Anchoring a Defined Sequence to the 55' Ends of mRNAs : The Bolt to Clone Rare Full Length mRNAs and Generate cDNA Libraries porn a Few Cells.

PubMed

Baptiste, J; Milne Edwards, D; Delort, J; Mallet, J

1993-01-01

Among numerous applications, the polymerase chain reaction (PCR) (1,2) provides a convenient means to clone 5' ends of rare mRNAs and to generate cDNA libraries from tissue available in amounts too low to be processed by conventional methods. Basically, the amplification of cDNAs by the PCR requires the availability of the sequences of two stretches of the molecule to be amplified. A sequence can easily be imposed at the 5' end of the first-strand cDNAs (corresponding to the 3' end of the mRNAs) by priming the reverse transcription with a specific primer (for cloning the 5' end of rare messenger) or with an oligonucleotide tailored with a poly (dT) stretch (for cDNA library construction), taking advantage of the poly (A) sequence that is located at the 3' end of mRNAs. Several strategies have been devised to tag the 3' end of the ss-cDNAs (corresponding to the 55' end of the mRNAs). We (3) and others have described strategies based on the addition of a homopolymeric dG (4,5) or dA (6,7) tail using terminal deoxyribonucleotide transferase (TdT) ("anchor-PCR" [4]). However, this strategy has important limitations. The TdT reaction is difficult to control and has a low efficiency (unpublished observations). But most importantly, the return primers containing a homopolymeric (dC or dT) tail generate nonspecific amplifications, a phenomenon that prevents the isolation of low abundance mRNA species and/or interferes with the relative abundance of primary clones in the library. To circumvent these drawbacks, we have used two approaches. First, we devised a strategy based on a cRNA enrichment procedure, which has been useful to eliminate nonspecific-PCR products and to allow detection and cloning of cDNAs of low abundance (3). More recently, to avoid the nonspecific amplification resulting from the annealing of the homopolymeric tail oligonucleotide, we have developed a novel anchoring strategy that is based on the ligation of an oligonucleotide to the 35' end of ss-cDNAs. This strategy is referred to as SLIC for single-strand ligation to ss-cDNA (8).

Ultrasensitive sensing platform for platelet-derived growth factor BB detection based on layered molybdenum selenide-graphene composites and Exonuclease III assisted signal amplification.

PubMed

Huang, Ke-Jing; Shuai, Hong-Lei; Zhang, Ji-Zong

2016-03-15

A highly sensitive and ultrasensitive electrochemical aptasensor for platelet-derived growth factor BB (PDGF-BB) detection is fabricated based on layered molybdenum selenide-graphene (MoSe2-Gr) composites and Exonuclease III (Exo III)-aided signal amplification. MoSe2-Gr is prepared by a simple hydrothermal method and used as a promising sensing platform. Exo III has a specifical exo-deoxyribonuclease activity for duplex DNAs in the direction from 3' to 5' terminus, however its activity is limited on the duplex DNAs with more than 4 mismatched terminal bases at 3' ends. Herein, aptamer and complementary DNA (cDNA) sequences are designed with four thymine bases on 3' ends. In the presence of target protein, the aptamer associates with it and facilitates the formation of duplex DNA between cDNA and signal DNA. The duplex DNA then is digested by Exo III and releases cDNA, which hybridizes with signal DNA to perform a new cleavage process. Nevertheless, in the absence of target protein, the aptamer hybridizes with cDNA will inhibit the Exo III-assisted nucleotides cleavage. The signal DNA then hybridizes with capture DNA on the electrode. Subsequently, horse radish peroxidase is fixed on electrode by avidin-biotin reaction and then catalyzes hydrogen peroxide and hydroquinone to produce electrochemical response. Therefore, a bridge can be established between the concentration of target protein and the degree of the attenuation of the obtained signal, providing a quantitative measure of target protein with a broad detection range of 0.0001-1 nM and a detection limit of 20 fM. Copyright © 2015 Elsevier B.V. All rights reserved.

Cloning and characterization of a cDNA encoding topoisomerase II in pea and analysis of its expression in relation to cell proliferation.

PubMed

Reddy, M K; Nair, S; Tewari, K K; Mudgil, Y; Yadav, B S; Sopory, S K

1999-09-01

We have isolated and sequenced four overlapping cDNA clones to identify the full-length cDNA for topoisomerase II (PsTopII) from pea. Using degenerate primers, based on the conserved amino acid sequences of other eukaryotic type II topoisomerases, a 680 bp fragment was PCR-amplified with pea cDNA as template. This fragment was used as a probe to screen an oligo-dT-primed pea cDNA library. A partial cDNA clone was isolated that was truncated at the 3' end. RACE-PCR was employed to isolate the remaining portion of the gene. The total size of PsTopII is 4639 bp with an open reading frame of 4392 bp. The deduced amino acid sequence shows a strong homology to other eukaryotic topoisomerase II (topo II) at the N-terminus end. The topo II transcript was abundant in proliferative tissues. We also show that the level of topo II transcripts could be stimulated by exogenous application of growth factors that induced proliferation in vitro cultures. Light irradiation to etiolated tissue strongly stimulated the expression of topo II. These results suggest that topo II gene expression is up-regulated in response to light and hormones and correlates with cell proliferation. Besides, we have also isolated and analysed the 5'-flanking region of the pea TopII gene. This is first report on the isolation of a putative promoter for topoisomerase II from plants.

LEDGF/p75 Deficiency Increases Deletions at the HIV-1 cDNA Ends.

PubMed

Bueno, Murilo T D; Reyes, Daniel; Llano, Manuel

2017-09-15

Processing of unintegrated linear HIV-1 cDNA by the host DNA repair system results in its degradation and/or circularization. As a consequence, deficient viral cDNA integration generally leads to an increase in the levels of HIV-1 cDNA circles containing one or two long terminal repeats (LTRs). Intriguingly, impaired HIV-1 integration in LEDGF/p75-deficient cells does not result in a correspondent increase in viral cDNA circles. We postulate that increased degradation of unintegrated linear viral cDNA in cells lacking the lens epithelium-derived growth factor (LEDGF/p75) account for this inconsistency. To evaluate this hypothesis, we characterized the nucleotide sequence spanning 2-LTR junctions isolated from LEDGF/p75-deficient and control cells. LEDGF/p75 deficiency resulted in a significant increase in the frequency of 2-LTRs harboring large deletions. Of note, these deletions were dependent on the 3' processing activity of integrase and were not originated by aberrant reverse transcription. Our findings suggest a novel role of LEDGF/p75 in protecting the unintegrated 3' processed linear HIV-1 cDNA from exonucleolytic degradation.

Informatic and genomic analysis of melanocyte cDNA libraries as a resource for the study of melanocyte development and function.

PubMed

Baxter, Laura L; Hsu, Benjamin J; Umayam, Lowell; Wolfsberg, Tyra G; Larson, Denise M; Frith, Martin C; Kawai, Jun; Hayashizaki, Yoshihide; Carninci, Piero; Pavan, William J

2007-06-01

As part of the RIKEN mouse encyclopedia project, two cDNA libraries were prepared from melanocyte-derived cell lines, using techniques of full-length clone selection and subtraction/normalization to enrich for rare transcripts. End sequencing showed that these libraries display over 83% complete coding sequence at the 5' end and 96-97% complete coding sequence at the 3' end. Evaluation of the libraries, derived from B16F10Y tumor cells and melan-c cells, revealed that they contain clones for a majority of the genes previously demonstrated to function in melanocyte biology. Analysis of genomic locations for transcripts revealed that the distribution of melanocyte genes is non-random throughout the genome. Three genomic regions identified that showed significant clustering of melanocyte-expressed genes contain one or more genes previously shown to regulate melanocyte development or function. A catalog of genes expressed in these libraries is presented, providing a valuable resource of cDNA clones and sequence information that can be used for identification of new genes important for melanocyte development, function, and disease.

Thermostable group II intron reverse transcriptase fusion proteins and their use in cDNA synthesis and next-generation RNA sequencing.

PubMed

Mohr, Sabine; Ghanem, Eman; Smith, Whitney; Sheeter, Dennis; Qin, Yidan; King, Olga; Polioudakis, Damon; Iyer, Vishwanath R; Hunicke-Smith, Scott; Swamy, Sajani; Kuersten, Scott; Lambowitz, Alan M

2013-07-01

Mobile group II introns encode reverse transcriptases (RTs) that function in intron mobility ("retrohoming") by a process that requires reverse transcription of a highly structured, 2-2.5-kb intron RNA with high processivity and fidelity. Although the latter properties are potentially useful for applications in cDNA synthesis and next-generation RNA sequencing (RNA-seq), group II intron RTs have been difficult to purify free of the intron RNA, and their utility as research tools has not been investigated systematically. Here, we developed general methods for the high-level expression and purification of group II intron-encoded RTs as fusion proteins with a rigidly linked, noncleavable solubility tag, and we applied them to group II intron RTs from bacterial thermophiles. We thus obtained thermostable group II intron RT fusion proteins that have higher processivity, fidelity, and thermostability than retroviral RTs, synthesize cDNAs at temperatures up to 81°C, and have significant advantages for qRT-PCR, capillary electrophoresis for RNA-structure mapping, and next-generation RNA sequencing. Further, we find that group II intron RTs differ from the retroviral enzymes in template switching with minimal base-pairing to the 3' ends of new RNA templates, making it possible to efficiently and seamlessly link adaptors containing PCR-primer binding sites to cDNA ends without an RNA ligase step. This novel template-switching activity enables facile and less biased cloning of nonpolyadenylated RNAs, such as miRNAs or protein-bound RNA fragments. Our findings demonstrate novel biochemical activities and inherent advantages of group II intron RTs for research, biotechnological, and diagnostic methods, with potentially wide applications.

Role of messenger RNA-ribosome complex in complementary DNA display.

PubMed

Naimuddin, Mohammed; Ohtsuka, Isao; Kitamura, Koichiro; Kudou, Motonori; Kimura, Shinnosuke

2013-07-15

In vitro display technologies such as ribosome display and messenger RNA (mRNA)/complementary DNA (cDNA) display are powerful methods that can generate library diversities on the order of 10(10-14). However, in mRNA and cDNA display methods, the end use diversity is two orders of magnitude lower than initial diversity and is dependent on the downstream processes that act as limiting factors. We found that in our previous cDNA display protocol, the purification of protein fusions by the use of streptavidin matrices from cell-free translation mixtures had poor efficiency (∼10-15%) that seriously affected the diversity of the purified library. Here, we have investigated and optimized the protocols that provided remarkable purification efficiencies. The stalled ribosome in the mRNA-ribosome complex was found to impede this purification efficiency. Among the various conditions tested, destabilization of ribosomes by appropriate concentration of metal chelating agents in combination with an optimal temperature of 30°C were found to be crucial and effective for nearly complete isolation of protein fusions from the cell-free translation system. Thus, this protocol provided 8- to 10-fold increased efficiency of purification over the previous method and results in retaining the diversity of the library by approximately an order of magnitude-important for directed evolution. We also discuss the possible effects in the fabrication of protein chips. Copyright © 2013 Elsevier Inc. All rights reserved.

Complementary DNA libraries: an overview.

PubMed

Ying, Shao-Yao

2004-07-01

The generation of complete and full-length cDNA libraries for potential functional assays of specific gene sequences is essential for most molecules in biotechnology and biomedical research. The field of cDNA library generation has changed rapidly in the past 10 yr. This review presents an overview of the method available for the basic information of generating cDNA libraries, including the definition of the cDNA library, different kinds of cDNA libraries, difference between methods for cDNA library generation using conventional approaches and a novel strategy, and the quality of cDNA libraries. It is anticipated that the high-quality cDNA libraries so generated would facilitate studies involving genechips and the microarray, differential display, subtractive hybridization, gene cloning, and peptide library generation.

The self primer of the long terminal repeat retrotransposon Tf1 is not removed during reverse transcription.

PubMed

Atwood-Moore, Angela; Yan, Kenneth; Judson, Robert L; Levin, Henry L

2006-08-01

The long terminal repeat retrotransposon Tf1 of Schizosaccharomyces pombe uses a unique mechanism of self priming to initiate reverse transcription. Instead of using a tRNA, Tf1 primes minus-strand synthesis with an 11-nucleotide RNA removed from the 5' end of its own transcript. We tested whether the self primer of Tf1 was similar to tRNA primers in being removed from the cDNA by RNase H. Our analysis of Tf1 cDNA extracted from virus-like particles revealed the surprising observation that the dominant species of cDNA retained the self primer. This suggests that integration of the cDNA relies on mechanisms other than reverse transcription to remove the primer.

Construction of a High-Quality Yeast Two-Hybrid Library and Its Application in Identification of Interacting Proteins with Brn1 in Curvularia lunata.

PubMed

Gao, Jin-Xin; Jing, Jing; Yu, Chuan-Jin; Chen, Jie

2015-06-01

Curvularia lunata is an important maize foliar fungal pathogen that distributes widely in maize growing area in China, and several key pathogenic factors have been isolated. An yeast two-hybrid (Y2H) library is a very useful platform to further unravel novel pathogenic factors in C. lunata. To construct a high-quality full length-expression cDNA library from the C. lunata for application to pathogenesis-related protein-protein interaction screening, total RNA was extracted. The SMART (Switching Mechanism At 5' end of the RNA Transcript) technique was used for cDNA synthesis. Double-stranded cDNA was ligated into the pGADT7-Rec vector with Herring Testes Carrier DNA using homologous recombination method. The ligation mixture was transformed into competent yeast AH109 cells to construct the primary cDNA library. Eventually, a high qualitative library was successfully established according to an evaluation on quality. The transformation efficiency was about 6.39 ×10(5) transformants/3 μg pGADT7-Rec. The titer of the primary cDNA library was 2.5×10(8) cfu/mL. The numbers for the cDNA library was 2.46×10(5). Randomly picked clones show that the recombination rate was 88.24%. Gel electrophoresis results indicated that the fragments ranged from 0.4 kb to 3.0 kb. Melanin synthesis protein Brn1 (1,3,8-hydroxynaphthalene reductase) was used as a "bait" to test the sufficiency of the Y2H library. As a result, a cDNA clone encoding VelB protein that was known to be involved in the regulation of diverse cellular processes, including control of secondary metabolism containing melanin and toxin production in many filamentous fungi was identified. Further study on the exact role of the VelB gene is underway.

Hop stunt viroid: molecular cloning and nucleotide sequence of the complete cDNA copy.

PubMed Central

Ohno, T; Takamatsu, N; Meshi, T; Okada, Y

1983-01-01

The complete cDNA of hop stunt viroid (HSV) has been cloned by the method of Okayama and Berg (Mol.Cell.Biol.2,161-170. (1982] and the complete nucleotide sequence has been established. The covalently closed circular single-stranded HSV RNA consists of 297 nucleotides. The secondary structure predicted for HSV contains 67% of its residues base-paired. The native HSV can possess an extended rod-like structure characteristic of viroids previously established. The central region of the native HSV has a similar structure to the conserved region found in all viroids sequenced so far except for avocado sunblotch viroid. The sequence homologous to the 5'-end of U1a RNA is also found in the sequence of HSV but not in the central conserved region. Images PMID:6312412

Rapid amplification of 5' complementary DNA ends (5' RACE).

PubMed

2005-08-01

This method is used to extend partial cDNA clones by amplifying the 5' sequences of the corresponding mRNAs 1-3. The technique requires knowledge of only a small region of sequence within the partial cDNA clone. During PCR, the thermostable DNA polymerase is directed to the appropriate target RNA by a single primer derived from the region of known sequence; the second primer required for PCR is complementary to a general feature of the target-in the case of 5' RACE, to a homopolymeric tail added (via terminal transferase) to the 3' termini of cDNAs transcribed from a preparation of mRNA. This synthetic tail provides a primer-binding site upstream of the unknown 5' sequence of the target mRNA. The products of the amplification reaction are cloned into a plasmid vector for sequencing and subsequent manipulation.

Construction and Cloning of Reporter-Tagged Replicon cDNA for an In Vitro Replication Study of Murine Norovirus-1 (MNV-1)

PubMed Central

Ahmad, Muhammad Khairi; Tabana, Yasser M; Ahmed, Mowaffaq Adam; Sandai, Doblin Anak; Mohamed, Rafeezul; Ismail, Ida Shazrina; Zulkiflie, Nurulisa; Yunus, Muhammad Amir

2017-01-01

Background A norovirus maintains its viability, infectivity and virulence by its ability to replicate. However, the biological mechanisms of the process remain to be explored. In this work, the NanoLuc™ Luciferase gene was used to develop a reporter-tagged replicon system to study norovirus replication. Methods The NanoLuc™ Luciferase reporter protein was engineered to be expressed as a fusion protein for MNV-1 minor capsid protein, VP2. The foot-and-mouth disease virus 2A (FMDV2A) sequence was inserted between the 3′end of the reporter gene and the VP2 start sequence to allow co-translational ‘cleavage’ of fusion proteins during intracellular transcript expression. Amplification of the fusion gene was performed using a series of standard and overlapping polymerase chain reactions. The resulting amplicon was then cloned into three readily available backbones of MNV-1 cDNA clones. Results Restriction enzyme analysis indicated that the NanoLucTM Luciferase gene was successfully inserted into the parental MNV-1 cDNA clone. The insertion was further confirmed by using DNA sequencing. Conclusion NanoLuc™ Luciferase-tagged MNV-1 cDNA clones were successfully engineered. Such clones can be exploited to develop robust experimental assays for in vitro assessments of viral RNA replication. PMID:29379384

The Self Primer of the Long Terminal Repeat Retrotransposon Tf1 Is Not Removed during Reverse Transcription

PubMed Central

Atwood-Moore, Angela; Yan, Kenneth; Judson, Robert L.; Levin, Henry L.

2006-01-01

The long terminal repeat retrotransposon Tf1 of Schizosaccharomyces pombe uses a unique mechanism of self priming to initiate reverse transcription. Instead of using a tRNA, Tf1 primes minus-strand synthesis with an 11-nucleotide RNA removed from the 5′ end of its own transcript. We tested whether the self primer of Tf1 was similar to tRNA primers in being removed from the cDNA by RNase H. Our analysis of Tf1 cDNA extracted from virus-like particles revealed the surprising observation that the dominant species of cDNA retained the self primer. This suggests that integration of the cDNA relies on mechanisms other than reverse transcription to remove the primer. PMID:16873283

Method for construction of normalized cDNA libraries

DOEpatents

Soares, Marcelo B.; Efstratiadis, Argiris

1998-01-01

This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to appropriate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. This invention also provides normalized cDNA libraries generated by the above-described method and uses of the generated libraries.

Method for construction of normalized cDNA libraries

DOEpatents

Soares, M.B.; Efstratiadis, A.

1998-11-03

This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3` noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to appropriate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. This invention also provides normalized cDNA libraries generated by the above-described method and uses of the generated libraries. 19 figs.

Insights from computational analysis of full-length β-ketoacyl-[ACP] synthase-II cDNA isolated from American and African oil palms

PubMed Central

Bhore, Subhash J.; Cha, Thye S.; Amelia, Kassim; Shah, Farida H.

2014-01-01

Background: Palm oil derived from fruits (mesocarp) of African oil palm (Elaeis guineensis Jacq. Tenera) and American oil palm (E. oleifera) is important for food industry. Due to high yield, Elaeis guineensis (Tenera) is cultivated on commercial scale, though its oil contains high (~54%) level of saturated fatty acids. The rate-limiting activity of beta-ketoacyl-[ACP] synthase-II (KAS-II) is considered mainly responsible for the high (44%) level of palmitic acid (C16:0) in the oil obtained from E. guineensis. Objective: The objective of this study was to annotate KAS-II cDNA isolated from American and African oil palms. Materials and Methods: The full-length E. oleifera KAS-II (EoKAS-II) cDNA clone was isolated using random method of gene isolation. Whereas, the E. guineensis KAS-II (EgTKAS-II) cDNA was isolated using reverse transcriptase polymerase chain reaction (RT-PCR) technique; and missing ends were obtained by employing 5’and 3’ RACE technique. Results: The results show that EoKAS-II and EgTKAS-II open reading frames (ORFs) are of 1689 and 1721 bp in length, respectively. Further analysis of the both EoKAS-II and EgTKAS-II predicted protein illustrates that they contains conserved domains for ‘KAS-I and II’, ‘elongating’ condensing enzymes, ‘condensing enzymes super-family’, and ‘3-oxoacyl-[ACP] synthase II’. The predicted protein sequences shows 95% similarity with each other. Consecutively, the three active sites (Cys, His, and His) were identified in both proteins. However, difference in positions of two active Histidine (His) residues was noticed. Conclusion: These insights may serve as the foundation in understanding the variable activity of KAS-II in American and African oil palms; and cDNA clones could be useful in the genetic engineering of oil palms. PMID:24678202

A large scale analysis of cDNA in Arabidopsis thaliana: generation of 12,028 non-redundant expressed sequence tags from normalized and size-selected cDNA libraries.

PubMed

Asamizu, E; Nakamura, Y; Sato, S; Tabata, S

2000-06-30

For comprehensive analysis of genes expressed in the model dicotyledonous plant, Arabidopsis thaliana, expressed sequence tags (ESTs) were accumulated. Normalized and size-selected cDNA libraries were constructed from aboveground organs, flower buds, roots, green siliques and liquid-cultured seedlings, respectively, and a total of 14,026 5'-end ESTs and 39,207 3'-end ESTs were obtained. The 3'-end ESTs could be clustered into 12,028 non-redundant groups. Similarity search of the non-redundant ESTs against the public non-redundant protein database indicated that 4816 groups show similarity to genes of known function, 1864 to hypothetical genes, and the remaining 5348 are novel sequences. Gene coverage by the non-redundant ESTs was analyzed using the annotated genomic sequences of approximately 10 Mb on chromosomes 3 and 5. A total of 923 regions were hit by at least one EST, among which only 499 regions were hit by the ESTs deposited in the public database. The result indicates that the EST source generated in this project complements the EST data in the public database and facilitates new gene discovery.

Assignment of chromosomal locus and evidence for alternatively spliced mRNAs of a human sperm membrane protein (hSMP-1).

PubMed

Wang, H; Miao, S; Chen, D; Wang, L; Koide, S S

1999-10-06

The gene (HSD-1) coding a human sperm membrane protein (hSMP-1) was isolated from a human testis cDNA expression library using antibodies found in the serum of an infertile woman. HSD-1 was localized to a single locus on chromosome 9 and assigned to band 9p12-p13 by fluorescent in situ hybridization (FISH) mapping and DAPI (4,6-diamidino-2-phenylindole) banding, using rat/human somatic cell hybrids and metaphase chromosomes of human lymphocytes. In rescreening a testis lambdagt10 cDNA expression library, the full-length cDNA (HSD-1) and several truncated cDNAs with heterologous regions were isolated from positive clones. The heterology consisted of deletion, insertion and alteration of the 5'-end. These heterologous truncated fragments may be produced by alternative splicing of mRNAs. Two recombinant prokaryotic expression vectors were constructed with one of the heterologous fragment (clone #26) with and without the alternative 5'-end. Escherichia coli transfected with the construct containing the alternative 5'-end failed to produce the recombinant product, whereas those transfected with the vector lacking the 5'-end produced hSMP-1. DNASIS analysis of the structure of #26 mRNA suggests that the 5'-end has a stable secondary configuration that may maintain the mRNA in an inactivated state, whereby hindering its translation and preventing the expression of the gene.

An alternative method for cDNA cloning from surrogate eukaryotic cells transfected with the corresponding genomic DNA.

PubMed

Hu, Lin-Yong; Cui, Chen-Chen; Song, Yu-Jie; Wang, Xiang-Guo; Jin, Ya-Ping; Wang, Ai-Hua; Zhang, Yong

2012-07-01

cDNA is widely used in gene function elucidation and/or transgenics research but often suitable tissues or cells from which to isolate mRNA for reverse transcription are unavailable. Here, an alternative method for cDNA cloning is described and tested by cloning the cDNA of human LALBA (human alpha-lactalbumin) from genomic DNA. First, genomic DNA containing all of the coding exons was cloned from human peripheral blood and inserted into a eukaryotic expression vector. Next, by delivering the plasmids into either 293T or fibroblast cells, surrogate cells were constructed. Finally, the total RNA was extracted from the surrogate cells and cDNA was obtained by RT-PCR. The human LALBA cDNA that was obtained was compared with the corresponding mRNA published in GenBank. The comparison showed that the two sequences were identical. The novel method for cDNA cloning from surrogate eukaryotic cells described here uses well-established techniques that are feasible and simple to use. We anticipate that this alternative method will have widespread applications.

Purification of Single-Stranded cDNA Based on RNA Degradation Treatment and Adsorption Chromatography.

PubMed

Trujillo-Esquivel, Elías; Franco, Bernardo; Flores-Martínez, Alberto; Ponce-Noyola, Patricia; Mora-Montes, Héctor M

2016-08-02

Analysis of gene expression is a common research tool to study networks controlling gene expression, the role of genes with unknown function, and environmentally induced responses of organisms. Most of the analytical tools used to analyze gene expression rely on accurate cDNA synthesis and quantification to obtain reproducible and quantifiable results. Thus far, most commercial kits for isolation and purification of cDNA target double-stranded molecules, which do not accurately represent the abundance of transcripts. In the present report, we provide a simple and fast method to purify single-stranded cDNA, exhibiting high purity and yield. This method is based on the treatment with RNase H and RNase A after cDNA synthesis, followed by separation in silica spin-columns and ethanol precipitation. In addition, our method avoids the use of DNase I to eliminate genomic DNA from RNA preparations, which improves cDNA yield. As a case report, our method proved to be useful in the purification of single-stranded cDNA from the pathogenic fungus Sporothrix schenckii.

Rapid and efficient cDNA library screening by self-ligation of inverse PCR products (SLIP).

PubMed

Hoskins, Roger A; Stapleton, Mark; George, Reed A; Yu, Charles; Wan, Kenneth H; Carlson, Joseph W; Celniker, Susan E

2005-12-02

cDNA cloning is a central technology in molecular biology. cDNA sequences are used to determine mRNA transcript structures, including splice junctions, open reading frames (ORFs) and 5'- and 3'-untranslated regions (UTRs). cDNA clones are valuable reagents for functional studies of genes and proteins. Expressed Sequence Tag (EST) sequencing is the method of choice for recovering cDNAs representing many of the transcripts encoded in a eukaryotic genome. However, EST sequencing samples a cDNA library at random, and it recovers transcripts with low expression levels inefficiently. We describe a PCR-based method for directed screening of plasmid cDNA libraries. We demonstrate its utility in a screen of libraries used in our Drosophila EST projects for 153 transcription factor genes that were not represented by full-length cDNA clones in our Drosophila Gene Collection. We recovered high-quality, full-length cDNAs for 72 genes and variously compromised clones for an additional 32 genes. The method can be used at any scale, from the isolation of cDNA clones for a particular gene of interest, to the improvement of large gene collections in model organisms and the human. Finally, we discuss the relative merits of directed cDNA library screening and RT-PCR approaches.

Comparative gene expression in sexual and apomictic ovaries of Pennisetum ciliare (L.) Link.

PubMed

Vielle-Calzada, J P; Nuccio, M L; Budiman, M A; Thomas, T L; Burson, B L; Hussey, M A; Wing, R A

1996-12-01

Limited emphasis has been given to the molecular study of apomixis, an asexual method of reproduction where seeds are produced without fertilization. Most buffelgrass (Pennisetum ciliare (L.) Link syn = Cenchrus ciliaris L.) genotypes reproduce by obligate apomixis (apospory); however, rare sexual plants have been recovered. A modified differential display procedure was used to compare gene expression in unpollinated ovaries containing ovules with either sexual or apomictic female gametophytes. The modification incorporated end-labeled poly(A)+ anchored primers as the only isotopic source, and was a reliable and consistent approach for detecting differentially displayed transcripts. Using 20 different decamers and two anchor primers, 2268 cDNA fragments between 200 and 600 bp were displayed. From these, eight reproducible differentially displayed cDNAs were identified and cloned. Based on northern analysis, one cDNA was detected in only the sexual ovaries, two cDNAs in only apomictic ovaries and one cDNA was present in both types of ovaries. Three fragments could not be detected and one fragment was detected in ovaries, stems, and leaves. Comparison of gene expression during sexual and apomictic development in buffelgrass represents a new model system and a strategy for investigating female reproductive development in the angiosperms.

Method for construction of normalized cDNA libraries

DOEpatents

Soares, M.B.; Efstratiadis, A.

1996-01-09

This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form. The method comprises: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3` noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. 4 figs.

Multimodal RNA-seq using single-strand, double-strand, and CircLigase-based capture yields a refined and extended description of the C. elegans transcriptome.

PubMed

Lamm, Ayelet T; Stadler, Michael R; Zhang, Huibin; Gent, Jonathan I; Fire, Andrew Z

2011-02-01

We have used a combination of three high-throughput RNA capture and sequencing methods to refine and augment the transcriptome map of a well-studied genetic model, Caenorhabditis elegans. The three methods include a standard (non-directional) library preparation protocol relying on cDNA priming and foldback that has been used in several previous studies for transcriptome characterization in this species, and two directional protocols, one involving direct capture of single-stranded RNA fragments and one involving circular-template PCR (CircLigase). We find that each RNA-seq approach shows specific limitations and biases, with the application of multiple methods providing a more complete map than was obtained from any single method. Of particular note in the analysis were substantial advantages of CircLigase-based and ssRNA-based capture for defining sequences and structures of the precise 5' ends (which were lost using the double-strand cDNA capture method). Of the three methods, ssRNA capture was most effective in defining sequences to the poly(A) junction. Using data sets from a spectrum of C. elegans strains and stages and the UCSC Genome Browser, we provide a series of tools, which facilitate rapid visualization and assignment of gene structures.

Isolation and Expression Profile of the Ca2+-Activated Chloride Channel-like Membrane Protein 6 Gene in Xenopus laevis

PubMed Central

Lee, Ra Mi; Ryu, Rae Hyung; Jeong, Seong Won; Oh, Soo Jin; Huang, Hue; Han, Jin Soo; Lee, Chi Ho; Lee, C. Justin; Jan, Lily Yeh

2011-01-01

To clone the first anion channel from Xenopus laevis (X. laevis), we isolated a calcium-activated chloride channel (CLCA)-like membrane protein 6 gene (CMP6) in X. laevis. As a first step in gene isolation, an expressed sequence tags database was screened to find the partial cDNA fragment. A putative partial cDNA sequence was obtained by comparison with rat CLCAs identified in our laboratory. First stranded cDNA was synthesized by reverse transcription polymerase-chain reaction (RT-PCR) using a specific primer designed for the target cDNA. Repeating the 5' and 3' rapid amplification of cDNA ends, full-length cDNA was constructed from the cDNA pool. The full-length CMP6 cDNA completed via 5'- and 3'-RACE was 2,940 bp long and had an open reading frame (ORF) of 940 amino acids. The predicted 940 polypeptides have four major transmembrane domains and showed about 50% identity with that of rat brain CLCAs in our previously published data. Semi-quantification analysis revealed that CMP6 was most abundantly expressed in small intestine, colon and liver. However, all tissues except small intestine, colon and liver had undetectable levels. This result became more credible after we did real-time PCR quantification for the target gene. In view of all CLCA studies focused on human or murine channels, this finding suggests a hypothetical protein as an ion channel, an X. laevis CLCA. PMID:21826170

Evaluation of normalization methods for cDNA microarray data by k-NN classification

PubMed Central

Wu, Wei; Xing, Eric P; Myers, Connie; Mian, I Saira; Bissell, Mina J

2005-01-01

Background Non-biological factors give rise to unwanted variations in cDNA microarray data. There are many normalization methods designed to remove such variations. However, to date there have been few published systematic evaluations of these techniques for removing variations arising from dye biases in the context of downstream, higher-order analytical tasks such as classification. Results Ten location normalization methods that adjust spatial- and/or intensity-dependent dye biases, and three scale methods that adjust scale differences were applied, individually and in combination, to five distinct, published, cancer biology-related cDNA microarray data sets. Leave-one-out cross-validation (LOOCV) classification error was employed as the quantitative end-point for assessing the effectiveness of a normalization method. In particular, a known classifier, k-nearest neighbor (k-NN), was estimated from data normalized using a given technique, and the LOOCV error rate of the ensuing model was computed. We found that k-NN classifiers are sensitive to dye biases in the data. Using NONRM and GMEDIAN as baseline methods, our results show that single-bias-removal techniques which remove either spatial-dependent dye bias (referred later as spatial effect) or intensity-dependent dye bias (referred later as intensity effect) moderately reduce LOOCV classification errors; whereas double-bias-removal techniques which remove both spatial- and intensity effect reduce LOOCV classification errors even further. Of the 41 different strategies examined, three two-step processes, IGLOESS-SLFILTERW7, ISTSPLINE-SLLOESS and IGLOESS-SLLOESS, all of which removed intensity effect globally and spatial effect locally, appear to reduce LOOCV classification errors most consistently and effectively across all data sets. We also found that the investigated scale normalization methods do not reduce LOOCV classification error. Conclusion Using LOOCV error of k-NNs as the evaluation criterion, three double-bias-removal normalization strategies, IGLOESS-SLFILTERW7, ISTSPLINE-SLLOESS and IGLOESS-SLLOESS, outperform other strategies for removing spatial effect, intensity effect and scale differences from cDNA microarray data. The apparent sensitivity of k-NN LOOCV classification error to dye biases suggests that this criterion provides an informative measure for evaluating normalization methods. All the computational tools used in this study were implemented using the R language for statistical computing and graphics. PMID:16045803

Evaluation of normalization methods for cDNA microarray data by k-NN classification.

PubMed

Wu, Wei; Xing, Eric P; Myers, Connie; Mian, I Saira; Bissell, Mina J

2005-07-26

Non-biological factors give rise to unwanted variations in cDNA microarray data. There are many normalization methods designed to remove such variations. However, to date there have been few published systematic evaluations of these techniques for removing variations arising from dye biases in the context of downstream, higher-order analytical tasks such as classification. Ten location normalization methods that adjust spatial- and/or intensity-dependent dye biases, and three scale methods that adjust scale differences were applied, individually and in combination, to five distinct, published, cancer biology-related cDNA microarray data sets. Leave-one-out cross-validation (LOOCV) classification error was employed as the quantitative end-point for assessing the effectiveness of a normalization method. In particular, a known classifier, k-nearest neighbor (k-NN), was estimated from data normalized using a given technique, and the LOOCV error rate of the ensuing model was computed. We found that k-NN classifiers are sensitive to dye biases in the data. Using NONRM and GMEDIAN as baseline methods, our results show that single-bias-removal techniques which remove either spatial-dependent dye bias (referred later as spatial effect) or intensity-dependent dye bias (referred later as intensity effect) moderately reduce LOOCV classification errors; whereas double-bias-removal techniques which remove both spatial- and intensity effect reduce LOOCV classification errors even further. Of the 41 different strategies examined, three two-step processes, IGLOESS-SLFILTERW7, ISTSPLINE-SLLOESS and IGLOESS-SLLOESS, all of which removed intensity effect globally and spatial effect locally, appear to reduce LOOCV classification errors most consistently and effectively across all data sets. We also found that the investigated scale normalization methods do not reduce LOOCV classification error. Using LOOCV error of k-NNs as the evaluation criterion, three double-bias-removal normalization strategies, IGLOESS-SLFILTERW7, ISTSPLINE-SLLOESS and IGLOESS-SLLOESS, outperform other strategies for removing spatial effect, intensity effect and scale differences from cDNA microarray data. The apparent sensitivity of k-NN LOOCV classification error to dye biases suggests that this criterion provides an informative measure for evaluating normalization methods. All the computational tools used in this study were implemented using the R language for statistical computing and graphics.

Differentially expressed genes of Coptotermes formosanus (Isoptera: Rhinotermitidae) challenged by chemical insecticides.

PubMed

Zhang, Yi; Zhao, Yuanyuan; Qiu, Xuehong; Han, Richou

2013-08-01

Coptotermes formosanus Shiraki (Isoptera: Rhinotermitidae) termites are harmful social insects to wood constructions. The current control methods heavily depend on the chemical insecticides with increasing resistance. Analysis of the differentially expressed genes mediated by chemical insecticides will contribute to the understanding of the termite resistance to chemicals and to the establishment of alternative control measures. In the present article, a full-length cDNA library was constructed from the termites induced by a mixture of commonly used insecticides (0.01% sulfluramid and 0.01% triflumuron) for 24 h, by using the RNA ligase-mediated Rapid Amplification cDNA End method. Fifty-eight differentially expressed clones were obtained by polymerase chain reaction and confirmed by dot-blot hybridization. Forty-six known sequences were obtained, which clustered into 33 unique sequences grouped in 6 contigs and 27 singlets. Sixty-seven percent (22) of the sequences had counterpart genes from other organisms, whereas 33% (11) were undescribed. A Gene Ontology analysis classified 33 unique sequences into different functional categories. In general, most of the differential expression genes were involved in binding and catalytic activity.

Method for construction of normalized cDNA libraries

DOEpatents

Soares, Marcelo B.; Efstratiadis, Argiris

1996-01-01

This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.

Isolation of a cDNA Encoding a Granule-Bound 152-Kilodalton Starch-Branching Enzyme in Wheat1

PubMed Central

Båga, Monica; Nair, Ramesh B.; Repellin, Anne; Scoles, Graham J.; Chibbar, Ravindra N.

2000-01-01

Screening of a wheat (Triticum aestivum) cDNA library for starch-branching enzyme I (SBEI) genes combined with 5′-rapid amplification of cDNA ends resulted in isolation of a 4,563-bp composite cDNA, Sbe1c. Based on sequence alignment to characterized SBEI cDNA clones isolated from plants, the SBEIc predicted from the cDNA sequence was produced with a transit peptide directing the polypeptide into plastids. Furthermore, the predicted mature form of SBEIc was much larger (152 kD) than previously characterized plant SBEI (80–100 kD) and contained a partial duplication of SBEI sequences. The first SBEI domain showed high amino acid similarity to a 74-kD wheat SBEI-like protein that is inactive as a branching enzyme when expressed in Escherichia coli. The second SBEI domain on SBEIc was identical in sequence to a functional 87-kD SBEI produced in the wheat endosperm. Immunoblot analysis of proteins produced in developing wheat kernels demonstrated that the 152-kD SBEIc was, in contrast to the 87- to 88-kD SBEI, preferentially associated with the starch granules. Proteins similar in size and recognized by wheat SBEI antibodies were also present in Triticum monococcum, Triticum tauschii, and Triticum turgidum subsp. durum. PMID:10982440

Molecular cloning and characterization of novel phytocystatin gene from turmeric, Curcuma longa.

PubMed

Chan, Seow-Neng; Abu Bakar, Norliza; Mahmood, Maziah; Ho, Chai-Ling; Shaharuddin, Noor Azmi

2014-01-01

Phytocystatin, a type of protease inhibitor (PI), plays major roles in plant defense mechanisms and has been reported to show antipathogenic properties and plant stress tolerance. Recombinant plant PIs are gaining popularity as potential candidates in engineering of crop protection and in synthesizing medicine. It is therefore crucial to identify PI from novel sources like Curcuma longa as it is more effective in combating against pathogens due to its novelty. In this study, a novel cDNA fragment encoding phytocystatin was isolated using degenerate PCR primers, designed from consensus regions of phytocystatin from other plant species. A full-length cDNA of the phytocystatin gene, designated CypCl, was acquired using 5'/3' rapid amplification of cDNA ends method and it has been deposited in NCBI database (accession number KF545954.1). It has a 687 bp long open reading frame (ORF) which encodes 228 amino acids. BLAST result indicated that CypCl is similar to cystatin protease inhibitor from Cucumis sativus with 74% max identity. Sequence analysis showed that CypCl contains most of the motifs found in a cystatin, including a G residue, LARFAV-, QxVxG sequence, PW dipeptide, and SNSL sequence at C-terminal extension. Phylogenetic studies also showed that CypCl is related to phytocystatin from Elaeis guineensis.

Molecular Cloning and Characterization of Novel Phytocystatin Gene from Turmeric, Curcuma longa

PubMed Central

Chan, Seow-Neng; Abu Bakar, Norliza; Mahmood, Maziah; Ho, Chai-Ling

2014-01-01

Phytocystatin, a type of protease inhibitor (PI), plays major roles in plant defense mechanisms and has been reported to show antipathogenic properties and plant stress tolerance. Recombinant plant PIs are gaining popularity as potential candidates in engineering of crop protection and in synthesizing medicine. It is therefore crucial to identify PI from novel sources like Curcuma longa as it is more effective in combating against pathogens due to its novelty. In this study, a novel cDNA fragment encoding phytocystatin was isolated using degenerate PCR primers, designed from consensus regions of phytocystatin from other plant species. A full-length cDNA of the phytocystatin gene, designated CypCl, was acquired using 5′/3′ rapid amplification of cDNA ends method and it has been deposited in NCBI database (accession number KF545954.1). It has a 687 bp long open reading frame (ORF) which encodes 228 amino acids. BLAST result indicated that CypCl is similar to cystatin protease inhibitor from Cucumis sativus with 74% max identity. Sequence analysis showed that CypCl contains most of the motifs found in a cystatin, including a G residue, LARFAV-, QxVxG sequence, PW dipeptide, and SNSL sequence at C-terminal extension. Phylogenetic studies also showed that CypCl is related to phytocystatin from Elaeis guineensis. PMID:25853138

Sequences of heavy and light chain variable regions from four bovine immunoglobulins.

PubMed

Armour, K L; Tempest, P R; Fawcett, P H; Fernie, M L; King, S I; White, P; Taylor, G; Harris, W J

1994-12-01

Oligodeoxyribonucleotide primers based on the 5' ends of bovine IgG1/2 and lambda constant (C) region genes, together with primers encoding conserved amino acids at the N-terminus of mature variable (V) regions from other species, have been used in cDNA and polymerase chain reactions (PCRs) to amplify heavy and light chain V region cDNA from bovine heterohybridomas. The amino acid sequences of VH and V lambda from four bovine immunoglobulins of different specificities are presented.

Attomole-level Genomics with Single-molecule Direct DNA, cDNA and RNA Sequencing Technologies.

PubMed

Ozsolak, Fatih

2016-01-01

With the introduction of next-generation sequencing (NGS) technologies in 2005, the domination of microarrays in genomics quickly came to an end due to NGS's superior technical performance and cost advantages. By enabling genetic analysis capabilities that were not possible previously, NGS technologies have started to play an integral role in all areas of biomedical research. This chapter outlines the low-quantity DNA and cDNA sequencing capabilities and applications developed with the Helicos single molecule DNA sequencing technology.

In vivo analysis of polyadenylation in prokaryotes.

PubMed

Mohanty, Bijoy K; Kushner, Sidney R

2014-01-01

Polyadenylation at the 3' ends of mRNAs, tRNAs, rRNAs, and sRNAs plays important roles in RNA metabolism in both prokaryotes and eukaryotes. However, the nature of poly(A) tails in prokaryotes is distinct compared to their eukaryotic counterparts. Specifically, depending on the organism, eukaryotic poly(A) tails average between 50 and >200 nt and can easily be isolated by several techniques involving oligo(dT)-dependent cDNA amplification. In contrast, the bulk of the poly(A) tails present on prokaryotic transcripts is relatively short (<10 nt) and is difficult to characterize using similar techniques. This chapter describes methods that can circumvent these problems. For example, we discuss how to isolate total RNA and characterize its overall polyadenylation status employing a poly(A) sizing assay. Furthermore, we describe a technique involving RNase H treatment of total RNA followed by northern analysis in order to distinguish length of poly(A) tails on various types of transcripts. Finally, we outline a useful procedure to clone the poly(A) tails of specific transcripts using 5'-3' end-ligated RNA, which is independent of oligo(dT)-dependent cDNA amplification. These approaches are particularly helpful in analyzing transcripts with either short or long poly(A) tails both in prokaryotes and eukaryotes.

A rapid and cost-effective method for sequencing pooled cDNA clones by using a combination of transposon insertion and Gateway technology.

PubMed

Morozumi, Takeya; Toki, Daisuke; Eguchi-Ogawa, Tomoko; Uenishi, Hirohide

2011-09-01

Large-scale cDNA-sequencing projects require an efficient strategy for mass sequencing. Here we describe a method for sequencing pooled cDNA clones using a combination of transposon insertion and Gateway technology. Our method reduces the number of shotgun clones that are unsuitable for reconstruction of cDNA sequences, and has the advantage of reducing the total costs of the sequencing project.

Identification of an NADH-Cytochrome b5 Reductase Gene from an Arachidonic Acid-Producing Fungus, Mortierella alpina 1S-4, by Sequencing of the Encoding cDNA and Heterologous Expression in a Fungus, Aspergillus oryzae

PubMed Central

Sakuradani, Eiji; Kobayashi, Michihiko; Shimizu, Sakayu

1999-01-01

Based on the sequence information for bovine and yeast NADH-cytochrome b5 reductases (CbRs), a DNA fragment was cloned from Mortierella alpina 1S-4 after PCR amplification. This fragment was used as a probe to isolate a cDNA clone with an open reading frame encoding 298 amino acid residues which show marked sequence similarity to CbRs from other sources, such as yeast (Saccharomyces cerevisiae), bovine, human, and rat CbRs. These results suggested that this cDNA is a CbR gene. The results of a structural comparison of the flavin-binding β-barrel domains of CbRs from various species and that of the M. alpina enzyme suggested that the overall barrel-folding patterns are similar to each other and that a specific arrangement of three highly conserved amino acid residues (i.e., arginine, tyrosine, and serine) plays a role in binding with the flavin (another prosthetic group) through hydrogen bonds. The corresponding genomic gene, which was also cloned from M. alpina 1S-4 by means of a hybridization method with the above probe, had four introns of different sizes. These introns had GT at the 5′ end and AG at the 3′ end, according to a general GT-AG rule. The expression of the full-length cDNA in a filamentous fungus, Aspergillus oryzae, resulted in an increase (4.7 times) in ferricyanide reduction activity involving the use of NADH as an electron donor in the microsomes. The M. alpina CbR was purified by solubilization of microsomes with cholic acid sodium salt, followed by DEAE-Sephacel, Mono-Q HR 5/5, and AMP-Sepharose 4B affinity column chromatographies; there was a 645-fold increase in the NADH-ferricyanide reductase specific activity. The purified CbR preferred NADH over NADPH as an electron donor. This is the first report of an analysis of this enzyme in filamentous fungi. PMID:10473389

Evaluation of vector-primed cDNA library production from microgram quantities of total RNA.

PubMed

Kuo, Jonathan; Inman, Jason; Brownstein, Michael; Usdin, Ted B

2004-12-15

cDNA sequences are important for defining the coding region of genes, and full-length cDNA clones have proven to be useful for investigation of the function of gene products. We produced cDNA libraries containing 3.5-5 x 10(5) primary transformants, starting with 5 mug of total RNA prepared from mouse pituitary, adrenal, thymus, and pineal tissue, using a vector-primed cDNA synthesis method. Of approximately 1000 clones sequenced, approximately 20% contained the full open reading frames (ORFs) of known transcripts, based on the presence of the initiating methionine residue codon. The libraries were complex, with 94, 91, 83 and 55% of the clones from the thymus, adrenal, pineal and pituitary libraries, respectively, represented only once. Twenty-five full-length clones, not yet represented in the Mammalian Gene Collection, were identified. Thus, we have produced useful cDNA libraries for the isolation of full-length cDNA clones that are not yet available in the public domain, and demonstrated the utility of a simple method for making high-quality libraries from small amounts of starting material.

[Cloning of cDNA for RNA polymerase subunit from the fission yeast Schizosaccharomyces pombe by heterospecific complementation in Saccharomyces cerevisiae].

PubMed

Shpakovskiĭ, G V; Lebedenko, E N; Thuriaux, P

1997-02-01

The rpb10 cDNA of the fission yeast Schizosaccharomyces pombe, encoding one of the five small subunits common to all three nuclear DNA-dependent RNA polymerases, was isolated from an expression cDNA library by two independent approaches: PCR-based screening and direct suppression by means of heterospecific complementation of a temperature-sensitive mutant defective in the corresponding gene of Saccharomyces cerevisiae. The cloned Sz. pombe cDNA encodes a protein Rpb10 of 71 amino acids with an M of 8,275 Da, sharing 51 amino acids (71% identity) with the subunit ABC10 beta of RNA polymerases I-III from S. cerevisiae. All eukaryotic members of this protein family have the same general organization featuring two highly conserved motifs (RCFT/SCGK and RYCCRRM) around an atypical zinc finger and an additional invariant HVDLIEK motif toward the C-terminal end. The last motif is only characteristics for homologs from eukaryotes. In keeping with this remarkable structural conservation, the Sz. pombe cDNA also fully complemented a S. cerevisiae deletion mutant lacking subunit ABC10 beta (null allele rpb10-delta 1::HIS3).

Molecular cloning and immunoglobulin E reactivity of a natural rubber latex lecithinase homologue, the major allergenic component of Hev b 4.

PubMed

Sunderasan, E; Bahari, A; Arif, S A M; Zainal, Z; Hamilton, R G; Yeang, H Y

2005-11-01

Hev b 4 is an allergenic natural rubber latex (NRL) protein complex that is reactive in skin prick tests and in vitro immunoassays. On SDS-polyacrylamide gel electrophoresis (SDS-PAGE), Hev b 4 is discerned predominantly at 53-55 kDa together with a 57 kDa minor component previously identified as a cyanogenic glucosidase. Of the 13 NRL allergens recognized by the International Union of Immunological Societies, the 53-55 kDa Hev b 4 major protein is the only candidate that lacks complete cDNA and protein sequence information. We sought to clone the transcript encoding the Hev b 4 major protein, and characterize the native protein and its recombinant form in relation to IgE binding. The 5'/3' rapid amplification of cDNA ends method was employed to obtain the complete cDNA of the Hev b 4 major protein. A recombinant form of the protein was over-expressed in Escherichia coli. The native Hev b 4 major protein was deglycosylated by trifluoromethane sulphonic acid. Western immunoblots of the native, deglycosylated and recombinant proteins were performed using both polyclonal antibodies and sera from latex-allergic patients. The cDNA encoding the Hev b 4 major protein was cloned. Its open reading frame matched lecithinases in the conserved domain database and contained 10 predicted glycosylation sites. Detection of glycans on the Hev b 4 lecithinase homologue confirmed it to be a glycoprotein. The deglycosylated lecithinase homologue was discerned at 40 kDa on SDS-PAGE, this being comparable to the 38.53 kDa mass predicted by its cDNA. Deglycosylation of the lecithinase homologue resulted in the loss of IgE recognition, although reactivity to polyclonal rabbit anti-Hev b 4 was retained. IgE from latex-allergic patients also failed to recognize the non-glycosylated E. coli recombinant lecithinase homologue. The IgE epitopes of the Hev b 4 lecithinase homologue reside mainly in its carbohydrate moiety, which also account for the discrepancy between the observed molecular weight of the protein and the value calculated from its cDNA.

cDNA cloning of the murine PEX gene implicated in X-linked hypophosphatemia and evidence for expression in bone

DOE Office of Scientific and Technical Information (OSTI.GOV)

Du, L.; Desbarats, M.; Viel, J.

1996-08-15

The recently identified human PEX g ene apparently encodes for a neutral endopeptidase that is mutated in patients with X-linked hypophosphatemia. The 3{prime} and 5{prime} ends of the coding region of PEX have not been cloned, nor has the tissue expression of the gene been identified. Here we report the isolation and characterization of the complete open reading frame of the mouse Pex gene and the demonstration of its expression in bone. Mouse Pex cDNA is predicted to encode a protein of 749 amino acids with 95% identity to the available human PEX sequence and significant homology to members ofmore » the membrane-bound metalloendopeptidase family. Northern blot analysis revealed a 6.6-kb transcript in bone and in cultured osteoblasts from normal mice that was not detectable in samples from the Hyp mouse, the murine homolog of human X-linked hypophosphatemia. Pex transcripts were, however, detectable in Hyp bone by RT-PCR amplification. Of particular interest, a cDNA clone from rat incisor shows 93% sequence identity to the 5{prime} end of Pex cDNA, suggesting that Pex may be expressed in another calcified tissue, the tooth. The association of impaired mineralization of bone and teeth and disturbed renal phosphate reabsorption with altered expression of Pex suggests that the Pex gene product may play a critical role in these processes. 47 refs., 2 figs., 1 tab.« less

RNA circularization reveals terminal sequence heterogeneity in a double-stranded RNA virus.

PubMed

Widmer, G

1993-03-01

Double-stranded RNA viruses (dsRNA), termed LRV1, have been found in several strains of the protozoan parasite Leishmania. With the aim of constructing a full-length cDNA copy of the viral genome, including its terminal sequences, a protocol based on PCR amplification across the 3'-5' junction of circularized RNA was developed. This method proved to be applicable to dsRNA. It provided a relatively simple alternative to one-sided PCR, without loss of specificity inherent in the use of generic primers. LRV1 terminal nucleotide sequences obtained by this method showed a considerable variation in length, particularly at the 5' end of the positive strand, as well as the potential for forming 3' overhangs. The opposite genomic end terminates in 0, 1, or 2 TCA trinucleotide repeats. These results are compared with terminal sequences derived from one-sided PCR experiments.

[Primary culture of cat intestinal epithelial cell and construction of its cDNA library].

PubMed

Ye, L; Gui-Hua, Z; Kun, Y; Hong-Fa, W; Ting, X; Gong-Zhen, L; Wei-Xia, Z; Yong, C

2017-04-12

Objective To establish the primary cat intestinal epithelial cells (IECs) culture methods and construct the cDNA library for the following yeast two-hybrid experiment, so as to screen the virulence interaction factors among the final host. Methods The primary cat IECs were cultured by the tissue cultivation and combined digestion with collagenase XI and dispase I separately. Then the cat IECs cultured was identified with the morphological observation and cyto-keratin detection, by using goat anti-cyto-keratin monoclonal antibodies. The mRNA of cat IECs was isolated and used as the template to synthesize the first strand cDNA by SMART™ technology, and then the double-strand cDNAs were acquired by LD-PCR, which were subsequently cloned into the plasmid PGADT7-Rec to construct yeast two-hybrid cDNA library in the yeast strain Y187 by homologous recombination. Matchmaker™ Insert Check PCR was used to detect the size distribution of cDNA fragments after the capacity calculation of the cDNA library. Results The comparison of the two cultivation methods indicated that the combined digestion of collagenase XI and dispase I was more effective than the tissue cultivation. The cat IECs system of continuous culture was established and the cat IECs with high purity were harvested for constructing the yeast two-hybrid cDNA library. The library contained 1.1×10 6 independent clones. The titer was 2.8×10 9 cfu/ml. The size of inserted fragments was among 0.5-2.0 kb. Conclusion The yeast two-hybrid cDNA library of cat IECs meets the requirements of further screen research, and this study lays the foundation of screening the Toxoplasma gondii virulence interaction factors among the cDNA libraries of its final hosts.

Construction of high-quality Caco-2 three-frame cDNA library and its application to yeast two-hybrid for the human astrovirus protein-protein interaction.

PubMed

Zhao, Wei; Li, Xin; Liu, Wen-Hui; Zhao, Jian; Jin, Yi-Ming; Sui, Ting-Ting

2014-09-01

Human epithelial colorectal adenocarcinoma (Caco-2) cells are widely used as an in vitro model of the human small intestinal mucosa. Caco-2 cells are host cells of the human astrovirus (HAstV) and other enteroviruses. High quality cDNA libraries are pertinent resources and critical tools for protein-protein interaction research, but are currently unavailable for Caco-2 cells. To construct a three-open reading frame, full length-expression cDNA library from the Caco-2 cell line for application to HAstV protein-protein interaction screening, total RNA was extracted from Caco-2 cells. The switching mechanism at the 5' end of the RNA transcript technique was used for cDNA synthesis. Double-stranded cDNA was digested by Sfi I and ligated to reconstruct a pGADT7-Sfi I three-frame vector. The ligation mixture was transformed into Escherichia coli HST08 premium electro cells by electroporation to construct the primary cDNA library. The library capacity was 1.0×10(6)clones. Gel electrophoresis results indicated that the fragments ranged from 0.5kb to 4.2kb. Randomly picked clones show that the recombination rate was 100%. The three-frame primary cDNA library plasmid mixture (5×10(5)cfu) was also transformed into E. coli HST08 premium electro cells, and all clones were harvested to amplify the cDNA library. To detect the sufficiency of the cDNA library, HAstV capsid protein as bait was screened and tested against the Caco-2 cDNA library by a yeast two-hybrid (Y2H) system. A total of 20 proteins were found to interact with the capsid protein. These results showed that a high-quality three-frame cDNA library from Caco-2 cells was successfully constructed. This library was efficient for the application to the Y2H system, and could be used for future research. Copyright © 2014 Elsevier B.V. All rights reserved.

Specific metabolic activity of ripening bacteria quantified by real-time reverse transcription PCR throughout Emmental cheese manufacture.

PubMed

Falentin, Hélène; Postollec, Florence; Parayre, Sandrine; Henaff, Nadine; Le Bivic, Pierre; Richoux, Romain; Thierry, Anne; Sohier, Danièle

2010-11-15

Bacterial communities of fermented foods are usually investigated by culture-dependent methods. Real-time quantitative PCR (qPCR) and reverse transcription (RT)-qPCR offer new possibilities to quantify the populations present and their metabolic activity. The aim of this work was to develop qPCR and RT-qPCR methods to assess the metabolic activity and the stress level of the two species used as ripening cultures in Emmental cheese manufacture, Propionibacterium freudenreichii and Lactobacillus paracasei. Three small scale (1/100) microbiologically controlled Emmental cheeses batches were manufactured and inoculated with Lactobacillus helveticus, Streptococcus thermophilus, P. freudenreichii and L. paracasei. At 12 steps of cheese manufacture and ripening, the populations of P. freudenreichii and L. paracasei were quantified by numerations on agar media and by qPCR. 16S, tuf and groL transcript levels were quantified by RT-qPCR. Sampling was carried out in triplicate. qPCR and RT-qPCR assessments were specific, efficient and linear. The quantification limit was 10(3) copies of cells or cDNA/g of cheese. Cell quantifications obtained by qPCR gave similar results than plate count for P. freudenreichii growth and 0.5 to 1 log lower in the stationary phase. Bacterial counts and qPCR quantifications showed that L. paracasei began to grow during the pressing step while P. freudenreichii began to grow from the beginning of ripening (in the cold room). Tuf cDNA quantification results suggested that metabolic activity of L. paracasei reached a maximum during the first part of the ripening (in cold room) and decreased progressively during ripening (in the warm room). Metabolic activity of P. freudenreichii was maximum at the end of cold ripening room and was stable during the first two weeks in warm room. After lactate exhaustion (after two weeks of warm room), the number of tuf cDNA decreased reflecting reduced metabolic activity. For L. paracasei, groL cDNA were stable during ripening. For P. freudenreichii, groL1 gene was highly-expressed during acidification, while groL2 gene highly expression was only observed at the end of the ripening stage after lactate (carbon substrate of P. freudenreichii) exhaustion. The potential use of 16S and tuf genes for the normalization of cDNA quantification throughout an Emmental cheese manufacture is discussed. For the first time, specific gene expression was performed by RT-qPCR yielding metabolic activity and stress response evaluation for L. paracasei and P. freudenreichii in cheese. Copyright © 2010 Elsevier B.V. All rights reserved.

An efficient and sensitive method for preparing cDNA libraries from scarce biological samples

PubMed Central

Sterling, Catherine H.; Veksler-Lublinsky, Isana; Ambros, Victor

2015-01-01

The preparation and high-throughput sequencing of cDNA libraries from samples of small RNA is a powerful tool to quantify known small RNAs (such as microRNAs) and to discover novel RNA species. Interest in identifying the small RNA repertoire present in tissues and in biofluids has grown substantially with the findings that small RNAs can serve as indicators of biological conditions and disease states. Here we describe a novel and straightforward method to clone cDNA libraries from small quantities of input RNA. This method permits the generation of cDNA libraries from sub-picogram quantities of RNA robustly, efficiently and reproducibly. We demonstrate that the method provides a significant improvement in sensitivity compared to previous cloning methods while maintaining reproducible identification of diverse small RNA species. This method should have widespread applications in a variety of contexts, including biomarker discovery from scarce samples of human tissue or body fluids. PMID:25056322

The delta-subunit of murine guanine nucleotide exchange factor eIF-2B. Characterization of cDNAs predicts isoforms differing at the amino-terminal end.

PubMed

Henderson, R A; Krissansen, G W; Yong, R Y; Leung, E; Watson, J D; Dholakia, J N

1994-12-02

Protein synthesis in mammalian cells is regulated at the level of the guanine nucleotide exchange factor, eIF-2B, which catalyzes the exchange of eukaryotic initiation factor 2-bound GDP for GTP. We have isolated and sequenced cDNA clones encoding the delta-subunit of murine eIF-2B. The cDNA sequence encodes a polypeptide of 544 amino acids with molecular mass of 60 kDa. Antibodies against a synthetic polypeptide of 30 amino acids deduced from the cDNA sequence specifically react with the delta-subunit of mammalian eIF-2B. The cDNA-derived amino acid sequence shows significant homology with the yeast translational regulator Gcd2, supporting the hypothesis that Gcd2 may be the yeast homolog of the delta-subunit of mammalian eIF-2B. Primer extension studies and anchor polymerase chain reaction analysis were performed to determine the 5'-end of the transcript for the delta-subunit of eIF-2B. Results of these experiments demonstrate two different mRNAs for the delta-subunit of eIF-2B in murine cells. The isolation and characterization of two different full-length cDNAs also predicts the presence of two alternate forms of the delta-subunit of eIF-2B in murine cells. These differ at their amino-terminal end but have identical nucleotide sequences coding for amino acids 31-544.

Cloning of a cDNA encoding 1-aminocyclopropane-1-carboxylate synthase and expression of its mRNA in ripening apple fruit.

PubMed

Dong, J G; Kim, W T; Yip, W K; Thompson, G A; Li, L; Bennett, A B; Yang, S F

1991-08-01

1-Aminocyclopropane-1-carboxylate (ACC) synthase (EC 4.4.1.14) purified from apple (Malus sylvestris Mill.) fruit was subjected to trypsin digestion. Following separation by reversed-phase high-pressure liquid chromatography, ten tryptic peptides were sequenced. Based on the sequences of three tryptic peptides, three sets of mixed oligonucleotide probes were synthesized and used to screen a plasmid cDNA library prepared from poly(A)(+) RNA of ripe apple fruit. A 1.5-kb (kilobase) cDNA clone which hybridized to all three probes were isolated. The clone contained an open reading frame of 1214 base pairs (bp) encoding a sequence of 404 amino acids. While the polyadenine tail at the 3'-end was intact, it lacked a portion of sequence at the 5'-end. Using the RNA-based polymerase chain reaction, an additional sequence of 148 bp was obtained at the 5'-end. Thus, 1362 bp were sequenced and they encode 454 amino acids. The deduced amino-acid sequence contained peptide sequences corresponding to all ten tryptic fragments, confirming the identity of the cDNA clone. Comparison of the deduced amino-acid sequence between ACC synthase from apple fruit and those from tomato (Lycopersicon esculentum Mill.) and winter squash (Cucurbita maxima Duch.) fruits demonstrated the presence of seven highly conserved regions, including the previously identified region for the active site. The size of the translation product of ACC-synthase mRNA was similar to that of the mature protein on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), indicating that apple ACC-synthase undergoes only minor, if any, post-translational proteolytic processing. Analysis of ACC-synthase mRNA by in-vitro translation-immunoprecipitation, and by Northern blotting indicates that the ACC-synthase mRNA was undetectable in unripe fruit, but was accumulated massively during the ripening proccess. These data demonstrate that the expression of the ACC-synthase gene is developmentally regulated.

Subtraction of cap-trapped full-length cDNA libraries to select rare transcripts.

PubMed

Hirozane-Kishikawa, Tomoko; Shiraki, Toshiyuki; Waki, Kazunori; Nakamura, Mari; Arakawa, Takahiro; Kawai, Jun; Fagiolini, Michela; Hensch, Takao K; Hayashizaki, Yoshihide; Carninci, Piero

2003-09-01

The normalization and subtraction of highly expressed cDNAs from relatively large tissues before cloning dramatically enhanced the gene discovery by sequencing for the mouse full-length cDNA encyclopedia, but these methods have not been suitable for limited RNA materials. To normalize and subtract full-length cDNA libraries derived from limited quantities of total RNA, here we report a method to subtract plasmid libraries excised from size-unbiased amplified lambda phage cDNA libraries that avoids heavily biasing steps such as PCR and plasmid library amplification. The proportion of full-length cDNAs and the gene discovery rate are high, and library diversity can be validated by in silico randomization.

Multiplex cDNA quantification method that facilitates the standardization of gene expression data

PubMed Central

Gotoh, Osamu; Murakami, Yasufumi; Suyama, Akira

2011-01-01

Microarray-based gene expression measurement is one of the major methods for transcriptome analysis. However, current microarray data are substantially affected by microarray platforms and RNA references because of the microarray method can provide merely the relative amounts of gene expression levels. Therefore, valid comparisons of the microarray data require standardized platforms, internal and/or external controls and complicated normalizations. These requirements impose limitations on the extensive comparison of gene expression data. Here, we report an effective approach to removing the unfavorable limitations by measuring the absolute amounts of gene expression levels on common DNA microarrays. We have developed a multiplex cDNA quantification method called GEP-DEAN (Gene expression profiling by DCN-encoding-based analysis). The method was validated by using chemically synthesized DNA strands of known quantities and cDNA samples prepared from mouse liver, demonstrating that the absolute amounts of cDNA strands were successfully measured with a sensitivity of 18 zmol in a highly multiplexed manner in 7 h. PMID:21415008

Topography of the Duchenne muscular dystrophy (DMD) gene: FIGE and cDNA analysis of 194 cases reveals 115 deletions and 13 duplications.

PubMed Central

Den Dunnen, J T; Grootscholten, P M; Bakker, E; Blonden, L A; Ginjaar, H B; Wapenaar, M C; van Paassen, H M; van Broeckhoven, C; Pearson, P L; van Ommen, G J

1989-01-01

We have studied 34 Becker and 160 Duchenne muscular dystrophy (DMD) patients with the dystrophin cDNA, using conventional blots and FIGE analysis. One hundred twenty-eight mutations (65%) were found, 115 deletions and 13 duplications, of which 106 deletions and 11 duplications could be precisely mapped in relation to both the mRNA and the major and minor mutation hot spots. Junction fragments, ideal markers for carrier detection, were found in 23 (17%) of the 128 cases. We identified eight new cDNA RFLPs within the DMD gene. With the use of cDNA probes we have completed the long-range map of the DMD gene, by the identification of a 680-kb SfiI fragment containing the gene's 3' end. The size of the DMD gene is now determined to be about 2.3 million basepairs. The combination of cDNA hybridizations with long-range analysis of deletion and duplication patients yields a global picture of the exon spacing within the dystrophin gene. The gene shows a large variability of intron size, ranging from only a few kilobases to 160-180 kb for the P20 intron. Images Figure 1 Figure 4 PMID:2573997

Tagging potato leafroll virus with the jellyfish green fluorescent protein gene.

PubMed

Nurkiyanova, K M; Ryabov, E V; Commandeur, U; Duncan, G H; Canto, T; Gray, S M; Mayo, M A; Taliansky, M E

2000-03-01

A full-length cDNA corresponding to the RNA genome of Potato leafroll virus (PLRV) was modified by inserting cDNA that encoded the jellyfish green fluorescent protein (GFP) into the P5 gene near its 3' end. Nicotiana benthamiana protoplasts electroporated with plasmid DNA containing this cDNA behind the 35S RNA promoter of Cauliflower mosaic virus became infected with the recombinant virus (PLRV-GFP). Up to 5% of transfected protoplasts showed GFP-specific fluorescence. Progeny virus particles were morphologically indistinguishable from those of wild-type PLRV but, unlike PLRV particles, they bound to grids coated with antibodies to GFP. Aphids fed on extracts of these protoplasts transmitted PLRV-GFP to test plants, as shown by specific fluorescence in some vascular tissue and epidermal cells and subsequent systemic infection. In plants agroinfected with PLRV-GFP cDNA in pBIN19, some cells became fluorescent and systemic infections developed. However, after either type of inoculation, fluorescence was mostly restricted to single cells and the only PLRV genome detected in systemically infected tissues lacked some or all of the inserted GFP cDNA, apparently because of naturally occurring deletions. Thus, intact PLRV-GFP was unable to move from cell to cell. Nevertheless, PLRV-GFP has novel potential for exploring the initial stages of PLRV infection.

Cloning and expression of a cDNA coding for catalase from zebrafish (Danio rerio).

PubMed

Ken, C F; Lin, C T; Wu, J L; Shaw, J F

2000-06-01

A full-length complementary DNA (cDNA) clone encoding a catalase was amplified by the rapid amplication of cDNA ends-polymerase chain reaction (RACE-PCR) technique from zebrafish (Danio rerio) mRNA. Nucleotide sequence analysis of this cDNA clone revealed that it comprised a complete open reading frame coding for 526 amino acid residues and that it had a molecular mass of 59 654 Da. The deduced amino acid sequence showed high similarity with the sequences of catalase from swine (86.9%), mouse (85.8%), rat (85%), human (83.7%), fruit fly (75.6%), nematode (71.1%), and yeast (58.6%). The amino acid residues for secondary structures are apparently conserved as they are present in other mammal species. Furthermore, the coding region of zebrafish catalase was introduced into an expression vector, pET-20b(+), and transformed into Escherichia coli expression host BL21(DE3)pLysS. A 60-kDa active catalase protein was expressed and detected by Coomassie blue staining as well as activity staining on polyacrylamide gel followed electrophoresis.

Molecular and characterization of NnPPO cDNA from lotus (Nelumbo nucifera) in rhizome browning.

PubMed

Dong, C; Yu, A Q; Yang, M G; Zhou, M Q; Hu, Z L

2016-04-30

The complete cDNA (NnPPO) of polyphenol oxidase in Nelumbo nucifera was successfully isolated, using Rapid amplification cDNA end (RACE) assays. The full-length cDNA of NnPPO was 2069 bp in size, containing a 1791 bp open reading frame coding 597 amino acids. The putative NnPPO possessed the conserved active sites and domains for PPO function. Phylogenetic analysis revealed that NnPPO shared high homology with PPO of high plants, and the homology modeling proved that NnPPO had the typical structure of PPO family. In order to characterize the role of NnPPO, Real-time PCR assay demonstrated that NnPPO mRNA was expressed in different tissues of N. nucifera including young leave, rhizome, flower, root and leafstalk, with the highest expression in rhizome. Patterns of NnPPO expression in rhizome illustrated its mRNA level was significantly elevated, which was consistent with the change of NnPPO activity during rhizome browning. Therefore, transcriptional activation of NnPPO was probably the main reason causing rhizome browning.

Normalized cDNA libraries

DOEpatents

Soares, Marcelo B.; Efstratiadis, Argiris

1997-01-01

This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.

Normalized cDNA libraries

DOEpatents

Soares, M.B.; Efstratiadis, A.

1997-06-10

This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3{prime} noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. 4 figs.

Genes expressed during the development and ripening of watermelon fruit.

PubMed

Levi, A; Davis, A; Hernandez, A; Wechter, P; Thimmapuram, J; Trebitsh, T; Tadmor, Y; Katzir, N; Portnoy, V; King, S

2006-11-01

A normalized cDNA library was constructed using watermelon flesh mRNA from three distinct developmental time-points and was subtracted by hybridization with leaf cDNA. Random cDNA clones of the watermelon flesh subtraction library were sequenced from the 5' end in order to identify potentially informative genes associated with fruit setting, development, and ripening. One-thousand and forty-six 5'-end sequences (expressed sequence tags; ESTs) were assembled into 832 non-redundant sequences, designated as "EST-unigenes". Of these 832 "EST-unigenes", 254 ( approximately 30%) have no significant homology to sequences published so far for other plant species. Additionally, 168 "EST-unigenes" ( approximately 20%) correspond to genes with unknown function, whereas 410 "EST-unigenes" ( approximately 50%) correspond to genes with known function in other plant species. These "EST-unigenes" are mainly associated with metabolism, membrane transport, cytoskeleton synthesis and structure, cell wall formation and cell division, signal transduction, nucleic acid binding and transcription factors, defense and stress response, and secondary metabolism. This study provides the scientific community with novel genetic information for watermelon as well as an expanded pool of genes associated with fruit development in watermelon. These genes will be useful targets in future genetic and functional genomic studies of watermelon and its development.

Identifications of SUMO-1 cDNA and Its Expression Patterns in Pacific White Shrimp Litopeanaeus vannamei

PubMed Central

Laoong-u-thai, Yanisa; Zhao, Baoping; Phongdara, Amornrat; Ako, Harry; Yang, Jinzeng

2009-01-01

Small ubiquitin-like modifiers (SUMO) work in a similar way as ubiquitin to alter the biological properties of a target protein by conjugation. A shrimp SUMO cDNA named LvSUMO-1 was identified in Litopenaeus vannamei. LvSUMO-1 cDNA contains a coding sequence of 282 nucleotides with untranslated regions of 37 bp at 5'-end and 347 bp at 3'-end, respectively. The deduced 93 amino acids exhibit 83% identity with the Western Honeybee SUMO-1, and more than 65% homologies with human and mouse SUMO-1. LvSUMO-1 mRNA is expressed in most L. vannamei tissues with the highest level in hepatopancrease. The mRNA expression of LvSUMO-1 over development stages in L. Vammamei is distinguished by a low level in nauplius stage and relatively high level in postlarva stage with continuous expression until juvenile stage. The LvSUMO-1 protein and its conjugated proteins are detected in both cytoplasm and nucleus in several tissues. Interestingly, LvSUMO-1 mRNA levels are high in abdominal muscle during the premolt stage, wherein it has significant activities of protein degradation, suggesting its possible role in the regulation of shrimp muscle protein degradation. PMID:19240809

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tzeng, W.-P.; Frey, Teryl K.

Rubella virus (RUB) replicons are derivatives of the RUB infectious cDNA clone that retain the nonstructural open reading frame (NS-ORF) that encodes the replicase proteins but not the structural protein ORF (SP-ORF) that encodes the virion proteins. RUB defective interfering (DI) RNAs contain deletions within the SP-ORF and thus resemble replicons. DI RNAs often retain the 5' end of the capsid protein (C) gene that has been shown to modulate virus-specific RNA synthesis. However, when replicons either with or without the C gene were passaged serially in the presence of wt RUB as a source of the virion proteins, itmore » was found that neither replicon was maintained and DI RNAs were generated. The majority DI RNA species contained in-frame deletions in the SP-ORF leading to a fusion between the 5' end of the C gene and the 3' end of the E1 glycoprotein gene. DI infectious cDNA clones were constructed and transcripts from these DI infectious cDNA clones were maintained during serial passage with wt RUB. The C-E1 fusion protein encoded by the DI RNAs was synthesized and was required for maintenance of the DI RNA during serial passage. This is the first report of a functional novel gene product resulting from deletion during DI RNA generation. Thus far, the role of the C-E1 fusion protein in maintenance of DI RNAs during serial passage remained elusive as it was found that the fusion protein diminished rather than enhanced DI RNA synthesis and was not incorporated into virus particles.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Leong, JoAnn Ching

The nucleotide sequence of the IHNV glycoprotein gene has been determined from a cDNA clone containing the entire coding region. The glycoprotein cDNA clone contained a leader sequence of 48 bases, a coding region of 1524 nucleotides, and 39 bases at the 3 foot end. The entire cDNA clone contains 1609 nucleodites and encodes a protein of 508 amino acids. The deduced amino acid sequence gave a translated molecular weight of 56,795 daltons. A hydropathicity profile of the deduced amino acid sequence indicated that there were two major hydrophobic domains: one,at the N-terminus,delineating a signal peptide of 18 amino acidsmore » and the other, at the C-terminus,delineating the region of the transmembrane. Five possible sites of N-linked glyscoylation were identified. Although no nucleic acid homology existed between the IHNV glycoprotein gene and the glycoprotein genes of rabies and VSV, there was significant homology at the amino acid level between all three rhabdovirus glycoproteins.« less

An atypical topoisomerase II sequence from the slime mold Physarum polycephalum.

