Cloning and sequence analysis of Hemonchus contortus HC58cDNA.
Muleke, Charles I; Ruofeng, Yan; Lixin, Xu; Xinwen, Bo; Xiangrui, Li
2007-06-01
The complete coding sequence of Hemonchus contortus HC58cDNA was generated by rapid amplification of cDNA ends and polymerase chain reaction using primers based on the 5' and 3' ends of the parasite mRNA, accession no. AF305964. The HC58cDNA gene was 851 bp long, with open reading frame of 717 bp, precursors to 239 amino acids coding for approximately 27 kDa protein. Analysis of amino acid sequence revealed conserved residues of cysteine, histidine, asparagine, occluding loop pattern, hemoglobinase motif and glutamine of the oxyanion hole characteristic of cathepsin B like proteases (CBL). Comparison of the predicted amino acid sequences showed the protein shared 33.5-58.7% identity to cathepsin B homologues in the papain clan CA family (family C1). Phylogenetic analysis revealed close evolutionary proximity of the protein sequence to counterpart sequences in the CBL, suggesting that HC58cDNA was a member of the papain family.
Ozawa, Tatsuhiko; Kondo, Masato; Isobe, Masaharu
2004-01-01
The 3' rapid amplification of cDNA ends (3' RACE) is widely used to isolate the cDNA of unknown 3' flanking sequences. However, the conventional 3' RACE often fails to amplify cDNA from a large transcript if there is a long distance between the 5' gene-specific primer and poly(A) stretch, since the conventional 3' RACE utilizes 3' oligo-dT-containing primer complementary to the poly(A) tail of mRNA at the first strand cDNA synthesis. To overcome this problem, we have developed an improved 3' RACE method suitable for the isolation of cDNA derived from very large transcripts. By using the oligonucleotide-containing random 9mer together with the GC-rich sequence for the suppression PCR technology at the first strand of cDNA synthesis, we have been able to amplify the cDNA from a very large transcript, such as the microtubule-actin crosslinking factor 1 (MACF1) gene, which codes a transcript of 20 kb in size. When there is no splicing variant, our highly specific amplification allows us to perform the direct sequencing of 3' RACE products without requiring cloning in bacterial hosts. Thus, this stepwise 3' RACE walking will help rapid characterization of the 3' structure of a gene, even when it encodes a very large transcript.
Baxter, Laura L; Hsu, Benjamin J; Umayam, Lowell; Wolfsberg, Tyra G; Larson, Denise M; Frith, Martin C; Kawai, Jun; Hayashizaki, Yoshihide; Carninci, Piero; Pavan, William J
2007-06-01
As part of the RIKEN mouse encyclopedia project, two cDNA libraries were prepared from melanocyte-derived cell lines, using techniques of full-length clone selection and subtraction/normalization to enrich for rare transcripts. End sequencing showed that these libraries display over 83% complete coding sequence at the 5' end and 96-97% complete coding sequence at the 3' end. Evaluation of the libraries, derived from B16F10Y tumor cells and melan-c cells, revealed that they contain clones for a majority of the genes previously demonstrated to function in melanocyte biology. Analysis of genomic locations for transcripts revealed that the distribution of melanocyte genes is non-random throughout the genome. Three genomic regions identified that showed significant clustering of melanocyte-expressed genes contain one or more genes previously shown to regulate melanocyte development or function. A catalog of genes expressed in these libraries is presented, providing a valuable resource of cDNA clones and sequence information that can be used for identification of new genes important for melanocyte development, function, and disease.
Asamizu, E; Nakamura, Y; Sato, S; Tabata, S
2000-06-30
For comprehensive analysis of genes expressed in the model dicotyledonous plant, Arabidopsis thaliana, expressed sequence tags (ESTs) were accumulated. Normalized and size-selected cDNA libraries were constructed from aboveground organs, flower buds, roots, green siliques and liquid-cultured seedlings, respectively, and a total of 14,026 5'-end ESTs and 39,207 3'-end ESTs were obtained. The 3'-end ESTs could be clustered into 12,028 non-redundant groups. Similarity search of the non-redundant ESTs against the public non-redundant protein database indicated that 4816 groups show similarity to genes of known function, 1864 to hypothetical genes, and the remaining 5348 are novel sequences. Gene coverage by the non-redundant ESTs was analyzed using the annotated genomic sequences of approximately 10 Mb on chromosomes 3 and 5. A total of 923 regions were hit by at least one EST, among which only 499 regions were hit by the ESTs deposited in the public database. The result indicates that the EST source generated in this project complements the EST data in the public database and facilitates new gene discovery.
3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.
Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong
2008-09-01
We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.
Gadkar, Vijay J; Filion, Martin
2013-06-01
In various experimental systems, limiting available amounts of RNA may prevent a researcher from performing large-scale analyses of gene transcripts. One way to circumvent this is to 'pre-amplify' the starting RNA/cDNA, so that sufficient amounts are available for any downstream analysis. In the present study, we report the development of a novel protocol for constructing amplified cDNA libraries using the Phi29 DNA polymerase based multiple displacement amplification (MDA) system. Using as little as 200 ng of total RNA, we developed a linear concatenation strategy to make the single-stranded cDNA template amenable for MDA. The concatenation, made possible by the template switching property of the reverse transcriptase enzyme, resulted in the amplified cDNA library with intact 5' ends. MDA generated micrograms of template, allowing large-scale polymerase chain reaction analyses or other large-scale downstream applications. As the amplified cDNA library contains intact 5' ends, it is also compatible with 5' RACE analyses of specific gene transcripts. Empirical validation of this protocol is demonstrated on a highly characterized (tomato) and an uncharacterized (corn gromwell) experimental system.
Chernicky, C L; Tan, H; Burfeind, P; Ilan, J; Ilan, J
1996-02-01
There are several cell types within the placenta that produce cytokines which can contribute to the regulatory mechanisms that ensure normal pregnancy. The immunological milieu at the maternofetal interface is considered to be crucial for survival of the fetus. Interleukin-2 (IL-2) is expressed by the syncytiotrophoblast, the cell layer between the mother and the fetus. IL-2 appears to be a key factor in maintenance of pregnancy. Therefore, it was important to determine the sequence of human placental interleukin-2. Direct sequencing of human placental IL-2 cDNA was determined for the coding region. Subclone sequencing was carried out for the 5'- and 3'-untranslated regions (5'-UTR and 3'-UTR). The 5'-UTR for human placental IL-2 cDNA is 294 bp, which is 247 nucleotides longer than that reported for cDNA IL-2 derived from T cells. The sequence of the coding region is identical to that reported for T cell IL-2, while sequence analysis of the polymerase chain reaction (PCR) product showed that the cDNA from the 3' end was the same as that reported for cDNA from T cells. Human placental IL-2 cDNA is 1,028 base pairs (excluding the poly A tail), which is 247 bp longer at the 5' end than that reported for IL-2 T cell cDNA. Therefore, the extended 5'-UTR of the placental IL-2 cDNA may be a consequence of alternative promoter utilization in the placenta.
Atwood-Moore, Angela; Yan, Kenneth; Judson, Robert L; Levin, Henry L
2006-08-01
The long terminal repeat retrotransposon Tf1 of Schizosaccharomyces pombe uses a unique mechanism of self priming to initiate reverse transcription. Instead of using a tRNA, Tf1 primes minus-strand synthesis with an 11-nucleotide RNA removed from the 5' end of its own transcript. We tested whether the self primer of Tf1 was similar to tRNA primers in being removed from the cDNA by RNase H. Our analysis of Tf1 cDNA extracted from virus-like particles revealed the surprising observation that the dominant species of cDNA retained the self primer. This suggests that integration of the cDNA relies on mechanisms other than reverse transcription to remove the primer.
Quantitative Analysis of HIV-1 Preintegration Complexes
Engelman, Alan; Oztop, Ilker; Vandegraaff, Nick; Raghavendra, Nidhanapati K.
2009-01-01
Retroviral replication proceeds through the formation of a provirus, an integrated DNA copy of the viral RNA genome. The linear cDNA product of reverse transcription is the integration substrate and two different integrase activities, 3′ processing and DNA strand transfer, are required for provirus formation. Integrase nicks the cDNA ends adjacent to phylogenetically-conserved CA dinucleotides during 3′ processing. After nuclear entry and locating a suitable chromatin acceptor site, integrase joins the recessed 3′-OHs to the 5′-phosphates of a double-stranded staggered cut in the DNA target. Integrase functions in the context of a large nucleoprotein complex, called the preintegration complex (PIC), and PICs are analyzed to determine levels of integrase 3′ processing and DNA strand transfer activities that occur during acute virus infection. Denatured cDNA end regions are monitored by indirect end-labeling to measure the extent of 3′ processing. Native PICs can efficiently integrate their viral cDNA into exogenously added target DNA in vitro, and Southern blotting or nested PCR assays are used to quantify the resultant DNA strand transfer activity. This study details HIV-1 infection, PIC extraction, partial purification, and quantitative analyses of integrase 3′ processing and DNA strand transfer activities. PMID:19233280
Atwood-Moore, Angela; Yan, Kenneth; Judson, Robert L.; Levin, Henry L.
2006-01-01
The long terminal repeat retrotransposon Tf1 of Schizosaccharomyces pombe uses a unique mechanism of self priming to initiate reverse transcription. Instead of using a tRNA, Tf1 primes minus-strand synthesis with an 11-nucleotide RNA removed from the 5′ end of its own transcript. We tested whether the self primer of Tf1 was similar to tRNA primers in being removed from the cDNA by RNase H. Our analysis of Tf1 cDNA extracted from virus-like particles revealed the surprising observation that the dominant species of cDNA retained the self primer. This suggests that integration of the cDNA relies on mechanisms other than reverse transcription to remove the primer. PMID:16873283
Reddy, M K; Nair, S; Tewari, K K; Mudgil, Y; Yadav, B S; Sopory, S K
1999-09-01
We have isolated and sequenced four overlapping cDNA clones to identify the full-length cDNA for topoisomerase II (PsTopII) from pea. Using degenerate primers, based on the conserved amino acid sequences of other eukaryotic type II topoisomerases, a 680 bp fragment was PCR-amplified with pea cDNA as template. This fragment was used as a probe to screen an oligo-dT-primed pea cDNA library. A partial cDNA clone was isolated that was truncated at the 3' end. RACE-PCR was employed to isolate the remaining portion of the gene. The total size of PsTopII is 4639 bp with an open reading frame of 4392 bp. The deduced amino acid sequence shows a strong homology to other eukaryotic topoisomerase II (topo II) at the N-terminus end. The topo II transcript was abundant in proliferative tissues. We also show that the level of topo II transcripts could be stimulated by exogenous application of growth factors that induced proliferation in vitro cultures. Light irradiation to etiolated tissue strongly stimulated the expression of topo II. These results suggest that topo II gene expression is up-regulated in response to light and hormones and correlates with cell proliferation. Besides, we have also isolated and analysed the 5'-flanking region of the pea TopII gene. This is first report on the isolation of a putative promoter for topoisomerase II from plants.
Den Dunnen, J T; Grootscholten, P M; Bakker, E; Blonden, L A; Ginjaar, H B; Wapenaar, M C; van Paassen, H M; van Broeckhoven, C; Pearson, P L; van Ommen, G J
1989-01-01
We have studied 34 Becker and 160 Duchenne muscular dystrophy (DMD) patients with the dystrophin cDNA, using conventional blots and FIGE analysis. One hundred twenty-eight mutations (65%) were found, 115 deletions and 13 duplications, of which 106 deletions and 11 duplications could be precisely mapped in relation to both the mRNA and the major and minor mutation hot spots. Junction fragments, ideal markers for carrier detection, were found in 23 (17%) of the 128 cases. We identified eight new cDNA RFLPs within the DMD gene. With the use of cDNA probes we have completed the long-range map of the DMD gene, by the identification of a 680-kb SfiI fragment containing the gene's 3' end. The size of the DMD gene is now determined to be about 2.3 million basepairs. The combination of cDNA hybridizations with long-range analysis of deletion and duplication patients yields a global picture of the exon spacing within the dystrophin gene. The gene shows a large variability of intron size, ranging from only a few kilobases to 160-180 kb for the P20 intron. Images Figure 1 Figure 4 PMID:2573997
The cDNA-derived amino acid sequence of hemoglobin II from Lucina pectinata.
Torres-Mercado, Elineth; Renta, Jessicca Y; Rodríguez, Yolanda; López-Garriga, Juan; Cadilla, Carmen L
2003-11-01
Hemoglobin II from the clam Lucina pectinata is an oxygen-reactive protein with a unique structural organization in the heme pocket involving residues Gln65 (E7), Tyr30 (B10), Phe44 (CD1), and Phe69 (E11). We employed the reverse transcriptase-polymerase chain reaction (RT-PCR) and methods to synthesize various cDNA(HbII). An initial 300-bp cDNA clone was amplified from total RNA by RT-PCR using degenerate oligonucleotides. Gene-specific primers derived from the HbII-partial cDNA sequence were used to obtain the 5' and 3' ends of the cDNA by RACE. The length of the HbII cDNA, estimated from overlapping clones, was approximately 2114 bases. Northern blot analysis revealed that the mRNA size of HbII agrees with the estimated size using cDNA data. The coding region of the full-length HbII cDNA codes for 151 amino acids. The calculated molecular weight of HbII, including the heme group and acetylated N-terminal residue, is 17,654.07 Da.
Attomole-level Genomics with Single-molecule Direct DNA, cDNA and RNA Sequencing Technologies.
Ozsolak, Fatih
2016-01-01
With the introduction of next-generation sequencing (NGS) technologies in 2005, the domination of microarrays in genomics quickly came to an end due to NGS's superior technical performance and cost advantages. By enabling genetic analysis capabilities that were not possible previously, NGS technologies have started to play an integral role in all areas of biomedical research. This chapter outlines the low-quantity DNA and cDNA sequencing capabilities and applications developed with the Helicos single molecule DNA sequencing technology.
Wang, H; Miao, S; Chen, D; Wang, L; Koide, S S
1999-10-06
The gene (HSD-1) coding a human sperm membrane protein (hSMP-1) was isolated from a human testis cDNA expression library using antibodies found in the serum of an infertile woman. HSD-1 was localized to a single locus on chromosome 9 and assigned to band 9p12-p13 by fluorescent in situ hybridization (FISH) mapping and DAPI (4,6-diamidino-2-phenylindole) banding, using rat/human somatic cell hybrids and metaphase chromosomes of human lymphocytes. In rescreening a testis lambdagt10 cDNA expression library, the full-length cDNA (HSD-1) and several truncated cDNAs with heterologous regions were isolated from positive clones. The heterology consisted of deletion, insertion and alteration of the 5'-end. These heterologous truncated fragments may be produced by alternative splicing of mRNAs. Two recombinant prokaryotic expression vectors were constructed with one of the heterologous fragment (clone #26) with and without the alternative 5'-end. Escherichia coli transfected with the construct containing the alternative 5'-end failed to produce the recombinant product, whereas those transfected with the vector lacking the 5'-end produced hSMP-1. DNASIS analysis of the structure of #26 mRNA suggests that the 5'-end has a stable secondary configuration that may maintain the mRNA in an inactivated state, whereby hindering its translation and preventing the expression of the gene.
Lee, Ra Mi; Ryu, Rae Hyung; Jeong, Seong Won; Oh, Soo Jin; Huang, Hue; Han, Jin Soo; Lee, Chi Ho; Lee, C. Justin; Jan, Lily Yeh
2011-01-01
To clone the first anion channel from Xenopus laevis (X. laevis), we isolated a calcium-activated chloride channel (CLCA)-like membrane protein 6 gene (CMP6) in X. laevis. As a first step in gene isolation, an expressed sequence tags database was screened to find the partial cDNA fragment. A putative partial cDNA sequence was obtained by comparison with rat CLCAs identified in our laboratory. First stranded cDNA was synthesized by reverse transcription polymerase-chain reaction (RT-PCR) using a specific primer designed for the target cDNA. Repeating the 5' and 3' rapid amplification of cDNA ends, full-length cDNA was constructed from the cDNA pool. The full-length CMP6 cDNA completed via 5'- and 3'-RACE was 2,940 bp long and had an open reading frame (ORF) of 940 amino acids. The predicted 940 polypeptides have four major transmembrane domains and showed about 50% identity with that of rat brain CLCAs in our previously published data. Semi-quantification analysis revealed that CMP6 was most abundantly expressed in small intestine, colon and liver. However, all tissues except small intestine, colon and liver had undetectable levels. This result became more credible after we did real-time PCR quantification for the target gene. In view of all CLCA studies focused on human or murine channels, this finding suggests a hypothetical protein as an ion channel, an X. laevis CLCA. PMID:21826170
Elrobh, Mohamed S.; Alanazi, Mohammad S.; Khan, Wajahatullah; Abduljaleel, Zainularifeen; Al-Amri, Abdullah; Bazzi, Mohammad D.
2011-01-01
Heat shock proteins are ubiquitous, induced under a number of environmental and metabolic stresses, with highly conserved DNA sequences among mammalian species. Camelus dromedaries (the Arabian camel) domesticated under semi-desert environments, is well adapted to tolerate and survive against severe drought and high temperatures for extended periods. This is the first report of molecular cloning and characterization of full length cDNA of encoding a putative stress-induced heat shock HSPA6 protein (also called HSP70B′) from Arabian camel. A full-length cDNA (2417 bp) was obtained by rapid amplification of cDNA ends (RACE) and cloned in pET-b expression vector. The sequence analysis of HSPA6 gene showed 1932 bp-long open reading frame encoding 643 amino acids. The complete cDNA sequence of the Arabian camel HSPA6 gene was submitted to NCBI GeneBank (accession number HQ214118.1). The BLAST analysis indicated that C. dromedaries HSPA6 gene nucleotides shared high similarity (77–91%) with heat shock gene nucleotide of other mammals. The deduced 643 amino acid sequences (accession number ADO12067.1) showed that the predicted protein has an estimated molecular weight of 70.5 kDa with a predicted isoelectric point (pI) of 6.0. The comparative analyses of camel HSPA6 protein sequences with other mammalian heat shock proteins (HSPs) showed high identity (80–94%). Predicted camel HSPA6 protein structure using Protein 3D structural analysis high similarities with human and mouse HSPs. Taken together, this study indicates that the cDNA sequences of HSPA6 gene and its amino acid and protein structure from the Arabian camel are highly conserved and have similarities with other mammalian species. PMID:21845074
Isolation of a cDNA Encoding a Granule-Bound 152-Kilodalton Starch-Branching Enzyme in Wheat1
Båga, Monica; Nair, Ramesh B.; Repellin, Anne; Scoles, Graham J.; Chibbar, Ravindra N.
2000-01-01
Screening of a wheat (Triticum aestivum) cDNA library for starch-branching enzyme I (SBEI) genes combined with 5′-rapid amplification of cDNA ends resulted in isolation of a 4,563-bp composite cDNA, Sbe1c. Based on sequence alignment to characterized SBEI cDNA clones isolated from plants, the SBEIc predicted from the cDNA sequence was produced with a transit peptide directing the polypeptide into plastids. Furthermore, the predicted mature form of SBEIc was much larger (152 kD) than previously characterized plant SBEI (80–100 kD) and contained a partial duplication of SBEI sequences. The first SBEI domain showed high amino acid similarity to a 74-kD wheat SBEI-like protein that is inactive as a branching enzyme when expressed in Escherichia coli. The second SBEI domain on SBEIc was identical in sequence to a functional 87-kD SBEI produced in the wheat endosperm. Immunoblot analysis of proteins produced in developing wheat kernels demonstrated that the 152-kD SBEIc was, in contrast to the 87- to 88-kD SBEI, preferentially associated with the starch granules. Proteins similar in size and recognized by wheat SBEI antibodies were also present in Triticum monococcum, Triticum tauschii, and Triticum turgidum subsp. durum. PMID:10982440
Large-Scale Concatenation cDNA Sequencing
Yu, Wei; Andersson, Björn; Worley, Kim C.; Muzny, Donna M.; Ding, Yan; Liu, Wen; Ricafrente, Jennifer Y.; Wentland, Meredith A.; Lennon, Greg; Gibbs, Richard A.
1997-01-01
A total of 100 kb of DNA derived from 69 individual human brain cDNA clones of 0.7–2.0 kb were sequenced by concatenated cDNA sequencing (CCS), whereby multiple individual DNA fragments are sequenced simultaneously in a single shotgun library. The method yielded accurate sequences and a similar efficiency compared with other shotgun libraries constructed from single DNA fragments (>20 kb). Computer analyses were carried out on 65 cDNA clone sequences and their corresponding end sequences to examine both nucleic acid and amino acid sequence similarities in the databases. Thirty-seven clones revealed no DNA database matches, 12 clones generated exact matches (≥98% identity), and 16 clones generated nonexact matches (57%–97% identity) to either known human or other species genes. Of those 28 matched clones, 8 had corresponding end sequences that failed to identify similarities. In a protein similarity search, 27 clone sequences displayed significant matches, whereas only 20 of the end sequences had matches to known protein sequences. Our data indicate that full-length cDNA insert sequences provide significantly more nucleic acid and protein sequence similarity matches than expressed sequence tags (ESTs) for database searching. [All 65 cDNA clone sequences described in this paper have been submitted to the GenBank data library under accession nos. U79240–U79304.] PMID:9110174
Lu, M; Wang, L F; Du, X H; Yu, Y K; Pan, J B; Nan, Z J; Han, J; Wang, W X; Zhang, Q Z; Sun, Q P
2015-11-30
Various plant genes can be activated or inhibited by phytohormones under conditions of biotic and abiotic stress, especially in response to jasmonic acid (JA) and salicylic acid (SA). Interactions between JA and SA may be synergistic or antagonistic, depending on the stress condition. In this study, we cloned a full-length cDNA (LeWRKY1, GenBank accession No. FJ654265) from Lycopersicon esculentum by rapid amplification of cDNA ends. Sequence analysis showed that this gene is a group II WRKY transcription factor. Analysis of LeWRKY1 mRNA expression in various tissues by qRT-PCR showed that the highest and lowest expression occurred in the leaves and stems, respectively. In addition, LeWRKY1 expression was induced by JA and Botrytis cinerea Pers., but not by SA.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Du, L.; Desbarats, M.; Viel, J.
1996-08-15
The recently identified human PEX g ene apparently encodes for a neutral endopeptidase that is mutated in patients with X-linked hypophosphatemia. The 3{prime} and 5{prime} ends of the coding region of PEX have not been cloned, nor has the tissue expression of the gene been identified. Here we report the isolation and characterization of the complete open reading frame of the mouse Pex gene and the demonstration of its expression in bone. Mouse Pex cDNA is predicted to encode a protein of 749 amino acids with 95% identity to the available human PEX sequence and significant homology to members ofmore » the membrane-bound metalloendopeptidase family. Northern blot analysis revealed a 6.6-kb transcript in bone and in cultured osteoblasts from normal mice that was not detectable in samples from the Hyp mouse, the murine homolog of human X-linked hypophosphatemia. Pex transcripts were, however, detectable in Hyp bone by RT-PCR amplification. Of particular interest, a cDNA clone from rat incisor shows 93% sequence identity to the 5{prime} end of Pex cDNA, suggesting that Pex may be expressed in another calcified tissue, the tooth. The association of impaired mineralization of bone and teeth and disturbed renal phosphate reabsorption with altered expression of Pex suggests that the Pex gene product may play a critical role in these processes. 47 refs., 2 figs., 1 tab.« less
Li, XiaoChing; Wang, Xiu-Jie; Tannenhauser, Jonathan; Podell, Sheila; Mukherjee, Piali; Hertel, Moritz; Biane, Jeremy; Masuda, Shoko; Nottebohm, Fernando; Gaasterland, Terry
2007-01-01
Vocal learning and neuronal replacement have been studied extensively in songbirds, but until recently, few molecular and genomic tools for songbird research existed. Here we describe new molecular/genomic resources developed in our laboratory. We made cDNA libraries from zebra finch (Taeniopygia guttata) brains at different developmental stages. A total of 11,000 cDNA clones from these libraries, representing 5,866 unique gene transcripts, were randomly picked and sequenced from the 3′ ends. A web-based database was established for clone tracking, sequence analysis, and functional annotations. Our cDNA libraries were not normalized. Sequencing ESTs without normalization produced many developmental stage-specific sequences, yielding insights into patterns of gene expression at different stages of brain development. In particular, the cDNA library made from brains at posthatching day 30–50, corresponding to the period of rapid song system development and song learning, has the most diverse and richest set of genes expressed. We also identified five microRNAs whose sequences are highly conserved between zebra finch and other species. We printed cDNA microarrays and profiled gene expression in the high vocal center of both adult male zebra finches and canaries (Serinus canaria). Genes differentially expressed in the high vocal center were identified from the microarray hybridization results. Selected genes were validated by in situ hybridization. Networks among the regulated genes were also identified. These resources provide songbird biologists with tools for genome annotation, comparative genomics, and microarray gene expression analysis. PMID:17426146
Cloning and expression of a cDNA coding for catalase from zebrafish (Danio rerio).
Ken, C F; Lin, C T; Wu, J L; Shaw, J F
2000-06-01
A full-length complementary DNA (cDNA) clone encoding a catalase was amplified by the rapid amplication of cDNA ends-polymerase chain reaction (RACE-PCR) technique from zebrafish (Danio rerio) mRNA. Nucleotide sequence analysis of this cDNA clone revealed that it comprised a complete open reading frame coding for 526 amino acid residues and that it had a molecular mass of 59 654 Da. The deduced amino acid sequence showed high similarity with the sequences of catalase from swine (86.9%), mouse (85.8%), rat (85%), human (83.7%), fruit fly (75.6%), nematode (71.1%), and yeast (58.6%). The amino acid residues for secondary structures are apparently conserved as they are present in other mammal species. Furthermore, the coding region of zebrafish catalase was introduced into an expression vector, pET-20b(+), and transformed into Escherichia coli expression host BL21(DE3)pLysS. A 60-kDa active catalase protein was expressed and detected by Coomassie blue staining as well as activity staining on polyacrylamide gel followed electrophoresis.
Molecular and characterization of NnPPO cDNA from lotus (Nelumbo nucifera) in rhizome browning.
Dong, C; Yu, A Q; Yang, M G; Zhou, M Q; Hu, Z L
2016-04-30
The complete cDNA (NnPPO) of polyphenol oxidase in Nelumbo nucifera was successfully isolated, using Rapid amplification cDNA end (RACE) assays. The full-length cDNA of NnPPO was 2069 bp in size, containing a 1791 bp open reading frame coding 597 amino acids. The putative NnPPO possessed the conserved active sites and domains for PPO function. Phylogenetic analysis revealed that NnPPO shared high homology with PPO of high plants, and the homology modeling proved that NnPPO had the typical structure of PPO family. In order to characterize the role of NnPPO, Real-time PCR assay demonstrated that NnPPO mRNA was expressed in different tissues of N. nucifera including young leave, rhizome, flower, root and leafstalk, with the highest expression in rhizome. Patterns of NnPPO expression in rhizome illustrated its mRNA level was significantly elevated, which was consistent with the change of NnPPO activity during rhizome browning. Therefore, transcriptional activation of NnPPO was probably the main reason causing rhizome browning.
De Oliveira Neto, Osmundo Brilhante; Batista, João Aguiar Nogueira; Rigden, Daniel John; Franco, Octávio Luiz; Fragoso, Rodrigo Rocha; Monteiro, Ana Carolina Santos; Monnerat, Rose Gomes; Grossi-De-Sa, Maria Fátima
2004-06-01
The cotton boll weevil (Anthonomus grandis) causes severe cotton crop losses in North and South America. This report describes the presence of cysteine proteinase activity in the cotton boll weevil. Cysteine proteinase inhibitors from different sources were assayed against total A. grandis proteinases but, unexpectedly, no inhibitor tested was particularly effective. In order to screen for active inhibitors against the boll weevil, a cysteine proteinase cDNA (Agcys1) was isolated from A. grandis larvae using degenerate primers and rapid amplification of cDNA ends (RACE) techniques. Sequence analysis showed significant homologies with other insect cysteine proteinases. Northern blot analysis indicated that the mRNA encoding the proteinase was transcribed mainly in the gut of larvae. No mRNA was detected in neonatal larvae, pupae, or in the gut of the adult insect, suggesting that Agcys1 is an important cysteine proteinase for larvae digestion. The isolated gene will facilitate the search for highly active inhibitors towards boll weevil larvae that may provide a new opportunity to control this important insect pest.
Henderson, R A; Krissansen, G W; Yong, R Y; Leung, E; Watson, J D; Dholakia, J N
1994-12-02
Protein synthesis in mammalian cells is regulated at the level of the guanine nucleotide exchange factor, eIF-2B, which catalyzes the exchange of eukaryotic initiation factor 2-bound GDP for GTP. We have isolated and sequenced cDNA clones encoding the delta-subunit of murine eIF-2B. The cDNA sequence encodes a polypeptide of 544 amino acids with molecular mass of 60 kDa. Antibodies against a synthetic polypeptide of 30 amino acids deduced from the cDNA sequence specifically react with the delta-subunit of mammalian eIF-2B. The cDNA-derived amino acid sequence shows significant homology with the yeast translational regulator Gcd2, supporting the hypothesis that Gcd2 may be the yeast homolog of the delta-subunit of mammalian eIF-2B. Primer extension studies and anchor polymerase chain reaction analysis were performed to determine the 5'-end of the transcript for the delta-subunit of eIF-2B. Results of these experiments demonstrate two different mRNAs for the delta-subunit of eIF-2B in murine cells. The isolation and characterization of two different full-length cDNAs also predicts the presence of two alternate forms of the delta-subunit of eIF-2B in murine cells. These differ at their amino-terminal end but have identical nucleotide sequences coding for amino acids 31-544.
Aptamer-based electrochemical sensors with aptamer-complementary DNA oligonucleotides as probe.
Lu, Ying; Li, Xianchan; Zhang, Limin; Yu, Ping; Su, Lei; Mao, Lanqun
2008-03-15
This study describes a facile and general strategy for the development of aptamer-based electrochemical sensors with a high specificity toward the targets and a ready regeneration feature. Very different from the existing strategies for the development of electrochemical aptasensors with the aptamers as the probes, the strategy proposed here is essentially based on the utilization of the aptamer-complementary DNA (cDNA) oligonucleotides as the probes for electrochemical sensing. In this context, the sequences at both ends of the cDNA are tailor-made to be complementary and both the redox moiety (i.e., ferrocene in this study) and thiol group are labeled onto the cDNA. The labeled cDNA are hybridized with their respective aptamers (i.e., ATP- and thrombin-binding aptamers in this study) to form double-stranded DNA (ds-DNA) and the electrochemical aptasensors are prepared by self-assembling the labeled ds-DNA onto Au electrodes. Upon target binding, the aptamers confined onto electrode surface dissociate from their respective cDNA oligonucleotides into the solution and the single-stranded cDNA could thus tend to form a hairpin structure through the hybridization of the complementary sequences at both its ends. Such a conformational change of the cDNA resulting from the target binding-induced dissociation of the aptamers essentially leads to the change in the voltammetric signal of the redox moiety labeled onto the cDNA and thus constitutes the mechanism for the electrochemical aptasensors for specific target sensing. The aptasensors demonstrated here with the cDNA as the probe are readily regenerated and show good responses toward the targets. This study may offer a new and relatively general approach to electrochemical aptasensors with good analytical properties and potential applications.
[Polymorphic loci and polymorphism analysis of short tandem repeats within XNP gene].
Liu, Qi-Ji; Gong, Yao-Qin; Guo, Chen-Hong; Chen, Bing-Xi; Li, Jiang-Xia; Guo, Yi-Shou
2002-01-01
To select polymorphic short tandem repeat markers within X-linked nuclear protein (XNP) gene, genomic clones which contain XNP gene were recognized by homologous analysis with XNP cDNA. By comparing the cDNA with genomic DNA, non-exonic sequences were identified, and short tandem repeats were selected from non-exonic sequences by using BCM search Launcher. Polymorphisms of the short tandem repeats in Chinese population were evaluated by PCR amplification and PAGE. Five short tandem repeats were identified from XNP gene, two of which were polymorphic. Four and 11 alleles were observed in Chinese population for XNPSTR1 and XNPSTR4, respectively. Heterozygosities were 47% for XNPSTR1 and 70% for XNPSTR4. XNPSTR1 and XNPSTR4 localized within 3' end and intron 10, respectively. Two polymorphic short tandem repeats have been identified within XNP gene and will be useful for linkage analysis and gene diagnosis of XNP gene.
Subramaniam, R; Reinold, S; Molitor, E K; Douglas, C J
1993-01-01
A heterologous probe encoding phenylalanine ammonia-lyase (PAL) was used to identify PAL clones in cDNA libraries made with RNA from young leaf tissue of two Populus deltoides x P. trichocarpa F1 hybrid clones. Sequence analysis of a 2.4-kb cDNA confirmed its identity as a full-length PAl clone. The predicted amino acid sequence is conserved in comparison with that of PAL genes from several other plants. Southern blot analysis of popular genomic DNA from parental and hybrid individuals, restriction site polymorphism in PAL cDNA clones, and sequence heterogeneity in the 3' ends of several cDNA clones suggested that PAL is encoded by at least two genes that can be distinguished by HindIII restriction site polymorphisms. Clones containing each type of PAL gene were isolated from a poplar genomic library. Analysis of the segregation of PAL-specific HindIII restriction fragment-length polymorphisms demonstrated the existence of two independently segregating PAL loci, one of which was mapped to a linkage group of the poplar genetic map. Developmentally regulated PAL expression in poplar was analyzed using RNA blots. Highest expression was observed in young stems, apical buds, and young leaves. Expression was lower in older stems and undetectable in mature leaves. Cellular localization of PAL expression by in situ hybridization showed very high levels of expression in subepidermal cells of leaves early during leaf development. In stems and petioles, expression was associated with subepidermal cells and vascular tissues. PMID:8108506
Cloning and sequence analysis of a cDNA clone coding for the mouse GM2 activator protein.
Bellachioma, G; Stirling, J L; Orlacchio, A; Beccari, T
1993-01-01
A cDNA (1.1 kb) containing the complete coding sequence for the mouse GM2 activator protein was isolated from a mouse macrophage library using a cDNA for the human protein as a probe. There was a single ATG located 12 bp from the 5' end of the cDNA clone followed by an open reading frame of 579 bp. Northern blot analysis of mouse macrophage RNA showed that there was a single band with a mobility corresponding to a size of 2.3 kb. We deduce from this that the mouse mRNA, in common with the mRNA for the human GM2 activator protein, has a long 3' untranslated sequence of approx. 1.7 kb. Alignment of the mouse and human deduced amino acid sequences showed 68% identity overall and 75% identity for the sequence on the C-terminal side of the first 31 residues, which in the human GM2 activator protein contains the signal peptide. Hydropathicity plots showed great similarity between the mouse and human sequences even in regions of low sequence similarity. There is a single N-glycosylation site in the mouse GM2 activator protein sequence (Asn151-Phe-Thr) which differs in its location from the single site reported in the human GM2 activator protein sequence (Asn63-Val-Thr). Images Figure 1 PMID:7689829
Dong, J G; Kim, W T; Yip, W K; Thompson, G A; Li, L; Bennett, A B; Yang, S F
1991-08-01
1-Aminocyclopropane-1-carboxylate (ACC) synthase (EC 4.4.1.14) purified from apple (Malus sylvestris Mill.) fruit was subjected to trypsin digestion. Following separation by reversed-phase high-pressure liquid chromatography, ten tryptic peptides were sequenced. Based on the sequences of three tryptic peptides, three sets of mixed oligonucleotide probes were synthesized and used to screen a plasmid cDNA library prepared from poly(A)(+) RNA of ripe apple fruit. A 1.5-kb (kilobase) cDNA clone which hybridized to all three probes were isolated. The clone contained an open reading frame of 1214 base pairs (bp) encoding a sequence of 404 amino acids. While the polyadenine tail at the 3'-end was intact, it lacked a portion of sequence at the 5'-end. Using the RNA-based polymerase chain reaction, an additional sequence of 148 bp was obtained at the 5'-end. Thus, 1362 bp were sequenced and they encode 454 amino acids. The deduced amino-acid sequence contained peptide sequences corresponding to all ten tryptic fragments, confirming the identity of the cDNA clone. Comparison of the deduced amino-acid sequence between ACC synthase from apple fruit and those from tomato (Lycopersicon esculentum Mill.) and winter squash (Cucurbita maxima Duch.) fruits demonstrated the presence of seven highly conserved regions, including the previously identified region for the active site. The size of the translation product of ACC-synthase mRNA was similar to that of the mature protein on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), indicating that apple ACC-synthase undergoes only minor, if any, post-translational proteolytic processing. Analysis of ACC-synthase mRNA by in-vitro translation-immunoprecipitation, and by Northern blotting indicates that the ACC-synthase mRNA was undetectable in unripe fruit, but was accumulated massively during the ripening proccess. These data demonstrate that the expression of the ACC-synthase gene is developmentally regulated.
Characterization and chromosomal mapping of the human TFG gene involved in thyroid carcinoma
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mencinger, M.; Panagopoulos, I.; Andreasson, P.
1997-05-01
Homology searches in the Expressed Sequence Tag Database were performed using SPYGQ-rich regions as query sequences to find genes encoding protein regions similar to the N-terminal parts of the sarcoma-associated EWS and FUS proteins. Clone 22911 (T74973), encoding a SPYGQ-rich region in its 5{prime} end, and several other clones that overlapped 22911 were selected. The combined data made it possible to assemble a full-length cDNA sequence. This cDNA sequence is 1677 bp, containing an initiation codon ATG, an open reading frame of 400 amino acids, a poly(A) signal, and a poly(A) tail. We found 100% identity between the 5{prime} partmore » of the consensus sequence and the 598-bp-long sequence named TFG. The TFG sequence is fused to the 3{prime} end of NTRK1, generating the TRK-T3 fusion transcript found in papillary thyroid carcinoma. The cDNA therefore represents the full-length transcript of the TFG gene. TFG was localized to 3q11-q12 by fluorescence in situ hybridization. The 3{prime} and the 5{prime} ends of the TFG cDNA probe hybridized to a 2.2-kb band on Northern blot filters in all tissues examined. 28 refs., 5 figs., 1 tab.« less
Problem-Solving Test: Expression Cloning of the Erythropoietin Receptor
ERIC Educational Resources Information Center
Szeberenyi, Jozsef
2008-01-01
Terms to be familiar with before you start to solve the test: cytokines, cytokine receptors, cDNA library, cDNA synthesis, poly(A)[superscript +] RNA, primer, template, reverse transcriptase, restriction endonucleases, cohesive ends, expression vector, promoter, Shine-Dalgarno sequence, poly(A) signal, DNA helicase, DNA ligase, topoisomerases,…
Geiss, K T; Abbas, G M; Makaroff, C A
1994-04-01
The mitochondrial gene coding for subunit 4 of the NADH dehydrogenase complex I (nad4) has been isolated and characterized from lettuce, Lactuca sativa. Analysis of nad4 genes in a number of plants by Southern hybridization had previously suggested that the intron content varied between species. Characterization of the lettuce gene confirms this observation. Lettuce nad4 contains two exons and one group IIA intron, whereas previously sequenced nad4 genes from turnip and wheat contain three group IIA introns. Northern analysis identified a transcript of 1600 nucleotides, which represents the mature nad4 mRNA and a primary transcript of 3200 nucleotides. Sequence analysis of lettuce and turnip nad4 cDNAs was used to confirm the intron/exon border sequences and to examine RNA editing patterns. Editing is observed at the 5' and 3' ends of the lettuce transcript, but is absent from sequences that correspond to exons two, three and the 5' end of exon four in turnip and wheat. In contrast, turnip transcripts are highly edited in this region, suggesting that homologous recombination of an edited and spliced cDNA intermediate was involved in the loss of introns two and three from an ancestral lettuce nad4 gene.
USDA-ARS?s Scientific Manuscript database
This study was conducted to clone and analyze the expression pattern of a C4H gene encoding cinnamate 4-hydroxylase from kenaf (Hibiscus cannabinus L.). A full-length C4H ortholog was cloned using degenerate primers and the RACE (rapid amplification of cDNA ends) method. The full-length C4H ortholog...
Analysis of expressed sequence tags generated from full-length enriched cDNA libraries of melon
2011-01-01
Background Melon (Cucumis melo), an economically important vegetable crop, belongs to the Cucurbitaceae family which includes several other important crops such as watermelon, cucumber, and pumpkin. It has served as a model system for sex determination and vascular biology studies. However, genomic resources currently available for melon are limited. Result We constructed eleven full-length enriched and four standard cDNA libraries from fruits, flowers, leaves, roots, cotyledons, and calluses of four different melon genotypes, and generated 71,577 and 22,179 ESTs from full-length enriched and standard cDNA libraries, respectively. These ESTs, together with ~35,000 ESTs available in public domains, were assembled into 24,444 unigenes, which were extensively annotated by comparing their sequences to different protein and functional domain databases, assigning them Gene Ontology (GO) terms, and mapping them onto metabolic pathways. Comparative analysis of melon unigenes and other plant genomes revealed that 75% to 85% of melon unigenes had homologs in other dicot plants, while approximately 70% had homologs in monocot plants. The analysis also identified 6,972 gene families that were conserved across dicot and monocot plants, and 181, 1,192, and 220 gene families specific to fleshy fruit-bearing plants, the Cucurbitaceae family, and melon, respectively. Digital expression analysis identified a total of 175 tissue-specific genes, which provides a valuable gene sequence resource for future genomics and functional studies. Furthermore, we identified 4,068 simple sequence repeats (SSRs) and 3,073 single nucleotide polymorphisms (SNPs) in the melon EST collection. Finally, we obtained a total of 1,382 melon full-length transcripts through the analysis of full-length enriched cDNA clones that were sequenced from both ends. Analysis of these full-length transcripts indicated that sizes of melon 5' and 3' UTRs were similar to those of tomato, but longer than many other dicot plants. Codon usages of melon full-length transcripts were largely similar to those of Arabidopsis coding sequences. Conclusion The collection of melon ESTs generated from full-length enriched and standard cDNA libraries is expected to play significant roles in annotating the melon genome. The ESTs and associated analysis results will be useful resources for gene discovery, functional analysis, marker-assisted breeding of melon and closely related species, comparative genomic studies and for gaining insights into gene expression patterns. PMID:21599934
Ahmad, Muhammad Khairi; Tabana, Yasser M; Ahmed, Mowaffaq Adam; Sandai, Doblin Anak; Mohamed, Rafeezul; Ismail, Ida Shazrina; Zulkiflie, Nurulisa; Yunus, Muhammad Amir
2017-12-01
A norovirus maintains its viability, infectivity and virulence by its ability to replicate. However, the biological mechanisms of the process remain to be explored. In this work, the NanoLuc™ Luciferase gene was used to develop a reporter-tagged replicon system to study norovirus replication. The NanoLuc™ Luciferase reporter protein was engineered to be expressed as a fusion protein for MNV-1 minor capsid protein, VP2. The foot-and-mouth disease virus 2A (FMDV2A) sequence was inserted between the 3'end of the reporter gene and the VP2 start sequence to allow co-translational 'cleavage' of fusion proteins during intracellular transcript expression. Amplification of the fusion gene was performed using a series of standard and overlapping polymerase chain reactions. The resulting amplicon was then cloned into three readily available backbones of MNV-1 cDNA clones. Restriction enzyme analysis indicated that the NanoLucTM Luciferase gene was successfully inserted into the parental MNV-1 cDNA clone. The insertion was further confirmed by using DNA sequencing. NanoLuc™ Luciferase-tagged MNV-1 cDNA clones were successfully engineered. Such clones can be exploited to develop robust experimental assays for in vitro assessments of viral RNA replication.
LEDGF/p75 Deficiency Increases Deletions at the HIV-1 cDNA Ends.
Bueno, Murilo T D; Reyes, Daniel; Llano, Manuel
2017-09-15
Processing of unintegrated linear HIV-1 cDNA by the host DNA repair system results in its degradation and/or circularization. As a consequence, deficient viral cDNA integration generally leads to an increase in the levels of HIV-1 cDNA circles containing one or two long terminal repeats (LTRs). Intriguingly, impaired HIV-1 integration in LEDGF/p75-deficient cells does not result in a correspondent increase in viral cDNA circles. We postulate that increased degradation of unintegrated linear viral cDNA in cells lacking the lens epithelium-derived growth factor (LEDGF/p75) account for this inconsistency. To evaluate this hypothesis, we characterized the nucleotide sequence spanning 2-LTR junctions isolated from LEDGF/p75-deficient and control cells. LEDGF/p75 deficiency resulted in a significant increase in the frequency of 2-LTRs harboring large deletions. Of note, these deletions were dependent on the 3' processing activity of integrase and were not originated by aberrant reverse transcription. Our findings suggest a novel role of LEDGF/p75 in protecting the unintegrated 3' processed linear HIV-1 cDNA from exonucleolytic degradation.
A putative peroxidase cDNA from turnip and analysis of the encoded protein sequence.
Romero-Gómez, S; Duarte-Vázquez, M A; García-Almendárez, B E; Mayorga-Martínez, L; Cervantes-Avilés, O; Regalado, C
2008-12-01
A putative peroxidase cDNA was isolated from turnip roots (Brassica napus L. var. purple top white globe) by reverse transcriptase-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). Total RNA extracted from mature turnip roots was used as a template for RT-PCR, using a degenerated primer designed to amplify the highly conserved distal motif of plant peroxidases. The resulting partial sequence was used to design the rest of the specific primers for 5' and 3' RACE. Two cDNA fragments were purified, sequenced, and aligned with the partial sequence from RT-PCR, and a complete overlapping sequence was obtained and labeled as BbPA (Genbank Accession No. AY423440, named as podC). The full length cDNA is 1167bp long and contains a 1077bp open reading frame (ORF) encoding a 358 deduced amino acid peroxidase polypeptide. The putative peroxidase (BnPA) showed a calculated Mr of 34kDa, and isoelectric point (pI) of 4.5, with no significant identity with other reported turnip peroxidases. Sequence alignment showed that only three peroxidases have a significant identity with BnPA namely AtP29a (84%), and AtPA2 (81%) from Arabidopsis thaliana, and HRPA2 (82%) from horseradish (Armoracia rusticana). Work is in progress to clone this gene into an adequate host to study the specific role and possible biotechnological applications of this alternative peroxidase source.
Rapid in silico cloning of genes using expressed sequence tags (ESTs).
Gill, R W; Sanseau, P
2000-01-01
Expressed sequence tags (ESTs) are short single-pass DNA sequences obtained from either end of cDNA clones. These ESTs are derived from a vast number of cDNA libraries obtained from different species. Human ESTs are the bulk of the data and have been widely used to identify new members of gene families, as markers on the human chromosomes, to discover polymorphism sites and to compare expression patterns in different tissues or pathologies states. Information strategies have been devised to query EST databases. Since most of the analysis is performed with a computer, the term "in silico" strategy has been coined. In this chapter we will review the current status of EST databases, the pros and cons of EST-type data and describe possible strategies to retrieve meaningful information.
NASA Astrophysics Data System (ADS)
Kikuchi, Shoshi
2009-02-01
Completion of the high-precision genome sequence analysis of rice led to the collection of about 35,000 full-length cDNA clones and the determination of their complete sequences. Mapping of these full-length cDNA sequences has given us information on (1) the number of genes expressed in the rice genome; (2) the start and end positions and exon-intron structures of rice genes; (3) alternative transcripts; (4) possible encoded proteins; (5) non-protein-coding (np) RNAs; (6) the density of gene localization on the chromosome; (7) setting the parameters of gene prediction programs; and (8) the construction of a microarray system that monitors global gene expression. Manual curation for rice gene annotation by using mapping information on full-length cDNA and EST assemblies has revealed about 32,000 expressed genes in the rice genome. Analysis of major gene families, such as those encoding membrane transport proteins (pumps, ion channels, and secondary transporters), along with the evolution from bacteria to higher animals and plants, reveals how gene numbers have increased through adaptation to circumstances. Family-based gene annotation also gives us a new way of comparing organisms. Massive amounts of data on gene expression under many kinds of physiological conditions are being accumulated in rice oligoarrays (22K and 44K) based on full-length cDNA sequences. Cluster analyses of genes that have the same promoter cis-elements, that have similar expression profiles, or that encode enzymes in the same metabolic pathways or signal transduction cascades give us clues to understanding the networks of gene expression in rice. As a tool for that purpose, we recently developed "RiCES", a tool for searching for cis-elements in the promoter regions of clustered genes.
Zhang, Quanwei; Gong, Jishang; Wang, Xueying; Wu, Xiaohu; Li, Yalan; Ma, Youji; Zhang, Yong; Zhao, Xingxu
2014-01-01
The IGF family is essential for normal embryonic and postnatal development and plays important roles in the immune system, myogenesis, bone metabolism and other physiological functions, which makes the study of its structure and biological characteristics important. Tianzhu white yak (Bos grunniens) domesticated under alpine hypoxia environments, is well adapted to survive and grow against severe hypoxia and cold temperatures for extended periods. In this study, a full coding sequence of the IGF2 gene of Tianzhu white yak was amplified by reverse transcription PCR and rapid-amplification of cDNA ends (RACE) for the first time. The cDNA sequence revealed an open reading frame of 450 nucleotides, encoding a protein with 179 amino acids. Its expression in different tissues was also studied by Real time PCR. Phylogenetic tree analysis indicated that yak IGF2 was similar to Bos taurus, and 3D structure showed high similarity with the human IGF2. The putative full CDS of yak IGF2 was amplified by PCR in five tissues, and cDNA sequence analysis showed high homology to bovine IGF2. Moreover the super secondary structure prediction showed a similar 3D structure with human IGF2. Its conservation in sequence and structure has facilitated research on IGF2 and its physiological function in yak. PMID:24394317
Cioffi, Anna Valentina; Ferrara, Diana; Cubellis, Maria Vittoria; Aniello, Francesco; Corrado, Marcella; Liguori, Francesca; Amoroso, Alessandro; Fucci, Laura; Branno, Margherita
2002-08-01
Analysis of the genome structure of the Paracentrotus lividus (sea urchin) DNA methyltransferase (DNA MTase) gene showed the presence of an open reading frame, named METEX, in intron 7 of the gene. METEX expression is developmentally regulated, showing no correlation with DNA MTase expression. In fact, DNA MTase transcripts are present at high concentrations in the early developmental stages, while METEX is expressed at late stages of development. Two METEX cDNA clones (Met1 and Met2) that are different in the 3' end have been isolated in a cDNA library screening. The putative translated protein from Met2 cDNA clone showed similarity with Escherichia coli endonuclease III on the basis of sequence and predictive three-dimensional structure. The protein, overexpressed in E. coli and purified, had functional properties similar to the endonuclease specific for apurinic/apyrimidinic (AP) sites on the basis of the lyase activity. Therefore the open reading frame, present in intron 7 of the P. lividus DNA MTase gene, codes for a functional AP endonuclease designated SuAP1.
Li, Kaiquan; Liu, Lin; Shang, Shengnan; Wang, Yi; Zhan, Yaoyao; Song, Jian; Zhang, Xiangxiang; Chang, Yaqing
2017-10-01
The ras-related C3 botulinum toxin substrate 1 (Rac1) belongs to Ras homolog (Rho) small GTPases subfamily. As an important molecular switch, Rac1 regulates various processes in the cell, especially in cellular immune response. With attempt to clarify characters and functions of Rac1 in sea cucumbers, full length cDNA of a Rac1 homolog in the sea cucumber Apostichopus japonicus (AjRac1) was cloned by transcriptome database mining and rapid amplification of cDNA ends (RACE) techniques. The open reading frame of AjRac1 is 579 bp encoding a protein with a length of 192 aa. Sequence analysis showed that AjRac1 is highly conserved as compared to those from other eukaryotic species. Phylogenetic analysis revealed that amino acid sequence of AjRac1 closely related to those from Strongylocentrotus purpuratus. Results of expression analysis showed that AjRac1 exhibited a relative high expression in blastula stage, adult coelomocytes and respiratory tree in A. japonicus. The transcription of AjRac1 in adult coelomocytes altered significantly at 4 h- and 12 h-after Vibrio splendidus infection, respectively, which indicated that AjRac1 involved in sea cucumber innate immunity. All data presented in this study will deepen our understanding of characterizations and immunological functions of Rac1 in sea cucumbers. Copyright © 2017 Elsevier Ltd. All rights reserved.
In vivo analysis of polyadenylation in prokaryotes.
Mohanty, Bijoy K; Kushner, Sidney R
2014-01-01
Polyadenylation at the 3' ends of mRNAs, tRNAs, rRNAs, and sRNAs plays important roles in RNA metabolism in both prokaryotes and eukaryotes. However, the nature of poly(A) tails in prokaryotes is distinct compared to their eukaryotic counterparts. Specifically, depending on the organism, eukaryotic poly(A) tails average between 50 and >200 nt and can easily be isolated by several techniques involving oligo(dT)-dependent cDNA amplification. In contrast, the bulk of the poly(A) tails present on prokaryotic transcripts is relatively short (<10 nt) and is difficult to characterize using similar techniques. This chapter describes methods that can circumvent these problems. For example, we discuss how to isolate total RNA and characterize its overall polyadenylation status employing a poly(A) sizing assay. Furthermore, we describe a technique involving RNase H treatment of total RNA followed by northern analysis in order to distinguish length of poly(A) tails on various types of transcripts. Finally, we outline a useful procedure to clone the poly(A) tails of specific transcripts using 5'-3' end-ligated RNA, which is independent of oligo(dT)-dependent cDNA amplification. These approaches are particularly helpful in analyzing transcripts with either short or long poly(A) tails both in prokaryotes and eukaryotes.
Li, Juan; Zhou, Jiao; Sun, Rongbo; Zhang, Haolin; Zong, Shixiang; Luo, Youqing; Sheng, Xia; Weng, Qiang
2013-04-01
The PBAN (pheromone biosynthesis activating neuropeptide)/pyrokinin peptides comprise a major neuropeptide family characterized by a common FXPRL amide at the C-terminus. These peptides are actively involved in many essential endocrine functions. For the first time, we reported the cDNA cloning and sequence determination of the PBAN from the seabuckthorn carpenterworm, Holcocerus hippophaecolus, by using rapid amplification of cDNA ends. The full-length cDNA of Hh-DH-PBAN contained five peptides: diapause hormone (DH) homolog, α-neuropeptide (NP), β-NP, PBAN, and γ-NP. All of the peptides were amidated at their C-terminus and shared a conserved motif, FXPR (or K) L. Moreover, Hh-DH-PBAN had high homology to the other members of the PBAN peptide family: 56% with Manduca sexta, 66% with Bombyx mori, 77% with Helicoverpa zea, and 47% with Plutella xylostella. Phylogenetic analysis revealed that Hh-DH-PBAN was closely related to PBANs from Noctuidae, demonstrated by the relatively higher similarity compared with H. zea. In addition, real-time quantitative PCR (qRT-PCR) analysis showed that Hh-DH-PBAN mRNA expression peaked in the brain-subesophageal ganglion (Br-SOG) complex, and was also detected at high levels during larval and adult stages. The expression decreased significantly after pupation. These results provided information concerning molecular structure characteristics of Hh-DH-PBAN, whose expression profile suggested that the Hh-DH-PBAN gene might be correlated with larval development and sex pheromone biosynthesis in females of the H. hippophaecolus. 2013 Wiley Periodicals, Inc
RNA-Seq analysis to capture the transcriptome landscape of a single cell
Tang, Fuchou; Barbacioru, Catalin; Nordman, Ellen; Xu, Nanlan; Bashkirov, Vladimir I; Lao, Kaiqin; Surani, M. Azim
2013-01-01
We describe here a protocol for digital transcriptome analysis in a single mouse blastomere using a deep sequencing approach. An individual blastomere was first isolated and put into lysate buffer by mouth pipette. Reverse transcription was then performed directly on the whole cell lysate. After this, the free primers were removed by Exonuclease I and a poly(A) tail was added to the 3′ end of the first-strand cDNA by Terminal Deoxynucleotidyl Transferase. Then the single cell cDNAs were amplified by 20 plus 9 cycles of PCR. Then 100-200 ng of these amplified cDNAs were used to construct a sequencing library. The sequencing library can be used for deep sequencing using the SOLiD system. Compared with the cDNA microarray technique, our assay can capture up to 75% more genes expressed in early embryos. The protocol can generate deep sequencing libraries within 6 days for 16 single cell samples. PMID:20203668
Beccari, T; Hoade, J; Orlacchio, A; Stirling, J L
1992-01-01
cDNAs encoding the mouse beta-N-acetylhexosaminidase alpha-subunit were isolated from a mouse testis library. The longest of these (1.7 kb) was sequenced and showed 83% similarity with the human alpha-subunit cDNA sequence. The 5' end of the coding sequence was obtained from a genomic DNA clone. Alignment of the human and mouse sequences showed that all three putative N-glycosylation sites are conserved, but that the mouse alpha-subunit has an additional site towards the C-terminus. All eight cysteines in the human sequence are conserved in the mouse. There are an additional two cysteines in the mouse alpha-subunit signal peptide. All amino acids affected in Tay-Sachs-disease mutations are conserved in the mouse. Images Fig. 1. PMID:1379046
Cloning and bioinformatics analysis of PDC genes from Hylocereus undatus
NASA Astrophysics Data System (ADS)
Wu, Yunli; Luo, Xian; Lu, Han; Shen, Yu; Yuan, Lei; Luo, Lan
2018-04-01
The cDNA of PDC1 and PDC2 were amplified from the seedling of Hylocereus undatus `Guangming 2' by the technique of RACE (rapid amplification of cDNA ends). The PDC1 and PDC2 had a length of 1191bp and 2046 bp, and an open reading frame that encoded a protein of 351 and 604 amino acids, respectively. PDC1 was similar to PDC2 in motif and domain, which indicated that the two protein was relatively conserved to some extent. The 3D structure prediction showed that both of the two proteins of PDC1 and PDC2 were homotetramers. Amino acid sequence comparisons suggested that PDC1 had high identity with Chenopodium quinoa PDC1 (88% identity), PDC2 had high identity with Beta vulgaris PDC2 (84% identity).
Clark, D P; Durell, S; Maloy, W L; Zasloff, M
1994-04-08
Antimicrobial peptides comprise a diverse class of molecules used in host defense by plants, insects, and animals. In this study we have isolated a novel antimicrobial peptide from the skin of the bullfrog, Rana catesbeiana. This 20 amino acid peptide, which we have termed Ranalexin, has the amino acid sequence: NH2-Phe-Leu-Gly-Gly-Leu-Ile-Lys-Ile-Val-Pro-Ala-Met-Ile-Cys-Ala-Val-Thr- Lys-Lys - Cys-COOH, and it contains a single intramolecular disulfide bond which forms a heptapeptide ring within the molecule. Structurally, Ranalexin resembles the bacterial antibiotic, polymyxin, which contains a similar heptapeptide ring. We have also cloned the cDNA for Ranalexin from a metamorphic R. catesbeiana tadpole cDNA library. Based on the cDNA sequence, it appears that Ranalexin is initially synthesized as a propeptide with a putative signal sequence and an acidic amino acid-rich region at its amino-terminal end. Interestingly, the putative signal sequence of the Ranalexin cDNA is strikingly similar to the signal sequence of opioid peptide precursors isolated from the skin of the South American frogs Phyllomedusa sauvagei and Phyllomedusa bicolor. Northern blot analysis and in situ hybridization experiments demonstrated that Ranalexin mRNA is first expressed in R. catesbeiana skin at metamorphosis and continues to be expressed into adulthood.
Yang, J; Yamamoto, M; Ishibashi, J; Taniai, K; Yamakawa, M
1998-08-01
An antibacterial protein, designated rhinocerosin, was purified to homogeneity from larvae of the coconut rhinoceros beetle, Oryctes rhinoceros immunized with Escherichia coli. Based on the amino acid sequence of the N-terminal region, a degenerate primer was synthesized and reverse-transcriptase PCR was performed to clone rhinocerosin cDNA. As a result, a 279-bp fragment was obtained. The complete nucleotide sequence was determined by sequencing the extended rhinocerosin cDNA clone by 5' rapid amplification of cDNA ends. The deduced amino acid sequence of the mature portion of rhinocerosin was composed of 72 amino acids without cystein residues and was shown to be rich in glycine (11.1%) and proline (11.1%) residues. Comparison of the deduced amino acid sequence of rhinocerosin with those of other antibacterial proteins indicated that it has 77.8% and 44.6% identity with holotricin 2 and coleoptrecin, respectively. Rhinocerosin had strong antibacterial activity against E. coli, Streptococcus pyogenes, Staphylococcus aureus but not against Pseudomonas aeruginosa. Results of reverse-transcriptase PCR analysis of gene expression in different tissues indicated that the rhinocerosin gene is strongly expressed in the fat body and the Malpighian tubule, and weakly expressed in hemocytes and midgut. In addition, gene expression was inducible by bacteria in the fat body, the Malpighian tubule and hemocyte but constitutive expression was observed in the midgut.
Ahmad, Muhammad Khairi; Tabana, Yasser M; Ahmed, Mowaffaq Adam; Sandai, Doblin Anak; Mohamed, Rafeezul; Ismail, Ida Shazrina; Zulkiflie, Nurulisa; Yunus, Muhammad Amir
2017-01-01
Background A norovirus maintains its viability, infectivity and virulence by its ability to replicate. However, the biological mechanisms of the process remain to be explored. In this work, the NanoLuc™ Luciferase gene was used to develop a reporter-tagged replicon system to study norovirus replication. Methods The NanoLuc™ Luciferase reporter protein was engineered to be expressed as a fusion protein for MNV-1 minor capsid protein, VP2. The foot-and-mouth disease virus 2A (FMDV2A) sequence was inserted between the 3′end of the reporter gene and the VP2 start sequence to allow co-translational ‘cleavage’ of fusion proteins during intracellular transcript expression. Amplification of the fusion gene was performed using a series of standard and overlapping polymerase chain reactions. The resulting amplicon was then cloned into three readily available backbones of MNV-1 cDNA clones. Results Restriction enzyme analysis indicated that the NanoLucTM Luciferase gene was successfully inserted into the parental MNV-1 cDNA clone. The insertion was further confirmed by using DNA sequencing. Conclusion NanoLuc™ Luciferase-tagged MNV-1 cDNA clones were successfully engineered. Such clones can be exploited to develop robust experimental assays for in vitro assessments of viral RNA replication. PMID:29379384
Zhang, Chun-Rong; Yang, Quan; Chen, Hu-Biao; Pang, Yu-Xin; Tang, Xiao-Min; Cheng, Xuan-Xuan; Wu, Wen-Ya; Chen, Shi-Min
2012-11-01
The rhizome of Alpinia officinarum is a widely used Chinese herbal medicine. The essential oil in A. officinarum rhizome is mainly composed of 1, 8-cineole and other monoterpenes, as the major bioactive ingredients. In plants, monoterpenes are synthesized through the methylerythritol phosphate (MEP) pathway in the plastids, and 1-deoxy-D-xylulose 5-phosphate reductoisomerase (DXR) is an enzyme catalyzing a committed step of the MEP pathway. In the present study, the full-length cDNA encoding DXR was cloned from the rhizome of A. officinarum, using homology-based RT-PCR and rapid amplification of cDNA ends (RACE) techniques. The new cDNA was designated as AoDXR and submitted to GenBank to be assigned with an accession number HQ874658. The full-length cDNA of AoDXR was 1 670 bp containing a 1 419 bp open reading frame encoding a polypeptide of 472 amino acids with a calculated molecular mass of 51.48 kDa and an isoelectric point of 6.15. Bioinformatic analyses revealed that AoDXR showed extensive homology with DXRs from other plant species and contained a conserved plastids transit peptide, a Pro-rich region and two highly conserved NADPH-binding motifs in its N-terminal region characterized by all plant DXRs. The phylogenetic analysis revealed that AoDXR belonged to angiosperm DXRs. The structural modeling of AoDXR showed that AoDXR had the typical V-shaped structure of DXR proteins. The tissue expression pattern analysis indicated that AoDXR expressed strongly in leaves, weak in rhizomes of A. officinarum. Exogenous methyl jasmonate (MeJA) could enhance the expression of AoDXR and the production of 1, 8-cineole in A. officinarum rhizomes. The cloning and characterization of AoDXR will be helpful to reveal the molecular regulation mechanism of monoterpene biosynthesis in A. officinarum and provides a candidate gene for metabolic engineering in improving the medicinal quality of A. officinarum rhizome.
Bhore, Subhash J.; Cha, Thye S.; Amelia, Kassim; Shah, Farida H.
2014-01-01
Background: Palm oil derived from fruits (mesocarp) of African oil palm (Elaeis guineensis Jacq. Tenera) and American oil palm (E. oleifera) is important for food industry. Due to high yield, Elaeis guineensis (Tenera) is cultivated on commercial scale, though its oil contains high (~54%) level of saturated fatty acids. The rate-limiting activity of beta-ketoacyl-[ACP] synthase-II (KAS-II) is considered mainly responsible for the high (44%) level of palmitic acid (C16:0) in the oil obtained from E. guineensis. Objective: The objective of this study was to annotate KAS-II cDNA isolated from American and African oil palms. Materials and Methods: The full-length E. oleifera KAS-II (EoKAS-II) cDNA clone was isolated using random method of gene isolation. Whereas, the E. guineensis KAS-II (EgTKAS-II) cDNA was isolated using reverse transcriptase polymerase chain reaction (RT-PCR) technique; and missing ends were obtained by employing 5’and 3’ RACE technique. Results: The results show that EoKAS-II and EgTKAS-II open reading frames (ORFs) are of 1689 and 1721 bp in length, respectively. Further analysis of the both EoKAS-II and EgTKAS-II predicted protein illustrates that they contains conserved domains for ‘KAS-I and II’, ‘elongating’ condensing enzymes, ‘condensing enzymes super-family’, and ‘3-oxoacyl-[ACP] synthase II’. The predicted protein sequences shows 95% similarity with each other. Consecutively, the three active sites (Cys, His, and His) were identified in both proteins. However, difference in positions of two active Histidine (His) residues was noticed. Conclusion: These insights may serve as the foundation in understanding the variable activity of KAS-II in American and African oil palms; and cDNA clones could be useful in the genetic engineering of oil palms. PMID:24678202
Qu, Chun-Pu; Xu, Zhi-Ru; Liu, Guan-Jun; Liu, Chun; Li, Yang; Wei, Zhi-Gang; Liu, Gui-Feng
2010-01-01
In aerobic organisms, protection against oxidative damage involves the combined action of highly specialized antioxidant enzymes, such as copper-zinc superoxide dismutase. In this work, a cDNA clone which encodes a copper-zinc superoxide dismutase gene, named PS-CuZnSOD, has been identified from P. sibiricum Laxm. by the rapid amplification of cDNA ends method (RACE). Analysis of the nucleotide sequence reveals that the PS-CuZnSOD gene cDNA clone consists of 669 bp, containing 87 bp in the 5' untranslated region; 459 bp in the open reading frame (ORF) encoding 152 amino acids; and 123 bp in 3' untranslated region. The gene accession nucleotide sequence number in GenBank is GQ472846. Sequence analysis indicates that the protein, like most plant superoxide dismutases (SOD), includes two conserved ecCuZnSOD signatures that are from the amino acids 43 to 51, and from the amino acids 137 to 148, and it has a signal peptide extension in the front of the N-terminus (1-16 aa). Expression analysis by real-time quantitative PCR reveals that the PS-CuZnSOD gene is expressed in leaves, stems and underground stems. PS-CuZnSOD gene expression can be induced by 3% NaHCO(3). The different mRNA levels' expression of PS-CuZnSOD show the gene's different expression modes in leaves, stems and underground stems under the salinity-alkalinity stress.
Mochida, Keiichi; Uehara-Yamaguchi, Yukiko; Takahashi, Fuminori; Yoshida, Takuhiro; Sakurai, Tetsuya; Shinozaki, Kazuo
2013-01-01
A comprehensive collection of full-length cDNAs is essential for correct structural gene annotation and functional analyses of genes. We constructed a mixed full-length cDNA library from 21 different tissues of Brachypodium distachyon Bd21, and obtained 78,163 high quality expressed sequence tags (ESTs) from both ends of ca. 40,000 clones (including 16,079 contigs). We updated gene structure annotations of Brachypodium genes based on full-length cDNA sequences in comparison with the latest publicly available annotations. About 10,000 non-redundant gene models were supported by full-length cDNAs; ca. 6,000 showed some transcription unit modifications. We also found ca. 580 novel gene models, including 362 newly identified in Bd21. Using the updated transcription start sites, we searched a total of 580 plant cis-motifs in the −3 kb promoter regions and determined a genome-wide Brachypodium promoter architecture. Furthermore, we integrated the Brachypodium full-length cDNAs and updated gene structures with available sequence resources in wheat and barley in a web-accessible database, the RIKEN Brachypodium FL cDNA database. The database represents a “one-stop” information resource for all genomic information in the Pooideae, facilitating functional analysis of genes in this model grass plant and seamless knowledge transfer to the Triticeae crops. PMID:24130698
Miles, M F; Barhite, S; Sganga, M; Elliott, M
1993-11-15
Acute and chronic exposure to ethanol produces specific changes in several signal transduction cascades. Such alterations in signaling are thought to be a crucial aspect of the central nervous system's adaptive response, which occurs with chronic exposure to ethanol. We have recently identified and isolated several genes whose expression is specifically induced by ethanol in neural cell cultures. The product of one of these genes has extensive sequence homology to phosducin, a phosphoprotein expressed in retina and pineal gland that modulates trimeric guanine nucleotide-binding protein (G protein) function by binding to G-protein beta gamma subunits. We identified from a rat brain cDNA library an isolate encoding the phosducin-like protein (PhLP), which has 41% identity and 65% amino acid homology to phosducin. PhLP cDNA is expressed in all tissues screened by RNA blot-hybridization analysis and shows marked evolutionary conservation on Southern hybridization. We have identified four forms of PhLP cDNA varying only in their 5' ends, probably due to alternative splicing. This 5'-end variation generates two predicted forms of PhLP protein that differ by 79 aa at the NH2 terminus. Treatment of NG108-15 cells for 24 hr with concentrations of ethanol seen in actively drinking alcoholics (25-100 mM) causes up to a 3-fold increase in PhLP mRNA levels. Induction of PhLP by ethanol could account for at least some of the widespread alterations in signal transduction and G-protein function that are known to occur with chronic exposure to ethanol.
Zhou, Rongqiong; Xia, Qingyou; Huang, Hancheng; Lai, Min; Wang, Zhenxin
2011-10-01
Toxocara canis is a widespread intestinal nematode parasite of dogs, which can also cause disease in humans. We employed an expressed sequence tag (EST) strategy in order to study gene-expression including development, digestion and reproduction of T. canis. ESTs provided a rapid way to identify genes, particularly in organisms for which we have very little molecular information. In this study, a cDNA library was constructed from a female adult of T. canis and 215 high-quality ESTs from 5'-ends of the cDNA clones representing 79 unigenes were obtained. The titer of the primary cDNA library was 1.83×10(6)pfu/mL with a recombination rate of 99.33%. Most of the sequences ranged from 300 to 900bp with an average length of 656bp. Cluster analysis of these ESTs allowed identification of 79 unique sequences containing 28 contigs and 51 singletons. BLASTX searches revealed that 18 unigenes (22.78% of the total) or 70 ESTs (32.56% of the total) were novel genes that had no significant matches to any protein sequences in the public databases. The rest of the 61 unigenes (77.22% of the total) or 145 ESTs (67.44% of the total) were closely matched to the known genes or sequences deposited in the public databases. These genes were classified into seven groups based on their known or putative biological functions. We also confirmed the gene expression patterns of several immune-related genes using RT-PCR examination. This work will provide a valuable resource for the further investigations in the stage-, sex- and tissue-specific gene transcription or expression. Copyright © 2011. Published by Elsevier Inc.
Comparative gene expression in sexual and apomictic ovaries of Pennisetum ciliare (L.) Link.
Vielle-Calzada, J P; Nuccio, M L; Budiman, M A; Thomas, T L; Burson, B L; Hussey, M A; Wing, R A
1996-12-01
Limited emphasis has been given to the molecular study of apomixis, an asexual method of reproduction where seeds are produced without fertilization. Most buffelgrass (Pennisetum ciliare (L.) Link syn = Cenchrus ciliaris L.) genotypes reproduce by obligate apomixis (apospory); however, rare sexual plants have been recovered. A modified differential display procedure was used to compare gene expression in unpollinated ovaries containing ovules with either sexual or apomictic female gametophytes. The modification incorporated end-labeled poly(A)+ anchored primers as the only isotopic source, and was a reliable and consistent approach for detecting differentially displayed transcripts. Using 20 different decamers and two anchor primers, 2268 cDNA fragments between 200 and 600 bp were displayed. From these, eight reproducible differentially displayed cDNAs were identified and cloned. Based on northern analysis, one cDNA was detected in only the sexual ovaries, two cDNAs in only apomictic ovaries and one cDNA was present in both types of ovaries. Three fragments could not be detected and one fragment was detected in ovaries, stems, and leaves. Comparison of gene expression during sexual and apomictic development in buffelgrass represents a new model system and a strategy for investigating female reproductive development in the angiosperms.
Wang, Tao; Yuan, Dengyue; Zhou, Chaowei; Lin, Fangjun; Wei, Rongbin; Chen, Hu; Wu, Hongwei; Xin, Zhiming; Liu, Ju; Gao, Yundi; Chen, Defang; Yang, Shiyong; Wang, Yan; Pu, Yundan; Li, Zhiqiong
2016-06-01
Melanin-concentrating hormone (MCH) is a crucial neuropeptide involved in various biological functions in both mammals and fish. In this study, the full-length MCH cDNA was obtained from Schizothorax prenanti by rapid amplification of cDNA ends polymerase chain reaction. The full-length MCH cDNA contained 589 nucleotides including an open reading frame of 375 nucleotides encoding 256 amino acids. MCH mRNA was highly expressed in the brain by real-time quantitative PCR analysis. Within the brain, expression of MCH mRNA was preponderantly detected in the hypothalamus. In addition, the MCH mRNA expression in the S. prenanti hypothalamus of fed group was significantly decreased compared with the fasted group at 1 and 3 h post-feeding, respectively. Furthermore, the MCH gene expression presented significant increase in the hypothalamus of fasted group compared with the fed group during long-term fasting. After re-feeding, there was a dramatic decrease in MCH mRNA expression in the hypothalamus of S. prenanti. The results indicate that the expression of MCH is affected by feeding status. Taken together, our results suggest that MCH may be involved in food intake regulation in S. prenanti.
Towards isolation of the gene for X-linked retinitis pigmentosa (RP3)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dry, K.L.; Aldred, M.A.; Hardwick, L.J.
1994-09-01
Until recently the region of interest containing the gene for X-linked retinitis pigmentosa (RP3) was thought to lie between CYBB (Xp21.1) and the proximal end of the deletion in patient BB (JBBprox). This region was thought to span 100-150 kb. Here we present new mapping data to show that the distance between the 5{prime} (most proximal) end of CYBB and JBBprox is only 50 kb. Recently Roux et al. (1994) have described the isolation of a gene within this region but this showed no disease-associated changes. Further evidence from mapping the deletion in patient NF (who suffered from McLead`s syndromemore » and CGD but not RP) and from linkage analysis of our RP3 families with a new dinucleotide repeat suggests that the gene must extend proximally from JBBprox. In order to extend the region of search we have constructed a YAC contig spanning 800 kb to OTC. We are continuing our search for the RP3 gene using a variety of strategies including exon trapping and cDNA enrichment as well as direct screening of cDNA libraries with subclones from this region.« less
Isolation of candidate genes of Friedreich`s ataxia on chromosome 9q13
DOE Office of Scientific and Technical Information (OSTI.GOV)
Montermini, L.; Zara, F.; Pandolfo, M.
1994-09-01
Friedreich`s ataxia (FRDA) is an autosomal recessive degenerative disease involving the central and peripheral nervous system and the heart. The mutated gene in FRDA has recently been localized within a 450 Kb interval on chromosome 9q13 between the markers D9S202/FR1/FR8. We have been able to confirm such localization for the disease gene by analysis of extended haplotype in consanguineous families. Cases of loss of marker homozygosity, which are likely to be due to ancient recombinations, have been found to involve D9S110, D9S15, and D9S111 on the telomeric side, and FR5 on the centromeric side, while homozygosity was always found formore » a core haplotype including D9S5, FD1, and D9S202. We constructed a YAC contig spanning the region between the telomeric markers and FR5, and cosmids have been obtained from the YACs. In order to isolate transcribed sequences from the FRDA candidate region we are utilizing a combination of approaches, including hybridization of YACs and cosmids to an arrayed human heart cDNA library, cDNA direct selection, and exon amplification. A transcribed sequence near the telomeric end of the region has been isolated by cDNA direct selection using pooled cosmids as genomic template and primary human heart, muscle, brain, liver and placenta cDNAs as cDNA source. We have shown this sequence to be the human equivalent of ZO-2, a tight junction protein previously described in the dog. No mutations of this gene have been found in FRDA subjects. Additional cDNA have recently been isolated and they are currently being evaluated.« less
Yu, Shunwu; Luo, Lijun
2008-12-01
Pyridoxal kinase is key enzyme for the biosynthesis of pyridoxal 5'-phosphate, the biologically active form of vitamin B6, in the salvage pathway. A pyridoxal kinase gene, BnPKL (GenBank accession No. DQ463962), was isolated from oilseed rape (Brassica napus L.) following water stress through rapid amplification of complementary DNA (cDNA) ends. The results showed that the gene had two splice variants: PKL and PKL2. PKL, the long cDNA, encodes a 334 amino acid protein with a complete ATP-binding site, pyridoxal kinase-binding site and dimer interface site of a pyridoxal kinase, while PKL2, the short cDNA, lacked a partial domain. Southern blot showed that there were two copies in Brassica napus. The expression of BnPKL cDNA could rescue the mutant phenotype of Escherichia coli defective in pyridoxal kinase. Real-time reverse transcription-polymerase chain reaction revealed that the relative abundance of two transcripts are modulated by development and environmental stresses. Abscisic acid and NaCl were inclined to decrease PKL expression, but H2O2 and cold temperatures induced the PKL expression. In addition, the PKL expression could be transiently induced by jasmonate acid at an early stage, abscisic acid, salicylic acid and jasmonate acid enhanced the PKL expression in roots. Our results demonstrated that BnPKL was a pyridoxal kinase involved in responses to biotic and abiotic stresses.
Shiroguchi, Katsuyuki; Jia, Tony Z.; Sims, Peter A.; Xie, X. Sunney
2012-01-01
RNA sequencing (RNA-Seq) is a powerful tool for transcriptome profiling, but is hampered by sequence-dependent bias and inaccuracy at low copy numbers intrinsic to exponential PCR amplification. We developed a simple strategy for mitigating these complications, allowing truly digital RNA-Seq. Following reverse transcription, a large set of barcode sequences is added in excess, and nearly every cDNA molecule is uniquely labeled by random attachment of barcode sequences to both ends. After PCR, we applied paired-end deep sequencing to read the two barcodes and cDNA sequences. Rather than counting the number of reads, RNA abundance is measured based on the number of unique barcode sequences observed for a given cDNA sequence. We optimized the barcodes to be unambiguously identifiable, even in the presence of multiple sequencing errors. This method allows counting with single-copy resolution despite sequence-dependent bias and PCR-amplification noise, and is analogous to digital PCR but amendable to quantifying a whole transcriptome. We demonstrated transcriptome profiling of Escherichia coli with more accurate and reproducible quantification than conventional RNA-Seq. PMID:22232676
Zhang, Yi; Zhao, Yuanyuan; Qiu, Xuehong; Han, Richou
2013-08-01
Coptotermes formosanus Shiraki (Isoptera: Rhinotermitidae) termites are harmful social insects to wood constructions. The current control methods heavily depend on the chemical insecticides with increasing resistance. Analysis of the differentially expressed genes mediated by chemical insecticides will contribute to the understanding of the termite resistance to chemicals and to the establishment of alternative control measures. In the present article, a full-length cDNA library was constructed from the termites induced by a mixture of commonly used insecticides (0.01% sulfluramid and 0.01% triflumuron) for 24 h, by using the RNA ligase-mediated Rapid Amplification cDNA End method. Fifty-eight differentially expressed clones were obtained by polymerase chain reaction and confirmed by dot-blot hybridization. Forty-six known sequences were obtained, which clustered into 33 unique sequences grouped in 6 contigs and 27 singlets. Sixty-seven percent (22) of the sequences had counterpart genes from other organisms, whereas 33% (11) were undescribed. A Gene Ontology analysis classified 33 unique sequences into different functional categories. In general, most of the differential expression genes were involved in binding and catalytic activity.
Expression analysis of HSP70 in the testis of Octopus tankahkeei under thermal stress.
Long, Ling-Li; Han, Ying-Li; Sheng, Zhang; Du, Chen; Wang, You-Fa; Zhu, Jun-Quan
2015-09-01
The gene encoding heat shock protein 70 (HSP70) was identified in Octopus tankahkeei by homologous cloning and rapid amplification of cDNA ends (RACE). The full-length cDNA (2471 bp) consists of a 5'-untranslated region (UTR) (89 bp), a 3'-UTR (426 bp), and an open reading frame (1956 bp) that encodes 651 amino acid residues with a predicted molecular mass of 71.8 kDa and an isoelectric point of 5.34. Based on the amino acid sequence analysis and multiple sequence alignment, this cDNA is a member of cytoplasmic hsp70 subfamily of the hsp70 family and was designated as ot-hsp70. Tissue expression analysis showed that HSP70 expression is highest in the testes when all examined organs were compared. Immunohistochemistry analysis, together with hematoxylin-eosin staining, revealed that the HSP70 protein was expressed in all spermatogenic cells, but not in fibroblasts. In addition, O. tankahkeei were heat challenged by exposure to 32 °C seawater for 2 h, then returned to 13 °C for various recovery time (0-24 h). Relative expression of ot-hsp70 mRNA in the testes was measured at different time points post-challenge by quantitative real-time PCR. A clear time-dependent mRNA expression of ot-hsp70 after thermal stress indicates that the HSP70 gene is inducible. Ultrastructural changes of the heat-stressed testis were observed by transmission electron microscopy. We suggest that HSP70 plays an important role in spermatogenesis and testis protection against thermal stress in O. tankahkeei. Copyright © 2015 Elsevier Inc. All rights reserved.
PMS2 gene mutational analysis: direct cDNA sequencing to circumvent pseudogene interference.
Wimmer, Katharina; Wernstedt, Annekatrin
2014-01-01
The presence of highly homologous pseudocopies can compromise the mutation analysis of a gene of interest. In particular, when using PCR-based strategies, pseudogene co-amplification has to be effectively prevented. This is often achieved by using primers designed to be parental gene specific according to the reference sequence and by applying stringent PCR conditions. However, there are cases in which this approach is of limited utility. For example, it has been shown that the PMS2 gene exchanges sequences with one of its pseudogenes, named PMS2CL. This results in functional PMS2 alleles containing pseudogene-derived sequences at their 3'-end and in nonfunctional PMS2CL pseudogene alleles that contain gene-derived sequences. Hence, the paralogues cannot be distinguished according to the reference sequence. This shortcoming can be effectively circumvented by using direct cDNA sequencing. This approach is based on the selective amplification of PMS2 transcripts in two overlapping 1.6-kb RT-PCR products. In addition to avoiding pseudogene co-amplification and allele dropout, this method has also the advantage that it allows to effectively identify deletions, splice mutations, and de novo retrotransposon insertions that escape the detection of most DNA-based mutation analysis protocols.
