. Furthermore, the steady-state kinetic data for NADP(+)-linked (S)-1-indanol oxidation by the recombinant isoenzyme were consistent with a sequential ordered mechanism in which NADP+ binds first. Phenolphthalein inhibited this isoenzyme much more potently than it did the other human liver dihydrodiol dehydrogenases, and was a competitive inhibitor (Ki = 20 nM) that bound to the enzyme-NADP+ complex.
Characterization and chromosomal mapping of the human TFG gene involved in thyroid carcinoma
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mencinger, M.; Panagopoulos, I.; Andreasson, P.
1997-05-01
Homology searches in the Expressed Sequence Tag Database were performed using SPYGQ-rich regions as query sequences to find genes encoding protein regions similar to the N-terminal parts of the sarcoma-associated EWS and FUS proteins. Clone 22911 (T74973), encoding a SPYGQ-rich region in its 5{prime} end, and several other clones that overlapped 22911 were selected. The combined data made it possible to assemble a full-length cDNA sequence. This cDNA sequence is 1677 bp, containing an initiation codon ATG, an open reading frame of 400 amino acids, a poly(A) signal, and a poly(A) tail. We found 100% identity between the 5{prime} partmore » of the consensus sequence and the 598-bp-long sequence named TFG. The TFG sequence is fused to the 3{prime} end of NTRK1, generating the TRK-T3 fusion transcript found in papillary thyroid carcinoma. The cDNA therefore represents the full-length transcript of the TFG gene. TFG was localized to 3q11-q12 by fluorescence in situ hybridization. The 3{prime} and the 5{prime} ends of the TFG cDNA probe hybridized to a 2.2-kb band on Northern blot filters in all tissues examined. 28 refs., 5 figs., 1 tab.« less
Molecular cloning of a cDNA encoding the glycoprotein of hen oviduct microsomal signal peptidase.
Newsome, A L; McLean, J W; Lively, M O
1992-01-01
Detergent-solubilized hen oviduct signal peptidase has been characterized previously as an apparent complex of a 19 kDa protein and a 23 kDa glycoprotein (GP23) [Baker & Lively (1987) Biochemistry 26, 8561-8567]. A cDNA clone encoding GP23 from a chicken oviduct lambda gt11 cDNA library has now been characterized. The cDNA encodes a protein of 180 amino acid residues with a single site for asparagine-linked glycosylation that has been directly identified by amino acid sequence analysis of a tryptic-digest peptide containing the glycosylated site. Immunoblot analysis reveals cross-reactivity with a dog pancreas protein. Comparison of the deduced amino acid sequence of GP23 with the 22/23 kDa glycoprotein of dog microsomal signal peptidase [Shelness, Kanwar & Blobel (1988) J. Biol. Chem. 263, 17063-17070], one of five proteins associated with this enzyme, reveals that the amino acid sequences are 90% identical. Thus the signal peptidase glycoprotein is as highly conserved as the sequences of cytochromes c and b from these same species and is likely to be found in a similar form in many, if not all, vertebrate species. The data also show conclusively that the dog and avian signal peptidases have at least one protein subunit in common. Images Fig. 1. PMID:1546959
DOE Office of Scientific and Technical Information (OSTI.GOV)
Akileswaran, L.; Brock, B.J.; Cereghino, J.L.
1999-02-01
A cDNA clone encoding a quinone reductase (QR) from the white rot basidiomycete Phanerochaete chrysosporium was isolated and sequenced. The cDNA consisted of 1,007 nucleotides and a poly(A) tail and encoded a deduced protein containing 271 amino acids. The experimentally determined eight-amino-acid N-germinal sequence of the purified QR protein from P. chrysosporium matched amino acids 72 to 79 of the predicted translation product of the cDNA. The M{sub r} of the predicted translation product, beginning with Pro-72, was essentially identical to the experimentally determined M{sub r} of one monomer of the QR dimer, and this finding suggested that QR ismore » synthesized as a proenzyme. The results of in vitro transcription-translation experiments suggested that QR is synthesized as a proenzyme with a 71-amino-acid leader sequence. This leader sequence contains two potential KEX2 cleavage sites and numerous potential cleavage sites for dipeptidyl aminopeptidase. The QR activity in cultures of P. chrysosporium increased following the addition of 2-dimethoxybenzoquinone, vanillic acid, or several other aromatic compounds. An immunoblot analysis indicated that induction resulted in an increase in the amount of QR protein, and a Northern blot analysis indicated that this regulation occurs at the level of the qr mRNA.« less
USDA-ARS?s Scientific Manuscript database
This study was conducted to clone and analyze the expression pattern of a C4H gene encoding cinnamate 4-hydroxylase from kenaf (Hibiscus cannabinus L.). A full-length C4H ortholog was cloned using degenerate primers and the RACE (rapid amplification of cDNA ends) method. The full-length C4H ortholog...
Kawai, Jun; Hayashizaki, Yoshihide
2003-01-01
We propose herein a new method of DNA distribution, whereby DNA clones or PCR products are printed directly onto the pages of books and delivered to users along with relevant scientific information. DNA sheets, comprising water-soluble paper onto which DNA is spotted, can be bound into books. Readers can easily extract the DNA fragments from DNA sheets and amplify them using PCR. We show that DNA sheets can withstand various conditions that may be experienced during bookbinding and delivery, such as high temperatures and humidity. Almost all genes (95%–100% of randomly selected RIKEN mouse cDNA clones) were recovered successfully by use of PCR. Readers can start their experiments after a 2-h PCR amplification without waiting for the delivery of DNA clones. The DNA Book thus provides a novel method for delivering DNA in a timely and cost-effective manner. A sample DNA sheet (carrying RIKEN mouse cDNA clones encoding genes of enzymes for the TCA cycle) is included in this issue for field-testing. We would greatly appreciate it if readers could attempt to extract DNA and report the results and whether the DNA sheet was shipped to readers in good condition. PMID:12819147
An oleate 12-hydroxylase from Ricinus communis L. is a fatty acyl desaturase homolog
DOE Office of Scientific and Technical Information (OSTI.GOV)
Van De Loo, F.J.; Broun, P.; Turner, S.
1995-07-18
Recent spectroscopic evidence implicating a binuclear iron site at the reaction center of fatty acyl desaturases suggested to us that certain fatty acyl hydroxylases may share significant amino acid sequence similarity with desaturases. To test this theory, we prepared a cDNA library from developing endosperm of the castor-oil plant (Ricinus communis L.) and obtained partial nucleotide sequences for 468 anonymous clones that were not expressed at high levels in leaves, a tissue deficient in 12-hydroxyoleic acid. This resulted in the identification of several cDNA clones encoding a polypeptide of 387 amino acids with a predicted molecular weight of 44,407 andmore » with {approx}67% sequence homology to microsomal oleate desaturase from Arabidopsis. Expression of a full-length clone under control of the cauliflower mosaic virus 35S promoter in transgenic tobacco resulted in the accumulation of low levels of 12-hydroxyoleic acid in seeds, indicating that the clone encodes the castor oleate hydroxylase. These results suggest that fatty acyl desaturases and hydroxylases share similar reaction mechanisms and provide an example of enzyme evolution. 26 refs., 6 figs., 1 tab.« less
Hong, Y K; Kim, D H; Beletskii, A; Lee, C; Memili, E; Strauss, W M
2001-04-01
Most conditional expression vectors designed for mammalian cells have been valuable systems for studying genes of interest by regulating their expressions. The available vectors, however, are reliable for the short-length cDNA clones and not optimal for relatively long fragments of genomic DNA or long cDNAs. Here, we report the construction of two bacterial artificial chromosome (BAC) vectors, capable of harboring large inserts and shuttling among Escherichia coli, yeast, and mammalian cells. These two vectors, pEYMT and pEYMI, contain conditional expression systems which are designed to be regulated by tetracycline and mouse interferons, respectively. To test the properties of the vectors, we cloned in both vectors the green fluorescence protein (GFP) through an in vitro ligation reaction and the 17.8-kb-long X-inactive-specific transcript (Xist) cDNA through homologous recombination in yeast. Subsequently, we characterized their regulated expression properties using real-time quantitative RT-PCR (TaqMan) and RNA-fluorescent in situ hybridization (FISH). We demonstrate that these two BAC vectors are good systems for recombination-based cloning and regulated expression of large genes in mammalian cells. Copyright 2001 Academic Press.
Payne, G; Ahl, P; Moyer, M; Harper, A; Beck, J; Meins, F; Ryals, J
1990-01-01
Complementary DNA clones encoding two isoforms of the acidic endochitinase (chitinase, EC 3.2.1.14) from tobacco were isolated. Comparison of amino acid sequences deduced from the cDNA clones and the sequence of peptides derived from purified proteins show that these clones encode the pathogenesis-related proteins PR-P and PR-Q. The cDNA inserts were not homologous to either the bacterial form of chitinase or the form from cucumber but shared significant homology to the basic form of chitinase from tobacco and bean. The acidic isoforms of tobacco chitinase did not contain the amino-terminal, cysteine-rich "hevein" domain found in the basic isoforms, indicating that this domain, which binds chitin, is not essential for chitinolytic activity. The accumulation of mRNA for the pathogenesis-related proteins PR-1, PR-R, PR-P, and PR-Q in Xanthi.nc tobacco leaves following infection with tobacco mosaic virus was measured by primer extension. The results indicate that the induction of these proteins during the local necrotic lesion response to the virus is coordinated at the mRNA level. Images PMID:2296608
Li, XiaoChing; Wang, Xiu-Jie; Tannenhauser, Jonathan; Podell, Sheila; Mukherjee, Piali; Hertel, Moritz; Biane, Jeremy; Masuda, Shoko; Nottebohm, Fernando; Gaasterland, Terry
2007-01-01
Vocal learning and neuronal replacement have been studied extensively in songbirds, but until recently, few molecular and genomic tools for songbird research existed. Here we describe new molecular/genomic resources developed in our laboratory. We made cDNA libraries from zebra finch (Taeniopygia guttata) brains at different developmental stages. A total of 11,000 cDNA clones from these libraries, representing 5,866 unique gene transcripts, were randomly picked and sequenced from the 3′ ends. A web-based database was established for clone tracking, sequence analysis, and functional annotations. Our cDNA libraries were not normalized. Sequencing ESTs without normalization produced many developmental stage-specific sequences, yielding insights into patterns of gene expression at different stages of brain development. In particular, the cDNA library made from brains at posthatching day 30–50, corresponding to the period of rapid song system development and song learning, has the most diverse and richest set of genes expressed. We also identified five microRNAs whose sequences are highly conserved between zebra finch and other species. We printed cDNA microarrays and profiled gene expression in the high vocal center of both adult male zebra finches and canaries (Serinus canaria). Genes differentially expressed in the high vocal center were identified from the microarray hybridization results. Selected genes were validated by in situ hybridization. Networks among the regulated genes were also identified. These resources provide songbird biologists with tools for genome annotation, comparative genomics, and microarray gene expression analysis. PMID:17426146
Comparison of the canine and human acid {beta}-galactosidase gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ahern-Rindell, A.J.; Kretz, K.A.; O`Brien, J.S.
Several canine cDNA libraries were screened with human {beta}-galactosidase cDNA as probe. Seven positive clones were isolated and sequenced yielding a partial (2060 bp) canine {beta}-galactosidase cDNA with 86% identity to the human {beta}-galactosidase cDNA. Preliminary analysis of a canine genomic library indicated conservation of exon number and size. Analysis by Northern blotting disclosed a single mRNA of 2.4 kb in fibroblasts and liver from normal dogs and dogs affected with GM1 gangliosidosis. Although incomplete, these results indicate canine GM1 gangliosidosis is a suitable animal model of the human disease and should further efforts to devise a gene therapy strategymore » for its treatment. 20 refs., 2 figs., 1 tab.« less
A novel role for the Bombyx Slbo homologue, BmC/EBP, in insect choriogenesis.