PubMed

Hugodot, Yannick; Dutertre, Murielle; Duguet, Michel

2004-01-21

We have determined the complete nucleotide sequence of the cDNA encoding DNA topoisomerase II from Physarum polycephalum. Using degenerate primers, based on the conserved amino acid sequences of other eukaryotic enzymes, a 250-bp fragment was polymerase chain reaction (PCR) amplified. This fragment was used as a probe to screen a Physarum cDNA library. A partial cDNA clone was isolated that was truncated at the 3' end. Rapid amplification of cDNA ends (RACE)-PCR was employed to isolate the remaining portion of the gene. The complete sequence of 4613 bp contains an open reading frame of 4494 bp that codes for 1498 amino acid residues with a theoretical molecular weight of 167 kDa. The predicted amino acid sequence shares similarity with those of other eukaryotes and shows the highest degree of identity with the enzyme of Dictyostelium discoideum. However, the enzyme of P. polycephalum contains an atypical amino-terminal domain very rich in serine and proline, whose function is unknown. Remarkably, both a mitochondrial targeting sequence and a nuclear localization signal were predicted respectively in the amino and carboxy-terminus of the protein, as in the case of human topoisomerase III alpha. At the Physarum genomic level, the topoisomerase II gene encompasses a region of about 16 kbp suggesting a large proportion of intronic sequences, an unusual situation for a gene of a lower eukaryote, often free of introns. Finally, expression of topoisomerase II mRNA does not appear significantly dependent on the plasmodium cycle stage, possibly due to the lack of G1 phase or (and) to a mitochondrial localization of the enzyme.

miR-ID: A novel, circularization-based platform for detection of microRNAs

PubMed Central

Kumar, Pavan; Johnston, Brian H.; Kazakov, Sergei A.

2011-01-01

MicroRNAs (miRNAs) are important regulators of gene expression and have great potential as biomarkers, prognostic indicators, and therapeutic targets. Determining the expression patterns of these molecules is essential for elucidating their biogenesis, regulation, relation to disease, and response to therapy. Although PCR-based assays are commonly used for expression profiling of miRNAs, the small size, sequence heterogeneity, and (in some cases) end modifications of miRNAs constrain the performance of existing PCR methods. Here we introduce miR-ID, a novel method that avoids these constraints while providing superior sensitivity and sequence specificity at a lower cost. It also has the unique ability to differentiate unmodified small RNAs from those carrying 2′-OMe groups at their 3′-ends while detecting both forms. miR-ID is comprised of the following steps: (1) circularization of the miRNA by a ligase; (2) reverse transcription of the circularized miRNA (RTC), producing tandem repeats of a DNA sequence complementary to the miRNA; and (3) qPCR amplification of segments of this multimeric cDNA using 5′-overlapping primers and a nonspecific dye such as SYBR Green. No chemically modified probes (e.g., TaqMan) or primers (e.g., LNA) are required. The circular RNA and multimeric cDNA templates provide unmatched flexibility in the positioning of primers, which may include straddling the boundaries between these repetitive miRNA sequences. miR-ID is based on new findings that are themselves of general interest, including reverse transcription of small RNA circles and the use of 5′-overlapping primers for detection of repetitive sequences by qPCR. PMID:21169480

A Polymerase Chain Reaction-Based Method for Isolating Clones from a Complimentary DNA Library in Sheep

PubMed Central

Friis, Thor Einar; Stephenson, Sally; Xiao, Yin; Whitehead, Jon

2014-01-01

The sheep (Ovis aries) is favored by many musculoskeletal tissue engineering groups as a large animal model because of its docile temperament and ease of husbandry. The size and weight of sheep are comparable to humans, which allows for the use of implants and fixation devices used in human clinical practice. The construction of a complimentary DNA (cDNA) library can capture the expression of genes in both a tissue- and time-specific manner. cDNA libraries have been a consistent source of gene discovery ever since the technology became commonplace more than three decades ago. Here, we describe the construction of a cDNA library using cells derived from sheep bones based on the pBluescript cDNA kit. Thirty clones were picked at random and sequenced. This led to the identification of a novel gene, C12orf29, which our initial experiments indicate is involved in skeletal biology. We also describe a polymerase chain reaction-based cDNA clone isolation method that allows the isolation of genes of interest from a cDNA library pool. The techniques outlined here can be applied in-house by smaller tissue engineering groups to generate tools for biomolecular research for large preclinical animal studies and highlights the power of standard cDNA library protocols to uncover novel genes. PMID:24447069

Non-biased and efficient global amplification of a single-cell cDNA library

PubMed Central

Huang, Huan; Goto, Mari; Tsunoda, Hiroyuki; Sun, Lizhou; Taniguchi, Kiyomi; Matsunaga, Hiroko; Kambara, Hideki

2014-01-01

Analysis of single-cell gene expression promises a more precise understanding of molecular mechanisms of a living system. Most techniques only allow studies of the expressions for limited numbers of gene species. When amplification of cDNA was carried out for analysing more genes, amplification biases were frequently reported. A non-biased and efficient global-amplification method, which uses a single-cell cDNA library immobilized on beads, was developed for analysing entire gene expressions for single cells. Every step in this analysis from reverse transcription to cDNA amplification was optimized. By removing degrading excess primers, the bias due to the digestion of cDNA was prevented. Since the residual reagents, which affect the efficiency of each subsequent reaction, could be removed by washing beads, the conditions for uniform and maximized amplification of cDNAs were achieved. The differences in the amplification rates for randomly selected eight genes were within 1.5-folds, which could be negligible for most of the applications of single-cell analysis. The global amplification gives a large amount of amplified cDNA (>100 μg) from a single cell (2-pg mRNA), and that amount is enough for downstream analysis. The proposed global-amplification method was used to analyse transcript ratios of multiple cDNA targets (from several copies to several thousand copies) quantitatively. PMID:24141095

The GA5 locus of Arabidopsis thaliana encodes a multifunctional gibberellin 20-oxidase: molecular cloning and functional expression.

PubMed

Xu, Y L; Li, L; Wu, K; Peeters, A J; Gage, D A; Zeevaart, J A

1995-07-03

The biosynthesis of gibberellins (GAs) after GA12-aldehyde involves a series of oxidative steps that lead to the formation of bioactive GAs. Previously, a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing), EC 1.14.11.-] was isolated by immunoscreening a cDNA library from liquid endosperm of pumpkin (Cucurbita maxima L.) with antibodies against partially purified GA 20-oxidase. Here, we report isolation of a genomic clone for GA 20-oxidase from a genomic library of the long-day species Arabidopsis thaliana Heynh., strain Columbia, by using the pumpkin cDNA clone as a heterologous probe. This genomic clone contains a GA 20-oxidase gene that consists of three exons and two introns. The three exons are 1131-bp long and encode 377 amino acid residues. A cDNA clone corresponding to the putative GA 20-oxidase genomic sequence was constructed with the reverse transcription-PCR method, and the identity of the cDNA clone was confirmed by analyzing the capability of the fusion protein expressed in Escherichia coli to convert GA53 to GA44 and GA19 to GA20. The Arabidopsis GA 20-oxidase shares 55% identity and > 80% similarity with the pumpkin GA 20-oxidase at the derived amino acid level. Both GA 20-oxidases share high homology with other 2-oxoglutarate-dependent dioxygenases (2-ODDs), but the highest homology was found between the two GA 20-oxidases. Mapping results indicated tight linkage between the cloned GA 20-oxidase and the GA5 locus of Arabidopsis. The ga5 semidwarf mutant contains a G-->A point mutation that inserts a translational stop codon in the protein-coding sequence, thus confirming that the GA5 locus encodes GA 20-oxidase. Expression of the GA5 gene in Ara-bidopsis leaves was enhanced after plants were transferred from short to long days; it was reduced by GA4 treatment, suggesting end-product repression in the GA biosynthetic pathway.

Skipping of Exons by Premature Termination of Transcription and Alternative Splicing within Intron-5 of the Sheep SCF Gene: A Novel Splice Variant

PubMed Central

Saravanaperumal, Siva Arumugam; Pediconi, Dario; Renieri, Carlo; La Terza, Antonietta

2012-01-01

Stem cell factor (SCF) is a growth factor, essential for haemopoiesis, mast cell development and melanogenesis. In the hematopoietic microenvironment (HM), SCF is produced either as a membrane-bound (−) or soluble (+) forms. Skin expression of SCF stimulates melanocyte migration, proliferation, differentiation, and survival. We report for the first time, a novel mRNA splice variant of SCF from the skin of white merino sheep via cloning and sequencing. Reverse transcriptase (RT)-PCR and molecular prediction revealed two different cDNA products of SCF. Full-length cDNA libraries were enriched by the method of rapid amplification of cDNA ends (RACE-PCR). Nucleotide sequencing and molecular prediction revealed that the primary 1519 base pair (bp) cDNA encodes a precursor protein of 274 amino acids (aa), commonly known as ‘soluble’ isoform. In contrast, the shorter (835 and/or 725 bp) cDNA was found to be a ‘novel’ mRNA splice variant. It contains an open reading frame (ORF) corresponding to a truncated protein of 181 aa (vs 245 aa) with an unique C-terminus lacking the primary proteolytic segment (28 aa) right after the D175G site which is necessary to produce ‘soluble’ form of SCF. This alternative splice (AS) variant was explained by the complete nucleotide sequencing of splice junction covering exon 5-intron (5)-exon 6 (948 bp) with a premature termination codon (PTC) whereby exons 6 to 9/10 are skipped (Cassette Exon, CE 6–9/10). We also demonstrated that the Northern blot analysis at transcript level is mediated via an intron-5 splicing event. Our data refine the structure of SCF gene; clarify the presence (+) and/or absence (−) of primary proteolytic-cleavage site specific SCF splice variants. This work provides a basis for understanding the functional role and regulation of SCF in hair follicle melanogenesis in sheep beyond what was known in mice, humans and other mammals. PMID:22719917

The GA5 locus of Arabidopsis thaliana encodes a multifunctional gibberellin 20-oxidase: Molecular cloning and functional expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xu, Yun-Ling; Li, Li; Wu, Keqiang

1995-07-03

The biosynthesis of gibberellins (GAs) after GA{sub 12}-aldehyde involves a series of oxidative steps that lead to the formation of bioactive GAs. Previously, a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing), EC 1.14.11-] was isolated by immunoscreening a cDNA library from liquid endosperm of pumpkin (Cucurbita maxima L.) with antibodies against partially purified GA 20-oxidase. Here, we report isolation of a genomic clone for GA 20-oxidase from a genomic library of the long-day species Arabidopsis thaliana Heynh., strain Columbia, by using the pumpkin cDNA clone as a heterologous probe. This genomic clone contains a GA 20-oxidasemore » gene that consists of three exons and two introns. The three exons are 1131-bp long and encode 377 amino acid residues. A cDNA clone corresponding to the putative GA 20-oxidase genomic sequence was constructed with the reverse transcription-PCR method, and the identity of the cDNA clone was confirmed by analyzing the capability of the fusion protein expressed in Escherichia coli to convert GA{sub 53} to GA{sub 44} and GA{sub 19} to GA{sub 20}. The Arabidopsis GA 20-oxidase shares 55% identity and >80% similarity with the pumpkin GA 20-oxidase at the derived amino acid level. Both GA 20-oxidases share high homology with other 2-oxoglutarate-dependent dioxygenases (2-ODDs), but the highest homology was found between the two GA 20-oxidases. Mapping results indicated tight linkage between the cloned GA 20-oxidase and the GA locus of Arabidopsis. The ga5 semidwarf mutant contains a G {yields} A point mutation that inserts a translational stop codon in the protein-coding sequence, thus confirming that the GA5 locus encodes GA 20-oxidase. Expression of the GA5 gene in Arabidopsis leaves was enhanced after plants were transferred from short to long days; it was reduced by GA{sub 4} treatment, suggesting end-product repression in the GA biosynthetic pathway. 28 refs., 6 figs.« less

Construction and EST sequencing of full-length, drought stress cDNA libraries for common beans (Phaseolus vulgaris L.)

PubMed Central

2011-01-01

Background Common bean is an important legume crop with only a moderate number of short expressed sequence tags (ESTs) made with traditional methods. The goal of this research was to use full-length cDNA technology to develop ESTs that would overlap with the beginning of open reading frames and therefore be useful for gene annotation of genomic sequences. The library was also constructed to represent genes expressed under drought, low soil phosphorus and high soil aluminum toxicity. We also undertook comparisons of the full-length cDNA library to two previous non-full clone EST sets for common bean. Results Two full-length cDNA libraries were constructed: one for the drought tolerant Mesoamerican genotype BAT477 and the other one for the acid-soil tolerant Andean genotype G19833 which has been selected for genome sequencing. Plants were grown in three soil types using deep rooting cylinders subjected to drought and non-drought stress and tissues were collected from both roots and above ground parts. A total of 20,000 clones were selected robotically, half from each library. Then, nearly 10,000 clones from the G19833 library were sequenced with an average read length of 850 nucleotides. A total of 4,219 unigenes were identified consisting of 2,981 contigs and 1,238 singletons. These were functionally annotated with gene ontology terms and placed into KEGG pathways. Compared to other EST sequencing efforts in common bean, about half of the sequences were novel or represented the 5' ends of known genes. Conclusions The present full-length cDNA libraries add to the technological toolbox available for common bean and our sequencing of these clones substantially increases the number of unique EST sequences available for the common bean genome. All of this should be useful for both functional gene annotation, analysis of splice site variants and intron/exon boundary determination by comparison to soybean genes or with common bean whole-genome sequences. In addition the library has a large number of transcription factors and will be interesting for discovery and validation of drought or abiotic stress related genes in common bean. PMID:22118559

Differential expression of copper-zinc superoxide dismutase gene of Polygonum sibiricum leaves, stems and underground stems, subjected to high-salt stress.

PubMed

Qu, Chun-Pu; Xu, Zhi-Ru; Liu, Guan-Jun; Liu, Chun; Li, Yang; Wei, Zhi-Gang; Liu, Gui-Feng

2010-01-01

In aerobic organisms, protection against oxidative damage involves the combined action of highly specialized antioxidant enzymes, such as copper-zinc superoxide dismutase. In this work, a cDNA clone which encodes a copper-zinc superoxide dismutase gene, named PS-CuZnSOD, has been identified from P. sibiricum Laxm. by the rapid amplification of cDNA ends method (RACE). Analysis of the nucleotide sequence reveals that the PS-CuZnSOD gene cDNA clone consists of 669 bp, containing 87 bp in the 5' untranslated region; 459 bp in the open reading frame (ORF) encoding 152 amino acids; and 123 bp in 3' untranslated region. The gene accession nucleotide sequence number in GenBank is GQ472846. Sequence analysis indicates that the protein, like most plant superoxide dismutases (SOD), includes two conserved ecCuZnSOD signatures that are from the amino acids 43 to 51, and from the amino acids 137 to 148, and it has a signal peptide extension in the front of the N-terminus (1-16 aa). Expression analysis by real-time quantitative PCR reveals that the PS-CuZnSOD gene is expressed in leaves, stems and underground stems. PS-CuZnSOD gene expression can be induced by 3% NaHCO(3). The different mRNA levels' expression of PS-CuZnSOD show the gene's different expression modes in leaves, stems and underground stems under the salinity-alkalinity stress.

Molecular characterization of cDNA encoding oxygen evolving enhancer protein 1 increased by salt treatment in the mangrove Bruguiera gymnorrhiza.

PubMed

Sugihara, K; Hanagata, N; Dubinsky, Z; Baba, S; Karube, I

2000-11-01

Young plants of the common Okinawa mangrove species Bruguiera gymnorrhiza were transferred from freshwater to a medium with seawater salt level (500 mM NaCl). Two-dimensional gel electrophoresis revealed in the leaf extract of the plant a 33 kDa protein with pI 5.2, whose quantity increased as a result of NaCl treatment. The N-terminal amino acids sequence of this protein had a significant homology with mature region of oxygen evolving enhancer protein 1 (OEE1) precursor. The cloning of OEE1 precursor cDNA fragment was carried out by means of reverse transcription-PCR (RT-PCR) using degenerated primers. Both 3'- and 5'-regions were isolated by rapid amplification of cDNA ends (RACE) method. The deduced amino acid sequence consisted of 322 amino acids and was 87% identical to that of Nicotiana tabacum. In B. gymnorrhiza, the predicted amino acid sequence of the mature protein starts at the residue number 85 of the open reading frame. The first 84-amino acid residues correspond to a typical transit sequence for the signal directing OEE1 to its appropriate compartment of chloroplast. The expression of OEE1 was analyzed together with other OEE subunits and D1 protein of photosystem II. The transcript levels of all the three OEEs were enhanced by NaCl treatment, but the significant increase of D1 protein was not observed.

Primary culture of cat intestinal epithelial cells in vitro and the cDNA library construction.

PubMed

Zhao, Gui Hua; Liu, Ye; Cheng, Yun Tang; Zhao, Qing Song; Qiu, Xiao; Xu, Chao; Xiao, Ting; Zhu, Song; Liu, Gong Zhen; Yin, Kun

2018-06-26

Felids are the only definitive hosts of Toxoplasma gondii. To lay a foundation for screening the T. gondii-felids interaction factors, we have developed a reproducible primary culture method for cat intestinal epithelial cells (IECs). The primary IECs were isolated from a new born cat's small intestine jejunum region without food ingress, and respectively in vitro cultured by tissue cultivation and combined digestion method with collagenase XI and dispase I, then purified by trypsinization. After identification, the ds cDNA of cat IECs was synthesized for constructing pGADT7 homogenization three-frame plasmid, and transformed into the yeast Y187 for generating the cDNA library. Our results indicated that cultivation of primary cat IECs relays on combined digestion to form polarized and confluent monolayers within 3 days with typical features of normal epithelial cells. The purified cells cultured by digestion method were identified to be nature intestinal epithelial cells using immunohistochemical analysis and were able to maintain viability for at least 15 passages. The homogenizable ds cDNA, which is synthesized from the total RNA extracted from our cultured IECs, distributed among 0.5-2.0 kb, and generated satisfying three-frame cDNA library with the capacity of 1.2 × 106 and the titer of 5.2 × 107 pfu/mL. Our results established an optimal method for the culturing and passage of cat IECs model in vitro, and laid a cDNA library foundation for the subsequent interaction factors screening by yeast two-hybrid.

Salt Sensitive Tet-Off-Like Systems to Knockdown Primordial Germ Cell Genes for Repressible Transgenic Sterilization in Channel Catfish, Ictalurus punctatus.

PubMed

Li, Hanbo; Su, Baofeng; Qin, Guyu; Ye, Zhi; Alsaqufi, Ahmed; Perera, Dayan A; Shang, Mei; Odin, Ramjie; Vo, Khoi; Drescher, David; Robinson, Dalton; Zhang, Dan; Abass, Nermeen; Dunham, Rex A

2017-05-31

Repressible knockdown approaches were investigated for transgenic sterilization in channel catfish, Ictalurus punctatus . Two primordial germ cell (PGC) marker genes, nanos and dead end , were targeted for knockdown, and an off-target gene, vasa , was monitored. Two potentially salt sensitive repressible promoters, zebrafish adenylosuccinate synthase 2 (ADSS) and zebrafish racemase (Rm), were each coupled with four knockdown strategies: ds-sh RNA targeting the 5' end (N1) or 3' end (N2) of channel catfish nanos , full-length cDNA sequence of channel catfish nanos for overexpression (cDNA) and ds-sh RNA targeting channel catfish dead end (DND). Each construct had an untreated group and treated group with sodium chloride as the repressor compound. Spawning rates of full-sibling P₁ fish exposed or not exposed to the constructs as treated and untreated embryos were 93% and 59%, respectively, indicating potential sterilization of fish and repression of the constructs. Although the mRNA expression data of PGC marker genes were inconsistent in P₁ fish, most F₁ individuals were able to downregulate the target genes in untreated groups and repress the knockdown process in treated groups. The results indicate that repressible transgenic sterilization is feasible for reproductive control of fish, but more data from F₂ or F₃ are needed for evaluation.

cDNA isolated from a human T-cell library encodes a member of the protein-tyrosine-phosphatase family

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cool, D.E.; Tonks, N.K.; Charbonneau, H.

1989-07-01

A human peripheral T-cell cDNA library was screened with two labeled synthetic oligonucleotides encoding regions of a human placenta protein-tyrosine-phosphatase. One positive clone was isolated and the nucleotide sequence was determined. It contained 1,305 base pairs of open reading frame followed by a TAA stop codon and 978 base pairs of 3{prime} untranslated end, although a poly(A){sup +} tail was not found. An initiator methionine residue was predicted at position 61, which would result in a protein of 415 amino acid residues. This was supported by the synthesis of a M{sub r} 48,000 protein in an in vitro reticulocyte lysatemore » translation system using RNA transcribed from the cloned cDNA and T7 RNA polymerase. The deduced amino acid sequence was compared to other known proteins revealing 65% identity to the low M{sub r} PTPase 1B isolated from placenta. In view of the high degree of similarity, the T-cell cDNA likely encodes a newly discovered protein-tyrosine-phosphatase, thus expanding this family of genes.« less

Purification, characterization, and cDNA cloning of a novel acidic endoglycoceramidase from the jellyfish, Cyanea nozakii.

PubMed

Horibata, Y; Okino, N; Ichinose, S; Omori, A; Ito, M

2000-10-06

Endoglycoceramidase (EC ) is an enzyme capable of cleaving the glycosidic linkage between oligosaccharides and ceramides in various glycosphingolipids. We report here the purification, characterization, and cDNA cloning of a novel endoglycoceramidase from the jellyfish, Cyanea nozakii. The purified enzyme showed a single protein band estimated to be 51 kDa on SDS-polyacrylamide gel electrophoresis. The enzyme showed a pH optimum of 3.0 and was activated by Triton X-100 and Lubrol PX but not by sodium taurodeoxycholate. This enzyme preferentially hydrolyzed gangliosides, especially GT1b and GQ1b, whereas neutral glycosphingolipids were somewhat resistant to hydrolysis by the enzyme. A full-length cDNA encoding the enzyme was cloned by 5'- and 3'-rapid amplification of cDNA ends using a partial amino acid sequence of the purified enzyme. The open reading frame of 1509 nucleotides encoded a polypeptide of 503 amino acids including a signal sequence of 25 residues and six potential N-glycosylation sites. Interestingly, the Asn-Glu-Pro sequence, which is the putative active site of Rhodococcus endoglycoceramidase, was conserved in the deduced amino acid sequences. This is the first report of the cloning of an endoglycoceramidase from a eukaryote.

Depletion of polycistronic transcripts using short interfering RNAs: cDNA synthesis method affects levels of non-targeted genes determined by quantitative PCR.

PubMed

Hanning, Jennifer E; Groves, Ian J; Pett, Mark R; Coleman, Nicholas

2013-05-21

Short interfering RNAs (siRNAs) are often used to deplete viral polycistronic transcripts, such as those encoded by human papillomavirus (HPV). There are conflicting data in the literature concerning how siRNAs targeting one HPV gene can affect levels of other genes in the polycistronic transcripts. We hypothesised that the conflict might be partly explained by the method of cDNA synthesis used prior to transcript quantification. We treated HPV16-positive cervical keratinocytes with siRNAs targeting the HPV16 E7 gene and used quantitative PCR to compare transcript levels of E7 with those of E6 and E2, viral genes located upstream and downstream of the target site respectively. We compared our findings from cDNA generated using oligo-dT primers alone with those from cDNA generated using a combination of random hexamer and oligo-dT primers. Our data show that when polycistronic transcripts are targeted by siRNAs, there is a period when untranslatable cleaved mRNA upstream of the siRNA binding site remains detectable by PCR, if cDNA is generated using random hexamer primers. Such false indications of mRNA abundance are avoided using oligo-dT primers. The period corresponds to the time taken for siRNA activity and degradation of the cleaved transcripts. Genes downstream of the siRNA binding site are detectable during this interval, regardless of how the cDNA is generated. These data emphasise the importance of the cDNA synthesis method used when measuring transcript abundance following siRNA depletion of polycistronic transcripts. They provide a partial explanation for erroneous reports suggesting that siRNAs targeting HPV E7 can have gene-specific effects.

Depletion of polycistronic transcripts using short interfering RNAs: cDNA synthesis method affects levels of non-targeted genes determined by quantitative PCR

PubMed Central

2013-01-01

Background Short interfering RNAs (siRNAs) are often used to deplete viral polycistronic transcripts, such as those encoded by human papillomavirus (HPV). There are conflicting data in the literature concerning how siRNAs targeting one HPV gene can affect levels of other genes in the polycistronic transcripts. We hypothesised that the conflict might be partly explained by the method of cDNA synthesis used prior to transcript quantification. Findings We treated HPV16-positive cervical keratinocytes with siRNAs targeting the HPV16 E7 gene and used quantitative PCR to compare transcript levels of E7 with those of E6 and E2, viral genes located upstream and downstream of the target site respectively. We compared our findings from cDNA generated using oligo-dT primers alone with those from cDNA generated using a combination of random hexamer and oligo-dT primers. Our data show that when polycistronic transcripts are targeted by siRNAs, there is a period when untranslatable cleaved mRNA upstream of the siRNA binding site remains detectable by PCR, if cDNA is generated using random hexamer primers. Such false indications of mRNA abundance are avoided using oligo-dT primers. The period corresponds to the time taken for siRNA activity and degradation of the cleaved transcripts. Genes downstream of the siRNA binding site are detectable during this interval, regardless of how the cDNA is generated. Conclusions These data emphasise the importance of the cDNA synthesis method used when measuring transcript abundance following siRNA depletion of polycistronic transcripts. They provide a partial explanation for erroneous reports suggesting that siRNAs targeting HPV E7 can have gene-specific effects. PMID:23693071

Differential cDNA cloning by enzymatic degrading subtraction (EDS).

PubMed Central

Zeng, J; Gorski, R A; Hamer, D

1994-01-01

We describe a new method, called enzymatic degrading subtraction (EDS), for the construction of subtractive libraries from PCR amplified cDNA. The novel features of this method are that i) the tester DNA is blocked by thionucleotide incorporation; ii) the rate of hybridization is accelerated by phenol-emulsion reassociation; and iii) the driver cDNA and hybrid molecules are enzymatically removed by digestion with exonucleases III and VII rather than by physical partitioning. We demonstrate the utility of EDS by constructing a subtractive library enriched for cDNAs expressed in adult but not in embryonic rat brains. Images PMID:7971268

Procedure for normalization of cDNA libraries

DOEpatents

Bonaldo, Maria DeFatima; Soares, Marcelo Bento

1997-01-01

This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library.

Molecular Cloning and Characterization of cDNA Encoding a Putative Stress-Induced Heat-Shock Protein from Camelus dromedarius

PubMed Central

Elrobh, Mohamed S.; Alanazi, Mohammad S.; Khan, Wajahatullah; Abduljaleel, Zainularifeen; Al-Amri, Abdullah; Bazzi, Mohammad D.

2011-01-01

Heat shock proteins are ubiquitous, induced under a number of environmental and metabolic stresses, with highly conserved DNA sequences among mammalian species. Camelus dromedaries (the Arabian camel) domesticated under semi-desert environments, is well adapted to tolerate and survive against severe drought and high temperatures for extended periods. This is the first report of molecular cloning and characterization of full length cDNA of encoding a putative stress-induced heat shock HSPA6 protein (also called HSP70B′) from Arabian camel. A full-length cDNA (2417 bp) was obtained by rapid amplification of cDNA ends (RACE) and cloned in pET-b expression vector. The sequence analysis of HSPA6 gene showed 1932 bp-long open reading frame encoding 643 amino acids. The complete cDNA sequence of the Arabian camel HSPA6 gene was submitted to NCBI GeneBank (accession number HQ214118.1). The BLAST analysis indicated that C. dromedaries HSPA6 gene nucleotides shared high similarity (77–91%) with heat shock gene nucleotide of other mammals. The deduced 643 amino acid sequences (accession number ADO12067.1) showed that the predicted protein has an estimated molecular weight of 70.5 kDa with a predicted isoelectric point (pI) of 6.0. The comparative analyses of camel HSPA6 protein sequences with other mammalian heat shock proteins (HSPs) showed high identity (80–94%). Predicted camel HSPA6 protein structure using Protein 3D structural analysis high similarities with human and mouse HSPs. Taken together, this study indicates that the cDNA sequences of HSPA6 gene and its amino acid and protein structure from the Arabian camel are highly conserved and have similarities with other mammalian species. PMID:21845074

A putative peroxidase cDNA from turnip and analysis of the encoded protein sequence.

PubMed

Romero-Gómez, S; Duarte-Vázquez, M A; García-Almendárez, B E; Mayorga-Martínez, L; Cervantes-Avilés, O; Regalado, C

2008-12-01

A putative peroxidase cDNA was isolated from turnip roots (Brassica napus L. var. purple top white globe) by reverse transcriptase-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). Total RNA extracted from mature turnip roots was used as a template for RT-PCR, using a degenerated primer designed to amplify the highly conserved distal motif of plant peroxidases. The resulting partial sequence was used to design the rest of the specific primers for 5' and 3' RACE. Two cDNA fragments were purified, sequenced, and aligned with the partial sequence from RT-PCR, and a complete overlapping sequence was obtained and labeled as BbPA (Genbank Accession No. AY423440, named as podC). The full length cDNA is 1167bp long and contains a 1077bp open reading frame (ORF) encoding a 358 deduced amino acid peroxidase polypeptide. The putative peroxidase (BnPA) showed a calculated Mr of 34kDa, and isoelectric point (pI) of 4.5, with no significant identity with other reported turnip peroxidases. Sequence alignment showed that only three peroxidases have a significant identity with BnPA namely AtP29a (84%), and AtPA2 (81%) from Arabidopsis thaliana, and HRPA2 (82%) from horseradish (Armoracia rusticana). Work is in progress to clone this gene into an adequate host to study the specific role and possible biotechnological applications of this alternative peroxidase source.

Genomic resources for songbird research and their use in characterizing gene expression during brain development

PubMed Central

Li, XiaoChing; Wang, Xiu-Jie; Tannenhauser, Jonathan; Podell, Sheila; Mukherjee, Piali; Hertel, Moritz; Biane, Jeremy; Masuda, Shoko; Nottebohm, Fernando; Gaasterland, Terry

2007-01-01

Vocal learning and neuronal replacement have been studied extensively in songbirds, but until recently, few molecular and genomic tools for songbird research existed. Here we describe new molecular/genomic resources developed in our laboratory. We made cDNA libraries from zebra finch (Taeniopygia guttata) brains at different developmental stages. A total of 11,000 cDNA clones from these libraries, representing 5,866 unique gene transcripts, were randomly picked and sequenced from the 3′ ends. A web-based database was established for clone tracking, sequence analysis, and functional annotations. Our cDNA libraries were not normalized. Sequencing ESTs without normalization produced many developmental stage-specific sequences, yielding insights into patterns of gene expression at different stages of brain development. In particular, the cDNA library made from brains at posthatching day 30–50, corresponding to the period of rapid song system development and song learning, has the most diverse and richest set of genes expressed. We also identified five microRNAs whose sequences are highly conserved between zebra finch and other species. We printed cDNA microarrays and profiled gene expression in the high vocal center of both adult male zebra finches and canaries (Serinus canaria). Genes differentially expressed in the high vocal center were identified from the microarray hybridization results. Selected genes were validated by in situ hybridization. Networks among the regulated genes were also identified. These resources provide songbird biologists with tools for genome annotation, comparative genomics, and microarray gene expression analysis. PMID:17426146

Purification, cDNA cloning, and characterization of LysM-containing plant chitinase from horsetail (Equisetum arvense).

PubMed

Inamine, Saki; Onaga, Shoko; Ohnuma, Takayuki; Fukamizo, Tamo; Taira, Toki

2015-01-01

Chitinase-A (EaChiA), molecular mass 36 kDa, was purified from the vegetative stems of a horsetail (Equisetum arvense) using a series of column chromatography. The N-terminal amino acid sequence of EaChiA was similar to the lysin motif (LysM). A cDNA encoding EaChiA was cloned by rapid amplification of cDNA ends and polymerase chain reaction. It consisted of 1320 nucleotides and encoded an open reading frame of 361 amino acid residues. The deduced amino acid sequence indicated that EaChiA is composed of a N-terminal LysM domain and a C-terminal plant class IIIb chitinase catalytic domain, belonging to the glycoside hydrolase family 18, linked by proline-rich regions. EaChiA has strong chitin-binding activity, however, no antifungal activity. This is the first report of a chitinase from Equisetopsida, a class of fern plants, and the second report of a LysM-containing chitinase from a plant.

Procedure for normalization of cDNA libraries

DOEpatents

Bonaldo, M.D.; Soares, M.B.

1997-12-30

This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library. 1 fig.

Signal sequence and keyword trap in silico for selection of full-length human cDNAs encoding secretion or membrane proteins from oligo-capped cDNA libraries.

PubMed

Otsuki, Tetsuji; Ota, Toshio; Nishikawa, Tetsuo; Hayashi, Koji; Suzuki, Yutaka; Yamamoto, Jun-ichi; Wakamatsu, Ai; Kimura, Kouichi; Sakamoto, Katsuhiko; Hatano, Naoto; Kawai, Yuri; Ishii, Shizuko; Saito, Kaoru; Kojima, Shin-ichi; Sugiyama, Tomoyasu; Ono, Tetsuyoshi; Okano, Kazunori; Yoshikawa, Yoko; Aotsuka, Satoshi; Sasaki, Naokazu; Hattori, Atsushi; Okumura, Koji; Nagai, Keiichi; Sugano, Sumio; Isogai, Takao

2005-01-01

We have developed an in silico method of selection of human full-length cDNAs encoding secretion or membrane proteins from oligo-capped cDNA libraries. Fullness rates were increased to about 80% by combination of the oligo-capping method and ATGpr, software for prediction of translation start point and the coding potential. Then, using 5'-end single-pass sequences, cDNAs having the signal sequence were selected by PSORT ('signal sequence trap'). We also applied 'secretion or membrane protein-related keyword trap' based on the result of BLAST search against the SWISS-PROT database for the cDNAs which could not be selected by PSORT. Using the above procedures, 789 cDNAs were primarily selected and subjected to full-length sequencing, and 334 of these cDNAs were finally selected as novel. Most of the cDNAs (295 cDNAs: 88.3%) were predicted to encode secretion or membrane proteins. In particular, 165(80.5%) of the 205 cDNAs selected by PSORT were predicted to have signal sequences, while 70 (54.2%) of the 129 cDNAs selected by 'keyword trap' preserved the secretion or membrane protein-related keywords. Many important cDNAs were obtained, including transporters, receptors, and ligands, involved in significant cellular functions. Thus, an efficient method of selecting secretion or membrane protein-encoding cDNAs was developed by combining the above four procedures.

Salt Sensitive Tet-Off-Like Systems to Knockdown Primordial Germ Cell Genes for Repressible Transgenic Sterilization in Channel Catfish, Ictalurus punctatus

PubMed Central

Li, Hanbo; Su, Baofeng; Qin, Guyu; Ye, Zhi; Alsaqufi, Ahmed; Perera, Dayan A.; Shang, Mei; Odin, Ramjie; Vo, Khoi; Drescher, David; Robinson, Dalton; Zhang, Dan; Abass, Nermeen; Dunham, Rex A.

2017-01-01

Repressible knockdown approaches were investigated for transgenic sterilization in channel catfish, Ictalurus punctatus. Two primordial germ cell (PGC) marker genes, nanos and dead end, were targeted for knockdown, and an off-target gene, vasa, was monitored. Two potentially salt sensitive repressible promoters, zebrafish adenylosuccinate synthase 2 (ADSS) and zebrafish racemase (Rm), were each coupled with four knockdown strategies: ds-sh RNA targeting the 5′ end (N1) or 3′ end (N2) of channel catfish nanos, full-length cDNA sequence of channel catfish nanos for overexpression (cDNA) and ds-sh RNA targeting channel catfish dead end (DND). Each construct had an untreated group and treated group with sodium chloride as the repressor compound. Spawning rates of full-sibling P1 fish exposed or not exposed to the constructs as treated and untreated embryos were 93% and 59%, respectively, indicating potential sterilization of fish and repression of the constructs. Although the mRNA expression data of PGC marker genes were inconsistent in P1 fish, most F1 individuals were able to downregulate the target genes in untreated groups and repress the knockdown process in treated groups. The results indicate that repressible transgenic sterilization is feasible for reproductive control of fish, but more data from F2 or F3 are needed for evaluation. PMID:28561774

Alternative splicing originates different domain structure organization of Lutzomyia longipalpis chitinases.

PubMed

Ortigão-Farias, João Ramalho; Di-Blasi, Tatiana; Telleria, Erich Loza; Andorinho, Ana Carolina; Lemos-Silva, Thais; Ramalho-Ortigão, Marcelo; Tempone, Antônio Jorge; Traub-Csekö, Yara Maria

2018-02-01

BACKGROUND The insect chitinase gene family is composed by more than 10 paralogs, which can codify proteins with different domain structures. In Lutzomyia longipalpis, the main vector of visceral leishmaniasis in Brazil, a chitinase cDNA from adult female insects was previously characterized. The predicted protein contains one catalytic domain and one chitin-binding domain (CBD). The expression of this gene coincided with the end of blood digestion indicating a putative role in peritrophic matrix degradation. OBJECTIVES To determine the occurrence of alternative splicing in chitinases of L. longipalpis. METHODS We sequenced the LlChit1 gene from a genomic clone and the three spliced forms obtained by reverse transcription polymerase chain reaction (RT-PCR) using larvae cDNA. FINDINGS We showed that LlChit1 from L. longipalpis immature forms undergoes alternative splicing. The spliced form corresponding to the adult cDNA was named LlChit1A and the two larvae specific transcripts were named LlChit1B and LlChit1C. The B and C forms possess stop codons interrupting the translation of the CBD. The A form is present in adult females post blood meal, L4 larvae and pre-pupae, while the other two forms are present only in L4 larvae and disappear just before pupation. Two bands of the expected size were identified by Western blot only in L4 larvae. MAIN CONCLUSIONS We show for the first time alternative splicing generating chitinases with different domain structures increasing our understanding on the finely regulated digestion physiology and shedding light on a potential target for controlling L. longipalpis larval development.

Cloning, functional characterization, and expression profiles of NADPH-cytochrome P450 reductase gene from the Asiatic rice striped stem borer, Chilo suppressalis (Lepidoptera: Pyralidae).

PubMed

Liu, Su; Liang, Qing-Mei; Huang, Yuan-Jie; Yuan, Xin; Zhou, Wen-Wu; Qiao, Fei; Cheng, Jiaan; Gurr, Geoff M; Zhu, Zeng-Rong

2013-01-01

NADPH-cytochrome P450 reductase (CPR) is one of the most important components of the cytochrome P450 enzyme system. It catalyzes electron transfer from NADPH to all known P450s, thus plays central roles not only in the metabolism of exogenous xenobiotics but also in the regulation of endogenous hormones in insects. In this study, a full-length cDNA encoding of a CPR (named CsCPR) was isolated from the Asiatic rice striped stem borer, Chilo suppressalis, by using reverse transcription-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE) methods. The cDNA contains a 2061 bp open reading frame, which encodes an enzyme of 686 amino acid residues, with a calculated molecular mass of 77.6 kDa. The deduced peptide has hallmarks of typical CPR, including an N-terminal membrane anchor and the FMN, FAD and NADPH binding domains. The N-terminal-truncated protein fused with a 6 × His·tag was heterologously expressed in Escherichia coli Rosetta (DE3) cells and purified, specific activity and the Km values of the recombinant enzyme were determined. Tissue- and developmental stage-dependent expression of CsCPR mRNA was investigated by real-time quantitative PCR. The CsCPR mRNA was noticeably expressed in the digestive, metabolic, and olfactory organs of the larvae and adults of C. suppressalis. Our initial results would provide valuable information for further study on the interactions between CPR and cytochrome P450 enzyme systems. © 2013.

Sequence characterization and spatiotemporal expression patterns of PbS26-RNase gene in Chinese White Pear (Pyrus bretschneideri).

PubMed

Zhang, Lin; Jia, Baoguang; Zou, Feng; Tan, Xiaofeng; Liu, Min; Song, Zhibo; Zeng, Yanling; Jiang, Nan; Yuan, Deyi

2014-01-01

Many flowering plants exhibit an important intraspecific reproductive barrier phenomenon, that is, self-incompatibility (SI), in which S-RNase genes play a significant role. To clarify the specific function of S-RNase genes in Chinese pears, the full length cDNA of PbS 26 -RNase was isolated by rapid amplification of cDNA ends (RACE) technology from Chinese white pear (Pyrus bretschneideri) cultivar "Hongpisu." The cDNA sequence for PbS 26 -RNase was deposited in GenBank under accession number EU081888. At the amino acid level, the PbS 26 -RNase displayed the highest similarity (96.9%) with PcSa-RNase of P. communis, and only seven amino acid differences were present in the two S-RNases. Phylogenetic analysis of rosaceous S-RNases indicated that the PbS 26 -RNase clustered with maloideous S-RNases, forming a subfamily-specific not a species-specific group. The PbS 26 -RNase gene was specifically expressed in the style but not other tissues/organs. The expression level of the PbS 26 -RNase gene rapidly increased at bell balloon stage (BBS), and then it dropped after pollination. However, the abundance of the PbS 26 -RNase gene transcript in the style was greater after cross-pollination than after self-pollination. In addition, a method for rapidly detecting the PbS 26 -RNase gene was developed via allele-specific primers design. The present study could provide a scientific basis for fully clarifying the mechanism of pear SI at the molecular level.

Sequence Characterization and Spatiotemporal Expression Patterns of PbS 26 -RNase Gene in Chinese White Pear (Pyrus bretschneideri)

PubMed Central

Jia, Baoguang; Liu, Min; Song, Zhibo; Zeng, Yanling; Jiang, Nan; Yuan, Deyi

2014-01-01

Many flowering plants exhibit an important intraspecific reproductive barrier phenomenon, that is, self-incompatibility (SI), in which S-RNase genes play a significant role. To clarify the specific function of S-RNase genes in Chinese pears, the full length cDNA of PbS 26 -RNase was isolated by rapid amplification of cDNA ends (RACE) technology from Chinese white pear (Pyrus bretschneideri) cultivar “Hongpisu.” The cDNA sequence for PbS 26 -RNase was deposited in GenBank under accession number EU081888. At the amino acid level, the PbS 26 -RNase displayed the highest similarity (96.9%) with PcSa-RNase of P. communis, and only seven amino acid differences were present in the two S-RNases. Phylogenetic analysis of rosaceous S-RNases indicated that the PbS 26 -RNase clustered with maloideous S-RNases, forming a subfamily-specific not a species-specific group. The PbS 26 -RNase gene was specifically expressed in the style but not other tissues/organs. The expression level of the PbS 26 -RNase gene rapidly increased at bell balloon stage (BBS), and then it dropped after pollination. However, the abundance of the PbS 26 -RNase gene transcript in the style was greater after cross-pollination than after self-pollination. In addition, a method for rapidly detecting the PbS 26 -RNase gene was developed via allele-specific primers design. The present study could provide a scientific basis for fully clarifying the mechanism of pear SI at the molecular level. PMID:24737959

Stachyose synthesis in seeds of adzuki bean (Vigna angularis): molecular cloning and functional expression of stachyose synthase.

PubMed

Peterbauer, T; Mucha, J; Mayer, U; Popp, M; Glössl, J; Richter, A

1999-12-01

Stachyose is the major soluble carbohydrate in seeds of a number of important crop species. It is synthesized from raffinose and galactinol by the action of stachyose synthase (EC 2.4.1.67). We report here on the identification of a cDNA encoding stachyose synthase from seeds of adzuki bean (Vigna angularis Ohwi et Ohashi). Based on internal amino acid sequences of the enzyme purified from adzuki bean, oligonucleotides were designed and used to amplify corresponding sequences from adzuki bean cDNA by RT-PCR, followed by rapid amplification of cDNA ends (RACE-PCR). The complete cDNA sequence comprised 3046 nucleotides and included an open reading frame which encoded a polypeptide of 857 amino acid residues. The entire coding region was amplified by PCR, engineered into the baculovirus expression vector pVL1393 and introduced into Spodoptera frugiperda (Sf21) insect cells for heterologous expression. The recombinant protein was immunologically reactive with polyclonal antibodies raised against stachyose synthase purified from adzuki bean and was shown to be a functional stachyose synthase with the same catalytic properties as its native counterpart. High levels of stachyose synthase mRNA were transiently accumulated midway through seed development, and the enzyme was also present in mature seeds and during germination.

Construction and Cloning of Reporter-Tagged Replicon cDNA for an In Vitro Replication Study of Murine Norovirus-1 (MNV-1).

PubMed

Ahmad, Muhammad Khairi; Tabana, Yasser M; Ahmed, Mowaffaq Adam; Sandai, Doblin Anak; Mohamed, Rafeezul; Ismail, Ida Shazrina; Zulkiflie, Nurulisa; Yunus, Muhammad Amir

2017-12-01

A norovirus maintains its viability, infectivity and virulence by its ability to replicate. However, the biological mechanisms of the process remain to be explored. In this work, the NanoLuc™ Luciferase gene was used to develop a reporter-tagged replicon system to study norovirus replication. The NanoLuc™ Luciferase reporter protein was engineered to be expressed as a fusion protein for MNV-1 minor capsid protein, VP2. The foot-and-mouth disease virus 2A (FMDV2A) sequence was inserted between the 3'end of the reporter gene and the VP2 start sequence to allow co-translational 'cleavage' of fusion proteins during intracellular transcript expression. Amplification of the fusion gene was performed using a series of standard and overlapping polymerase chain reactions. The resulting amplicon was then cloned into three readily available backbones of MNV-1 cDNA clones. Restriction enzyme analysis indicated that the NanoLucTM Luciferase gene was successfully inserted into the parental MNV-1 cDNA clone. The insertion was further confirmed by using DNA sequencing. NanoLuc™ Luciferase-tagged MNV-1 cDNA clones were successfully engineered. Such clones can be exploited to develop robust experimental assays for in vitro assessments of viral RNA replication.

Cloning and expression of cDNA for a human low-K sub m , rolipram-sensitive cyclic AMP phosphodiesterase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Livi, G.P.; McHale, M.J.; Sathe, G.M.

1990-06-01

The authors have isolated cDNA clones representing cyclic AMP (cAMP)-specific phosphodiesterases (PDEases) from a human monocyte cDNA library. One cDNA clone (hPDE-1) defines a large open reading frame of ca. 2.1 kilobases, predicting a 686-amino-acid, ca. 77-kilodalton protein which contains significant homology to both rat brain and {ital Drosophila} cAMP PDEases, especially within an internal conserved domain of ca. 270 residues. Amino acid sequence divergence exists at the NH{sub 2} terminus and also within a 40- to 100-residue domain near the COOH-terminal end. hPDE-1 hybridizes to a major 4.8-kilobase mRNA transcript from both human monocytes and placenta. The coding regionmore » of hPDE-1 was engineered for expression in COS-1 cells, resulting in the overproduction of cAMP PDEase activity. The hPDE-1 recombinant gene product was identified as a low-{ital K{sub m}} cAMP phosphodiesterase on the basis of several biochemical properties including selective inhibition by the antidepressant drug rolipram. Known inhibitors of other PDEases (cGMP-specific PDEase, cGMP-inhibited PDEase) had little or no effect on the hPDE-1 recombinant gene product.« less

Base Preferences in Non-Templated Nucleotide Incorporation by MMLV-Derived Reverse Transcriptases

PubMed Central

Zajac, Pawel; Islam, Saiful; Hochgerner, Hannah; Lönnerberg, Peter; Linnarsson, Sten

2013-01-01

Reverse transcriptases derived from Moloney Murine Leukemia Virus (MMLV) have an intrinsic terminal transferase activity, which causes the addition of a few non-templated nucleotides at the 3´ end of cDNA, with a preference for cytosine. This mechanism can be exploited to make the reverse transcriptase switch template from the RNA molecule to a secondary oligonucleotide during first-strand cDNA synthesis, and thereby to introduce arbitrary barcode or adaptor sequences in the cDNA. Because the mechanism is relatively efficient and occurs in a single reaction, it has recently found use in several protocols for single-cell RNA sequencing. However, the base preference of the terminal transferase activity is not known in detail, which may lead to inefficiencies in template switching when starting from tiny amounts of mRNA. Here, we used fully degenerate oligos to determine the exact base preference at the template switching site up to a distance of ten nucleotides. We found a strong preference for guanosine at the first non-templated nucleotide, with a greatly reduced bias at progressively more distant positions. Based on this result, and a number of careful optimizations, we report conditions for efficient template switching for cDNA amplification from single cells. PMID:24392002

PMS2 gene mutational analysis: direct cDNA sequencing to circumvent pseudogene interference.

PubMed

Wimmer, Katharina; Wernstedt, Annekatrin

2014-01-01

The presence of highly homologous pseudocopies can compromise the mutation analysis of a gene of interest. In particular, when using PCR-based strategies, pseudogene co-amplification has to be effectively prevented. This is often achieved by using primers designed to be parental gene specific according to the reference sequence and by applying stringent PCR conditions. However, there are cases in which this approach is of limited utility. For example, it has been shown that the PMS2 gene exchanges sequences with one of its pseudogenes, named PMS2CL. This results in functional PMS2 alleles containing pseudogene-derived sequences at their 3'-end and in nonfunctional PMS2CL pseudogene alleles that contain gene-derived sequences. Hence, the paralogues cannot be distinguished according to the reference sequence. This shortcoming can be effectively circumvented by using direct cDNA sequencing. This approach is based on the selective amplification of PMS2 transcripts in two overlapping 1.6-kb RT-PCR products. In addition to avoiding pseudogene co-amplification and allele dropout, this method has also the advantage that it allows to effectively identify deletions, splice mutations, and de novo retrotransposon insertions that escape the detection of most DNA-based mutation analysis protocols.

[Construction of fetal mesenchymal stem cell cDNA subtractive library].

PubMed

Yang, Li; Wang, Dong-Mei; Li, Liang; Bai, Ci-Xian; Cao, Hua; Li, Ting-Yu; Pei, Xue-Tao

2002-04-01

To identify differentially expressed genes between fetal mesenchymal stem cell (MSC) and adult MSC, especially specified genes expressed in fetal MSC, a cDNA subtractive library of fetal MSC was constructed using suppression subtractive hybridization (SSH) technique. At first, total RNA was isolated from fetal and adult MSC. Using SMART PCR synthesis method, single-strand and double-strand cDNAs were synthesized. After Rsa I digestion, fetal MSC cDNAs were divided into two groups and ligated to adaptor 1 and adaptor 2 respectively. Results showed that the amplified library contains 890 clones. Analysis of 890 clones with PCR demonstrated that 768 clones were positive. The positive rate is 86.3%. The size of inserted fragments in these positive clones was between 0.2 - 1 kb, with an average of 400 - 600 bp. SSH is a convenient and effective method for screening differentially expressed genes. The constructed cDNA subtractive library of fetal MSC cDNA lays solid foundation for screening and cloning new and specific function related genes of fetal MSC.

Mutations Affecting Expression of the rosy Locus in Drosophila melanogaster

PubMed Central

Lee, Chong Sung; Curtis, Daniel; McCarron, Margaret; Love, Carol; Gray, Mark; Bender, Welcome; Chovnick, Arthur

1987-01-01

The rosy locus in Drosophila melanogaster codes for the enzyme xanthine dehydrogenase (XDH). Previous studies defined a "control element" near the 5' end of the gene, where variant sites affected the amount of rosy mRNA and protein produced. We have determined the DNA sequence of this region from both genomic and cDNA clones, and from the ry+10 underproducer strain. This variant strain had many sequence differences, so that the site of the regulatory change could not be fixed. A mutagenesis was also undertaken to isolate new regulatory mutations. We induced 376 new mutations with 1-ethyl-1-nitrosourea (ENU) and screened them to isolate those that reduced the amount of XDH protein produced, but did not change the properties of the enzyme. Genetic mapping was used to find mutations located near the 5' end of the gene. DNA from each of seven mutants was cloned and sequenced through the 5' region. Mutant base changes were identified in all seven; they appear to affect splicing and translation of the rosy mRNA. In a related study (T. P. Keith et al. 1987), the genomic and cDNA sequences are extended through the 3' end of the gene; the combined sequences define the processing pattern of the rosy transcript and predict the amino acid sequence of XDH. PMID:3036645

Gene for ataxia-telangiectasia complementation group D (ATDC)

DOEpatents

Murnane, John P.; Painter, Robert B.; Kapp, Leon N.; Yu, Loh-Chung

1995-03-07

Disclosed herein is a new gene, an AT gene for complementation group D, the ATDC gene and fragments thereof. Nucleic acid probes for said gene are provided as well as proteins encoded by said gene, cDNA therefrom, preferably a 3 kilobase (kb) cDNA, and recombinant nucleic acid molecules for expression of said proteins. Further disclosed are methods to detect mutations in said gene, preferably methods employing the polymerase chain reaction (PCR). Also disclosed are methods to detect AT genes from other AT complementation groups.

Expression of beta2-microglobulin and c-fos mRNA: is there an influence of high- or low-flux dialyzer membranes?

PubMed

Haufe, C C; Eismann, U; Deppisch, R M; Stein, G

2001-02-01

Dialysis-related amyloidosis is an important complication of long-term hemodialysis (HD) therapy with several pathogenetic factors. One of them is the influence of the dialyzer membrane type on the synthesis of beta2-microglobulin (beta2m). In vitro results are controversial. Thus, the hypothesis of whether in vivo beta2m generation is induced by the HD procedure and whether this induction depends on the type of the used dialyzer membrane should be tested. The aim of the present study was to investigate the influence of "biocompatible" high-flux versus "bioincompatible" low-flux HD on in vivo beta2m generation as well as the induction of the early activation gene c-fos in peripheral blood cells. Six nondiabetic HD patients [mean age 46 (21 to 69) years; Kt/V> 1.2] were included in a randomized crossover study using either a low-flux (cellulosic/cuprophan) or a high-flux (polyamide) dialyzer membrane. At the end of a four-week run-in period for each membrane, whole blood samples were taken before, immediately at, and four hours after the end of the dialysis session. MRNA was extracted, and after transcription to cDNA, quantitative polymerase chain reaction was performed for the beta2m gene, the early response gene c-fos, and the GAP-DH housekeeping gene. Based on the applied method for detection of specific mRNA, the results were given as ratio of beta2m or c-fos cDNA per GAP-DH cDNA. General cell activation during HD was indicated by increasing mRNA expression of c-fos related to the time course of the dialysis session, whereas beta2m did not change significantly. However, no difference was found when comparing the low-flux and the high-flux dialyzer membranes. Despite the evidence for activation of peripheral blood cells, as indicated by increasing c-fos message, no sign of beta2m mRNA induction during HD procedure with different dialyzer membranes was seen. Our results suggest that there is post-transcriptional regulation of beta2m generation and/or release as well as the influence of the dialyzer membrane type on post-translational processes, that is, advance glycation end products (AGE) or conformational modification of the beta2m protein. Furthermore, our data demonstrate that gene expression patterns during dialysis and/or uremia are not homogenous and need to be investigated further, especially with respect to the proinflammatory role of early leukocyte activation signals.

An open reading frame in intron seven of the sea urchin DNA-methyltransferase gene codes for a functional AP1 endonuclease.

PubMed

Cioffi, Anna Valentina; Ferrara, Diana; Cubellis, Maria Vittoria; Aniello, Francesco; Corrado, Marcella; Liguori, Francesca; Amoroso, Alessandro; Fucci, Laura; Branno, Margherita

2002-08-01

Analysis of the genome structure of the Paracentrotus lividus (sea urchin) DNA methyltransferase (DNA MTase) gene showed the presence of an open reading frame, named METEX, in intron 7 of the gene. METEX expression is developmentally regulated, showing no correlation with DNA MTase expression. In fact, DNA MTase transcripts are present at high concentrations in the early developmental stages, while METEX is expressed at late stages of development. Two METEX cDNA clones (Met1 and Met2) that are different in the 3' end have been isolated in a cDNA library screening. The putative translated protein from Met2 cDNA clone showed similarity with Escherichia coli endonuclease III on the basis of sequence and predictive three-dimensional structure. The protein, overexpressed in E. coli and purified, had functional properties similar to the endonuclease specific for apurinic/apyrimidinic (AP) sites on the basis of the lyase activity. Therefore the open reading frame, present in intron 7 of the P. lividus DNA MTase gene, codes for a functional AP endonuclease designated SuAP1.

Identification and characterization of a DnaJ gene from red alga Pyropia yezoensis (Bangiales, Rhodophyta)

NASA Astrophysics Data System (ADS)

Liu, Jiao; Li, Xianchao; Tang, Xuexi; Zhou, Bin

2016-03-01

Members of the DnaJ family are proteins that play a pivotal role in various cellular processes, such as protein folding, protein transport and cellular responses to stress. In the present study, we identified and characterized the full-length DnaJ cDNA sequence from expressed sequence tags of Pyropia yezoensis ( PyDnaJ) via rapid identification of cDNA ends. This cDNA encoded a protein of 429 amino acids, which shared high sequence similarity with other identified DnaJ proteins, such as a heat shock protein 40/DnaJ from Pyropia haitanensis. The relative mRNA expression level of PyDnaJ was investigated using real-time PCR to determine its specific expression during the algal life cycle and during desiccation. The relative mRNA expression level in sporophytes was higher than that in gametophytes and significantly increased during the whole desiccation process. These results indicate that PyDnaJ is an authentic member of the DnaJ family in plants and red algae and might play a pivotal role in mitigating damage to P. yezoensis during desiccation.

Molecular cloning of a cysteine proteinase cDNA from the cotton boll weevil Anthonomus grandis (Coleoptera: Curculionidae).

PubMed

De Oliveira Neto, Osmundo Brilhante; Batista, João Aguiar Nogueira; Rigden, Daniel John; Franco, Octávio Luiz; Fragoso, Rodrigo Rocha; Monteiro, Ana Carolina Santos; Monnerat, Rose Gomes; Grossi-De-Sa, Maria Fátima

2004-06-01

The cotton boll weevil (Anthonomus grandis) causes severe cotton crop losses in North and South America. This report describes the presence of cysteine proteinase activity in the cotton boll weevil. Cysteine proteinase inhibitors from different sources were assayed against total A. grandis proteinases but, unexpectedly, no inhibitor tested was particularly effective. In order to screen for active inhibitors against the boll weevil, a cysteine proteinase cDNA (Agcys1) was isolated from A. grandis larvae using degenerate primers and rapid amplification of cDNA ends (RACE) techniques. Sequence analysis showed significant homologies with other insect cysteine proteinases. Northern blot analysis indicated that the mRNA encoding the proteinase was transcribed mainly in the gut of larvae. No mRNA was detected in neonatal larvae, pupae, or in the gut of the adult insect, suggesting that Agcys1 is an important cysteine proteinase for larvae digestion. The isolated gene will facilitate the search for highly active inhibitors towards boll weevil larvae that may provide a new opportunity to control this important insect pest.

Characterization and expression of the calpastatin gene in Cyprinus carpio.

PubMed

Chen, W X; Ma, Y

2015-07-03

Calpastatin, an important protein used to regulate meat quality traits in animals, is encoded by the CAST gene. The aim of the present study was to clone the cDNA sequence of the CAST gene and detect the expression of CAST in the tissues of Cyprinus carpio. The cDNA of the C. carpio CAST gene, amplified using rapid amplification of cDNA ends PCR, is 2834 bp in length (accession No. JX275386), contains a 2634-bp open reading frame, and encodes a protein with 877 amino acid residues. The amino acid sequence of the C. carpio CAST gene was 88, 80, and 59% identical to the sequences observed in grass carp, zebrafish, and other fish, respectively. The C. carpio CAST was observed to contain four conserved domains with 54 serine phosphorylation loci, 28 threonine phosphorylation loci, 1 tyrosine phosphorylation loci, and 6 specific protein kinase C phosphorylation loci. The CAST gene showed widespread expression in different tissues of C. carpio. Surprisingly, the relative expression of the CAST transcript in the muscle and heart tissues of C. carpio was significantly higher than in other tissues (P < 0.01).

Purification and cDNA cloning of a protein derived from Flammulina velutipes that increases the permeability of the intestinal Caco-2 cell monolayer.

PubMed

Watanabe, H; Narai, A; Shimizu, M

1999-06-01

A new protein that decreases transepithelial electrical resistance (TEER) in the human intestinal Caco-2 cell monolayer was found in a water-soluble fraction of the mushroom Flammulina velutipes. This protein, termed TEER-decreasing protein (TDP), is not cytotoxic and does not induce cell detachment, but rapidly increases the tight junctional permeability for water-soluble marker substances such as Lucifer Yellow CH (Mr 457) through the paracellular pathway. TDP was isolated and purified from the aqueous extract of F. velutipes by chromatographic means. Purified TDP was found to be a simple, nonglycosylated protein without intermolecular disulfide bonds, and the apparent molecular mass as estimated by SDS/PAGE and gel filtration is 30 kDa. It was revealed that the N-terminal amino-acid sequence of purified TDP is identical to the recently reported N-terminal sequence of flammutoxin, a membrane-perturbing hemolytic protein, for which the complete primary structure has not yet been reported [Tomita, T., Ishikawa, D., Noguchi, T., Katayama, E., and Hashimoto, Y. (1998) Biochem. J. 333, 24794-24799]. The cDNA coding for TDP was cloned by 5' and 3' rapid amplification of cDNA ends. The ORF encodes a protein with 272 amino-acid residues showing no homology to known proteins. Relevant studies using TDP cDNA will provide insight into the structure-function relationships of membrane pore-forming toxins.

Cloning and sequence analysis of a cDNA clone coding for the mouse GM2 activator protein.

PubMed Central

Bellachioma, G; Stirling, J L; Orlacchio, A; Beccari, T

1993-01-01

A cDNA (1.1 kb) containing the complete coding sequence for the mouse GM2 activator protein was isolated from a mouse macrophage library using a cDNA for the human protein as a probe. There was a single ATG located 12 bp from the 5' end of the cDNA clone followed by an open reading frame of 579 bp. Northern blot analysis of mouse macrophage RNA showed that there was a single band with a mobility corresponding to a size of 2.3 kb. We deduce from this that the mouse mRNA, in common with the mRNA for the human GM2 activator protein, has a long 3' untranslated sequence of approx. 1.7 kb. Alignment of the mouse and human deduced amino acid sequences showed 68% identity overall and 75% identity for the sequence on the C-terminal side of the first 31 residues, which in the human GM2 activator protein contains the signal peptide. Hydropathicity plots showed great similarity between the mouse and human sequences even in regions of low sequence similarity. There is a single N-glycosylation site in the mouse GM2 activator protein sequence (Asn151-Phe-Thr) which differs in its location from the single site reported in the human GM2 activator protein sequence (Asn63-Val-Thr). Images Figure 1 PMID:7689829

Ranalexin. A novel antimicrobial peptide from bullfrog (Rana catesbeiana) skin, structurally related to the bacterial antibiotic, polymyxin.

PubMed

Clark, D P; Durell, S; Maloy, W L; Zasloff, M

1994-04-08

Antimicrobial peptides comprise a diverse class of molecules used in host defense by plants, insects, and animals. In this study we have isolated a novel antimicrobial peptide from the skin of the bullfrog, Rana catesbeiana. This 20 amino acid peptide, which we have termed Ranalexin, has the amino acid sequence: NH2-Phe-Leu-Gly-Gly-Leu-Ile-Lys-Ile-Val-Pro-Ala-Met-Ile-Cys-Ala-Val-Thr- Lys-Lys - Cys-COOH, and it contains a single intramolecular disulfide bond which forms a heptapeptide ring within the molecule. Structurally, Ranalexin resembles the bacterial antibiotic, polymyxin, which contains a similar heptapeptide ring. We have also cloned the cDNA for Ranalexin from a metamorphic R. catesbeiana tadpole cDNA library. Based on the cDNA sequence, it appears that Ranalexin is initially synthesized as a propeptide with a putative signal sequence and an acidic amino acid-rich region at its amino-terminal end. Interestingly, the putative signal sequence of the Ranalexin cDNA is strikingly similar to the signal sequence of opioid peptide precursors isolated from the skin of the South American frogs Phyllomedusa sauvagei and Phyllomedusa bicolor. Northern blot analysis and in situ hybridization experiments demonstrated that Ranalexin mRNA is first expressed in R. catesbeiana skin at metamorphosis and continues to be expressed into adulthood.

Isolation, cDNA cloning and gene expression of an antibacterial protein from larvae of the coconut rhinoceros beetle, Oryctes rhinoceros.

PubMed

Yang, J; Yamamoto, M; Ishibashi, J; Taniai, K; Yamakawa, M

1998-08-01

An antibacterial protein, designated rhinocerosin, was purified to homogeneity from larvae of the coconut rhinoceros beetle, Oryctes rhinoceros immunized with Escherichia coli. Based on the amino acid sequence of the N-terminal region, a degenerate primer was synthesized and reverse-transcriptase PCR was performed to clone rhinocerosin cDNA. As a result, a 279-bp fragment was obtained. The complete nucleotide sequence was determined by sequencing the extended rhinocerosin cDNA clone by 5' rapid amplification of cDNA ends. The deduced amino acid sequence of the mature portion of rhinocerosin was composed of 72 amino acids without cystein residues and was shown to be rich in glycine (11.1%) and proline (11.1%) residues. Comparison of the deduced amino acid sequence of rhinocerosin with those of other antibacterial proteins indicated that it has 77.8% and 44.6% identity with holotricin 2 and coleoptrecin, respectively. Rhinocerosin had strong antibacterial activity against E. coli, Streptococcus pyogenes, Staphylococcus aureus but not against Pseudomonas aeruginosa. Results of reverse-transcriptase PCR analysis of gene expression in different tissues indicated that the rhinocerosin gene is strongly expressed in the fat body and the Malpighian tubule, and weakly expressed in hemocytes and midgut. In addition, gene expression was inducible by bacteria in the fat body, the Malpighian tubule and hemocyte but constitutive expression was observed in the midgut.

Transcriptional regulation of human retinoic acid receptor-alpha (RAR-{alpha}) by Wilms` tumour gene product

DOE Office of Scientific and Technical Information (OSTI.GOV)

Goodyer, P.R.; Torban, E.; Dehbi, M.

1994-09-01

The Wilms` tumor gene encodes a 47-49 kDa transcription factor expressed in kidney, gonads and mesothelium during embryogenesis. Inherited mutations of WT1 lead to aberrant urogenital development and Wilms` tumor, but the role of WT1 in development is not fully understood. Since the human RAR-{alpha} gene contains a potential WT1 binding site at its 5{prime} end, we studied the effect of WT1 co-transfection on expression of an RAR-{alpha} promoter/CAT reporter construct in COS cells. COS cells were plated at 5X10{sup 5} cells/dish in DMEM with 10% FBS and transfected by the Ca/PO4 method with an expression plasmid containing the full-lengthmore » WT1 (-/-) cDNA under the control of the CMV promoter, plasmid containing the RAR-{alpha} promoter (-519 to +36)/CAT reporter and TK/growth hormone plasmid to control for efficiency of transfection. CAT/GH activity at 48 hours was inhibited by co-transfection with increasing amounts of WT1 (-/-); maximum inhibition = 5% of control. WT1 co-transfection did not affect expression of TKGH, nor of a CMV-CAT vector. Expression of WT1 protein in tranfected COS cells was demonstrated by Western blotting. Minimal inhibiton of RAR-{alpha}/CAT activity was seen when cells were co-transfected with vectors containing WT1 deletion mutants, alternate WT1 splicing variants, or WT1 (-/-) cDNA bearing a mutation identified in a patient with Drash syndrome. Gel shift assays indicated binding of WT1 to RAR-{alpha} cDNA but not to an RAR-{alpha} deletion mutant lacking the GCGGGGGGCG site. These observations suggest that WT1 may function to regulate RAR-{alpha} expression during normal development.« less

Molecular characterisation of tumour necrosis factor alpha and its potential connection with lipoprotein lipase and peroxisome proliferator-activated receptors in blunt snout bream (Megalobrama amblycephala).

PubMed

Zhou, Man; Mi, Hai-Feng; Liu, Wen-Bin; Wu, Ye-Yang; Wang, Kai-Zhou; Jiang, Guang-Zhen

2017-08-01

Tumour necrosis factor alpha (TNF-α) is one kind of cytokines which is related to inflammation and lipid metabolism. TNF-α cDNA was cloned from the liver of blunt snout bream (Megalobrama amblycephala) through real-time polymerase chain reaction (PCR) and rapid amplification of cDNA ends (RACE) methods. The full-length cDNA of TNF-α covered 1467 bp, with an open reading frame (ORF) of 723 bp, which encodes 240 amino acids. It possessed the TNF family signature IIIPDDGIYFVYSQ. After the lipopolysaccharide (LPS) challenge test, a graded tissue-specific expression pattern of TNF-α was observed and there was high expression abundance in the kidney, brain and liver. After 8 weeks feeding trial, liver samples, two groups fed with 6% and 11% lipid levels, were collected. The results showed that, for fish fed with high-fat diet, the triglyceride of serum and lipid content of liver were elevated. Furthermore, TNF-α and peroxisome proliferator-activated receptors (PPARα, β) mRNA expression of fish fed 11% lipid diet were significantly up-regulated (p < 0.05). Lipoprotein lipase (LPL) and PPARγ mRNA expression of fish fed 11% lipid lever diet were significantly decreased compared to those of fish fed 6% (p < 0.05). The differences between the various expression of related genes in the high and low fat groups demonstrated that TNF-α played a key role in lipid metabolism, which may have an influence on fat metabolism through reducing fat synthesis and strengthening the β-oxidation of fatty acid. These discrepancies warrant further research.

Alternative splicing originates different domain structure organization of Lutzomyia longipalpis chitinases

PubMed Central

Ortigão-Farias, João Ramalho; Di-Blasi, Tatiana; Telleria, Erich Loza; Andorinho, Ana Carolina; Lemos-Silva, Thais; Ramalho-Ortigão, Marcelo; Tempone, Antônio Jorge; Traub-Csekö, Yara Maria

2018-01-01

BACKGROUND The insect chitinase gene family is composed by more than 10 paralogs, which can codify proteins with different domain structures. In Lutzomyia longipalpis, the main vector of visceral leishmaniasis in Brazil, a chitinase cDNA from adult female insects was previously characterized. The predicted protein contains one catalytic domain and one chitin-binding domain (CBD). The expression of this gene coincided with the end of blood digestion indicating a putative role in peritrophic matrix degradation. OBJECTIVES To determine the occurrence of alternative splicing in chitinases of L. longipalpis. METHODS We sequenced the LlChit1 gene from a genomic clone and the three spliced forms obtained by reverse transcription polymerase chain reaction (RT-PCR) using larvae cDNA. FINDINGS We showed that LlChit1 from L. longipalpis immature forms undergoes alternative splicing. The spliced form corresponding to the adult cDNA was named LlChit1A and the two larvae specific transcripts were named LlChit1B and LlChit1C. The B and C forms possess stop codons interrupting the translation of the CBD. The A form is present in adult females post blood meal, L4 larvae and pre-pupae, while the other two forms are present only in L4 larvae and disappear just before pupation. Two bands of the expected size were identified by Western blot only in L4 larvae. MAIN CONCLUSIONS We show for the first time alternative splicing generating chitinases with different domain structures increasing our understanding on the finely regulated digestion physiology and shedding light on a potential target for controlling L. longipalpis larval development. PMID:29236932

A genotype independent, full-genome reverse-transcription protocol for HCV genotyping and resistance testing.

PubMed

Walker, Andreas; Bergmann, Matthias; Camdereli, Jennifer; Kaiser, Rolf; Lübke, Nadine; Timm, Jörg

2017-06-01

HCV treatment options and cure rates have tremendously increased in the last decade. Although a pan-genotype HCV treatment has recently been approved, most DAA therapies are still genotype specific. Resistance-associated variants (RAVs) can limit the efficacy of DAA therapy and are associated with increased risk for therapy failure. With the approval of DAA regimens that recommend resistance testing prior to therapy, correct assessment of the genotype and testing for viruses with RAVs is clinically relevant. However, genotyping and resistance testing is generally done in costly and laborious separate reactions. The aim of the study was to establish a genotype-independent full-genome reverse transcription protocol to generate a template for both genotyping and resistance testing and to implement it into our routine diagnostic setup. The complete HCV genome was reverse transcribed with a pan-genotype primer binding at the 3'end of the viral RNA. This cDNA served as template for transcription of the genotyping amplicon in the core region as well as for the resistance testing of NS3, NS5A, and NS5B. With the established RT-protocol the HCV core region was successfully amplified and genotyped from 124 out of 125 (99.2%) HCV-positive samples. The amplification efficiency of RAV containing regions in NS3, NS5A, NS5B was 96.2%, 96.6% and 94.4%, respectively. We developed a method for HCV full-genome cDNA synthesis and implemented it into a routine diagnostic setup. This cDNA can be used as template for genotyping amplicons covering the core or NS5B region as well as for resistance testing amplicons in NS3, NS5A and NS5B. Copyright © 2017 Elsevier B.V. All rights reserved.

Physiological and Molecular Biological Characterization of Intracellular Carbonic Anhydrase from the Marine Diatom Phaeodactylum tricornutum1

PubMed Central

Satoh, Dan; Hiraoka, Yasutaka; Colman, Brian; Matsuda, Yusuke

2001-01-01

A single intracellular carbonic anhydrase (CA) was detected in air-grown and, at reduced levels, in high CO2-grown cells of the marine diatom Phaeodactylum tricornutum (UTEX 642). No external CA activity was detected irrespective of growth CO2 conditions. Ethoxyzolamide (0.4 mm), a CA-specific inhibitor, severely inhibited high-affinity photosynthesis at low concentrations of dissolved inorganic carbon, whereas 2 mm acetazolamide had little effect on the affinity for dissolved inorganic carbon, suggesting that internal CA is crucial for the operation of a carbon concentrating mechanism in P. tricornutum. Internal CA was purified 36.7-fold of that of cell homogenates by ammonium sulfate precipitation, and two-step column chromatography on diethylaminoethyl-sephacel and p-aminomethylbenzene sulfone amide agarose. The purified CA was shown, by SDS-PAGE, to comprise an electrophoretically single polypeptide of 28 kD under both reduced and nonreduced conditions. The entire sequence of the cDNA of this CA was obtained by the rapid amplification of cDNA ends method and indicated that the cDNA encodes 282 amino acids. Comparison of this putative precursor sequence with the N-terminal amino acid sequence of the purified CA indicated that it included a possible signal sequence of up to 46 amino acids at the N terminus. The mature CA was found to consist of 236 amino acids and the sequence was homologous to β-type CAs. Even though the zinc-ligand amino acid residues were shown to be completely conserved, the amino acid residues that may constitute a CO2-binding site appeared to be unique among the β-CAs so far reported. PMID:11500545

A Rapid and Improved Method to Generate Recombinant Dengue Virus Vaccine Candidates

PubMed Central

Govindarajan, Dhanasekaran; Guan, Liming; Meschino, Steven; Fridman, Arthur; Bagchi, Ansu; Pak, Irene; ter Meulen, Jan; Casimiro, Danilo R.; Bett, Andrew J.