Constructing and detecting a cDNA library for mites.
Hu, Li; Zhao, YaE; Cheng, Juan; Yang, YuanJun; Li, Chen; Lu, ZhaoHui
2015-10-01
RNA extraction and construction of complementary DNA (cDNA) library for mites have been quite challenging due to difficulties in acquiring tiny living mites and breaking their hard chitin. The present study is to explore a better method to construct cDNA library for mites that will lay the foundation on transcriptome and molecular pathogenesis research. We selected Psoroptes cuniculi as an experimental subject and took the following steps to construct and verify cDNA library. First, we combined liquid nitrogen grinding with TRIzol for total RNA extraction. Then, switching mechanism at 5' end of the RNA transcript (SMART) technique was used to construct full-length cDNA library. To evaluate the quality of cDNA library, the library titer and recombination rate were calculated. The reliability of cDNA library was detected by sequencing and analyzing positive clones and genes amplified by specific primers. The results showed that the RNA concentration was 836 ng/μl and the absorbance ratio at 260/280 nm was 1.82. The library titer was 5.31 × 10(5) plaque-forming unit (PFU)/ml and the recombination rate was 98.21%, indicating that the library was of good quality. In the 33 expressed sequence tags (ESTs) of P. cuniculi, two clones of 1656 and 1658 bp were almost identical with only three variable sites detected, which had an identity of 99.63% with that of Psoroptes ovis, indicating that the cDNA library was reliable. Further detection by specific primers demonstrated that the 553-bp Pso c II gene sequences of P. cuniculi had an identity of 98.56% with those of P. ovis, confirming that the cDNA library was not only reliable but also feasible.
NASA Astrophysics Data System (ADS)
Hamid, Nur Athirah Abd; Ismail, Ismanizan
2013-11-01
Polygonum minus, locally named as Kesum is an aromatic herb which is high in secondary metabolite content. Alcohol dehydrogenase is an important enzyme that catalyzes the reversible oxidation of alcohol and aldehyde with the presence of NAD(P)(H) as co-factor. The main focus of this research is to identify the gene of ADH. The total RNA was extracted from leaves of P. minus which was treated with 150 μM Jasmonic acid. Full-length cDNA sequence of ADH was isolated via rapid amplification cDNA end (RACE). Subsequently, in silico analysis was conducted on the full-length cDNA sequence and PCR was done on genomic DNA to determine the exon and intron organization. Two sequences of ADH, designated as PmADH1 and PmADH2 were successfully isolated. Both sequences have ORF of 801 bp which encode 266 aa residues. Nucleotide sequence comparison of PmADH1 and PmADH2 indicated that both sequences are highly similar at the ORF region but divergent in the 3' untranslated regions (UTR). The amino acid is differ at the 107 residue; PmADH1 contains Gly (G) residue while PmADH2 contains Cys (C) residue. The intron-exon organization pattern of both sequences are also same, with 3 introns and 4 exons. Based on in silico analysis, both sequences contain "classical" short chain alcohol dehydrogenases/reductases ((c) SDRs) conserved domain. The results suggest that both sequences are the members of short chain alcohol dehydrogenase family.
In silico Analysis of 2085 Clones from a Normalized Rat Vestibular Periphery 3′ cDNA Library
Roche, Joseph P.; Cioffi, Joseph A.; Kwitek, Anne E.; Erbe, Christy B.; Popper, Paul
2005-01-01
The inserts from 2400 cDNA clones isolated from a normalized Rattus norvegicus vestibular periphery cDNA library were sequenced and characterized. The Wackym-Soares vestibular 3′ cDNA library was constructed from the saccular and utricular maculae, the ampullae of all three semicircular canals and Scarpa's ganglia containing the somata of the primary afferent neurons, microdissected from 104 male and female rats. The inserts from 2400 randomly selected clones were sequenced from the 5′ end. Each sequence was analyzed using the BLAST algorithm compared to the Genbank nonredundant, rat genome, mouse genome and human genome databases to search for high homology alignments. Of the initial 2400 clones, 315 (13%) were found to be of poor quality and did not yield useful information, and therefore were eliminated from the analysis. Of the remaining 2085 sequences, 918 (44%) were found to represent 758 unique genes having useful annotations that were identified in databases within the public domain or in the published literature; these sequences were designated as known characterized sequences. 1141 sequences (55%) aligned with 1011 unique sequences had no useful annotations and were designated as known but uncharacterized sequences. Of the remaining 26 sequences (1%), 24 aligned with rat genomic sequences, but none matched previously described rat expressed sequence tags or mRNAs. No significant alignment to the rat or human genomic sequences could be found for the remaining 2 sequences. Of the 2085 sequences analyzed, 86% were singletons. The known, characterized sequences were analyzed with the FatiGO online data-mining tool (http://fatigo.bioinfo.cnio.es/) to identify level 5 biological process gene ontology (GO) terms for each alignment and to group alignments with similar or identical GO terms. Numerous genes were identified that have not been previously shown to be expressed in the vestibular system. Further characterization of the novel cDNA sequences may lead to the identification of genes with vestibular-specific functions. Continued analysis of the rat vestibular periphery transcriptome should provide new insights into vestibular function and generate new hypotheses. Physiological studies are necessary to further elucidate the roles of the identified genes and novel sequences in vestibular function. PMID:16103642
Sequences of heavy and light chain variable regions from four bovine immunoglobulins.
Armour, K L; Tempest, P R; Fawcett, P H; Fernie, M L; King, S I; White, P; Taylor, G; Harris, W J
1994-12-01
Oligodeoxyribonucleotide primers based on the 5' ends of bovine IgG1/2 and lambda constant (C) region genes, together with primers encoding conserved amino acids at the N-terminus of mature variable (V) regions from other species, have been used in cDNA and polymerase chain reactions (PCRs) to amplify heavy and light chain V region cDNA from bovine heterohybridomas. The amino acid sequences of VH and V lambda from four bovine immunoglobulins of different specificities are presented.
Stress and transcriptional regulation of tick ferritin HC.
Mulenga, A; Simser, J A; Macaluso, K R; Azad, A F
2004-08-01
We previously identified a partial Dermacentor variabilis cDNA encoding ferritin HC (HC) subunit homolog (DVFER) that was differentially upregulated in Rickettsia montanensis infected ticks (Mulenga et al., 2003a). We have used rapid amplification of cDNA ends to clone full-length DVFER cDNA and its apparent ortholog from the wood tick, D. andersoni (DAFER), both of which show high sequence similarity to vertebrate than insect ferritin. Both DVFER and DAFER contain the stem-loop structure of a putative iron responsive element in the 5' untranslated region (nucleotide positions, 16-42) and the feroxidase centre loop typical for vertebrate ferritin HC subunits. Quantitative Western and Northern blotting analyses of protein and RNA from unfed and partially fed whole tick as well as dissected tick tissues demonstrated that DVFER is constitutively and ubiquitously expressed. Based on densitometric analysis of detected protein and mRNA bands, DVFER is predominantly expressed in the midgut, and to a lesser extent in the salivary glands, ovary and fatbody. Sham treatment (mechanical injury) and Escherichia coli challenge of D. variabilis ticks stimulated statistically significant (approximately 1.5- and approximately 3.0-fold, respectively) increases in DVFER mRNA abundance over time point matched naive control ticks. These data suggest that DVFER mRNA is nonspecifically up regulated in response to mechanical injury or bacterial infection induced stress.
NASA Astrophysics Data System (ADS)
Zhao, Chunling; Ju, Jiyu
2015-06-01
The full-length cDNA of a protease gene from a marine annelid Arenicola cristata was amplified through rapid amplification of cDNA ends technique and sequenced. The size of the cDNA was 936 bp in length, including an open reading frame encoding a polypeptide of 270 amino acid residues. The deduced amino acid sequnce consisted of pro- and mature sequences. The protease belonged to the serine protease family because it contained the highly conserved sequence GDSGGP. This protease was novel as it showed a low amino acid sequence similarity (< 40%) to other serine proteases. The gene encoding the active form of A. cristata serine protease was cloned and expressed in E. coli. Purified recombinant protease in a supernatant could dissolve an artificial fibrin plate with plasminogen-rich fibrin, whereas the plasminogen-free fibrin showed no clear zone caused by hydrolysis. This result suggested that the recombinant protease showed an indirect fibrinolytic activity of dissolving fibrin, and was probably a plasminogen activator. A rat model with venous thrombosis was established to demonstrate that the recombinant protease could also hydrolyze blood clot in vivo. Therefore, this recombinant protease may be used as a thrombolytic agent for thrombosis treatment. To our knowledge, this study is the first of reporting the fibrinolytic serine protease gene in A. cristata.
Molecular cloning and characterization of novel phytocystatin gene from turmeric, Curcuma longa.
Chan, Seow-Neng; Abu Bakar, Norliza; Mahmood, Maziah; Ho, Chai-Ling; Shaharuddin, Noor Azmi
2014-01-01
Phytocystatin, a type of protease inhibitor (PI), plays major roles in plant defense mechanisms and has been reported to show antipathogenic properties and plant stress tolerance. Recombinant plant PIs are gaining popularity as potential candidates in engineering of crop protection and in synthesizing medicine. It is therefore crucial to identify PI from novel sources like Curcuma longa as it is more effective in combating against pathogens due to its novelty. In this study, a novel cDNA fragment encoding phytocystatin was isolated using degenerate PCR primers, designed from consensus regions of phytocystatin from other plant species. A full-length cDNA of the phytocystatin gene, designated CypCl, was acquired using 5'/3' rapid amplification of cDNA ends method and it has been deposited in NCBI database (accession number KF545954.1). It has a 687 bp long open reading frame (ORF) which encodes 228 amino acids. BLAST result indicated that CypCl is similar to cystatin protease inhibitor from Cucumis sativus with 74% max identity. Sequence analysis showed that CypCl contains most of the motifs found in a cystatin, including a G residue, LARFAV-, QxVxG sequence, PW dipeptide, and SNSL sequence at C-terminal extension. Phylogenetic studies also showed that CypCl is related to phytocystatin from Elaeis guineensis.
MASA syndrome is caused by mutations in the neural cell adhesion gene, L1CAM
DOE Office of Scientific and Technical Information (OSTI.GOV)
Schwartz, C.E.; Wang, Y.; Schroer, R.J.
1994-09-01
The MASA syndrome is a recessive X-linked disorder characterized by Mental retardation, Adducted thumbs, Shuffling gait and Aphasia. Recently we found that MASA in one family was likely caused by a point mutation in exon 6 of the L1CAM gene. This gene has also been shown to be involved in X-linked hydrocephalus (HSAS). We have screened 60 patients with either sporadic HSAS or MASA as well as two additional families with MASA. For the screening, we initially utilized 3 cDNA probes for the L1CAM gene. In one of the MASA families, K8310, two affected males were found to have anmore » altered BglII band. The band was present in their carrier mother but not in their normal brothers. This band was detected by the entire cDNA probe as well as the cDNA probe for 3{prime} end of the gene. Analysis of the L1CAM sequence indicated the altered BglII site is distal to the exon 28 but proximal to the punative poly A signal site. It is hypothesized that this point mutation alters the stability of the L1CAM mRNA. This is being tested using cell lines established from the two affected males.« less
Molecular Cloning and Characterization of Novel Phytocystatin Gene from Turmeric, Curcuma longa
Chan, Seow-Neng; Abu Bakar, Norliza; Mahmood, Maziah; Ho, Chai-Ling
2014-01-01
Phytocystatin, a type of protease inhibitor (PI), plays major roles in plant defense mechanisms and has been reported to show antipathogenic properties and plant stress tolerance. Recombinant plant PIs are gaining popularity as potential candidates in engineering of crop protection and in synthesizing medicine. It is therefore crucial to identify PI from novel sources like Curcuma longa as it is more effective in combating against pathogens due to its novelty. In this study, a novel cDNA fragment encoding phytocystatin was isolated using degenerate PCR primers, designed from consensus regions of phytocystatin from other plant species. A full-length cDNA of the phytocystatin gene, designated CypCl, was acquired using 5′/3′ rapid amplification of cDNA ends method and it has been deposited in NCBI database (accession number KF545954.1). It has a 687 bp long open reading frame (ORF) which encodes 228 amino acids. BLAST result indicated that CypCl is similar to cystatin protease inhibitor from Cucumis sativus with 74% max identity. Sequence analysis showed that CypCl contains most of the motifs found in a cystatin, including a G residue, LARFAV-, QxVxG sequence, PW dipeptide, and SNSL sequence at C-terminal extension. Phylogenetic studies also showed that CypCl is related to phytocystatin from Elaeis guineensis. PMID:25853138
Non-biased and efficient global amplification of a single-cell cDNA library
Huang, Huan; Goto, Mari; Tsunoda, Hiroyuki; Sun, Lizhou; Taniguchi, Kiyomi; Matsunaga, Hiroko; Kambara, Hideki
2014-01-01
Analysis of single-cell gene expression promises a more precise understanding of molecular mechanisms of a living system. Most techniques only allow studies of the expressions for limited numbers of gene species. When amplification of cDNA was carried out for analysing more genes, amplification biases were frequently reported. A non-biased and efficient global-amplification method, which uses a single-cell cDNA library immobilized on beads, was developed for analysing entire gene expressions for single cells. Every step in this analysis from reverse transcription to cDNA amplification was optimized. By removing degrading excess primers, the bias due to the digestion of cDNA was prevented. Since the residual reagents, which affect the efficiency of each subsequent reaction, could be removed by washing beads, the conditions for uniform and maximized amplification of cDNAs were achieved. The differences in the amplification rates for randomly selected eight genes were within 1.5-folds, which could be negligible for most of the applications of single-cell analysis. The global amplification gives a large amount of amplified cDNA (>100 μg) from a single cell (2-pg mRNA), and that amount is enough for downstream analysis. The proposed global-amplification method was used to analyse transcript ratios of multiple cDNA targets (from several copies to several thousand copies) quantitatively. PMID:24141095
Sakuradani, Eiji; Kobayashi, Michihiko; Shimizu, Sakayu
1999-01-01
Based on the sequence information for bovine and yeast NADH-cytochrome b5 reductases (CbRs), a DNA fragment was cloned from Mortierella alpina 1S-4 after PCR amplification. This fragment was used as a probe to isolate a cDNA clone with an open reading frame encoding 298 amino acid residues which show marked sequence similarity to CbRs from other sources, such as yeast (Saccharomyces cerevisiae), bovine, human, and rat CbRs. These results suggested that this cDNA is a CbR gene. The results of a structural comparison of the flavin-binding β-barrel domains of CbRs from various species and that of the M. alpina enzyme suggested that the overall barrel-folding patterns are similar to each other and that a specific arrangement of three highly conserved amino acid residues (i.e., arginine, tyrosine, and serine) plays a role in binding with the flavin (another prosthetic group) through hydrogen bonds. The corresponding genomic gene, which was also cloned from M. alpina 1S-4 by means of a hybridization method with the above probe, had four introns of different sizes. These introns had GT at the 5′ end and AG at the 3′ end, according to a general GT-AG rule. The expression of the full-length cDNA in a filamentous fungus, Aspergillus oryzae, resulted in an increase (4.7 times) in ferricyanide reduction activity involving the use of NADH as an electron donor in the microsomes. The M. alpina CbR was purified by solubilization of microsomes with cholic acid sodium salt, followed by DEAE-Sephacel, Mono-Q HR 5/5, and AMP-Sepharose 4B affinity column chromatographies; there was a 645-fold increase in the NADH-ferricyanide reductase specific activity. The purified CbR preferred NADH over NADPH as an electron donor. This is the first report of an analysis of this enzyme in filamentous fungi. PMID:10473389
[cDNA library construction from panicle meristem of finger millet].
Radchuk, V; Pirko, Ia V; Isaenkov, S V; Emets, A I; Blium, Ia B
2014-01-01
The protocol for production of full-size cDNA using SuperScript Full-Length cDNA Library Construction Kit II (Invitrogen) was tested and high quality cDNA library from meristematic tissue of finger millet panicle (Eleusine coracana (L.) Gaertn) was created. The titer of obtained cDNA library comprised 3.01 x 10(5) CFU/ml in avarage. In average the length of cDNA insertion consisted about 1070 base pairs, the effectivity of cDNA fragment insertions--99.5%. The selective sequencing of cDNA clones from created library was performed. The sequences of cDNA clones were identified with usage of BLAST-search. The results of cDNA library analysis and selective sequencing represents prove good functionality and full length character of inserted cDNA clones. Obtained cDNA library from meristematic tissue of finger millet panicle represents good and valuable source for isolation and identification of key genes regulating metabolism and meristematic development and for mining of new molecular markers to conduct out high quality genetic investigations and molecular breeding as well.
NASA Technical Reports Server (NTRS)
Wu, L. L.; Mitchell, J. P.; Cohn, N. S.; Kaufman, P. B.
1993-01-01
The invertase (EC 3.2.1.26) purified from cell walls of dwarf pea stems to homogeneity has a molecular mass of 64 kilodaltons (kD). Poly(A)+RNA was isolated from shoots of dwarf pea plants, and a cDNA library was constructed using lambda gt11 as an expression vector. The expression cDNA library was screened with polyclonal antibodies against pea cell wall invertase. One invertase cDNA clone was characterized as a full-length cDNA with 1,863 base pairs. Compared with other known invertases, one homologous region in the amino acid sequence was found. The conserved motif, Asn-Asp-Pro-Asn-Gly, is located near the N-terminal end of invertase. Northern blot analysis showed that the amount of invertase mRNA (1.86 kb) was rapidly induced to a maximal level 4 h after GA3 treatment, then gradually decreased to the control level. The mRNA level at 4 h in GA3-treated peas was fivefold higher than that of the control group. The maximal increase in activity of pea cell wall invertase elicited by GA3 occcured at 8 h after GA3 treatment. This invertase isoform was shown immunocytochemically to be localized in the cell walls, where a 10-fold higher accumulation occurred in GA3-treated tissue compared with control tissue. This study indicates that the expression of the pea shoot cell-wall invertase gene could be regulated by GA3 at transcriptional and/or translational levels.
Shpakovskiĭ, G V; Lebedenko, E N; Thuriaux, P
1997-02-01
The rpb10 cDNA of the fission yeast Schizosaccharomyces pombe, encoding one of the five small subunits common to all three nuclear DNA-dependent RNA polymerases, was isolated from an expression cDNA library by two independent approaches: PCR-based screening and direct suppression by means of heterospecific complementation of a temperature-sensitive mutant defective in the corresponding gene of Saccharomyces cerevisiae. The cloned Sz. pombe cDNA encodes a protein Rpb10 of 71 amino acids with an M of 8,275 Da, sharing 51 amino acids (71% identity) with the subunit ABC10 beta of RNA polymerases I-III from S. cerevisiae. All eukaryotic members of this protein family have the same general organization featuring two highly conserved motifs (RCFT/SCGK and RYCCRRM) around an atypical zinc finger and an additional invariant HVDLIEK motif toward the C-terminal end. The last motif is only characteristics for homologs from eukaryotes. In keeping with this remarkable structural conservation, the Sz. pombe cDNA also fully complemented a S. cerevisiae deletion mutant lacking subunit ABC10 beta (null allele rpb10-delta 1::HIS3).
Li, Jitao; Han, Junying; Chen, Ping; Chang, Zhiqiang; He, Yuying; Liu, Ping; Wang, Qingyin; Li, Jian
2012-06-01
Heat shock protein 90 (HSP90) is a highly conserved molecular chaperone contributing to the folding, maintenance of structural integrity and proper regulation of a subset of cytosolic proteins. In this study, a heat shock protein 90 cDNA named EcHSP90 was cloned from the hepatopancreas of ridgetail white prawn Exopalaemon carinicauda by reverse transcription polymerase chain reaction (RT-PCR) coupled with rapid amplification of cDNA ends (RACE) approaches. The full-length cDNA of EcHSP90 was of 2695 bp, including an open reading frame (ORF) of 2163 bp encoding a polypeptide of 720 amino acids with an estimated molecular mass of 82.73 kDa and an estimated isoelectric point of 4.83. BLAST analysis revealed that the EcHSP90 shared high similarity (87.6%-75.24%) with other known HSP90s. The five conserved amino acid blocks defined as HSP90 protein family signatures were also identified in EcHSP90, which indicated that EcHSP90 should be a cytosolic member of the HSP90 family. Quantitative real-time RT-PCR analysis revealed that EcHSP90 transcript could be detected in all the tested tissues, and strongly expressed in ovary of E. carinicauda. The transcript of EcHSP90 in hepatopancreas of E. carinicauda showed different expression profiles after pH and ammonia-N stresses. The results indicated that EcHSP90 was a constitutive and inducible expressed protein and could be induced by various stresses from environment. Copyright © 2012 Elsevier Ltd. All rights reserved.
Strand-specific transcriptome profiling with directly labeled RNA on genomic tiling microarrays
2011-01-01
Background With lower manufacturing cost, high spot density, and flexible probe design, genomic tiling microarrays are ideal for comprehensive transcriptome studies. Typically, transcriptome profiling using microarrays involves reverse transcription, which converts RNA to cDNA. The cDNA is then labeled and hybridized to the probes on the arrays, thus the RNA signals are detected indirectly. Reverse transcription is known to generate artifactual cDNA, in particular the synthesis of second-strand cDNA, leading to false discovery of antisense RNA. To address this issue, we have developed an effective method using RNA that is directly labeled, thus by-passing the cDNA generation. This paper describes this method and its application to the mapping of transcriptome profiles. Results RNA extracted from laboratory cultures of Porphyromonas gingivalis was fluorescently labeled with an alkylation reagent and hybridized directly to probes on genomic tiling microarrays specifically designed for this periodontal pathogen. The generated transcriptome profile was strand-specific and produced signals close to background level in most antisense regions of the genome. In contrast, high levels of signal were detected in the antisense regions when the hybridization was done with cDNA. Five antisense areas were tested with independent strand-specific RT-PCR and none to negligible amplification was detected, indicating that the strong antisense cDNA signals were experimental artifacts. Conclusions An efficient method was developed for mapping transcriptome profiles specific to both coding strands of a bacterial genome. This method chemically labels and uses extracted RNA directly in microarray hybridization. The generated transcriptome profile was free of cDNA artifactual signals. In addition, this method requires fewer processing steps and is potentially more sensitive in detecting small amount of RNA compared to conventional end-labeling methods due to the incorporation of more fluorescent molecules per RNA fragment. PMID:21235785
NASA Astrophysics Data System (ADS)
Qi, Fei; Guo, Huarong; Wang, Jian
2008-02-01
Reversible protein phosphorylation, catalyzed by protein kinases and phosphatases, is an important and versatile mechanism by which eukaryotic cells regulate almost all the signaling processes. Protein phosphatase 1 (PP1) is the first and well-characterized member of the protein serine/threonine phosphatase family. In the present study, a full-length cDNA encoding the beta isoform of the catalytic subunit of protein phosphatase 1(PP1cb), was for the first time isolated and sequenced from the skin tissue of flatfish turbot Scophthalmus maximus, designated SmPP1cb, by the rapid amplification of cDNA ends (RACE) technique. The cDNA sequence of SmPP1cb we obtained contains a 984 bp open reading frame (ORF), flanked by a complete 39 bp 5' untranslated region and 462 bp 3' untranslated region. The ORF encodes a putative 327 amino acid protein, and the N-terminal section of this protein is highly acidic, Met-Ala-Glu-Gly-Glu-Leu-Asp-Val-Asp, a common feature for PP1 catalytic subunit but absent in protein phosphatase 2B (PP2B). And its calculated molecular mass is 37 193 Da and pI 5.8. Sequence analysis indicated that, SmPP1cb is extremely conserved in both amino acid and nucleotide acid levels compared with the PP1cb of other vertebrates and invertebrates, and its Kozak motif contained in the 5'UTR around ATG start codon is GXXAXXGXX ATGG, which is different from mammalian in two positions A-6 and G-3, indicating the possibility of different initiation of translation in turbot, and also the 3'UTR of SmPP1cb is highly diverse in the sequence similarity and length compared with other animals, especially zebrafish. The cloning and sequencing of SmPP1cb gene lays a good foundation for the future work on the biological functions of PP1 in the flatfish turbot.
Zhao, Wei; Li, Xin; Liu, Wen-Hui; Zhao, Jian; Jin, Yi-Ming; Sui, Ting-Ting
2014-09-01
Human epithelial colorectal adenocarcinoma (Caco-2) cells are widely used as an in vitro model of the human small intestinal mucosa. Caco-2 cells are host cells of the human astrovirus (HAstV) and other enteroviruses. High quality cDNA libraries are pertinent resources and critical tools for protein-protein interaction research, but are currently unavailable for Caco-2 cells. To construct a three-open reading frame, full length-expression cDNA library from the Caco-2 cell line for application to HAstV protein-protein interaction screening, total RNA was extracted from Caco-2 cells. The switching mechanism at the 5' end of the RNA transcript technique was used for cDNA synthesis. Double-stranded cDNA was digested by Sfi I and ligated to reconstruct a pGADT7-Sfi I three-frame vector. The ligation mixture was transformed into Escherichia coli HST08 premium electro cells by electroporation to construct the primary cDNA library. The library capacity was 1.0×10(6)clones. Gel electrophoresis results indicated that the fragments ranged from 0.5kb to 4.2kb. Randomly picked clones show that the recombination rate was 100%. The three-frame primary cDNA library plasmid mixture (5×10(5)cfu) was also transformed into E. coli HST08 premium electro cells, and all clones were harvested to amplify the cDNA library. To detect the sufficiency of the cDNA library, HAstV capsid protein as bait was screened and tested against the Caco-2 cDNA library by a yeast two-hybrid (Y2H) system. A total of 20 proteins were found to interact with the capsid protein. These results showed that a high-quality three-frame cDNA library from Caco-2 cells was successfully constructed. This library was efficient for the application to the Y2H system, and could be used for future research. Copyright © 2014 Elsevier B.V. All rights reserved.
Roux, Michelle M.; Pain, Arnab; Klimpel, Kurt R.; Dhar, Arun K.
2002-01-01
Pattern recognition proteins such as lipopolysaccharide and β-1,3-glucan binding protein (LGBP) play an important role in the innate immune response of crustaceans and insects. Random sequencing of cDNA clones from a hepatopancreas cDNA library of white spot virus (WSV)-infected shrimp provided a partial cDNA (PsEST-289) that showed similarity to the LGBP gene of crayfish and insects. Subsequently full-length cDNA was cloned by the 5′-RACE (rapid amplification of cDNA ends) technique and sequenced. The shrimp LGBP gene is 1,352 bases in length and is capable of encoding a polypeptide of 376 amino acids that showed significant similarity to homologous genes from crayfish, insects, earthworms, and sea urchins. Analysis of the shrimp LGBP deduced amino acid sequence identified conserved features of this gene family including a potential recognition motif for β-(1→3) linkage of polysaccharides and putative RGD cell adhesion sites. It is known that LGBP gene expression is upregulated in bacterial and fungal infection and that the binding of lipopolysaccharide and β-1,3-glucan to LGBP activates the prophenoloxidase (proPO) cascade. The temporal expression of LGBP and proPO genes in healthy and WSV-challenged Penaeus stylirostris shrimp was measured by real-time quantitative reverse transcription-PCR, and we showed that LGBP gene expression in shrimp was upregulated as the WSV infection progressed. Interestingly, the proPO expression was upregulated initially after infection followed by a downregulation as the viral infection progressed. The downward trend in the expression of proPO coincided with the detection of WSV in the infected shrimp. Our data suggest that shrimp LGBP is an inducible acute-phase protein that may play a critical role in shrimp-WSV interaction and that the WSV infection regulates the activation and/or activity of the proPO cascade in a novel way. PMID:12072514
Liao, Zhihua; Chen, Rong; Chen, Min; Yang, Chunxian; Wang, Qiang; Gong, Yifu
2007-01-01
1-Deoxy-D-xylulose 5-phosphate (DXP) reductoisomerase (DXR; EC 1.1.1.267) catalyzes a committed step of the methylerythritol phosphate (MEP) pathway for the biosynthesis of pharmaceutical terpenoid indole alkaloid (TIA) precursors. The full-length cDNA sequence was cloned and characterized from a TIA-producing species, Rauvolfia verticillata, using rapid amplification of cDNA ends (RACE) technique. The new cDNA was named as RvDXR and submitted to GenBank to be assigned with an accession number (DQ779286). The full-length cDNA of RvDXR was 1804 bp containing a 1425 bp open reading frame (ORF) encoding a polypeptide of 474 amino acids with a calculated molecular mass of 51.3 kDa and an isoelectric point of 5.88. Comparative and bioinformatic analyses revealed that RvDXR showed extensive homology with DXRs from other plant species and contained a conserved transit peptide for plastids, an extended Pro-rich region and a highly conserved NADPH-binding motif in its N-terminal region owned by all plant DXRs. The phylogenetic analysis revealed that DXRs had two groups including a plant and bacterial group; RvDXR belonged to angiosperm DXRs that were obtained from Synechocystis through gene transfer according to the phylogenetic analysis. The structural modeling of RvDXR showed that RvDXR had the typical V-shaped structure of DXR proteins. The tissue expression pattern analysis indicated that RvDXR expressed in all tissues including roots, stems, leaves, fruits and followers but at different levels. The lowest transcription level was observed in followers and the highest transcription was found in fruits of R. verticillata; the transcription level of RvDXR was a little higher in roots and stems than in leaves. The cloning and characterization of RvDXR will be helpful to understand more about the role of DXR involved in R. verticillata TIA biosynthesis at the molecular level and provides a candidate gene for metabolic engineering of the TIAs pathway in R. verticillata.
Isolation and characterization of cDNA clones for carrot extensin and a proline-rich 33-kDa protein
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chen, J.; Varner, J.E.
1985-07-01
Extensins are hydroxyproline-rich glycoproteins associated with most dicotyledonous plant cell walls. To isolate cDNA clones encoding extensin, the authors started by isolating poly(A) RNA from carrot root tissue, and then translating the RNA in vitro, in the presence of tritiated leucine or proline. A 33-kDa peptide was identified in the translation products as a putative extensin precursor. From a cDNA library constructed with poly(A) RNA from wounded carrots, one cDNA clone (pDC5) was identified that specifically hybridized to poly(A) RNA encoding this 33-kDa peptide. They isolated three cDNA clones (pDC11, pDC12, and pDC16) from another cDNA library using pCD5 asmore » a probe. DNA sequence data, RNA hybridization analysis, and hybrid released in vitro translation indicate that the cDNA clones pDC11 encodes extensin and that cDNA clones pDC12 and pDC16 encode the 33-kDa peptide, which as yet has an unknown identity and function. The assumption that the 33-kDa peptide was an extensin precursor was invalid. RNA hybridization analysis showed that RNA encoded by both clone types is accumulated upon wounding.« less
İnce, İkbal Agah; Pijlman, Gorben P; Vlak, Just M; van Oers, Monique M
2017-11-01
Previously, we observed that the transcripts of Invertebrate iridescent virus 6 (IIV6) are not polyadenylated, in line with the absence of canonical poly(A) motifs (AATAAA) downstream of the open reading frames (ORFs) in the genome. Here, we determined the 3' ends of the transcripts of fifty-four IIV6 virion protein genes in infected Drosophila Schneider 2 (S2) cells. By using ligation-based amplification of cDNA ends (LACE) it was shown that the IIV6 mRNAs often ended with a CAUUA motif. In silico analysis showed that the 3'-untranslated regions of IIV6 genes have the ability to form hairpin structures (22-56 nt in length) and that for about half of all IIV6 genes these 3' sequences contained complementary TAATG and CATTA motifs. We also show that a hairpin in the 3' flanking region with conserved sequence motifs is a conserved feature in invertebrate-infecting iridoviruses (genus Iridovirus and Chloriridovirus). Copyright © 2017 Elsevier Inc. All rights reserved.
Ma, Guang Xu; Zhou, Rong Qiong; Hu, Shi Jun; Huang, Han Cheng; Zhu, Tao; Xia, Qing You
2014-06-01
Toxocara canis (T. canis) is a widely prevalent zoonotic parasite that infects a wide range of mammalian hosts, including humans. We generated the full-length complementary DNA (cDNA) of the serine/threonine phosphatase gene of T. canis (Tc stp) using 5' rapid amplification of the cDNA ends. The 1192-bp sequence contained a continuous 942-nucleotide open reading frame, encoding a 313-amino-acid polypeptide. The Tc STP polypeptide shares a high level of amino-acid sequence identity with the predicted STPs of Loa loa (89%), Brugia malayi (86%), Oesophagostomum columbianum (76%), and Oesophagostomumdentatum (76%). The Tc STP contains GDXHG, GDXVDRG, GNHE motifs, which are characteristic of members of the phosphoprotein phosphatase family. Our quantitative real-time polymerase chain reaction analysis showed that the Tc STP was expressed in six different tissues in the adult male, with high-level expression in the spermary, vas deferens, and musculature, but was not expressed in the adult female, suggesting that Tc STP might be involved in spermatogenesis and mating behavior. Thus, STP might represent a potential molecular target for controlling T. canis reproduction. Copyright © 2014 Elsevier Inc. All rights reserved.
Han, Jong Won; Klochkova, Tatyana A.; Shim, Jun Bo; Yoon, Kangsup
2012-01-01
In red algae, spermatial binding to female trichogynes is mediated by a lectin-carbohydrate complementary system. Aglaothamnion oosumiense is a microscopic filamentous red alga. The gamete recognition and binding occur at the surface of the hairlike trichogyne on the female carpogonium. Male spermatia are nonmotile. Previous studies suggested the presence of a lectin responsible for gamete recognition on the surface of female trychogynes. A novel N-acetyl-d-galactosamine-specific protein was isolated from female plants of A. oosumiense by affinity chromatography and named AOL1. The lectin was monomeric and did not agglutinate horse blood or human erythrocytes. The N-terminal amino acid sequence of the protein was analyzed, and degenerate primers were designed. A full-length cDNA encoding the lectin was obtained using rapid amplification of cDNA ends-PCR (RACE-PCR). The cDNA was 1,095 bp in length and coded for a protein of 259 amino acids with a deduced molecular mass of 21.4 kDa, which agreed well with the protein data. PCR analysis using genomic DNA showed that both male and female plants have this gene. However, Northern blotting and two-dimensional electrophoresis showed that this protein was expressed 12 to 15 times more in female plants. The lectin inhibited spermatial binding to the trichogynes when preincubated with spermatia, suggesting its involvement in gamete binding. PMID:22865077
Hoter, Abdullah; Amiri, Mahdi; Warda, Mohamad; Naim, Hassan Y
2018-05-27
Endoplasmin, or GRP94, is an ER-located stress inducible molecular chaperone implicated in the folding and assembly of many proteins. The Arabian one-humped camel lives in an environment of thermal stress, nevertheless is able to encounter the risk of misfolded proteins. Here, the cDNA encoding camel GRP94 was isolated by rapid amplification of cDNA ends. The isolated cDNA contained an open reading frame of 2412 bp encoding a protein of 803 amino acids with predicted molecular mass of 92.5 kDa. Nucleotide and protein BLAST analysis of cGRP94 revealed strong conservation between camel and other domestic mammals. Overexpression of cGRP94 in COS-1 cells revealed multiple isoforms including one N-glycosylated species. Immunofluorescence colocalized cGRP94 with the ER resident protein calnexin. Interestingly, none of the cGRP94 isoforms expressed in CHO cells was N-glycosylated, presumably due to folding determinants that mask the N-glycosylation sites as proposed by in silico modelling. Surprisingly, isoforms of cGRP94 were detected in the culture media of transfected cells indicating that the protein, although an ER resident, also is trafficked and secreted into the exterior milieu. The overall striking structural homologies of GRP94s among mammalian reflects their pivotal role in the ER quality control and protein homeostasis. Copyright © 2017. Published by Elsevier B.V.
Baptiste, J; Milne Edwards, D; Delort, J; Mallet, J
1993-01-01
Among numerous applications, the polymerase chain reaction (PCR) (1,2) provides a convenient means to clone 5' ends of rare mRNAs and to generate cDNA libraries from tissue available in amounts too low to be processed by conventional methods. Basically, the amplification of cDNAs by the PCR requires the availability of the sequences of two stretches of the molecule to be amplified. A sequence can easily be imposed at the 5' end of the first-strand cDNAs (corresponding to the 3' end of the mRNAs) by priming the reverse transcription with a specific primer (for cloning the 5' end of rare messenger) or with an oligonucleotide tailored with a poly (dT) stretch (for cDNA library construction), taking advantage of the poly (A) sequence that is located at the 3' end of mRNAs. Several strategies have been devised to tag the 3' end of the ss-cDNAs (corresponding to the 55' end of the mRNAs). We (3) and others have described strategies based on the addition of a homopolymeric dG (4,5) or dA (6,7) tail using terminal deoxyribonucleotide transferase (TdT) ("anchor-PCR" [4]). However, this strategy has important limitations. The TdT reaction is difficult to control and has a low efficiency (unpublished observations). But most importantly, the return primers containing a homopolymeric (dC or dT) tail generate nonspecific amplifications, a phenomenon that prevents the isolation of low abundance mRNA species and/or interferes with the relative abundance of primary clones in the library. To circumvent these drawbacks, we have used two approaches. First, we devised a strategy based on a cRNA enrichment procedure, which has been useful to eliminate nonspecific-PCR products and to allow detection and cloning of cDNAs of low abundance (3). More recently, to avoid the nonspecific amplification resulting from the annealing of the homopolymeric tail oligonucleotide, we have developed a novel anchoring strategy that is based on the ligation of an oligonucleotide to the 35' end of ss-cDNAs. This strategy is referred to as SLIC for single-strand ligation to ss-cDNA (8).
Cloning and expression analysis of a HSP70 gene from Pacific abalone (Haliotis discus hannai).
Cheng, Peizhou; Liu, Xiao; Zhang, Guofan; He, Jianguo
2007-01-01
Heat shock protein 70 (HSP70), the primary member of HSPs that are responsive of thermal stress, is found in all multicellular organisms and functions mostly as molecular chaperon. The inducible HSP70 cDNA cloned from Pacific abalone (Haliotis discus hannai) using rapid amplification of cDNA ends (RACE), was highly homologous to other HSP70 genes. The full-length cDNA of the Pacific abalone HSP70 was 2631bp, consisting of a 5'-terminal untranslated region (UTR) of 90bp, a 3'-terminal UTR of 573bp with a canonical polyadenylation signal sequence AATAAA and a poly (A) tail, and an open reading frame of 1968bp. The HSP70 cDNA encoded a polypeptide of 655 amino acids with an ATPase domain of 382 amino acids, the substrate peptide binding domain of 161 amino acids and a C-terminus domain of 112 amino acids. The temporal expression of HSP70 was measured by semi-quantitative RT-PCR after heat shock and bacterial challenge. Challenge of Pacific abalone with heat shock or the pathogenic bacteria Vibrio anguillarum resulted in a dramatic increase in the expression of HSP70 mRNA level in muscle, followed by a recovery to normal level after 96h. Unlike the muscle, the levels of HSP70 expression in gills reached the top at 12h and maintained a relatively high level compared with the control after thermal and bacterial challenge. The upregulated mRNA expression of HSP70 in the abalone following heat shock and infection response indicates that the HSP70 gene is inducible and involved in immune response.
Tagging potato leafroll virus with the jellyfish green fluorescent protein gene.
Nurkiyanova, K M; Ryabov, E V; Commandeur, U; Duncan, G H; Canto, T; Gray, S M; Mayo, M A; Taliansky, M E
2000-03-01
A full-length cDNA corresponding to the RNA genome of Potato leafroll virus (PLRV) was modified by inserting cDNA that encoded the jellyfish green fluorescent protein (GFP) into the P5 gene near its 3' end. Nicotiana benthamiana protoplasts electroporated with plasmid DNA containing this cDNA behind the 35S RNA promoter of Cauliflower mosaic virus became infected with the recombinant virus (PLRV-GFP). Up to 5% of transfected protoplasts showed GFP-specific fluorescence. Progeny virus particles were morphologically indistinguishable from those of wild-type PLRV but, unlike PLRV particles, they bound to grids coated with antibodies to GFP. Aphids fed on extracts of these protoplasts transmitted PLRV-GFP to test plants, as shown by specific fluorescence in some vascular tissue and epidermal cells and subsequent systemic infection. In plants agroinfected with PLRV-GFP cDNA in pBIN19, some cells became fluorescent and systemic infections developed. However, after either type of inoculation, fluorescence was mostly restricted to single cells and the only PLRV genome detected in systemically infected tissues lacked some or all of the inserted GFP cDNA, apparently because of naturally occurring deletions. Thus, intact PLRV-GFP was unable to move from cell to cell. Nevertheless, PLRV-GFP has novel potential for exploring the initial stages of PLRV infection.
Chalcone synthase genes from milk thistle (Silybum marianum): isolation and expression analysis.
Sanjari, Sepideh; Shobbar, Zahra Sadat; Ebrahimi, Mohsen; Hasanloo, Tahereh; Sadat-Noori, Seyed-Ahmad; Tirnaz, Soodeh
2015-12-01
Silymarin is a flavonoid compound derived from milk thistle (Silybum marianum) seeds which has several pharmacological applications. Chalcone synthase (CHS) is a key enzyme in the biosynthesis of flavonoids; thereby, the identification of CHS encoding genes in milk thistle plant can be of great importance. In the current research, fragments of CHS genes were amplified using degenerate primers based on the conserved parts of Asteraceae CHS genes, and then cloned and sequenced. Analysis of the resultant nucleotide and deduced amino acid sequences led to the identification of two different members of CHS gene family,SmCHS1 and SmCHS2. Third member, full-length cDNA (SmCHS3) was isolated by rapid amplification of cDNA ends (RACE), whose open reading frame contained 1239 bp including exon 1 (190 bp) and exon 2 (1049 bp), encoding 63 and 349 amino acids, respectively. In silico analysis of SmCHS3 sequence contains all the conserved CHS sites and shares high homology with CHS proteins from other plants.Real-time PCR analysis indicated that SmCHS1 and SmCHS3 had the highest transcript level in petals in the early flowering stage and in the stem of five upper leaves, followed by five upper leaves in the mid-flowering stage which are most probably involved in anthocyanin and silymarin biosynthesis.
Lü, Dingding; Hou, Chengxiang; Qin, Guangxing; Gao, Kun; Chen, Tian; Guo, Xijie
2017-01-01
A full-length cDNA of lebocin 5 (BmLeb5) was first cloned from silkworm, Bombyx mori , by rapid amplification of cDNA ends. The BmLeb5 gene is 808 bp in length and the open reading frame encodes a 179-amino acid hydroxyproline-rich peptide. Bioinformatic analysis results showed that BmLeb5 owns an O-glycosylation site and four RXXR motifs as other lebocins. Sequence similarity and phylogenic analysis results indicated that lebocins form a multiple gene family in silkworm as cecropins. Quantitative real-time PCR analysis revealed that BmLeb5 was highest expressed in the fat body. In the silkworm larvae infected by Beauveria bassiana , the expression level of BmLeb5 was upregulated in the fat body and hemolymph which are the most important immune tissues in silkworm. The recombinant protein of BmLeb5 was for the first time successfully expressed with prokaryotic expression system and purified. There are no reports so far that the expression of lebocins could be induced by entomopathogenic fungus. Our study suggested that BmLeb5 might play an important role in the immune response of silkworm to defend B. bassiana infection. The results also provided helpful information for further studying the lebocin family functioned in antifungal immune response in the silkworm.
Isolation of CYP3A5P cDNA from human liver: a reflection of a novel cytochrome P-450 pseudogene.
Schuetz, J D; Guzelian, P S
1995-03-14
We have isolated, from a human liver cDNA library, a 1627 bp CYP3A5 cDNA variant (CYP3A5P) that contains several large insertions, deletions, and in-frame termination codons. By comparison with the genomic structure of other CYP3A genes, the major insertions in CYP3A5P cDNA demarcate the inferred sites of several CYP3A5 exons. The segments inserted in CYP3A5P have no homology with splice donor acceptor sites. It is unlikely that CYP3A5P cDNA represents an artifact of the cloning procedures since Southern blot analysis of human genomic DNA disclosed that CYP3A5P cDNA hybridized with a DNA fragment distinct from fragments that hybridized with either CYP3A5, CYP3A3 or CYP3A4. Moreover, analysis of adult human liver RNA on Northern blots hybridized with a CYP3A5P cDNA fragment revealed the presence of an mRNA with the predicted size of CYP3A5P. We conclude that CYP3A5P cDNA was derived from a separate gene, CYP3A5P, most likely a pseudogene evolved from CYP3A5.
NASA Astrophysics Data System (ADS)
Han, Xiaolin; Liu, Ping; Gao, Baoquan; Wang, Haofeng; Duan, Yafei; Xu, Wenfei; Chen, Ping
2015-07-01
Na+/K+-ATPases are membrane-associated enzymes responsible for the active transport of Na+ and K+ ions across cell membranes, generating chemical and electrical gradients. These enzymes' α-subunit provides catalytic function, binding and hydrolyzing ATP, and itself becoming phosphorylated during the transport cycle. In this study, Na+/K+-ATPase α-subunit cDNA was cloned from gill tissue of the swimming crab Portunus trituberculatus by reverse-transcription polymerase chain reaction (RT-PCR) and rapid amplification of cDNA end methods. Analysis of the nucleotide sequence revealed that the cDNA had a full-length of 3 833 base pairs (bp), with an open reading frame of 3 120 bp, 5' untranslated region (UTR) of 317 bp, and 3' UTR of 396 bp. The sequence encoded a 1 039 amino acid protein with a predicted molecular weight of 115.57 kDa and with estimated pI of 5.21. It was predicted here to possess all expected features of Na+/K+-ATPase members, including eight transmembrane domains, putative ATP-binding site, and phosphorylation site. Comparison of amino acid sequences showed that the P. trituberculatus α-subunit possessed an overall identity of 75%-99% to that of other organisms. Phylogenetic analysis revealed that this α-subunit was in the same category as those of crustaceans. Quantitative real-time RT-PCR analysis indicated that this α-subunit's transcript were most highly expressed in gill and lowest in muscle. RT-PCR analysis also revealed that α-subunit expression in crab gill decreased after 2 and 6 h, but increased after 12, 24, 48, and 72 h. In addition, α-subunit expression in hepatopancreas of crab decreased after 2-72 h. These facts indicated that the crab's Na+/K+-ATPase α-subunit was potentially involved in the observed acute response to low salinity stress.
Lu, L; Komada, M; Kitamura, N
1998-06-15
Hrs is a 115kDa zinc finger protein which is rapidly tyrosine phosphorylated in cells stimulated with various growth factors. We previously purified the protein from a mouse cell line and cloned its cDNA. In the present study, we cloned a human Hrs cDNA from a human placenta cDNA library by cross-hybridization, using the mouse cDNA as a probe, and determined its nucleotide sequence. The human Hrs cDNA encoded a 777-amino-acid protein whose sequence was 93% identical to that of mouse Hrs. Northern blot analysis showed that the Hrs mRNA was about 3.0kb long and was expressed in all the human adult and fetal tissues tested. In addition, we showed by genomic Southern blot analysis that the human Hrs gene was a single-copy gene with a size of about 20kb. Furthermore, the human Hrs gene was mapped to chromosome 17 by Southern blotting of genomic DNAs from human/rodent somatic cell hybrids. Copyright 1998 Elsevier Science B.V. All rights reserved.
Genes expressed during the development and ripening of watermelon fruit.
Levi, A; Davis, A; Hernandez, A; Wechter, P; Thimmapuram, J; Trebitsh, T; Tadmor, Y; Katzir, N; Portnoy, V; King, S
2006-11-01
A normalized cDNA library was constructed using watermelon flesh mRNA from three distinct developmental time-points and was subtracted by hybridization with leaf cDNA. Random cDNA clones of the watermelon flesh subtraction library were sequenced from the 5' end in order to identify potentially informative genes associated with fruit setting, development, and ripening. One-thousand and forty-six 5'-end sequences (expressed sequence tags; ESTs) were assembled into 832 non-redundant sequences, designated as "EST-unigenes". Of these 832 "EST-unigenes", 254 ( approximately 30%) have no significant homology to sequences published so far for other plant species. Additionally, 168 "EST-unigenes" ( approximately 20%) correspond to genes with unknown function, whereas 410 "EST-unigenes" ( approximately 50%) correspond to genes with known function in other plant species. These "EST-unigenes" are mainly associated with metabolism, membrane transport, cytoskeleton synthesis and structure, cell wall formation and cell division, signal transduction, nucleic acid binding and transcription factors, defense and stress response, and secondary metabolism. This study provides the scientific community with novel genetic information for watermelon as well as an expanded pool of genes associated with fruit development in watermelon. These genes will be useful targets in future genetic and functional genomic studies of watermelon and its development.
Laoong-u-thai, Yanisa; Zhao, Baoping; Phongdara, Amornrat; Ako, Harry; Yang, Jinzeng
2009-01-01
Small ubiquitin-like modifiers (SUMO) work in a similar way as ubiquitin to alter the biological properties of a target protein by conjugation. A shrimp SUMO cDNA named LvSUMO-1 was identified in Litopenaeus vannamei. LvSUMO-1 cDNA contains a coding sequence of 282 nucleotides with untranslated regions of 37 bp at 5'-end and 347 bp at 3'-end, respectively. The deduced 93 amino acids exhibit 83% identity with the Western Honeybee SUMO-1, and more than 65% homologies with human and mouse SUMO-1. LvSUMO-1 mRNA is expressed in most L. vannamei tissues with the highest level in hepatopancrease. The mRNA expression of LvSUMO-1 over development stages in L. Vammamei is distinguished by a low level in nauplius stage and relatively high level in postlarva stage with continuous expression until juvenile stage. The LvSUMO-1 protein and its conjugated proteins are detected in both cytoplasm and nucleus in several tissues. Interestingly, LvSUMO-1 mRNA levels are high in abdominal muscle during the premolt stage, wherein it has significant activities of protein degradation, suggesting its possible role in the regulation of shrimp muscle protein degradation. PMID:19240809
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tzeng, W.-P.; Frey, Teryl K.
Rubella virus (RUB) replicons are derivatives of the RUB infectious cDNA clone that retain the nonstructural open reading frame (NS-ORF) that encodes the replicase proteins but not the structural protein ORF (SP-ORF) that encodes the virion proteins. RUB defective interfering (DI) RNAs contain deletions within the SP-ORF and thus resemble replicons. DI RNAs often retain the 5' end of the capsid protein (C) gene that has been shown to modulate virus-specific RNA synthesis. However, when replicons either with or without the C gene were passaged serially in the presence of wt RUB as a source of the virion proteins, itmore » was found that neither replicon was maintained and DI RNAs were generated. The majority DI RNA species contained in-frame deletions in the SP-ORF leading to a fusion between the 5' end of the C gene and the 3' end of the E1 glycoprotein gene. DI infectious cDNA clones were constructed and transcripts from these DI infectious cDNA clones were maintained during serial passage with wt RUB. The C-E1 fusion protein encoded by the DI RNAs was synthesized and was required for maintenance of the DI RNA during serial passage. This is the first report of a functional novel gene product resulting from deletion during DI RNA generation. Thus far, the role of the C-E1 fusion protein in maintenance of DI RNAs during serial passage remained elusive as it was found that the fusion protein diminished rather than enhanced DI RNA synthesis and was not incorporated into virus particles.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Leong, JoAnn Ching
The nucleotide sequence of the IHNV glycoprotein gene has been determined from a cDNA clone containing the entire coding region. The glycoprotein cDNA clone contained a leader sequence of 48 bases, a coding region of 1524 nucleotides, and 39 bases at the 3 foot end. The entire cDNA clone contains 1609 nucleodites and encodes a protein of 508 amino acids. The deduced amino acid sequence gave a translated molecular weight of 56,795 daltons. A hydropathicity profile of the deduced amino acid sequence indicated that there were two major hydrophobic domains: one,at the N-terminus,delineating a signal peptide of 18 amino acidsmore » and the other, at the C-terminus,delineating the region of the transmembrane. Five possible sites of N-linked glyscoylation were identified. Although no nucleic acid homology existed between the IHNV glycoprotein gene and the glycoprotein genes of rabies and VSV, there was significant homology at the amino acid level between all three rhabdovirus glycoproteins.« less
Comparison of the canine and human acid {beta}-galactosidase gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ahern-Rindell, A.J.; Kretz, K.A.; O`Brien, J.S.
Several canine cDNA libraries were screened with human {beta}-galactosidase cDNA as probe. Seven positive clones were isolated and sequenced yielding a partial (2060 bp) canine {beta}-galactosidase cDNA with 86% identity to the human {beta}-galactosidase cDNA. Preliminary analysis of a canine genomic library indicated conservation of exon number and size. Analysis by Northern blotting disclosed a single mRNA of 2.4 kb in fibroblasts and liver from normal dogs and dogs affected with GM1 gangliosidosis. Although incomplete, these results indicate canine GM1 gangliosidosis is a suitable animal model of the human disease and should further efforts to devise a gene therapy strategymore » for its treatment. 20 refs., 2 figs., 1 tab.« less
Inada, Mari; Kihara, Keisuke; Kono, Tomoya; Sudhakaran, Raja; Mekata, Tohru; Sakai, Masahiro; Yoshida, Terutoyo; Itami, Toshiaki
2013-02-01
In many physiological processes, including the innate immune system, free radicals such as nitric oxide (NO) and reactive oxygen species (ROS) play significant roles. In humans, 2 homologs of Dual oxidases (Duox) generate hydrogen peroxide (H(2)O(2)), which is a type of ROS. Here, we report the identification and characterization of a Duox from kuruma shrimp, Marsupenaeus japonicus. The full-length cDNA sequence of the M. japonicus Dual oxidase (MjDuox) gene contains 4695 bp and was generated using reverse transcriptase-polymerase chain reaction (RT-PCR) and random amplification of cDNA ends (RACE). The open reading frame of MjDuox encodes a protein of 1498 amino acids with an estimated mass of 173 kDa. In a homology analysis using amino acid sequences, MjDuox exhibited 69.3% sequence homology with the Duox of the red flour beetle, Tribolium castaneum. A transcriptional analysis revealed that the MjDuox mRNA is highly expressed in the gills of healthy kuruma shrimp. In the gills, MjDuox expression reached its peak 60 h after injection with WSSV and decreased to its normal level at 72 h. In gene knockdown experiments of free radical-generating enzymes, the survival rates decreased during the early stages of a white spot syndrome virus (WSSV) infection following the knockdown of the NADPH oxidase (MjNox) or MjDuox genes. In the present study, the identification, cloning and gene knockdown of the kuruma shrimp MjDuox are reported. Duoxes have been identified in vertebrates and some insects; however, few reports have investigated Duoxes in crustaceans. This study is the first to identify and clone a Dual oxidase from a crustacean species. Copyright © 2012 Elsevier Ltd. All rights reserved.
Yang, Hui-Peng; Luo, Su-Juan; Li, Yi-Nü; Zhang, Yao-Zhou; Zhang, Zhi-Fang
2011-10-01
The ORC (origin recognition complex) binds to the DNA replication origin and recruits other replication factors to form the pre-replication complex. The cDNA and genomic sequences of all six subunits of ORC in Bombyx mori (BmORC1-6) were determined by RACE (rapid amplification of cDNA ends) and bioinformatic analysis. The conserved domains were identified in BmOrc1p-6p and the C-terminal of BmOrc6p features a short sequence that may be specific for Lepidoptera. As in other organisms, each of the six BmORC subunits had evolved individually from ancestral genes in early eukaryotes. During embryo development, the six genes were co-regulated, but different ratios of the abundance of mRNAs were observed in 13 tissues of the fifth instar day-6 larvae. Infection by BmNPV (B. mori nucleopolyhedrovirus) initially decreased and then increased the abundance of BmORC. We suggest that some of the BmOrc proteins may have additional functions and that BmOrc proteins participate in the replication of BmNPV.
An atypical topoisomerase II sequence from the slime mold Physarum polycephalum.
Hugodot, Yannick; Dutertre, Murielle; Duguet, Michel
2004-01-21
We have determined the complete nucleotide sequence of the cDNA encoding DNA topoisomerase II from Physarum polycephalum. Using degenerate primers, based on the conserved amino acid sequences of other eukaryotic enzymes, a 250-bp fragment was polymerase chain reaction (PCR) amplified. This fragment was used as a probe to screen a Physarum cDNA library. A partial cDNA clone was isolated that was truncated at the 3' end. Rapid amplification of cDNA ends (RACE)-PCR was employed to isolate the remaining portion of the gene. The complete sequence of 4613 bp contains an open reading frame of 4494 bp that codes for 1498 amino acid residues with a theoretical molecular weight of 167 kDa. The predicted amino acid sequence shares similarity with those of other eukaryotes and shows the highest degree of identity with the enzyme of Dictyostelium discoideum. However, the enzyme of P. polycephalum contains an atypical amino-terminal domain very rich in serine and proline, whose function is unknown. Remarkably, both a mitochondrial targeting sequence and a nuclear localization signal were predicted respectively in the amino and carboxy-terminus of the protein, as in the case of human topoisomerase III alpha. At the Physarum genomic level, the topoisomerase II gene encompasses a region of about 16 kbp suggesting a large proportion of intronic sequences, an unusual situation for a gene of a lower eukaryote, often free of introns. Finally, expression of topoisomerase II mRNA does not appear significantly dependent on the plasmodium cycle stage, possibly due to the lack of G1 phase or (and) to a mitochondrial localization of the enzyme.
Huang, Ke-Jing; Shuai, Hong-Lei; Zhang, Ji-Zong
2016-03-15
A highly sensitive and ultrasensitive electrochemical aptasensor for platelet-derived growth factor BB (PDGF-BB) detection is fabricated based on layered molybdenum selenide-graphene (MoSe2-Gr) composites and Exonuclease III (Exo III)-aided signal amplification. MoSe2-Gr is prepared by a simple hydrothermal method and used as a promising sensing platform. Exo III has a specifical exo-deoxyribonuclease activity for duplex DNAs in the direction from 3' to 5' terminus, however its activity is limited on the duplex DNAs with more than 4 mismatched terminal bases at 3' ends. Herein, aptamer and complementary DNA (cDNA) sequences are designed with four thymine bases on 3' ends. In the presence of target protein, the aptamer associates with it and facilitates the formation of duplex DNA between cDNA and signal DNA. The duplex DNA then is digested by Exo III and releases cDNA, which hybridizes with signal DNA to perform a new cleavage process. Nevertheless, in the absence of target protein, the aptamer hybridizes with cDNA will inhibit the Exo III-assisted nucleotides cleavage. The signal DNA then hybridizes with capture DNA on the electrode. Subsequently, horse radish peroxidase is fixed on electrode by avidin-biotin reaction and then catalyzes hydrogen peroxide and hydroquinone to produce electrochemical response. Therefore, a bridge can be established between the concentration of target protein and the degree of the attenuation of the obtained signal, providing a quantitative measure of target protein with a broad detection range of 0.0001-1 nM and a detection limit of 20 fM. Copyright © 2015 Elsevier B.V. All rights reserved.
Li, Hanbo; Su, Baofeng; Qin, Guyu; Ye, Zhi; Alsaqufi, Ahmed; Perera, Dayan A; Shang, Mei; Odin, Ramjie; Vo, Khoi; Drescher, David; Robinson, Dalton; Zhang, Dan; Abass, Nermeen; Dunham, Rex A
2017-05-31
Repressible knockdown approaches were investigated for transgenic sterilization in channel catfish, Ictalurus punctatus . Two primordial germ cell (PGC) marker genes, nanos and dead end , were targeted for knockdown, and an off-target gene, vasa , was monitored. Two potentially salt sensitive repressible promoters, zebrafish adenylosuccinate synthase 2 (ADSS) and zebrafish racemase (Rm), were each coupled with four knockdown strategies: ds-sh RNA targeting the 5' end (N1) or 3' end (N2) of channel catfish nanos , full-length cDNA sequence of channel catfish nanos for overexpression (cDNA) and ds-sh RNA targeting channel catfish dead end (DND). Each construct had an untreated group and treated group with sodium chloride as the repressor compound. Spawning rates of full-sibling P₁ fish exposed or not exposed to the constructs as treated and untreated embryos were 93% and 59%, respectively, indicating potential sterilization of fish and repression of the constructs. Although the mRNA expression data of PGC marker genes were inconsistent in P₁ fish, most F₁ individuals were able to downregulate the target genes in untreated groups and repress the knockdown process in treated groups. The results indicate that repressible transgenic sterilization is feasible for reproductive control of fish, but more data from F₂ or F₃ are needed for evaluation.
Li, Chibo; Ding, Xi-Qin; O’Brien, John; Al-Ubaidi, Muayyad R.
2010-01-01
PURPOSE A great deal of information about functionally significant domains of a protein may be obtained by comparison of primary sequences of gene homologues over a broad phylogenetic base. This study was designed to identify evolutionarily conserved domains of the photoreceptor disc membrane protein peripherin/rds by analysis of the homologue in a primitive vertebrate, the skate. METHODS A skate retinal cDNA library was screened using a mouse peripherin/rds clone. The 5′ and 3′ untranslated regions of the skate peripherin/rds (srds) cDNA were isolated by the rapid amplification of cDNA ends (RACE) approach. The gene structure was characterized by PCR amplification and sequencing of genomic fragments. Northern and Western blot analyses were used to identify srds transcript and protein, respectively. RESULTS A new homologue of peripherin/rds was identified from the skate retinal cDNA library. SRDS is a glycoprotein with a predicted molecular mass of 40.2 kDa. The srds gene consists of two exons and one small intron and transcribes into a single 6-kb message. Phylogenetic analysis places SRDS at the base of peripherin/rds family and near the division of that group and the branch leading to rds-like and rom-1 genes. SRDS protein is 54.5% identical with peripherin/rds across species. Identity is significantly higher (73%) in the intradiscal domains. Sequence comparison revealed the conservation of all residues that have been shown, on mutation, to associate with retinitis pigmentosa and showed conservation of most residues associated with macular dystrophies. Comparison with ROM-1 and other rds-like proteins revealed the presence of a highly conserved domain in the large intradiscal loop. CONCLUSIONS Srds represents the skate orthologue of mammalian peripherin/rds genes. Conservation of most of the residues associated with human retinal diseases indicates that these residues serve important functional roles. The high degree of conservation of a short stretch within the large intradiscal loop also suggests an important function for this domain. PMID:12766040
Lata, Charu; Bhutty, Sarita; Bahadur, Ranjit Prasad; Majee, Manoj; Prasad, Manoj
2011-06-01
The DREB genes code for important plant transcription factors involved in the abiotic stress response and signal transduction. Characterization of DREB genes and development of functional markers for effective alleles is important for marker-assisted selection in foxtail millet. Here the characterization of a cDNA (SiDREB2) encoding a putative dehydration-responsive element-binding protein 2 from foxtail millet and the development of an allele-specific marker (ASM) for dehydration tolerance is reported. A cDNA clone (GenBank accession no. GT090998) coding for a putative DREB2 protein was isolated as a differentially expressed gene from a 6 h dehydration stress SSH library. A 5' RACE (rapid amplification of cDNA ends) was carried out to obtain the full-length cDNA, and sequence analysis showed that SiDREB2 encoded a polypeptide of 234 amino acids with a predicted mol. wt of 25.72 kDa and a theoretical pI of 5.14. A theoretical model of the tertiary structure shows that it has a highly conserved GCC-box-binding N-terminal domain, and an acidic C-terminus that acts as an activation domain for transcription. Based on its similarity to AP2 domains, SiDREB2 was classified into the A-2 subgroup of the DREB subfamily. Quantitative real-time PCR analysis showed significant up-regulation of SiDREB2 by dehydration (polyethylene glycol) and salinity (NaCl), while its expression was less affected by other stresses. A synonymous single nucleotide polymorphism (SNP) associated with dehydration tolerance was detected at the 558th base pair (an A/G transition) in the SiDREB2 gene in a core set of 45 foxtail millet accessions used. Based on the identified SNP, three primers were designed to develop an ASM for dehydration tolerance. The ASM produced a 261 bp fragment in all the tolerant accessions and produced no amplification in the sensitive accessions. The use of this ASM might be faster, cheaper, and more reproducible than other SNP genotyping methods, and thus will enable marker-aided breeding of foxtail millet for dehydration tolerance.
Saravanaperumal, Siva Arumugam; Pediconi, Dario; Renieri, Carlo; La Terza, Antonietta
2012-01-01
Stem cell factor (SCF) is a growth factor, essential for haemopoiesis, mast cell development and melanogenesis. In the hematopoietic microenvironment (HM), SCF is produced either as a membrane-bound (−) or soluble (+) forms. Skin expression of SCF stimulates melanocyte migration, proliferation, differentiation, and survival. We report for the first time, a novel mRNA splice variant of SCF from the skin of white merino sheep via cloning and sequencing. Reverse transcriptase (RT)-PCR and molecular prediction revealed two different cDNA products of SCF. Full-length cDNA libraries were enriched by the method of rapid amplification of cDNA ends (RACE-PCR). Nucleotide sequencing and molecular prediction revealed that the primary 1519 base pair (bp) cDNA encodes a precursor protein of 274 amino acids (aa), commonly known as ‘soluble’ isoform. In contrast, the shorter (835 and/or 725 bp) cDNA was found to be a ‘novel’ mRNA splice variant. It contains an open reading frame (ORF) corresponding to a truncated protein of 181 aa (vs 245 aa) with an unique C-terminus lacking the primary proteolytic segment (28 aa) right after the D175G site which is necessary to produce ‘soluble’ form of SCF. This alternative splice (AS) variant was explained by the complete nucleotide sequencing of splice junction covering exon 5-intron (5)-exon 6 (948 bp) with a premature termination codon (PTC) whereby exons 6 to 9/10 are skipped (Cassette Exon, CE 6–9/10). We also demonstrated that the Northern blot analysis at transcript level is mediated via an intron-5 splicing event. Our data refine the structure of SCF gene; clarify the presence (+) and/or absence (−) of primary proteolytic-cleavage site specific SCF splice variants. This work provides a basis for understanding the functional role and regulation of SCF in hair follicle melanogenesis in sheep beyond what was known in mice, humans and other mammals. PMID:22719917
2011-01-01
Background Common bean is an important legume crop with only a moderate number of short expressed sequence tags (ESTs) made with traditional methods. The goal of this research was to use full-length cDNA technology to develop ESTs that would overlap with the beginning of open reading frames and therefore be useful for gene annotation of genomic sequences. The library was also constructed to represent genes expressed under drought, low soil phosphorus and high soil aluminum toxicity. We also undertook comparisons of the full-length cDNA library to two previous non-full clone EST sets for common bean. Results Two full-length cDNA libraries were constructed: one for the drought tolerant Mesoamerican genotype BAT477 and the other one for the acid-soil tolerant Andean genotype G19833 which has been selected for genome sequencing. Plants were grown in three soil types using deep rooting cylinders subjected to drought and non-drought stress and tissues were collected from both roots and above ground parts. A total of 20,000 clones were selected robotically, half from each library. Then, nearly 10,000 clones from the G19833 library were sequenced with an average read length of 850 nucleotides. A total of 4,219 unigenes were identified consisting of 2,981 contigs and 1,238 singletons. These were functionally annotated with gene ontology terms and placed into KEGG pathways. Compared to other EST sequencing efforts in common bean, about half of the sequences were novel or represented the 5' ends of known genes. Conclusions The present full-length cDNA libraries add to the technological toolbox available for common bean and our sequencing of these clones substantially increases the number of unique EST sequences available for the common bean genome. All of this should be useful for both functional gene annotation, analysis of splice site variants and intron/exon boundary determination by comparison to soybean genes or with common bean whole-genome sequences. In addition the library has a large number of transcription factors and will be interesting for discovery and validation of drought or abiotic stress related genes in common bean. PMID:22118559
Van de Wetering, M; Castrop, J; Korinek, V; Clevers, H
1996-01-01
Previously, we reported the isolation of cDNA clones representing four alternative splice forms of TCF-1, a T-cell-specific transcription factor. In the present study, Western blotting (immunoblotting) yielded a multitude of TCF-1 proteins ranging from 25-55 kDa, a pattern not simply explained from the known splice alternatives. Subsequent cDNA cloning, PCR amplification, and analysis by rapid amplification of 5' cDNA ends revealed (i) the presence of an alternative upstream promoter, which extended the known N terminus by 116 amino acids, (ii) the presence of four alternative exons, and (iii) the existence of a second reading frame in the last exon encoding an extended C terminus. Inclusion of the extended N terminus into the originally reported protein resulted in a striking similarity to the lymphoid factor Lef-1. Several of the TCF-1 isoforms, although less potent, mimicked Lef-1 in transactivating transcription through the T-cell receptor alpha-chain (TCR-alpha) enhancer. These data provide a molecular basis for the complexity of the expressed TCF-1 proteins and establish the existence of functional differences between these isoforms. Furthermore, the functional redundancy between Tcf-1 and Lef-1 explains the apparently normal TCR-alpha expression in single Tcf-1 or Lef-1 knockout mice despite the firm in vitro evidence for the importance of the Tcf/Lef site in the TCR-alpha enhancer. PMID:8622675
Qiu, Lihua; Zhang, Hanhua; Yang, Keng; Jiang, Shigui
2009-05-01
Interleukin-8 (IL-8), the first known chemokine, is a CXC chemokine, which is cable of attracting neutrophils and inducing them to release lysozomal enzymes, triggering the respiratory burst. In the present study, the cDNA of an IL-8 was cloned from Japanese sea perch Lateolabrax japonicus (designated LjIL-8) by homology cloning and rapid amplification of cDNA ends (RACE) approaches. The full-length cDNA of LjIL-8 consisted of 803 nucleotides with a canonical polyadenylation signal sequence AATAAA and a poly(A) tail, and an open reading frame (ORF) of 300 bp encoding a polypeptide of 99 amino acid residues with a predicted molecular weight of 6.6 kDa. The high identity of LjIL-8 with IL-8 in other organisms indicated that LjIL-8 should be a new member of the IL-8 family. By fluorescent quantitative real-time PCR, mRNA transcript of LjIL-8 was detectable in all the examined tissues with higher level in spleen and head-kidney. The temporal expression of LjIL-8 mRNA in the spleen was up-regulated by lipopolyssacharide (LPS) stimulation and reached the maximum level at 6 h post-stimulation, and then dropped back to the original level gradually. These results indicated that LjIL-8 was a constitutive and inducible acute-phase protein that perhaps involved in the immune defense of L. japonicus.
Zhang, Jia-Xin; Song, Ren; Sang, Ming; Sun, Si-Qing; Ma, Lei; Zhang, Jie; Zhang, Shuang-Quan
2015-10-01
B-cell activating factor (BAFF) from the TNF family is critical for B-cell survival and maturation. In this study, we identified a Yangtze alligator (Alligator sinensis, Alligatoridae) BAFF cDNA, designated as asBAFF, using reverse transcription polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). The open reading frame of this cDNA encodes a 287-amino acid protein containing a predicted transmembrane domain and a furin protease cleavage site, similar to mammalian and avian BAFF. The amino acid identity between biologically soluble asBAFF (assBAFF) and csBAFF, hsBAFF, and msBAFF is 94, 76, and 71%, respectively. Real-time quantitative PCR analysis showed that the asBAFF gene is strongly expressed in the spleen. Since BAFF is always expressed as inclusion bodies in bacteria, it is difficult to purify. To enhance the soluble expression of assBAFF in Escherichia coli, we fused the extracellular region of the asBAFF gene to a small ubiquitin-related modifier gene (SUMO). Purified assBAFF was able to promote the survival of splenic lymphocytes and co-stimulate the proliferation of mouse B cells with anti-mouse IgM. These findings suggest that asBAFF plays an important role in the survival and proliferation of Yangtze alligator B cells, and because it is evolutionarily highly conserved, functional cross-reactivity exists between mammalian and Yangtze alligator BAFF. Copyright © 2015 Elsevier GmbH. All rights reserved.
Single molecule fluorescence microscopy for ultra-sensitive RNA expression profiling
NASA Astrophysics Data System (ADS)
Hesse, Jan; Jacak, Jaroslaw; Regl, Gerhard; Eichberger, Thomas; Aberger, Fritz; Schlapak, Robert; Howorka, Stefan; Muresan, Leila; Frischauf, Anna-Maria; Schütz, Gerhard J.
2007-02-01
We developed a microarray analysis platform for ultra-sensitive RNA expression profiling of minute samples. It utilizes a novel scanning system for single molecule fluorescence detection on cm2 size samples in combination with specialized biochips, optimized for low autofluorescence and weak unspecific adsorption. 20 μg total RNA was extracted from 10 6 cells of a human keratinocyte cell line (HaCaT) and reversely transcribed in the presence of Alexa647-aha-dUTP. 1% of the resulting labeled cDNA was used for complex hybridization to a custom-made oligonucleotide microarray representing a set of 125 different genes. For low abundant genes, individual cDNA molecules hybridized to the microarray spots could be resolved. Single cDNA molecules hybridized to the chip surface appeared as diffraction limited features in the fluorescence images. The à trous wavelet method was utilized for localization and counting of the separated cDNA signals. Subsequently, the degree of labeling of the localized cDNA molecules was determined by brightness analysis for the different genes. Variations by factors up to 6 were found, which in conventional microarray analysis would result in a misrepresentation of the relative abundance of mRNAs.
Yasuno, Rie; Wada, Hajime
1998-01-01
Lipoic acid is a coenzyme that is essential for the activity of enzyme complexes such as those of pyruvate dehydrogenase and glycine decarboxylase. We report here the isolation and characterization of LIP1 cDNA for lipoic acid synthase of Arabidopsis. The Arabidopsis LIP1 cDNA was isolated using an expressed sequence tag homologous to the lipoic acid synthase of Escherichia coli. This cDNA was shown to code for Arabidopsis lipoic acid synthase by its ability to complement a lipA mutant of E. coli defective in lipoic acid synthase. DNA-sequence analysis of the LIP1 cDNA revealed an open reading frame predicting a protein of 374 amino acids. Comparisons of the deduced amino acid sequence with those of E. coli and yeast lipoic acid synthase homologs showed a high degree of sequence similarity and the presence of a leader sequence presumably required for import into the mitochondria. Southern-hybridization analysis suggested that LIP1 is a single-copy gene in Arabidopsis. Western analysis with an antibody against lipoic acid synthase demonstrated that this enzyme is located in the mitochondrial compartment in Arabidopsis cells as a 43-kD polypeptide. PMID:9808738
HUNT: launch of a full-length cDNA database from the Helix Research Institute.
Yudate, H T; Suwa, M; Irie, R; Matsui, H; Nishikawa, T; Nakamura, Y; Yamaguchi, D; Peng, Z Z; Yamamoto, T; Nagai, K; Hayashi, K; Otsuki, T; Sugiyama, T; Ota, T; Suzuki, Y; Sugano, S; Isogai, T; Masuho, Y
2001-01-01
The Helix Research Institute (HRI) in Japan is releasing 4356 HUman Novel Transcripts and related information in the newly established HUNT database. The institute is a joint research project principally funded by the Japanese Ministry of International Trade and Industry, and the clones were sequenced in the governmental New Energy and Industrial Technology Development Organization (NEDO) Human cDNA Sequencing Project. The HUNT database contains an extensive amount of annotation from advanced analysis and represents an essential bioinformatics contribution towards understanding of the gene function. The HRI human cDNA clones were obtained from full-length enriched cDNA libraries constructed with the oligo-capping method and have resulted in novel full-length cDNA sequences. A large fraction has little similarity to any proteins of known function and to obtain clues about possible function we have developed original analysis procedures. Any putative function deduced here can be validated or refuted by complementary analysis results. The user can also extract information from specific categories like PROSITE patterns, PFAM domains, PSORT localization, transmembrane helices and clones with GENIUS structure assignments. The HUNT database can be accessed at http://www.hri.co.jp/HUNT.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cool, D.E.; Tonks, N.K.; Charbonneau, H.
1989-07-01
A human peripheral T-cell cDNA library was screened with two labeled synthetic oligonucleotides encoding regions of a human placenta protein-tyrosine-phosphatase. One positive clone was isolated and the nucleotide sequence was determined. It contained 1,305 base pairs of open reading frame followed by a TAA stop codon and 978 base pairs of 3{prime} untranslated end, although a poly(A){sup +} tail was not found. An initiator methionine residue was predicted at position 61, which would result in a protein of 415 amino acid residues. This was supported by the synthesis of a M{sub r} 48,000 protein in an in vitro reticulocyte lysatemore » translation system using RNA transcribed from the cloned cDNA and T7 RNA polymerase. The deduced amino acid sequence was compared to other known proteins revealing 65% identity to the low M{sub r} PTPase 1B isolated from placenta. In view of the high degree of similarity, the T-cell cDNA likely encodes a newly discovered protein-tyrosine-phosphatase, thus expanding this family of genes.« less
Horibata, Y; Okino, N; Ichinose, S; Omori, A; Ito, M
2000-10-06
Endoglycoceramidase (EC ) is an enzyme capable of cleaving the glycosidic linkage between oligosaccharides and ceramides in various glycosphingolipids. We report here the purification, characterization, and cDNA cloning of a novel endoglycoceramidase from the jellyfish, Cyanea nozakii. The purified enzyme showed a single protein band estimated to be 51 kDa on SDS-polyacrylamide gel electrophoresis. The enzyme showed a pH optimum of 3.0 and was activated by Triton X-100 and Lubrol PX but not by sodium taurodeoxycholate. This enzyme preferentially hydrolyzed gangliosides, especially GT1b and GQ1b, whereas neutral glycosphingolipids were somewhat resistant to hydrolysis by the enzyme. A full-length cDNA encoding the enzyme was cloned by 5'- and 3'-rapid amplification of cDNA ends using a partial amino acid sequence of the purified enzyme. The open reading frame of 1509 nucleotides encoded a polypeptide of 503 amino acids including a signal sequence of 25 residues and six potential N-glycosylation sites. Interestingly, the Asn-Glu-Pro sequence, which is the putative active site of Rhodococcus endoglycoceramidase, was conserved in the deduced amino acid sequences. This is the first report of the cloning of an endoglycoceramidase from a eukaryote.
Shanthi, S; Vaseeharan, B
2012-03-20
A new member of antimicrobial peptide genes of the penaeidin family, penaeidin 3, was cloned from the haemocytes of Indian white shrimp Fenneropeneaus indicus (F. indicus), by reverse transcription PCR (RT-PCR) and rapid amplification of cDNA end (RACE-PCR) methods. The complete nucleotide sequence of cDNA clone of Indian white shrimp F. indicus Penaeidin 3 (Fi-Pen3) was 243bp long and has an open reading frame which encodes 80 amino acid peptide. The homology analysis of Fi-Pen3 sequence with other Penaeidins 3 shows higher similarity with Penaeus monodon (92%). The theoretical 3D structure generated through ab initio modelling indicated the presence of two-disulphide bridges in the alpha-helix. The signal peptide sequence of Fi-Pen3 is almost entirely homologous to that of other Penaeidin 3 of crustaceans, while differing relatively in the N-terminal domain of the mature peptide. The mature peptide has a predicted molecular weight of 84.9kDa, and a theoretical pI of 9.38. Phylogenetic analysis of Fi-Pen3 shows high resemblance with other Pen-3 from P. monodon, Litopenaeus stylirostris, Litopenaeus vannamei and Litopenaeus setiferus. Fi-Pen3 found to be expressed in haemocytes, heart, hepatopancreas, muscles, gills, intestine, and eyestalk with higher expression in haemocytes. Microbial challenge resulted in mRNA up-regulation, up to 6h post injection of Vibrio parahemolyticus. The Fi-Pen3 mRNA expression of F. indicus in the premolt stage (D(01) and D(02)) was significantly up-regulated than the postmolt (A and B) and intermolt stages (C). The findings of the present paper underline the involvement of Fi-Pen3 in innate immune system of F. indicus. Copyright © 2011 Elsevier GmbH. All rights reserved.
Charron, Jean-Benoit Frenette; Breton, Ghislain; Danyluk, Jean; Muzac, Ingrid; Ibrahim, Ragai K.; Sarhan, Fathey
2002-01-01
A cDNA that encodes a methyltransferase (MT) was cloned from a cold-acclimated wheat (Triticum aestivum) cDNA library. Molecular analysis indicated that the enzyme WPEAMT (wheat phosphoethanolamine [P-EA] MT) is a bipartite protein with two separate sets of S-adenosyl-l-Met-binding domains, one close to the N-terminal end and the second close to the C-terminal end. The recombinant protein was found to catalyze the three sequential methylations of P-EA to form phosphocholine, a key precursor for the synthesis of phosphatidylcholine and glycine betaine in plants. Deletion and mutation analyses of the two S-adenosyl-l-Met-binding domains indicated that the N-terminal domain could perform the three N-methylation steps transforming P-EA to phosphocholine. This is in contrast to the MT from spinach (Spinacia oleracea), suggesting a different functional evolution for the monocot enzyme. The truncated C-terminal and the N-terminal mutated enzyme were only able to methylate phosphomonomethylethanolamine and phosphodimethylethanolamine, but not P-EA. This may suggest that the C-terminal part is involved in regulating the rate and the equilibrium of the three methylation steps. Northern and western analyses demonstrated that both Wpeamt transcript and the corresponding protein are up-regulated during cold acclimation. This accumulation was associated with an increase in enzyme activity, suggesting that the higher activity is due to de novo protein synthesis. The role of this enzyme during cold acclimation and the development of freezing tolerance are discussed. PMID:12011366
Isolation and characterization of cDNA clones for human erythrocyte beta-spectrin.
Prchal, J T; Morley, B J; Yoon, S H; Coetzer, T L; Palek, J; Conboy, J G; Kan, Y W
1987-01-01
Spectrin is an important structural component of the membrane skeleton that underlies and supports the erythrocyte plasma membrane. It is composed of nonidentical alpha (Mr 240,000) and beta (Mr 220,000) subunits, each of which contains multiple homologous 106-amino acid segments. We report here the isolation and characterization of a human erythroid-specific beta-spectrin cDNA clone that encodes parts of the beta-9 through beta-12 repeat segments. This cDNA was used as a hybridization probe to assign the beta-spectrin gene to human chromosome 14 and to begin molecular analysis of the gene and its mRNA transcripts. RNA transfer blot analysis showed that the reticulocyte beta-spectrin mRNA is 7.8 kilobases in length. Southern blot analysis of genomic DNA revealed the presence of restriction fragment length polymorphisms (RFLPs) within the beta-spectrin gene locus. The isolation of human spectrin cDNA probes and the identification of closely linked RFLPs will facilitate analysis of mutant spectrin genes causing congenital hemolytic anemias associated with quantitative and qualitative spectrin abnormalities. Images PMID:3478706
Construction and application of EST library from Setaria italica in response to dehydration stress.
Zhang, Jinpeng; Liu, Tingsong; Fu, Junjie; Zhu, Yun; Jia, Jinping; Zheng, Jun; Zhao, Yinhe; Zhang, Ying; Wang, Guoying
2007-07-01
Foxtail millet is a gramineous crop with low water requirement. Despite its high water use efficiency, less attention has been paid to the molecular genetics of foxtail millet. This article reports the construction of subtracted cDNA libraries from foxtail millet seedlings under dehydration stress and the expression profile analysis of 1947 UniESTs from the subtracted cDNA libraries by a cDNA microarray. The results showed that 95 and 57 ESTs were upregulated by dehydration stress, respectively, in roots and shoots of seedlings and that 10 and 27 ESTs were downregulated, respectively, in roots and shoots. The expression profile analysis showed that genes induced in foxtail millet roots were different from those in shoots during dehydration stress and that the early response to dehydration stress in foxtail millet roots was the activation of the glycolysis metabolism. Moreover, protein degradation pathway may also play a pivotal role in drought-tolerant responses of foxtail millet. Finally, Northern blot analysis validated well the cDNA microarray data.