Sourmeli, S; Papantonis, A; Lecanidou, R
2005-11-18
One previously unidentified cDNA clone coding for a C/EBP factor, BmC/EBP, was isolated from Bombyx mori follicular cells. This is the first time that a C/EBP factor has been isolated and characterized in Lepidoptera. We provide information concerning structural features and developmental specificity, as well as in vitro interaction properties with chorion gene promoter modules. BmC/EBP was capable of effectively recognizing homologous binding sites from chorion gene promoters derived from flies and other moths, despite significant diversity of chorion structure, gene organization, and gene expression profiles. We propose that the relative concentration of BmC/EBP, in relation to its differential binding affinity for promoter cis-elements, results in activation or repression of silkmoth chorion gene expression.
Dipeptidyl peptidase III is a zinc metallo-exopeptidase. Molecular cloning and expression.
Fukasawa, K; Fukasawa, K M; Kanai, M; Fujii, S; Hirose, J; Harada, M
1998-01-01
We have purified dipeptidyl peptidase III (EC 3.4.14.4) from human placenta. It had a pH optimum of 8.8 and readily hydrolysed Arg-Arg-beta-naphthylamide. Monoamino acid-, Gly-Phe-, Gly-Pro- and Bz-Arg-beta-naphthylamides were not hydrolysed at all. The enzyme was inhibited by p-chloromercuriphenylsulphonic acid, metal chelators and 3,4-dichloroisocoumarin and contained 1 mol of zinc per mol of enzyme. The zinc dissociation constant was 250 fM at pH 7. 4 as determined by the zinc binding study. We isolated, by immunological screening of a Uni-ZAP XR cDNA library constructed from rat liver mRNA species, a cDNA clone with 2633 bp encoding the rat enzyme. The longest open reading frame encodes a 827-residue protein with a theoretical molecular mass of 92790 Da. Escherichia coli SOLR cells were infected with the pBluescript phagemid containing the cloned cDNA and established the overexpression of a protein that hydrolysed Arg-Arg-beta-naphthylamide. The recombinant protein was purified and the amino acid sequence of the protein was confirmed. We presumed that the putative zinc-binding domain involved in catalysis was present in the recombinant enzyme. It was a novel zinc-binding motif in that one amino acid residue was inserted into the conserved HEXXH motif characteristic of the metalloproteinases. PMID:9425109
Sarker, Lukman S; Galata, Mariana; Demissie, Zerihun A; Mahmoud, Soheil S
2012-12-15
Several varieties of Lavandula x intermedia (lavandins) are cultivated for their essential oils (EOs) for use in cosmetic, hygiene and personal care products. These EOs are mainly constituted of monoterpenes including camphor, which contributes an off odor reducing the olfactory appeal of the oil. We have recently constructed a cDNA library from the glandular trichomes (the sites of EO synthesis) of L. x intermedia plants. Here, we describe the cloning of a borneol dehydrogenase cDNA (LiBDH) from this library. The 780 bp open reading frame of the cDNA encoded a 259 amino acid short chain alcohol dehydrogenase with a predicted molecular mass of ca. 27.5 kDa. The recombinant LiBDH was expressed in Escherichia coli, purified by Ni-NTA agarose affinity chromatography, and functionally characterized in vitro. The bacterially produced enzyme specifically converted borneol to camphor as the only product with K(m) and k(cat) values of 53 μM and 4.0 × 10(-4) s(-1), respectively. The LiBDH transcripts were specifically expressed in glandular trichomes of mature flowers indicating that like other Lavandula monoterpene synthases the expression of this gene is regulated in a tissue-specific manner. The cloning of LiBDH has far reaching implications in improving the quality of Lavandula EOs through metabolic engineering. Copyright © 2012 Elsevier Inc. All rights reserved.
Characterization and mapping of cDNA encoding aspartate aminotransferase in rice, Oryza sativa L.
Song, J; Yamamoto, K; Shomura, A; Yano, M; Minobe, Y; Sasaki, T
1996-10-31
Fifteen cDNA clones, putatively identified as encoding aspartate aminotransferase (AST, EC 2.6.1.1.), were isolated and partially sequenced. Together with six previously isolated clones putatively identified to encode ASTs (Sasaki, et al. 1994, Plant Journal 6, 615-624), their sequences were characterized and classified into 4 cDNA species. Two of the isolated clones, C60213 and C2079, were full-length cDNAs, and their complete nucleotide sequences were determined. C60213 was 1612 bp long and its deduced amino acid sequence showed 88% homology with that of Panicum miliaceum L. mitochondrial AST. The C60213-encoded protein had an N-terminal amino acid sequence that was characteristic of a mitochondrial transit peptide. On the other hand, C2079 was 1546 bp long and had 91% amino acid sequence homology with P. miliaceum L. cytosolic AST but lacked in the transit peptide sequence. The homologies of nucleotide sequences and deduced amino acid sequences of C2079 and C60213 were 54% and 52%, respectively. C2079 and C60213 were mapped on chromosomes 1 and 6, respectively, by restriction fragment length polymorphism linkage analysis. Northern blot analysis using C2079 as a probe revealed much higher transcript levels in callus and root than in green and etiolated shoots, suggesting tissue-specific variations of AST gene expression.
Bärfacker, Lars
2017-01-01
The cDNA of the mineralocorticoid receptor (MR) was cloned 30 years ago, in 1987. At that time, spirolactone, the first generation of synthetic steroid-based MR antagonists (MRAs), which was identified in preclinical in vivo models, had already been in clinical use for 30 years. Subsequent decades of research and development by Searle & Co., Ciba-Geigy, Roussel Uclaf and Schering AG toward identifying a second generation of much more specific steroidal MRAs were all based on the initial 17-spirolactone construct. The salient example is eplerenone, first described in 1987, coincidentally with the cloning of MR cDNA. Its launch on the market in 2003 paralleled intensive drug discovery programs for a new generation of non-steroidal MRAs. Now, 30 years after the cDNA cloning of MR and 60 years of clinical use of steroidal MRAs, novel non-steroidal MRAs such as apararenone, esaxerenone and finerenone are in late-stage clinical trials in patients with heart failure, chronic kidney disease (CKD), hypertension and liver disease. Finerenone has already been studied in over 2000 patients with heart failure plus chronic kidney disease and/or diabetes, and in patients with diabetic kidney disease, in five phase II clinical trials. Here, we reflect on the history of the various generations of MRAs and review characteristics of the most important steroidal and non-steroidal MRAs. PMID:28634268
Henderson, R A; Krissansen, G W; Yong, R Y; Leung, E; Watson, J D; Dholakia, J N
1994-12-02
Protein synthesis in mammalian cells is regulated at the level of the guanine nucleotide exchange factor, eIF-2B, which catalyzes the exchange of eukaryotic initiation factor 2-bound GDP for GTP. We have isolated and sequenced cDNA clones encoding the delta-subunit of murine eIF-2B. The cDNA sequence encodes a polypeptide of 544 amino acids with molecular mass of 60 kDa. Antibodies against a synthetic polypeptide of 30 amino acids deduced from the cDNA sequence specifically react with the delta-subunit of mammalian eIF-2B. The cDNA-derived amino acid sequence shows significant homology with the yeast translational regulator Gcd2, supporting the hypothesis that Gcd2 may be the yeast homolog of the delta-subunit of mammalian eIF-2B. Primer extension studies and anchor polymerase chain reaction analysis were performed to determine the 5'-end of the transcript for the delta-subunit of eIF-2B. Results of these experiments demonstrate two different mRNAs for the delta-subunit of eIF-2B in murine cells. The isolation and characterization of two different full-length cDNAs also predicts the presence of two alternate forms of the delta-subunit of eIF-2B in murine cells. These differ at their amino-terminal end but have identical nucleotide sequences coding for amino acids 31-544.
Chow, C M; Yagüe, E; Raguz, S; Wood, D A; Thurston, C F
1994-01-01
A 52-kDa protein, CEL3, has been separated from the culture filtrate of Agaricus bisporus during growth on cellulose. A PCR-derived probe was made, with a degenerate oligodeoxynucleotide derived from the amino acid sequence of a CEL3 CNBr cleavage product and was used to select cel3 cDNA clones from an A. bisporus cDNA library. Two allelic cDNAs were isolated. They showed 98.8% identity of their nucleotide sequences. The deduced amino acid sequence and domain architecture of CEL3 showed a high degree of similarity to those of cellobiohydrolase II of Trichoderma reesei. Functional expression of cel3 cDNA in Saccharomyces cerevisiae was achieved by placing it under the control of a constitutive promoter and fusing it to the yeast invertase signal sequence. Recombinant CEL3 secreted by yeast showed enzymatic activity towards crystalline cellulose. At long reaction times, CEL3 was also able to degrade carboxymethyl cellulose. Northern (RNA) analysis showed that cel3 gene expression was induced by cellulose and repressed by glucose, fructose, 2-deoxyglucose, and lactose. Glycerol, mannitol, sorbitol, and maltose were neutral carbon sources. Nuclear run-on analysis showed that the rate of synthesis of cel3 mRNA in cellulose-grown cultures was 13 times higher than that in glucose-grown cultures. A low basal rate of cel3 mRNA synthesis was observed in the nuclei isolated from glucose-grown mycelia. Images PMID:8085821
Mapping Flagellar Genes in Chlamydomonas Using Restriction Fragment Length Polymorphisms
Ranum, LPW.; Thompson, M. D.; Schloss, J. A.; Lefebvre, P. A.; Silflow, C. D.
1988-01-01
To correlate cloned nuclear DNA sequences with previously characterized mutations in Chlamydomonas and, to gain insight into the organization of its nuclear genome, we have begun to map molecular markers using restriction fragment length polymorphisms (RFLPs). A Chlamydomonas reinhardtii strain (CC-29) containing phenotypic markers on nine of the 19 linkage groups was crossed to the interfertile species Chlamydomonas smithii. DNA from each member of 22 randomly selected tetrads was analyzed for the segregation of RFLPs associated with cloned genes detected by hybridization with radioactive DNA probes. The current set of markers allows the detection of linkage to new molecular markers over approximately 54% of the existing genetic map. This study focused on mapping cloned flagellar genes and genes whose transcripts accumulate after deflagellation. Twelve different molecular clones have been assigned to seven linkage groups. The α-1 tubulin gene maps to linkage group III and is linked to the genomic sequence homologous to pcf6-100, a cDNA clone whose corresponding transcript accumulates after deflagellation. The α-2 tubulin gene maps to linkage group IV. The two β-tubulin genes are linked, with the β-1 gene being approximately 12 cM more distal from the centromere than the β-2 gene. A clone corresponding to a 73-kD dynein protein maps to the opposite arm of the same linkage group. The gene corresponding to the cDNA clone pcf6-187, whose mRNA accumulates after deflagellation, maps very close to the tightly linked pf-26 and pf-1 mutations on linkage group V. PMID:2906025
Kerschner, Joseph E; Erdos, Geza; Hu, Fen Ze; Burrows, Amy; Cioffi, Joseph; Khampang, Pawjai; Dahlgren, Margaret; Hayes, Jay; Keefe, Randy; Janto, Benjamin; Post, J Christopher; Ehrlich, Garth D
2010-04-01
We sought to construct and partially characterize complementary DNA (cDNA) libraries prepared from the middle ear mucosa (MEM) of chinchillas to better understand pathogenic aspects of infection and inflammation, particularly with respect to leukotriene biogenesis and response. Chinchilla MEM was harvested from controls and after middle ear inoculation with nontypeable Haemophilus influenzae. RNA was extracted to generate cDNA libraries. Randomly selected clones were subjected to sequence analysis to characterize the libraries and to provide DNA sequence for phylogenetic analyses. Reverse transcription-polymerase chain reaction of the RNA pools was used to generate cDNA sequences corresponding to genes associated with leukotriene biosynthesis and metabolism. Sequence analysis of 921 randomly selected clones from the uninfected MEM cDNA library produced approximately 250,000 nucleotides of almost entirely novel sequence data. Searches of the GenBank database with the Basic Local Alignment Search Tool provided for identification of 515 unique genes expressed in the MEM and not previously described in chinchillas. In almost all cases, the chinchilla cDNA sequences displayed much greater homology to human or other primate genes than with rodent species. Genes associated with leukotriene metabolism were present in both normal and infected MEM. Based on both phylogenetic comparisons and gene expression similarities with humans, chinchilla MEM appears to be an excellent model for the study of middle ear inflammation and infection. The higher degree of sequence similarity between chinchillas and humans compared to chinchillas and rodents was unexpected. The cDNA libraries from normal and infected chinchilla MEM will serve as useful molecular tools in the study of otitis media and should yield important information with respect to middle ear pathogenesis.