2016-01-01

Dengue is one of the most important mosquito-borne infections accounting for severe morbidity and mortality worldwide. Recently, the tetravalent chimeric live attenuated Dengue vaccine Dengvaxia® was approved for use in several dengue endemic countries. In general, live attenuated vaccines (LAV) are very efficacious and offer long-lasting immunity against virus-induced disease. Rationally designed LAVs can be generated through reverse genetics technology, a method of generating infectious recombinant viruses from full length cDNA contained in bacterial plasmids. In vitro transcribed (IVT) viral RNA from these infectious clones is transfected into susceptible cells to generate recombinant virus. However, the generation of full-length dengue virus cDNA clones can be difficult due to the genetic instability of viral sequences in bacterial plasmids. To circumvent the need for a single plasmid containing a full length cDNA, in vitro ligation of two or three cDNA fragments contained in separate plasmids can be used to generate a full-length dengue viral cDNA template. However, in vitro ligation of multiple fragments often yields low quality template for IVT reactions, resulting in inconsistent low yield RNA. These technical difficulties make recombinant virus recovery less efficient. In this study, we describe a simple, rapid and efficient method of using LONG-PCR to recover recombinant chimeric Yellow fever dengue (CYD) viruses as potential dengue vaccine candidates. Using this method, we were able to efficiently generate several viable recombinant viruses without introducing any artificial mutations into the viral genomes. We believe that the techniques reported here will enable rapid and efficient recovery of recombinant flaviviruses for evaluation as vaccine candidates and, be applicable to the recovery of other RNA viruses. PMID:27008550

A Rapid and Improved Method to Generate Recombinant Dengue Virus Vaccine Candidates.

PubMed

Govindarajan, Dhanasekaran; Guan, Liming; Meschino, Steven; Fridman, Arthur; Bagchi, Ansu; Pak, Irene; ter Meulen, Jan; Casimiro, Danilo R; Bett, Andrew J

2016-01-01

Dengue is one of the most important mosquito-borne infections accounting for severe morbidity and mortality worldwide. Recently, the tetravalent chimeric live attenuated Dengue vaccine Dengvaxia® was approved for use in several dengue endemic countries. In general, live attenuated vaccines (LAV) are very efficacious and offer long-lasting immunity against virus-induced disease. Rationally designed LAVs can be generated through reverse genetics technology, a method of generating infectious recombinant viruses from full length cDNA contained in bacterial plasmids. In vitro transcribed (IVT) viral RNA from these infectious clones is transfected into susceptible cells to generate recombinant virus. However, the generation of full-length dengue virus cDNA clones can be difficult due to the genetic instability of viral sequences in bacterial plasmids. To circumvent the need for a single plasmid containing a full length cDNA, in vitro ligation of two or three cDNA fragments contained in separate plasmids can be used to generate a full-length dengue viral cDNA template. However, in vitro ligation of multiple fragments often yields low quality template for IVT reactions, resulting in inconsistent low yield RNA. These technical difficulties make recombinant virus recovery less efficient. In this study, we describe a simple, rapid and efficient method of using LONG-PCR to recover recombinant chimeric Yellow fever dengue (CYD) viruses as potential dengue vaccine candidates. Using this method, we were able to efficiently generate several viable recombinant viruses without introducing any artificial mutations into the viral genomes. We believe that the techniques reported here will enable rapid and efficient recovery of recombinant flaviviruses for evaluation as vaccine candidates and, be applicable to the recovery of other RNA viruses.

Phosducin-like protein: an ethanol-responsive potential modulator of guanine nucleotide-binding protein function.

PubMed

Miles, M F; Barhite, S; Sganga, M; Elliott, M

1993-11-15

Acute and chronic exposure to ethanol produces specific changes in several signal transduction cascades. Such alterations in signaling are thought to be a crucial aspect of the central nervous system's adaptive response, which occurs with chronic exposure to ethanol. We have recently identified and isolated several genes whose expression is specifically induced by ethanol in neural cell cultures. The product of one of these genes has extensive sequence homology to phosducin, a phosphoprotein expressed in retina and pineal gland that modulates trimeric guanine nucleotide-binding protein (G protein) function by binding to G-protein beta gamma subunits. We identified from a rat brain cDNA library an isolate encoding the phosducin-like protein (PhLP), which has 41% identity and 65% amino acid homology to phosducin. PhLP cDNA is expressed in all tissues screened by RNA blot-hybridization analysis and shows marked evolutionary conservation on Southern hybridization. We have identified four forms of PhLP cDNA varying only in their 5' ends, probably due to alternative splicing. This 5'-end variation generates two predicted forms of PhLP protein that differ by 79 aa at the NH2 terminus. Treatment of NG108-15 cells for 24 hr with concentrations of ethanol seen in actively drinking alcoholics (25-100 mM) causes up to a 3-fold increase in PhLP mRNA levels. Induction of PhLP by ethanol could account for at least some of the widespread alterations in signal transduction and G-protein function that are known to occur with chronic exposure to ethanol.

Isolation of candidate genes of Friedreich`s ataxia on chromosome 9q13

DOE Office of Scientific and Technical Information (OSTI.GOV)

Montermini, L.; Zara, F.; Pandolfo, M.

1994-09-01

Friedreich`s ataxia (FRDA) is an autosomal recessive degenerative disease involving the central and peripheral nervous system and the heart. The mutated gene in FRDA has recently been localized within a 450 Kb interval on chromosome 9q13 between the markers D9S202/FR1/FR8. We have been able to confirm such localization for the disease gene by analysis of extended haplotype in consanguineous families. Cases of loss of marker homozygosity, which are likely to be due to ancient recombinations, have been found to involve D9S110, D9S15, and D9S111 on the telomeric side, and FR5 on the centromeric side, while homozygosity was always found formore » a core haplotype including D9S5, FD1, and D9S202. We constructed a YAC contig spanning the region between the telomeric markers and FR5, and cosmids have been obtained from the YACs. In order to isolate transcribed sequences from the FRDA candidate region we are utilizing a combination of approaches, including hybridization of YACs and cosmids to an arrayed human heart cDNA library, cDNA direct selection, and exon amplification. A transcribed sequence near the telomeric end of the region has been isolated by cDNA direct selection using pooled cosmids as genomic template and primary human heart, muscle, brain, liver and placenta cDNAs as cDNA source. We have shown this sequence to be the human equivalent of ZO-2, a tight junction protein previously described in the dog. No mutations of this gene have been found in FRDA subjects. Additional cDNA have recently been isolated and they are currently being evaluated.« less

A general strategy for cloning viroids and other small circular RNAs that uses minimal amounts of template and does not require prior knowledge of its sequence.

PubMed

Navarro, B; Daròs, J A; Flores, R

1996-01-01

Two PCR-based methods are described for obtaining clones of small circular RNAs of unknown sequence and for which only minute amounts are available. To avoid introducing any assumption about the RNA sequence, synthesis of the cDNAs is initiated with random primers. The cDNA population is then PCR-amplified using a primer whose sequence is present at both sides of the cDNAs, since they have been obtained with random hexamers and then a linker with the sequence of the PCR primer has been ligated to their termini, or because the cDNAs have been synthesized with an oligonucleotide that contains the sequence of the PCR primer at its 5' end and six randomized positions at its 3' end. The procedures need only approximately 50 ng of purified RNA template. The reasons for the emergence of cloning artifacts and precautions to avoid them are discussed.

Soldier caste-specific gene expression in the mandibular glands of Hodotermopsis japonica (Isoptera: Termopsidae)

PubMed Central

Miura, Toru; Kamikouchi, Azusa; Sawata, Miyuki; Takeuchi, Hideaki; Natori, Syunji; Kubo, Takeo; Matsumoto, Tadao

1999-01-01

Although “polymorphic castes” in social insects are well known as one of the most important phenomena of polyphenism, few studies of caste-specific gene expressions have been performed in social insects. To identify genes specifically expressed in the soldier caste of the Japanese damp-wood termite Hodotermopsis japonica, we employed the differential-display method using oligo(dT) and arbitrary primers, compared mRNA from the heads of mature soldiers and pseudergates (worker caste), and identified a clone (PCR product) 329 bp in length termed SOL1. Northern blot analysis showed that the SOL1 mRNA is about 1.0 kb in length and is expressed specifically in mature soldiers, but not in pseudergates, even in the presoldier induction by juvenile hormone analogue, suggesting that the product is specific for terminally differentiated soldiers. By using the method of 5′- and 3′-rapid amplification of cDNA ends, we isolated the full length of SOL1 cDNA, which contained an ORF with a putative signal peptide at the N terminus. The sequence showed no significant homology with any other known protein sequences. In situ hybridization analysis showed that SOL1 is expressed specifically in the mandibular glands. These results strongly suggest that the SOL1 gene encodes a secretory protein specifically synthesized in the mandibular glands of the soldiers. Histological observations revealed that the gland actually develops during the differentiation into the soldier caste. PMID:10570166

Probe-Directed Degradation (PDD) for Flexible Removal of Unwanted cDNA Sequences from RNA-Seq Libraries.

PubMed

Archer, Stuart K; Shirokikh, Nikolay E; Preiss, Thomas

2015-04-01

Most applications for RNA-seq require the depletion of abundant transcripts to gain greater coverage of the underlying transcriptome. The sequences to be targeted for depletion depend on application and species and in many cases may not be supported by commercial depletion kits. This unit describes a method for generating RNA-seq libraries that incorporates probe-directed degradation (PDD), which can deplete any unwanted sequence set, with the low-bias split-adapter method of library generation (although many other library generation methods are in principle compatible). The overall strategy is suitable for applications requiring customized sequence depletion or where faithful representation of fragment ends and lack of sequence bias is paramount. We provide guidelines to rapidly design specific probes against the target sequence, and a detailed protocol for library generation using the split-adapter method including several strategies for streamlining the technique and reducing adapter dimer content. Copyright © 2015 John Wiley & Sons, Inc.

Gene for ataxia-telangiectasia complementation group D (ATDC)

DOEpatents

Murnane, J.P.; Painter, R.B.; Kapp, L.N.; Yu, L.C.

1995-03-07

Disclosed herein is a new gene, an AT gene for complementation group D, the ATDC gene and fragments thereof. Nucleic acid probes for the gene are provided as well as proteins encoded by the gene, cDNA therefrom, preferably a 3 kilobase (kb) cDNA, and recombinant nucleic acid molecules for expression of the proteins. Further disclosed are methods to detect mutations in the gene, preferably methods employing the polymerase chain reaction (PCR). Also disclosed are methods to detect AT genes from other AT complementation groups. 30 figs.

Molecular Characterization of the Skate Peripherin/rds Gene: Relationship to Its Orthologues and Paralogues

PubMed Central

Li, Chibo; Ding, Xi-Qin; O’Brien, John; Al-Ubaidi, Muayyad R.

2010-01-01

PURPOSE A great deal of information about functionally significant domains of a protein may be obtained by comparison of primary sequences of gene homologues over a broad phylogenetic base. This study was designed to identify evolutionarily conserved domains of the photoreceptor disc membrane protein peripherin/rds by analysis of the homologue in a primitive vertebrate, the skate. METHODS A skate retinal cDNA library was screened using a mouse peripherin/rds clone. The 5′ and 3′ untranslated regions of the skate peripherin/rds (srds) cDNA were isolated by the rapid amplification of cDNA ends (RACE) approach. The gene structure was characterized by PCR amplification and sequencing of genomic fragments. Northern and Western blot analyses were used to identify srds transcript and protein, respectively. RESULTS A new homologue of peripherin/rds was identified from the skate retinal cDNA library. SRDS is a glycoprotein with a predicted molecular mass of 40.2 kDa. The srds gene consists of two exons and one small intron and transcribes into a single 6-kb message. Phylogenetic analysis places SRDS at the base of peripherin/rds family and near the division of that group and the branch leading to rds-like and rom-1 genes. SRDS protein is 54.5% identical with peripherin/rds across species. Identity is significantly higher (73%) in the intradiscal domains. Sequence comparison revealed the conservation of all residues that have been shown, on mutation, to associate with retinitis pigmentosa and showed conservation of most residues associated with macular dystrophies. Comparison with ROM-1 and other rds-like proteins revealed the presence of a highly conserved domain in the large intradiscal loop. CONCLUSIONS Srds represents the skate orthologue of mammalian peripherin/rds genes. Conservation of most of the residues associated with human retinal diseases indicates that these residues serve important functional roles. The high degree of conservation of a short stretch within the large intradiscal loop also suggests an important function for this domain. PMID:12766040

Association of an SNP in a novel DREB2-like gene SiDREB2 with stress tolerance in foxtail millet [Setaria italica (L.)].

PubMed

Lata, Charu; Bhutty, Sarita; Bahadur, Ranjit Prasad; Majee, Manoj; Prasad, Manoj

2011-06-01

The DREB genes code for important plant transcription factors involved in the abiotic stress response and signal transduction. Characterization of DREB genes and development of functional markers for effective alleles is important for marker-assisted selection in foxtail millet. Here the characterization of a cDNA (SiDREB2) encoding a putative dehydration-responsive element-binding protein 2 from foxtail millet and the development of an allele-specific marker (ASM) for dehydration tolerance is reported. A cDNA clone (GenBank accession no. GT090998) coding for a putative DREB2 protein was isolated as a differentially expressed gene from a 6 h dehydration stress SSH library. A 5' RACE (rapid amplification of cDNA ends) was carried out to obtain the full-length cDNA, and sequence analysis showed that SiDREB2 encoded a polypeptide of 234 amino acids with a predicted mol. wt of 25.72 kDa and a theoretical pI of 5.14. A theoretical model of the tertiary structure shows that it has a highly conserved GCC-box-binding N-terminal domain, and an acidic C-terminus that acts as an activation domain for transcription. Based on its similarity to AP2 domains, SiDREB2 was classified into the A-2 subgroup of the DREB subfamily. Quantitative real-time PCR analysis showed significant up-regulation of SiDREB2 by dehydration (polyethylene glycol) and salinity (NaCl), while its expression was less affected by other stresses. A synonymous single nucleotide polymorphism (SNP) associated with dehydration tolerance was detected at the 558th base pair (an A/G transition) in the SiDREB2 gene in a core set of 45 foxtail millet accessions used. Based on the identified SNP, three primers were designed to develop an ASM for dehydration tolerance. The ASM produced a 261 bp fragment in all the tolerant accessions and produced no amplification in the sensitive accessions. The use of this ASM might be faster, cheaper, and more reproducible than other SNP genotyping methods, and thus will enable marker-aided breeding of foxtail millet for dehydration tolerance.

Isolation and functional identification of a novel cDNA for astaxanthin biosynthesis from Haematococcus pluvialis, and astaxanthin synthesis in Escherichia coli.

PubMed

Kajiwara, S; Kakizono, T; Saito, T; Kondo, K; Ohtani, T; Nishio, N; Nagai, S; Misawa, N

1995-10-01

We succeeded in isolating a novel cDNA involved in astaxanthin biosynthesis from the green alga Haematococcus pluvialis, by an expression cloning method using an Escherichia coli transformant as a host that synthesizes beta-carotene due to the Erwinia uredovora carotenoid biosynthesis genes. The cloned cDNA was shown to encode a novel enzyme, beta-carotene ketolase (beta-carotene oxygenase), which converted beta-carotene to canthaxanthin via echinenone, through chromatographic and spectroscopic analysis of the pigments accumulated in an E. coli transformant. This indicates that the encoded enzyme is responsible for the direct conversion of methylene to keto groups, a mechanism that usually requires two different enzymatic reactions proceeding via a hydroxy intermediate. Northern blot analysis showed that the mRNA was synthesized only in the cyst cells of H. pluvialis. E. coli carrying the H. pluvialis cDNA and the E. uredovora genes required for zeaxanthin biosynthesis was also found to synthesize astaxanthin (3S, 3'S), which was identified after purification by a variety of spectroscopic methods.

Cloning, expression, and purification of a new antimicrobial peptide gene from Musca domestica larva.

PubMed

Pei, Zhihua; Sun, Xiaoning; Tang, Yan; Wang, Kai; Gao, Yunhang; Ma, Hongxia

2014-10-01

Musca domestica (Diptera: Muscidae), the housefly, exhibits unique immune defences and can produce antimicrobial peptides upon stimulation with bacteria. Based on the cDNA library constructed using the suppression subtractive hybridization (SSH) method, a 198-bp antimicrobial peptide gene, which we named MDAP-2, was amplified by rapid amplification of cDNA ends (RACE) from M. domestica larvae stimulated with Salmonella pullorum (Enterobacteriaceae: Salmonella). In the present study, the full-length MDAP-2 gene was cloned and inserted into a His-tagged Escherichia coli prokaryotic expression system to enable production of the recombinant peptide. The recombinant MDAP-2 peptide was purified using Ni-NTA HisTrap FF crude column chromatography. The bacteriostatic activity of the recombinant purified MDAP-2 protein was assessed. The results indicated that MDAP-2 had in vitro antibacterial activity against all of the tested Gram- bacteria from clinical isolates, including E. coli (Enterobacteriaceae: Escherichia), one strain of S. pullorum (Enterobacteriaceae: Salmonella), and one strain of Pasteurella multocida. DNA sequencing and BLAST analysis showed that the MDAP-2 antimicrobial peptide gene was not homologous to any other antimicrobial peptide genes in GenBank. The antibacterial mechanisms of the newly discovered MDAP-2 peptide warrant further study. Copyright © 2014 Elsevier B.V. All rights reserved.

First complete genome sequence of an emerging cucumber green mottle mosaic virus isolate in North America

USDA-ARS?s Scientific Manuscript database

The complete genome sequence (6,423 nt) of an emerging Cucumber green mottle mosaic virus (CGMMV) isolate on cucumber in North America was determined through deep sequencing of sRNA and rapid amplification of cDNA ends. It shares 99% nucleotide sequence identity to the Asian genotype, but only 90% t...

Regulation of 4CL, encoding 4-coumarate: coenzyme A ligase, expression in kenaf under diverse stress conditions

USDA-ARS?s Scientific Manuscript database

We cloned the full length 4CL ortholog encoding 4-coumarate: coenzymeA ligase from kenaf (Hibiscus cannabiuns) using degenerate primers and RACE (rapid amplification of cDNA ends) systems. The 4CL is a key regulatory enzyme of the phenylpropanoid pathway that regulates the activation of cinnamic ac...

Rapid in silico cloning of genes using expressed sequence tags (ESTs).

PubMed

Gill, R W; Sanseau, P

2000-01-01

Expressed sequence tags (ESTs) are short single-pass DNA sequences obtained from either end of cDNA clones. These ESTs are derived from a vast number of cDNA libraries obtained from different species. Human ESTs are the bulk of the data and have been widely used to identify new members of gene families, as markers on the human chromosomes, to discover polymorphism sites and to compare expression patterns in different tissues or pathologies states. Information strategies have been devised to query EST databases. Since most of the analysis is performed with a computer, the term "in silico" strategy has been coined. In this chapter we will review the current status of EST databases, the pros and cons of EST-type data and describe possible strategies to retrieve meaningful information.

Adenylylation of small RNA sequencing adapters using the TS2126 RNA ligase I.

PubMed

Lama, Lodoe; Ryan, Kevin

2016-01-01

Many high-throughput small RNA next-generation sequencing protocols use 5' preadenylylated DNA oligonucleotide adapters during cDNA library preparation. Preadenylylation of the DNA adapter's 5' end frees from ATP-dependence the ligation of the adapter to RNA collections, thereby avoiding ATP-dependent side reactions. However, preadenylylation of the DNA adapters can be costly and difficult. The currently available method for chemical adenylylation of DNA adapters is inefficient and uses techniques not typically practiced in laboratories profiling cellular RNA expression. An alternative enzymatic method using a commercial RNA ligase was recently introduced, but this enzyme works best as a stoichiometric adenylylating reagent rather than a catalyst and can therefore prove costly when several variant adapters are needed or during scale-up or high-throughput adenylylation procedures. Here, we describe a simple, scalable, and highly efficient method for the 5' adenylylation of DNA oligonucleotides using the thermostable RNA ligase 1 from bacteriophage TS2126. Adapters with 3' blocking groups are adenylylated at >95% yield at catalytic enzyme-to-adapter ratios and need not be gel purified before ligation to RNA acceptors. Experimental conditions are also reported that enable DNA adapters with free 3' ends to be 5' adenylylated at >90% efficiency. © 2015 Lama and Ryan; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Sharpening spots: correcting for bleedover in cDNA array images.

PubMed

Therneau, Terry; Tschumper, Renee C; Jelinek, Diane

2002-03-01

For cDNA array methods that depend on imaging of a radiolabel, we show that bleedover of one spot onto another, due to the gap between the array and the imaging media, can be a major problem. The images can be sharpened, however, using a blind convolution method based on the EM algorithm. The sharpened images look like a set of donuts, which concurs with our knowledge of the spotting process. Oversharpened images are actually useful as well, in locating the centers of each spot.

Structure, inheritance, and expression of hybrid poplar (Populus trichocarpa x Populus deltoides) phenylalanine ammonia-lyase genes.

PubMed Central

Subramaniam, R; Reinold, S; Molitor, E K; Douglas, C J

1993-01-01

A heterologous probe encoding phenylalanine ammonia-lyase (PAL) was used to identify PAL clones in cDNA libraries made with RNA from young leaf tissue of two Populus deltoides x P. trichocarpa F1 hybrid clones. Sequence analysis of a 2.4-kb cDNA confirmed its identity as a full-length PAl clone. The predicted amino acid sequence is conserved in comparison with that of PAL genes from several other plants. Southern blot analysis of popular genomic DNA from parental and hybrid individuals, restriction site polymorphism in PAL cDNA clones, and sequence heterogeneity in the 3' ends of several cDNA clones suggested that PAL is encoded by at least two genes that can be distinguished by HindIII restriction site polymorphisms. Clones containing each type of PAL gene were isolated from a poplar genomic library. Analysis of the segregation of PAL-specific HindIII restriction fragment-length polymorphisms demonstrated the existence of two independently segregating PAL loci, one of which was mapped to a linkage group of the poplar genetic map. Developmentally regulated PAL expression in poplar was analyzed using RNA blots. Highest expression was observed in young stems, apical buds, and young leaves. Expression was lower in older stems and undetectable in mature leaves. Cellular localization of PAL expression by in situ hybridization showed very high levels of expression in subepidermal cells of leaves early during leaf development. In stems and petioles, expression was associated with subepidermal cells and vascular tissues. PMID:8108506

Expression analysis of a novel pyridoxal kinase messenger RNA splice variant, PKL, in oil rape suffering abiotic stress and phytohormones.

PubMed

Yu, Shunwu; Luo, Lijun

2008-12-01

Pyridoxal kinase is key enzyme for the biosynthesis of pyridoxal 5'-phosphate, the biologically active form of vitamin B6, in the salvage pathway. A pyridoxal kinase gene, BnPKL (GenBank accession No. DQ463962), was isolated from oilseed rape (Brassica napus L.) following water stress through rapid amplification of complementary DNA (cDNA) ends. The results showed that the gene had two splice variants: PKL and PKL2. PKL, the long cDNA, encodes a 334 amino acid protein with a complete ATP-binding site, pyridoxal kinase-binding site and dimer interface site of a pyridoxal kinase, while PKL2, the short cDNA, lacked a partial domain. Southern blot showed that there were two copies in Brassica napus. The expression of BnPKL cDNA could rescue the mutant phenotype of Escherichia coli defective in pyridoxal kinase. Real-time reverse transcription-polymerase chain reaction revealed that the relative abundance of two transcripts are modulated by development and environmental stresses. Abscisic acid and NaCl were inclined to decrease PKL expression, but H2O2 and cold temperatures induced the PKL expression. In addition, the PKL expression could be transiently induced by jasmonate acid at an early stage, abscisic acid, salicylic acid and jasmonate acid enhanced the PKL expression in roots. Our results demonstrated that BnPKL was a pyridoxal kinase involved in responses to biotic and abiotic stresses.

Targeting a Complex Transcriptome: The Construction of the Mouse Full-Length cDNA Encyclopedia

PubMed Central

Carninci, Piero; Waki, Kazunori; Shiraki, Toshiyuki; Konno, Hideaki; Shibata, Kazuhiro; Itoh, Masayoshi; Aizawa, Katsunori; Arakawa, Takahiro; Ishii, Yoshiyuki; Sasaki, Daisuke; Bono, Hidemasa; Kondo, Shinji; Sugahara, Yuichi; Saito, Rintaro; Osato, Naoki; Fukuda, Shiro; Sato, Kenjiro; Watahiki, Akira; Hirozane-Kishikawa, Tomoko; Nakamura, Mari; Shibata, Yuko; Yasunishi, Ayako; Kikuchi, Noriko; Yoshiki, Atsushi; Kusakabe, Moriaki; Gustincich, Stefano; Beisel, Kirk; Pavan, William; Aidinis, Vassilis; Nakagawara, Akira; Held, William A.; Iwata, Hiroo; Kono, Tomohiro; Nakauchi, Hiromitsu; Lyons, Paul; Wells, Christine; Hume, David A.; Fagiolini, Michela; Hensch, Takao K.; Brinkmeier, Michelle; Camper, Sally; Hirota, Junji; Mombaerts, Peter; Muramatsu, Masami; Okazaki, Yasushi; Kawai, Jun; Hayashizaki, Yoshihide

2003-01-01

We report the construction of the mouse full-length cDNA encyclopedia,the most extensive view of a complex transcriptome,on the basis of preparing and sequencing 246 libraries. Before cloning,cDNAs were enriched in full-length by Cap-Trapper,and in most cases,aggressively subtracted/normalized. We have produced 1,442,236 successful 3′-end sequences clustered into 171,144 groups, from which 60,770 clones were fully sequenced cDNAs annotated in the FANTOM-2 annotation. We have also produced 547,149 5′ end reads,which clustered into 124,258 groups. Altogether, these cDNAs were further grouped in 70,000 transcriptional units (TU),which represent the best coverage of a transcriptome so far. By monitoring the extent of normalization/subtraction, we define the tentative equivalent coverage (TEC),which was estimated to be equivalent to >12,000,000 ESTs derived from standard libraries. High coverage explains discrepancies between the very large numbers of clusters (and TUs) of this project,which also include non-protein-coding RNAs,and the lower gene number estimation of genome annotations. Altogether,5′-end clusters identify regions that are potential promoters for 8637 known genes and 5′-end clusters suggest the presence of almost 63,000 transcriptional starting points. An estimate of the frequency of polyadenylation signals suggests that at least half of the singletons in the EST set represent real mRNAs. Clones accounting for about half of the predicted TUs await further sequencing. The continued high-discovery rate suggests that the task of transcriptome discovery is not yet complete. PMID:12819125

cDNA library construction of two human Demodexspecies.

PubMed

Niu, DongLing; Wang, RuiLing; Zhao, YaE; Yang, Rui; Hu, Li; Lei, YuYang; Dan, WeiChao

2017-06-01

The research of Demodex, a type of pathogen causing various dermatoses in animals and human beings, is lacking at RNA level. This study aims at extracting RNA and constructing cDNA library for Demodex. First, P. cuniculiand D. farinaewere mixed to establish homogenization method for RNA extraction. Second, D. folliculorumand D. breviswere collected and preserved in Trizol, which were mixed with D. farinaerespectively to extract RNA. Finally, cDNA library was constructed and its quality was assessed. The results indicated that for D. folliculorum& D. farinae, the recombination rate of cDNA library was 90.67% and the library titer was 7.50 × 104 pfu/ml. 17 of the 59 positive clones were predicted to be of D. folliculorum; For D. brevis& D. farinae, the recombination rate was 90.96% and the library titer was 7.85 x104 pfu/ml. 40 of the 59 positive clones were predicted to be of D. brevis. Further detection by specific primers demonstrated that mtDNA cox1, cox3and ATP6 detected from cDNA libraries had 96.52%-99.73% identities with the corresponding sequences in GenBank. In conclusion, the cDNA libraries constructed for Demodexmixed with D. farinaewere successful and could satisfy the requirements for functional genes detection.

Molecular characterization of melanin-concentrating hormone (MCH) in Schizothorax prenanti: cloning, tissue distribution and role in food intake regulation.

PubMed

Wang, Tao; Yuan, Dengyue; Zhou, Chaowei; Lin, Fangjun; Wei, Rongbin; Chen, Hu; Wu, Hongwei; Xin, Zhiming; Liu, Ju; Gao, Yundi; Chen, Defang; Yang, Shiyong; Wang, Yan; Pu, Yundan; Li, Zhiqiong

2016-06-01

Melanin-concentrating hormone (MCH) is a crucial neuropeptide involved in various biological functions in both mammals and fish. In this study, the full-length MCH cDNA was obtained from Schizothorax prenanti by rapid amplification of cDNA ends polymerase chain reaction. The full-length MCH cDNA contained 589 nucleotides including an open reading frame of 375 nucleotides encoding 256 amino acids. MCH mRNA was highly expressed in the brain by real-time quantitative PCR analysis. Within the brain, expression of MCH mRNA was preponderantly detected in the hypothalamus. In addition, the MCH mRNA expression in the S. prenanti hypothalamus of fed group was significantly decreased compared with the fasted group at 1 and 3 h post-feeding, respectively. Furthermore, the MCH gene expression presented significant increase in the hypothalamus of fasted group compared with the fed group during long-term fasting. After re-feeding, there was a dramatic decrease in MCH mRNA expression in the hypothalamus of S. prenanti. The results indicate that the expression of MCH is affected by feeding status. Taken together, our results suggest that MCH may be involved in food intake regulation in S. prenanti.

Towards isolation of the gene for X-linked retinitis pigmentosa (RP3)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dry, K.L.; Aldred, M.A.; Hardwick, L.J.

1994-09-01

Until recently the region of interest containing the gene for X-linked retinitis pigmentosa (RP3) was thought to lie between CYBB (Xp21.1) and the proximal end of the deletion in patient BB (JBBprox). This region was thought to span 100-150 kb. Here we present new mapping data to show that the distance between the 5{prime} (most proximal) end of CYBB and JBBprox is only 50 kb. Recently Roux et al. (1994) have described the isolation of a gene within this region but this showed no disease-associated changes. Further evidence from mapping the deletion in patient NF (who suffered from McLead`s syndromemore » and CGD but not RP) and from linkage analysis of our RP3 families with a new dinucleotide repeat suggests that the gene must extend proximally from JBBprox. In order to extend the region of search we have constructed a YAC contig spanning 800 kb to OTC. We are continuing our search for the RP3 gene using a variety of strategies including exon trapping and cDNA enrichment as well as direct screening of cDNA libraries with subclones from this region.« less

High-resolution mapping and sequence analysis of 597 cDNA clones transcribed from the 1 Mb region in human chromosome 4q16.3 containing Huntington disease gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hadano, S.; Ishida, Y.; Tomiyasu, H.

1994-09-01

To complete a transcription map of the 1 Mb region in human chromosome 4p16.3 containing the Huntington disease (HD) gene, the isolation of cDNA clones are being performed throughout. Our method relies on a direct screening of the cDNA libraries probed with single copy microclones from 3 YAC clones spanning 1 Mbp of the HD gene region. AC-DNAs were isolated by a preparative pulsed-field gel electrophoresis, amplified by both a single unique primer (SUP)-PCR and a linker ligation PCR, and 6 microclone-DNA libraries were generated. Then, 8,640 microclones from these libraries were independently amplified by PCR, and arrayed onto themore » membranes. 800-900 microclones that were not cross-hybridized with total human and yeast genomic DNA, TAC vector DNA, and ribosomal cDNA on a dot hybridization (putatively carrying single copy sequences) were pooled to make 9 probe pools. A total of {approximately}1.8x10{sup 7} plaques from the human brain cDNA libraries was screened with 9 pool-probes, and then 672 positive cDNA clones were obtained. So far, 597 cDNA clones were defined and arrayed onto a map of the 1 Mbp of the HD gene region by hybridization with HD region-specific cosmid contigs and YAC clones. Further characterization including a DNA sequencing and Northern blot analysis is currently underway.« less

The effect of column purification on cDNA indirect labelling for microarrays

PubMed Central

Molas, M Lia; Kiss, John Z

2007-01-01

Background The success of the microarray reproducibility is dependent upon the performance of standardized procedures. Since the introduction of microarray technology for the analysis of global gene expression, reproducibility of results among different laboratories has been a major problem. Two of the main contributors to this variability are the use of different microarray platforms and different laboratory practices. In this paper, we address the latter question in terms of how variation in one of the steps of a labelling procedure affects the cDNA product prior to microarray hybridization. Results We used a standard procedure to label cDNA for microarray hybridization and employed different types of column chromatography for cDNA purification. After purifying labelled cDNA, we used the Agilent 2100 Bioanalyzer and agarose gel electrophoresis to assess the quality of the labelled cDNA before its hybridization onto a microarray platform. There were major differences in the cDNA profile (i.e. cDNA fragment lengths and abundance) as a result of using four different columns for purification. In addition, different columns have different efficiencies to remove rRNA contamination. This study indicates that the appropriate column to use in this type of protocol has to be experimentally determined. Finally, we present new evidence establishing the importance of testing the method of purification used during an indirect labelling procedure. Our results confirm the importance of assessing the quality of the sample in the labelling procedure prior to hybridization onto a microarray platform. Conclusion Standardization of column purification systems to be used in labelling procedures will improve the reproducibility of microarray results among different laboratories. In addition, implementation of a quality control check point of the labelled samples prior to microarray hybridization will prevent hybridizing a poor quality sample to expensive micorarrays. PMID:17597522

The effect of column purification on cDNA indirect labelling for microarrays.

PubMed

Molas, M Lia; Kiss, John Z

2007-06-27

The success of the microarray reproducibility is dependent upon the performance of standardized procedures. Since the introduction of microarray technology for the analysis of global gene expression, reproducibility of results among different laboratories has been a major problem. Two of the main contributors to this variability are the use of different microarray platforms and different laboratory practices. In this paper, we address the latter question in terms of how variation in one of the steps of a labelling procedure affects the cDNA product prior to microarray hybridization. We used a standard procedure to label cDNA for microarray hybridization and employed different types of column chromatography for cDNA purification. After purifying labelled cDNA, we used the Agilent 2100 Bioanalyzer and agarose gel electrophoresis to assess the quality of the labelled cDNA before its hybridization onto a microarray platform. There were major differences in the cDNA profile (i.e. cDNA fragment lengths and abundance) as a result of using four different columns for purification. In addition, different columns have different efficiencies to remove rRNA contamination. This study indicates that the appropriate column to use in this type of protocol has to be experimentally determined. Finally, we present new evidence establishing the importance of testing the method of purification used during an indirect labelling procedure. Our results confirm the importance of assessing the quality of the sample in the labelling procedure prior to hybridization onto a microarray platform. Standardization of column purification systems to be used in labelling procedures will improve the reproducibility of microarray results among different laboratories. In addition, implementation of a quality control check point of the labelled samples prior to microarray hybridization will prevent hybridizing a poor quality sample to expensive micorarrays.

Construction of a Transcription Map for Papillomaviruses using RACE, RNAse Protection and Primer Extension Assays

PubMed Central

Wang, Xiaohong; Zheng, Zhi-Ming

2016-01-01

Papillomaviruses are a family of small, non-enveloped DNA tumor viruses. Knowing a complete transcription map from each papillomavirus genome can provide guidance for various papillomavirus studies. This unit provides detailed protocols to construct a transcription map of human papillomavirus type 18. The same approach can be easily adapted to other transcription map studies of any other papillomavirus genotype due to the high degree of conservation in the genome structure, organization and gene expression among papillomaviruses. The focused methods are 5’- and 3’- rapid amplification of cDNA ends (RACE), which are the techniques commonly used in molecular biology to obtain the full length RNA transcript or to map a transcription start site (TSS) or an RNA polyadenylation (pA) cleavage site. Primer walking RT-PCR is a method for studying splicing junction of RACE products. In addition, RNase protection assay and primer extension are also introduced as alternative methods in the mapping analysis. PMID:26855281

Agroinoculation of Beet necrotic yellow vein virus cDNA clones results in plant systemic infection and efficient Polymyxa betae transmission.

PubMed

Delbianco, Alice; Lanzoni, Chiara; Klein, Elodie; Rubies Autonell, Concepcion; Gilmer, David; Ratti, Claudio

2013-05-01

Agroinoculation is a quick and easy method for the infection of plants with viruses. This method involves the infiltration of tissue with a suspension of Agrobacterium tumefaciens carrying binary plasmids harbouring full-length cDNA copies of viral genome components. When transferred into host cells, transcription of the cDNA produces RNA copies of the viral genome that initiate infection. We produced full-length cDNA corresponding to Beet necrotic yellow vein virus (BNYVV) RNAs and derived replicon vectors expressing viral and fluorescent proteins in pJL89 binary plasmid under the control of the Cauliflower mosaic virus 35S promoter. We infected Nicotiana benthamiana and Beta macrocarpa plants with BNYVV by leaf agroinfiltration of combinations of agrobacteria carrying full-length cDNA clones of BNYVV RNAs. We validated the ability of agroclones to reproduce a complete viral cycle, from replication to cell-to-cell and systemic movement and, finally, plant-to-plant transmission by its plasmodiophorid vector. We also showed successful root agroinfection of B. vulgaris, a new tool for the assay of resistance to rhizomania, the sugar beet disease caused by BNYVV. © 2013 BSPP AND BLACKWELL PUBLISHING LTD.

Development and analysis of a tick-borne encephalitis virus infectious clone using a novel and rapid strategy.

PubMed

Gritsun, T S; Gould, E A

1998-12-01

In less than 1 month we have constructed an infectious clone of attenuated tick-borne encephalitis virus (strain Vasilchenko) from 100 microl of unpurified virus suspension using long high fidelity PCR and a modified bacterial cloning system. Optimization of the 3' antisense primer concentration was essential to achieve PCR synthesis of an 11 kb cDNA copy of RNA from infectious virus. A novel system utilising two antisense primers, a 14-mer for reverse transcription and a 35-mer for long PCR, produced high yields of genomic length cDNA. Use of low copy number Able K cells and an incubation temperature of 28 degrees C increased the genetic stability of cloned cDNA. Clones containing 11 kb cDNA inserts produced colonies of reduced size, thus providing a positive selection system for full length clones. Sequencing of the infectious clone emphasised the improved fidelity of the method compared with conventional PCR and cloning methods. A simple and rapid strategy for genetic manipulation of the infectious clone is also described. These developments represent a significant advance in recombinant technology and should be applicable to positive stranded RNA viruses which cannot easily be purified or genetically manipulated.

Cloning and sequence analysis of a cDNA encoding the alpha-subunit of mouse beta-N-acetylhexosaminidase and comparison with the human enzyme.

PubMed Central

Beccari, T; Hoade, J; Orlacchio, A; Stirling, J L

1992-01-01

cDNAs encoding the mouse beta-N-acetylhexosaminidase alpha-subunit were isolated from a mouse testis library. The longest of these (1.7 kb) was sequenced and showed 83% similarity with the human alpha-subunit cDNA sequence. The 5' end of the coding sequence was obtained from a genomic DNA clone. Alignment of the human and mouse sequences showed that all three putative N-glycosylation sites are conserved, but that the mouse alpha-subunit has an additional site towards the C-terminus. All eight cysteines in the human sequence are conserved in the mouse. There are an additional two cysteines in the mouse alpha-subunit signal peptide. All amino acids affected in Tay-Sachs-disease mutations are conserved in the mouse. Images Fig. 1. PMID:1379046

Cloning and bioinformatics analysis of PDC genes from Hylocereus undatus

NASA Astrophysics Data System (ADS)

Wu, Yunli; Luo, Xian; Lu, Han; Shen, Yu; Yuan, Lei; Luo, Lan

2018-04-01

The cDNA of PDC1 and PDC2 were amplified from the seedling of Hylocereus undatus `Guangming 2' by the technique of RACE (rapid amplification of cDNA ends). The PDC1 and PDC2 had a length of 1191bp and 2046 bp, and an open reading frame that encoded a protein of 351 and 604 amino acids, respectively. PDC1 was similar to PDC2 in motif and domain, which indicated that the two protein was relatively conserved to some extent. The 3D structure prediction showed that both of the two proteins of PDC1 and PDC2 were homotetramers. Amino acid sequence comparisons suggested that PDC1 had high identity with Chenopodium quinoa PDC1 (88% identity), PDC2 had high identity with Beta vulgaris PDC2 (84% identity).

Intervening sequences in a plant gene-comparison of the partial sequence of cDNA and genomic DNA of French bean phaseolin

NASA Astrophysics Data System (ADS)

Sun, S. M.; Slightom, J. L.; Hall, T. C.

1981-01-01

A plant gene coding for the major storage protein (phaseolin, G1-globulin) of the French bean was isolated from a genomic library constructed in the phage vector Charon 24A. Comparison of the nucleotide sequence of part of the gene with that of the cloned messenger RNA (cDNA) revealed the presence of three intervening sequences, all beginning with GTand ending with AG. The 5' and 3' boundaries of intervening sequences TVS-A (88 base pairs) and IVS-B (124 base pairs) are similar to those described for animal and viral genes, but the 3' boundary of IVS-C (129 base pairs) shows some differences. A sequence of 185 amino acids deduced from the cloned DMAs represents about 40% of a phaseolin polypeptide.

Molecular cloning and expression analysis of jasmonic acid dependent but salicylic acid independent LeWRKY1.

PubMed

Lu, M; Wang, L F; Du, X H; Yu, Y K; Pan, J B; Nan, Z J; Han, J; Wang, W X; Zhang, Q Z; Sun, Q P

2015-11-30

Various plant genes can be activated or inhibited by phytohormones under conditions of biotic and abiotic stress, especially in response to jasmonic acid (JA) and salicylic acid (SA). Interactions between JA and SA may be synergistic or antagonistic, depending on the stress condition. In this study, we cloned a full-length cDNA (LeWRKY1, GenBank accession No. FJ654265) from Lycopersicon esculentum by rapid amplification of cDNA ends. Sequence analysis showed that this gene is a group II WRKY transcription factor. Analysis of LeWRKY1 mRNA expression in various tissues by qRT-PCR showed that the highest and lowest expression occurred in the leaves and stems, respectively. In addition, LeWRKY1 expression was induced by JA and Botrytis cinerea Pers., but not by SA.

Mass spectrometry-based cDNA profiling as a potential tool for human body fluid identification.

PubMed

Donfack, Joseph; Wiley, Anissa

2015-05-01

Several mRNA markers have been exhaustively evaluated for the identification of human venous blood, saliva, and semen in forensic genetics. As new candidate human body fluid specific markers are discovered, evaluated, and reported in the scientific literature, there is an increasing trend toward determining the ideal markers for cDNA profiling of body fluids of forensic interest. However, it has not been determined which molecular genetics-based technique(s) should be utilized to assess the performance of these markers. In recent years, only a few confirmatory, mRNA/cDNA-based methods have been evaluated for applications in body fluid identification. The most frequently described methods tested to date include quantitative polymerase chain reaction (qPCR) and capillary electrophoresis (CE). However these methods, in particular qPCR, often favor narrow multiplex PCR due to the availability of a limited number of fluorescent dyes/tags. In an attempt to address this technological constraint, this study explored matrix-assisted laser desorption/ionization-time of flight mass spectrometry (MALDI-TOF MS) for human body fluid identification via cDNA profiling of venous blood, saliva, and semen. Using cDNA samples at 20pg input phosphoglycerate kinase 1 (PGK1) amounts, body fluid specific markers for the candidate genes were amplified in their corresponding body fluid (i.e., venous blood, saliva, or semen) and absent in the remaining two (100% specificity). The results of this study provide an initial indication that MALDI-TOF MS is a potential fluorescent dye-free alternative method for body fluid identification in forensic casework. However, the inherent issues of low amounts of mRNA, and the damage caused to mRNA by environmental exposures, extraction processes, and storage conditions are important factors that significantly hinder the implementation of cDNA profiling into forensic casework. Published by Elsevier Ireland Ltd.

Comparison of next generation sequencing technologies for transcriptome characterization

PubMed Central

2009-01-01

Background We have developed a simulation approach to help determine the optimal mixture of sequencing methods for most complete and cost effective transcriptome sequencing. We compared simulation results for traditional capillary sequencing with "Next Generation" (NG) ultra high-throughput technologies. The simulation model was parameterized using mappings of 130,000 cDNA sequence reads to the Arabidopsis genome (NCBI Accession SRA008180.19). We also generated 454-GS20 sequences and de novo assemblies for the basal eudicot California poppy (Eschscholzia californica) and the magnoliid avocado (Persea americana) using a variety of methods for cDNA synthesis. Results The Arabidopsis reads tagged more than 15,000 genes, including new splice variants and extended UTR regions. Of the total 134,791 reads (13.8 MB), 119,518 (88.7%) mapped exactly to known exons, while 1,117 (0.8%) mapped to introns, 11,524 (8.6%) spanned annotated intron/exon boundaries, and 3,066 (2.3%) extended beyond the end of annotated UTRs. Sequence-based inference of relative gene expression levels correlated significantly with microarray data. As expected, NG sequencing of normalized libraries tagged more genes than non-normalized libraries, although non-normalized libraries yielded more full-length cDNA sequences. The Arabidopsis data were used to simulate additional rounds of NG and traditional EST sequencing, and various combinations of each. Our simulations suggest a combination of FLX and Solexa sequencing for optimal transcriptome coverage at modest cost. We have also developed ESTcalc http://fgp.huck.psu.edu/NG_Sims/ngsim.pl, an online webtool, which allows users to explore the results of this study by specifying individualized costs and sequencing characteristics. Conclusion NG sequencing technologies are a highly flexible set of platforms that can be scaled to suit different project goals. In terms of sequence coverage alone, the NG sequencing is a dramatic advance over capillary-based sequencing, but NG sequencing also presents significant challenges in assembly and sequence accuracy due to short read lengths, method-specific sequencing errors, and the absence of physical clones. These problems may be overcome by hybrid sequencing strategies using a mixture of sequencing methodologies, by new assemblers, and by sequencing more deeply. Sequencing and microarray outcomes from multiple experiments suggest that our simulator will be useful for guiding NG transcriptome sequencing projects in a wide range of organisms. PMID:19646272

[Construction and characterization of a cDNA library from human liver tissue of cirrhosis].

PubMed

Chen, Xiao-hong; Chen, Zhi; Chen, Feng; Zhu, Hai-hong; Zhou, Hong-juan; Yao, Hang-ping

2005-03-01

To construct a cDNA library from human liver tissue of cirrhosis. The total RNA from human liver tissue of cirrhosis was extracted using Trizol method, and the mRNA was purified using mRNA purification kit. SMART technique and CDSIII/3' primer were used for first-strand cDNA synthesis. Long distance PCR was then used to synthesize the double-strand cDNA that was then digested by proteinase K and Sfi I, and was fractionated by CHOMA SPIN-400 column. The cDNA fragments longer than 0.4 kb were collected and ligated to lambdaTripl Ex2 vector. Then lambda-phage packaging reaction and library amplification were performed. The qualities of both unamplified and amplified cDNA libraries was strictly checked by conventional titer determination. Eleven plaques were randomly picked and tested using PCR with universal primers derived from the sequence flanking the vector. The titers of unamplifed and amplified libraries were 1.03 x 10(6) pfu/ml and 1.36 x 10(9) pfu/ml respectively. The percentages of recombinants from both libraries were 97.24 % in unamplified library and 99.02 % in amplified library. The lengths of the inserts were 1.02 kb in average (36.36 % 1 approximately equals 2 kb and 63.64 % 0.5 approximately equals 1.0 kb). A high quality cDNA library from human liver tissue of cirrhosis was constructed successfully, which can be used for screening and cloning new special genes associated with the occurrence of cirrhosis.

Integrating De Novo Transcriptome Assembly and Cloning to Obtain Chicken Ovocleidin-17 Full-Length cDNA

PubMed Central

Ning, ZhongHua; Hincke, Maxwell T.; Yang, Ning; Hou, ZhuoCheng

2014-01-01

Efficiently obtaining full-length cDNA for a target gene is the key step for functional studies and probing genetic variations. However, almost all sequenced domestic animal genomes are not ‘finished’. Many functionally important genes are located in these gapped regions. It can be difficult to obtain full-length cDNA for which only partial amino acid/EST sequences exist. In this study we report a general pipeline to obtain full-length cDNA, and illustrate this approach for one important gene (Ovocleidin-17, OC-17) that is associated with chicken eggshell biomineralization. Chicken OC-17 is one of the best candidates to control and regulate the deposition of calcium carbonate in the calcified eggshell layer. OC-17 protein has been purified, sequenced, and has had its three-dimensional structure solved. However, researchers still cannot conduct OC-17 mRNA related studies because the mRNA sequence is unknown and the gene is absent from the current chicken genome. We used RNA-Seq to obtain the entire transcriptome of the adult hen uterus, and then conducted de novo transcriptome assembling with bioinformatics analysis to obtain candidate OC-17 transcripts. Based on this sequence, we used RACE and PCR cloning methods to successfully obtain the full-length OC-17 cDNA. Temporal and spatial OC-17 mRNA expression analyses were also performed to demonstrate that OC-17 is predominantly expressed in the adult hen uterus during the laying cycle and barely at immature developmental stages. Differential uterine expression of OC-17 was observed in hens laying eggs with weak versus strong eggshell, confirming its important role in the regulation of eggshell mineralization and providing a new tool for genetic selection for eggshell quality parameters. This study is the first one to report the full-length OC-17 cDNA sequence, and builds a foundation for OC-17 mRNA related studies. We provide a general method for biologists experiencing difficulty in obtaining candidate gene full-length cDNA sequences. PMID:24676480

Integrating de novo transcriptome assembly and cloning to obtain chicken Ovocleidin-17 full-length cDNA.

PubMed

Zhang, Quan; Liu, Long; Zhu, Feng; Ning, ZhongHua; Hincke, Maxwell T; Yang, Ning; Hou, ZhuoCheng

2014-01-01

Efficiently obtaining full-length cDNA for a target gene is the key step for functional studies and probing genetic variations. However, almost all sequenced domestic animal genomes are not 'finished'. Many functionally important genes are located in these gapped regions. It can be difficult to obtain full-length cDNA for which only partial amino acid/EST sequences exist. In this study we report a general pipeline to obtain full-length cDNA, and illustrate this approach for one important gene (Ovocleidin-17, OC-17) that is associated with chicken eggshell biomineralization. Chicken OC-17 is one of the best candidates to control and regulate the deposition of calcium carbonate in the calcified eggshell layer. OC-17 protein has been purified, sequenced, and has had its three-dimensional structure solved. However, researchers still cannot conduct OC-17 mRNA related studies because the mRNA sequence is unknown and the gene is absent from the current chicken genome. We used RNA-Seq to obtain the entire transcriptome of the adult hen uterus, and then conducted de novo transcriptome assembling with bioinformatics analysis to obtain candidate OC-17 transcripts. Based on this sequence, we used RACE and PCR cloning methods to successfully obtain the full-length OC-17 cDNA. Temporal and spatial OC-17 mRNA expression analyses were also performed to demonstrate that OC-17 is predominantly expressed in the adult hen uterus during the laying cycle and barely at immature developmental stages. Differential uterine expression of OC-17 was observed in hens laying eggs with weak versus strong eggshell, confirming its important role in the regulation of eggshell mineralization and providing a new tool for genetic selection for eggshell quality parameters. This study is the first one to report the full-length OC-17 cDNA sequence, and builds a foundation for OC-17 mRNA related studies. We provide a general method for biologists experiencing difficulty in obtaining candidate gene full-length cDNA sequences.

Molecular cloning and characterization of the light-harvesting chlorophyll a/b gene from the pigeon pea (Cajanus cajan).

PubMed

Qiao, Guang; Wen, Xiao-Peng; Zhang, Ting

2015-12-01

Light-harvesting chlorophyll a/b-binding proteins (LHCB) have been implicated in the stress response. In this study, a gene encoding LHCB in the pigeon pea was cloned and characterized. Based on the sequence of a previously obtained 327 bp Est, a full-length 793 bp cDNA was cloned using the rapid amplification of cDNA ends (RACE) method. It was designated CcLHCB1 and encoded a 262 amino acid protein. The calculated molecular weight of the CcLHCB1 protein was 27.89 kDa, and the theoretical isoelectric point was 5.29. Homology search and sequence multi-alignment demonstrated that the CcLHCB1 protein sequence shared a high identity with LHCB from other plants. Bioinformatics analysis revealed that CcLHCB1 was a hydrophobic protein with three transmembrane domains. By fluorescent quantitative real-time polymerase chain reaction (PCR), CcLHCB1 mRNA transcripts were detectable in different tissues (leaf, stem, and root), with the highest level found in the leaf. The expression of CcLHCB1 mRNA in the leaves was up-regulated by drought stimulation and AM inoculation. Our results provide the basis for a better understanding of the molecular organization of LCHB and might be useful for understanding the interaction between plants and microbes in the future.

[Cloning and expression regulation of 1-deoxy-D-xylulose-5-phosphate reductoisomerase cDNA from Alpinia officinarum].

PubMed

Zhang, Chun-Rong; Yang, Quan; Chen, Hu-Biao; Pang, Yu-Xin; Tang, Xiao-Min; Cheng, Xuan-Xuan; Wu, Wen-Ya; Chen, Shi-Min

2012-11-01

The rhizome of Alpinia officinarum is a widely used Chinese herbal medicine. The essential oil in A. officinarum rhizome is mainly composed of 1, 8-cineole and other monoterpenes, as the major bioactive ingredients. In plants, monoterpenes are synthesized through the methylerythritol phosphate (MEP) pathway in the plastids, and 1-deoxy-D-xylulose 5-phosphate reductoisomerase (DXR) is an enzyme catalyzing a committed step of the MEP pathway. In the present study, the full-length cDNA encoding DXR was cloned from the rhizome of A. officinarum, using homology-based RT-PCR and rapid amplification of cDNA ends (RACE) techniques. The new cDNA was designated as AoDXR and submitted to GenBank to be assigned with an accession number HQ874658. The full-length cDNA of AoDXR was 1 670 bp containing a 1 419 bp open reading frame encoding a polypeptide of 472 amino acids with a calculated molecular mass of 51.48 kDa and an isoelectric point of 6.15. Bioinformatic analyses revealed that AoDXR showed extensive homology with DXRs from other plant species and contained a conserved plastids transit peptide, a Pro-rich region and two highly conserved NADPH-binding motifs in its N-terminal region characterized by all plant DXRs. The phylogenetic analysis revealed that AoDXR belonged to angiosperm DXRs. The structural modeling of AoDXR showed that AoDXR had the typical V-shaped structure of DXR proteins. The tissue expression pattern analysis indicated that AoDXR expressed strongly in leaves, weak in rhizomes of A. officinarum. Exogenous methyl jasmonate (MeJA) could enhance the expression of AoDXR and the production of 1, 8-cineole in A. officinarum rhizomes. The cloning and characterization of AoDXR will be helpful to reveal the molecular regulation mechanism of monoterpene biosynthesis in A. officinarum and provides a candidate gene for metabolic engineering in improving the medicinal quality of A. officinarum rhizome.

The Lipopolysaccharide and β-1,3-Glucan Binding Protein Gene Is Upregulated in White Spot Virus-Infected Shrimp (Penaeus stylirostris)

PubMed Central

Roux, Michelle M.; Pain, Arnab; Klimpel, Kurt R.; Dhar, Arun K.

2002-01-01

Pattern recognition proteins such as lipopolysaccharide and β-1,3-glucan binding protein (LGBP) play an important role in the innate immune response of crustaceans and insects. Random sequencing of cDNA clones from a hepatopancreas cDNA library of white spot virus (WSV)-infected shrimp provided a partial cDNA (PsEST-289) that showed similarity to the LGBP gene of crayfish and insects. Subsequently full-length cDNA was cloned by the 5′-RACE (rapid amplification of cDNA ends) technique and sequenced. The shrimp LGBP gene is 1,352 bases in length and is capable of encoding a polypeptide of 376 amino acids that showed significant similarity to homologous genes from crayfish, insects, earthworms, and sea urchins. Analysis of the shrimp LGBP deduced amino acid sequence identified conserved features of this gene family including a potential recognition motif for β-(1→3) linkage of polysaccharides and putative RGD cell adhesion sites. It is known that LGBP gene expression is upregulated in bacterial and fungal infection and that the binding of lipopolysaccharide and β-1,3-glucan to LGBP activates the prophenoloxidase (proPO) cascade. The temporal expression of LGBP and proPO genes in healthy and WSV-challenged Penaeus stylirostris shrimp was measured by real-time quantitative reverse transcription-PCR, and we showed that LGBP gene expression in shrimp was upregulated as the WSV infection progressed. Interestingly, the proPO expression was upregulated initially after infection followed by a downregulation as the viral infection progressed. The downward trend in the expression of proPO coincided with the detection of WSV in the infected shrimp. Our data suggest that shrimp LGBP is an inducible acute-phase protein that may play a critical role in shrimp-WSV interaction and that the WSV infection regulates the activation and/or activity of the proPO cascade in a novel way. PMID:12072514

Gibberellin (GA3) enhances cell wall invertase activity and mRNA levels in elongating dwarf pea (Pisum sativum) shoots

NASA Technical Reports Server (NTRS)

Wu, L. L.; Mitchell, J. P.; Cohn, N. S.; Kaufman, P. B.

1993-01-01

The invertase (EC 3.2.1.26) purified from cell walls of dwarf pea stems to homogeneity has a molecular mass of 64 kilodaltons (kD). Poly(A)+RNA was isolated from shoots of dwarf pea plants, and a cDNA library was constructed using lambda gt11 as an expression vector. The expression cDNA library was screened with polyclonal antibodies against pea cell wall invertase. One invertase cDNA clone was characterized as a full-length cDNA with 1,863 base pairs. Compared with other known invertases, one homologous region in the amino acid sequence was found. The conserved motif, Asn-Asp-Pro-Asn-Gly, is located near the N-terminal end of invertase. Northern blot analysis showed that the amount of invertase mRNA (1.86 kb) was rapidly induced to a maximal level 4 h after GA3 treatment, then gradually decreased to the control level. The mRNA level at 4 h in GA3-treated peas was fivefold higher than that of the control group. The maximal increase in activity of pea cell wall invertase elicited by GA3 occcured at 8 h after GA3 treatment. This invertase isoform was shown immunocytochemically to be localized in the cell walls, where a 10-fold higher accumulation occurred in GA3-treated tissue compared with control tissue. This study indicates that the expression of the pea shoot cell-wall invertase gene could be regulated by GA3 at transcriptional and/or translational levels.

cDNA cloning and sequence determination of the pheromone biosynthesis activating neuropeptide from the seabuckthorn carpenterworm, Holcocerus hippophaecolus (Lepidoptera: Cossidae).

PubMed

Li, Juan; Zhou, Jiao; Sun, Rongbo; Zhang, Haolin; Zong, Shixiang; Luo, Youqing; Sheng, Xia; Weng, Qiang

2013-04-01

The PBAN (pheromone biosynthesis activating neuropeptide)/pyrokinin peptides comprise a major neuropeptide family characterized by a common FXPRL amide at the C-terminus. These peptides are actively involved in many essential endocrine functions. For the first time, we reported the cDNA cloning and sequence determination of the PBAN from the seabuckthorn carpenterworm, Holcocerus hippophaecolus, by using rapid amplification of cDNA ends. The full-length cDNA of Hh-DH-PBAN contained five peptides: diapause hormone (DH) homolog, α-neuropeptide (NP), β-NP, PBAN, and γ-NP. All of the peptides were amidated at their C-terminus and shared a conserved motif, FXPR (or K) L. Moreover, Hh-DH-PBAN had high homology to the other members of the PBAN peptide family: 56% with Manduca sexta, 66% with Bombyx mori, 77% with Helicoverpa zea, and 47% with Plutella xylostella. Phylogenetic analysis revealed that Hh-DH-PBAN was closely related to PBANs from Noctuidae, demonstrated by the relatively higher similarity compared with H. zea. In addition, real-time quantitative PCR (qRT-PCR) analysis showed that Hh-DH-PBAN mRNA expression peaked in the brain-subesophageal ganglion (Br-SOG) complex, and was also detected at high levels during larval and adult stages. The expression decreased significantly after pupation. These results provided information concerning molecular structure characteristics of Hh-DH-PBAN, whose expression profile suggested that the Hh-DH-PBAN gene might be correlated with larval development and sex pheromone biosynthesis in females of the H. hippophaecolus. 2013 Wiley Periodicals, Inc

Rapid isolation of novel FK506 binding proteins from multiple organisms using gDNA and cDNA T7 phage display.

PubMed

Piggott, Andrew M; Kriegel, Alison M; Willows, Robert D; Karuso, Peter

2009-10-01

Reverse chemical proteomics using T7 phage display is a powerful technique for identifying cellular receptors of biologically active small molecules. However, to date this method has generally been limited to cDNA libraries constructed from mRNA isolated from eukaryotes. In this paper, we describe the construction of the first prokaryotic T7 phage display libraries from randomly digested Pseudomonas stutzeri and Vibrio fischeri gDNA, as well as a plant cDNA library from Arabidopsis thaliana. We also describe the use of T7 phage display to identify novel proteins from environmental DNA samples using biotinylated FK506 as a model affinity probe.

Single molecule fluorescence microscopy for ultra-sensitive RNA expression profiling

NASA Astrophysics Data System (ADS)

Hesse, Jan; Jacak, Jaroslaw; Regl, Gerhard; Eichberger, Thomas; Aberger, Fritz; Schlapak, Robert; Howorka, Stefan; Muresan, Leila; Frischauf, Anna-Maria; Schütz, Gerhard J.

2007-02-01

We developed a microarray analysis platform for ultra-sensitive RNA expression profiling of minute samples. It utilizes a novel scanning system for single molecule fluorescence detection on cm2 size samples in combination with specialized biochips, optimized for low autofluorescence and weak unspecific adsorption. 20 μg total RNA was extracted from 10 6 cells of a human keratinocyte cell line (HaCaT) and reversely transcribed in the presence of Alexa647-aha-dUTP. 1% of the resulting labeled cDNA was used for complex hybridization to a custom-made oligonucleotide microarray representing a set of 125 different genes. For low abundant genes, individual cDNA molecules hybridized to the microarray spots could be resolved. Single cDNA molecules hybridized to the chip surface appeared as diffraction limited features in the fluorescence images. The à trous wavelet method was utilized for localization and counting of the separated cDNA signals. Subsequently, the degree of labeling of the localized cDNA molecules was determined by brightness analysis for the different genes. Variations by factors up to 6 were found, which in conventional microarray analysis would result in a misrepresentation of the relative abundance of mRNAs.

HUNT: launch of a full-length cDNA database from the Helix Research Institute.

PubMed

Yudate, H T; Suwa, M; Irie, R; Matsui, H; Nishikawa, T; Nakamura, Y; Yamaguchi, D; Peng, Z Z; Yamamoto, T; Nagai, K; Hayashi, K; Otsuki, T; Sugiyama, T; Ota, T; Suzuki, Y; Sugano, S; Isogai, T; Masuho, Y

2001-01-01

The Helix Research Institute (HRI) in Japan is releasing 4356 HUman Novel Transcripts and related information in the newly established HUNT database. The institute is a joint research project principally funded by the Japanese Ministry of International Trade and Industry, and the clones were sequenced in the governmental New Energy and Industrial Technology Development Organization (NEDO) Human cDNA Sequencing Project. The HUNT database contains an extensive amount of annotation from advanced analysis and represents an essential bioinformatics contribution towards understanding of the gene function. The HRI human cDNA clones were obtained from full-length enriched cDNA libraries constructed with the oligo-capping method and have resulted in novel full-length cDNA sequences. A large fraction has little similarity to any proteins of known function and to obtain clues about possible function we have developed original analysis procedures. Any putative function deduced here can be validated or refuted by complementary analysis results. The user can also extract information from specific categories like PROSITE patterns, PFAM domains, PSORT localization, transmembrane helices and clones with GENIUS structure assignments. The HUNT database can be accessed at http://www.hri.co.jp/HUNT.

Electronic Activation of a DNA Nanodevice Using a Multilayer Nanofilm.

PubMed

Jeong, Hyejoong; Ranallo, Simona; Rossetti, Marianna; Heo, Jiwoong; Shin, Jooseok; Park, Kwangyong; Ricci, Francesco; Hong, Jinkee

2016-10-01

A method to control activation of a DNA nanodevice by supplying a complementary DNA (cDNA) strand from an electro-responsive nanoplatform is reported. To develop functional nanoplatform, hexalayer nanofilm is precisely designed by layer-by-layer assembly technique based on electrostatic interaction with four kinds of materials: Hydrolyzed poly(β-amino ester) can help cDNA release from the film. A cDNA is used as a key building block to activate DNA nanodevice. Reduced graphene oxides (rGOs) and the conductive polymer provide conductivity. In particular, rGOs efficiently incorporate a cDNA in the film via several interactions and act as a barrier. Depending on the types of applied electronic stimuli (reductive and oxidative potentials), a cDNA released from the electrode can quantitatively control the activation of DNA nanodevice. From this report, a new system is successfully demonstrated to precisely control DNA release on demand. By applying more advanced form of DNA-based nanodevices into multilayer system, the electro-responsive nanoplatform will expand the availability of DNA nanotechnology allowing its improved application in areas such as diagnosis, biosensing, bioimaging, and drug delivery. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

An extraovarian protein accumulated in mosquito oocytes is a carboxypeptidase activated in embryos

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wenlong Cho; Deitsch, K.W.; Raikhel, A.S.

1991-12-01

The authors report a phenomenon previously unknown for oviparous animals; in Aedes aegypti mosquitoes a serine carboxypeptidase is synthesized extraovarially and then internalized by oocytes. The cDNA encoding mosquito vitellogenic carboxypeptidase (VCP) was cloned and sequenced. The VCP cDNA hybridizes to a 1.5-kilobase mRNA present only in the fat body of vitellogenic females. The deduced amino acid sequence of VCP shares significant homology with members of the serine carboxypeptidase family. Binding assays using a serine protease inhibitor, ({sup 3}H)diisopropyl fluorophosphate, showed that VCP is activated in eggs at the onset of embryonic development. Activation of VCP is associated with themore » reduction in its size from 53 kDa (inactive proenzyme) to 48 kDa (active enzyme). The active, 48-kDa, form of VCP is maximally present at the middle of embryonic development and disappears by the end.« less

[Polymorphic loci and polymorphism analysis of short tandem repeats within XNP gene].

PubMed

Liu, Qi-Ji; Gong, Yao-Qin; Guo, Chen-Hong; Chen, Bing-Xi; Li, Jiang-Xia; Guo, Yi-Shou

2002-01-01

To select polymorphic short tandem repeat markers within X-linked nuclear protein (XNP) gene, genomic clones which contain XNP gene were recognized by homologous analysis with XNP cDNA. By comparing the cDNA with genomic DNA, non-exonic sequences were identified, and short tandem repeats were selected from non-exonic sequences by using BCM search Launcher. Polymorphisms of the short tandem repeats in Chinese population were evaluated by PCR amplification and PAGE. Five short tandem repeats were identified from XNP gene, two of which were polymorphic. Four and 11 alleles were observed in Chinese population for XNPSTR1 and XNPSTR4, respectively. Heterozygosities were 47% for XNPSTR1 and 70% for XNPSTR4. XNPSTR1 and XNPSTR4 localized within 3' end and intron 10, respectively. Two polymorphic short tandem repeats have been identified within XNP gene and will be useful for linkage analysis and gene diagnosis of XNP gene.

Error minimization algorithm for comparative quantitative PCR analysis: Q-Anal.

PubMed

OConnor, William; Runquist, Elizabeth A

2008-07-01

Current methods for comparative quantitative polymerase chain reaction (qPCR) analysis, the threshold and extrapolation methods, either make assumptions about PCR efficiency that require an arbitrary threshold selection process or extrapolate to estimate relative levels of messenger RNA (mRNA) transcripts. Here we describe an algorithm, Q-Anal, that blends elements from current methods to by-pass assumptions regarding PCR efficiency and improve the threshold selection process to minimize error in comparative qPCR analysis. This algorithm uses iterative linear regression to identify the exponential phase for both target and reference amplicons and then selects, by minimizing linear regression error, a fluorescence threshold where efficiencies for both amplicons have been defined. From this defined fluorescence threshold, cycle time (Ct) and the error for both amplicons are calculated and used to determine the expression ratio. Ratios in complementary DNA (cDNA) dilution assays from qPCR data were analyzed by the Q-Anal method and compared with the threshold method and an extrapolation method. Dilution ratios determined by the Q-Anal and threshold methods were 86 to 118% of the expected cDNA ratios, but relative errors for the Q-Anal method were 4 to 10% in comparison with 4 to 34% for the threshold method. In contrast, ratios determined by an extrapolation method were 32 to 242% of the expected cDNA ratios, with relative errors of 67 to 193%. Q-Anal will be a valuable and quick method for minimizing error in comparative qPCR analysis.

Molecular genetics of X-linked retinitis pigmentosa: Progress towards cloning the RP3 gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fujita, R.; Yan, D.; McHenry, C.

1994-09-01

Our goal is to identify the X-linked retinitis pigmentosa (XLRP) gene RP3. The location of RP3 is genetically delimited to a region of 1 Mb, distal to DXS140, CYBB and tctex-1-like gene and proximal to the gene OTC. It is currently thought that RP3 is within 40 kb of the proximal deletion breakpoint of a patient BB. However, a more proximal location of the gene, closer to OTC, is not ruled out. We initiated the isolation of the genomic region between DXS140 to OTC in YACs. One of the clones from DXS140 region (55B) is 460 kb and spans aboutmore » 200 kb at each side of BB patient`s proximal breakpoint. It contains CYBB, tctex-1-like genes and two additional CpG islands. The 55B clone has been covered by cosmid and phage subclones. Another YAC clone from the OTC region (OTCC) spans about 1 Mb and contains at least 5 CpG islands. In situ hybridization performed with OTCC showed its location in Xp21; however, several derivative cosmids map to chromosome 7, indicating that it is a chimeric YAC. No overlap is evident between 55B and OTCC. We have isolated the YAC end-sequences and isolation of clones to close the gap is in progress. Cosmids are being used for screening eye tissue cDNA libraries, mainly from retina. Screening is done by hybridization to replica filters or by cDNA enrichment methods. Several cDNA clones have been isolated and are being characterized. Exon-amplification is also being used with the cosmids and phages. Genetic analysis is being performed to determine RP3 patients from clinically indistinguishable RP2, located in Xp11.23-p11.4, and to reduce the genetic distance of current flanking markers. For this we are analyzing a number of XLRP families with established markers in the region and with new microsatellites.« less

cDNA cloning, characterization and expression analysis of a novel antimicrobial peptide gene penaeidin-3 (Fi-Pen3) from the haemocytes of Indian white shrimp Fenneropenaeus indicus.

PubMed

Shanthi, S; Vaseeharan, B

2012-03-20

A new member of antimicrobial peptide genes of the penaeidin family, penaeidin 3, was cloned from the haemocytes of Indian white shrimp Fenneropeneaus indicus (F. indicus), by reverse transcription PCR (RT-PCR) and rapid amplification of cDNA end (RACE-PCR) methods. The complete nucleotide sequence of cDNA clone of Indian white shrimp F. indicus Penaeidin 3 (Fi-Pen3) was 243bp long and has an open reading frame which encodes 80 amino acid peptide. The homology analysis of Fi-Pen3 sequence with other Penaeidins 3 shows higher similarity with Penaeus monodon (92%). The theoretical 3D structure generated through ab initio modelling indicated the presence of two-disulphide bridges in the alpha-helix. The signal peptide sequence of Fi-Pen3 is almost entirely homologous to that of other Penaeidin 3 of crustaceans, while differing relatively in the N-terminal domain of the mature peptide. The mature peptide has a predicted molecular weight of 84.9kDa, and a theoretical pI of 9.38. Phylogenetic analysis of Fi-Pen3 shows high resemblance with other Pen-3 from P. monodon, Litopenaeus stylirostris, Litopenaeus vannamei and Litopenaeus setiferus. Fi-Pen3 found to be expressed in haemocytes, heart, hepatopancreas, muscles, gills, intestine, and eyestalk with higher expression in haemocytes. Microbial challenge resulted in mRNA up-regulation, up to 6h post injection of Vibrio parahemolyticus. The Fi-Pen3 mRNA expression of F. indicus in the premolt stage (D(01) and D(02)) was significantly up-regulated than the postmolt (A and B) and intermolt stages (C). The findings of the present paper underline the involvement of Fi-Pen3 in innate immune system of F. indicus. Copyright © 2011 Elsevier GmbH. All rights reserved.

Transcript profiles of mitochondrial and cytoplasmic manganese superoxide dismutases in Exopalaemon carinicauda under ammonia stress

NASA Astrophysics Data System (ADS)

Ren, Hai; Li, Jian; Li, Jitao; Liu, Ping; Liang, Zhongxiu; Wu, Jianhua

2015-05-01

Superoxide dismutase (SOD) is one of the most important antioxidant defense enzymes, and is considered as the first line against oxidative stress. In this study, we cloned a mitochondrial manganese (Mn) SOD ( mMnSOD) cDNA from the ridgetail white prawn Exopalaemon carinicauda by using rapid amplification of cDNA ends (RACE) methods. The full-length cDNA for mMnSOD was 1 014-bp long, containing a 5'-untranslated region (UTR) of 37-bp, a 3'-UTR of 321-bp with a poly (A) tail, and included a 657-bp open reading frame encoding a protein of 218 amino acids with a 16-amino-acid signal peptide. The protein had a calculated molecular weight of 23.87 kDa and a theoretical isoelectric point of 6.75. The mMnSOD sequence included two putative N-glycosylation sites (NHT and NLS), the MnSOD signature sequence 180DVWEHAYY187, and four putative Mn binding sites (H48, H96, D180, and H184). Sequence comparison showed that the mMnSOD deduced amino acid sequence of E. carinicauda shared 97%, 95%, 89%, 84%, 82%, 72%, and 69% identity with that of Macrobrachium rosenbergii, Macrobrachium nipponense, Fenneropeneaus chinensis, Callinectes sapidus, Perisesarma bidens, Danio rerio, and Homo sapiens, resectively. Quantitative real-time RT-PCR analysis showed that mMnSOD transcripts were present in all E. carinicauda tissues examined, with the highest levels in the hepatopancreas. During an ammonia stress treatment, the transcript levels of mMnSOD and cMnSOD were up-regulated at 12 h in hemocytes and at 24 h in the hepatopancreas. As the duration of the ammonia stress treatment extended to 72 h, the transcript levels of mMnSOD and cMnSOD significantly decreased both in hemocytes and hepatopancreas. These findings indicate that the SOD system is induced to respond to acute ammonia stress, and may be involved in environmental stress responses in E. carinicauda.

Na+/K+-ATPase α-subunit in swimming crab Portunus trituberculatus: molecular cloning, characterization, and expression under low salinity stress

NASA Astrophysics Data System (ADS)

Han, Xiaolin; Liu, Ping; Gao, Baoquan; Wang, Haofeng; Duan, Yafei; Xu, Wenfei; Chen, Ping

2015-07-01

Na+/K+-ATPases are membrane-associated enzymes responsible for the active transport of Na+ and K+ ions across cell membranes, generating chemical and electrical gradients. These enzymes' α-subunit provides catalytic function, binding and hydrolyzing ATP, and itself becoming phosphorylated during the transport cycle. In this study, Na+/K+-ATPase α-subunit cDNA was cloned from gill tissue of the swimming crab Portunus trituberculatus by reverse-transcription polymerase chain reaction (RT-PCR) and rapid amplification of cDNA end methods. Analysis of the nucleotide sequence revealed that the cDNA had a full-length of 3 833 base pairs (bp), with an open reading frame of 3 120 bp, 5' untranslated region (UTR) of 317 bp, and 3' UTR of 396 bp. The sequence encoded a 1 039 amino acid protein with a predicted molecular weight of 115.57 kDa and with estimated pI of 5.21. It was predicted here to possess all expected features of Na+/K+-ATPase members, including eight transmembrane domains, putative ATP-binding site, and phosphorylation site. Comparison of amino acid sequences showed that the P. trituberculatus α-subunit possessed an overall identity of 75%-99% to that of other organisms. Phylogenetic analysis revealed that this α-subunit was in the same category as those of crustaceans. Quantitative real-time RT-PCR analysis indicated that this α-subunit's transcript were most highly expressed in gill and lowest in muscle. RT-PCR analysis also revealed that α-subunit expression in crab gill decreased after 2 and 6 h, but increased after 12, 24, 48, and 72 h. In addition, α-subunit expression in hepatopancreas of crab decreased after 2-72 h. These facts indicated that the crab's Na+/K+-ATPase α-subunit was potentially involved in the observed acute response to low salinity stress.