Chromosome-Encoded Broad-Spectrum Ambler Class A β-Lactamase RUB-1 from Serratia rubidaea
Didi, Jennifer; Ergani, Ayla; Lima, Sandra
2016-01-01
ABSTRACT Whole-genome sequencing of Serratia rubidaea CIP 103234T revealed a chromosomally located Ambler class A β-lactamase gene. The gene was cloned, and the β-lactamase, RUB-1, was characterized. RUB-1 displayed 74% and 73% amino acid sequence identity with the GIL-1 and TEM-1 penicillinases, respectively, and its substrate profile was similar to that of the latter β-lactamases. Analysis by 5′ rapid amplification of cDNA ends revealed promoter sequences highly divergent from the Escherichia coli σ70 consensus sequence. This work further illustrates the heterogeneity of β-lactamases among Serratia spp. PMID:27956418
Chromosome-Encoded Broad-Spectrum Ambler Class A β-Lactamase RUB-1 from Serratia rubidaea.
Bonnin, Rémy A; Didi, Jennifer; Ergani, Ayla; Lima, Sandra; Naas, Thierry
2017-02-01
Whole-genome sequencing of Serratia rubidaea CIP 103234 T revealed a chromosomally located Ambler class A β-lactamase gene. The gene was cloned, and the β-lactamase, RUB-1, was characterized. RUB-1 displayed 74% and 73% amino acid sequence identity with the GIL-1 and TEM-1 penicillinases, respectively, and its substrate profile was similar to that of the latter β-lactamases. Analysis by 5' rapid amplification of cDNA ends revealed promoter sequences highly divergent from the Escherichia coli σ 70 consensus sequence. This work further illustrates the heterogeneity of β-lactamases among Serratia spp. Copyright © 2017 American Society for Microbiology.
Gao, Jin-Xin; Jing, Jing; Yu, Chuan-Jin; Chen, Jie
2015-06-01
Curvularia lunata is an important maize foliar fungal pathogen that distributes widely in maize growing area in China, and several key pathogenic factors have been isolated. An yeast two-hybrid (Y2H) library is a very useful platform to further unravel novel pathogenic factors in C. lunata. To construct a high-quality full length-expression cDNA library from the C. lunata for application to pathogenesis-related protein-protein interaction screening, total RNA was extracted. The SMART (Switching Mechanism At 5' end of the RNA Transcript) technique was used for cDNA synthesis. Double-stranded cDNA was ligated into the pGADT7-Rec vector with Herring Testes Carrier DNA using homologous recombination method. The ligation mixture was transformed into competent yeast AH109 cells to construct the primary cDNA library. Eventually, a high qualitative library was successfully established according to an evaluation on quality. The transformation efficiency was about 6.39 ×10(5) transformants/3 μg pGADT7-Rec. The titer of the primary cDNA library was 2.5×10(8) cfu/mL. The numbers for the cDNA library was 2.46×10(5). Randomly picked clones show that the recombination rate was 88.24%. Gel electrophoresis results indicated that the fragments ranged from 0.4 kb to 3.0 kb. Melanin synthesis protein Brn1 (1,3,8-hydroxynaphthalene reductase) was used as a "bait" to test the sufficiency of the Y2H library. As a result, a cDNA clone encoding VelB protein that was known to be involved in the regulation of diverse cellular processes, including control of secondary metabolism containing melanin and toxin production in many filamentous fungi was identified. Further study on the exact role of the VelB gene is underway.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hadano, S.; Ishida, Y.; Tomiyasu, H.
1994-09-01
To complete a transcription map of the 1 Mb region in human chromosome 4p16.3 containing the Huntington disease (HD) gene, the isolation of cDNA clones are being performed throughout. Our method relies on a direct screening of the cDNA libraries probed with single copy microclones from 3 YAC clones spanning 1 Mbp of the HD gene region. AC-DNAs were isolated by a preparative pulsed-field gel electrophoresis, amplified by both a single unique primer (SUP)-PCR and a linker ligation PCR, and 6 microclone-DNA libraries were generated. Then, 8,640 microclones from these libraries were independently amplified by PCR, and arrayed onto themore » membranes. 800-900 microclones that were not cross-hybridized with total human and yeast genomic DNA, TAC vector DNA, and ribosomal cDNA on a dot hybridization (putatively carrying single copy sequences) were pooled to make 9 probe pools. A total of {approximately}1.8x10{sup 7} plaques from the human brain cDNA libraries was screened with 9 pool-probes, and then 672 positive cDNA clones were obtained. So far, 597 cDNA clones were defined and arrayed onto a map of the 1 Mbp of the HD gene region by hybridization with HD region-specific cosmid contigs and YAC clones. Further characterization including a DNA sequencing and Northern blot analysis is currently underway.« less
Xu, Li; Ding, Zhi-Shan; Zhou, Yun-Kai; Tao, Xue-Fen
2009-06-01
To obtain the full-length cDNA sequence of Secoisolariciresinol Dehydrogenase gene from Dysosma versipellis by RACE PCR,then investigate the character of Secoisolariciresinol Dehydrogenase gene. The full-length cDNA sequence of Secoisolariciresinol Dehydrogenase gene was obtained by 3'-RACE and 5'-RACE from Dysosma versipellis. We first reported the full cDNA sequences of Secoisolariciresinol Dehydrogenase in Dysosma versipellis. The acquired gene was 991bp in full length, including 5' untranslated region of 42bp, 3' untranslated region of 112bp with Poly (A). The open reading frame (ORF) encoding 278 amino acid with molecular weight 29253.3 Daltons and isolectric point 6.328. The gene accession nucleotide sequence number in GeneBank was EU573789. Semi-quantitative RT-PCR analysis revealed that the Secoisolariciresinol Dehydrogenase gene was highly expressed in stem. Alignment of the amino acid sequence of Secoisolariciresinol Dehydrogenase indicated there may be some significant amino acid sequence difference among different species. Obtain the full-length cDNA sequence of Secoisolariciresinol Dehydrogenase gene from Dysosma versipellis.
Xu, De-Quan; Zhang, Yi-Bing; Xiong, Yuan-Zhu; Gui, Jian-Fang; Jiang, Si-Wen; Su, Yu-Hong
2003-07-01
Using suppression subtractive hybridization (SSH) technique, forward and reverse subtracted cDNA libraries were constructed between Longissimus muscles from Meishan and Landrace pigs. A housekeeping gene, G3PDH, was used to estimate the efficiency of subtractive cDNA. In two cDNA libraries, G3PDH was subtracted very efficiently at appropriate 2(10) and 2(5) folds, respectively, indicating that some differentially expressed genes were also enriched at the same folds and the two subtractive cDNA libraries were very successful. A total of 709 and 673 positive clones were isolated from forward and reverse subtracted cDNA libraries, respectively. Analysis of PCR showed that most of all plasmids in the clones contained 150-750 bp inserts. The construction of subtractive cDNA libraries between muscle tissue from different pig breeds laid solid foundations for isolating and identifying the genes determining muscle growth and meat quality, which will be important to understand the mechanism of muscle growth, determination of meat quality and practice of molecular breeding.
Trujillo-Esquivel, Elías; Franco, Bernardo; Flores-Martínez, Alberto; Ponce-Noyola, Patricia; Mora-Montes, Héctor M
2016-08-02
Analysis of gene expression is a common research tool to study networks controlling gene expression, the role of genes with unknown function, and environmentally induced responses of organisms. Most of the analytical tools used to analyze gene expression rely on accurate cDNA synthesis and quantification to obtain reproducible and quantifiable results. Thus far, most commercial kits for isolation and purification of cDNA target double-stranded molecules, which do not accurately represent the abundance of transcripts. In the present report, we provide a simple and fast method to purify single-stranded cDNA, exhibiting high purity and yield. This method is based on the treatment with RNase H and RNase A after cDNA synthesis, followed by separation in silica spin-columns and ethanol precipitation. In addition, our method avoids the use of DNase I to eliminate genomic DNA from RNA preparations, which improves cDNA yield. As a case report, our method proved to be useful in the purification of single-stranded cDNA from the pathogenic fungus Sporothrix schenckii.
Inamine, Saki; Onaga, Shoko; Ohnuma, Takayuki; Fukamizo, Tamo; Taira, Toki
2015-01-01
Chitinase-A (EaChiA), molecular mass 36 kDa, was purified from the vegetative stems of a horsetail (Equisetum arvense) using a series of column chromatography. The N-terminal amino acid sequence of EaChiA was similar to the lysin motif (LysM). A cDNA encoding EaChiA was cloned by rapid amplification of cDNA ends and polymerase chain reaction. It consisted of 1320 nucleotides and encoded an open reading frame of 361 amino acid residues. The deduced amino acid sequence indicated that EaChiA is composed of a N-terminal LysM domain and a C-terminal plant class IIIb chitinase catalytic domain, belonging to the glycoside hydrolase family 18, linked by proline-rich regions. EaChiA has strong chitin-binding activity, however, no antifungal activity. This is the first report of a chitinase from Equisetopsida, a class of fern plants, and the second report of a LysM-containing chitinase from a plant.
Stevens, Mark; Viganó, Felicita
2007-04-01
The full-length cDNA of Beet mild yellowing virus (Broom's Barn isolate) was sequenced and cloned into the vector pLitmus 29 (pBMYV-BBfl). The sequence of BMYV-BBfl (5721 bases) shared 96% and 98% nucleotide identity with the other complete sequences of BMYV (BMYV-2ITB, France and BMYV-IPP, Germany respectively). Full-length capped RNA transcripts of pBMYV-BBfl were synthesised and found to be biologically active in Arabidopsis thaliana protoplasts following electroporation or PEG inoculation when the protoplasts were subsequently analysed using serological and molecular methods. The BMYV sequence was modified by inserting DNA that encoded the jellyfish green fluorescent protein (GFP) into the P5 gene close to its 3' end. A. thaliana protoplasts electroporated with these RNA transcripts were biologically active and up to 2% of transfected protoplasts showed GFP-specific fluorescence. The exploitation of these cDNA clones for the study of the biology of beet poleroviruses is discussed.
Construction of a cDNA microarray derived from the ascidian Ciona intestinalis.
Azumi, Kaoru; Takahashi, Hiroki; Miki, Yasufumi; Fujie, Manabu; Usami, Takeshi; Ishikawa, Hisayoshi; Kitayama, Atsusi; Satou, Yutaka; Ueno, Naoto; Satoh, Nori
2003-10-01
A cDNA microarray was constructed from a basal chordate, the ascidian Ciona intestinalis. The draft genome of Ciona has been read and inferred to contain approximately 16,000 protein-coding genes, and cDNAs for transcripts of 13,464 genes have been characterized and compiled as the "Ciona intestinalis Gene Collection Release I". In the present study, we constructed a cDNA microarray of these 13,464 Ciona genes. A preliminary experiment with Cy3- and Cy5-labeled probes showed extensive differential gene expression between fertilized eggs and larvae. In addition, there was a good correlation between results obtained by the present microarray analysis and those from previous EST analyses. This first microarray of a large collection of Ciona intestinalis cDNA clones should facilitate the analysis of global gene expression and gene networks during the embryogenesis of basal chordates.
Li, Hanbo; Su, Baofeng; Qin, Guyu; Ye, Zhi; Alsaqufi, Ahmed; Perera, Dayan A.; Shang, Mei; Odin, Ramjie; Vo, Khoi; Drescher, David; Robinson, Dalton; Zhang, Dan; Abass, Nermeen; Dunham, Rex A.
2017-01-01
Repressible knockdown approaches were investigated for transgenic sterilization in channel catfish, Ictalurus punctatus. Two primordial germ cell (PGC) marker genes, nanos and dead end, were targeted for knockdown, and an off-target gene, vasa, was monitored. Two potentially salt sensitive repressible promoters, zebrafish adenylosuccinate synthase 2 (ADSS) and zebrafish racemase (Rm), were each coupled with four knockdown strategies: ds-sh RNA targeting the 5′ end (N1) or 3′ end (N2) of channel catfish nanos, full-length cDNA sequence of channel catfish nanos for overexpression (cDNA) and ds-sh RNA targeting channel catfish dead end (DND). Each construct had an untreated group and treated group with sodium chloride as the repressor compound. Spawning rates of full-sibling P1 fish exposed or not exposed to the constructs as treated and untreated embryos were 93% and 59%, respectively, indicating potential sterilization of fish and repression of the constructs. Although the mRNA expression data of PGC marker genes were inconsistent in P1 fish, most F1 individuals were able to downregulate the target genes in untreated groups and repress the knockdown process in treated groups. The results indicate that repressible transgenic sterilization is feasible for reproductive control of fish, but more data from F2 or F3 are needed for evaluation. PMID:28561774
Peterbauer, T; Mucha, J; Mayer, U; Popp, M; Glössl, J; Richter, A
1999-12-01
Stachyose is the major soluble carbohydrate in seeds of a number of important crop species. It is synthesized from raffinose and galactinol by the action of stachyose synthase (EC 2.4.1.67). We report here on the identification of a cDNA encoding stachyose synthase from seeds of adzuki bean (Vigna angularis Ohwi et Ohashi). Based on internal amino acid sequences of the enzyme purified from adzuki bean, oligonucleotides were designed and used to amplify corresponding sequences from adzuki bean cDNA by RT-PCR, followed by rapid amplification of cDNA ends (RACE-PCR). The complete cDNA sequence comprised 3046 nucleotides and included an open reading frame which encoded a polypeptide of 857 amino acid residues. The entire coding region was amplified by PCR, engineered into the baculovirus expression vector pVL1393 and introduced into Spodoptera frugiperda (Sf21) insect cells for heterologous expression. The recombinant protein was immunologically reactive with polyclonal antibodies raised against stachyose synthase purified from adzuki bean and was shown to be a functional stachyose synthase with the same catalytic properties as its native counterpart. High levels of stachyose synthase mRNA were transiently accumulated midway through seed development, and the enzyme was also present in mature seeds and during germination.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Livi, G.P.; McHale, M.J.; Sathe, G.M.
1990-06-01
The authors have isolated cDNA clones representing cyclic AMP (cAMP)-specific phosphodiesterases (PDEases) from a human monocyte cDNA library. One cDNA clone (hPDE-1) defines a large open reading frame of ca. 2.1 kilobases, predicting a 686-amino-acid, ca. 77-kilodalton protein which contains significant homology to both rat brain and {ital Drosophila} cAMP PDEases, especially within an internal conserved domain of ca. 270 residues. Amino acid sequence divergence exists at the NH{sub 2} terminus and also within a 40- to 100-residue domain near the COOH-terminal end. hPDE-1 hybridizes to a major 4.8-kilobase mRNA transcript from both human monocytes and placenta. The coding regionmore » of hPDE-1 was engineered for expression in COS-1 cells, resulting in the overproduction of cAMP PDEase activity. The hPDE-1 recombinant gene product was identified as a low-{ital K{sub m}} cAMP phosphodiesterase on the basis of several biochemical properties including selective inhibition by the antidepressant drug rolipram. Known inhibitors of other PDEases (cGMP-specific PDEase, cGMP-inhibited PDEase) had little or no effect on the hPDE-1 recombinant gene product.« less
Base Preferences in Non-Templated Nucleotide Incorporation by MMLV-Derived Reverse Transcriptases
Zajac, Pawel; Islam, Saiful; Hochgerner, Hannah; Lönnerberg, Peter; Linnarsson, Sten
2013-01-01
Reverse transcriptases derived from Moloney Murine Leukemia Virus (MMLV) have an intrinsic terminal transferase activity, which causes the addition of a few non-templated nucleotides at the 3´ end of cDNA, with a preference for cytosine. This mechanism can be exploited to make the reverse transcriptase switch template from the RNA molecule to a secondary oligonucleotide during first-strand cDNA synthesis, and thereby to introduce arbitrary barcode or adaptor sequences in the cDNA. Because the mechanism is relatively efficient and occurs in a single reaction, it has recently found use in several protocols for single-cell RNA sequencing. However, the base preference of the terminal transferase activity is not known in detail, which may lead to inefficiencies in template switching when starting from tiny amounts of mRNA. Here, we used fully degenerate oligos to determine the exact base preference at the template switching site up to a distance of ten nucleotides. We found a strong preference for guanosine at the first non-templated nucleotide, with a greatly reduced bias at progressively more distant positions. Based on this result, and a number of careful optimizations, we report conditions for efficient template switching for cDNA amplification from single cells. PMID:24392002
RICD: a rice indica cDNA database resource for rice functional genomics.
Lu, Tingting; Huang, Xuehui; Zhu, Chuanrang; Huang, Tao; Zhao, Qiang; Xie, Kabing; Xiong, Lizhong; Zhang, Qifa; Han, Bin
2008-11-26
The Oryza sativa L. indica subspecies is the most widely cultivated rice. During the last few years, we have collected over 20,000 putative full-length cDNAs and over 40,000 ESTs isolated from various cDNA libraries of two indica varieties Guangluai 4 and Minghui 63. A database of the rice indica cDNAs was therefore built to provide a comprehensive web data source for searching and retrieving the indica cDNA clones. Rice Indica cDNA Database (RICD) is an online MySQL-PHP driven database with a user-friendly web interface. It allows investigators to query the cDNA clones by keyword, genome position, nucleotide or protein sequence, and putative function. It also provides a series of information, including sequences, protein domain annotations, similarity search results, SNPs and InDels information, and hyperlinks to gene annotation in both The Rice Annotation Project Database (RAP-DB) and The TIGR Rice Genome Annotation Resource, expression atlas in RiceGE and variation report in Gramene of each cDNA. The online rice indica cDNA database provides cDNA resource with comprehensive information to researchers for functional analysis of indica subspecies and for comparative genomics. The RICD database is available through our website http://www.ncgr.ac.cn/ricd.
Zhang, W; Zou, A; Miao, J; Yin, Y; Tian, R; Pang, Y; Yang, R; Qi, J; Yang, Y
2011-03-01
We previously showed that ethylene might be involved in the process of shikonin biosynthesis regulated by light signals. Here, we cloned a full-length cDNA of LeERF-1, a putative ethylene response factor gene, from Lithospermum erythrorhizon using the RACE (rapid amplification of cDNA ends) method. Phylogenetic analysis revealed that LeERF-1 was classified in the B3 subfamily, together with ERF1 and ORA59 of Arabidopsis. Heterologous expression of LeERF-1 in Arabidopsis showed that LeERF-1:eGFP fusion protein was precisely localised to the nucleus, implying that it might function as a transcription factor. Detailed expression analysis with real-time PCR showed that LeERF-1 was significantly down-regulated by white, blue and red light, although the inhibitory effect of red light was relatively weak compared to other light conditions. Tissue-specific expression analysis also indicated that LeERF-1 was dominantly expressed in the roots, which grow in soil in darkness. These patterns are all consistent with the effects of different light signals on regulating formation of shikonin and its derivatives, indicating that LeERF-1 might be a crucial positive regulator, like other B3 subfamily proteins (such as ORCA3 and ORA59), in regulating biosynthesis of secondary metabolites. © 2010 German Botanical Society and The Royal Botanical Society of the Netherlands.
Large-scale collection of full-length cDNA and transcriptome analysis in Hevea brasiliensis
Makita, Yuko; Ng, Kiaw Kiaw; Veera Singham, G.; Kawashima, Mika; Hirakawa, Hideki; Sato, Shusei
2017-01-01
Abstract Natural rubber has unique physical properties that cannot be replaced by products from other latex-producing plants or petrochemically produced synthetic rubbers. Rubber from Hevea brasiliensis is the main commercial source for this natural rubber that has a cis-polyisoprene configuration. For sustainable production of enough rubber to meet demand elucidation of the molecular mechanisms involved in the production of latex is vital. To this end, we firstly constructed rubber full-length cDNA libraries of RRIM 600 cultivar and sequenced around 20,000 clones by the Sanger method and over 15,000 contigs by Illumina sequencer. With these data, we updated around 5,500 gene structures and newly annotated around 9,500 transcription start sites. Second, to elucidate the rubber biosynthetic pathways and their transcriptional regulation, we carried out tissue- and cultivar-specific RNA-Seq analysis. By using our recently published genome sequence, we confirmed the expression patterns of the rubber biosynthetic genes. Our data suggest that the cytoplasmic mevalonate (MVA) pathway is the main route for isoprenoid biosynthesis in latex production. In addition to the well-studied polymerization factors, we suggest that rubber elongation factor 8 (REF8) is a candidate factor in cis-polyisoprene biosynthesis. We have also identified 39 transcription factors that may be key regulators in latex production. Expression profile analysis using two additional cultivars, RRIM 901 and PB 350, via an RNA-Seq approach revealed possible expression differences between a high latex-yielding cultivar and a disease-resistant cultivar. PMID:28431015
Su, Y; Feng, J; Sun, X; Guo, Z; Xu, L; Jiang, J
2013-01-01
Chemokines are small, secreted cytokine peptides, known principally for their ability to induce migration and activation of leukocyte populations under both pathological and physiological conditions. On the basis of previously constructed express sequence tags (ESTs) of the head kidney and spleen cDNA library of the perciform marine fish Rachycentron canadum (common name cobia). We used bi-directional rapid amplification of cDNA ends (RACE) and obtained a full-length cDNA of a new CC chemokine gene (designated RcCC3). The RcCC3 putative peptide exhibits sequence similarity to the group of CCL19/21/25 CC chemokines. The reverse transcription quantitative polymerase chain reaction (RT-qPCR) was used in transcript expression studies of RcCC3. We examined the constitutive expression of the transcripts in 12 tissues of non-stressed cobia; RcCC3 transcripts were detected in all tissues examined, with the highest expression in gill and liver, following by head kidney, kidney, spleen, skin, intestine, muscle, stomach, heart, blood and brain. Transcript expression of RcCC3 was examined in immune-related organs, including head kidney, spleen and liver, following intraperitoneal injection of phosphate-buffered saline control, polyriboinosinic polyribocytidylic acid (poly(I:C)) and formalin-killed Vibrio carchariae (bacterial vaccine). The transcripts in these tissues were quickly up-regulated by the injection of poly(I:C) and bacterial vaccine at early time points, although with different expression profiles. These results indicate RcCC3 represents an important component of innate immunity in cobia.
Zhu, Ling; Song, Linsheng; Zhang, Huan; Zhao, Jianmin; Li, Chenghua; Xu, Wei
2008-06-01
Apoptosis is an active process of cell death, which is an integral part of growth and development in multicellular organisms. The defender against cell death 1 (DAD1), the regulatory protein to inhibit the apoptosis process, was first cloned from the bay scallop Argopecten irradians by randomly sequencing a whole tissue cDNA library and rapid amplification of cDNA end (RACE). The full-length cDNA of the A. irradians DAD1 was 607 bp, consist of a 5'-terminal untranslated region (UTR) of 63 bp, a 3'-terminal UTR of 205 bp with a canonical polyadenylation signal sequence AATAAA and a poly (A) tail, and an open reading frame of 339 bp. The deduced amino acid sequence of the A. irradians DAD1 showed 75.5% identity to Araneus ventricosus, 74.5% to Drosophila melanogaster, and 73.6% to Homo sapiens, Sus scrofa, Mesocricetus auratus, Rattus norvegicus and Mus musculus. Excluding the Saccharomyces cerevisiae DAD1 homologue, all animal DAD1 including A. irradians DAD1 homologue formed a subgroup and all plant DAD1 proteins formed another subgroup in the phylogenetic analysis. The A. irradians DAD1 was expressed in all examined tissues including adductor muscle, mantle, gills, digestive gland, gonad and hemolymph, suggesting that A. irradians DAD1 is expressed in most body tissues. Furthermore, the mRNA expression levels of A. irradians DAD1 gene of hemolymph were particularly high after injury, suggesting that the gene is responsive to injury stimuli.
Ishibashi, J; Saido-Sakanaka, H; Yang, J; Sagisaka, A; Yamakawa, M
1999-12-01
A novel member of the insect defensins, a family of antibacterial peptides, was purified from larvae of the coconut rhinoceros beetle, Oryctes rhinoceros, immunized with Escherichia coli. A full-size cDNA was cloned by combining reverse-transcription PCR (RT-PCR), and 5'- and 3'-rapid amplification of cDNA ends (RACE). Analysis of the O. rhinoceros defensin gene expression showed it to be expressed in the fat body and hemocyte, midgut and Malpighian tubules. O. rhinoceros defensin showed strong antibacterial activity against Staphylococcus aureus. A 9-mer peptide amidated at its C-terminus, AHCLAICRK-NH2 (Ala22-Lys30-NH2), was synthesized based on the deduced amino-acid sequence, assumed to be an active site sequence by analogy with the sequence of a defensin isolated from larvae of the beetle Allomyrina dichotoma. This peptide showed antibacterial activity against S. aureus, methicillin-resistant S. aureus, E. coli and Pseudomonas aeruginosa. We further modified this oligopeptide and synthesized five 9-mer peptides, ALRLAIRKR-NH2, ALLLAIRKR-NH2, AWLLAIRKR-NH2, ALYLAIRKR-NH2 and ALWLAIRKR-NH2. These oligopeptides showed strong antibacterial activity against Gram-negative and Gram-positive bacteria. The antibacterial effect of Ala22-Lys30-NH2 analogues was due to its interaction with bacterial membranes, judging from the leakage of liposome-entrapped glucose. These Ala22-Lys30-NH2 analogues did not show haemolytic activity and did not inhibit the growth of murine fibroblast cells or macrophages, except for AWLLAIRKR-NH2.
Zhang, Lin; Jia, Baoguang; Zou, Feng; Tan, Xiaofeng; Liu, Min; Song, Zhibo; Zeng, Yanling; Jiang, Nan; Yuan, Deyi
2014-01-01
Many flowering plants exhibit an important intraspecific reproductive barrier phenomenon, that is, self-incompatibility (SI), in which S-RNase genes play a significant role. To clarify the specific function of S-RNase genes in Chinese pears, the full length cDNA of PbS 26 -RNase was isolated by rapid amplification of cDNA ends (RACE) technology from Chinese white pear (Pyrus bretschneideri) cultivar "Hongpisu." The cDNA sequence for PbS 26 -RNase was deposited in GenBank under accession number EU081888. At the amino acid level, the PbS 26 -RNase displayed the highest similarity (96.9%) with PcSa-RNase of P. communis, and only seven amino acid differences were present in the two S-RNases. Phylogenetic analysis of rosaceous S-RNases indicated that the PbS 26 -RNase clustered with maloideous S-RNases, forming a subfamily-specific not a species-specific group. The PbS 26 -RNase gene was specifically expressed in the style but not other tissues/organs. The expression level of the PbS 26 -RNase gene rapidly increased at bell balloon stage (BBS), and then it dropped after pollination. However, the abundance of the PbS 26 -RNase gene transcript in the style was greater after cross-pollination than after self-pollination. In addition, a method for rapidly detecting the PbS 26 -RNase gene was developed via allele-specific primers design. The present study could provide a scientific basis for fully clarifying the mechanism of pear SI at the molecular level.
Jia, Baoguang; Liu, Min; Song, Zhibo; Zeng, Yanling; Jiang, Nan; Yuan, Deyi
2014-01-01
Many flowering plants exhibit an important intraspecific reproductive barrier phenomenon, that is, self-incompatibility (SI), in which S-RNase genes play a significant role. To clarify the specific function of S-RNase genes in Chinese pears, the full length cDNA of PbS 26 -RNase was isolated by rapid amplification of cDNA ends (RACE) technology from Chinese white pear (Pyrus bretschneideri) cultivar “Hongpisu.” The cDNA sequence for PbS 26 -RNase was deposited in GenBank under accession number EU081888. At the amino acid level, the PbS 26 -RNase displayed the highest similarity (96.9%) with PcSa-RNase of P. communis, and only seven amino acid differences were present in the two S-RNases. Phylogenetic analysis of rosaceous S-RNases indicated that the PbS 26 -RNase clustered with maloideous S-RNases, forming a subfamily-specific not a species-specific group. The PbS 26 -RNase gene was specifically expressed in the style but not other tissues/organs. The expression level of the PbS 26 -RNase gene rapidly increased at bell balloon stage (BBS), and then it dropped after pollination. However, the abundance of the PbS 26 -RNase gene transcript in the style was greater after cross-pollination than after self-pollination. In addition, a method for rapidly detecting the PbS 26 -RNase gene was developed via allele-specific primers design. The present study could provide a scientific basis for fully clarifying the mechanism of pear SI at the molecular level. PMID:24737959
Liu, X J; Jin, C; Wu, L M; Dong, S J; Zeng, S M; Li, J L
2016-07-29
Matrix proteins that either weakly acidic or unusually highly acidic have important roles in shell biomineralization. In this study, we have identified and characterized hic22, a weakly acidic matrix protein, from the nacreous layer of Hyriopsis cumingii. Total protein was extracted from the nacre using 5 M EDTA and hic22 was purified using a DEAE-sepharose column. The N-terminal amino acid sequence of hic22 was determined and the complete cDNA encoding hic22 was cloned and sequenced by rapid amplification of cDNA ends-polymerase chain reaction. Finally, the localization and distribution of hic22 was determined by in situ hybridization. Our results revealed that hic22 encodes a 22-kDa protein composed of 185 amino acids. Tissue expression analysis and in situ hybridization indicated that hic22 is expressed in the dorsal epithelial cells of the mantle pallial; moreover, significant expression levels of hic22 were observed after the early formation of the pearl sac (days 19-77), implying that hic22 may play an important role in biomineralization of the nacreous layer.
MASQOT: a method for cDNA microarray spot quality control
Bylesjö, Max; Eriksson, Daniel; Sjödin, Andreas; Sjöström, Michael; Jansson, Stefan; Antti, Henrik; Trygg, Johan
2005-01-01
Background cDNA microarray technology has emerged as a major player in the parallel detection of biomolecules, but still suffers from fundamental technical problems. Identifying and removing unreliable data is crucial to prevent the risk of receiving illusive analysis results. Visual assessment of spot quality is still a common procedure, despite the time-consuming work of manually inspecting spots in the range of hundreds of thousands or more. Results A novel methodology for cDNA microarray spot quality control is outlined. Multivariate discriminant analysis was used to assess spot quality based on existing and novel descriptors. The presented methodology displays high reproducibility and was found superior in identifying unreliable data compared to other evaluated methodologies. Conclusion The proposed methodology for cDNA microarray spot quality control generates non-discrete values of spot quality which can be utilized as weights in subsequent analysis procedures as well as to discard spots of undesired quality using the suggested threshold values. The MASQOT approach provides a consistent assessment of spot quality and can be considered an alternative to the labor-intensive manual quality assessment process. PMID:16223442
Oakes, Theres; Heather, James M.; Best, Katharine; Byng-Maddick, Rachel; Husovsky, Connor; Ismail, Mazlina; Joshi, Kroopa; Maxwell, Gavin; Noursadeghi, Mahdad; Riddell, Natalie; Ruehl, Tabea; Turner, Carolin T.; Uddin, Imran; Chain, Benny
2017-01-01
The T cell receptor (TCR) repertoire can provide a personalized biomarker for infectious and non-infectious diseases. We describe a protocol for amplifying, sequencing, and analyzing TCRs which is robust, sensitive, and versatile. The key experimental step is ligation of a single-stranded oligonucleotide to the 3′ end of the TCR cDNA. This allows amplification of all possible rearrangements using a single set of primers per locus. It also introduces a unique molecular identifier to label each starting cDNA molecule. This molecular identifier is used to correct for sequence errors and for effects of differential PCR amplification efficiency, thus producing more accurate measures of the true TCR frequency within the sample. This integrated experimental and computational pipeline is applied to the analysis of human memory and naive subpopulations, and results in consistent measures of diversity and inequality. After error correction, the distribution of TCR sequence abundance in all subpopulations followed a power law over a wide range of values. The power law exponent differed between naïve and memory populations, but was consistent between individuals. The integrated experimental and analysis pipeline we describe is appropriate to studies of T cell responses in a broad range of physiological and pathological contexts. PMID:29075258
NASA Astrophysics Data System (ADS)
Cong, Ming; Zhao, Jianmin; Lü, Jiasen; Ren, Zhiming; Wu, Huifeng
2016-09-01
The halophyte Suaeda salsa can grow in heavy metal-polluted areas along intertidal zones having high salinity. Since phytochelatins can eff ectively chelate heavy metals, it was hypothesized that S. salsa possessed a phytochelatin synthase (PCS) gene. In the present study, the cDNA of PCS was obtained from S. salsa (designated as SsPCS) using homologous cloning and the rapid amplification of cDNA ends (RACE). A sequence analysis revealed that SsPCS consisted of 1 916 bp nucleotides, encoding a polypeptide of 492 amino acids with one phytochelatin domain and one phytochelatin C domain. A similarity analysis suggested that SsPCS shared up to a 58.6% identity with other PCS proteins and clustered with PCS proteins from eudicots. There was a new kind of metal ion sensor motif in its C-terminal domain. The SsPCS transcript was more highly expressed in elongated and fibered roots and stems ( P<0.05) than in leaves. Lead and mercury exposure significantly enhanced the mRNA expression of SsPCS ( P<0.05). To the best of our knowledge, SsPCS is the second PCS gene cloned from a halophyte, and it might contain a diff erent metal sensing capability than the first PCS from Thellungiella halophila. This study provided a new view of halophyte PCS genes in heavy metal tolerance.
Unit-length line-1 transcripts in human teratocarcinoma cells.
Skowronski, J; Fanning, T G; Singer, M F
1988-01-01
We have characterized the approximately 6.5-kilobase cytoplasmic poly(A)+ Line-1 (L1) RNA present in a human teratocarcinoma cell line, NTera2D1, by primer extension and by analysis of cloned cDNAs. The bulk of the RNA begins (5' end) at the residue previously identified as the 5' terminus of the longest known primate genomic L1 elements, presumed to represent "unit" length. Several of the cDNA clones are close to 6 kilobase pairs, that is, close to full length. The partial sequences of 18 cDNA clones and full sequence of one (5,975 base pairs) indicate that many different genomic L1 elements contribute transcripts to the 6.5-kilobase cytoplasmic poly(A)+ RNA in NTera2D1 cells because no 2 of the 19 cDNAs analyzed had identical sequences. The transcribed elements appear to represent a subset of the total genomic L1s, a subset that has a characteristic consensus sequence in the 3' noncoding region and a high degree of sequence conservation throughout. Two open reading frames (ORFs) of 1,122 (ORF1) and 3,852 (ORF2) bases, flanked by about 800 and 200 bases of sequence at the 5' and 3' ends, respectively, can be identified in the cDNAs. Both ORFs are in the same frame, and they are separated by 33 bases bracketed by two conserved in-frame stop codons. ORF 2 is interrupted by at least one randomly positioned stop codon in the majority of the cDNAs. The data support proposals suggesting that the human L1 family includes one or more functional genes as well as an extraordinarily large number of pseudogenes whose ORFs are broken by stop codons. The cDNA structures suggest that both genes and pseudogenes are transcribed. At least one of the cDNAs (cD11), which was sequenced in its entirety, could, in principle, represent an mRNA for production of the ORF1 polypeptide. The similarity of mammalian L1s to several recently described invertebrate movable elements defines a new widely distributed class of elements which we term class II retrotransposons. Images PMID:2454389
Characterization and analysis of ribosomal proteins in two marine calanoid copepods
NASA Astrophysics Data System (ADS)
Yang, Feifei; Xu, Donghui; Zhuang, Yunyun; Huang, Yousong; Yi, Xiaoyan; Chen, Hongju; Liu, Guangxing; Zhang, Huan
2016-11-01
Copepods are among the most abundant and successful metazoans in the marine ecosystem. However, genomic resources related to fundamental cellular processes are still limited in this particular group of crustaceans. Ribosomal proteins are the building blocks of ribosomes, the primary site for protein synthesis. In this study, we characterized and analyzed the cDNAs of cytoplasmic ribosomal proteins (cRPs) of two calanoid copepods, Pseudodiaptomus poplesia and Acartia pacifica. We obtained 79 cRP cDNAs from P. poplesia and 67 from A. pacifica by cDNA library construction/sequencing and rapid amplification of cDNA ends. Analysis of the nucleic acid composition showed that the copepod cRP-encoding genes had higher GC content in the protein-coding regions (CDSs) than in the untranslated regions (UTRs), and single nucleotide repeats (>3 repeats) were common, with "A" repeats being the most frequent, especially in the CDSs. The 3'-UTRs of the cRP genes were significantly longer than the 5'-UTRs. Codon usage analysis showed that the third positions of the codons were dominated by C or G. The deduced amino acid sequences of the cRPs contained high proportions of positively charged residues and had high pI values. This is the first report of a complete set of cRP-encoding genes from copepods. Our results shed light on the characteristics of cRPs in copepods, and provide fundamental data for further studies of protein synthesis in copepods. The copepod cRP information revealed in this study indicates that additional comparisons and analysis should be performed on different taxonomic categories such as orders and families.
Cloning and Expression of cDNA for Rat Heme Oxygenase
NASA Astrophysics Data System (ADS)
Shibahara, Shigeki; Muller, Rita; Taguchi, Hayao; Yoshida, Tadashi
1985-12-01
Two cDNA clones for rat heme oxygenase have been isolated from a rat spleen cDNA library in λ gt11 by immunological screening using a specific polyclonal antibody. One of these clones has an insert of 1530 nucleotides that contains the entire protein-coding region. To confirm that the isolated cDNA encodes heme oxygenase, we transfected monkey kidney cells (COS-7) with the cDNA carried in a simian virus 40 vector. The heme oxygenase was highly expressed in endoplasmic reticulum of transfected cells. The nucleotide sequence of the cloned cDNA was determined and the primary structure of heme oxygenase was deduced. Heme oxygenase is composed of 289 amino acids and has one hydrophobic segment at its carboxyl terminus, which is probably important for the insertion of heme oxygenase into endoplasmic reticulum. The cloned cDNA was used to analyze the induction of heme oxygenase in rat liver by treatment with CoCl2 or with hemin. RNA blot analysis showed that both CoCl2 and hemin increased the amount of hybridizable mRNA, suggesting that these substances may act at the transcriptional level to increase the amount of heme oxygenase.
Fabrication of high quality cDNA microarray using a small amount of cDNA.
Park, Chan Hee; Jeong, Ha Jin; Jung, Jae Jun; Lee, Gui Yeon; Kim, Sang-Chul; Kim, Tae Soo; Yang, Sang Hwa; Chung, Hyun Cheol; Rha, Sun Young
2004-05-01
DNA microarray technology has become an essential part of biological research. It enables the genome-scale analysis of gene expression in various types of model systems. Manufacturing high quality cDNA microarrays of microdeposition type depends on some key factors including a printing device, spotting pins, glass slides, spotting solution, and humidity during spotting. UsingEthe Microgrid II TAS model printing device, this study defined the optimal conditions for producing high density, high quality cDNA microarrays with the least amount of cDNA product. It was observed that aminosilane-modified slides were superior to other types of surface modified-slides. A humidity of 30+/-3% in a closed environment and the overnight drying of the spotted slides gave the best conditions for arraying. In addition, the cDNA dissolved in 30% DMSO gave the optimal conditions for spotting compared to the 1X ArrayIt, 3X SSC and 50% DMSO. Lastly, cDNA in the concentration range of 100-300 ng/ micro l was determined to be best for arraying and post-processing. Currently, the printing system in this study yields reproducible 9000 spots with a spot size 150 mm diameter, and a 200 nm spot spacing.
Genome-Wide Profiling of RNA–Protein Interactions Using CLIP-Seq
Stork, Cheryl; Zheng, Sika
2017-01-01
UV crosslinking immunoprecipitation (CLIP) is an increasingly popular technique to study protein–RNA interactions in tissues and cells. Whole cells or tissues are ultraviolet irradiated to generate a covalent bond between RNA and proteins that are in close contact. After partial RNase digestion, antibodies specific to an RNA binding protein (RBP) or a protein–epitope tag is then used to immunoprecipitate the protein–RNA complexes. After stringent washing and gel separation the RBP–RNA complex is excised. The RBP is protease digested to allow purification of the bound RNA. Reverse transcription of the RNA followed by high-throughput sequencing of the cDNA library is now often used to identify protein bound RNA on a genome-wide scale. UV irradiation can result in cDNA truncations and/or mutations at the crosslink sites, which complicates the alignment of the sequencing library to the reference genome and the identification of the crosslinking sites. Meanwhile, one or more amino acids of a crosslinked RBP can remain attached to its bound RNA due to incomplete digestion of the protein. As a result, reverse transcriptase may not read through the crosslink sites, and produce cDNA ending at the crosslinked nucleotide. This is harnessed by one variant of CLIP methods to identify crosslinking sites at a nucleotide resolution. This method, individual nucleotide resolution CLIP (iCLIP) circularizes cDNA to capture the truncated cDNA and also increases the efficiency of ligating sequencing adapters to the library. Here, we describe the detailed procedure of iCLIP. PMID:26965263
Woods, D E; Edge, M D; Colten, H R
1984-01-01
Complementary DNA (cDNA) clones corresponding to the major histocompatibility (MHC) class III antigen, complement protein C2, have been isolated from human liver cDNA libraries with the use of a complex mixture of synthetic oligonucleotides (17 mer) that contains 576 different oligonucleotide sequences. The C2 cDNA were used to identify a DNA restriction enzyme fragment length polymorphism that provides a genetic marker within the MHC that was not detectable at the protein level. An extensive search for genomic polymorphisms using a cDNA clone for another MHC class III gene, factor B, failed to reveal any DNA variants. The genomic variants detected with the C2 cDNA probe provide an additional genetic marker for analysis of MHC-linked diseases. Images PMID:6086718
Mutations Affecting Expression of the rosy Locus in Drosophila melanogaster
Lee, Chong Sung; Curtis, Daniel; McCarron, Margaret; Love, Carol; Gray, Mark; Bender, Welcome; Chovnick, Arthur
1987-01-01
The rosy locus in Drosophila melanogaster codes for the enzyme xanthine dehydrogenase (XDH). Previous studies defined a "control element" near the 5' end of the gene, where variant sites affected the amount of rosy mRNA and protein produced. We have determined the DNA sequence of this region from both genomic and cDNA clones, and from the ry+10 underproducer strain. This variant strain had many sequence differences, so that the site of the regulatory change could not be fixed. A mutagenesis was also undertaken to isolate new regulatory mutations. We induced 376 new mutations with 1-ethyl-1-nitrosourea (ENU) and screened them to isolate those that reduced the amount of XDH protein produced, but did not change the properties of the enzyme. Genetic mapping was used to find mutations located near the 5' end of the gene. DNA from each of seven mutants was cloned and sequenced through the 5' region. Mutant base changes were identified in all seven; they appear to affect splicing and translation of the rosy mRNA. In a related study (T. P. Keith et al. 1987), the genomic and cDNA sequences are extended through the 3' end of the gene; the combined sequences define the processing pattern of the rosy transcript and predict the amino acid sequence of XDH. PMID:3036645
Haas, Christian S; Creighton, Chad J; Pi, Xiujun; Maine, Ira; Koch, Alisa E; Haines, G Kenneth; Ling, Song; Chinnaiyan, Arul M; Holoshitz, Joseph
2006-07-01
To identify disease-specific gene expression profiles in patients with rheumatoid arthritis (RA), using complementary DNA (cDNA) microarray analyses on lymphoblastoid B cell lines (LCLs) derived from RA-discordant monozygotic (MZ) twins. The cDNA was prepared from LCLs derived from the peripheral blood of 11 pairs of RA-discordant MZ twins. The RA twin cDNA was labeled with cy5 fluorescent dye, and the cDNA of the healthy co-twin was labeled with cy3. To determine relative expression profiles, cDNA from each twin pair was combined and hybridized on 20,000-element microarray chips. Immunohistochemistry and real-time polymerase chain reaction were used to detect the expression of selected gene products in synovial tissue from patients with RA compared with patients with osteoarthritis and normal healthy controls. In RA twin LCLs compared with healthy co-twin LCLs, 1,163 transcripts were significantly differentially expressed. Of these, 747 were overexpressed and 416 were underexpressed. Gene ontology analysis revealed many genes known to play a role in apoptosis, angiogenesis, proteolysis, and signaling. The 3 most significantly overexpressed genes were laeverin (a novel enzyme with sequence homology to CD13), 11beta-hydroxysteroid dehydrogenase type 2 (a steroid pathway enzyme), and cysteine-rich, angiogenic inducer 61 (a known angiogenic factor). The products of these genes, heretofore uncharacterized in RA, were all abundantly expressed in RA synovial tissues. Microarray cDNA analysis of peripheral blood-derived LCLs from well-controlled patient populations is a useful tool to detect RA-relevant genes and could help in identifying novel therapeutic targets.
Tong, C G; Reichler, S; Blumenthal, S; Balk, J; Hsieh, H L; Roux, S J
1997-01-01
A cDNA encoding a nucleolar protein was selected from a pea (Pisum sativum) plumule library, cloned, and sequenced. The translated sequence of the cDNA has significant percent identity to Xenopus laevis nucleolin (31%), the alfalfa (Medicago sativa) nucleolin homolog (66%), and the yeast (Saccharomyces cerevisiae) nucleolin homolog (NSR1) (28%). It also has sequence patterns in its primary structure that are characteristic of all nucleolins, including an N-terminal acidic motif, RNA recognition motifs, and a C-terminal Gly- and Arg-rich domain. By immunoblot analysis, the polyclonal antibodies used to select the cDNA bind selectively to a 90-kD protein in purified pea nuclei and nucleoli and to an 88-kD protein in extracts of Escherichia coli expressing the cDNA. In immunolocalization assays of pea plumule cells, the antibodies stained primarily a region surrounding the fibrillar center of nucleoli, where animal nucleolins are typically found. Southern analysis indicated that the pea nucleolin-like protein is encoded by a single gene, and northern analysis showed that the labeled cDNA binds to a single band of RNA, approximately the same size and the cDNA. After irradiation of etiolated pea seedlings by red light, the mRNA level in plumules decreased during the 1st hour and then increased to a peak of six times the 0-h level at 12 h. Far-red light reversed this effect of red light, and the mRNA accumulation from red/far-red light irradiation was equal to that found in the dark control. This indicates that phytochrome may regulate the expression of this gene. PMID:9193096
NASA Astrophysics Data System (ADS)
Zhao, Liyuan; Mi, Tiezhu; Zhen, Yu; Yu, Zhigang
2012-05-01
Mitochondrial cytochrome b (Cytb), one of the few proteins encoded by the mitochondrial DNA, plays an important role in transferring electrons. As a mitochondrial gene, it has been widely used for phylogenetic analysis. Previously, a 949-bp fragment of the coding gene and mRNA editing were characterized from Prorocentrum donghaiense, which might prove useful for resolving P. donghaiense from closely related species. However, the full-length coding region has not been characterized. In this study, we used rapid amplification of cDNA ends (RACE) to obtain full-length, 1 124 bp cDNA. Cytb transcript contained a standard initiation codon ATG, but did not have a recognizable stop codon. Homology comparison showed that the P. donghaiense Cytb had a high sequence identity to Cytb sequences from other dinoflagellate species. Phylogenetic analysis placed Cytb from P. donghaiense in the clade of dinoflagellates and it clustered together strongly with that from P. minimum. Based on the full-length sequence, we inferred 32 editing events at different positions, accounting for 2.93% of the Cytb gene. 34.4% (11) of the changes were A to G, 25% (8) were T to C, and 25% (8) were C to U, with smaller proportions of G to C and G to A edits (9.4% (3) and 6.2% (2), respectively). The expression level of the Cytb transcript was quantified by real-time PCR with a TaqMan probe at different times during the whole growth phase. The average Cytb transcript was present at 39.27±7.46 copies of cDNA per cell during the whole growth cycle, and the expression of Cytb was relatively stable over the different phases. These results deepen our understanding of the structure and characteristics of Cytb in P. donghaiense, and confirmed that Cytb in P. donghaiense is a candidate reference gene for studying the expression of other genes.
Display of a maize cDNA library on baculovirus infected insect cells.
Meller Harel, Helene Y; Fontaine, Veronique; Chen, Hongying; Jones, Ian M; Millner, Paul A
2008-08-12
Maize is a good model system for cereal crop genetics and development because of its rich genetic heritage and well-characterized morphology. The sequencing of its genome is well advanced, and new technologies for efficient proteomic analysis are needed. Baculovirus expression systems have been used for the last twenty years to express in insect cells a wide variety of eukaryotic proteins that require complex folding or extensive posttranslational modification. More recently, baculovirus display technologies based on the expression of foreign sequences on the surface of Autographa californica (AcMNPV) have been developed. We investigated the potential of a display methodology for a cDNA library of maize young seedlings. We constructed a full-length cDNA library of young maize etiolated seedlings in the transfer vector pAcTMVSVG. The library contained a total of 2.5 x 10(5) independent clones. Expression of two known maize proteins, calreticulin and auxin binding protein (ABP1), was shown by western blot analysis of protein extracts from insect cells infected with the cDNA library. Display of the two proteins in infected insect cells was shown by selective biopanning using magnetic cell sorting and demonstrated proof of concept that the baculovirus maize cDNA display library could be used to identify and isolate proteins. The maize cDNA library constructed in this study relies on the novel technology of baculovirus display and is unique in currently published cDNA libraries. Produced to demonstrate proof of principle, it opens the way for the development of a eukaryotic in vivo display tool which would be ideally suited for rapid screening of the maize proteome for binding partners, such as proteins involved in hormone regulation or defence.
Multiplex cDNA quantification method that facilitates the standardization of gene expression data
Gotoh, Osamu; Murakami, Yasufumi; Suyama, Akira
2011-01-01
Microarray-based gene expression measurement is one of the major methods for transcriptome analysis. However, current microarray data are substantially affected by microarray platforms and RNA references because of the microarray method can provide merely the relative amounts of gene expression levels. Therefore, valid comparisons of the microarray data require standardized platforms, internal and/or external controls and complicated normalizations. These requirements impose limitations on the extensive comparison of gene expression data. Here, we report an effective approach to removing the unfavorable limitations by measuring the absolute amounts of gene expression levels on common DNA microarrays. We have developed a multiplex cDNA quantification method called GEP-DEAN (Gene expression profiling by DCN-encoding-based analysis). The method was validated by using chemically synthesized DNA strands of known quantities and cDNA samples prepared from mouse liver, demonstrating that the absolute amounts of cDNA strands were successfully measured with a sensitivity of 18 zmol in a highly multiplexed manner in 7 h. PMID:21415008
Bhore, Subhash J; Kassim, Amelia; Loh, Chye Ying; Shah, Farida H
2010-01-01
It is well known that the nutritional quality of the American oil-palm (Elaeis oleifera) mesocarp oil is superior to that of African oil-palm (Elaeis guineensis Jacq. Tenera) mesocarp oil. Therefore, it is of important to identify the genetic features for its superior value. This could be achieved through the genome sequencing of the oil-palm. However, the genome sequence is not available in the public domain due to commercial secrecy. Hence, we constructed a cDNA library and generated expressed sequence tags (3,205) from the mesocarp tissue of the American oil-palm. We continued to annotate each of these cDNAs after submitting to GenBank/DDBJ/EMBL. A rough analysis turned our attention to the beta-carotene hydroxylase (Chyb) enzyme encoding cDNA. Then, we completed the full sequencing of cDNA clone for its both strands using M13 forward and reverse primers. The full nucleotide and protein sequence was further analyzed and annotated using various Bioinformatics tools. The analysis results showed the presence of fatty acid hydroxylase superfamily domain in the protein sequence. The multiple sequence alignment of selected Chyb amino acid sequences from other plant species and algal members with E. oleifera Chyb using ClustalW and its phylogenetic analysis suggest that Chyb from monocotyledonous plant species, Lilium hubrid, Crocus sativus and Zea mays are the most evolutionary related with E. oleifera Chyb. This study reports the annotation of E. oleifera Chyb. Abbreviations ESTs - expressed sequence tags, EoChyb - Elaeis oleifera beta-carotene hydroxylase, MC - main cluster PMID:21364789
USDA-ARS?s Scientific Manuscript database
We cloned the full-length of the gene putatively encoding caffeic acid O-methyltransferase (COMT) from kenaf (Hibiscus cannabinus L.) using degenerate primers and the RACE (rapid amplification of cDNA ends) method. Kenaf is an herbaceous and rapidly growing dicotyledonous plant with great potential ...
Colby, Sheila M.; Crock, John; Dowdle-Rizzo, Barbara; Lemaux, Peggy G.; Croteau, Rodney
1998-01-01
Germacrene C was found by GC-MS and NMR analysis to be the most abundant sesquiterpene in the leaf oil of Lycopersicon esculentum cv. VFNT Cherry, with lesser amounts of germacrene A, guaia-6,9-diene, germacrene B, β-caryophyllene, α-humulene, and germacrene D. Soluble enzyme preparations from leaves catalyzed the divalent metal ion-dependent cyclization of [1-3H]farnesyl diphosphate to these same sesquiterpene olefins, as determined by radio-GC. To obtain a germacrene synthase cDNA, a set of degenerate primers was constructed based on conserved amino acid sequences of related terpenoid cyclases. With cDNA prepared from leaf epidermis-enriched mRNA, these primers amplified a 767-bp fragment that was used as a hybridization probe to screen the cDNA library. Thirty-one clones were evaluated for functional expression of terpenoid cyclase activity in Escherichia coli by using labeled geranyl, farnesyl, and geranylgeranyl diphosphates as substrates. Nine cDNA isolates expressed sesquiterpene synthase activity, and GC-MS analysis of the products identified germacrene C with smaller amounts of germacrene A, B, and D. None of the expressed proteins was active with geranylgeranyl diphosphate; however, one truncated protein converted geranyl diphosphate to the monoterpene limonene. The cDNA inserts specify a deduced polypeptide of 548 amino acids (Mr = 64,114), and sequence comparison with other plant sesquiterpene cyclases indicates that germacrene C synthase most closely resembles cotton δ-cadinene synthase (50% identity). PMID:9482865
NASA Astrophysics Data System (ADS)
Liu, Jiao; Li, Xianchao; Tang, Xuexi; Zhou, Bin
2016-03-01
Members of the DnaJ family are proteins that play a pivotal role in various cellular processes, such as protein folding, protein transport and cellular responses to stress. In the present study, we identified and characterized the full-length DnaJ cDNA sequence from expressed sequence tags of Pyropia yezoensis ( PyDnaJ) via rapid identification of cDNA ends. This cDNA encoded a protein of 429 amino acids, which shared high sequence similarity with other identified DnaJ proteins, such as a heat shock protein 40/DnaJ from Pyropia haitanensis. The relative mRNA expression level of PyDnaJ was investigated using real-time PCR to determine its specific expression during the algal life cycle and during desiccation. The relative mRNA expression level in sporophytes was higher than that in gametophytes and significantly increased during the whole desiccation process. These results indicate that PyDnaJ is an authentic member of the DnaJ family in plants and red algae and might play a pivotal role in mitigating damage to P. yezoensis during desiccation.
Characterization and expression of the calpastatin gene in Cyprinus carpio.
Chen, W X; Ma, Y
2015-07-03
Calpastatin, an important protein used to regulate meat quality traits in animals, is encoded by the CAST gene. The aim of the present study was to clone the cDNA sequence of the CAST gene and detect the expression of CAST in the tissues of Cyprinus carpio. The cDNA of the C. carpio CAST gene, amplified using rapid amplification of cDNA ends PCR, is 2834 bp in length (accession No. JX275386), contains a 2634-bp open reading frame, and encodes a protein with 877 amino acid residues. The amino acid sequence of the C. carpio CAST gene was 88, 80, and 59% identical to the sequences observed in grass carp, zebrafish, and other fish, respectively. The C. carpio CAST was observed to contain four conserved domains with 54 serine phosphorylation loci, 28 threonine phosphorylation loci, 1 tyrosine phosphorylation loci, and 6 specific protein kinase C phosphorylation loci. The CAST gene showed widespread expression in different tissues of C. carpio. Surprisingly, the relative expression of the CAST transcript in the muscle and heart tissues of C. carpio was significantly higher than in other tissues (P < 0.01).
A pilot study of gene expression analysis in workers with hand-arm vibration syndrome.
Maeda, Setsuo; Yu, Xiaozhong; Wang, Rui-Sheng; Sakakibara, Hisataka
2008-04-01
The purpose of this pilot study was to examine differences in gene expressions by cDNA microarray analysis of hand-arm vibration syndrome (HAVS) patients. Vein blood samples were collected and total RNA was extracted. All blood samples were obtained in the morning in one visit after a standard light breakfast. We performed microarray analysis with the labeled cDNA prepared by reverse transcription from RNA samples, using the Human CHIP version 1 (DNA Chip Research Inc, Yokohama, Japan). There are 2,976 genes on the chip, and these genes were selected from a cDNA library prepared with human peripheral white blood cells (WBC). Different gene levels between the HAVS patients and controls, and between groups of HAVS with different levels of symptoms, were indicated by the randomized variance model. The most up-regulated genes were analyzed for their possible functions and association with the occurrence of HAVS. From the results of this pilot study, although the results were obtained a limited number of subjects, it would appear that cDNA microarray analysis of HAVS patients has potential as a new objective method of HAVS diagnosis. Further research is needed to examine the gene expression with increased numbers of patients at different stages of HAVS.
Genetic Regulation in the Aiptasia pallida Symbiosis - Performance Report, Year 1.
1997-02-01
and symbiotic zooxanthellae is one developed for serial analysis of gene expression (SAGE). We initially tested the SAGE protocol with cDNA generated...technically difficult. We are now focusing on constructing representative cDNA libraries from cultured and symbiotic zooxanthellae and will sequence
Watanabe, H; Narai, A; Shimizu, M
1999-06-01
A new protein that decreases transepithelial electrical resistance (TEER) in the human intestinal Caco-2 cell monolayer was found in a water-soluble fraction of the mushroom Flammulina velutipes. This protein, termed TEER-decreasing protein (TDP), is not cytotoxic and does not induce cell detachment, but rapidly increases the tight junctional permeability for water-soluble marker substances such as Lucifer Yellow CH (Mr 457) through the paracellular pathway. TDP was isolated and purified from the aqueous extract of F. velutipes by chromatographic means. Purified TDP was found to be a simple, nonglycosylated protein without intermolecular disulfide bonds, and the apparent molecular mass as estimated by SDS/PAGE and gel filtration is 30 kDa. It was revealed that the N-terminal amino-acid sequence of purified TDP is identical to the recently reported N-terminal sequence of flammutoxin, a membrane-perturbing hemolytic protein, for which the complete primary structure has not yet been reported [Tomita, T., Ishikawa, D., Noguchi, T., Katayama, E., and Hashimoto, Y. (1998) Biochem. J. 333, 24794-24799]. The cDNA coding for TDP was cloned by 5' and 3' rapid amplification of cDNA ends. The ORF encodes a protein with 272 amino-acid residues showing no homology to known proteins. Relevant studies using TDP cDNA will provide insight into the structure-function relationships of membrane pore-forming toxins.
HOXBES2: a novel epididymal HOXB2 homeoprotein and its domain-specific association with spermatozoa.
Prabagaran, E; Bandivdekar, A H; Dighe, V; Raghavan, V P
2007-02-01
The sperm from the testis acquires complete fertilizing ability and forward progressive motility following its transit through the epididymis. Acquisition of these characteristics results from the modification of the sperm proteome following interactions with epididymal secretions. In our attempts to identify epididymis-specific sperm plasma membrane proteins, a partial 2.83-kb clone was identified by immunoscreening a monkey epididymal cDNA library with an agglutinating monoclonal antibody raised against washed human spermatozoa. The sequence of the 2.83-kb clone exhibited homology to the region between 1 and 1097 bp of the homeobox gene, Hoxb2. This sequence was found to be species conserved, as revealed by RT-PCR analysis. To obtain a full-length clone of the sequence, 5' RACE-PCR (rapid amplification of cDNA ends PCR) was carried out using rat epididymal RNA as the template. It resulted in a full-length 1.657-kb cDNA encoding a 32.9-kDa putative protein. The protein designated HOXBES2 exhibited homology to the conserved 61-amino acid homeodomain region of the HOXB2 homeoprotein. However, characteristic differences were noted in its amino and carboxyl termini compared with HOXB2. A putative 30-kDa protein was detected in the tissue extracts from adult rat epididymis and caudal spermatozoa, and a 37-kDa protein was detected in the rat embryo when probed with a polyclonal antibody against HOXB2 protein. Multiple tissue Western blot and immunohistochemical analysis further indicated its expression in the cytoplasm of the principal and basal epithelial cells, with maximal expression in the distal epididymal segments. Northern blot analysis detected a single approximately 2.5-kb transcript from the adult epididymis. Indirect immunofluorescence localized the protein to the acrosome, midpiece, and equatorial segments of rat caudal and ejaculated human and monkey spermatozoa, respectively. In conclusion, we have identified and characterized a novel epididymal homeoprotein different from HOXB2 protein and hereafter referred to as HOXBES2, (HOXB2 homeodomain containing epididymis-specific sperm protein) with a probable role in fertilization.
Comparative Analysis of Expressed Genes from Cacao Meristems Infected by Moniliophthora perniciosa
Gesteira, Abelmon S.; Micheli, Fabienne; Carels, Nicolas; Da Silva, Aline C.; Gramacho, Karina P.; Schuster, Ivan; Macêdo, Joci N.; Pereira, Gonçalo A. G.; Cascardo, Júlio C. M.
2007-01-01
Background and Aims Witches' broom disease is caused by the hemibiotrophic basidiomycete Moniliophthora perniciosa, and is one of the most important diseases of cacao in the western hemisphere. Because very little is known about the global process of such disease development, expressed sequence tags (ESTs) were used to identify genes expressed during the Theobroma cacao–Moniliophthora perniciosa interaction. Methods Two cDNA libraries corresponding to the resistant (RT) and susceptible (SP) cacao–M. perniciosa interactions were constructed from total RNA, using the DB SMART Creator cDNA library kit (Clontech). Clones were randomly selected, sequenced from the 5′ end and analysed using bioinformatics tools including in silico analysis of the differential gene expression. Key Results A total of 6884 ESTs were generated from the RT and SP cDNA libraries. These ESTs were composed of 2585 singlets and 341 contigs for a total of 2926 non-redundant sequences. The redundancy of the libraries was low and their specificity high when compared with the few other cacao libraries already published. Sequence analysis allowed the assignment of a putative functional category for 54 % of sequences, whereas approx. 22 % of sequences corresponded to unknown function and approx. 24 % of sequences did not show any significant similarity with other proteins present in the database. Despite the similar overall distribution of the sequences in functional categories between the two libraries, qualitative differences were observed. Genes involved during the defence response to pathogen infection or in programmed cell death were identified, such as pathogenesis related-proteins, trypsin inhibitor or oxalate oxidase, and some of them showed an in silico differential expression between the resistant and the susceptible interactions. Conclusions As far as is known this is the first EST resource from the cacao–M. perniciosa interaction and it is believed that it will provide a significant contribution to the understanding of the molecular mechanisms of the resistance and susceptibility of cacao to M. perniciosa, to develop strategies to control witches broom, and as a source of polymorphism for molecular marker development and marker-assisted selection. PMID:17557832
Wang, Mengqiang; Wang, Lingling; Huang, Mengmeng; Yi, Qilin; Guo, Ying; Gai, Yunchao; Wang, Hao; Zhang, Huan; Song, Linsheng
2016-08-01
Galectins are a family of β-galactoside binding lectins that function as pattern recognition receptors (PRRs) in innate immune system of both vertebrates and invertebrates. The cDNA of Chinese mitten crab Eriocheir sinensis galectin (designated as EsGal) was cloned via rapid amplification of cDNA ends (RACE) technique based on expressed sequence tags (ESTs) analysis. The full-length cDNA of EsGal was 999 bp. Its open reading frame encoded a polypeptide of 218 amino acids containing a GLECT/Gal-bind_lectin domain and a proline/glycine rich low complexity region. The deduced amino acid sequence and domain organization of EsGal were highly similar to those of crustacean galectins. The mRNA transcripts of EsGal were found to be constitutively expressed in a wide range of tissues and mainly in hepatopancreas, gill and haemocytes. The mRNA expression level of EsGal increased rapidly and significantly after crabs were stimulated by different microbes. The recombinant EsGal (rEsGal) could bind various pathogen-associated molecular patterns (PAMPs), including lipopolysaccharide (LPS), peptidoglycan (PGN) and glucan (GLU), and exhibited strong activity to agglutinate Escherichia coli, Vibrio anguillarum, Bacillus subtilis, Micrococcus luteus, Staphylococcus aureus and Pichia pastoris, and such agglutinating activity could be inhibited by both d-galactose and α-lactose. The in vitro encapsulation assay revealed that rEsGal could enhance the encapsulation of haemocytes towards agarose beads. These results collectively suggested that EsGal played crucial roles in the immune recognition and elimination of pathogens and contributed to the innate immune response against various microbes in crabs. Copyright © 2016 Elsevier Ltd. All rights reserved.
Gerasimenko, Irina; Sheludko, Yuri; Ma, Xueyan; Stöckigt, Joachim
2002-04-01
Strictosidine glucosidase (SG) is an enzyme that catalyses the second step in the biosynthesis of various classes of monoterpenoid indole alkaloids. Based on the comparison of cDNA sequences of SG from Catharanthus roseus and raucaffricine glucosidase (RG) from Rauvolfia serpentina, primers for RT-PCR were designed and the cDNA encoding SG was cloned from R. serpentina cell suspension cultures. The active enzyme was expressed in Escherichia coli and purified to homogeneity. Analysis of its deduced amino-acid sequence assigned the SG from R. serpentina to family 1 of glycosyl hydrolases. In contrast to the SG from C. roseus, the enzyme from R. serpentina is predicted to lack an uncleavable N-terminal signal sequence, which is believed to direct proteins to the endoplasmic reticulum. The temperature and pH optimum, enzyme kinetic parameters and substrate specificity of the heterologously expressed SG were studied and compared to those of the C. roseus enzyme, revealing some differences between the two glucosidases. In vitro deglucosylation of strictosidine by R. serpentina SG proceeds by the same mechanism as has been shown for the C. roseus enzyme preparation. The reaction gives rise to the end product cathenamine and involves 4,21-dehydrocorynantheine aldehyde as an intermediate. The enzymatic hydrolysis of dolichantoside (Nbeta-methylstrictosidine) leads to several products. One of them was identified as a new compound, 3-isocorreantine A. From the data it can be concluded that the divergence of the biosynthetic pathways leading to different classes of indole alkaloids formed in R. serpentina and C. roseus cell suspension cultures occurs at a later stage than strictosidine deglucosylation.
The organisation and interviral homologies of genes at the 3' end of tobacco rattle virus RNA1
Boccara, Martine; Hamilton, William D. O.; Baulcombe, David C.
1986-01-01
The RNA1 of tobacco rattle virus (TRV) has been cloned as cDNA and the nucleotide sequence determined of 2 kb from the 3'-terminal region. The sequence contains three long open reading frames. One of these starts 5' of the cDNA and probably corresponds to the carboxy-terminal sequence of a 170-K protein encoded on RNA1. The deduced protein sequence from this reading frame shows homology with the putative replicases of tobacco mosaic virus (TMV) and tricornaviruses. The location of the second open reading frame, which encodes a 29-K polypeptide, was shown by Northern blot analysis to coincide with a 1.6-kb subgenomic RNA. The validity of this reading frame was confirmed by showing that the cDNA extending over this region could be transcribed and translated in vitro to produce a polypeptide of the predicted size which co-migrates in electrophoresis with a translation product of authentic viral RNA. The sequence of this 29-K polypeptide showed homology with two regions in the 30-K protein of TMV. This homology includes positions in the TMV 30-K protein where mutations have been identified which affect the transport of virus between cells. The third open reading frame encodes a potential 16-K protein and was shown by Northern blot hybridisation to be contained within the region of a 0.7-kb subgenomic RNA which is found in cellular RNA of infected cells but not virus particles. The many similarities between TRV and TMV in viral morphology, gene organisation and sequence suggest that these two viral groups may share a common viral ancestor. ImagesFig. 2.Fig. 3. PMID:16453668
Pu, L; Zhang, L C; Zhang, J S; Song, X; Wang, L G; Liang, J; Zhang, Y B; Liu, X; Yan, H; Zhang, T; Yue, J W; Li, N; Wu, Q Q; Wang, L X
2016-08-12
Mitogen-activated protein kinase kinase kinase 5 (MAP3K5) is essential for apoptosis, proliferation, differentiation, and immune responses, and is a candidate marker for residual feed intake (RFI) in pig. We cloned the full-length cDNA sequence of porcine MAP3K5 by rapid-amplification of cDNA ends. The 5451-bp gene contains a 5'-untranslated region (UTR) (718 bp), a coding region (3738 bp), and a 3'-UTR (995 bp), and encodes a peptide of 1245 amino acids, which shares 97, 99, 97, 93, 91, and 84% sequence identity with cattle, sheep, human, mouse, chicken, and zebrafish MAP3K5, respectively. The deduced MAP3K5 protein sequence contains two conserved domains: a DUF4071 domain and a protein kinase domain. Phylogenetic analysis showed that porcine MAP3K5 forms a separate branch to vicugna and camel MAP3K5. Tissue expression analysis using real-time quantitative polymerase chain reaction (qRT-PCR) revealed that MAP3K5 was expressed in the heart, liver, spleen, lung, kidney, muscle, fat, pancrea, ileum, and stomach tissues. Copy number variation was detected for porcine MAP3K5 and validated by qRT-PCR. Furthermore, a significant increase in average copy number was detected in the low RFI group when compared to the high RFI group in a Duroc pig population. These results provide useful information regarding the influence of MAP3K5 on RFI in pigs.
Large-scale collection of full-length cDNA and transcriptome analysis in Hevea brasiliensis.
Makita, Yuko; Ng, Kiaw Kiaw; Veera Singham, G; Kawashima, Mika; Hirakawa, Hideki; Sato, Shusei; Othman, Ahmad Sofiman; Matsui, Minami
2017-04-01
Natural rubber has unique physical properties that cannot be replaced by products from other latex-producing plants or petrochemically produced synthetic rubbers. Rubber from Hevea brasiliensis is the main commercial source for this natural rubber that has a cis-polyisoprene configuration. For sustainable production of enough rubber to meet demand elucidation of the molecular mechanisms involved in the production of latex is vital. To this end, we firstly constructed rubber full-length cDNA libraries of RRIM 600 cultivar and sequenced around 20,000 clones by the Sanger method and over 15,000 contigs by Illumina sequencer. With these data, we updated around 5,500 gene structures and newly annotated around 9,500 transcription start sites. Second, to elucidate the rubber biosynthetic pathways and their transcriptional regulation, we carried out tissue- and cultivar-specific RNA-Seq analysis. By using our recently published genome sequence, we confirmed the expression patterns of the rubber biosynthetic genes. Our data suggest that the cytoplasmic mevalonate (MVA) pathway is the main route for isoprenoid biosynthesis in latex production. In addition to the well-studied polymerization factors, we suggest that rubber elongation factor 8 (REF8) is a candidate factor in cis-polyisoprene biosynthesis. We have also identified 39 transcription factors that may be key regulators in latex production. Expression profile analysis using two additional cultivars, RRIM 901 and PB 350, via an RNA-Seq approach revealed possible expression differences between a high latex-yielding cultivar and a disease-resistant cultivar. © The Author 2017. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
Ziegenhagen, Birgit; Liepelt, Sascha
2015-01-01
Increasing drought periods as a result of global climate change pose a threat to many tree species by possibly outpacing their adaptive capabilities. Revealing the genetic basis of drought stress response is therefore implemental for future conservation strategies and risk assessment. Access to informative genomic regions is however challenging, especially for conifers, partially due to their large genomes, which puts constraints on the feasibility of whole genome scans. Candidate genes offer a valuable tool to reduce the complexity of the analysis and the amount of sequencing work and costs. For this study we combined an improved drought stress phenotyping of needles via a novel terahertz water monitoring technique with Massive Analysis of cDNA Ends to identify candidate genes for drought stress response in European silver fir (Abies alba Mill.). A pooled cDNA library was constructed from the cotyledons of six drought stressed and six well-watered silver fir seedlings, respectively. Differential expression analyses of these libraries revealed 296 candidate genes for drought stress response in silver fir (247 up- and 49 down-regulated) of which a subset was validated by RT-qPCR of the twelve individual cotyledons. A majority of these genes code for currently uncharacterized proteins and hint on new genomic resources to be explored in conifers. Furthermore, we could show that some traditional reference genes from model plant species (GAPDH and eIF4A2) are not suitable for differential analysis and we propose a new reference gene, TPC1, for drought stress expression profiling in needles of conifer seedlings. PMID:25924061
Cloning of rat MLH1 and expression analysis of MSH2, MSH3, MSH6, and MLH1 during spermatogenesis.
Geeta Vani, R; Varghese, C M; Rao, M R
1999-12-15
The mismatch repair system has been highly conserved in various species. In eukaryotic cells, the Mut S and Mut L homologues play crucial roles in both DNA mismatch repair and meiotic recombination. A full-length rat cDNA clone for rat MLH1 has been constructed using the RT-PCR method. The cDNA has an open reading frame of 2274 nucleotides for a protein of 757 amino acids. We have also obtained partial cDNA clones for MSH3 and MSH6. Northern blot analysis of rat MLH1, MSH2, MSH3, and MSH6 in the testes of rats of different ages showed differential expression of these genes as a function of developmental maturation of the testes. The expression analysis suggests that MSH3 may have a more predominant role in the meiotic recombination process. Copyright 1999 Academic Press.
Molecular cloning of cDNAs for the nerve-cell specific phosphoprotein, synapsin I.
Kilimann, M W; DeGennaro, L J
1985-01-01
To provide access to synapsin I-specific DNA sequences, we have constructed cDNA clones complementary to synapsin I mRNA isolated from rat brain. Synapsin I mRNA was specifically enriched by immunoadsorption of polysomes prepared from the brains of 10-14 day old rats. Employing this enriched mRNA, a cDNA library was constructed in pBR322 and screened by differential colony hybridization with single-stranded cDNA probes made from synapsin I mRNA and total polysomal poly(A)+ RNA. This screening procedure proved to be highly selective. Five independent recombinant plasmids which exhibited distinctly stronger hybridization with the synapsin I probe were characterized further by restriction mapping. All of the cDNA inserts gave restriction enzyme digestion patterns which could be aligned. In addition, some of the cDNA inserts were shown to contain poly(dA) sequences. Final identification of synapsin I cDNA clones relied on the ability of the cDNA inserts to hybridize specifically to synapsin I mRNA. Several plasmids were tested by positive hybridization selection. They specifically selected synapsin I mRNA which was identified by in vitro translation and immunoprecipitation of the translation products. The established cDNA clones were used for a blot-hybridization analysis of synapsin I mRNA. A fragment (1600 bases) from the longest cDNA clone hybridized with two discrete RNA species 5800 and 4500 bases long, in polyadenylated RNA from rat brain and PC12 cells. No hybridization was detected to RNA from rat liver, skeletal muscle or cardiac muscle. Images Fig. 1. Fig. 2. Fig. 4. Fig. 5. PMID:3933975
USDA-ARS?s Scientific Manuscript database
The complete genome sequence (6,423 nt) of an emerging Cucumber green mottle mosaic virus (CGMMV) isolate on cucumber in North America was determined through deep sequencing of sRNA and rapid amplification of cDNA ends. It shares 99% nucleotide sequence identity to the Asian genotype, but only 90% t...
USDA-ARS?s Scientific Manuscript database
We cloned the full length 4CL ortholog encoding 4-coumarate: coenzymeA ligase from kenaf (Hibiscus cannabiuns) using degenerate primers and RACE (rapid amplification of cDNA ends) systems. The 4CL is a key regulatory enzyme of the phenylpropanoid pathway that regulates the activation of cinnamic ac...
Bai, W L; Yin, R H; Dou, Q L; Jiang, W Q; Zhao, S J; Ma, Z J; Luo, G B; Zhao, Z H
2011-04-01
κ-Casein is one of the major proteins in the milk of mammals. It plays an important role in determining the size and specific function of milk micelles. We have previously identified and characterized a genetic variant of yak κ-casein by evaluating genomic DNA. Here, we isolate and characterize a yak κ-casein cDNA harboring the full-length open reading frame (ORF) from lactating mammary gland. Total RNA was extracted from mammary tissue of lactating female yak, and the κ-casein cDNA were synthesized by RT-PCR technique, then cloned and sequenced. The obtained cDNA of 660-bp contained an ORF sufficient to encode the entire amino acid sequence of κ-casein precursor protein consisting of 190 amino acids with a signal peptide of 21 amino acids. Yak κ-casein has a predicted molecular mass of 19,006.588 Da with a calculated isoelectric point of 7.245. Compared with the corresponding sequences in GenBank of cattle, buffalo, sheep, goat, Arabian camel, horse, and rabbit, yak κ-casein sequence had identity of 64.76-98.78% in cDNA, and identity of 44.79-98.42% and similarity of 53.65-98.42% in deduced amino acids, revealing a high homology with the other livestock species. Based on κ-casein cDNA sequences, the phylogenetic analysis indicated that yak κ-casein had a close relationship with that of cattle. This work might be useful in the genetic engineering researches for yak κ-casein.
Peng, Jinbiao; Han, Hongxiao; Hong, Yang; Wang, Yan; Guo, Fanji; Shi, Yaojun; Fu, Zhiqiang; Liu, Jinming; Cheng, Guofeng; Lin, Jiaojiao
2010-03-01
The present study was intend to clone and express the cDNA encoding Cyclophilin B (CyPB) of Schistosoma japonicum, its preliminary biological function and further immunoprotective effect against schistosome infection in mice. RT-PCR technique was applied to amplify a full-length cDNA encoding protein Cyclophilin B (Sj CyPB) from schistosomula cDNA. The expression profiles of Sj CyPB were determined by Real-time PCR using the template cDNAs isolated from 7, 13, 18, 23, 32 and 42 days parasites. The cDNA containing the Open Reading Frame of CyPB was then subcloned into a pGEX-6P-1 vector and transformed into competent Escherichia coli BL21 for expressing. The recombinant protein was renaturated, purified and its antigenicity were detected by Western blotting, and the immunoprotective effect induced by recombinant Sj CyPB was evaluated in Balb/C mice. The cDNA containing the ORF of Sj CyPB was cloned with the length of 672 base pairs, encoding 223 amino acids. Real-time PCR analysis revealed that the gene had the highest expression in 18-day schistosomula, suggesting that Sj CyPB was schistosomula differentially expressed gene. The recombinant protein showed a good antigenicity detected by Western blotting. Animal experiment indicated that the vaccination of recombinant CyPB protein in mice led to 31.5% worm and 41.01% liver egg burden reduction, respectively, compared with those of the control. A full-length cDNA differentially expressed in schistosomula was obtained. The recombinant Sj CyPB protein could induce partial protection against schistosome infection.
Yi, S Y; Hwang, B K
1998-10-31
Differential display techniques were used to isolate cDNA clones corresponding to genes which were expressed in soybean hypocotyls by Phytophthora sojae f.sp. glycines infection. With a partial cDNA clone C20CI4 from the differential display PCR as a probe, a new basic peroxidase cDNA clone, designated GMIPER1, was isolated from a cDNA library of soybean hypocotyls infected with P. sojae f.sp. glycines. Sequence analysis revealed that the peroxidase clone encodes a mature protein of 35,813 Da with a putative signal peptide of 27 amino acids in its N-terminus. The amino acid sequence of the soybean peroxidase GMIPER1 is between 54-75% identical to other plant peroxidases including a soybean seed coat peroxidase. Southern blot analysis indicated that multiple copies of sequences related to GMIPER1 exist in the soybean genome. The mRNAs corresponding to the GMIPER1 cDNA accumulated predominantly in the soybean hypocotyls infected with the incompatible race of P. sojae f.sp. glycines, but were expressed at low levels in the compatible interaction. Soybean GMIPER1 mRNAs were not expressed in hypocotyls, leaves, stems, and roots of soybean seedlings. However, treatments with ethephon, salicylic acid or methyl jasmonate induced the accumulation of the GMIPER1 mRNAs in the different organs of soybean. These results suggest that the GMIPER1 gene encoding a putative pathogen-induced peroxidase may play an important role in induced resistance of soybean to P. sojae f.sp. glycines and in response to various external stresses.
Huh, T L; Ryu, J H; Huh, J W; Sung, H C; Oh, I U; Song, B J; Veech, R L
1993-01-01
Mitochondrial NADP(+)-specific isocitrate dehydrogenase (IDP) was co-purified with the pyruvate dehydrogenase complex from bovine kidney mitochondria. The determination of its N-terminal 16-amino-acid sequence revealed that it is highly similar to the IDP from yeast. A cDNA clone (1.8 kb long) encoding this protein was isolated from a bovine kidney lambda gt11 cDNA library using a synthetic oligodeoxynucleotide. The deduced protein sequence of this cDNA clone rendered a precursor protein of 452 amino-acid residues (50,830 Da) and a mature protein of 413 amino-acid residues (46,519 Da). It is 100% identical to the internal tryptic peptide sequences of the autologous form from pig heart and 62% similar to that from yeast. However, it shares little similarity with the mitochondrial NAD(+)-specific isoenzyme from yeast. Structural analyses of the deduced proteins of IDP isoenzymes from different species indicated that similarity exists in certain regions, which may represent the common domains for the active sites or coenzyme-binding sites. In Northern-blot analysis, one species of mRNA (about 2.2 kb for both bovine and human) was hybridized with a 32P-labelled cDNA probe. Southern-blot analysis of genomic DNAs verified simple patterns of hybridization with this cDNA. These results strongly indicate that the mitochondrial IDP may be derived from a single gene family which does not appear to be closely related to that of the NAD(+)-specific isoenzyme. Images Figure 1 Figure 3 Figure 4 Figure 5 PMID:8318002
NASA Astrophysics Data System (ADS)
Chen, Zhong; Zhou, Zunchun; Yang, Aifu; Dong, Ying; Guan, Xiaoyan; Jiang, Bei; Wang, Bai
2015-12-01
The complement system plays a crucial role in the innate immune system of animals. It can be activated by distinct yet overlapping classical, alternative and lectin pathways. In the alternative pathway, complement factor B (Bf) serves as the catalytic subunit of complement component 3 (C3) convertase, which plays the central role among three activation pathways. In this study, the Bf gene in sea cucumber ( Apostichopus japonicus), termed AjBf, was obtained by rapid amplification of cDNA ends (RACE). The full-length cDNA of AjBf was 3231 bp in length barring the poly (A) tail. It contained an open reading frame (ORF) of 2742 bp encoding 913 amino acids, a 105 bp 5'-UTR (5'-terminal untranslated region) and a 384 bp 3'-UTR. AjBf was a mosaic protein with six CCP (complement control protein) domains, a VWA (von Willebrand factor A) domain, and a serine protease domain. The deduced molecular weight of AjBf protein was 101 kDa. Quantitative real time PCR (qRT-PCR) analysis indicated that the expression level of AjBf in A. japonicus was obviously higher at larval stage than that at embryonic stage. Expression detection in different tissues showed that AjBf expressed higher in coelomocytes than in other four tissues. In addation, AjBf expression in different tissues was induced significantly after LPS or PolyI:C challenge. These results indicated that AjBf plays an important role in immune responses to pathogen infection.