Kerschner, Joseph E.; Erdos, Geza; Hu, Fen Ze; Burrows, Amy; Cioffi, Joseph; Khampang, Pawjai; Dahlgren, Margaret; Hayes, Jay; Keefe, Randy; Janto, Benjamin; Post, J. Christopher; Ehrlich, Garth D.
2010-01-01
Objectives We sought to construct and partially characterize complementary DNA (cDNA) libraries prepared from the middle ear mucosa (MEM) of chinchillas to better understand pathogenic aspects of infection and inflammation, particularly with respect to leukotriene biogenesis and response. Methods Chinchilla MEM was harvested from controls and after middle ear inoculation with nontypeable Haemophilus influenzae. RNA was extracted to generate cDNA libraries. Randomly selected clones were subjected to sequence analysis to characterize the libraries and to provide DNA sequence for phylogenetic analyses. Reverse transcription–polymerase chain reaction of the RNA pools was used to generate cDNA sequences corresponding to genes associated with leukotriene biosynthesis and metabolism. Results Sequence analysis of 921 randomly selected clones from the uninfected MEM cDNA library produced approximately 250,000 nucleotides of almost entirely novel sequence data. Searches of the GenBank database with the Basic Local Alignment Search Tool provided for identification of 515 unique genes expressed in the MEM and not previously described in chinchillas. In almost all cases, the chinchilla cDNA sequences displayed much greater homology to human or other primate genes than with rodent species. Genes associated with leukotriene metabolism were present in both normal and infected MEM. Conclusions Based on both phylogenetic comparisons and gene expression similarities with humans, chinchilla MEM appears to be an excellent model for the study of middle ear inflammation and infection. The higher degree of sequence similarity between chinchillas and humans compared to chinchillas and rodents was unexpected. The cDNA libraries from normal and infected chinchilla MEM will serve as useful molecular tools in the study of otitis media and should yield important information with respect to middle ear pathogenesis. PMID:20433028
Zhang, Jianqiang; Go, Yun Young; Huang, Chengjin M.; Meade, Barry J.; Lu, Zhengchun; Snijder, Eric J.; Timoney, Peter J.
2012-01-01
A stable full-length cDNA clone of the modified live virus (MLV) vaccine strain of equine arteritis virus (EAV) was developed. RNA transcripts generated from this plasmid (pEAVrMLV) were infectious upon transfection into mammalian cells, and the resultant recombinant virus (rMLV) had 100% nucleotide identity to the parental MLV vaccine strain of EAV. A single silent nucleotide substitution was introduced into the nucleocapsid gene (pEAVrMLVB), enabling the cloned vaccine virus (rMLVB) to be distinguished from parental MLV vaccine as well as other field and laboratory strains of EAV by using an allelic discrimination real-time reverse transcription (RT)-PCR assay. In vitro studies revealed that the cloned vaccine virus rMLVB and the parental MLV vaccine virus had identical growth kinetics and plaque morphologies in equine endothelial cells. In vivo studies confirmed that the cloned vaccine virus was very safe and induced high titers of neutralizing antibodies against EAV in experimentally immunized horses. When challenged with the heterologous EAV KY84 strain, the rMLVB vaccine virus protected immunized horses in regard to reducing the magnitude and duration of viremia and virus shedding but did not suppress the development of signs of EVA, although these were reduced in clinical severity. The vaccine clone pEAVrMLVB could be further manipulated to improve the vaccine efficacy as well as to develop a marker vaccine for serological differentiation of EAV naturally infected from vaccinated animals. PMID:22739697
Shpakovskiĭ, G V; Lebedenko, E N
1996-12-01
The rpb10+ cDNA from the fission yeast Schizosaccharomyces pombe was cloned using two independent approaches (PCR and genetic suppression). The cloned cDNA encoded the Rpb10 subunit common for all three RNA polymerases. Comparison of the deduced amino acid sequence of the Sz. pombe Rbp10 subunit (71 amino acid residues) with those of the homologous subunits of RNA polymerases I, II, and III from Saccharomyces cerevisiae and Home sapiens revealed that heptapeptides RCFT/SCGK (residues 6-12), RYCCRRM (residues 43-49), and HVDLIEK (residues 53-59) were evolutionarily the most conserved structural motifs of these subunits. It is shown that the Rbp10 subunit from Sz. pombe can substitute its homolog (ABC10 beta) in the baker's yeast S. cerevisiae.
Cloning and expression of trehalose-6-phosphate synthase 1 from Rhizopus oryzae.
Ozer Uyar, Ebru; Yücel, Meral; Hamamcı, Haluk
2016-05-01
Trehalose is a reducing disaccharide acting as a protectant against environmental stresses in many organisms. In fungi, Trehalose-6-phosphate synthase 1 (TPS1) plays a key role in the biosynthesis of trehalose. In this study, a full-length cDNA from Rhizopus oryzae encoding TPS1 (designated as RoTPS1) was isolated. The RoTPS1 cDNA is composed of 2505 nucleotides and encodes a protein of 834 amino acids with a molecular mass of 97.8 kDa. The amino acid sequence of RoTPS1 has a relatively high homology with the TPS1s in several other filamentous fungi. RoTPS1 was cloned into Saccharomyces cerevisiae and secretively expressed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Rapid in silico cloning of genes using expressed sequence tags (ESTs).
Gill, R W; Sanseau, P
2000-01-01
Expressed sequence tags (ESTs) are short single-pass DNA sequences obtained from either end of cDNA clones. These ESTs are derived from a vast number of cDNA libraries obtained from different species. Human ESTs are the bulk of the data and have been widely used to identify new members of gene families, as markers on the human chromosomes, to discover polymorphism sites and to compare expression patterns in different tissues or pathologies states. Information strategies have been devised to query EST databases. Since most of the analysis is performed with a computer, the term "in silico" strategy has been coined. In this chapter we will review the current status of EST databases, the pros and cons of EST-type data and describe possible strategies to retrieve meaningful information.
Nicosia, Aldo; Maggio, Teresa; Mazzola, Salvatore; Cuttitta, Angela
2013-10-30
Anemonia viridis is a widespread and extensively studied Mediterranean species of sea anemone from which a large number of polypeptide toxins, such as blood depressing substances (BDS) peptides, have been isolated. The first members of this class, BDS-1 and BDS-2, are polypeptides belonging to the β-defensin fold family and were initially described for their antihypertensive and antiviral activities. BDS-1 and BDS-2 are 43 amino acid peptides characterised by three disulfide bonds that act as neurotoxins affecting Kv3.1, Kv3.2 and Kv3.4 channel gating kinetics. In addition, BDS-1 inactivates the Nav1.7 and Nav1.3 channels. The development of a large dataset of A. viridis expressed sequence tags (ESTs) and the identification of 13 putative BDS-like cDNA sequences has attracted interest, especially as scientific and diagnostic tools. A comparison of BDS cDNA sequences showed that the untranslated regions are more conserved than the protein-coding regions. Moreover, the KA/KS ratios calculated for all pairwise comparisons showed values greater than 1, suggesting mechanisms of accelerated evolution. The structures of the BDS homologs were predicted by molecular modelling. All toxins possess similar 3D structures that consist of a triple-stranded antiparallel β-sheet and an additional small antiparallel β-sheet located downstream of the cleavage/maturation site; however, the orientation of the triple-stranded β-sheet appears to differ among the toxins. To characterise the spatial expression profile of the putative BDS cDNA sequences, tissue-specific cDNA libraries, enriched for BDS transcripts, were constructed. In addition, the proper amplification of ectodermal or endodermal markers ensured the tissue specificity of each library. Sequencing randomly selected clones from each library revealed ectodermal-specific expression of ten BDS transcripts, while transcripts of BDS-8, BDS-13, BDS-14 and BDS-15 failed to be retrieved, likely due to under-representation in our cDNA libraries. The calculation of the relative abundance of BDS transcripts in the cDNA libraries revealed that BDS-1, BDS-3, BDS-4, BDS-5 and BDS-6 are the most represented transcripts.
Yamamura, Yoshimi; Sahin, F Pinar; Nagatsu, Akito; Mizukami, Hajime
2003-04-01
A cDNA (LEPS-2) encoding a novel cell wall protein was cloned from shikonin-producing callus tissues of Lithospermum erythrorhizon by differential display between a shikonin-producing culture strain and a non-producing strain. The LEPS-2 cDNA encoded a polypeptide of 184 amino acids. The deduced amino acid sequence exhibited no significant homology with known proteins. Expression of LEPS-2 gene as well as accumulation of LEPS-2 protein was highly correlated with shikonin production in L. erythrorhizon cells in culture. In the intact plant, expression of LEPS-2 was detected only in the roots where shikonin pigments accumulated. Cell fractionation experiments and immunocytochemical analysis showed that the protein was localized in the apoplast fraction of the cell walls. The shikonin pigments were also stored on the cell walls as oil droplets. These results indicate that expression of the LEPS-2 is closely linked with shikonin biosynthesis and the LEPS-2 protein may be involved in the intra-cell wall trapping of shikonin pigments.
Human retina-specific amine oxidase (RAO): cDNA cloning, tissue expression, and chromosomal mapping
DOE Office of Scientific and Technical Information (OSTI.GOV)
Imamura, Yutaka; Kubota, Ryo; Wang, Yimin
In search of candidate genes for hereditary retinal disease, we have employed a subtractive and differential cDNA cloning strategy and isolated a novel retina-specific cDNA. Nucleotide sequence analysis revealed an open reading frame of 2187 bp, which encodes a 729-amino-acid protein with a calculated molecular mass of 80,644 Da. The putative protein contained a conserved domain of copper amine oxidase, which is found in various species from bacteria to mammals. It showed the highest homology to bovine serum amine oxidase, which is believed to control the level of serum biogenic amines. Northern blot analysis of human adult and fetal tissuesmore » revealed that the protein is expressed abundantly and specifically in retina as a 2.7-kb transcript. Thus, we considered this protein a human retina-specific amine oxidase (RAO). The RAO gene (AOC2) was mapped by fluorescence in situ hybridization to human chromosome 17q21. We propose that AOC2 may be a candidate gene for hereditary ocular diseases. 38 refs., 4 figs.« less
NASA Astrophysics Data System (ADS)
Zhao, Liyuan; Mi, Tiezhu; Zhen, Yu; Yu, Zhigang
2012-05-01
Mitochondrial cytochrome b (Cytb), one of the few proteins encoded by the mitochondrial DNA, plays an important role in transferring electrons. As a mitochondrial gene, it has been widely used for phylogenetic analysis. Previously, a 949-bp fragment of the coding gene and mRNA editing were characterized from Prorocentrum donghaiense, which might prove useful for resolving P. donghaiense from closely related species. However, the full-length coding region has not been characterized. In this study, we used rapid amplification of cDNA ends (RACE) to obtain full-length, 1 124 bp cDNA. Cytb transcript contained a standard initiation codon ATG, but did not have a recognizable stop codon. Homology comparison showed that the P. donghaiense Cytb had a high sequence identity to Cytb sequences from other dinoflagellate species. Phylogenetic analysis placed Cytb from P. donghaiense in the clade of dinoflagellates and it clustered together strongly with that from P. minimum. Based on the full-length sequence, we inferred 32 editing events at different positions, accounting for 2.93% of the Cytb gene. 34.4% (11) of the changes were A to G, 25% (8) were T to C, and 25% (8) were C to U, with smaller proportions of G to C and G to A edits (9.4% (3) and 6.2% (2), respectively). The expression level of the Cytb transcript was quantified by real-time PCR with a TaqMan probe at different times during the whole growth phase. The average Cytb transcript was present at 39.27±7.46 copies of cDNA per cell during the whole growth cycle, and the expression of Cytb was relatively stable over the different phases. These results deepen our understanding of the structure and characteristics of Cytb in P. donghaiense, and confirmed that Cytb in P. donghaiense is a candidate reference gene for studying the expression of other genes.