Identification of a CYP3A form (CYP3A126) in fathead minnow (Pimephales promelas) and characterisation of putative CYP3A enzyme activity.

PubMed

Christen, Verena; Caminada, Daniel; Arand, Michael; Fent, Karl

2010-01-01

Cytochrome P450-dependent monooxygenases (CYPs) are involved in the metabolic defence against xenobiotics. Human CYP3A enzymes metabolise about 50% of all pharmaceuticals in use today. Induction of CYPs and associated xenobiotic metabolism occurs also in fish and may serve as a useful tool for biomonitoring of environmental contamination. In this study we report on the cloning of a CYP3A family gene from fathead minnows (Pimephales promelas), which has been designated as CYP3A126 by the P450 nomenclature committee (GenBank no. EU332792). The cDNA was isolated, identified and characterised by extended inverse polymerase chain reaction (PCR), an alternative to the commonly used method of rapid amplification of cDNA ends. In a fathead minnow cell line we identified a full-length cDNA sequence (1,863 base pairs (bp)) consisting of a 1,536 bp open reading frame encoding a 512 amino acid protein. Genomic analysis of the identified CYP3A isoenzyme revealed a DNA sequence consisting of 13 exons and 12 introns. CYP3A126 is also expressed in fathead minnow liver as demonstrated by reverse transcription PCR. Exposure of fathead minnow (FHM) cells with the CYP3A inducer rifampicin leads to dose-dependent increase in putative CYP3A enzyme activity. In contrast, inhibitory effects of diazepam treatment were observed on putative CYP3A enzyme activity and additionally on CYP3A126 mRNA expression. This indicates that CYP3A is active in FHM cells and that CYP3A126 is at least in part responsible for this CYP3A activity. Further investigations will show whether CYP3A126 is involved in the metabolism of environmental chemicals.

Stress and transcriptional regulation of tick ferritin HC.

PubMed

Mulenga, A; Simser, J A; Macaluso, K R; Azad, A F

2004-08-01

We previously identified a partial Dermacentor variabilis cDNA encoding ferritin HC (HC) subunit homolog (DVFER) that was differentially upregulated in Rickettsia montanensis infected ticks (Mulenga et al., 2003a). We have used rapid amplification of cDNA ends to clone full-length DVFER cDNA and its apparent ortholog from the wood tick, D. andersoni (DAFER), both of which show high sequence similarity to vertebrate than insect ferritin. Both DVFER and DAFER contain the stem-loop structure of a putative iron responsive element in the 5' untranslated region (nucleotide positions, 16-42) and the feroxidase centre loop typical for vertebrate ferritin HC subunits. Quantitative Western and Northern blotting analyses of protein and RNA from unfed and partially fed whole tick as well as dissected tick tissues demonstrated that DVFER is constitutively and ubiquitously expressed. Based on densitometric analysis of detected protein and mRNA bands, DVFER is predominantly expressed in the midgut, and to a lesser extent in the salivary glands, ovary and fatbody. Sham treatment (mechanical injury) and Escherichia coli challenge of D. variabilis ticks stimulated statistically significant (approximately 1.5- and approximately 3.0-fold, respectively) increases in DVFER mRNA abundance over time point matched naive control ticks. These data suggest that DVFER mRNA is nonspecifically up regulated in response to mechanical injury or bacterial infection induced stress.

Cloning, expression and activity analysis of a novel fibrinolytic serine protease from Arenicola cristata

NASA Astrophysics Data System (ADS)

Zhao, Chunling; Ju, Jiyu

2015-06-01

The full-length cDNA of a protease gene from a marine annelid Arenicola cristata was amplified through rapid amplification of cDNA ends technique and sequenced. The size of the cDNA was 936 bp in length, including an open reading frame encoding a polypeptide of 270 amino acid residues. The deduced amino acid sequnce consisted of pro- and mature sequences. The protease belonged to the serine protease family because it contained the highly conserved sequence GDSGGP. This protease was novel as it showed a low amino acid sequence similarity (< 40%) to other serine proteases. The gene encoding the active form of A. cristata serine protease was cloned and expressed in E. coli. Purified recombinant protease in a supernatant could dissolve an artificial fibrin plate with plasminogen-rich fibrin, whereas the plasminogen-free fibrin showed no clear zone caused by hydrolysis. This result suggested that the recombinant protease showed an indirect fibrinolytic activity of dissolving fibrin, and was probably a plasminogen activator. A rat model with venous thrombosis was established to demonstrate that the recombinant protease could also hydrolyze blood clot in vivo. Therefore, this recombinant protease may be used as a thrombolytic agent for thrombosis treatment. To our knowledge, this study is the first of reporting the fibrinolytic serine protease gene in A. cristata.

MASA syndrome is caused by mutations in the neural cell adhesion gene, L1CAM

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schwartz, C.E.; Wang, Y.; Schroer, R.J.

1994-09-01

The MASA syndrome is a recessive X-linked disorder characterized by Mental retardation, Adducted thumbs, Shuffling gait and Aphasia. Recently we found that MASA in one family was likely caused by a point mutation in exon 6 of the L1CAM gene. This gene has also been shown to be involved in X-linked hydrocephalus (HSAS). We have screened 60 patients with either sporadic HSAS or MASA as well as two additional families with MASA. For the screening, we initially utilized 3 cDNA probes for the L1CAM gene. In one of the MASA families, K8310, two affected males were found to have anmore » altered BglII band. The band was present in their carrier mother but not in their normal brothers. This band was detected by the entire cDNA probe as well as the cDNA probe for 3{prime} end of the gene. Analysis of the L1CAM sequence indicated the altered BglII site is distal to the exon 28 but proximal to the punative poly A signal site. It is hypothesized that this point mutation alters the stability of the L1CAM mRNA. This is being tested using cell lines established from the two affected males.« less

Lipoxygenase in Caragana jubata responds to low temperature, abscisic acid, methyl jasmonate and salicylic acid.

PubMed

Bhardwaj, Pardeep Kumar; Kaur, Jagdeep; Sobti, Ranbir Chander; Ahuja, Paramvir Singh; Kumar, Sanjay

2011-09-01

Lipoxygenase (LOX) catalyses oxygenation of free polyunsaturated fatty acids into oxylipins, and is a critical enzyme of the jasmonate signaling pathway. LOX has been shown to be associated with biotic and abiotic stress responses in diverse plant species, though limited data is available with respect to low temperature and the associated cues. Using rapid amplification of cDNA ends, a full-length cDNA (CjLOX) encoding lipoxygenase was cloned from apical buds of Caragana jubata, a temperate plant species that grows under extreme cold. The cDNA obtained was 2952bp long consisting of an open reading frame of 2610bp encoding 869 amino acids protein. Multiple alignment of the deduced amino acid sequence with those of other plants demonstrated putative LH2/ PLAT domain, lipoxygenase iron binding catalytic domain and lipoxygenase_2 signature sequences. CjLOX exhibited up- and down-regulation of gene expression pattern in response to low temperature (LT), abscisic acid (ABA), methyl jasmonate (MJ) and salicylic acid (SA). Among all the treatments, a strong up-regulation was observed in response to MJ. Data suggests an important role of jasmonate signaling pathway in response to LT in C. jubata. Copyright © 2011 Elsevier B.V. All rights reserved.

Intron loss from the NADH dehydrogenase subunit 4 gene of lettuce mitochondrial DNA: evidence for homologous recombination of a cDNA intermediate.

PubMed

Geiss, K T; Abbas, G M; Makaroff, C A

1994-04-01

The mitochondrial gene coding for subunit 4 of the NADH dehydrogenase complex I (nad4) has been isolated and characterized from lettuce, Lactuca sativa. Analysis of nad4 genes in a number of plants by Southern hybridization had previously suggested that the intron content varied between species. Characterization of the lettuce gene confirms this observation. Lettuce nad4 contains two exons and one group IIA intron, whereas previously sequenced nad4 genes from turnip and wheat contain three group IIA introns. Northern analysis identified a transcript of 1600 nucleotides, which represents the mature nad4 mRNA and a primary transcript of 3200 nucleotides. Sequence analysis of lettuce and turnip nad4 cDNAs was used to confirm the intron/exon border sequences and to examine RNA editing patterns. Editing is observed at the 5' and 3' ends of the lettuce transcript, but is absent from sequences that correspond to exons two, three and the 5' end of exon four in turnip and wheat. In contrast, turnip transcripts are highly edited in this region, suggesting that homologous recombination of an edited and spliced cDNA intermediate was involved in the loss of introns two and three from an ancestral lettuce nad4 gene.

Improved coverage of cDNA-AFLP by sequential digestion of immobilized cDNA.

PubMed

Weiberg, Arne; Pöhler, Dirk; Morgenstern, Burkhard; Karlovsky, Petr

2008-10-13

cDNA-AFLP is a transcriptomics technique which does not require prior sequence information and can therefore be used as a gene discovery tool. The method is based on selective amplification of cDNA fragments generated by restriction endonucleases, electrophoretic separation of the products and comparison of the band patterns between treated samples and controls. Unequal distribution of restriction sites used to generate cDNA fragments negatively affects the performance of cDNA-AFLP. Some transcripts are represented by more than one fragment while other escape detection, causing redundancy and reducing the coverage of the analysis, respectively. With the goal of improving the coverage of cDNA-AFLP without increasing its redundancy, we designed a modified cDNA-AFLP protocol. Immobilized cDNA is sequentially digested with several restriction endonucleases and the released DNA fragments are collected in mutually exclusive pools. To investigate the performance of the protocol, software tool MECS (Multiple Enzyme cDNA-AFLP Simulation) was written in Perl. cDNA-AFLP protocols described in the literature and the new sequential digestion protocol were simulated on sets of cDNA sequences from mouse, human and Arabidopsis thaliana. The redundancy and coverage, the total number of PCR reactions, and the average fragment length were calculated for each protocol and cDNA set. Simulation revealed that sequential digestion of immobilized cDNA followed by the partitioning of released fragments into mutually exclusive pools outperformed other cDNA-AFLP protocols in terms of coverage, redundancy, fragment length, and the total number of PCRs. Primers generating 30 to 70 amplicons per PCR provided the highest fraction of electrophoretically distinguishable fragments suitable for normalization. For A. thaliana, human and mice transcriptome, the use of two marking enzymes and three sequentially applied releasing enzymes for each of the marking enzymes is recommended.

Heterologous Array Analysis in Pinaceae: Hybridization of Pinus Taeda cDNA Arrays With cDNA From Needles and Embryogenic Cultures of P. Taeda, P. Sylvestris or Picea Abies

PubMed Central

van Zyl, Leonel; von Arnold, Sara; Bozhkov, Peter; Chen, Yongzhong; Egertsdotter, Ulrika; MacKay, John; Sederoff, Ronald R.; Shen, Jing; Zelena, Lyubov

2002-01-01

Hybridization of labelled cDNA from various cell types with high-density arrays of expressed sequence tags is a powerful technique for investigating gene expression. Few conifer cDNA libraries have been sequenced. Because of the high level of sequence conservation between Pinus and Picea we have investigated the use of arrays from one genus for studies of gene expression in the other. The partial cDNAs from 384 identifiable genes expressed in differentiating xylem of Pinus taeda were printed on nylon membranes in randomized replicates. These were hybridized with labelled cDNA from needles or embryogenic cultures of Pinus taeda, P. sylvestris and Picea abies, and with labelled cDNA from leaves of Nicotiana tabacum. The Spearman correlation of gene expression for pairs of conifer species was high for needles (r2 = 0.78 − 0.86), and somewhat lower for embryogenic cultures (r2 = 0.68 − 0.83). The correlation of gene expression for tobacco leaves and needles of each of the three conifer species was lower but sufficiently high (r2 = 0.52 − 0.63) to suggest that many partial gene sequences are conserved in angiosperms and gymnosperms. Heterologous probing was further used to identify tissue-specific gene expression over species boundaries. To evaluate the significance of differences in gene expression, conventional parametric tests were compared with permutation tests after four methods of normalization. Permutation tests after Z-normalization provide the highest degree of discrimination but may enhance the probability of type I errors. It is concluded that arrays of cDNA from loblolly pine are useful for studies of gene expression in other pines or spruces. PMID:18629264

Isolation of epidermal cells and cDNA cloning of TNF decoy receptor 3 of conger eel, Conger myriaster.

PubMed

Tsutsui, Shigeyuki; Yoshino, Yuko; Matsui, Saho; Nakamura, Osamu; Muramoto, Koji; Watanabe, Tasuku

2008-03-01

By using EDTA and a trypsin solution, we established a method for isolating the epidermal cells of the conger eel, Conger myriaster. We then identified TNF decoy receptor (DcR) cDNA in the species from a suppression subtractive hybridization library prepared from the epidermal cells stimulated with LPS. The full-length cDNA of conger TNF DcR (conDcR) consisted of 1479 base pairs, and the protein comprised 286 amino acid residues. Phylogenetic analysis indicated that conDcR was clustered into a DcR3 branch. ConDcR is likely to act as an important immune-regulating factor in inhibiting the apoptosis-inducing effect of TNF in the skin of conger eel.

Using single nuclei for RNA-seq to capture the transcriptome of postmortem neurons

PubMed Central

Krishnaswami, Suguna Rani; Grindberg, Rashel V; Novotny, Mark; Venepally, Pratap; Lacar, Benjamin; Bhutani, Kunal; Linker, Sara B; Pham, Son; Erwin, Jennifer A; Miller, Jeremy A; Hodge, Rebecca; McCarthy, James K; Kelder, Martin; McCorrison, Jamison; Aevermann, Brian D; Fuertes, Francisco Diez; Scheuermann, Richard H; Lee, Jun; Lein, Ed S; Schork, Nicholas; McConnell, Michael J; Gage, Fred H; Lasken, Roger S

2016-01-01

A protocol is described for sequencing the transcriptome of a cell nucleus. Nuclei are isolated from specimens and sorted by FACS, cDNA libraries are constructed and RNA-seq is performed, followed by data analysis. Some steps follow published methods (Smart-seq2 for cDNA synthesis and Nextera XT barcoded library preparation) and are not described in detail here. Previous single-cell approaches for RNA-seq from tissues include cell dissociation using protease treatment at 30 °C, which is known to alter the transcriptome. We isolate nuclei at 4 °C from tissue homogenates, which cause minimal damage. Nuclear transcriptomes can be obtained from postmortem human brain tissue stored at −80 °C, making brain archives accessible for RNA-seq from individual neurons. The method also allows investigation of biological features unique to nuclei, such as enrichment of certain transcripts and precursors of some noncoding RNAs. By following this procedure, it takes about 4 d to construct cDNA libraries that are ready for sequencing. PMID:26890679

The proteins interacting with C-terminal of μ receptor are identified by bacterial two-hybrid system from brain cDNA library in morphine-dependent rats.

PubMed

Zhou, Peilan; Jiang, Jiebing; Dong, Zhaoqi; Yan, Hui; You, Zhendong; Su, Ruibin; Gong, Zehui

2015-12-15

Opioid addiction is associated with long-term adaptive changes in the brain that involve protein expression. The carboxyl-terminal of the μ opioid receptor (MOR-C) is important for receptor signal transduction under opioid treatment. However, the proteins that interact with MOR-C after chronic morphine exposure remain unknown. The brain cDNA library of chronic morphine treatment rats was screened using rat MOR-C to investigate the regulator of opioids dependence in the present study. The brain cDNA library from chronic morphine-dependent rats was constructed using the SMART (Switching Mechanism At 5' end of RNA Transcript) technique. Bacterial two-hybrid system was used to screening the rat MOR-C interacting proteins from the cDNA library. RT-qPCR and immunoblotting were used to determine the variation of MOR-C interacting proteins in rat brain after chronic morphine treatment. Column overlay assays, immunocytochemistry and coimmunoprecipitation were used to demonstrate the interaction of MOR-C and p75NTR-associated cell death executor (NADE). 21 positive proteins, including 19 known proteins were screened to interact with rat MOR-C. Expression of several of these proteins was altered in specific rat brain regions after chronic morphine treatment. Among these proteins, NADE was confirmed to interact with rat MOR-C by in vitro protein-protein binding and coimmunoprecipitation in Chinese hamster ovary (CHO) cells and rat brain with or without chronic morphine treatment. Understanding the rat MOR-C interacting proteins and the proteins variation under chronic morphine treatment may be critical for determining the pathophysiological basis of opioid tolerance and addiction. Copyright © 2015. Published by Elsevier Inc.

Massive Collection of Full-Length Complementary DNA Clones and Microarray Analyses:. Keys to Rice Transcriptome Analysis

NASA Astrophysics Data System (ADS)

Kikuchi, Shoshi

2009-02-01

Completion of the high-precision genome sequence analysis of rice led to the collection of about 35,000 full-length cDNA clones and the determination of their complete sequences. Mapping of these full-length cDNA sequences has given us information on (1) the number of genes expressed in the rice genome; (2) the start and end positions and exon-intron structures of rice genes; (3) alternative transcripts; (4) possible encoded proteins; (5) non-protein-coding (np) RNAs; (6) the density of gene localization on the chromosome; (7) setting the parameters of gene prediction programs; and (8) the construction of a microarray system that monitors global gene expression. Manual curation for rice gene annotation by using mapping information on full-length cDNA and EST assemblies has revealed about 32,000 expressed genes in the rice genome. Analysis of major gene families, such as those encoding membrane transport proteins (pumps, ion channels, and secondary transporters), along with the evolution from bacteria to higher animals and plants, reveals how gene numbers have increased through adaptation to circumstances. Family-based gene annotation also gives us a new way of comparing organisms. Massive amounts of data on gene expression under many kinds of physiological conditions are being accumulated in rice oligoarrays (22K and 44K) based on full-length cDNA sequences. Cluster analyses of genes that have the same promoter cis-elements, that have similar expression profiles, or that encode enzymes in the same metabolic pathways or signal transduction cascades give us clues to understanding the networks of gene expression in rice. As a tool for that purpose, we recently developed "RiCES", a tool for searching for cis-elements in the promoter regions of clustered genes.

Construction of a cDNA library from female adult of Toxocara canis, and analysis of EST and immune-related genes expressions.

PubMed

Zhou, Rongqiong; Xia, Qingyou; Huang, Hancheng; Lai, Min; Wang, Zhenxin

2011-10-01

Toxocara canis is a widespread intestinal nematode parasite of dogs, which can also cause disease in humans. We employed an expressed sequence tag (EST) strategy in order to study gene-expression including development, digestion and reproduction of T. canis. ESTs provided a rapid way to identify genes, particularly in organisms for which we have very little molecular information. In this study, a cDNA library was constructed from a female adult of T. canis and 215 high-quality ESTs from 5'-ends of the cDNA clones representing 79 unigenes were obtained. The titer of the primary cDNA library was 1.83×10(6)pfu/mL with a recombination rate of 99.33%. Most of the sequences ranged from 300 to 900bp with an average length of 656bp. Cluster analysis of these ESTs allowed identification of 79 unique sequences containing 28 contigs and 51 singletons. BLASTX searches revealed that 18 unigenes (22.78% of the total) or 70 ESTs (32.56% of the total) were novel genes that had no significant matches to any protein sequences in the public databases. The rest of the 61 unigenes (77.22% of the total) or 145 ESTs (67.44% of the total) were closely matched to the known genes or sequences deposited in the public databases. These genes were classified into seven groups based on their known or putative biological functions. We also confirmed the gene expression patterns of several immune-related genes using RT-PCR examination. This work will provide a valuable resource for the further investigations in the stage-, sex- and tissue-specific gene transcription or expression. Copyright © 2011. Published by Elsevier Inc.

Molecular cloning and characterization of SoxB2 gene from Zhikong scallop Chlamys farreri

NASA Astrophysics Data System (ADS)

He, Yan; Bao, Zhenmin; Guo, Huihui; Zhang, Yueyue; Zhang, Lingling; Wang, Shi; Hu, Jingjie; Hu, Xiaoli

2013-11-01

The Sox proteins play critical roles during the development of animals, including sex determination and central nervous system development. In this study, the SoxB2 gene was cloned from a mollusk, the Zhikong scallop ( Chlamys farreri), and characterized with respect to phylogeny and tissue distribution. The full-length cDNA and genomic DNA sequences of C. farreri SoxB2 ( Cf SoxB2) were obtained by rapid amplification of cDNA ends and genome walking, respectively, using a partial cDNA fragment from the highly conserved DNA-binding domain, i.e., the High Mobility Group (HMG) box. The full-length cDNA sequence of Cf SoxB2 was 2 048 bp and encoded 268 amino acids protein. The genomic sequence was 5 551 bp in length with only one exon. Several conserved elements, such as the TATA-box, GC-box, CAAT-box, GATA-box, and Sox/sry-sex/testis-determining and related HMG box factors, were found in the promoter region. Furthermore, real-time quantitative reverse transcription PCR assays were carried out to assess the mRNA expression of Cf SoxB 2 in different tissues. SoxB2 was highly expressed in the mantle, moderately in the digestive gland and gill, and weakly expressed in the gonad, kidney and adductor muscle. In male and female gonads at different developmental stages of reproduction, the expression levels of Cf SoxB2 were similar. Considering the specific expression and roles of SoxB 2 in other animals, in particular vertebrates, and the fact that there are many pallial nerves in the mantle, cerebral ganglia in the digestive gland and gill nerves in gill, we propose a possible essential role in nervous tissue function for Sox B 2 in C. farreri.

Cloning and expression analysis of a HSP70 gene from Pacific abalone (Haliotis discus hannai).

PubMed

Cheng, Peizhou; Liu, Xiao; Zhang, Guofan; He, Jianguo

2007-01-01

Heat shock protein 70 (HSP70), the primary member of HSPs that are responsive of thermal stress, is found in all multicellular organisms and functions mostly as molecular chaperon. The inducible HSP70 cDNA cloned from Pacific abalone (Haliotis discus hannai) using rapid amplification of cDNA ends (RACE), was highly homologous to other HSP70 genes. The full-length cDNA of the Pacific abalone HSP70 was 2631bp, consisting of a 5'-terminal untranslated region (UTR) of 90bp, a 3'-terminal UTR of 573bp with a canonical polyadenylation signal sequence AATAAA and a poly (A) tail, and an open reading frame of 1968bp. The HSP70 cDNA encoded a polypeptide of 655 amino acids with an ATPase domain of 382 amino acids, the substrate peptide binding domain of 161 amino acids and a C-terminus domain of 112 amino acids. The temporal expression of HSP70 was measured by semi-quantitative RT-PCR after heat shock and bacterial challenge. Challenge of Pacific abalone with heat shock or the pathogenic bacteria Vibrio anguillarum resulted in a dramatic increase in the expression of HSP70 mRNA level in muscle, followed by a recovery to normal level after 96h. Unlike the muscle, the levels of HSP70 expression in gills reached the top at 12h and maintained a relatively high level compared with the control after thermal and bacterial challenge. The upregulated mRNA expression of HSP70 in the abalone following heat shock and infection response indicates that the HSP70 gene is inducible and involved in immune response.

The Role of eIF4E Activity in Breast Cancer

DTIC Science & Technology

2010-08-01

ORF, open reading frame; qPCR, quantitative PCR; RACE, rapid amplification of cDNA ends; RT, reverse transcriptase ; uORF, upstream ORF; UTR...were also performed using template lacking RT ( reverse transcriptase ): products were either undetectable or greatly reduced (>30000-fold less product...have previously shown that a 5’UTR expressed from the human AXIN2 gene contains a sixty nucleotide sequence that is predicted to form a stable stem

[cDNA library construction from panicle meristem of finger millet].

PubMed

Radchuk, V; Pirko, Ia V; Isaenkov, S V; Emets, A I; Blium, Ia B

2014-01-01

The protocol for production of full-size cDNA using SuperScript Full-Length cDNA Library Construction Kit II (Invitrogen) was tested and high quality cDNA library from meristematic tissue of finger millet panicle (Eleusine coracana (L.) Gaertn) was created. The titer of obtained cDNA library comprised 3.01 x 10(5) CFU/ml in avarage. In average the length of cDNA insertion consisted about 1070 base pairs, the effectivity of cDNA fragment insertions--99.5%. The selective sequencing of cDNA clones from created library was performed. The sequences of cDNA clones were identified with usage of BLAST-search. The results of cDNA library analysis and selective sequencing represents prove good functionality and full length character of inserted cDNA clones. Obtained cDNA library from meristematic tissue of finger millet panicle represents good and valuable source for isolation and identification of key genes regulating metabolism and meristematic development and for mining of new molecular markers to conduct out high quality genetic investigations and molecular breeding as well.

Digital transcriptome profiling using selective hexamer priming for cDNA synthesis.

PubMed

Armour, Christopher D; Castle, John C; Chen, Ronghua; Babak, Tomas; Loerch, Patrick; Jackson, Stuart; Shah, Jyoti K; Dey, John; Rohl, Carol A; Johnson, Jason M; Raymond, Christopher K

2009-09-01

We developed a procedure for the preparation of whole transcriptome cDNA libraries depleted of ribosomal RNA from only 1 microg of total RNA. The method relies on a collection of short, computationally selected oligonucleotides, called 'not-so-random' (NSR) primers, to obtain full-length, strand-specific representation of nonribosomal RNA transcripts. In this study we validated the technique by profiling human whole brain and universal human reference RNA using ultra-high-throughput sequencing.

Differentiation of respiratory syncytial virus subgroups with cDNA probes in a nucleic acid hybridization assay.

PubMed Central

Sullender, W M; Anderson, L J; Anderson, K; Wertz, G W

1990-01-01

A new approach to respiratory syncytial (RS) virus subgroup determination was developed by using a simple nucleic acid filter hybridization technique. By this method, virus-infected cells are bound and fixed in a single step, and the viral RNA in the fixed-cell preparation is characterized directly by its ability to hybridize to cDNA probes specific for either the A or B subgroups of RS virus. The subgroup-specific probes were constructed from cDNA clones that corresponded to a portion of the extracellular domain of the RS virus G protein of either a subgroup B RS virus (8/60) or a subgroup A RS virus (A2). The cDNA probes were labeled with 32P and used to analyze RS virus isolates collected over a period of three decades. Replicate templates of infected cell preparations were hybridized with either the subgroup A or B probe. The subgroup assignments of 40 viruses tested by nucleic acid hybridization were in agreement with the results of subgroup determinations based on their reactivities with monoclonal antibodies, which previously has been the only method available for determining the subgroup classification of RS virus isolates. The nucleic acid hybridization assay has the advantage of providing broad-based discrimination of the two subgroups on the basis of nucleic acid homology, irrespective of minor antigenic differences that are detected in assays in which monoclonal antibodies are used. The nucleic acid hybridization technique provides a reliable method for RS virus subgroup characterization. Images PMID:2118548

Quantitation of apolipoprotein epsilon gene expression by competitive polymerase chain reaction in a patient with familial apolipoprotein E deficiency.

PubMed

Dobmeyer, J M; Rexin, M; Dobmeyer, T S; Klein, S A; Rossol, R; Feussner, G

1998-06-22

A simple method of obtaining semiquantitative and reliable data on apolipoprotein (apo) sigma gene expression is described. We detected apo sigma specific sequences by reverse transcription (rT)-PCR. For quantitative measurement, an apo sigma DNA standard was produced allowing the development of a competitive PCR-method. The efficiency of RNA extraction and cDNA synthesis was controlled by quantitation of a housekeeping gene (glyceraldehyde-3-phosphatedehydrogenase, G3PDH) in separate reactions. To imitate a defined induction of apo sigma gene expression, serial twofold dilutions of total RNA were reversely transcribed and the respective cDNAs used to perform a competitive apo sigma and G3PDH PCR. The change in apo sigma cDNA and G3PDH cDNA was 1.7-2.3-fold with an expected value of 2.0-fold. Standard deviations in three independently performed experiments were within a range of < 15% of the mean, indicating low intra-assay variation and high reproducibility. To illustrate this method, apo sigma gene expression was measured in a patient with complete lack of functional active apo E in comparison to healthy controls. The method presented here might be valuable in assessment of apo sigma gene expression in human disease.

Targeted disruption of the murine Facc gene: Towards the establishment of a mouse model for Fanconi anemia

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, M.; Auerbach, W.; Buchwald, M.

1994-09-01

Fanconi anemia (FA) is an autosomal recessive disease characterized by bone marrow failure, congenital malformations and predisposition to malignancies. The gene responsible for the defect in FA group C has been cloned and designated the Fanconi Anemia Complementation Group C gene (FACC). A murine cDNA for this gene (Facc) was also cloned. Here we report our progress in the establishment of a mouse model for FA. The mouse Facc cDNA was used as probe to screen a genomic library of mouse strain 129. More than twenty positive clones were isolated. Three of them were mapped and found to be overlappingmore » clones, encompassing the genomic region from exon 8 to the end of the 3{prime} UTR of the mouse cDNA. A targeting vector was constructed using the most 5{prime} mouse genomic sequence available. The end result of the homologous recombination is that exon 8 is deleted and the neo gene is inserted. The last exon, exon 14, is essential for the complementing function of the FACC gene product; the disruption in the middle of the murine Facc gene should render this locus biologically inactive. This targeting vector was linearized and electroporated into R1 embryonic stem (ES) cells which were derived from the 129 mouse. Of 102 clones screened, 19 positive cell lines were identified. Four targeted cell lines have been used to produce chimeric mice. 129-derived ES cells were aggregated ex vivo into the morulas derived from CD1 mice and then implanted into foster mothers. 22 chimeras have been obtained. Moderately and strongly chimeric mice have been bred to test for germline transmission. Progeny with the expected coat color derived from 2 chimeras are currently being examined to confirm transmission of the targeted allele.« less

Isolation and characterization of 21 novel expressed DNA sequences from the distal region of human chromosome 4p

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ishida, Yoshikazu; Hadano, Shinji; Nagayama, Tomiko

1994-07-15

The authors have established an approach to the isolation of expressed DNA sequences from a defined region of the human chromosome. The method relies on the direct screening of cDNA libraries using pooled single-copy microclones generated by a laser chromosome microdissection in conjunction with a single unique primer polymerase chain reaction (SUP-PCR) procedure. They applied this method to the distal region of human chromosome 4p (4p15-4pter), which contains the Huntington disease (HD) and the Wolf-Hirschhorn syndrome (WHS) loci. Twenty-one nonoverlapping and region-specific cDNA clones encoding novel genes were isolated in this manner. Ten of 21 clones were subregionally assigned tomore » 4p16.1-4pter, and the remainder mapped to the region proximal to 4p16.1. Northern blot and reverse transcription followed by the PCR (RT-PCR) analysis revealed that 16 of these 21 clones detected transcripts in total RNA from human tissues. The method is applicable to other chromosomal regions and is a powerful approach to the isolation of region-specific cDNA clones. 44 refs., 3 figs., 3 tabs.« less

LeERF-1, a novel AP2/ERF family gene within the B3 subcluster, is down-regulated by light signals in Lithospermum erythrorhizon.

PubMed

Zhang, W; Zou, A; Miao, J; Yin, Y; Tian, R; Pang, Y; Yang, R; Qi, J; Yang, Y

2011-03-01

We previously showed that ethylene might be involved in the process of shikonin biosynthesis regulated by light signals. Here, we cloned a full-length cDNA of LeERF-1, a putative ethylene response factor gene, from Lithospermum erythrorhizon using the RACE (rapid amplification of cDNA ends) method. Phylogenetic analysis revealed that LeERF-1 was classified in the B3 subfamily, together with ERF1 and ORA59 of Arabidopsis. Heterologous expression of LeERF-1 in Arabidopsis showed that LeERF-1:eGFP fusion protein was precisely localised to the nucleus, implying that it might function as a transcription factor. Detailed expression analysis with real-time PCR showed that LeERF-1 was significantly down-regulated by white, blue and red light, although the inhibitory effect of red light was relatively weak compared to other light conditions. Tissue-specific expression analysis also indicated that LeERF-1 was dominantly expressed in the roots, which grow in soil in darkness. These patterns are all consistent with the effects of different light signals on regulating formation of shikonin and its derivatives, indicating that LeERF-1 might be a crucial positive regulator, like other B3 subfamily proteins (such as ORCA3 and ORA59), in regulating biosynthesis of secondary metabolites. © 2010 German Botanical Society and The Royal Botanical Society of the Netherlands.

Targeted Modification of a Novel Amphibian Antimicrobial Peptide from Phyllomedusa tarsius to Enhance Its Activity against MRSA and Microbial Biofilm

PubMed Central

Gao, Yitian; Wu, Di; Wang, Lei; Lin, Chen; Ma, Chengbang; Xi, Xinping; Zhou, Mei; Duan, Jinao; Bininda-Emonds, Olaf R. P.; Chen, Tianbao; Shaw, Chris

2017-01-01

Antimicrobial peptides (AMPs) in the skin secretions of amphibians are fundamental components of a unique defense system that has evolved to protect these hosts from microbial invasion. Medusins constitute a recently-discovered AMP family from phyllomedusine leaf frog skin and exhibit highly-conserved structural characteristics. Here, we report a novel medusin, medusin-PT, from the skin secretion of the Tarsier Leaf Frog, Phyllomedusa tarsius. The mature peptide was initially identified from its cloned biosynthetic precursor-encoding cDNA as obtained by the rapid amplification of cDNA ends (RACE) method. Reverse-phase HPLC and tandem mass spectrometry confirmed both the presence of medusin-PT in the skin secretion and its primary structure. In a range of bioassays, medusin-PT exhibited antimicrobial activity against only the Gram-positive bacterium Staphylococcus aureus at 64 μg/ml. However, after directed changes to enhance the cationicity and amphipathicity of the peptide structure, three analog showed more potent antimicrobial activity against several additional bacteria including the antibiotic-resistant bacterium MRSA. In addition, these analog exhibited activity against microbial biofilm (minimum biofilm inhibitory and eradication concentrations of 32 μg/ml and over 64 μg/ml, respectively). These data provide evidence that medusins might be promising candidates as novel antibiotic leads and that the targeted modification of a natural AMP can both improve its efficacy so as to provide new insights into antibiotic design and development. PMID:28469603

Large-scale collection of full-length cDNA and transcriptome analysis in Hevea brasiliensis

PubMed Central

Makita, Yuko; Ng, Kiaw Kiaw; Veera Singham, G.; Kawashima, Mika; Hirakawa, Hideki; Sato, Shusei

2017-01-01

Abstract Natural rubber has unique physical properties that cannot be replaced by products from other latex-producing plants or petrochemically produced synthetic rubbers. Rubber from Hevea brasiliensis is the main commercial source for this natural rubber that has a cis-polyisoprene configuration. For sustainable production of enough rubber to meet demand elucidation of the molecular mechanisms involved in the production of latex is vital. To this end, we firstly constructed rubber full-length cDNA libraries of RRIM 600 cultivar and sequenced around 20,000 clones by the Sanger method and over 15,000 contigs by Illumina sequencer. With these data, we updated around 5,500 gene structures and newly annotated around 9,500 transcription start sites. Second, to elucidate the rubber biosynthetic pathways and their transcriptional regulation, we carried out tissue- and cultivar-specific RNA-Seq analysis. By using our recently published genome sequence, we confirmed the expression patterns of the rubber biosynthetic genes. Our data suggest that the cytoplasmic mevalonate (MVA) pathway is the main route for isoprenoid biosynthesis in latex production. In addition to the well-studied polymerization factors, we suggest that rubber elongation factor 8 (REF8) is a candidate factor in cis-polyisoprene biosynthesis. We have also identified 39 transcription factors that may be key regulators in latex production. Expression profile analysis using two additional cultivars, RRIM 901 and PB 350, via an RNA-Seq approach revealed possible expression differences between a high latex-yielding cultivar and a disease-resistant cultivar. PMID:28431015

Gardenia jasminoides Encodes an Inhibitor-2 Protein for Protein Phosphatase Type 1

NASA Astrophysics Data System (ADS)

Gao, Lan; Li, Hao-Ming

2017-08-01

Protein phosphatase-1 (PP1) regulates diverse, essential cellular processes such as cell cycle progression, protein synthesis, muscle contraction, carbohydrate metabolism, transcription and neuronal signaling. Inhibitor-2 (I-2) can inhibit the activity of PP1 and has been found in diverse organisms. In this work, a Gardenia jasminoides fruit cDNA library was constructed, and the GjI-2 cDNA was isolated from the cDNA library by sequencing method. The GjI-2 cDNA contains a predicted 543 bp open reading frame that encodes 180 amino acids. The bioinformatics analysis suggested that the GjI-2 has conserved PP1c binding motif, and contains a conserved phosphorylation site, which is important in regulation of its activity. The three-dimensional model structure of GjI-2 was buite, its similar with the structure of I-2 from mouse. The results suggest that GjI-2 has relatively conserved RVxF, FxxR/KxR/K and HYNE motif, and these motifs are involved in interaction with PP1.

Recovery of infectious type Asia1 foot-and-mouth disease virus from suckling mice directly inoculated with an RNA polymerase I/II-driven unidirectional transcription plasmid.

PubMed

Lian, Kaiqi; Yang, Fan; Zhu, Zixiang; Cao, Weijun; Jin, Ye; Li, Dan; Zhang, Keshan; Guo, Jianhong; Zheng, Haixue; Liu, Xiangtao

2015-10-02

We developed an RNA polymerase (pol) I- and II-driven plasmid-based reverse genetics system to rescue infectious foot-and-mouth disease virus (FMDV) from cloned cDNA. In this plasmid-based transfection, the full-length viral cDNA was flanked by hammerhead ribozyme (HamRz) and hepatitis delta ribozyme (HdvRz) sequences, which were arranged downstream of the two promoters (cytomegalovirus (CMV) and pol I promoter) and upstream of the terminators and polyadenylation signal, respectively. The utility of this method was demonstrated by the recovery of FMDV Asia1 HN/CHA/06 in BHK-21 cells transfected with cDNA plasmids. Furthermore, infectious FMDV Asia1 HN/CHA/06 could be rescued from suckling mice directly inoculated with cDNA plasmids. Thus, this reverse genetics system can be applied to fundamental research and vaccine studies, most notably to rescue those viruses for which there is currently an absence of a suitable cell culture system. Copyright © 2015 Elsevier B.V. All rights reserved.

MASQOT: a method for cDNA microarray spot quality control

PubMed Central

Bylesjö, Max; Eriksson, Daniel; Sjödin, Andreas; Sjöström, Michael; Jansson, Stefan; Antti, Henrik; Trygg, Johan

2005-01-01

Background cDNA microarray technology has emerged as a major player in the parallel detection of biomolecules, but still suffers from fundamental technical problems. Identifying and removing unreliable data is crucial to prevent the risk of receiving illusive analysis results. Visual assessment of spot quality is still a common procedure, despite the time-consuming work of manually inspecting spots in the range of hundreds of thousands or more. Results A novel methodology for cDNA microarray spot quality control is outlined. Multivariate discriminant analysis was used to assess spot quality based on existing and novel descriptors. The presented methodology displays high reproducibility and was found superior in identifying unreliable data compared to other evaluated methodologies. Conclusion The proposed methodology for cDNA microarray spot quality control generates non-discrete values of spot quality which can be utilized as weights in subsequent analysis procedures as well as to discard spots of undesired quality using the suggested threshold values. The MASQOT approach provides a consistent assessment of spot quality and can be considered an alternative to the labor-intensive manual quality assessment process. PMID:16223442

Molecular Cloning, Bioinformatics Analysis and Expression of Insulin-Like Growth Factor 2 from Tianzhu White Yak, Bos grunniens

PubMed Central

Zhang, Quanwei; Gong, Jishang; Wang, Xueying; Wu, Xiaohu; Li, Yalan; Ma, Youji; Zhang, Yong; Zhao, Xingxu

2014-01-01

The IGF family is essential for normal embryonic and postnatal development and plays important roles in the immune system, myogenesis, bone metabolism and other physiological functions, which makes the study of its structure and biological characteristics important. Tianzhu white yak (Bos grunniens) domesticated under alpine hypoxia environments, is well adapted to survive and grow against severe hypoxia and cold temperatures for extended periods. In this study, a full coding sequence of the IGF2 gene of Tianzhu white yak was amplified by reverse transcription PCR and rapid-amplification of cDNA ends (RACE) for the first time. The cDNA sequence revealed an open reading frame of 450 nucleotides, encoding a protein with 179 amino acids. Its expression in different tissues was also studied by Real time PCR. Phylogenetic tree analysis indicated that yak IGF2 was similar to Bos taurus, and 3D structure showed high similarity with the human IGF2. The putative full CDS of yak IGF2 was amplified by PCR in five tissues, and cDNA sequence analysis showed high homology to bovine IGF2. Moreover the super secondary structure prediction showed a similar 3D structure with human IGF2. Its conservation in sequence and structure has facilitated research on IGF2 and its physiological function in yak. PMID:24394317

Isolation and Characterization of a Sex-Specific Lectin in a Marine Red Alga, Aglaothamnion oosumiense Itono

PubMed Central

Han, Jong Won; Klochkova, Tatyana A.; Shim, Jun Bo; Yoon, Kangsup

2012-01-01

In red algae, spermatial binding to female trichogynes is mediated by a lectin-carbohydrate complementary system. Aglaothamnion oosumiense is a microscopic filamentous red alga. The gamete recognition and binding occur at the surface of the hairlike trichogyne on the female carpogonium. Male spermatia are nonmotile. Previous studies suggested the presence of a lectin responsible for gamete recognition on the surface of female trychogynes. A novel N-acetyl-d-galactosamine-specific protein was isolated from female plants of A. oosumiense by affinity chromatography and named AOL1. The lectin was monomeric and did not agglutinate horse blood or human erythrocytes. The N-terminal amino acid sequence of the protein was analyzed, and degenerate primers were designed. A full-length cDNA encoding the lectin was obtained using rapid amplification of cDNA ends-PCR (RACE-PCR). The cDNA was 1,095 bp in length and coded for a protein of 259 amino acids with a deduced molecular mass of 21.4 kDa, which agreed well with the protein data. PCR analysis using genomic DNA showed that both male and female plants have this gene. However, Northern blotting and two-dimensional electrophoresis showed that this protein was expressed 12 to 15 times more in female plants. The lectin inhibited spermatial binding to the trichogynes when preincubated with spermatia, suggesting its involvement in gamete binding. PMID:22865077

Large-Scale Collection and Analysis of Full-Length cDNAs from Brachypodium distachyon and Integration with Pooideae Sequence Resources

PubMed Central

Mochida, Keiichi; Uehara-Yamaguchi, Yukiko; Takahashi, Fuminori; Yoshida, Takuhiro; Sakurai, Tetsuya; Shinozaki, Kazuo

2013-01-01

A comprehensive collection of full-length cDNAs is essential for correct structural gene annotation and functional analyses of genes. We constructed a mixed full-length cDNA library from 21 different tissues of Brachypodium distachyon Bd21, and obtained 78,163 high quality expressed sequence tags (ESTs) from both ends of ca. 40,000 clones (including 16,079 contigs). We updated gene structure annotations of Brachypodium genes based on full-length cDNA sequences in comparison with the latest publicly available annotations. About 10,000 non-redundant gene models were supported by full-length cDNAs; ca. 6,000 showed some transcription unit modifications. We also found ca. 580 novel gene models, including 362 newly identified in Bd21. Using the updated transcription start sites, we searched a total of 580 plant cis-motifs in the −3 kb promoter regions and determined a genome-wide Brachypodium promoter architecture. Furthermore, we integrated the Brachypodium full-length cDNAs and updated gene structures with available sequence resources in wheat and barley in a web-accessible database, the RIKEN Brachypodium FL cDNA database. The database represents a “one-stop” information resource for all genomic information in the Pooideae, facilitating functional analysis of genes in this model grass plant and seamless knowledge transfer to the Triticeae crops. PMID:24130698

Nucleic Acid Research Group (NARG) 2009-2010 Study : Optimal Priming Strategies for cDNA Synthesis in Real-Time RT-qPCR

PubMed Central

Hunter, T.C.; Knudtson, K.L.; Nadella, V.; Sol-Church, K.; Taylor, W.L.; Tighe, S.; Yueng, A.T.; Chittur, S.

2010-01-01

r1-1 Real-time reverse transcriptase quantitative PCR (RT-qPCR) is a widely used technique for measuring transcript levels. Priming strategy and reverse transcriptase enzyme are key elements that affect sensitivity and variability of RT-qPCR and microarray results. Previously, the Nucleic Acid Research Group (NARG) had conducted preliminary studies within the group to examine the effects of priming strategy on generating cDNA for use with qPCR. This year's study was an open study in which the qPCR community was invited to participate. Participants received the RT primers and RNA template and were asked to perform the RT reaction using their preferred reaction conditions. Each participating laboratory was provided at least two RNA templates of varying quality. The RT products were returned to the NARG and all RT reactions were used in a qPCR reaction. The qPCR assays looked at three genes of varying abundance, b-actin (high copy), b-glucuronidase (medium copy) and TATA binding protein (low copy) as well as varying distance from the 3? end for each transcript. Results from participating laboratories will be evaluated to determine the impact of priming strategy, assay chemistry and experimental setup on the RT step. Additionally, we will address the impact of RNA integrity on cDNA synthesis.

Molecular cloning, cellular expression and characterization of Arabian camel (Camelus dromedarius) endoplasmin.

PubMed

Hoter, Abdullah; Amiri, Mahdi; Warda, Mohamad; Naim, Hassan Y

2018-05-27

Endoplasmin, or GRP94, is an ER-located stress inducible molecular chaperone implicated in the folding and assembly of many proteins. The Arabian one-humped camel lives in an environment of thermal stress, nevertheless is able to encounter the risk of misfolded proteins. Here, the cDNA encoding camel GRP94 was isolated by rapid amplification of cDNA ends. The isolated cDNA contained an open reading frame of 2412 bp encoding a protein of 803 amino acids with predicted molecular mass of 92.5 kDa. Nucleotide and protein BLAST analysis of cGRP94 revealed strong conservation between camel and other domestic mammals. Overexpression of cGRP94 in COS-1 cells revealed multiple isoforms including one N-glycosylated species. Immunofluorescence colocalized cGRP94 with the ER resident protein calnexin. Interestingly, none of the cGRP94 isoforms expressed in CHO cells was N-glycosylated, presumably due to folding determinants that mask the N-glycosylation sites as proposed by in silico modelling. Surprisingly, isoforms of cGRP94 were detected in the culture media of transfected cells indicating that the protein, although an ER resident, also is trafficked and secreted into the exterior milieu. The overall striking structural homologies of GRP94s among mammalian reflects their pivotal role in the ER quality control and protein homeostasis. Copyright © 2017. Published by Elsevier B.V.

[Investigation of RNA viral genome amplification by multiple displacement amplification technique].

PubMed

Pang, Zheng; Li, Jian-Dong; Li, Chuan; Liang, Mi-Fang; Li, De-Xin

2013-06-01

In order to facilitate the detection of newly emerging or rare viral infectious diseases, a negative-strand RNA virus-severe fever with thrombocytopenia syndrome bunyavirus, and a positive-strand RNA virus-dengue virus, were used to investigate RNA viral genome unspecific amplification by multiple displacement amplification technique from clinical samples. Series of 10-fold diluted purified viral RNA were utilized as analog samples with different pathogen loads, after a series of reactions were sequentially processed, single-strand cDNA, double-strand cDNA, double-strand cDNA treated with ligation without or with supplemental RNA were generated, then a Phi29 DNA polymerase depended isothermal amplification was employed, and finally the target gene copies were detected by real time PCR assays to evaluate the amplification efficiencies of various methods. The results showed that multiple displacement amplification effects of single-strand or double-strand cDNA templates were limited, while the fold increases of double-strand cDNA templates treated with ligation could be up to 6 X 10(3), even 2 X 10(5) when supplemental RNA existed, and better results were obtained when viral RNA loads were lower. A RNA viral genome amplification system using multiple displacement amplification technique was established in this study and effective amplification of RNA viral genome with low load was achieved, which could provide a tool to synthesize adequate viral genome for multiplex pathogens detection.

Evaluation of reference genes for reverse transcription quantitative real-time PCR (RT-qPCR) studies in Silene vulgaris considering the method of cDNA preparation

PubMed Central

Koloušková, Pavla; Stone, James D.

2017-01-01

Accurate gene expression measurements are essential in studies of both crop and wild plants. Reverse transcription quantitative real-time PCR (RT-qPCR) has become a preferred tool for gene expression estimation. A selection of suitable reference genes for the normalization of transcript levels is an essential prerequisite of accurate RT-qPCR results. We evaluated the expression stability of eight candidate reference genes across roots, leaves, flower buds and pollen of Silene vulgaris (bladder campion), a model plant for the study of gynodioecy. As random priming of cDNA is recommended for the study of organellar transcripts and poly(A) selection is indicated for nuclear transcripts, we estimated gene expression with both random-primed and oligo(dT)-primed cDNA. Accordingly, we determined reference genes that perform well with oligo(dT)- and random-primed cDNA, making it possible to estimate levels of nucleus-derived transcripts in the same cDNA samples as used for organellar transcripts, a key benefit in studies of cyto-nuclear interactions. Gene expression variance was estimated by RefFinder, which integrates four different analytical tools. The SvACT and SvGAPDH genes were the most stable candidates across various organs of S. vulgaris, regardless of whether pollen was included or not. PMID:28817728

Developing cDNA Libraries of Receptors Involved in the Recruitment of the Biofouling Tubeworm Hydroides elegans

DTIC Science & Technology

2014-06-12

Transcriptome, Hydroides elegans, Next Generation Sequencing, Illumina HiSeq, PacBio SMRT, Biofilm , Metamorphosis 16. SECURITY CLASSIFICATION OF: a...to a bacterial cue from a bacterial biofilm . Recently, this cue has been identified to be a phage-tail like bacteriocin produced by the bacterium...submitted to the Huntsman Cancer Institute at the University of Utah and the subsequent isolation of mRNA was used for Illumina HiSeq 101 paired end

The Role of elF4E Activity in Breast Cancer

DTIC Science & Technology

2011-08-01

protein; ORF, open reading frame; qPCR, quantitative PCR; RACE, rapid amplification of cDNA ends; RT, reverse transcriptase ; uORF, upstream ORF; UTR...Reactions were also performed using template lacking RT ( reverse transcriptase ): products were either undetectable or greatly reduced (>30000-fold less...that a 5’UTR expressed from the human AXIN2 gene contains a sixty nucleotide sequence that is predicted to form a stable stem-loop structure6. This

Striated muscle preferentially expressed genes alpha and beta are two serine/threonine protein kinases derived from the same gene as the aortic preferentially expressed gene-1.

PubMed

Hsieh, C M; Fukumoto, S; Layne, M D; Maemura, K; Charles, H; Patel, A; Perrella, M A; Lee, M E

2000-11-24

Aortic preferentially expressed gene (APEG)-1 is a 1.4-kilobase pair (kb) mRNA expressed in vascular smooth muscle cells and is down-regulated by vascular injury. An APEG-1 5'-end cDNA probe identified three additional isoforms. The 9-kb striated preferentially expressed gene (SPEG)alpha and the 11-kb SPEGbeta were found in skeletal muscle and heart. The 4-kb brain preferentially expressed gene was detected in the brain and aorta. We report here cloning of the 11-kb SPEGbeta cDNA. SPEGbeta encodes a 355-kDa protein that contains two serine/threonine kinase domains and is homologous to proteins of the myosin light chain kinase family. At least one kinase domain is active and capable of autophosphorylation. In the genome, all four isoforms share the middle three of the five exons of APEG-1, and they differ from each other by using different 5'- and 3'-ends and alternative splicing. We show that the expression of SPEGalpha and SPEGbeta is developmentally regulated in the striated muscle during C2C12 myoblast to myotube differentiation in vitro and cardiomyocyte maturation in vivo. This developmental regulation suggests that both SPEGalpha and SPEGbeta can serve as sensitive markers for striated muscle differentiation and that they may be important for adult striated muscle function.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gilchrist, Michael J.; Sobral, Daniel; Khoueiry, Pierre

Genome-wide resources, such as collections of cDNA clones encoding for complete proteins (full-ORF clones), are crucial tools for studying the evolution of gene function and genetic interactions. Non-model organisms, in particular marine organisms, provide a rich source of functional diversity. Marine organism genomes are, however, frequently highly polymorphic and encode proteins that diverge significantly from those of well-annotated model genomes. The construction of full-ORF clone collections from non-model organisms is hindered by the difficulty of predicting accurately the N-terminal ends of proteins, and distinguishing recent paralogs from highly polymorphic alleles. We also report a computational strategy that overcomes these difficulties,more » and allows for accurate gene level clustering of transcript data followed by the automated identification of full-ORFs with correct 5'- and 3'-ends. It is robust to polymorphism, includes paralog calling and does not require evolutionary proximity to well annotated model organisms. Here, we developed this pipeline for the ascidian Ciona intestinalis, a highly polymorphic member of the divergent sister group of the vertebrates, emerging as a powerful model organism to study chordate gene function, Gene Regulatory Networks and molecular mechanisms underlying human pathologies. Furthermore, using this pipeline we have generated the first full-ORF collection for a highly polymorphic marine invertebrate. It contains 19,163 full-ORF cDNA clones covering 60% of Ciona coding genes, and full-ORF orthologs for approximately half of curated human disease-associated genes.« less

Multisegment nanowire sensors for the detection of DNA molecules.

PubMed

Wang, Xu; Ozkan, Cengiz S

2008-02-01

We describe a novel application for detecting specific single strand DNA sequences using multisegment nanowires via a straightforward surface functionalization method. Nanowires comprising CdTe-Au-CdTe segments are fabricated using electrochemical deposition, and electrical characterization indicates a p-type behavior for the multisegment nanostructures, in a back-to-back Schottky diode configuration. Such nanostructures modified with thiol-terminated probe DNA fragments could function as high fidelity sensors for biomolecules at very low concentration. The gold segment is utilized for functionalization and binding of single strand DNA (ssDNA) fragments while the CdTe segments at both ends serve to modulate the equilibrium Fermi level of the heterojunction device upon hybridization of the complementary DNA fragments (cDNA) to the ssDNA over the Au segment. Employing such multisegment nanowires could lead to the fabrication more sophisticated and high multispecificity biosensors via selective functionalization of individual segments for biowarfare sensing and medical diagnostics applications.

RNA-Seq analysis to capture the transcriptome landscape of a single cell

PubMed Central

Tang, Fuchou; Barbacioru, Catalin; Nordman, Ellen; Xu, Nanlan; Bashkirov, Vladimir I; Lao, Kaiqin; Surani, M. Azim

2013-01-01

We describe here a protocol for digital transcriptome analysis in a single mouse blastomere using a deep sequencing approach. An individual blastomere was first isolated and put into lysate buffer by mouth pipette. Reverse transcription was then performed directly on the whole cell lysate. After this, the free primers were removed by Exonuclease I and a poly(A) tail was added to the 3′ end of the first-strand cDNA by Terminal Deoxynucleotidyl Transferase. Then the single cell cDNAs were amplified by 20 plus 9 cycles of PCR. Then 100-200 ng of these amplified cDNAs were used to construct a sequencing library. The sequencing library can be used for deep sequencing using the SOLiD system. Compared with the cDNA microarray technique, our assay can capture up to 75% more genes expressed in early embryos. The protocol can generate deep sequencing libraries within 6 days for 16 single cell samples. PMID:20203668

Preparation of fluorescent-dye-labeled cDNA from RNA for microarray hybridization.

PubMed

Ares, Manuel

2014-01-01

This protocol describes how to prepare fluorescently labeled cDNA for hybridization to microarrays. It consists of two steps: first, a mixture of anchored oligo(dT) and random hexamers is used to prime amine-modified cDNA synthesis by reverse transcriptase using a modified deoxynucleotide with a reactive amine group (aminoallyl-dUTP) and an RNA sample as a template. Second, the cDNA is purified and exchanged into bicarbonate buffer so that the amine groups in the cDNA react with the dye N-hydroxysuccinimide (NHS) esters, covalently joining the dye to the cDNA. The dye-coupled cDNA is purified again, and the amount of dye incorporated per microgram of cDNA is determined.

Leishmania mexicana Gp63 cDNA Using Gene Gun Induced Higher Immunity to L. mexicana Infection Compared to Soluble Leishmania Antigen in BALB/C

PubMed Central

Rezvan, H; Rees, R; Ali, SA

2011-01-01

Background Leishmaniasis is a worldwide disease prevalent in tropical and sub tropical countries. Many attempts have been made and different strategies have been approached to develop a potent vaccine against Leishmania. DNA immunisation is a method, which is shown to be effective in Leishmania vaccination. Leishmania Soluble Antigen (SLA) has also recently been used Leishmania vaccination. Methods The immunity generated by SLA and L. mexicana gp63 cDNA was compared in groups of 6 mice, which were statistically analysed by student t- test with the P-value of 0.05. SLA was administered by two different methods; intramuscular injection and injection of dendritic cells (DCs) loaded with SLA. L. mexicana gp63 cDNA was administered by the gene gun. Results Immunisation of BALB/c mice with L. mexicana gp63 resulted in high levels of Th1-type immune response and cytotoxic T lymphocytes (CTL) activity, which were accompanied with protection induced by the immunisation against L. mexicana infection. In contrast, administration of SLA, produced a mixed Th1/Th2-type immune responses as well as a high level of CTL activity but did not protect mice from the infection. Conclusion The results indicate higher protection by DNA immunisation using L. mexicana gp63 cDNA compared to SLA, which is accompanied by a high level of Th1 immune response. However, the CTL activity does not necessarily correlate with the protection induced by the vaccine. Also, gene gun immunisation is a potential approach in Leishmania vaccination. These findings would be helpful in opening new windows in Leishmania vaccine research. PMID:22347315

Repressible Transgenic Sterilization in Channel Catfish, Ictalurus punctatus, by Knockdown of Primordial Germ Cell Genes with Copper-Sensitive Constructs.

PubMed

Li, Hanbo; Su, Baofeng; Qin, Guyu; Ye, Zhi; Elaswad, Ahmed; Alsaqufi, Ahmed; Perera, Dayan A; Qin, Zhenkui; Odin, Ramji; Vo, Khoi; Drescher, David; Robinson, Dalton; Dong, Sheng; Zhang, Dan; Shang, Mei; Abass, Nermeen; Das, Sanjay K; Bangs, Max; Dunham, Rex A

2018-06-01

Repressible knockdown approaches were investigated to manipulate for transgenic sterilization in channel catfish, Ictalurus punctatus. Two primordial germ cell (PGC) marker genes, nanos and dead end, were targeted for knockdown and an off-target gene, vasa, was monitored. Two potentially copper-sensitive repressible promoters, yeast ctr3 (M) and ctr3-reduced (Mctr), were coupled with four knockdown strategies separately including: ds-sh RNA targeting the 5' end (N1) or 3' end (N2) of channel catfish nanos, full-length cDNA sequence of channel catfish nanos for overexpression (cDNA), and ds-sh RNA-targeting channel catfish dead end (DND). Each construct had an untreated group and treated group with copper sulfate as the repressor compound. Spawning rates of full-sibling P 1 fish exposed or not exposed to the constructs as treated and untreated embryos were 85 and 54%, respectively, indicating potential sterilization of fish and repression of the constructs. In F 1 fish, mRNA expressions of PGC marker genes for most constructs were downregulated in the untreated group and the knockdown was repressed in the treated group. Gonad development in transgenic, untreated F 1 channel catfish was reduced compared to non-transgenic fish for MctrN2, MN1, MN2, and MDND. For 3-year-old adults, gonad size in the transgenic untreated group was 93.4% smaller than the non-transgenic group for females and 92.3% for males. However, mean body weight of transgenic females (781.8 g) and males (883.8 g) was smaller than of non-transgenic counterparts (984.2 and 1254.3 g) at 3 years of age, a 25.8 and 41.9% difference for females and males, respectively. The results indicate that repressible transgenic sterilization is feasible for reproductive control of fish, but negative pleiotropic effects can result.

Partial Characterization of Normal and Haemophilus influenzae–Infected Mucosal Complementary DNA Libraries in Chinchilla Middle Ear Mucosa

PubMed Central

Kerschner, Joseph E.; Erdos, Geza; Hu, Fen Ze; Burrows, Amy; Cioffi, Joseph; Khampang, Pawjai; Dahlgren, Margaret; Hayes, Jay; Keefe, Randy; Janto, Benjamin; Post, J. Christopher; Ehrlich, Garth D.

2010-01-01

Objectives We sought to construct and partially characterize complementary DNA (cDNA) libraries prepared from the middle ear mucosa (MEM) of chinchillas to better understand pathogenic aspects of infection and inflammation, particularly with respect to leukotriene biogenesis and response. Methods Chinchilla MEM was harvested from controls and after middle ear inoculation with nontypeable Haemophilus influenzae. RNA was extracted to generate cDNA libraries. Randomly selected clones were subjected to sequence analysis to characterize the libraries and to provide DNA sequence for phylogenetic analyses. Reverse transcription–polymerase chain reaction of the RNA pools was used to generate cDNA sequences corresponding to genes associated with leukotriene biosynthesis and metabolism. Results Sequence analysis of 921 randomly selected clones from the uninfected MEM cDNA library produced approximately 250,000 nucleotides of almost entirely novel sequence data. Searches of the GenBank database with the Basic Local Alignment Search Tool provided for identification of 515 unique genes expressed in the MEM and not previously described in chinchillas. In almost all cases, the chinchilla cDNA sequences displayed much greater homology to human or other primate genes than with rodent species. Genes associated with leukotriene metabolism were present in both normal and infected MEM. Conclusions Based on both phylogenetic comparisons and gene expression similarities with humans, chinchilla MEM appears to be an excellent model for the study of middle ear inflammation and infection. The higher degree of sequence similarity between chinchillas and humans compared to chinchillas and rodents was unexpected. The cDNA libraries from normal and infected chinchilla MEM will serve as useful molecular tools in the study of otitis media and should yield important information with respect to middle ear pathogenesis. PMID:20433028

Csa-19, a radiation-responsive human gene, identified by an unbiased two-gel cDNA library screening method in human cancer cells

NASA Technical Reports Server (NTRS)

Balcer-Kubiczek, E. K.; Meltzer, S. J.; Han, L. H.; Zhang, X. F.; Shi, Z. M.; Harrison, G. H.; Abraham, J. M.

1997-01-01

A novel polymerase chain reaction (PCR)-based method was used to identify candidate genes whose expression is altered in cancer cells by ionizing radiation. Transcriptional induction of randomly selected genes in control versus irradiated human HL60 cells was compared. Among several complementary DNA (cDNA) clones recovered by this approach, one cDNA clone (CL68-5) was downregulated in X-irradiated HL60 cells but unaffected by 12-O-tetradecanoyl phorbol-13-acetate, forskolin, or cyclosporin-A. DNA sequencing of the CL68-5 cDNA revealed 100% nucleotide sequence homology to the reported human Csa-19 gene. Northern blot analysis of RNA from control and irradiated cells revealed the expression of a single 0.7-kilobase (kb) messenger RNA (mRNA) transcript. This 0.7-kb Csa-19 mRNA transcript was also expressed in a variety of human adult and corresponding fetal normal tissues. Moreover, when the effect of X- or fission neutron-irradiation on Csa-19 mRNA was compared in cultured human cells differing in p53 gene status (p53-/- versus p53+/+), downregulation of Csa-19 by X-rays or fission neutrons was similar in p53-wild type and p53-null cell lines. Our results provide the first known example of a radiation-responsive gene in human cancer cells whose expression is not associated with p53, adenylate cyclase or protein kinase C.

Direct sequencing of hepatitis A virus and norovirus RT-PCR products from environmentally contaminated oyster using M13-tailed primers.

PubMed

Williams-Woods, Jacquelina; González-Escalona, Narjol; Burkhardt, William

2011-12-01

Human norovirus (HuNoV) and hepatitis A (HAV) are recognized as leading causes of non-bacterial foodborne associated illnesses in the United States. DNA sequencing is generally considered the standard for accurate viral genotyping in support of epidemiological investigations. Due to the genetic diversity of noroviruses (NoV), degenerate primer sets are often used in conventional reverse transcription (RT) PCR and real-time RT-quantitative PCR (RT-qPCR) for the detection of these viruses and cDNA fragments are generally cloned prior to sequencing. HAV detection methods that are sensitive and specific for real-time RT-qPCR yields small fragments sizes of 89-150bp, which can be difficult to sequence. In order to overcome these obstacles, norovirus and HAV primers were tailed with M13 forward and reverse primers. This modification increases the sequenced product size and allows for direct sequencing of the amplicons utilizing complementary M13 primers. HuNoV and HAV cDNA products from environmentally contaminated oysters were analyzed using this method. Alignments of the sequenced samples revealed ≥95% nucleotide identities. Tailing NoV and HAV primers with M13 sequence increases the cDNA product size, offers an alternative to cloning, and allows for rapid, accurate and direct sequencing of cDNA products produced by conventional or real time RT-qPCR assays. Published by Elsevier B.V.

A simple and novel method for RNA-seq library preparation of single cell cDNA analysis by hyperactive Tn5 transposase.

PubMed

Brouilette, Scott; Kuersten, Scott; Mein, Charles; Bozek, Monika; Terry, Anna; Dias, Kerith-Rae; Bhaw-Rosun, Leena; Shintani, Yasunori; Coppen, Steven; Ikebe, Chiho; Sawhney, Vinit; Campbell, Niall; Kaneko, Masahiro; Tano, Nobuko; Ishida, Hidekazu; Suzuki, Ken; Yashiro, Kenta

2012-10-01

Deep sequencing of single cell-derived cDNAs offers novel insights into oncogenesis and embryogenesis. However, traditional library preparation for RNA-seq analysis requires multiple steps with consequent sample loss and stochastic variation at each step significantly affecting output. Thus, a simpler and better protocol is desirable. The recently developed hyperactive Tn5-mediated library preparation, which brings high quality libraries, is likely one of the solutions. Here, we tested the applicability of hyperactive Tn5-mediated library preparation to deep sequencing of single cell cDNA, optimized the protocol, and compared it with the conventional method based on sonication. This new technique does not require any expensive or special equipment, which secures wider availability. A library was constructed from only 100 ng of cDNA, which enables the saving of precious specimens. Only a few steps of robust enzymatic reaction resulted in saved time, enabling more specimens to be prepared at once, and with a more reproducible size distribution among the different specimens. The obtained RNA-seq results were comparable to the conventional method. Thus, this Tn5-mediated preparation is applicable for anyone who aims to carry out deep sequencing for single cell cDNAs. Copyright © 2012 Wiley Periodicals, Inc.

An evaluation of tyramide signal amplification and archived fixed and frozen tissue in microarray gene expression analysis

PubMed Central

Karsten, Stanislav L.; Van Deerlin, Vivianna M. D.; Sabatti, Chiara; Gill, Lisa H.; Geschwind, Daniel H.

2002-01-01

Archival formalin-fixed, paraffin-embedded and ethanol-fixed tissues represent a potentially invaluable resource for gene expression analysis, as they are the most widely available material for studies of human disease. Little data are available evaluating whether RNA obtained from fixed (archival) tissues could produce reliable and reproducible microarray expression data. Here we compare the use of RNA isolated from human archival tissues fixed in ethanol and formalin to frozen tissue in cDNA microarray experiments. Since an additional factor that can limit the utility of archival tissue is the often small quantities available, we also evaluate the use of the tyramide signal amplification method (TSA), which allows the use of small amounts of RNA. Detailed analysis indicates that TSA provides a consistent and reproducible signal amplification method for cDNA microarray analysis, across both arrays and the genes tested. Analysis of this method also highlights the importance of performing non-linear channel normalization and dye switching. Furthermore, archived, fixed specimens can perform well, but not surprisingly, produce more variable results than frozen tissues. Consistent results are more easily obtainable using ethanol-fixed tissues, whereas formalin-fixed tissue does not typically provide a useful substrate for cDNA synthesis and labeling. PMID:11788730

Hairpin structures with conserved sequence motifs determine the 3' ends of non-polyadenylated invertebrate iridovirus transcripts.

PubMed

İnce, İkbal Agah; Pijlman, Gorben P; Vlak, Just M; van Oers, Monique M

2017-11-01

Previously, we observed that the transcripts of Invertebrate iridescent virus 6 (IIV6) are not polyadenylated, in line with the absence of canonical poly(A) motifs (AATAAA) downstream of the open reading frames (ORFs) in the genome. Here, we determined the 3' ends of the transcripts of fifty-four IIV6 virion protein genes in infected Drosophila Schneider 2 (S2) cells. By using ligation-based amplification of cDNA ends (LACE) it was shown that the IIV6 mRNAs often ended with a CAUUA motif. In silico analysis showed that the 3'-untranslated regions of IIV6 genes have the ability to form hairpin structures (22-56 nt in length) and that for about half of all IIV6 genes these 3' sequences contained complementary TAATG and CATTA motifs. We also show that a hairpin in the 3' flanking region with conserved sequence motifs is a conserved feature in invertebrate-infecting iridoviruses (genus Iridovirus and Chloriridovirus). Copyright © 2017 Elsevier Inc. All rights reserved.

Sequence of Spider Aciniform and Piriform Silks

DTIC Science & Technology

2001-09-19

7/98nd subtan-6/01 4. TITLE AND SUBTITLE Sequence of Spider Aciniform and Piriform Silks 5. FUNDING NUMBERS DAAD19-01-1-0569 6...aciniform glands from Argiope trifasciata were used to construct a cDNA library. The library was probed with various DNA probes based on known spider silk ...sequence in a number of other spider silks . The 5’end of the clone still appears to be repetitive sequence and thus it is unlikely to be a full-length

Targeted Elimination of PCDH-PC Expressing Prostate Cancer Cells for Control of Hormone-Resistant Prostate Cancer

DTIC Science & Technology

2009-11-01

expression knockout by shRNAs or antisense oligonucleotides ( ASOs ) might be useful in preventing the development of castration-recurrent prostate...cancer in prostate cancer patients. To this end, we have created functional shRNA vectors and ASOs capable of suppressing PCDH-PC expression and we have...containing PCDH-PC cDNA. Cell extracts were prepared 48 hrs after co-transfection and were electrophoresed on an SDS-PAGE gel and blotted onto a

Qualitative and Quantitative Assays of Transposition and Homologous Recombination of the Retrotransposon Tf1 in Schizosaccharomyces pombe.

PubMed

Sangesland, Maya; Atwood-Moore, Angela; Rai, Sudhir K; Levin, Henry L

2016-01-01

Transposition and homologous recombination assays are valuable genetic tools to measure the production and integration of cDNA from the long terminal repeat (LTR) retrotransposon Tf1 in the fission yeast (Schizosaccharomyces pombe). Here we describe two genetic assays, one that measures the transposition activity of Tf1 by monitoring the mobility of a drug resistance marked Tf1 element expressed from a multi-copy plasmid and another assay that measures homologous recombination between Tf1 cDNA and the expression plasmid. While the transposition assay measures insertion of full-length Tf1 cDNA mediated by the transposon integrase, the homologous recombination assay measures levels of cDNA present in the nucleus and is independent of integrase activity. Combined, these assays can be used to systematically screen large collections of strains to identify mutations that specifically inhibit the integration step in the retroelement life cycle. Such mutations can be identified because they reduce transposition activity but nevertheless have wild-type frequencies of homologous recombination. Qualitative assays of yeast patches on agar plates detect large defects in integration and recombination, while the quantitative approach provides a precise method of determining integration and recombination frequencies.

Assignment of Alzheimer's presenilin-2 (PS-2) gene to 1q42.1 by fluorescence in situ hybridization.

PubMed

Takano, T; Sahara, N; Yamanouchi, Y; Mori, H

1997-01-17

Presenilin-2 (PS-2) was suggested to be localized on 1q31-42 based on linkage analysis and cDNA cloning. The final identification of PS-2 as the causal gene for early-onset familial Alzheimer's disease in Voga-German pedigrees was concluded based on the point mutation found in the candidate cDNA isolated from this familial AD. We present evidence of its physical genome mapping of PS-2 on chromosome 1q42.1 by fluorescence in situ hybridization method.

A general method to eliminate laboratory induced recombinants during massive, parallel sequencing of cDNA library.

PubMed

Waugh, Caryll; Cromer, Deborah; Grimm, Andrew; Chopra, Abha; Mallal, Simon; Davenport, Miles; Mak, Johnson

2015-04-09

Massive, parallel sequencing is a potent tool for dissecting the regulation of biological processes by revealing the dynamics of the cellular RNA profile under different conditions. Similarly, massive, parallel sequencing can be used to reveal the complexity of viral quasispecies that are often found in the RNA virus infected host. However, the production of cDNA libraries for next-generation sequencing (NGS) necessitates the reverse transcription of RNA into cDNA and the amplification of the cDNA template using PCR, which may introduce artefact in the form of phantom nucleic acids species that can bias the composition and interpretation of original RNA profiles. Using HIV as a model we have characterised the major sources of error during the conversion of viral RNA to cDNA, namely excess RNA template and the RNaseH activity of the polymerase enzyme, reverse transcriptase. In addition we have analysed the effect of PCR cycle on detection of recombinants and assessed the contribution of transfection of highly similar plasmid DNA to the formation of recombinant species during the production of our control viruses. We have identified RNA template concentrations, RNaseH activity of reverse transcriptase, and PCR conditions as key parameters that must be carefully optimised to minimise chimeric artefacts. Using our optimised RT-PCR conditions, in combination with our modified PCR amplification procedure, we have developed a reliable technique for accurate determination of RNA species using NGS technology.

Comparative Analysis of Expressed Genes from Cacao Meristems Infected by Moniliophthora perniciosa

PubMed Central

Gesteira, Abelmon S.; Micheli, Fabienne; Carels, Nicolas; Da Silva, Aline C.; Gramacho, Karina P.; Schuster, Ivan; Macêdo, Joci N.; Pereira, Gonçalo A. G.; Cascardo, Júlio C. M.

2007-01-01

Background and Aims Witches' broom disease is caused by the hemibiotrophic basidiomycete Moniliophthora perniciosa, and is one of the most important diseases of cacao in the western hemisphere. Because very little is known about the global process of such disease development, expressed sequence tags (ESTs) were used to identify genes expressed during the Theobroma cacao–Moniliophthora perniciosa interaction. Methods Two cDNA libraries corresponding to the resistant (RT) and susceptible (SP) cacao–M. perniciosa interactions were constructed from total RNA, using the DB SMART Creator cDNA library kit (Clontech). Clones were randomly selected, sequenced from the 5′ end and analysed using bioinformatics tools including in silico analysis of the differential gene expression. Key Results A total of 6884 ESTs were generated from the RT and SP cDNA libraries. These ESTs were composed of 2585 singlets and 341 contigs for a total of 2926 non-redundant sequences. The redundancy of the libraries was low and their specificity high when compared with the few other cacao libraries already published. Sequence analysis allowed the assignment of a putative functional category for 54 % of sequences, whereas approx. 22 % of sequences corresponded to unknown function and approx. 24 % of sequences did not show any significant similarity with other proteins present in the database. Despite the similar overall distribution of the sequences in functional categories between the two libraries, qualitative differences were observed. Genes involved during the defence response to pathogen infection or in programmed cell death were identified, such as pathogenesis related-proteins, trypsin inhibitor or oxalate oxidase, and some of them showed an in silico differential expression between the resistant and the susceptible interactions. Conclusions As far as is known this is the first EST resource from the cacao–M. perniciosa interaction and it is believed that it will provide a significant contribution to the understanding of the molecular mechanisms of the resistance and susceptibility of cacao to M. perniciosa, to develop strategies to control witches broom, and as a source of polymorphism for molecular marker development and marker-assisted selection. PMID:17557832

The Iron-regulated Transporter, MbNRAMP1, Isolated from Malus baccata is Involved in Fe, Mn and Cd Trafficking

PubMed Central

Xiao, Haihua; Yin, Liping; Xu, Xuefeng; Li, Tianzhong; Han, Zhenhai

2008-01-01

Background and Aims Iron deficiency is one of the most common nutritional disorders in plants, especially in fruit trees grown in calcareous soil. Malus baccata is widely used as an apple rootstock in north China and is highly resistant to low temperatures. There are few studies on iron absorption by this species at the molecular level. It is very important to understand the mechanism of iron uptake and transport in such woody plants. As a helpful tool, the aim of the present study was the cloning and functional analysis of NRAMP (natural resistance-associated macrophage protein) genes from the apple tree in relation to trafficking of micronutrients (Fe, Mn and Cd). Methods Reverse transcription-PCR (RT-PCR) combined with RACE (rapid amplification of cDNA ends) was adopted to isolate the full-length NRAMP1 cDNA. Southern blotting was used to test gene copy information, and northern blot was used to detect the gene's expression level. Complementation experiments using the yeast mutant strains DEY1453 and SLY8 were employed to confirm the iron- and manganese-transporting ability of NRAMP1 from apple, and inductively coupled plasma (ICP) spectrometry was used to measure Cd accumulation in yeast. NRAMP1–green fluorescent protein (GFP) fusion protein was used to determine the cellular localization in yeast. Key Results A 2090 bp cDNA was isolated and named MbNRAMP1. It encodes a predicted polypeptide of 551 amino acids. MbNRAMP1 exists in the M. baccata genome as a single copy and was expressed mainly in roots. MbNRAMP1 rescued the phenotype of yeast mutant strains DEY1453 and SLY8, and also increased Cd2+ sensitivity and accumulation. MbNRAMP1 expression in yeast was largely influenced by iron status, and the expression pattern of MbNRAMP1–GFP varied with the environmental iron nutrition status. Conclusions MbNRAMP1 encodes a functional metal transporter capable of mediating the distribution of ions as well as transport of the micronutrients, Fe and Mn, and the toxic metal, Cd. PMID:18819951

Cloning of rat MLH1 and expression analysis of MSH2, MSH3, MSH6, and MLH1 during spermatogenesis.