Miura, Toru; Kamikouchi, Azusa; Sawata, Miyuki; Takeuchi, Hideaki; Natori, Syunji; Kubo, Takeo; Matsumoto, Tadao
1999-01-01
Although “polymorphic castes” in social insects are well known as one of the most important phenomena of polyphenism, few studies of caste-specific gene expressions have been performed in social insects. To identify genes specifically expressed in the soldier caste of the Japanese damp-wood termite Hodotermopsis japonica, we employed the differential-display method using oligo(dT) and arbitrary primers, compared mRNA from the heads of mature soldiers and pseudergates (worker caste), and identified a clone (PCR product) 329 bp in length termed SOL1. Northern blot analysis showed that the SOL1 mRNA is about 1.0 kb in length and is expressed specifically in mature soldiers, but not in pseudergates, even in the presoldier induction by juvenile hormone analogue, suggesting that the product is specific for terminally differentiated soldiers. By using the method of 5′- and 3′-rapid amplification of cDNA ends, we isolated the full length of SOL1 cDNA, which contained an ORF with a putative signal peptide at the N terminus. The sequence showed no significant homology with any other known protein sequences. In situ hybridization analysis showed that SOL1 is expressed specifically in the mandibular glands. These results strongly suggest that the SOL1 gene encodes a secretory protein specifically synthesized in the mandibular glands of the soldiers. Histological observations revealed that the gland actually develops during the differentiation into the soldier caste. PMID:10570166
Asamizu, Erika; Nakamura, Yasukazu; Sato, Shusei; Tabata, Satoshi
2004-02-01
To perform a comprehensive analysis of genes expressed in a model legume, Lotus japonicus, a total of 74472 3'-end expressed sequence tags (EST) were generated from cDNA libraries produced from six different organs. Clustering of sequences was performed with an identity criterion of 95% for 50 bases, and a total of 20457 non-redundant sequences, 8503 contigs and 11954 singletons were generated. EST sequence coverage was analyzed by using the annotated L. japonicus genomic sequence and 1093 of the 1889 predicted protein-encoding genes (57.9%) were hit by the EST sequence(s). Gene content was compared to several plant species. Among the 8503 contigs, 471 were identified as sequences conserved only in leguminous species and these included several disease resistance-related genes. This suggested that in legumes, these genes may have evolved specifically to resist pathogen attack. The rate of gene sequence divergence was assessed by comparing similarity level and functional category based on the Gene Ontology (GO) annotation of Arabidopsis genes. This revealed that genes encoding ribosomal proteins, as well as those related to translation, photosynthesis, and cellular structure were more abundantly represented in the highly conserved class, and that genes encoding transcription factors and receptor protein kinases were abundantly represented in the less conserved class. To make the sequence information and the cDNA clones available to the research community, a Web database with useful services was created at http://www.kazusa.or.jp/en/plant/lotus/EST/.
Pei, Zhihua; Sun, Xiaoning; Tang, Yan; Wang, Kai; Gao, Yunhang; Ma, Hongxia
2014-10-01
Musca domestica (Diptera: Muscidae), the housefly, exhibits unique immune defences and can produce antimicrobial peptides upon stimulation with bacteria. Based on the cDNA library constructed using the suppression subtractive hybridization (SSH) method, a 198-bp antimicrobial peptide gene, which we named MDAP-2, was amplified by rapid amplification of cDNA ends (RACE) from M. domestica larvae stimulated with Salmonella pullorum (Enterobacteriaceae: Salmonella). In the present study, the full-length MDAP-2 gene was cloned and inserted into a His-tagged Escherichia coli prokaryotic expression system to enable production of the recombinant peptide. The recombinant MDAP-2 peptide was purified using Ni-NTA HisTrap FF crude column chromatography. The bacteriostatic activity of the recombinant purified MDAP-2 protein was assessed. The results indicated that MDAP-2 had in vitro antibacterial activity against all of the tested Gram- bacteria from clinical isolates, including E. coli (Enterobacteriaceae: Escherichia), one strain of S. pullorum (Enterobacteriaceae: Salmonella), and one strain of Pasteurella multocida. DNA sequencing and BLAST analysis showed that the MDAP-2 antimicrobial peptide gene was not homologous to any other antimicrobial peptide genes in GenBank. The antibacterial mechanisms of the newly discovered MDAP-2 peptide warrant further study. Copyright © 2014 Elsevier B.V. All rights reserved.
Arabidopsis chloroplast chaperonin 10 is a calmodulin-binding protein
NASA Technical Reports Server (NTRS)
Yang, T.; Poovaiah, B. W.
2000-01-01
Calcium regulates diverse cellular activities in plants through the action of calmodulin (CaM). By using (35)S-labeled CaM to screen an Arabidopsis seedling cDNA expression library, a cDNA designated as AtCh-CPN10 (Arabidopsis thaliana chloroplast chaperonin 10) was cloned. Chloroplast CPN10, a nuclear-encoded protein, is a functional homolog of E. coli GroES. It is believed that CPN60 and CPN10 are involved in the assembly of Rubisco, a key enzyme involved in the photosynthetic pathway. Northern analysis revealed that AtCh-CPN10 is highly expressed in green tissues. The recombinant AtCh-CPN10 binds to CaM in a calcium-dependent manner. Deletion mutants revealed that there is only one CaM-binding site in the last 31 amino acids of the AtCh-CPN10 at the C-terminal end. The CaM-binding region in AtCh-CPN10 has higher homology to other chloroplast CPN10s in comparison to GroES and mitochondrial CPN10s, suggesting that CaM may only bind to chloroplast CPN10s. Furthermore, the results also suggest that the calcium/CaM messenger system is involved in regulating Rubisco assembly in the chloroplast, thereby influencing photosynthesis. Copyright 2000 Academic Press.
Lamm, Ayelet T; Stadler, Michael R; Zhang, Huibin; Gent, Jonathan I; Fire, Andrew Z
2011-02-01
We have used a combination of three high-throughput RNA capture and sequencing methods to refine and augment the transcriptome map of a well-studied genetic model, Caenorhabditis elegans. The three methods include a standard (non-directional) library preparation protocol relying on cDNA priming and foldback that has been used in several previous studies for transcriptome characterization in this species, and two directional protocols, one involving direct capture of single-stranded RNA fragments and one involving circular-template PCR (CircLigase). We find that each RNA-seq approach shows specific limitations and biases, with the application of multiple methods providing a more complete map than was obtained from any single method. Of particular note in the analysis were substantial advantages of CircLigase-based and ssRNA-based capture for defining sequences and structures of the precise 5' ends (which were lost using the double-strand cDNA capture method). Of the three methods, ssRNA capture was most effective in defining sequences to the poly(A) junction. Using data sets from a spectrum of C. elegans strains and stages and the UCSC Genome Browser, we provide a series of tools, which facilitate rapid visualization and assignment of gene structures.
Gong, Mingbo; Tang, Chaoxi; Zhu, Changxiong
2014-11-01
A primary cDNA library of Penicillium oxalicum I1 was constructed using the switching mechanism at the 5' end of the RNA transcript (SMART) technique. A total of 106 clones showed halos in tricalcium phosphate (TCP) medium, and clone I-40 showed clear halos. The full-length cDNA of clone I-40 was 1355 bp with a complete open reading frame (ORF) of 1032 bp, encoding a protein of 343 amino acids. Multiple alignment analysis revealed a high degree of homology between the ORF of clone I-40 and delta-1-pyrroline-5-carboxylate dehydrogenase (P5CDH) of other fungi. The ORF expression vector was constructed and transformed into Escherichia coli DH5α. The transformant (ORF-1) with the P5CDH gene secreted organic acid in medium with TCP as the sole source of phosphate. Acetic acid and α-ketoglutarate were secreted in 4 and 24 h, respectively. ORF-1 decreased the pH of the medium from 6.62 to 3.45 and released soluble phosphate at 0.172 mg·mL(-1) in 28 h. Expression of the P. oxalicum I1 p5cdh gene in E. coli could enhance organic acid secretion and phosphate-solubilizing ability.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Geraghty, M.T.; Stetten, G.; Kearns, W.
1994-09-01
X-linked adrenoleukodystrophy (ALD) is a disorder of peroxisomal {beta}-oxidation of very long chain fatty acids. It presents either as progressive dementia in childhood or as progressive paraparesis in later years. Adrenal insufficiency occurs in both phenotypes. The gene of the ALD protein has been mapped to Xq28 and has recently been cloned and characterized. The ALD protein has significant homology to the peroxisomal membrane protein, PMP70 and belongs to the ATP binding cassette superfamily of transporters. We screened a human genomic library with an ALDP cDNA and isolated 5 different but highly similar clones containing sequences corresponding to the 3{prime}more » end of the ALDP gene. Comparison of the sequences over the region corresponding to exon 9 through the 3{prime} end of the ALDP gene reveals {approximately}96% nucleotide identity in both exonic and intronic regions. Splice sites and open reading frames are maintained. Using both FISH and human-rodent DNA mapping panels, we positively assign these ALDP-related sequences to chromosomes 2, 16 and 22, and provisionally to 1 and 20. Southern blot of primate DNA probed with a partial ALDP cDNA (exon 2-10) shows that expansion of ALDP-related sequences occurred in higher primates (chimp, gorilla and human). Although Northern blots show multiple ALDP-hybridizing transcripts in certain tissues, we have no evidence to date for expression of these ALDP-related sequences. In conclusion, our data show there has been an unusual and recent dispersal to multiple chromosomes of structural gene sequences related to the ALDP gene. The functional significance of these sequences remains to be determined but their existence complicates PCR and mutation analysis of the ALDP gene.« less
USDA-ARS?s Scientific Manuscript database
Genic microsatellites or simple sequence repeat (genic-SSR) markers were developed in boxwood (Buxus taxa) for genetic diversity analysis, identification of taxa, and to facilitate breeding. cDNA libraries were developed from mRNA extracted from leaves of Buxus sempervirens ‘Vardar Valley’ and seque...
Kajiwara, S; Kakizono, T; Saito, T; Kondo, K; Ohtani, T; Nishio, N; Nagai, S; Misawa, N
1995-10-01
We succeeded in isolating a novel cDNA involved in astaxanthin biosynthesis from the green alga Haematococcus pluvialis, by an expression cloning method using an Escherichia coli transformant as a host that synthesizes beta-carotene due to the Erwinia uredovora carotenoid biosynthesis genes. The cloned cDNA was shown to encode a novel enzyme, beta-carotene ketolase (beta-carotene oxygenase), which converted beta-carotene to canthaxanthin via echinenone, through chromatographic and spectroscopic analysis of the pigments accumulated in an E. coli transformant. This indicates that the encoded enzyme is responsible for the direct conversion of methylene to keto groups, a mechanism that usually requires two different enzymatic reactions proceeding via a hydroxy intermediate. Northern blot analysis showed that the mRNA was synthesized only in the cyst cells of H. pluvialis. E. coli carrying the H. pluvialis cDNA and the E. uredovora genes required for zeaxanthin biosynthesis was also found to synthesize astaxanthin (3S, 3'S), which was identified after purification by a variety of spectroscopic methods.
Construction of a cDNA library for miniature pig mandibular deciduous molars
2014-01-01
Background The miniature pig provides an excellent experimental model for tooth morphogenesis because its diphyodont and heterodont dentition resembles that of humans. However, little information is available on the process of tooth development or the exact molecular mechanisms controlling tooth development in miniature pigs or humans. Thus, the analysis of gene expression related to each stage of tooth development is very important. Results In our study, after serial sections were made, the development of the crown of the miniature pigs’ mandibular deciduous molar could be divided into five main phases: dental lamina stage (E33-E35), bud stage (E35-E40), cap stage (E40-E50), early bell stage (E50-E60), and late bell stage (E60-E65). Total RNA was isolated from the tooth germ of miniature pig embryos at E35, E45, E50, and E60, and a cDNA library was constructed. Then, we identified cDNA sequences on a large scale screen for cDNA profiles in the developing mandibular deciduous molars (E35, E45, E50, and E60) of miniature pigs using Illumina Solexa deep sequencing. Microarray assay was used to detect the expression of genes. Lastly, through Unigene sequence analysis and cDNA expression pattern analysis at E45 and E60, we found that 12 up-regulated and 15 down-regulated genes during the four periods are highly conserved genes homologous with known Homo sapiens genes. Furthermore, there were 6 down-regulated and 2 up-regulated genes in the miniature pig that were highly homologous to Homo sapiens genes compared with those in the mouse. Conclusion Our results not only identify the specific transcriptome and cDNA profile in developing mandibular deciduous molars of the miniature pig, but also provide useful information for investigating the molecular mechanism of tooth development in the miniature pig. PMID:24750690
DOE Office of Scientific and Technical Information (OSTI.GOV)
Clines, G.; Lovett, M.
1994-09-01
Diastrophic dysplasia (DTD) is an autosomal recessive disorder of unknown pathogenesis that is characterized by abnormal skeletal and cartilage growth. Phenotypic characteristics of the disorder include short stature, scoliosis, and deformation of the first metacarpal. The diastrophic dysplasia gene has been localized to chromosome 5q31-33, within {approximately}60 kb of the colony stimulating factor 1 receptor gene (CSF1R). We have used direct cDNA selection to build a transcription map across {approximately}250 kb surrounding and including the CSF1R locus. cDNA pools from human placenta, activated T cells, cerebellum, Hela cells, fetal brain, chondrocytes, chondrosarcomas and osteosarcomas were multiplexed in these selections. Aftermore » two rounds of selection, an analysis revealed that {approximately}70% of the selected cDNAs were contained within the contig. DNA sequencing and cosmid mapping data from a collection of 310 clones revealed the presence of three new genes in this region that show no appreciable homologies on sequence database searches, as well as cDNA clones from the CSF1R and the PDGFRB loci (another of the known genes in the region). An additional cDNA was found with 100% homology to the gene encoding human ribosomal protein L7 (RPL7). This cDNA comprised {approximately}25% of all selected clones. However, further analysis of the genomic contig revealed the presence of an RPL7 processed pseudogene in very close proximity to the CSF1R and PDGFRB genes. The selection of processed pseudogenes is one previously anticipated artifact of selection metholodolgies, but has not been previously observed. Mutational analysis of the three new genes is underway in diastrophic dysplasia families, as is derivation of full length cDNA clones and the expansion of this detailed transcription map into a larger genomic contig.« less
Cloning, sequencing and expression in MEL cells of a cDNA encoding the mouse ribosomal protein S5.
Vanegas, N; Castañeda, V; Santamaría, D; Hernández, P; Schvartzman, J B; Krimer, D B
1997-06-05
We describe the isolation and characterization of a cDNA encoding the mouse S5 ribosomal protein. It was isolated from a MEL (murine erythroleukemia) cell cDNA library by differential hybridization as a down regulated sequence during HMBA-induced differentiation. Northern series analysis showed that S5 mRNA expression is reduced 5-fold throughout the differentiation process. The mouse S5 mRNA is 760 bp long and encodes for a 204 amino acid protein with 94% homology with the human and rat S5.
Targeting a Complex Transcriptome: The Construction of the Mouse Full-Length cDNA Encyclopedia
Carninci, Piero; Waki, Kazunori; Shiraki, Toshiyuki; Konno, Hideaki; Shibata, Kazuhiro; Itoh, Masayoshi; Aizawa, Katsunori; Arakawa, Takahiro; Ishii, Yoshiyuki; Sasaki, Daisuke; Bono, Hidemasa; Kondo, Shinji; Sugahara, Yuichi; Saito, Rintaro; Osato, Naoki; Fukuda, Shiro; Sato, Kenjiro; Watahiki, Akira; Hirozane-Kishikawa, Tomoko; Nakamura, Mari; Shibata, Yuko; Yasunishi, Ayako; Kikuchi, Noriko; Yoshiki, Atsushi; Kusakabe, Moriaki; Gustincich, Stefano; Beisel, Kirk; Pavan, William; Aidinis, Vassilis; Nakagawara, Akira; Held, William A.; Iwata, Hiroo; Kono, Tomohiro; Nakauchi, Hiromitsu; Lyons, Paul; Wells, Christine; Hume, David A.; Fagiolini, Michela; Hensch, Takao K.; Brinkmeier, Michelle; Camper, Sally; Hirota, Junji; Mombaerts, Peter; Muramatsu, Masami; Okazaki, Yasushi; Kawai, Jun; Hayashizaki, Yoshihide
2003-01-01
We report the construction of the mouse full-length cDNA encyclopedia,the most extensive view of a complex transcriptome,on the basis of preparing and sequencing 246 libraries. Before cloning,cDNAs were enriched in full-length by Cap-Trapper,and in most cases,aggressively subtracted/normalized. We have produced 1,442,236 successful 3′-end sequences clustered into 171,144 groups, from which 60,770 clones were fully sequenced cDNAs annotated in the FANTOM-2 annotation. We have also produced 547,149 5′ end reads,which clustered into 124,258 groups. Altogether, these cDNAs were further grouped in 70,000 transcriptional units (TU),which represent the best coverage of a transcriptome so far. By monitoring the extent of normalization/subtraction, we define the tentative equivalent coverage (TEC),which was estimated to be equivalent to >12,000,000 ESTs derived from standard libraries. High coverage explains discrepancies between the very large numbers of clusters (and TUs) of this project,which also include non-protein-coding RNAs,and the lower gene number estimation of genome annotations. Altogether,5′-end clusters identify regions that are potential promoters for 8637 known genes and 5′-end clusters suggest the presence of almost 63,000 transcriptional starting points. An estimate of the frequency of polyadenylation signals suggests that at least half of the singletons in the EST set represent real mRNAs. Clones accounting for about half of the predicted TUs await further sequencing. The continued high-discovery rate suggests that the task of transcriptome discovery is not yet complete. PMID:12819125
Wolffe, E J; Gause, W C; Pelfrey, C M; Holland, S M; Steinberg, A D; August, J T
1990-01-05
We describe the isolation and sequencing of a cDNA encoding mouse Pgp-1. An oligonucleotide probe corresponding to the NH2-terminal sequence of the purified protein was synthesized by the polymerase chain reaction and used to screen a mouse macrophage lambda gt11 library. A cDNA clone with an insert of 1.2 kilobases was selected and sequenced. In Northern blot analysis, only cells expressing Pgp-1 contained mRNA species that hybridized with this Pgp-1 cDNA. The nucleotide sequence of the cDNA has a single open reading frame that yields a protein-coding sequence of 1076 base pairs followed by a 132-base pair 3'-untranslated sequence that includes a putative polyadenylation signal but no poly(A) tail. The translated sequence comprises a 13-amino acid signal peptide followed by a polypeptide core of 345 residues corresponding to an Mr of 37,800. Portions of the deduced amino acid sequence were identical to those obtained by amino acid sequence analysis from the purified glycoprotein, confirming that the cDNA encodes Pgp-1. The predicted structure of Pgp-1 includes an NH2-terminal extracellular domain (residues 14-265), a transmembrane domain (residues 266-286), and a cytoplasmic tail (residues 287-358). Portions of the mouse Pgp-1 sequence are highly similar to that of the human CD44 cell surface glycoprotein implicated in cell adhesion. The protein also shows sequence similarity to the proteoglycan tandem repeat sequences found in cartilage link protein and cartilage proteoglycan core protein which are thought to be involved in binding to hyaluronic acid.
Kerschner, Joseph E; Erdos, Geza; Hu, Fen Ze; Burrows, Amy; Cioffi, Joseph; Khampang, Pawjai; Dahlgren, Margaret; Hayes, Jay; Keefe, Randy; Janto, Benjamin; Post, J Christopher; Ehrlich, Garth D
2010-04-01
We sought to construct and partially characterize complementary DNA (cDNA) libraries prepared from the middle ear mucosa (MEM) of chinchillas to better understand pathogenic aspects of infection and inflammation, particularly with respect to leukotriene biogenesis and response. Chinchilla MEM was harvested from controls and after middle ear inoculation with nontypeable Haemophilus influenzae. RNA was extracted to generate cDNA libraries. Randomly selected clones were subjected to sequence analysis to characterize the libraries and to provide DNA sequence for phylogenetic analyses. Reverse transcription-polymerase chain reaction of the RNA pools was used to generate cDNA sequences corresponding to genes associated with leukotriene biosynthesis and metabolism. Sequence analysis of 921 randomly selected clones from the uninfected MEM cDNA library produced approximately 250,000 nucleotides of almost entirely novel sequence data. Searches of the GenBank database with the Basic Local Alignment Search Tool provided for identification of 515 unique genes expressed in the MEM and not previously described in chinchillas. In almost all cases, the chinchilla cDNA sequences displayed much greater homology to human or other primate genes than with rodent species. Genes associated with leukotriene metabolism were present in both normal and infected MEM. Based on both phylogenetic comparisons and gene expression similarities with humans, chinchilla MEM appears to be an excellent model for the study of middle ear inflammation and infection. The higher degree of sequence similarity between chinchillas and humans compared to chinchillas and rodents was unexpected. The cDNA libraries from normal and infected chinchilla MEM will serve as useful molecular tools in the study of otitis media and should yield important information with respect to middle ear pathogenesis.
Kerschner, Joseph E.; Erdos, Geza; Hu, Fen Ze; Burrows, Amy; Cioffi, Joseph; Khampang, Pawjai; Dahlgren, Margaret; Hayes, Jay; Keefe, Randy; Janto, Benjamin; Post, J. Christopher; Ehrlich, Garth D.
2010-01-01
Objectives We sought to construct and partially characterize complementary DNA (cDNA) libraries prepared from the middle ear mucosa (MEM) of chinchillas to better understand pathogenic aspects of infection and inflammation, particularly with respect to leukotriene biogenesis and response. Methods Chinchilla MEM was harvested from controls and after middle ear inoculation with nontypeable Haemophilus influenzae. RNA was extracted to generate cDNA libraries. Randomly selected clones were subjected to sequence analysis to characterize the libraries and to provide DNA sequence for phylogenetic analyses. Reverse transcription–polymerase chain reaction of the RNA pools was used to generate cDNA sequences corresponding to genes associated with leukotriene biosynthesis and metabolism. Results Sequence analysis of 921 randomly selected clones from the uninfected MEM cDNA library produced approximately 250,000 nucleotides of almost entirely novel sequence data. Searches of the GenBank database with the Basic Local Alignment Search Tool provided for identification of 515 unique genes expressed in the MEM and not previously described in chinchillas. In almost all cases, the chinchilla cDNA sequences displayed much greater homology to human or other primate genes than with rodent species. Genes associated with leukotriene metabolism were present in both normal and infected MEM. Conclusions Based on both phylogenetic comparisons and gene expression similarities with humans, chinchilla MEM appears to be an excellent model for the study of middle ear inflammation and infection. The higher degree of sequence similarity between chinchillas and humans compared to chinchillas and rodents was unexpected. The cDNA libraries from normal and infected chinchilla MEM will serve as useful molecular tools in the study of otitis media and should yield important information with respect to middle ear pathogenesis. PMID:20433028
Mohr, Sabine; Ghanem, Eman; Smith, Whitney; Sheeter, Dennis; Qin, Yidan; King, Olga; Polioudakis, Damon; Iyer, Vishwanath R; Hunicke-Smith, Scott; Swamy, Sajani; Kuersten, Scott; Lambowitz, Alan M
2013-07-01
Mobile group II introns encode reverse transcriptases (RTs) that function in intron mobility ("retrohoming") by a process that requires reverse transcription of a highly structured, 2-2.5-kb intron RNA with high processivity and fidelity. Although the latter properties are potentially useful for applications in cDNA synthesis and next-generation RNA sequencing (RNA-seq), group II intron RTs have been difficult to purify free of the intron RNA, and their utility as research tools has not been investigated systematically. Here, we developed general methods for the high-level expression and purification of group II intron-encoded RTs as fusion proteins with a rigidly linked, noncleavable solubility tag, and we applied them to group II intron RTs from bacterial thermophiles. We thus obtained thermostable group II intron RT fusion proteins that have higher processivity, fidelity, and thermostability than retroviral RTs, synthesize cDNAs at temperatures up to 81°C, and have significant advantages for qRT-PCR, capillary electrophoresis for RNA-structure mapping, and next-generation RNA sequencing. Further, we find that group II intron RTs differ from the retroviral enzymes in template switching with minimal base-pairing to the 3' ends of new RNA templates, making it possible to efficiently and seamlessly link adaptors containing PCR-primer binding sites to cDNA ends without an RNA ligase step. This novel template-switching activity enables facile and less biased cloning of nonpolyadenylated RNAs, such as miRNAs or protein-bound RNA fragments. Our findings demonstrate novel biochemical activities and inherent advantages of group II intron RTs for research, biotechnological, and diagnostic methods, with potentially wide applications.
Wu, Xiangwei; Tan, Jing; Cai, Mingyi; Liu, Xiande
2014-06-15
In this study, a full-length HSP70 cDNA from Paphia undulata was cloned using reverse transcriptase polymerase chain reaction (RT-PCR) coupled with rapid amplification of cDNA ends (RACE). The full-length cDNA is 2,351 bp, consisting of a 5'-untranslated region (UTR) of 83 bp, a 3'-UTR of 315 bp, and an open reading frame (ORF) of 1,953 bp. This cDNA encodes 650 amino acids with an estimated molecular weight of 71.3 kDa and an isoelectric point of 5.51. Based on the amino acid sequence analysis and phylogenetic analysis, this HSP70 gene was identified as a member of the cytoplasmic HSP70 family, being the constitutive expression, and it was designated as PuHSC70. The distribution of PuHSC70 mRNA in the mantle, digestive gland, adductor muscle, gonad, gill, heart, and hemocytes suggested that PuHSC70 is ubiquitously expressed. The mRNA levels of PuHSC70 under high temperature and high salinity stresses were analyzed by real-time PCR. Under high temperature stress of 32°C, PuHSC70 mRNA in the mantle, digestive gland, gill, and heart was significantly up-regulated at 1h and 2h, and it was then progressively down-regulated. In the adductor muscle, the level of PuHSC70 mRNA gradually increased throughout the study period; the mRNA levels in the gonad and hemocytes increased significantly at 4h and 8h (P<0.05) and then decreased at 8h and 14 h, respectively, however they increased again afterwards, reaching the highest levels at 50h. Under high salinity (32 ‰) stress, the mRNA levels of PuHSC70 in the mantle and gonad were increased significantly only at 24h and 48 h (P<0.05), and at the rest of the study period they were slightly elevated. Compared with the pretreatment level, the levels of expression in the digestive gland and gill were unchanged or reduced throughout the study period. The levels of PuHSC70 mRNA in the adductor muscle, hemocytes, and heart were significantly increased, reaching a maximum at 24h, and then they gradually decreased; moreover, in the heart, the mRNA expression recovered to the pretreatment level at 50h; while in the adductor muscle and hemocytes, the expression level remained higher than that of the control. The cloning and expression analyses of PuHSC70 provide theoretical basis to further study the mechanism of physiological response to thermal and high salinity stresses. Copyright © 2014 Elsevier B.V. All rights reserved.
Chen, Jin-Zhong; Wang, Shu; Tang, Rong; Yang, Quan-Sheng; Zhao, Enpeng; Chao, Yaoqiong; Ying, Kang; Xie, Yi; Mao, Yu-Min
2002-09-01
A cDNA was isolated from the fetal brain cDNA library by high throughput cDNA sequencing. The 2390 bp cDNA with an open reading fragment (ORF) of 816 bp encodes a 272 amino acids putative protein with a thrombospondin type I repeat (TSR) domain and a cysteine-rich region at the N-terminus, so it is named hPWTSR. We used Northern blot detected two bands with length of about 3 kb and 4 kb respectively, which expressed in human adult tissues with different intensities. The expression pattern was verified by RT-PCR, revealing that the transcripts were expressed ubiquitously in fetal tissues and human tumor tissues too. However, the transcript was detected neither in ovarian carcinoma GI-102 nor in lung carcinoma LX-1. Blast analysis against NCBI database revealed that the new gene contained at least 5 exons and located in human chromosome 6q22.33. Our results demonstrate that the gene is a novel member of TSR supergene family.
The effect of column purification on cDNA indirect labelling for microarrays
Molas, M Lia; Kiss, John Z
2007-01-01
Background The success of the microarray reproducibility is dependent upon the performance of standardized procedures. Since the introduction of microarray technology for the analysis of global gene expression, reproducibility of results among different laboratories has been a major problem. Two of the main contributors to this variability are the use of different microarray platforms and different laboratory practices. In this paper, we address the latter question in terms of how variation in one of the steps of a labelling procedure affects the cDNA product prior to microarray hybridization. Results We used a standard procedure to label cDNA for microarray hybridization and employed different types of column chromatography for cDNA purification. After purifying labelled cDNA, we used the Agilent 2100 Bioanalyzer and agarose gel electrophoresis to assess the quality of the labelled cDNA before its hybridization onto a microarray platform. There were major differences in the cDNA profile (i.e. cDNA fragment lengths and abundance) as a result of using four different columns for purification. In addition, different columns have different efficiencies to remove rRNA contamination. This study indicates that the appropriate column to use in this type of protocol has to be experimentally determined. Finally, we present new evidence establishing the importance of testing the method of purification used during an indirect labelling procedure. Our results confirm the importance of assessing the quality of the sample in the labelling procedure prior to hybridization onto a microarray platform. Conclusion Standardization of column purification systems to be used in labelling procedures will improve the reproducibility of microarray results among different laboratories. In addition, implementation of a quality control check point of the labelled samples prior to microarray hybridization will prevent hybridizing a poor quality sample to expensive micorarrays. PMID:17597522
The effect of column purification on cDNA indirect labelling for microarrays.
Molas, M Lia; Kiss, John Z
2007-06-27
The success of the microarray reproducibility is dependent upon the performance of standardized procedures. Since the introduction of microarray technology for the analysis of global gene expression, reproducibility of results among different laboratories has been a major problem. Two of the main contributors to this variability are the use of different microarray platforms and different laboratory practices. In this paper, we address the latter question in terms of how variation in one of the steps of a labelling procedure affects the cDNA product prior to microarray hybridization. We used a standard procedure to label cDNA for microarray hybridization and employed different types of column chromatography for cDNA purification. After purifying labelled cDNA, we used the Agilent 2100 Bioanalyzer and agarose gel electrophoresis to assess the quality of the labelled cDNA before its hybridization onto a microarray platform. There were major differences in the cDNA profile (i.e. cDNA fragment lengths and abundance) as a result of using four different columns for purification. In addition, different columns have different efficiencies to remove rRNA contamination. This study indicates that the appropriate column to use in this type of protocol has to be experimentally determined. Finally, we present new evidence establishing the importance of testing the method of purification used during an indirect labelling procedure. Our results confirm the importance of assessing the quality of the sample in the labelling procedure prior to hybridization onto a microarray platform. Standardization of column purification systems to be used in labelling procedures will improve the reproducibility of microarray results among different laboratories. In addition, implementation of a quality control check point of the labelled samples prior to microarray hybridization will prevent hybridizing a poor quality sample to expensive micorarrays.
Sunderasan, E; Bahari, A; Arif, S A M; Zainal, Z; Hamilton, R G; Yeang, H Y
2005-11-01
Hev b 4 is an allergenic natural rubber latex (NRL) protein complex that is reactive in skin prick tests and in vitro immunoassays. On SDS-polyacrylamide gel electrophoresis (SDS-PAGE), Hev b 4 is discerned predominantly at 53-55 kDa together with a 57 kDa minor component previously identified as a cyanogenic glucosidase. Of the 13 NRL allergens recognized by the International Union of Immunological Societies, the 53-55 kDa Hev b 4 major protein is the only candidate that lacks complete cDNA and protein sequence information. We sought to clone the transcript encoding the Hev b 4 major protein, and characterize the native protein and its recombinant form in relation to IgE binding. The 5'/3' rapid amplification of cDNA ends method was employed to obtain the complete cDNA of the Hev b 4 major protein. A recombinant form of the protein was over-expressed in Escherichia coli. The native Hev b 4 major protein was deglycosylated by trifluoromethane sulphonic acid. Western immunoblots of the native, deglycosylated and recombinant proteins were performed using both polyclonal antibodies and sera from latex-allergic patients. The cDNA encoding the Hev b 4 major protein was cloned. Its open reading frame matched lecithinases in the conserved domain database and contained 10 predicted glycosylation sites. Detection of glycans on the Hev b 4 lecithinase homologue confirmed it to be a glycoprotein. The deglycosylated lecithinase homologue was discerned at 40 kDa on SDS-PAGE, this being comparable to the 38.53 kDa mass predicted by its cDNA. Deglycosylation of the lecithinase homologue resulted in the loss of IgE recognition, although reactivity to polyclonal rabbit anti-Hev b 4 was retained. IgE from latex-allergic patients also failed to recognize the non-glycosylated E. coli recombinant lecithinase homologue. The IgE epitopes of the Hev b 4 lecithinase homologue reside mainly in its carbohydrate moiety, which also account for the discrepancy between the observed molecular weight of the protein and the value calculated from its cDNA.
Hop stunt viroid: molecular cloning and nucleotide sequence of the complete cDNA copy.
Ohno, T; Takamatsu, N; Meshi, T; Okada, Y
1983-01-01
The complete cDNA of hop stunt viroid (HSV) has been cloned by the method of Okayama and Berg (Mol.Cell.Biol.2,161-170. (1982] and the complete nucleotide sequence has been established. The covalently closed circular single-stranded HSV RNA consists of 297 nucleotides. The secondary structure predicted for HSV contains 67% of its residues base-paired. The native HSV can possess an extended rod-like structure characteristic of viroids previously established. The central region of the native HSV has a similar structure to the conserved region found in all viroids sequenced so far except for avocado sunblotch viroid. The sequence homologous to the 5'-end of U1a RNA is also found in the sequence of HSV but not in the central conserved region. Images PMID:6312412
Rapid amplification of 5' complementary DNA ends (5' RACE).
2005-08-01
This method is used to extend partial cDNA clones by amplifying the 5' sequences of the corresponding mRNAs 1-3. The technique requires knowledge of only a small region of sequence within the partial cDNA clone. During PCR, the thermostable DNA polymerase is directed to the appropriate target RNA by a single primer derived from the region of known sequence; the second primer required for PCR is complementary to a general feature of the target-in the case of 5' RACE, to a homopolymeric tail added (via terminal transferase) to the 3' termini of cDNAs transcribed from a preparation of mRNA. This synthetic tail provides a primer-binding site upstream of the unknown 5' sequence of the target mRNA. The products of the amplification reaction are cloned into a plasmid vector for sequencing and subsequent manipulation.
NASA Astrophysics Data System (ADS)
Sun, S. M.; Slightom, J. L.; Hall, T. C.
1981-01-01
A plant gene coding for the major storage protein (phaseolin, G1-globulin) of the French bean was isolated from a genomic library constructed in the phage vector Charon 24A. Comparison of the nucleotide sequence of part of the gene with that of the cloned messenger RNA (cDNA) revealed the presence of three intervening sequences, all beginning with GTand ending with AG. The 5' and 3' boundaries of intervening sequences TVS-A (88 base pairs) and IVS-B (124 base pairs) are similar to those described for animal and viral genes, but the 3' boundary of IVS-C (129 base pairs) shows some differences. A sequence of 185 amino acids deduced from the cloned DMAs represents about 40% of a phaseolin polypeptide.
Escaping introns in COI through cDNA barcoding of mushrooms: Pleurotus as a test case.
Avin, Farhat A; Subha, Bhassu; Tan, Yee-Shin; Braukmann, Thomas W A; Vikineswary, Sabaratnam; Hebert, Paul D N
2017-09-01
DNA barcoding involves the use of one or more short, standardized DNA fragments for the rapid identification of species. A 648-bp segment near the 5' terminus of the mitochondrial cytochrome c oxidase subunit I (COI) gene has been adopted as the universal DNA barcode for members of the animal kingdom, but its utility in mushrooms is complicated by the frequent occurrence of large introns. As a consequence, ITS has been adopted as the standard DNA barcode marker for mushrooms despite several shortcomings. This study employed newly designed primers coupled with cDNA analysis to examine COI sequence diversity in six species of Pleurotus and compared these results with those for ITS. The ability of the COI gene to discriminate six species of Pleurotus , the commonly cultivated oyster mushroom, was examined by analysis of cDNA. The amplification success, sequence variation within and among species, and the ability to design effective primers was tested. We compared ITS sequences to their COI cDNA counterparts for all isolates. ITS discriminated between all six species, but some sequence results were uninterpretable, because of length variation among ITS copies. By comparison, a complete COI sequences were recovered from all but three individuals of Pleurotus giganteus where only the 5' region was obtained. The COI sequences permitted the resolution of all species when partial data was excluded for P. giganteus . Our results suggest that COI can be a useful barcode marker for mushrooms when cDNA analysis is adopted, permitting identifications in cases where ITS cannot be recovered or where it offers higher resolution when fresh tissue is. The suitability of this approach remains to be confirmed for other mushrooms.
Cadet, Patrick; Mantione, Kirk J; Stefano, George B
2003-05-15
Studies from our laboratory have revealed a novel mu opiate receptor, mu 3, which is expressed in both vascular tissues and leukocytes. The mu 3 receptor is selective for opiate alkaloids and is insensitive to opioid peptides. We now identify the mu 3 receptor at the molecular level using a 441-bp conserved region of the mu 1 receptor. Sequence analysis of the isolated cDNA suggests that it is a novel, alternatively spliced variant of the mu opiate receptor gene. To determine whether protein expressed from this cDNA exhibits the biochemical characteristics expected of the mu 3 receptor, the cDNA clone was expressed in a heterologous system. At the functional level, COS-1 cells transfected with the mu 3 receptor cDNA exhibited dose-dependent release of NO following treatment with morphine, but not opioid peptides (i.e., Met-enkephalin). Naloxone was able to block the effect of morphine on COS-1 transfected cells. Nontransfected COS-1 cells did not produce NO in the presence of morphine or the opioid peptides at similar concentrations. Receptor binding analysis with [(3)H]dihydromorphine further supports the opiate alkaloid selectivity and opioid peptide insensitivity of this receptor. These data suggest that this new mu opiate receptor cDNA encodes the mu 3 opiate receptor, since it exhibits biochemical characteristics known to be unique to this receptor (opiate alkaloid selective and opioid peptide insensitive). Furthermore, using Northern blot, RT-PCR, and sequence analysis, we have demonstrated the expression of this new mu variant in human vascular tissue, mononuclear cells, polymorphonuclear cells, and human neuroblastoma cells.
Yang, Zhifan; Chen, Jun; Chen, Yongqin; Jiang, Sijing
2010-01-01
A full cDNA encoding an acetylcholinesterase (AChE, EC 3.1.1.7) was cloned and characterized from the brown planthopper, Nilaparvata lugens Stål (Hemiptera: Delphacidae). The complete cDNA (2467 bp) contains a 1938-bp open reading frame encoding 646 amino acid residues. The amino acid sequence of the AChE deduced from the cDNA consists of 30 residues for a putative signal peptide and 616 residues for the mature protein with a predicted molecular weight of 69,418. The three residues (Ser242, Glu371, and His485) that putatively form the catalytic triad and the six Cys that form intra-subunit disulfide bonds are completely conserved, and 10 out of the 14 aromatic residues lining the active site gorge of the AChE are also conserved. Northern blot analysis of poly(A)+ RNA showed an approximately 2.6-kb transcript, and Southern blot analysis revealed there likely was just a single copy of this gene in N. lugens. The deduced protein sequence is most similar to AChE of Nephotettix cincticeps with 83% amino acid identity. Phylogenetic analysis constructed with 45 AChEs from 30 species showed that the deduced N. lugens AChE formed a cluster with the other 8 insect AChE2s. Additionally, the hypervariable region and amino acids specific to insect AChE2 also existed in the AChE of N. lugens. The results revealed that the AChE cDNA cloned in this work belongs to insect AChE2 subgroup, which is orthologous to Drosophila AChE. Comparison of the AChEs between the susceptible and resistant strains revealed a point mutation, Gly185Ser, is likely responsible for the insensitivity of the AChE to methamidopho in the resistant strain.
Identification of drought-responsive genes in roots of upland rice (Oryza sativa L)
Rabello, Aline R; Guimarães, Cléber M; Rangel, Paulo HN; da Silva, Felipe R; Seixas, Daniela; de Souza, Emanuel; Brasileiro, Ana CM; Spehar, Carlos R; Ferreira, Márcio E; Mehta, Ângela
2008-01-01
Background Rice (Oryza sativa L.) germplasm represents an extraordinary source of genes that control traits of agronomic importance such as drought tolerance. This diversity is the basis for the development of new cultivars better adapted to water restriction conditions, in particular for upland rice, which is grown under rainfall. The analyses of subtractive cDNA libraries and differential protein expression of drought tolerant and susceptible genotypes can contribute to the understanding of the genetic control of water use efficiency in rice. Results Two subtractive libraries were constructed using cDNA of drought susceptible and tolerant genotypes submitted to stress against cDNA of well-watered plants. In silico analysis revealed 463 reads, which were grouped into 282 clusters. Several genes expressed exclusively in the tolerant or susceptible genotypes were identified. Additionally, proteome analysis of roots from stressed plants was performed and 22 proteins putatively associated to drought tolerance were identified by mass spectrometry. Conclusion Several genes and proteins involved in drought-response, as well as genes with no described homologs were identified. Genes exclusively expressed in the tolerant genotype were, in general, related to maintenance of turgor and cell integrity. In contrast, in the susceptible genotype, expression of genes involved in protection against cell damage was not detected. Several protein families identified in the proteomic analysis were not detected in the cDNA analysis. There is an indication that the mechanisms of susceptibility to drought in upland rice are similar to those of lowland varieties. PMID:18922162
Loudig, Olivier; Wang, Tao; Ye, Kenny; Lin, Juan; Wang, Yihong; Ramnauth, Andrew; Liu, Christina; Stark, Azadeh; Chitale, Dhananjay; Greenlee, Robert; Multerer, Deborah; Honda, Stacey; Daida, Yihe; Spencer Feigelson, Heather; Glass, Andrew; Couch, Fergus J.; Rohan, Thomas; Ben-Dov, Iddo Z.
2017-01-01
Formalin-fixed paraffin-embedded (FFPE) specimens, when used in conjunction with patient clinical data history, represent an invaluable resource for molecular studies of cancer. Even though nucleic acids extracted from archived FFPE tissues are degraded, their molecular analysis has become possible. In this study, we optimized a laboratory-based next-generation sequencing barcoded cDNA library preparation protocol for analysis of small RNAs recovered from archived FFPE tissues. Using matched fresh and FFPE specimens, we evaluated the robustness and reproducibility of our optimized approach, as well as its applicability to archived clinical specimens stored for up to 35 years. We then evaluated this cDNA library preparation protocol by performing a miRNA expression analysis of archived breast ductal carcinoma in situ (DCIS) specimens, selected for their relation to the risk of subsequent breast cancer development and obtained from six different institutions. Our analyses identified six miRNAs (miR-29a, miR-221, miR-375, miR-184, miR-363, miR-455-5p) differentially expressed between DCIS lesions from women who subsequently developed an invasive breast cancer (cases) and women who did not develop invasive breast cancer within the same time interval (control). Our thorough evaluation and application of this laboratory-based miRNA sequencing analysis indicates that the preparation of small RNA cDNA libraries can reliably be performed on older, archived, clinically-classified specimens. PMID:28335433
Saito, T; Ochiai, H
1999-10-01
cDNA fragments putatively encoding amino acid sequences characteristic of the fatty acid desaturase were obtained using expressed sequence tag (EST) information of the Dictyostelium cDNA project. Using this sequence, we have determined the cDNA sequence and genomic sequence of a desaturase. The cloned cDNA is 1489 nucleotides long and the deduced amino acid sequence comprised 464 amino acid residues containing an N-terminal cytochrome b5 domain. The whole sequence was 38.6% identical to the initially identified Delta5-desaturase of Mortierella alpina. We have confirmed its function as Delta5-desaturase by over expression mutation in D. discoideum and also the gain of function mutation in the yeast Saccharomyces cerevisiae. Analysis of the lipids from transformed D. discoideum and yeast demonstrated the accumulation of Delta5-desaturated products. This is the first report concering fatty acid desaturase in cellular slime molds.
Lu, W; Wainwright, G; Olohan, L A; Webster, S G; Rees, H H; Turner, P C
2001-10-31
Synthesis of ecdysteroids (molting hormones) by crustacean Y-organs is regulated by a neuropeptide, molt-inhibiting hormone (MIH), produced in eyestalk neural ganglia. We report here the molecular cloning of a cDNA encoding MIH of the edible crab, Cancer pagurus. Full-length MIH cDNA was obtained by using reverse transcription-polymerase chain reaction (RT-PCR) with degenerate oligonucleotides based upon the amino acid sequence of MIH, in conjunction with 5'- and 3'-RACE. Full-length clones of MIH cDNA were obtained that encoded a 35 amino acid putative signal peptide and the mature 78 amino acid peptide. Of various tissues examined by Northern blot analysis, the X-organ was the sole major site of expression of the MIH gene. However, a nested-PCR approach using non-degenerate MIH-specific primers indicated the presence of MIH transcripts in other tissues. Southern blot analysis indicated a simple gene arrangement with at least two copies of the MIH gene in the genome of C. pagurus. Additional Southern blotting experiments detected MIH-hybridizing bands in another Cancer species, Cancer antennarius and another crab species, Carcinus maenas.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Claffey, K.P.; Herrera, V.L.; Brecher, P.
1987-12-01
A fatty acid binding protein (FABP) as been identified and characterized in rat heart, but the function and regulation of this protein are unclear. In this study the cDNA for rat heart FABP was cloned from a lambda gt11 library. Sequencing of the cDNA showed an open reading frame coding for a protein with 133 amino acids and a calculated size of 14,776 daltons. Several differences were found between the sequence determined from the cDNA and that reported previously by protein sequencing techniques. Northern blot analysis using rat heart FABP cDNA as a probe established the presence of an abundantmore » mRNA in rat heart about 0.85 kilobases in length. This mRNA was detected, but was not abundant, in fetal heart tissue. Tissue distribution studies showed a similar mRNA species in red, but not white, skeletal muscle. In general, the mRNA tissue distribution was similar to that of the protein detected by Western immunoblot analysis, suggesting that heart FABP expression may be regulated at the transcriptional level. S1 nuclease mapping studies confirmed that the mRNA hybridized to rat heart FABP cDNA was identical in heart and red skeletal muscle throughout the entire open reading frame. The structural differences between heart FABP and other members of this multigene family may be related to the functional requirements of oxidative muscle for fatty acids as a fuel source.« less
Marques, M Carmen; Alonso-Cantabrana, Hugo; Forment, Javier; Arribas, Raquel; Alamar, Santiago; Conejero, Vicente; Perez-Amador, Miguel A
2009-01-01
Background Interpretation of ever-increasing raw sequence information generated by modern genome sequencing technologies faces multiple challenges, such as gene function analysis and genome annotation. Indeed, nearly 40% of genes in plants encode proteins of unknown function. Functional characterization of these genes is one of the main challenges in modern biology. In this regard, the availability of full-length cDNA clones may fill in the gap created between sequence information and biological knowledge. Full-length cDNA clones facilitate functional analysis of the corresponding genes enabling manipulation of their expression in heterologous systems and the generation of a variety of tagged versions of the native protein. In addition, the development of full-length cDNA sequences has the power to improve the quality of genome annotation. Results We developed an integrated method to generate a new normalized EST collection enriched in full-length and rare transcripts of different citrus species from multiple tissues and developmental stages. We constructed a total of 15 cDNA libraries, from which we isolated 10,898 high-quality ESTs representing 6142 different genes. Percentages of redundancy and proportion of full-length clones range from 8 to 33, and 67 to 85, respectively, indicating good efficiency of the approach employed. The new EST collection adds 2113 new citrus ESTs, representing 1831 unigenes, to the collection of citrus genes available in the public databases. To facilitate functional analysis, cDNAs were introduced in a Gateway-based cloning vector for high-throughput functional analysis of genes in planta. Herein, we describe the technical methods used in the library construction, sequence analysis of clones and the overexpression of CitrSEP, a citrus homolog to the Arabidopsis SEP3 gene, in Arabidopsis as an example of a practical application of the engineered Gateway vector for functional analysis. Conclusion The new EST collection denotes an important step towards the identification of all genes in the citrus genome. Furthermore, public availability of the cDNA clones generated in this study, and not only their sequence, enables testing of the biological function of the genes represented in the collection. Expression of the citrus SEP3 homologue, CitrSEP, in Arabidopsis results in early flowering, along with other phenotypes resembling the over-expression of the Arabidopsis SEPALLATA genes. Our findings suggest that the members of the SEP gene family play similar roles in these quite distant plant species. PMID:19747386
Deng, Yunyan; Yao, Jianting; Fu, Gang; Guo, Hui; Duan, Delin
2014-04-01
Photosynthetic stramenopile have chloroplasts of secondary endosymbiotic origin and are significant as aquatic primary productivity and biomass production. In marine environments, many photosynthetic stramenopiles utilize blue light to regulate growth, development, and organelle movement. Aureochrome (AUREO) is a new type blue light photoreceptor specific in photosynthetic stramenopiles. Previously, several AUREO orthologs were reported in genomes of stramenopile members, but the full-length cDNA sequences were completed only in Vaucheria frigida (Xanthophyceae), Fucus distichus (Phaeophyceae), and Ochromonas danica (Chrysophyceae). In this study, the full-length cDNA of AUREO from Saccharina japonica (designated as SjAUREO) was isolated based on homologous cloning and the rapid amplification of cDNA ends (RACE). It characterized by the full length of 1,013 bp with an open reading frame of 612 bp, which encoded a polypeptide of 203 amino acids with predicted molecular weight of 23.08 kDa and theoretical isoelectric point of 7.63. The deduced amino acid sequence of SjAUREO contained one N-terminal basic region/leucine zipper (bZIP) transcription regulation domain and a single light-, oxygen-, or voltage-sensitive (LOV) domain near the C-terminus. Homologous analysis showed that SjAUREO shared 40-92 % similarities with those of other photosynthetic stramenopiles. Phylogenetic analysis revealed close phylogenetic affinity between SjAUREO and AUREO4 of brown alga Ectocarpus siliculosus. Real-time PCR detection revealed that the SjAUREO transcription was markedly increased under BL exposure and dramatically upregulated in the 1-month juvenile sporophyte than those in the 2 and 3-month materials, which indirectly reflected the SjAUREO associated with the BL-mediated photomorphogenesis during the growth and early development of juvenile sporophytes. In vitro expression showed one distinct band existed at ∼27 kDa, and western blot detection proved that it was positive to the anti-His antibody with high specificity. Our results enriched the knowledge of AUREO properties in S. japonica and provided clues to explore the mechanisms underlying diverse physiological responses mediated by BL photoreceptors AUREO in the photosynthetic stramenopiles.
1985-01-01
Previous studies (21) have shown that two mouse kappa light (L) chain variable (V) region polymorphisms, the IB-peptide and Efla markers, reflect expression of a characteristic group of V kappa regions, called V kappa Ser, by some inbred strains and not others. Expression of V kappa Ser is controlled by a locus on chromosome 6, the chromosome that contains the kappa locus. To further characterize this V kappa group and begin to analyze the basis for its strain-specific expression, full- length complementary DNA (cDNA) copies were produced of L chain mRNA from the M75 myeloma that had been induced in the C.C58 strain of mice, and which produces a V kappa Ser L chain. The C.C58 strain is congenic with BALB/cAn, differing in the region of chromosome 6 that controls expression of the V kappa polymorphisms and the Lyt-2 and Lyt-3 T cell alloantigens. The complete nucleotide sequence of this cloned cDNA was determined and compared with the nucleotide sequences the most closely related BALB/c myeloma L chains known. Results indicated significant differences throughout the variable region, but particularly toward the 5' portion of the sequence. A probe corresponding to 200 bp of the 5' end of the cloned V kappa Ser cDNA was used in Southern hybridizations of restriction digests of liver DNA from a number of inbred, recombinant, and recombinant inbred strains. Under stringent hybridization conditions, one strongly-hybridizing fragment was observed in Bam HI, Hind III, and Eco RI digests, and based on the size of the fragments, strains could be organized into two groups. The presence of strongly hybridizing Bam HI, Hind III, and Eco RI fragments of 3.2, 2.8, and 2.1 kb, respectively, was found to correlate completely with expression by the strain of the IB-peptide and Efla markers. All nonexpressor strains yielded hybridizing fragments of 7.8, 8.4, and 2.8 kb, respectively. Possible explanations for strain- specific expression of V kappa Ser-associated phenotypic markers are discussed. PMID:3926938
Xu, Min-jie; Zhang, Cong; Yang, Zhigang
2018-01-01
Dopamine (DA) plays a modulatory role in numerous physiological processes such as light adaptation and food intake, and exerts these functions through DA receptors (DARs). This study presents, for the first time, isolation and characterization of the dopamine receptor 2(DA2 receptor) cDNA from the intestinal tissue of Eriocheir sinensis, an economically important freshwater aquaculture species in China. The DA2 receptor cDNA sequence, which was obtained by rapid amplification of cDNA ends, is 2369bp long, encode peptide of 589 amino acid, and is highly homologous to related sequences in crustaceans. Analysis of the deduced amino acid sequence and the structure of the DA2 indicated that this receptor is a member of the family of G protein-coupled receptors (GPCRs), as it contains seven transmembrane domains and other common signatures of GPCRs. RT-PCR showed that the expression of the DA2 receptor gene was distributed in various tissues, and high expression levels were observed in the cranial ganglia and the thoracic ganglia. Further study of the effect of photoperiod on DA2 expression showed that constant darkness induced a significant increase in DA2 expression in the cranial ganglia. Finally, analysis of DA2 receptor expression under different feeding statuses showed that there was significantly greater expression in the hepatopancreas and intestines after feeding than before feeding, but there were no differences in expression between the before feeding and during feeding periods in either tissue. Our results indicate that the DA2 receptor structurally belongs to the family of G protein-coupled receptors, and that the cranial ganglia are the main tissues in which the DA2 receptor participates in light adaptation during dark hours. In addition, the DA2 receptor in E. sinensis may be involved in the physiological regulation of the hepatopancreas and digestive tract after the ingestion of food. This study provides a foundation for further exploration of the light adaptation and digestive functions of the DA2 receptor in decapods. PMID:29554147
Yu, Haining; Gao, Jiuxiang; Lu, Yiling; Guang, Huijuan; Cai, Shasha; Zhang, Songyan; Wang, Yipeng
2013-11-01
Lysozymes are key proteins that play important roles in innate immune defense in many animal phyla by breaking down the bacterial cell-walls. In this study, we report the molecular cloning, sequence analysis and phylogeny of the first caudate amphibian g-lysozyme: a full-length spleen cDNA library from axolotl (Ambystoma mexicanum). A goose-type (g-lysozyme) EST was identified and the full-length cDNA was obtained using RACE-PCR. The axolotl g-lysozyme sequence represents an open reading frame for a putative signal peptide and the mature protein composed of 184 amino acids. The calculated molecular mass and the theoretical isoelectric point (pl) of this mature protein are 21523.0 Da and 4.37, respectively. Expression of g-lysozyme mRNA is predominantly found in skin, with lower levels in spleen, liver, muscle, and lung. Phylogenetic analysis revealed that caudate amphibian g-lysozyme had distinct evolution pattern for being juxtaposed with not only anura amphibian, but also with the fish, bird and mammal. Although the first complete cDNA sequence for caudate amphibian g-lysozyme is reported in the present study, clones encoding axolotl's other functional immune molecules in the full-length cDNA library will have to be further sequenced to gain insight into the fundamental aspects of antibacterial mechanisms in caudate.
Liu, Hong-tao; Wang, Jun; Mao, Yong; Liu, Min; Niu, Su-fang; Qiao, Ying; Su, Yong-quan; Wang, Chun-zhong; Zheng, Zhi-peng
2015-12-01
Antimicrobial peptides (AMPs) are important components of the innate immune system and function as the first line of defense against invading pathogens. In current study we identified, cloned and characterized a novel stylicin AMP from Kuruma shrimp Marsupenaeus japonicus (Mj-sty). The full-length cDNA of Mj-sty was 428 bp with an open reading frame of 315 bp that encoded 104 amino acids. The theoretical molecular mass of mature Mj-sty was 8.693 kDa with an isoelectric point (pI) of 4.79. A proline-rich N-terminal region and a C-terminal region contained 13 cysteine residues were identified. Genomic sequence analysis with respect to its cDNA showed that Mj-sty was organized into two exons interrupted by one intron. Tissue-specific expression revealed that Mj-sty was mainly transcribed in gills and hemocytes. Expression of Mj-sty in early developmental stages demonstrated that Mj-sty mRNA were present from fertilized eggs to post-larvae of 17 days (PL17), and the expression levels showed a significant variation in different developmental stages. After challenge of white spot syndrome virus (WSSV), the time-dependent expression pattern of Mj-sty in both gills and hepatopancrease showed down-regulation at the early hours of infection, subsequently up-regulation and down-regulation, and then up-regulation at the end hours to almost the half of the controls. The results indicate that Mj-sty is potentially involved in the ontogenesis and immune responses against WSSV. Copyright © 2015 Elsevier Ltd. All rights reserved.
Xia, Xiaohua; Zhao, Jie; Du, Qiyan; Chang, Zhongjie
2010-08-01
The Sox9 gene attracts a lot of attention because of its connection with gonadal development and differentiation. However, Sox8, belonging to the same subgroup SoxE, has rarely been studied. To investigate the function as well as the evolutionary origin of SOXE subgroup, we amplified the genomic DNA of Paramisgurnus dabryanu using a pair of degenerate primers. Using rapid amplification of the cDNA ends (RACE), it was discovered that P. dabryanu has two duplicates: Sox8a and Sox8b. Each has an intron of different length in the conserved HMG-box region. The overall sequence similarity of the deduced amino acid of PdSox8a and PdSox8b was 46.26%, and only two amino acids changed in the HMG-box. This is the first evidence showing that there are two distinct duplications of Sox8 genes in Cypriniformes. Southern blot analysis showed only one hybrid band, with lengths 7.4 or 9.2 kb. Both semi-quantitative RT-PCR and real-time quantitative PCR assay displayed that both PdSox8a and PdSox8b are downregulated during early embryonic development. In adult tissues, the two Sox8 genes expressed ubiquitously, and expression levels are particularly high in the gonads and brain. In gonads, both PdSox8a and PdSox8b are expressed at a higher level in the tesis than in the ovary. PdSox8a and PdSox8b may have functional overlaps and are essential for the neuronal development and differentiation of gonads.
Goetz, Frederick W; Norberg, Birgitta; McCauley, Linda A R; Iliev, Dimitar B
2004-03-01
The full-length cDNA for the cod (Gadus morhua) StAR was cloned by RT-PCR and library screening using ovarian RNA. From the library screening, 2 size classes of cDNA were obtained; a 1577 bp cDNA (cStAR1) and a 2851 bp cDNA (cStAR2). The cStAR1 cDNA presumably encodes a protein of 286 amino acids. The cStAR2 cDNA was composed of 6 separated sequences that contained all of the coding regions of cStAR1 when added together, but also contained 5 noncoding regions not observed in cStAR1. Polymerase chain reactions of cod genomic DNA produced products slightly larger than cStAR2. The sequence of these products were the same as cStAR2 but revealed one additional noncoding region (intron). Thus, the fish StAR gene contains the same number of exons (7) and introns (6) as observed in mammals, but is approximately half the size of the mammalian gene. Using Northern analysis and RT-PCR, cStAR1 expression was observed only in testes, ovaries and head kidneys. Polymerase chain reaction products were also observed using cDNA from steroidogenic tissues and primers designed to regions specific for cStAR2, indicating that cStAR2 is expressed in tissues and may account for the presence of larger transcripts observed on Northern blots.
Cheng, Xiao-Rui; Zhou, Wen-Xia; Zhang, Yong-Xiang
2006-05-01
Alzheimer' s disease (AD) is the most common form of dementia in the elderly. AD is an invariably fatal neurodegenerative disorder with no effective treatment. Senescence-accelerated mouse prone 8 (SAMP8) is a model for studying age-related cognitive impairments and also is a good model to study brain aging and one of mouse model of AD. The technique of cDNA microarray can monitor the expression levels of thousands of genes simultaneously and can be used to study AD with the character of multi-mechanism, multi-targets and multi-pathway. In order to disclose the mechanism of AD and find the drug targets of AD, cDNA microarray containing 3136 cDNAs amplified from the suppression subtracted cDNA library of hippocampus of SAMP8 and SAMR1 was prepared with 16 blocks and 14 x 14 pins, the housekeeping gene beta-actin and G3PDH as inner conference. The background of this microarray was low and unanimous, and dots divided evenly. The conditions of hybridization and washing were optimized during the hybridization of probe and target molecule. After the data of hybridization analysis, the differential expressed cDNAs were sequenced and analyzed by the bioinformatics, and some of genes were quantified by the real time RT-PCR and the reliability of this cDNA microarray were validated. This cDNA microarray may be the good means to select the differential expressed genes and disclose the molecular mechanism of SAMP8's brain aging and AD.
Takamitsu, Emi; Otsuka, Motoaki; Haebara, Tatsuki; Yano, Manami; Matsuzaki, Kanako; Kobuchi, Hirotsugu; Moriya, Koko; Utsumi, Toshihiko
2015-01-01
To identify physiologically important human N-myristoylated proteins, 90 cDNA clones predicted to encode human N-myristoylated proteins were selected from a human cDNA resource (4,369 Kazusa ORFeome project human cDNA clones) by two bioinformatic N-myristoylation prediction systems, NMT-The MYR Predictor and Myristoylator. After database searches to exclude known human N-myristoylated proteins, 37 cDNA clones were selected as potential human N-myristoylated proteins. The susceptibility of these cDNA clones to protein N-myristoylation was first evaluated using fusion proteins in which the N-terminal ten amino acid residues were fused to an epitope-tagged model protein. Then, protein N-myristoylation of the gene products of full-length cDNAs was evaluated by metabolic labeling experiments both in an insect cell-free protein synthesis system and in transfected human cells. As a result, the products of 13 cDNA clones (FBXL7, PPM1B, SAMM50, PLEKHN, AIFM3, C22orf42, STK32A, FAM131C, DRICH1, MCC1, HID1, P2RX5, STK32B) were found to be human N-myristoylated proteins. Analysis of the role of protein N-myristoylation on the intracellular localization of SAMM50, a mitochondrial outer membrane protein, revealed that protein N-myristoylation was required for proper targeting of SAMM50 to mitochondria. Thus, the strategy used in this study is useful for the identification of physiologically important human N-myristoylated proteins from human cDNA resources.
Takamitsu, Emi; Otsuka, Motoaki; Haebara, Tatsuki; Yano, Manami; Matsuzaki, Kanako; Kobuchi, Hirotsugu; Moriya, Koko; Utsumi, Toshihiko
2015-01-01
To identify physiologically important human N-myristoylated proteins, 90 cDNA clones predicted to encode human N-myristoylated proteins were selected from a human cDNA resource (4,369 Kazusa ORFeome project human cDNA clones) by two bioinformatic N-myristoylation prediction systems, NMT-The MYR Predictor and Myristoylator. After database searches to exclude known human N-myristoylated proteins, 37 cDNA clones were selected as potential human N-myristoylated proteins. The susceptibility of these cDNA clones to protein N-myristoylation was first evaluated using fusion proteins in which the N-terminal ten amino acid residues were fused to an epitope-tagged model protein. Then, protein N-myristoylation of the gene products of full-length cDNAs was evaluated by metabolic labeling experiments both in an insect cell-free protein synthesis system and in transfected human cells. As a result, the products of 13 cDNA clones (FBXL7, PPM1B, SAMM50, PLEKHN, AIFM3, C22orf42, STK32A, FAM131C, DRICH1, MCC1, HID1, P2RX5, STK32B) were found to be human N-myristoylated proteins. Analysis of the role of protein N-myristoylation on the intracellular localization of SAMM50, a mitochondrial outer membrane protein, revealed that protein N-myristoylation was required for proper targeting of SAMM50 to mitochondria. Thus, the strategy used in this study is useful for the identification of physiologically important human N-myristoylated proteins from human cDNA resources. PMID:26308446
USDA-ARS?s Scientific Manuscript database
Giardia canis virus (GCV) is a double-stranded RNA (dsRNA) virus of the family Totiviridae. In this study, the full-length cDNA of the G. canis virus was constructed in pPoly2/sfinot vector and RNA was transcribed in vitro. Virus-free G. canis trophozoites were transfected with in vitro transcribed ...
Luis F. Larrondo; Marcela Avila; Loreto Salas; Dan Cullen; Rafael Vicuna
2003-01-01
Analysis of genomic clones encoding a putative laccase in homokaryon strains of Ceriporiopsis subvermispora led to the identification of an allelic variant of the previously described lcs-1 gene. A cDNA clone corresponding to this gene was expressed in Aspergillus nidulans and in Aspergillus niger. Enzyme assays and Western blots showed that both hosts secreted active...
Li, Minchao; Perelman, Juliy M; Zhou, Xiangdong
2012-05-01
To construct phosphorylation sites domain (PSD) mutant of myristoylated alaninerich C kinase substrate (MARCKS) and explore the role of transient receptor potential melastatin 8 cation channels (TRPM8) and MARCKS in cold-induced synthesis and exocytosis of mucin (MUC) 5AC. Human placental cDNA was used as a template to amplify the full coding region of MARCKS cDNA by PCR. Ser159, Ser 163, Ser 167, Ser 170 in the PSD were mutated to aspartic acids by an overlap PCR method. The resultant PSD mutant cDNA and the wild-type MARCKS cDNA were each subcloned into a mammalian expression vector pcDNA3.0. Recombinant constructs were confirmed by restriction enzyme digestion analysis and DNA sequencing. In intervention experiments, cells were pretreated with the TRPM8 channel antagonist BCTC and transfected with MARCKS-PSD mutant cDNA, and thereafter cold stimulation was applied. The levels of MUC5AC were measured by immunofluorescence and ELISA to clarify the roles of TRPM8 and PSD mutant on the synthesis and secretion of MUC5AC induced by cold, respectively. Restriction enzyme digestion analysis and DNA sequencing revealed that the pcDNA3.0- MARCKS and pcDNA3.0-MARCKS-PSD mutants were successfully constructed. The levels of intracellular and secreted MUC5AC of cold treated group were significantly higher than those of control group (P<0.05). BCTC attenuated the cold-induced synthesis and secretion of MUC5AC when compared with cold treated group (P<0.05). Transfection of 16HBE cells with the MARCKS-PSD mutant cDNA resulted in significant inhibition of mucin secretion in response to cold, and significantly higher level of intracellular MUC5AC than that of control group (P<0.01), whereas transfection with the vector DNA or the wild-type MARCKS cDNA had no effect on the mucin synthesis and secretion in response to cold (P>0.05). TRPM8 and phosphorylation of MARCKS-PSD mediates the cold-induced exocytosis of MUC5AC by airway epithelial cells.
Jeong, Joo Yeon; Lee, Dong Hoon; Kang, Sang Soo
2013-12-01
Stress affects body weight and food intake, but the underlying mechanisms are not well understood. We evaluated the changes in body weight and food intake of ICR male mice subjected to daily 2 hours restraint stress for 15 days. Hypothalamic gene expression profiling was analyzed by cDNA microarray. Daily body weight and food intake measurements revealed that both parameters decreased rapidly after initiating daily restraint stress. Body weights of stressed mice then remained significantly lower than the control body weights, even though food intake slowly recovered to 90% of the control intake at the end of the experiment. cDNA microarray analysis revealed that chronic restraint stress affects the expression of hypothalamic genes possibly related to body weight control. Since decreases of daily food intake and body weight were remarkable in days 1 to 4 of restraint, we examined the expression of food intake-related genes in the hypothalamus. During these periods, the expressions of ghrelin and pro-opiomelanocortin mRNA were significantly changed in mice undergoing restraint stress. Moreover, daily serum corticosterone levels gradually increased, while leptin levels significantly decreased. The present study demonstrates that restraint stress affects body weight and food intake by initially modifying canonical food intake-related genes and then later modifying other genes involved in energy metabolism. These genetic changes appear to be mediated, at least in part, by corticosterone.
Qiao, Guang; Wen, Xiao-Peng; Zhang, Ting
2015-12-01
Light-harvesting chlorophyll a/b-binding proteins (LHCB) have been implicated in the stress response. In this study, a gene encoding LHCB in the pigeon pea was cloned and characterized. Based on the sequence of a previously obtained 327 bp Est, a full-length 793 bp cDNA was cloned using the rapid amplification of cDNA ends (RACE) method. It was designated CcLHCB1 and encoded a 262 amino acid protein. The calculated molecular weight of the CcLHCB1 protein was 27.89 kDa, and the theoretical isoelectric point was 5.29. Homology search and sequence multi-alignment demonstrated that the CcLHCB1 protein sequence shared a high identity with LHCB from other plants. Bioinformatics analysis revealed that CcLHCB1 was a hydrophobic protein with three transmembrane domains. By fluorescent quantitative real-time polymerase chain reaction (PCR), CcLHCB1 mRNA transcripts were detectable in different tissues (leaf, stem, and root), with the highest level found in the leaf. The expression of CcLHCB1 mRNA in the leaves was up-regulated by drought stimulation and AM inoculation. Our results provide the basis for a better understanding of the molecular organization of LCHB and might be useful for understanding the interaction between plants and microbes in the future.
Cho, Young Sun; Choi, Buyl Nim; Ha, En-Mi; Kim, Ki Hong; Kim, Sung Koo; Kim, Dong Soo; Nam, Yoon Kwon
2005-01-01
Novel metallothionein (MT) complementary DNA and genomic sequences were isolated from a cartilaginous shark species, Scyliorhinus torazame. The full-length open reading frame (ORF) of shark MT cDNA encoded 68 amino acids with a high cysteine content (29%). The genomic ORF sequence (932 bp) of shark MT isolated by polymerase chain reaction (PCR) comprised 3 exons with 2 interventing introns. Shark MT sequence shared many conserved features with other vertebrate MTs: overall amino acid identities of shark MT ranged from 47% to 57% with fish MTs, and 41% to 62% with mammalian MTs. However, in addition to these conserved characteristics, shark MT sequence exhibited some unique characteristics. It contained 4 extra amino acids (Lys-Ala-Gly-Arg) at the end of the beta-domain, which have not been reported in any other vertebrate MTs. The last amino acid residue at the C-terminus was Ser, which also has not been reported in fish and mammalian MTs. The MT messenger RNA levels in shark liver and kidney, assessed by semiquantitative reverse transcriptase PCR and RNA blot hybridization, were significantly affected by experimental exposures to heavy metals (cadmium, copper, and zinc). Generally, the transcriptional activation of shark MT gene was dependent on the dose (0-10 mg/kg body weight for injection and 0-20 microM for immersion) and duration (1-10 days); zinc was a more potent inducer than copper and cadmium.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Garcia, C.K.; Li, X.; Luna, J.
1994-09-15
Lactate and pyruvate are transported across cell membranes by monocarboxylate transporters (MCTs). Here, the authors use the recently cloned cDNA for hamster MCT1 to isolate cDNA and genomic clones for human MCT1. Comparison of the human and hamster amino acid sequences revealed that the proteins are 86% identical. The gene for human MCT1 (gene symbol, SLC16A1) was localized to human chromosome bands 1p13.2-p12 by PCR analysis of panels of human X rodent cell hybrid lines and by fluorescence chromosomal in situ hybridization. 9 refs., 2 figs.
Hirotani, M; Kuroda, R; Suzuki, H; Yoshikawa, T
2000-05-01
A cDNA encoding UDP-glucose: baicalein 7-O-glucosyltransferase (UBGT) was isolated from a cDNA library from hairy root cultures of Scutellaria baicalensis Georgi probed with a partial-length cDNA clone of a UDP-glucose: flavonoid 3-O-glucosyltransferase (UFGT) from grape (Vitis vinifera L.). The heterologous probe contained a glucosyltransferase consensus amino acid sequence which was also present in the Scutellaria cDNA clones. The complete nucleotide sequence of the 1688-bp cDNA insert was determined and the deduced amino acid sequences are presented. The nucleotide sequence analysis of UBGT revealed an open reading frame encoding a polypeptide of 476 amino acids with a calculated molecular mass of 53,094 Da. The reaction product for baicalein and UDP-glucose catalyzed by recombinant UBGT in Escherichia coli was identified as authentic baicalein 7-O-glucoside using high-performance liquid chromatography and proton nuclear magnetic resonance spectroscopy. The enzyme activities of recombinant UBGT expressed in E. coli were also detected towards flavonoids such as baicalein, wogonin, apigenin, scutellarein, 7,4'-dihydroxyflavone and kaempferol, and phenolic compounds. The accumulation of UBGT mRNA in hairy roots was in response to wounding or salicylic acid treatments.
An extraovarian protein accumulated in mosquito oocytes is a carboxypeptidase activated in embryos
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wenlong Cho; Deitsch, K.W.; Raikhel, A.S.
1991-12-01
The authors report a phenomenon previously unknown for oviparous animals; in Aedes aegypti mosquitoes a serine carboxypeptidase is synthesized extraovarially and then internalized by oocytes. The cDNA encoding mosquito vitellogenic carboxypeptidase (VCP) was cloned and sequenced. The VCP cDNA hybridizes to a 1.5-kilobase mRNA present only in the fat body of vitellogenic females. The deduced amino acid sequence of VCP shares significant homology with members of the serine carboxypeptidase family. Binding assays using a serine protease inhibitor, ({sup 3}H)diisopropyl fluorophosphate, showed that VCP is activated in eggs at the onset of embryonic development. Activation of VCP is associated with themore » reduction in its size from 53 kDa (inactive proenzyme) to 48 kDa (active enzyme). The active, 48-kDa, form of VCP is maximally present at the middle of embryonic development and disappears by the end.« less
Xia, Xichao; Liu, Rongzhi; Li, Yi; Xue, Shipeng; Liu, Qingchun; Jiang, Xiao; Zhang, Wenjuan; Ding, Ke
2014-09-01
Hyaluronidase is a common component of scorpion venom and has been considered as "spreading factor" that promotes a fast penetration of the venom in the anaphylactic reaction. In the current study, a novel full-length of hyaluronidase BmHYI and three noncoding isoforms of BmHYII, BmHYIII and BmHYIV were cloned by using a combined strategy based on peptide sequencing and Rapid Amplification of cDNA Ends (RACE). BmHYI has 410 amino acid residues containing the catalytic, positional and five potential N-glycosylation sites. The deduced protein sequence of BmHYI shares significant identity with venom hyaluronidases from bees and snakes. The phylogenetic analysis showed early divergence and independent evolution of BmHYI from other hyaluronidases. An extraordinarily high level of sequence similarity was detected among four sequences. But, BmHYII, BmHYIII and BmHYIV were short of stop-codon in the open reading frame and poly(A) signal in the 3' end. Copyright © 2014 Elsevier B.V. All rights reserved.
Himuro, Yasuyo; Tanaka, Hidenori; Hashiguchi, Masatsugu; Ichikawa, Takanari; Nakazawa, Miki; Seki, Motoaki; Fujita, Miki; Shinozaki, Kazuo; Matsui, Minami; Akashi, Ryo; Hoffmann, Franz
2011-01-15
Using the full-length cDNA overexpressor (FOX) gene-hunting system, we have generated 130 Arabidopsis FOX-superroot lines in bird's-foot trefoil (Lotus corniculatus) for the systematic functional analysis of genes expressed in roots and for the selection of induced mutants with interesting root growth characteristics. We used the Arabidopsis-FOX Agrobacterium library (constructed by ligating pBIG2113SF) for the Agrobacterium-mediated transformation of superroots (SR) and the subsequent selection of gain-of-function mutants with ectopically expressed Arabidopsis genes. The original superroot culture of L. corniculatus is a unique host system displaying fast root growth in vitro, allowing continuous root cloning, direct somatic embryogenesis and mass regeneration of plants under entirely hormone-free culture conditions. Several of the Arabidopsis FOX-superroot lines show interesting deviations from normal growth and morphology of roots from SR-plants, such as differences in pigmentation, growth rate, length or diameter. Some of these mutations are of potential agricultural interest. Genomic PCR analysis revealed that 100 (76.9%) out of the 130 transgenic lines showed the amplification of single fragments. Sequence analysis of the PCR fragments from these 100 lines identified full-length cDNA in 74 of them. Forty-three out of 74 full-length cDNA carried known genes. The Arabidopsis FOX-superroot lines of L. corniculatus, produced in this study, expand the FOX hunting system and provide a new tool for the genetic analysis and control of root growth in a leguminous forage plant. Copyright © 2010 Elsevier GmbH. All rights reserved.
Informatic selection of a neural crest-melanocyte cDNA set for microarray analysis
Loftus, S. K.; Chen, Y.; Gooden, G.; Ryan, J. F.; Birznieks, G.; Hilliard, M.; Baxevanis, A. D.; Bittner, M.; Meltzer, P.; Trent, J.; Pavan, W.
1999-01-01
With cDNA microarrays, it is now possible to compare the expression of many genes simultaneously. To maximize the likelihood of finding genes whose expression is altered under the experimental conditions, it would be advantageous to be able to select clones for tissue-appropriate cDNA sets. We have taken advantage of the extensive sequence information in the dbEST expressed sequence tag (EST) database to identify a neural crest-derived melanocyte cDNA set for microarray analysis. Analysis of characterized genes with dbEST identified one library that contained ESTs representing 21 neural crest-expressed genes (library 198). The distribution of the ESTs corresponding to these genes was biased toward being derived from library 198. This is in contrast to the EST distribution profile for a set of control genes, characterized to be more ubiquitously expressed in multiple tissues (P < 1 × 10−9). From library 198, a subset of 852 clustered ESTs were selected that have a library distribution profile similar to that of the 21 neural crest-expressed genes. Microarray analysis demonstrated the majority of the neural crest-selected 852 ESTs (Mel1 array) were differentially expressed in melanoma cell lines compared with a non-neural crest kidney epithelial cell line (P < 1 × 10−8). This was not observed with an array of 1,238 ESTs that was selected without library origin bias (P = 0.204). This study presents an approach for selecting tissue-appropriate cDNAs that can be used to examine the expression profiles of developmental processes and diseases. PMID:10430933
D'Angelo, D D; Davis, M G; Houser, W A; Eubank, J J; Ritchie, M E; Dorn, G W
1995-09-01
Platelet thromboxane receptors are acutely and reversibly upregulated after acute myocardial infarction. To determine if platelet thromboxane receptors are under transcriptional control, we isolated and characterized human genomic DNA clones containing the 5' flanking region of the thromboxane receptor gene. The exon-intron structure of the 5' portion of the thromboxane receptor gene was determined initially by comparing the nucleotide sequence of the 5' flanking genomic clone with that of a novel human uterine thromboxane receptor cDNA that extended the mRNA 141 bp further upstream than the previously identified human placental cDNA. A major transcription initiation site was located in three human tissues approximately 560 bp upstream from the translation initiation codon and 380 bp upstream from any previously identified transcription initiation site. The thromboxane receptor gene has neither a TATA nor a CAAT consensus site. Promoter function of the 5' flanking region of the thromboxane receptor gene was evaluated by transfection of thromboxane receptor gene promoter/chloramphenicol acetyltransferase (CAT) chimera plasmids into platelet-like K562 cells. Thromboxane receptor promoter activity, as assessed by CAT expression, was relatively weak but was significantly enhanced by phorbol ester treatment. Functional analysis of 5' deletion constructs in transfected K562 cells and gel mobility shift localized the major phorbol ester-responsive motifs in the thromboxane receptor gene promoter to a cluster of activator protein-2 (AP-2) binding consensus sites located approximately 1.8 kb 5' from the transcription initiation site. These studies are the first to determine the structure and organization of the 5' end of the thromboxane receptor gene and demonstrate that thromboxane receptor gene expression can be regulated by activation of protein kinase C via induction of an AP-2-like nuclear factor binding to upstream promoter elements. These findings strongly suggest that the mechanism for previously described upregulation of platelet thromboxane receptors after acute myocardial infarction is increased thromboxane receptor gene transcription in platelet-progenitor cells.
Bhardwaj, Pardeep Kumar; Kaur, Jagdeep; Sobti, Ranbir Chander; Ahuja, Paramvir Singh; Kumar, Sanjay
2011-09-01
Lipoxygenase (LOX) catalyses oxygenation of free polyunsaturated fatty acids into oxylipins, and is a critical enzyme of the jasmonate signaling pathway. LOX has been shown to be associated with biotic and abiotic stress responses in diverse plant species, though limited data is available with respect to low temperature and the associated cues. Using rapid amplification of cDNA ends, a full-length cDNA (CjLOX) encoding lipoxygenase was cloned from apical buds of Caragana jubata, a temperate plant species that grows under extreme cold. The cDNA obtained was 2952bp long consisting of an open reading frame of 2610bp encoding 869 amino acids protein. Multiple alignment of the deduced amino acid sequence with those of other plants demonstrated putative LH2/ PLAT domain, lipoxygenase iron binding catalytic domain and lipoxygenase_2 signature sequences. CjLOX exhibited up- and down-regulation of gene expression pattern in response to low temperature (LT), abscisic acid (ABA), methyl jasmonate (MJ) and salicylic acid (SA). Among all the treatments, a strong up-regulation was observed in response to MJ. Data suggests an important role of jasmonate signaling pathway in response to LT in C. jubata. Copyright © 2011 Elsevier B.V. All rights reserved.
Characterization of transformation related genes in oral cancer cells.
Chang, D D; Park, N H; Denny, C T; Nelson, S F; Pe, M
1998-04-16
A cDNA representational difference analysis (cDNA-RDA) and an arrayed filter technique were used to characterize transformation-related genes in oral cancer. From an initial comparison of normal oral epithelial cells and a human papilloma virus (HPV)-immortalized oral epithelial cell line, we obtained 384 differentially expressed gene fragments and arrayed them on a filter. Two hundred and twelve redundant clones were identified by three rounds of back hybridization. Sequence analysis of the remaining clones revealed 99 unique clones corresponding to 69 genes. The expression of these transformation related gene fragments in three nontumorigenic HPV-immortalized oral epithelial cell lines and three oral cancer cell lines were simultaneously monitored using a cDNA array hybridization. Although there was a considerable cell line-to-cell line variability in the expression of these clones, a reliable prediction of their expression could be made from the cDNA array hybridization. Our study demonstrates the utility of combining cDNA-RDA and arrayed filters in high-throughput gene expression difference analysis. The differentially expressed genes identified in this study should be informative in studying oral epithelial cell carcinogenesis.
The Viral Evolution Core within the AIDS and Cancer Virus Program will extract viral RNA/DNA from cell-free or cell-associated samples. Complementary (cDNA) will be generated as needed, and cDNA or DNA will be diluted to a single copy prior to nested
Large-scale analysis of gene expression using cDNA microarrays promises the
rapid detection of the mode of toxicity for drugs and other chemicals. cDNA
microarrays were used to examine chemically-induced alterations of gene
expression in HepG2 cells exposed to oxidative ...
Salton, S R
1991-09-01
A nervous system-specific mRNA that is rapidly induced in PC12 cells to a greater extent by nerve growth factor (NGF) than by epidermal growth factor treatment has been cloned. The polypeptide deduced from the nucleic acid sequence of the NGF33.1 cDNA clone contains regions of amino acid sequence identity with that predicted by the cDNA clone VGF, and further analysis suggests that both NGF33.1 and VGF cDNA clones very likely correspond to the same mRNA (VGF). In this report both the nucleic acid sequence that corresponds to VGF mRNA and the polypeptide predicted by the NGF33.1 cDNA clone are presented. Genomic Southern analysis and database comparison did not detect additional sequences with high homology to the VGF gene. Induction of VGF mRNA by depolarization and phorbol 12-myristate 13-acetate treatment was greater than by serum stimulation or protein kinase A pathway activation. These studies suggest that VGF mRNA is induced to the greatest extent by NGF treatment and that VGF is one of the most rapidly regulated neuronal mRNAs identified in PC12 cells.