Anisimov, S V; Bokheler, K R; Khavinson, V Kh; Anisimov, V N
2002-03-01
Expression of 15,247 clones from a cDNA library in the heart of mice receiving Vilon and Epithalon was studied by DNA-microarray technology. We revealed 300 clones (1.94% of the total count), whose expression changed more than by 2 times. Vilon changed expression of 36 clones, while Epithalon modulated expression of 98 clones. Combined treatment with Vilon and Epithalon changed expression of 144 clones. Vilon alone or in combination with Epithalon activated expression of 157 clones (maximally by 6.13 times) and inhibited expression of 23 clones (maximally by 2.79 times). Epithalon alone or in combination with Vilon activated expression of 194 clones (maximally by 6.61 times) and inhibited expression of 48 clones (maximally by 2.71 times). Our results demonstrate the specific effects of Epithalon and Vilon on gene expression.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chen, M.; Auerbach, W.; Buchwald, M.
1994-09-01
Fanconi anemia (FA) is an autosomal recessive disease characterized by bone marrow failure, congenital malformations and predisposition to malignancies. The gene responsible for the defect in FA group C has been cloned and designated the Fanconi Anemia Complementation Group C gene (FACC). A murine cDNA for this gene (Facc) was also cloned. Here we report our progress in the establishment of a mouse model for FA. The mouse Facc cDNA was used as probe to screen a genomic library of mouse strain 129. More than twenty positive clones were isolated. Three of them were mapped and found to be overlappingmore » clones, encompassing the genomic region from exon 8 to the end of the 3{prime} UTR of the mouse cDNA. A targeting vector was constructed using the most 5{prime} mouse genomic sequence available. The end result of the homologous recombination is that exon 8 is deleted and the neo gene is inserted. The last exon, exon 14, is essential for the complementing function of the FACC gene product; the disruption in the middle of the murine Facc gene should render this locus biologically inactive. This targeting vector was linearized and electroporated into R1 embryonic stem (ES) cells which were derived from the 129 mouse. Of 102 clones screened, 19 positive cell lines were identified. Four targeted cell lines have been used to produce chimeric mice. 129-derived ES cells were aggregated ex vivo into the morulas derived from CD1 mice and then implanted into foster mothers. 22 chimeras have been obtained. Moderately and strongly chimeric mice have been bred to test for germline transmission. Progeny with the expected coat color derived from 2 chimeras are currently being examined to confirm transmission of the targeted allele.« less
cDNA sequence and expression of a cold-responsive gene in Citrus unshiu.
Hara, M; Wakasugi, Y; Ikoma, Y; Yano, M; Ogawa, K; Kuboi, T
1999-02-01
A cDNA clone encoding a protein (CuCOR19), the sequence of which is similar to Poncirus COR19, of the dehydrin family was isolated from the epicarp of Citrus unshiu. The molecular mass of the predicted protein was 18,980 daltons. CuCOR19 was highly hydrophilic and contained three repeating elements including Lys-rich motifs. The gene expression in leaves increased by cold stress.
Lectin cDNA and transgenic plants derived therefrom
Raikhel, Natasha V.
2000-10-03
Transgenic plants containing cDNA encoding Gramineae lectin are described. The plants preferably contain cDNA coding for barley lectin and store the lectin in the leaves. The transgenic plants, particularly the leaves exhibit insecticidal and fungicidal properties.
Vallée, Maud; Gravel, Catherine; Palin, Marie-France; Reghenas, Hélène; Stothard, Paul; Wishart, David S; Sirard, Marc-André
2005-07-01
The main objective of the present study was to identify novel oocyte-specific genes in three different species: bovine, mouse, and Xenopus laevis. To achieve this goal, two powerful technologies were combined: a polymerase chain reaction (PCR)-based cDNA subtraction, and cDNA microarrays. Three subtractive libraries consisting of 3456 clones were established and enriched for oocyte-specific transcripts. Sequencing analysis of the positive insert-containing clones resulted in the following classification: 53% of the clones corresponded to known cDNAs, 26% were classified as uncharacterized cDNAs, and a final 9% were classified as novel sequences. All these clones were used for cDNA microarray preparation. Results from these microarray analyses revealed that in addition to already known oocyte-specific genes, such as GDF9, BMP15, and ZP, known genes with unknown function in the oocyte were identified, such as a MLF1-interacting protein (MLF1IP), B-cell translocation gene 4 (BTG4), and phosphotyrosine-binding protein (xPTB). Furthermore, 15 novel oocyte-specific genes were validated by reverse transcription-PCR to confirm their preferential expression in the oocyte compared to somatic tissues. The results obtained in the present study confirmed that microarray analysis is a robust technique to identify true positives from the suppressive subtractive hybridization experiment. Furthermore, obtaining oocyte-specific genes from three species simultaneously allowed us to look at important genes that are conserved across species. Further characterization of these novel oocyte-specific genes will lead to a better understanding of the molecular mechanisms related to the unique functions found in the oocyte.
Fang, Ying; Rowland, Raymond R R; Roof, Michael; Lunney, Joan K; Christopher-Hennings, Jane; Nelson, Eric A
2006-12-01
The recent emergence of a unique group of North American type 1 porcine reproductive and respiratory syndrome virus (PRRSV) in the United States presents new disease control problems for a swine industry that has already been impacted seriously by North American type 2 PRRSV. In this study, a full-length cDNA infectious clone was generated from a low-virulence North American type 1 PRRSV isolate, SD01-08. In vitro studies demonstrated that the cloned virus maintained growth properties similar to those of the parental virus. Virological, pathological, and immunological observations from animals challenged with cloned viruses were similar to those from animals challenged with the parental virus and a modified live virus vaccine. To further explore the potential use as a viral backbone for expressing foreign genes, the green fluorescent protein (GFP) was inserted into a unique deletion site located at amino acid positions 348 and 349 of the predicted Nsp2 region in the virus, and expression of the Nsp2-GFP fusion protein was visualized by fluorescent microscopy. The availability of this North American type 1 infectious clone provides an important research tool for further study of the basic viral biology and pathogenic mechanisms of this group of type 1 PRRSV in the United States.
Fang, Ying; Rowland, Raymond R. R.; Roof, Michael; Lunney, Joan K.; Christopher-Hennings, Jane; Nelson, Eric A.
2006-01-01
The recent emergence of a unique group of North American type 1 porcine reproductive and respiratory syndrome virus (PRRSV) in the United States presents new disease control problems for a swine industry that has already been impacted seriously by North American type 2 PRRSV. In this study, a full-length cDNA infectious clone was generated from a low-virulence North American type 1 PRRSV isolate, SD01-08. In vitro studies demonstrated that the cloned virus maintained growth properties similar to those of the parental virus. Virological, pathological, and immunological observations from animals challenged with cloned viruses were similar to those from animals challenged with the parental virus and a modified live virus vaccine. To further explore the potential use as a viral backbone for expressing foreign genes, the green fluorescent protein (GFP) was inserted into a unique deletion site located at amino acid positions 348 and 349 of the predicted Nsp2 region in the virus, and expression of the Nsp2-GFP fusion protein was visualized by fluorescent microscopy. The availability of this North American type 1 infectious clone provides an important research tool for further study of the basic viral biology and pathogenic mechanisms of this group of type 1 PRRSV in the United States. PMID:16971421
Premraj, Avinash; Nautiyal, Binita; Aleyas, Abi G; Rasool, Thaha Jamal
2015-10-01
Interleukin-26 (IL-26) is a member of the IL-10 family of cytokines. Though conserved across vertebrates, the IL-26 gene is functionally inactivated in a few mammals like rat, mouse and horse. We report here the identification, isolation and cloning of the cDNA of IL-26 from the dromedary camel. The camel cDNA contains a 516 bp open reading frame encoding a 171 amino acid precursor protein, including a 21 amino acid signal peptide. Sequence analysis revealed high similarity with other mammalian IL-26 homologs and the conservation of IL-10 cytokine family domain structure including key amino acid residues. We also report the identification and cloning of four novel transcript variants produced by alternative splicing at the Exon 3-Exon 4 regions of the gene. Three of the alternative splice variants had premature termination codons and are predicted to code for truncated proteins. The transcript variant 4 (Tv4) having an insertion of an extra 120 bp nucleotides in the ORF was predicted to encode a full length protein product with 40 extra amino acid residues. The mRNA transcripts of all the variants were identified in lymph node, where as fewer variants were observed in other tissues like blood, liver and kidney. The expression of Tv2 and Tv3 were found to be up regulated in mitogen induced camel peripheral blood mononuclear cells. IL-26-Tv2 expression was also induced in camel fibroblast cells infected with Camel pox virus in-vitro. The identification of the transcript variants of IL-26 from the dromedary camel is the first report of alternative splicing for IL-26 in a species in which the gene has not been inactivated. Copyright © 2015 Elsevier Ltd. All rights reserved.
Yang, G; Liu, X G; Qiu, B S
2000-07-01
The complete nucleotides of two Chinese tobacco mosaic virus (TMV) isolates, TMV-Cv (vulgare strain) and TMV-N14 (an attenuated virus originated from a tomato strain), were determined from their respective full-length infectious cDNA clones and compared with published TMV sequences. The genome structure of TMV-Cv contained 6395 nucleotides, in which four functional open reading frames (ORF), coding for replicase (126 kD/183 kD), movement protein (MP, 30 kD) and coat protein (CP, 17.6 kD) respectively, could be recognized. TMV-N14 contained 6384 nucleotides in its genome. In contrast to TMV-Cv, five functional ORFs encoding the replicase 98.5 kD/126 kD/183 kD, MP(27 kD) and CP(17.6 kD), respectively, were detected in the TMV-N14 genome. TMV-Cv is 99% homologous to a Korean TMV isolate belonging to the vulgare strain at the nucleotide level. TMV-N14 is 99% homologous to a highly virulent Japanese isolate TMV-L (tomato strain) at the nucleotide level. In TMV-N14, one opal nulation (UGA) occurred in the replicase gene and one ochre nutation (UAA) in the MP gene. The former mutation created a potential, additional ORF within the replicase gene, the latter reduced the size of the MP to 27 kD. In addition, there were also 13 amino acid substitutions in the replicase gene of TMV-N14 when compared to that of TMV-L. Collectively, these changes may have significant implications in the attenuation of the virulence of TMV-N14.
Molecular and analysis of a phenylalanine ammonia-lyase gene (LrPAL2) from Lycoris radiata.
Jiang, Yumei; Xia, Bing; Liang, Lijian; Li, Xiaodan; Xu, Sheng; Peng, Feng; Wang, Ren
2013-03-01
Phenylalanine ammonia-lyase (PAL), the first enzyme of phenylpropanoid biosynthesis, participates in the biosynthesis of flavonoids, lignins, stilbenes and many other compounds. In this study, we cloned a 2,326 bp full-length PAL2 gene from Lycoris radiata by using degenerate oligonucleotide primer PCR (DOP-PCR) and the rapid amplification of cDNA ends method. The cDNA contains a 2,124 bp coding region encoding 707 amino acids. The LrPAL2 shares about 77.0 % nucleic acid identity and 83 % amino acid identity with LrPAL1. Furthermore, genome sequence analysis demonstrated that LrPAL2 gene contains one intron and two exons. The 5' flanking sequence of LrPAL2 was also cloned by self-formed adaptor PCR (SEFA-PCR), and a group of putative cis-acting elements such as TATA box, CAAT box, G box, TC-rich repeats, CGTCA motif and TCA-element were identified. The LrPAL2 was detected in all tissues examined, with high abundance in bulbs at leaf sprouting stage and in petals at blooming stage. Besides, LrPAL2 drastically responded to MJ, SNP and UV, moderately responded to GA and SA, and a little increased under wounding. Comparison of LrPAL2 expression and LrPAL1 expression demonstrated that LrPAL2 can be more significantly induced than LrPAL1 under the above treatments, and LrPAL2 transcripts accumulated prominently at blooming stage, especially in petals, while LrPAL1 transcripts did not accumulated significantly at blooming stage. All these results suggested that LrPAL2 might play distinct roles in different branches of the phenylpropanoid pathway.