PubMed

Geeta Vani, R; Varghese, C M; Rao, M R

1999-12-15

The mismatch repair system has been highly conserved in various species. In eukaryotic cells, the Mut S and Mut L homologues play crucial roles in both DNA mismatch repair and meiotic recombination. A full-length rat cDNA clone for rat MLH1 has been constructed using the RT-PCR method. The cDNA has an open reading frame of 2274 nucleotides for a protein of 757 amino acids. We have also obtained partial cDNA clones for MSH3 and MSH6. Northern blot analysis of rat MLH1, MSH2, MSH3, and MSH6 in the testes of rats of different ages showed differential expression of these genes as a function of developmental maturation of the testes. The expression analysis suggests that MSH3 may have a more predominant role in the meiotic recombination process. Copyright 1999 Academic Press.

Extensive alternative splicing and dual promoter usage generate Tcf-1 protein isoforms with differential transcription control properties.

PubMed Central

Van de Wetering, M; Castrop, J; Korinek, V; Clevers, H

1996-01-01

Previously, we reported the isolation of cDNA clones representing four alternative splice forms of TCF-1, a T-cell-specific transcription factor. In the present study, Western blotting (immunoblotting) yielded a multitude of TCF-1 proteins ranging from 25-55 kDa, a pattern not simply explained from the known splice alternatives. Subsequent cDNA cloning, PCR amplification, and analysis by rapid amplification of 5' cDNA ends revealed (i) the presence of an alternative upstream promoter, which extended the known N terminus by 116 amino acids, (ii) the presence of four alternative exons, and (iii) the existence of a second reading frame in the last exon encoding an extended C terminus. Inclusion of the extended N terminus into the originally reported protein resulted in a striking similarity to the lymphoid factor Lef-1. Several of the TCF-1 isoforms, although less potent, mimicked Lef-1 in transactivating transcription through the T-cell receptor alpha-chain (TCR-alpha) enhancer. These data provide a molecular basis for the complexity of the expressed TCF-1 proteins and establish the existence of functional differences between these isoforms. Furthermore, the functional redundancy between Tcf-1 and Lef-1 explains the apparently normal TCR-alpha expression in single Tcf-1 or Lef-1 knockout mice despite the firm in vitro evidence for the importance of the Tcf/Lef site in the TCR-alpha enhancer. PMID:8622675

Molecular cloning and mRNA expression analysis of interleukin-8 gene in Japanese sea perch (Lateolabrax japonicus).

PubMed

Qiu, Lihua; Zhang, Hanhua; Yang, Keng; Jiang, Shigui

2009-05-01

Interleukin-8 (IL-8), the first known chemokine, is a CXC chemokine, which is cable of attracting neutrophils and inducing them to release lysozomal enzymes, triggering the respiratory burst. In the present study, the cDNA of an IL-8 was cloned from Japanese sea perch Lateolabrax japonicus (designated LjIL-8) by homology cloning and rapid amplification of cDNA ends (RACE) approaches. The full-length cDNA of LjIL-8 consisted of 803 nucleotides with a canonical polyadenylation signal sequence AATAAA and a poly(A) tail, and an open reading frame (ORF) of 300 bp encoding a polypeptide of 99 amino acid residues with a predicted molecular weight of 6.6 kDa. The high identity of LjIL-8 with IL-8 in other organisms indicated that LjIL-8 should be a new member of the IL-8 family. By fluorescent quantitative real-time PCR, mRNA transcript of LjIL-8 was detectable in all the examined tissues with higher level in spleen and head-kidney. The temporal expression of LjIL-8 mRNA in the spleen was up-regulated by lipopolyssacharide (LPS) stimulation and reached the maximum level at 6 h post-stimulation, and then dropped back to the original level gradually. These results indicated that LjIL-8 was a constitutive and inducible acute-phase protein that perhaps involved in the immune defense of L. japonicus.

Isolation and characterization of full-length putative alcohol dehydrogenase genes from polygonum minus

NASA Astrophysics Data System (ADS)

Hamid, Nur Athirah Abd; Ismail, Ismanizan

2013-11-01

Polygonum minus, locally named as Kesum is an aromatic herb which is high in secondary metabolite content. Alcohol dehydrogenase is an important enzyme that catalyzes the reversible oxidation of alcohol and aldehyde with the presence of NAD(P)(H) as co-factor. The main focus of this research is to identify the gene of ADH. The total RNA was extracted from leaves of P. minus which was treated with 150 μM Jasmonic acid. Full-length cDNA sequence of ADH was isolated via rapid amplification cDNA end (RACE). Subsequently, in silico analysis was conducted on the full-length cDNA sequence and PCR was done on genomic DNA to determine the exon and intron organization. Two sequences of ADH, designated as PmADH1 and PmADH2 were successfully isolated. Both sequences have ORF of 801 bp which encode 266 aa residues. Nucleotide sequence comparison of PmADH1 and PmADH2 indicated that both sequences are highly similar at the ORF region but divergent in the 3' untranslated regions (UTR). The amino acid is differ at the 107 residue; PmADH1 contains Gly (G) residue while PmADH2 contains Cys (C) residue. The intron-exon organization pattern of both sequences are also same, with 3 introns and 4 exons. Based on in silico analysis, both sequences contain "classical" short chain alcohol dehydrogenases/reductases ((c) SDRs) conserved domain. The results suggest that both sequences are the members of short chain alcohol dehydrogenase family.

Molecular and functional characterization of BAFF from the Yangtze alligator (Alligator sinensis, Alligatoridae).

PubMed

Zhang, Jia-Xin; Song, Ren; Sang, Ming; Sun, Si-Qing; Ma, Lei; Zhang, Jie; Zhang, Shuang-Quan

2015-10-01

B-cell activating factor (BAFF) from the TNF family is critical for B-cell survival and maturation. In this study, we identified a Yangtze alligator (Alligator sinensis, Alligatoridae) BAFF cDNA, designated as asBAFF, using reverse transcription polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). The open reading frame of this cDNA encodes a 287-amino acid protein containing a predicted transmembrane domain and a furin protease cleavage site, similar to mammalian and avian BAFF. The amino acid identity between biologically soluble asBAFF (assBAFF) and csBAFF, hsBAFF, and msBAFF is 94, 76, and 71%, respectively. Real-time quantitative PCR analysis showed that the asBAFF gene is strongly expressed in the spleen. Since BAFF is always expressed as inclusion bodies in bacteria, it is difficult to purify. To enhance the soluble expression of assBAFF in Escherichia coli, we fused the extracellular region of the asBAFF gene to a small ubiquitin-related modifier gene (SUMO). Purified assBAFF was able to promote the survival of splenic lymphocytes and co-stimulate the proliferation of mouse B cells with anti-mouse IgM. These findings suggest that asBAFF plays an important role in the survival and proliferation of Yangtze alligator B cells, and because it is evolutionarily highly conserved, functional cross-reactivity exists between mammalian and Yangtze alligator BAFF. Copyright © 2015 Elsevier GmbH. All rights reserved.

cDNA cloning, expression and immune function analysis of a novel Rac1 gene (AjRac1) in the sea cucumber Apostichopus japonicus.

PubMed

Li, Kaiquan; Liu, Lin; Shang, Shengnan; Wang, Yi; Zhan, Yaoyao; Song, Jian; Zhang, Xiangxiang; Chang, Yaqing

2017-10-01

The ras-related C3 botulinum toxin substrate 1 (Rac1) belongs to Ras homolog (Rho) small GTPases subfamily. As an important molecular switch, Rac1 regulates various processes in the cell, especially in cellular immune response. With attempt to clarify characters and functions of Rac1 in sea cucumbers, full length cDNA of a Rac1 homolog in the sea cucumber Apostichopus japonicus (AjRac1) was cloned by transcriptome database mining and rapid amplification of cDNA ends (RACE) techniques. The open reading frame of AjRac1 is 579 bp encoding a protein with a length of 192 aa. Sequence analysis showed that AjRac1 is highly conserved as compared to those from other eukaryotic species. Phylogenetic analysis revealed that amino acid sequence of AjRac1 closely related to those from Strongylocentrotus purpuratus. Results of expression analysis showed that AjRac1 exhibited a relative high expression in blastula stage, adult coelomocytes and respiratory tree in A. japonicus. The transcription of AjRac1 in adult coelomocytes altered significantly at 4 h- and 12 h-after Vibrio splendidus infection, respectively, which indicated that AjRac1 involved in sea cucumber innate immunity. All data presented in this study will deepen our understanding of characterizations and immunological functions of Rac1 in sea cucumbers. Copyright © 2017 Elsevier Ltd. All rights reserved.

Large-scale collection of full-length cDNA and transcriptome analysis in Hevea brasiliensis.

PubMed

Makita, Yuko; Ng, Kiaw Kiaw; Veera Singham, G; Kawashima, Mika; Hirakawa, Hideki; Sato, Shusei; Othman, Ahmad Sofiman; Matsui, Minami

2017-04-01

Natural rubber has unique physical properties that cannot be replaced by products from other latex-producing plants or petrochemically produced synthetic rubbers. Rubber from Hevea brasiliensis is the main commercial source for this natural rubber that has a cis-polyisoprene configuration. For sustainable production of enough rubber to meet demand elucidation of the molecular mechanisms involved in the production of latex is vital. To this end, we firstly constructed rubber full-length cDNA libraries of RRIM 600 cultivar and sequenced around 20,000 clones by the Sanger method and over 15,000 contigs by Illumina sequencer. With these data, we updated around 5,500 gene structures and newly annotated around 9,500 transcription start sites. Second, to elucidate the rubber biosynthetic pathways and their transcriptional regulation, we carried out tissue- and cultivar-specific RNA-Seq analysis. By using our recently published genome sequence, we confirmed the expression patterns of the rubber biosynthetic genes. Our data suggest that the cytoplasmic mevalonate (MVA) pathway is the main route for isoprenoid biosynthesis in latex production. In addition to the well-studied polymerization factors, we suggest that rubber elongation factor 8 (REF8) is a candidate factor in cis-polyisoprene biosynthesis. We have also identified 39 transcription factors that may be key regulators in latex production. Expression profile analysis using two additional cultivars, RRIM 901 and PB 350, via an RNA-Seq approach revealed possible expression differences between a high latex-yielding cultivar and a disease-resistant cultivar. © The Author 2017. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

Cloning and sequence analysis of a full-length cDNA of SmPP1cb encoding turbot protein phosphatase 1 beta catalytic subunit

NASA Astrophysics Data System (ADS)

Qi, Fei; Guo, Huarong; Wang, Jian

2008-02-01

Reversible protein phosphorylation, catalyzed by protein kinases and phosphatases, is an important and versatile mechanism by which eukaryotic cells regulate almost all the signaling processes. Protein phosphatase 1 (PP1) is the first and well-characterized member of the protein serine/threonine phosphatase family. In the present study, a full-length cDNA encoding the beta isoform of the catalytic subunit of protein phosphatase 1(PP1cb), was for the first time isolated and sequenced from the skin tissue of flatfish turbot Scophthalmus maximus, designated SmPP1cb, by the rapid amplification of cDNA ends (RACE) technique. The cDNA sequence of SmPP1cb we obtained contains a 984 bp open reading frame (ORF), flanked by a complete 39 bp 5' untranslated region and 462 bp 3' untranslated region. The ORF encodes a putative 327 amino acid protein, and the N-terminal section of this protein is highly acidic, Met-Ala-Glu-Gly-Glu-Leu-Asp-Val-Asp, a common feature for PP1 catalytic subunit but absent in protein phosphatase 2B (PP2B). And its calculated molecular mass is 37 193 Da and pI 5.8. Sequence analysis indicated that, SmPP1cb is extremely conserved in both amino acid and nucleotide acid levels compared with the PP1cb of other vertebrates and invertebrates, and its Kozak motif contained in the 5'UTR around ATG start codon is GXXAXXGXX ATGG, which is different from mammalian in two positions A-6 and G-3, indicating the possibility of different initiation of translation in turbot, and also the 3'UTR of SmPP1cb is highly diverse in the sequence similarity and length compared with other animals, especially zebrafish. The cloning and sequencing of SmPP1cb gene lays a good foundation for the future work on the biological functions of PP1 in the flatfish turbot.

Cloning and expression of cyclophilin from Platanus orientalis pollens in Escherichia coli

PubMed Central

Sankian, Mojtaba; Vahedi, Fatemeh; Pazouki, Nazanin; Moghadam, Malihe; Jabbari Azad, Farahzad; Varasteh, Abdol-Reza

2012-01-01

Background: Allergy is a clinical disorder affecting the human population with wide geographical distribution. Platanus orientalis (P. orientalis) trees are planted in many countries and their pollen causes allergic reactions. Cyclophilin has recently been identified as one of the most important allergens of P. orientalis pollen. We aimed to clone and purify this allergen in Escherichia coli for further studies and therapeutic and diagnostic purposes for allergy to P. orientalis. Methods: RNA was extracted from P. orientalis. A full-length fragment encoding cyclophilin was prepared by polymerase chain reaction amplification of the first-strand cDNA synthesized from P. orientalis RNA. The cDNA was inserted into the pET32b (+) vector, and the construct transformed into E. coli Top10 and BL21 cells. The expressed protein was purified by the CuSO4 method. Results: The cDNA for the cyclophilin of P. orientalis pollen was cloned, and a specific reactivity of recombinant cyclophin was confirmed by immunoblotting using sera from patients allergic to P. orientalis pollen. Conclusion: The recombinant cyclophilin has a potential for immunologic assays for evaluation of allergy to P. orientalis pollen. PMID:26989705

Screening and identification of gastric adenocarcinoma metastasis-related genes by using cDNA microarray coupled to FDD-PCR.

PubMed

Wang, Jian-Hua; Chen, Shi-Shu

2002-07-01

To clone gastric adenocarcinoma metastasis related genes, RF-1 cell line (primary tumor of a gastric adenocarcinoma patient ) and RF-48 cell line (its metastatic counterpart) were used as a model for studying the molecular mechanism of tumor metastasis. Two fluorescent cDNA probes, labeled with Cy3 and Cy5 dyes, were prepared from RF-1 and RF-48 mRNA samples by reverse transcription method. The two color probes were then mixed and hybridized to the cDNA chip constructed by double-dots of 4 096 human genes, and scanned at two wavelengths. The experiment was repeated for 2 times. Differential expression genes from the above two cells were analyzed using the computer. 138 in all genes (3.4%) revealed differential expression in RF-48 cells compared with RF-1 cells: 81(2.1%) genes revealed apparent up-regulation, and 56(1.3%) genes revealed down-regulation. 45 genes involved in gastric adenocarcinoma metastasis were cloned using fluorescent differential display-PCR (FDD-PCR), including 3 novel genes. There were 7 differential expression genes that agreed with each other in two detection methods. The possible roles of some differential expressed genes, which maybe involved in the mechanism of tumor metastasis, were discussed. cDNA chip was used to analyze gene expression in a high-throughput and large scale manner, in combination with FDD-PCR for cloning unknown novel genes. In conclusion, some genes related to metastasis were preliminarily scanned, which would contribute to disclose the molecular mechanism of gastric adenocarcinoma metastasis.

[Role of phosphorylation of MARCKS-PSD in the secretion of MUC5AC induced by cold temperatures in human airway epithelial cells].

PubMed

Li, Minchao; Perelman, Juliy M; Zhou, Xiangdong

2012-05-01

To construct phosphorylation sites domain (PSD) mutant of myristoylated alaninerich C kinase substrate (MARCKS) and explore the role of transient receptor potential melastatin 8 cation channels (TRPM8) and MARCKS in cold-induced synthesis and exocytosis of mucin (MUC) 5AC. Human placental cDNA was used as a template to amplify the full coding region of MARCKS cDNA by PCR. Ser159, Ser 163, Ser 167, Ser 170 in the PSD were mutated to aspartic acids by an overlap PCR method. The resultant PSD mutant cDNA and the wild-type MARCKS cDNA were each subcloned into a mammalian expression vector pcDNA3.0. Recombinant constructs were confirmed by restriction enzyme digestion analysis and DNA sequencing. In intervention experiments, cells were pretreated with the TRPM8 channel antagonist BCTC and transfected with MARCKS-PSD mutant cDNA, and thereafter cold stimulation was applied. The levels of MUC5AC were measured by immunofluorescence and ELISA to clarify the roles of TRPM8 and PSD mutant on the synthesis and secretion of MUC5AC induced by cold, respectively. Restriction enzyme digestion analysis and DNA sequencing revealed that the pcDNA3.0- MARCKS and pcDNA3.0-MARCKS-PSD mutants were successfully constructed. The levels of intracellular and secreted MUC5AC of cold treated group were significantly higher than those of control group (P<0.05). BCTC attenuated the cold-induced synthesis and secretion of MUC5AC when compared with cold treated group (P<0.05). Transfection of 16HBE cells with the MARCKS-PSD mutant cDNA resulted in significant inhibition of mucin secretion in response to cold, and significantly higher level of intracellular MUC5AC than that of control group (P<0.01), whereas transfection with the vector DNA or the wild-type MARCKS cDNA had no effect on the mucin synthesis and secretion in response to cold (P>0.05). TRPM8 and phosphorylation of MARCKS-PSD mediates the cold-induced exocytosis of MUC5AC by airway epithelial cells.

Construction of C35 gene bait recombinants and T47D cell cDNA library.

PubMed

Yin, Kun; Xu, Chao; Zhao, Gui-Hua; Liu, Ye; Xiao, Ting; Zhu, Song; Yan, Ge

2017-11-20

C35 is a novel tumor biomarker associated with metastasis progression. To investigate the interaction factors of C35 in its high expressed breast cancer cell lines, we constructed bait recombinant plasmids of C35 gene and T47D cell cDNA library for yeast two-hybrid screening. Full length C35 sequences were subcloned using RT-PCR from cDNA template extracted from T47D cells. Based on functional domain analysis, the full-length C35 1-348bp was also truncated into two fragments C351-153bp and C35154-348bp to avoid auto-activation. The three kinds of C35 genes were successfully amplified and inserted into pGBKT7 to construct bait recombinant plasmids pGBKT7-C351-348bp, pGBKT7-C351-153bp and pGBKT7-C35154-348bp, then transformed into Y187 yeast cells by the lithium acetate method. Auto-activation and toxicity of C35 baits were detected using nutritional deficient medium and X-α-Gal assays. The T47D cell ds cDNA was generated by SMART TM technology and the library was constructed using in vivo recombination-mediated cloning in the AH109 yeast strain using a pGADT7-Rec plasmid. The transformed Y187/pGBKT7-C351-348bp line was intensively inhibited while the truncated Y187/pGBKT7-C35 lines had no auto-activation and toxicity in yeast cells. The titer of established cDNA library was 2 × 10 7 pfu/mL with high transformation efficiency of 1.4 × 10 6 , and the insert size of ds cDNA was distributed homogeneously between 0.5-2.0 kb. Our research generated a T47D cell cDNA library with high titer, and the constructed two C35 "baits" contained a respective functional immunoreceptor tyrosine based activation motif (ITAM) and the conserved last four amino acids Cys-Ile-Leu-Val (CILV) motif, and therefore laid a foundation for screening the C35 interaction factors in a BC cell line.

Molecular and Biochemical Characterization of a Cold-Regulated Phosphoethanolamine N-Methyltransferase from Wheat1

PubMed Central

Charron, Jean-Benoit Frenette; Breton, Ghislain; Danyluk, Jean; Muzac, Ingrid; Ibrahim, Ragai K.; Sarhan, Fathey

2002-01-01

A cDNA that encodes a methyltransferase (MT) was cloned from a cold-acclimated wheat (Triticum aestivum) cDNA library. Molecular analysis indicated that the enzyme WPEAMT (wheat phosphoethanolamine [P-EA] MT) is a bipartite protein with two separate sets of S-adenosyl-l-Met-binding domains, one close to the N-terminal end and the second close to the C-terminal end. The recombinant protein was found to catalyze the three sequential methylations of P-EA to form phosphocholine, a key precursor for the synthesis of phosphatidylcholine and glycine betaine in plants. Deletion and mutation analyses of the two S-adenosyl-l-Met-binding domains indicated that the N-terminal domain could perform the three N-methylation steps transforming P-EA to phosphocholine. This is in contrast to the MT from spinach (Spinacia oleracea), suggesting a different functional evolution for the monocot enzyme. The truncated C-terminal and the N-terminal mutated enzyme were only able to methylate phosphomonomethylethanolamine and phosphodimethylethanolamine, but not P-EA. This may suggest that the C-terminal part is involved in regulating the rate and the equilibrium of the three methylation steps. Northern and western analyses demonstrated that both Wpeamt transcript and the corresponding protein are up-regulated during cold acclimation. This accumulation was associated with an increase in enzyme activity, suggesting that the higher activity is due to de novo protein synthesis. The role of this enzyme during cold acclimation and the development of freezing tolerance are discussed. PMID:12011366

5' Rapid Amplification of cDNA Ends and Illumina MiSeq Reveals B Cell Receptor Features in Healthy Adults, Adults With Chronic HIV-1 Infection, Cord Blood, and Humanized Mice.

PubMed

Waltari, Eric; Jia, Manxue; Jiang, Caroline S; Lu, Hong; Huang, Jing; Fernandez, Cristina; Finzi, Andrés; Kaufmann, Daniel E; Markowitz, Martin; Tsuji, Moriya; Wu, Xueling

2018-01-01

Using 5' rapid amplification of cDNA ends, Illumina MiSeq, and basic flow cytometry, we systematically analyzed the expressed B cell receptor (BCR) repertoire in 14 healthy adult PBMCs, 5 HIV-1+ adult PBMCs, 5 cord blood samples, and 3 HIS-CD4/B mice, examining the full-length variable region of μ, γ, α, κ, and λ chains for V-gene usage, somatic hypermutation (SHM), and CDR3 length. Adding to the known repertoire of healthy adults, Illumina MiSeq consistently detected small fractions of reads with high mutation frequencies including hypermutated μ reads, and reads with long CDR3s. Additionally, the less studied IgA repertoire displayed similar characteristics to that of IgG. Compared to healthy adults, the five HIV-1 chronically infected adults displayed elevated mutation frequencies for all μ, γ, α, κ, and λ chains examined and slightly longer CDR3 lengths for γ, α, and λ. To evaluate the reconstituted human BCR sequences in a humanized mouse model, we analyzed cord blood and HIS-CD4/B mice, which all lacked the typical SHM seen in the adult reference. Furthermore, MiSeq revealed identical unmutated IgM sequences derived from separate cell aliquots, thus for the first time demonstrating rare clonal members of unmutated IgM B cells by sequencing.

Capturing the Alternative Cleavage and Polyadenylation Sites of 14 NAC Genes in Populus Using a Combination of 3'-RACE and High-Throughput Sequencing.

PubMed

Wang, Haoran; Wang, Mingxiu; Cheng, Qiang

2018-03-08

Detection of complex splice sites (SSs) and polyadenylation sites (PASs) of eukaryotic genes is essential for the elucidation of gene regulatory mechanisms. Transcriptome-wide studies using high-throughput sequencing (HTS) have revealed prevalent alternative splicing (AS) and alternative polyadenylation (APA) in plants. However, small-scale and high-depth HTS aimed at detecting genes or gene families are very few and limited. We explored a convenient and flexible method for profiling SSs and PASs, which combines rapid amplification of 3'-cDNA ends (3'-RACE) and HTS. Fourteen NAC (NAM, ATAF1/2, CUC2) transcription factor genes of Populus trichocarpa were analyzed by 3'-RACE-seq. Based on experimental reproducibility, boundary sequence analysis and reverse transcription PCR (RT-PCR) verification, only canonical SSs were considered to be authentic. Based on stringent criteria, candidate PASs without any internal priming features were chosen as authentic PASs and assumed to be PAS-rich markers. Thirty-four novel canonical SSs, six intronic/internal exons and thirty 3'-UTR PAS-rich markers were revealed by 3'-RACE-seq. Using 3'-RACE and real-time PCR, we confirmed that three APA transcripts ending in/around PAS-rich markers were differentially regulated in response to plant hormones. Our results indicate that 3'-RACE-seq is a robust and cost-effective method to discover SSs and label active regions subjected to APA for genes or gene families. The method is suitable for small-scale AS and APA research in the initial stage.

Capture, Unfolding, and Detection of Individual tRNA Molecules Using a Nanopore Device

PubMed Central

Smith, Andrew M.; Abu-Shumays, Robin; Akeson, Mark; Bernick, David L.

2015-01-01

Transfer RNAs (tRNA) are the most common RNA molecules in cells and have critical roles as both translators of the genetic code and regulators of protein synthesis. As such, numerous methods have focused on studying tRNA abundance and regulation, with the most widely used methods being RNA-seq and microarrays. Though revolutionary to transcriptomics, these assays are limited by an inability to encode tRNA modifications in the requisite cDNA. These modifications are abundant in tRNA and critical to their function. Here, we describe proof-of-concept experiments where individual tRNA molecules are examined as linear strands using a biological nanopore. This method utilizes an enzymatically ligated synthetic DNA adapter to concentrate tRNA at the lipid bilayer of the nanopore device and efficiently denature individual tRNA molecules, as they are pulled through the α-hemolysin (α-HL) nanopore. Additionally, the DNA adapter provides a loading site for ϕ29 DNA polymerase (ϕ29 DNAP), which acts as a brake on the translocating tRNA. This increases the dwell time of adapted tRNA in the nanopore, allowing us to identify the region of the nanopore signal that is produced by the translocating tRNA itself. Using adapter-modified Escherichia coli tRNAfMet and tRNALys, we show that the nanopore signal during controlled translocation is dependent on the identity of the tRNA. This confirms that adapter-modified tRNA can translocate end-to-end through nanopores and provide the foundation for future work in direct sequencing of individual transfer RNA with a nanopore-based device. PMID:26157798

Unit-length line-1 transcripts in human teratocarcinoma cells.

PubMed Central

Skowronski, J; Fanning, T G; Singer, M F

1988-01-01

We have characterized the approximately 6.5-kilobase cytoplasmic poly(A)+ Line-1 (L1) RNA present in a human teratocarcinoma cell line, NTera2D1, by primer extension and by analysis of cloned cDNAs. The bulk of the RNA begins (5' end) at the residue previously identified as the 5' terminus of the longest known primate genomic L1 elements, presumed to represent "unit" length. Several of the cDNA clones are close to 6 kilobase pairs, that is, close to full length. The partial sequences of 18 cDNA clones and full sequence of one (5,975 base pairs) indicate that many different genomic L1 elements contribute transcripts to the 6.5-kilobase cytoplasmic poly(A)+ RNA in NTera2D1 cells because no 2 of the 19 cDNAs analyzed had identical sequences. The transcribed elements appear to represent a subset of the total genomic L1s, a subset that has a characteristic consensus sequence in the 3' noncoding region and a high degree of sequence conservation throughout. Two open reading frames (ORFs) of 1,122 (ORF1) and 3,852 (ORF2) bases, flanked by about 800 and 200 bases of sequence at the 5' and 3' ends, respectively, can be identified in the cDNAs. Both ORFs are in the same frame, and they are separated by 33 bases bracketed by two conserved in-frame stop codons. ORF 2 is interrupted by at least one randomly positioned stop codon in the majority of the cDNAs. The data support proposals suggesting that the human L1 family includes one or more functional genes as well as an extraordinarily large number of pseudogenes whose ORFs are broken by stop codons. The cDNA structures suggest that both genes and pseudogenes are transcribed. At least one of the cDNAs (cD11), which was sequenced in its entirety, could, in principle, represent an mRNA for production of the ORF1 polypeptide. The similarity of mammalian L1s to several recently described invertebrate movable elements defines a new widely distributed class of elements which we term class II retrotransposons. Images PMID:2454389

Assignment of the human glutamate receptor gene GLUR5 to 21q22 by screening a chromosome 21 YAC library

DOE Office of Scientific and Technical Information (OSTI.GOV)

Potier, M.C.; Dutriaux, A.; Lambolez, B.

1993-03-01

Ionotropic L-glutamate receptors form transmembrane channels permeant to cations which are involved in synaptic transmission. Nine different subunits coding for non-NMDA (N-methyl-D-aspartate) receptors have been cloned and sequenced in rat. One of them, the GluR5 subunit, has a high affinity binding site for kainate and is expressed in neurons of the developing and adult nervous system. The permeability of the GluR5 receptor channel is modulated by edition of the transcripts. In human, GluR1 and GluR2 cDNAs have been sequenced and mapped to chromosomes 5 and 4, respectively. Also, GluR3 and GluR4 genes have been mapped to chromosome X and 11,more » respectively. Screening of the YAC chromosome 21 library was performed by colony hybridization on nylon Hybond-N filters at high stringency, as previously described, with the pore located in the center of the rat cDNA. Two positive colonies were obtained and analyzed for their YAC content by PFGE and Southern blotting. Only one (HY128) contained a 450-kb YAC hybridizing to the central rat cDNA probe as well as to the 5[prime] and 3[prime] end probes. Since GluR5 and GluR6 are highly homologous in rat, a probe in the 3[prime] untranslated region of GluR6, showing low homology to GluR5, was synthetized by PCR. Sequences and positions of the PCR primers on the rat sequence (9) are from 5[prime] to 3[prime]: CGACAGAAGGTTGCCAGGT (sense, position 2690-2708)/GATGTTCTGCCTTCAGTTCCAC (antisense, 3314-3335). HY128 YAC did not hybridize to the GluR6 probe (data not shown). Southern blot of human genomic DNA and yeast DNA from HY128 clone cut with EcoRI and HindIII showed the same bands of more than 10 and 6.6 kb, respectively, when hybridized to the 3[prime] end rat cDNA probe (data not shown). This last result confirms the presence of human GluR5 gene in HY128.« less

Analysis of expressed sequence tags generated from full-length enriched cDNA libraries of melon

PubMed Central

2011-01-01

Background Melon (Cucumis melo), an economically important vegetable crop, belongs to the Cucurbitaceae family which includes several other important crops such as watermelon, cucumber, and pumpkin. It has served as a model system for sex determination and vascular biology studies. However, genomic resources currently available for melon are limited. Result We constructed eleven full-length enriched and four standard cDNA libraries from fruits, flowers, leaves, roots, cotyledons, and calluses of four different melon genotypes, and generated 71,577 and 22,179 ESTs from full-length enriched and standard cDNA libraries, respectively. These ESTs, together with ~35,000 ESTs available in public domains, were assembled into 24,444 unigenes, which were extensively annotated by comparing their sequences to different protein and functional domain databases, assigning them Gene Ontology (GO) terms, and mapping them onto metabolic pathways. Comparative analysis of melon unigenes and other plant genomes revealed that 75% to 85% of melon unigenes had homologs in other dicot plants, while approximately 70% had homologs in monocot plants. The analysis also identified 6,972 gene families that were conserved across dicot and monocot plants, and 181, 1,192, and 220 gene families specific to fleshy fruit-bearing plants, the Cucurbitaceae family, and melon, respectively. Digital expression analysis identified a total of 175 tissue-specific genes, which provides a valuable gene sequence resource for future genomics and functional studies. Furthermore, we identified 4,068 simple sequence repeats (SSRs) and 3,073 single nucleotide polymorphisms (SNPs) in the melon EST collection. Finally, we obtained a total of 1,382 melon full-length transcripts through the analysis of full-length enriched cDNA clones that were sequenced from both ends. Analysis of these full-length transcripts indicated that sizes of melon 5' and 3' UTRs were similar to those of tomato, but longer than many other dicot plants. Codon usages of melon full-length transcripts were largely similar to those of Arabidopsis coding sequences. Conclusion The collection of melon ESTs generated from full-length enriched and standard cDNA libraries is expected to play significant roles in annotating the melon genome. The ESTs and associated analysis results will be useful resources for gene discovery, functional analysis, marker-assisted breeding of melon and closely related species, comparative genomic studies and for gaining insights into gene expression patterns. PMID:21599934

Novel transcripts of the estrogen receptor α gene in channel catfish

USGS Publications Warehouse

Patino, Reynaldo; Xia, Zhenfang; Gale, William L.; Wu, Chunfa; Maule, Alec G.; Chang, Xiaotian

2000-01-01

Complementary DNA libraries from liver and ovary of an immature female channel catfish were screened with a homologous ERα cDNA probe. The hepatic library yielded two new channel catfish ER cDNAs that encode N-terminal ERα variants of different sizes. Relative to the catfish ERα (medium size; 581 residues) previously reported, these new cDNAs encode Long-ERα (36 residues longer) and Short-ERα (389 residues shorter). The 5′-end of Long-ERα cDNA is identical to that of Medium-ERα but has an additional 503-bp segment with an upstream, in-frame translation-start codon. Recombinant Long-ERα binds estrogen with high affinity (Kd = 3.4 nM), similar to that previously reported for Medium-ERα but lower than reported for catfish ERβ. Short-ERα cDNA encodes a protein that lacks most of the receptor protein and does not bind estrogen. Northern hybridization confirmed the existence of multiple hepatic ERα RNAs that include the size range of the ERα cDNAs obtained from the libraries as well as additional sizes. Using primers for RT-PCR that target locations internal to the protein-coding sequence, we also established the presence of several ERα cDNA variants with in-frame insertions in the ligand-binding and DNA-binding domains and in-frame or out-of-frame deletions in the ligand-binding domain. These internal variants showed patterns of expression that differed between the ovary and liver. Further, the ovarian library yielded a full-length, ERα antisense cDNA containing a poly(A) signal and tail. A limited survey of histological preparations from juvenile catfish by in situ hybridization using directionally synthesized cRNA probes also suggested the expression of ERα antisense RNA in a tissue-specific manner. In conclusion, channel catfish seemingly have three broad classes of ERα mRNA variants: those encoding N-terminal truncated variants, those encoding internal variants (including C-terminal truncated variants), and antisense mRNA. The sense variants may encode functional ERα or related proteins that modulate ERα or ERβ activity. The existence of ER antisense mRNA is reported in this study for the first time. Its role may be to participate in the regulation of ER gene expression.

In silico Analysis of 2085 Clones from a Normalized Rat Vestibular Periphery 3′ cDNA Library

PubMed Central

Roche, Joseph P.; Cioffi, Joseph A.; Kwitek, Anne E.; Erbe, Christy B.; Popper, Paul

2005-01-01

The inserts from 2400 cDNA clones isolated from a normalized Rattus norvegicus vestibular periphery cDNA library were sequenced and characterized. The Wackym-Soares vestibular 3′ cDNA library was constructed from the saccular and utricular maculae, the ampullae of all three semicircular canals and Scarpa's ganglia containing the somata of the primary afferent neurons, microdissected from 104 male and female rats. The inserts from 2400 randomly selected clones were sequenced from the 5′ end. Each sequence was analyzed using the BLAST algorithm compared to the Genbank nonredundant, rat genome, mouse genome and human genome databases to search for high homology alignments. Of the initial 2400 clones, 315 (13%) were found to be of poor quality and did not yield useful information, and therefore were eliminated from the analysis. Of the remaining 2085 sequences, 918 (44%) were found to represent 758 unique genes having useful annotations that were identified in databases within the public domain or in the published literature; these sequences were designated as known characterized sequences. 1141 sequences (55%) aligned with 1011 unique sequences had no useful annotations and were designated as known but uncharacterized sequences. Of the remaining 26 sequences (1%), 24 aligned with rat genomic sequences, but none matched previously described rat expressed sequence tags or mRNAs. No significant alignment to the rat or human genomic sequences could be found for the remaining 2 sequences. Of the 2085 sequences analyzed, 86% were singletons. The known, characterized sequences were analyzed with the FatiGO online data-mining tool (http://fatigo.bioinfo.cnio.es/) to identify level 5 biological process gene ontology (GO) terms for each alignment and to group alignments with similar or identical GO terms. Numerous genes were identified that have not been previously shown to be expressed in the vestibular system. Further characterization of the novel cDNA sequences may lead to the identification of genes with vestibular-specific functions. Continued analysis of the rat vestibular periphery transcriptome should provide new insights into vestibular function and generate new hypotheses. Physiological studies are necessary to further elucidate the roles of the identified genes and novel sequences in vestibular function. PMID:16103642

Characterization and simulation of cDNA microarray spots using a novel mathematical model

PubMed Central

Kim, Hye Young; Lee, Seo Eun; Kim, Min Jung; Han, Jin Il; Kim, Bo Kyung; Lee, Yong Sung; Lee, Young Seek; Kim, Jin Hyuk

2007-01-01

Background The quality of cDNA microarray data is crucial for expanding its application to other research areas, such as the study of gene regulatory networks. Despite the fact that a number of algorithms have been suggested to increase the accuracy of microarray gene expression data, it is necessary to obtain reliable microarray images by improving wet-lab experiments. As the first step of a cDNA microarray experiment, spotting cDNA probes is critical to determining the quality of spot images. Results We developed a governing equation of cDNA deposition during evaporation of a drop in the microarray spotting process. The governing equation included four parameters: the surface site density on the support, the extrapolated equilibrium constant for the binding of cDNA molecules with surface sites on glass slides, the macromolecular interaction factor, and the volume constant of a drop of cDNA solution. We simulated cDNA deposition from the single model equation by varying the value of the parameters. The morphology of the resulting cDNA deposit can be classified into three types: a doughnut shape, a peak shape, and a volcano shape. The spot morphology can be changed into a flat shape by varying the experimental conditions while considering the parameters of the governing equation of cDNA deposition. The four parameters were estimated by fitting the governing equation to the real microarray images. With the results of the simulation and the parameter estimation, the phenomenon of the formation of cDNA deposits in each type was investigated. Conclusion This study explains how various spot shapes can exist and suggests which parameters are to be adjusted for obtaining a good spot. This system is able to explore the cDNA microarray spotting process in a predictable, manageable and descriptive manner. We hope it can provide a way to predict the incidents that can occur during a real cDNA microarray experiment, and produce useful data for several research applications involving cDNA microarrays. PMID:18096047

Comprehensive red blood cell and platelet antigen prediction from whole genome sequencing: proof of principle

PubMed Central

Westhoff, Connie M.; Uy, Jon Michael; Aguad, Maria; Smeland‐Wagman, Robin; Kaufman, Richard M.; Rehm, Heidi L.; Green, Robert C.; Silberstein, Leslie E.

2015-01-01

BACKGROUND There are 346 serologically defined red blood cell (RBC) antigens and 33 serologically defined platelet (PLT) antigens, most of which have known genetic changes in 45 RBC or six PLT genes that correlate with antigen expression. Polymorphic sites associated with antigen expression in the primary literature and reference databases are annotated according to nucleotide positions in cDNA. This makes antigen prediction from next‐generation sequencing data challenging, since it uses genomic coordinates. STUDY DESIGN AND METHODS The conventional cDNA reference sequences for all known RBC and PLT genes that correlate with antigen expression were aligned to the human reference genome. The alignments allowed conversion of conventional cDNA nucleotide positions to the corresponding genomic coordinates. RBC and PLT antigen prediction was then performed using the human reference genome and whole genome sequencing (WGS) data with serologic confirmation. RESULTS Some major differences and alignment issues were found when attempting to convert the conventional cDNA to human reference genome sequences for the following genes: ABO, A4GALT, RHD, RHCE, FUT3, ACKR1 (previously DARC), ACHE, FUT2, CR1, GCNT2, and RHAG. However, it was possible to create usable alignments, which facilitated the prediction of all RBC and PLT antigens with a known molecular basis from WGS data. Traditional serologic typing for 18 RBC antigens were in agreement with the WGS‐based antigen predictions, providing proof of principle for this approach. CONCLUSION Detailed mapping of conventional cDNA annotated RBC and PLT alleles can enable accurate prediction of RBC and PLT antigens from whole genomic sequencing data. PMID:26634332

Cell-free identification of novel N-myristoylated proteins from complementary DNA resources using bioorthogonal myristic acid analogues.

PubMed

Takamitsu, Emi; Fukunaga, Kazuki; Iio, Yusuke; Moriya, Koko; Utsumi, Toshihiko

2014-11-01

To establish a non-radioactive, cell-free detection system for protein N-myristoylation, metabolic labeling in a cell-free protein synthesis system using bioorthogonal myristic acid analogues was performed. After Cu(I)-catalyzed azide-alkyne cycloaddition (CuAAC) with a biotin tag, the tagged proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and blotted on a polyvinylidene fluoride (PVDF) membrane, and then protein N-myristoylation was detected by enhanced chemiluminescence (ECL) using horseradish peroxidase (HRP)-conjugated streptavidin. The results showed that metabolic labeling in an insect cell-free protein synthesis system using an azide analogue of myristic acid followed by CuAAC with alkynyl biotin was the most effective strategy for cell-free detection of protein N-myristoylation. To determine whether the newly developed detection method can be applied for the detection of novel N-myristoylated proteins from complementary DNA (cDNA) resources, four candidate cDNA clones were selected from a human cDNA resource and their susceptibility to protein N-myristoylation was evaluated using the newly developed strategy. As a result, the products of three cDNA clones were found to be novel N-myristoylated protein, and myristoylation-dependent specific intracellular localization was observed for two novel N-myristoylated proteins. Thus, the metabolic labeling in an insect cell-free protein synthesis system using bioorthogonal azide analogue of myristic acid was an effective strategy to identify novel N-myristoylated proteins from cDNA resources. Copyright © 2014 Elsevier Inc. All rights reserved.

Sequence, molecular properties, and chromosomal mapping of mouse lumican

NASA Technical Reports Server (NTRS)

Funderburgh, J. L.; Funderburgh, M. L.; Hevelone, N. D.; Stech, M. E.; Justice, M. J.; Liu, C. Y.; Kao, W. W.; Conrad, G. W.; Spooner, B. S. (Principal Investigator)

1995-01-01

PURPOSE. Lumican is a major proteoglycan of vertebrate cornea. This study characterizes mouse lumican, its molecular form, cDNA sequence, and chromosomal localization. METHODS. Lumican sequence was determined from cDNA clones selected from a mouse corneal cDNA expression library using a bovine lumican cDNA probe. Tissue expression and size of lumican mRNA were determined using Northern hybridization. Glycosidase digestion followed by Western blot analysis provided characterization of molecular properties of purified mouse corneal lumican. Chromosomal mapping of the lumican gene (Lcn) used Southern hybridization of a panel of genomic DNAs from an interspecific murine backcross. RESULTS. Mouse lumican is a 338-amino acid protein with high-sequence identity to bovine and chicken lumican proteins. The N-terminus of the lumican protein contains consensus sequences for tyrosine sulfation. A 1.9-kb lumican mRNA is present in cornea and several other tissues. Antibody against bovine lumican reacted with recombinant mouse lumican expressed in Escherichia coli and also detected high molecular weight proteoglycans in extracts of mouse cornea. Keratanase digestion of corneal proteoglycans released lumican protein, demonstrating the presence of sulfated keratan sulfate chains on mouse corneal lumican in vivo. The lumican gene (Lcn) was mapped to the distal region of mouse chromosome 10. The Lcn map site is in the region of a previously identified developmental mutant, eye blebs, affecting corneal morphology. CONCLUSIONS. This study demonstrates sulfated keratan sulfate proteoglycan in mouse cornea and describes the tools (antibodies and cDNA) necessary to investigate the functional role of this important corneal molecule using naturally occurring and induced mutants of the murine lumican gene.

Cloning and Expression of Genes for Dengue Virus Type-2 Encoded Antigens for Rapid Diagnosis and Vaccine Development

DTIC Science & Technology

1986-11-26

cloning at the SalI site of pUCI8 vector DNA, iii) by treatment with EcoRl DNA methylase, ligation to EcoRI and cloning at the EcoRl site of pUCI8...cDNA to synthetic Sail linker 10 2.3.10 Treatment of DEN-2 cDNA with EcoRi methylase, followed 10 by ligation to EcoRI linkers and digestion with...picked by the mini plasmid preparation method as described in Maniatis et al. (1982). The procedure followed involved briefly treatment with a

Identification and characterization of the DNA replication origin recognition complex gene family in the silkworm Bombyx mori.

PubMed

Yang, Hui-Peng; Luo, Su-Juan; Li, Yi-Nü; Zhang, Yao-Zhou; Zhang, Zhi-Fang

2011-10-01

The ORC (origin recognition complex) binds to the DNA replication origin and recruits other replication factors to form the pre-replication complex. The cDNA and genomic sequences of all six subunits of ORC in Bombyx mori (BmORC1-6) were determined by RACE (rapid amplification of cDNA ends) and bioinformatic analysis. The conserved domains were identified in BmOrc1p-6p and the C-terminal of BmOrc6p features a short sequence that may be specific for Lepidoptera. As in other organisms, each of the six BmORC subunits had evolved individually from ancestral genes in early eukaryotes. During embryo development, the six genes were co-regulated, but different ratios of the abundance of mRNAs were observed in 13 tissues of the fifth instar day-6 larvae. Infection by BmNPV (B. mori nucleopolyhedrovirus) initially decreased and then increased the abundance of BmORC. We suggest that some of the BmOrc proteins may have additional functions and that BmOrc proteins participate in the replication of BmNPV.

Comparative 454 pyrosequencing of transcripts from two olive genotypes during fruit development

PubMed Central

Alagna, Fiammetta; D'Agostino, Nunzio; Torchia, Laura; Servili, Maurizio; Rao, Rosa; Pietrella, Marco; Giuliano, Giovanni; Chiusano, Maria Luisa; Baldoni, Luciana; Perrotta, Gaetano

2009-01-01

Background Despite its primary economic importance, genomic information on olive tree is still lacking. 454 pyrosequencing was used to enrich the very few sequence data currently available for the Olea europaea species and to identify genes involved in expression of fruit quality traits. Results Fruits of Coratina, a widely cultivated variety characterized by a very high phenolic content, and Tendellone, an oleuropein-lacking natural variant, were used as starting material for monitoring the transcriptome. Four different cDNA libraries were sequenced, respectively at the beginning and at the end of drupe development. A total of 261,485 reads were obtained, for an output of about 58 Mb. Raw sequence data were processed using a four step pipeline procedure and data were stored in a relational database with a web interface. Conclusion Massively parallel sequencing of different fruit cDNA collections has provided large scale information about the structure and putative function of gene transcripts accumulated during fruit development. Comparative transcript profiling allowed the identification of differentially expressed genes with potential relevance in regulating the fruit metabolism and phenolic content during ripening. PMID:19709400

Identification and characterisation of DfCHS, a chalcone synthase gene regulated by temperature and ultraviolet in Dryopteris fragrans.

PubMed

Sun, L L; Li, Y; Li, S S; Wu, X J; Hu, B Z; Chang, Y

2014-12-30

Chalcone synthase (CHS) is an enzyme that catalyzes the first committed step in flavonoid biosynthesis, and its transcription level is regulated by light conditions. By using homology cloning and rapid amplification of cDNA ends, we cloned a chalcone synthase gene (DfCHS) from Dryopteris fragrans (L.) Schott. The full-length cDNA of DfCHS is 1,737 bp, with an open reading frame (ORF) of 1,122 bp (deposited in GenBank under Accession Number KF530802) encoding a predicted protein of 373 amino acids. The calculated molecular mass of DfCHS is 41.3 kDa. We studied the expression of DfCHS and total flavonoid contents in tissue culture seedlings cultured under the low temperature at 4ºC, high temperature at 35ºC and UV conditions, respectively. The results show that the expression of DfCHS are not the same, but all present rising trends, then flavonoid contents were increased. Overall, our results imply that the expression of DfCHS gene provide a certain theory basis in the status of evolution among ferns.

A pilot study of gene expression analysis in workers with hand-arm vibration syndrome.

PubMed

Maeda, Setsuo; Yu, Xiaozhong; Wang, Rui-Sheng; Sakakibara, Hisataka

2008-04-01

The purpose of this pilot study was to examine differences in gene expressions by cDNA microarray analysis of hand-arm vibration syndrome (HAVS) patients. Vein blood samples were collected and total RNA was extracted. All blood samples were obtained in the morning in one visit after a standard light breakfast. We performed microarray analysis with the labeled cDNA prepared by reverse transcription from RNA samples, using the Human CHIP version 1 (DNA Chip Research Inc, Yokohama, Japan). There are 2,976 genes on the chip, and these genes were selected from a cDNA library prepared with human peripheral white blood cells (WBC). Different gene levels between the HAVS patients and controls, and between groups of HAVS with different levels of symptoms, were indicated by the randomized variance model. The most up-regulated genes were analyzed for their possible functions and association with the occurrence of HAVS. From the results of this pilot study, although the results were obtained a limited number of subjects, it would appear that cDNA microarray analysis of HAVS patients has potential as a new objective method of HAVS diagnosis. Further research is needed to examine the gene expression with increased numbers of patients at different stages of HAVS.

A Strategy To Isolate Modifiers of Caenorhabditis elegans Lethal Mutations: Investigating the Endoderm Specifying Ability of the Intestinal Differentiation GATA Factor ELT-2.

PubMed

Wiesenfahrt, Tobias; Duanmu, Jingjie; Snider, Frances; Moerman, Don; Au, Vinci; Li-Leger, Erica; Flibotte, Stephane; Parker, Dylan M; Marshall, Craig J; Nishimura, Erin Osborne; Mains, Paul E; McGhee, James D

2018-05-04

The ELT-2 GATA factor normally functions in differentiation of the C. elegans endoderm, downstream of endoderm specification. We have previously shown that, if ELT-2 is expressed sufficiently early, it is also able to specify the endoderm and to replace all other members of the core GATA-factor transcriptional cascade (END-1, END-3, ELT-7). However, such rescue requires multiple copies (and presumably overexpression) of the end-1p :: elt-2 cDNA transgene; a single copy of the transgene does not rescue. We have made this observation the basis of a genetic screen to search for genetic modifiers that allow a single copy of the end-1p :: elt-2 cDNA transgene to rescue the lethality of the end-1 end-3 double mutant. We performed this screen on a strain that has a single copy insertion of the transgene in an end-1 end-3 background. These animals are kept alive by virtue of an extrachromosomal array containing multiple copies of the rescuing transgene; the extrachromosomal array also contains a toxin under heat shock control to counterselect for mutagenized survivors that have been able to lose the rescuing array. A screen of ∼14,000 mutagenized haploid genomes produced 17 independent surviving strains. Whole genome sequencing was performed to identify genes that incurred independent mutations in more than one surviving strain. The C. elegans gene tasp-1 was mutated in four independent strains. tasp-1 encodes the C. elegans homolog of Taspase, a threonine-aspartic acid protease that has been found, in both mammals and insects, to cleave several proteins involved in transcription, in particular MLL1/trithorax and TFIIA. A second gene, pqn-82 , was mutated in two independent strains and encodes a glutamine-asparagine rich protein. tasp-1 and pqn-82 were verified as loss-of-function modifiers of the end-1p :: elt-2 transgene by RNAi and by CRISPR/Cas9-induced mutations. In both cases, gene loss leads to modest increases in the level of ELT-2 protein in the early endoderm although ELT-2 levels do not strictly correlate with rescue. We suggest that tasp-1 and pqn-82 represent a class of genes acting in the early embryo to modulate levels of critical transcription factors or to modulate the responsiveness of critical target genes. The screen's design, rescuing lethality with an extrachromosomal transgene followed by counterselection, has a background survival rate of <10 -4 without mutagenesis and should be readily adapted to the general problem of identifying suppressors of C. elegans lethal mutations. Copyright © 2018 Wiesenfahrt et al.

Sequence of the cDNA of a human dihydrodiol dehydrogenase isoform (AKR1C2) and tissue distribution of its mRNA.

PubMed Central

Shiraishi, H; Ishikura, S; Matsuura, K; Deyashiki, Y; Ninomiya, M; Sakai, S; Hara, A

1998-01-01

Human liver contains three isoforms (DD1, DD2 and DD4) of dihydrodiol dehydrogenase with 20alpha- or 3alpha-hydroxysteroid dehydrogenase activity; the dehydrogenases belong to the aldo-oxo reductase (AKR) superfamily. cDNA species encoding DD1 and DD4 have been identified. However, four cDNA species with more than 99% sequence identity have been cloned and are compatible with a partial amino acid sequence of DD2. In this study we have isolated a cDNA clone encoding DD2, which was confirmed by comparison of the properties of the recombinant and hepatic enzymes. This cDNA showed differences of one, two, four and five nucleotides from the previously reported four cDNA species for a dehydrogenase of human colon carcinoma HT29 cells, human prostatic 3alpha-hydroxysteroid dehydrogenase, a human liver 3alpha-hydroxysteroid dehydrogenase-like protein and chlordecone reductase-like protein respectively. Expression of mRNA species for the five similar cDNA species in 20 liver samples and 10 other different tissue samples was examined by reverse transcriptase-mediated PCR with specific primers followed by diagnostic restriction with endonucleases. All the tissues expressed only one mRNA species corresponding to the newly identified cDNA for DD2: mRNA transcripts corresponding to the other cDNA species were not detected. We suggest that the new cDNA is derived from the principal gene for DD2, which has been named AKR1C2 by a new nomenclature for the AKR superfamily. It is possible that some of the other cDNA species previously reported are rare allelic variants of this gene. PMID:9716498

Simplified Microarray Technique for Identifying mRNA in Rare Samples

NASA Technical Reports Server (NTRS)

Almeida, Eduardo; Kadambi, Geeta

2007-01-01

Two simplified methods of identifying messenger ribonucleic acid (mRNA), and compact, low-power apparatuses to implement the methods, are at the proof-of-concept stage of development. These methods are related to traditional methods based on hybridization of nucleic acid, but whereas the traditional methods must be practiced in laboratory settings, these methods could be practiced in field settings. Hybridization of nucleic acid is a powerful technique for detection of specific complementary nucleic acid sequences, and is increasingly being used for detection of changes in gene expression in microarrays containing thousands of gene probes. A traditional microarray study entails at least the following six steps: 1. Purification of cellular RNA, 2. Amplification of complementary deoxyribonucleic acid [cDNA] by polymerase chain reaction (PCR), 3. Labeling of cDNA with fluorophores of Cy3 (a green cyanine dye) and Cy5 (a red cyanine dye), 4. Hybridization to a microarray chip, 5. Fluorescence scanning the array(s) with dual excitation wavelengths, and 6. Analysis of the resulting images. This six-step procedure must be performed in a laboratory because it requires bulky equipment.

Methods for processing high-throughput RNA sequencing data.

PubMed

Ares, Manuel

2014-11-03

High-throughput sequencing (HTS) methods for analyzing RNA populations (RNA-Seq) are gaining rapid application to many experimental situations. The steps in an RNA-Seq experiment require thought and planning, especially because the expense in time and materials is currently higher and the protocols are far less routine than those used for other high-throughput methods, such as microarrays. As always, good experimental design will make analysis and interpretation easier. Having a clear biological question, an idea about the best way to do the experiment, and an understanding of the number of replicates needed will make the entire process more satisfying. Whether the goal is capturing transcriptome complexity from a tissue or identifying small fragments of RNA cross-linked to a protein of interest, conversion of the RNA to cDNA followed by direct sequencing using the latest methods is a developing practice, with new technical modifications and applications appearing every day. Even more rapid are the development and improvement of methods for analysis of the very large amounts of data that arrive at the end of an RNA-Seq experiment, making considerations regarding reproducibility, validation, visualization, and interpretation increasingly important. This introduction is designed to review and emphasize a pathway of analysis from experimental design through data presentation that is likely to be successful, with the recognition that better methods are right around the corner. © 2014 Cold Spring Harbor Laboratory Press.

Screening and identification of gastric adenocarcinoma metastasis-related genes using cDNA microarray coupled to FDD-PCR.

PubMed

Wang, Jianhua; Chen, Shishu

2002-10-01

To identify certain gastric adenocarcinoma metastasis-related genes, an RF-1 cell line (primary tumor from a gastric adenocarcinoma patient) and an RF-48 cell line (its metastatic counterpart) were used as a model for studying the molecular mechanism of tumor metastasis. Two fluorescent cDNA probes, labeled with Cy3 and Cy5 dyes, were prepared from RF-1 and RF-48 mRNA samples by the reverse transcription method. The two color probes were then mixed and hybridized to a cDNA chip constructed with double-dots from 4,096 human genes, and scanned at two wavelengths. The experiment was repeated twice. Differentially expressedn genes from the above two cells were analyzed by use of computer. Of the total genes, 138 (3.4%) revealed differential expression in RF-48 cells compared with RF-1 cells: 81 (2.1%) genes revealed apparent up-regulation, and 56 (1.3%) genes revealed down-regulation. Forty-five genes involved in gastric adenocarcinoma metastasis were cloned using fluorescent differential display-PCR (FDD-PCR), including three novel genes. There were seven differentially expressed genes that presented the same behaviour under both detection methods. The possible roles of some differentially expressed genes, which may be involved in the mechanism of tumor metastasis, were discussed. cDNA chip was used to analyze gene expression in a high-throughput and large-scale manner in combination with FDD-PCR for cloning unknown novel genes. Some genes related to metastasis were preliminarily scanned, which would contribute to disclose the molecular mechanism of gastric adenocarcinoma metastasis and provide new targets for therapeutic intervention.

Microtubule actin cross-linking factor (MACF): a hybrid of dystonin and dystrophin that can interact with the actin and microtubule cytoskeletons.

PubMed

Leung, C L; Sun, D; Zheng, M; Knowles, D R; Liem, R K

1999-12-13

We cloned and characterized a full-length cDNA of mouse actin cross-linking family 7 (mACF7) by sequential rapid amplification of cDNA ends-PCR. The completed mACF7 cDNA is 17 kb and codes for a 608-kD protein. The closest relative of mACF7 is the Drosophila protein Kakapo, which shares similar architecture with mACF7. mACF7 contains a putative actin-binding domain and a plakin-like domain that are highly homologous to dystonin (BPAG1-n) at its NH(2) terminus. However, unlike dystonin, mACF7 does not contain a coiled-coil rod domain; instead, the rod domain of mACF7 is made up of 23 dystrophin-like spectrin repeats. At its COOH terminus, mACF7 contains two putative EF-hand calcium-binding motifs and a segment homologous to the growth arrest-specific protein, Gas2. In this paper, we demonstrate that the NH(2)-terminal actin-binding domain of mACF7 is functional both in vivo and in vitro. More importantly, we found that the COOH-terminal domain of mACF7 interacts with and stabilizes microtubules. In transfected cells full-length mACF7 can associate not only with actin but also with microtubules. Hence, we suggest a modified name: MACF (microtubule actin cross-linking factor). The properties of MACF are consistent with the observation that mutations in kakapo cause disorganization of microtubules in epidermal muscle attachment cells and some sensory neurons.

[Characterization and transcriptional analysis of a new CC chemokine associated with innate imimune response in cobia (Rachycentron canadum)].

PubMed

Su, Y; Feng, J; Sun, X; Guo, Z; Xu, L; Jiang, J

2013-01-01

Chemokines are small, secreted cytokine peptides, known principally for their ability to induce migration and activation of leukocyte populations under both pathological and physiological conditions. On the basis of previously constructed express sequence tags (ESTs) of the head kidney and spleen cDNA library of the perciform marine fish Rachycentron canadum (common name cobia). We used bi-directional rapid amplification of cDNA ends (RACE) and obtained a full-length cDNA of a new CC chemokine gene (designated RcCC3). The RcCC3 putative peptide exhibits sequence similarity to the group of CCL19/21/25 CC chemokines. The reverse transcription quantitative polymerase chain reaction (RT-qPCR) was used in transcript expression studies of RcCC3. We examined the constitutive expression of the transcripts in 12 tissues of non-stressed cobia; RcCC3 transcripts were detected in all tissues examined, with the highest expression in gill and liver, following by head kidney, kidney, spleen, skin, intestine, muscle, stomach, heart, blood and brain. Transcript expression of RcCC3 was examined in immune-related organs, including head kidney, spleen and liver, following intraperitoneal injection of phosphate-buffered saline control, polyriboinosinic polyribocytidylic acid (poly(I:C)) and formalin-killed Vibrio carchariae (bacterial vaccine). The transcripts in these tissues were quickly up-regulated by the injection of poly(I:C) and bacterial vaccine at early time points, although with different expression profiles. These results indicate RcCC3 represents an important component of innate immunity in cobia.

Molecular cloning and responsive expression to injury stimulus of a defender against cell death 1 (DAD1) gene from bay scallops Argopecten irradians.

PubMed

Zhu, Ling; Song, Linsheng; Zhang, Huan; Zhao, Jianmin; Li, Chenghua; Xu, Wei

2008-06-01

Apoptosis is an active process of cell death, which is an integral part of growth and development in multicellular organisms. The defender against cell death 1 (DAD1), the regulatory protein to inhibit the apoptosis process, was first cloned from the bay scallop Argopecten irradians by randomly sequencing a whole tissue cDNA library and rapid amplification of cDNA end (RACE). The full-length cDNA of the A. irradians DAD1 was 607 bp, consist of a 5'-terminal untranslated region (UTR) of 63 bp, a 3'-terminal UTR of 205 bp with a canonical polyadenylation signal sequence AATAAA and a poly (A) tail, and an open reading frame of 339 bp. The deduced amino acid sequence of the A. irradians DAD1 showed 75.5% identity to Araneus ventricosus, 74.5% to Drosophila melanogaster, and 73.6% to Homo sapiens, Sus scrofa, Mesocricetus auratus, Rattus norvegicus and Mus musculus. Excluding the Saccharomyces cerevisiae DAD1 homologue, all animal DAD1 including A. irradians DAD1 homologue formed a subgroup and all plant DAD1 proteins formed another subgroup in the phylogenetic analysis. The A. irradians DAD1 was expressed in all examined tissues including adductor muscle, mantle, gills, digestive gland, gonad and hemolymph, suggesting that A. irradians DAD1 is expressed in most body tissues. Furthermore, the mRNA expression levels of A. irradians DAD1 gene of hemolymph were particularly high after injury, suggesting that the gene is responsive to injury stimuli.

Purification, cDNA cloning and modification of a defensin from the coconut rhinoceros beetle, Oryctes rhinoceros.

PubMed

Ishibashi, J; Saido-Sakanaka, H; Yang, J; Sagisaka, A; Yamakawa, M

1999-12-01

A novel member of the insect defensins, a family of antibacterial peptides, was purified from larvae of the coconut rhinoceros beetle, Oryctes rhinoceros, immunized with Escherichia coli. A full-size cDNA was cloned by combining reverse-transcription PCR (RT-PCR), and 5'- and 3'-rapid amplification of cDNA ends (RACE). Analysis of the O. rhinoceros defensin gene expression showed it to be expressed in the fat body and hemocyte, midgut and Malpighian tubules. O. rhinoceros defensin showed strong antibacterial activity against Staphylococcus aureus. A 9-mer peptide amidated at its C-terminus, AHCLAICRK-NH2 (Ala22-Lys30-NH2), was synthesized based on the deduced amino-acid sequence, assumed to be an active site sequence by analogy with the sequence of a defensin isolated from larvae of the beetle Allomyrina dichotoma. This peptide showed antibacterial activity against S. aureus, methicillin-resistant S. aureus, E. coli and Pseudomonas aeruginosa. We further modified this oligopeptide and synthesized five 9-mer peptides, ALRLAIRKR-NH2, ALLLAIRKR-NH2, AWLLAIRKR-NH2, ALYLAIRKR-NH2 and ALWLAIRKR-NH2. These oligopeptides showed strong antibacterial activity against Gram-negative and Gram-positive bacteria. The antibacterial effect of Ala22-Lys30-NH2 analogues was due to its interaction with bacterial membranes, judging from the leakage of liposome-entrapped glucose. These Ala22-Lys30-NH2 analogues did not show haemolytic activity and did not inhibit the growth of murine fibroblast cells or macrophages, except for AWLLAIRKR-NH2.

Molecular cloning and 3D model of first cytochrome P450 from CYP3A subfamily in saltwater crocodile (Crocodylus porosus).

PubMed

Tabassum, Rabia

2017-10-18

Cytochrome P450s (CYPs) play critical role in oxidative metabolism of numerous xenobiotics and endogenous compounds. The first CYP3A subfamily member in saltwater crocodile has been cloned and modelled for three-dimensional (3D) structure. The full-length cDNA was obtained employing reverse transcription polymerase chain reaction (RT-PCR) strategy and rapid amplification of cDNA ends (RACE). The cDNA sequence of 1659 nucleotides includes 132 nucleotides from 5' untranslated region (UTR), an open reading frame of 1527 nucleotides encoding 509 amino acids designated as CYP3A163. The alignment of CYP3A163 sequence with CYP3A subfamily across the lineages exhibit the loss of 1 residue in birds and 7 residues in mammals in comparison to reptiles suggesting the adaptation processes during evolution. The amino acid identity of CYP3A163 with Alligator mississippiensis CYP3A77 and Homo sapiens CYP3A4 is 91% and 62% respectively. The 3D structure of CYP3A163 modelled using human CYP3A4 structure as a template with Phyre 2 software, represents high similarity with its functionally important motifs and catalytic domain. Both sequence and structure of CYP3A163 display the common and conserved features of CYP3A subfamily. Overall, this study provides primary molecular and structural data of CYP3A163 required to investigate the xenobiotic metabolism in saltwater crocodiles. Copyright © 2017 Elsevier Inc. All rights reserved.

RT-PCR analysis of RNA extracted from Bouin-fixed and paraffin-embedded lymphoid tissues.

PubMed

Gloghini, Annunziata; Canal, Barbara; Klein, Ulf; Dal Maso, Luigino; Perin, Tiziana; Dalla-Favera, Riccardo; Carbone, Antonino

2004-11-01

In the present study, we have investigated whether RNA can be efficiently isolated from Bouin-fixed or formalin-fixed, paraffin-embedded lymphoid tissue specimens. To this aim, we applied a new and simple method that includes the combination of proteinase K digestion and column purification. By this method, we demonstrated that the amplification of long fragments could be accomplished after a pre-heating step before cDNA synthesis associated with the use of enzymes that work at high temperature. By means of PCR using different primers for two examined genes (glyceraldehyde-3-phosphate dehydrogenase [GAPDH]- and CD40), we amplified segments of cDNA obtained by reverse transcription of the isolated RNA extracted from Bouin-fixed or formalin-fixed paraffin-embedded tissues. Amplified fragments of the expected sizes were obtained for both genes tested indicating that this method is suitable for the isolation of high-quality RNA. To explore the possibility for giving accurate real time quantitative RT-PCR results, cDNA obtained from matched frozen, Bouin-fixed and formalin-fixed neoplastic samples (two diffuse large cell lymphomas, one plasmacytoma) was tested for the following target genes: CD40, Aquaporin-3, BLIMP1, IRF4, Syndecan-1. Delta threshold cycle (DeltaC(T)) values for Bouin-fixed and formalin-fixed paraffin-embedded tissues and their correlation with those for frozen samples showed an extremely high correlation (r > 0.90) for all of the tested genes. These results show that the method of RNA extraction we propose is suitable for giving accurate real time quantitative RT-PCR results.

cDNA cloning of Brassica napus malonyl-CoA:ACP transacylase (MCAT) (fab D) and complementation of an E. coli MCAT mutant.

PubMed

Simon, J W; Slabas, A R

1998-09-18

The GenBank database was searched using the E. coli malonyl CoA:ACP transacylase (MCAT) sequence, for plant protein/cDNA sequences corresponding to MCAT, a component of plant fatty acid synthetase (FAS), for which the plant cDNA has not been isolated. A 272-bp Zea mays EST sequence (GenBank accession number: AA030706) was identified which has strong homology to the E. coli MCAT. A PCR derived cDNA probe from Zea mays was used to screen a Brassica napus (rape) cDNA library. This resulted in the isolation of a 1200-bp cDNA clone which encodes an open reading frame corresponding to a protein of 351 amino acids. The protein shows 47% homology to the E. coli MCAT amino acid sequence in the coding region for the mature protein. Expression of a plasmid (pMCATrap2) containing the plant cDNA sequence in Fab D89, an E. coli mutant, in MCAT activity restores growth demonstrating functional complementation and direct function of the cloned cDNA. This is the first functional evidence supporting the identification of a plant cDNA for MCAT.

A new set of ESTs and cDNA clones from full-length and normalized libraries for gene discovery and functional characterization in citrus

PubMed Central

Marques, M Carmen; Alonso-Cantabrana, Hugo; Forment, Javier; Arribas, Raquel; Alamar, Santiago; Conejero, Vicente; Perez-Amador, Miguel A

2009-01-01

Background Interpretation of ever-increasing raw sequence information generated by modern genome sequencing technologies faces multiple challenges, such as gene function analysis and genome annotation. Indeed, nearly 40% of genes in plants encode proteins of unknown function. Functional characterization of these genes is one of the main challenges in modern biology. In this regard, the availability of full-length cDNA clones may fill in the gap created between sequence information and biological knowledge. Full-length cDNA clones facilitate functional analysis of the corresponding genes enabling manipulation of their expression in heterologous systems and the generation of a variety of tagged versions of the native protein. In addition, the development of full-length cDNA sequences has the power to improve the quality of genome annotation. Results We developed an integrated method to generate a new normalized EST collection enriched in full-length and rare transcripts of different citrus species from multiple tissues and developmental stages. We constructed a total of 15 cDNA libraries, from which we isolated 10,898 high-quality ESTs representing 6142 different genes. Percentages of redundancy and proportion of full-length clones range from 8 to 33, and 67 to 85, respectively, indicating good efficiency of the approach employed. The new EST collection adds 2113 new citrus ESTs, representing 1831 unigenes, to the collection of citrus genes available in the public databases. To facilitate functional analysis, cDNAs were introduced in a Gateway-based cloning vector for high-throughput functional analysis of genes in planta. Herein, we describe the technical methods used in the library construction, sequence analysis of clones and the overexpression of CitrSEP, a citrus homolog to the Arabidopsis SEP3 gene, in Arabidopsis as an example of a practical application of the engineered Gateway vector for functional analysis. Conclusion The new EST collection denotes an important step towards the identification of all genes in the citrus genome. Furthermore, public availability of the cDNA clones generated in this study, and not only their sequence, enables testing of the biological function of the genes represented in the collection. Expression of the citrus SEP3 homologue, CitrSEP, in Arabidopsis results in early flowering, along with other phenotypes resembling the over-expression of the Arabidopsis SEPALLATA genes. Our findings suggest that the members of the SEP gene family play similar roles in these quite distant plant species. PMID:19747386

Rapid Construction of Stable Infectious Full-Length cDNA Clone of Papaya Leaf Distortion Mosaic Virus Using In-Fusion Cloning

PubMed Central

Tuo, Decai; Shen, Wentao; Yan, Pu; Li, Xiaoying; Zhou, Peng

2015-01-01

Papaya leaf distortion mosaic virus (PLDMV) is becoming a threat to papaya and transgenic papaya resistant to the related pathogen, papaya ringspot virus (PRSV). The generation of infectious viral clones is an essential step for reverse-genetics studies of viral gene function and cross-protection. In this study, a sequence- and ligation-independent cloning system, the In-Fusion® Cloning Kit (Clontech, Mountain View, CA, USA), was used to construct intron-less or intron-containing full-length cDNA clones of the isolate PLDMV-DF, with the simultaneous scarless assembly of multiple viral and intron fragments into a plasmid vector in a single reaction. The intron-containing full-length cDNA clone of PLDMV-DF was stably propagated in Escherichia coli. In vitro intron-containing transcripts were processed and spliced into biologically active intron-less transcripts following mechanical inoculation and then initiated systemic infections in Carica papaya L. seedlings, which developed similar symptoms to those caused by the wild-type virus. However, no infectivity was detected when the plants were inoculated with RNA transcripts from the intron-less construct because the instability of the viral cDNA clone in bacterial cells caused a non-sense or deletion mutation of the genomic sequence of PLDMV-DF. To our knowledge, this is the first report of the construction of an infectious full-length cDNA clone of PLDMV and the splicing of intron-containing transcripts following mechanical inoculation. In-Fusion cloning shortens the construction time from months to days. Therefore, it is a faster, more flexible, and more efficient method than the traditional multistep restriction enzyme-mediated subcloning procedure. PMID:26633465

Preparation of Proper Immunogen by Cloning and Stable Expression of cDNA coding for Human Hematopoietic Stem Cell Marker CD34 in NIH-3T3 Mouse Fibroblast Cell Line

PubMed Central

Shafaghat, Farzaneh; Abbasi-Kenarsari, Hajar; Majidi, Jafar; Movassaghpour, Ali Akbar; Shanehbandi, Dariush; Kazemi, Tohid

2015-01-01

Purpose: Transmembrane CD34 glycoprotein is the most important marker for identification, isolation and enumeration of hematopoietic stem cells (HSCs). We aimed in this study to clone the cDNA coding for human CD34 from KG1a cell line and stably express in mouse fibroblast cell line NIH-3T3. Such artificial cell line could be useful as proper immunogen for production of mouse monoclonal antibodies. Methods: CD34 cDNA was cloned from KG1a cell line after total RNA extraction and cDNA synthesis. Pfu DNA polymerase-amplified specific band was ligated to pGEMT-easy TA-cloning vector and sub-cloned in pCMV6-Neo expression vector. After transfection of NIH-3T3 cells using 3 μg of recombinant construct and 6 μl of JetPEI transfection reagent, stable expression was obtained by selection of cells by G418 antibiotic and confirmed by surface flow cytometry. Results: 1158 bp specific band was aligned completely to reference sequence in NCBI database corresponding to long isoform of human CD34. Transient and stable expression of human CD34 on transfected NIH-3T3 mouse fibroblast cells was achieved (25% and 95%, respectively) as shown by flow cytometry. Conclusion: Cloning and stable expression of human CD34 cDNA was successfully performed and validated by standard flow cytometric analysis. Due to murine origin of NIH-3T3 cell line, CD34-expressing NIH-3T3 cells could be useful as immunogen in production of diagnostic monoclonal antibodies against human CD34. This approach could bypass the need for purification of recombinant proteins produced in eukaryotic expression systems. PMID:25789221

Rapid Construction of Stable Infectious Full-Length cDNA Clone of Papaya Leaf Distortion Mosaic Virus Using In-Fusion Cloning.