Molecular cloning of a cDNA encoding the glycoprotein of hen oviduct microsomal signal peptidase.
Newsome, A L; McLean, J W; Lively, M O
1992-01-01
Detergent-solubilized hen oviduct signal peptidase has been characterized previously as an apparent complex of a 19 kDa protein and a 23 kDa glycoprotein (GP23) [Baker & Lively (1987) Biochemistry 26, 8561-8567]. A cDNA clone encoding GP23 from a chicken oviduct lambda gt11 cDNA library has now been characterized. The cDNA encodes a protein of 180 amino acid residues with a single site for asparagine-linked glycosylation that has been directly identified by amino acid sequence analysis of a tryptic-digest peptide containing the glycosylated site. Immunoblot analysis reveals cross-reactivity with a dog pancreas protein. Comparison of the deduced amino acid sequence of GP23 with the 22/23 kDa glycoprotein of dog microsomal signal peptidase [Shelness, Kanwar & Blobel (1988) J. Biol. Chem. 263, 17063-17070], one of five proteins associated with this enzyme, reveals that the amino acid sequences are 90% identical. Thus the signal peptidase glycoprotein is as highly conserved as the sequences of cytochromes c and b from these same species and is likely to be found in a similar form in many, if not all, vertebrate species. The data also show conclusively that the dog and avian signal peptidases have at least one protein subunit in common. Images Fig. 1. PMID:1546959
DOE Office of Scientific and Technical Information (OSTI.GOV)
Akileswaran, L.; Brock, B.J.; Cereghino, J.L.
1999-02-01
A cDNA clone encoding a quinone reductase (QR) from the white rot basidiomycete Phanerochaete chrysosporium was isolated and sequenced. The cDNA consisted of 1,007 nucleotides and a poly(A) tail and encoded a deduced protein containing 271 amino acids. The experimentally determined eight-amino-acid N-germinal sequence of the purified QR protein from P. chrysosporium matched amino acids 72 to 79 of the predicted translation product of the cDNA. The M{sub r} of the predicted translation product, beginning with Pro-72, was essentially identical to the experimentally determined M{sub r} of one monomer of the QR dimer, and this finding suggested that QR ismore » synthesized as a proenzyme. The results of in vitro transcription-translation experiments suggested that QR is synthesized as a proenzyme with a 71-amino-acid leader sequence. This leader sequence contains two potential KEX2 cleavage sites and numerous potential cleavage sites for dipeptidyl aminopeptidase. The QR activity in cultures of P. chrysosporium increased following the addition of 2-dimethoxybenzoquinone, vanillic acid, or several other aromatic compounds. An immunoblot analysis indicated that induction resulted in an increase in the amount of QR protein, and a Northern blot analysis indicated that this regulation occurs at the level of the qr mRNA.« less
Molecular genetics of X-linked retinitis pigmentosa: Progress towards cloning the RP3 gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fujita, R.; Yan, D.; McHenry, C.
1994-09-01
Our goal is to identify the X-linked retinitis pigmentosa (XLRP) gene RP3. The location of RP3 is genetically delimited to a region of 1 Mb, distal to DXS140, CYBB and tctex-1-like gene and proximal to the gene OTC. It is currently thought that RP3 is within 40 kb of the proximal deletion breakpoint of a patient BB. However, a more proximal location of the gene, closer to OTC, is not ruled out. We initiated the isolation of the genomic region between DXS140 to OTC in YACs. One of the clones from DXS140 region (55B) is 460 kb and spans aboutmore » 200 kb at each side of BB patient`s proximal breakpoint. It contains CYBB, tctex-1-like genes and two additional CpG islands. The 55B clone has been covered by cosmid and phage subclones. Another YAC clone from the OTC region (OTCC) spans about 1 Mb and contains at least 5 CpG islands. In situ hybridization performed with OTCC showed its location in Xp21; however, several derivative cosmids map to chromosome 7, indicating that it is a chimeric YAC. No overlap is evident between 55B and OTCC. We have isolated the YAC end-sequences and isolation of clones to close the gap is in progress. Cosmids are being used for screening eye tissue cDNA libraries, mainly from retina. Screening is done by hybridization to replica filters or by cDNA enrichment methods. Several cDNA clones have been isolated and are being characterized. Exon-amplification is also being used with the cosmids and phages. Genetic analysis is being performed to determine RP3 patients from clinically indistinguishable RP2, located in Xp11.23-p11.4, and to reduce the genetic distance of current flanking markers. For this we are analyzing a number of XLRP families with established markers in the region and with new microsatellites.« less
NASA Astrophysics Data System (ADS)
Ren, Hai; Li, Jian; Li, Jitao; Liu, Ping; Liang, Zhongxiu; Wu, Jianhua
2015-05-01
Superoxide dismutase (SOD) is one of the most important antioxidant defense enzymes, and is considered as the first line against oxidative stress. In this study, we cloned a mitochondrial manganese (Mn) SOD ( mMnSOD) cDNA from the ridgetail white prawn Exopalaemon carinicauda by using rapid amplification of cDNA ends (RACE) methods. The full-length cDNA for mMnSOD was 1 014-bp long, containing a 5'-untranslated region (UTR) of 37-bp, a 3'-UTR of 321-bp with a poly (A) tail, and included a 657-bp open reading frame encoding a protein of 218 amino acids with a 16-amino-acid signal peptide. The protein had a calculated molecular weight of 23.87 kDa and a theoretical isoelectric point of 6.75. The mMnSOD sequence included two putative N-glycosylation sites (NHT and NLS), the MnSOD signature sequence 180DVWEHAYY187, and four putative Mn binding sites (H48, H96, D180, and H184). Sequence comparison showed that the mMnSOD deduced amino acid sequence of E. carinicauda shared 97%, 95%, 89%, 84%, 82%, 72%, and 69% identity with that of Macrobrachium rosenbergii, Macrobrachium nipponense, Fenneropeneaus chinensis, Callinectes sapidus, Perisesarma bidens, Danio rerio, and Homo sapiens, resectively. Quantitative real-time RT-PCR analysis showed that mMnSOD transcripts were present in all E. carinicauda tissues examined, with the highest levels in the hepatopancreas. During an ammonia stress treatment, the transcript levels of mMnSOD and cMnSOD were up-regulated at 12 h in hemocytes and at 24 h in the hepatopancreas. As the duration of the ammonia stress treatment extended to 72 h, the transcript levels of mMnSOD and cMnSOD significantly decreased both in hemocytes and hepatopancreas. These findings indicate that the SOD system is induced to respond to acute ammonia stress, and may be involved in environmental stress responses in E. carinicauda.
Christen, Verena; Caminada, Daniel; Arand, Michael; Fent, Karl
2010-01-01
Cytochrome P450-dependent monooxygenases (CYPs) are involved in the metabolic defence against xenobiotics. Human CYP3A enzymes metabolise about 50% of all pharmaceuticals in use today. Induction of CYPs and associated xenobiotic metabolism occurs also in fish and may serve as a useful tool for biomonitoring of environmental contamination. In this study we report on the cloning of a CYP3A family gene from fathead minnows (Pimephales promelas), which has been designated as CYP3A126 by the P450 nomenclature committee (GenBank no. EU332792). The cDNA was isolated, identified and characterised by extended inverse polymerase chain reaction (PCR), an alternative to the commonly used method of rapid amplification of cDNA ends. In a fathead minnow cell line we identified a full-length cDNA sequence (1,863 base pairs (bp)) consisting of a 1,536 bp open reading frame encoding a 512 amino acid protein. Genomic analysis of the identified CYP3A isoenzyme revealed a DNA sequence consisting of 13 exons and 12 introns. CYP3A126 is also expressed in fathead minnow liver as demonstrated by reverse transcription PCR. Exposure of fathead minnow (FHM) cells with the CYP3A inducer rifampicin leads to dose-dependent increase in putative CYP3A enzyme activity. In contrast, inhibitory effects of diazepam treatment were observed on putative CYP3A enzyme activity and additionally on CYP3A126 mRNA expression. This indicates that CYP3A is active in FHM cells and that CYP3A126 is at least in part responsible for this CYP3A activity. Further investigations will show whether CYP3A126 is involved in the metabolism of environmental chemicals.
A large-scale full-length cDNA analysis to explore the budding yeast transcriptome
Miura, Fumihito; Kawaguchi, Noriko; Sese, Jun; Toyoda, Atsushi; Hattori, Masahira; Morishita, Shinichi; Ito, Takashi
2006-01-01
We performed a large-scale cDNA analysis to explore the transcriptome of the budding yeast Saccharomyces cerevisiae. We sequenced two cDNA libraries, one from the cells exponentially growing in a minimal medium and the other from meiotic cells. Both libraries were generated by using a vector-capping method that allows the accurate mapping of transcription start sites (TSSs). Consequently, we identified 11,575 TSSs associated with 3,638 annotated genomic features, including 3,599 ORFs, to suggest that most yeast genes have two or more TSSs. In addition, we identified 45 previously undescribed introns, including those affecting current ORF annotations and those spliced alternatively. Furthermore, the analysis revealed 667 transcription units in the intergenic regions and transcripts derived from antisense strands of 367 known features. We also found that 348 ORFs carry TSSs in their 3′-halves to generate sense transcripts starting from inside the ORFs. These results indicate that the budding yeast transcriptome is considerably more complex than previously thought, and it shares many recently revealed characteristics with the transcriptomes of mammals and other higher eukaryotes. Thus, the genome-wide active transcription that generates novel classes of transcripts appears to be an intrinsic feature of the eukaryotic cells. The budding yeast will serve as a versatile model for the studies on these aspects of transcriptome, and the full-length cDNA clones can function as an invaluable resource in such studies. PMID:17101987
Human mRNA polyadenylate binding protein: evolutionary conservation of a nucleic acid binding motif.
Grange, T; de Sa, C M; Oddos, J; Pictet, R
1987-01-01
We have isolated a full length cDNA (cDNA) coding for the human poly(A) binding protein. The cDNA derived 73 kd basic translation product has the same Mr, isoelectric point and peptidic map as the poly(A) binding protein. DNA sequence analysis reveals a 70,244 dalton protein. The N terminal part, highly homologous to the yeast poly(A) binding protein, is sufficient for poly(A) binding activity. This domain consists of a four-fold repeated unit of approximately 80 amino acids present in other nucleic acid binding proteins. In the C terminal part there is, as in the yeast protein, a sequence of approximately 150 amino acids, rich in proline, alanine and glutamine which together account for 48% of the residues. A 2,9 kb mRNA corresponding to this cDNA has been detected in several vertebrate cell types and in Drosophila melanogaster at every developmental stage including oogenesis. Images PMID:2885805
[Construction of fetal mesenchymal stem cell cDNA subtractive library].
Yang, Li; Wang, Dong-Mei; Li, Liang; Bai, Ci-Xian; Cao, Hua; Li, Ting-Yu; Pei, Xue-Tao
2002-04-01
To identify differentially expressed genes between fetal mesenchymal stem cell (MSC) and adult MSC, especially specified genes expressed in fetal MSC, a cDNA subtractive library of fetal MSC was constructed using suppression subtractive hybridization (SSH) technique. At first, total RNA was isolated from fetal and adult MSC. Using SMART PCR synthesis method, single-strand and double-strand cDNAs were synthesized. After Rsa I digestion, fetal MSC cDNAs were divided into two groups and ligated to adaptor 1 and adaptor 2 respectively. Results showed that the amplified library contains 890 clones. Analysis of 890 clones with PCR demonstrated that 768 clones were positive. The positive rate is 86.3%. The size of inserted fragments in these positive clones was between 0.2 - 1 kb, with an average of 400 - 600 bp. SSH is a convenient and effective method for screening differentially expressed genes. The constructed cDNA subtractive library of fetal MSC cDNA lays solid foundation for screening and cloning new and specific function related genes of fetal MSC.
Improved coverage of cDNA-AFLP by sequential digestion of immobilized cDNA.
Weiberg, Arne; Pöhler, Dirk; Morgenstern, Burkhard; Karlovsky, Petr
2008-10-13
cDNA-AFLP is a transcriptomics technique which does not require prior sequence information and can therefore be used as a gene discovery tool. The method is based on selective amplification of cDNA fragments generated by restriction endonucleases, electrophoretic separation of the products and comparison of the band patterns between treated samples and controls. Unequal distribution of restriction sites used to generate cDNA fragments negatively affects the performance of cDNA-AFLP. Some transcripts are represented by more than one fragment while other escape detection, causing redundancy and reducing the coverage of the analysis, respectively. With the goal of improving the coverage of cDNA-AFLP without increasing its redundancy, we designed a modified cDNA-AFLP protocol. Immobilized cDNA is sequentially digested with several restriction endonucleases and the released DNA fragments are collected in mutually exclusive pools. To investigate the performance of the protocol, software tool MECS (Multiple Enzyme cDNA-AFLP Simulation) was written in Perl. cDNA-AFLP protocols described in the literature and the new sequential digestion protocol were simulated on sets of cDNA sequences from mouse, human and Arabidopsis thaliana. The redundancy and coverage, the total number of PCR reactions, and the average fragment length were calculated for each protocol and cDNA set. Simulation revealed that sequential digestion of immobilized cDNA followed by the partitioning of released fragments into mutually exclusive pools outperformed other cDNA-AFLP protocols in terms of coverage, redundancy, fragment length, and the total number of PCRs. Primers generating 30 to 70 amplicons per PCR provided the highest fraction of electrophoretically distinguishable fragments suitable for normalization. For A. thaliana, human and mice transcriptome, the use of two marking enzymes and three sequentially applied releasing enzymes for each of the marking enzymes is recommended.
van Zyl, Leonel; von Arnold, Sara; Bozhkov, Peter; Chen, Yongzhong; Egertsdotter, Ulrika; MacKay, John; Sederoff, Ronald R.; Shen, Jing; Zelena, Lyubov
2002-01-01
Hybridization of labelled cDNA from various cell types with high-density arrays of expressed sequence tags is a powerful technique for investigating gene expression. Few conifer cDNA libraries have been sequenced. Because of the high level of sequence conservation between Pinus and Picea we have investigated the use of arrays from one genus for studies of gene expression in the other. The partial cDNAs from 384 identifiable genes expressed in differentiating xylem of Pinus taeda were printed on nylon membranes in randomized replicates. These were hybridized with labelled cDNA from needles or embryogenic cultures of Pinus taeda, P. sylvestris and Picea abies, and with labelled cDNA from leaves of Nicotiana tabacum. The Spearman correlation of gene expression for pairs of conifer species was high for needles (r2 = 0.78 − 0.86), and somewhat lower for embryogenic cultures (r2 = 0.68 − 0.83). The correlation of gene expression for tobacco leaves and needles of each of the three conifer species was lower but sufficiently high (r2 = 0.52 − 0.63) to suggest that many partial gene sequences are conserved in angiosperms and gymnosperms. Heterologous probing was further used to identify tissue-specific gene expression over species boundaries. To evaluate the significance of differences in gene expression, conventional parametric tests were compared with permutation tests after four methods of normalization. Permutation tests after Z-normalization provide the highest degree of discrimination but may enhance the probability of type I errors. It is concluded that arrays of cDNA from loblolly pine are useful for studies of gene expression in other pines or spruces. PMID:18629264
Karsten, Stanislav L.; Van Deerlin, Vivianna M. D.; Sabatti, Chiara; Gill, Lisa H.; Geschwind, Daniel H.
2002-01-01
Archival formalin-fixed, paraffin-embedded and ethanol-fixed tissues represent a potentially invaluable resource for gene expression analysis, as they are the most widely available material for studies of human disease. Little data are available evaluating whether RNA obtained from fixed (archival) tissues could produce reliable and reproducible microarray expression data. Here we compare the use of RNA isolated from human archival tissues fixed in ethanol and formalin to frozen tissue in cDNA microarray experiments. Since an additional factor that can limit the utility of archival tissue is the often small quantities available, we also evaluate the use of the tyramide signal amplification method (TSA), which allows the use of small amounts of RNA. Detailed analysis indicates that TSA provides a consistent and reproducible signal amplification method for cDNA microarray analysis, across both arrays and the genes tested. Analysis of this method also highlights the importance of performing non-linear channel normalization and dye switching. Furthermore, archived, fixed specimens can perform well, but not surprisingly, produce more variable results than frozen tissues. Consistent results are more easily obtainable using ethanol-fixed tissues, whereas formalin-fixed tissue does not typically provide a useful substrate for cDNA synthesis and labeling. PMID:11788730
DOE Office of Scientific and Technical Information (OSTI.GOV)
Eggers, B.; Kurth, J.H.; Kurth, M.C.
1994-09-01
Epidemiological studies suggest that several different environmental agents interact with a number of genetic elements to cause Parkinson`s disease (PD), a common neurodegenerative disease. Abnormalities of oxidative metabolism may be central to this process. Specifically, the production and degradation of dopamine may lead to toxic by-products and increased oxidative stress. Toxic by-products include hydrogen peroxide, superoxide, and hydroxyl radicals, all of which are implicated in the aging process of the central nervous system. Superoxide dismutase (SOD) catalyzes superoxide to hydrogen peroxide. Genetic predisposition to PD may be at least partially a result of certain SOD alleles. Using the cDNA sequencemore » of Mn-SOD gene, oligonucleotide primers were designed which span several presumptive splice junction sites. An approximatley 2.4kb PCR product was amplified from gDNA samples that span one or more intron near the 3{prime} end of the Mn-SOD cDNA sequence. The resultant product was screened with a panel of 4-cutters to identify fragments appropriate for SSCP analysis. Twenty-two gDNA samples were screened for SSCP and size differences of these PCR products. After digestion with AluI, two polymorphisms were observed. Two alleles with a size difference of 2-4 bp were observed by denaturing PAGE in one of the fragments. SSCP analysis revealed a polymorphism with 2 alleles in another fragment. Sequence analysis of these polymorphisms is in progress. DNA from several DEPH families was used to confirm Mendelian inheritance of these polymorphisms. Genomic DNA samples have been collected from 265 PD patients and 169 control individuals; allelic frequencies will be determined for these populations, compared by {chi}{sup 2} analysis, and relative risk calculated. These results may support a contribution of Mn-SOD in the genetic predisposition to PD.« less
Isolation of stress responsive Psb A gene from rice (Oryza sativa l.) using differential display.
Tyagi, Aruna; Chandra, Arti
2006-08-01
Differential display (DD) experiments were performed on drought-tolerant rice (Oryza sativa L.) genotype N22 to identify both upregulated and downregulated partial cDNAs with respect to moisture stress. DNA polymorphism was detected between drought-stressed and control leaf tissues on the DD gels. A partial cDNA showing differential expression, with respect to moisture stress was isolated from the gel. Northern blotting analysis was performed using this cDNA as a probe and it was observed that mRNA corresponding to this transcript was accumulated to high level in rice leaves under water deficit stress. At the DNA sequence level, the partial cDNA showed homology with psb A gene encoding for Dl protein.
Réfega, Susana; Girard-Misguich, Fabienne; Bourdieu, Christiane; Péry, Pierre; Labbé, Marie
2003-04-02
Specific antibodies were produced ex vivo from intestinal culture of Eimeria tenella infected chickens. The specificity of these intestinal antibodies was tested against different parasite stages. These antibodies were used to immunoscreen first generation schizont and sporozoite cDNA libraries permitting the identification of new E. tenella antigens. We obtained a total of 119 cDNA clones which were subjected to sequence analysis. The sequences coding for the proteins inducing local immune responses were compared with nucleotide or protein databases and with expressed sequence tags (ESTs) databases. We identified new Eimeria genes coding for heat shock proteins, a ribosomal protein, a pyruvate kinase and a pyridoxine kinase. Specific features of other sequences are discussed.
Guerrero, Consuelo; Martín-Rufián, M; Reina, José J; Heredia, Antonio
2006-01-01
A cDNA encoding an acyl-CoA binding protein (ACBP) homologue has been cloned from a cDNA library made from mRNA isolated from epidermis of young leaves of Agave americana L. The derived amino acid sequence reveals a protein corresponding to the membrane-associated form of ACBPs only previously described in Arabidopsis and rice. Northern blot analysis showed that the A. americana ACBP gene is mainly expressed in the epidermis of mature zone of the leaves. The epidermis of A. americana leaves have a well developed cuticle with the highest amounts of the cuticular components waxes, cutin and cutan suggesting a potential role of the protein in cuticle formation.
Tsutsui, Shigeyuki; Yoshino, Yuko; Matsui, Saho; Nakamura, Osamu; Muramoto, Koji; Watanabe, Tasuku
2008-03-01
By using EDTA and a trypsin solution, we established a method for isolating the epidermal cells of the conger eel, Conger myriaster. We then identified TNF decoy receptor (DcR) cDNA in the species from a suppression subtractive hybridization library prepared from the epidermal cells stimulated with LPS. The full-length cDNA of conger TNF DcR (conDcR) consisted of 1479 base pairs, and the protein comprised 286 amino acid residues. Phylogenetic analysis indicated that conDcR was clustered into a DcR3 branch. ConDcR is likely to act as an important immune-regulating factor in inhibiting the apoptosis-inducing effect of TNF in the skin of conger eel.
Human brain factor 1, a new member of the fork head gene family
DOE Office of Scientific and Technical Information (OSTI.GOV)
Murphy, D.B.; Wiese, S.; Burfeind, P.
1994-06-01
Analysis of cDNA clones that cross-hybridized with the fork head domain of the rat HNF-3 gene family revealed 10 cDNAs from human fetal brain and human testis cDNA libraries containing this highly conserved DNA-binding domain. Three of these cDNAs (HFK1, HFK2, and HFK3) were further analyzed. The cDNA HFK1 has a length of 2557 nucleotides and shows strong homology at the nucleotide level (91.2%) to brain factor 1 (BF-1) from rat. The HFK1 cDNA codes for a putative 476 amino acid protein. The homology to BF-1 from rat in the coding region at the amino acid level is 87.5%. Themore » fork head homologous region includes 111 amino acids starting at amino acid 160 and has a 97.5% homology to BF-1. Southern hybridization revealed that HFK1 is highly conserved among mammalian species and possibly birds. Northern analysis with total RNA from human tissues and poly(A)-rich RNA from mouse revealed a 3.2-kb transcript that is present in human and mouse fetal brain and in adult mouse brain. In situ hybridization with sections of mouse embryo and human fetal brain reveals that HFK1 expression is restricted to the neuronal cells in the telencepthalon, with strong expression being observed in the developing dentate gyrus and hippocampus. HFK1 was chromosomally localized by in situ hybridization to 14q12. The cDNA clones HFK2 and HFK3 were analyzed by restriction analysis and sequencing. HFK2 and HFK3 were found to be closely related but different from HFK1. Therefore, it would appear that HFK1, HFK2, HFK3, and BF-1 form a new fork head related subfamily. 33 refs., 6 figs.« less
Yang, Zhifan; Chen, Jun; Chen, Yongqin; Jiang, Sijing
2010-01-01
A full cDNA encoding an acetylcholinesterase (AChE, EC 3.1.1.7) was cloned and characterized from the brown planthopper, Nilaparvata lugens Stål (Hemiptera: Delphacidae). The complete cDNA (2467 bp) contains a 1938-bp open reading frame encoding 646 amino acid residues. The amino acid sequence of the AChE deduced from the cDNA consists of 30 residues for a putative signal peptide and 616 residues for the mature protein with a predicted molecular weight of 69,418. The three residues (Ser242, Glu371, and His485) that putatively form the catalytic triad and the six Cys that form intra-subunit disulfide bonds are completely conserved, and 10 out of the 14 aromatic residues lining the active site gorge of the AChE are also conserved. Northern blot analysis of poly(A)+ RNA showed an approximately 2.6-kb transcript, and Southern blot analysis revealed there likely was just a single copy of this gene in N. lugens. The deduced protein sequence is most similar to AChE of Nephotettix cincticeps with 83% amino acid identity. Phylogenetic analysis constructed with 45 AChEs from 30 species showed that the deduced N. lugens AChE formed a cluster with the other 8 insect AChE2s. Additionally, the hypervariable region and amino acids specific to insect AChE2 also existed in the AChE of N. lugens. The results revealed that the AChE cDNA cloned in this work belongs to insect AChE2 subgroup, which is orthologous to Drosophila AChE. Comparison of the AChEs between the susceptible and resistant strains revealed a point mutation, Gly185Ser, is likely responsible for the insensitivity of the AChE to methamidopho in the resistant strain. PMID:20874389
JPRS Report, Science and Technology USSR: Life Sciences.
1990-07-16
4 1 VETERINARY MEDICINE Primary Structure of RNA Polymerase Gene of Foot-and-Mouth Disease Virus ( FMDV ...neering were used to obtain cDNA corresponding to the Primary Structure of RNA Polymerase Gene of RNA polymerase gene to FMDV A 2 2 , with a map of the...Foot-and-Mouth Disease Virus ( FMDV ) A22 primary nucleotide sequence of the cDNA provided. 18400538F Moscow BIOORGANICHESKA YA Analysis of the data
Zhou, Peilan; Jiang, Jiebing; Dong, Zhaoqi; Yan, Hui; You, Zhendong; Su, Ruibin; Gong, Zehui
2015-12-15
Opioid addiction is associated with long-term adaptive changes in the brain that involve protein expression. The carboxyl-terminal of the μ opioid receptor (MOR-C) is important for receptor signal transduction under opioid treatment. However, the proteins that interact with MOR-C after chronic morphine exposure remain unknown. The brain cDNA library of chronic morphine treatment rats was screened using rat MOR-C to investigate the regulator of opioids dependence in the present study. The brain cDNA library from chronic morphine-dependent rats was constructed using the SMART (Switching Mechanism At 5' end of RNA Transcript) technique. Bacterial two-hybrid system was used to screening the rat MOR-C interacting proteins from the cDNA library. RT-qPCR and immunoblotting were used to determine the variation of MOR-C interacting proteins in rat brain after chronic morphine treatment. Column overlay assays, immunocytochemistry and coimmunoprecipitation were used to demonstrate the interaction of MOR-C and p75NTR-associated cell death executor (NADE). 21 positive proteins, including 19 known proteins were screened to interact with rat MOR-C. Expression of several of these proteins was altered in specific rat brain regions after chronic morphine treatment. Among these proteins, NADE was confirmed to interact with rat MOR-C by in vitro protein-protein binding and coimmunoprecipitation in Chinese hamster ovary (CHO) cells and rat brain with or without chronic morphine treatment. Understanding the rat MOR-C interacting proteins and the proteins variation under chronic morphine treatment may be critical for determining the pathophysiological basis of opioid tolerance and addiction. Copyright © 2015. Published by Elsevier Inc.
Molecular cloning and characterization of SoxB2 gene from Zhikong scallop Chlamys farreri
NASA Astrophysics Data System (ADS)
He, Yan; Bao, Zhenmin; Guo, Huihui; Zhang, Yueyue; Zhang, Lingling; Wang, Shi; Hu, Jingjie; Hu, Xiaoli
2013-11-01
The Sox proteins play critical roles during the development of animals, including sex determination and central nervous system development. In this study, the SoxB2 gene was cloned from a mollusk, the Zhikong scallop ( Chlamys farreri), and characterized with respect to phylogeny and tissue distribution. The full-length cDNA and genomic DNA sequences of C. farreri SoxB2 ( Cf SoxB2) were obtained by rapid amplification of cDNA ends and genome walking, respectively, using a partial cDNA fragment from the highly conserved DNA-binding domain, i.e., the High Mobility Group (HMG) box. The full-length cDNA sequence of Cf SoxB2 was 2 048 bp and encoded 268 amino acids protein. The genomic sequence was 5 551 bp in length with only one exon. Several conserved elements, such as the TATA-box, GC-box, CAAT-box, GATA-box, and Sox/sry-sex/testis-determining and related HMG box factors, were found in the promoter region. Furthermore, real-time quantitative reverse transcription PCR assays were carried out to assess the mRNA expression of Cf SoxB 2 in different tissues. SoxB2 was highly expressed in the mantle, moderately in the digestive gland and gill, and weakly expressed in the gonad, kidney and adductor muscle. In male and female gonads at different developmental stages of reproduction, the expression levels of Cf SoxB2 were similar. Considering the specific expression and roles of SoxB 2 in other animals, in particular vertebrates, and the fact that there are many pallial nerves in the mantle, cerebral ganglia in the digestive gland and gill nerves in gill, we propose a possible essential role in nervous tissue function for Sox B 2 in C. farreri.
Sequence analysis and molecular characterization of Wnt4 gene in metacestodes of Taenia solium.
Hou, Junling; Luo, Xuenong; Wang, Shuai; Yin, Cai; Zhang, Shaohua; Zhu, Xueliang; Dou, Yongxi; Cai, Xuepeng
2014-04-01
Wnt proteins are a family of secreted glycoproteins that are evolutionarily conserved and considered to be involved in extensive developmental processes in metazoan organisms. The characterization of wnt genes may improve understanding the parasite's development. In the present study, a wnt4 gene encoding 491amino acids was amplified from cDNA of metacestodes of Taenia solium using reverse transcription PCR (RT-PCR). Bioinformatics tools were used for sequence analysis. The conserved domain of the wnt gene family was predicted. The expression profile of Wnt4 was investigated using real-time PCR. Wnt4 expression was found to be dramatically increased in scolex evaginated cysticerci when compared to invaginated cysticerci. In situ hybridization showed that wnt4 gene was distributed in the posterior end of the worm along the primary body axis in evaginated cysticerci. These findings indicated that wnt4 may take part in the process of cysticerci evagination and play a role in scolex/bladder development of cysticerci of T. solium.
Thormar, Hans G; Gudmundsson, Bjarki; Eiriksdottir, Freyja; Kil, Siyoen; Gunnarsson, Gudmundur H; Magnusson, Magnus Karl; Hsu, Jason C; Jonsson, Jon J
2013-04-01
The causes of imprecision in microarray expression analysis are poorly understood, limiting the use of this technology in molecular diagnostics. Two-dimensional strandness-dependent electrophoresis (2D-SDE) separates nucleic acid molecules on the basis of length and strandness, i.e., double-stranded DNA (dsDNA), single-stranded DNA (ssDNA), and RNA·DNA hybrids. We used 2D-SDE to measure the efficiency of cDNA synthesis and its importance for the imprecision of an in vitro transcription-based microarray expression analysis. The relative amount of double-stranded cDNA formed in replicate experiments that used the same RNA sample template was highly variable, ranging between 0% and 72% of the total DNA. Microarray experiments showed an inverse relationship between the difference between sample pairs in probe variance and the relative amount of dsDNA. Approximately 15% of probes showed between-sample variation (P < 0.05) when the dsDNA percentage was between 12% and 35%. In contrast, only 3% of probes showed between-sample variation when the dsDNA percentage was 69% and 72%. Replication experiments of the 35% dsDNA and 72% dsDNA samples were used to separate sample variation from probe replication variation. The estimated SD of the sample-to-sample variation and of the probe replicates was lower in 72% dsDNA samples than in 35% dsDNA samples. Variation in the relative amount of double-stranded cDNA synthesized can be an important component of the imprecision in T7 RNA polymerase-based microarray expression analysis. © 2013 American Association for Clinical Chemistry
The Role of eIF4E Activity in Breast Cancer
2010-08-01
ORF, open reading frame; qPCR, quantitative PCR; RACE, rapid amplification of cDNA ends; RT, reverse transcriptase ; uORF, upstream ORF; UTR...were also performed using template lacking RT ( reverse transcriptase ): products were either undetectable or greatly reduced (>30000-fold less product...have previously shown that a 5’UTR expressed from the human AXIN2 gene contains a sixty nucleotide sequence that is predicted to form a stable stem
Chen, Tony H.H.
2012-01-01
The orange color of tiger lily (Lolium lancifolium ‘Splendens’) flowers is due, primarily, to the accumulation of two κ-xanthophylls, capsanthin and capsorubin. An enzyme, known as capsanthin-capsorubin synthase (CCS), catalyzes the conversion of antheraxanthin and violaxanthin into capsanthin and capsorubin, respectively. We cloned the gene for capsanthin-capsorubin synthase (Llccs) from flower tepals of L. lancifolium by the rapid amplification of cDNA ends (RACE) with a heterologous non-degenerate primer that was based on the sequence of a gene for lycopene β-cyclase (lcyB). The full-length cDNA of Llccs was 1,785 bp long and contained an open reading frame of 1,425 bp that encoded a polypeptide of 474 amino acids with a predicted N-terminal plastid-targeting sequence. Analysis by reverse transcription–PCR (RT–PCR) revealed that expression of Llccs was spatially and temporally regulated, with expression in flower buds and flowers of L. lancifolium but not in vegetative tissues. Stable overexpression of the Llccs gene in callus tissue of Iris germanica, which accumulates several xanthophylls including violaxanthin, the precursor of capsorubin, resulted in transgenic callus whose color had changed from its normal yellow to red-orange. This novel red-orange coloration was due to the accumulation of two non-native κ-xanthophylls, capsanthin and capsorubin, as confirmed by HPLC and ultraperformance liquid chromatography–tandem mass spectrometry (UPLC-MS/MS) analysis with authentic standards. Cloning of the Llccs gene should advance our understanding of the molecular and genetic mechanisms of the biosynthesis of κ-carotenoids in general and in the genus Lilium in particular, and will facilitate transgenic alterations of the colors of flowers and fruits of many plant species. PMID:23008421
Shen, Jian-Dong; Cai, Qiu-Feng; Yan, Long-Jie; Du, Cui-Hong; Liu, Guang-Ming; Su, Wen-Jin; Ke, Caihuan; Cao, Min-Jie
2015-12-01
Cathepsin L, an immune-related protein, was purified from the hepatopancreas of Pacific abalone (Haliotis discus hannai) by ammonium sulfate precipitation and column chromatographies of SP-Sepharose and Sephacryl S-200 HR. Purified cathepsin L appeared as two bands with molecular masses of 28.0 and 28.5 kDa (namely cathepsin La and Lb) on SDS-PAGE under reducing conditions, suggesting that it is a glycoprotein. Peptide mass fingerprinting (PMF) analysis revealed that peptide fragments of 95 amino acid residues was high similarity to cathepsin L of pearl oyster (Pinctada fucata). The optimal temperature and pH of cathepsin L were 35 °C and pH 5.5. Cathepsin L was particularly inhibited by cysteine proteinase inhibitors of E-64 and leupeptin, while it was activated by metalloproteinase inhibitors EDTA and EGTA. The full-length cathepsin L cDNA was further cloned from the hepatopancreas by rapid PCR amplification of cDNA ends (RACE). The open reading frame of the enzyme was 981 bp, encoding 327 amino acid residues, with a conserved catalytic triad (Cys134, His273 and Asn293), a potential N-glycosylation site and conserved ERFNIN, GNYD, and GCGG motifs, which are characteristics of cathepsin L. Western blot and proteinase activity analysis revealed that the expression and enzyme activity of cathepsin L were significantly up-regulated in hepatopancreas at 8 h following Vibrio parahaemolyticus infection, demonstrating that cathepsin L is involved in the innate immune system of abalone. Our present study for the first time reported the purification, characterization, molecular cloning, and tissue expression of cathepsin L in abalone. Copyright © 2015 Elsevier Ltd. All rights reserved.
Molecular and analysis of a phenylalanine ammonia-lyase gene (LrPAL2) from Lycoris radiata.
Jiang, Yumei; Xia, Bing; Liang, Lijian; Li, Xiaodan; Xu, Sheng; Peng, Feng; Wang, Ren
2013-03-01
Phenylalanine ammonia-lyase (PAL), the first enzyme of phenylpropanoid biosynthesis, participates in the biosynthesis of flavonoids, lignins, stilbenes and many other compounds. In this study, we cloned a 2,326 bp full-length PAL2 gene from Lycoris radiata by using degenerate oligonucleotide primer PCR (DOP-PCR) and the rapid amplification of cDNA ends method. The cDNA contains a 2,124 bp coding region encoding 707 amino acids. The LrPAL2 shares about 77.0 % nucleic acid identity and 83 % amino acid identity with LrPAL1. Furthermore, genome sequence analysis demonstrated that LrPAL2 gene contains one intron and two exons. The 5' flanking sequence of LrPAL2 was also cloned by self-formed adaptor PCR (SEFA-PCR), and a group of putative cis-acting elements such as TATA box, CAAT box, G box, TC-rich repeats, CGTCA motif and TCA-element were identified. The LrPAL2 was detected in all tissues examined, with high abundance in bulbs at leaf sprouting stage and in petals at blooming stage. Besides, LrPAL2 drastically responded to MJ, SNP and UV, moderately responded to GA and SA, and a little increased under wounding. Comparison of LrPAL2 expression and LrPAL1 expression demonstrated that LrPAL2 can be more significantly induced than LrPAL1 under the above treatments, and LrPAL2 transcripts accumulated prominently at blooming stage, especially in petals, while LrPAL1 transcripts did not accumulated significantly at blooming stage. All these results suggested that LrPAL2 might play distinct roles in different branches of the phenylpropanoid pathway.
Chávez-Mardones, Jacqueline; Valenzuela-Muñoz, Valentina; Núñez-Acuña, Gustavo; Maldonado-Aguayo, Waleska; Gallardo-Escárate, Cristian
2013-09-01
Ferritin has been identified as the principal protein of iron storage and iron detoxification, playing a pivotal role for the cellular homeostasis in living organisms. However, recent studies in marine invertebrates have suggested its association with innate immune system. In the present study, one Ferritin subunit was identified from the gastropod Concholepas concholepas (CcFer), which was fully characterized by Rapid Amplification of cDNA Ends technique. Simultaneously, a challenge test was performed to evaluate the immune response against Vibrio anguillarum. The full length of cDNA Ccfer was 1030 bp, containing 513 bp of open reading frame that encodes to 170 amino acid peptide, which was similar to the Ferritin H subunit described in vertebrates. Untranslated Regions (UTRs) were identified with a 5'UTR of 244 bp that contains iron responsive element (IRE), and a 3'UTR of 273 bp. The predicted molecular mass of deduced amino acid of CcFer was 19.66 kDa and isoelectric point of 4.92. Gene transcription analysis revealed that CcFer increases against infections with V. anguillarum, showing a peak expression at 6 h post-infection. Moreover, a single nucleotide polymorphism was detected at -64 downstream 5'UTR sequence (SNP-64). Quantitative real time analysis showed that homozygous mutant allele (TT) was significantly associated with higher expression levels of the challenged group compared to wild (CC) and heterozygous (CT) variants. Our findings suggest that CcFer is associated to innate immune response in C. concholepas and that the presence of SNPs may involve differential transcriptional expression of CcFer. Copyright © 2013 Elsevier Ltd. All rights reserved.
Magnotta, Scot M; Gogarten, Johann Peter
2002-01-01
Background Vacuolar type H+-ATPases play a critical role in the maintenance of vacuolar homeostasis in plant cells. V-ATPases are also involved in plants' defense against environmental stress. This research examined the expression and regulation of the catalytic subunit of the vacuolar type H+-ATPase in Arabidopsis thaliana and the effect of environmental stress on multiple transcripts generated by this gene. Results Evidence suggests that subunit A of the vacuolar type H+-ATPase is encoded by a single gene in Arabidopsis thaliana. Genome blot analysis showed no indication of a second subunit A gene being present. The single gene identified was shown by whole RNA blot analysis to be transcribed in all organs of the plant. Subunit A was shown by sequencing the 3' end of multiple cDNA clones to exhibit multi site polyadenylation. Four different poly (A) tail attachment sites were revealed. Experiments were performed to determine the response of transcript levels for subunit A to environmental stress. A PCR based strategy was devised to amplify the four different transcripts from the subunit A gene. Conclusions Amplification of cDNA generated from seedlings exposed to cold, salt stress, and etiolation showed that transcript levels for subunit A of the vacuolar type H+-ATPase in Arabidopsis were responsive to stress conditions. Cold and salt stress resulted in a 2–4 fold increase in all four subunit A transcripts evaluated. Etiolation resulted in a slight increase in transcript levels. All four transcripts appeared to behave identically with respect to stress conditions tested with no significant differential regulation. PMID:11985780
R1, a novel repressor of the human monoamine oxidase A.
Chen, Kevin; Ou, Xiao-Ming; Chen, Gao; Choi, Si Ho; Shih, Jean C
2005-03-25
Monoamine oxidase catalyzes the oxidative deamination of a number of neurotransmitters. A deficiency in monoamine oxidase A results in aggressive behavior in both humans and mice. Studies on the regulation of monoamine oxidase A gene expression have shown that the Sp1 family is important for monoamine oxidase A expression. To search for novel transcription factors, the sequences of three Sp1 sites in the monoamine oxidase A core promoter were used in the yeast one-hybrid system to screen a human cDNA library. A novel repressor, R1 (RAM2), has been cloned. The R1 cDNA encodes a protein with 454 amino acids and an open reading frame at the 5'-end. The transfection of R1 in a human neuroblastoma cell line, SK-N-BE (2)-C, inhibited the monoamine oxidase A promoter and enzymatic activity. The degree of inhibition of monoamine oxidase A by R1 correlated with the level of R1 protein expression. R1 was also found to repress monoamine oxidase A promoter activity within a natural chromatin environment. A gel-shift assay indicated that the endogenous R1 protein in SK-N-BE (2)-C cells interacted with the R1 binding sequence. R1 also bound directly to the natural monoamine oxidase A promoter in vivo as shown by chromatin immunoprecipitation assay. Immunocytochemical analysis showed that R1 was expressed in both cytosol and nucleus, which suggested a role for R1 in transcriptional regulation. Northern blot analysis revealed the presence of endogenous R1 mRNA in human brain and peripheral tissues. Taken together, this study shows that R1 is a novel repressor that inhibits monoamine oxidase A gene expression.
HIP1-ALK, a novel fusion protein identified in lung adenocarcinoma.
Hong, Mineui; Kim, Ryong Nam; Song, Ji-Young; Choi, So-Jung; Oh, Ensel; Lira, Maruja E; Mao, Mao; Takeuchi, Kengo; Han, Joungho; Kim, Jhingook; Choi, Yoon-La
2014-03-01
The most common mechanism underlying overexpression and activation of anaplastic lymphoma kinase (ALK) in non-small-cell lung carcinoma could be attributed to the formation of a fusion protein. To date, five fusion partners of ALK have been reported, namely, echinoderm microtubule associated protein like 4, tropomyosin-related kinase-fused gene, kinesin family member 5B, kinesin light chain 1, and protein tyrosine phosphatase, nonreceptor type 3. In this article, we report a novel fusion gene huntingtin interacting protein 1 (HIP1)-ALK, which is conjoined between the huntingtin-interacting protein 1 gene HIP1 and ALK. Reverse-transcriptase polymerase chain reaction and immunohistochemical analysis were used to detect this fusion gene's transcript and protein expression, respectively. We had amplified the full-length cDNA sequence of this novel fusion gene by using 5'-rapid amplification of cDNA ends. The causative genomic translocation t(2;7)(p23;q11.23) for generating this novel fusion gene was verified by using genomic sequencing. The examined adenocarcinoma showed predominant acinar pattern, and ALK immunostaining was localized to the cytoplasm, with intense staining in the submembrane region. In break-apart, fluorescence in situ hybridization analysis for ALK, split of the 5' and 3' probe signals, and isolated 3' signals were observed. Reverse-transcriptase polymerase chain reaction revealed that the tumor harbored a novel fusion transcript in which exon 21 of HIP1 was fused to exon 20 of ALK in-frame. The novel fusion gene and its protein HIP1-ALK harboring epsin N-terminal homology, coiled-coil, juxtamembrane, and kinase domains, which could play a role in carcinogenesis, could become diagnostic and therapeutic target of the lung adenocarcinoma and deserve a further study in the future.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chen, M.; Auerbach, W.; Buchwald, M.
1994-09-01
Fanconi anemia (FA) is an autosomal recessive disease characterized by bone marrow failure, congenital malformations and predisposition to malignancies. The gene responsible for the defect in FA group C has been cloned and designated the Fanconi Anemia Complementation Group C gene (FACC). A murine cDNA for this gene (Facc) was also cloned. Here we report our progress in the establishment of a mouse model for FA. The mouse Facc cDNA was used as probe to screen a genomic library of mouse strain 129. More than twenty positive clones were isolated. Three of them were mapped and found to be overlappingmore » clones, encompassing the genomic region from exon 8 to the end of the 3{prime} UTR of the mouse cDNA. A targeting vector was constructed using the most 5{prime} mouse genomic sequence available. The end result of the homologous recombination is that exon 8 is deleted and the neo gene is inserted. The last exon, exon 14, is essential for the complementing function of the FACC gene product; the disruption in the middle of the murine Facc gene should render this locus biologically inactive. This targeting vector was linearized and electroporated into R1 embryonic stem (ES) cells which were derived from the 129 mouse. Of 102 clones screened, 19 positive cell lines were identified. Four targeted cell lines have been used to produce chimeric mice. 129-derived ES cells were aggregated ex vivo into the morulas derived from CD1 mice and then implanted into foster mothers. 22 chimeras have been obtained. Moderately and strongly chimeric mice have been bred to test for germline transmission. Progeny with the expected coat color derived from 2 chimeras are currently being examined to confirm transmission of the targeted allele.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hartmann, Nils; Scherthan, Harry
The telomere binding proteins TRF1 and TRF2 maintain and protect chromosome ends and confer karyotypic stability. Chromosome evolution in the genus Muntiacus is characterized by numerous tandem (end-to-end) fusions. To study TRF1 and TRF2 telomere binding proteins in Muntiacus species, we isolated and characterized the TERF1 and -2 genes from Indian muntjac (Muntiacus muntjak vaginalis; 2n = 6 female) and from Chinese muntjac (Muntiacus reveesi; 2n = 46). Expression analysis revealed that both genes are ubiquitously expressed and sequence analysis identified several transcript variants of both TERF genes. Control experiments disclosed a novel testis-specific splice variant of TERF1 in humanmore » testes. Amino acid sequence comparisons demonstrate that Muntiacus TRF1 and in particular TRF2 are highly conserved between muntjac and human. In vivo TRF2-GFP and immuno-staining studies in muntjac cell lines revealed telomeric TRF2 localization, while deletion of the DNA binding domain abrogated this localization, suggesting muntjac TRF2 represents a functional telomere protein. Finally, expression analysis of a set of telomere-related genes revealed their presence in muntjac fibroblasts and testis tissue, which suggests the presence of a conserved telomere complex in muntjacs. However, a deviation from the common theme was noted for the TERT gene, encoding the catalytic subunit of telomerase; TERT expression could not be detected in Indian or Chinese muntjac cDNA or genomic DNA using a series of conserved primers, while TRAP assay revealed functional telomerase in Chinese muntjac testis tissues. This suggests muntjacs may harbor a diverged telomerase sequence.« less
Lardizabal, K D; Metz, J G; Sakamoto, T; Hutton, W C; Pollard, M R; Lassner, M W
2000-03-01
Wax synthase (WS, fatty acyl-coenzyme A [coA]: fatty alcohol acyltransferase) catalyzes the final step in the synthesis of linear esters (waxes) that accumulate in seeds of jojoba (Simmondsia chinensis). We have characterized and partially purified this enzyme from developing jojoba embryos. A protein whose presence correlated with WS activity during chromatographic fractionation was identified and a cDNA encoding that protein was cloned. Seed-specific expression of the cDNA in transgenic Arabidopsis conferred high levels of WS activity on developing embryos from those plants. The WS sequence has significant homology with several Arabidopsis open reading frames of unknown function. Wax production in jojoba requires, in addition to WS, a fatty acyl-CoA reductase (FAR) and an efficient fatty acid elongase system that forms the substrates preferred by the FAR. We have expressed the jojoba WS cDNA in Arabidopsis in combination with cDNAs encoding the jojoba FAR and a beta-ketoacyl-CoA synthase (a component of fatty acid elongase) from Lunaria annua. (13)C-Nuclear magnetic resonance analysis of pooled whole seeds from transgenic plants indicated that as many as 49% of the oil molecules in the seeds were waxes. Gas chromatography analysis of transmethylated oil from individual seeds suggested that wax levels may represent up to 70% (by weight) of the oil present in those seeds.
Matthews, R J; Cahir, E D; Thomas, M L
1990-01-01
Protein-tyrosine-phosphatases (protein-tyrosine-phosphate phosphohydrolase, EC 3.13.48) have been implicated in the regulation of cell growth; however, to date few tyrosine phosphatases have been characterized. To identify additional family members, the cDNA for the human tyrosine phosphatase leukocyte common antigen (LCA; CD45) was used to screen, under low stringency, a mouse pre-B-cell cDNA library. Two cDNA clones were isolated and sequence analysis predicts a protein sequence of 793 amino acids. We have named the molecule LRP (LCA-related phosphatase). RNA transfer analysis indicates that the cDNAs were derived from a 3.2-kilobase mRNA. The LRP mRNA is transcribed in a wide variety of tissues. The predicted protein structure can be divided into the following structural features: a short 19-amino acid leader sequence, an exterior domain of 123 amino acids that is predicted to be highly glycosylated, a 24-amino acid membrane-spanning region, and a 627-amino acid cytoplasmic region. The cytoplasmic region contains two approximately 260-amino acid domains, each with homology to the tyrosine phosphatase family. One of the cDNA clones differed in that it had a 108-base-pair insertion that, while preserving the reading frame, would disrupt the first protein-tyrosine-phosphatase domain. Analysis of genomic DNA indicates that the insertion is due to an alternatively spliced exon. LRP appears to be evolutionarily conserved as a putative homologue has been identified in the invertebrate Styela plicata. Images PMID:2162042
NASA Astrophysics Data System (ADS)
Reed, Jason; Hsueh, Carlin; Mishra, Bud; Gimzewski, James K.
2008-09-01
We have used an atomic force microscope to examine a clinically derived sample of single-molecule gene transcripts, in the form of double-stranded cDNA, (c: complementary) obtained from human cardiac muscle without the use of polymerase chain reaction (PCR) amplification. We observed a log-normal distribution of transcript sizes, with most molecules being in the range of 0.4-7.0 kilobase pairs (kb) or 130-2300 nm in contour length, in accordance with the expected distribution of mRNA (m: messenger) sizes in mammalian cells. We observed novel branching structures not previously known to exist in cDNA, and which could have profound negative effects on traditional analysis of cDNA samples through cloning, PCR and DNA sequencing.
Primary culture of cat intestinal epithelial cells in vitro and the cDNA library construction.
Zhao, Gui Hua; Liu, Ye; Cheng, Yun Tang; Zhao, Qing Song; Qiu, Xiao; Xu, Chao; Xiao, Ting; Zhu, Song; Liu, Gong Zhen; Yin, Kun
2018-06-26
Felids are the only definitive hosts of Toxoplasma gondii. To lay a foundation for screening the T. gondii-felids interaction factors, we have developed a reproducible primary culture method for cat intestinal epithelial cells (IECs). The primary IECs were isolated from a new born cat's small intestine jejunum region without food ingress, and respectively in vitro cultured by tissue cultivation and combined digestion method with collagenase XI and dispase I, then purified by trypsinization. After identification, the ds cDNA of cat IECs was synthesized for constructing pGADT7 homogenization three-frame plasmid, and transformed into the yeast Y187 for generating the cDNA library. Our results indicated that cultivation of primary cat IECs relays on combined digestion to form polarized and confluent monolayers within 3 days with typical features of normal epithelial cells. The purified cells cultured by digestion method were identified to be nature intestinal epithelial cells using immunohistochemical analysis and were able to maintain viability for at least 15 passages. The homogenizable ds cDNA, which is synthesized from the total RNA extracted from our cultured IECs, distributed among 0.5-2.0 kb, and generated satisfying three-frame cDNA library with the capacity of 1.2 × 106 and the titer of 5.2 × 107 pfu/mL. Our results established an optimal method for the culturing and passage of cat IECs model in vitro, and laid a cDNA library foundation for the subsequent interaction factors screening by yeast two-hybrid.
Okamura, Yo; Inada, Mari; Elshopakey, Gehad Elsaid; Itami, Toshiaki
2018-05-16
Reactive oxygen species (ROS) play key roles in many physiological processes. In particular, the sterilization mechanism of bacteria using ROS in macrophages is a very important function for biological defense. Xanthine dehydrogenase (XDH) and aldehyde oxidase (AOX), members of the molybdo-flavoenzyme subfamily, are known to generate ROS. Although these enzymes occur in many vertebrates, some insects, and plants, little research has been conducted on XDHs and AOXs in crustaceans. Here, we cloned the entire cDNA sequences of XDH (MjXDH: 4328 bp) and AOX (MjAOX: 4425 bp) from Marsupenaeus japonicus (kuruma shrimp) using reverse transcriptase-polymerase chain reaction (RT-PCR) and random amplification of cDNA ends (RACE). Quantitative real-time RT-PCR transcriptional analysis revealed that MjXDH mRNA is highly expressed in heart and stomach tissues, whereas MjAOX mRNA is highly expressed in the lymphoid organ and intestinal tissues. Furthermore, expression of MjAOX was determined to be up-regulated in the lymphoid organ in response to Vibrio penaeicida at 48 and 72 h after injection; in contrast, hydrogen peroxide (H 2 O 2 ) concentrations increased significantly at 6, 12, 48, and 72 h after injection with white spot syndrome virus (WSSV) and at 72 h after injection with V. penaeicida. To the best of our knowledge, this study is the first to have identified and cloned XDH and AOX from a crustacean species.
Role of messenger RNA-ribosome complex in complementary DNA display.
Naimuddin, Mohammed; Ohtsuka, Isao; Kitamura, Koichiro; Kudou, Motonori; Kimura, Shinnosuke
2013-07-15
In vitro display technologies such as ribosome display and messenger RNA (mRNA)/complementary DNA (cDNA) display are powerful methods that can generate library diversities on the order of 10(10-14). However, in mRNA and cDNA display methods, the end use diversity is two orders of magnitude lower than initial diversity and is dependent on the downstream processes that act as limiting factors. We found that in our previous cDNA display protocol, the purification of protein fusions by the use of streptavidin matrices from cell-free translation mixtures had poor efficiency (∼10-15%) that seriously affected the diversity of the purified library. Here, we have investigated and optimized the protocols that provided remarkable purification efficiencies. The stalled ribosome in the mRNA-ribosome complex was found to impede this purification efficiency. Among the various conditions tested, destabilization of ribosomes by appropriate concentration of metal chelating agents in combination with an optimal temperature of 30°C were found to be crucial and effective for nearly complete isolation of protein fusions from the cell-free translation system. Thus, this protocol provided 8- to 10-fold increased efficiency of purification over the previous method and results in retaining the diversity of the library by approximately an order of magnitude-important for directed evolution. We also discuss the possible effects in the fabrication of protein chips. Copyright © 2013 Elsevier Inc. All rights reserved.
Hunter, T.C.; Knudtson, K.L.; Nadella, V.; Sol-Church, K.; Taylor, W.L.; Tighe, S.; Yueng, A.T.; Chittur, S.
2010-01-01
r1-1 Real-time reverse transcriptase quantitative PCR (RT-qPCR) is a widely used technique for measuring transcript levels. Priming strategy and reverse transcriptase enzyme are key elements that affect sensitivity and variability of RT-qPCR and microarray results. Previously, the Nucleic Acid Research Group (NARG) had conducted preliminary studies within the group to examine the effects of priming strategy on generating cDNA for use with qPCR. This year's study was an open study in which the qPCR community was invited to participate. Participants received the RT primers and RNA template and were asked to perform the RT reaction using their preferred reaction conditions. Each participating laboratory was provided at least two RNA templates of varying quality. The RT products were returned to the NARG and all RT reactions were used in a qPCR reaction. The qPCR assays looked at three genes of varying abundance, b-actin (high copy), b-glucuronidase (medium copy) and TATA binding protein (low copy) as well as varying distance from the 3? end for each transcript. Results from participating laboratories will be evaluated to determine the impact of priming strategy, assay chemistry and experimental setup on the RT step. Additionally, we will address the impact of RNA integrity on cDNA synthesis.
A cDNA clone highly expressed in ripe banana fruit shows homology to pectate lyases.
Dominguez-Puigjaner, E; LLop, I; Vendrell, M; Prat, S
1997-07-01
A cDNA clone (Ban17), encoding a protein homologous to pectate lyase, has been isolated from a cDNA library from climacteric banana fruit by means of differential screening. Northern analysis showed that Ban17 mRNA is first detected in early climacteric fruit, reaches a steady-state maximum at the climacteric peak, and declines thereafter in overripe fruit. Accumulation of the Ban17 transcript can be induced in green banana fruit by exogenous application of ethylene. The demonstrates that expression of this gene is under hormonal control, its induction being regulated by the rapid increase in ethylene production at the onset of ripening. The deduced amino acid sequence derived from the Ban17 cDNA shares significant identity with pectate lyases from pollen and plant pathogenic bacteria of the genus Erwinia. Similarity to bacterial pectate lyases that were proven to break down the pectic substances of the plant cell wall suggest that Ban17 might play a role in the loss of mesocarp firmness during fruit ripening.
Gardenia jasminoides Encodes an Inhibitor-2 Protein for Protein Phosphatase Type 1
NASA Astrophysics Data System (ADS)
Gao, Lan; Li, Hao-Ming
2017-08-01
Protein phosphatase-1 (PP1) regulates diverse, essential cellular processes such as cell cycle progression, protein synthesis, muscle contraction, carbohydrate metabolism, transcription and neuronal signaling. Inhibitor-2 (I-2) can inhibit the activity of PP1 and has been found in diverse organisms. In this work, a Gardenia jasminoides fruit cDNA library was constructed, and the GjI-2 cDNA was isolated from the cDNA library by sequencing method. The GjI-2 cDNA contains a predicted 543 bp open reading frame that encodes 180 amino acids. The bioinformatics analysis suggested that the GjI-2 has conserved PP1c binding motif, and contains a conserved phosphorylation site, which is important in regulation of its activity. The three-dimensional model structure of GjI-2 was buite, its similar with the structure of I-2 from mouse. The results suggest that GjI-2 has relatively conserved RVxF, FxxR/KxR/K and HYNE motif, and these motifs are involved in interaction with PP1.
Tissue Gene Expression Analysis Using Arrayed Normalized cDNA Libraries
Eickhoff, Holger; Schuchhardt, Johannes; Ivanov, Igor; Meier-Ewert, Sebastian; O'Brien, John; Malik, Arif; Tandon, Neeraj; Wolski, Eryk-Witold; Rohlfs, Elke; Nyarsik, Lajos; Reinhardt, Richard; Nietfeld, Wilfried; Lehrach, Hans
2000-01-01
We have used oligonucleotide-fingerprinting data on 60,000 cDNA clones from two different mouse embryonic stages to establish a normalized cDNA clone set. The normalized set of 5,376 clones represents different clusters and therefore, in almost all cases, different genes. The inserts of the cDNA clones were amplified by PCR and spotted on glass slides. The resulting arrays were hybridized with mRNA probes prepared from six different adult mouse tissues. Expression profiles were analyzed by hierarchical clustering techniques. We have chosen radioactive detection because it combines robustness with sensitivity and allows the comparison of multiple normalized experiments. Sensitive detection combined with highly effective clustering algorithms allowed the identification of tissue-specific expression profiles and the detection of genes specifically expressed in the tissues investigated. The obtained results are publicly available (http://www.rzpd.de) and can be used by other researchers as a digital expression reference. [The sequence data described in this paper have been submitted to the EMBL data library under accession nos. AL360374–AL36537.] PMID:10958641
Guo, Mei; Lu, Fuping; Pu, Jun; Bai, Dongqing; Du, Lianxiang
2005-11-01
A cDNA encoding for laccase was isolated from the ligninolytic fungus Trametes versicolor by RNA-PCR. The cDNA corresponds to the gene Lcc1, which encodes a laccase isoenzyme of 498 amino acid residues preceded by a 22-residue signal peptide. The Lcc1 cDNA was cloned into the vectors pMETA and pMETalphaA and expressed in Pichia methanolica. The laccase activity obtained with the Saccharomyces cerevisiae alpha-factor signal peptide was found to be twofold higher than that obtained with the native secretion signal peptide. The extracellular laccase activity in recombinants with the alpha-factor signal peptide was 9.79 U ml(-1). The presence of 0.2 mM copper was necessary for optimal activity of laccase. The expression level was favoured by lower cultivation temperature. The identity of the recombinant protein was further confirmed by immunodetection using Western blot analysis. As expected, the molecular mass of the mature laccase was 64.0 kDa, similar to that of the native form.
Xu, Y L; Li, L; Wu, K; Peeters, A J; Gage, D A; Zeevaart, J A
1995-07-03
The biosynthesis of gibberellins (GAs) after GA12-aldehyde involves a series of oxidative steps that lead to the formation of bioactive GAs. Previously, a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing), EC 1.14.11.-] was isolated by immunoscreening a cDNA library from liquid endosperm of pumpkin (Cucurbita maxima L.) with antibodies against partially purified GA 20-oxidase. Here, we report isolation of a genomic clone for GA 20-oxidase from a genomic library of the long-day species Arabidopsis thaliana Heynh., strain Columbia, by using the pumpkin cDNA clone as a heterologous probe. This genomic clone contains a GA 20-oxidase gene that consists of three exons and two introns. The three exons are 1131-bp long and encode 377 amino acid residues. A cDNA clone corresponding to the putative GA 20-oxidase genomic sequence was constructed with the reverse transcription-PCR method, and the identity of the cDNA clone was confirmed by analyzing the capability of the fusion protein expressed in Escherichia coli to convert GA53 to GA44 and GA19 to GA20. The Arabidopsis GA 20-oxidase shares 55% identity and > 80% similarity with the pumpkin GA 20-oxidase at the derived amino acid level. Both GA 20-oxidases share high homology with other 2-oxoglutarate-dependent dioxygenases (2-ODDs), but the highest homology was found between the two GA 20-oxidases. Mapping results indicated tight linkage between the cloned GA 20-oxidase and the GA5 locus of Arabidopsis. The ga5 semidwarf mutant contains a G-->A point mutation that inserts a translational stop codon in the protein-coding sequence, thus confirming that the GA5 locus encodes GA 20-oxidase. Expression of the GA5 gene in Ara-bidopsis leaves was enhanced after plants were transferred from short to long days; it was reduced by GA4 treatment, suggesting end-product repression in the GA biosynthetic pathway.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xu, Yun-Ling; Li, Li; Wu, Keqiang
1995-07-03
The biosynthesis of gibberellins (GAs) after GA{sub 12}-aldehyde involves a series of oxidative steps that lead to the formation of bioactive GAs. Previously, a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing), EC 1.14.11-] was isolated by immunoscreening a cDNA library from liquid endosperm of pumpkin (Cucurbita maxima L.) with antibodies against partially purified GA 20-oxidase. Here, we report isolation of a genomic clone for GA 20-oxidase from a genomic library of the long-day species Arabidopsis thaliana Heynh., strain Columbia, by using the pumpkin cDNA clone as a heterologous probe. This genomic clone contains a GA 20-oxidasemore » gene that consists of three exons and two introns. The three exons are 1131-bp long and encode 377 amino acid residues. A cDNA clone corresponding to the putative GA 20-oxidase genomic sequence was constructed with the reverse transcription-PCR method, and the identity of the cDNA clone was confirmed by analyzing the capability of the fusion protein expressed in Escherichia coli to convert GA{sub 53} to GA{sub 44} and GA{sub 19} to GA{sub 20}. The Arabidopsis GA 20-oxidase shares 55% identity and >80% similarity with the pumpkin GA 20-oxidase at the derived amino acid level. Both GA 20-oxidases share high homology with other 2-oxoglutarate-dependent dioxygenases (2-ODDs), but the highest homology was found between the two GA 20-oxidases. Mapping results indicated tight linkage between the cloned GA 20-oxidase and the GA locus of Arabidopsis. The ga5 semidwarf mutant contains a G {yields} A point mutation that inserts a translational stop codon in the protein-coding sequence, thus confirming that the GA5 locus encodes GA 20-oxidase. Expression of the GA5 gene in Arabidopsis leaves was enhanced after plants were transferred from short to long days; it was reduced by GA{sub 4} treatment, suggesting end-product repression in the GA biosynthetic pathway. 28 refs., 6 figs.« less
Zhang, Zhanhui; Zhang, Qizhong
2012-04-15
Heat shock protein 70 (HSP70) acts mostly as a molecular chaperone and plays a key role in the process of protecting cells by facilitating the folding of nascent peptides and the cellular stress response. The cDNA of the oyster Crassostrea hongkongensis hsp70 (designated chhsp70) was cloned with the techniques of homological cloning and rapid amplification of cDNA ends (RACE). The full-length chhsp70 cDNA was 2251bp, consisting of a 130bp 5'-UTR, 216bp 3'-UTR with a canonical polyadenylation signal sequence AATAAA and a poly (A) tail, and an open reading frame of 1905bp, which encoded a polypeptide of 634 amino acids. Three classical HSP signature motifs were detected in ChHSP70, i.e., DLGTT-S-V, IFDLGGGTFDVSIL and VVLVGGSTRIPKIQK. BLAST analysis revealed that the ChHSP70 shared high identity with other bivalve HSP70. The phylogenetic analysis indicated that the ChHSP70 was a member of the HSP70 family. The chhsp70 mRNA transcripts were quantified by fluorescent real time RT-PCR under both unstressed and stressed conditions, i. e., heat shock and exposure to Cu(2+) and malachite green. Basal expression level was similar in mantle, gill, digestive gland, and heart, but higher in muscle than that in the others. A similar trend showed that the chhsp70 mRNA expression significantly increased at 3-6h, then dropped and returned to control level at 24h in the five tissues and organs mentioned above after heat shock. A clearly time-dependent expression pattern of chhsp70 mRNA in digestive gland and gill of the oyster was observed after exposure of Cu(2+) and malachite green. In the two tissues, the chhsp70 mRNA level reached the maximum at 6h after malachite green exposure and on day 4 after Cu(2+) exposure, and then decreased progressively to the control level. The results indicated that ChHSP70 of the oyster is an inducible protein, and plays an important role in response to the Cu(2+) and malachite green polluted stress, so chhsp70 might be used as a potential molecular biomarker of above pollutants. Copyright © 2012 Elsevier B.V. All rights reserved.
Zhao, Jiu-Gang; Zhou, Li; Jin, Jun-Yan; Zhao, Zhe; Lan, Jing; Zhang, Yi-Bin; Zhang, Qi-Ya; Gui, Jian-Fang
2009-04-01
Defensins are a group of cationic antimicrobial peptides which play an important role in the innate immune system by exerting their antimicrobial activity against pathogens. In this study, we cloned a novel beta-defensin cDNA from medaka (Oryzias latipes) by rapid amplification of cDNA ends (RACE) technique. The full-length cDNA consists of 480 bp, and the open reading frame (ORF) of 189 bp encodes a polypeptide of 63 amino acids (aa) with a predicted molecular weight of 7.44 kDa. Its genomic organization was analyzed, and Southern blot detection confirmed that only one copy of beta-defensin exists in the medaka HNI strain. RT-PCR, Western blot and immunohistochemistry detections showed that the beta-defensin transcript and protein could be detected in eyes, liver, kidney, blood, spleen and gill, and obviously prevalent expression was found in eyes. Antimicrobial activity of the medaka beta-defensin was evaluated, and the antibacterial activity-specific to Gram-negative bacteria was revealed. Furthermore, the lipopolysaccharide (LPS), a major component of the outer membrane of Gram-negative bacteria, was demonstrated to be able to induce about 13-fold up-regulation of the beta-defensin within first 12h. In addition, promoter and promoter mutagenesis analysis were performed in the medaka beta-defensin. A proximal 100 base pair (bp) sequence (+26 to -73) and the next 1700 bp sequence (-73 to -1755) were demonstrated to be responsible for the basal promoter activity and for the transcription regulation. Three nuclear factor kappa B (NF-kappaB) cis-elements and a Sp1 cis-element were revealed by mutagenesis analysis to exist in the 5' flanking sequence, and they were confirmed to be responsible for the up-regulation of medaka beta-defensin stimulated by LPS. And, the Sp1 cis-element was further revealed to be related to the basal promoter activity, and transcriptional factor II D (TFIID) was found to be in charge of the gene transcription initiation. All the obtained data suggested that the novel medaka beta-defensin should have antimicrobial activity-specific to Gram-negative bacteria, and the antibacterial immune function should be modulated by NF-kappaB and Sp1.
2014-06-12
Transcriptome, Hydroides elegans, Next Generation Sequencing, Illumina HiSeq, PacBio SMRT, Biofilm , Metamorphosis 16. SECURITY CLASSIFICATION OF: a...to a bacterial cue from a bacterial biofilm . Recently, this cue has been identified to be a phage-tail like bacteriocin produced by the bacterium...submitted to the Huntsman Cancer Institute at the University of Utah and the subsequent isolation of mRNA was used for Illumina HiSeq 101 paired end
The Role of elF4E Activity in Breast Cancer
2011-08-01
protein; ORF, open reading frame; qPCR, quantitative PCR; RACE, rapid amplification of cDNA ends; RT, reverse transcriptase ; uORF, upstream ORF; UTR...Reactions were also performed using template lacking RT ( reverse transcriptase ): products were either undetectable or greatly reduced (>30000-fold less...that a 5’UTR expressed from the human AXIN2 gene contains a sixty nucleotide sequence that is predicted to form a stable stem-loop structure6. This
Hsieh, C M; Fukumoto, S; Layne, M D; Maemura, K; Charles, H; Patel, A; Perrella, M A; Lee, M E
2000-11-24
Aortic preferentially expressed gene (APEG)-1 is a 1.4-kilobase pair (kb) mRNA expressed in vascular smooth muscle cells and is down-regulated by vascular injury. An APEG-1 5'-end cDNA probe identified three additional isoforms. The 9-kb striated preferentially expressed gene (SPEG)alpha and the 11-kb SPEGbeta were found in skeletal muscle and heart. The 4-kb brain preferentially expressed gene was detected in the brain and aorta. We report here cloning of the 11-kb SPEGbeta cDNA. SPEGbeta encodes a 355-kDa protein that contains two serine/threonine kinase domains and is homologous to proteins of the myosin light chain kinase family. At least one kinase domain is active and capable of autophosphorylation. In the genome, all four isoforms share the middle three of the five exons of APEG-1, and they differ from each other by using different 5'- and 3'-ends and alternative splicing. We show that the expression of SPEGalpha and SPEGbeta is developmentally regulated in the striated muscle during C2C12 myoblast to myotube differentiation in vitro and cardiomyocyte maturation in vivo. This developmental regulation suggests that both SPEGalpha and SPEGbeta can serve as sensitive markers for striated muscle differentiation and that they may be important for adult striated muscle function.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gilchrist, Michael J.; Sobral, Daniel; Khoueiry, Pierre
Genome-wide resources, such as collections of cDNA clones encoding for complete proteins (full-ORF clones), are crucial tools for studying the evolution of gene function and genetic interactions. Non-model organisms, in particular marine organisms, provide a rich source of functional diversity. Marine organism genomes are, however, frequently highly polymorphic and encode proteins that diverge significantly from those of well-annotated model genomes. The construction of full-ORF clone collections from non-model organisms is hindered by the difficulty of predicting accurately the N-terminal ends of proteins, and distinguishing recent paralogs from highly polymorphic alleles. We also report a computational strategy that overcomes these difficulties,more » and allows for accurate gene level clustering of transcript data followed by the automated identification of full-ORFs with correct 5'- and 3'-ends. It is robust to polymorphism, includes paralog calling and does not require evolutionary proximity to well annotated model organisms. Here, we developed this pipeline for the ascidian Ciona intestinalis, a highly polymorphic member of the divergent sister group of the vertebrates, emerging as a powerful model organism to study chordate gene function, Gene Regulatory Networks and molecular mechanisms underlying human pathologies. Furthermore, using this pipeline we have generated the first full-ORF collection for a highly polymorphic marine invertebrate. It contains 19,163 full-ORF cDNA clones covering 60% of Ciona coding genes, and full-ORF orthologs for approximately half of curated human disease-associated genes.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hoefler, G.; Forstner, M.; Hulla, W.
1994-01-01
Enoyl-CoA hydratase:3-hydroxyacyl-CoA dehydrogenase bifunctional enzyme is one of the four enzymes of the peroxisomal, [beta]-oxidation pathway. Here, the authors report the full-length human cDNA sequence and the localization of the corresponding gene on chromosome 3q26.3-3q28. The cDNA sequence spans 3779 nucleotides with an open reading frame of 2169 nucleotides. The tripeptide SKL at the carboxy terminus, known to serve as a peroxisomal targeting signal, is present. DNA sequence comparison of the coding region showed an 80% homology between human and rat bifunctional enzyme cDNA. The 3[prime] noncoding sequence contains 117 nucleotides homologous to an Alu repeat. Based on sequence comparison,more » they propose that these nucleotides are a free left Alu arm with 86% homology to the Alu-J family. RNA analysis shows one band with highest intensity in liver and kidney. This cDNA will allow in-depth studies of molecular defects in patients with defective peroxisomal bifunctional enzyme. Moreover, it will also provide a means for studying the regulation of peroxisomal [beta]-oxidation in humans. 33 refs., 5 figs.« less
Complementary DNA libraries: an overview.
Ying, Shao-Yao
2004-07-01
The generation of complete and full-length cDNA libraries for potential functional assays of specific gene sequences is essential for most molecules in biotechnology and biomedical research. The field of cDNA library generation has changed rapidly in the past 10 yr. This review presents an overview of the method available for the basic information of generating cDNA libraries, including the definition of the cDNA library, different kinds of cDNA libraries, difference between methods for cDNA library generation using conventional approaches and a novel strategy, and the quality of cDNA libraries. It is anticipated that the high-quality cDNA libraries so generated would facilitate studies involving genechips and the microarray, differential display, subtractive hybridization, gene cloning, and peptide library generation.
Preparation of fluorescent-dye-labeled cDNA from RNA for microarray hybridization.
Ares, Manuel
2014-01-01
This protocol describes how to prepare fluorescently labeled cDNA for hybridization to microarrays. It consists of two steps: first, a mixture of anchored oligo(dT) and random hexamers is used to prime amine-modified cDNA synthesis by reverse transcriptase using a modified deoxynucleotide with a reactive amine group (aminoallyl-dUTP) and an RNA sample as a template. Second, the cDNA is purified and exchanged into bicarbonate buffer so that the amine groups in the cDNA react with the dye N-hydroxysuccinimide (NHS) esters, covalently joining the dye to the cDNA. The dye-coupled cDNA is purified again, and the amount of dye incorporated per microgram of cDNA is determined.
Cloning and Characterization of the Scalloped Region of Drosophila Melanogaster
Campbell, S. D.; Duttaroy, A.; Katzen, A. L.; Chovnick, A.
1991-01-01
Viable mutants of the scalloped gene (sd) of Drosophila melanogaster exhibit defects that can include gapping of the wing margin and ectopic bristle formation on the wing. Lethal sd alleles characterized in the present study now implicate this gene in a genetic function essential for normal development. In order to further characterize the developmental role of this gene, we have undertaken to clone and characterize the region where sd maps. A P[ry(+)] transposon insertion at 13F associated with sd([ry+2216]) served as the starting point for a 42-kb chromosomal walk. Molecular lesions associated with viable and lethal sd alleles were characterized by genomic hybridization analysis as a means of defining the extent of the gene. DNA rearrangements associated with 11 viable sd alleles map to a 2-kb interval which appears to be a ``hot spot'' for P element activity. Four of five recessive lethal sd mutations were mapped by denaturing gradient gel electrophoresis to a region 12-14 kb away from the region of viable lesions. In a sd(+) genotype, at least two structurally related and developmentally regulated transcripts hybridize to the genomic region where several sd lethal alleles have been localized. A viable mutation, sd(58), used for comparison in the transcript analysis, makes at least two slightly smaller transcripts that also hybridize to this region. Preliminary analysis of cDNA clones has identified three structurally related transcripts that hybridize to this genomic region. The 5' end of these transcripts extends into the 2-kb genomic region wherein DNA rearrangements were seen in the P element rearrangements. We favor the view that the transcripts represented by these cDNA clones are products of the sd gene. If this is true, the sd gene would include genomic sequences extending over at least 14 kb of the described chromosomal walk, and would appear to be subject to alternative splicing. PMID:1706292
Human retina-specific amine oxidase (RAO): cDNA cloning, tissue expression, and chromosomal mapping
DOE Office of Scientific and Technical Information (OSTI.GOV)
Imamura, Yutaka; Kubota, Ryo; Wang, Yimin
In search of candidate genes for hereditary retinal disease, we have employed a subtractive and differential cDNA cloning strategy and isolated a novel retina-specific cDNA. Nucleotide sequence analysis revealed an open reading frame of 2187 bp, which encodes a 729-amino-acid protein with a calculated molecular mass of 80,644 Da. The putative protein contained a conserved domain of copper amine oxidase, which is found in various species from bacteria to mammals. It showed the highest homology to bovine serum amine oxidase, which is believed to control the level of serum biogenic amines. Northern blot analysis of human adult and fetal tissuesmore » revealed that the protein is expressed abundantly and specifically in retina as a 2.7-kb transcript. Thus, we considered this protein a human retina-specific amine oxidase (RAO). The RAO gene (AOC2) was mapped by fluorescence in situ hybridization to human chromosome 17q21. We propose that AOC2 may be a candidate gene for hereditary ocular diseases. 38 refs., 4 figs.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Schlagnhaufer, C.D.; Arteca, R.N.; Pell, E.J.
When potato plants (Solanum tuberosum L. cv Norland) are subjected to oxone stress ethylene is emitted. Increases in ethylene production are often the result of increased expression of the enzyme ACC synthase. We used the polymerase chain reaction (PCR) to clone a cDNA encoding an ozone-induced ACC synthase. After treating potato plants with 300 ppb ozone for 4 h, RNA was extracted using a guanidinium isothiocyanate method. Using degenerate oligonucleotides corresponding to several conserved regions of ACC synthase sequences reported from different plant tissues as primers, we were able to reverse transcribe the RNA and amplify a cDNA for ACCmore » synthase. The clone is 1098 bp in length encoding for 386 amino acids comprising [approximately]80% of the protein. Computer analysis of the deduced amino acid sequence showed that our clone is 50-70% homologous with ACC synthase genes cloned from other plant tissues. Using the cDNA as a probe in northern analysis we found that there is little or no expression in control tissue: however there is a large increase in the expression of the ACC synthase message in response to ozone treatment.« less
Li, Hanbo; Su, Baofeng; Qin, Guyu; Ye, Zhi; Elaswad, Ahmed; Alsaqufi, Ahmed; Perera, Dayan A; Qin, Zhenkui; Odin, Ramji; Vo, Khoi; Drescher, David; Robinson, Dalton; Dong, Sheng; Zhang, Dan; Shang, Mei; Abass, Nermeen; Das, Sanjay K; Bangs, Max; Dunham, Rex A
2018-06-01
Repressible knockdown approaches were investigated to manipulate for transgenic sterilization in channel catfish, Ictalurus punctatus. Two primordial germ cell (PGC) marker genes, nanos and dead end, were targeted for knockdown and an off-target gene, vasa, was monitored. Two potentially copper-sensitive repressible promoters, yeast ctr3 (M) and ctr3-reduced (Mctr), were coupled with four knockdown strategies separately including: ds-sh RNA targeting the 5' end (N1) or 3' end (N2) of channel catfish nanos, full-length cDNA sequence of channel catfish nanos for overexpression (cDNA), and ds-sh RNA-targeting channel catfish dead end (DND). Each construct had an untreated group and treated group with copper sulfate as the repressor compound. Spawning rates of full-sibling P 1 fish exposed or not exposed to the constructs as treated and untreated embryos were 85 and 54%, respectively, indicating potential sterilization of fish and repression of the constructs. In F 1 fish, mRNA expressions of PGC marker genes for most constructs were downregulated in the untreated group and the knockdown was repressed in the treated group. Gonad development in transgenic, untreated F 1 channel catfish was reduced compared to non-transgenic fish for MctrN2, MN1, MN2, and MDND. For 3-year-old adults, gonad size in the transgenic untreated group was 93.4% smaller than the non-transgenic group for females and 92.3% for males. However, mean body weight of transgenic females (781.8 g) and males (883.8 g) was smaller than of non-transgenic counterparts (984.2 and 1254.3 g) at 3 years of age, a 25.8 and 41.9% difference for females and males, respectively. The results indicate that repressible transgenic sterilization is feasible for reproductive control of fish, but negative pleiotropic effects can result.
Circularization of the HIV-1 genome facilitates strand transfer during reverse transcription
Beerens, Nancy; Kjems, Jørgen
2010-01-01
Two obligatory DNA strand transfers take place during reverse transcription of a retroviral RNA genome. The first strand transfer involves a jump from the 5′ to the 3′ terminal repeat (R) region positioned at each end of the viral genome. The process depends on base pairing between the cDNA synthesized from the 5′ R region and the 3′ R RNA. The tertiary conformation of the viral RNA genome may facilitate strand transfer by juxtaposing the 5′ R and 3′ R sequences that are 9 kb apart in the linear sequence. In this study, RNA sequences involved in an interaction between the 5′ and 3′ ends of the HIV-1 genome were mapped by mutational analysis. This interaction appears to be mediated mainly by a sequence in the extreme 3′ end of the viral genome and in the gag open reading frame. Mutation of 3′ R sequences was found to inhibit the 5′–3′ interaction, which could be restored by a complementary mutation in the 5′ gag region. Furthermore, we find that circularization of the HIV-1 genome does not affect the initiation of reverse transcription, but stimulates the first strand transfer during reverse transcription in vitro, underscoring the functional importance of the interaction. PMID:20430859
Soares, Marcelo Bento; Bonaldo, Maria de Fatima
1998-01-01
This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods.
Soares, M.B.; Fatima Bonaldo, M. de
1998-12-08
This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods. 25 figs.
Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P
1988-02-01
Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators.
Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P
1988-01-01
Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators. Images PMID:3257578
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gault, J.; Zonana, J.; Zeltinger, J.