Type IV carbonic anhydrase is present in the gills of spiny dogfish (Squalus acanthias).
Gilmour, K M; Bayaa, M; Kenney, L; McNeill, B; Perry, S F
2007-01-01
Physiological and biochemical studies have provided indirect evidence for a membrane-associated carbonic anhydrase (CA) isoform, similar to mammalian type IV CA, in the gills of dogfish (Squalus acanthias). This CA isoform is linked to the plasma membrane of gill epithelial cells by a glycosylphosphatidylinositol anchor and oriented toward the plasma, such that it can catalyze the dehydration of plasma HCO(3)(-) ions. The present study directly tested the hypothesis that CA IV is present in dogfish gills in a location amenable to catalyzing plasma HCO(3)(-) dehydration. Homology cloning techniques were used to assemble a 1,127 base pair cDNA that coded for a deduced protein of 306 amino acids. Phylogenetic analysis suggested that this protein was a type IV CA. For purposes of comparison, a second cDNA (1,107 base pairs) was cloned from dogfish blood; it encoded a deduced protein of 260 amino acids that was identified as a cytosolic CA through phylogenetic analysis. Using real-time PCR and in situ hybridization, mRNA expression for the dogfish type IV CA was detected in gill tissue and specifically localized to pillar cells and branchial epithelial cells that flanked the pillar cells. Immunohistochemistry using a polyclonal antibody raised against rainbow trout type IV CA revealed a similar pattern of CA IV immunoreactivity and demonstrated a limited degree of colocalization with Na(+)-K(+)-ATPase immunoreactivity. The presence and localization of a type IV CA isoform in the gills of dogfish is consistent with the hypothesis that branchial membrane-bound CA with an extracellular orientation contributes to CO(2) excretion in dogfish by catalyzing the dehydration of plasma HCO(3)(-) ions.
Arasu, Abirami; Kumaresan, Venkatesh; Sathyamoorthi, Akila; Chaurasia, Mukesh Kumar; Bhatt, Prasanth; Gnanam, Annie J; Palanisamy, Rajesh; Marimuthu, Kasi; Pasupuleti, Mukesh; Arockiaraj, Jesu
2014-11-01
In this study, we reported a molecular characterization of a novel proto-type galectin-1 from the striped murrel Channa striatus (named as CsGal-1). The full length CsGal-1 was identified from an established striped murrel cDNA library and further we confirmed the sequence by cloning. The complete cDNA sequence of CsGal-1 is 590 base pairs (bp) in length and its coding region encoded a poly peptide of 135 amino acids. The polypeptide contains a galactoside binding lectin domain at 4-135. The domain carries a sugar binding site at 45-74 along with its signatures (H(45)-X-Asn(47)-X-Arg(49) and Trp(69)-X-X-Glu(72)-X-Arg(74)). CsGal-1 shares a highly conserved carbohydrate recognition domain (CRD) with galectin-1 from other proto-type galectin of teleosts. The mRNA expressions of CsGal-1 in healthy and various immune stimulants including Aphanomyces invadans, Aeromonas hydrophila, Escherchia coli lipopolysaccharide and poly I:C injected tissues of C. striatus were examined using qRT-PCR. CsGal-1 mRNA is highly expressed in kidney and is up-regulated with different immune stimulants at various time points. To understand its biological activity, the coding region of CsGal-1 gene was expressed in an E. coli BL21 (DE3) cloning system and its recombinant protein was purified. The recombinant CsGal-1 protein was agglutinated with mouse erythrocytes at a concentration of 4μg/mL in a calcium independent manner. CsGal-1 activity was inhibited by d-galactose at 25mM(-1) and d-glucose and d-fructose at 100mM(-1). The results of microbial binding assay showed that the recombinant CsGal-1 protein agglutinated only with the Gram-negative bacteria. Interestingly, we observed no agglutination against Gram-positive bacteria. Overall, the study showed that CsGal-1 is an important immune gene involved in the recognition and elimination of pathogens in C. striatus. Copyright © 2014 Elsevier GmbH. All rights reserved.
Gao, Jin-Xin; Jing, Jing; Yu, Chuan-Jin; Chen, Jie
2015-06-01
Curvularia lunata is an important maize foliar fungal pathogen that distributes widely in maize growing area in China, and several key pathogenic factors have been isolated. An yeast two-hybrid (Y2H) library is a very useful platform to further unravel novel pathogenic factors in C. lunata. To construct a high-quality full length-expression cDNA library from the C. lunata for application to pathogenesis-related protein-protein interaction screening, total RNA was extracted. The SMART (Switching Mechanism At 5' end of the RNA Transcript) technique was used for cDNA synthesis. Double-stranded cDNA was ligated into the pGADT7-Rec vector with Herring Testes Carrier DNA using homologous recombination method. The ligation mixture was transformed into competent yeast AH109 cells to construct the primary cDNA library. Eventually, a high qualitative library was successfully established according to an evaluation on quality. The transformation efficiency was about 6.39 ×10(5) transformants/3 μg pGADT7-Rec. The titer of the primary cDNA library was 2.5×10(8) cfu/mL. The numbers for the cDNA library was 2.46×10(5). Randomly picked clones show that the recombination rate was 88.24%. Gel electrophoresis results indicated that the fragments ranged from 0.4 kb to 3.0 kb. Melanin synthesis protein Brn1 (1,3,8-hydroxynaphthalene reductase) was used as a "bait" to test the sufficiency of the Y2H library. As a result, a cDNA clone encoding VelB protein that was known to be involved in the regulation of diverse cellular processes, including control of secondary metabolism containing melanin and toxin production in many filamentous fungi was identified. Further study on the exact role of the VelB gene is underway.
Koenig, R; Loss, S; Specht, J; Varrelmann, M; Lüddecke, P; Deml, G
2009-03-01
Beet necrotic yellow vein virus (BNYVV) A type isolates E12 and S8, originating from areas where resistance-breaking had or had not been observed, respectively, served as starting material for studying the influence of sequence variations in BNYVV RNA 3 on virus accumulation in partially resistant sugar beet varieties. Sub-isolates containing only RNAs 1 and 2 were obtained by serial local lesion passages; biologically active cDNA clones were prepared for RNAs 3 which differed in their coding sequences for P25 aa 67, 68 and 129. Sugar beet seedlings were mechanically inoculated with RNA 1+2/RNA 3 pseudorecombinants. The origin of RNAs 1+2 had little influence on virus accumulation in rootlets. E12 RNA 3 coding for V(67)C(68)Y(129) P25, however, enabled a much higher virus accumulation than S8 RNA 3 coding for A(67)H(68)H(129) P25. Mutants revealed that this was due only to the V(67) 'GUU' codon as opposed to the A(67) 'GCU' codon.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Potier, M.C.; Dutriaux, A.; Lambolez, B.
1993-03-01
Ionotropic L-glutamate receptors form transmembrane channels permeant to cations which are involved in synaptic transmission. Nine different subunits coding for non-NMDA (N-methyl-D-aspartate) receptors have been cloned and sequenced in rat. One of them, the GluR5 subunit, has a high affinity binding site for kainate and is expressed in neurons of the developing and adult nervous system. The permeability of the GluR5 receptor channel is modulated by edition of the transcripts. In human, GluR1 and GluR2 cDNAs have been sequenced and mapped to chromosomes 5 and 4, respectively. Also, GluR3 and GluR4 genes have been mapped to chromosome X and 11,more » respectively. Screening of the YAC chromosome 21 library was performed by colony hybridization on nylon Hybond-N filters at high stringency, as previously described, with the pore located in the center of the rat cDNA. Two positive colonies were obtained and analyzed for their YAC content by PFGE and Southern blotting. Only one (HY128) contained a 450-kb YAC hybridizing to the central rat cDNA probe as well as to the 5[prime] and 3[prime] end probes. Since GluR5 and GluR6 are highly homologous in rat, a probe in the 3[prime] untranslated region of GluR6, showing low homology to GluR5, was synthetized by PCR. Sequences and positions of the PCR primers on the rat sequence (9) are from 5[prime] to 3[prime]: CGACAGAAGGTTGCCAGGT (sense, position 2690-2708)/GATGTTCTGCCTTCAGTTCCAC (antisense, 3314-3335). HY128 YAC did not hybridize to the GluR6 probe (data not shown). Southern blot of human genomic DNA and yeast DNA from HY128 clone cut with EcoRI and HindIII showed the same bands of more than 10 and 6.6 kb, respectively, when hybridized to the 3[prime] end rat cDNA probe (data not shown). This last result confirms the presence of human GluR5 gene in HY128.« less
Metatranscriptomics of Soil Eukaryotic Communities.
Yadav, Rajiv K; Bragalini, Claudia; Fraissinet-Tachet, Laurence; Marmeisse, Roland; Luis, Patricia
2016-01-01
Functions expressed by eukaryotic organisms in soil can be specifically studied by analyzing the pool of eukaryotic-specific polyadenylated mRNA directly extracted from environmental samples. In this chapter, we describe two alternative protocols for the extraction of high-quality RNA from soil samples. Total soil RNA or mRNA can be converted to cDNA for direct high-throughput sequencing. Polyadenylated mRNA-derived full-length cDNAs can also be cloned in expression plasmid vectors to constitute soil cDNA libraries, which can be subsequently screened for functional gene categories. Alternatively, the diversity of specific gene families can also be explored following cDNA sequence capture using exploratory oligonucleotide probes.
Unprecedented genomic diversity of AhR1 and AhR2 genes in Atlantic salmon (Salmo salar L.).
Hansson, Maria C; Wittzell, Håkan; Persson, Kerstin; von Schantz, Torbjörn
2004-06-24
Aryl hydrocarbon receptor (AhR) genes encode proteins involved in mediating the toxic responses induced by several environmental pollutants. Here, we describe the identification of the first two AhR1 (alpha and beta) genes and two additional AhR2 (alpha and beta) genes in the tetraploid species Atlantic salmon (Salmo salar L.) from a cosmid library screening. Cosmid clones containing genomic salmon AhR sequences were isolated using a cDNA clone containing the coding region of the Atlantic salmon AhR2gamma as a probe. Screening revealed 14 positive clones, from which four were chosen for further analyses. One of the cosmids contained genomic AhR sequences that were highly similar to the rainbow trout (Oncorhynchus mykiss) AhR2alpha and beta genes. SMART RACE amplified two complete, highly similar but not identical AhR type 2 sequences from salmon cDNA, which from phylogenetic analyses were determined as the rainbow trout AhR2alpha and beta orthologs. The salmon AhR2alpha and beta encode proteins of 1071 and 1058 residues, respectively, and encompass characteristic AhR sequence elements like a basic-helix-loop-helix (bHLH) and two PER-ARNT-SIM (PAS) domains. Both genes are transcribed in liver, spleen and muscle tissues of adult salmon. A second cosmid contained partial sequences, which were identical to the previously characterized AhR2gamma gene. The last two cosmids contained partial genomic AhR sequences, which were more similar to other AhR type 1 fish genes than the four characterized salmon AhR2 genes. However, attempts to amplify the corresponding complete cDNA sequences of the inserts proved very difficult, suggesting that these genes are non-functional or very weakly transcribed in the examined tissues. Phylogenetic analyses of the conserved regions did, however, clearly indicate that these two AhRs belong to the AhR type 1 clade and have been assigned as the Atlantic salmon AhR1alpha and AhR1beta genes. Taken together, these findings demonstrate that multiple AhR genes are present in Atlantic salmon genome, which likely is a consequence of previous genome duplications in the evolutionary past of salmonids. Plausible explanations for the high incidence of AhR genes in fish and more specifically in salmonids, like rapid divergences in specialized functions, are discussed.