PubMed

Tuo, Decai; Shen, Wentao; Yan, Pu; Li, Xiaoying; Zhou, Peng

2015-12-01

Papaya leaf distortion mosaic virus (PLDMV) is becoming a threat to papaya and transgenic papaya resistant to the related pathogen, papaya ringspot virus (PRSV). The generation of infectious viral clones is an essential step for reverse-genetics studies of viral gene function and cross-protection. In this study, a sequence- and ligation-independent cloning system, the In-Fusion(®) Cloning Kit (Clontech, Mountain View, CA, USA), was used to construct intron-less or intron-containing full-length cDNA clones of the isolate PLDMV-DF, with the simultaneous scarless assembly of multiple viral and intron fragments into a plasmid vector in a single reaction. The intron-containing full-length cDNA clone of PLDMV-DF was stably propagated in Escherichia coli. In vitro intron-containing transcripts were processed and spliced into biologically active intron-less transcripts following mechanical inoculation and then initiated systemic infections in Carica papaya L. seedlings, which developed similar symptoms to those caused by the wild-type virus. However, no infectivity was detected when the plants were inoculated with RNA transcripts from the intron-less construct because the instability of the viral cDNA clone in bacterial cells caused a non-sense or deletion mutation of the genomic sequence of PLDMV-DF. To our knowledge, this is the first report of the construction of an infectious full-length cDNA clone of PLDMV and the splicing of intron-containing transcripts following mechanical inoculation. In-Fusion cloning shortens the construction time from months to days. Therefore, it is a faster, more flexible, and more efficient method than the traditional multistep restriction enzyme-mediated subcloning procedure.

What peptides these deltorphins be.

PubMed

Lazarus, L H; Bryant, S D; Cooper, P S; Salvadori, S

1999-02-01

The deltorphins are a class of highly selective delta-opioid heptapeptides from the skin of the Amazonian frogs Phyllomedusa sauvagei and P. bicolor. The first of these fascinating peptides came to light in 1987 by cloning of the cDNA of from frog skins, while the other members of this family were identified either by cDNA or isolation of the peptides. The distinctive feature of deltorphins is the presence of a naturally occurring D-enantiomer at the second position in their common N-terminal sequence, Tyr-D-Xaa-Phe, comparable to dermorphin, which is the prototype of a group of mu-selective opioids from the same source. The D-amino acid and the anionic residues, either Glu or Asp, as well as their unique amino acid compositions are responsible for the remarkable biostability, high delta-receptor affinity, bioactivity and peptide conformation. This review summarizes a decade of research from many laboratories that defined which residues and substituents in the deltorphins interact with the delta-receptor and characterized pharmacological and physiological activities in vitro and in vivo. It begins with a historical description of the topic and presents general schema for the synthesis of peptide analogues of deltorphins A, B and C as a means to document the methods employed in producing a myriad of analogues. Structure activity studies of the peptides and their pharmacological activities in vitro are detailed in abundantly tabulated data. A brief compendium of the current level of knowledge of the delta-receptor assists the reader to appreciate the rationale for the design of these analogues. Discussion of the conformation of these peptides addresses how structure leads to further hypotheses regarding ligand receptor interaction. The review ends with a broad discussion of the potential applications of these peptides in clinical and therapeutic settings.

Molecular and analysis of a phenylalanine ammonia-lyase gene (LrPAL2) from Lycoris radiata.

PubMed

Jiang, Yumei; Xia, Bing; Liang, Lijian; Li, Xiaodan; Xu, Sheng; Peng, Feng; Wang, Ren

2013-03-01

Phenylalanine ammonia-lyase (PAL), the first enzyme of phenylpropanoid biosynthesis, participates in the biosynthesis of flavonoids, lignins, stilbenes and many other compounds. In this study, we cloned a 2,326 bp full-length PAL2 gene from Lycoris radiata by using degenerate oligonucleotide primer PCR (DOP-PCR) and the rapid amplification of cDNA ends method. The cDNA contains a 2,124 bp coding region encoding 707 amino acids. The LrPAL2 shares about 77.0 % nucleic acid identity and 83 % amino acid identity with LrPAL1. Furthermore, genome sequence analysis demonstrated that LrPAL2 gene contains one intron and two exons. The 5' flanking sequence of LrPAL2 was also cloned by self-formed adaptor PCR (SEFA-PCR), and a group of putative cis-acting elements such as TATA box, CAAT box, G box, TC-rich repeats, CGTCA motif and TCA-element were identified. The LrPAL2 was detected in all tissues examined, with high abundance in bulbs at leaf sprouting stage and in petals at blooming stage. Besides, LrPAL2 drastically responded to MJ, SNP and UV, moderately responded to GA and SA, and a little increased under wounding. Comparison of LrPAL2 expression and LrPAL1 expression demonstrated that LrPAL2 can be more significantly induced than LrPAL1 under the above treatments, and LrPAL2 transcripts accumulated prominently at blooming stage, especially in petals, while LrPAL1 transcripts did not accumulated significantly at blooming stage. All these results suggested that LrPAL2 might play distinct roles in different branches of the phenylpropanoid pathway.

Technique for quantitative RT-PCR analysis directly from single muscle fibers.

PubMed

Wacker, Michael J; Tehel, Michelle M; Gallagher, Philip M

2008-07-01

The use of single-cell quantitative RT-PCR has greatly aided the study of gene expression in fields such as muscle physiology. For this study, we hypothesized that single muscle fibers from a biopsy can be placed directly into the reverse transcription buffer and that gene expression data can be obtained without having to first extract the RNA. To test this hypothesis, biopsies were taken from the vastus lateralis of five male subjects. Single muscle fibers were isolated and underwent RNA isolation (technique 1) or placed directly into reverse transcription buffer (technique 2). After cDNA conversion, individual fiber cDNA was pooled and quantitative PCR was performed using primer-probes for beta(2)-microglobulin, glyceraldehyde-3-phosphate dehydrogenase, insulin-like growth factor I receptor, and glucose transporter subtype 4. The no RNA extraction method provided similar quantitative PCR data as that of the RNA extraction method. A third technique was also tested in which we used one-quarter of an individual fiber's cDNA for PCR (not pooled) and the average coefficient of variation between fibers was <8% (cycle threshold value) for all genes studied. The no RNA extraction technique was tested on isolated muscle fibers using a gene known to increase after exercise (pyruvate dehydrogenase kinase 4). We observed a 13.9-fold change in expression after resistance exercise, which is consistent with what has been previously observed. These results demonstrate a successful method for gene expression analysis directly from single muscle fibers.

Template-independent DNA synthesis activity associated with the reverse transcriptase of the long terminal repeat retrotransposon Tf1.

PubMed

Oz-Gleenberg, Iris; Herzig, Eytan; Hizi, Amnon

2012-01-01

Reverse transcriptases (RTs) possess a non-templated addition (NTA) activity while synthesizing DNA with blunt-ended DNA primer/templates. Interestingly, the RT of the long terminal repeat retrotransposon Tf1 has an NTA activity that is substantially higher than that of HIV-1 or murine leukemia virus RTs. By performing steady state kinetics, we found that the differences between the NTA activities of Tf1 and HIV-1 RTs can be explained by the substantially lower K(M) value for the incoming dNTP of Tf1 RT (while the differences between the apparent k(cat) values of these two RTs are relatively small). Furthermore, the K(M) values, calculated for both RTs with the same dNTP, are much lower for the template-dependent synthesis (TDS) than those of NTA. However, TDS of HIV-1 RT is higher than that of Tf1 RT. The overall relative order of the apparent k(cat)/K(M) values for dATP is: HIV-1 RT (TDS) > Tf1 RT (TDS) > Tf1 RT (NTA) > HIV-1 RT (NTA). Under the employed conditions, Tf1 RT can add up to seven nucleotides to the blunt-ended substrate, while the other RTs add mostly a single nucleotide. The NTA activity of Tf1 RT is restricted to DNA primers. Furthermore, the NTA activity of Tf1 and HIV-1 RTs is suppressed by ATP, as it competes with the incoming dATP (although ATP is not incorporated by the NTA activity of the RTs). The unusually high NTA activity of Tf1 RT can explain why, after completing cDNA synthesis, the in vivo generated Tf1 cDNA has relatively long extra sequences beyond the highly conserved CA at its 3'-ends. © 2011 The Authors Journal compilation © 2011 FEBS.

A pipeline for the systematic identification of non-redundant full-ORF cDNAs for polymorphic and evolutionary divergent genomes: Application to the ascidian Ciona intestinalis

DOE PAGES

Gilchrist, Michael J.; Sobral, Daniel; Khoueiry, Pierre; ...

2015-05-27

Genome-wide resources, such as collections of cDNA clones encoding for complete proteins (full-ORF clones), are crucial tools for studying the evolution of gene function and genetic interactions. Non-model organisms, in particular marine organisms, provide a rich source of functional diversity. Marine organism genomes are, however, frequently highly polymorphic and encode proteins that diverge significantly from those of well-annotated model genomes. The construction of full-ORF clone collections from non-model organisms is hindered by the difficulty of predicting accurately the N-terminal ends of proteins, and distinguishing recent paralogs from highly polymorphic alleles. We also report a computational strategy that overcomes these difficulties,more » and allows for accurate gene level clustering of transcript data followed by the automated identification of full-ORFs with correct 5'- and 3'-ends. It is robust to polymorphism, includes paralog calling and does not require evolutionary proximity to well annotated model organisms. Here, we developed this pipeline for the ascidian Ciona intestinalis, a highly polymorphic member of the divergent sister group of the vertebrates, emerging as a powerful model organism to study chordate gene function, Gene Regulatory Networks and molecular mechanisms underlying human pathologies. Furthermore, using this pipeline we have generated the first full-ORF collection for a highly polymorphic marine invertebrate. It contains 19,163 full-ORF cDNA clones covering 60% of Ciona coding genes, and full-ORF orthologs for approximately half of curated human disease-associated genes.« less

Construction of cDNA expression library of watermelon for isolation of ClWRKY1 transcription factors gene involved in resistance to Fusarium wilt.

PubMed

Yang, Bing-Yan; Huo, Xiu-Ai; Li, Peng-Fei; Wang, Cui-Xia; Duan, Hui-Jun

2014-08-01

Full-length cDNAs are very important for genome annotation and functional analysis of genes. The number of full-length cDNAs from watermelon remains limited. Here we report first the construction of a full-length enriched cDNA library from Fusarium wilt stressed watermelon (Citrullus lanatus Thunb.) cultivar PI296341 root tissues using the SMART method. The titer of primary cDNA library and amplified library was 2.21 x 10(6) and 2.0 x 10(10) pfu/ml, respectively and the rate of recombinant was above 85%. The size of insert fragment ranged from 0.3 to 2.0 kb. In this study, we first cloned a gene named ClWRKY1, which was 1981 bp long and encoded a protein consisting of 394 amino acids. It contained two characteristic WRKY domains and two zinc finger motifs. Quantitative real-time PCR showed that ClWRKY1 expression levels reached maximum level at 12 h after inoculation with Fusarium oxysporum f. sp. niveum. The full-length cDNA library of watermelon root tissues is not only essential for the cloning of genes which are known, but also an initial key for the screening and cloning of new genes that might be involved in resistance to Fusarium wilt.

A novel RET rearrangement (ACBD5/RET) by pericentric inversion, inv(10)(p12.1;q11.2), in papillary thyroid cancer from an atomic bomb survivor exposed to high-dose radiation.

PubMed

Hamatani, Kiyohiro; Eguchi, Hidetaka; Koyama, Kazuaki; Mukai, Mayumi; Nakachi, Kei; Kusunoki, Yoichiro

2014-11-01

During analysis of RET/PTC rearrangements in papillary thyroid cancer (PTC) among atomic bomb survivors, a cDNA fragment of a novel type of RET rearrangement was identified in a PTC patient exposed to a high radiation dose using the improved 5' RACE method. This gene resulted from the fusion of the 3' portion of RET containing tyrosine kinase domain to the 5' portion of the acyl-coenzyme A binding domain containing 5 (ACBD5) gene, by pericentric inversion inv(10)(p12.1;q11.2); expression of the fusion gene was confirmed by RT-PCR. ACBD5 gene is ubiquitously expressed in various human normal tissues including thyroid. Full-length cDNA of the ACBD5-RET gene was constructed and then examined for tumorigenicity. Enhanced phosphorylation of ERK proteins in the MAPK pathway was observed in NIH3T3 cells transfected with expression vector encoding the full-length ACBD5/RET cDNA, while this was not observed in the cells transfected with empty expression vector. Stable NIH3T3 transfectants with ACBD5-RET cDNA induced tumor formation after their injection into nude mice. These findings suggest that the ACBD5-RET rearrangement is causatively involved in the development of PTC.

Recovery of infectious classical swine fever virus (CSFV) from full-length genomic cDNA clones by a swine kidney cell line expressing bacteriophage T7 RNA polymerase.

PubMed

van Gennip, H G; van Rijn, P A; Widjojoatmodjo, M N; Moormann, R J

1999-03-01

A new method for the recovery of infectious classical swine fever virus (CSFV) from full-length genomic cDNA clones of the C-strain was developed. Classical reverse genetics is based on transfection of in vitro transcribed RNA to target cells to recover RNA viruses. However, the specific infectivity of such in vitro transcribed RNA in swine kidney cells is usually low. To improve reverse genetics for CSFV, a stable swine kidney cell line was established that expresses cytoplasmic bacteriophage T7 RNA polymerase (SK6.T7). A 200-fold increased virus titre was obtained from SK6.T7 cells transfected with linearized full-length cDNA compared to in vitro transcribed RNA, whereas transfection of circular full-length cDNA resulted in 20-fold increased virus titres. Viruses generated on the SK6.T7 cells are indistinguishable from the viruses generated by the classical reverse genetic procedures. These results show the improved recovery of infectious CSFV directly from full-length cDNAs. Furthermore, the reverse genetic procedures are simplified to a faster, one step protocol. We conclude that the SK6.T7 cell line will be a valuable tool for recovering mutant CSFV and will contribute to future pestivirus research.

Isolation and characterization of cDNA clones for carrot extensin and a proline-rich 33-kDa protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, J.; Varner, J.E.

1985-07-01

Extensins are hydroxyproline-rich glycoproteins associated with most dicotyledonous plant cell walls. To isolate cDNA clones encoding extensin, the authors started by isolating poly(A) RNA from carrot root tissue, and then translating the RNA in vitro, in the presence of tritiated leucine or proline. A 33-kDa peptide was identified in the translation products as a putative extensin precursor. From a cDNA library constructed with poly(A) RNA from wounded carrots, one cDNA clone (pDC5) was identified that specifically hybridized to poly(A) RNA encoding this 33-kDa peptide. They isolated three cDNA clones (pDC11, pDC12, and pDC16) from another cDNA library using pCD5 asmore » a probe. DNA sequence data, RNA hybridization analysis, and hybrid released in vitro translation indicate that the cDNA clones pDC11 encodes extensin and that cDNA clones pDC12 and pDC16 encode the 33-kDa peptide, which as yet has an unknown identity and function. The assumption that the 33-kDa peptide was an extensin precursor was invalid. RNA hybridization analysis showed that RNA encoded by both clone types is accumulated upon wounding.« less

RICD: a rice indica cDNA database resource for rice functional genomics.

PubMed

Lu, Tingting; Huang, Xuehui; Zhu, Chuanrang; Huang, Tao; Zhao, Qiang; Xie, Kabing; Xiong, Lizhong; Zhang, Qifa; Han, Bin

2008-11-26

The Oryza sativa L. indica subspecies is the most widely cultivated rice. During the last few years, we have collected over 20,000 putative full-length cDNAs and over 40,000 ESTs isolated from various cDNA libraries of two indica varieties Guangluai 4 and Minghui 63. A database of the rice indica cDNAs was therefore built to provide a comprehensive web data source for searching and retrieving the indica cDNA clones. Rice Indica cDNA Database (RICD) is an online MySQL-PHP driven database with a user-friendly web interface. It allows investigators to query the cDNA clones by keyword, genome position, nucleotide or protein sequence, and putative function. It also provides a series of information, including sequences, protein domain annotations, similarity search results, SNPs and InDels information, and hyperlinks to gene annotation in both The Rice Annotation Project Database (RAP-DB) and The TIGR Rice Genome Annotation Resource, expression atlas in RiceGE and variation report in Gramene of each cDNA. The online rice indica cDNA database provides cDNA resource with comprehensive information to researchers for functional analysis of indica subspecies and for comparative genomics. The RICD database is available through our website http://www.ncgr.ac.cn/ricd.

Phenol emulsion-enhanced DNA-driven subtractive cDNA cloning: isolation of low-abundance monkey cortex-specific mRNAs.

PubMed Central

Travis, G H; Sutcliffe, J G

1988-01-01

To isolate cDNA clones of low-abundance mRNAs expressed in monkey cerebral cortex but absent from cerebellum, we developed an improved subtractive cDNA cloning procedure that requires only modest quantities of mRNA. Plasmid DNA from a monkey cerebellum cDNA library was hybridized in large excess to radiolabeled monkey cortex cDNA in a phenol emulsion-enhanced reaction. The unhybridized cortex cDNA was isolated by chromatography on hydroxyapatite and used to probe colonies from a monkey cortex cDNA library. Of 60,000 colonies screened, 163 clones were isolated and confirmed by colony hybridization or RNA blotting to represent mRNAs, ranging from 0.001% to 0.1% abundance, specific to or highly enriched in cerebral cortex relative to cerebellum. Clones of one medium-abundance mRNA were recovered almost quantitatively. Two of the lower-abundance mRNAs were expressed at levels reduced by a factor of 10 in Alzheimer disease relative to normal human cortex. One of these was identified as the monkey preprosomatostatin I mRNA. Images PMID:2894033

[Construction of forward and reverse subtracted cDNA libraries between muscle tissue of Meishan and Landrace pigs].

PubMed

Xu, De-Quan; Zhang, Yi-Bing; Xiong, Yuan-Zhu; Gui, Jian-Fang; Jiang, Si-Wen; Su, Yu-Hong

2003-07-01

Using suppression subtractive hybridization (SSH) technique, forward and reverse subtracted cDNA libraries were constructed between Longissimus muscles from Meishan and Landrace pigs. A housekeeping gene, G3PDH, was used to estimate the efficiency of subtractive cDNA. In two cDNA libraries, G3PDH was subtracted very efficiently at appropriate 2(10) and 2(5) folds, respectively, indicating that some differentially expressed genes were also enriched at the same folds and the two subtractive cDNA libraries were very successful. A total of 709 and 673 positive clones were isolated from forward and reverse subtracted cDNA libraries, respectively. Analysis of PCR showed that most of all plasmids in the clones contained 150-750 bp inserts. The construction of subtractive cDNA libraries between muscle tissue from different pig breeds laid solid foundations for isolating and identifying the genes determining muscle growth and meat quality, which will be important to understand the mechanism of muscle growth, determination of meat quality and practice of molecular breeding.

Construction of Infectious cDNA Clone of a Chrysanthemum stunt viroid Korean Isolate

PubMed Central

Yoon, Ju-Yeon; Cho, In-Sook; Choi, Gug-Seoun; Choi, Seung-Kook

2014-01-01

Chrysanthemum stunt viroid (CSVd), a noncoding infectious RNA molecule, causes seriously economic losses of chrysanthemum for 3 or 4 years after its first infection. Monomeric cDNA clones of CSVd isolate SK1 (CSVd-SK1) were constructed in the plasmids pGEM-T easy vector and pUC19 vector. Linear positive-sense transcripts synthesized in vitro from the full-length monomeric cDNA clones of CSVd-SK1 could infect systemically tomato seedlings and chrysanthemum plants, suggesting that the linear CSVd RNA transcribed from the cDNA clones could be replicated as efficiently as circular CSVd in host species. However, direct inoculation of plasmid cDNA clones containing full-length monomeric cDNA of CSVd-SK1 failed to infect tomato and chrysanthemum and linear negative-sense transcripts from the plasmid DNAs were not infectious in the two plant species. The cDNA sequences of progeny viroid in systemically infected tomato and chrysanthemum showed a few substitutions at a specific nucleotide position, but there were no deletions and insertions in the sequences of the CSVd progeny from tomato and chrysanthemum plants. PMID:25288987

Molecular Cloning and Characterization of Novel Morus alba Germin-Like Protein Gene Which Encodes for a Silkworm Gut Digestion-Resistant Antimicrobial Protein

PubMed Central

Patnaik, Bharat Bhusan; Kim, Dong Hyun; Oh, Seung Han; Song, Yong-Su; Chanh, Nguyen Dang Minh; Kim, Jong Sun; Jung, Woo-jin; Saha, Atul Kumar; Bindroo, Bharat Bhushan; Han, Yeon Soo

2012-01-01

Background Silkworm fecal matter is considered one of the richest sources of antimicrobial and antiviral protein (substances) and such economically feasible and eco-friendly proteins acting as secondary metabolites from the insect system can be explored for their practical utility in conferring broad spectrum disease resistance against pathogenic microbial specimens. Methodology/Principal Findings Silkworm fecal matter extracts prepared in 0.02 M phosphate buffer saline (pH 7.4), at a temperature of 60°C was subjected to 40% saturated ammonium sulphate precipitation and purified by gel-filtration chromatography (GFC). SDS-PAGE under denaturing conditions showed a single band at about 21.5 kDa. The peak fraction, thus obtained by GFC wastested for homogeneityusing C18reverse-phase high performance liquid chromatography (HPLC). The activity of the purified protein was tested against selected Gram +/− bacteria and phytopathogenic Fusarium species with concentration-dependent inhibitionrelationship. The purified bioactive protein was subjected to matrix-assisted laser desorption and ionization-time of flight mass spectrometry (MALDI-TOF-MS) and N-terminal sequencing by Edman degradation towards its identification. The N-terminal first 18 amino acid sequence following the predicted signal peptide showed homology to plant germin-like proteins (Glp). In order to characterize the full-length gene sequence in detail, the partial cDNA was cloned and sequenced using degenerate primers, followed by 5′- and 3′-rapid amplification of cDNA ends (RACE-PCR). The full-length cDNA sequence composed of 630 bp encoding 209 amino acids and corresponded to germin-like proteins (Glps) involved in plant development and defense. Conclusions/Significance The study reports, characterization of novel Glpbelonging to subfamily 3 from M. alba by the purification of mature active protein from silkworm fecal matter. The N-terminal amino acid sequence of the purified protein was found similar to the deduced amino acid sequence (without the transit peptide sequence) of the full length cDNA from M. alba. PMID:23284650

A new 1-deoxy-D-xylulose 5-phosphate reductoisomerase gene encoding the committed-step enzyme in the MEP pathway from Rauvolfia verticillata.

PubMed

Liao, Zhihua; Chen, Rong; Chen, Min; Yang, Chunxian; Wang, Qiang; Gong, Yifu

2007-01-01

1-Deoxy-D-xylulose 5-phosphate (DXP) reductoisomerase (DXR; EC 1.1.1.267) catalyzes a committed step of the methylerythritol phosphate (MEP) pathway for the biosynthesis of pharmaceutical terpenoid indole alkaloid (TIA) precursors. The full-length cDNA sequence was cloned and characterized from a TIA-producing species, Rauvolfia verticillata, using rapid amplification of cDNA ends (RACE) technique. The new cDNA was named as RvDXR and submitted to GenBank to be assigned with an accession number (DQ779286). The full-length cDNA of RvDXR was 1804 bp containing a 1425 bp open reading frame (ORF) encoding a polypeptide of 474 amino acids with a calculated molecular mass of 51.3 kDa and an isoelectric point of 5.88. Comparative and bioinformatic analyses revealed that RvDXR showed extensive homology with DXRs from other plant species and contained a conserved transit peptide for plastids, an extended Pro-rich region and a highly conserved NADPH-binding motif in its N-terminal region owned by all plant DXRs. The phylogenetic analysis revealed that DXRs had two groups including a plant and bacterial group; RvDXR belonged to angiosperm DXRs that were obtained from Synechocystis through gene transfer according to the phylogenetic analysis. The structural modeling of RvDXR showed that RvDXR had the typical V-shaped structure of DXR proteins. The tissue expression pattern analysis indicated that RvDXR expressed in all tissues including roots, stems, leaves, fruits and followers but at different levels. The lowest transcription level was observed in followers and the highest transcription was found in fruits of R. verticillata; the transcription level of RvDXR was a little higher in roots and stems than in leaves. The cloning and characterization of RvDXR will be helpful to understand more about the role of DXR involved in R. verticillata TIA biosynthesis at the molecular level and provides a candidate gene for metabolic engineering of the TIAs pathway in R. verticillata.

Display of disulfide-rich proteins by complementary DNA display and disulfide shuffling assisted by protein disulfide isomerase.

PubMed

Naimuddin, Mohammed; Kubo, Tai

2011-12-01

We report an efficient system to produce and display properly folded disulfide-rich proteins facilitated by coupled complementary DNA (cDNA) display and protein disulfide isomerase-assisted folding. The results show that a neurotoxin protein containing four disulfide linkages can be displayed in the folded state. Furthermore, it can be refolded on a solid support that binds efficiently to its natural acetylcholine receptor. Probing the efficiency of the display proteins prepared by these methods provided up to 8-fold higher enrichment by the selective enrichment method compared with cDNA display alone, more than 10-fold higher binding to its receptor by the binding assays, and more than 10-fold higher affinities by affinity measurements. Cotranslational folding was found to have better efficiency than posttranslational refolding between the two investigated methods. We discuss the utilities of efficient display of such proteins in the preparation of superior quality proteins and protein libraries for directed evolution leading to ligand discovery. Copyright © 2011 Elsevier Inc. All rights reserved.

[Cloning,expression and functional identification of secoisolariciresinol dehydrogenase gene from Dysosma versipellis callus].

PubMed

Shen, Yun; Chen, Ri-Dao; Xie, Ke-Bo; Zou, Jian-Hua; Dai, Jun-Gui

2016-12-01

Secoisolariciresinol dehydrogenase (SDH) is a key enzyme involved in the biosynthetic pathway of podophyllotoxin.In this study, two SDH candidate genes,SO282 and SO1223, were cloned from callus of Dysosma versipellis by homology-based PCR and rapid amplification of cDNA end (RACE).The SDH candidate genes were expressed in Escherichia coli and the subsequent enzyme assay in vitro showed that recombinant SO282 had the SDH activity. These results pave the way to the follow-up investigation of the biosynthetic of podophyllotoxin. Copyright© by the Chinese Pharmaceutical Association.

Lectin cDNA and transgenic plants derived therefrom

DOEpatents

Raikhel, Natasha V.

2000-10-03

Transgenic plants containing cDNA encoding Gramineae lectin are described. The plants preferably contain cDNA coding for barley lectin and store the lectin in the leaves. The transgenic plants, particularly the leaves exhibit insecticidal and fungicidal properties.

Molecular characterization and functional analysis of serine/threonine protein phosphatase of Toxocara canis.

PubMed

Ma, Guang Xu; Zhou, Rong Qiong; Hu, Shi Jun; Huang, Han Cheng; Zhu, Tao; Xia, Qing You

2014-06-01

Toxocara canis (T. canis) is a widely prevalent zoonotic parasite that infects a wide range of mammalian hosts, including humans. We generated the full-length complementary DNA (cDNA) of the serine/threonine phosphatase gene of T. canis (Tc stp) using 5' rapid amplification of the cDNA ends. The 1192-bp sequence contained a continuous 942-nucleotide open reading frame, encoding a 313-amino-acid polypeptide. The Tc STP polypeptide shares a high level of amino-acid sequence identity with the predicted STPs of Loa loa (89%), Brugia malayi (86%), Oesophagostomum columbianum (76%), and Oesophagostomumdentatum (76%). The Tc STP contains GDXHG, GDXVDRG, GNHE motifs, which are characteristic of members of the phosphoprotein phosphatase family. Our quantitative real-time polymerase chain reaction analysis showed that the Tc STP was expressed in six different tissues in the adult male, with high-level expression in the spermary, vas deferens, and musculature, but was not expressed in the adult female, suggesting that Tc STP might be involved in spermatogenesis and mating behavior. Thus, STP might represent a potential molecular target for controlling T. canis reproduction. Copyright © 2014 Elsevier Inc. All rights reserved.

The Cotton Kinesin-Like Calmodulin-Binding Protein Associates with Cortical Microtubles in Cotton Fibers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Preuss, Mary L.; Delmar, Deborah P.; Liu, Bo

Microtubules in interphase plant cells form a cortical array, which is critical for plant cell morphogenesis. Genetic studies imply that the minus end-directed microtubule motor kinesin-like calmodulin-binding protein (KCBP) plays a role in trichome morphogenesis in Arabidopsis. However, it was not clear whether this motor interacted with interphase microtubules. In cotton (Gossypium hirsutum) fibers, cortical microtubules undergo dramatic reorganization during fiber development. In this study, cDNA clones of the cotton KCBP homolog GhKCBP were isolated from a cotton fiber-specific cDNA library. During cotton fiber development from 10 to 21 DPA, the GhKCBP protein level gradually decreases. By immunofluorescence, GhKCBP wasmore » detected as puncta along cortical microtubules in fiber cells of different developmental stages. Thus the results provide evidence that GhKCBP plays a role in interphase cell growth likely by interacting with cortical microtubules. In contrast to fibers, in dividing cells of cotton, GhKCBP localized to the nucleus, the microtubule preprophase band, mitotic spindle, and the phragmoplast. Therefore KCBP likely exerts multiple roles in cell division and cell growth in flowering plants.« less

The mapping of the human 52-kD Ro/SSA autoantigen gene to human chromosome II, and its polymorphisms

DOE Office of Scientific and Technical Information (OSTI.GOV)

Frank, M.B.; Itoh, Kazuko; Fujisaku, Atsushi

1993-01-01

Autoantibodies to the ribonucleoprotein Ro/SSA occur in nearly half of the patients with systemic lupus erythematosus and are associated with lymphopenia, photosensitive dermatitis, and pulmonary and renal disease, which suggests that they have an immunopathologic role. The majority of Ro/SSA precipitin-positive patients produce serum antibodies that bind to the 60-kD and 52-kD Ro/SSA proteins. The authors previously isolated and determined the nucleotide sequence of a cDNA clone that encodes the 52-kD form of the human Ro/SSA protein. In the present study, they have determined the chromosomal location of the gene by in situ hybridization to the end of the shortmore » arm of chromosome 11. Hybridization of portions of the cDNA probe to restriction enzyme-digested DNA indicated the gene is composed of at least three exons. The exon encoding the putative zinc fingers of this protein was found to be distinct from that which encodes the leucine zipper. An RFLP of this gene was identified and is associated with the presence of lupus, primarily in black Americans. 60 refs., 3 figs., 3 tabs.« less

The yeast Ty3 retrotransposon contains a 5'-3' bipartite primer-binding site and encodes nucleocapsid protein NCp9 functionally homologous to HIV-1 NCp7.

PubMed Central

Gabus, C; Ficheux, D; Rau, M; Keith, G; Sandmeyer, S; Darlix, J L

1998-01-01

Retroviruses, including HIV-1 and the distantly related yeast retroelement Ty3, all encode a nucleoprotein required for virion structure and replication. During an in vitro comparison of HIV-1 and Ty3 nucleoprotein function in RNA dimerization and cDNA synthesis, we discovered a bipartite primer-binding site (PBS) for Ty3 composed of sequences located at opposite ends of the genome. Ty3 cDNA synthesis requires the 3' PBS for primer tRNAiMet annealing to the genomic RNA, and the 5' PBS, in cis or in trans, as the reverse transcription start site. Ty3 RNA alone is unable to dimerize, but formation of dimeric tRNAiMet bound to the PBS was found to direct dimerization of Ty3 RNA-tRNAiMet. Interestingly, HIV-1 nucleocapsid protein NCp7 and Ty3 NCp9 were interchangeable using HIV-1 and Ty3 RNA template-primer systems. Our findings impact on the understanding of non-canonical reverse transcription as well as on the use of Ty3 systems to screen for anti-NCp7 drugs. PMID:9707446

The yeast Ty3 retrotransposon contains a 5'-3' bipartite primer-binding site and encodes nucleocapsid protein NCp9 functionally homologous to HIV-1 NCp7.

PubMed

Gabus, C; Ficheux, D; Rau, M; Keith, G; Sandmeyer, S; Darlix, J L

1998-08-17

Retroviruses, including HIV-1 and the distantly related yeast retroelement Ty3, all encode a nucleoprotein required for virion structure and replication. During an in vitro comparison of HIV-1 and Ty3 nucleoprotein function in RNA dimerization and cDNA synthesis, we discovered a bipartite primer-binding site (PBS) for Ty3 composed of sequences located at opposite ends of the genome. Ty3 cDNA synthesis requires the 3' PBS for primer tRNAiMet annealing to the genomic RNA, and the 5' PBS, in cis or in trans, as the reverse transcription start site. Ty3 RNA alone is unable to dimerize, but formation of dimeric tRNAiMet bound to the PBS was found to direct dimerization of Ty3 RNA-tRNAiMet. Interestingly, HIV-1 nucleocapsid protein NCp7 and Ty3 NCp9 were interchangeable using HIV-1 and Ty3 RNA template-primer systems. Our findings impact on the understanding of non-canonical reverse transcription as well as on the use of Ty3 systems to screen for anti-NCp7 drugs.

Molecular cloning of mevalonate pathway genes from Taraxacum brevicorniculatum and functional characterisation of the key enzyme 3-hydroxy-3-methylglutaryl-coenzyme A reductase.

PubMed

van Deenen, Nicole; Bachmann, Anne-Lena; Schmidt, Thomas; Schaller, Hubert; Sand, Jennifer; Prüfer, Dirk; Schulze Gronover, Christian

2012-04-01

Taraxacum brevicorniculatum is known to produce high quality rubber. The biosynthesis of rubber is dependent on isopentenyl pyrophosphate (IPP) precursors derived from the mevalonate (MVA) pathway. The cDNA sequences of seven MVA pathway genes from latex of T. brevicorniculatum were isolated, including three cDNA sequences encoding for 3-hydroxy-3-methylglutaryl-coenzyme A (HMG-CoA) reductases (TbHMGR1-3). Expression analyses indicate an important role of TbHMGR1 as well as for the HMG-CoA synthase (TbHMGS), the diphosphomevalonate decarboxylase and the mevalonate kinase in the provision of precursors for rubber biosynthesis. The amino acid sequences of the TbHMGRs show the typical motifs described for plant HMGRs such as two transmembrane domains and a catalytic domain containing two HMG-CoA and two NADP(H) binding sites. The functionality of the HMGRs was demonstrated by complementation assay using an IPP auxotroph mutant of Escherichia coli. Furthermore, the transient expression of the catalytic domains of TbHMGR1 and TbHMGR2 in Nicotiana benthamiana resulted in a strong accumulation of sterol precursors, one of the major groups of pathway end-products.

Isolation and characterization of a novel acidic matrix protein hic22 from the nacreous layer of the freshwater mussel, Hyriopsis cumingii.

PubMed

Liu, X J; Jin, C; Wu, L M; Dong, S J; Zeng, S M; Li, J L

2016-07-29

Matrix proteins that either weakly acidic or unusually highly acidic have important roles in shell biomineralization. In this study, we have identified and characterized hic22, a weakly acidic matrix protein, from the nacreous layer of Hyriopsis cumingii. Total protein was extracted from the nacre using 5 M EDTA and hic22 was purified using a DEAE-sepharose column. The N-terminal amino acid sequence of hic22 was determined and the complete cDNA encoding hic22 was cloned and sequenced by rapid amplification of cDNA ends-polymerase chain reaction. Finally, the localization and distribution of hic22 was determined by in situ hybridization. Our results revealed that hic22 encodes a 22-kDa protein composed of 185 amino acids. Tissue expression analysis and in situ hybridization indicated that hic22 is expressed in the dorsal epithelial cells of the mantle pallial; moreover, significant expression levels of hic22 were observed after the early formation of the pearl sac (days 19-77), implying that hic22 may play an important role in biomineralization of the nacreous layer.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schlagnhaufer, C.D.; Arteca, R.N.; Pell, E.J.

When potato plants (Solanum tuberosum L. cv Norland) are subjected to oxone stress ethylene is emitted. Increases in ethylene production are often the result of increased expression of the enzyme ACC synthase. We used the polymerase chain reaction (PCR) to clone a cDNA encoding an ozone-induced ACC synthase. After treating potato plants with 300 ppb ozone for 4 h, RNA was extracted using a guanidinium isothiocyanate method. Using degenerate oligonucleotides corresponding to several conserved regions of ACC synthase sequences reported from different plant tissues as primers, we were able to reverse transcribe the RNA and amplify a cDNA for ACCmore » synthase. The clone is 1098 bp in length encoding for 386 amino acids comprising [approximately]80% of the protein. Computer analysis of the deduced amino acid sequence showed that our clone is 50-70% homologous with ACC synthase genes cloned from other plant tissues. Using the cDNA as a probe in northern analysis we found that there is little or no expression in control tissue: however there is a large increase in the expression of the ACC synthase message in response to ozone treatment.« less

Isolation of CYP3A5P cDNA from human liver: a reflection of a novel cytochrome P-450 pseudogene.

PubMed

Schuetz, J D; Guzelian, P S

1995-03-14

We have isolated, from a human liver cDNA library, a 1627 bp CYP3A5 cDNA variant (CYP3A5P) that contains several large insertions, deletions, and in-frame termination codons. By comparison with the genomic structure of other CYP3A genes, the major insertions in CYP3A5P cDNA demarcate the inferred sites of several CYP3A5 exons. The segments inserted in CYP3A5P have no homology with splice donor acceptor sites. It is unlikely that CYP3A5P cDNA represents an artifact of the cloning procedures since Southern blot analysis of human genomic DNA disclosed that CYP3A5P cDNA hybridized with a DNA fragment distinct from fragments that hybridized with either CYP3A5, CYP3A3 or CYP3A4. Moreover, analysis of adult human liver RNA on Northern blots hybridized with a CYP3A5P cDNA fragment revealed the presence of an mRNA with the predicted size of CYP3A5P. We conclude that CYP3A5P cDNA was derived from a separate gene, CYP3A5P, most likely a pseudogene evolved from CYP3A5.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Culbert, A.A.; Wallis, G.A.; Kadler, K.E.

The brittleness of bone in people with lethal (type II) osteogenesis imperfecta, a heritable disorder caused by mutations in the type I collagen genes, arises from the deposition of abnormal collagen in the bone matrix. The inability of the abnormal collagen to participate in mineralization may be caused by its failure to interact with other bone proteins. Here, we have designed a strategy to isolate the genes important for mineralization of collagen during bone formation. Cells isolated from 16-day embryonic chick calvaria and seeded post-confluence in culture deposited a mineralized matrix over a period of 2 weeks. Chick skin fibroblastsmore » seeded and cultured under the same conditions did not mineralize. Using RT-PCR, we prepared short cDNAs ({approximately}300 bp) corresponding to the 3{prime} ends of mRNA from fibroblasts and separately from the mineralizing calvarial cells. Subtractive cDNA hybridization generated a pool of cDNAs that were specific to mineralizing calvarial cells but not to fibroblasts. Screening of 100,000 plaques of a chick bone ZAP Express cDNA library with this pool of mineralizing-specific cDNAs identified ten clones which comprised full-length cDNAs for the bone proteins osteopontin (eight of the ten positives), bone sialoprotein II (one of the ten positives), and cystatin (one of the ten positives). cDNAs for type I collagen, fibronectin, alkaline phosphatase, house-keeping genes, and other genes expressed in fibroblasts were not identified in this preliminary screen. The pool of short cDNAs is likely to comprise cDNAs for further bone-specific genes and will be used to screen the entire bone cDNA library of 4.2 million clones. 30 refs., 4 figs.« less

A galectin from Eriocheir sinensis functions as pattern recognition receptor enhancing microbe agglutination and haemocytes encapsulation.

PubMed

Wang, Mengqiang; Wang, Lingling; Huang, Mengmeng; Yi, Qilin; Guo, Ying; Gai, Yunchao; Wang, Hao; Zhang, Huan; Song, Linsheng

2016-08-01

Galectins are a family of β-galactoside binding lectins that function as pattern recognition receptors (PRRs) in innate immune system of both vertebrates and invertebrates. The cDNA of Chinese mitten crab Eriocheir sinensis galectin (designated as EsGal) was cloned via rapid amplification of cDNA ends (RACE) technique based on expressed sequence tags (ESTs) analysis. The full-length cDNA of EsGal was 999 bp. Its open reading frame encoded a polypeptide of 218 amino acids containing a GLECT/Gal-bind_lectin domain and a proline/glycine rich low complexity region. The deduced amino acid sequence and domain organization of EsGal were highly similar to those of crustacean galectins. The mRNA transcripts of EsGal were found to be constitutively expressed in a wide range of tissues and mainly in hepatopancreas, gill and haemocytes. The mRNA expression level of EsGal increased rapidly and significantly after crabs were stimulated by different microbes. The recombinant EsGal (rEsGal) could bind various pathogen-associated molecular patterns (PAMPs), including lipopolysaccharide (LPS), peptidoglycan (PGN) and glucan (GLU), and exhibited strong activity to agglutinate Escherichia coli, Vibrio anguillarum, Bacillus subtilis, Micrococcus luteus, Staphylococcus aureus and Pichia pastoris, and such agglutinating activity could be inhibited by both d-galactose and α-lactose. The in vitro encapsulation assay revealed that rEsGal could enhance the encapsulation of haemocytes towards agarose beads. These results collectively suggested that EsGal played crucial roles in the immune recognition and elimination of pathogens and contributed to the innate immune response against various microbes in crabs. Copyright © 2016 Elsevier Ltd. All rights reserved.

Expression analysis of HSP70 in the testis of Octopus tankahkeei under thermal stress.

PubMed

Long, Ling-Li; Han, Ying-Li; Sheng, Zhang; Du, Chen; Wang, You-Fa; Zhu, Jun-Quan

2015-09-01

The gene encoding heat shock protein 70 (HSP70) was identified in Octopus tankahkeei by homologous cloning and rapid amplification of cDNA ends (RACE). The full-length cDNA (2471 bp) consists of a 5'-untranslated region (UTR) (89 bp), a 3'-UTR (426 bp), and an open reading frame (1956 bp) that encodes 651 amino acid residues with a predicted molecular mass of 71.8 kDa and an isoelectric point of 5.34. Based on the amino acid sequence analysis and multiple sequence alignment, this cDNA is a member of cytoplasmic hsp70 subfamily of the hsp70 family and was designated as ot-hsp70. Tissue expression analysis showed that HSP70 expression is highest in the testes when all examined organs were compared. Immunohistochemistry analysis, together with hematoxylin-eosin staining, revealed that the HSP70 protein was expressed in all spermatogenic cells, but not in fibroblasts. In addition, O. tankahkeei were heat challenged by exposure to 32 °C seawater for 2 h, then returned to 13 °C for various recovery time (0-24 h). Relative expression of ot-hsp70 mRNA in the testes was measured at different time points post-challenge by quantitative real-time PCR. A clear time-dependent mRNA expression of ot-hsp70 after thermal stress indicates that the HSP70 gene is inducible. Ultrastructural changes of the heat-stressed testis were observed by transmission electron microscopy. We suggest that HSP70 plays an important role in spermatogenesis and testis protection against thermal stress in O. tankahkeei. Copyright © 2015 Elsevier Inc. All rights reserved.

Deciphering of the Dual oxidase (Nox family) gene from kuruma shrimp, Marsupenaeus japonicus: full-length cDNA cloning and characterization.

PubMed

Inada, Mari; Kihara, Keisuke; Kono, Tomoya; Sudhakaran, Raja; Mekata, Tohru; Sakai, Masahiro; Yoshida, Terutoyo; Itami, Toshiaki

2013-02-01

In many physiological processes, including the innate immune system, free radicals such as nitric oxide (NO) and reactive oxygen species (ROS) play significant roles. In humans, 2 homologs of Dual oxidases (Duox) generate hydrogen peroxide (H(2)O(2)), which is a type of ROS. Here, we report the identification and characterization of a Duox from kuruma shrimp, Marsupenaeus japonicus. The full-length cDNA sequence of the M. japonicus Dual oxidase (MjDuox) gene contains 4695 bp and was generated using reverse transcriptase-polymerase chain reaction (RT-PCR) and random amplification of cDNA ends (RACE). The open reading frame of MjDuox encodes a protein of 1498 amino acids with an estimated mass of 173 kDa. In a homology analysis using amino acid sequences, MjDuox exhibited 69.3% sequence homology with the Duox of the red flour beetle, Tribolium castaneum. A transcriptional analysis revealed that the MjDuox mRNA is highly expressed in the gills of healthy kuruma shrimp. In the gills, MjDuox expression reached its peak 60 h after injection with WSSV and decreased to its normal level at 72 h. In gene knockdown experiments of free radical-generating enzymes, the survival rates decreased during the early stages of a white spot syndrome virus (WSSV) infection following the knockdown of the NADPH oxidase (MjNox) or MjDuox genes. In the present study, the identification, cloning and gene knockdown of the kuruma shrimp MjDuox are reported. Duoxes have been identified in vertebrates and some insects; however, few reports have investigated Duoxes in crustaceans. This study is the first to identify and clone a Dual oxidase from a crustacean species. Copyright © 2012 Elsevier Ltd. All rights reserved.

Molecular cloning and immunochemical characterization of a novel major Japanese cedar pollen allergen belonging to the aspartic protease family.

PubMed

Ibrahim, Ahmed Ragaa Nour; Kawamoto, Seiji; Aki, Tsunehiro; Shimada, Yayoi; Rikimaru, Satoshi; Onishi, Nobukazu; Babiker, Elfadil Elfadl; Oiso, Isao; Hashimoto, Kunihiko; Hayashi, Takaharu; Ono, Kazuhisa

2010-01-01

Japanese cedar (Cryptomeria japonica) pollen is a major cause of seasonal pollinosis in Japan. Protease activity in the pollen grains may trigger pro-allergic responses but no such proteases have yet been identified as pollen allergens. We report the molecular cloning and immunochemical characterization of a novel C. japonica pollen allergen belonging to the aspartic protease family. We focused on the C. japonica pollen allergen spot No. 63 (CPA63, 47.5% IgE binding frequency) on our 2-dimensional IgE immunoblot map. The internal amino acid sequences were determined using time-of-flight mass spectrometry. Full-length cpa63 cDNA was cloned by rapid amplification of cDNA ends (RACE)-PCR. Recombinant CPA63 (r-CPA63) was expressed using the baculovirus-insect cell culture system and its IgE binding capacity was analyzed by enzyme-linked immunosorbent assay (ELISA). The proteolytic activity of r-CPA63 was also assessed using a putative mature enzyme produced upon autolysis. cpa63 cDNA encoded a 472 amino acid polypeptide showing about 40% sequence identity to members of the plant atypical aspartic protease family. ELISA showed that r-CPA63 was recognized by IgE antibodies in the serum of 58% (18/31) of Japanese cedar pollinosis patients. We also demonstrated an aspartic protease-like enzyme activity of the putative mature r-CPA63. We have identified the first plant aspartic protease allergen from Japanese cedar pollen. The availability of the CPA63 sequence and its recombinant allergen production system are useful not only for pharmaceutical applications but also for further examination of the role of protease activity in the pathogenesis of cedar pollinosis. 2010 S. Karger AG, Basel.

An annotated cDNA library of juvenile Euprymna scolopes with and without colonization by the symbiont Vibrio fischeri

PubMed Central

Chun, Carlene K; Scheetz, Todd E; Bonaldo, Maria de Fatima; Brown, Bartley; Clemens, Anik; Crookes-Goodson, Wendy J; Crouch, Keith; DeMartini, Tad; Eyestone, Mari; Goodson, Michael S; Janssens, Bernadette; Kimbell, Jennifer L; Koropatnick, Tanya A; Kucaba, Tamara; Smith, Christina; Stewart, Jennifer J; Tong, Deyan; Troll, Joshua V; Webster, Sarahrose; Winhall-Rice, Jane; Yap, Cory; Casavant, Thomas L; McFall-Ngai, Margaret J; Soares, M Bento

2006-01-01

Background Biologists are becoming increasingly aware that the interaction of animals, including humans, with their coevolved bacterial partners is essential for health. This growing awareness has been a driving force for the development of models for the study of beneficial animal-bacterial interactions. In the squid-vibrio model, symbiotic Vibrio fischeri induce dramatic developmental changes in the light organ of host Euprymna scolopes over the first hours to days of their partnership. We report here the creation of a juvenile light-organ specific EST database. Results We generated eleven cDNA libraries from the light organ of E. scolopes at developmentally significant time points with and without colonization by V. fischeri. Single pass 3' sequencing efforts generated 42,564 expressed sequence tags (ESTs) of which 35,421 passed our quality criteria and were then clustered via the UIcluster program into 13,962 nonredundant sequences. The cDNA clones representing these nonredundant sequences were sequenced from the 5' end of the vector and 58% of these resulting sequences overlapped significantly with the associated 3' sequence to generate 8,067 contigs with an average sequence length of 1,065 bp. All sequences were annotated with BLASTX (E-value < -03) and Gene Ontology (GO). Conclusion Both the number of ESTs generated from each library and GO categorizations are reflective of the activity state of the light organ during these early stages of symbiosis. Future analyses of the sequences identified in these libraries promise to provide valuable information not only about pathways involved in colonization and early development of the squid light organ, but also about pathways conserved in response to bacterial colonization across the animal kingdom. PMID:16780587

Heterologous expression of a Rauvolfia cDNA encoding strictosidine glucosidase, a biosynthetic key to over 2000 monoterpenoid indole alkaloids.

PubMed

Gerasimenko, Irina; Sheludko, Yuri; Ma, Xueyan; Stöckigt, Joachim

2002-04-01

Strictosidine glucosidase (SG) is an enzyme that catalyses the second step in the biosynthesis of various classes of monoterpenoid indole alkaloids. Based on the comparison of cDNA sequences of SG from Catharanthus roseus and raucaffricine glucosidase (RG) from Rauvolfia serpentina, primers for RT-PCR were designed and the cDNA encoding SG was cloned from R. serpentina cell suspension cultures. The active enzyme was expressed in Escherichia coli and purified to homogeneity. Analysis of its deduced amino-acid sequence assigned the SG from R. serpentina to family 1 of glycosyl hydrolases. In contrast to the SG from C. roseus, the enzyme from R. serpentina is predicted to lack an uncleavable N-terminal signal sequence, which is believed to direct proteins to the endoplasmic reticulum. The temperature and pH optimum, enzyme kinetic parameters and substrate specificity of the heterologously expressed SG were studied and compared to those of the C. roseus enzyme, revealing some differences between the two glucosidases. In vitro deglucosylation of strictosidine by R. serpentina SG proceeds by the same mechanism as has been shown for the C. roseus enzyme preparation. The reaction gives rise to the end product cathenamine and involves 4,21-dehydrocorynantheine aldehyde as an intermediate. The enzymatic hydrolysis of dolichantoside (Nbeta-methylstrictosidine) leads to several products. One of them was identified as a new compound, 3-isocorreantine A. From the data it can be concluded that the divergence of the biosynthetic pathways leading to different classes of indole alkaloids formed in R. serpentina and C. roseus cell suspension cultures occurs at a later stage than strictosidine deglucosylation.

Molecular cloning and characterization of enhanced disease susceptibility 1 (EDS1) from Gossypium barbadense.

PubMed

Su, Xiaofeng; Qi, Xiliang; Cheng, Hongmei

2014-06-01

Arabidopsis enhanced disease susceptibility 1 (EDS1) plays an important role in plant defense against biotrophic and necrotrophic pathogens. The necrotrophic pathogen Verticillium dahliae infection of Gossypium barbadense could lead to Verticillium wilt which seriously reduces the cotton production. Here, we cloned and characterized a G. barbadense homolog of EDS1, designated as GbEDS1. The full-length cDNA of the GbEDS1 gene was obtained by the technique of rapid-amplification of cDNA ends. The open reading frame of the GbEDS1 gene was 1,647 bp long and encoded a protein of 548 amino acids residues. Comparison of the cDNA and genomic DNA sequence of GbEDS1 indicated that this gene contained a single intron and two exons. Like other EDS1s, GbEDS1 contained a conserved N-terminal lipase domain and an EDS1-specific KNEDT motif. Subcellular localization assay revealed that GbEDS1-green fluorescence protein fusion protein was localized in both cytosol and nucleus. Interestingly, the transcript levels of GbEDS1 were dramatically increased in response to pathogen V. dahliae infection. To investigate the role of GbEDS1 in plant resistance against V. dahliae, a conserved fragment derived from GbEDS1 was used to knockdown the endogenous EDS1 in Nicotiana benthamiana by heterologous virus-induced gene silencing. Our data showed that silencing of NbEDS1 resulted in increased susceptibility to V. dahliae infection in N. benthamiana, suggesting a possible involvement of the novelly isolated GbEDS1 in the regulation of plant defense against V. dahliae.

Cloning of a heat shock protein 90 (HSP90) gene and expression analysis in the ridgetail white prawn Exopalaemon carinicauda.

PubMed

Li, Jitao; Han, Junying; Chen, Ping; Chang, Zhiqiang; He, Yuying; Liu, Ping; Wang, Qingyin; Li, Jian

2012-06-01

Heat shock protein 90 (HSP90) is a highly conserved molecular chaperone contributing to the folding, maintenance of structural integrity and proper regulation of a subset of cytosolic proteins. In this study, a heat shock protein 90 cDNA named EcHSP90 was cloned from the hepatopancreas of ridgetail white prawn Exopalaemon carinicauda by reverse transcription polymerase chain reaction (RT-PCR) coupled with rapid amplification of cDNA ends (RACE) approaches. The full-length cDNA of EcHSP90 was of 2695 bp, including an open reading frame (ORF) of 2163 bp encoding a polypeptide of 720 amino acids with an estimated molecular mass of 82.73 kDa and an estimated isoelectric point of 4.83. BLAST analysis revealed that the EcHSP90 shared high similarity (87.6%-75.24%) with other known HSP90s. The five conserved amino acid blocks defined as HSP90 protein family signatures were also identified in EcHSP90, which indicated that EcHSP90 should be a cytosolic member of the HSP90 family. Quantitative real-time RT-PCR analysis revealed that EcHSP90 transcript could be detected in all the tested tissues, and strongly expressed in ovary of E. carinicauda. The transcript of EcHSP90 in hepatopancreas of E. carinicauda showed different expression profiles after pH and ammonia-N stresses. The results indicated that EcHSP90 was a constitutive and inducible expressed protein and could be induced by various stresses from environment. Copyright © 2012 Elsevier Ltd. All rights reserved.

Submesoscale characteristics and transcription of a fatty acid elongase gene from a freshwater green microalgae, Myrmecia incisa Reisigl

NASA Astrophysics Data System (ADS)

Yu, Shuiyan; Liu, Shicheng; Li, Chunyang; Zhou, Zhigang

2011-01-01

Myrmecia incisa is a green coccoid freshwater microalgae, which is rich in arachidonic acid (ArA, C20: 4ω-6, δ5, 8, 11, 14), a long chain polyunsaturated fatty acid (PUFA), especially under nitrogen starvation stress. A cDNA library of M. incisa was constructed with λ phage vectors and a 545 nt expressed sequence tag (EST) was screened from this library as a putative elongase gene due to its 56% and 49% identity to Marchantia polymorpha L. and Ostreococcus tauri Courties et Chrétiennot-Dinet, respectively. Based upon this EST sequence, an elongase gene designated MiFAE was isolated from M. incisa via 5'/3' rapid amplification of cDNA ends (RACE). The cDNA sequence was 1 331 bp long and included a 33 bp 5'-untranslated region (UTR) and a 431 bp 3'-UTR with a typical poly-A tail. The 867 bp ORF encoded a predicted protein of 288 amino acids. This protein was characterized by a conserved histidine-rich box and a MYxYY motif that was present in other members of the elongase family. The genomic DNA sequence of MiFAE was found to be interrupted by three introns with splicing sites of Introns I (81 bp), II (81 bp), and III (67 bp) that conformed to the GT-AG rule. Quantitative real-time PCR showed that the transcription level of MiFAE in this microalga under nitrogen starvation was higher than that under normal condition. Prior to the ArA content accumulation, the transcription of MiFAE was enhanced, suggesting that it was possibly responsible for the ArA accumulation in this microalga cultured under nitrogen starvation conditions.

The organisation and interviral homologies of genes at the 3' end of tobacco rattle virus RNA1

PubMed Central

Boccara, Martine; Hamilton, William D. O.; Baulcombe, David C.

1986-01-01

The RNA1 of tobacco rattle virus (TRV) has been cloned as cDNA and the nucleotide sequence determined of 2 kb from the 3'-terminal region. The sequence contains three long open reading frames. One of these starts 5' of the cDNA and probably corresponds to the carboxy-terminal sequence of a 170-K protein encoded on RNA1. The deduced protein sequence from this reading frame shows homology with the putative replicases of tobacco mosaic virus (TMV) and tricornaviruses. The location of the second open reading frame, which encodes a 29-K polypeptide, was shown by Northern blot analysis to coincide with a 1.6-kb subgenomic RNA. The validity of this reading frame was confirmed by showing that the cDNA extending over this region could be transcribed and translated in vitro to produce a polypeptide of the predicted size which co-migrates in electrophoresis with a translation product of authentic viral RNA. The sequence of this 29-K polypeptide showed homology with two regions in the 30-K protein of TMV. This homology includes positions in the TMV 30-K protein where mutations have been identified which affect the transport of virus between cells. The third open reading frame encodes a potential 16-K protein and was shown by Northern blot hybridisation to be contained within the region of a 0.7-kb subgenomic RNA which is found in cellular RNA of infected cells but not virus particles. The many similarities between TRV and TMV in viral morphology, gene organisation and sequence suggest that these two viral groups may share a common viral ancestor. ImagesFig. 2.Fig. 3. PMID:16453668

Cloning and Expression of cDNA for Rat Heme Oxygenase

NASA Astrophysics Data System (ADS)

Shibahara, Shigeki; Muller, Rita; Taguchi, Hayao; Yoshida, Tadashi

1985-12-01

Two cDNA clones for rat heme oxygenase have been isolated from a rat spleen cDNA library in λ gt11 by immunological screening using a specific polyclonal antibody. One of these clones has an insert of 1530 nucleotides that contains the entire protein-coding region. To confirm that the isolated cDNA encodes heme oxygenase, we transfected monkey kidney cells (COS-7) with the cDNA carried in a simian virus 40 vector. The heme oxygenase was highly expressed in endoplasmic reticulum of transfected cells. The nucleotide sequence of the cloned cDNA was determined and the primary structure of heme oxygenase was deduced. Heme oxygenase is composed of 289 amino acids and has one hydrophobic segment at its carboxyl terminus, which is probably important for the insertion of heme oxygenase into endoplasmic reticulum. The cloned cDNA was used to analyze the induction of heme oxygenase in rat liver by treatment with CoCl2 or with hemin. RNA blot analysis showed that both CoCl2 and hemin increased the amount of hybridizable mRNA, suggesting that these substances may act at the transcriptional level to increase the amount of heme oxygenase.

Fabrication of high quality cDNA microarray using a small amount of cDNA.

PubMed

Park, Chan Hee; Jeong, Ha Jin; Jung, Jae Jun; Lee, Gui Yeon; Kim, Sang-Chul; Kim, Tae Soo; Yang, Sang Hwa; Chung, Hyun Cheol; Rha, Sun Young

2004-05-01

DNA microarray technology has become an essential part of biological research. It enables the genome-scale analysis of gene expression in various types of model systems. Manufacturing high quality cDNA microarrays of microdeposition type depends on some key factors including a printing device, spotting pins, glass slides, spotting solution, and humidity during spotting. UsingEthe Microgrid II TAS model printing device, this study defined the optimal conditions for producing high density, high quality cDNA microarrays with the least amount of cDNA product. It was observed that aminosilane-modified slides were superior to other types of surface modified-slides. A humidity of 30+/-3% in a closed environment and the overnight drying of the spotted slides gave the best conditions for arraying. In addition, the cDNA dissolved in 30% DMSO gave the optimal conditions for spotting compared to the 1X ArrayIt, 3X SSC and 50% DMSO. Lastly, cDNA in the concentration range of 100-300 ng/ micro l was determined to be best for arraying and post-processing. Currently, the printing system in this study yields reproducible 9000 spots with a spot size 150 mm diameter, and a 200 nm spot spacing.

Molecular detection of Borrelia burgdorferi sensu lato – An analytical comparison of real-time PCR protocols from five different Scandinavian laboratories

PubMed Central

Faller, Maximilian; Wilhelmsson, Peter; Kjelland, Vivian; Andreassen, Åshild; Dargis, Rimtas; Quarsten, Hanne; Dessau, Ram; Fingerle, Volker; Margos, Gabriele; Noraas, Sølvi; Ornstein, Katharina; Petersson, Ann-Cathrine; Matussek, Andreas; Lindgren, Per-Eric; Henningsson, Anna J.

2017-01-01

Introduction Lyme borreliosis (LB) is the most common tick transmitted disease in Europe. The diagnosis of LB today is based on the patient´s medical history, clinical presentation and laboratory findings. The laboratory diagnostics are mainly based on antibody detection, but in certain conditions molecular detection by polymerase chain reaction (PCR) may serve as a complement. Aim The purpose of this study was to evaluate the analytical sensitivity, analytical specificity and concordance of eight different real-time PCR methods at five laboratories in Sweden, Norway and Denmark. Method Each participating laboratory was asked to analyse three different sets of samples (reference panels; all blinded) i) cDNA extracted and transcribed from water spiked with cultured Borrelia strains, ii) cerebrospinal fluid spiked with cultured Borrelia strains, and iii) DNA dilution series extracted from cultured Borrelia and relapsing fever strains. The results and the method descriptions of each laboratory were systematically evaluated. Results and conclusions The analytical sensitivities and the concordance between the eight protocols were in general high. The concordance was especially high between the protocols using 16S rRNA as the target gene, however, this concordance was mainly related to cDNA as the type of template. When comparing cDNA and DNA as the type of template the analytical sensitivity was in general higher for the protocols using DNA as template regardless of the use of target gene. The analytical specificity for all eight protocols was high. However, some protocols were not able to detect Borrelia spielmanii, Borrelia lusitaniae or Borrelia japonica. PMID:28937997

Role of cytochrome P450 IA2 in acetanilide 4-hydroxylation as determined with cDNA expression and monoclonal antibodies.

PubMed

Liu, G; Gelboin, H V; Myers, M J

1991-02-01

The role of P450 IA2 in the hydroxylation of acetanilide was examined using an inhibitory monoclonal antibody (MAb) 1-7-1 and vaccinia cDNA expression producing murine P450 IA1 (mIA1), murine P450 IA2 (mIA2), or human P450 IA2 (hIA2). Acetanilide hydroxylase (AcOH) activity was measured using an HPLC method with more than 500-fold greater sensitivity than previously described procedures. This method, which does not require the use of radioactive acetanilide, was achieved by optimizing both the gradient system and the amount of enzyme needed to achieve detection by uv light. MAb 1-7-1 inhibits up to 80% of the AcOH activity in both rat liver microsomes and cDNA expressed mouse and human P450 IA2. MAb 1-7-1, which recognizes both P450 IA1 and P450 IA2, completely inhibits the aryl hydrocarbon hydroxylase (AHH) activity of cDNA expressed in IA1. The inhibition of only 80% of the AHH activity present in MC liver microsomes by MAb 1-7-1 suggests that additional P450 forms are contributing to the overall AHH activity present in methylcholanthrene (MC)-liver microsomes as MAb 1-7-1 almost completely inhibits the AHH activity of expressed mIA1. Maximal inhibition of IA2 by 1-7-1 results in an 80% decrease in acetanilide hydroxylase activity in both liver microsomes and expressed mouse and human IA2. The capacity of MAb 1-7-1 to produce identical levels of inhibition of acetanilide hydroxylase activity in rat MC microsomes (80%) and in expressed mouse (81%) and human P450 IA2 (80%) strongly suggests that P450 IA2 is the major and perhaps the only enzyme responsible for the metabolism of acetanilide. These results demonstrate the complementary utility of monoclonal antibodies and cDNA expression for defining the contribution of specific P450 enzymes to the metabolism of a given substrate. This complementary approach allows for a more precise determination of the inhibitory capacity of MAb with respect to the metabolic capacity of the target P450.

Molecular cloning of cDNAs for the nerve-cell specific phosphoprotein, synapsin I.

PubMed Central

Kilimann, M W; DeGennaro, L J

1985-01-01

To provide access to synapsin I-specific DNA sequences, we have constructed cDNA clones complementary to synapsin I mRNA isolated from rat brain. Synapsin I mRNA was specifically enriched by immunoadsorption of polysomes prepared from the brains of 10-14 day old rats. Employing this enriched mRNA, a cDNA library was constructed in pBR322 and screened by differential colony hybridization with single-stranded cDNA probes made from synapsin I mRNA and total polysomal poly(A)+ RNA. This screening procedure proved to be highly selective. Five independent recombinant plasmids which exhibited distinctly stronger hybridization with the synapsin I probe were characterized further by restriction mapping. All of the cDNA inserts gave restriction enzyme digestion patterns which could be aligned. In addition, some of the cDNA inserts were shown to contain poly(dA) sequences. Final identification of synapsin I cDNA clones relied on the ability of the cDNA inserts to hybridize specifically to synapsin I mRNA. Several plasmids were tested by positive hybridization selection. They specifically selected synapsin I mRNA which was identified by in vitro translation and immunoprecipitation of the translation products. The established cDNA clones were used for a blot-hybridization analysis of synapsin I mRNA. A fragment (1600 bases) from the longest cDNA clone hybridized with two discrete RNA species 5800 and 4500 bases long, in polyadenylated RNA from rat brain and PC12 cells. No hybridization was detected to RNA from rat liver, skeletal muscle or cardiac muscle. Images Fig. 1. Fig. 2. Fig. 4. Fig. 5. PMID:3933975

A large-scale full-length cDNA analysis to explore the budding yeast transcriptome

PubMed Central

Miura, Fumihito; Kawaguchi, Noriko; Sese, Jun; Toyoda, Atsushi; Hattori, Masahira; Morishita, Shinichi; Ito, Takashi

2006-01-01

We performed a large-scale cDNA analysis to explore the transcriptome of the budding yeast Saccharomyces cerevisiae. We sequenced two cDNA libraries, one from the cells exponentially growing in a minimal medium and the other from meiotic cells. Both libraries were generated by using a vector-capping method that allows the accurate mapping of transcription start sites (TSSs). Consequently, we identified 11,575 TSSs associated with 3,638 annotated genomic features, including 3,599 ORFs, to suggest that most yeast genes have two or more TSSs. In addition, we identified 45 previously undescribed introns, including those affecting current ORF annotations and those spliced alternatively. Furthermore, the analysis revealed 667 transcription units in the intergenic regions and transcripts derived from antisense strands of 367 known features. We also found that 348 ORFs carry TSSs in their 3′-halves to generate sense transcripts starting from inside the ORFs. These results indicate that the budding yeast transcriptome is considerably more complex than previously thought, and it shares many recently revealed characteristics with the transcriptomes of mammals and other higher eukaryotes. Thus, the genome-wide active transcription that generates novel classes of transcripts appears to be an intrinsic feature of the eukaryotic cells. The budding yeast will serve as a versatile model for the studies on these aspects of transcriptome, and the full-length cDNA clones can function as an invaluable resource in such studies. PMID:17101987

Cloning and characterization of a novel stress-responsive WRKY transcription factor gene (MusaWRKY71) from Musa spp. cv. Karibale Monthan (ABB group) using transformed banana cells.

PubMed

Shekhawat, Upendra K Singh; Ganapathi, Thumballi R; Srinivas, Lingam

2011-08-01

WRKY transcription factor proteins play significant roles in plant stress responses. Here, we report the cloning and characterization of a novel WRKY gene, MusaWRKY71 isolated from an edible banana cultivar Musa spp. Karibale Monthan (ABB group). MusaWRKY71, initially identified using in silico approaches from an abiotic stress-related EST library, was later extended towards the 3' end using rapid amplification of cDNA ends technique. The 1299-bp long cDNA of MusaWRKY71 encodes a protein with 280 amino acids and contains a characteristic WRKY domain in the C-terminal half. Although MusaWRKY71 shares good similarity with other monocot WRKY proteins the substantial size difference makes it a unique member of the WRKY family in higher plants. The 918-bp long 5' proximal region determined using thermal asymmetric interlaced-polymerase chain reaction has many putative cis-acting elements and transcription factor binding motifs. Subcellular localization assay of MusaWRKY71 performed using a GFP-fusion platform confirmed its nuclear targeting in transformed banana suspension cells. Importantly, MusaWRKY71 expression in banana plantlets was up-regulated manifold by cold, dehydration, salt, ABA, H2O2, ethylene, salicylic acid and methyl jasmonate treatment indicating its involvement in response to a variety of stress conditions in banana. Further, transient overexpression of MusaWRKY71 in transformed banana cells led to the induction of several genes, homologues of which have been proven to be involved in diverse stress responses in other important plants. The present study is the first report on characterization of a banana stress-related transcription factor using transformed banana cells.

Isolation and characterization of adrenoleukodystrophy protein (ALDP) related sequences in the human genome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Geraghty, M.T.; Stetten, G.; Kearns, W.

1994-09-01

X-linked adrenoleukodystrophy (ALD) is a disorder of peroxisomal {beta}-oxidation of very long chain fatty acids. It presents either as progressive dementia in childhood or as progressive paraparesis in later years. Adrenal insufficiency occurs in both phenotypes. The gene of the ALD protein has been mapped to Xq28 and has recently been cloned and characterized. The ALD protein has significant homology to the peroxisomal membrane protein, PMP70 and belongs to the ATP binding cassette superfamily of transporters. We screened a human genomic library with an ALDP cDNA and isolated 5 different but highly similar clones containing sequences corresponding to the 3{prime}more » end of the ALDP gene. Comparison of the sequences over the region corresponding to exon 9 through the 3{prime} end of the ALDP gene reveals {approximately}96% nucleotide identity in both exonic and intronic regions. Splice sites and open reading frames are maintained. Using both FISH and human-rodent DNA mapping panels, we positively assign these ALDP-related sequences to chromosomes 2, 16 and 22, and provisionally to 1 and 20. Southern blot of primate DNA probed with a partial ALDP cDNA (exon 2-10) shows that expansion of ALDP-related sequences occurred in higher primates (chimp, gorilla and human). Although Northern blots show multiple ALDP-hybridizing transcripts in certain tissues, we have no evidence to date for expression of these ALDP-related sequences. In conclusion, our data show there has been an unusual and recent dispersal to multiple chromosomes of structural gene sequences related to the ALDP gene. The functional significance of these sequences remains to be determined but their existence complicates PCR and mutation analysis of the ALDP gene.« less

DNA encoding for plant digalactosyldiacylglycerol galactosyltransferase and methods of use

DOEpatents

Benning, Christoph; Doermann, Peter

2003-11-04

The cDNA encoding digalactosyldiacylglycerol galactosyltransferase (DGD1) is provided. The deduced amino acid sequence is also provided. Methods of making and using DGD1 to screen for new herbicides and alter a plant's leaf lipid composition are also provided, as well as expression vectors, transgenic plants or other organisms transfected with said vectors.

Gene-expression profiling using suppression-subtractive hybridization and cDNA microarray in rat mononuclear cells in response to welding-fume exposure.

PubMed

Rim, Kyung Taek; Park, Kun Koo; Sung, Jae Hyuck; Chung, Yong Hyun; Han, Jeong Hee; Cho, Key Seung; Kim, Kwang Jong; Yu, Il Je

2004-06-01

Welders with radiographic pneumoconiosis abnormalities have shown a gradual clearing of the X-ray identified effects following removal from exposure. In some cases, the pulmonary fibrosis associated with welding fumes appears in a more severe form in welders. Accordingly, for the early detection of welding-fume-exposure-induced pulmonary fibrosis, the gene expression profiles of peripheral mononuclear cells from rats exposed to welding fumes were studied using suppression-subtractive hybridization (SSH) and a cDNA microarray. As such, Sprague-Dawley rats were exposed to a stainless steel arc welding fume for 2 h/day in an inhalation chamber with a 1107.5 +/- 2.6 mg/m3 concentration of total suspended particulate (TSP) for 30 days. Thereafter, the total RNA was extracted from the peripheral blood mononuclear cells, the cDNA synthesized from the total RNA using the SMART PCR cDNA method, and SSH performed to select the welding-fume-exposure-regulated genes. The cDNAs identified by the SSH were then cloned into a plasmid miniprep, sequenced and the sequences analysed using the NCBI BLAST programme. In the SSH cloned cDNA microarray analysis, five genes were found to increase their expression by 1.9-fold or more, including Rgs 14, which plays an important function in cellular signal transduction pathways; meanwhile 36 genes remained the same and 30 genes decreased their expression by more than 59%, including genes associated with the immune response, transcription factors and tyrosine kinases. Among the 5200 genes analysed, 256 genes (5.1%) were found to increase their gene expression, while 742 genes (15%) decreased their gene expression in response to the welding-fume exposure when tested using a commercial 5.0k DNA microarray. Therefore, unlike exposure to other toxic substances, prolonged welding-fume exposure was found to substantially downregulate many genes.

Characterization of embryo-specific genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

1989-01-01

The objective of the proposed research is to characterize the structure and function of a set of genes whose expression is regulated in embryo development, and that is not expressed in mature tissues -- the embryonic genes. In the last two years, using cDNA clones, we have isolated 22 cDNA clones, and characterized the expression pattern of their corresponding RNA. At least 4 cDNA clones detect RNAs of embryonic genes. These cDNA clones detect RNAs expressed in somatic as well as zygotic embryos of carrot. Using the cDNA clones, we screened the genomic library of carrot embryo DNA, and isolatedmore » genomic clones for three genes. The structure and function of two genes DC 8 and DC 59 have been characterized and are reported in this paper.« less

Development and Application of a Salmonid EST Database and cDNA Microarray: Data Mining and Interspecific Hybridization Characteristics

PubMed Central

Rise, Matthew L.; von Schalburg, Kristian R.; Brown, Gordon D.; Mawer, Melanie A.; Devlin, Robert H.; Kuipers, Nathanael; Busby, Maura; Beetz-Sargent, Marianne; Alberto, Roberto; Gibbs, A. Ross; Hunt, Peter; Shukin, Robert; Zeznik, Jeffrey A.; Nelson, Colleen; Jones, Simon R.M.; Smailus, Duane E.; Jones, Steven J.M.; Schein, Jacqueline E.; Marra, Marco A.; Butterfield, Yaron S.N.; Stott, Jeff M.; Ng, Siemon H.S.; Davidson, William S.; Koop, Ben F.

2004-01-01

We report 80,388 ESTs from 23 Atlantic salmon (Salmo salar) cDNA libraries (61,819 ESTs), 6 rainbow trout (Oncorhynchus mykiss) cDNA libraries (14,544 ESTs), 2 chinook salmon (Oncorhynchus tshawytscha) cDNA libraries (1317 ESTs), 2 sockeye salmon (Oncorhynchus nerka) cDNA libraries (1243 ESTs), and 2 lake whitefish (Coregonus clupeaformis) cDNA libraries (1465 ESTs). The majority of these are 3′ sequences, allowing discrimination between paralogs arising from a recent genome duplication in the salmonid lineage. Sequence assembly reveals 28,710 different S. salar, 8981 O. mykiss, 1085 O. tshawytscha, 520 O. nerka, and 1176 C. clupeaformis putative transcripts. We annotate the submitted portion of our EST database by molecular function. Higher- and lower-molecular-weight fractions of libraries are shown to contain distinct gene sets, and higher rates of gene discovery are associated with higher-molecular weight libraries. Pyloric caecum library group annotations indicate this organ may function in redox control and as a barrier against systemic uptake of xenobiotics. A microarray is described, containing 7356 salmonid elements representing 3557 different cDNAs. Analyses of cross-species hybridizations to this cDNA microarray indicate that this resource may be used for studies involving all salmonids. PMID:14962987

Reverse Genetics of Newcastle Disease Virus.

PubMed

Cardenas-Garcia, Stivalis; Afonso, Claudio L

2017-01-01

Reverse genetics allows for the generation of recombinant viruses or vectors used in functional studies, vaccine development, and gene therapy. This technique enables genetic manipulation and cloning of viral genomes, gene mutation through site-directed mutagenesis, along with gene insertion or deletion, among other studies. An in vitro infection-based system including the highly attenuated vaccinia virus Ankara strain expressing the T7 RNA polymerase from bacteriophage T7, with co-transfection of three helper plasmids and a full-length cDNA plasmid, was successfully developed to rescue genetically modified Newcastle disease viruses in 1999. In this chapter, the materials and the methods involved in rescuing Newcastle disease virus (NDV) from cDNA, utilizing site-directed mutagenesis and gene replacement techniques, are described in detail.