A conserved mouse genomic clone was used to identify a homologous human genomic clone (the DXS732E locus), which was subsequently employed to isolate cDNAs from a human fetal brain library. Nine unique overlapping cDNAs were isolated, and sequences analysis of 3.9 kb identified a putative 1 kb ORF. GRAIL analysis of the sequence supported the hypothesis that the putative ORF was coding sequence, and Prosite analysis of the putative ORF identified potential glycosylation and phosphorylation sites. The 5{prime} end of the gene maps within a CpG island, and comparison of cDNA sequences indicate the gene is alternatively spliced at itsmore » 3{prime} end. Northern analysis and RT-PCR indicate that two different sized messages appear to be expressed with the gene expressed in human fetal kidney, intestine, brain, and muscle. The gene is expressed in 77 day human skin, a time when hair follicle formation occurs. Anhidrotic ectodermal dysplasia (EDA) results in the abnormal morphogenesis of hair, teeth and eccrine sweat glands. A positional cloning strategy towards cloning the EDA gene had been used, and deletion and X-autosome translocation patients have been useful in further delimiting the EDA region. The present gene at the DXS732E locus is partially deleted in one EDA patient who does not have other apparent abnormalities. No rearrangements of the gene have been detected in two female X-autosome translocation EDA patients, nor in four additional male patients with submicroscopic molecular deletions.« less
Falentin, Hélène; Postollec, Florence; Parayre, Sandrine; Henaff, Nadine; Le Bivic, Pierre; Richoux, Romain; Thierry, Anne; Sohier, Danièle
2010-11-15
Bacterial communities of fermented foods are usually investigated by culture-dependent methods. Real-time quantitative PCR (qPCR) and reverse transcription (RT)-qPCR offer new possibilities to quantify the populations present and their metabolic activity. The aim of this work was to develop qPCR and RT-qPCR methods to assess the metabolic activity and the stress level of the two species used as ripening cultures in Emmental cheese manufacture, Propionibacterium freudenreichii and Lactobacillus paracasei. Three small scale (1/100) microbiologically controlled Emmental cheeses batches were manufactured and inoculated with Lactobacillus helveticus, Streptococcus thermophilus, P. freudenreichii and L. paracasei. At 12 steps of cheese manufacture and ripening, the populations of P. freudenreichii and L. paracasei were quantified by numerations on agar media and by qPCR. 16S, tuf and groL transcript levels were quantified by RT-qPCR. Sampling was carried out in triplicate. qPCR and RT-qPCR assessments were specific, efficient and linear. The quantification limit was 10(3) copies of cells or cDNA/g of cheese. Cell quantifications obtained by qPCR gave similar results than plate count for P. freudenreichii growth and 0.5 to 1 log lower in the stationary phase. Bacterial counts and qPCR quantifications showed that L. paracasei began to grow during the pressing step while P. freudenreichii began to grow from the beginning of ripening (in the cold room). Tuf cDNA quantification results suggested that metabolic activity of L. paracasei reached a maximum during the first part of the ripening (in cold room) and decreased progressively during ripening (in the warm room). Metabolic activity of P. freudenreichii was maximum at the end of cold ripening room and was stable during the first two weeks in warm room. After lactate exhaustion (after two weeks of warm room), the number of tuf cDNA decreased reflecting reduced metabolic activity. For L. paracasei, groL cDNA were stable during ripening. For P. freudenreichii, groL1 gene was highly-expressed during acidification, while groL2 gene highly expression was only observed at the end of the ripening stage after lactate (carbon substrate of P. freudenreichii) exhaustion. The potential use of 16S and tuf genes for the normalization of cDNA quantification throughout an Emmental cheese manufacture is discussed. For the first time, specific gene expression was performed by RT-qPCR yielding metabolic activity and stress response evaluation for L. paracasei and P. freudenreichii in cheese. Copyright © 2010 Elsevier B.V. All rights reserved.
Lardizabal, Kathryn D.; Metz, James G.; Sakamoto, Tetsuo; Hutton, William C.; Pollard, Michael R.; Lassner, Michael W.
2000-01-01
Wax synthase (WS, fatty acyl-coenzyme A [coA]: fatty alcohol acyltransferase) catalyzes the final step in the synthesis of linear esters (waxes) that accumulate in seeds of jojoba (Simmondsia chinensis). We have characterized and partially purified this enzyme from developing jojoba embryos. A protein whose presence correlated with WS activity during chromatographic fractionation was identified and a cDNA encoding that protein was cloned. Seed-specific expression of the cDNA in transgenic Arabidopsis conferred high levels of WS activity on developing embryos from those plants. The WS sequence has significant homology with several Arabidopsis open reading frames of unknown function. Wax production in jojoba requires, in addition to WS, a fatty acyl-CoA reductase (FAR) and an efficient fatty acid elongase system that forms the substrates preferred by the FAR. We have expressed the jojoba WS cDNA in Arabidopsis in combination with cDNAs encoding the jojoba FAR and a β-ketoacyl-CoA synthase (a component of fatty acid elongase) from Lunaria annua. 13C-Nuclear magnetic resonance analysis of pooled whole seeds from transgenic plants indicated that as many as 49% of the oil molecules in the seeds were waxes. Gas chromatography analysis of transmethylated oil from individual seeds suggested that wax levels may represent up to 70% (by weight) of the oil present in those seeds. PMID:10712527
Saini, M.; Palai, T. K.; Das, D. K.; Hatle, K. M.; Gupta, P. K.
2013-01-01
Interleukin-4 (IL-4) produced from Th2 cells modulates both innate and adaptive immune responses. It is a common belief that wild animals possess better immunity against diseases than domestic and laboratory animals; however, the immune system of wild animals is not fully explored yet. Therefore, a comparative study was designed to explore the wildlife immunity through characterisation of IL-4 cDNA of nilgai, a wild ruminant, and Indian buffalo, a domestic ruminant. Total RNA was extracted from peripheral blood mononuclear cells of nilgai and Indian buffalo and reverse transcribed into cDNA. Respective cDNA was further cloned and sequenced. Sequences were analysed in silico and compared with their homologues available at GenBank. The deduced 135 amino acid protein of nilgai IL-4 is 95.6% similar to that of Indian buffalo. N-linked glycosylation sequence, leader sequence, Cysteine residues in the signal peptide region, and 3′ UTR of IL-4 were found to be conserved across species. Six nonsynonymous nucleotide substitutions were found in Indian buffalo compared to nilgai amino acid sequence. Tertiary structure of this protein in both species was modeled, and it was found that this protein falls under 4-helical cytokines superfamily and short chain cytokine family. Phylogenetic analysis revealed a single cluster of ruminants including both nilgai and Indian buffalo that was placed distinct from other nonruminant mammals. PMID:24348167
Sequence of Spider Aciniform and Piriform Silks
2001-09-19
7/98nd subtan-6/01 4. TITLE AND SUBTITLE Sequence of Spider Aciniform and Piriform Silks 5. FUNDING NUMBERS DAAD19-01-1-0569 6...aciniform glands from Argiope trifasciata were used to construct a cDNA library. The library was probed with various DNA probes based on known spider silk ...sequence in a number of other spider silks . The 5’end of the clone still appears to be repetitive sequence and thus it is unlikely to be a full-length
2009-11-01
expression knockout by shRNAs or antisense oligonucleotides ( ASOs ) might be useful in preventing the development of castration-recurrent prostate...cancer in prostate cancer patients. To this end, we have created functional shRNA vectors and ASOs capable of suppressing PCDH-PC expression and we have...containing PCDH-PC cDNA. Cell extracts were prepared 48 hrs after co-transfection and were electrophoresed on an SDS-PAGE gel and blotted onto a
Valdés-Alemán, Javier; Téllez-Sosa, Juan; Ovilla-Muñoz, Marbella; Godoy-Lozano, Elizabeth; Velázquez-Ramírez, Daniel; Valdovinos-Torres, Humberto; Gómez-Barreto, Rosa E; Martinez-Barnetche, Jesús
2014-01-01
High-throughput sequencing of the antibody repertoire is enabling a thorough analysis of B cell diversity and clonal selection, which may improve the novel antibody discovery process. Theoretically, an adequate bioinformatic analysis could allow identification of candidate antigen-specific antibodies, requiring their recombinant production for experimental validation of their specificity. Gene synthesis is commonly used for the generation of recombinant antibodies identified in silico. Novel strategies that bypass gene synthesis could offer more accessible antibody identification and validation alternatives. We developed a hybridization-based recovery strategy that targets the complementarity-determining region 3 (CDRH3) for the enrichment of cDNA of candidate antigen-specific antibody sequences. Ten clonal groups of interest were identified through bioinformatic analysis of the heavy chain antibody repertoire of mice immunized with hen egg white lysozyme (HEL). cDNA from eight of the targeted clonal groups was recovered efficiently, leading to the generation of recombinant antibodies. One representative heavy chain sequence from each clonal group recovered was paired with previously reported anti-HEL light chains to generate full antibodies, later tested for HEL-binding capacity. The recovery process proposed represents a simple and scalable molecular strategy that could enhance antibody identification and specificity assessment, enabling a more cost-efficient generation of recombinant antibodies.
Gritsun, T S; Gould, E A
1998-12-01
In less than 1 month we have constructed an infectious clone of attenuated tick-borne encephalitis virus (strain Vasilchenko) from 100 microl of unpurified virus suspension using long high fidelity PCR and a modified bacterial cloning system. Optimization of the 3' antisense primer concentration was essential to achieve PCR synthesis of an 11 kb cDNA copy of RNA from infectious virus. A novel system utilising two antisense primers, a 14-mer for reverse transcription and a 35-mer for long PCR, produced high yields of genomic length cDNA. Use of low copy number Able K cells and an incubation temperature of 28 degrees C increased the genetic stability of cloned cDNA. Clones containing 11 kb cDNA inserts produced colonies of reduced size, thus providing a positive selection system for full length clones. Sequencing of the infectious clone emphasised the improved fidelity of the method compared with conventional PCR and cloning methods. A simple and rapid strategy for genetic manipulation of the infectious clone is also described. These developments represent a significant advance in recombinant technology and should be applicable to positive stranded RNA viruses which cannot easily be purified or genetically manipulated.
Molecular analysis of two cDNA clones encoding acidic class I chitinase in maize.
Wu, S; Kriz, A L; Widholm, J M
1994-01-01
The cloning and analysis of two different cDNA clones encoding putative maize (Zea mays L.) chitinases obtained by polymerase chain reaction (PCR) and cDNA library screening is described. The cDNA library was made from poly(A)+ RNA from leaves challenged with mercuric chloride for 2 d. The two clones, pCh2 and pCh11, appear to encode class I chitinase isoforms with cysteine-rich domains (not found in pCh11 due to the incomplete sequence) and proline-/glycine-rich or proline-rich hinge domains, respectively. The pCh11 clone resembles a previously reported maize seed chitinase; however, the deduced proteins were found to have acidic isoelectric points. Analysis of all monocot chitinase sequences available to date shows that not all class I chitinases possess the basic isoelectric points usually found in dicotyledonous plants and that monocot class II chitinases do not necessarily exhibit acidic isoelectric points. Based on sequence analysis, the pCh2 protein is apparently synthesized as a precursor polypeptide with a signal peptide. Although these two clones belong to class I chitinases, they share only about 70% amino acid homology in the catalytic domain region. Southern blot analysis showed that pCh2 may be encoded by a small gene family, whereas pCh11 was single copy. Northern blot analysis demonstrated that these genes are differentially regulated by mercuric chloride treatment. Mercuric chloride treatment caused rapid induction of pCh2 from 6 to 48 h, whereas pCh11 responded only slightly to the same treatment. During seed germination, embryos constitutively expressed both chitinase genes and the phytohormone abscisic acid had no effect on the expression. The fungus Aspergillus flavus was able to induce both genes to comparable levels in aleurone layers and embryos but not in endosperm tissue. Maize callus growth on the same plate with A. flavus for 1 week showed induction of the transcripts corresponding to pCh2 but not to pCh11. These studies indicate that the different chitinase isoforms in maize might have different functions in the plant, since they show differential expression patterns under different conditions. PMID:7972490
Freije, J M; Díez-Itza, I; Balbín, M; Sánchez, L M; Blasco, R; Tolivia, J; López-Otín, C
1994-06-17
A cDNA coding for a new human matrix metalloproteinase (MMP) has been cloned from a cDNA library derived from a breast tumor. The isolated cDNA contains an open reading frame coding for a polypeptide of 471 amino acids. The predicted protein sequence displays extensive similarity to the previously known MMPs and presents all the structural features characteristic of the members of this protein family, including the well conserved PRCGXPD motif, involved in the latency of the enzyme and the zinc-binding domain (HEXGHXXXXXHS). In addition, this novel human MMP contains in its amino acid sequence several residues specific to the collagenase subfamily (Tyr-214, Asp-235, and Gly-237) and lacks the 9-residue insertion present in the stromelysins. According to these structural characteristics, the MMP described herein has been tentatively called collagenase-3, since it represents the third member of this subfamily, composed at present of fibroblast and neutrophil collagenases. The collagenase-3 cDNA was expressed in a vaccinia virus system, and the recombinant protein was able to degrade fibrillar collagens, providing support to the hypothesis that the isolated cDNA codes for an authentic collagenase. Northern blot analysis of RNA from normal and pathological tissues demonstrated the existence in breast tumors of three different mRNA species, which seem to be the result of the utilization of different polyadenylation sites present in the 3'-noncoding region of the gene. By contrast, no collagenase-3 mRNA was detected either by Northern blot or RNA polymerase chain reaction analysis with RNA from other human tissues, including normal breast, mammary fibroadenomas, liver, placenta, ovary, uterus, prostate, and parotid gland. On the basis of the increased expression of collagenase-3 in breast carcinomas and the absence of detectable expression in normal tissues, a possible role for this metalloproteinase in the tumoral process is proposed.
Laursen, J R; di Liu, H; Wu, X J; Yoshino, T P
1997-11-01
Sublethal heat-shock of cells of the Bge (Biomphalaria glabrata embryonic) snail cell line resulted in increased or new expression of metabolically labeled polypeptides of approximately 21.5, 41, 70, and 74 kDa molecular mass. Regulation of this response appeared to be at the transcriptional level since a similar protein banding pattern was seen upon SDS-PAGE/fluorographic analysis of polypeptides produced by in vitro translation of total RNA from cells subjected to heat shock. Using a yeast (Saccharomyces cerevisiae) 70-kDa heat-shock protein (HSP70) probe to screen a cDNA library from heat-treated Bge cells, we isolated a full-length cDNA clone encoding a putative Bge HSP70. The cDNA was 2453 bp in length and contained an open reading frame of 1908 bp encoding a 636-amino-acid polypeptide with calculated molecular mass of 70,740 Da. Comparison of a conserved region of 209 amino acid residues revealed > 80% identity between the deduced amino acid sequence of Bge HSP70 and that of yeast (81%), the human blood fluke Schistosoma mansoni (for which B. glabrata serves as intermediate host) (81%), Drosophila (81%), human (84%), and the marine gastropod Aplysia californica (88%, 90%). In addition to the extensive sharing of sequence homology, the identification of several eukaryotic HSP70 signature sequences and an N-linked glycosylation site characteristic of cytoplasmic HSPs strongly support the identity of the Bge cDNA as encoding an authentic HSP70. Results of a Northern blot analysis, using Bge HSP70 clone-specific probes, indicated that gene expression was heat inducible and not constitutively expressed. This is the first reported sequence of an inducible HSP70 from cells originating from a freshwater gastropod and provides a first step in the development of a genetic transformation system for molluscs of medical importance.
Xiao, Haihua; Yin, Liping; Xu, Xuefeng; Li, Tianzhong; Han, Zhenhai
2008-01-01
Background and Aims Iron deficiency is one of the most common nutritional disorders in plants, especially in fruit trees grown in calcareous soil. Malus baccata is widely used as an apple rootstock in north China and is highly resistant to low temperatures. There are few studies on iron absorption by this species at the molecular level. It is very important to understand the mechanism of iron uptake and transport in such woody plants. As a helpful tool, the aim of the present study was the cloning and functional analysis of NRAMP (natural resistance-associated macrophage protein) genes from the apple tree in relation to trafficking of micronutrients (Fe, Mn and Cd). Methods Reverse transcription-PCR (RT-PCR) combined with RACE (rapid amplification of cDNA ends) was adopted to isolate the full-length NRAMP1 cDNA. Southern blotting was used to test gene copy information, and northern blot was used to detect the gene's expression level. Complementation experiments using the yeast mutant strains DEY1453 and SLY8 were employed to confirm the iron- and manganese-transporting ability of NRAMP1 from apple, and inductively coupled plasma (ICP) spectrometry was used to measure Cd accumulation in yeast. NRAMP1–green fluorescent protein (GFP) fusion protein was used to determine the cellular localization in yeast. Key Results A 2090 bp cDNA was isolated and named MbNRAMP1. It encodes a predicted polypeptide of 551 amino acids. MbNRAMP1 exists in the M. baccata genome as a single copy and was expressed mainly in roots. MbNRAMP1 rescued the phenotype of yeast mutant strains DEY1453 and SLY8, and also increased Cd2+ sensitivity and accumulation. MbNRAMP1 expression in yeast was largely influenced by iron status, and the expression pattern of MbNRAMP1–GFP varied with the environmental iron nutrition status. Conclusions MbNRAMP1 encodes a functional metal transporter capable of mediating the distribution of ions as well as transport of the micronutrients, Fe and Mn, and the toxic metal, Cd. PMID:18819951
Walker, J; Tait, A
1997-11-01
A reverse-transcriptase polymerase chain reaction (PCR) procedure was used to isolate an Ostertagia circumcincta partial cDNA encoding a protein with general primary sequence features characteristic of members of the mitochondrial processing peptidase (MPP) subfamily of M16 metallopeptidases. The structural relationships of the predicted protein (Oc MPPX) with MPP subfamily proteins from other species (including the model free-living nematode Caenorhabditis elegans) were examined, and Northern analysis confirmed the expression of the Oc mppx gene in adult nematodes.
Assignment of Alzheimer's presenilin-2 (PS-2) gene to 1q42.1 by fluorescence in situ hybridization.
Takano, T; Sahara, N; Yamanouchi, Y; Mori, H
1997-01-17
Presenilin-2 (PS-2) was suggested to be localized on 1q31-42 based on linkage analysis and cDNA cloning. The final identification of PS-2 as the causal gene for early-onset familial Alzheimer's disease in Voga-German pedigrees was concluded based on the point mutation found in the candidate cDNA isolated from this familial AD. We present evidence of its physical genome mapping of PS-2 on chromosome 1q42.1 by fluorescence in situ hybridization method.
2006-07-01
Jeffrey S. S., Botstein D ., Brown P . O. Genome-wide analysis of DNA copy-number changes using cDNA microarrays. Nat. Genet., 23: 41-46, 1999 3...Duggan D . J., Bittner M., Chen Y., Meltzer P ., Trent J. M. Expression profiling using cDNA microarrays. Nat. Genet., 21: 10-14, 1999 4. Oh J. M...1999 5. Golub T. R., Slonim D . K., Tamayo P ., Huard C., Gaasenbeek M., Mesirov J. P ., Coller H., Loh M. L., Downing J. R., Caligiuri M. A
Song, Xiaomin; Wang, Jing; Wu, Fang; Li, Xu; Teng, Maikun; Gong, Weimin
2005-01-01
SPE10 is an antifungal protein isolated from the seeds of Pachyrrhizus erosus. cDNA encoding a 47 amino acid peptide was cloned by RT-PCR and the gene sequence proved SPE10 to be a new member of plant defensin family. The synthetic cDNA with codons preferred in yeast was cloned into the pPIC9 plasmid directly in-frame with the secretion signal alpha-mating factor, and highly expressed in methylotrophic Pichia pastoris. Activity assays showed the recombinant SPE10 inhibited specifically the growth of several pathogenic fungi as native SPE10. Circular dichroism and fluorescence spectroscopy analysis indicated that the native and recombinant protein should have same folding, though there are eight cystein residues in the sequence. Several evidence suggested SPE10 should be the first dimeric plant defensin reported so far.
Capsicum annuum dehydrin, an osmotic-stress gene in hot pepper plants.
Chung, Eunsook; Kim, Soo-Yong; Yi, So Young; Choi, Doil
2003-06-30
Osmotic stress-related genes were selected from an EST database constructed from 7 cDNA libraries from different tissues of the hot pepper. A full-length cDNA of Capsicum annuum dehydrin (Cadhn), a late embryogenesis abundant (lea) gene, was selected from the 5' single pass sequenced cDNA clones and sequenced. The deduced polypeptide has 87% identity with potato dehydrin C17, but very little identity with the dehydrin genes of other organisms. It contains a serine-tract (S-segment) and 3 conserved lysine-rich domains (K-segments). Southern blot analysis showed that 2 copies are present in the hot pepper genome. Cadhn was induced by osmotic stress in leaf tissues as well as by the application of abscisic acid. The RNA was most abundant in green fruit. The expression of several osmotic stress-related genes was examined and Cadhn proved to be the most abundantly expressed of these in response to osmotic stress.
Dialynas, D P; Murre, C; Quertermous, T; Boss, J M; Leiden, J M; Seidman, J G; Strominger, J L
1986-01-01
Complementary DNA (cDNA) encoding a human T-cell gamma chain has been cloned and sequenced. At the junction of the variable and joining regions, there is an apparent deletion of two nucleotides in the human cDNA sequence relative to the murine gamma-chain cDNA sequence, resulting simultaneously in the generation of an in-frame stop codon and in a translational frameshift. For this reason, the sequence presented here encodes an aberrantly rearranged human T-cell gamma chain. There are several surprising differences between the deduced human and murine gamma-chain amino acid sequences. These include poor homology in the variable region, poor homology in a discrete segment of the constant region precisely bounded by the expected junctions of exon CII, and the presence in the human sequence of five potential sites for N-linked glycosylation. Images PMID:3458221
Casein expression in cytotoxic T lymphocytes.
Grusby, M J; Mitchell, S C; Nabavi, N; Glimcher, L H
1990-01-01
A cDNA that expresses a mRNA restricted to cytotoxic T lymphocytes (CTL) and mammary tissue has been isolated and characterized. The deduced amino acid sequence from this cDNA shows extensive homology with the previously reported amino acid sequence for rat alpha-casein. Indeed, the presence of a six-residue-repeated motif that is specific for rodent alpha-caseins strongly supports the identification of this cDNA as mouse alpha-casein. Northern (RNA) blot analysis of many hematopoietic cell types revealed that this gene is restricted to CTL, being expressed in four of six CTL lines examined. Furthermore, CTL that express this gene were also found to express other members of the casein gene family, such as beta- and kappa-casein. These results suggest that caseins may be important in CTL function, and their potential role in CTL-mediated lysis is discussed. Images PMID:2395885
Sugihara, K; Hanagata, N; Dubinsky, Z; Baba, S; Karube, I
2000-11-01
Young plants of the common Okinawa mangrove species Bruguiera gymnorrhiza were transferred from freshwater to a medium with seawater salt level (500 mM NaCl). Two-dimensional gel electrophoresis revealed in the leaf extract of the plant a 33 kDa protein with pI 5.2, whose quantity increased as a result of NaCl treatment. The N-terminal amino acids sequence of this protein had a significant homology with mature region of oxygen evolving enhancer protein 1 (OEE1) precursor. The cloning of OEE1 precursor cDNA fragment was carried out by means of reverse transcription-PCR (RT-PCR) using degenerated primers. Both 3'- and 5'-regions were isolated by rapid amplification of cDNA ends (RACE) method. The deduced amino acid sequence consisted of 322 amino acids and was 87% identical to that of Nicotiana tabacum. In B. gymnorrhiza, the predicted amino acid sequence of the mature protein starts at the residue number 85 of the open reading frame. The first 84-amino acid residues correspond to a typical transit sequence for the signal directing OEE1 to its appropriate compartment of chloroplast. The expression of OEE1 was analyzed together with other OEE subunits and D1 protein of photosystem II. The transcript levels of all the three OEEs were enhanced by NaCl treatment, but the significant increase of D1 protein was not observed.
Feeding-Related Traits Are Affected by Dosage of the foraging Gene in Drosophila melanogaster
Allen, Aaron M.; Anreiter, Ina; Neville, Megan C.; Sokolowski, Marla B.
2017-01-01
Nutrient acquisition and energy storage are critical parts of achieving metabolic homeostasis. The foraging gene in Drosophila melanogaster has previously been implicated in multiple feeding-related and metabolic traits. Before foraging’s functions can be further dissected, we need a precise genetic null mutant to definitively map its amorphic phenotypes. We used homologous recombination to precisely delete foraging, generating the for0 null allele, and used recombineering to reintegrate a full copy of the gene, generating the {forBAC} rescue allele. We show that a total loss of foraging expression in larvae results in reduced larval path length and food intake behavior, while conversely showing an increase in triglyceride levels. Furthermore, varying foraging gene dosage demonstrates a linear dose-response on these phenotypes in relation to foraging gene expression levels. These experiments have unequivocally proven a causal, dose-dependent relationship between the foraging gene and its pleiotropic influence on these feeding-related traits. Our analysis of foraging’s transcription start sites, termination sites, and splicing patterns using rapid amplification of cDNA ends (RACE) and full-length cDNA sequencing, revealed four independent promoters, pr1–4, that produce 21 transcripts with nine distinct open reading frames (ORFs). The use of alternative promoters and alternative splicing at the foraging locus creates diversity and flexibility in the regulation of gene expression, and ultimately function. Future studies will exploit these genetic tools to precisely dissect the isoform- and tissue-specific requirements of foraging’s functions and shed light on the genetic control of feeding-related traits involved in energy homeostasis. PMID:28007892
Tetteh, Kevin K. A.; Loukas, Alex; Tripp, Cindy; Maizels, Rick M.
1999-01-01
Larvae of Toxocara canis, a nematode parasite of dogs, infect humans, causing visceral and ocular larva migrans. In noncanid hosts, larvae neither grow nor differentiate but endure in a state of arrested development. Reasoning that parasite protein production is orientated to immune evasion, we undertook a random sequencing project from a larval cDNA library to characterize the most highly expressed transcripts. In all, 266 clones were sequenced, most from both 3′ and 5′ ends, and similarity searches against GenBank protein and dbEST nucleotide databases were conducted. Cluster analyses showed that 128 distinct gene products had been found, all but 3 of which represented newly identified genes. Ninety-five genes were represented by a single clone, but seven transcripts were present at high frequencies, each composing >2% of all clones sequenced. These high-abundance transcripts include a mucin and a C-type lectin, which are both major excretory-secretory antigens released by parasites. Four highly expressed novel gene transcripts, termed ant (abundant novel transcript) genes, were found. Together, these four genes comprised 18% of all cDNA clones isolated, but no similar sequences occur in the Caenorhabditis elegans genome. While the coding regions of the four genes are dissimilar, their 3′ untranslated tracts have significant homology in nucleotide sequence. The discovery of these abundant, parasite-specific genes of newly identified lectins and mucins, as well as a range of conserved and novel proteins, provides defined candidates for future analysis of the molecular basis of immune evasion by T. canis. PMID:10456930
Lv, Ling-Ling; Duan, Jun; Xie, Jiang-Hui; Liu, Yu-Ge; Wei, Chang-Bin; Liu, Sheng-Hui; Zhang, Jian-Xia; Sun, Guang-Ming
2012-01-01
PISTILLATA (PI)-like genes are crucial regulators of flowering in angiosperms. A homologue of PI, designated as AcPI (Genbank accession number HQ717796), was isolated from pineapple cultivar Comte de Paris by reverse transcriptase polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). The cDNA sequence of AcPI is 907 bp in length and contains an open reading frame of 594 bp, which encodes a protein of 197 amino acids. The molecular weight was 2.29 kDa and the isoelectric point was 9.28. The alignment showed that AcPI had a high identity with CsPIC2 (78.6%), AoPI (77.4%), OrcPI (75.7%) and HPI2 (72.4%). Quantitative real-time polymerase chain reaction (qRT-PCR) analyses in different tissues showed that the expression pattern of AcPI was different from the B-class genes in eudicots. AcPI was expressed in all the tissues investigated. The expression level was very low in fruit stems, bracts, leaves and sepals, high in petals and carpels, and moderate in apical meristems, flesh and stamens. The qRT-PCR analyses in different stages indicated that the expression of AcPI reached the highest level at 40 days after flower inducement, when the multiple fruit and floral organs were forming. It proved the important role of AcPI in floral organs and fruit development. The 35S::AcPI transgenic Arabidopsis plants flowered earlier and had more inflorescences or branches than wild type plants. PMID:22312303
Lv, Ling-Ling; Duan, Jun; Xie, Jiang-Hui; Liu, Yu-Ge; Wei, Chang-Bin; Liu, Sheng-Hui; Zhang, Jian-Xia; Sun, Guang-Ming
2012-01-01
PISTILLATA (PI)-like genes are crucial regulators of flowering in angiosperms. A homologue of PI, designated as AcPI (Genbank accession number HQ717796), was isolated from pineapple cultivar Comte de Paris by reverse transcriptase polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). The cDNA sequence of AcPI is 907 bp in length and contains an open reading frame of 594 bp, which encodes a protein of 197 amino acids. The molecular weight was 2.29 kDa and the isoelectric point was 9.28. The alignment showed that AcPI had a high identity with CsPIC2 (78.6%), AoPI (77.4%), OrcPI (75.7%) and HPI2 (72.4%). Quantitative real-time polymerase chain reaction (qRT-PCR) analyses in different tissues showed that the expression pattern of AcPI was different from the B-class genes in eudicots. AcPI was expressed in all the tissues investigated. The expression level was very low in fruit stems, bracts, leaves and sepals, high in petals and carpels, and moderate in apical meristems, flesh and stamens. The qRT-PCR analyses in different stages indicated that the expression of AcPI reached the highest level at 40 days after flower inducement, when the multiple fruit and floral organs were forming. It proved the important role of AcPI in floral organs and fruit development. The 35S::AcPI transgenic Arabidopsis plants flowered earlier and had more inflorescences or branches than wild type plants.
Evidence for Phex haploinsufficiency in murine X-linked hypophosphatemia.
Wang, L; Du, L; Ecarot, B
1999-04-01
Mutations in the PHEX gene (phosphate-regulating gene with homology to endopeptidases on the X-chromosome) are responsible for X-linked hypophosphatemia (HYP). We previously reported the full-length coding sequence of murine Phex cDNA and provided evidence of Phex expression in bone and tooth. Here, we report the cloning of the entire 3.5-kb 3'UTR of the Phex gene, yielding a total of 6248 bp for the Phex transcript. Southern blot and RT-PCR analyses revealed that the 3' end of the coding sequence and the 3'UTR of the Phex gene, spanning exons 16 to 22, are deleted in Hyp, the mouse model for HYP. Northern blot analysis of bone revealed lack of expression of stable Phex mRNA from the mutant allele and expression of Phex transcripts from the wild-type allele in Hyp heterozygous females. Expression of the Phex protein in heterozygotes was confirmed by Western analysis with antibodies raised against a COOH-terminal peptide of the mouse Phex protein. Taken together, these results indicate that the dominant pattern of Hyp inheritance in mice is due to Phex haploinsufficiency.
Kim, Dong Hyun; Patnaik, Bharat Bhusan; Seo, Gi Won; Kang, Seong Min; Lee, Yong Seok; Lee, Bok Luel; Han, Yeon Soo
2013-11-01
We have identified novel ricin-type (R-type) lectin by sequencing of random clones from cDNA library of the coleopteran beetle, Tenebrio molitor. The cDNA sequence is comprised of 495 bp encoding a protein of 164 amino acid residues and shows 49% identity with galectin of Tribolium castaneum. Bioinformatics analysis shows that the amino acid residues from 35 to 162 belong to ricin-type beta-trefoil structure. The transcript was significantly upregulated after early hours of injection with peptidoglycans derived from Gram (+) and Gram (-) bacteria, beta-1, 3 glucan from fungi and an intracellular pathogen, Listeria monocytogenes suggesting putative function in innate immunity. Copyright © 2013 Elsevier Inc. All rights reserved.
Waltari, Eric; Jia, Manxue; Jiang, Caroline S; Lu, Hong; Huang, Jing; Fernandez, Cristina; Finzi, Andrés; Kaufmann, Daniel E; Markowitz, Martin; Tsuji, Moriya; Wu, Xueling
2018-01-01
Using 5' rapid amplification of cDNA ends, Illumina MiSeq, and basic flow cytometry, we systematically analyzed the expressed B cell receptor (BCR) repertoire in 14 healthy adult PBMCs, 5 HIV-1+ adult PBMCs, 5 cord blood samples, and 3 HIS-CD4/B mice, examining the full-length variable region of μ, γ, α, κ, and λ chains for V-gene usage, somatic hypermutation (SHM), and CDR3 length. Adding to the known repertoire of healthy adults, Illumina MiSeq consistently detected small fractions of reads with high mutation frequencies including hypermutated μ reads, and reads with long CDR3s. Additionally, the less studied IgA repertoire displayed similar characteristics to that of IgG. Compared to healthy adults, the five HIV-1 chronically infected adults displayed elevated mutation frequencies for all μ, γ, α, κ, and λ chains examined and slightly longer CDR3 lengths for γ, α, and λ. To evaluate the reconstituted human BCR sequences in a humanized mouse model, we analyzed cord blood and HIS-CD4/B mice, which all lacked the typical SHM seen in the adult reference. Furthermore, MiSeq revealed identical unmutated IgM sequences derived from separate cell aliquots, thus for the first time demonstrating rare clonal members of unmutated IgM B cells by sequencing.
Ning, ZhongHua; Hincke, Maxwell T.; Yang, Ning; Hou, ZhuoCheng
2014-01-01
Efficiently obtaining full-length cDNA for a target gene is the key step for functional studies and probing genetic variations. However, almost all sequenced domestic animal genomes are not ‘finished’. Many functionally important genes are located in these gapped regions. It can be difficult to obtain full-length cDNA for which only partial amino acid/EST sequences exist. In this study we report a general pipeline to obtain full-length cDNA, and illustrate this approach for one important gene (Ovocleidin-17, OC-17) that is associated with chicken eggshell biomineralization. Chicken OC-17 is one of the best candidates to control and regulate the deposition of calcium carbonate in the calcified eggshell layer. OC-17 protein has been purified, sequenced, and has had its three-dimensional structure solved. However, researchers still cannot conduct OC-17 mRNA related studies because the mRNA sequence is unknown and the gene is absent from the current chicken genome. We used RNA-Seq to obtain the entire transcriptome of the adult hen uterus, and then conducted de novo transcriptome assembling with bioinformatics analysis to obtain candidate OC-17 transcripts. Based on this sequence, we used RACE and PCR cloning methods to successfully obtain the full-length OC-17 cDNA. Temporal and spatial OC-17 mRNA expression analyses were also performed to demonstrate that OC-17 is predominantly expressed in the adult hen uterus during the laying cycle and barely at immature developmental stages. Differential uterine expression of OC-17 was observed in hens laying eggs with weak versus strong eggshell, confirming its important role in the regulation of eggshell mineralization and providing a new tool for genetic selection for eggshell quality parameters. This study is the first one to report the full-length OC-17 cDNA sequence, and builds a foundation for OC-17 mRNA related studies. We provide a general method for biologists experiencing difficulty in obtaining candidate gene full-length cDNA sequences. PMID:24676480
Construction of C35 gene bait recombinants and T47D cell cDNA library.
Yin, Kun; Xu, Chao; Zhao, Gui-Hua; Liu, Ye; Xiao, Ting; Zhu, Song; Yan, Ge
2017-11-20
C35 is a novel tumor biomarker associated with metastasis progression. To investigate the interaction factors of C35 in its high expressed breast cancer cell lines, we constructed bait recombinant plasmids of C35 gene and T47D cell cDNA library for yeast two-hybrid screening. Full length C35 sequences were subcloned using RT-PCR from cDNA template extracted from T47D cells. Based on functional domain analysis, the full-length C35 1-348bp was also truncated into two fragments C351-153bp and C35154-348bp to avoid auto-activation. The three kinds of C35 genes were successfully amplified and inserted into pGBKT7 to construct bait recombinant plasmids pGBKT7-C351-348bp, pGBKT7-C351-153bp and pGBKT7-C35154-348bp, then transformed into Y187 yeast cells by the lithium acetate method. Auto-activation and toxicity of C35 baits were detected using nutritional deficient medium and X-α-Gal assays. The T47D cell ds cDNA was generated by SMART TM technology and the library was constructed using in vivo recombination-mediated cloning in the AH109 yeast strain using a pGADT7-Rec plasmid. The transformed Y187/pGBKT7-C351-348bp line was intensively inhibited while the truncated Y187/pGBKT7-C35 lines had no auto-activation and toxicity in yeast cells. The titer of established cDNA library was 2 × 10 7 pfu/mL with high transformation efficiency of 1.4 × 10 6 , and the insert size of ds cDNA was distributed homogeneously between 0.5-2.0 kb. Our research generated a T47D cell cDNA library with high titer, and the constructed two C35 "baits" contained a respective functional immunoreceptor tyrosine based activation motif (ITAM) and the conserved last four amino acids Cys-Ile-Leu-Val (CILV) motif, and therefore laid a foundation for screening the C35 interaction factors in a BC cell line.
Zhang, Quan; Liu, Long; Zhu, Feng; Ning, ZhongHua; Hincke, Maxwell T; Yang, Ning; Hou, ZhuoCheng
2014-01-01
Efficiently obtaining full-length cDNA for a target gene is the key step for functional studies and probing genetic variations. However, almost all sequenced domestic animal genomes are not 'finished'. Many functionally important genes are located in these gapped regions. It can be difficult to obtain full-length cDNA for which only partial amino acid/EST sequences exist. In this study we report a general pipeline to obtain full-length cDNA, and illustrate this approach for one important gene (Ovocleidin-17, OC-17) that is associated with chicken eggshell biomineralization. Chicken OC-17 is one of the best candidates to control and regulate the deposition of calcium carbonate in the calcified eggshell layer. OC-17 protein has been purified, sequenced, and has had its three-dimensional structure solved. However, researchers still cannot conduct OC-17 mRNA related studies because the mRNA sequence is unknown and the gene is absent from the current chicken genome. We used RNA-Seq to obtain the entire transcriptome of the adult hen uterus, and then conducted de novo transcriptome assembling with bioinformatics analysis to obtain candidate OC-17 transcripts. Based on this sequence, we used RACE and PCR cloning methods to successfully obtain the full-length OC-17 cDNA. Temporal and spatial OC-17 mRNA expression analyses were also performed to demonstrate that OC-17 is predominantly expressed in the adult hen uterus during the laying cycle and barely at immature developmental stages. Differential uterine expression of OC-17 was observed in hens laying eggs with weak versus strong eggshell, confirming its important role in the regulation of eggshell mineralization and providing a new tool for genetic selection for eggshell quality parameters. This study is the first one to report the full-length OC-17 cDNA sequence, and builds a foundation for OC-17 mRNA related studies. We provide a general method for biologists experiencing difficulty in obtaining candidate gene full-length cDNA sequences.
cDNA cloning and analysis of betaine aldehyde dehydrogenase, a salt inducible enzyme in sugar beet
DOE Office of Scientific and Technical Information (OSTI.GOV)
McCue, K.F.; Hanson, A.D.
1990-05-01
Betaine accumulates and serves as a compatible osmolyte in some plants subjected to drought or salinity stress. The last enzyme in the betaine biosynthetic pathway is betaine aldehyde dehydrogenase (BADH). The activity of BADH increases in response to increasing salinity levels. This increase in activity corresponds to an increase in protein detectable by immunoblotting, and to an increase in the translatable BADH mRNA. BADH was cloned from a cDNA library constructed in {lambda}gt10 using poly(A){sup +} RNA from sugar beets salinized to 500 mM NaCl. cDNAs were size selected (>1kb) before ligation into the vector, and the library was screenedmore » with a spinach BADH cDNA probe. Three nearly full length clones obtained were confirmed as BADH by their nucleotide and deduced amino acid homology to spinach BADH. Clones averaged 1.8 kb and contained open reading frames of 500 amino acids at 80% identity with spinach BADH. RNA gel blot analysis of poly(A){sup +} RNA indicated that salinization to 500 mM NaCl resulted in a 5-fold increase of BADH mRNA level.« less
Ngo, J T; Bateman, J B; Cortessis, V; Sparkes, R S; Mohandas, T; Inana, G; Spence, M A
1989-05-01
Previous study has shown that the usual DNA marker for Norrie disease, the L1.28 probe which identifies the DXS7 locus, can recombine with the disease locus. In this study, we used a human ornithine aminotransferase (OAT) cDNA which detects OAT-related DNA sequences mapped to the same region on the X chromosome as that of the L1.28 probe to investigate the family with Norrie disease who exhibited the recombinational event. When genomic DNA from this family was digested with the PvuII restriction endonuclease, we found a restriction fragment length polymorphism (RFLP) of 4.2 kb in size. This fragment was absent in the affected males and cosegregated with the disease locus; we calculated a lod score of 0.602, at theta = 0.00. No deletion could be detected by chromosomal analysis or on Southern blots with other enzymes. These results suggest that one of the OAT-related sequences on the X chromosome may be in close proximity to the Norrie disease locus and represent the first report which indicates that the OAT cDNA may be useful for the identification of carrier status and/or prenatal diagnosis.
Yan, Xu; Bishop, David J.
2018-01-01
Gene expression analysis by quantitative PCR in skeletal muscle is routine in exercise studies. The reproducibility and reliability of the data fundamentally depend on how the experiments are performed and interpreted. Despite the popularity of the assay, there is a considerable variation in experimental protocols and data analyses from different laboratories, and there is a lack of consistency of proper quality control steps throughout the assay. In this study, we present a number of experiments on various steps of quantitative PCR workflow, and demonstrate how to perform a quantitative PCR experiment with human skeletal muscle samples in an exercise study. We also tested some common mistakes in performing qPCR. Interestingly, we found that mishandling of muscle for a short time span (10 mins) before RNA extraction did not affect RNA quality, and isolated total RNA was preserved for up to one week at room temperature. Demonstrated by our data, use of unstable reference genes lead to substantial differences in the final results. Alternatively, cDNA content can be used for data normalisation; however, complete removal of RNA from cDNA samples is essential for obtaining accurate cDNA content. PMID:29746477
Petersen, M; Sander, L; Child, R; van Onckelen, H; Ulvskov, P; Borkhardt, B
1996-06-01
Seven distinct partial cDNAs, similar in sequence to previously described polygalacturonases (PGs), were amplified from cDNA derived from rape pod wall, dehiscence zone and leaves by the polymerase chain reaction. Northern analysis showed that one clone, PG35-8, was expressed at low levels in the dehiscence zone during the first five weeks after anthesis but was very abundantly expressed at week 6. In contrast, no PG35-8-related RNA was detected in the pod wall. Our data suggest that there are temporal and spatial correlations between the breakdown of the middle lamella, of the dehiscence zone cells and the pattern of synthesis of PG35-8 transcripts which may indicate a role for this particular PG in rape pod dehiscence. PG35-8 was used to isolate five cDNA clones from a rape dehiscence zone cDNA library. Restriction enzyme analysis and partial sequencing revealed that they were derived from four highly homologous transcripts which are probably allelic forms of a single gene. One full-length clone, RDPG1, was completely sequenced. The predicted protein of RDPG1 showed its highest identity with PG from apple fruit with an identity of 52%.
Vettore, André L.; da Silva, Felipe R.; Kemper, Edson L.; Souza, Glaucia M.; da Silva, Aline M.; Ferro, Maria Inês T.; Henrique-Silva, Flavio; Giglioti, Éder A.; Lemos, Manoel V.F.; Coutinho, Luiz L.; Nobrega, Marina P.; Carrer, Helaine; França, Suzelei C.; Bacci, Maurício; Goldman, Maria Helena S.; Gomes, Suely L.; Nunes, Luiz R.; Camargo, Luis E.A.; Siqueira, Walter J.; Van Sluys, Marie-Anne; Thiemann, Otavio H.; Kuramae, Eiko E.; Santelli, Roberto V.; Marino, Celso L.; Targon, Maria L.P.N.; Ferro, Jesus A.; Silveira, Henrique C.S.; Marini, Danyelle C.; Lemos, Eliana G.M.; Monteiro-Vitorello, Claudia B.; Tambor, José H.M.; Carraro, Dirce M.; Roberto, Patrícia G.; Martins, Vanderlei G.; Goldman, Gustavo H.; de Oliveira, Regina C.; Truffi, Daniela; Colombo, Carlos A.; Rossi, Magdalena; de Araujo, Paula G.; Sculaccio, Susana A.; Angella, Aline; Lima, Marleide M.A.; de Rosa, Vicente E.; Siviero, Fábio; Coscrato, Virginia E.; Machado, Marcos A.; Grivet, Laurent; Di Mauro, Sonia M.Z.; Nobrega, Francisco G.; Menck, Carlos F.M.; Braga, Marilia D.V.; Telles, Guilherme P.; Cara, Frank A.A.; Pedrosa, Guilherme; Meidanis, João; Arruda, Paulo
2003-01-01
To contribute to our understanding of the genome complexity of sugarcane, we undertook a large-scale expressed sequence tag (EST) program. More than 260,000 cDNA clones were partially sequenced from 26 standard cDNA libraries generated from different sugarcane tissues. After the processing of the sequences, 237,954 high-quality ESTs were identified. These ESTs were assembled into 43,141 putative transcripts. Of the assembled sequences, 35.6% presented no matches with existing sequences in public databases. A global analysis of the whole SUCEST data set indicated that 14,409 assembled sequences (33% of the total) contained at least one cDNA clone with a full-length insert. Annotation of the 43,141 assembled sequences associated almost 50% of the putative identified sugarcane genes with protein metabolism, cellular communication/signal transduction, bioenergetics, and stress responses. Inspection of the translated assembled sequences for conserved protein domains revealed 40,821 amino acid sequences with 1415 Pfam domains. Reassembling the consensus sequences of the 43,141 transcripts revealed a 22% redundancy in the first assembling. This indicated that possibly 33,620 unique genes had been identified and indicated that >90% of the sugarcane expressed genes were tagged. PMID:14613979
Characterization of a monoclonal antibody and a cDNA for polyubiquitin of Amoeba proteus.
Lee, S Y; Kim, H J; Yoo, S Y; Ahn, T I
1998-01-01
A monoclonal antibody was obtained that reacts with many different proteins (14-200 kDa) of Amoeba proteus. By indirect immunofluorescence microscopy we found the antigens to be dispersed throughout the cytoplasm but were more concentrated in the nucleus. The antibody cross-reacted with proteins of Tetrahymena, Xenopus embryo, and mouse macrophages. Using the antibody as a probe we cloned a cDNA of 1.2 kb coding for ubiquitin in five repeats. Amino acid sequences of ameba's polyubiquitin showed the most variations among the nineteen polyubiquitins of other organisms compared. The well-conserved 20Ser and 55Thr residues were replaced with Gly and Ser, respectively. The 28Ala residue found in most organisms was replaced with Gln or Glu in the amoeba. Amoebae contained two ubiquitin-mRNAs that could be detected by Northern blot analysis using the cDNA as a probe. In an analysis for specificity, the antibody reacted with polyubiquitin and ubiquitin-fusion proteins larger than 14 kDa but not with monomeric ubiquitin. The antibody is a useful probe in the detection and characterization of proteins ubiquitinated in response to cellular stresses.
Han, Ying-Li; Hou, Cong-Cong; Du, Chen; Zhu, Jun-Quan
2017-01-01
Heat shock proteins 70 (HSP70s) are molecular chaperones that aid in protection against environmental stress. In this study, we cloned and characterized five members of the HSP70 family (designated as HSPa1a, HSC70-1, HSC70-2, HSPa4 and HSPa14) from Lateolabrax maculatus using rapid amplification cDNA ends (RACE). Multiple sequence alignment and structural analysis revealed that all members of the HSP70 family had a conserved domain architecture, with some distinguishing features unique to each HSP70. Quantitative real-time (qPCR) analysis revealed that all members of the HSP70 family were ubiquitously and differentially expressed in all major types of tissues, including testicular tissue. This indicated that HSP70s have vital and conserved biological functions, and may also function in the development of germinal cells. The expression of mRNA of the five HSP70 family members mRNA expression was significantly increased in the head kidney, intestine and gill after Vibrio harveyi challenge, suggesting that HSP70s play an important role in the immune response. Copyright © 2016 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Potier, M.C.; Dutriaux, A.; Lambolez, B.
1993-03-01
Ionotropic L-glutamate receptors form transmembrane channels permeant to cations which are involved in synaptic transmission. Nine different subunits coding for non-NMDA (N-methyl-D-aspartate) receptors have been cloned and sequenced in rat. One of them, the GluR5 subunit, has a high affinity binding site for kainate and is expressed in neurons of the developing and adult nervous system. The permeability of the GluR5 receptor channel is modulated by edition of the transcripts. In human, GluR1 and GluR2 cDNAs have been sequenced and mapped to chromosomes 5 and 4, respectively. Also, GluR3 and GluR4 genes have been mapped to chromosome X and 11,more » respectively. Screening of the YAC chromosome 21 library was performed by colony hybridization on nylon Hybond-N filters at high stringency, as previously described, with the pore located in the center of the rat cDNA. Two positive colonies were obtained and analyzed for their YAC content by PFGE and Southern blotting. Only one (HY128) contained a 450-kb YAC hybridizing to the central rat cDNA probe as well as to the 5[prime] and 3[prime] end probes. Since GluR5 and GluR6 are highly homologous in rat, a probe in the 3[prime] untranslated region of GluR6, showing low homology to GluR5, was synthetized by PCR. Sequences and positions of the PCR primers on the rat sequence (9) are from 5[prime] to 3[prime]: CGACAGAAGGTTGCCAGGT (sense, position 2690-2708)/GATGTTCTGCCTTCAGTTCCAC (antisense, 3314-3335). HY128 YAC did not hybridize to the GluR6 probe (data not shown). Southern blot of human genomic DNA and yeast DNA from HY128 clone cut with EcoRI and HindIII showed the same bands of more than 10 and 6.6 kb, respectively, when hybridized to the 3[prime] end rat cDNA probe (data not shown). This last result confirms the presence of human GluR5 gene in HY128.« less
Novel transcripts of the estrogen receptor α gene in channel catfish
Patino, Reynaldo; Xia, Zhenfang; Gale, William L.; Wu, Chunfa; Maule, Alec G.; Chang, Xiaotian
2000-01-01
Complementary DNA libraries from liver and ovary of an immature female channel catfish were screened with a homologous ERα cDNA probe. The hepatic library yielded two new channel catfish ER cDNAs that encode N-terminal ERα variants of different sizes. Relative to the catfish ERα (medium size; 581 residues) previously reported, these new cDNAs encode Long-ERα (36 residues longer) and Short-ERα (389 residues shorter). The 5′-end of Long-ERα cDNA is identical to that of Medium-ERα but has an additional 503-bp segment with an upstream, in-frame translation-start codon. Recombinant Long-ERα binds estrogen with high affinity (Kd = 3.4 nM), similar to that previously reported for Medium-ERα but lower than reported for catfish ERβ. Short-ERα cDNA encodes a protein that lacks most of the receptor protein and does not bind estrogen. Northern hybridization confirmed the existence of multiple hepatic ERα RNAs that include the size range of the ERα cDNAs obtained from the libraries as well as additional sizes. Using primers for RT-PCR that target locations internal to the protein-coding sequence, we also established the presence of several ERα cDNA variants with in-frame insertions in the ligand-binding and DNA-binding domains and in-frame or out-of-frame deletions in the ligand-binding domain. These internal variants showed patterns of expression that differed between the ovary and liver. Further, the ovarian library yielded a full-length, ERα antisense cDNA containing a poly(A) signal and tail. A limited survey of histological preparations from juvenile catfish by in situ hybridization using directionally synthesized cRNA probes also suggested the expression of ERα antisense RNA in a tissue-specific manner. In conclusion, channel catfish seemingly have three broad classes of ERα mRNA variants: those encoding N-terminal truncated variants, those encoding internal variants (including C-terminal truncated variants), and antisense mRNA. The sense variants may encode functional ERα or related proteins that modulate ERα or ERβ activity. The existence of ER antisense mRNA is reported in this study for the first time. Its role may be to participate in the regulation of ER gene expression.
Characterization and simulation of cDNA microarray spots using a novel mathematical model
Kim, Hye Young; Lee, Seo Eun; Kim, Min Jung; Han, Jin Il; Kim, Bo Kyung; Lee, Yong Sung; Lee, Young Seek; Kim, Jin Hyuk
2007-01-01
Background The quality of cDNA microarray data is crucial for expanding its application to other research areas, such as the study of gene regulatory networks. Despite the fact that a number of algorithms have been suggested to increase the accuracy of microarray gene expression data, it is necessary to obtain reliable microarray images by improving wet-lab experiments. As the first step of a cDNA microarray experiment, spotting cDNA probes is critical to determining the quality of spot images. Results We developed a governing equation of cDNA deposition during evaporation of a drop in the microarray spotting process. The governing equation included four parameters: the surface site density on the support, the extrapolated equilibrium constant for the binding of cDNA molecules with surface sites on glass slides, the macromolecular interaction factor, and the volume constant of a drop of cDNA solution. We simulated cDNA deposition from the single model equation by varying the value of the parameters. The morphology of the resulting cDNA deposit can be classified into three types: a doughnut shape, a peak shape, and a volcano shape. The spot morphology can be changed into a flat shape by varying the experimental conditions while considering the parameters of the governing equation of cDNA deposition. The four parameters were estimated by fitting the governing equation to the real microarray images. With the results of the simulation and the parameter estimation, the phenomenon of the formation of cDNA deposits in each type was investigated. Conclusion This study explains how various spot shapes can exist and suggests which parameters are to be adjusted for obtaining a good spot. This system is able to explore the cDNA microarray spotting process in a predictable, manageable and descriptive manner. We hope it can provide a way to predict the incidents that can occur during a real cDNA microarray experiment, and produce useful data for several research applications involving cDNA microarrays. PMID:18096047
Haufe, C C; Eismann, U; Deppisch, R M; Stein, G
2001-02-01
Dialysis-related amyloidosis is an important complication of long-term hemodialysis (HD) therapy with several pathogenetic factors. One of them is the influence of the dialyzer membrane type on the synthesis of beta2-microglobulin (beta2m). In vitro results are controversial. Thus, the hypothesis of whether in vivo beta2m generation is induced by the HD procedure and whether this induction depends on the type of the used dialyzer membrane should be tested. The aim of the present study was to investigate the influence of "biocompatible" high-flux versus "bioincompatible" low-flux HD on in vivo beta2m generation as well as the induction of the early activation gene c-fos in peripheral blood cells. Six nondiabetic HD patients [mean age 46 (21 to 69) years; Kt/V> 1.2] were included in a randomized crossover study using either a low-flux (cellulosic/cuprophan) or a high-flux (polyamide) dialyzer membrane. At the end of a four-week run-in period for each membrane, whole blood samples were taken before, immediately at, and four hours after the end of the dialysis session. MRNA was extracted, and after transcription to cDNA, quantitative polymerase chain reaction was performed for the beta2m gene, the early response gene c-fos, and the GAP-DH housekeeping gene. Based on the applied method for detection of specific mRNA, the results were given as ratio of beta2m or c-fos cDNA per GAP-DH cDNA. General cell activation during HD was indicated by increasing mRNA expression of c-fos related to the time course of the dialysis session, whereas beta2m did not change significantly. However, no difference was found when comparing the low-flux and the high-flux dialyzer membranes. Despite the evidence for activation of peripheral blood cells, as indicated by increasing c-fos message, no sign of beta2m mRNA induction during HD procedure with different dialyzer membranes was seen. Our results suggest that there is post-transcriptional regulation of beta2m generation and/or release as well as the influence of the dialyzer membrane type on post-translational processes, that is, advance glycation end products (AGE) or conformational modification of the beta2m protein. Furthermore, our data demonstrate that gene expression patterns during dialysis and/or uremia are not homogenous and need to be investigated further, especially with respect to the proinflammatory role of early leukocyte activation signals.
Error minimization algorithm for comparative quantitative PCR analysis: Q-Anal.
OConnor, William; Runquist, Elizabeth A
2008-07-01
Current methods for comparative quantitative polymerase chain reaction (qPCR) analysis, the threshold and extrapolation methods, either make assumptions about PCR efficiency that require an arbitrary threshold selection process or extrapolate to estimate relative levels of messenger RNA (mRNA) transcripts. Here we describe an algorithm, Q-Anal, that blends elements from current methods to by-pass assumptions regarding PCR efficiency and improve the threshold selection process to minimize error in comparative qPCR analysis. This algorithm uses iterative linear regression to identify the exponential phase for both target and reference amplicons and then selects, by minimizing linear regression error, a fluorescence threshold where efficiencies for both amplicons have been defined. From this defined fluorescence threshold, cycle time (Ct) and the error for both amplicons are calculated and used to determine the expression ratio. Ratios in complementary DNA (cDNA) dilution assays from qPCR data were analyzed by the Q-Anal method and compared with the threshold method and an extrapolation method. Dilution ratios determined by the Q-Anal and threshold methods were 86 to 118% of the expected cDNA ratios, but relative errors for the Q-Anal method were 4 to 10% in comparison with 4 to 34% for the threshold method. In contrast, ratios determined by an extrapolation method were 32 to 242% of the expected cDNA ratios, with relative errors of 67 to 193%. Q-Anal will be a valuable and quick method for minimizing error in comparative qPCR analysis.
Comparative 454 pyrosequencing of transcripts from two olive genotypes during fruit development
Alagna, Fiammetta; D'Agostino, Nunzio; Torchia, Laura; Servili, Maurizio; Rao, Rosa; Pietrella, Marco; Giuliano, Giovanni; Chiusano, Maria Luisa; Baldoni, Luciana; Perrotta, Gaetano
2009-01-01
Background Despite its primary economic importance, genomic information on olive tree is still lacking. 454 pyrosequencing was used to enrich the very few sequence data currently available for the Olea europaea species and to identify genes involved in expression of fruit quality traits. Results Fruits of Coratina, a widely cultivated variety characterized by a very high phenolic content, and Tendellone, an oleuropein-lacking natural variant, were used as starting material for monitoring the transcriptome. Four different cDNA libraries were sequenced, respectively at the beginning and at the end of drupe development. A total of 261,485 reads were obtained, for an output of about 58 Mb. Raw sequence data were processed using a four step pipeline procedure and data were stored in a relational database with a web interface. Conclusion Massively parallel sequencing of different fruit cDNA collections has provided large scale information about the structure and putative function of gene transcripts accumulated during fruit development. Comparative transcript profiling allowed the identification of differentially expressed genes with potential relevance in regulating the fruit metabolism and phenolic content during ripening. PMID:19709400
Sun, L L; Li, Y; Li, S S; Wu, X J; Hu, B Z; Chang, Y
2014-12-30
Chalcone synthase (CHS) is an enzyme that catalyzes the first committed step in flavonoid biosynthesis, and its transcription level is regulated by light conditions. By using homology cloning and rapid amplification of cDNA ends, we cloned a chalcone synthase gene (DfCHS) from Dryopteris fragrans (L.) Schott. The full-length cDNA of DfCHS is 1,737 bp, with an open reading frame (ORF) of 1,122 bp (deposited in GenBank under Accession Number KF530802) encoding a predicted protein of 373 amino acids. The calculated molecular mass of DfCHS is 41.3 kDa. We studied the expression of DfCHS and total flavonoid contents in tissue culture seedlings cultured under the low temperature at 4ºC, high temperature at 35ºC and UV conditions, respectively. The results show that the expression of DfCHS are not the same, but all present rising trends, then flavonoid contents were increased. Overall, our results imply that the expression of DfCHS gene provide a certain theory basis in the status of evolution among ferns.
Wiesenfahrt, Tobias; Duanmu, Jingjie; Snider, Frances; Moerman, Don; Au, Vinci; Li-Leger, Erica; Flibotte, Stephane; Parker, Dylan M; Marshall, Craig J; Nishimura, Erin Osborne; Mains, Paul E; McGhee, James D
2018-05-04
The ELT-2 GATA factor normally functions in differentiation of the C. elegans endoderm, downstream of endoderm specification. We have previously shown that, if ELT-2 is expressed sufficiently early, it is also able to specify the endoderm and to replace all other members of the core GATA-factor transcriptional cascade (END-1, END-3, ELT-7). However, such rescue requires multiple copies (and presumably overexpression) of the end-1p :: elt-2 cDNA transgene; a single copy of the transgene does not rescue. We have made this observation the basis of a genetic screen to search for genetic modifiers that allow a single copy of the end-1p :: elt-2 cDNA transgene to rescue the lethality of the end-1 end-3 double mutant. We performed this screen on a strain that has a single copy insertion of the transgene in an end-1 end-3 background. These animals are kept alive by virtue of an extrachromosomal array containing multiple copies of the rescuing transgene; the extrachromosomal array also contains a toxin under heat shock control to counterselect for mutagenized survivors that have been able to lose the rescuing array. A screen of ∼14,000 mutagenized haploid genomes produced 17 independent surviving strains. Whole genome sequencing was performed to identify genes that incurred independent mutations in more than one surviving strain. The C. elegans gene tasp-1 was mutated in four independent strains. tasp-1 encodes the C. elegans homolog of Taspase, a threonine-aspartic acid protease that has been found, in both mammals and insects, to cleave several proteins involved in transcription, in particular MLL1/trithorax and TFIIA. A second gene, pqn-82 , was mutated in two independent strains and encodes a glutamine-asparagine rich protein. tasp-1 and pqn-82 were verified as loss-of-function modifiers of the end-1p :: elt-2 transgene by RNAi and by CRISPR/Cas9-induced mutations. In both cases, gene loss leads to modest increases in the level of ELT-2 protein in the early endoderm although ELT-2 levels do not strictly correlate with rescue. We suggest that tasp-1 and pqn-82 represent a class of genes acting in the early embryo to modulate levels of critical transcription factors or to modulate the responsiveness of critical target genes. The screen's design, rescuing lethality with an extrachromosomal transgene followed by counterselection, has a background survival rate of <10 -4 without mutagenesis and should be readily adapted to the general problem of identifying suppressors of C. elegans lethal mutations. Copyright © 2018 Wiesenfahrt et al.
Sjursen, Wenche; Bjørnevoll, Inga; Engebretsen, Lars F; Fjelland, Kristine; Halvorsen, Tore; Myrvold, Helge E
2009-01-01
Turcot syndrome is a rare, inherited disease predisposing of tumours in the central nerve system and in the colorectal system. This report describes a Turcot patient with an extraordinary clinical history. The patient is still alive at the age of 43. She was operated at the age of 10 by brain tumour and at the age of 16 by colorectal cancer. She has since then been treated for multiple cancers (gastrointestinal, endometrial, basal cell carcinomas), and removal of adenomatous polyps at several occasions. The aim of this work was to investigate if there was any specific genotype that explains her remarkable clinical history. Microsatellite instability and immunohistochemistry analysis for four DNA mismatch repair proteins were performed. DNA mutation analysis was done for genes involved in polyposis and mismatch repair by denaturing high performance liquid chromatography and sequencing. cDNA analysis was carried out for the mismatch repair gene PMS2. The patients genotype was found to be a homozygous splice site mutation in the PMS2 gene, c.989-1G
Seliger, Barbara; Dressler, Sven P.; Wang, Ena; Kellner, Roland; Recktenwald, Christian V.; Lottspeich, Friedrich; Marincola, Francesco M.; Baumgärtner, Maja; Atkins, Derek; Lichtenfels, Rudolf
2012-01-01
Results obtained from expression profilings of renal cell carcinoma using different “ome”-based approaches and comprehensive data analysis demonstrated that proteome-based technologies and cDNA microarray analyses complement each other during the discovery phase for disease-related candidate biomarkers. The integration of the respective data revealed the uniqueness and complementarities of the different technologies. While comparative cDNA microarray analyses though restricted to upregulated targets largely revealed genes involved in controlling gene/protein expression (19%) and signal transduction processes (13%), proteomics/PROTEOMEX-defined candidate biomarkers include enzymes of the cellular metabolism (36%), transport proteins (12%) and cell motility/structural molecules (10%). Candidate biomarkers defined by proteomics and PROTEOMEX are frequently shared, whereas the sharing rate between cDNA microarray and proteome-based profilings is limited. Putative candidate biomarkers provide insights into their cellular (dys)function and their diagnostic/prognostic value but still warrant further validation in larger patient numbers. Based on the fact that merely 3 candidate biomarkers were shared by all applied technologies, namely annexin A4, tubulin alpha-1A chain and ubiquitin carboxyl-terminal hydrolase L1 the analysis at a single hierarchical level of biological regulation seems to provide only limited results thus emphasizing the importance and benefit of performing rather combinatorial screenings which can complement the standard clinical predictors. PMID:19235166
Gocayne, J; Robinson, D A; FitzGerald, M G; Chung, F Z; Kerlavage, A R; Lentes, K U; Lai, J; Wang, C D; Fraser, C M; Venter, J C
1987-12-01
Two cDNA clones, lambda RHM-MF and lambda RHB-DAR, encoding the muscarinic cholinergic receptor and the beta-adrenergic receptor, respectively, have been isolated from a rat heart cDNA library. The cDNA clones were characterized by restriction mapping and automated DNA sequence analysis utilizing fluorescent dye primers. The rat heart muscarinic receptor consists of 466 amino acids and has a calculated molecular weight of 51,543. The rat heart beta-adrenergic receptor consists of 418 amino acids and has a calculated molecular weight of 46,890. The two cardiac receptors have substantial amino acid homology (27.2% identity, 50.6% with favored substitutions). The rat cardiac beta receptor has 88.0% homology (92.5% with favored substitutions) with the human brain beta receptor and the rat cardiac muscarinic receptor has 94.6% homology (97.6% with favored substitutions) with the porcine cardiac muscarinic receptor. The muscarinic cholinergic and beta-adrenergic receptors appear to be as conserved as hemoglobin and cytochrome c but less conserved than histones and are clearly members of a multigene family. These data support our hypothesis, based upon biochemical and immunological evidence, that suggests considerable structural homology and evolutionary conservation between adrenergic and muscarinic cholinergic receptors. To our knowledge, this is the first report utilizing automated DNA sequence analysis to determine the structure of a gene.
Gong, Ya-Nan; Li, Wei-Wei; Sun, Jiang-Ling; Ren, Fei; He, Lin; Jiang, Hui; Wang, Qun
2010-09-16
Fatty acid-binding proteins (FABPs), small cytosolic proteins that function in the uptake and utilization of fatty acids, have been extensively studied in higher vertebrates while invertebrates have received little attention despite similar nutritional requirements during periods of reproductive activity. Therefore, a cDNA encoding Eriocheir sinensis FABP (Es-FABP) was cloned based upon EST analysis of a hepatopancreas cDNA library. The full length cDNA was 750 bp and encoded a 131 aa polypeptide that was highly homologous to related genes reported in shrimp. The 9108 bp Es-FABP gene contained four exons that were interrupted by three introns, a genomic organization common among FABP multigene family members in vertebrates. Gene expression analysis, as determined by RT-PCR, revealed the presence of Es-FABP transcripts in hepatopancreas, hemocytes, ovary, gills, muscle, thoracic ganglia, heart, and intestine, but not stomach or eyestalk. Real-time quantitative RT-PCR analysis revealed that Es-FABP expression in ovary, hemocytes, and hepatopancreas was dependent on the status of ovarian development, with peak expression observed in January. Evidence provided in the present report supports a role of Es-FABP in lipid transport during the period of rapid ovarian growth in E. sinensis, and indirectly confirms the participation of the hepatopancreas, ovary, and hemocytes in lipid nutrient absorption and utilization processes.
Stec, James; Wang, Jing; Coombes, Kevin; Ayers, Mark; Hoersch, Sebastian; Gold, David L.; Ross, Jeffrey S; Hess, Kenneth R.; Tirrell, Stephen; Linette, Gerald; Hortobagyi, Gabriel N.; Symmans, W. Fraser; Pusztai, Lajos
2005-01-01
We examined how well differentially expressed genes and multigene outcome classifiers retain their class-discriminating values when tested on data generated by different transcriptional profiling platforms. RNA from 33 stage I-III breast cancers was hybridized to both Affymetrix GeneChip and Millennium Pharmaceuticals cDNA arrays. Only 30% of all corresponding gene expression measurements on the two platforms had Pearson correlation coefficient r ≥ 0.7 when UniGene was used to match probes. There was substantial variation in correlation between different Affymetrix probe sets matched to the same cDNA probe. When cDNA and Affymetrix probes were matched by basic local alignment tool (BLAST) sequence identity, the correlation increased substantially. We identified 182 genes in the Affymetrix and 45 in the cDNA data (including 17 common genes) that accurately separated 91% of cases in supervised hierarchical clustering in each data set. Cross-platform testing of these informative genes resulted in lower clustering accuracy of 45 and 79%, respectively. Several sets of accurate five-gene classifiers were developed on each platform using linear discriminant analysis. The best 100 classifiers showed average misclassification error rate of 2% on the original data that rose to 19.5% when tested on data from the other platform. Random five-gene classifiers showed misclassification error rate of 33%. We conclude that multigene predictors optimized for one platform lose accuracy when applied to data from another platform due to missing genes and sequence differences in probes that result in differing measurements for the same gene. PMID:16049308
Immune-Related Transcriptome of Coptotermes formosanus Shiraki Workers: The Defense Mechanism
Hussain, Abid; Li, Yi-Feng; Cheng, Yu; Liu, Yang; Chen, Chuan-Cheng; Wen, Shuo-Yang
2013-01-01
Formosan subterranean termites, Coptotermes formosanus Shiraki, live socially in microbial-rich habitats. To understand the molecular mechanism by which termites combat pathogenic microbes, a full-length normalized cDNA library and four Suppression Subtractive Hybridization (SSH) libraries were constructed from termite workers infected with entomopathogenic fungi (Metarhizium anisopliae and Beauveria bassiana), Gram-positive Bacillus thuringiensis and Gram-negative Escherichia coli, and the libraries were analyzed. From the high quality normalized cDNA library, 439 immune-related sequences were identified. These sequences were categorized as pattern recognition receptors (47 sequences), signal modulators (52 sequences), signal transducers (137 sequences), effectors (39 sequences) and others (164 sequences). From the SSH libraries, 27, 17, 22 and 15 immune-related genes were identified from each SSH library treated with M. anisopliae, B. bassiana, B. thuringiensis and E. coli, respectively. When the normalized cDNA library was compared with the SSH libraries, 37 immune-related clusters were found in common; 56 clusters were identified in the SSH libraries, and 259 were identified in the normalized cDNA library. The immune-related gene expression pattern was further investigated using quantitative real time PCR (qPCR). Important immune-related genes were characterized, and their potential functions were discussed based on the integrated analysis of the results. We suggest that normalized cDNA and SSH libraries enable us to discover functional genes transcriptome. The results remarkably expand our knowledge about immune-inducible genes in C. formosanus Shiraki and enable the future development of novel control strategies for the management of Formosan subterranean termites. PMID:23874972
Sequence, molecular properties, and chromosomal mapping of mouse lumican
NASA Technical Reports Server (NTRS)
Funderburgh, J. L.; Funderburgh, M. L.; Hevelone, N. D.; Stech, M. E.; Justice, M. J.; Liu, C. Y.; Kao, W. W.; Conrad, G. W.; Spooner, B. S. (Principal Investigator)
1995-01-01
PURPOSE. Lumican is a major proteoglycan of vertebrate cornea. This study characterizes mouse lumican, its molecular form, cDNA sequence, and chromosomal localization. METHODS. Lumican sequence was determined from cDNA clones selected from a mouse corneal cDNA expression library using a bovine lumican cDNA probe. Tissue expression and size of lumican mRNA were determined using Northern hybridization. Glycosidase digestion followed by Western blot analysis provided characterization of molecular properties of purified mouse corneal lumican. Chromosomal mapping of the lumican gene (Lcn) used Southern hybridization of a panel of genomic DNAs from an interspecific murine backcross. RESULTS. Mouse lumican is a 338-amino acid protein with high-sequence identity to bovine and chicken lumican proteins. The N-terminus of the lumican protein contains consensus sequences for tyrosine sulfation. A 1.9-kb lumican mRNA is present in cornea and several other tissues. Antibody against bovine lumican reacted with recombinant mouse lumican expressed in Escherichia coli and also detected high molecular weight proteoglycans in extracts of mouse cornea. Keratanase digestion of corneal proteoglycans released lumican protein, demonstrating the presence of sulfated keratan sulfate chains on mouse corneal lumican in vivo. The lumican gene (Lcn) was mapped to the distal region of mouse chromosome 10. The Lcn map site is in the region of a previously identified developmental mutant, eye blebs, affecting corneal morphology. CONCLUSIONS. This study demonstrates sulfated keratan sulfate proteoglycan in mouse cornea and describes the tools (antibodies and cDNA) necessary to investigate the functional role of this important corneal molecule using naturally occurring and induced mutants of the murine lumican gene.
Complete cDNA sequence and amino acid analysis of a bovine ribonuclease K6 gene.
Pietrowski, D; Förster, M
2000-01-01
The complete cDNA sequence of a ribonuclease k6 gene of Bos Taurus has been determined. It codes for a protein with 154 amino acids and contains the invariant cysteine, histidine and lysine residues as well as the characteristic motifs specific to ribonuclease active sites. The deduced protein sequence is 27 residues longer than other known ribonucleases k6 and shows amino acids exchanges which could reflect a strain specificity or polymorphism within the bovine genome. Based on sequence similarity we have termed the identified gene bovine ribonuclease k6 b (brk6b).
Muldoon, L. L.; Neuwelt, E. A.; Pagel, M. A.; Weiss, D. L.
1994-01-01
The Korat cat provides an animal model for type II GM2-gangliosidosis (Sandhoff disease) that may be suitable for tests of gene replacement therapy with the HEXB gene encoding the beta subunit of the beta-hexosaminidases. In the present report, we examined the brain and liver pathology of a typical Sandhoff-affected cat. We characterized the feline HEXB complementary DNA (cDNA) and determined the molecular defect in this feline model. cDNA libraries were produced from one normal and one affected animal, and cDNA clones homologous to human HEXB were sequenced. In the affected cDNA clone, the deletion of a cytosine residue at position +39 of the putative coding region results in a frame shift and a stop codon at base +191. This disease-related deletion was consistently detected by sequencing of cloned polymerase chain reaction amplified reverse transcribed messenger RNA from one more normal Korat and two additional affected animals. The defect was further demonstrated using single-strand conformational polymorphism analysis of the polymerase chain reaction products. In addition, alternative splicing of both normal and affected messenger RNAs was demonstrated. These results should facilitate the use of this animal model to assess gene therapy. Images Figure 1 Figure 3 Figure 4 Figure 5 PMID:8178934
Muldoon, L L; Neuwelt, E A; Pagel, M A; Weiss, D L
1994-05-01
The Korat cat provides an animal model for type II GM2-gangliosidosis (Sandhoff disease) that may be suitable for tests of gene replacement therapy with the HEXB gene encoding the beta subunit of the beta-hexosaminidases. In the present report, we examined the brain and liver pathology of a typical Sandhoff-affected cat. We characterized the feline HEXB complementary DNA (cDNA) and determined the molecular defect in this feline model. cDNA libraries were produced from one normal and one affected animal, and cDNA clones homologous to human HEXB were sequenced. In the affected cDNA clone, the deletion of a cytosine residue at position +39 of the putative coding region results in a frame shift and a stop codon at base +191. This disease-related deletion was consistently detected by sequencing of cloned polymerase chain reaction amplified reverse transcribed messenger RNA from one more normal Korat and two additional affected animals. The defect was further demonstrated using single-strand conformational polymorphism analysis of the polymerase chain reaction products. In addition, alternative splicing of both normal and affected messenger RNAs was demonstrated. These results should facilitate the use of this animal model to assess gene therapy.
Nolden, T; Pfaff, F; Nemitz, S; Freuling, C M; Höper, D; Müller, T; Finke, Stefan
2016-04-05
Reverse genetics approaches are indispensable tools for proof of concepts in virus replication and pathogenesis. For negative strand RNA viruses (NSVs) the limited number of infectious cDNA clones represents a bottleneck as clones are often generated from cell culture adapted or attenuated viruses, with limited potential for pathogenesis research. We developed a system in which cDNA copies of complete NSV genomes were directly cloned into reverse genetics vectors by linear-to-linear RedE/T recombination. Rapid cloning of multiple rabies virus (RABV) full length genomes and identification of clones identical to field virus consensus sequence confirmed the approache's reliability. Recombinant viruses were recovered from field virus cDNA clones. Similar growth kinetics of parental and recombinant viruses, preservation of field virus characters in cell type specific replication and virulence in the mouse model were confirmed. Reduced titers after reporter gene insertion indicated that the low level of field virus replication is affected by gene insertions. The flexibility of the strategy was demonstrated by cloning multiple copies of an orthobunyavirus L genome segment. This important step in reverse genetics technology development opens novel avenues for the analysis of virus variability combined with phenotypical characterization of recombinant viruses at a clonal level.
NASA Astrophysics Data System (ADS)
Woon, J. S. K.; Murad, A. M. A.; Abu Bakar, F. D.
2015-09-01
A cellobiohydrolase B (CbhB) from Aspergillus niger ATCC 10574 was cloned and expressed in E. coli. CbhB has an open reading frame of 1611 bp encoding a putative polypeptide of 536 amino acids. Analysis of the encoded polypeptide predicted a molecular mass of 56.2 kDa, a cellulose binding module (CBM) and a catalytic module. In order to obtain the mRNA of cbhB, total RNA was extracted from A. niger cells induced by 1% Avicel. First strand cDNA was synthesized from total RNA via reverse transcription. The full length cDNA of cbhB was amplified by PCR and cloned into the cloning vector, pGEM-T Easy. A comparison between genomic DNA and cDNA sequences of cbhB revealed that the gene is intronless. Upon the removal of the signal peptide, the cDNA of cbhB was cloned into the expression vector pET-32b. However, the recombinant CbhB was expressed in Escherichia coli Origami DE3 as an insoluble protein. A homology model of CbhB predicted the presence of nine disulfide bonds in the protein structure which may have contributed to the improper folding of the protein and thus, resulting in inclusion bodies in E. coli.
NASA Technical Reports Server (NTRS)
Reddy, A. S.; Czernik, A. J.; An, G.; Poovaiah, B. W.
1992-01-01
We cloned and sequenced a plant cDNA that encodes U1 small nuclear ribonucleoprotein (snRNP) 70K protein. The plant U1 snRNP 70K protein cDNA is not full length and lacks the coding region for 68 amino acids in the amino-terminal region as compared to human U1 snRNP 70K protein. Comparison of the deduced amino acid sequence of the plant U1 snRNP 70K protein with the amino acid sequence of animal and yeast U1 snRNP 70K protein showed a high degree of homology. The plant U1 snRNP 70K protein is more closely related to the human counter part than to the yeast 70K protein. The carboxy-terminal half is less well conserved but, like the vertebrate 70K proteins, is rich in charged amino acids. Northern analysis with the RNA isolated from different parts of the plant indicates that the snRNP 70K gene is expressed in all of the parts tested. Southern blotting of genomic DNA using the cDNA indicates that the U1 snRNP 70K protein is coded by a single gene.
Bellantuono, I; Lashford, L S; Rafferty, J A; Fairbairn, L J
2000-05-01
As a single gene defect in mature bone marrow cells, chronic granulomatous disease (X-CGD) represents a disorder which may be amenable to gene therapy by the transfer of the missing subunit into hemopoietic stem cells. In the majority of cases lack of Gp91-phox causes the disease. So far, studies involving transfer of Gp91-phox cDNA, including a phase I clinical trial, have yielded disappointing results. Most often, low titers of virus have been reported. In the present study we investigated the possible reasons for low titer amphotropic viral production. To investigate the effect of Gp91 cDNA on the efficiency of retroviral production from the packaging cell line, GP+envAm12, we constructed vectors containing either the native cDNA, truncated versions of the cDNA or a mutated form (LATG) in which the natural translational start codon was changed to a stop codon. Following derivation of clonal packaging cell lines, these were assessed for viral titer by RNA slot blot and analyzed by non-parametrical statistical analysis (Whitney-Mann U-test). An improvement in viral titer of just over two-fold was found in packaging cells containing the start-codon mutant of Gp91 and no evidence of truncated viral RNA was seen in these cells. Further analysis revealed the presence of rearranged forms of the provirus in Gp91-expressing cells, and the production of truncated, unpackaged viral RNA. Protein analysis revealed that LATG-transduced cells did not express full-length Gp91-phox, whereas those containing the wild-type cDNA did. However, a truncated protein was seen in ATG-transduced cells which was also present in wild type cells. No evidence for the presence of a negative transcriptional regulatory element was found from studies with the deletion mutants. A statistically significant effect of protein production on the production of virus from Gp91-expressing cells was found. Our data point to a need to restrict expression of the Gp91-phox protein and its derivatives in order to enhance retroviral production and suggest that improvements in current vectors for CGD gene therapy may need to include controlled, directed expression only in mature neutrophils.
Rapid and efficient cDNA library screening by self-ligation of inverse PCR products (SLIP).
Hoskins, Roger A; Stapleton, Mark; George, Reed A; Yu, Charles; Wan, Kenneth H; Carlson, Joseph W; Celniker, Susan E
2005-12-02
cDNA cloning is a central technology in molecular biology. cDNA sequences are used to determine mRNA transcript structures, including splice junctions, open reading frames (ORFs) and 5'- and 3'-untranslated regions (UTRs). cDNA clones are valuable reagents for functional studies of genes and proteins. Expressed Sequence Tag (EST) sequencing is the method of choice for recovering cDNAs representing many of the transcripts encoded in a eukaryotic genome. However, EST sequencing samples a cDNA library at random, and it recovers transcripts with low expression levels inefficiently. We describe a PCR-based method for directed screening of plasmid cDNA libraries. We demonstrate its utility in a screen of libraries used in our Drosophila EST projects for 153 transcription factor genes that were not represented by full-length cDNA clones in our Drosophila Gene Collection. We recovered high-quality, full-length cDNAs for 72 genes and variously compromised clones for an additional 32 genes. The method can be used at any scale, from the isolation of cDNA clones for a particular gene of interest, to the improvement of large gene collections in model organisms and the human. Finally, we discuss the relative merits of directed cDNA library screening and RT-PCR approaches.
Li, Xinguo; Wu, Harry X; Dillon, Shannon K; Southerton, Simon G
2009-01-01
Background Wood is a major renewable natural resource for the timber, fibre and bioenergy industry. Pinus radiata D. Don is the most important commercial plantation tree species in Australia and several other countries; however, genomic resources for this species are very limited in public databases. Our primary objective was to sequence a large number of expressed sequence tags (ESTs) from genes involved in wood formation in radiata pine. Results Six developing xylem cDNA libraries were constructed from earlywood and latewood tissues sampled at juvenile (7 yrs), transition (11 yrs) and mature (30 yrs) ages, respectively. These xylem tissues represent six typical development stages in a rotation period of radiata pine. A total of 6,389 high quality ESTs were collected from 5,952 cDNA clones. Assembly of 5,952 ESTs from 5' end sequences generated 3,304 unigenes including 952 contigs and 2,352 singletons. About 97.0% of the 5,952 ESTs and 96.1% of the unigenes have matches in the UniProt and TIGR databases. Of the 3,174 unigenes with matches, 42.9% were not assigned GO (Gene Ontology) terms and their functions are unknown or unclassified. More than half (52.1%) of the 5,952 ESTs have matches in the Pfam database and represent 772 known protein families. About 18.0% of the 5,952 ESTs matched cell wall related genes in the MAIZEWALL database, representing all 18 categories, 91 of all 174 families and possibly 557 genes. Fifteen cell wall-related genes are ranked in the 30 most abundant genes, including CesA, tubulin, AGP, SAMS, actin, laccase, CCoAMT, MetE, phytocyanin, pectate lyase, cellulase, SuSy, expansin, chitinase and UDP-glucose dehydrogenase. Based on the PlantTFDB database 41 of the 64 transcription factor families in the poplar genome were identified as being involved in radiata pine wood formation. Comparative analysis of GO term abundance revealed a distinct transcriptome in juvenile earlywood formation compared to other stages of wood development. Conclusion The first large scale genomic resource in radiata pine was generated from six developing xylem cDNA libraries. Cell wall-related genes and transcription factors were identified. Juvenile earlywood has a distinct transcriptome, which is likely to contribute to the undesirable properties of juvenile wood in radiata pine. The publicly available resource of radiata pine will also be valuable for gene function studies and comparative genomics in forest trees. PMID:19159482
Salem, Nida’ M.; Miller, W. Allen; Rowhani, Adib; Golino, Deborah A.; Moyne, Anne-Laure; Falk, Bryce W.