Katsu, Kenjiro; Suzuki, Rintaro; Tsuchiya, Wataru; Inagaki, Noritoshi; Yamazaki, Toshimasa; Hisano, Tomomi; Yasui, Yasuo; Komori, Toshiyuki; Koshio, Motoyuki; Kubota, Seiji; Walker, Amanda R; Furukawa, Kiyoshi; Matsui, Katsuhiro
2017-12-11
Dihydroflavonol 4-reductase (DFR) is the key enzyme committed to anthocyanin and proanthocyanidin biosynthesis in the flavonoid biosynthetic pathway. DFR proteins can catalyse mainly the three substrates (dihydrokaempferol, dihydroquercetin, and dihydromyricetin), and show different substrate preferences. Although relationships between the substrate preference and amino acids in the region responsible for substrate specificity have been investigated in several plant species, the molecular basis of the substrate preference of DFR is not yet fully understood. By using degenerate primers in a PCR, we isolated two cDNA clones that encoded DFR in buckwheat (Fagopyrum esculentum). Based on sequence similarity, one cDNA clone (FeDFR1a) was identical to the FeDFR in DNA databases (DDBJ/Gen Bank/EMBL). The other cDNA clone, FeDFR2, had a similar sequence to FeDFR1a, but a different exon-intron structure. Linkage analysis in an F 2 segregating population showed that the two loci were linked. Unlike common DFR proteins in other plant species, FeDFR2 contained a valine instead of the typical asparagine at the third position and an extra glycine between sites 6 and 7 in the region that determines substrate specificity, and showed less activity against dihydrokaempferol than did FeDFR1a with an asparagine at the third position. Our 3D model suggested that the third residue and its neighbouring residues contribute to substrate specificity. FeDFR1a was expressed in all organs that we investigated, whereas FeDFR2 was preferentially expressed in roots and seeds. We isolated two buckwheat cDNA clones of DFR genes. FeDFR2 has unique structural and functional features that differ from those of previously reported DFRs in other plants. The 3D model suggested that not only the amino acid at the third position but also its neighbouring residues that are involved in the formation of the substrate-binding pocket play important roles in determining substrate preferences. The unique characteristics of FeDFR2 would provide a useful tool for future studies on the substrate specificity and organ-specific expression of DFRs.
Evaluation of the arrestin gene in patients with retinitis pigmentosa or an allied disease
DOE Office of Scientific and Technical Information (OSTI.GOV)
DeStefano, D.J.; Berson, E.L.; Dryja, T.P.
1994-09-01
Arrestin, also called 48K protein or S-antigen, plays a role in deactivating rhodopsin, the photosensitive, seven-helix, G-protein receptor found in rod photoreceptors. In Drosophila, null mutations in arrestin genes cause a light-dependent photoreceptor degeneration. It is possible that a comparable photoreceptor degeneration in humans is caused by defects in the rod arrestin gene. In order to evaluate this possibility, we are characterizing the human arrestin locus on chromosome 2q. We screened a genomic library (5 million plaques) using an arrestin cDNA clone. Sixty-eight hybridizing clones were identified; portions of 7 clones were sequenced to determine the intron sequence flanking themore » exons. We are using SSCP analysis and direct genomic sequencing to screen the entire coding region, splice donor and acceptor sites, and the promoter region of the arrestin gene in 188 patients with autosomal dominant and 104 patients with autosomal recessive retinitis pigmentosa. We have already obtained flanking intron sequences necessary for SSCP analysis for 13 of 16 exons. So far, we have identified 4 silent base changes at codons 67 (TGC-to-TGT), 107 (CTG-to-CTC), 163 (GCC-to-GCT), and 288 (CTG-to-TGT), all with allele frequencies at 1% or less. Several other variant bands detected by SSCP analysis are currently being sequenced.« less
Martínez, Lidia Mayorga; Orozco, Aurea; Villalobos, Patricia; Valverde-R, Carlos
2008-05-01
Thyroid hormone bioactivity is finely regulated at the cellular level by the peripheral iodothyronine deiodinases (D). The study of thyroid function in fish has been restricted mainly to teleosts, whereas the study and characterization of Ds have been overlooked in chondrichthyes. Here we report the cloning and operational characterization of both the native and the recombinant hepatic type 3 iodothyronine deiodinase in the tropical shark Chiloscyllium punctatum. Native and recombinant sD3 show identical catalytic activities: a strong preference for T3-inner-ring deiodination, a requirement for a high concentration of DTT, a sequential reaction mechanism, and resistance to PTU inhibition. The cloned cDNA contains 1298 nucleotides [excluding the poly(A) tail] and encodes a predicted protein of 259 amino acids. The triplet TGA coding for selenocysteine (Sec) is at position 123. The consensus selenocysteine insertion sequence (SECIS) was identified 228 bp upstream of the poly(A) tail and corresponds to form 2. The deduced amino acid sequence was 77% and 72% identical to other D3 cDNAs in fishes and other vertebrates, respectively. As in the case of other piscivore teleost species, shark expresses hepatic D3 through adulthood. This characteristic may be associated with the alimentary strategy in which the protection from an exogenous overload of thyroid hormones could be of physiological importance for thyroidal homeostasis.
Takamitsu, Emi; Fukunaga, Kazuki; Iio, Yusuke; Moriya, Koko; Utsumi, Toshihiko
2014-11-01
To establish a non-radioactive, cell-free detection system for protein N-myristoylation, metabolic labeling in a cell-free protein synthesis system using bioorthogonal myristic acid analogues was performed. After Cu(I)-catalyzed azide-alkyne cycloaddition (CuAAC) with a biotin tag, the tagged proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and blotted on a polyvinylidene fluoride (PVDF) membrane, and then protein N-myristoylation was detected by enhanced chemiluminescence (ECL) using horseradish peroxidase (HRP)-conjugated streptavidin. The results showed that metabolic labeling in an insect cell-free protein synthesis system using an azide analogue of myristic acid followed by CuAAC with alkynyl biotin was the most effective strategy for cell-free detection of protein N-myristoylation. To determine whether the newly developed detection method can be applied for the detection of novel N-myristoylated proteins from complementary DNA (cDNA) resources, four candidate cDNA clones were selected from a human cDNA resource and their susceptibility to protein N-myristoylation was evaluated using the newly developed strategy. As a result, the products of three cDNA clones were found to be novel N-myristoylated protein, and myristoylation-dependent specific intracellular localization was observed for two novel N-myristoylated proteins. Thus, the metabolic labeling in an insect cell-free protein synthesis system using bioorthogonal azide analogue of myristic acid was an effective strategy to identify novel N-myristoylated proteins from cDNA resources. Copyright © 2014 Elsevier Inc. All rights reserved.
Reddy, B A; Kloc, M; Etkin, L D
1992-12-01
We have cloned a cDNA (xlan4) from a Xenopus laevis oocyte cDNA library whose cognate mRNA is localized in the animal pole region of full grown oocytes. The cDNA can be translated in vitro to produce a predicted size protein of 35 kDa and, is also expressed in E. coli as a fusion protein. The conceptual protein encoded by the xlan4 cDNA is 17.5% proline rich and possesses several PEST sequences found in proteins with short half-lives. The xlan4 mRNA is 2.6 kb and during early development its titer decreases until the neurula stage after which it begins to reaccumulate. Northern blots on dissected embryos and in situ hybridization revealed that the zygotic expression is limited to the dorsal axial structures consisting primarily of the CNS. UV irradiation of the vegetal pole region immediately following fertilization that produces ventralized embryos results in a loss of zygotic xlan4 expression. In the adult, xlan4 mRNA is limited primarily to the brain. The presence of this mRNA in animal pole region which contributes to the future neural cell lineages suggests that this gene product may function either in the specification of neural cell types or in a neural specific function.
Lardizabal, K D; Metz, J G; Sakamoto, T; Hutton, W C; Pollard, M R; Lassner, M W
2000-03-01
Wax synthase (WS, fatty acyl-coenzyme A [coA]: fatty alcohol acyltransferase) catalyzes the final step in the synthesis of linear esters (waxes) that accumulate in seeds of jojoba (Simmondsia chinensis). We have characterized and partially purified this enzyme from developing jojoba embryos. A protein whose presence correlated with WS activity during chromatographic fractionation was identified and a cDNA encoding that protein was cloned. Seed-specific expression of the cDNA in transgenic Arabidopsis conferred high levels of WS activity on developing embryos from those plants. The WS sequence has significant homology with several Arabidopsis open reading frames of unknown function. Wax production in jojoba requires, in addition to WS, a fatty acyl-CoA reductase (FAR) and an efficient fatty acid elongase system that forms the substrates preferred by the FAR. We have expressed the jojoba WS cDNA in Arabidopsis in combination with cDNAs encoding the jojoba FAR and a beta-ketoacyl-CoA synthase (a component of fatty acid elongase) from Lunaria annua. (13)C-Nuclear magnetic resonance analysis of pooled whole seeds from transgenic plants indicated that as many as 49% of the oil molecules in the seeds were waxes. Gas chromatography analysis of transmethylated oil from individual seeds suggested that wax levels may represent up to 70% (by weight) of the oil present in those seeds.
Walker, M D; Park, C W; Rosen, A; Aronheim, A
1990-01-01
Cell specific expression of the insulin gene is achieved through transcriptional mechanisms operating on multiple DNA sequence elements located in the 5' flanking region of the gene. Of particular importance in the rat insulin I gene are two closely similar 9 bp sequences (IEB1 and IEB2): mutation of either of these leads to 5-10 fold reduction in transcriptional activity. We have screened an expression cDNA library derived from mouse pancreatic endocrine beta cells with a radioactive DNA probe containing multiple copies of the IEB1 sequence. A cDNA clone (A1) isolated by this procedure encodes a protein which shows efficient binding to the IEB1 probe, but much weaker binding to either an unrelated DNA probe or to a probe bearing a single base pair insertion within the recognition sequence. DNA sequence analysis indicates a protein belonging to the helix-loop-helix family of DNA-binding proteins. The ability of the protein encoded by clone A1 to recognize a number of wild type and mutant DNA sequences correlates closely with the ability of each sequence element to support transcription in vivo in the context of the insulin 5' flanking DNA. We conclude that the isolated cDNA may encode a transcription factor that participates in control of insulin gene expression. Images PMID:2181401
van Gennip, H G; van Rijn, P A; Widjojoatmodjo, M N; Moormann, R J
1999-03-01
A new method for the recovery of infectious classical swine fever virus (CSFV) from full-length genomic cDNA clones of the C-strain was developed. Classical reverse genetics is based on transfection of in vitro transcribed RNA to target cells to recover RNA viruses. However, the specific infectivity of such in vitro transcribed RNA in swine kidney cells is usually low. To improve reverse genetics for CSFV, a stable swine kidney cell line was established that expresses cytoplasmic bacteriophage T7 RNA polymerase (SK6.T7). A 200-fold increased virus titre was obtained from SK6.T7 cells transfected with linearized full-length cDNA compared to in vitro transcribed RNA, whereas transfection of circular full-length cDNA resulted in 20-fold increased virus titres. Viruses generated on the SK6.T7 cells are indistinguishable from the viruses generated by the classical reverse genetic procedures. These results show the improved recovery of infectious CSFV directly from full-length cDNAs. Furthermore, the reverse genetic procedures are simplified to a faster, one step protocol. We conclude that the SK6.T7 cell line will be a valuable tool for recovering mutant CSFV and will contribute to future pestivirus research.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jing Chen; Cairney, J.; Newton, R.J.
1991-05-01
Atriplex canescens (Pursh.) Nutt. is known to have a high degree of morphological and physiological drought-tolerance, which appears to be related to molecular responses. A cDNA library, constructed from drought-induced messenger RNA, was differentially screened with radioactively labelled cDNA probes synthesized from mRNA extracted from stressed and non-stressed Atriplex. Two clones named 19-3 and 27-3, whose expression is induced by drought-stress, have been characterized. Sequence analysis shows that they are more than 96% homologous. Each clone has an open reading frame which specifies a protein of 95 amino acids (12.77 kDa and 12.74 kDa respectively.) In vitro transcription and translationmore » of each clone results in a single protein of apparent molecular weight 8.6 kDa. The disparity in size may be due to secondary structure, dictated, at least in part, by a highly charged carboxy terminus which may be important for the function of these proteins in drought tolerance.« less
Yokozaki, H; Tahara, H; Oue, N; Tahara, E
2000-01-01
A new transcription variant of hepatocyte growth factor/scatter factor (HGF/SF) was cloned from human gastric cancer cell line HSC-39. Northern blot analysis of eight human gastric cancer cell lines (TMK-1, MKN-1, MKN-7, MKN-28, MKN-45, MKN-74, KATO-III and HSC-39) demonstrated that HSC-39 cells expressed a 1.3 kb abnormal HGF/SF transcript. Screening of 1 x 10(6) colonies of cDNA library from HSC-39 constructed in pAP3neo mammalian expression vector selected four positive clones containing HGF/SF transcript. Among them, two contained a 1.3 kbp insert detecting the identical transcript to that obtained with HGF/SF probe by Northern blotting. Deoxynucleotide sequencing of the 1.3 kbp insert revealed that it was composed of a part of HGF/SF cDNA from exon 14 to exon 18, corresponding to the whole sequence of HGF/SF light chain, with 5' 75 nucleotides unrelated to any sequence involved in HGF/SF.