Characterization of the alkaline/neutral invertase gene in Dendrobium officinale and its relationship with polysaccharide accumulation.

PubMed

Gao, F; Cao, X F; Si, J P; Chen, Z Y; Duan, C L

2016-05-06

Dendrobium officinale is one of the most well-known traditional Chinese medicines, and polysaccharide is its main active ingredient. Many studies have investigated the synthesis and accumulation mechanisms of polysaccharide, but until recently, little was known about the molecular mechanism of how polysaccharide is synthesized because no related genes have been cloned. In this study, we cloned an alkaline/neutral invertase gene from D. officinale (DoNI) by the rapid amplification of cDNA ends (RACE) method. DoNI was 2231 bp long and contained an open reading frame that predicted a 62.8-kDa polypeptide with 554-amino acid residues. An alkaline/neutral invertase conserved domain was predicted from this deduced amino acid sequence, and DoNI had a similar deduced amino acid sequence to Setaria italica and Oryza brachyantha. We also found that DoNI expression in different tissues was closely related to DoNI activity, and more importantly, polysaccharide level. Our results indicate that DoNI is associated with polysaccharide accumulation in D. officinale.

A powerful and flexible statistical framework for testing hypotheses of allele-specific gene expression from RNA-seq data

PubMed Central

Skelly, Daniel A.; Johansson, Marnie; Madeoy, Jennifer; Wakefield, Jon; Akey, Joshua M.

2011-01-01

Variation in gene expression is thought to make a significant contribution to phenotypic diversity among individuals within populations. Although high-throughput cDNA sequencing offers a unique opportunity to delineate the genome-wide architecture of regulatory variation, new statistical methods need to be developed to capitalize on the wealth of information contained in RNA-seq data sets. To this end, we developed a powerful and flexible hierarchical Bayesian model that combines information across loci to allow both global and locus-specific inferences about allele-specific expression (ASE). We applied our methodology to a large RNA-seq data set obtained in a diploid hybrid of two diverse Saccharomyces cerevisiae strains, as well as to RNA-seq data from an individual human genome. Our statistical framework accurately quantifies levels of ASE with specified false-discovery rates, achieving high reproducibility between independent sequencing platforms. We pinpoint loci that show unusual and biologically interesting patterns of ASE, including allele-specific alternative splicing and transcription termination sites. Our methodology provides a rigorous, quantitative, and high-resolution tool for profiling ASE across whole genomes. PMID:21873452

Infectious Maize rayado fino virus from cloned cDNA

USDA-ARS?s Scientific Manuscript database

Maize rayado fino virus (MRFV) is the type member of the marafiviruses within the family Tymoviridae. A cDNA clone from which infectious RNA can be transcribed was produced from a US isolate of MRFV (MRFV-US). Infectivity of transcripts derived from cDNA clones was demonstrated by infection of mai...

cDNA encoding a polypeptide including a hevein sequence

DOEpatents

Raikhel, N.V.; Broekaert, W.F.; Namhai Chua; Kush, A.

1993-02-16

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids.

Human Hrs, a tyrosine kinase substrate in growth factor-stimulated cells: cDNA cloning and mapping of the gene to chromosome 17.

PubMed

Lu, L; Komada, M; Kitamura, N

1998-06-15

Hrs is a 115kDa zinc finger protein which is rapidly tyrosine phosphorylated in cells stimulated with various growth factors. We previously purified the protein from a mouse cell line and cloned its cDNA. In the present study, we cloned a human Hrs cDNA from a human placenta cDNA library by cross-hybridization, using the mouse cDNA as a probe, and determined its nucleotide sequence. The human Hrs cDNA encoded a 777-amino-acid protein whose sequence was 93% identical to that of mouse Hrs. Northern blot analysis showed that the Hrs mRNA was about 3.0kb long and was expressed in all the human adult and fetal tissues tested. In addition, we showed by genomic Southern blot analysis that the human Hrs gene was a single-copy gene with a size of about 20kb. Furthermore, the human Hrs gene was mapped to chromosome 17 by Southern blotting of genomic DNAs from human/rodent somatic cell hybrids. Copyright 1998 Elsevier Science B.V. All rights reserved.

Generation of a reliable full-length cDNA of infectiousTembusu virus using a PCR-based protocol.

PubMed

Liang, Te; Liu, Xiaoxiao; Cui, Shulin; Qu, Shenghua; Wang, Dan; Liu, Ning; Wang, Fumin; Ning, Kang; Zhang, Bing; Zhang, Dabing

2016-02-02

Full-length cDNA of Tembusu virus (TMUV) cloned in a plasmid has been found instable in bacterial hosts. Using a PCR-based protocol, we generated a stable full-length cDNA of TMUV. Different cDNA fragments of TMUV were amplified by reverse transcription (RT)-PCR, and cloned into plasmids. Fragmented cDNAs were amplified and assembled by fusion PCR to produce a full-length cDNA using the recombinant plasmids as templates. Subsequently, a full-length RNA was transcribed from the full-length cDNA in vitro and transfected into BHK-21 cells; infectious viral particles were rescued successfully. Following several passages in BKH-21 cells, the rescued virus was compared with the parental virus by genetic marker checks, growth curve determinations and animal experiments. These assays clearly demonstrated the genetic and biological stabilities of the rescued virus. The present work will be useful for future investigations on the molecular mechanisms involved in replication and pathogenesis of TMUV. Copyright © 2015 Elsevier B.V. All rights reserved.

Cloning and characterization of transferrin cDNA and rapid detection of transferrin gene polymorphism in rainbow trout (Oncorhynchus mykiss).

PubMed

Tange, N; Jong-Young, L; Mikawa, N; Hirono, I; Aoki, T

1997-12-01

A cDNA clone of rainbow trout (Oncorhynchus mykiss) transferrin was obtained from a liver cDNA library. The 2537-bp cDNA sequence contained an open reading frame encoding 691 amino acids and the 5' and 3' noncoding regions. The amino acid sequences at the iron-binding sites and the two N-linked glycosylation sites, and the cysteine residues were consistent with known, conserved vertebrate transferrin cDNA sequences. Single N-linked glycosylation sites existed on the N- and C-lobe. The deduced amino acid sequence of the rainbow trout transferrin cDNA had 92.9% identities with transferrin of coho salmon (Oncorhynchus kisutch); 85%, Atlantic salmon (Salmo salar); 67.3%, medaka (Oryzias latipes); 61.3% Atlantic cod (Gadus morhua); and 59.7%, Japanese flounder (Paralichthys olivaceus). The long and accurate polymerase chain reaction (LA-PCR) was used to amplify approximately 6.5 kb of the transferrin gene from rainbow trout genomic DNA. Restriction fragment length polymorphisms (RFLPs) of the LA-PCR products revealed three digestion patterns in 22 samples.

Reverse transcription strand invasion based amplification (RT-SIBA): a method for rapid detection of influenza A and B.

PubMed

Eboigbodin, Kevin; Filén, Sanna; Ojalehto, Tuomas; Brummer, Mirko; Elf, Sonja; Pousi, Kirsi; Hoser, Mark

2016-06-01

Rapid and accurate diagnosis of influenza viruses plays an important role in infection control, as well as in preventing the misuse of antibiotics. Isothermal nucleic acid amplification methods offer significant advantages over the polymerase chain reaction (PCR), since they are more rapid and do not require the sophisticated instruments needed for thermal cycling. We previously described a novel isothermal nucleic acid amplification method, 'Strand Invasion Based Amplification' (SIBA®), with high analytical sensitivity and specificity, for the detection of DNA. In this study, we describe the development of a variant of the SIBA method, namely, reverse transcription SIBA (RT-SIBA), for the rapid detection of viral RNA targets. The RT-SIBA method includes a reverse transcriptase enzyme that allows one-step reverse transcription of RNA to complementary DNA (cDNA) and simultaneous amplification and detection of the cDNA by SIBA under isothermal reaction conditions. The RT-SIBA method was found to be more sensitive than PCR for the detection of influenza A and B and could detect 100 copies of influenza RNA within 15 min. The development of RT-SIBA will enable rapid and accurate diagnosis of viral RNA targets within point-of-care or central laboratory settings.

Orpinomyces cellulase CelE protein and coding sequences

DOEpatents

Li, Xin-Liang; Ljungdahl, Lars G.; Chen, Huizhong

2000-08-29

A CDNA designated celE cloned from Orpinomyces PC-2 encodes a polypeptide (CelE) of 477 amino acids. CelE is highly homologous to CelB of Orpinomyces (72.3% identity) and Neocallimastix (67.9% identity), and like them, it has a non-catalytic repeated peptide domain (NCRPD) at the C-terminal end. The catalytic domain of CelE is homologous to glycosyl hydrolases of Family 5, found in several anaerobic bacteria. The gene of celE is devoid of introns. The recombinant proteins CelE and CelB of Orpinomyces PC-2 randomly hydrolyze carboxymethylcellulose and cello-oligosaccharides in the pattern of endoglucanases.

Chromosome-Encoded Broad-Spectrum Ambler Class A β-Lactamase RUB-1 from Serratia rubidaea

PubMed Central

Didi, Jennifer; Ergani, Ayla; Lima, Sandra

2016-01-01

ABSTRACT Whole-genome sequencing of Serratia rubidaea CIP 103234T revealed a chromosomally located Ambler class A β-lactamase gene. The gene was cloned, and the β-lactamase, RUB-1, was characterized. RUB-1 displayed 74% and 73% amino acid sequence identity with the GIL-1 and TEM-1 penicillinases, respectively, and its substrate profile was similar to that of the latter β-lactamases. Analysis by 5′ rapid amplification of cDNA ends revealed promoter sequences highly divergent from the Escherichia coli σ70 consensus sequence. This work further illustrates the heterogeneity of β-lactamases among Serratia spp. PMID:27956418

Chromosome-Encoded Broad-Spectrum Ambler Class A β-Lactamase RUB-1 from Serratia rubidaea.

PubMed

Bonnin, Rémy A; Didi, Jennifer; Ergani, Ayla; Lima, Sandra; Naas, Thierry

2017-02-01

Whole-genome sequencing of Serratia rubidaea CIP 103234 T revealed a chromosomally located Ambler class A β-lactamase gene. The gene was cloned, and the β-lactamase, RUB-1, was characterized. RUB-1 displayed 74% and 73% amino acid sequence identity with the GIL-1 and TEM-1 penicillinases, respectively, and its substrate profile was similar to that of the latter β-lactamases. Analysis by 5' rapid amplification of cDNA ends revealed promoter sequences highly divergent from the Escherichia coli σ 70 consensus sequence. This work further illustrates the heterogeneity of β-lactamases among Serratia spp. Copyright © 2017 American Society for Microbiology.

Improved method for analysis of RNA present in long-term preserved thyroid cancer tissue of atomic bomb survivors.

PubMed

Hamatani, Kiyohiro; Eguchi, Hidetaka; Mukai, Mayumi; Koyama, Kazuaki; Taga, Masataka; Ito, Reiko; Hayashi, Yuzo; Nakachi, Kei

2010-01-01

Since many thyroid cancer tissue samples from atomic bomb (A-bomb) survivors have been preserved for several decades as unbuffered formalin-fixed, paraffin-embedded specimens, molecular oncological analysis of such archival specimens is indispensable for clarifying the mechanisms of thyroid carcinogenesis in A-bomb survivors. Although RET gene rearrangements are the most important targets, it is a difficult task to examine all of the 13 known types of RET gene rearrangements with the use of the limited quantity of RNA that has been extracted from invaluable paraffin-embedded tissue specimens of A-bomb survivors. In this study, we established an improved 5' rapid amplification of cDNA ends (RACE) method using a small amount of RNA extracted from archival thyroid cancer tissue specimens. Three archival thyroid cancer tissue specimens from three different patients were used as in-house controls to determine the conditions for an improved switching mechanism at 5' end of RNA transcript (SMART) RACE method; one tissue specimen with RET/PTC1 rearrangement and one with RET/PTC3 rearrangement were used as positive samples. One other specimen, used as a negative sample, revealed no detectable expression of the RET gene tyrosine kinase domain. We established a 5' RACE method using an amount of RNA as small as 10 ng extracted from long-term preserved, unbuffered formalin-fixed, paraffin-embedded thyroid cancer tissue by application of SMART technology. This improved SMART RACE method not only identified common RET gene rearrangements, but also isolated a clone containing a 93-bp insert of rare RTE/PTC8 in RNA extracted from formalin-fixed, paraffin-embedded thyroid cancer specimens from one A-bomb survivor who had been exposed to a high radiation dose. In addition, in the papillary thyroid cancer of another high-dose A-bomb survivor, this method detected one novel type of RET gene rearrangement whose partner gene is acyl coenzyme A binding domain 5, located on chromosome 10p. We conclude that our improved SMART RACE method is expected to prove useful in molecular analyses using archival formalin-fixed, paraffin-embedded tissue samples of limited quantity.

cDNA cloning and immunological characterization of a newly identified enolase allergen from Penicillium citrinum and Aspergillus fumigatus.

PubMed

Lai, Hsiu-Yu; Tam, Ming F; Tang, Ren-Bin; Chou, Hong; Chang, Ching-Yun; Tsai, Jaw-Ji; Shen, Horng-Der

2002-03-01

Penicillium citrinum and Aspergillus fumigatus are prevalent indoor airborne fungal species that have been implicated in human respiratory allergic disorders. It is important to understand the allergenic profile of these fungal species. The purpose of the present study is to characterize a newly identified enolase allergen from P. citrinum and A. fumigatus. Fungal proteins were separated by two-dimensional (2D) gel electrophoresis and blotted onto polyvinylidene difluoride membranes. Protein spots that reacted with IgE antibodies in serum samples from asthmatic patients were identified and the N-terminal amino acid sequences were determined by Edman degradation. The peptide sequences obtained were utilized in cloning the cDNA of the allergen genes by reverse transcriptase-polymerase chain reaction and the 5'- and 3'-rapid amplification cDNA end reactions. Our results from 2D immunoblotting identified a 47-kD IgE-reactive component in the extracts of P. citrinum and A. fumigatus. The N-terminal amino acid sequences of the 47-kD proteins are homologous to those of fungal enolases. The corresponding enolase cDNA from P. citrinum contains 1,552 bp and encodes a protein of 438 residues. In A. fumigatus, the isolated enolase cDNA has 1,649 bp and contains a 438-amino acid open reading frame. The deduced amino acid sequences of these two enolases have 94% identity. These enolases from P. citrinum and A. fumigatus were expressed in Escherichia coli as a His-tagged protein and designated as rPen c 22 and rAsp f 22, respectively. Sera from 7 (30%) of the 23 Penicillium-sensitized asthmatic patients showed IgE binding to the 47-kD P. citrinum component (Pen c 22) and rPen c 22. In addition, six of seven Pen c 22-positive serum samples have IgE immunoblot reactivity to the 47-kD A. fumigatus component (Asp f 22) and rAsp f 22. A polyclonal rabbit antiserum generated against the N-terminal peptide of Pen c 22 can react with Pen c 22, rPen c 22, Asp f 22 and rAsp f 22. In addition, the presence of IgE cross-reactivity between rPen c 22 and rAsp f 22 and between enolases from A. fumigatus and Alternaria alternata was also detected by immunoblot inhibition. These results demonstrated that a novel enolase allergen from P. citrinum (Pen c 22) and A. fumigatus (Asp f 22) was identified. In addition, IgE cross-reactivity between enolase allergens from A. fumigatus and P. citrinum and between enolases from A. fumigatus and A. alternata was also detected. Results obtained provide more information on fungal enolase allergens. Copyright 2002 S. Karger AG, Basel

A simplified approach to construct infectious cDNA clones of a tobamovirus in a binary vector.

PubMed

Junqueira, Bruna Rayane Teodoro; Nicolini, Cícero; Lucinda, Natalia; Orílio, Anelise Franco; Nagata, Tatsuya

2014-03-01

Infectious cDNA clones of RNA viruses are important tools to study molecular processes such as replication and host-virus interactions. However, the cloning steps necessary for construction of cDNAs of viral RNA genomes in binary vectors are generally laborious. In this study, a simplified method of producing an agro-infectious Pepper mild mottle virus (PMMoV) clone is described in detail. Initially, the complete genome of PMMoV was amplified by a single-step RT-PCR, cloned, and subcloned into a small plasmid vector under the T7 RNA polymerase promoter to confirm the infectivity of the cDNA clone through transcript inoculation. The complete genome was then transferred to a binary vector using a single-step, overlap-extension PCR. The selected clones were agro-infiltrated to Nicotiana benthamiana plants and showed to be infectious, causing typical PMMoV symptoms. No differences in host responses were observed when the wild-type PMMoV isolate, the T7 RNA polymerase-derived transcripts and the agroinfiltration-derived viruses were inoculated to N. benthamiana, Capsicum chinense PI 159236 and Capsicum annuum plants. Copyright © 2013 Elsevier B.V. All rights reserved.

Micropreparative capillary gel electrophoresis of DNA: rapid expressed sequence tag library construction.

PubMed

Shi, Liang; Khandurina, Julia; Ronai, Zsolt; Li, Bi-Yu; Kwan, Wai King; Wang, Xun; Guttman, András

2003-01-01

A capillary gel electrophoresis based automated DNA fraction collection technique was developed to support a novel DNA fragment-pooling strategy for expressed sequence tag (EST) library construction. The cDNA population is first cleaved by BsaJ I and EcoR I restriction enzymes, and then subpooled by selective ligation with specific adapters followed by polymerase chain reaction (PCR) amplification and labeling. Combination of this cDNA fingerprinting method with high-resolution capillary gel electrophoresis separation and precise fractionation of individual cDNA transcript representatives avoids redundant fragment selection and concomitant repetitive sequencing of abundant transcripts. Using a computer-controlled capillary electrophoresis device the transcript representatives were separated by their size and fractions were automatically collected in every 30 s into 96-well plates. The high resolving power of the sieving matrix ensured sequencing grade separation of the DNA fragments (i.e., single-base resolution) and successful fraction collection. Performance and precision of the fraction collection procedure was validated by PCR amplification of the collected DNA fragments followed by capillary electrophoresis analysis for size and purity verification. The collected and PCR-amplified transcript representatives, ranging up to several hundred base pairs, were then sequenced to create an EST library.

Cloning and expression of the cDNA encoding human fumarylacetoacetate hydrolase, the enzyme deficient in hereditary tyrosinemia: assignment of the gene to chromosome 15.

PubMed Central

Phaneuf, D; Labelle, Y; Bérubé, D; Arden, K; Cavenee, W; Gagné, R; Tanguay, R M

1991-01-01

Type 1 hereditary tyrosinemia (HT) is an autosomal recessive disease characterized by a deficiency of the enzyme fumarylacetoacetate hydrolase (FAH; E.C.3.7.1.2). We have isolated human FAH cDNA clones by screening a liver cDNA expression library using specific antibodies and plaque hybridization with a rat FAH cDNA probe. A 1,477-bp cDNA was sequenced and shown to code for FAH by an in vitro transcription-translation assay and sequence homology with tryptic fragments of purified FAH. Transient expression of this FAH cDNA in transfected CV-1 mammalian cells resulted in the synthesis of an immunoreactive protein comigrating with purified human liver FAH on SDS-PAGE and having enzymatic activity as shown by the hydrolysis of the natural substrate fumarylacetoacetate. This indicates that the single polypeptide chain encoded by the FAH gene contains all the genetic information required for functional activity, suggesting that the dimer found in vivo is a homodimer. The human FAH cDNA was used as a probe to determine the gene's chromosomal localization using somatic cell hybrids and in situ hybridization. The human FAH gene maps to the long arm of chromosome 15 in the region q23-q25. Images Figure 1 Figure 3 Figure 4 Figure 6 Figure 8 PMID:1998338

The TGA codons are present in the open reading frame of selenoprotein P cDNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hill, K.E.; Lloyd, R.S.; Read, R.

1991-03-11

The TGA codon in DNA has been shown to direct incorporation of selenocysteine into protein. Several proteins from bacteria and animals contain selenocysteine in their primary structures. Each of the cDNA clones of these selenoproteins contains one TGA codon in the open reading frame which corresponds to the selenocysteine in the protein. A cDNA clone for selenoprotein P (SeP), obtained from a {gamma}ZAP rat liver library, was sequenced by the dideoxy termination method. The correct reading frame was determined by comparison of the deduced amino acid sequence with the amino acid sequence of several peptides from SeP. Using SeP labelledmore » with {sup 75}Se in vivo, the selenocysteine content of the peptides was verified by the collection of carboxymethylated {sup 77}Se-selenocysteine as it eluted from the amino acid analyzer and determination of the radioactivity contained in the collected samples. Ten TGA codons are present in the open reading frame of the cDNA. Peptide fragmentation studies and the deduced sequence indicate that selenium-rich regions are located close to the carboxy terminus. Nine of the 10 selenocysteines are located in the terminal 26% of the sequence with four in the terminal 15 amino acids. The deduced sequence codes for a protein of 385 amino acids. Cleavage of the signal peptide gives the mature protein with 366 amino acids and a calculated mol wt of 41,052 Da. Searches of PIR and SWISSPROT protein databases revealed no similarity with glutathione peroxidase or other selenoproteins.« less

Gene expression profiling of whole blood: Comparison of target preparation methods for accurate and reproducible microarray analysis

PubMed Central

Vartanian, Kristina; Slottke, Rachel; Johnstone, Timothy; Casale, Amanda; Planck, Stephen R; Choi, Dongseok; Smith, Justine R; Rosenbaum, James T; Harrington, Christina A

2009-01-01

Background Peripheral blood is an accessible and informative source of transcriptomal information for many human disease and pharmacogenomic studies. While there can be significant advantages to analyzing RNA isolated from whole blood, particularly in clinical studies, the preparation of samples for microarray analysis is complicated by the need to minimize artifacts associated with highly abundant globin RNA transcripts. The impact of globin RNA transcripts on expression profiling data can potentially be reduced by using RNA preparation and labeling methods that remove or block globin RNA during the microarray assay. We compared four different methods for preparing microarray hybridization targets from human whole blood collected in PAXGene tubes. Three of the methods utilized the Affymetrix one-cycle cDNA synthesis/in vitro transcription protocol but varied treatment of input RNA as follows: i. no treatment; ii. treatment with GLOBINclear; or iii. treatment with globin PNA oligos. In the fourth method cDNA targets were prepared with the Ovation amplification and labeling system. Results We find that microarray targets generated with labeling methods that reduce globin mRNA levels or minimize the impact of globin transcripts during hybridization detect more transcripts in the microarray assay compared with the standard Affymetrix method. Comparison of microarray results with quantitative PCR analysis of a panel of genes from the NF-kappa B pathway shows good correlation of transcript measurements produced with all four target preparation methods, although method-specific differences in overall correlation were observed. The impact of freezing blood collected in PAXGene tubes on data reproducibility was also examined. Expression profiles show little or no difference when RNA is extracted from either fresh or frozen blood samples. Conclusion RNA preparation and labeling methods designed to reduce the impact of globin mRNA transcripts can significantly improve the sensitivity of the DNA microarray expression profiling assay for whole blood samples. While blockage of globin transcripts during first strand cDNA synthesis with globin PNAs resulted in the best overall performance in this study, we conclude that selection of a protocol for expression profiling studies in blood should depend on several factors, including implementation requirements of the method and study design. RNA isolated from either freshly collected or frozen blood samples stored in PAXGene tubes can be used without altering gene expression profiles. PMID:19123946

Identification and characterization of L-lysine decarboxylase from Huperzia serrata and its role in the metabolic pathway of lycopodium alkaloid.

PubMed

Xu, Baofu; Lei, Lei; Zhu, Xiaocen; Zhou, Yiqing; Xiao, Youli

2017-04-01

Lysine decarboxylation is the first biosynthetic step of Huperzine A (HupA). Six cDNAs encoding lysine decarboxylases (LDCs) were cloned from Huperzia serrata by degenerate PCR and rapid amplification of cDNA ends (RACE). One HsLDC isoform was functionally characterized as lysine decarboxylase. The HsLDC exhibited greatest catalytic efficiency (k cat /K m , 2.11 s -1  mM -1 ) toward L-lysine in vitro among all reported plant-LDCs. Moreover, transient expression of the HsLDC in tobacco leaves specifically increased cadaverine content from zero to 0.75 mg per gram of dry mass. Additionally, a convenient and reliable method used to detect the two catalytic products was developed. With the novel method, the enzymatic products of HsLDC and HsCAO, namely cadaverine and 5-aminopentanal, respectively, were detected simultaneously both in assay with purified enzymes and in transgenic tobacco leaves. This work not only provides direct evidence of the first two-step in biosynthetic pathway of HupA in Huperzia serrata and paves the way for further elucidation of the pathway, but also enables engineering heterologous production of HupA. Copyright © 2017 Elsevier Ltd. All rights reserved.

Analysis of mutations in oral poliovirus vaccine by hybridization with generic oligonucleotide microchips.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Proudnikov, D.; Kirillov, E.; Chumakov, K.

2000-01-01

This paper describes use of a new technology of hybridization with a micro-array of immobilized oligonucleotides for detection and quantification of neurovirulent mutants in Oral Poliovirus Vaccine (OPV). We used a micro-array consisting of three-dimensional gel-elements containing all possible hexamers (total of 4096 probes). Hybridization of fluorescently labelled viral cDNA samples with such microchips resulted in a pattern of spots that was registered and quantified by a computer-linked CCD camera, so that the sequence of the original cDNA could be deduced. The method could reliably identify single point mutations, since each of them affected fluorescence intensity of 12 micro-array elements.more » Micro-array hybridization of DNA mixtures with varying contents of point mutants demonstrated that the method can detect as little as 10% of revertants in a population of vaccine virus. This new technology should be useful for quality control of live viral vaccines, as well as for other applications requiring identification and quantification of point mutations.« less

cDNA cloning, functional expression and cellular localization of rat liver mitochondrial electron-transfer flavoprotein-ubiquinone oxidoreductase protein.

PubMed

Huang, Shengbing; Song, Wei; Lin, Qishui

2005-08-01

A membrane-bound protein was purified from rat liver mitochondria. After being digested with V8 protease, two peptides containing identical 14 amino acid residue sequences were obtained. Using the 14 amino acid peptide derived DNA sequence as gene specific primer, the cDNA of correspondent gene 5'-terminal and 3'-terminal were obtained by RACE technique. The full-length cDNA that encoded a protein of 616 amino acids was thus cloned, which included the above mentioned peptide sequence. The full length cDNA was highly homologous to that of human ETF-QO, indicating that it may be the cDNA of rat ETF-QO. ETF-QO is an iron sulfur protein located in mitochondria inner membrane containing two kinds of redox center: FAD and [4Fe-4S] center. After comparing the sequence from the cDNA of the 616 amino acids protein with that of the mature protein of rat liver mitochondria, it was found that the N terminal 32 amino acid residues did not exist in the mature protein, indicating that the cDNA was that of ETF-QOp. When the cDNA was expressed in Saccharomyces cerevisiae with inducible vectors, the protein product was enriched in mitochondrial fraction and exhibited electron transfer activity (NBT reductase activity) of ETF-QO. Results demonstrated that the 32 amino acid peptide was a mitochondrial targeting peptide, and both FAD and iron-sulfur cluster were inserted properly into the expressed ETF-QO. ETF-QO had a high level expression in rat heart, liver and kidney. The fusion protein of GFP-ETF-QO co-localized with mitochondria in COS-7 cells.

Arabidopsis chloroplast chaperonin 10 is a calmodulin-binding protein

NASA Technical Reports Server (NTRS)

Yang, T.; Poovaiah, B. W.

2000-01-01

Calcium regulates diverse cellular activities in plants through the action of calmodulin (CaM). By using (35)S-labeled CaM to screen an Arabidopsis seedling cDNA expression library, a cDNA designated as AtCh-CPN10 (Arabidopsis thaliana chloroplast chaperonin 10) was cloned. Chloroplast CPN10, a nuclear-encoded protein, is a functional homolog of E. coli GroES. It is believed that CPN60 and CPN10 are involved in the assembly of Rubisco, a key enzyme involved in the photosynthetic pathway. Northern analysis revealed that AtCh-CPN10 is highly expressed in green tissues. The recombinant AtCh-CPN10 binds to CaM in a calcium-dependent manner. Deletion mutants revealed that there is only one CaM-binding site in the last 31 amino acids of the AtCh-CPN10 at the C-terminal end. The CaM-binding region in AtCh-CPN10 has higher homology to other chloroplast CPN10s in comparison to GroES and mitochondrial CPN10s, suggesting that CaM may only bind to chloroplast CPN10s. Furthermore, the results also suggest that the calcium/CaM messenger system is involved in regulating Rubisco assembly in the chloroplast, thereby influencing photosynthesis. Copyright 2000 Academic Press.

Molecular Cloning and Optimization for High Level Expression of Cold-Adapted Serine Protease from Antarctic Yeast Glaciozyma antarctica PI12

PubMed Central

Ahmad Mazian, Mu'adz; Salleh, Abu Bakar; Basri, Mahiran; Rahman, Raja Noor Zaliha Raja Abd.

2014-01-01

Psychrophilic basidiomycete yeast, Glaciozyma antarctica strain PI12, was shown to be a protease-producer. Isolation of the PI12 protease gene from genomic and mRNA sequences allowed determination of 19 exons and 18 introns. Full-length cDNA of PI12 protease gene was amplified by rapid amplification of cDNA ends (RACE) strategy with an open reading frame (ORF) of 2892 bp, coded for 963 amino acids. PI12 protease showed low homology with the subtilisin-like protease from fungus Rhodosporidium toruloides (42% identity) and no homology to other psychrophilic proteases. The gene encoding mature PI12 protease was cloned into Pichia pastoris expression vector, pPIC9, and positioned under the induction of methanol-alcohol oxidase (AOX) promoter. The recombinant PI12 protease was efficiently secreted into the culture medium driven by the Saccharomyces cerevisiae α-factor signal sequence. The highest protease production (28.3 U/ml) was obtained from P. pastoris GS115 host (GpPro2) at 20°C after 72 hours of postinduction time with 0.5% (v/v) of methanol inducer. The expressed protein was detected by SDS-PAGE and activity staining with a molecular weight of 99 kDa. PMID:25093119

Molecular cloning and structural characterization of Ecdysis Triggering Hormone from Choristoneura fumiferana.

PubMed

P, Bhagath Kumar; K, Kasi Viswanath; S, Tuleshwori Devi; R, Sampath Kumar; Doucet, Daniel; Retnakaran, Arthur; Krell, Peter J; Feng, Qili; Ampasala, Dinakara Rao

2016-07-01

At the end of each stadium, insects undergo a precisely orchestrated process known as ecdysis which results in the replacement of the old cuticle with a new one. This physiological event is necessary to accommodate growth in arthropods since they have a rigid chitinous exoskeleton. Ecdysis is initiated by the direct action of Ecdysis Triggering Hormones on the central nervous system. Choristoneura fumiferana is a major defoliator of coniferous forests in Eastern North America. It is assumed that, studies on the ecdysis behavior of this pest might lead to the development of novel pest management strategies. Hence in this study, the cDNA of CfETH was cloned. The open reading frame of the cDNA sequence was found to encode three putative peptides viz., Pre-Ecdysis Triggering Hormone (PETH), Ecdysis Triggering Hormone (ETH), and Ecdysis Triggering Hormone Associated Peptide (ETH-AP). The CfETH transcript was detected in the epidermal tissue of larval and pupal stages, but not in eggs and adults. In order to explore the structural conformation of ETH, ab initio modelling and Molecular Dynamics (MD) Simulations were performed. Further, a library of insecticides was generated and virtual screening was performed to identify the compounds displaying high binding capacity to ETH. Copyright © 2016 Elsevier B.V. All rights reserved.

Isolation and characterization of a FLOWERING LOCUS T homolog from pineapple (Ananas comosus (L.) Merr).

PubMed

Lv, LingLing; Duan, Jun; Xie, JiangHui; Wei, ChangBin; Liu, YuGe; Liu, ShengHui; Sun, GuangMing

2012-09-01

FLOWERING LOCUS T (FT)-like genes are crucial regulators of flowering in angiosperms. A homolog of FT, designated as AcFT (GenBank ID: HQ343233), was isolated from pineapple cultivar Comte de Paris by reverse transcriptase polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). The cDNA sequence of AcFT is 915 bp in length and contains an ORF of 534 bp, which encodes a protein of 177 aa. Molecular weight was 19.9 kDa and isoelectric point was 6.96. The deduced protein sequence of AcFT was 84% and 82% identical to homologs encoded by CgFT in Cymbidium goeringii and OgFT in Oncidium Gower Ramsey respectively. Quantitative real-time PCR (qRT-PCR) analyses showed that the expression of AcFT was high in flesh and none in leaves. qRT-PCR analyses in different stages indicated that the expression of AcFT reached the highest level on 40 d after flower inducing, when the multiple fruit and floral organs were forming. The 35S::AcFT transgenic Arabidopsis plants flowered earlier and had more inflorescences or branches than wild type plants. Copyright © 2012 Elsevier B.V. All rights reserved.

Cloning and expression of delta-1-pyrroline-5-carboxylate dehydrogenase in Escherichia coli DH5α improves phosphate solubilization.

PubMed

Gong, Mingbo; Tang, Chaoxi; Zhu, Changxiong

2014-11-01

A primary cDNA library of Penicillium oxalicum I1 was constructed using the switching mechanism at the 5' end of the RNA transcript (SMART) technique. A total of 106 clones showed halos in tricalcium phosphate (TCP) medium, and clone I-40 showed clear halos. The full-length cDNA of clone I-40 was 1355 bp with a complete open reading frame (ORF) of 1032 bp, encoding a protein of 343 amino acids. Multiple alignment analysis revealed a high degree of homology between the ORF of clone I-40 and delta-1-pyrroline-5-carboxylate dehydrogenase (P5CDH) of other fungi. The ORF expression vector was constructed and transformed into Escherichia coli DH5α. The transformant (ORF-1) with the P5CDH gene secreted organic acid in medium with TCP as the sole source of phosphate. Acetic acid and α-ketoglutarate were secreted in 4 and 24 h, respectively. ORF-1 decreased the pH of the medium from 6.62 to 3.45 and released soluble phosphate at 0.172 mg·mL(-1) in 28 h. Expression of the P. oxalicum I1 p5cdh gene in E. coli could enhance organic acid secretion and phosphate-solubilizing ability.

Isolation of a complementary DNA clone for the human complement protein C2 and its use in the identification of a restriction fragment length polymorphism.

PubMed Central

Woods, D E; Edge, M D; Colten, H R

1984-01-01

Complementary DNA (cDNA) clones corresponding to the major histocompatibility (MHC) class III antigen, complement protein C2, have been isolated from human liver cDNA libraries with the use of a complex mixture of synthetic oligonucleotides (17 mer) that contains 576 different oligonucleotide sequences. The C2 cDNA were used to identify a DNA restriction enzyme fragment length polymorphism that provides a genetic marker within the MHC that was not detectable at the protein level. An extensive search for genomic polymorphisms using a cDNA clone for another MHC class III gene, factor B, failed to reveal any DNA variants. The genomic variants detected with the C2 cDNA probe provide an additional genetic marker for analysis of MHC-linked diseases. Images PMID:6086718

Isolation and characterization of a cDNA clone for the complete protein coding region of the delta subunit of the mouse acetylcholine receptor.

PubMed Central

LaPolla, R J; Mayne, K M; Davidson, N

1984-01-01

A mouse cDNA clone has been isolated that contains the complete coding region of a protein highly homologous to the delta subunit of the Torpedo acetylcholine receptor (AcChoR). The cDNA library was constructed in the vector lambda 10 from membrane-associated poly(A)+ RNA from BC3H-1 mouse cells. Surprisingly, the delta clone was selected by hybridization with cDNA encoding the gamma subunit of the Torpedo AcChoR. The nucleotide sequence of the mouse cDNA clone contains an open reading frame of 520 amino acids. This amino acid sequence exhibits 59% and 50% sequence homology to the Torpedo AcChoR delta and gamma subunits, respectively. However, the mouse nucleotide sequence has several stretches of high homology with the Torpedo gamma subunit cDNA, but not with delta. The mouse protein has the same general structural features as do the Torpedo subunits. It is encoded by a 3.3-kilobase mRNA. There is probably only one, but at most two, chromosomal genes coding for this or closely related sequences. Images PMID:6096870

Extractions of High Quality RNA from the Seeds of Jerusalem Artichoke and Other Plant Species with High Levels of Starch and Lipid.

PubMed

Mornkham, Tanupat; Wangsomnuk, Preeya Puangsomlee; Fu, Yong-Bi; Wangsomnuk, Pinich; Jogloy, Sanun; Patanothai, Aran

2013-04-29

Jerusalem artichoke (Helianthus tuberosus L.) is an important tuber crop. However, Jerusalem artichoke seeds contain high levels of starch and lipid, making the extraction of high-quality RNA extremely difficult and the gene expression analysis challenging. This study was aimed to improve existing methods for extracting total RNA from Jerusalem artichoke dry seeds and to assess the applicability of the improved method in other plant species. Five RNA extraction methods were evaluated on Jerusalem artichoke seeds and two were modified. One modified method with the significant improvement was applied to assay seeds of diverse Jerusalem artichoke accessions, sunflower, rice, maize, peanut and marigold. The effectiveness of the improved method to extract total RNA from seeds was assessed using qPCR analysis of four selected genes. The improved method of Ma and Yang (2011) yielded a maximum RNA solubility and removed most interfering substances. The improved protocol generated 29 to 41 µg RNA/30 mg fresh weight. An A260/A280 ratio of 1.79 to 2.22 showed their RNA purity. Extracted RNA was effective for downstream applications such as first-stranded cDNA synthesis, cDNA cloning and qPCR. The improved method was also effective to extract total RNA from seeds of sunflower, rice, maize and peanut that are rich in polyphenols, lipids and polysaccharides.

Directional, seamless, and restriction enzyme-free construction of random-primed complementary DNA libraries using phosphorothioate-modified primers.

PubMed

Howland, Shanshan W; Poh, Chek-Meng; Rénia, Laurent

2011-09-01

Directional cloning of complementary DNA (cDNA) primed by oligo(dT) is commonly achieved by appending a restriction site to the primer, whereas the second strand is synthesized through the combined action of RNase H and Escherichia coli DNA polymerase I (PolI). Although random primers provide more uniform and complete coverage, directional cloning with the same strategy is highly inefficient. We report that phosphorothioate linkages protect the tail sequence appended to random primers from the 5'→3' exonuclease activity of PolI. We present a simple strategy for constructing a random-primed cDNA library using the efficient, size-independent, and seamless In-Fusion cloning method instead of restriction enzymes. Copyright © 2011 Elsevier Inc. All rights reserved.

Single-Cell RNA Sequencing of Glioblastoma Cells.

PubMed

Sen, Rajeev; Dolgalev, Igor; Bayin, N Sumru; Heguy, Adriana; Tsirigos, Aris; Placantonakis, Dimitris G

2018-01-01

Single-cell RNA sequencing (sc-RNASeq) is a recently developed technique used to evaluate the transcriptome of individual cells. As opposed to conventional RNASeq in which entire populations are sequenced in bulk, sc-RNASeq can be beneficial when trying to better understand gene expression patterns in markedly heterogeneous populations of cells or when trying to identify transcriptional signatures of rare cells that may be underrepresented when using conventional bulk RNASeq. In this method, we describe the generation and analysis of cDNA libraries from single patient-derived glioblastoma cells using the C1 Fluidigm system. The protocol details the use of the C1 integrated fluidics circuit (IFC) for capturing, imaging and lysing cells; performing reverse transcription; and generating cDNA libraries that are ready for sequencing and analysis.

Cloning, sequencing, and expression of cDNA for human. beta. -glucuronidase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oshima, A.; Kyle, J.W.; Miller, R.D.

1987-02-01

The authors report here the cDNA sequence for human placental ..beta..-glucuronidase (..beta..-D-glucuronoside glucuronosohydrolase, EC 3.2.1.31) and demonstrate expression of the human enzyme in transfected COS cells. They also sequenced a partial cDNA clone from human fibroblasts that contained a 153-base-pair deletion within the coding sequence and found a second type of cDNA clone from placenta that contained the same deletion. Nuclease S1 mapping studies demonstrated two types of mRNAs in human placenta that corresponded to the two types of cDNA clones isolated. The NH/sub 2/-terminal amino acid sequence determined for human spleen ..beta..-glucuronidase agreed with that inferred from the DNAmore » sequence of the two placental clones, beginning at amino acid 23, suggesting a cleaved signal sequence of 22 amino acids. When transfected into COS cells, plasmids containing either placental clone expressed an immunoprecipitable protein that contained N-linked oligosaccharides as evidenced by sensitivity to endoglycosidase F. However, only transfection with the clone containing the 153-base-pair segment led to expression of human ..beta..-glucuronidase activity. These studies provide the sequence for the full-length cDNA for human ..beta..-glucuronidase, demonstrate the existence of two populations of mRNA for ..beta..-glucuronidase in human placenta, only one of which specifies a catalytically active enzyme, and illustrate the importance of expression studies in verifying that a cDNA is functionally full-length.« less

Transcription Start Site Evolution in Drosophila

PubMed Central

Main, Bradley J.; Smith, Andrew D.; Jang, Hyosik; Nuzhdin, Sergey V.

2013-01-01

Transcription start site (TSS) evolution remains largely undescribed in Drosophila, likely due to limited annotations in non-melanogaster species. In this study, we introduce a concise new method that selectively sequences from the 5′-end of mRNA and used it to identify TSS in four Drosophila species, including Drosophila melanogaster, D. simulans, D. sechellia, and D. pseudoobscura. For verification, we compared our results in D. melanogaster with known annotations, published 5′-rapid amplification of cDNA ends data, and with RNAseq from the same mRNA pool. Then, we paired 2,849 D. melanogaster TSS with its closest equivalent TSS in each species (likely to be its true ortholog) using the available multiple sequence alignments. Most of the D. melanogaster TSSs were successfully paired with an ortholog in each species (83%, 86%, and 55% for D. simulans, D. sechellia, and D. pseudoobscura, respectively). On the basis of the number and distribution of reads mapped at each TSS, we also estimated promoter-specific expression (PSE) and TSS peak shape, respectively. Among paired TSS orthologs, the location and promoter activity were largely conserved. TSS location appears important as PSE, and TSS peak shape was more frequently divergent among TSS that had moved. Unpaired TSS were surprisingly common in D. pseudoobscura. An increased mutation rate upstream of TSS might explain this pattern. We found an enrichment of ribosomal protein genes among diverged TSS, suggesting that TSS evolution is not uniform across the genome. PMID:23649539

Evidence for the proteolytic processing of dentin matrix protein 1. Identification and characterization of processed fragments and cleavage sites.

PubMed

Qin, Chunlin; Brunn, Jan C; Cook, Richard G; Orkiszewski, Ralph S; Malone, James P; Veis, Arthur; Butler, William T

2003-09-05

Full-length cDNA coding for dentin matrix protein 1 (DMP1) has been cloned and sequenced, but the corresponding complete protein has not been isolated. In searching for naturally occurring DMP1, we recently discovered that the extracellular matrix of bone contains fragments originating from DMP1. Shortened forms of DMP1, termed 37K and 57K fragments, were treated with alkaline phosphatase and then digested with trypsin. The resultant peptides were purified by a two-dimensional method: size exclusion followed by reversed-phase high performance liquid chromatography. Purified peptides were sequenced by Edman degradation and mass spectrometry, and the sequences compared with the DMP1 sequence predicted from cDNA. Extensive sequencing of tryptic peptides revealed that the 37K fragments originated from the NH2-terminal region, and the 57K fragments were from the COOH-terminal part of DMP1. Phosphate analysis indicated that the 37K fragments contained 12 phosphates, and the 57K fragments had 41. From 37K fragments, two peptides lacked a COOH-terminal lysine or arginine; instead they ended at Phe173 and Ser180 and were thus COOH termini of 37K fragments. Two peptides were from the NH2 termini of 57K fragments, starting at Asp218 and Asp222. These findings indicated that DMP1 is proteolytically cleaved at four bonds, Phe173-Asp174, Ser180-Asp181, Ser217-Asp218, and Gln221-Asp222, forming eight fragments. The uniformity of cleavages at the NH2-terminal peptide bonds of aspartyl residues suggests that a single proteinase is involved. Based on its reported specificity, we hypothesize that these scissions are catalyzed by PHEX protein. We envision that the proteolytic processing of DMP1 plays a crucial role during osteogenesis and dentinogenesis.

Molecular cloning and preliminary function study of iron responsive element binding protein 1 gene from cypermethrin-resistant Culex pipiens pallens

PubMed Central

2011-01-01

Background Insecticide resistance jeopardizes the control of mosquito populations and mosquito-borne disease control, which creates a major public health concern. Two-dimensional electrophoresis identified one protein segment with high sequence homology to part of Aedes aegypti iron-responsive element binding protein (IRE-BP). Method RT-PCR and RACE (rapid amplification of cDNA end) were used to clone a cDNA encoding full length IRE-BP 1. Real-time quantitative RT-PCR was used to evaluate the transcriptional level changes in the Cr-IRE strain Aedes aegypti compared to the susceptible strain of Cx. pipiens pallens. The expression profile of the gene was established in the mosquito life cycle. Methyl tritiated thymidine (3H-TdR) was used to observe the cypermethrin resistance changes in C6/36 cells containing the stably transfected IRE-BP 1 gene of Cx. pipiens pallens. Results The complete sequence of iron responsive element binding protein 1 (IRE-BP 1) has been cloned from the cypermethrin-resistant strain of Culex pipiens pallens (Cr-IRE strain). Quantitative RT-PCR analysis indicated that the IRE-BP 1 transcription level was 6.7 times higher in the Cr-IRE strain than in the susceptible strain of 4th instar larvae. The IRE-BP 1 expression was also found to be consistently higher throughout the life cycle of the Cr-IRE strain. A protein of predicted size 109.4 kDa has been detected by Western blotting in IRE-BP 1-transfected mosquito C6/36 cells. These IRE-BP 1-transfected cells also showed enhanced cypermethrin resistance compared to null-transfected or plasmid vector-transfected cells as determined by 3H-TdR incorporation. Conclusion IRE-BP 1 is expressed at higher levels in the Cr-IRE strain, and may confer some insecticide resistance in Cx. pipiens pallens. PMID:22075242

Cloning and characterization of the major histone H2A genes completes the cloning and sequencing of known histone genes of Tetrahymena thermophila.

PubMed Central

Liu, X; Gorovsky, M A

1996-01-01

A truncated cDNA clone encoding Tetrahymena thermophila histone H2A2 was isolated using synthetic degenerate oligonucleotide probes derived from H2A protein sequences of Tetrahymena pyriformis. The cDNA clone was used as a homologous probe to isolate a truncated genomic clone encoding H2A1. The remaining regions of the genes for H2A1 (HTA1) and H2A2 (HTA2) were then isolated using inverse PCR on circularized genomic DNA fragments. These partial clones were assembled into intact HTA1 and HTA2 clones. Nucleotide sequences of the two genes were highly homologous within the coding region but not in the noncoding regions. Comparison of the deduced amino acid sequences with protein sequences of T. pyriformis H2As showed only two and three differences respectively, in a total of 137 amino acids for H2A1, and 132 amino acids for H2A2, indicating the two genes arose before the divergence of these two species. The HTA2 gene contains a TAA triplet within the coding region, encoding a glutamine residue. In contrast with the T. thermophila HHO and HTA3 genes, no introns were identified within the two genes. The 5'- and 3'-ends of the histone H2A mRNAs; were determined by RNase protection and by PCR mapping using RACE and RLM-RACE methods. Both genes encode polyadenylated mRNAs and are highly expressed in vegetatively growing cells but only weakly expressed in starved cultures. With the inclusion of these two genes, T. thermophila is the first organism whose entire complement of known core and linker histones, including replication-dependent and basal variants, has been cloned and sequenced. PMID:8760889

A robust two-way semi-linear model for normalization of cDNA microarray data

PubMed Central

Wang, Deli; Huang, Jian; Xie, Hehuang; Manzella, Liliana; Soares, Marcelo Bento

2005-01-01

Background Normalization is a basic step in microarray data analysis. A proper normalization procedure ensures that the intensity ratios provide meaningful measures of relative expression values. Methods We propose a robust semiparametric method in a two-way semi-linear model (TW-SLM) for normalization of cDNA microarray data. This method does not make the usual assumptions underlying some of the existing methods. For example, it does not assume that: (i) the percentage of differentially expressed genes is small; or (ii) the numbers of up- and down-regulated genes are about the same, as required in the LOWESS normalization method. We conduct simulation studies to evaluate the proposed method and use a real data set from a specially designed microarray experiment to compare the performance of the proposed method with that of the LOWESS normalization approach. Results The simulation results show that the proposed method performs better than the LOWESS normalization method in terms of mean square errors for estimated gene effects. The results of analysis of the real data set also show that the proposed method yields more consistent results between the direct and the indirect comparisons and also can detect more differentially expressed genes than the LOWESS method. Conclusions Our simulation studies and the real data example indicate that the proposed robust TW-SLM method works at least as well as the LOWESS method and works better when the underlying assumptions for the LOWESS method are not satisfied. Therefore, it is a powerful alternative to the existing normalization methods. PMID:15663789

Production of hydroxylated fatty acids in genetically modified plants

DOEpatents

Somerville, Chris; Broun, Pierre; van de Loo, Frank

2001-01-01

This invention relates to plant fatty acyl hydroxylases. Methods to use conserved amino acid or nucleotide sequences to obtain plant fatty acyl hydroxylases are described. Also described is the use of cDNA clones encoding a plant hydroxylase to produce a family of hydroxylated fatty acids in transgenic plants.

Genes from the 20Q13 amplicon and their uses

DOEpatents

Gray, Joe; Collins, Colin; Hwang, Soo-in; Godfrey, Tony; Kowbel, David; Rommens, Johanna

1999-01-01

The present invention relates to cDNA sequences from a region of amplification on chromosome 20 associated with disease. The sequences can be used in hybridization methods for the identification of chromosomal abnormalities associated with various diseases. The sequences can also be used for treatment of diseases.

The construction of cDNA library and the screening of related antigen of ascitic tumor cells of ovarian cancer.

PubMed

Hou, Q; Chen, K; Shan, Z

2015-01-01

To construct the cDNA library of the ascites tumor cells of ovarian cancer, which can be used to screen the related antigen for the early diagnosis of ovarian cancer and therapeutic targets of immune treatment. Four cases of ovarian serous cystadenocarcinoma, two cases of ovarian mucinous cystadenocarcinoma, and two cases of ovarian endometrial carcinoma in patients with ascitic tumor cells which were used to construct the cDNA library. To screen the ovarian cancer antigen gene, evaluate the enzyme, and analyze nucleotide sequence, serological analysis of recombinant tumor cDNA expression libraries (SEREX) and suppression subtractive hybridization technique (SSH) techniques were utilized. The detection method of recombinant expression-based serological mini-arrays (SMARTA) was used to detect the ovarian cancer antigen and the positive reaction of 105 cases of ovarian cancer patients and 105 normal women's autoantibodies correspondingly in serum. After two rounds of serologic screening and glycosides sequencing analysis, 59 candidates of ovarian cancer antigen gene fragments were finally identified, which corresponded to 50 genes. They were then divided into six categories: (1) the homologous genes which related to the known ovarian cancer genes, such as BARD 1 gene, etc; (2) the homologous genes which were associated with other tumors, such as TM4SFI gene, etc; (3) the genes which were expressed in a special organization, such as ILF3, FXR1 gene, etc; (4) the genes which were the same with some protein genes of special function, such as TIZ, ClD gene; (5) the homologous genes which possessed the same source with embryonic genes, such as PKHD1 gene, etc; (6) the remaining genes were the unknown genes without the homologous sequence in the gene pool, such as OV-189 genes. SEREX technology combined with SSH method is an effective research strategy which can filter tumor antigen with high specific character; the corresponding autoantibodies of TM4SFl, ClD, TIZ, BARDI, FXRI, and OV-189 gene's recombinant antigen in serum can be regarded as the biomarkers which are used to diagnose ovarian cancer. The combination of multiple antigen detection can improve diagnostic efficiency.

A comparative study of digital PCR and real-time qPCR for the detection and quantification of HPV mRNA in sentinel lymph nodes of cervical cancer patients.

PubMed

Carow, Katrin; Read, Christina; Häfner, Norman; Runnebaum, Ingo B; Corner, Adam; Dürst, Matthias

2017-10-30

Qualitative analyses showed that the presence of HPV mRNA in sentinel lymph nodes of cervical cancer patients with pN0 status is associated with significantly decreased recurrence free survival. To further address the clinical potential of the strategy and to define prognostic threshold levels it is necessary to use a quantitative assay. Here, we compare two methods of quantification: digital PCR and standard quantitative PCR. Serial dilutions of 5 ng-5 pg RNA (≙ 500-0.5 cells) of the cervical cancer cell line SiHa were prepared in 5 µg RNA of the HPV-negative human keratinocyte cell line HaCaT. Clinical samples consisted of 10 sentinel lymph nodes with varying HPV transcript levels. Reverse transcription of total RNA (5 µg RNA each) was performed in 100 µl and cDNA aliquots were analyzed by qPCR and dPCR. Digital PCR was run in the RainDrop ® Digital PCR system (RainDance Technologies) using a probe-based detection of HPV E6/E7 cDNA PCR products with 11 µl template. qPCR was done using a Rotor Gene Q 5plex HRM (Qiagen) amplifying HPV E6/E7 cDNA in a SYBR Green format with 1 µl template. For the analysis of both, clinical samples and serial dilution samples, dPCR and qPCR showed comparable sensitivity. With regard to reproducibility, both methods differed considerably, especially for low template samples. Here, we found with qPCR a mean variation coefficient of 126% whereas dPCR enabled a significantly lower mean variation coefficient of 40% (p = 0.01). Generally, we saw with dPCR a substantial reduction of subsampling errors, which most likely reflects the large cDNA amounts available for analysis. Compared to real-time PCR, dPCR shows higher reliability. Thus, our HPV mRNA dPCR assay holds promise for the clinical evaluation of occult tumor cells in histologically tumor-free lymph nodes in future studies.

Expression of ayu (Plecoglossus altivelis) Pit-1 in Escherichia coli: its purification and immunohistochemical detection using monoclonal antibody.

PubMed

Chiu, Chi-Chien; John, Joseph Abraham Christopher; Hseu, Tzong-Hsiung; Chang, Chi-Yao

2002-03-01

The pituitary-specific transcription factor Pit-1 belongs to the family of POU-domain proteins and is known to play an important role in the differentiation of pituitary cells. Here we report the complete nucleotide sequence of cDNA encoding Pit-1 from the brackish water fish, ayu (Plecoglossus altivelis). Nucleotide sequence analysis of 1910 bp of ayu Pit-1 cDNA revealed an open reading frame of 1074 bp that encodes a protein of 358 amino acids containing a POU-specific domain, POU homeodomain, and an STA (Ser/Thr-rich activation) transactivation domain. We inserted the coding region of Pit-1 cDNA, obtained by PCR, into a pET-20b(+) plasmid to produce recombinant Pit-1 in Escherichia coli BL21 (DE3) pLysS cells. Upon induction with isopropyl beta-D-thiogalactopyranoside, Pit-1 was expressed and accumulated as inclusion bodies in E. coli. The protein was then purified in one step by affinity chromatography on a nickel-nitrilotriacetic acid agarose column under denaturing conditions. This method yielded 0.7 mg of highly pure and stable protein per 200 ml of bacterial culture. A band of 40 kDa, resolved as recombinant ayu Pit-1 by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, agrees well with the molecular mass calculated from the translated cDNA sequence. The purified recombinant Pit-1 was confirmed in vitro through Western blot analysis, using its monoclonal antibody. This monoclonal antibody detected Pit-1 in the nuclei of ayu developing pituitary by immunohistochemical reaction. It serves as a good reagent for the detection of ayu Pit-1 in situ. Copyright 2002 Elsevier Science (USA).

BIGEL analysis of gene expression in HL60 cells exposed to X rays or 60 Hz magnetic fields

NASA Technical Reports Server (NTRS)

Balcer-Kubiczek, E. K.; Zhang, X. F.; Han, L. H.; Harrison, G. H.; Davis, C. C.; Zhou, X. J.; Ioffe, V.; McCready, W. A.; Abraham, J. M.; Meltzer, S. J.

1998-01-01

We screened a panel of 1,920 randomly selected cDNAs to discover genes that are differentially expressed in HL60 cells exposed to 60 Hz magnetic fields (2 mT) or X rays (5 Gy) compared to unexposed cells. Identification of these clones was accomplished using our two-gel cDNA library screening method (BIGEL). Eighteen cDNAs differentially expressed in X-irradiated compared to control HL60 cells were recovered from a panel of 1,920 clones. Differential expression in experimental compared to control cells was confirmed independently by Northern blotting of paired total RNA samples hybridized to each of the 18 clone-specific cDNA probes. DNA sequencing revealed that 15 of the 18 cDNA clones produced matches with the database for genes related to cell growth, protein synthesis, energy metabolism, oxidative stress or apoptosis (including MYC, neuroleukin, copper zinc-dependent superoxide dismutase, TC4 RAS-like protein, peptide elongation factor 1alpha, BNIP3, GATA3, NF45, cytochrome c oxidase II and triosephosphate isomerase mRNAs). In contrast, BIGEL analysis of the same 1,920 cDNAs revealed no differences greater than 1.5-fold in expression levels in magnetic-field compared to sham-exposed cells. Magnetic-field-exposed and control samples were analyzed further for the presence of mRNA encoding X-ray-responsive genes by hybridization of the 18 specific cDNA probes to RNA from exposed and control HL60 cells. Our results suggest that differential gene expression is induced in approximately 1% of a random pool of cDNAs by ionizing radiation but not by 60 Hz magnetic fields under the present experimental conditions.

Effectiveness of liquid soap and hand sanitizer against Norwalk virus on contaminated hands.

PubMed

Liu, Pengbo; Yuen, Yvonne; Hsiao, Hui-Mien; Jaykus, Lee-Ann; Moe, Christine

2010-01-01

Disinfection is an essential measure for interrupting human norovirus (HuNoV) transmission, but it is difficult to evaluate the efficacy of disinfectants due to the absence of a practicable cell culture system for these viruses. The purpose of this study was to screen sodium hypochlorite and ethanol for efficacy against Norwalk virus (NV) and expand the studies to evaluate the efficacy of antibacterial liquid soap and alcohol-based hand sanitizer for the inactivation of NV on human finger pads. Samples were tested by real-time reverse transcription-quantitative PCR (RT-qPCR) both with and without a prior RNase treatment. In suspension assay, sodium hypochlorite concentrations of >or=160 ppm effectively eliminated RT-qPCR detection signal, while ethanol, regardless of concentration, was relatively ineffective, giving at most a 0.5 log(10) reduction in genomic copies of NV cDNA. Using the American Society for Testing and Materials (ASTM) standard finger pad method and a modification thereof (with rubbing), we observed the greatest reduction in genomic copies of NV cDNA with the antibacterial liquid soap treatment (0.67 to 1.20 log(10) reduction) and water rinse only (0.58 to 1.58 log(10) reduction). The alcohol-based hand sanitizer was relatively ineffective, reducing the genomic copies of NV cDNA by only 0.14 to 0.34 log(10) compared to baseline. Although the concentrations of genomic copies of NV cDNA were consistently lower on finger pad eluates pretreated with RNase compared to those without prior RNase treatment, these differences were not statistically significant. Despite the promise of alcohol-based sanitizers for the control of pathogen transmission, they may be relatively ineffective against the HuNoV, reinforcing the need to develop and evaluate new products against this important group of viruses.

Cloning, characterization, and expression of Cytochrome b ( Cytb)—a key mitochondrial gene from Prorocentrum donghaiense

NASA Astrophysics Data System (ADS)

Zhao, Liyuan; Mi, Tiezhu; Zhen, Yu; Yu, Zhigang

2012-05-01

Mitochondrial cytochrome b (Cytb), one of the few proteins encoded by the mitochondrial DNA, plays an important role in transferring electrons. As a mitochondrial gene, it has been widely used for phylogenetic analysis. Previously, a 949-bp fragment of the coding gene and mRNA editing were characterized from Prorocentrum donghaiense, which might prove useful for resolving P. donghaiense from closely related species. However, the full-length coding region has not been characterized. In this study, we used rapid amplification of cDNA ends (RACE) to obtain full-length, 1 124 bp cDNA. Cytb transcript contained a standard initiation codon ATG, but did not have a recognizable stop codon. Homology comparison showed that the P. donghaiense Cytb had a high sequence identity to Cytb sequences from other dinoflagellate species. Phylogenetic analysis placed Cytb from P. donghaiense in the clade of dinoflagellates and it clustered together strongly with that from P. minimum. Based on the full-length sequence, we inferred 32 editing events at different positions, accounting for 2.93% of the Cytb gene. 34.4% (11) of the changes were A to G, 25% (8) were T to C, and 25% (8) were C to U, with smaller proportions of G to C and G to A edits (9.4% (3) and 6.2% (2), respectively). The expression level of the Cytb transcript was quantified by real-time PCR with a TaqMan probe at different times during the whole growth phase. The average Cytb transcript was present at 39.27±7.46 copies of cDNA per cell during the whole growth cycle, and the expression of Cytb was relatively stable over the different phases. These results deepen our understanding of the structure and characteristics of Cytb in P. donghaiense, and confirmed that Cytb in P. donghaiense is a candidate reference gene for studying the expression of other genes.

Lectin cDNA and transgenic plants derived therefrom

DOEpatents

Raikhel, N.V.

1994-01-04

Transgenic plants containing cDNA encoding Gramineae lectin are described. The plants preferably contain cDNA coding for barley lectin and store the lectin in the leaves. The transgenic plants, particularly the leaves exhibit insecticidal and fungicidal properties. GOVERNMENT RIGHTS This application was funded under Department of Energy Contract DE-AC02-76ER01338. The U.S. Government has certain rights under this application and any patent issuing thereon. .

Lectin cDNA and transgenic plants derived therefrom

DOEpatents

Raikhel, Natasha V.

1994-01-04

Transgenic plants containing cDNA encoding Gramineae lectin are described. The plants preferably contain cDNA coding for barley lectin and store the lectin in the leaves. The transgenic plants, particularly the leaves exhibit insecticidal and fungicidal properties. GOVERNMENT RIGHTS This application was funded under Department of Energy Contract DE-AC02-76ER01338. The U.S. Government has certain rights under this application and any patent issuing thereon.

Characterization of infectious Murray Valley encephalitis virus derived from a stably cloned genome-length cDNA.

PubMed

Hurrelbrink, R J; Nestorowicz, A; McMinn, P C

1999-12-01

An infectious cDNA clone of Murray Valley encephalitis virus prototype strain 1-51 (MVE-1-51) was constructed by stably inserting genome-length cDNA into the low-copy-number plasmid vector pMC18. Designated pMVE-1-51, the clone consisted of genome-length cDNA of MVE-1-51 under the control of a T7 RNA polymerase promoter. The clone was constructed by using existing components of a cDNA library, in addition to cDNA of the 3' terminus derived by RT-PCR of poly(A)-tailed viral RNA. Upon comparison with other flavivirus sequences, the previously undetermined sequence of the 3' UTR was found to contain elements conserved throughout the genus FLAVIVIRUS: RNA transcribed from pMVE-1-51 and subsequently transfected into BHK-21 cells generated infectious virus. The plaque morphology, replication kinetics and antigenic profile of clone-derived virus (CDV-1-51) was similar to the parental virus in vitro. Furthermore, the virulence properties of CDV-1-51 and MVE-1-51 (LD(50) values and mortality profiles) were found to be identical in vivo in the mouse model. Through site-directed mutagenesis, the infectious clone should serve as a valuable tool for investigating the molecular determinants of virulence in MVE virus.

Isolation of a new dual-functional caffeine synthase gene encoding an enzyme for the conversion of 7-methylxanthine to caffeine from coffee (Coffea arabica L.).

PubMed

Mizuno, Kouichi; Okuda, Akira; Kato, Misako; Yoneyama, Naho; Tanaka, Hiromi; Ashihara, Hiroshi; Fujimura, Tatsuhito

2003-01-16

In coffee and tea plants, caffeine is synthesized from xanthosine via a pathway that includes three methylation steps. We report the isolation of a bifunctional coffee caffeine synthase (CCS1) clone from coffee endosperm by reverse transcription-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE) technique using previously reported sequence information for theobromine synthases (CTSs). The predicted amino acid sequences of CCS1 are more than 80% identical to CTSs and are about 40% similar to those of tea caffeine synthase (TCS1). Interestingly, CCS1 has dual methylation activity like tea TCS1.

Characterization of the cod (Gadus morhua) steroidogenic acute regulatory protein (StAR) sheds light on StAR gene structure in fish.

PubMed

Goetz, Frederick W; Norberg, Birgitta; McCauley, Linda A R; Iliev, Dimitar B

2004-03-01

The full-length cDNA for the cod (Gadus morhua) StAR was cloned by RT-PCR and library screening using ovarian RNA. From the library screening, 2 size classes of cDNA were obtained; a 1577 bp cDNA (cStAR1) and a 2851 bp cDNA (cStAR2). The cStAR1 cDNA presumably encodes a protein of 286 amino acids. The cStAR2 cDNA was composed of 6 separated sequences that contained all of the coding regions of cStAR1 when added together, but also contained 5 noncoding regions not observed in cStAR1. Polymerase chain reactions of cod genomic DNA produced products slightly larger than cStAR2. The sequence of these products were the same as cStAR2 but revealed one additional noncoding region (intron). Thus, the fish StAR gene contains the same number of exons (7) and introns (6) as observed in mammals, but is approximately half the size of the mammalian gene. Using Northern analysis and RT-PCR, cStAR1 expression was observed only in testes, ovaries and head kidneys. Polymerase chain reaction products were also observed using cDNA from steroidogenic tissues and primers designed to regions specific for cStAR2, indicating that cStAR2 is expressed in tissues and may account for the presence of larger transcripts observed on Northern blots.

cDNA cloning of rat and human medium chain acyl-CoA dehydrogenase (MCAD)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Matsubara, Y.; Kraus, J.P.; Rosenberg, L.E.

MCAD is one of three mitochondrial flavoenzymes which catalyze the first step in the ..beta..-oxidation of straight chain fatty acids. It is a tetramer with a subunit Mr of 45 kDa. MCAD is synthesized in the cytosol as a 49 kDa precursor polypeptide (pMCAD), imported into mitochondria, and cleaved to the mature form. Genetic deficiency of MCAD causes recurrent episodes of hypoglycemic coma accompanied by medium chain dicarboxylic aciduria. Employing a novel approach, the authors now report isolation of partial rat and human cDNA clones encoding pMCAD. mRNA encoding pMCAD was purified to near homogeneity by polysome immunoadsorption using polyclonalmore » monospecific antibody. Single-stranded (/sup 32/P)labeled cDNA probe was synthesized using the enriched mRNA as template, and was used to screen directly 16,000 colonies from a total rat liver cDNA library constructed in pBR322. One clone (600 bp) was detected by in situ hybridization. Hybrid-selected translation with this cDNA yielded a 49 kDa polypeptide indistinguishable in size from rat pMCAD and immunoprecipitable with anti-MCAD antibody. Using the rat cDNA as probe, 43,000 colonies from a human liver cDNA library were screened. Four identical positive clones (400 bp) were isolated and positively identified by hybrid-selected translation and immunoprecipitation. The sizes of rat and human mRNAs encoding pMCAD were 2.2 kb and 2.4 kb, respectively, as determined by Northern blotting.« less

Cost-effective sequencing of full-length cDNA clones powered by a de novo-reference hybrid assembly.

PubMed

Kuroshu, Reginaldo M; Watanabe, Junichi; Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka; Kasahara, Masahiro

2010-05-07

Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence approximately 800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only approximately US$3 per clone, demonstrating a significant advantage over previous approaches.

[Preparation of the cDNA microarray on the differential expressed cDNA of senescence-accelerated mouse's hippocampus].

PubMed

Cheng, Xiao-Rui; Zhou, Wen-Xia; Zhang, Yong-Xiang

2006-05-01

Alzheimer' s disease (AD) is the most common form of dementia in the elderly. AD is an invariably fatal neurodegenerative disorder with no effective treatment. Senescence-accelerated mouse prone 8 (SAMP8) is a model for studying age-related cognitive impairments and also is a good model to study brain aging and one of mouse model of AD. The technique of cDNA microarray can monitor the expression levels of thousands of genes simultaneously and can be used to study AD with the character of multi-mechanism, multi-targets and multi-pathway. In order to disclose the mechanism of AD and find the drug targets of AD, cDNA microarray containing 3136 cDNAs amplified from the suppression subtracted cDNA library of hippocampus of SAMP8 and SAMR1 was prepared with 16 blocks and 14 x 14 pins, the housekeeping gene beta-actin and G3PDH as inner conference. The background of this microarray was low and unanimous, and dots divided evenly. The conditions of hybridization and washing were optimized during the hybridization of probe and target molecule. After the data of hybridization analysis, the differential expressed cDNAs were sequenced and analyzed by the bioinformatics, and some of genes were quantified by the real time RT-PCR and the reliability of this cDNA microarray were validated. This cDNA microarray may be the good means to select the differential expressed genes and disclose the molecular mechanism of SAMP8's brain aging and AD.

Identification of Human N-Myristoylated Proteins from Human Complementary DNA Resources by Cell-Free and Cellular Metabolic Labeling Analyses.

PubMed

Takamitsu, Emi; Otsuka, Motoaki; Haebara, Tatsuki; Yano, Manami; Matsuzaki, Kanako; Kobuchi, Hirotsugu; Moriya, Koko; Utsumi, Toshihiko

2015-01-01

To identify physiologically important human N-myristoylated proteins, 90 cDNA clones predicted to encode human N-myristoylated proteins were selected from a human cDNA resource (4,369 Kazusa ORFeome project human cDNA clones) by two bioinformatic N-myristoylation prediction systems, NMT-The MYR Predictor and Myristoylator. After database searches to exclude known human N-myristoylated proteins, 37 cDNA clones were selected as potential human N-myristoylated proteins. The susceptibility of these cDNA clones to protein N-myristoylation was first evaluated using fusion proteins in which the N-terminal ten amino acid residues were fused to an epitope-tagged model protein. Then, protein N-myristoylation of the gene products of full-length cDNAs was evaluated by metabolic labeling experiments both in an insect cell-free protein synthesis system and in transfected human cells. As a result, the products of 13 cDNA clones (FBXL7, PPM1B, SAMM50, PLEKHN, AIFM3, C22orf42, STK32A, FAM131C, DRICH1, MCC1, HID1, P2RX5, STK32B) were found to be human N-myristoylated proteins. Analysis of the role of protein N-myristoylation on the intracellular localization of SAMM50, a mitochondrial outer membrane protein, revealed that protein N-myristoylation was required for proper targeting of SAMM50 to mitochondria. Thus, the strategy used in this study is useful for the identification of physiologically important human N-myristoylated proteins from human cDNA resources.

Identification of Human N-Myristoylated Proteins from Human Complementary DNA Resources by Cell-Free and Cellular Metabolic Labeling Analyses

PubMed Central

Takamitsu, Emi; Otsuka, Motoaki; Haebara, Tatsuki; Yano, Manami; Matsuzaki, Kanako; Kobuchi, Hirotsugu; Moriya, Koko; Utsumi, Toshihiko

2015-01-01

To identify physiologically important human N-myristoylated proteins, 90 cDNA clones predicted to encode human N-myristoylated proteins were selected from a human cDNA resource (4,369 Kazusa ORFeome project human cDNA clones) by two bioinformatic N-myristoylation prediction systems, NMT-The MYR Predictor and Myristoylator. After database searches to exclude known human N-myristoylated proteins, 37 cDNA clones were selected as potential human N-myristoylated proteins. The susceptibility of these cDNA clones to protein N-myristoylation was first evaluated using fusion proteins in which the N-terminal ten amino acid residues were fused to an epitope-tagged model protein. Then, protein N-myristoylation of the gene products of full-length cDNAs was evaluated by metabolic labeling experiments both in an insect cell-free protein synthesis system and in transfected human cells. As a result, the products of 13 cDNA clones (FBXL7, PPM1B, SAMM50, PLEKHN, AIFM3, C22orf42, STK32A, FAM131C, DRICH1, MCC1, HID1, P2RX5, STK32B) were found to be human N-myristoylated proteins. Analysis of the role of protein N-myristoylation on the intracellular localization of SAMM50, a mitochondrial outer membrane protein, revealed that protein N-myristoylation was required for proper targeting of SAMM50 to mitochondria. Thus, the strategy used in this study is useful for the identification of physiologically important human N-myristoylated proteins from human cDNA resources. PMID:26308446

The construction of an EST database for Bombyx mori and its application

PubMed Central

Mita, Kazuei; Morimyo, Mitsuoki; Okano, Kazuhiro; Koike, Yoshiko; Nohata, Junko; Kawasaki, Hideki; Kadono-Okuda, Keiko; Yamamoto, Kimiko; Suzuki, Masataka G.; Shimada, Toru; Goldsmith, Marian R.; Maeda, Susumu

2003-01-01

To build a foundation for the complete genome analysis of Bombyx mori, we have constructed an EST database. Because gene expression patterns deeply depend on tissues as well as developmental stages, we analyzed many cDNA libraries prepared from various tissues and different developmental stages to cover the entire set of Bombyx genes. So far, the Bombyx EST database contains 35,000 ESTs from 36 cDNA libraries, which are grouped into ≈11,000 nonredundant ESTs with the average length of 1.25 kb. The comparison with FlyBase suggests that the present EST database, SilkBase, covers >55% of all genes of Bombyx. The fraction of library-specific ESTs in each cDNA library indicates that we have not yet reached saturation, showing the validity of our strategy for constructing an EST database to cover all genes. To tackle the coming saturation problem, we have checked two methods, subtraction and normalization, to increase coverage and decrease the number of housekeeping genes, resulting in a 5–11% increase of library-specific ESTs. The identification of a number of genes and comprehensive cloning of gene families have already emerged from the SilkBase search. Direct links of SilkBase with FlyBase and WormBase provide ready identification of candidate Lepidoptera-specific genes. PMID:14614147

Sentaurus® based modeling and simulation for GFET's characteristic for ssDNA immobilization and hybridization

NASA Astrophysics Data System (ADS)

Yunfang, Jia; Cheng, Ju

2016-01-01

The graphene field effect transistor (GFET) has been widely studied and developed as sensors and functional devices. The first report about GFET sensing simulation on the device level is proposed. The GFET's characteristics, its responding for single strand DNA (ssDNA) and hybridization with the complimentary DNA (cDNA) are simulated based on Sentaurus, a popular CAD tool for electronic devices. The agreement between the simulated blank GFET feature and the reported experimental data suggests the feasibility of the presented simulation method. Then the simulations of ssDNA immobilization on GFET and hybridization with its cDNA are performed, the results are discussed based on the electron transfer (ET) mechanism between DNA and graphene. Project supported by the National Natural Science Foundation of China (No. 61371028) and the Tianjin Natural Science Foundation (No. 12JCZDJC22400).

Generation of Infectious Poliovirus with Altered Genetic Information from Cloned cDNA.

PubMed

Bujaki, Erika

2016-01-01

The effect of specific genetic alterations on virus biology and phenotype can be studied by a great number of available assays. The following method describes the basic protocol to generate infectious poliovirus with altered genetic information from cloned cDNA in cultured cells.The example explained here involves generation of a recombinant poliovirus genome by simply replacing a portion of the 5' noncoding region with a synthetic gene by restriction cloning. The vector containing the full length poliovirus genome and the insert DNA with the known mutation(s) are cleaved for directional cloning, then ligated and transformed into competent bacteria. The recombinant plasmid DNA is then propagated in bacteria and transcribed to RNA in vitro before RNA transfection of cultured cells is performed. Finally, viral particles are recovered from the cell culture.

Accurate RNA consensus sequencing for high-fidelity detection of transcriptional mutagenesis-induced epimutations.