2015-01-01
We determined the complete nucleotide sequence of the Rose spring dwarf-associated virus (RSDaV) genomic RNA (GenBank accession no. EU024678) and compared its predicted RNA structural characteristics affecting gene expression. A cDNA library was derived from RSDaV double-stranded RNAs (dsRNAs) purified from infected tissue. Nucleotide sequence analysis of the cloned cDNAs, plus for clones generated by 5′- and 3′-RACE showed the RSDaV genomic RNA to be 5,808 nucleotides. The genomic RNA contains five major open reading frames (ORFs), and three small ORFs in the 3′-terminal 800 nucleotides, typical for viruses of genus Luteovirus in the family Luteoviridae. Northern blot hybridization analysis revealed the genomic RNA and two prominent subgenomic RNAs of approximately 3 kb and 1 kb. Putative 5′ ends of the sgRNAs were predicted by identification of conserved sequences and secondary structures which resembled the Barley yellow dwarf virus (BYDV) genomic RNA 5′ end and subgenomic RNA promoter sequences. Secondary structures of the BYDV-like ribosomal frameshift elements and cap-independent translation elements, including long-distance base pairing spanning four kb were identified. These contain similarities but also informative differences with the BYDV structures, including a strikingly different structure predicted for the 3′ cap-independent translation element. These analyses of the RSDaV genomic RNA show more complexity for the RNA structural elements for members of the Luteoviridae. PMID:18329064
Salem, Nida' M; Miller, W Allen; Rowhani, Adib; Golino, Deborah A; Moyne, Anne-Laure; Falk, Bryce W
2008-06-05
We determined the complete nucleotide sequence of the Rose spring dwarf-associated virus (RSDaV) genomic RNA (GenBank accession no. EU024678) and compared its predicted RNA structural characteristics affecting gene expression. A cDNA library was derived from RSDaV double-stranded RNAs (dsRNAs) purified from infected tissue. Nucleotide sequence analysis of the cloned cDNAs, plus for clones generated by 5'- and 3'-RACE showed the RSDaV genomic RNA to be 5808 nucleotides. The genomic RNA contains five major open reading frames (ORFs), and three small ORFs in the 3'-terminal 800 nucleotides, typical for viruses of genus Luteovirus in the family Luteoviridae. Northern blot hybridization analysis revealed the genomic RNA and two prominent subgenomic RNAs of approximately 3 kb and 1 kb. Putative 5' ends of the sgRNAs were predicted by identification of conserved sequences and secondary structures which resembled the Barley yellow dwarf virus (BYDV) genomic RNA 5' end and subgenomic RNA promoter sequences. Secondary structures of the BYDV-like ribosomal frameshift elements and cap-independent translation elements, including long-distance base pairing spanning four kb were identified. These contain similarities but also informative differences with the BYDV structures, including a strikingly different structure predicted for the 3' cap-independent translation element. These analyses of the RSDaV genomic RNA show more complexity for the RNA structural elements for members of the Luteoviridae.
Shiraishi, H; Ishikura, S; Matsuura, K; Deyashiki, Y; Ninomiya, M; Sakai, S; Hara, A
1998-01-01
Human liver contains three isoforms (DD1, DD2 and DD4) of dihydrodiol dehydrogenase with 20alpha- or 3alpha-hydroxysteroid dehydrogenase activity; the dehydrogenases belong to the aldo-oxo reductase (AKR) superfamily. cDNA species encoding DD1 and DD4 have been identified. However, four cDNA species with more than 99% sequence identity have been cloned and are compatible with a partial amino acid sequence of DD2. In this study we have isolated a cDNA clone encoding DD2, which was confirmed by comparison of the properties of the recombinant and hepatic enzymes. This cDNA showed differences of one, two, four and five nucleotides from the previously reported four cDNA species for a dehydrogenase of human colon carcinoma HT29 cells, human prostatic 3alpha-hydroxysteroid dehydrogenase, a human liver 3alpha-hydroxysteroid dehydrogenase-like protein and chlordecone reductase-like protein respectively. Expression of mRNA species for the five similar cDNA species in 20 liver samples and 10 other different tissue samples was examined by reverse transcriptase-mediated PCR with specific primers followed by diagnostic restriction with endonucleases. All the tissues expressed only one mRNA species corresponding to the newly identified cDNA for DD2: mRNA transcripts corresponding to the other cDNA species were not detected. We suggest that the new cDNA is derived from the principal gene for DD2, which has been named AKR1C2 by a new nomenclature for the AKR superfamily. It is possible that some of the other cDNA species previously reported are rare allelic variants of this gene. PMID:9716498
An insight into the sialome of the blood-sucking bug Triatoma infestans, a vector of Chagas' disease
Assumpção, Teresa C. F.; Francischetti, Ivo M. B.; Andersen, John F.; Schwarz, Alexandra; Santana, Jaime M.; Ribeiro, José M. C.
2008-01-01
Triatoma infestans is a hemiptera, vector of Chagas’ disease, that feeds exclusively on vertebrate blood in all life stages. Hematophagous insects’ salivary glands (SG) produce potent pharmacological compounds that counteract host hemostasis, including anti-clotting, anti-platelet, and vasodilatory molecules. To obtain a further insight into the salivary biochemical and pharmacological complexity of this insect, a cDNA library from its salivary glands was randomly sequenced. Also, salivary proteins were submitted to two dimentional gel (2D-gel) electrophoresis followed by MS analysis. We present the analysis of a set of 1,534 (SG) cDNA sequences, 645 of which coded for proteins of a putative secretory nature. Most salivary proteins described as lipocalins matched peptide sequences obtained from proteomic results. PMID:18207082
Single-Cell RNA Sequencing of Glioblastoma Cells.
Sen, Rajeev; Dolgalev, Igor; Bayin, N Sumru; Heguy, Adriana; Tsirigos, Aris; Placantonakis, Dimitris G
2018-01-01
Single-cell RNA sequencing (sc-RNASeq) is a recently developed technique used to evaluate the transcriptome of individual cells. As opposed to conventional RNASeq in which entire populations are sequenced in bulk, sc-RNASeq can be beneficial when trying to better understand gene expression patterns in markedly heterogeneous populations of cells or when trying to identify transcriptional signatures of rare cells that may be underrepresented when using conventional bulk RNASeq. In this method, we describe the generation and analysis of cDNA libraries from single patient-derived glioblastoma cells using the C1 Fluidigm system. The protocol details the use of the C1 integrated fluidics circuit (IFC) for capturing, imaging and lysing cells; performing reverse transcription; and generating cDNA libraries that are ready for sequencing and analysis.
Zhou, Kaimin; Zhou, Falin; Huang, Jianhua; Yang, Qibin; Jiang, Song; Qiu, Lihua; Yang, Lishi; Zhu, Caiyan; Jiang, Shigui
2017-03-01
Chitinase is a multi-gene family, which play important physiological roles in crustaceans, involved in several biological processes, including digestion, molting and defense against viruses. In the present study, a chitinase-4 gene (PmChi-4) was cloned from Penaeus monodon by rapid amplification of cDNA ends (RACE). The full length of PmChi-4 cDNA was 2178 bp, including an 1815 bp open reading frame (ORF) which encoded 604 amino acid residues. The predicted PmChi-4 protein was 67.7 kDa and shared 61%-88% identity with the type of Chi-4s from other crustaceans. Quantitative real-time (qRT-PCR) analysis indicated that PmChi-4 was expressed ubiquitously with the high expression level in hepatopancreas. PmChi-4 was expressed throughout the whole larvae stages, and the highest level of PmChi-4 transcripts was detected at Mysis3 stage, which indicated that PmChi-4 may be involved in larval metamorphosis. In order to know whether PmChi-4 was related to the immune response of shrimp, Streptococcus agalactiae and Vibrio harveyi were chosen to challenge the shrimp, PmChi-4 transcripts were significantly increased and reached to the maximum at 6 h in hepatopancreas and at 12 h in gill, respectively. The results suggested that PmChi-4 participated in the immune defenses to pathogen infection. Besides, the ammonia nitrogen stress treatment was also carried out, PmChi-4 transcripts were significantly decreased in hepatopancreas and gill and the result showed that PmChi-4 may be involved in ammonia nitrogen stress in P. monodon. Overall, our present study lay a foundation for further research into the biological function and regulation of chitinase in P. monodon. Copyright © 2017 Elsevier Ltd. All rights reserved.
Han, Hongyu; Dong, Hui; Zhu, Shunhai; Zhao, Qiping; Jiang, Lianlian; Wang, Yange; Li, Liujia; Wu, Youlin; Huang, Bing
2014-01-01
Protein disulfide isomerase (PDI) and PDI-like proteins are members of the thioredoxin superfamily. They contain thioredoxin-like domains and catalyze the physiological oxidation, reduction and isomerization of protein disulfide bonds, which are involved in cell function and development in prokaryotes and eukaryotes. In this study, EtPDIL, a novel PDI-like gene of Eimeria tenella, was cloned using rapid amplification of cDNA ends (RACE) according to the expressed sequence tag (EST). The EtPDIL cDNA contained 1129 nucleotides encoding 216 amino acids. The deduced EtPDIL protein belonged to thioredoxin-like superfamily and had a single predicted thioredoxin domain with a non-classical thioredoxin-like motif (SXXC). BLAST analysis showed that the EtPDIL protein was 55-59% identical to PDI-like proteins of other apicomplexan parasites. The transcript and protein levels of EtPDIL at different development stages were investigated by real-time quantitative PCR and western blot. The messenger RNA and protein levels of EtPDIL were higher in sporulated oocysts than in unsporulated oocysts, sporozoites or merozoites. Protein expression was barely detectable in unsporulated oocysts. Western blots showed that rabbit antiserum against recombinant EtPDIL recognized only a native 24 kDa protein from parasites. Immunolocalization with EtPDIL antibody showed that EtPDIL had a disperse distribution in the cytoplasm of whole sporozoites and merozoites. After sporozoites were incubated in complete medium, EtPDIL protein concentrated at the anterior of the sporozoites and appeared on the surface of parasites. Specific staining was more intense and mainly located on the parasite surface after merozoites released from mature schizonts invaded DF-1 cells. After development of parasites in DF-1 cells, staining intensified in trophozoites, immature schizonts and mature schizonts. Antibody inhibition of EtPDIL function reduced the ability of E. tenella to invade DF-1 cells. These results suggested that EtPDIL might be involved in sporulation in external environments and in host cell adhesion, invasion and development of E. tenella.
Zhu, Jiantang; Hao, Pengchao; Chen, Guanxing; Han, Caixia; Li, Xiaohui; Zeller, Friedrich J; Hsam, Sai L K; Hu, Yingkao; Yan, Yueming
2014-10-01
The endoplasmic reticulum chaperone binding protein (BiP) is an important functional protein, which is involved in protein synthesis, folding assembly, and secretion. In order to study the role of BiP in the process of wheat seed development, we cloned three BiP homologous cDNA sequences in bread wheat (Triticum aestivum), completed by rapid amplification of cDNA ends (RACE), and examined the expression of wheat BiP in wheat tissues, particularly the relationship between BiP expression and the subunit types of HMW-GS using near-isogenic lines (NILs) of HMW-GS silencing, and under abiotic stress. Sequence analysis demonstrated that all BiPs contained three highly conserved domains present in plants, animals, and microorganisms, indicating their evolutionary conservation among different biological species. Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) revealed that TaBiP (Triticum aestivum BiP) expression was not organ-specific, but was predominantly localized to seed endosperm. Furthermore, immunolocalization confirmed that TaBiP was primarily located within the protein bodies (PBs) in wheat endosperm. Three TaBiP genes exhibited significantly down-regulated expression following high molecular weight-glutenin subunit (HMW-GS) silencing. Drought stress induced significantly up-regulated expression of TaBiPs in wheat roots, leaves, and developing grains. The high conservation of BiP sequences suggests that BiP plays the same role, or has common mechanisms, in the folding and assembly of nascent polypeptides and protein synthesis across species. The expression of TaBiPs in different wheat tissue and under abiotic stress indicated that TaBiP is most abundant in tissues with high secretory activity and with high proportions of cells undergoing division, and that the expression level of BiP is associated with the subunit types of HMW-GS and synthesis. The expression of TaBiPs is developmentally regulated during seed development and early seedling growth, and under various abiotic stresses.
Alawad, Abdullah; Alharbi, Sultan; Alhazzaa, Othman; Alagrafi, Faisal; Alkhrayef, Mohammed; Alhamdan, Ziyad; Alenazi, Abdullah; Al-Johi, Hasan; Alanazi, Ibrahim O; Hammad, Mohamed
2016-01-01
Although the sequencing information of Sox2 cDNA for many mammalian is available, the Sox2 cDNA of Camelus dromedaries has not yet been characterized. The objective of this study was to sequence and characterize Sox2 cDNA from the brain of C. dromedarius (also known as Arabian camel). A full coding sequence of the Sox2 gene from the brain of C. dromedarius was amplified by reverse transcription PCRjmc and then sequenced using the 3730XL series platform Sequencer (Applied Biosystem) for the first time. The cDNA sequence displayed an open reading frame of 822 nucleotides, encoding a protein of 273 amino acids. The molecular weight and the isoelectric point of the translated protein were calculated as 29.825 kDa and 10.11, respectively, using bioinformatics analysis. The predicted cSox2 protein sequence exhibited high identity: 99% for Homo sapiens, Mus musculus, Bos taurus, and Vicugna pacos; 98% for Sus scrofa and 93% for Camelus ferus. A 3D structure was built based on the available crystal structure of the HMG-box domain of human stem cell transcription factor Sox2 (PDB: 2 LE4) with 81 residues and predicting bioinformatics software for 273 amino acid residues. The comparison confirms the presence of the HMG-box domain in the cSox2 protein. The orthologous phylogenetic analysis showed that the Sox2 isoform from C. dromedarius was grouped with humans, alpacas, cattle, and pigs. We believe that this genetic and structural information will be a helpful source for the annotation. Furthermore, Sox2 is one of the transcription factors that contributes to the generation-induced pluripotent stem cells (iPSCs), which in turn will probably help generate camel induced pluripotent stem cells (CiPSCs).
Bai, W L; Yang, R J; Yin, R H; Jiang, W Q; Luo, G B; Yin, R L; Zhao, S J; Li, C; Zhao, Z H
2012-04-01
Osteopontin (OPN) is a secreted phosphorylated glycoprotein. It has an important role in mammary gland development and lactation, as well as, is thought to be a potential candidate gene for lactation traits. In the present work, we isolated and characterized a full-length open reading frame (ORF) of yak OPN cDNA from lactating mammary tissue, and examined its expression pattern in mammary gland during different stages of lactation, as well as, the recombinant OPN protein of yak was expressed successfully in E. coli. The sequencing results indicated that the isolated cDNA was 1132-bp in length containing a complete ORF of 837-bp. It encoded a precursor protein of yak OPN consisting of 278 amino acid with a signal peptide of 16 amino acids. Yak OPN has a predicted molecular mass of 29285.975 Da and an isoelectric point of 4.245. It had an identity of 65.50-99.16% in cDNA, identity of 52.06-98.56% and similarity of 65.40-98.56% in deduced amino acids with the corresponding sequences of cattle, buffalo, sheep, goat, pig, human, and rabbit. The phylogenetic analysis indicated that yak OPN had the closest evolutionary relationship with that of cattle, and next buffalo. In mammary gland, yak OPN was generally transcribed in a declining pattern from colostrum period to dry period with an apparent increase of OPN expression being present in the late period of lactation compared with peak period of lactation. Western blot analysis indicated that His-tagged yak OPN protein expressed in E. coli could be recognized not only by an anti-His-tag antibody but also by an anti-human OPN antibody. These results from the present work provided a foundation for further insight into the role of OPN gene in yak lactation.
Wang, Hai-Tao; Kong, Jian-Ping; Ding, Fang; Wang, Xiu-Qin; Wang, Ming-Rong; Liu, Lian-Xin; Wu, Min; Liu, Zhi-Hua
2003-01-01
AIM: To obtain human esophageal cancer cell EC9706 stably expressed epithelial membrane protein-1 (EMP-1) with integrated eukaryotic plasmid harboring the open reading frame (ORF) of human EMP-1, and then to study the mechanism by which EMP-1 exerts its diverse cellular action on cell proliferation and altered gene profile by exploring the effect of EMP-1. METHODS: The authors first constructed pcDNA3.1/myc-his expression vector harboring the ORF of EMP-1 and then transfected it into human esophageal carcinoma cell line EC9706. The positive clones were analyzed by Western blot and RT-PCR. Moreover, the cell growth curve was observed and the cell cycle was checked by FACS technique. Using cDNA microarray technology, the authors compared the gene expression pattern in positive clones with control. To confirm the gene expression profile, semi-quantitative RT-PCR was carried out for 4 of the randomly picked differentially expressed genes. For those differentially expressed genes, classification was performed according to their function and cellular component. RESULTS: Human EMP-1 gene can be stably expressed in EC9706 cell line transfected with human EMP-1. The authors found the cell growth decreased, among which S phase was arrested and G1 phase was prolonged in the transfected positive clones. By cDNA microarray analysis, 35 genes showed an over 2.0 fold change in expression level after transfection, with 28 genes being consistently up-regulated and 7 genes being down-regulated. Among the classified genes, almost half of the induced genes (13 out of 28 genes) were related to cell signaling, cell communication and particularly to adhesion. CONCLUSION: Overexpression of human EMP-1 gene can inhibit the proliferation of EC9706 cell with S phase arrested and G1 phase prolonged. The cDNA microarray analysis suggested that EMP-1 may be one of regulators involved in cell signaling, cell communication and adhesion regulators. PMID:12632483
Wang, Hai-Tao; Kong, Jian-Ping; Ding, Fang; Wang, Xiu-Qin; Wang, Ming-Rong; Liu, Lian-Xin; Wu, Min; Liu, Zhi-Hua
2003-03-01
To obtain human esophageal cancer cell EC9706 stably expressed epithelial membrane protein-1 (EMP-1) with integrated eukaryotic plasmid harboring the open reading frame (ORF) of human EMP-1, and then to study the mechanism by which EMP-1 exerts its diverse cellular action on cell proliferation and altered gene profile by exploring the effect of EMP-1. The authors first constructed pcDNA3.1/myc-his expression vector harboring the ORF of EMP-1 and then transfected it into human esophageal carcinoma cell line EC9706. The positive clones were analyzed by Western blot and RT-PCR. Moreover, the cell growth curve was observed and the cell cycle was checked by FACS technique. Using cDNA microarray technology, the authors compared the gene expression pattern in positive clones with control. To confirm the gene expression profile, semi-quantitative RT-PCR was carried out for 4 of the randomly picked differentially expressed genes. For those differentially expressed genes, classification was performed according to their function and cellular component. Human EMP-1 gene can be stably expressed in EC9706 cell line transfected with human EMP-1. The authors found the cell growth decreased, among which S phase was arrested and G1 phase was prolonged in the transfected positive clones. By cDNA microarray analysis, 35 genes showed an over 2.0 fold change in expression level after transfection, with 28 genes being consistently up-regulated and 7 genes being down-regulated. Among the classified genes, almost half of the induced genes (13 out of 28 genes) were related to cell signaling, cell communication and particularly to adhesion. Overexpression of human EMP-1 gene can inhibit the proliferation of EC9706 cell with S phase arrested and G1 phase prolonged. The cDNA microarray analysis suggested that EMP-1 may be one of regulators involved in cell signaling, cell communication and adhesion regulators.
Lake, Jennifer; Gravel, Catherine; Koko, Gabriel Koffi D; Robert, Claude; Vandenberg, Grant W
2010-03-01
Phosphorus (P)-responsive genes and how they regulate renal adaptation to phosphorous-deficient diets in animals, including fish, are not well understood. RNA abundance profiling using cDNA microarrays is an efficient approach to study nutrient-gene interactions and identify these dietary P-responsive genes. To test the hypothesis that dietary P-responsive genes are differentially expressed in fish fed varying P levels, rainbow trout were fed a practical high-P diet (R20: 0.96% P) or a low-P diet (R0: 0.38% P) for 7 weeks. The differentially-expressed genes between dietary groups were identified and compared from the kidney by combining suppressive subtractive hybridization (SSH) with cDNA microarray analysis. A number of genes were confirmed by real-time PCR, and correlated with plasma and bone P concentrations. Approximately 54 genes were identified as potential dietary P-responsive after 7 weeks on a diet deficient in P according to cDNA microarray analysis. Of 18 selected genes, 13 genes were confirmed to be P-responsive at 7 weeks by real-time PCR analysis, including: iNOS, cytochrome b, cytochrome c oxidase subunit II , alpha-globin I, beta-globin, ATP synthase, hyperosmotic protein 21, COL1A3, Nkef, NDPK, glucose phosphate isomerase 1, Na+/H+ exchange protein and GDP dissociation inhibitor 2. Many of these dietary P-responsive genes responded in a moderate way (R0/R20 ratio: <2-3 or >0.5) and in a transient manner to dietary P limitation. In summary, renal adaptation to dietary P deficiency in trout involves changes in the expression of several genes, suggesting a profile of metabolic stress, since many of these differentially-expressed candidates are associated with the cellular adaptative responses. Crown Copyright 2009. Published by Elsevier Inc. All rights reserved.
Leung, C L; Sun, D; Zheng, M; Knowles, D R; Liem, R K
1999-12-13
We cloned and characterized a full-length cDNA of mouse actin cross-linking family 7 (mACF7) by sequential rapid amplification of cDNA ends-PCR. The completed mACF7 cDNA is 17 kb and codes for a 608-kD protein. The closest relative of mACF7 is the Drosophila protein Kakapo, which shares similar architecture with mACF7. mACF7 contains a putative actin-binding domain and a plakin-like domain that are highly homologous to dystonin (BPAG1-n) at its NH(2) terminus. However, unlike dystonin, mACF7 does not contain a coiled-coil rod domain; instead, the rod domain of mACF7 is made up of 23 dystrophin-like spectrin repeats. At its COOH terminus, mACF7 contains two putative EF-hand calcium-binding motifs and a segment homologous to the growth arrest-specific protein, Gas2. In this paper, we demonstrate that the NH(2)-terminal actin-binding domain of mACF7 is functional both in vivo and in vitro. More importantly, we found that the COOH-terminal domain of mACF7 interacts with and stabilizes microtubules. In transfected cells full-length mACF7 can associate not only with actin but also with microtubules. Hence, we suggest a modified name: MACF (microtubule actin cross-linking factor). The properties of MACF are consistent with the observation that mutations in kakapo cause disorganization of microtubules in epidermal muscle attachment cells and some sensory neurons.
Ortigão-Farias, João Ramalho; Di-Blasi, Tatiana; Telleria, Erich Loza; Andorinho, Ana Carolina; Lemos-Silva, Thais; Ramalho-Ortigão, Marcelo; Tempone, Antônio Jorge; Traub-Csekö, Yara Maria
2018-02-01
BACKGROUND The insect chitinase gene family is composed by more than 10 paralogs, which can codify proteins with different domain structures. In Lutzomyia longipalpis, the main vector of visceral leishmaniasis in Brazil, a chitinase cDNA from adult female insects was previously characterized. The predicted protein contains one catalytic domain and one chitin-binding domain (CBD). The expression of this gene coincided with the end of blood digestion indicating a putative role in peritrophic matrix degradation. OBJECTIVES To determine the occurrence of alternative splicing in chitinases of L. longipalpis. METHODS We sequenced the LlChit1 gene from a genomic clone and the three spliced forms obtained by reverse transcription polymerase chain reaction (RT-PCR) using larvae cDNA. FINDINGS We showed that LlChit1 from L. longipalpis immature forms undergoes alternative splicing. The spliced form corresponding to the adult cDNA was named LlChit1A and the two larvae specific transcripts were named LlChit1B and LlChit1C. The B and C forms possess stop codons interrupting the translation of the CBD. The A form is present in adult females post blood meal, L4 larvae and pre-pupae, while the other two forms are present only in L4 larvae and disappear just before pupation. Two bands of the expected size were identified by Western blot only in L4 larvae. MAIN CONCLUSIONS We show for the first time alternative splicing generating chitinases with different domain structures increasing our understanding on the finely regulated digestion physiology and shedding light on a potential target for controlling L. longipalpis larval development.
Liu, Su; Liang, Qing-Mei; Huang, Yuan-Jie; Yuan, Xin; Zhou, Wen-Wu; Qiao, Fei; Cheng, Jiaan; Gurr, Geoff M; Zhu, Zeng-Rong
2013-01-01
NADPH-cytochrome P450 reductase (CPR) is one of the most important components of the cytochrome P450 enzyme system. It catalyzes electron transfer from NADPH to all known P450s, thus plays central roles not only in the metabolism of exogenous xenobiotics but also in the regulation of endogenous hormones in insects. In this study, a full-length cDNA encoding of a CPR (named CsCPR) was isolated from the Asiatic rice striped stem borer, Chilo suppressalis, by using reverse transcription-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE) methods. The cDNA contains a 2061 bp open reading frame, which encodes an enzyme of 686 amino acid residues, with a calculated molecular mass of 77.6 kDa. The deduced peptide has hallmarks of typical CPR, including an N-terminal membrane anchor and the FMN, FAD and NADPH binding domains. The N-terminal-truncated protein fused with a 6 × His·tag was heterologously expressed in Escherichia coli Rosetta (DE3) cells and purified, specific activity and the Km values of the recombinant enzyme were determined. Tissue- and developmental stage-dependent expression of CsCPR mRNA was investigated by real-time quantitative PCR. The CsCPR mRNA was noticeably expressed in the digestive, metabolic, and olfactory organs of the larvae and adults of C. suppressalis. Our initial results would provide valuable information for further study on the interactions between CPR and cytochrome P450 enzyme systems. © 2013.
Tabassum, Rabia
2017-10-18
Cytochrome P450s (CYPs) play critical role in oxidative metabolism of numerous xenobiotics and endogenous compounds. The first CYP3A subfamily member in saltwater crocodile has been cloned and modelled for three-dimensional (3D) structure. The full-length cDNA was obtained employing reverse transcription polymerase chain reaction (RT-PCR) strategy and rapid amplification of cDNA ends (RACE). The cDNA sequence of 1659 nucleotides includes 132 nucleotides from 5' untranslated region (UTR), an open reading frame of 1527 nucleotides encoding 509 amino acids designated as CYP3A163. The alignment of CYP3A163 sequence with CYP3A subfamily across the lineages exhibit the loss of 1 residue in birds and 7 residues in mammals in comparison to reptiles suggesting the adaptation processes during evolution. The amino acid identity of CYP3A163 with Alligator mississippiensis CYP3A77 and Homo sapiens CYP3A4 is 91% and 62% respectively. The 3D structure of CYP3A163 modelled using human CYP3A4 structure as a template with Phyre 2 software, represents high similarity with its functionally important motifs and catalytic domain. Both sequence and structure of CYP3A163 display the common and conserved features of CYP3A subfamily. Overall, this study provides primary molecular and structural data of CYP3A163 required to investigate the xenobiotic metabolism in saltwater crocodiles. Copyright © 2017 Elsevier Inc. All rights reserved.
Kim, Yucheol; De Zoysa, Mahanama; Lee, Youngdeuk; Whang, Ilson; Lee, Jehee
2010-11-01
A BRICHOS domain-containing leukocyte cell-derived chemotaxin 1-like cDNA was cloned from the disk abalone (Haliotis discus discus) and designated as AbLECT-1. A full-length (705 bp) of AbLECT-1 cDNA was composed of a 576 bp open reading frame that translates into a putative peptide of 192 amino acids. Deduced amino acid sequence of AbLECT-1 had 15.5- and 27.8% identity and similarity to human LECT-1, respectively. Quantitative real-time PCR analysis results showed that the mRNA of AbLECT-1 was constitutively expressed in abalone hemocytes, gills, mantle, muscle, digestive tract and hepatopancreas in a tissue-specific manner. Moreover, the AbLECT-1 transcription level was induced in hemocytes after challenge with Vibrio alginolyticus, Vibrio parahemolyticus, and Listeria monocytogenes suggesting that it may be involved in immune response reactions in abalone. Copyright 2010 Elsevier Ltd. All rights reserved.
Wang, Hong; Bi, Yongyi; Tao, Ning; Wang, Chunhong
2005-08-01
To detect the differential expression of cell signal transduction genes associated with benzene poisoning, and to explore the pathogenic mechanisms of blood system damage induced by benzene. Peripheral white blood cell gene expression profile of 7 benzene poisoning patients, including one aplastic anemia, was determined by cDNA microarray. Seven chips from normal workers were served as controls. Cluster analysis of gene expression profile was performed. Among the 4265 target genes, 176 genes associated with cell signal transduction were differentially expressed. 35 up-regulated genes including PTPRC, STAT4, IFITM1 etc were found in at least 6 pieces of microarray; 45 down-regulated genes including ARHB, PPP3CB, CDC37 etc were found in at least 5 pieces of microarray. cDNA microarray technology is an effective technique for screening the differentially expressed genes of cell signal transduction. Disorder in cell signal transduction may play certain role in the pathogenic mechanism of benzene poisoning.
Molecular cloning and characterization of Hymenolepis diminuta alpha-tubulin gene.
Mohajer-Maghari, Behrokh; Amini-Bavil-Olyaee, Samad; Webb, Rodney A; Coe, Imogen R
2007-02-01
To isolate a full-length alpha-tubulin cDNA from an eucestode, Hymenolepis diminuta, a lambda phage cDNA library was constructed. The alpha-tubulin gene was cloned, sequenced and characterized. The H. diminuta alpha-tubulin consisted of 450 amino acids. This protein contained putative sites for all posttranslational modifications as detyrosination/tyrosination at the carboxyl-terminal of protien, phosphorylation at residues R79 and K336, glycylation/glutamylation at residue G445 and acetylation at residue K40. Comparisons of H. diminuta alpha-tubulin with all full-length alpha-tubulin proteins revealed that H. diminuta alpha-tubulin possesses 10 distinctive residues, which are not found in any other alpha-tubulins. Phylogenetic analysis showed that H. diminuta alpha-tubulin has grouped in a separated branch adjacent eucestode and trematodes branch with 92% bootstrap value (1000 replicates). In conclusion, this is the first report of H. diminuta cDNA library construction, cloning and characterization of H. diminuta alpha-tubulin gene.
A Potato cDNA Encoding a Homologue of Mammalian Multidrug Resistant P-Glycoprotein
NASA Technical Reports Server (NTRS)
Wang, W.; Takezawa, D.; Poovaiah, B. W.
1996-01-01
A homologue of the multidrug resistance (MDR) gene was obtained while screening a potato stolon tip cDNA expression library with S-15-labeled calmodulin. The mammalian MDR gene codes for a membrane-bound P-glycoprotein (170-180 kDa) which imparts multidrug resistance to cancerous cells. The potato cDNA (PMDR1) codes for a polypeptide of 1313 amino acid residues (ca. 144 kDa) and its structural features are very similar to the MDR P-glycoprotein. The N-terminal half of the PMDR1-encoded protein shares striking homology with its C-terminal half, and each half contains a conserved ATP-binding site and six putative transmembrane domains. Southern blot analysis indicated that potato has one or two MDR-like genes. PMDR1 mRNA is constitutively expressed in all organs studied with higher expression in the stem and stolon tip. The PMDR1 expression was highest during tuber initiation and decreased during tuber development.
Qin, Xiaobo; Lin, Fanrong; Lii, Yifan; Gou, Chunbao; Chen, Fang
2011-03-01
A cDNA clone designated arf1 was isolated from a physic nut (Jatropha curcas L.) endosperm cDNA library which encodes a small GTP-binding protein and has significant homology to ADP-ribosylation factors (ARF) in plants, animals and microbes. The cDNA contains an open reading frame that encodes a polypeptide of 181 amino acids with a calculated molecular mass of 20.7 kDa. The deduced amino acid sequence showed high homology to known ARFs from other organisms. The products of the arf1 obtained by overexpression in E. coli revealed the specific binding activity toward GTP. The expression of arf1 was observed in flowers, roots, stems and leaves as analyzed by RT-PCR, and its transcriptional level was highest in flowers. In particular, the accumulation of arf1 transcripts was different under various environmental stresses in seedlings. The results suggest that arf1 plays distinct physiological roles in Jatropha curcas cells.
Ichinose, H; Wariishi, H; Tanaka, H
2002-09-01
A cDNA encoding cytochrome P450 oxidoreductase (CPR) from the lignin-degrading basidiomycete Coriolus versicolor was identified using RT-PCR. The full-length cDNA consisted of 2,484 nucleotides with a poly(A) tail, and contained an open reading frame. The G+C content of the cDNA isolated was 60%. A deduced protein contained 730 amino acid residues with a calculated molecular weight of 80.7 kDa. The conserved amino acid residues involved in functional domains such as FAD-, FMN-, and NADPH-binding domains, were all found in the deduced protein. A phylogenetic analysis demonstrated that C. versicolor CPR is significantly similar to CPR of the basidiomycete Phanerochaete chrysosporium and that they share the same major branch in the fungal cluster. A recombinant CPR protein was expressed using a pET/ Escherichia coli system. The recombinant CPR protein migrated at 81 kDa on SDS polyacrylamide gel electrophoresis. It exhibited an NADPH-dependent cytochrome c reducing activity.
Using single nuclei for RNA-seq to capture the transcriptome of postmortem neurons
Krishnaswami, Suguna Rani; Grindberg, Rashel V; Novotny, Mark; Venepally, Pratap; Lacar, Benjamin; Bhutani, Kunal; Linker, Sara B; Pham, Son; Erwin, Jennifer A; Miller, Jeremy A; Hodge, Rebecca; McCarthy, James K; Kelder, Martin; McCorrison, Jamison; Aevermann, Brian D; Fuertes, Francisco Diez; Scheuermann, Richard H; Lee, Jun; Lein, Ed S; Schork, Nicholas; McConnell, Michael J; Gage, Fred H; Lasken, Roger S
2016-01-01
A protocol is described for sequencing the transcriptome of a cell nucleus. Nuclei are isolated from specimens and sorted by FACS, cDNA libraries are constructed and RNA-seq is performed, followed by data analysis. Some steps follow published methods (Smart-seq2 for cDNA synthesis and Nextera XT barcoded library preparation) and are not described in detail here. Previous single-cell approaches for RNA-seq from tissues include cell dissociation using protease treatment at 30 °C, which is known to alter the transcriptome. We isolate nuclei at 4 °C from tissue homogenates, which cause minimal damage. Nuclear transcriptomes can be obtained from postmortem human brain tissue stored at −80 °C, making brain archives accessible for RNA-seq from individual neurons. The method also allows investigation of biological features unique to nuclei, such as enrichment of certain transcripts and precursors of some noncoding RNAs. By following this procedure, it takes about 4 d to construct cDNA libraries that are ready for sequencing. PMID:26890679
Kang, Yun; McMillan, Ian; Norris, Michael H; Hoang, Tung T
2015-07-01
Until recently, transcriptome analyses of single cells have been confined to eukaryotes. The information obtained from single-cell transcripts can provide detailed insight into spatiotemporal gene expression, and it could be even more valuable if expanded to prokaryotic cells. Transcriptome analysis of single prokaryotic cells is a recently developed and powerful tool. Here we describe a procedure that allows amplification of the total transcript of a single prokaryotic cell for in-depth analysis. This is performed by using a laser-capture microdissection instrument for single-cell isolation, followed by reverse transcription via Moloney murine leukemia virus, degradation of chromosomal DNA with McrBC and DpnI restriction enzymes, single-stranded cDNA (ss-cDNA) ligation using T4 polynucleotide kinase and CircLigase, and polymerization of ss-cDNA to double-stranded cDNA (ds-cDNA) by Φ29 polymerase. This procedure takes ∼5 d, and sufficient amounts of ds-cDNA can be obtained from single-cell RNA template for further microarray analysis.
Chiu, Chi-Chien; John, Joseph Abraham Christopher; Hseu, Tzong-Hsiung; Chang, Chi-Yao
2002-03-01
The pituitary-specific transcription factor Pit-1 belongs to the family of POU-domain proteins and is known to play an important role in the differentiation of pituitary cells. Here we report the complete nucleotide sequence of cDNA encoding Pit-1 from the brackish water fish, ayu (Plecoglossus altivelis). Nucleotide sequence analysis of 1910 bp of ayu Pit-1 cDNA revealed an open reading frame of 1074 bp that encodes a protein of 358 amino acids containing a POU-specific domain, POU homeodomain, and an STA (Ser/Thr-rich activation) transactivation domain. We inserted the coding region of Pit-1 cDNA, obtained by PCR, into a pET-20b(+) plasmid to produce recombinant Pit-1 in Escherichia coli BL21 (DE3) pLysS cells. Upon induction with isopropyl beta-D-thiogalactopyranoside, Pit-1 was expressed and accumulated as inclusion bodies in E. coli. The protein was then purified in one step by affinity chromatography on a nickel-nitrilotriacetic acid agarose column under denaturing conditions. This method yielded 0.7 mg of highly pure and stable protein per 200 ml of bacterial culture. A band of 40 kDa, resolved as recombinant ayu Pit-1 by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, agrees well with the molecular mass calculated from the translated cDNA sequence. The purified recombinant Pit-1 was confirmed in vitro through Western blot analysis, using its monoclonal antibody. This monoclonal antibody detected Pit-1 in the nuclei of ayu developing pituitary by immunohistochemical reaction. It serves as a good reagent for the detection of ayu Pit-1 in situ. Copyright 2002 Elsevier Science (USA).
Loit, Evelin; Melnyk, Charles W; MacFarlane, Amanda J; Scott, Fraser W; Altosaar, Illimar
2009-01-01
Background Exposure to dietary wheat proteins in genetically susceptible individuals has been associated with increased risk for the development of Type 1 diabetes (T1D). Recently, a wheat protein encoded by cDNA WP5212 has been shown to be antigenic in mice, rats and humans with autoimmune T1D. To investigate the genomic origin of the identified wheat protein cDNA, a hexaploid wheat genomic library from Glenlea cultivar was screened. Results Three unique wheat globulin genes, Glo-3A, Glo3-B and Glo-3C, were identified. We describe the genomic structure of these genes and their expression pattern in wheat seeds. The Glo-3A gene shared 99% identity with the cDNA of WP5212 at the nucleotide and deduced amino acid level, indicating that we have identified the gene(s) encoding wheat protein WP5212. Southern analysis revealed the presence of multiple copies of Glo-3-like sequences in all wheat samples, including hexaploid, tetraploid and diploid species wheat seed. Aleurone and embryo tissue specificity of WP5212 gene expression, suggested by promoter region analysis, which demonstrated an absence of endosperm specific cis elements, was confirmed by immunofluorescence microscopy using anti-WP5212 antibodies. Conclusion Taken together, the results indicate that a diverse group of globulins exists in wheat, some of which could be associated with the pathogenesis of T1D in some susceptible individuals. These data expand our knowledge of specific wheat globulins and will enable further elucidation of their role in wheat biology and human health. PMID:19615078
2012-01-01
Background The feline genome is valuable to the veterinary and model organism genomics communities because the cat is an obligate carnivore and a model for endangered felids. The initial public release of the Felis catus genome assembly provided a framework for investigating the genomic basis of feline biology. However, the entire set of protein coding genes has not been elucidated. Results We identified and characterized 1227 protein coding feline sequences, of which 913 map to public sequences and 314 are novel. These sequences have been deposited into NCBI's genbank database and complement public genomic resources by providing additional protein coding sequences that fill in some of the gaps in the feline genome assembly. Through functional and comparative genomic analyses, we gained an understanding of the role of these sequences in feline development, nutrition and health. Specifically, we identified 104 orthologs of human genes associated with Mendelian disorders. We detected negative selection within sequences with gene ontology annotations associated with intracellular trafficking, cytoskeleton and muscle functions. We detected relatively less negative selection on protein sequences encoding extracellular networks, apoptotic pathways and mitochondrial gene ontology annotations. Additionally, we characterized feline cDNA sequences that have mouse orthologs associated with clinical, nutritional and developmental phenotypes. Together, this analysis provides an overview of the value of our cDNA sequences and enhances our understanding of how the feline genome is similar to, and different from other mammalian genomes. Conclusions The cDNA sequences reported here expand existing feline genomic resources by providing high-quality sequences annotated with comparative genomic information providing functional, clinical, nutritional and orthologous gene information. PMID:22257742
Shin, Seung-Yong; Lee, Haeng-Soon; Kwon, Suk-Yoon; Kwon, Soon-Tae; Kwak, Sang-Soo
2005-01-01
Superoxide dismutase (SOD) cDNA, mSOD2, encoding cytosolic copper/zinc SOD (CuZnSOD) cDNA was isolated from suspension-cultured cells of cassava (Manihot esculenta Crantz) by cDNA library screening, and its expression was investigated in relation to environmental stress. mSOD2 is 774 bp in length with an open reading frame (ORF) of 152 amino acids, corresponding to a protein of predicted molecular mass 15 kDa and a pI of 5.22. One copy of the mSOD2 gene was found to be present in the cassava genome by Southern analysis using an mSOD2 cDNA-specific probe. Reverse transcriptase-polymerase chain reaction (RT-PCR) analysis revealed diverse expression patterns for the mSOD2 gene in various tissues of intact cassava plants, at various stages of the growth in suspension cultures, and in the leaf tissues exposed to different stresses. The mSOD2 gene was highly expressed in suspension-cultured cells and in the stems of intact plants. However, it was expressed at low levels in leaves and roots. During suspension cell growth, the mSOD2 transcript progressively increased during culture. Moreover, the mSOD2 gene in excised cassava leaves responded to various stresses in different ways. In particular, it was highly induced in leaf tissue by several abiotic stresses, including high temperature (37 degrees C), chilling (4 degrees C), methyl viologen (MV) exposure, and wounding treatment. These results indicate that the mSOD2 gene is involved in the antioxidative process triggered by oxidative stress induced by environmental change.
BIGEL analysis of gene expression in HL60 cells exposed to X rays or 60 Hz magnetic fields
NASA Technical Reports Server (NTRS)
Balcer-Kubiczek, E. K.; Zhang, X. F.; Han, L. H.; Harrison, G. H.; Davis, C. C.; Zhou, X. J.; Ioffe, V.; McCready, W. A.; Abraham, J. M.; Meltzer, S. J.
1998-01-01
We screened a panel of 1,920 randomly selected cDNAs to discover genes that are differentially expressed in HL60 cells exposed to 60 Hz magnetic fields (2 mT) or X rays (5 Gy) compared to unexposed cells. Identification of these clones was accomplished using our two-gel cDNA library screening method (BIGEL). Eighteen cDNAs differentially expressed in X-irradiated compared to control HL60 cells were recovered from a panel of 1,920 clones. Differential expression in experimental compared to control cells was confirmed independently by Northern blotting of paired total RNA samples hybridized to each of the 18 clone-specific cDNA probes. DNA sequencing revealed that 15 of the 18 cDNA clones produced matches with the database for genes related to cell growth, protein synthesis, energy metabolism, oxidative stress or apoptosis (including MYC, neuroleukin, copper zinc-dependent superoxide dismutase, TC4 RAS-like protein, peptide elongation factor 1alpha, BNIP3, GATA3, NF45, cytochrome c oxidase II and triosephosphate isomerase mRNAs). In contrast, BIGEL analysis of the same 1,920 cDNAs revealed no differences greater than 1.5-fold in expression levels in magnetic-field compared to sham-exposed cells. Magnetic-field-exposed and control samples were analyzed further for the presence of mRNA encoding X-ray-responsive genes by hybridization of the 18 specific cDNA probes to RNA from exposed and control HL60 cells. Our results suggest that differential gene expression is induced in approximately 1% of a random pool of cDNAs by ionizing radiation but not by 60 Hz magnetic fields under the present experimental conditions.
Simon, J W; Slabas, A R
1998-09-18
The GenBank database was searched using the E. coli malonyl CoA:ACP transacylase (MCAT) sequence, for plant protein/cDNA sequences corresponding to MCAT, a component of plant fatty acid synthetase (FAS), for which the plant cDNA has not been isolated. A 272-bp Zea mays EST sequence (GenBank accession number: AA030706) was identified which has strong homology to the E. coli MCAT. A PCR derived cDNA probe from Zea mays was used to screen a Brassica napus (rape) cDNA library. This resulted in the isolation of a 1200-bp cDNA clone which encodes an open reading frame corresponding to a protein of 351 amino acids. The protein shows 47% homology to the E. coli MCAT amino acid sequence in the coding region for the mature protein. Expression of a plasmid (pMCATrap2) containing the plant cDNA sequence in Fab D89, an E. coli mutant, in MCAT activity restores growth demonstrating functional complementation and direct function of the cloned cDNA. This is the first functional evidence supporting the identification of a plant cDNA for MCAT.
Bernstein, Steven L; Guo, Yan; Peterson, Katherine; Wistow, Graeme
2009-01-01
Background The optic nerve is a pure white matter central nervous system (CNS) tract with an isolated blood supply, and is widely used in physiological studies of white matter response to various insults. We examined the gene expression profile of human optic nerve (ON) and, through the NEIBANK online resource, to provide a resource of sequenced verified cDNA clones. An un-normalized cDNA library was constructed from pooled human ON tissues and was used in expressed sequence tag (EST) analysis. Location of an abundant oligodendrocyte marker was examined by immunofluorescence. Quantitative real time polymerase chain reaction (qRT-PCR) and Western analysis were used to compare levels of expression for key calcium channel protein genes and protein product in primate and rodent ON. Results Our analyses revealed a profile similar in many respects to other white matter related tissues, but significantly different from previously available ON cDNA libraries. The previous libraries were found to include specific markers for other eye tissues, suggesting contamination. Immune/inflammatory markers were abundant in the new ON library. The oligodendrocyte marker QKI was abundant at the EST level. Immunofluorescence revealed that this protein is a useful oligodendrocyte cell-type marker in rodent and primate ONs. L-type calcium channel EST abundance was found to be particularly low. A qRT-PCR-based comparative mammalian species analysis reveals that L-type calcium channel expression levels are significantly lower in primate than in rodent ON, which may help account for the class-specific difference in responsiveness to calcium channel blocking agents. Several known eye disease genes are abundantly expressed in ON. Many genes associated with normal axonal function, mRNAs associated with axonal transport, inflammation and neuroprotection are observed. Conclusion We conclude that the new cDNA library is a faithful representation of human ON and EST data provide an initial overview of gene expression patterns in this tissue. The data provide clues for tissue-specific and species-specific properties of human ON that will help in design of therapeutic models. PMID:19778450
Polyketide synthases from poison hemlock (Conium maculatum L.).
Hotti, Hannu; Seppänen-Laakso, Tuulikki; Arvas, Mikko; Teeri, Teemu H; Rischer, Heiko
2015-11-01
Coniine is a toxic alkaloid, the biosynthesis of which is not well understood. A possible route, supported by evidence from labelling experiments, involves a polyketide formed by the condensation of one acetyl-CoA and three malonyl-CoAs catalysed by a polyketide synthase (PKS). We isolated PKS genes or their fragments from poison hemlock (Conium maculatum L.) by using random amplification of cDNA ends (RACE) and transcriptome analysis, and characterized three full-length enzymes by feeding different starter-CoAs in vitro. On the basis of our in vitro experiments, two of the three characterized PKS genes in poison hemlock encode chalcone synthases (CPKS1 and CPKS2), and one encodes a novel type of PKS (CPKS5). We show that CPKS5 kinetically favours butyryl-CoA as a starter-CoA in vitro. Our results suggest that CPKS5 is responsible for the initiation of coniine biosynthesis by catalysing the synthesis of the carbon backbone from one butyryl-CoA and two malonyl-CoAs. © 2015 FEBS.
Wang, Xiaohong; Zheng, Zhi-Ming
2016-01-01
Papillomaviruses are a family of small, non-enveloped DNA tumor viruses. Knowing a complete transcription map from each papillomavirus genome can provide guidance for various papillomavirus studies. This unit provides detailed protocols to construct a transcription map of human papillomavirus type 18. The same approach can be easily adapted to other transcription map studies of any other papillomavirus genotype due to the high degree of conservation in the genome structure, organization and gene expression among papillomaviruses. The focused methods are 5’- and 3’- rapid amplification of cDNA ends (RACE), which are the techniques commonly used in molecular biology to obtain the full length RNA transcript or to map a transcription start site (TSS) or an RNA polyadenylation (pA) cleavage site. Primer walking RT-PCR is a method for studying splicing junction of RACE products. In addition, RNase protection assay and primer extension are also introduced as alternative methods in the mapping analysis. PMID:26855281
Brouilette, Scott; Kuersten, Scott; Mein, Charles; Bozek, Monika; Terry, Anna; Dias, Kerith-Rae; Bhaw-Rosun, Leena; Shintani, Yasunori; Coppen, Steven; Ikebe, Chiho; Sawhney, Vinit; Campbell, Niall; Kaneko, Masahiro; Tano, Nobuko; Ishida, Hidekazu; Suzuki, Ken; Yashiro, Kenta
2012-10-01
Deep sequencing of single cell-derived cDNAs offers novel insights into oncogenesis and embryogenesis. However, traditional library preparation for RNA-seq analysis requires multiple steps with consequent sample loss and stochastic variation at each step significantly affecting output. Thus, a simpler and better protocol is desirable. The recently developed hyperactive Tn5-mediated library preparation, which brings high quality libraries, is likely one of the solutions. Here, we tested the applicability of hyperactive Tn5-mediated library preparation to deep sequencing of single cell cDNA, optimized the protocol, and compared it with the conventional method based on sonication. This new technique does not require any expensive or special equipment, which secures wider availability. A library was constructed from only 100 ng of cDNA, which enables the saving of precious specimens. Only a few steps of robust enzymatic reaction resulted in saved time, enabling more specimens to be prepared at once, and with a more reproducible size distribution among the different specimens. The obtained RNA-seq results were comparable to the conventional method. Thus, this Tn5-mediated preparation is applicable for anyone who aims to carry out deep sequencing for single cell cDNAs. Copyright © 2012 Wiley Periodicals, Inc.
Zhu, Yue; Peng, Qingzhong; Li, Kegang; Xie, De-Yu
2018-04-10
Vitis bellula is a new grape crop in southern China. Berries of this species are rich in antioxidative anthocyanins and proanthocyanidins. This study reports cloning and functional characterization of a cDNA encoding a V. bellula dihydroflavonol reductase (VbDFR) involved in the biosynthesis of anthocyanins and proanthocyanidins. A cDNA including 1014 bp was cloned from young leaves and its open reading frame (ORF) was deduced encoding 337 amino acids, highly similar to V. vinifera DFR (VvDFR). Green florescence protein fusion and confocal microscopy analysis determined the cytosolic localization of VbDFR in plant cells. A soluble recombinant VbDFR was induced and purified from E. coli for enzyme assay. In the presence of NADPH, the recombinant enzyme catalyzed dihydrokaempferol (DHK) and dihydroquercetin (DHQ) to their corresponding leucoanthocyanidins. The VbDFR cDNA was introduced into tobacco plants via Agrobacterium -mediated transformation. The overexpression of VbDFR increased anthocyanin production in flowers. Anthocyanin hydrolysis and chromatographic analysis revealed that transgenic flowers produced pelargonidin and delphinidin, which were not detected in control flowers. These data demonstrated that the overexpression of VbDFR produced new tobacco anthocyanidins. In summary, all data demonstrate that VbDFR is a useful gene to provide three types of substrates for metabolic engineering of anthocyanins and proanthocyanidins in grape crops and other crops.
El-Halawany, Nermin; Abd-El-Monsif, Shawky A; Al-Tohamy Ahmed, F M; Hegazy, Lamees; Abdel-Shafy, Hamdy; Abdel-Latif, Magdy A; Ghazi, Yasser A; Neuhoff, Christiane; Salilew-Wondim, Dessie; Schellander, Karl
2017-03-01
Mastitis is an infectious disease of the mammary gland that leads to reduced milk production and change in milk composition. Complement component C3 plays a major role as a central molecule of the complement cascade involving in killing of microorganisms, either directly or in cooperation with phagocytic cells. C3 cDNA were isolated, from Egyptian buffalo and cattle, sequenced and characterized. The C3 cDNA sequences of buffalo and cattle consist of 5025 and 5019 bp, respectively. Buffalo and cattle C3 cDNAs share 99% of sequence identity with each other. The 4986 bp open reading frame in buffalo encodes a putative protein of 1661 amino acids-as in cattle-and includes all the functional domains. Further, analysis of the C3 cDNA sequences detected six novel single-nucleotide polymorphisms (SNPs) in buffalo and three novel SNPs in cattle. The association analysis of the detected SNPs with milk somatic cell score as an indicator of mastitis revealed that the most significant association in buffalo was found in the C>A substitution (ss: 1752816097) in exon 27, whereas in cattle it was in the C>T substitution (ss: 1752816085) in exon 12. Our findings provide preliminary information about the contribution of C3 polymorphisms to mastitis resistance in buffalo and cattle.
Li, Lishu; Ikezono, Tetsuo; Sekine, Kuwon; Shindo, Susumu; Matsumura, Tomohiro; Pawankar, Ruby; Ichimiya, Issei; Yagi, Toshiaki
2010-08-01
We have cloned guinea pig Coch cDNA and the sequence information will be useful for future molecular study combined with physiological experiments. Proper Coch gene expression appears to be dependent on the unique extracellular micro-environment of the inner ear in vivo. These results provide insight into the Coch gene expression and its regulation. To characterize the guinea pig Coch gene, we performed molecular cloning and expression analysis in the inner ear and cultured fibrocytes of the spiral ligament. The Coch cDNA was isolated using RACE. Cochlin isofoms were studied by Western blot using three different types of mammalian inner ear. The cochlear fibrocytes were cultured and characterized by immunostaining. Coch gene expression in the fibrocytes was investigated and the influence of cytokine stimulation was evaluated. The full-length 1991 bp Coch cDNA that encodes a 553 amino acid protein was isolated. The sequence had significant homology with other mammals, and the sizes of the Cochlin isoforms were identical. In the cultured fibrocytes, Coch mRNA was expressed in a very small amount and the isoform production was different, compared with the results in vivo. Cytokine stimulation did not alter the level of mRNA expression or isoform formation.
Oz-Gleenberg, Iris; Herzig, Eytan; Hizi, Amnon
2012-01-01
Reverse transcriptases (RTs) possess a non-templated addition (NTA) activity while synthesizing DNA with blunt-ended DNA primer/templates. Interestingly, the RT of the long terminal repeat retrotransposon Tf1 has an NTA activity that is substantially higher than that of HIV-1 or murine leukemia virus RTs. By performing steady state kinetics, we found that the differences between the NTA activities of Tf1 and HIV-1 RTs can be explained by the substantially lower K(M) value for the incoming dNTP of Tf1 RT (while the differences between the apparent k(cat) values of these two RTs are relatively small). Furthermore, the K(M) values, calculated for both RTs with the same dNTP, are much lower for the template-dependent synthesis (TDS) than those of NTA. However, TDS of HIV-1 RT is higher than that of Tf1 RT. The overall relative order of the apparent k(cat)/K(M) values for dATP is: HIV-1 RT (TDS) > Tf1 RT (TDS) > Tf1 RT (NTA) > HIV-1 RT (NTA). Under the employed conditions, Tf1 RT can add up to seven nucleotides to the blunt-ended substrate, while the other RTs add mostly a single nucleotide. The NTA activity of Tf1 RT is restricted to DNA primers. Furthermore, the NTA activity of Tf1 and HIV-1 RTs is suppressed by ATP, as it competes with the incoming dATP (although ATP is not incorporated by the NTA activity of the RTs). The unusually high NTA activity of Tf1 RT can explain why, after completing cDNA synthesis, the in vivo generated Tf1 cDNA has relatively long extra sequences beyond the highly conserved CA at its 3'-ends. © 2011 The Authors Journal compilation © 2011 FEBS.
Gilchrist, Michael J.; Sobral, Daniel; Khoueiry, Pierre; ...
2015-05-27
Genome-wide resources, such as collections of cDNA clones encoding for complete proteins (full-ORF clones), are crucial tools for studying the evolution of gene function and genetic interactions. Non-model organisms, in particular marine organisms, provide a rich source of functional diversity. Marine organism genomes are, however, frequently highly polymorphic and encode proteins that diverge significantly from those of well-annotated model genomes. The construction of full-ORF clone collections from non-model organisms is hindered by the difficulty of predicting accurately the N-terminal ends of proteins, and distinguishing recent paralogs from highly polymorphic alleles. We also report a computational strategy that overcomes these difficulties,more » and allows for accurate gene level clustering of transcript data followed by the automated identification of full-ORFs with correct 5'- and 3'-ends. It is robust to polymorphism, includes paralog calling and does not require evolutionary proximity to well annotated model organisms. Here, we developed this pipeline for the ascidian Ciona intestinalis, a highly polymorphic member of the divergent sister group of the vertebrates, emerging as a powerful model organism to study chordate gene function, Gene Regulatory Networks and molecular mechanisms underlying human pathologies. Furthermore, using this pipeline we have generated the first full-ORF collection for a highly polymorphic marine invertebrate. It contains 19,163 full-ORF cDNA clones covering 60% of Ciona coding genes, and full-ORF orthologs for approximately half of curated human disease-associated genes.« less
Shafaghat, Farzaneh; Abbasi-Kenarsari, Hajar; Majidi, Jafar; Movassaghpour, Ali Akbar; Shanehbandi, Dariush; Kazemi, Tohid
2015-01-01
Purpose: Transmembrane CD34 glycoprotein is the most important marker for identification, isolation and enumeration of hematopoietic stem cells (HSCs). We aimed in this study to clone the cDNA coding for human CD34 from KG1a cell line and stably express in mouse fibroblast cell line NIH-3T3. Such artificial cell line could be useful as proper immunogen for production of mouse monoclonal antibodies. Methods: CD34 cDNA was cloned from KG1a cell line after total RNA extraction and cDNA synthesis. Pfu DNA polymerase-amplified specific band was ligated to pGEMT-easy TA-cloning vector and sub-cloned in pCMV6-Neo expression vector. After transfection of NIH-3T3 cells using 3 μg of recombinant construct and 6 μl of JetPEI transfection reagent, stable expression was obtained by selection of cells by G418 antibiotic and confirmed by surface flow cytometry. Results: 1158 bp specific band was aligned completely to reference sequence in NCBI database corresponding to long isoform of human CD34. Transient and stable expression of human CD34 on transfected NIH-3T3 mouse fibroblast cells was achieved (25% and 95%, respectively) as shown by flow cytometry. Conclusion: Cloning and stable expression of human CD34 cDNA was successfully performed and validated by standard flow cytometric analysis. Due to murine origin of NIH-3T3 cell line, CD34-expressing NIH-3T3 cells could be useful as immunogen in production of diagnostic monoclonal antibodies against human CD34. This approach could bypass the need for purification of recombinant proteins produced in eukaryotic expression systems. PMID:25789221
Zhang, Mingming; Pan, Xietian; Zou, Qian; Xia, Yuesheng; Chen, Jiangwei; Hao, Qimeng; Wang, Haichang; Sun, Dongdong
2016-10-01
Notch3 and TGF-β1 signaling play a key role in the pathogenesis and progression of chronic cardiovascular disease. However, whether Notch3 protects against myocardial infarction (MI) and the underlying mechanisms remains unknown. C57BL/6 mice were randomized to be treated with Notch3 siRNA (siNotch3) or lentivirus carrying Notch3 cDNA (Notch3) before coronary artery ligation. Four weeks after constructing MI model, cardiac function and fibrosis were compared between groups. The cardiac fibroblast cells (CFs) were isolated from newborn C57BL/6 mice (1-3 days old) and transfected with lentivirus carrying Notch3 cDNA. TGF-β1 (5 ng/ml), a well-known pro-fibrotic factor, was administered 72 h after Notch3 cDNA administration in CFs. The related proteins of fibrosis such as a-smooth muscle actin (a-SMA), Type I collagen, metalloprotease (MMP)-9 and the tissue inhibitor of metalloproteinases (TIMP)-2 were examined by western blot analysis. Notch3 cDNA treatment attenuated cardiac damage and inhibited fibrosis in mice with MI. Meanwhile, Notch3 siRNA administration aggravated cardiac function damage and markedly enhanced cardiac fibrosis in mice with MI. Overexpression of Notch3 inhibited TGF-β1-induced fibroblast-myofibroblast transition of mouse cardiac fibroblast cells, as evidenced by down-regulating a-SMA and Type I collagen expression. Notch3 cDNA treatment also increased MMP-9 expression and decreased TIMP-2 expression in the TGF-β1-stimulated cells. This study indicates that Notch3 is an important protective factor for cardiac fibrosis in a MI model, and the protective effect of Notch3 is attributable to its action on TGF-β1/Smad3 signaling.
Zhao, Hongjuan; Hastie, Trevor; Whitfield, Michael L; Børresen-Dale, Anne-Lise; Jeffrey, Stefanie S
2002-01-01
Background T7 based linear amplification of RNA is used to obtain sufficient antisense RNA for microarray expression profiling. We optimized and systematically evaluated the fidelity and reproducibility of different amplification protocols using total RNA obtained from primary human breast carcinomas and high-density cDNA microarrays. Results Using an optimized protocol, the average correlation coefficient of gene expression of 11,123 cDNA clones between amplified and unamplified samples is 0.82 (0.85 when a virtual array was created using repeatedly amplified samples to minimize experimental variation). Less than 4% of genes show changes in expression level by 2-fold or greater after amplification compared to unamplified samples. Most changes due to amplification are not systematic both within one tumor sample and between different tumors. Amplification appears to dampen the variation of gene expression for some genes when compared to unamplified poly(A)+ RNA. The reproducibility between repeatedly amplified samples is 0.97 when performed on the same day, but drops to 0.90 when performed weeks apart. The fidelity and reproducibility of amplification is not affected by decreasing the amount of input total RNA in the 0.3–3 micrograms range. Adding template-switching primer, DNA ligase, or column purification of double-stranded cDNA does not improve the fidelity of amplification. The correlation coefficient between amplified and unamplified samples is higher when total RNA is used as template for both experimental and reference RNA amplification. Conclusion T7 based linear amplification reproducibly generates amplified RNA that closely approximates original sample for gene expression profiling using cDNA microarrays. PMID:12445333
Ferrer, Valéria Pereira; de Mari, Thiago Lopes; Gremski, Luiza Helena; Trevisan Silva, Dilza; da Silveira, Rafael Bertoni; Gremski, Waldemiro; Chaim, Olga Meiri; Senff-Ribeiro, Andrea; Nader, Helena Bonciani; Veiga, Silvio Sanches
2013-01-01
Loxoscelism is the designation given to clinical symptoms evoked by Loxosceles spider's bites. Clinical manifestations include skin necrosis with gravitational spreading and systemic disturbs. The venom contains several enzymatic toxins. Herein, we describe the cloning, expression, refolding and biological evaluation of a novel brown spider protein characterized as a hyaluronidase. Employing a venom gland cDNA library, we cloned a hyaluronidase (1200 bp cDNA) that encodes for a signal peptide and a mature protein. Amino acid alignment revealed a structural relationship with members of hyaluronidase family, such as scorpion and snake species. Recombinant hyaluronidase was expressed as N-terminal His-tag fusion protein (∼45 kDa) in inclusion bodies and activity was achieved using refolding. Immunoblot analysis showed that antibodies that recognize the recombinant protein cross-reacted with hyaluronidase from whole venom as well as an anti-venom serum reacted with recombinant protein. Recombinant hyaluronidase was able to degrade purified hyaluronic acid (HA) and chondroitin sulfate (CS), while dermatan sulfate (DS) and heparan sulfate (HS) were not affected. Zymograph experiments resulted in ∼45 kDa lytic zones in hyaluronic acid (HA) and chondroitin sulfate (CS) substrates. Through in vivo experiments of dermonecrosis using rabbit skin, the recombinant hyaluronidase was shown to increase the dermonecrotic effect produced by recombinant dermonecrotic toxin from L. intermedia venom (LiRecDT1). These data support the hypothesis that hyaluronidase is a “spreading factor”. Recombinant hyaluronidase provides a useful tool for biotechnological ends. We propose the name Dietrich's Hyaluronidase for this enzyme, in honor of Professor Carl Peter von Dietrich, who dedicated his life to studying proteoglycans and glycosaminoglycans. PMID:23658852
Systematic cloning and analysis of autophagy-related genes from the silkworm Bombyx mori
Zhang, Xuan; Hu, Zhan-Ying; Li, Wei-Fang; Li, Qing-Rong; Deng, Xiao-Juan; Yang, Wan-Ying; Cao, Yang; Zhou, Cong-Zhao
2009-01-01
Background Through the whole life of eukaryotes, autophagy plays an important role in various biological events including development, differentiation and determination of lifespan. A full set of genes and their encoded proteins of this evolutionarily conserved pathway have been identified in many eukaryotic organisms from yeast to mammals. However, this pathway in the insect model organism, the silkworm Bombyx mori, remains poorly investigated. Results Based on the autophagy pathway in several model organisms and a series of bioinformatic analyses, we have found more than 20 autophagy-related genes from the current database of the silkworm Bombyx mori. These genes could be further classified into the signal transduction pathway and two ubiquitin-like pathways. Using the mRNA extracted from the silkgland, we cloned the full length cDNA fragments of some key genes via reverse transcription PCR and 3' rapid amplification of cDNA ends (RACE). In addition, we found that the transcription levels of two indicator genes BmATG8 and BmATG12 in the silkgland tend to be increased from 1st to 8th day of the fifth instar larvae. Conclusion Bioinformatics in combination with RT-PCR enable us to remodel a preliminary pathway of autophagy in the silkworm. Amplification and cloning of most autophagy-related genes from the silkgland indicated autophagy is indeed an activated process. Furthermore, the time-course transcriptional profiles of BmATG8 and BmATG12 revealed that both genes are up-regulated along the maturation of the silkgland during the fifth instar. These findings suggest that the autophagy should play an important role in Bombyx mori silkgland. PMID:19470186
Parra-Unda, Ricardo; Vaca-Paniagua, Felipe; Jiménez, Lucia; Landa, Abraham
2012-01-01
Cytosolic Cu,Zn superoxide dismutase (Cu,Zn-SOD) catalyzes the dismutation of superoxide (O(2)(-)) to oxygen and hydrogen peroxide (H(2)O(2)) and plays an important role in the establishment and survival of helminthes in their hosts. In this work, we describe the Taenia solium Cu,Zn-SOD gene (TsCu,Zn-SOD) and a Taenia crassiceps (TcCu,Zn-SOD) cDNA. TsCu,Zn-SOD gene that spans 2.841 kb, and has three exons and two introns; the splicing junctions follow the GT-AG rule. Analysis in silico of the gene revealed that the 5'-flanking region has three putative TATA and CCAAT boxes, and transcription factor binding sites for NF1 and AP1. The transcription start site was a C, located at 22 nucleotides upstream of the translation start codon (ATG). Southern blot analysis showed that TcCu,Zn-SOD and TsCu,Zn-SOD genes are encoded by a single copy. The deduced amino acid sequences of TsCu,Zn-SOD gene and TcCu,Zn-SOD cDNA reveal 98.47% of identity, and the characteristic motives, including the catalytic site and β-barrel structure of the Cu,Zn-SOD. Proteomic and immunohistochemical analysis indicated that Cu,Zn-SOD does not have isoforms, is distributed throughout the bladder wall and is concentrated in the tegument of T. solium and T. crassiceps cysticerci. Expression analysis revealed that TcCu,Zn-SOD mRNA and protein expression levels do not change in cysticerci, even upon exposure to O(2)(-) (0-3.8 nmol/min) and H(2)O(2) (0-2mM), suggesting that this gene is constitutively expressed in these parasites. Published by Elsevier Inc.
Xiao, Yongli; Sheng, Zong-Mei; Taubenberger, Jeffery K.
2015-01-01
The vast majority of surgical biopsy and post-mortem tissue samples are formalin-fixed and paraffin-embedded (FFPE), but this process leads to RNA degradation that limits gene expression analysis. As an example, the viral RNA genome of the 1918 pandemic influenza A virus was previously determined in a 9-year effort by overlapping RT-PCR from post-mortem samples. Using the protocols described here, the full genome of the 1918 virus at high coverage was determined in one high-throughput sequencing run of a cDNA library derived from total RNA of a 1918 FFPE sample after duplex-specific nuclease treatments. This basic methodological approach should assist in the analysis of FFPE tissue samples isolated over the past century from a variety of infectious diseases. PMID:26344216
NASA Astrophysics Data System (ADS)
Jiang, Keyong; Sun, Shujuan; Liu, Mei; Wang, Baojie; Meng, Xiaolin; Wang, Lei
2013-01-01
AMP deaminase catalyzes the conversion of AMP into IMP and ammonia. In the present study, a full-length cDNA of AMPD1 from skeletal muscle of Japanese flounder Paralichthys olivaceus was cloned and characterized. The 2 526 bp cDNA contains a 5'-UTR of 78 bp, a 3'-UTR of 237 bp and an open reading frame (ORF) of 2 211 bp, which encodes a protein of 736 amino acids. The predicted protein contains a highly conserved AMP deaminase motif (SLSTDDP) and an ATP-binding site sequence (EPLMEEYAIAAQVFK). Phylogenetic analysis showed that the AMPD1 and AMPD3 genes originate from the same branch, but are evolutionarily distant from the AMPD2 gene. RT-PCR showed that the flounder AMPD1 gene was expressed only in skeletal muscle. QRT-PCR analysis revealed a statistically significant 2.54 fold higher level of AMPD1 mRNA in adult muscle (750±40 g) compared with juvenile muscle (7.5±2 g) ( P<0.05). HPLC analysis showed that the IMP content in adult muscle (3.35±0.21 mg/g) was also statistically significantly higher than in juvenile muscle (1.08±0.04 mg/g) ( P<0.05). There is a direct relationship between the AMPD1 gene expression level and IMP content in the skeletal muscle of juvenile and adult flounders. These results may provide useful information for quality improvement and molecular breeding of aquatic animals.
Seo, H S; Kim, H Y; Jeong, J Y; Lee, S Y; Cho, M J; Bahk, J D
1995-03-01
A cDNA clone, RGA1, was isolated by using a GPA1 cDNA clone of Arabidopsis thaliana G protein alpha subunit as a probe from a rice (Oryza sativa L. IR-36) seedling cDNA library from roots and leaves. Sequence analysis of genomic clone reveals that the RGA1 gene has 14 exons and 13 introns, and encodes a polypeptide of 380 amino acid residues with a calculated molecular weight of 44.5 kDa. The encoded protein exhibits a considerable degree of amino acid sequence similarity to all the other known G protein alpha subunits. A putative TATA sequence (ATATGA), a potential CAAT box sequence (AGCAATAC), and a cis-acting element, CCACGTGG (ABRE), known to be involved in ABA induction are found in the promoter region. The RGA1 protein contains all the consensus regions of G protein alpha subunits except the cysteine residue near the C-terminus for ADP-ribosylation by pertussis toxin. The RGA1 polypeptide expressed in Escherichia coli was, however, ADP-ribosylated by 10 microM [adenylate-32P] NAD and activated cholera toxin. Southern analysis indicates that there are no other genes similar to the RGA1 gene in the rice genome. Northern analysis reveals that the RGA1 mRNA is 1.85 kb long and expressed in vegetative tissues, including leaves and roots, and that its expression is regulated by light.
Gocayne, J; Robinson, D A; FitzGerald, M G; Chung, F Z; Kerlavage, A R; Lentes, K U; Lai, J; Wang, C D; Fraser, C M; Venter, J C
1987-01-01
Two cDNA clones, lambda RHM-MF and lambda RHB-DAR, encoding the muscarinic cholinergic receptor and the beta-adrenergic receptor, respectively, have been isolated from a rat heart cDNA library. The cDNA clones were characterized by restriction mapping and automated DNA sequence analysis utilizing fluorescent dye primers. The rat heart muscarinic receptor consists of 466 amino acids and has a calculated molecular weight of 51,543. The rat heart beta-adrenergic receptor consists of 418 amino acids and has a calculated molecular weight of 46,890. The two cardiac receptors have substantial amino acid homology (27.2% identity, 50.6% with favored substitutions). The rat cardiac beta receptor has 88.0% homology (92.5% with favored substitutions) with the human brain beta receptor and the rat cardiac muscarinic receptor has 94.6% homology (97.6% with favored substitutions) with the porcine cardiac muscarinic receptor. The muscarinic cholinergic and beta-adrenergic receptors appear to be as conserved as hemoglobin and cytochrome c but less conserved than histones and are clearly members of a multigene family. These data support our hypothesis, based upon biochemical and immunological evidence, that suggests considerable structural homology and evolutionary conservation between adrenergic and muscarinic cholinergic receptors. To our knowledge, this is the first report utilizing automated DNA sequence analysis to determine the structure of a gene. Images PMID:2825184
Primary structure of stanniocalcin in two basal Actinopterygii.
Amemiya, Yutaka; Youson, John H
2004-01-15
The primary structure of stanniocalcin (STC), the principal product of the corpuscles of Stannius (CS) in ray-finned fishes, was deduced from STC cDNA clones for two species of holostean, the gar, Lepisosteus osseus and the bowfin, Amia calva. Overlapping partial cDNA clones were amplified by polymerase chain reaction (PCR) from single-strand cDNA of the CS. Excluding the poly(A) tail, the cDNAs of 1863 base pairs [bp] (gar) and 914 bp (bowfin) contained the 5' untranslated region followed by the coding region and the 3' untranslated region. Both the gar and bowfin STC cDNA encode a prehormone of 252 amino acids (aa) with a signal peptide of 32 aa and a mature protein of 220 aa. The deduced aa sequence of gar STC shows 87% identity with bowfin STC, 60-72% identity with most vertebrate STCs and 26% identity with mouse STC2. Phylogenetic analysis of the sequences support a view that the gar and bowfin form a monophyletic holostean clade. RT-PCR revealed in the gar and bowfin that, just as in mammals and rainbow trout, the expression of STC mRNA is widely spread in many tissues and organs. Since the gar and bowfin are representatives of the most ancient fishes known to possess CS, the corpuscular-derived STC molecule in fish has had a conserved evolution.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Woon, J. S. K., E-mail: jameswoon@siswa.ukm.edu.my; Murad, A. M. A., E-mail: munir@ukm.edu.my; Abu Bakar, F. D., E-mail: fabyff@ukm.edu.my
A cellobiohydrolase B (CbhB) from Aspergillus niger ATCC 10574 was cloned and expressed in E. coli. CbhB has an open reading frame of 1611 bp encoding a putative polypeptide of 536 amino acids. Analysis of the encoded polypeptide predicted a molecular mass of 56.2 kDa, a cellulose binding module (CBM) and a catalytic module. In order to obtain the mRNA of cbhB, total RNA was extracted from A. niger cells induced by 1% Avicel. First strand cDNA was synthesized from total RNA via reverse transcription. The full length cDNA of cbhB was amplified by PCR and cloned into the cloning vector, pGEM-Tmore » Easy. A comparison between genomic DNA and cDNA sequences of cbhB revealed that the gene is intronless. Upon the removal of the signal peptide, the cDNA of cbhB was cloned into the expression vector pET-32b. However, the recombinant CbhB was expressed in Escherichia coli Origami DE3 as an insoluble protein. A homology model of CbhB predicted the presence of nine disulfide bonds in the protein structure which may have contributed to the improper folding of the protein and thus, resulting in inclusion bodies in E. coli.« less
Yang, Bing-Yan; Huo, Xiu-Ai; Li, Peng-Fei; Wang, Cui-Xia; Duan, Hui-Jun
2014-08-01
Full-length cDNAs are very important for genome annotation and functional analysis of genes. The number of full-length cDNAs from watermelon remains limited. Here we report first the construction of a full-length enriched cDNA library from Fusarium wilt stressed watermelon (Citrullus lanatus Thunb.) cultivar PI296341 root tissues using the SMART method. The titer of primary cDNA library and amplified library was 2.21 x 10(6) and 2.0 x 10(10) pfu/ml, respectively and the rate of recombinant was above 85%. The size of insert fragment ranged from 0.3 to 2.0 kb. In this study, we first cloned a gene named ClWRKY1, which was 1981 bp long and encoded a protein consisting of 394 amino acids. It contained two characteristic WRKY domains and two zinc finger motifs. Quantitative real-time PCR showed that ClWRKY1 expression levels reached maximum level at 12 h after inoculation with Fusarium oxysporum f. sp. niveum. The full-length cDNA library of watermelon root tissues is not only essential for the cloning of genes which are known, but also an initial key for the screening and cloning of new genes that might be involved in resistance to Fusarium wilt.
Construction of cDNA library and preliminary analysis of expressed sequence tags from Siberian tiger
Liu, Chang-Qing; Lu, Tao-Feng; Feng, Bao-Gang; Liu, Dan; Guan, Wei-Jun; Ma, Yue-Hui
2010-01-01
In this study we successfully constructed a full-length cDNA library from Siberian tiger, Panthera tigris altaica, the most well-known wild Animal. Total RNA was extracted from cultured Siberian tiger fibroblasts in vitro. The titers of primary and amplified libraries were 1.30×106 pfu/ml and 1.62×109 pfu/ml respectively. The proportion of recombinants from unamplified library was 90.5% and average length of exogenous inserts was 1.13 kb. A total of 282 individual ESTs with sizes ranging from 328 to 1,142bps were then analyzed the BLASTX score revealed that 53.9% of the sequences were classified as strong match, 38.6% as nominal and 7.4% as weak match. 28.0% of them were found to be related to enzyme/catalytic protein, 20.9% ESTs to metabolism, 13.1% ESTs to transport, 12.1% ESTs to signal transducer/cell communication, 9.9% ESTs to structure protein, 3.9% ESTs to immunity protein/defense metabolism, 3.2% ESTs to cell cycle, and 8.9 ESTs classified as novel genes. These results demonstrated that the reliability and representativeness of the cDNA library attained to the requirements of a standard cDNA library. This library provided a useful platform for the functional genomic research of Siberian tigers. PMID:20941376
Walker, M D; Park, C W; Rosen, A; Aronheim, A
1990-01-01
Cell specific expression of the insulin gene is achieved through transcriptional mechanisms operating on multiple DNA sequence elements located in the 5' flanking region of the gene. Of particular importance in the rat insulin I gene are two closely similar 9 bp sequences (IEB1 and IEB2): mutation of either of these leads to 5-10 fold reduction in transcriptional activity. We have screened an expression cDNA library derived from mouse pancreatic endocrine beta cells with a radioactive DNA probe containing multiple copies of the IEB1 sequence. A cDNA clone (A1) isolated by this procedure encodes a protein which shows efficient binding to the IEB1 probe, but much weaker binding to either an unrelated DNA probe or to a probe bearing a single base pair insertion within the recognition sequence. DNA sequence analysis indicates a protein belonging to the helix-loop-helix family of DNA-binding proteins. The ability of the protein encoded by clone A1 to recognize a number of wild type and mutant DNA sequences correlates closely with the ability of each sequence element to support transcription in vivo in the context of the insulin 5' flanking DNA. We conclude that the isolated cDNA may encode a transcription factor that participates in control of insulin gene expression. Images PMID:2181401
Hamatani, Kiyohiro; Eguchi, Hidetaka; Koyama, Kazuaki; Mukai, Mayumi; Nakachi, Kei; Kusunoki, Yoichiro
2014-11-01
During analysis of RET/PTC rearrangements in papillary thyroid cancer (PTC) among atomic bomb survivors, a cDNA fragment of a novel type of RET rearrangement was identified in a PTC patient exposed to a high radiation dose using the improved 5' RACE method. This gene resulted from the fusion of the 3' portion of RET containing tyrosine kinase domain to the 5' portion of the acyl-coenzyme A binding domain containing 5 (ACBD5) gene, by pericentric inversion inv(10)(p12.1;q11.2); expression of the fusion gene was confirmed by RT-PCR. ACBD5 gene is ubiquitously expressed in various human normal tissues including thyroid. Full-length cDNA of the ACBD5-RET gene was constructed and then examined for tumorigenicity. Enhanced phosphorylation of ERK proteins in the MAPK pathway was observed in NIH3T3 cells transfected with expression vector encoding the full-length ACBD5/RET cDNA, while this was not observed in the cells transfected with empty expression vector. Stable NIH3T3 transfectants with ACBD5-RET cDNA induced tumor formation after their injection into nude mice. These findings suggest that the ACBD5-RET rearrangement is causatively involved in the development of PTC.
Molecular cloning and expression of rat brain endopeptidase 3.4.24.16.
Dauch, P; Vincent, J P; Checler, F
1995-11-10
We have isolated by immunological screening of a lambda ZAPII cDNA library constructed from rat brain mRNAs a cDNA clone encoding endopeptidase 3.4.24.16. The longest open reading frame encodes a 704-amino acid protein with a theoretical molecular mass of 80,202 daltons and bears the consensus sequence of the zinc metalloprotease family. The sequence exhibits a 60.2% homology with those of another zinc metallopeptidase, endopeptidase 3.4.24.15. Northern blot analysis reveals two mRNA species of about 3 and 5 kilobases in rat brain, ileum, kidney, and testis. We have transiently transfected COS-7 cells with pcDNA3 containing the cloned cDNA and established the overexpression of a 70-75-kDa immunoreactive protein. This protein hydrolyzes QFS, a quenched fluorimetric substrate of endopeptidase 3.4.24.16, and cleaves neurotensin at a single peptide bond, leading to the formation of neurotensin (1-10) and neurotensin (11-13). QFS and neurotensin hydrolysis are potently inhibited by the selective endopeptidase 3.4.24.16 dipeptide blocker Pro-Ile and by dithiothreitol, while the enzymatic activity remains unaffected by phosphoramidon and captopril, the specific inhibitors of endopeptidase 3.4.24.11 and angiotensin-converting enzyme, respectively. Altogether, these physicochemical, biochemical, and immunological properties unambiguously identify endopeptidase 3.4.24.16 as the protein encoded by the isolated cDNA clone.
Method for construction of normalized cDNA libraries
Soares, Marcelo B.; Efstratiadis, Argiris
1998-01-01
This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to appropriate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. This invention also provides normalized cDNA libraries generated by the above-described method and uses of the generated libraries.
Method for construction of normalized cDNA libraries
Soares, M.B.; Efstratiadis, A.
1998-11-03
This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3` noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to appropriate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. This invention also provides normalized cDNA libraries generated by the above-described method and uses of the generated libraries. 19 figs.
Travis, G H; Sutcliffe, J G
1988-01-01
To isolate cDNA clones of low-abundance mRNAs expressed in monkey cerebral cortex but absent from cerebellum, we developed an improved subtractive cDNA cloning procedure that requires only modest quantities of mRNA. Plasmid DNA from a monkey cerebellum cDNA library was hybridized in large excess to radiolabeled monkey cortex cDNA in a phenol emulsion-enhanced reaction. The unhybridized cortex cDNA was isolated by chromatography on hydroxyapatite and used to probe colonies from a monkey cortex cDNA library. Of 60,000 colonies screened, 163 clones were isolated and confirmed by colony hybridization or RNA blotting to represent mRNAs, ranging from 0.001% to 0.1% abundance, specific to or highly enriched in cerebral cortex relative to cerebellum. Clones of one medium-abundance mRNA were recovered almost quantitatively. Two of the lower-abundance mRNAs were expressed at levels reduced by a factor of 10 in Alzheimer disease relative to normal human cortex. One of these was identified as the monkey preprosomatostatin I mRNA. Images PMID:2894033
Hu, Lin-Yong; Cui, Chen-Chen; Song, Yu-Jie; Wang, Xiang-Guo; Jin, Ya-Ping; Wang, Ai-Hua; Zhang, Yong
2012-07-01
cDNA is widely used in gene function elucidation and/or transgenics research but often suitable tissues or cells from which to isolate mRNA for reverse transcription are unavailable. Here, an alternative method for cDNA cloning is described and tested by cloning the cDNA of human LALBA (human alpha-lactalbumin) from genomic DNA. First, genomic DNA containing all of the coding exons was cloned from human peripheral blood and inserted into a eukaryotic expression vector. Next, by delivering the plasmids into either 293T or fibroblast cells, surrogate cells were constructed. Finally, the total RNA was extracted from the surrogate cells and cDNA was obtained by RT-PCR. The human LALBA cDNA that was obtained was compared with the corresponding mRNA published in GenBank. The comparison showed that the two sequences were identical. The novel method for cDNA cloning from surrogate eukaryotic cells described here uses well-established techniques that are feasible and simple to use. We anticipate that this alternative method will have widespread applications.