[The primary structure of a vaccine strain of tobacco mosaic virus V-69].
Shiian, A N; Mil'shina, N V; Snegireva, P B; Pukhal'skiĭ, V A
1994-12-01
A random set of cDNA fragments were synthesized on genomic RNA of TMV vaccine strain V-69, using random primers and reverse transcriptase. Following synthesis of double-stranded cDNA, they were cloned into the pUC-19 plasmid; and 28 clones were sequenced (insert size 100-500 bp). High nucleotide sequence homology of V-69 (more than 95%) was shown only with tomato strain TMV-L [1]. Sequenced clones represent 54% of the genome (50% of the replicase gene, 98% of the transport protein gene, and 60% of the coat protein gene). In this genome region, 24 base substitutions were revealed, as compared to the wild-type TMV-L sequence. Six base substitutions resulted in changes in corresponding amino acid codons. No substitutions coincided with those discovered in the related TMV vaccine strain L11A [2], while two substitutions in the replicase gene were identical to those found in TMV strain Lta1 [3], which is capable of overcoming protection in tomatoes with the resistance gene Tm-1.
Cloning and characterization of two novel zebrafish P2X receptor subunits.
Diaz-Hernandez, Miguel; Cox, Jane A; Migita, Keisuke; Haines, William; Egan, Terrance M; Voigt, Mark M
2002-07-26
In this report we describe the cloning and characterization of two P2X receptor subunits cloned from the zebrafish (Danio rerio). Primary sequence analysis suggests that one cDNA encodes an ortholog of the mammalian P2X(4) subunit and the second cDNA encodes the ortholog of the mammalian P2X(5) subunit. The zP2X(4) subunit forms a homo-oligomeric receptor that displays a low affinity for ATP (EC(50)=274+/-48 microM) and very low affinity (EC(50)>500 microM) for other purinergic ligands such as alphabetameATP, suramin, and PPADS. As seen with the mammalian orthologs, the zP2X(5) subunit forms a homo-oligomeric receptor that yields very small whole-cell currents (<20pA), making determination of an EC(50) problematic. Both subunit genes were physically mapped onto the zebrafish genome using radiation hybrid analysis of the T51 panel, with the zp2x4 localized to LG21 and zp2x5 to LG5.
Odorant-binding proteins from a primitive termite.
Ishida, Yuko; Chiang, Vicky P; Haverty, Michael I; Leal, Walter S
2002-09-01
Hitherto, odorant-binding proteins (OBPs) have been identified from insects belonging to more highly evolved insect orders (Lepidoptera, Coleoptera, Diptera, Hymenoptera, and Hemiptera), whereas only chemosensory proteins have been identified from more primitive species, such as orthopteran and phasmid species. Here, we report for the first time the isolation and cloning of odorant-binding proteins from a primitive termite species, the dampwood termite. Zootermopsis nevadensis nevadensis (Isoptera: Termopsidae). A major antennae-specific protein was detected by native PAGE along with four other minor proteins, which were also absent in the extract from control tissues (hindlegs). Multiple cDNA cloning led to the full characterization of the major antennae-specific protein (ZnevOBP1) and to the identification of two other antennae-specific cDNAs, encoding putative odorant-binding proteins (ZnevOBP2 and ZnevOBP3). N-terminal amino acid sequencing of the minor antennal bands and cDNA cloning showed that olfaction in Z. n. nevadensis may involve multiple odorant-binding proteins. Database searches suggest that the OBPs from this primitive termite are homologues of the pheromone-binding proteins from scarab beetles and antennal-binding proteins from moths.
Hop stunt viroid: molecular cloning and nucleotide sequence of the complete cDNA copy.
Ohno, T; Takamatsu, N; Meshi, T; Okada, Y
1983-01-01
The complete cDNA of hop stunt viroid (HSV) has been cloned by the method of Okayama and Berg (Mol.Cell.Biol.2,161-170. (1982] and the complete nucleotide sequence has been established. The covalently closed circular single-stranded HSV RNA consists of 297 nucleotides. The secondary structure predicted for HSV contains 67% of its residues base-paired. The native HSV can possess an extended rod-like structure characteristic of viroids previously established. The central region of the native HSV has a similar structure to the conserved region found in all viroids sequenced so far except for avocado sunblotch viroid. The sequence homologous to the 5'-end of U1a RNA is also found in the sequence of HSV but not in the central conserved region. Images PMID:6312412
Shpakovskiĭ, G V; Lebedenko, E N
1997-05-01
The full-length cDNA of the rpc10+ gene encoding mini-subunit Rpc10, which is common for all three nuclear RNA polymerases of the fission yeast Schizosaccharomyces pombe, was cloned and sequenced. The Rpc10 subunit of Sz. pombe and its homologs from S. cerevisiae and H. sapiens are positively charged proteins with a highly conserved C-terminal region and an invariant zinc-binding domain (Zn-finger) of a typical amino acid composition: YxCx2Cx12RCx2CGxR. Functional tests of heterospecific complementation, using tetrad analysis or plasmid shuffling, showed that the Rpc10 subunit of Sz. pombe can successfully replace the homologous ABC10 alpha subunit in nuclear RNA polymerases I-III of S. cerevisiae.
Lu, M; Wang, L F; Du, X H; Yu, Y K; Pan, J B; Nan, Z J; Han, J; Wang, W X; Zhang, Q Z; Sun, Q P
2015-11-30
Various plant genes can be activated or inhibited by phytohormones under conditions of biotic and abiotic stress, especially in response to jasmonic acid (JA) and salicylic acid (SA). Interactions between JA and SA may be synergistic or antagonistic, depending on the stress condition. In this study, we cloned a full-length cDNA (LeWRKY1, GenBank accession No. FJ654265) from Lycopersicon esculentum by rapid amplification of cDNA ends. Sequence analysis showed that this gene is a group II WRKY transcription factor. Analysis of LeWRKY1 mRNA expression in various tissues by qRT-PCR showed that the highest and lowest expression occurred in the leaves and stems, respectively. In addition, LeWRKY1 expression was induced by JA and Botrytis cinerea Pers., but not by SA.
Cloning and baculovirus expression of a desiccation stress gene from the beetle, Tenebrio molitor.
Graham, L A; Bendena, W G; Walker, V K
1996-02-01
The cDNA sequence encoding a novel desiccation stress protein (dsp28) found in the hemolymph of the common yellow mealworm beetle, Tenebrio molitor, has been determined. The sequence encodes a 225 amino acid protein containing a 20 amino acid signal peptide. Dsp28 shows no significant similarity to any known nucleic acid or protein sequence. Levels of dsp28 mRNA were found to increase approx 5-fold following desiccation. Dsp28 cDNA has been cloned into a baculovirus expression vector and the expressed protein was compared to native dsp28. Both dsp28 expressed by recombinant baculovirus and native dsp28 are glycosylated and N-terminally processed. Although dsp28 is induced by cold in addition to desiccation stress, it does not contribute to the freezing point depression (thermal hysteresis) observed in Tenebrio hemolymph.
Qiu, Lihua; Zhang, Hanhua; Yang, Keng; Jiang, Shigui
2009-05-01
Interleukin-8 (IL-8), the first known chemokine, is a CXC chemokine, which is cable of attracting neutrophils and inducing them to release lysozomal enzymes, triggering the respiratory burst. In the present study, the cDNA of an IL-8 was cloned from Japanese sea perch Lateolabrax japonicus (designated LjIL-8) by homology cloning and rapid amplification of cDNA ends (RACE) approaches. The full-length cDNA of LjIL-8 consisted of 803 nucleotides with a canonical polyadenylation signal sequence AATAAA and a poly(A) tail, and an open reading frame (ORF) of 300 bp encoding a polypeptide of 99 amino acid residues with a predicted molecular weight of 6.6 kDa. The high identity of LjIL-8 with IL-8 in other organisms indicated that LjIL-8 should be a new member of the IL-8 family. By fluorescent quantitative real-time PCR, mRNA transcript of LjIL-8 was detectable in all the examined tissues with higher level in spleen and head-kidney. The temporal expression of LjIL-8 mRNA in the spleen was up-regulated by lipopolyssacharide (LPS) stimulation and reached the maximum level at 6 h post-stimulation, and then dropped back to the original level gradually. These results indicated that LjIL-8 was a constitutive and inducible acute-phase protein that perhaps involved in the immune defense of L. japonicus.
NASA Technical Reports Server (NTRS)
Stankovic, B.; Vian, A.; Henry-Vian, C.; Davies, E.
2000-01-01
Localized wounding of one leaf in intact tomato (Lycopersicon esculentum Mill.) plants triggers rapid systemic transcriptional responses that might be involved in defense. To better understand the mechanism(s) of intercellular signal transmission in wounded tomatoes, and to identify the array of genes systemically up-regulated by wounding, a subtractive cDNA library for wounded tomato leaves was constructed. A novel cDNA clone (designated LebZIP1) encoding a DNA-binding protein was isolated and identified. This clone appears to be encoded by a single gene, and belongs to the family of basic leucine zipper domain (bZIP) transcription factors shown to be up-regulated by cold and dark treatments. Analysis of the mRNA levels suggests that the transcript for LebZIP1 is both organ-specific and up-regulated by wounding. In wounded wild-type tomatoes, the LebZIP1 mRNA levels in distant tissue were maximally up-regulated within only 5 min following localized wounding. Exogenous abscisic acid (ABA) prevented the rapid wound-induced increase in LebZIP1 mRNA levels, while the basal levels of LebZIP1 transcripts were higher in the ABA mutants notabilis (not), sitiens (sit), and flacca (flc), and wound-induced increases were greater in the ABA-deficient mutants. Together, these results suggest that ABA acts to curtail the wound-induced synthesis of LebZIP1 mRNA.
Asega, Amanda Francine; do Nascimento, João Roberto O; Schroeven, Lindsey; Van den Ende, Wim; Carvalho, Maria Angela M
2008-08-01
Variations in the inulin contents have been detected in rhizophores of Vernonia herbacea during the phenological cycle. These variations indicate the occurrence of active inulin synthesis and depolymerization throughout the cycle and a role for this carbohydrate as a reserve compound. 1-Fructan exohydrolase (1-FEH) is the enzyme responsible for inulin depolymerization, and its activity has been detected in rhizophores of sprouting plants. Defoliation and low temperature are enhancer conditions of this 1-FEH activity. The aim of the present work was the cloning of this enzyme. Rhizophores were collected from plants induced to sprout, followed by storage at 5 degrees C. A full length 1-FEH cDNA sequence was obtained by PCR and inverse PCR techniques, and expressed in Pichia pastoris. Cold storage enhances FEH gene expression. Vh1-FEH was shown to be a functional 1-FEH, hydrolyzing predominantly beta-2,1 linkages, sharing high identity with chicory FEH sequences, and its activity was inhibited by 81% in the presence of 10 mM sucrose. In V. herbacea, low temperature and sucrose play a role in the control of fructan degradation. This is the first study concerning the cloning and functional analysis of a 1-FEH cDNA of a native species from the Brazilian Cerrado. Results will contribute to understanding the role of fructans in the establishment of a very successful fructan flora of the Brazilian Cerrado, subjected to water limitation and low temperature during winter.
Characterization and antifungal properties of wheat nonspecific lipid transfer proteins.
Sun, Jin-Yue; Gaudet, Denis A; Lu, Zhen-Xiang; Frick, Michele; Puchalski, Byron; Laroche, André
2008-03-01
This study simultaneously considered the phylogeny, fatty acid binding ability, and fungal toxicity of a large number of monocot nonspecific lipid transfer proteins (ns-LTP). Nine novel full-length wheat ns-LTP1 clones, all possessing coding sequences of 348 bp, isolated from abiotic- and biotic-stressed cDNA libraries from aerial tissues, exhibited highly conserved coding regions with 78 to 99 and 71 to 100% identity at the nucleotide and amino acid levels, respectively. Phylogenetic analyses revealed two major ns-LTP families in wheat. Eight wheat ns-LTP genes from different clades were cloned into the expression vector pPICZalpha and transformed into Pichia pastoris. Sodium dodecyl sulfate polyacrylamide gel electrophoresis, Western blotting, and in vitro lipid binding activity assay confirmed that the eight ns-LTP were all successfully expressed and capable of in vitro binding fatty acid molecules. A comparative in vitro study on the toxicity of eight wheat ns-LTP to mycelium growth or spore germination of eight wheat pathogens and three nonwheat pathogens revealed differential toxicities among different ns-LTP. Values indicating 50% inhibition of fungal growth or spore germination of three selected ns-LTP against six fungi ranged from 1 to 7 microM. In vitro lipid-binding activity of ns-LTP was not correlated with their antifungal activity. Using the fluorescent probe SYTOX Green as an indicator of fungal membrane integrity, the in vitro toxicity of wheat ns-LTP was associated with alteration in permeability of fungal membranes.
Geranyl diphosphate synthase from mint
Croteau, Rodney Bruce; Wildung, Mark Raymond; Burke, Charles Cullen; Gershenzon, Jonathan
1999-01-01
A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate.
Geranyl diphosphate synthase from mint
Croteau, R.B.; Wildung, M.R.; Burke, C.C.; Gershenzon, J.
1999-03-02
A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate. 5 figs.
cDNA Clones with Rare and Recurrent Mutations Found in Cancers | Office of Cancer Genomics
The CTD2 Center at UT- MD Anderson Cancer Center has developed High-Throughput Mutagenesis and Molecular Barcoding (HiTMMoB)1,2 pipeline to construct mutant alleles open reading frame expression clones that are either recurrent or rare in cancers. These barcoded genes can be used for context-specific functional validation, detection of novel biomarkers (pathway activation) and targets (drug sensitivity).
Novel Cell Culture-Adapted Genotype 2a Hepatitis C Virus Infectious Clone
Date, Tomoko; Kato, Takanobu; Kato, Junko; Takahashi, Hitoshi; Morikawa, Kenichi; Akazawa, Daisuke; Murayama, Asako; Tanaka-Kaneko, Keiko; Sata, Tetsutaro; Tanaka, Yasuhito; Mizokami, Masashi
2012-01-01
Although the recently developed infectious hepatitis C virus system that uses the JFH-1 clone enables the study of whole HCV viral life cycles, limited particular HCV strains have been available with the system. In this study, we isolated another genotype 2a HCV cDNA, the JFH-2 strain, from a patient with fulminant hepatitis. JFH-2 subgenomic replicons were constructed. HuH-7 cells transfected with in vitro transcribed replicon RNAs were cultured with G418, and selected colonies were isolated and expanded. From sequencing analysis of the replicon genome, several mutations were found. Some of the mutations enhanced JFH-2 replication; the 2217AS mutation in the NS5A interferon sensitivity-determining region exhibited the strongest adaptive effect. Interestingly, a full-length chimeric or wild-type JFH-2 genome with the adaptive mutation could replicate in Huh-7.5.1 cells and produce infectious virus after extensive passages of the virus genome-replicating cells. Virus infection efficiency was sufficient for autonomous virus propagation in cultured cells. Additional mutations were identified in the infectious virus genome. Interestingly, full-length viral RNA synthesized from the cDNA clone with these adaptive mutations was infectious for cultured cells. This approach may be applicable for the establishment of new infectious HCV clones. PMID:22787209
Cuenda, A; Alonso, G; Morrice, N; Jones, M; Meier, R; Cohen, P; Nebreda, A R
1996-01-01
Two chromatographically distinct stress-activated protein kinase kinases (SAPKKs) have been identified in several mammalian cells, termed SAPKK2 and SAPKK3, which activate the MAP kinase family member RK/p38 but not JNK/SAPK in vitro. Here we demonstrate that SAPKK2 is identical or very closely related to the MAP kinase kinase family member MKK3. However, under our assay conditions, SAPKK3 was the major activator of RK/p38 detected in extracts prepared from stress- or interleukin-1-stimulated epithelial (KB) cells, from bacterial lipopolysaccharide and tumour necrosis factor alpha-stimulated THP1 monocytes or from rabbit skeletal muscle. The activated form of SAPKK3 was purified from muscle to near homogeneity, and tryptic peptide sequences were used to clone human and murine cDNAs encoding this enzyme. Human SAPKK3 comprised 334 amino acids and was 78% identical to MKK3. The murine and human SAPKK3 were 97% identical in their amino acid sequences. We also cloned a different murine cDNA that appears to encode a SAPKK3 protein truncated at the N-terminus. SAPKK3 is identical to the recently cloned MKK6. Images PMID:8861944
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gault, J.; Zonana, J.; Zeltinger, J.
A conserved mouse genomic clone was used to identify a homologous human genomic clone (the DXS732E locus), which was subsequently employed to isolate cDNAs from a human fetal brain library. Nine unique overlapping cDNAs were isolated, and sequences analysis of 3.9 kb identified a putative 1 kb ORF. GRAIL analysis of the sequence supported the hypothesis that the putative ORF was coding sequence, and Prosite analysis of the putative ORF identified potential glycosylation and phosphorylation sites. The 5{prime} end of the gene maps within a CpG island, and comparison of cDNA sequences indicate the gene is alternatively spliced at itsmore » 3{prime} end. Northern analysis and RT-PCR indicate that two different sized messages appear to be expressed with the gene expressed in human fetal kidney, intestine, brain, and muscle. The gene is expressed in 77 day human skin, a time when hair follicle formation occurs. Anhidrotic ectodermal dysplasia (EDA) results in the abnormal morphogenesis of hair, teeth and eccrine sweat glands. A positional cloning strategy towards cloning the EDA gene had been used, and deletion and X-autosome translocation patients have been useful in further delimiting the EDA region. The present gene at the DXS732E locus is partially deleted in one EDA patient who does not have other apparent abnormalities. No rearrangements of the gene have been detected in two female X-autosome translocation EDA patients, nor in four additional male patients with submicroscopic molecular deletions.« less
Medeiros, Marcelo N.; Logullo, Raquel; Ramos, Isabela B.; Sorgine, Marcos H. F.; Paiva-Silva, Gabriela O.; Mesquita, Rafael D.; Machado, Ednildo Alcantara; Coutinho, Maria Alice; Masuda, Hatisaburo; Capurro, Margareth L.; Ribeiro, José M.C.; Cardoso Braz, Glória Regina; Oliveira, Pedro L
2013-01-01
Insect oocytes grow in close association with the ovarian follicular epithelium (OFE), which escorts the oocyte during oogenesis and is responsible for synthesis and secretion of the eggshell. We describe a transcriptome of OFE of the triatomine bug Rhodnius prolixus, a vector of Chagas disease, to increase our knowledge of the role of FE in egg development. Random clones were sequenced from a cDNA library of different stages of follicle development. The transcriptome showed high commitment to transcription, protein synthesis, and secretion. The most abundant cDNA was a secreted (S) small, proline-rich protein with maximal expression in the vitellogenic follicle, suggesting a role in oocyte maturation. We also found Rp45, a chorion protein already described, and a putative chitin-associated cuticle protein that was an eggshell component candidate. Six transcripts coding for proteins related to the unfolded protein response (UPR) by were chosen and their expression analyzed. Surprisingly, transcripts related to UPR showed higher expression during early stages of development and downregulation during late stages, when transcripts coding for S proteins participating in chorion formation were highly expressed. Several transcripts with potential roles in oogenesis and embryo development are also discussed. We propose that intense protein synthesis at the FE results in reticulum stress (RS) and that lowering expression of a set of genes related to cell survival should lead to degeneration of follicular cells at oocyte maturation. This paradoxical suppression of UPR suggests that ovarian follicles may represent an interesting model for studying control of RS and cell survival in professional S cell types. PMID:21736942
[Cloning and bioinformatics analysis of abscisic acid 8'-hydroxylase from Pseudostellariae Radix].
Li, Jun; Long, Deng-Kai; Zhou, Tao; Ding, Ling; Zheng, Wei; Jiang, Wei-Ke
2016-07-01
Abscisic acid 8'-hydroxylase was one of key enzymes genes in the metabolism of abscisic acid (ABA). Seven menbers of abscisic acid 8'-hydroxylase were identified from Pseudostellaria heterophylla transcriptome sequencing results by using sequence homology. The expression profiles of these genes were analyzed by transcriptome data. The coding sequence of ABA8ox1 was cloned and analyzed by informational technology. The full-length cDNA of ABA8ox1 was 1 401 bp,with 480 encoded amino acids. The predicated isoelectric point (pI) and relative molecular mass (MW) were 8.55 and 53 kDa,respectively. Transmembrane structure analysis showed that there were 21 amino acids in-side and 445 amino acids out-side. High level of transcripts can detect in bark of root and fibrous root. Multi-alignment and phylogenetic analysis both show that ABA8ox1 had a high similarity with the CYP707As from other plants,especially with AtCYP707A1 and AtCYP707A3 in Arabidopsis thaliana. These results lay a foundation for molecular mechanism of tuberous root expanding and response to adversity stress. Copyright© by the Chinese Pharmaceutical Association.
Gong, Liang; Zhong, Guo-Hua; Hu, Mei-Ying; Luo, Qian; Ren, Zhen-Zhen
2010-01-01
Chemosensory proteins play an important role in transporting chemical compounds to their receptors on dendrite membranes. In this study, two full-length cDNA codings for chemosensory proteins of Plutella xylostella (Lepidoptera: Plutellidae) were obtained by RACE-PCR. PxylCSP3 and Pxyl-CSP4, with GenBank accession numbers ABM92663 and ABM92664, respectively, were cloned and sequenced. The gene sequences both consisted of three exons and two introns. RT-PCR analysis showed that Pxyl-CSP3 and Pxyl-CSP4 had different expression patterns in the examined developmental stages, but were expressed in all larval stages. Phylogenetic analysis indicated that lepidopteran insects consist of three branches, and Pxyl-CSP3 and Pxyl-CSP4 belong to different branches. The 5′regulatory regions of Pxyl-CSP3 and Pxyl-CSP4 were isolated and analyzed, and the results consist of not only the core promoter sequences (TATA-box), but also several transcriptional elements (BR-C Z4, Hb, Dfd, CF2-II, etc.). This study provides clues to better understanding the various physiological functions of CSPs in P. xylostella and other insects. PMID:21073345
Shi, Xingzheng; Wang, Xinliang; Peng, Futian; Zhao, Yu
2012-08-01
Nonsymbiotic hemoglobins (nsHbs) are involved in a variety of cellular processes in plants. Previous studies indicate that nsHb expression improves plant tolerance during waterlogging and hypoxia. In the present work, the nsHb class-1 coding sequence was cloned from Malus hupehensis Rehd. var. pinyiensis Jiang and subsequently named MhGLB1. The results elucidated the expressed characteristics and physiological effects of MhGLB1. The full-length cDNA contained a 477 bp open reading frame encoding a protein with a molecular mass of 17.8 KDa with 158 amino acids. Quantitative real-time PCR analysis showed that MhGLB1 expresses in roots, stems and leaves growing under normal and nitrate-induced conditions. Hypoxic stress induced accumulation of MhGLB1 within 12 h, and abscisic acid significantly induced expression of MhGLB1 in roots. The photosynthetic, transpiration and stomatal conductance rates of transgenic MhGLB1 tomato plants decreased more slowly than that of wild-type plants under waterlogging treatment. These results indicated that the MhGLB1 gene has an important role in hypoxia.