Construction of Infectious cDNA Clone of a Chrysanthemum stunt viroid Korean Isolate
Yoon, Ju-Yeon; Cho, In-Sook; Choi, Gug-Seoun; Choi, Seung-Kook
2014-01-01
Chrysanthemum stunt viroid (CSVd), a noncoding infectious RNA molecule, causes seriously economic losses of chrysanthemum for 3 or 4 years after its first infection. Monomeric cDNA clones of CSVd isolate SK1 (CSVd-SK1) were constructed in the plasmids pGEM-T easy vector and pUC19 vector. Linear positive-sense transcripts synthesized in vitro from the full-length monomeric cDNA clones of CSVd-SK1 could infect systemically tomato seedlings and chrysanthemum plants, suggesting that the linear CSVd RNA transcribed from the cDNA clones could be replicated as efficiently as circular CSVd in host species. However, direct inoculation of plasmid cDNA clones containing full-length monomeric cDNA of CSVd-SK1 failed to infect tomato and chrysanthemum and linear negative-sense transcripts from the plasmid DNAs were not infectious in the two plant species. The cDNA sequences of progeny viroid in systemically infected tomato and chrysanthemum showed a few substitutions at a specific nucleotide position, but there were no deletions and insertions in the sequences of the CSVd progeny from tomato and chrysanthemum plants. PMID:25288987
Evaluation of vector-primed cDNA library production from microgram quantities of total RNA.
Kuo, Jonathan; Inman, Jason; Brownstein, Michael; Usdin, Ted B
2004-12-15
cDNA sequences are important for defining the coding region of genes, and full-length cDNA clones have proven to be useful for investigation of the function of gene products. We produced cDNA libraries containing 3.5-5 x 10(5) primary transformants, starting with 5 mug of total RNA prepared from mouse pituitary, adrenal, thymus, and pineal tissue, using a vector-primed cDNA synthesis method. Of approximately 1000 clones sequenced, approximately 20% contained the full open reading frames (ORFs) of known transcripts, based on the presence of the initiating methionine residue codon. The libraries were complex, with 94, 91, 83 and 55% of the clones from the thymus, adrenal, pineal and pituitary libraries, respectively, represented only once. Twenty-five full-length clones, not yet represented in the Mammalian Gene Collection, were identified. Thus, we have produced useful cDNA libraries for the isolation of full-length cDNA clones that are not yet available in the public domain, and demonstrated the utility of a simple method for making high-quality libraries from small amounts of starting material.
Patnaik, Bharat Bhusan; Kim, Dong Hyun; Oh, Seung Han; Song, Yong-Su; Chanh, Nguyen Dang Minh; Kim, Jong Sun; Jung, Woo-jin; Saha, Atul Kumar; Bindroo, Bharat Bhushan; Han, Yeon Soo
2012-01-01
Background Silkworm fecal matter is considered one of the richest sources of antimicrobial and antiviral protein (substances) and such economically feasible and eco-friendly proteins acting as secondary metabolites from the insect system can be explored for their practical utility in conferring broad spectrum disease resistance against pathogenic microbial specimens. Methodology/Principal Findings Silkworm fecal matter extracts prepared in 0.02 M phosphate buffer saline (pH 7.4), at a temperature of 60°C was subjected to 40% saturated ammonium sulphate precipitation and purified by gel-filtration chromatography (GFC). SDS-PAGE under denaturing conditions showed a single band at about 21.5 kDa. The peak fraction, thus obtained by GFC wastested for homogeneityusing C18reverse-phase high performance liquid chromatography (HPLC). The activity of the purified protein was tested against selected Gram +/− bacteria and phytopathogenic Fusarium species with concentration-dependent inhibitionrelationship. The purified bioactive protein was subjected to matrix-assisted laser desorption and ionization-time of flight mass spectrometry (MALDI-TOF-MS) and N-terminal sequencing by Edman degradation towards its identification. The N-terminal first 18 amino acid sequence following the predicted signal peptide showed homology to plant germin-like proteins (Glp). In order to characterize the full-length gene sequence in detail, the partial cDNA was cloned and sequenced using degenerate primers, followed by 5′- and 3′-rapid amplification of cDNA ends (RACE-PCR). The full-length cDNA sequence composed of 630 bp encoding 209 amino acids and corresponded to germin-like proteins (Glps) involved in plant development and defense. Conclusions/Significance The study reports, characterization of novel Glpbelonging to subfamily 3 from M. alba by the purification of mature active protein from silkworm fecal matter. The N-terminal amino acid sequence of the purified protein was found similar to the deduced amino acid sequence (without the transit peptide sequence) of the full length cDNA from M. alba. PMID:23284650
Klimyuk, V I; Jones, J D
1997-01-01
Based on homologies between the yeast DMC1 and the lily LIM15 meiosis-specific genes, degenerate PCR primers were designed that amplified the Arabidopsis DMC1 gene (AtDMC1). AtDMC1 genomic DNA (8 kb) was sequenced, and the transcript was characterized by reverse transcriptase-polymerase chain reaction (RT-PCR) and by 5' and 3' RACE (rapid amplification of cDNA ends). The AtDMC1 gene contains 15 exons and 14 introns. RNA in situ hybridization analysis showed that expression of the AtDMC1 is restricted to pollen mother cells in anthers and to megaspore mother cells in ovules. The AtDMC1 promoter was fused to the GUS reporter gene, and conferred meiosis-associated expression in both male and female floral lineages. Comparison of AtDMC1 isolated from Landsberg erecta ecotype to its Columbia allele ArLIM15, revealed the presence of a 1874 bp transposon-like element within the promoter region of ArLIM15. RT-PCR analysis showed that the expression levels of AtDMC1 and ArLIM15 are similar. Possible uses for the AtDMC1 promoter are discussed.
Analysis of xylem formation in pine by cDNA sequencing
NASA Technical Reports Server (NTRS)
Allona, I.; Quinn, M.; Shoop, E.; Swope, K.; St Cyr, S.; Carlis, J.; Riedl, J.; Retzel, E.; Campbell, M. M.; Sederoff, R.;
1998-01-01
Secondary xylem (wood) formation is likely to involve some genes expressed rarely or not at all in herbaceous plants. Moreover, environmental and developmental stimuli influence secondary xylem differentiation, producing morphological and chemical changes in wood. To increase our understanding of xylem formation, and to provide material for comparative analysis of gymnosperm and angiosperm sequences, ESTs were obtained from immature xylem of loblolly pine (Pinus taeda L.). A total of 1,097 single-pass sequences were obtained from 5' ends of cDNAs made from gravistimulated tissue from bent trees. Cluster analysis detected 107 groups of similar sequences, ranging in size from 2 to 20 sequences. A total of 361 sequences fell into these groups, whereas 736 sequences were unique. About 55% of the pine EST sequences show similarity to previously described sequences in public databases. About 10% of the recognized genes encode factors involved in cell wall formation. Sequences similar to cell wall proteins, most known lignin biosynthetic enzymes, and several enzymes of carbohydrate metabolism were found. A number of putative regulatory proteins also are represented. Expression patterns of several of these genes were studied in various tissues and organs of pine. Sequencing novel genes expressed during xylem formation will provide a powerful means of identifying mechanisms controlling this important differentiation pathway.
Biomarker discovery and transcriptomic responses in Daphnia magna exposed to munitions constituents.
Garcia-Reyero, Natalia; Poynton, Helen C; Kennedy, Alan J; Guan, Xin; Escalon, B Lynn; Chang, Bonnie; Varshavsky, Julia; Loguinov, Alex V; Vulpe, Chris D; Perkins, Edward J
2009-06-01
Ecotoxicogenomic approaches are emerging as alternative methods in environmental monitoring because they allow insight into pollutant modes of action and help assess the causal agents and potential toxicity beyond the traditional end points of death, growth, and reproduction. Gene expression analysis has shown particular promise for identifying gene expression biomarkers of chemical exposure that can be further used to monitor specific chemical exposures in the environment. We focused on the development of gene expression markers to detect and discriminate between chemical exposures. Using a custom cDNA microarray for Daphnia magna, we identified distinct expression fingerprints in response to exposure at sublethal concentrations of Cu, Zn, Pb, and munitions constituents. Using the results obtained from microarray analysis, we chose a suite of potential biomarkers for each of the specific exposures. The selected potential biomarkers were tested in independent chemical exposures for specificity using quantitative reverse transcription polymerase chain reaction. Six genes were confirmed as differentially regulated bythe selected chemical exposures. Furthermore, each exposure was identified by response of a unique combination (suite) of individual gene expression biomarkers. These results demonstrate the potential for discovery and validation of novel biomarkers of chemical exposures using gene expression analysis, which could have broad applicability in environmental monitoring.
Shen, Yun; Chen, Ri-Dao; Xie, Ke-Bo; Zou, Jian-Hua; Dai, Jun-Gui
2016-12-01
Secoisolariciresinol dehydrogenase (SDH) is a key enzyme involved in the biosynthetic pathway of podophyllotoxin.In this study, two SDH candidate genes,SO282 and SO1223, were cloned from callus of Dysosma versipellis by homology-based PCR and rapid amplification of cDNA end (RACE).The SDH candidate genes were expressed in Escherichia coli and the subsequent enzyme assay in vitro showed that recombinant SO282 had the SDH activity. These results pave the way to the follow-up investigation of the biosynthetic of podophyllotoxin. Copyright© by the Chinese Pharmaceutical Association.
Towards a transcription map spanning a 250 kb area within the DiGeorge syndrome chromosome region
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wong, W.; Emanuel, B.S.; Siegert, J.
1994-09-01
DiGeorge syndrome (DGS) and velocardiofacial syndrome (VCFS) are congenital anomalies affecting predominantly the thymus, parathyroid glands, heart and craniofacial development. Detection of 22q11.2 deletions in the majority of DGS and VCFS patients implicate 22q11 haploinsufficiency in the etiology of these disorders. The VCFS/DGS critical region lies within the proximal portion of a commonly deleted 1.2 Mb region in 22q11. A 250 kb cosmid contig covering this critical region and containing D22S74 (N25) has been established. From this contig, eleven cosmids with minimal overlap were biotinylated by nick translation, and hybridized to PCR-amplified cDNAs prepared from different tissues. The use ofmore » cDNAs from a variety of tissues increases the likelihood of identifying low abundance transcripts and tissue-specific expressed sequences. A DGCR-specific cDNA sublibrary consisting of 670 cDNA clones has been constructed. To date, 49 cDNA clones from this sub-library have been identified with single copy probes and cosmids containing putative CpG islands. Based on sequence analysis, 25 of the clones contain regions of homology to several cDNAs which map within the proximal contig. LAN is a novel partial cDNA isolated from a fetal brain library probed with one of the cosmids in the proximal contig. Using LAN as a probe, we have found 19 positive clones in the DGCR-specific cDNA sub-library (4 clones from fetal brain, 14 from adult skeletal muscle and one from fetal liver). Some of the LAN-positive clones extend the partial cDNA in the 5{prime} direction and will be useful in assembling a full length transcript. This resource will be used to develop a complete transcriptional map of the critical region in order to identify candidate gene(s) involved in the etiology of DGS/VCFS and to determine the relationship between the transcriptional and physical maps of 22q11.« less
Lectin cDNA and transgenic plants derived therefrom
Raikhel, Natasha V.
2000-10-03
Transgenic plants containing cDNA encoding Gramineae lectin are described. The plants preferably contain cDNA coding for barley lectin and store the lectin in the leaves. The transgenic plants, particularly the leaves exhibit insecticidal and fungicidal properties.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Preuss, Mary L.; Delmar, Deborah P.; Liu, Bo
Microtubules in interphase plant cells form a cortical array, which is critical for plant cell morphogenesis. Genetic studies imply that the minus end-directed microtubule motor kinesin-like calmodulin-binding protein (KCBP) plays a role in trichome morphogenesis in Arabidopsis. However, it was not clear whether this motor interacted with interphase microtubules. In cotton (Gossypium hirsutum) fibers, cortical microtubules undergo dramatic reorganization during fiber development. In this study, cDNA clones of the cotton KCBP homolog GhKCBP were isolated from a cotton fiber-specific cDNA library. During cotton fiber development from 10 to 21 DPA, the GhKCBP protein level gradually decreases. By immunofluorescence, GhKCBP wasmore » detected as puncta along cortical microtubules in fiber cells of different developmental stages. Thus the results provide evidence that GhKCBP plays a role in interphase cell growth likely by interacting with cortical microtubules. In contrast to fibers, in dividing cells of cotton, GhKCBP localized to the nucleus, the microtubule preprophase band, mitotic spindle, and the phragmoplast. Therefore KCBP likely exerts multiple roles in cell division and cell growth in flowering plants.« less
The mapping of the human 52-kD Ro/SSA autoantigen gene to human chromosome II, and its polymorphisms
DOE Office of Scientific and Technical Information (OSTI.GOV)
Frank, M.B.; Itoh, Kazuko; Fujisaku, Atsushi
1993-01-01
Autoantibodies to the ribonucleoprotein Ro/SSA occur in nearly half of the patients with systemic lupus erythematosus and are associated with lymphopenia, photosensitive dermatitis, and pulmonary and renal disease, which suggests that they have an immunopathologic role. The majority of Ro/SSA precipitin-positive patients produce serum antibodies that bind to the 60-kD and 52-kD Ro/SSA proteins. The authors previously isolated and determined the nucleotide sequence of a cDNA clone that encodes the 52-kD form of the human Ro/SSA protein. In the present study, they have determined the chromosomal location of the gene by in situ hybridization to the end of the shortmore » arm of chromosome 11. Hybridization of portions of the cDNA probe to restriction enzyme-digested DNA indicated the gene is composed of at least three exons. The exon encoding the putative zinc fingers of this protein was found to be distinct from that which encodes the leucine zipper. An RFLP of this gene was identified and is associated with the presence of lupus, primarily in black Americans. 60 refs., 3 figs., 3 tabs.« less
Gabus, C; Ficheux, D; Rau, M; Keith, G; Sandmeyer, S; Darlix, J L
1998-01-01
Retroviruses, including HIV-1 and the distantly related yeast retroelement Ty3, all encode a nucleoprotein required for virion structure and replication. During an in vitro comparison of HIV-1 and Ty3 nucleoprotein function in RNA dimerization and cDNA synthesis, we discovered a bipartite primer-binding site (PBS) for Ty3 composed of sequences located at opposite ends of the genome. Ty3 cDNA synthesis requires the 3' PBS for primer tRNAiMet annealing to the genomic RNA, and the 5' PBS, in cis or in trans, as the reverse transcription start site. Ty3 RNA alone is unable to dimerize, but formation of dimeric tRNAiMet bound to the PBS was found to direct dimerization of Ty3 RNA-tRNAiMet. Interestingly, HIV-1 nucleocapsid protein NCp7 and Ty3 NCp9 were interchangeable using HIV-1 and Ty3 RNA template-primer systems. Our findings impact on the understanding of non-canonical reverse transcription as well as on the use of Ty3 systems to screen for anti-NCp7 drugs. PMID:9707446
Gabus, C; Ficheux, D; Rau, M; Keith, G; Sandmeyer, S; Darlix, J L
1998-08-17
Retroviruses, including HIV-1 and the distantly related yeast retroelement Ty3, all encode a nucleoprotein required for virion structure and replication. During an in vitro comparison of HIV-1 and Ty3 nucleoprotein function in RNA dimerization and cDNA synthesis, we discovered a bipartite primer-binding site (PBS) for Ty3 composed of sequences located at opposite ends of the genome. Ty3 cDNA synthesis requires the 3' PBS for primer tRNAiMet annealing to the genomic RNA, and the 5' PBS, in cis or in trans, as the reverse transcription start site. Ty3 RNA alone is unable to dimerize, but formation of dimeric tRNAiMet bound to the PBS was found to direct dimerization of Ty3 RNA-tRNAiMet. Interestingly, HIV-1 nucleocapsid protein NCp7 and Ty3 NCp9 were interchangeable using HIV-1 and Ty3 RNA template-primer systems. Our findings impact on the understanding of non-canonical reverse transcription as well as on the use of Ty3 systems to screen for anti-NCp7 drugs.
van Deenen, Nicole; Bachmann, Anne-Lena; Schmidt, Thomas; Schaller, Hubert; Sand, Jennifer; Prüfer, Dirk; Schulze Gronover, Christian
2012-04-01
Taraxacum brevicorniculatum is known to produce high quality rubber. The biosynthesis of rubber is dependent on isopentenyl pyrophosphate (IPP) precursors derived from the mevalonate (MVA) pathway. The cDNA sequences of seven MVA pathway genes from latex of T. brevicorniculatum were isolated, including three cDNA sequences encoding for 3-hydroxy-3-methylglutaryl-coenzyme A (HMG-CoA) reductases (TbHMGR1-3). Expression analyses indicate an important role of TbHMGR1 as well as for the HMG-CoA synthase (TbHMGS), the diphosphomevalonate decarboxylase and the mevalonate kinase in the provision of precursors for rubber biosynthesis. The amino acid sequences of the TbHMGRs show the typical motifs described for plant HMGRs such as two transmembrane domains and a catalytic domain containing two HMG-CoA and two NADP(H) binding sites. The functionality of the HMGRs was demonstrated by complementation assay using an IPP auxotroph mutant of Escherichia coli. Furthermore, the transient expression of the catalytic domains of TbHMGR1 and TbHMGR2 in Nicotiana benthamiana resulted in a strong accumulation of sterol precursors, one of the major groups of pathway end-products.
Palmisano, Aldo N.; Winton, James R.; Dickhoff, Walton W.
1999-01-01
We cloned and sequenced a chinook salmon Hsp90 cDNA; sequence analysis shows it to be Hsp90??. Phylogenetic analysis supports the hypothesis that ?? and ?? paralogs of Hsp90 arose as a result of a gene duplication event and that they diverged early in the evolution of vertebrates, before tetrapods separated from the teleost lineage. Among several differences distinguishing poikilothermic Hsp90?? sequences from their bird and mammal orthologs, the teleost versions specifically lack a characteristic QTQDQP phosphorylation site near the N-terminus. We used the cDNA to develop an RNA (Northern) blot to quantify cellular Hsp90 mRNA levels. Chinook salmon embryonic (CHSE-214) cells responded to heat shock with a rapid rise in Hsp90 mRNA through 4 h, followed by a gradual decline over the next 20 h. Hsp90 mRNA level may be useful as a stress indicator, especially in a laboratory setting or in response to acute heat stress.
Kuhn, Josef; Tengler, Ulrike; Binder, Stefan
2001-01-01
To determine the influence of posttranscriptional modifications on 3′ end processing and RNA stability in plant mitochondria, pea atp9 and Oenothera atp1 transcripts were investigated for the presence and function of 3′ nonencoded nucleotides. A 3′ rapid amplification of cDNA ends approach initiated at oligo(dT)-adapter primers finds the expected poly(A) tails predominantly attached within the second stem or downstream of the double stem-loop structures at sites of previously mapped 3′ ends. Functional studies in a pea mitochondrial in vitro processing system reveal a rapid removal of the poly(A) tails up to termini at the stem-loop structure but little if any influence on further degradation of the RNA. In contrast 3′ poly(A) tracts at RNAs without such stem-loop structures significantly promote total degradation in vitro. To determine the in vivo identity of 3′ nonencoded nucleotides more accurately, pea atp9 transcripts were analyzed by a direct anchor primer ligation-reverse transcriptase PCR approach. This analysis identified maximally 3-nucleotide-long nonencoded extensions most frequently of adenosines combined with cytidines. Processing assays with substrates containing homopolymer stretches of different lengths showed that 10 or more adenosines accelerate RNA processivity, while 3 adenosines have no impact on RNA life span. Thus polyadenylation can generally stimulate the decay of RNAs, but processivity of degradation is almost annihilated by the stabilizing effect of the stem-loop structures. These antagonistic actions thus result in the efficient formation of 3′ processed and stable transcripts. PMID:11154261
DOE Office of Scientific and Technical Information (OSTI.GOV)
Culbert, A.A.; Wallis, G.A.; Kadler, K.E.
The brittleness of bone in people with lethal (type II) osteogenesis imperfecta, a heritable disorder caused by mutations in the type I collagen genes, arises from the deposition of abnormal collagen in the bone matrix. The inability of the abnormal collagen to participate in mineralization may be caused by its failure to interact with other bone proteins. Here, we have designed a strategy to isolate the genes important for mineralization of collagen during bone formation. Cells isolated from 16-day embryonic chick calvaria and seeded post-confluence in culture deposited a mineralized matrix over a period of 2 weeks. Chick skin fibroblastsmore » seeded and cultured under the same conditions did not mineralize. Using RT-PCR, we prepared short cDNAs ({approximately}300 bp) corresponding to the 3{prime} ends of mRNA from fibroblasts and separately from the mineralizing calvarial cells. Subtractive cDNA hybridization generated a pool of cDNAs that were specific to mineralizing calvarial cells but not to fibroblasts. Screening of 100,000 plaques of a chick bone ZAP Express cDNA library with this pool of mineralizing-specific cDNAs identified ten clones which comprised full-length cDNAs for the bone proteins osteopontin (eight of the ten positives), bone sialoprotein II (one of the ten positives), and cystatin (one of the ten positives). cDNAs for type I collagen, fibronectin, alkaline phosphatase, house-keeping genes, and other genes expressed in fibroblasts were not identified in this preliminary screen. The pool of short cDNAs is likely to comprise cDNAs for further bone-specific genes and will be used to screen the entire bone cDNA library of 4.2 million clones. 30 refs., 4 figs.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Goodyer, P.R.; Torban, E.; Dehbi, M.
1994-09-01
The Wilms` tumor gene encodes a 47-49 kDa transcription factor expressed in kidney, gonads and mesothelium during embryogenesis. Inherited mutations of WT1 lead to aberrant urogenital development and Wilms` tumor, but the role of WT1 in development is not fully understood. Since the human RAR-{alpha} gene contains a potential WT1 binding site at its 5{prime} end, we studied the effect of WT1 co-transfection on expression of an RAR-{alpha} promoter/CAT reporter construct in COS cells. COS cells were plated at 5X10{sup 5} cells/dish in DMEM with 10% FBS and transfected by the Ca/PO4 method with an expression plasmid containing the full-lengthmore » WT1 (-/-) cDNA under the control of the CMV promoter, plasmid containing the RAR-{alpha} promoter (-519 to +36)/CAT reporter and TK/growth hormone plasmid to control for efficiency of transfection. CAT/GH activity at 48 hours was inhibited by co-transfection with increasing amounts of WT1 (-/-); maximum inhibition = 5% of control. WT1 co-transfection did not affect expression of TKGH, nor of a CMV-CAT vector. Expression of WT1 protein in tranfected COS cells was demonstrated by Western blotting. Minimal inhibiton of RAR-{alpha}/CAT activity was seen when cells were co-transfected with vectors containing WT1 deletion mutants, alternate WT1 splicing variants, or WT1 (-/-) cDNA bearing a mutation identified in a patient with Drash syndrome. Gel shift assays indicated binding of WT1 to RAR-{alpha} cDNA but not to an RAR-{alpha} deletion mutant lacking the GCGGGGGGCG site. These observations suggest that WT1 may function to regulate RAR-{alpha} expression during normal development.« less
Zhou, Man; Mi, Hai-Feng; Liu, Wen-Bin; Wu, Ye-Yang; Wang, Kai-Zhou; Jiang, Guang-Zhen
2017-08-01
Tumour necrosis factor alpha (TNF-α) is one kind of cytokines which is related to inflammation and lipid metabolism. TNF-α cDNA was cloned from the liver of blunt snout bream (Megalobrama amblycephala) through real-time polymerase chain reaction (PCR) and rapid amplification of cDNA ends (RACE) methods. The full-length cDNA of TNF-α covered 1467 bp, with an open reading frame (ORF) of 723 bp, which encodes 240 amino acids. It possessed the TNF family signature IIIPDDGIYFVYSQ. After the lipopolysaccharide (LPS) challenge test, a graded tissue-specific expression pattern of TNF-α was observed and there was high expression abundance in the kidney, brain and liver. After 8 weeks feeding trial, liver samples, two groups fed with 6% and 11% lipid levels, were collected. The results showed that, for fish fed with high-fat diet, the triglyceride of serum and lipid content of liver were elevated. Furthermore, TNF-α and peroxisome proliferator-activated receptors (PPARα, β) mRNA expression of fish fed 11% lipid diet were significantly up-regulated (p < 0.05). Lipoprotein lipase (LPL) and PPARγ mRNA expression of fish fed 11% lipid lever diet were significantly decreased compared to those of fish fed 6% (p < 0.05). The differences between the various expression of related genes in the high and low fat groups demonstrated that TNF-α played a key role in lipid metabolism, which may have an influence on fat metabolism through reducing fat synthesis and strengthening the β-oxidation of fatty acid. These discrepancies warrant further research.
Ibrahim, Ahmed Ragaa Nour; Kawamoto, Seiji; Aki, Tsunehiro; Shimada, Yayoi; Rikimaru, Satoshi; Onishi, Nobukazu; Babiker, Elfadil Elfadl; Oiso, Isao; Hashimoto, Kunihiko; Hayashi, Takaharu; Ono, Kazuhisa
2010-01-01
Japanese cedar (Cryptomeria japonica) pollen is a major cause of seasonal pollinosis in Japan. Protease activity in the pollen grains may trigger pro-allergic responses but no such proteases have yet been identified as pollen allergens. We report the molecular cloning and immunochemical characterization of a novel C. japonica pollen allergen belonging to the aspartic protease family. We focused on the C. japonica pollen allergen spot No. 63 (CPA63, 47.5% IgE binding frequency) on our 2-dimensional IgE immunoblot map. The internal amino acid sequences were determined using time-of-flight mass spectrometry. Full-length cpa63 cDNA was cloned by rapid amplification of cDNA ends (RACE)-PCR. Recombinant CPA63 (r-CPA63) was expressed using the baculovirus-insect cell culture system and its IgE binding capacity was analyzed by enzyme-linked immunosorbent assay (ELISA). The proteolytic activity of r-CPA63 was also assessed using a putative mature enzyme produced upon autolysis. cpa63 cDNA encoded a 472 amino acid polypeptide showing about 40% sequence identity to members of the plant atypical aspartic protease family. ELISA showed that r-CPA63 was recognized by IgE antibodies in the serum of 58% (18/31) of Japanese cedar pollinosis patients. We also demonstrated an aspartic protease-like enzyme activity of the putative mature r-CPA63. We have identified the first plant aspartic protease allergen from Japanese cedar pollen. The availability of the CPA63 sequence and its recombinant allergen production system are useful not only for pharmaceutical applications but also for further examination of the role of protease activity in the pathogenesis of cedar pollinosis. 2010 S. Karger AG, Basel.
Ortigão-Farias, João Ramalho; Di-Blasi, Tatiana; Telleria, Erich Loza; Andorinho, Ana Carolina; Lemos-Silva, Thais; Ramalho-Ortigão, Marcelo; Tempone, Antônio Jorge; Traub-Csekö, Yara Maria
2018-01-01
BACKGROUND The insect chitinase gene family is composed by more than 10 paralogs, which can codify proteins with different domain structures. In Lutzomyia longipalpis, the main vector of visceral leishmaniasis in Brazil, a chitinase cDNA from adult female insects was previously characterized. The predicted protein contains one catalytic domain and one chitin-binding domain (CBD). The expression of this gene coincided with the end of blood digestion indicating a putative role in peritrophic matrix degradation. OBJECTIVES To determine the occurrence of alternative splicing in chitinases of L. longipalpis. METHODS We sequenced the LlChit1 gene from a genomic clone and the three spliced forms obtained by reverse transcription polymerase chain reaction (RT-PCR) using larvae cDNA. FINDINGS We showed that LlChit1 from L. longipalpis immature forms undergoes alternative splicing. The spliced form corresponding to the adult cDNA was named LlChit1A and the two larvae specific transcripts were named LlChit1B and LlChit1C. The B and C forms possess stop codons interrupting the translation of the CBD. The A form is present in adult females post blood meal, L4 larvae and pre-pupae, while the other two forms are present only in L4 larvae and disappear just before pupation. Two bands of the expected size were identified by Western blot only in L4 larvae. MAIN CONCLUSIONS We show for the first time alternative splicing generating chitinases with different domain structures increasing our understanding on the finely regulated digestion physiology and shedding light on a potential target for controlling L. longipalpis larval development. PMID:29236932
Chun, Carlene K; Scheetz, Todd E; Bonaldo, Maria de Fatima; Brown, Bartley; Clemens, Anik; Crookes-Goodson, Wendy J; Crouch, Keith; DeMartini, Tad; Eyestone, Mari; Goodson, Michael S; Janssens, Bernadette; Kimbell, Jennifer L; Koropatnick, Tanya A; Kucaba, Tamara; Smith, Christina; Stewart, Jennifer J; Tong, Deyan; Troll, Joshua V; Webster, Sarahrose; Winhall-Rice, Jane; Yap, Cory; Casavant, Thomas L; McFall-Ngai, Margaret J; Soares, M Bento
2006-01-01
Background Biologists are becoming increasingly aware that the interaction of animals, including humans, with their coevolved bacterial partners is essential for health. This growing awareness has been a driving force for the development of models for the study of beneficial animal-bacterial interactions. In the squid-vibrio model, symbiotic Vibrio fischeri induce dramatic developmental changes in the light organ of host Euprymna scolopes over the first hours to days of their partnership. We report here the creation of a juvenile light-organ specific EST database. Results We generated eleven cDNA libraries from the light organ of E. scolopes at developmentally significant time points with and without colonization by V. fischeri. Single pass 3' sequencing efforts generated 42,564 expressed sequence tags (ESTs) of which 35,421 passed our quality criteria and were then clustered via the UIcluster program into 13,962 nonredundant sequences. The cDNA clones representing these nonredundant sequences were sequenced from the 5' end of the vector and 58% of these resulting sequences overlapped significantly with the associated 3' sequence to generate 8,067 contigs with an average sequence length of 1,065 bp. All sequences were annotated with BLASTX (E-value < -03) and Gene Ontology (GO). Conclusion Both the number of ESTs generated from each library and GO categorizations are reflective of the activity state of the light organ during these early stages of symbiosis. Future analyses of the sequences identified in these libraries promise to provide valuable information not only about pathways involved in colonization and early development of the squid light organ, but also about pathways conserved in response to bacterial colonization across the animal kingdom. PMID:16780587
Su, Xiaofeng; Qi, Xiliang; Cheng, Hongmei
2014-06-01
Arabidopsis enhanced disease susceptibility 1 (EDS1) plays an important role in plant defense against biotrophic and necrotrophic pathogens. The necrotrophic pathogen Verticillium dahliae infection of Gossypium barbadense could lead to Verticillium wilt which seriously reduces the cotton production. Here, we cloned and characterized a G. barbadense homolog of EDS1, designated as GbEDS1. The full-length cDNA of the GbEDS1 gene was obtained by the technique of rapid-amplification of cDNA ends. The open reading frame of the GbEDS1 gene was 1,647 bp long and encoded a protein of 548 amino acids residues. Comparison of the cDNA and genomic DNA sequence of GbEDS1 indicated that this gene contained a single intron and two exons. Like other EDS1s, GbEDS1 contained a conserved N-terminal lipase domain and an EDS1-specific KNEDT motif. Subcellular localization assay revealed that GbEDS1-green fluorescence protein fusion protein was localized in both cytosol and nucleus. Interestingly, the transcript levels of GbEDS1 were dramatically increased in response to pathogen V. dahliae infection. To investigate the role of GbEDS1 in plant resistance against V. dahliae, a conserved fragment derived from GbEDS1 was used to knockdown the endogenous EDS1 in Nicotiana benthamiana by heterologous virus-induced gene silencing. Our data showed that silencing of NbEDS1 resulted in increased susceptibility to V. dahliae infection in N. benthamiana, suggesting a possible involvement of the novelly isolated GbEDS1 in the regulation of plant defense against V. dahliae.
Walker, Andreas; Bergmann, Matthias; Camdereli, Jennifer; Kaiser, Rolf; Lübke, Nadine; Timm, Jörg
2017-06-01
HCV treatment options and cure rates have tremendously increased in the last decade. Although a pan-genotype HCV treatment has recently been approved, most DAA therapies are still genotype specific. Resistance-associated variants (RAVs) can limit the efficacy of DAA therapy and are associated with increased risk for therapy failure. With the approval of DAA regimens that recommend resistance testing prior to therapy, correct assessment of the genotype and testing for viruses with RAVs is clinically relevant. However, genotyping and resistance testing is generally done in costly and laborious separate reactions. The aim of the study was to establish a genotype-independent full-genome reverse transcription protocol to generate a template for both genotyping and resistance testing and to implement it into our routine diagnostic setup. The complete HCV genome was reverse transcribed with a pan-genotype primer binding at the 3'end of the viral RNA. This cDNA served as template for transcription of the genotyping amplicon in the core region as well as for the resistance testing of NS3, NS5A, and NS5B. With the established RT-protocol the HCV core region was successfully amplified and genotyped from 124 out of 125 (99.2%) HCV-positive samples. The amplification efficiency of RAV containing regions in NS3, NS5A, NS5B was 96.2%, 96.6% and 94.4%, respectively. We developed a method for HCV full-genome cDNA synthesis and implemented it into a routine diagnostic setup. This cDNA can be used as template for genotyping amplicons covering the core or NS5B region as well as for resistance testing amplicons in NS3, NS5A and NS5B. Copyright © 2017 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Yu, Shuiyan; Liu, Shicheng; Li, Chunyang; Zhou, Zhigang
2011-01-01
Myrmecia incisa is a green coccoid freshwater microalgae, which is rich in arachidonic acid (ArA, C20: 4ω-6, δ5, 8, 11, 14), a long chain polyunsaturated fatty acid (PUFA), especially under nitrogen starvation stress. A cDNA library of M. incisa was constructed with λ phage vectors and a 545 nt expressed sequence tag (EST) was screened from this library as a putative elongase gene due to its 56% and 49% identity to Marchantia polymorpha L. and Ostreococcus tauri Courties et Chrétiennot-Dinet, respectively. Based upon this EST sequence, an elongase gene designated MiFAE was isolated from M. incisa via 5'/3' rapid amplification of cDNA ends (RACE). The cDNA sequence was 1 331 bp long and included a 33 bp 5'-untranslated region (UTR) and a 431 bp 3'-UTR with a typical poly-A tail. The 867 bp ORF encoded a predicted protein of 288 amino acids. This protein was characterized by a conserved histidine-rich box and a MYxYY motif that was present in other members of the elongase family. The genomic DNA sequence of MiFAE was found to be interrupted by three introns with splicing sites of Introns I (81 bp), II (81 bp), and III (67 bp) that conformed to the GT-AG rule. Quantitative real-time PCR showed that the transcription level of MiFAE in this microalga under nitrogen starvation was higher than that under normal condition. Prior to the ArA content accumulation, the transcription of MiFAE was enhanced, suggesting that it was possibly responsible for the ArA accumulation in this microalga cultured under nitrogen starvation conditions.
Satoh, Dan; Hiraoka, Yasutaka; Colman, Brian; Matsuda, Yusuke
2001-01-01
A single intracellular carbonic anhydrase (CA) was detected in air-grown and, at reduced levels, in high CO2-grown cells of the marine diatom Phaeodactylum tricornutum (UTEX 642). No external CA activity was detected irrespective of growth CO2 conditions. Ethoxyzolamide (0.4 mm), a CA-specific inhibitor, severely inhibited high-affinity photosynthesis at low concentrations of dissolved inorganic carbon, whereas 2 mm acetazolamide had little effect on the affinity for dissolved inorganic carbon, suggesting that internal CA is crucial for the operation of a carbon concentrating mechanism in P. tricornutum. Internal CA was purified 36.7-fold of that of cell homogenates by ammonium sulfate precipitation, and two-step column chromatography on diethylaminoethyl-sephacel and p-aminomethylbenzene sulfone amide agarose. The purified CA was shown, by SDS-PAGE, to comprise an electrophoretically single polypeptide of 28 kD under both reduced and nonreduced conditions. The entire sequence of the cDNA of this CA was obtained by the rapid amplification of cDNA ends method and indicated that the cDNA encodes 282 amino acids. Comparison of this putative precursor sequence with the N-terminal amino acid sequence of the purified CA indicated that it included a possible signal sequence of up to 46 amino acids at the N terminus. The mature CA was found to consist of 236 amino acids and the sequence was homologous to β-type CAs. Even though the zinc-ligand amino acid residues were shown to be completely conserved, the amino acid residues that may constitute a CO2-binding site appeared to be unique among the β-CAs so far reported. PMID:11500545
Yamamura, Yoshimi; Sahin, F Pinar; Nagatsu, Akito; Mizukami, Hajime
2003-04-01
A cDNA (LEPS-2) encoding a novel cell wall protein was cloned from shikonin-producing callus tissues of Lithospermum erythrorhizon by differential display between a shikonin-producing culture strain and a non-producing strain. The LEPS-2 cDNA encoded a polypeptide of 184 amino acids. The deduced amino acid sequence exhibited no significant homology with known proteins. Expression of LEPS-2 gene as well as accumulation of LEPS-2 protein was highly correlated with shikonin production in L. erythrorhizon cells in culture. In the intact plant, expression of LEPS-2 was detected only in the roots where shikonin pigments accumulated. Cell fractionation experiments and immunocytochemical analysis showed that the protein was localized in the apoplast fraction of the cell walls. The shikonin pigments were also stored on the cell walls as oil droplets. These results indicate that expression of the LEPS-2 is closely linked with shikonin biosynthesis and the LEPS-2 protein may be involved in the intra-cell wall trapping of shikonin pigments.
Huang, P L; Do, Y Y; Huang, F C; Thay, T S; Chang, T W
1997-04-01
A cDNA encoding the banana 1-aminocyclopropane-1-carboxylate (ACC) oxidase has previously been isolated from a cDNA library that was constructed by extracting poly(A)+ RNA from peels of ripening banana. This cDNA, designated as pMAO2, has 1,199 bp and contains an open reading frame of 318 amino acids. In order to identify ripening-related promoters of the banana ACC oxidase gene, pMAO2 was used as a probe to screen a banana genomic library constructed in the lambda EMBL3 vector. The banana ACC oxidase MAO2 gene has four exons and three introns, with all of the boundaries between these introns and exons sharing a consensus dinucleotide sequence of GT-AG. The expression of MAO2 gene in banana begins after the onset of ripening (stage 2) and continuous into later stages of the ripening process. The accumulation of MAO2 mRNA can be induced by 1 microliter/l exogenous ethylene, and it reached steady state level when 100 microliters/l exogenous ethylene was present.
Allison, J; Hall, L; MacIntyre, I; Craig, R K
1981-01-01
(1) Total poly(A)-containing RNA isolated from human thyroid medullary carcinoma tissue was shown to direct the synthesis in the wheat germ cell-free system of a major (Mr 21000) and several minor forms of human calcitonin precursor polyproteins. Evidence for processing of these precursor(s) by the wheat germ cell-free system is also presented. (2) A small complementary DNA (cDNA) plasmid library has been constructed in the PstI site of the plasmid pAT153, using total human thyroid medullary carcinoma poly(A)-containing RNA as the starting material. (3) Plasmids containing abundant cDNA sequences were selected by hybridization in situ, and two of these (ph T-B3 and phT-B6) were characterized by hybridization--translation and restriction analysis. Each was shown to contain human calcitonin precursor polyprotein cDNA sequences. (4) RNA blotting techniques demonstrate that the human calcitonin precursor polyprotein is encoded within a mRNA containing 1000 bases. (5) The results demonstrate that human calcitonin is synthesized as a precursor polyprotein. Images Fig. 1. Fig. 2. Fig. 3. PMID:6896146
Cloning of a cDNA encoding rat aldehyde dehydrogenase with high activity for retinal oxidation.
Bhat, P V; Labrecque, J; Boutin, J M; Lacroix, A; Yoshida, A
1995-12-12
Retinoic acid (RA), an important regulator of cell differentiation, is biosynthesized from retinol via retinal by a two-step oxidation process. We previously reported the purification and partial amino acid (aa) sequence of a rat kidney aldehyde dehydrogenase (ALDH) isozyme that catalyzed the oxidation of 9-cis and all-trans retinal to corresponding RA with high efficiency [Labrecque et al. Biochem. J. 305 (1995) 681-684]. A rat kidney cDNA library was screened using a 291-bp PCR product generated from total kidney RNA using a pair of oligodeoxyribonucleotide primers matched with the aa sequence. The full-length rat kidney ALDH cDNA contains a 2315-bp (501 aa) open reading frame (ORF). The aa sequence of rat kidney ALDH is 89, 96 and 87% identical to that of the rat cytosolic ALDH, the mouse cytosolic ALDH and human cytosolic ALDH, respectively. Northern blot and RT-PCR-mediated analysis demonstrated that rat kidney ALDH is strongly expressed in kidney, lung, testis, intestine, stomach and trachea, but weakly in the liver.
Yoshida, S; Arakawa, F; Higuchi, F; Ishibashi, Y; Goto, M; Sugita, Y; Nomura, Y; Niino, D; Shimizu, K; Aoki, R; Hashikawa, K; Kimura, Y; Yasuda, K; Tashiro, K; Kuhara, S; Nagata, K; Ohshima, K
2012-01-01
Objectives The main histological change in rheumatoid arthritis (RA) is the villous proliferation of synovial lining cells, an important source of cytokines and chemokines, which are associated with inflammation. The aim of this study was to evaluate gene expression in the microdissected synovial lining cells of RA patients, using those of osteoarthritis (OA) patients as the control. Methods Samples were obtained during total joint replacement from 11 RA and five OA patients. Total RNA from the synovial lining cells was derived from selected specimens by laser microdissection (LMD) for subsequent cDNA microarray analysis. In addition, the expression of significant genes was confirmed immunohistochemically. Results The 14 519 genes detected by cDNA microarray were used to compare gene expression levels in synovial lining cells from RA with those from OA patients. Cluster analysis indicated that RA cells, including low- and high-expression subgroups, and OA cells were stored in two main clusters. The molecular activity of RA was statistically consistent with its clinical and histological activity. Expression levels of signal transducer and activator of transcription 1 (STAT1), interferon regulatory factor 1 (IRF1), and the chemokines CXCL9, CXCL10, and CCL5 were statistically significantly higher in the synovium of RA than in that of OA. Immunohistochemically, the lining synovium of RA, but not that of OA, clearly expressed STAT1, IRF1, and chemokines, as was seen in microarray analysis combined with LMD. Conclusions Our findings indicate an important role for lining synovial cells in the inflammatory and proliferative processes of RA. Further understanding of the local signalling in structural components is important in rheumatology. PMID:22401175
A meta-data based method for DNA microarray imputation.
Jörnsten, Rebecka; Ouyang, Ming; Wang, Hui-Yu
2007-03-29
DNA microarray experiments are conducted in logical sets, such as time course profiling after a treatment is applied to the samples, or comparisons of the samples under two or more conditions. Due to cost and design constraints of spotted cDNA microarray experiments, each logical set commonly includes only a small number of replicates per condition. Despite the vast improvement of the microarray technology in recent years, missing values are prevalent. Intuitively, imputation of missing values is best done using many replicates within the same logical set. In practice, there are few replicates and thus reliable imputation within logical sets is difficult. However, it is in the case of few replicates that the presence of missing values, and how they are imputed, can have the most profound impact on the outcome of downstream analyses (e.g. significance analysis and clustering). This study explores the feasibility of imputation across logical sets, using the vast amount of publicly available microarray data to improve imputation reliability in the small sample size setting. We download all cDNA microarray data of Saccharomyces cerevisiae, Arabidopsis thaliana, and Caenorhabditis elegans from the Stanford Microarray Database. Through cross-validation and simulation, we find that, for all three species, our proposed imputation using data from public databases is far superior to imputation within a logical set, sometimes to an astonishing degree. Furthermore, the imputation root mean square error for significant genes is generally a lot less than that of non-significant ones. Since downstream analysis of significant genes, such as clustering and network analysis, can be very sensitive to small perturbations of estimated gene effects, it is highly recommended that researchers apply reliable data imputation prior to further analysis. Our method can also be applied to cDNA microarray experiments from other species, provided good reference data are available.
Katayama, S; Takeshita, N; Yano, T; Ubagai, T; Qiu, X J; Katagiri, Y; Kubo, H; Hirakawa, S
1993-06-01
We compared the efficacy of the multiplex PCR with that of the cDNA analysis for detection of deletions of the DMD gene in the Japanese patients. Thirty males with DMD from 27 Japanese families were studied by the multiplex PCR, and 24 of them were also investigated by Southern blot analysis. We used five dystrophin cDNA probes for deletion analysis. A total of 19 regions were amplified by the PCR to detect deletions, 9 regions by the method of Chamberlain et al. and another 10 regions by the method of Beggs et al. Deletions were detected in 14 (52%) out of 27 DMD families by the PCR. Southern blot analysis detected deletions in 14 (64%) out of 22 families. Thirteen (93%) of the 14 DMD families with deletions detected by Southern blotting were also confirmed by the multiplex PCR. Provided care is taken in cases where the deletion is limited to a single exon, the multiplex PCR appears to be an efficient and useful alternative to conventional Southern blot analysis for detecting deletions during the prenatal and postnatal diagnosis of DMD.
Horner, W E; Reese, G; Lehrer, S B
1995-01-01
Basidiospores are a prevalent and frequent cause of respiratory allergies, yet their allergens remain poorly defined; thus, we have attempted a molecular characterization of representative basidiomycete allergens. A Psilocybe cubensis mycelial cDNA library was immunoscreened with patient serum. A clone was isolated that expressed a 23-kD recombinant allergen as a fusion protein and inhibited a 16-kD band (Psi c 2) in immunoprints of P. cubenis extract, indicating antigenic identity. Sequence (cDNA) analysis of the clone indicates homology with cyclophilin and the deduced amino acid sequence of Psi c 2 showed 78% identity and 4% similarity with the amino acid sequence of Schizosaccharomyces pombe cyclophilin. This recombinant allergen is a useful model for epitope analysis of basidiospore allergens and fungal allergen cross-reactivity, and may provide an improved reagent for basidiospore allergy diagnosis and treatment.
Krylov, V; Tlapáková, T; Mácha, J; Curlej, J; Ryban, L; Chrenek, P
2008-01-01
For chromosomal localization of the hFVIII human transgene in F2 and F3 generation of transgenic rabbits, FISH-TSA was applied. A short cDNA probe (1250 bp) targeted chromosomes 3, 7, 8, 9 and 18 of an F2 male (animal 1-3-8). Two transgenic offspring (F3) revealed signal positions in chromosome 3 and chromosomes 3 and 7, respectively. Sequencing and structure analysis of the rabbit orthologous gene revealed high similarity to its human counterpart. Part of the sequenced cDNA (1310 bp) served as a probe for FISH-TSA analysis. The rabbit gene was localized in the q arm terminus of the X chromosome. This result is in agreement with reciprocal chromosome painting between the rabbit and the human. The presented FISH-TSA method provides strong signals without any interspecies reactivity.
Yao, Lin; Yang, Qian; Song, Jinzhu; Tan, Chong; Guo, Changhong; Wang, Li; Qu, Lianhai; Wang, Yun
2013-04-01
Trichoderma harzianum 88, a filamentous soil fungus, is an effective biocontrol agent against several plant pathogens. High-throughput sequencing was used here to study the mycoparasitism mechanisms of T. harzianum 88. Plate confrontation tests of T. harzianum 88 against plant pathogens were conducted, and a cDNA library was constructed from T. harzianum 88 mycelia in the presence of plant pathogen cell walls. Randomly selected transcripts from the cDNA library were compared with eukaryotic plant and fungal genomes. Of the 1,386 transcripts sequenced, the most abundant Gene Ontology (GO) classification group was "physiological process". Differential expression of 19 genes was confirmed by real-time RT-PCR at different mycoparasitism stages against plant pathogens. Gene expression analysis revealed the transcription of various genes involved in mycoparasitism of T. harzianum 88. Our study provides helpful insights into the mechanisms of T. harzianum 88-plant pathogen interactions.
Liu, Zhong-Yuan; Wang, Yun; Lü, Guo-Dong; Wang, Xian-Lei; Zhang, Fu-Chun; Ma, Ji
2006-12-01
The partial cDNA sequence coding for the antifreeze proteins in the Tenebrio molitor was obtained by RT-PCR. Sequence analysis revealed nine putative cDNAs with a high degree of homology to Tenebrio molitor antifreeze proteins. The recombinant pGEX-4T-1-tmafp-XJ430 was introduced into E. coli BL21 to induce a GST fusion protein by IPTG. SDS-PAGE of the fusion protein demonstrated that the antifreeze protein migrated at a size of 38 kDa. The immunization was performed by intra-muscular injection of pCDNA3-tmafp-XJ430, and then antiserum was detected by ELISA. The titer of the antibody was 1:2,000. Western blotting analysis showed the antiserum was specific against the antifreeze protein. This finding could lead to further investigation of the properties and function of antifreeze proteins.
Analysis of large-scale gene expression data.
Sherlock, G
2000-04-01
The advent of cDNA and oligonucleotide microarray technologies has led to a paradigm shift in biological investigation, such that the bottleneck in research is shifting from data generation to data analysis. Hierarchical clustering, divisive clustering, self-organizing maps and k-means clustering have all been recently used to make sense of this mass of data.
Reverse Transcriptase Activity in Mature Spermatozoa of Mouse
Giordano, Roberto; Magnano, Anna Rosa; Zaccagnini, Germana; Pittoggi, Carmine; Moscufo, Nicola; Lorenzini, Rodolfo; Spadafora, Corrado
2000-01-01
We show here that a reverse transcriptase (RT) activity is present in murine epididymal spermatozoa. Sperm cells incubated with human poliovirus RNA can take up exogenous RNA molecules and internalize them in nuclei. Direct PCR amplification of DNA extracted from RNA-incubated spermatozoa indicate that poliovirus RNA is reverse-transcribed in cDNA fragments. PCR analysis of two-cell embryos shows that poliovirus RNA-challenged spermatozoa transfer retrotranscribed cDNA molecules into eggs during in vitro fertilization. Finally, RT molecules can be visualized on sperm nuclear scaffolds by immunogold electron microscopy. These results, therefore, reveal a novel metabolic function in spermatozoa, which may play a role during early embryonic development. PMID:10725323
Cloning and kinetic characterization of Arabidopsis thaliana solanesyl diphosphate synthase.
Hirooka, Kazutake; Bamba, Takeshi; Fukusaki, Ei-ichiro; Kobayashi, Akio
2003-03-01
trans -Long-chain prenyl diphosphate synthases catalyse the sequential condensation of isopentenyl diphosphate (C(5)) units with allylic diphosphate to produce the C(30)-C(50) prenyl diphosphates, which are precursors of the side chains of prenylquinones. Based on the relationship between product specificity and the region around the first aspartate-rich motif in trans -prenyl diphosphate synthases characterized so far, we have isolated the cDNA for a member of trans -long-chain prenyl diphosphate synthases from Arabidopsis thaliana. The cDNA was heterologously expressed in Escherichia coli, and the recombinant His(6)-tagged protein was purified and characterized. Product analysis revealed that the cDNA encodes solanesyl diphosphate (C(45)) synthase (At-SPS). At-SPS utilized farnesyl diphosphate (FPP; C(15)) and geranylgeranyl diphosphate (GGPP; C(20)), but did not accept either the C(5) or the C(10) allylic diphosphate as a primer substrate. The Michaelis constants for FPP and GGPP were 5.73 microM and 1.61 microM respectively. We also performed an analysis of the side chains of prenylquinones extracted from the A. thaliana plant, and showed that its major prenylquinones, i.e. plastoquinone and ubiquinone, contain the C(45) prenyl moiety. This suggests that At-SPS might be devoted to the biosynthesis of either or both of the prenylquinone side chains. This is the first established trans -long-chain prenyl diphosphate synthase from a multicellular organism.
Characterization and mapping of cDNA encoding aspartate aminotransferase in rice, Oryza sativa L.
Song, J; Yamamoto, K; Shomura, A; Yano, M; Minobe, Y; Sasaki, T
1996-10-31
Fifteen cDNA clones, putatively identified as encoding aspartate aminotransferase (AST, EC 2.6.1.1.), were isolated and partially sequenced. Together with six previously isolated clones putatively identified to encode ASTs (Sasaki, et al. 1994, Plant Journal 6, 615-624), their sequences were characterized and classified into 4 cDNA species. Two of the isolated clones, C60213 and C2079, were full-length cDNAs, and their complete nucleotide sequences were determined. C60213 was 1612 bp long and its deduced amino acid sequence showed 88% homology with that of Panicum miliaceum L. mitochondrial AST. The C60213-encoded protein had an N-terminal amino acid sequence that was characteristic of a mitochondrial transit peptide. On the other hand, C2079 was 1546 bp long and had 91% amino acid sequence homology with P. miliaceum L. cytosolic AST but lacked in the transit peptide sequence. The homologies of nucleotide sequences and deduced amino acid sequences of C2079 and C60213 were 54% and 52%, respectively. C2079 and C60213 were mapped on chromosomes 1 and 6, respectively, by restriction fragment length polymorphism linkage analysis. Northern blot analysis using C2079 as a probe revealed much higher transcript levels in callus and root than in green and etiolated shoots, suggesting tissue-specific variations of AST gene expression.
Molecular characterization of a family of ligands for eph-related tyrosine kinase receptors.
Beckmann, M P; Cerretti, D P; Baum, P; Vanden Bos, T; James, L; Farrah, T; Kozlosky, C; Hollingsworth, T; Shilling, H; Maraskovsky, E
1994-01-01
A family of tyrosine kinase receptors related to the product of the eph gene has been described recently. One of these receptors, elk, has been shown to be expressed only in brain and testes. Using a direct expression cloning technique, a ligand for the elk receptor has been isolated by screening a human placenta cDNA library with a fusion protein containing the extracellular domain of the receptor. This isolated cDNA encodes a transmembrane protein. While the sequence of the ligand cDNA is unique, it is related to a previously described sequence known as B61. Northern blot analysis of human tissue mRNA showed that the elk ligand's mRNA is 3.5 kb long and is found in placenta, heart, lung, liver, skeletal muscle, kidney and pancreas. Southern blot analysis showed that the gene is highly conserved in a wide variety of species. Both elk ligand and B61 mRNAs are inducible by tumour necrosis factor in human umbilical vein endothelial cells. In addition, both proteins show promiscuity in binding to the elk and the related hek receptors. Since these two ligand sequences are similar, and since elk and hek are members of a larger family of eph-related receptor molecules, we refer to these ligands as LERKs (ligands for eph-related kinases). Images PMID:8070404
NASA Technical Reports Server (NTRS)
Wu, Liu-Lai; Song, Il; Karuppiah, Nadarajah; Kaufman, Peter B.
1993-01-01
An asymmetric (top vs. bottom halves of pulvini) induction of invertase mRNA by gravistimulation was analyzed in oat shoot pulvini. Total RNA and poly(A)(+) RNA, isolated from oat pulvini, and two oli-gonucleotide primers, corresponding to two conserved amino acid sequences (NDPNG and WECPD) found in invertase from other species, were used for the polymerase chain reaction (PCR). A partial length cDNA (550 bp) was obtained and characterized. A 62% nucleotide sequence homology and 58% deduced amino acid sequence homology, as compared to beta-fructosidase of carrot cell wall, was found. Northern blot analysis showed that there was an obviously transient induction of invertase mRNA by gravistimulation in the oat pulvinus system. The mRNA was rapidly induced to a maximum level at 1 hour after gravistimulation treatment and gradually decreased afterwards. The mRNA level in the bottom half of the oat pulvinus was significantly higher than that in the top half of the pulvinus tissue. The kinetic induction of invertase mRNA was consistent with the transient accumulation of invertase activity during the graviresponse of the pulvinus. This indicates that the expression of the invertase gene(s) could be regulated by gravistimulation at the transcriptional level. Southern blot analysis showed that there were two to three genomic DNA fragments which hybridized with the partial-length invertase cDNA.
Park, Miey; Shin, Hae J; Lee, Soo Y; Ahn, Tae I
2005-01-01
Phagocytic cells have defense systems against reactive oxygen species generated as the first non-specific defense mechanism against invading pathogens or microorganisms. We cloned a cDNA encoding a 21.69-kDa protein in Amoeba proteus homologous to 2-Cys peroxiredoxin (Prx-Ap). In the disk inhibition assay using H2O2 as an oxidizing agent, Escherichia coli overproducing Prx-Ap showed better viability than did E. coli transformed with pBluescript II SK for control. Monoclonal antibodies (mAb) produced against Prx-Ap reacted with a 22.5-kDa protein and several minor proteins. In Western blot analysis, levels of the 22.5-kDa protein in amoebae treated with 2-mM H2O2 for 1 h increased about 2-fold over those in control cells. Immunofluorescence scattered throughout the cytoplasm also increased after H2O2 treatment. In Northern blot analysis using the cDNA as a probe, the level of transcripts also changed with H2O2 treatment. When amoebae were fed with Tetrahymena, the intensity of immunofluorescence increased from 15 min and persisted until 2 h after phagocytosis. These results suggest that the 22.5-kDa protein of A. proteus is a Prx protein and that it has an antioxidant property responding to phagocytosis.
Soares, Marcelo B.; Efstratiadis, Argiris
1997-01-01
This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.
Soares, M.B.; Efstratiadis, A.
1997-06-10
This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3{prime} noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. 4 figs.
[Primary culture of cat intestinal epithelial cell and construction of its cDNA library].
Ye, L; Gui-Hua, Z; Kun, Y; Hong-Fa, W; Ting, X; Gong-Zhen, L; Wei-Xia, Z; Yong, C
2017-04-12
Objective To establish the primary cat intestinal epithelial cells (IECs) culture methods and construct the cDNA library for the following yeast two-hybrid experiment, so as to screen the virulence interaction factors among the final host. Methods The primary cat IECs were cultured by the tissue cultivation and combined digestion with collagenase XI and dispase I separately. Then the cat IECs cultured was identified with the morphological observation and cyto-keratin detection, by using goat anti-cyto-keratin monoclonal antibodies. The mRNA of cat IECs was isolated and used as the template to synthesize the first strand cDNA by SMART™ technology, and then the double-strand cDNAs were acquired by LD-PCR, which were subsequently cloned into the plasmid PGADT7-Rec to construct yeast two-hybrid cDNA library in the yeast strain Y187 by homologous recombination. Matchmaker™ Insert Check PCR was used to detect the size distribution of cDNA fragments after the capacity calculation of the cDNA library. Results The comparison of the two cultivation methods indicated that the combined digestion of collagenase XI and dispase I was more effective than the tissue cultivation. The cat IECs system of continuous culture was established and the cat IECs with high purity were harvested for constructing the yeast two-hybrid cDNA library. The library contained 1.1×10 6 independent clones. The titer was 2.8×10 9 cfu/ml. The size of inserted fragments was among 0.5-2.0 kb. Conclusion The yeast two-hybrid cDNA library of cat IECs meets the requirements of further screen research, and this study lays the foundation of screening the Toxoplasma gondii virulence interaction factors among the cDNA libraries of its final hosts.
Chen, Honglin; Wang, Lixia; Liu, Xiaoyan; Hu, Liangliang; Wang, Suhua; Cheng, Xuzhen
2017-07-11
Cowpea [Vigna unguiculata (L.) Walp.] is one of the most important legumes in tropical and semi-arid regions. However, there is relatively little genomic information available for genetic research on and breeding of cowpea. The objectives of this study were to analyse the cowpea transcriptome and develop genic molecular markers for future genetic studies of this genus. Approximately 54 million high-quality cDNA sequence reads were obtained from cowpea based on Illumina paired-end sequencing technology and were de novo assembled to generate 47,899 unigenes with an N50 length of 1534 bp. Sequence similarity analysis revealed 36,289 unigenes (75.8%) with significant similarity to known proteins in the non-redundant (Nr) protein database, 23,471 unigenes (49.0%) with BLAST hits in the Swiss-Prot database, and 20,654 unigenes (43.1%) with high similarity in the Kyoto Encyclopedia of Genes and Genomes (KEGG) database. Further analysis identified 5560 simple sequence repeats (SSRs) as potential genic molecular markers. Validating a random set of 500 SSR markers yielded 54 polymorphic markers among 32 cowpea accessions. This transcriptomic analysis of cowpea provided a valuable set of genomic data for characterizing genes with important agronomic traits in Vigna unguiculata and a new set of genic SSR markers for further genetic studies and breeding in cowpea and related Vigna species.
Fan, Qing-Jie; Yan, Feng-Xia; Qiao, Guang; Zhang, Bing-Xue; Wen, Xiao-Peng
2014-01-01
Drought is one of the most severe threats to the growth, development and yield of plant. In order to unravel the molecular basis underlying the high tolerance of pitaya (Hylocereus undatus) to drought stress, suppression subtractive hybridization (SSH) and cDNA microarray approaches were firstly combined to identify the potential important or novel genes involved in the plant responses to drought stress. The forward (drought over drought-free) and reverse (drought-free over drought) suppression subtractive cDNA libraries were constructed using in vitro shoots of cultivar 'Zihonglong' exposed to drought stress and drought-free (control). A total of 2112 clones, among which half were from either forward or reverse SSH library, were randomly picked up to construct a pitaya cDNA microarray. Microarray analysis was carried out to verify the expression fluctuations of this set of clones upon drought treatment compared with the controls. A total of 309 expressed sequence tags (ESTs), 153 from forward library and 156 from reverse library, were obtained, and 138 unique ESTs were identified after sequencing by clustering and blast analyses, which included genes that had been previously reported as responsive to water stress as well as some functionally unknown genes. Thirty six genes were mapped to 47 KEGG pathways, including carbohydrate metabolism, lipid metabolism, energy metabolism, nucleotide metabolism, and amino acid metabolism of pitaya. Expression analysis of the selected ESTs by reverse transcriptase polymerase chain reaction (RT-PCR) corroborated the results of differential screening. Moreover, time-course expression patterns of these selected ESTs further confirmed that they were closely responsive to drought treatment. Among the differentially expressed genes (DEGs), many are related to stress tolerances including drought tolerance. Thereby, the mechanism of drought tolerance of this pitaya genotype is a very complex physiological and biochemical process, in which multiple metabolism pathways and many genes were implicated. The data gained herein provide an insight into the mechanism underlying the drought stress tolerance of pitaya, as well as may facilitate the screening of candidate genes for drought tolerance. © 2013 Elsevier B.V. All rights reserved.
Pichler, Martin; Zatloukal, Kurt
2013-01-01
Analysis of RNA isolated from fixed and paraffin-embedded tissues is widely used in biomedical research and molecular pathological diagnostics. We have performed a comprehensive and systematic investigation of the impact of factors in the pre-analytical workflow, such as different fixatives, fixation time, RNA extraction method and storage of tissues in paraffin blocks, on several downstream reactions including complementary DNA (cDNA) synthesis, quantitative reverse transcription polymerase chain reaction (qRT-PCR) and microarray hybridization. We compared the effects of routine formalin fixation with the non-crosslinking, alcohol-based Tissue Tek Xpress Molecular Fixative (TTXMF, Sakura Finetek), and cryopreservation as gold standard for molecular analyses. Formalin fixation introduced major changes into microarray gene expression data and led to marked gene-to-gene variations in delta-ct values of qRT-PCR. We found that qRT-PCR efficiency and gene-to-gene variations were mainly attributed to differences in the efficiency of cDNA synthesis as the most sensitive step. These differences could not be reliably detected by quality assessment of total RNA isolated from formalin-fixed tissues by electrophoresis or spectrophotometry. Although RNA from TTXMF fixed samples was as fragmented as RNA from formalin fixed samples, much higher cDNA yield and lower ct-values were obtained in qRT-PCR underlining the negative impact of crosslinking by formalin. In order to better estimate the impact of pre-analytical procedures such as fixation on the reliability of downstream analysis, we applied a qRT-PCR-based assay using amplicons of different length and an assay measuring the efficiency of cDNA generation. Together these two assays allowed better quality assessment of RNA extracted from fixed and paraffin-embedded tissues and should be used to supplement quality scores derived from automated electrophoresis. A better standardization of the pre-analytical workflow, application of additional quality controls and detailed sample information would markedly improve the comparability and reliability of molecular studies based on formalin-fixed and paraffin-embedded tissue samples. PMID:23936242
RNA circularization reveals terminal sequence heterogeneity in a double-stranded RNA virus.
Widmer, G
1993-03-01
Double-stranded RNA viruses (dsRNA), termed LRV1, have been found in several strains of the protozoan parasite Leishmania. With the aim of constructing a full-length cDNA copy of the viral genome, including its terminal sequences, a protocol based on PCR amplification across the 3'-5' junction of circularized RNA was developed. This method proved to be applicable to dsRNA. It provided a relatively simple alternative to one-sided PCR, without loss of specificity inherent in the use of generic primers. LRV1 terminal nucleotide sequences obtained by this method showed a considerable variation in length, particularly at the 5' end of the positive strand, as well as the potential for forming 3' overhangs. The opposite genomic end terminates in 0, 1, or 2 TCA trinucleotide repeats. These results are compared with terminal sequences derived from one-sided PCR experiments.
NASA Astrophysics Data System (ADS)
Xue, Zhuang; Li, Hui; Liu, Yang; Zhou, Wei; Sun, Jing; Wang, Xiuli
2017-12-01
As a `living fossil' of species origin and `rich treasure' of food and nutrition development, sea cucumber has received a lot of attentions from researchers. The cDNA library construction and EST sequencing of blood had been conducted previously in our lab. The bioinformatic analysis provided a gene fragment which is highly homologous with the genes of lectin family, named AjL ( Apostichopus japonicus lectin). To characterize and determine the phylogeny of AjL genes in early evolution, we isolated a full-length cDNA of lectin gene from the body wall of A. japonicus. The open reading frame of this gene contained 489 bp and encoded a 163 amino acids secretory protein being homologous to lectins of mammals and aquatic organisms. The deduced protein included a lectin-like domain. SDS-PAGE analysis showed that AjL migrated as a specific band (about 36.09 kDa under reducing), and agglutinated against rabbit red blood cells. AjL was similar to chain A of CEL-IV in space structure. We predicted that AjL may play the same role of CEL-IV. Our results suggested that more than one lectin gene functioned in sea cucumber and most of other species, which was fused by uncertain sequences during the evolution and encoded different proteins with diverse functions. Our findings provided the insights into the function and characteristics of lectin genes invertebrates. The results will also be helpful for the identification and structural, functional, and evolutionary analyses of lectin genes.
Figueredo, Diego de Siqueira; Barbosa, Mayara Rodrigues; Coimbra, Daniel Gomes; Dos Santos, José Luiz Araújo; Costa, Ellyda Fernanda Lopes; Koike, Bruna Del Vechio; Alexandre Moreira, Magna Suzana; de Andrade, Tiago Gomes
2018-03-01
Recent studies have shown that transcriptomes from different tissues present circadian oscillations. Therefore, the endogenous variation of total RNA should be considered as a potential bias in circadian studies of gene expression. However, normalization strategies generally include the equalization of total RNA concentration between samples prior to cDNA synthesis. Moreover, endogenous housekeeping genes (HKGs) frequently used for data normalization may exhibit circadian variation and distort experimental results if not detected or considered. In this study, we controlled experimental conditions from the amount of initial brain tissue samples through extraction steps, cDNA synthesis, and quantitative real time PCR (qPCR) to demonstrate a circadian oscillation of total RNA concentration. We also identified that the normalization of the RNA's yield affected the rhythmic profiles of different genes, including Per1-2 and Bmal1. Five widely used HKGs (Actb, Eif2a, Gapdh, Hprt1, and B2m) also presented rhythmic variations not detected by geNorm algorithm. In addition, the analysis of exogenous microRNAs (Cel-miR-54 and Cel-miR-39) spiked during RNA extraction suggests that the yield was affected by total RNA concentration, which may impact circadian studies of small RNAs. The results indicate that the approach of tissue normalization without total RNA equalization prior to cDNA synthesis can avoid bias from endogenous broad variations in transcript levels. Also, the circadian analysis of 2 -Cycle threshold (Ct) data, without HKGs, may be an alternative for chronobiological studies under controlled experimental conditions.
Myamoto, D T; Pidde-Queiroz, G; Pedroso, A; Gonçalves-de-Andrade, R M; van den Berg, C W; Tambourgi, D V
2016-09-01
A transcriptome analysis of the venom glands of the spider Loxosceles laeta, performed by our group, in a previous study (Fernandes-Pedrosa et al., 2008), revealed a transcript with a sequence similar to the human complement component C3. Here we present the analysis of this transcript. cDNA fragments encoding the C3 homologue (Lox-C3) were amplified from total RNA isolated from the venom glands of L. laeta by RACE-PCR. Lox-C3 is a 5178 bps cDNA sequence encoding a 190kDa protein, with a domain configuration similar to human C3. Multiple alignments of C3-like proteins revealed two processing sites, suggesting that Lox-C3 is composed of three chains. Furthermore, the amino acids consensus sequences for the thioester was found, in addition to putative sequences responsible for FB binding. The phylogenetic analysis showed that Lox-C3 belongs to the same group as two C3 isoforms from the spider Hasarius adansoni (Family Salcitidae), showing 53% homology with these. This is the first characterization of a Loxosceles cDNA sequence encoding a human C3 homologue, and this finding, together with our previous finding of the expression of a FB-like molecule, suggests that this spider species also has a complement system. This work will help to improve our understanding of the innate immune system in these spiders and the ancestral structure of C3. Copyright © 2016 Elsevier GmbH. All rights reserved.
Anti-liver-kidney microsome antibody type 1 recognizes human cytochrome P450 db1.
Gueguen, M; Yamamoto, A M; Bernard, O; Alvarez, F
1989-03-15
Anti-liver-kidney microsome antibody type 1 (LKM1), present in the sera of a group of children with autoimmune hepatitis, was recently shown to recognize a 50 kDa protein identified as rat liver cytochromes P450 db1 and db2. High homology between these two members of the rat P450 IID subfamily and human P450 db1 suggested that anti-LKM1 antibody is directed against this human protein. To test this hypothesis, a human liver cDNA expression library in phage lambda GT-11 was screened using rat P450 db1 cDNA as a probe. Two human cDNA clones were found to be identical to human P450 db1 by restriction mapping. Immunoblot analysis using as antigen, the purified fusion protein from one of the human cDNA clones showed that only anti-LKM1 with anti-50 kDa reactivity recognized the fusion protein. This fusion protein was further used to develop an ELISA test that was shown to be specific for sera of children with this disease. These results: 1) identify the human liver antigen recognized by anti-LKM1 auto-antibodies as cytochrome P450 db1, 2) allow to speculate that mutation on the human P450 db1 gene could alter its expression in the hepatocyte and make it auto-antigenic, 3) provide a simple and specific diagnostic test for this disease.
NASA Technical Reports Server (NTRS)
Balcer-Kubiczek, E. K.; Meltzer, S. J.; Han, L. H.; Zhang, X. F.; Shi, Z. M.; Harrison, G. H.; Abraham, J. M.
1997-01-01
A novel polymerase chain reaction (PCR)-based method was used to identify candidate genes whose expression is altered in cancer cells by ionizing radiation. Transcriptional induction of randomly selected genes in control versus irradiated human HL60 cells was compared. Among several complementary DNA (cDNA) clones recovered by this approach, one cDNA clone (CL68-5) was downregulated in X-irradiated HL60 cells but unaffected by 12-O-tetradecanoyl phorbol-13-acetate, forskolin, or cyclosporin-A. DNA sequencing of the CL68-5 cDNA revealed 100% nucleotide sequence homology to the reported human Csa-19 gene. Northern blot analysis of RNA from control and irradiated cells revealed the expression of a single 0.7-kilobase (kb) messenger RNA (mRNA) transcript. This 0.7-kb Csa-19 mRNA transcript was also expressed in a variety of human adult and corresponding fetal normal tissues. Moreover, when the effect of X- or fission neutron-irradiation on Csa-19 mRNA was compared in cultured human cells differing in p53 gene status (p53-/- versus p53+/+), downregulation of Csa-19 by X-rays or fission neutrons was similar in p53-wild type and p53-null cell lines. Our results provide the first known example of a radiation-responsive gene in human cancer cells whose expression is not associated with p53, adenylate cyclase or protein kinase C.
Abolhassani, Mohsen; Roux, Kenneth H
2009-06-01
Tree nuts, including almond (prunus dulcis) are a source of food allergens often associated with life-threatening allergic reactions in susceptible individuals. Although the proteins in almonds have been biochemically characterized, relatively little has been reported regarding the identity of the allergens involved in almond sensitivity. The present study was undertaken to identify the allergens of the almond by cDNA library approach. cDNA library of almond seeds was constructed in Uni-Zap XR lamda vector and expressed in E. coli XL-1 blue. Plaques were immunoscreened with pooled sera of allergic patients. The cDNA clone reacting significantly with specific IgE antibodies was selected and subcloned and subsequently expressed in E. coli. The amino acids deducted from PCR product of clone showed homology to 60s acidic ribosomal protein of almond. The expressed protein was 11,450 Dalton without leader sequence. Immunoreactivity of the recombinant 60s ribosomal protein (r60sRP) was evaluated with dot blot analysis using pooled and individual sera of allergic patients. The data showed that r60sRP and almond extract (as positive control) possess the ability to bind the IgE antibodies. The results showed that expressed protein is an almond allergen.Whether this r60sRP represents a major allergen of almond needs to be further studied which requires a large number of sera from the almond atopic patients and also need to determine the IgE-reactive frequencies of each individual allergen.
Tappaz, M; Bitoun, M; Reymond, I; Sergeant, A
1999-09-01
Cysteine sulfinate decarboxylase (CSD) is considered as the rate-limiting enzyme in the biosynthesis of taurine, a possible osmoregulator in brain. Through cloning and sequencing of RT-PCR and RACE-PCR products of rat brain mRNAs, a 2,396-bp cDNA sequence was obtained encoding a protein of 493 amino acids (calculated molecular mass, 55.2 kDa). The corresponding fusion protein showed a substrate specificity similar to that of the endogenous enzyme. The sequence of the encoded protein is identical to that encoded by liver CSD cDNA. Among other characterized amino acid decarboxylases, CSD shows the highest homology (54%) with either isoform of glutamic acid decarboxylase (GAD65 and GAD67). A single mRNA band, approximately 2.5 kb, was detected by northern blot in RNA extracts of brain, liver, and kidney. However, brain and liver CSD cDNA sequences differed in the 5' untranslated region. This indicates two forms of CSD mRNA. Analysis of PCR-amplified products of genomic DNA suggests that the brain form results from the use of a 3' alternative internal splicing site within an exon specifically found in liver CSD mRNA. Through selective RT-PCR the brain form was detected in brain only, whereas the liver form was found in liver and kidney. These results indicate a tissue-specific regulation of CSD genomic expression.
Du, Yu-Jie; Hou, Yi-Ling; Hou, Wan-Ru
2013-02-01
The Giant Panda is an endangered and valuable gene pool in genetic, its important functional gene POLR2H encodes an essential shared peptide H of RNA polymerases. The genomic DNA and cDNA sequences were cloned successfully for the first time from the Giant Panda (Ailuropoda melanoleuca) adopting touchdown-PCR and reverse transcription polymerase chain reaction (RT-PCR), respectively. The length of the genomic sequence of the Giant Panda is 3,285 bp, including five exons and four introns. The cDNA fragment cloned is 509 bp in length, containing an open reading frame of 453 bp encoding 150 amino acids. Alignment analysis indicated that both the cDNA and its deduced amino acid sequence were highly conserved. Protein structure prediction showed that there was one protein kinase C phosphorylation site, four casein kinase II phosphorylation sites and one amidation site in the POLR2H protein, further shaping advanced protein structure. The cDNA cloned was expressed in Escherichia coli, which indicated that POLR2H fusion with the N-terminally His-tagged form brought about the accumulation of an expected 20.5 kDa polypeptide in line with the predicted protein. On the basis of what has already been achieved in this study, further deep-in research will be conducted, which has great value in theory and practical significance.
Cloning a Chymotrypsin-Like 1 (CTRL-1) Protease cDNA from the Jellyfish Nemopilema nomurai
Heo, Yunwi; Kwon, Young Chul; Bae, Seong Kyeong; Hwang, Duhyeon; Yang, Hye Ryeon; Choudhary, Indu; Lee, Hyunkyoung; Yum, Seungshic; Shin, Kyoungsoon; Yoon, Won Duk; Kang, Changkeun; Kim, Euikyung
2016-01-01
An enzyme in a nematocyst extract of the Nemopilema nomurai jellyfish, caught off the coast of the Republic of Korea, catalyzed the cleavage of chymotrypsin substrate in an amidolytic kinetic assay, and this activity was inhibited by the serine protease inhibitor, phenylmethanesulfonyl fluoride. We isolated the full-length cDNA sequence of this enzyme, which contains 850 nucleotides, with an open reading frame of 801 encoding 266 amino acids. A blast analysis of the deduced amino acid sequence showed 41% identity with human chymotrypsin-like (CTRL) and the CTRL-1 precursor. Therefore, we designated this enzyme N. nomurai CTRL-1. The primary structure of N. nomurai CTRL-1 includes a leader peptide and a highly conserved catalytic triad of His69, Asp117, and Ser216. The disulfide bonds of chymotrypsin and the substrate-binding sites are highly conserved compared with the CTRLs of other species, including mammalian species. Nemopilema nomurai CTRL-1 is evolutionarily more closely related to Actinopterygii than to Scyphozoan (Aurelia aurita) or Hydrozoan (Hydra vulgaris). The N. nomurai CTRL1 was amplified from the genomic DNA with PCR using specific primers designed based on the full-length cDNA, and then sequenced. The N. nomurai CTRL1 gene contains 2434 nucleotides and four distinct exons. The 5′ donor splice (GT) and 3′ acceptor splice sequences (AG) are wholly conserved. This is the first report of the CTRL1 gene and cDNA structures in the jellyfish N. nomurai. PMID:27399771
Cloning a Chymotrypsin-Like 1 (CTRL-1) Protease cDNA from the Jellyfish Nemopilema nomurai.
Heo, Yunwi; Kwon, Young Chul; Bae, Seong Kyeong; Hwang, Duhyeon; Yang, Hye Ryeon; Choudhary, Indu; Lee, Hyunkyoung; Yum, Seungshic; Shin, Kyoungsoon; Yoon, Won Duk; Kang, Changkeun; Kim, Euikyung
2016-07-05
An enzyme in a nematocyst extract of the Nemopilema nomurai jellyfish, caught off the coast of the Republic of Korea, catalyzed the cleavage of chymotrypsin substrate in an amidolytic kinetic assay, and this activity was inhibited by the serine protease inhibitor, phenylmethanesulfonyl fluoride. We isolated the full-length cDNA sequence of this enzyme, which contains 850 nucleotides, with an open reading frame of 801 encoding 266 amino acids. A blast analysis of the deduced amino acid sequence showed 41% identity with human chymotrypsin-like (CTRL) and the CTRL-1 precursor. Therefore, we designated this enzyme N. nomurai CTRL-1. The primary structure of N. nomurai CTRL-1 includes a leader peptide and a highly conserved catalytic triad of His(69), Asp(117), and Ser(216). The disulfide bonds of chymotrypsin and the substrate-binding sites are highly conserved compared with the CTRLs of other species, including mammalian species. Nemopilema nomurai CTRL-1 is evolutionarily more closely related to Actinopterygii than to Scyphozoan (Aurelia aurita) or Hydrozoan (Hydra vulgaris). The N. nomurai CTRL1 was amplified from the genomic DNA with PCR using specific primers designed based on the full-length cDNA, and then sequenced. The N. nomurai CTRL1 gene contains 2434 nucleotides and four distinct exons. The 5' donor splice (GT) and 3' acceptor splice sequences (AG) are wholly conserved. This is the first report of the CTRL1 gene and cDNA structures in the jellyfish N. nomurai.
Blancher, C; Omri, B; Bidou, L; Pessac, B; Crisanti, P
1996-10-18
We report the isolation and characterization of a novel cDNA from quail neuroretina encoding a putative protein named nectinepsin. The nectinepsin cDNA identifies a major 2.2-kilobase mRNA that is detected from ED 5 in neuroretina and is increasingly abundant during embryonic development. A nectinepsin mRNA is also found in quail liver, brain, and intestine and in mouse retina. The deduced nectinepsin amino acid sequence contains the RGD cell binding motif of integrin ligands. Furthermore, nectinepsin shares substantial homologies with vitronectin and structural protein similarities with most of the matricial metalloproteases. However, the presence of a specific sequence and the lack of heparin and collagen binding domains of the vitronectin indicate that nectinepsin is a new extracellular matrix protein. Furthermore, genomic Southern blot studies suggest that nectinepsin and vitronectin are encoded by different genes. Western blot analysis with an anti-human vitronectin antiserum revealed, in addition to the 65- and 70-kDa vitronectin bands, an immunoreactive protein of about 54 kDa in all tissues containing nectinepsin mRNA. It seems likely that the form of vitronectin found in chick egg yolk plasma by Nagano et al. ((1992) J. Biol. Chem. 267, 24863-24870) is the protein that corresponds to the nectinepsin cDNA. This new protein could be an important molecule involved in the early steps of the development.
Lockyer, Anne E; Spinks, Jenny; Kane, Richard A; Hoffmann, Karl F; Fitzpatrick, Jennifer M; Rollinson, David; Noble, Leslie R; Jones, Catherine S
2008-01-01
Background Biomphalaria glabrata is an intermediate snail host for Schistosoma mansoni, one of the important schistosomes infecting man. B. glabrata/S. mansoni provides a useful model system for investigating the intimate interactions between host and parasite. Examining differential gene expression between S. mansoni-exposed schistosome-resistant and susceptible snail lines will identify genes and pathways that may be involved in snail defences. Results We have developed a 2053 element cDNA microarray for B. glabrata containing clones from ORESTES (Open Reading frame ESTs) libraries, suppression subtractive hybridization (SSH) libraries and clones identified in previous expression studies. Snail haemocyte RNA, extracted from parasite-challenged resistant and susceptible snails, 2 to 24 h post-exposure to S. mansoni, was hybridized to the custom made cDNA microarray and 98 differentially expressed genes or gene clusters were identified, 94 resistant-associated and 4 susceptible-associated. Quantitative PCR analysis verified the cDNA microarray results for representative transcripts. Differentially expressed genes were annotated and clustered using gene ontology (GO) terminology and Kyoto Encyclopaedia of Genes and Genomes (KEGG) pathway analysis. 61% of the identified differentially expressed genes have no known function including the 4 susceptible strain-specific transcripts. Resistant strain-specific expression of genes implicated in innate immunity of invertebrates was identified, including hydrolytic enzymes such as cathepsin L, a cysteine proteinase involved in lysis of phagocytosed particles; metabolic enzymes such as ornithine decarboxylase, the rate-limiting enzyme in the production of polyamines, important in inflammation and infection processes, as well as scavenging damaging free radicals produced during production of reactive oxygen species; stress response genes such as HSP70; proteins involved in signalling, such as importin 7 and copine 1, cytoplasmic intermediate filament (IF) protein and transcription enzymes such as elongation factor 1α and EF-2. Conclusion Production of the first cDNA microarray for profiling gene expression in B. glabrata provides a foundation for expanding our understanding of pathways and genes involved in the snail internal defence system (IDS). We demonstrate resistant strain-specific expression of genes potentially associated with the snail IDS, ranging from signalling and inflammation responses through to lysis of proteinacous products (encapsulated sporocysts or phagocytosed parasite components) and processing/degradation of these targeted products by ubiquitination. PMID:19114004