PubMed

Reid-Bayliss, Kate S; Loeb, Lawrence A

2017-08-29

Transcriptional mutagenesis (TM) due to misincorporation during RNA transcription can result in mutant RNAs, or epimutations, that generate proteins with altered properties. TM has long been hypothesized to play a role in aging, cancer, and viral and bacterial evolution. However, inadequate methodologies have limited progress in elucidating a causal association. We present a high-throughput, highly accurate RNA sequencing method to measure epimutations with single-molecule sensitivity. Accurate RNA consensus sequencing (ARC-seq) uniquely combines RNA barcoding and generation of multiple cDNA copies per RNA molecule to eliminate errors introduced during cDNA synthesis, PCR, and sequencing. The stringency of ARC-seq can be scaled to accommodate the quality of input RNAs. We apply ARC-seq to directly assess transcriptome-wide epimutations resulting from RNA polymerase mutants and oxidative stress.

Acetylcholinesterase of the Sand Fly, Phlebotomus papatasi (Scopoli): cDNA Sequence, Baculovirus Expression, and Biochemical Properties

DTIC Science & Technology

2013-01-01

identity to acetylcholinesterase mRNA sequences of Culex tritaeniorhynchus and Lutzomyia longipalpis, respectively. The P. papatasi cDNA ORF encoded a...tritaeniorhynchus and Lutzomyia longipalpis, respectively. The P. papatasi cDNA ORF encoded a 710-amino acid protein [GenBank: AFP20868] exhibiting 85...improve effectiveness of pesticide application for control of the new world sand fly Lutzomyia longipalpis in chicken sheds [13]. Attempts to control

Comparison of the canine and human acid {beta}-galactosidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ahern-Rindell, A.J.; Kretz, K.A.; O`Brien, J.S.

Several canine cDNA libraries were screened with human {beta}-galactosidase cDNA as probe. Seven positive clones were isolated and sequenced yielding a partial (2060 bp) canine {beta}-galactosidase cDNA with 86% identity to the human {beta}-galactosidase cDNA. Preliminary analysis of a canine genomic library indicated conservation of exon number and size. Analysis by Northern blotting disclosed a single mRNA of 2.4 kb in fibroblasts and liver from normal dogs and dogs affected with GM1 gangliosidosis. Although incomplete, these results indicate canine GM1 gangliosidosis is a suitable animal model of the human disease and should further efforts to devise a gene therapy strategymore » for its treatment. 20 refs., 2 figs., 1 tab.« less

Cost-Effective Sequencing of Full-Length cDNA Clones Powered by a De Novo-Reference Hybrid Assembly

PubMed Central

Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka

2010-01-01

Background Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. Methodology We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence ∼800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. Conclusions The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only ∼US$3 per clone, demonstrating a significant advantage over previous approaches. PMID:20479877

Display of a maize cDNA library on baculovirus infected insect cells.

PubMed

Meller Harel, Helene Y; Fontaine, Veronique; Chen, Hongying; Jones, Ian M; Millner, Paul A

2008-08-12

Maize is a good model system for cereal crop genetics and development because of its rich genetic heritage and well-characterized morphology. The sequencing of its genome is well advanced, and new technologies for efficient proteomic analysis are needed. Baculovirus expression systems have been used for the last twenty years to express in insect cells a wide variety of eukaryotic proteins that require complex folding or extensive posttranslational modification. More recently, baculovirus display technologies based on the expression of foreign sequences on the surface of Autographa californica (AcMNPV) have been developed. We investigated the potential of a display methodology for a cDNA library of maize young seedlings. We constructed a full-length cDNA library of young maize etiolated seedlings in the transfer vector pAcTMVSVG. The library contained a total of 2.5 x 10(5) independent clones. Expression of two known maize proteins, calreticulin and auxin binding protein (ABP1), was shown by western blot analysis of protein extracts from insect cells infected with the cDNA library. Display of the two proteins in infected insect cells was shown by selective biopanning using magnetic cell sorting and demonstrated proof of concept that the baculovirus maize cDNA display library could be used to identify and isolate proteins. The maize cDNA library constructed in this study relies on the novel technology of baculovirus display and is unique in currently published cDNA libraries. Produced to demonstrate proof of principle, it opens the way for the development of a eukaryotic in vivo display tool which would be ideally suited for rapid screening of the maize proteome for binding partners, such as proteins involved in hormone regulation or defence.

Suppression of antitumour protective cytotoxic T lymphocyte responses to a human papillomavirus 16 E7 DNA vaccine by coinjection of interleukin-12 complementary DNA: involvement of nitric oxide in immune suppression

PubMed Central

Sin, Jeong-Im

2009-01-01

Interleukin-12 (IL-12) has been shown to enhance cellular immunity in vitro and in vivo. The beneficial roles of IL-12 as a DNA vaccine adjuvant have been commonly observed. Here the impact of IL-12 complementary DNA (cDNA) as an adjuvant for a human papillomavirus (HPV) type 16 E7 DNA vaccine is investigated in a mouse tumour model. Coinjection of E7 DNA vaccine with IL-12 cDNA completely suppressed antigen-specific cytotoxic T-lymphocyte (CTL) responses, leading to a complete loss of antitumour protection from a tumour cell challenge. In addition, antigen-specific antibody and T helper cell proliferative responses were also suppressed by IL-12 cDNA coinjection. This inhibition was observed over different IL-12 cDNA doses. Furthermore, separate leg injections of IL-12 and E7 cDNAs suppressed antigen-specific CTL and tumour protective responses, but not antibody and T helper cell proliferative responses, suggesting different pathways for suppression of these two separate responses. Further knockout animal studies demonstrated that interferon-γ and nitric oxide are not directly associated with suppression of antigen-specific antibody responses by IL-12 cDNA coinjection. However, nitric oxide was found to be involved in suppression of antigen-specific CTL and tumour protective responses by IL-12 cDNA coinjection. These data suggest that coinjection of IL-12 cDNA results in suppression of E7-specific CTL responses through nitric oxide, leading to a loss of antitumour resistance in this DNA vaccine model. This study further shows that the adjuvant effect of IL-12 is dependent on the antigen types tested. PMID:19740332

Suppression of antitumour protective cytotoxic T lymphocyte responses to a human papillomavirus 16 E7 DNA vaccine by coinjection of interleukin-12 complementary DNA: involvement of nitric oxide in immune suppression.

PubMed

Sin, Jeong-Im

2009-09-01

Interleukin-12 (IL-12) has been shown to enhance cellular immunity in vitro and in vivo. The beneficial roles of IL-12 as a DNA vaccine adjuvant have been commonly observed. Here the impact of IL-12 complementary DNA (cDNA) as an adjuvant for a human papillomavirus (HPV) type 16 E7 DNA vaccine is investigated in a mouse tumour model. Coinjection of E7 DNA vaccine with IL-12 cDNA completely suppressed antigen-specific cytotoxic T-lymphocyte (CTL) responses, leading to a complete loss of antitumour protection from a tumour cell challenge. In addition, antigen-specific antibody and T helper cell proliferative responses were also suppressed by IL-12 cDNA coinjection. This inhibition was observed over different IL-12 cDNA doses. Furthermore, separate leg injections of IL-12 and E7 cDNAs suppressed antigen-specific CTL and tumour protective responses, but not antibody and T helper cell proliferative responses, suggesting different pathways for suppression of these two separate responses. Further knockout animal studies demonstrated that interferon-gamma and nitric oxide are not directly associated with suppression of antigen-specific antibody responses by IL-12 cDNA coinjection. However, nitric oxide was found to be involved in suppression of antigen-specific CTL and tumour protective responses by IL-12 cDNA coinjection. These data suggest that coinjection of IL-12 cDNA results in suppression of E7-specific CTL responses through nitric oxide, leading to a loss of antitumour resistance in this DNA vaccine model. This study further shows that the adjuvant effect of IL-12 is dependent on the antigen types tested.

DNA book.

PubMed

Kawai, Jun; Hayashizaki, Yoshihide

2003-06-01

We propose herein a new method of DNA distribution, whereby DNA clones or PCR products are printed directly onto the pages of books and delivered to users along with relevant scientific information. DNA sheets, comprising water-soluble paper onto which DNA is spotted, can be bound into books. Readers can easily extract the DNA fragments from DNA sheets and amplify them using PCR. We show that DNA sheets can withstand various conditions that may be experienced during bookbinding and delivery, such as high temperatures and humidity. Almost all genes (95%-100% of randomly selected RIKEN mouse cDNA clones) were recovered successfully by use of PCR. Readers can start their experiments after a 2-h PCR amplification without waiting for the delivery of DNA clones. The DNA Book thus provides a novel method for delivering DNA in a timely and cost-effective manner. A sample DNA sheet (carrying RIKEN mouse cDNA clones encoding genes of enzymes for the TCA cycle) is included in this issue for field-testing. We would greatly appreciate it if readers could attempt to extract DNA and report the results and whether the DNA sheet was shipped to readers in good condition.

Normal uniform mixture differential gene expression detection for cDNA microarrays

PubMed Central

Dean, Nema; Raftery, Adrian E

2005-01-01

Background One of the primary tasks in analysing gene expression data is finding genes that are differentially expressed in different samples. Multiple testing issues due to the thousands of tests run make some of the more popular methods for doing this problematic. Results We propose a simple method, Normal Uniform Differential Gene Expression (NUDGE) detection for finding differentially expressed genes in cDNA microarrays. The method uses a simple univariate normal-uniform mixture model, in combination with new normalization methods for spread as well as mean that extend the lowess normalization of Dudoit, Yang, Callow and Speed (2002) [1]. It takes account of multiple testing, and gives probabilities of differential expression as part of its output. It can be applied to either single-slide or replicated experiments, and it is very fast. Three datasets are analyzed using NUDGE, and the results are compared to those given by other popular methods: unadjusted and Bonferroni-adjusted t tests, Significance Analysis of Microarrays (SAM), and Empirical Bayes for microarrays (EBarrays) with both Gamma-Gamma and Lognormal-Normal models. Conclusion The method gives a high probability of differential expression to genes known/suspected a priori to be differentially expressed and a low probability to the others. In terms of known false positives and false negatives, the method outperforms all multiple-replicate methods except for the Gamma-Gamma EBarrays method to which it offers comparable results with the added advantages of greater simplicity, speed, fewer assumptions and applicability to the single replicate case. An R package called nudge to implement the methods in this paper will be made available soon at . PMID:16011807

The Status, Quality, and Expansion of the NIH Full-Length cDNA Project: The Mammalian Gene Collection (MGC)

PubMed Central

2004-01-01

The National Institutes of Health's Mammalian Gene Collection (MGC) project was designed to generate and sequence a publicly accessible cDNA resource containing a complete open reading frame (ORF) for every human and mouse gene. The project initially used a random strategy to select clones from a large number of cDNA libraries from diverse tissues. Candidate clones were chosen based on 5′-EST sequences, and then fully sequenced to high accuracy and analyzed by algorithms developed for this project. Currently, more than 11,000 human and 10,000 mouse genes are represented in MGC by at least one clone with a full ORF. The random selection approach is now reaching a saturation point, and a transition to protocols targeted at the missing transcripts is now required to complete the mouse and human collections. Comparison of the sequence of the MGC clones to reference genome sequences reveals that most cDNA clones are of very high sequence quality, although it is likely that some cDNAs may carry missense variants as a consequence of experimental artifact, such as PCR, cloning, or reverse transcriptase errors. Recently, a rat cDNA component was added to the project, and ongoing frog (Xenopus) and zebrafish (Danio) cDNA projects were expanded to take advantage of the high-throughput MGC pipeline. PMID:15489334

Benchmarking of the Oxford Nanopore MinION sequencing for quantitative and qualitative assessment of cDNA populations.

PubMed

Oikonomopoulos, Spyros; Wang, Yu Chang; Djambazian, Haig; Badescu, Dunarel; Ragoussis, Jiannis

2016-08-24

To assess the performance of the Oxford Nanopore Technologies MinION sequencing platform, cDNAs from the External RNA Controls Consortium (ERCC) RNA Spike-In mix were sequenced. This mix mimics mammalian mRNA species and consists of 92 polyadenylated transcripts with known concentration. cDNA libraries were generated using a template switching protocol to facilitate the direct comparison between different sequencing platforms. The MinION performance was assessed for its ability to sequence the cDNAs directly with good accuracy in terms of abundance and full length. The abundance of the ERCC cDNA molecules sequenced by MinION agreed with their expected concentration. No length or GC content bias was observed. The majority of cDNAs were sequenced as full length. Additionally, a complex cDNA population derived from a human HEK-293 cell line was sequenced on an Illumina HiSeq 2500, PacBio RS II and ONT MinION platforms. We observed that there was a good agreement in the measured cDNA abundance between PacBio RS II and ONT MinION (rpearson = 0.82, isoforms with length more than 700bp) and between Illumina HiSeq 2500 and ONT MinION (rpearson = 0.75). This indicates that the ONT MinION can sequence quantitatively both long and short full length cDNA molecules.

Mitotic stability and nuclear inheritance of integrated viral cDNA in engineered hypovirulent strains of the chestnut blight fungus.

PubMed Central

Chen, B; Choi, G H; Nuss, D L

1993-01-01

Transmissible hypovirulence is a novel form of biological control in which virulence of a fungal pathogen is attenuated by an endogenous RNA virus. The feasibility of engineering hypovirulence was recently demonstrated by transformation of the chestnut blight fungus, Cryphonectria parasitica, with a full-length cDNA copy of a hypovirulence-associated viral RNA. Engineered hypovirulent transformants were found to contain both a chromsomally integrated cDNA copy of the viral genome and a resurrected cytoplasmically replicating double-stranded RNA form. We now report stable maintenance of integrated viral cDNA through repeated rounds of asexual sporulation and passages on host plant tissue. We also demonstrate stable nuclear inheritance of the integrated viral cDNA and resurrection of the cytoplasmic viral double-stranded RNA form in progeny resulting from the mating of an engineered hypovirulent C. parasitica strain and a vegetatively incompatible virulent strain. Mitotic stability of the viral cDNA ensures highly efficient transmission of the hypovirulence phenotype through conidia. Meiotic transmission, a mode not observed for natural hypovirulent strains, introduces virus into ascospore progeny representing a spectrum of vegetative compatibility groups, thereby circumventing barriers to anastomosis-mediated transmission imposed by the fungal vegetative incompatibility system. These transmission properties significantly enhance the potential of engineered hypovirulent C. parasitica strains as effective biocontrol agents. Images PMID:8344241

Single Cell Transcriptomics of Hypothalamic Warm Sensitive Neurons that Control Core Body Temperature and Fever Response

PubMed Central

Eberwine, James; Bartfai, Tamas

2011-01-01

We report on an ‘unbiased’ molecular characterization of individual, adult neurons, active in a central, anterior hypothalamic neuronal circuit, by establishing cDNA libraries from each individual, electrophysiologically identified warm sensitive neuron (WSN). The cDNA libraries were analyzed by Affymetrix microarray. The presence and frequency of cDNAs was confirmed and enhanced with Illumina sequencing of each single cell cDNA library. cDNAs encoding the GABA biosynthetic enzyme. GAD1 and of adrenomedullin, galanin, prodynorphin, somatostatin, and tachykinin were found in the WSNs. The functional cellular and in vivo studies on dozens of the more than 500 neurotransmitter -, hormone- receptors and ion channels, whose cDNA was identified and sequence confirmed, suggest little or no discrepancy between the transcriptional and functional data in WSNs; whenever agonists were available for a receptor whose cDNA was identified, a functional response was found.. Sequencing single neuron libraries permitted identification of rarely expressed receptors like the insulin receptor, adiponectin receptor2 and of receptor heterodimers; information that is lost when pooling cells leads to dilution of signals and mixing signals. Despite the common electrophysiological phenotype and uniform GAD1 expression, WSN- transcriptomes show heterogenity, suggesting strong epigenetic influence on the transcriptome. Our study suggests that it is well-worth interrogating the cDNA libraries of single neurons by sequencing and chipping. PMID:20970451

IgE reactivity to profilin in pollen-sensitized subjects with adverse reactions to banana and pineapple.

PubMed

Reindl, J; Rihs, H P; Scheurer, S; Wangorsch, A; Haustein, D; Vieths, S

2002-06-01

The so-called 'latex-fruit syndrome' is a well-documented phenomenon in cross-reactive allergies. By contrast, there is a lack of information about allergy to exotic fruits in patients with a predominant pollen sensitization. Since the ubiquitous protein profilin has been identified as an allergen in natural rubber latex as well as in pollen-related foods, the aim of this study was to investigate the role of profilin in allergy to certain exotic fruits. Recombinant profilins from banana and pineapple were cloned by a PCR technique after isolation of total RNA using degenerated profilin-specific primers. The unknown 5' ends of copy DNA (cDNA) were identified by rapid amplification of 5'cDNA ends (5'-RACE) and expression in Escherichia coli BL21(DE3) cells. The recombinant profilins were purified by affinity chromatography using poly-(L)-proline as the solid phase. IgE-binding capabilities were characterized by means of immunoblot and Enzyme Allergosorbent Test (EAST). The cross-reactivity to birch pollen profilin and latex profilin was studied by EAST as well as by immunoblot inhibition experiments. Both banana and pineapple profilin were found to consist of 131 amino acid residues with high amino acid sequence identity to known allergenic pollen and food profilins (71-84%). IgE binding to the recombinant profilins was observed in 7/16 sera from subjects with suspected banana allergy (44%) and in 8/19 sera from subjects with suspected pineapple allergy (42%). Inhibition experiments indicated similar IgE reactivity of natural and recombinant allergens. In addition, high cross-reactivity to birch pollen profilin Bet v 2 and latex profilin Hev b 8 was demonstrated by immunoblot inhibition as well as EAST inhibition experiments. Since a high IgE-binding prevalence of about 40% was obtained in both banana and pineapple allergy, we conclude that profilin is an important mediator of IgE cross-reactivity between pollen and exotic fruits. Copyright 2002 S. Karger AG, Basel

Towards the isolation of the idiopathic hemochromatosis disease gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chorney, M.J.; Venditti, C.P.; Harris, J.M.

1994-09-01

Despite the existence of many useful reagents which exist to aid in the positional cloning of the idiopathic hermochromatosis disease gene (HFE), the nature and precise location of this common genetic disease has remained elusive. Our group has pursued an MHC-based positional cloning approach which has centered on the precise physical definition of HLA-A variant chromosomes. Using deletion breakpoint locations in combination with genetic data derived from the Brittany founder population, we have used cDNA selection techniques to isolate new members of distinct multigene families which reside in the HFE critical region (distal to the HLA-A9 breakpoint/proximal to HLA-F). Wemore » have also initiated an independent set of cytogenetic and physical mapping studies to position the marker D6S105 with respect to the telomeric end of the class I subregion. Toward this end, we have performed double labelling FISH experiments which have allowed the localization of D6S105-containing YACs with respect to the HLA-A subregion and to the major G-bands which contain these loci. We have also derived single-copy probes, cosmids and cDNA clones from the region which have been used to create a physical map around D6S105. The combination of the cytogenetic and physical mapping data indicate that D6S105 is at least 2 Mb from HLA-A and that the distal limit of the MHC class I region may extend much further into the the euchromatic region of 6p21.3 than previously expected. A mega-YAC walk is now in progress to link the two loci. Finally, we have identified and characterized a family which is segregating a balanced inversion in phase with HFE. The breakpoint locations of this mutant chromosome may be important in the precise positioning of the HFE gene and attempts to define coding sequences in the proximity of this rearrangement are underway.« less

Genetic Heterogeneity in Streptococcus mutans1

PubMed Central

Coykendall, Alan L.

1971-01-01

The genetic homogeneity among eight cariogenic strains of Streptococcus mutans was assessed by deoxyribonucleic acid (DNA)-DNA reassociation experiments. DNA species were extracted from strains GS5, Ingbritt, 10449, FAl, BHT, E49, SLl, and KlR. Labeled DNA (14C-DNA) was extracted from strains 10449, FAl, and SLl. Denatured 14C-DNA fragments were allowed to reassociate, i.e., form hybrid duplexes, with denatured DNA immobilized on membrane filters incubated in 0.45 m NaCl-0.045 m sodium citrate at 67 or 75 C. At 67 C, 10449 14C-DNA reassociated extensively only with GS5 and Ingbritt DNA. FAl 14C-DNA hybridized extensively only with BHT DNA, and SLl 14C-DNA reassociated with KlR and E49 DNA. DNA which hybridized extensively at 67 C also reassociated to a high degree at 75 C. Thermal elution of 14C-FAl-BHT duplexes showed that the hybrid duplexes were thermostable. The results indicate that S. mutans is a genetically heterogeneous species. The strains studied can be divided into three (possibly four) genetic groups, and these groups closely parallel antigenic groups. PMID:5551636

[Cloning and sequence analysis of full-length cDNA of secoisolariciresinol dehydrogenase of Dysosma versipellis].

PubMed

Xu, Li; Ding, Zhi-Shan; Zhou, Yun-Kai; Tao, Xue-Fen

2009-06-01

To obtain the full-length cDNA sequence of Secoisolariciresinol Dehydrogenase gene from Dysosma versipellis by RACE PCR,then investigate the character of Secoisolariciresinol Dehydrogenase gene. The full-length cDNA sequence of Secoisolariciresinol Dehydrogenase gene was obtained by 3'-RACE and 5'-RACE from Dysosma versipellis. We first reported the full cDNA sequences of Secoisolariciresinol Dehydrogenase in Dysosma versipellis. The acquired gene was 991bp in full length, including 5' untranslated region of 42bp, 3' untranslated region of 112bp with Poly (A). The open reading frame (ORF) encoding 278 amino acid with molecular weight 29253.3 Daltons and isolectric point 6.328. The gene accession nucleotide sequence number in GeneBank was EU573789. Semi-quantitative RT-PCR analysis revealed that the Secoisolariciresinol Dehydrogenase gene was highly expressed in stem. Alignment of the amino acid sequence of Secoisolariciresinol Dehydrogenase indicated there may be some significant amino acid sequence difference among different species. Obtain the full-length cDNA sequence of Secoisolariciresinol Dehydrogenase gene from Dysosma versipellis.

Cloning and identification of a cDNA that encodes a novel human protein with thrombospondin type I repeat domain, hPWTSR.

PubMed

Chen, Jin-Zhong; Wang, Shu; Tang, Rong; Yang, Quan-Sheng; Zhao, Enpeng; Chao, Yaoqiong; Ying, Kang; Xie, Yi; Mao, Yu-Min

2002-09-01

A cDNA was isolated from the fetal brain cDNA library by high throughput cDNA sequencing. The 2390 bp cDNA with an open reading fragment (ORF) of 816 bp encodes a 272 amino acids putative protein with a thrombospondin type I repeat (TSR) domain and a cysteine-rich region at the N-terminus, so it is named hPWTSR. We used Northern blot detected two bands with length of about 3 kb and 4 kb respectively, which expressed in human adult tissues with different intensities. The expression pattern was verified by RT-PCR, revealing that the transcripts were expressed ubiquitously in fetal tissues and human tumor tissues too. However, the transcript was detected neither in ovarian carcinoma GI-102 nor in lung carcinoma LX-1. Blast analysis against NCBI database revealed that the new gene contained at least 5 exons and located in human chromosome 6q22.33. Our results demonstrate that the gene is a novel member of TSR supergene family.

Characterization of embryo-specific genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sung, Z.R.

1988-01-01

The objective of the proposed research is to characterize the structure and function of a set of genes whose expression is regulated in embryo development, and that are not expressed in mature tissues -- the embryogenic genes. In order to isolate these genes, we immunized a rabbit with total extracts of somatic embryos of carrot, and enriched the anti-embryo antiserum for antibodies reacting with extracts of carrot somatic embryos. Using this enriched antiserum, we screened a lambda gt11 cDNA library constructed from embryo poly A{sup +} RNA, and isolated 10 cDNA clones that detect embryogenic mRNAs. Monospecific antibodies have beenmore » purified for proteins corresponding to each cDNA sequence. Four cDNA clones were further characterized in terms of the expression of their corresponding mRNA and protein in somatic embryos of carrot. In some cases, comparable gene sequences or products have been detected in somatic and zygotic embryos of other plant species. The characteristics of these 4 cDNA clones -- clone Nos. 8, 59, and 66 -- are described in this report. 3 figs.« less

A thermolabile aspartic proteinase from Mucor mucedo DSM 809: gene identification, cloning, and functional expression in Pichia pastoris.

PubMed

Yegin, Sirma; Fernandez-Lahore, Marcelo

2013-06-01

In this study, the cDNA encoding the aspartic proteinase of Mucor mucedo DSM 809 has been identified by RNA ligased-mediated and oligo-capping rapid amplification of cDNA ends (RACE) technique. The gene contained an open reading frame of 1,200 bp and encoded for a signal peptide of 21 amino acid residues. Two N-glycosylation sites were observed within the identified sequence. The proteinase gene was cloned into the vector pGAPZαA and expressed in Pichia pastoris X-33 for the first time. The protein has been secreted in functionally active form into the culture medium. The expression system does not require any acid activation process. The factors affecting the expression level were optimized in shaking flask cultures. Maximum enzyme production was observed with an initial medium pH of 3.5 at 20 °C and 220 rpm shaking speed utilizing 4 % glucose as a carbon and energy source. The enzyme was purified with cation exchange chromatography and further studies revealed that the enzyme was secreted in glycosylated form. The purified enzyme exhibited remarkable sensitivity to thermal treatment and became completely inactivated after incubation at 55 °C for 10 min. These results indicated that the recombinant proteinase could be considered as a potential rennet candidate for the cheese-making industry.

Quantitative Characterization of the T Cell Receptor Repertoire of Naïve and Memory Subsets Using an Integrated Experimental and Computational Pipeline Which Is Robust, Economical, and Versatile

PubMed Central

Oakes, Theres; Heather, James M.; Best, Katharine; Byng-Maddick, Rachel; Husovsky, Connor; Ismail, Mazlina; Joshi, Kroopa; Maxwell, Gavin; Noursadeghi, Mahdad; Riddell, Natalie; Ruehl, Tabea; Turner, Carolin T.; Uddin, Imran; Chain, Benny

2017-01-01

The T cell receptor (TCR) repertoire can provide a personalized biomarker for infectious and non-infectious diseases. We describe a protocol for amplifying, sequencing, and analyzing TCRs which is robust, sensitive, and versatile. The key experimental step is ligation of a single-stranded oligonucleotide to the 3′ end of the TCR cDNA. This allows amplification of all possible rearrangements using a single set of primers per locus. It also introduces a unique molecular identifier to label each starting cDNA molecule. This molecular identifier is used to correct for sequence errors and for effects of differential PCR amplification efficiency, thus producing more accurate measures of the true TCR frequency within the sample. This integrated experimental and computational pipeline is applied to the analysis of human memory and naive subpopulations, and results in consistent measures of diversity and inequality. After error correction, the distribution of TCR sequence abundance in all subpopulations followed a power law over a wide range of values. The power law exponent differed between naïve and memory populations, but was consistent between individuals. The integrated experimental and analysis pipeline we describe is appropriate to studies of T cell responses in a broad range of physiological and pathological contexts. PMID:29075258

The arbuscular mycorrhizal fungal protein glomalin is a putative homolog of heat shock protein 60.

PubMed

Gadkar, Vijay; Rillig, Matthias C

2006-10-01

Work on glomalin-related soil protein produced by arbuscular mycorrhizal (AM) fungi (AMF) has been limited because of the unknown identity of the protein. A protein band cross-reactive with the glomalin-specific antibody MAb32B11 from the AM fungus Glomus intraradices was partially sequenced using tandem liquid chromatography-mass spectrometry. A 17 amino acid sequence showing similarity to heat shock protein 60 (hsp 60) was obtained. Based on degenerate PCR, a full-length cDNA of 1773 bp length encoding the hsp 60 gene was isolated from a G. intraradices cDNA library. The ORF was predicted to encode a protein of 590 amino acids. The protein sequence had three N-terminal glycosylation sites and a string of GGM motifs at the C-terminal end. The GiHsp 60 ORF had three introns of 67, 76 and 131 bp length. The GiHsp 60 was expressed using an in vitro translation system, and the protein was purified using the 6xHis-tag system. A dot-blot assay on the purified protein showed that it was highly cross-reactive with the glomalin-specific antibody MAb32B11. The present work provides the first evidence for the identity of the glomalin protein in the model AMF G. intraradices, thus facilitating further characterization of this protein, which is of great interest in soil ecology.

Genomic organization of the neurofibromatosis 1 gene (NF1)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Y.; O`Connell, P.; Huntsman Breidenbach, H.

Neurofibromatosis 1 maps to chromosome band 17q11.2, and the NF1 locus has been partially characterized. Even though the full-length NF1 cDNA has been sequenced, the complete genomic structure of the NF1 gene has not been elucidated. The 5{prime} end of NF1 is embedded in a CpG island containing a NotI restriction site, and the remainder of the gene lies in the adjacent 350-kb NotI fragment. In our efforts to develop a comprehensive screen for NF1 mutations, we have isolated genomic DNA clones that together harbor the entire NF1 cDNA sequence. We have identified all intron-exon boundaries of the coding regionmore » and established that it is composed of 59 exons. Furthermore, we have defined the 3{prime}-untranslated region (3{prime}-UTR) of the NF1 gene; it spans approximately 3.5 kb of genomic DNA sequence and is continuous with the stop codon. Oligonucleotide primer pairs synthesized from exon-flanking DNA sequences were used in the polymerase chain reaction with cloned, chromosome 17-specific genomic DNA as template to amplify NF1 exons 1 through 27b and the exon containing the 3{prime}-UTR separately. This information should be useful for implementing a comprehensive NF1 mutation screen using genomic DNA as template. 41 refs., 3 figs., 2 tabs.« less

Effects of chronic restraint stress on body weight, food intake, and hypothalamic gene expressions in mice.

PubMed

Jeong, Joo Yeon; Lee, Dong Hoon; Kang, Sang Soo

2013-12-01

Stress affects body weight and food intake, but the underlying mechanisms are not well understood. We evaluated the changes in body weight and food intake of ICR male mice subjected to daily 2 hours restraint stress for 15 days. Hypothalamic gene expression profiling was analyzed by cDNA microarray. Daily body weight and food intake measurements revealed that both parameters decreased rapidly after initiating daily restraint stress. Body weights of stressed mice then remained significantly lower than the control body weights, even though food intake slowly recovered to 90% of the control intake at the end of the experiment. cDNA microarray analysis revealed that chronic restraint stress affects the expression of hypothalamic genes possibly related to body weight control. Since decreases of daily food intake and body weight were remarkable in days 1 to 4 of restraint, we examined the expression of food intake-related genes in the hypothalamus. During these periods, the expressions of ghrelin and pro-opiomelanocortin mRNA were significantly changed in mice undergoing restraint stress. Moreover, daily serum corticosterone levels gradually increased, while leptin levels significantly decreased. The present study demonstrates that restraint stress affects body weight and food intake by initially modifying canonical food intake-related genes and then later modifying other genes involved in energy metabolism. These genetic changes appear to be mediated, at least in part, by corticosterone.

Homologous cloning, characterization and expression of a new halophyte phytochelatin synthase gene in Suaeda salsa

NASA Astrophysics Data System (ADS)

Cong, Ming; Zhao, Jianmin; Lü, Jiasen; Ren, Zhiming; Wu, Huifeng

2016-09-01

The halophyte Suaeda salsa can grow in heavy metal-polluted areas along intertidal zones having high salinity. Since phytochelatins can eff ectively chelate heavy metals, it was hypothesized that S. salsa possessed a phytochelatin synthase (PCS) gene. In the present study, the cDNA of PCS was obtained from S. salsa (designated as SsPCS) using homologous cloning and the rapid amplification of cDNA ends (RACE). A sequence analysis revealed that SsPCS consisted of 1 916 bp nucleotides, encoding a polypeptide of 492 amino acids with one phytochelatin domain and one phytochelatin C domain. A similarity analysis suggested that SsPCS shared up to a 58.6% identity with other PCS proteins and clustered with PCS proteins from eudicots. There was a new kind of metal ion sensor motif in its C-terminal domain. The SsPCS transcript was more highly expressed in elongated and fibered roots and stems ( P<0.05) than in leaves. Lead and mercury exposure significantly enhanced the mRNA expression of SsPCS ( P<0.05). To the best of our knowledge, SsPCS is the second PCS gene cloned from a halophyte, and it might contain a diff erent metal sensing capability than the first PCS from Thellungiella halophila. This study provided a new view of halophyte PCS genes in heavy metal tolerance.

Molecular cloning of a family of xenobiotic-inducible drosophilid cytochrome P450s: Evidence for involvement in host-plant allelochemical resistance

PubMed Central

Danielson, Phillip B.; MacIntyre, Ross J.; Fogleman, James C.

1997-01-01

Cytochrome P450s constitute a superfamily of genes encoding mostly microsomal hemoproteins that play a dominant role in the metabolism of a wide variety of both endogenous and foreign compounds. In insects, xenobiotic metabolism (i.e., metabolism of insecticides and toxic natural plant compounds) is known to involve members of the CYP6 family of cytochrome P450s. Use of a 3′ RACE (rapid amplification of cDNA ends) strategy with a degenerate primer based on the conserved cytochrome P450 heme-binding decapeptide loop resulted in the amplification of four cDNA sequences representing another family of cytochrome P450 genes (CYP28) from two species of isoquinoline alkaloid-resistant Drosophila and the cosmopolitan species Drosophila hydei. The CYP28 family forms a monophyletic clade with strong regional homologies to the vertebrate CYP3 family and the insect CYP6 family (both of which are involved in xenobiotic metabolism) and to the insect CYP9 family (of unknown function). Induction of mRNA levels for three of the CYP28 cytochrome P450s by toxic host-plant allelochemicals (up to 11.5-fold) and phenobarbital (up to 49-fold) corroborates previous in vitro metabolism studies and suggests a potentially important role for the CYP28 family in determining patterns of insect–host-plant relationships through xenobiotic detoxification. PMID:9380713

Chalcone synthase genes from milk thistle (Silybum marianum): isolation and expression analysis.

PubMed

Sanjari, Sepideh; Shobbar, Zahra Sadat; Ebrahimi, Mohsen; Hasanloo, Tahereh; Sadat-Noori, Seyed-Ahmad; Tirnaz, Soodeh

2015-12-01

Silymarin is a flavonoid compound derived from milk thistle (Silybum marianum) seeds which has several pharmacological applications. Chalcone synthase (CHS) is a key enzyme in the biosynthesis of flavonoids; thereby, the identification of CHS encoding genes in milk thistle plant can be of great importance. In the current research, fragments of CHS genes were amplified using degenerate primers based on the conserved parts of Asteraceae CHS genes, and then cloned and sequenced. Analysis of the resultant nucleotide and deduced amino acid sequences led to the identification of two different members of CHS gene family,SmCHS1 and SmCHS2. Third member, full-length cDNA (SmCHS3) was isolated by rapid amplification of cDNA ends (RACE), whose open reading frame contained 1239 bp including exon 1 (190 bp) and exon 2 (1049 bp), encoding 63 and 349 amino acids, respectively. In silico analysis of SmCHS3 sequence contains all the conserved CHS sites and shares high homology with CHS proteins from other plants.Real-time PCR analysis indicated that SmCHS1 and SmCHS3 had the highest transcript level in petals in the early flowering stage and in the stem of five upper leaves, followed by five upper leaves in the mid-flowering stage which are most probably involved in anthocyanin and silymarin biosynthesis.

Cloning and expression of SgCYP450-4 from Siraitia grosvenorii.

PubMed

Tu, Dongping; Ma, Xiaojun; Zhao, Huan; Mo, Changming; Tang, Qi; Wang, Liuping; Huang, Jie; Pan, Limei

2016-11-01

CYP450 plays an essential role in the development and growth of the fruits of Siraitia grosvenorii . However, little is known about the SgCYP450-4 gene in S. grosvenorii . Here, based on transcriptome data, a full-length cDNA sequence of SgCYP450-4 was cloned by reverse transcriptase-polymerase chain reaction (RT-PCR) and rapid-amplification of cDNA ends (RACE) strategies. SgCYP450-4 is 1677 bp in length (GenBank accession No. AEM42985.1) and contains a complete open reading frame (ORF) of 1422 bp. The deduced protein was composed of 473 amino acids, the molecular weight is 54.01 kDa, the theoretical isoelectric point (PI) is 8.8, and the protein was predicted to possess cytochrome P450 domains. SgCYP450-4 gene was highly expressed in root, diploid fruit and fruit treated with hormone and pollination. At 10 days after treatment with pollination and hormones, the expression of Sg CYP450-4 had the highest level and then decreased over time, which was consistent with the development of fruits of S. Grosvenorii . Hormonal treatment could significantly induce the expression of SgCYP450-4 . These results provide a reference for regulation of fruit development and the use of parthenocarpy to generate seedless fruit, and provide a scientific basis for the production of growth regulator application agents.

Molecular Cloning, Bioinformatic Analysis, and Expression of Bombyx mori Lebocin 5 Gene Related to Beauveria bassiana Infection.

PubMed

Lü, Dingding; Hou, Chengxiang; Qin, Guangxing; Gao, Kun; Chen, Tian; Guo, Xijie

2017-01-01

A full-length cDNA of lebocin 5 (BmLeb5) was first cloned from silkworm, Bombyx mori , by rapid amplification of cDNA ends. The BmLeb5 gene is 808 bp in length and the open reading frame encodes a 179-amino acid hydroxyproline-rich peptide. Bioinformatic analysis results showed that BmLeb5 owns an O-glycosylation site and four RXXR motifs as other lebocins. Sequence similarity and phylogenic analysis results indicated that lebocins form a multiple gene family in silkworm as cecropins. Quantitative real-time PCR analysis revealed that BmLeb5 was highest expressed in the fat body. In the silkworm larvae infected by Beauveria bassiana , the expression level of BmLeb5 was upregulated in the fat body and hemolymph which are the most important immune tissues in silkworm. The recombinant protein of BmLeb5 was for the first time successfully expressed with prokaryotic expression system and purified. There are no reports so far that the expression of lebocins could be induced by entomopathogenic fungus. Our study suggested that BmLeb5 might play an important role in the immune response of silkworm to defend B. bassiana infection. The results also provided helpful information for further studying the lebocin family functioned in antifungal immune response in the silkworm.

Shark (Scyliorhinus torazame) metallothionein: cDNA cloning, genomic sequence, and expression analysis.

PubMed

Cho, Young Sun; Choi, Buyl Nim; Ha, En-Mi; Kim, Ki Hong; Kim, Sung Koo; Kim, Dong Soo; Nam, Yoon Kwon

2005-01-01

Novel metallothionein (MT) complementary DNA and genomic sequences were isolated from a cartilaginous shark species, Scyliorhinus torazame. The full-length open reading frame (ORF) of shark MT cDNA encoded 68 amino acids with a high cysteine content (29%). The genomic ORF sequence (932 bp) of shark MT isolated by polymerase chain reaction (PCR) comprised 3 exons with 2 interventing introns. Shark MT sequence shared many conserved features with other vertebrate MTs: overall amino acid identities of shark MT ranged from 47% to 57% with fish MTs, and 41% to 62% with mammalian MTs. However, in addition to these conserved characteristics, shark MT sequence exhibited some unique characteristics. It contained 4 extra amino acids (Lys-Ala-Gly-Arg) at the end of the beta-domain, which have not been reported in any other vertebrate MTs. The last amino acid residue at the C-terminus was Ser, which also has not been reported in fish and mammalian MTs. The MT messenger RNA levels in shark liver and kidney, assessed by semiquantitative reverse transcriptase PCR and RNA blot hybridization, were significantly affected by experimental exposures to heavy metals (cadmium, copper, and zinc). Generally, the transcriptional activation of shark MT gene was dependent on the dose (0-10 mg/kg body weight for injection and 0-20 microM for immersion) and duration (1-10 days); zinc was a more potent inducer than copper and cadmium.

Molecular cloning of a C-type lectin with two CRD domains from the banana shrimp Fenneropenaeus merguiensis: early gene up-regulation after Vibrio harveyi infection.

PubMed

Rattanaporn, Onnicha; Utarabhand, Prapaporn

2011-02-01

A diverse class of pattern-recognition proteins called lectins play important roles in shrimp innate immunity. A novel C-type lectin gene (FmLC) was cloned from the hepatopancreas of banana shrimp Fenneropenaeus merguiensis by means of PCR and 5' and 3' rapid amplification of cDNA ends (RACE). The full-length cDNA consists of 1118 bp with one 1002 bp open reading frame, encoding 333 amino acids. Its deduced amino acid sequence contains a putative signal peptide of 20 amino acids. FmLC contains two carbohydrate recognition domains, CRD1 and CRD2, that share only 30% identity with each other. The first CRD comprises a QPD motif with specificity for binding galactose and a single Ca(2+) binding site, while the second CRD consists of an EPN motif for a mannose-specific binding site. FmLC had a close evolutionary relationship to other dual-CRD lectins of penaeid shrimp. Expression results showed that transcripts of FmLC were detected only in the hepatopancreas, none was found in other tissues. After challenging either whole shrimp or hepatopancreas tissue fragments with Vibrioharveyi, the expression of FmLC was up-regulated. This indicates that FmLC is inducible and may be involved in a shrimp immune response to recognize potential bacterial pathogens. Copyright © 2010 Elsevier Inc. All rights reserved.

Design and screening of M13 phage display cDNA libraries.

PubMed

Georgieva, Yuliya; Konthur, Zoltán

2011-02-17

The last decade has seen a steady increase in screening of cDNA expression product libraries displayed on the surface of filamentous bacteriophage. At the same time, the range of applications extended from the identification of novel allergens over disease markers to protein-protein interaction studies. However, the generation and selection of cDNA phage display libraries is subjected to intrinsic biological limitations due to their complex nature and heterogeneity, as well as technical difficulties regarding protein presentation on the phage surface. Here, we review the latest developments in this field, discuss a number of strategies and improvements anticipated to overcome these challenges making cDNA and open reading frame (ORF) libraries more readily accessible for phage display. Furthermore, future trends combining phage display with next generation sequencing (NGS) will be presented.

The construction, identification and partial characterization of plasmids containing guinea-pig milk protein complementary DNA sequences.

PubMed Central

Craig, R K; Hall, L; Parker, D; Campbell, P N

1981-01-01

A complementary DNA (cDNA) plasmid library has been constructed in the plasmid pAT153, using poly(A)-containing RNA isolated from the lactating guinea-pig mammary gland as the starting material. Double stranded cDNA was inserted into the EcoRI site of the plasmid using poly(dA . dT) tails, then transformed into Escherichia coli HB101. From the resulting colonies we have selected and partially characterized plasmids containing cDNA copies of the mRNAs for casein A, casein B, casein C and alpha-lactalbumin. However, the proportion containing casein C cDNA was exceptionally low, and these contained at best 60% of the mRNA sequence. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. PMID:7306038

Primer design for a prokaryotic differential display RT-PCR.

PubMed Central

Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

1997-01-01

We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR. PMID:9108168

Primer design for a prokaryotic differential display RT-PCR.

PubMed

Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

1997-05-01

We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.

Cloning and characterization of WRKY gene homologs in Chieh-qua (Benincasa hispida Cogn. var. Chieh-qua How) and their expression in response to fusaric acid treatment.

PubMed

Mao, Yizhou; Jiang, Biao; Peng, Qingwu; Liu, Wenrui; Lin, Yue; Xie, Dasen; He, Xiaoming; Li, Shaoshan

2017-05-01

The WRKY transcription factors play an important role in plant resistance for biotic and abiotic stresses. In the present study, we cloned 10 WRKY gene homologs (CqWRKY) in Chieh-qua (Benincasa hispida Cogn. var. Chieh-qua) using the rapid-amplification of cDNA ends (RACE) or homology-based cloning methods. We characterized the structure of these CqWRKY genes. Phylogenetic analysis of these sequences with cucumber homologs suggested possible structural conservation of these genes among cucurbit crops. We examined the expression levels of these genes in response to fusaric acid (FA) treatment between resistant and susceptible Chieh-qua lines with quantitative real-time PCR. All genes could be upregulated upon FA treatment, but four CqWRKY genes exhibited differential expression between resistant and susceptible lines before and after FA application. CqWRKY31 seemed to be a positive regulator while CqWRKY1, CqWRKY23 and CqWRKY53 were negative regulators of fusaric resistance. This is the first report of characterization of WRKY family genes in Chieh-qua. The results may also be useful in breeding Chieh-qua for Fusarium wilt resistance.

A meta-data based method for DNA microarray imputation.

PubMed

Jörnsten, Rebecka; Ouyang, Ming; Wang, Hui-Yu

2007-03-29

DNA microarray experiments are conducted in logical sets, such as time course profiling after a treatment is applied to the samples, or comparisons of the samples under two or more conditions. Due to cost and design constraints of spotted cDNA microarray experiments, each logical set commonly includes only a small number of replicates per condition. Despite the vast improvement of the microarray technology in recent years, missing values are prevalent. Intuitively, imputation of missing values is best done using many replicates within the same logical set. In practice, there are few replicates and thus reliable imputation within logical sets is difficult. However, it is in the case of few replicates that the presence of missing values, and how they are imputed, can have the most profound impact on the outcome of downstream analyses (e.g. significance analysis and clustering). This study explores the feasibility of imputation across logical sets, using the vast amount of publicly available microarray data to improve imputation reliability in the small sample size setting. We download all cDNA microarray data of Saccharomyces cerevisiae, Arabidopsis thaliana, and Caenorhabditis elegans from the Stanford Microarray Database. Through cross-validation and simulation, we find that, for all three species, our proposed imputation using data from public databases is far superior to imputation within a logical set, sometimes to an astonishing degree. Furthermore, the imputation root mean square error for significant genes is generally a lot less than that of non-significant ones. Since downstream analysis of significant genes, such as clustering and network analysis, can be very sensitive to small perturbations of estimated gene effects, it is highly recommended that researchers apply reliable data imputation prior to further analysis. Our method can also be applied to cDNA microarray experiments from other species, provided good reference data are available.

Rapid and label-free electrochemical DNA biosensor for detecting hepatitis A virus.

PubMed

Manzano, Marisa; Viezzi, Sara; Mazerat, Sandra; Marks, Robert S; Vidic, Jasmina

2018-02-15

Diagnostic systems that can deliver highly specific and sensitive detection of hepatitis A virus (HAV) in food and water are of particular interest in many fields including food safety, biosecurity and control of outbreaks. Our aim was the development of an electrochemical method based on DNA hybridization to detect HAV. A ssDNA probe specific for HAV (capture probe) was designed and tested on DNAs from various viral and bacterial samples using Nested-Reverse Transcription Polymerase Chain Reaction (nRT-PCR). To develop the electrochemical device, a disposable gold electrode was functionalized with the specific capture probe and tested on complementary ssDNA and on HAV cDNA. The DNA hybridization on the electrode was measured through the monitoring of the oxidative peak potential of the indicator tripropylamine by cyclic voltammetry. To prevent non-specific binding the gold surface was treated with 3% BSA before detection. High resolution atomic force microscopy (AFM) confirmed the efficiency of electrode functionalization and on-electrode hybridization. The proposed device showed a limit of detection of 0.65pM for the complementary ssDNA and 6.94fg/µL for viral cDNA. For a comparison, nRT-PCR quantified the target HAV cDNA with a limit of detection of 6.4fg/µL. The DNA-sensor developed can be adapted to a portable format to be adopted as an easy-to- use and low cost method for screening HAV in contaminated food and water. In addition, it can be useful for rapid control of HAV infections as it takes only a few minutes to provide the results. Copyright © 2017. Published by Elsevier B.V.

Multiple primer extension by DNA polymerase on a novel plastic DNA array coated with a biocompatible polymer

PubMed Central

Kinoshita, Kenji; Fujimoto, Kentaro; Yakabe, Toru; Saito, Shin; Hamaguchi, Yuzo; Kikuchi, Takayuki; Nonaka, Ken; Murata, Shigenori; Masuda, Daisuke; Takada, Wataru; Funaoka, Sohei; Arai, Susumu; Nakanishi, Hisao; Yokoyama, Kanehisa; Fujiwara, Kazuhiko; Matsubara, Kenichi

2007-01-01

DNA microarrays are routinely used to monitor gene expression profiling and single nucleotide polymorphisms (SNPs). However, for practically useful high performance, the detection sensitivity is still not adequate, leaving low expression genes undetected. To resolve this issue, we have developed a new plastic S-BIO® PrimeSurface® with a biocompatible polymer; its surface chemistry offers an extraordinarily stable thermal property for a lack of pre-activated glass slide surface. The oligonucleotides immobilized on this substrate are robust in boiling water and show no significant loss of hybridization activity during dissociation treatment. This allowed us to hybridize the templates, extend the 3′ end of the immobilized DNA primers on the S-Bio® by DNA polymerase using deoxynucleotidyl triphosphates (dNTP) as extender units, release the templates by denaturalization and use the same templates for a second round of reactions similar to that of the PCR method. By repeating this cycle, the picomolar concentration range of the template oligonucleotide can be detected as stable signals via the incorporation of labeled dUTP into primers. This method of Multiple Primer EXtension (MPEX) could be further extended as an alternative route for producing DNA microarrays for SNP analyses via simple template preparation such as reverse transcript cDNA or restriction enzyme treatment of genome DNA. PMID:17135189

Molecular cloning of actin genes in Trichomonas vaginalis and phylogeny inferred from actin sequences.

PubMed

Bricheux, G; Brugerolle, G

1997-08-01

The parasitic protozoan Trichomonas vaginalis is known to contain the ubiquitous and highly conserved protein actin. A genomic library and a cDNA library have been screened to identify and clone the actin gene(s) of T. vaginalis. The nucleotide sequence of one gene and its flanking regions have been determined. The open reading frame encodes a protein of 376 amino acids. The sequence is not interrupted by any introns and the promoter could be represented by a 10 bp motif close to a consensus motif also found upstream of most sequenced T. vaginalis genes. The five different clones isolated from the cDNA library have similar sequences and encode three actin proteins differing only by one or two amino acids. A phylogenetic analysis of 31 actin sequences by distance matrix and parsimony methods, using centractin as outgroup, gives congruent trees with Parabasala branching above Diplomonadida.

Transcript Quantification of Genes Involved in Steviol Glycoside Biosynthesis in Stevia rebaudiana Bertoni by Real-Time Polymerase Chain Reaction (RT-PCR).

PubMed

Modi, Arpan; Kumar, Nitish; Narayanan, Subhash

2016-01-01

Stevia (Stevia rebaudiana Bertoni) is a medicinal plant having sweet, diterpenoid glycosides known as steviol glycosides which are 200-300 times sweeter than sucrose (0.4 % solution). They are synthesized mainly in the leaves via plastid localized 2-C-methyl-D-erythrose-4-phosphate pathway (MEP pathway). Fifteen genes are involved in the formation of these glycosides. In the present protocol, a method for the quantification of transcripts of these genes is shown. The work involves RNA extraction and cDNA preparation, and therefore, procedures for the confirmation of DNA-free cDNA preparation have also been illustrated. Moreover, details of plant treatments are not mentioned as this protocol may apply to relative gene expression profile in any medicinal plant with any treatment. The treatments are numbered as T0 (Control), T1, T2, T3, and T4.

Localization of human coagulation factor VIII (hFVIII) in transgenic rabbit by FISH-TSA: identification of transgene copy number and transmission to the next generation.

PubMed

Krylov, V; Tlapáková, T; Mácha, J; Curlej, J; Ryban, L; Chrenek, P

2008-01-01

For chromosomal localization of the hFVIII human transgene in F2 and F3 generation of transgenic rabbits, FISH-TSA was applied. A short cDNA probe (1250 bp) targeted chromosomes 3, 7, 8, 9 and 18 of an F2 male (animal 1-3-8). Two transgenic offspring (F3) revealed signal positions in chromosome 3 and chromosomes 3 and 7, respectively. Sequencing and structure analysis of the rabbit orthologous gene revealed high similarity to its human counterpart. Part of the sequenced cDNA (1310 bp) served as a probe for FISH-TSA analysis. The rabbit gene was localized in the q arm terminus of the X chromosome. This result is in agreement with reciprocal chromosome painting between the rabbit and the human. The presented FISH-TSA method provides strong signals without any interspecies reactivity.

Triazophos up-regulated gene expression in the female brown planthopper, Nilaparvata lugens.

PubMed

Bao, Yan-Yuan; Li, Bao-Ling; Liu, Zhao-Bu; Xue, Jian; Zhu, Zeng-Rong; Cheng, Jia-An; Zhang, Chuan-Xi

2010-09-01

The widespread use of insecticides has caused the resurgence of the brown planthopper, Nilaparvata lugens, in Asia. In this study, we investigated an organo-phosphorous insecticide, triazophos, and its ability to induce gene expression variation in female N. lugens nymphs just before emergence. By using the suppression subtractive hybridization method, a triazophos-induced cDNA library was constructed. In total, 402 differentially expressed cDNA clones were obtained. Real-time qPCR analysis confirmed that triazophos up-regulated the expression of six candidate genes at the transcript level in nymphs on day 3 of the 5th instar. These genes encode N. lugens vitellogenin, bystin, multidrug resistance protein (MRP), purine nucleoside phosphorylase (PNP), pyrroline-5-carboxylate reductase (P5CR) and carboxylesterase. Our results imply that the up-regulation of these genes may be involved in the induction of N. lugens female reproduction or resistance to insecticides.

A new approach for cloning hLIF cDNA from genomic DNA isolated from the oral mucous membrane.

PubMed

Cui, Y H; Zhu, G Q; Chen, Q J; Wang, Y F; Yang, M M; Song, Y X; Wang, J G; Cao, B Y

2011-11-25

Complementary DNA (cDNA) is valuable for investigating protein structure and function in the study of life science, but it is difficult to obtain by traditional reverse transcription. We employed a novel strategy to clone human leukemia inhibitory factor (hLIF) gene cDNA from genomic DNA, which was directly isolated from the mucous membrane of mouth. The hLIF sequence, which is 609 bp long and is composed of three exons, can be acquired within a few hours by amplifying each exon and splicing all of them using overlap-PCR. This new approach developed is simple, time- and cost-effective, without RNA preparation or cDNA synthesis, and is not limited to the specific tissues for a particular gene and the expression level of the gene.

Increased yield of PCR products by addition of T4 gene 32 protein to the SMART PCR cDNA synthesis system.

PubMed

Villalva, C; Touriol, C; Seurat, P; Trempat, P; Delsol, G; Brousset, P

2001-07-01

Under certain conditions, T4 gene 32 protein is known to increase the efficiency of different enzymes, such as Taq DNA polymerase, reverse transcriptase, and telomerase. In this study, we compared the efficiency of the SMART PCR cDNA synthesis kit with and without the T4 gene 32 protein. The use of this cDNA synthesis procedure, in combination with T4 gene 32 protein, increases the yield of RT-PCR products from approximately 90% to 150%. This effect is even observed for long mRNA templates and low concentrations of total RNA (25 ng). Therefore, we suggest the addition of T4 gene 32 protein in the RT-PCR mixture to increase the efficiency of cDNA synthesis, particularly in cases when low amounts of tissue are used.

Single cell transcriptomics of hypothalamic warm sensitive neurons that control core body temperature and fever response Signaling asymmetry and an extension of chemical neuroanatomy.

PubMed

Eberwine, James; Bartfai, Tamas

2011-03-01

We report on an 'unbiased' molecular characterization of individual, adult neurons, active in a central, anterior hypothalamic neuronal circuit, by establishing cDNA libraries from each individual, electrophysiologically identified warm sensitive neuron (WSN). The cDNA libraries were analyzed by Affymetrix microarray. The presence and frequency of cDNAs were confirmed and enhanced with Illumina sequencing of each single cell cDNA library. cDNAs encoding the GABA biosynthetic enzyme Gad1 and of adrenomedullin, galanin, prodynorphin, somatostatin, and tachykinin were found in the WSNs. The functional cellular and in vivo studies on dozens of the more than 500 neurotransmitters, hormone receptors and ion channels, whose cDNA was identified and sequence confirmed, suggest little or no discrepancy between the transcriptional and functional data in WSNs; whenever agonists were available for a receptor whose cDNA was identified, a functional response was found. Sequencing single neuron libraries permitted identification of rarely expressed receptors like the insulin receptor, adiponectin receptor 2 and of receptor heterodimers; information that is lost when pooling cells leads to dilution of signals and mixing signals. Despite the common electrophysiological phenotype and uniform Gad1 expression, WSN transcriptomes show heterogeneity, suggesting strong epigenetic influence on the transcriptome. Our study suggests that it is well-worth interrogating the cDNA libraries of single neurons by sequencing and chipping. Copyright © 2010 Elsevier Inc. All rights reserved.

Germacrene C synthase from Lycopersicon esculentum cv. VFNT Cherry tomato: cDNA isolation, characterization, and bacterial expression of the multiple product sesquiterpene cyclase

PubMed Central

Colby, Sheila M.; Crock, John; Dowdle-Rizzo, Barbara; Lemaux, Peggy G.; Croteau, Rodney

1998-01-01

Germacrene C was found by GC-MS and NMR analysis to be the most abundant sesquiterpene in the leaf oil of Lycopersicon esculentum cv. VFNT Cherry, with lesser amounts of germacrene A, guaia-6,9-diene, germacrene B, β-caryophyllene, α-humulene, and germacrene D. Soluble enzyme preparations from leaves catalyzed the divalent metal ion-dependent cyclization of [1-3H]farnesyl diphosphate to these same sesquiterpene olefins, as determined by radio-GC. To obtain a germacrene synthase cDNA, a set of degenerate primers was constructed based on conserved amino acid sequences of related terpenoid cyclases. With cDNA prepared from leaf epidermis-enriched mRNA, these primers amplified a 767-bp fragment that was used as a hybridization probe to screen the cDNA library. Thirty-one clones were evaluated for functional expression of terpenoid cyclase activity in Escherichia coli by using labeled geranyl, farnesyl, and geranylgeranyl diphosphates as substrates. Nine cDNA isolates expressed sesquiterpene synthase activity, and GC-MS analysis of the products identified germacrene C with smaller amounts of germacrene A, B, and D. None of the expressed proteins was active with geranylgeranyl diphosphate; however, one truncated protein converted geranyl diphosphate to the monoterpene limonene. The cDNA inserts specify a deduced polypeptide of 548 amino acids (Mr = 64,114), and sequence comparison with other plant sesquiterpene cyclases indicates that germacrene C synthase most closely resembles cotton δ-cadinene synthase (50% identity). PMID:9482865

Characterization of cDNA for human tripeptidyl peptidase II: The N-terminal part of the enzyme is similar to subtilisin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tomkinson, B.; Jonsson, A-K

1991-01-01

Tripeptidyl peptidase II is a high molecular weight serine exopeptidase, which has been purified from rat liver and human erythrocytes. Four clones, representing 4453 bp, or 90{percent} of the mRNA of the human enzyme, have been isolated from two different cDNA libraries. One clone, designated A2, was obtained after screening a human B-lymphocyte cDNA library with a degenerated oligonucleotide mixture. The B-lymphocyte cDNA library, obtained from human fibroblasts, were rescreened with a 147 bp fragment from the 5{prime} part of the A2 clone, whereby three different overlapping cDNA clones could be isolated. The deduced amino acid sequence, 1196 amino acidmore » residues, corresponding to the longest open rading frame of the assembled nucleotide sequence, was compared to sequences of current databases. This revealed a 56{percent} similarity between the bacterial enzyme subtilisin and the N-terminal part of tripeptidyl peptidase II. The enzyme was found to be represented by two different mRNAs of 4.2 and 5.0 kilobases, respectively, which probably result from the utilziation of two different polyadenylation sites. Futhermore, cDNA corresponding to both the N-terminal and C-terminal part of tripeptidyl peptidase II hybridized with genomic DNA from mouse, horse, calf, and hen, even under fairly high stringency conditions, indicating that tripeptidyl peptidase II is highly conserved.« less

Liposomal gene transfer of keratinocyte growth factor improves wound healing by altering growth factor and collagen expression.

PubMed

Pereira, Clifford T; Herndon, David N; Rocker, Roland; Jeschke, Marc G

2007-05-15

Growth factors affect the complex cascade of wound healing; however, interaction between different growth factors during dermal and epidermal regeneration are still not entirely defined. In the present study, we thought to determine the interaction between keratinocyte growth factor (KGF) administered as liposomal cDNA with other dermal and epidermal growth factors and collagen synthesis in an acute wound. Rats received an acute wound and were divided into two groups to receive weekly subcutaneous injections of liposomes plus the Lac-Z gene (0.22 microg, vehicle), or liposomes plus the KGF cDNA (2.2 microg) and Lac-Z gene (0.22 microg). Histological and immunohistochemical techniques were used to determine growth factor, collagen expression, and dermal and epidermal structure. KGF cDNA increased insulin-like growth factor-I (IGF-I), insulin-like growth factor binding protein-3 (IGFBP-3), and fibroblast growth factor (FGF), decreased transforming growth factor-beta (TGF-beta), while it had no effect on platelet-derived growth factor (PDGF) levels in the wound. KGF cDNA significantly increased collagen Type IV at both the wound edge as well as the wound bed, while it had no effect on collagen Type I and III. KGF cDNA increased re-epithelialization, improved dermal regeneration, and increased neovascularization. Exogenous administered KGF cDNA causes increases in IGF-I, IGF-BP3, FGF, and collagen IV and decreases TGF-beta concentration. KGF gene transfer accelerates wound healing without causing an increase in collagen I or III.

17q Inversion involving the neurofibromatosis type one locus in a family with neurofibromatosis type one

DOE Office of Scientific and Technical Information (OSTI.GOV)

Asamoah, A.; North, K.; Wagstaff, J.

We report a family with a paracentric inversion of the long arm of chromosome 17 [inv(17)(q11.2q25.1)] and neurofibromatosis type one (NF1). The family was ascertained because of NF1 and multiple miscarriages. Fluorescence in situ hybridization using cosmid probes from opposite ends of the NF1 gene confirmed that the inversion gel electrophoresis we have found that the inversion separates cDNA probes FB5D and AE25, which are normally adjacent to one published report of a gross chromosomal rearrangement responsible for NF1. The features in this family are typical for NF1, and are not unusually severe. 26 refs., 5 figs.

Molecular characterization of an ependymin precursor from goldfish brain.

PubMed

Königstorfer, A; Sterrer, S; Eckerskorn, C; Lottspeich, F; Schmidt, R; Hoffmann, W

1989-01-01

Ependymins are thought to be implicated in fundamental processes involved in plasticity of the goldfish CNS. Gas-phase sequencing of purified ependymins beta and gamma revealed that they share the same N-terminal sequence. Each sequence displays microheterogeneities at several positions. Based on the protein sequences obtained, we constructed synthetic oligonucleotides and used them as hybridization probes for screening cDNA libraries of goldfish brain. In this article we describe the full-length sequence of a mRNA encoding a precursor of ependymins. A cleavable signal sequence characteristic of secretory proteins is located at the N-terminal end, followed directly by the ependymin sequence. Also, two potential N-glycosylation sites were detected. A computer search revealed that ependymins form a novel family of unique proteins.

Optimization of cDNA microarrays procedures using criteria that do not rely on external standards.

PubMed

Bruland, Torunn; Anderssen, Endre; Doseth, Berit; Bergum, Hallgeir; Beisvag, Vidar; Laegreid, Astrid

2007-10-18

The measurement of gene expression using microarray technology is a complicated process in which a large number of factors can be varied. Due to the lack of standard calibration samples such as are used in traditional chemical analysis it may be a problem to evaluate whether changes done to the microarray procedure actually improve the identification of truly differentially expressed genes. The purpose of the present work is to report the optimization of several steps in the microarray process both in laboratory practices and in data processing using criteria that do not rely on external standards. We performed a cDNA microarry experiment including RNA from samples with high expected differential gene expression termed "high contrasts" (rat cell lines AR42J and NRK52E) compared to self-self hybridization, and optimized a pipeline to maximize the number of genes found to be differentially expressed in the "high contrasts" RNA samples by estimating the false discovery rate (FDR) using a null distribution obtained from the self-self experiment. The proposed high-contrast versus self-self method (HCSSM) requires only four microarrays per evaluation. The effects of blocking reagent dose, filtering, and background corrections methodologies were investigated. In our experiments a dose of 250 ng LNA (locked nucleic acid) dT blocker, no background correction and weight based filtering gave the largest number of differentially expressed genes. The choice of background correction method had a stronger impact on the estimated number of differentially expressed genes than the choice of filtering method. Cross platform microarray (Illumina) analysis was used to validate that the increase in the number of differentially expressed genes found by HCSSM was real. The results show that HCSSM can be a useful and simple approach to optimize microarray procedures without including external standards. Our optimizing method is highly applicable to both long oligo-probe microarrays which have become commonly used for well characterized organisms such as man, mouse and rat, as well as to cDNA microarrays which are still of importance for organisms with incomplete genome sequence information such as many bacteria, plants and fish.

Optimization of cDNA microarrays procedures using criteria that do not rely on external standards

PubMed Central

Bruland, Torunn; Anderssen, Endre; Doseth, Berit; Bergum, Hallgeir; Beisvag, Vidar; Lægreid, Astrid

2007-01-01

Background The measurement of gene expression using microarray technology is a complicated process in which a large number of factors can be varied. Due to the lack of standard calibration samples such as are used in traditional chemical analysis it may be a problem to evaluate whether changes done to the microarray procedure actually improve the identification of truly differentially expressed genes. The purpose of the present work is to report the optimization of several steps in the microarray process both in laboratory practices and in data processing using criteria that do not rely on external standards. Results We performed a cDNA microarry experiment including RNA from samples with high expected differential gene expression termed "high contrasts" (rat cell lines AR42J and NRK52E) compared to self-self hybridization, and optimized a pipeline to maximize the number of genes found to be differentially expressed in the "high contrasts" RNA samples by estimating the false discovery rate (FDR) using a null distribution obtained from the self-self experiment. The proposed high-contrast versus self-self method (HCSSM) requires only four microarrays per evaluation. The effects of blocking reagent dose, filtering, and background corrections methodologies were investigated. In our experiments a dose of 250 ng LNA (locked nucleic acid) dT blocker, no background correction and weight based filtering gave the largest number of differentially expressed genes. The choice of background correction method had a stronger impact on the estimated number of differentially expressed genes than the choice of filtering method. Cross platform microarray (Illumina) analysis was used to validate that the increase in the number of differentially expressed genes found by HCSSM was real. Conclusion The results show that HCSSM can be a useful and simple approach to optimize microarray procedures without including external standards. Our optimizing method is highly applicable to both long oligo-probe microarrays which have become commonly used for well characterized organisms such as man, mouse and rat, as well as to cDNA microarrays which are still of importance for organisms with incomplete genome sequence information such as many bacteria, plants and fish. PMID:17949480

Application of Reverse Transcriptase-PCR-DGGE as a rapid method for routine determination of Vibrio spp. in foods.

PubMed

Chahorm, Kanchana; Prakitchaiwattana, Cheunjit

2018-01-02

The aim of this research was to evaluate the feasibility of PCR-DGGE and Reverse Transcriptase-PCR-DGGE techniques for rapid detection of Vibrio species in foods. Primers GC567F and 680R were initially evaluated for amplifying DNA and cDNA of ten references Vibrio species by PCR method. The GC-clamp PCR amplicons were separated according to their sequences by the DGGE using 10% (w/v) polyacrylamide gel containing 45-70% urea and formamide denaturants. Two pair of Vibrio species, which could not be differentiated on the gel, was Vibrio fluvialis - Vibrio furnissii and Vibrio parahaemolyticus - Vibrio harveyi. To determine the detection limit, in the community of 10 reference strains containing the same viable population, distinct DNA bands of 3 species; Vibrio cholerae, Vibrio mimicus and Vibrio alginolyticus were consistently observed by PCR-DGGE technique. In fact, 5 species; Vibrio cholerae, Vibrio mimicus, Vibrio alginolyticus, Vibrio parahaemolyticus and Vibrio fluvialis consistently observed by Reverse Transcriptase-PCR-DGGE. In the community containing different viable population increasing from 10 2 to 10 5 CFU/mL, PCR-DGGE analysis only detected the two most prevalent species, while RT-PCR-DGGE detected the five most prevalent species. Therefore, Reverse Transcriptase-PCR-DGGE was also selected for detection of various Vibrio cell conditions, including viable cell (VC), injured cells from frozen cultures (IVC) and injured cells from frozen cultures with pre-enrichment (PIVC). It was found that cDNA band of all cell conditions gave the same migratory patterns, except that multiple cDNA bands of Plesiomonas shigelloides under IVC and PIVC conditions were found. When Reverse Transcriptase-PCR-DGGE was used for detecting Vibrio parahaemolyticus in the pathogen-spiked food samples, Vibrio parahaemolyticus could be detected in the spiked samples containing at least 10 2 CFU/g of this pathogen. The results obtained also corresponded to standard method (USFDA, 2004). In comparison with the detection of the Vibrio profiles in fourteen food samples using standard method, Reverse Transcriptase-PCR-DGGE resulted in 100%, 75% and 50% similarity in 3, 1 and 6 food samples, respectively. Copyright © 2017 Elsevier B.V. All rights reserved.

Utilization of a tobacco rattle virus vector to clone an Nicotiana benthamiana cDNA library for VIGS

USDA-ARS?s Scientific Manuscript database

Virus-induced gene silencing (VIGS) is an efficient and rapid method to identify plant gene functions. One of the most widely used VIGS vectors is Tobacco rattle virus (TRV) which has been used successfully for RNA interference (RNAi) in N. benthamiana and tomato. We previously modified a TRV VIGS v...

Anti-NGF Local Therapy for Autonomic Dysreflexia in Spinal Cord Injury

DTIC Science & Technology

2012-10-01

propyl ]-N,N,N trimethylammonium methylsulfate) were made by thin film hydration method and hydrated with nuclease free water with the final lipid...isolation method (Qiagen, Valencia CA). Synthesis of cDNA was performed as described previously (Takimoto et al., 2002). These primers were designed to...probe synthesis . Primers used for the cloning were as follows: Kv4.1 5’-cacagacgagctaactttcag-3′ and 5′-tcacagggaagagatcttgac-3′ (GenBank ID: 116695

Flow cytometric purification of Colletotrichum higginsianum biotrophic hyphae from Arabidopsis leaves for stage-specific transcriptome analysis.

PubMed

Takahara, Hiroyuki; Dolf, Andreas; Endl, Elmar; O'Connell, Richard

2009-08-01

Generation of stage-specific cDNA libraries is a powerful approach to identify pathogen genes that are differentially expressed during plant infection. Biotrophic pathogens develop specialized infection structures inside living plant cells, but sampling the transcriptome of these structures is problematic due to the low ratio of fungal to plant RNA, and the lack of efficient methods to isolate them from infected plants. Here we established a method, based on fluorescence-activated cell sorting (FACS), to purify the intracellular biotrophic hyphae of Colletotrichum higginsianum from homogenates of infected Arabidopsis leaves. Specific selection of viable hyphae using a fluorescent vital marker provided intact RNA for cDNA library construction. Pilot-scale sequencing showed that the library was enriched with plant-induced and pathogenicity-related fungal genes, including some encoding small, soluble secreted proteins that represent candidate fungal effectors. The high purity of the hyphae (94%) prevented contamination of the library by sequences derived from host cells or other fungal cell types. RT-PCR confirmed that genes identified in the FACS-purified hyphae were also expressed in planta. The method has wide applicability for isolating the infection structures of other plant pathogens, and will facilitate cell-specific transcriptome analysis via deep sequencing and microarray hybridization, as well as proteomic analyses.

Notification and management of congenital syphilis in the Northern Territory 2009 to 2014.

PubMed

McLeod, Charlie; Su, Jiunn-Yih; Francis, Joshua R; Ishwar, Alice; Ryder, Nathan

2015-09-30

To determine whether cases of congenital syphilis in the Northern Territory between 2009 and 2014 were correctly notified based on probable or confirmed case criteria stipulated by the Communicable Diseases Network Australia (CDNA). Pregnant women with positive syphilis serology defined as reactive treponemal test and rapid plasma reagin titre ≥1:8 were identified from the Northern Territory Syphilis Register Information System. Risk classification was performed based on local guidelines, and CDNA criteria for probable/confirmed cases of congenital syphilis were applied to determine whether cases were appropriately notified. Thirty-four cases of positive maternal syphilis serology in pregnancy were identified from 31 women; all were Indigenous. Twenty-one cases fulfilled criteria for probable congenital syphilis; 1 case was formally notified to the Centre for Disease Control. Twenty cases (95%) fulfilling CDNA criteria for probable congenital syphilis were not notified over the study period. Application of standard case definitions significantly increases the rate of congenital syphilis cases in the Northern Territory. Improved education regarding CDNA criteria for notification of congenital syphilis is necessary for clinicians and public health staff. Emerging evidence has supported the recent simplification of CDNA criteria for notification of congenital syphilis, effective 1 July 2015.

Biosynthesis of Lipoic Acid in Arabidopsis: Cloning and Characterization of the cDNA for Lipoic Acid Synthase1

PubMed Central

Yasuno, Rie; Wada, Hajime

1998-01-01

Lipoic acid is a coenzyme that is essential for the activity of enzyme complexes such as those of pyruvate dehydrogenase and glycine decarboxylase. We report here the isolation and characterization of LIP1 cDNA for lipoic acid synthase of Arabidopsis. The Arabidopsis LIP1 cDNA was isolated using an expressed sequence tag homologous to the lipoic acid synthase of Escherichia coli. This cDNA was shown to code for Arabidopsis lipoic acid synthase by its ability to complement a lipA mutant of E. coli defective in lipoic acid synthase. DNA-sequence analysis of the LIP1 cDNA revealed an open reading frame predicting a protein of 374 amino acids. Comparisons of the deduced amino acid sequence with those of E. coli and yeast lipoic acid synthase homologs showed a high degree of sequence similarity and the presence of a leader sequence presumably required for import into the mitochondria. Southern-hybridization analysis suggested that LIP1 is a single-copy gene in Arabidopsis. Western analysis with an antibody against lipoic acid synthase demonstrated that this enzyme is located in the mitochondrial compartment in Arabidopsis cells as a 43-kD polypeptide. PMID:9808738

Cloning and expression of UDP-glucose: flavonoid 7-O-glucosyltransferase from hairy root cultures of Scutellaria baicalensis.

PubMed

Hirotani, M; Kuroda, R; Suzuki, H; Yoshikawa, T

2000-05-01

A cDNA encoding UDP-glucose: baicalein 7-O-glucosyltransferase (UBGT) was isolated from a cDNA library from hairy root cultures of Scutellaria baicalensis Georgi probed with a partial-length cDNA clone of a UDP-glucose: flavonoid 3-O-glucosyltransferase (UFGT) from grape (Vitis vinifera L.). The heterologous probe contained a glucosyltransferase consensus amino acid sequence which was also present in the Scutellaria cDNA clones. The complete nucleotide sequence of the 1688-bp cDNA insert was determined and the deduced amino acid sequences are presented. The nucleotide sequence analysis of UBGT revealed an open reading frame encoding a polypeptide of 476 amino acids with a calculated molecular mass of 53,094 Da. The reaction product for baicalein and UDP-glucose catalyzed by recombinant UBGT in Escherichia coli was identified as authentic baicalein 7-O-glucoside using high-performance liquid chromatography and proton nuclear magnetic resonance spectroscopy. The enzyme activities of recombinant UBGT expressed in E. coli were also detected towards flavonoids such as baicalein, wogonin, apigenin, scutellarein, 7,4'-dihydroxyflavone and kaempferol, and phenolic compounds. The accumulation of UBGT mRNA in hairy roots was in response to wounding or salicylic acid treatments.

cDNA encoding a polypeptide including a hevein sequence

DOEpatents

Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

1993-02-16

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a pu GOVERNMENT RIGHTS This application was funded under Department of Energy Contract DE-AC02-76ER01338. The U.S. Government has certain rights under this application and any patent issuing thereon.

Housekeeping while brain's storming Validation of normalizing factors for gene expression studies in a murine model of traumatic brain injury

PubMed Central

Rhinn, Hervé; Marchand-Leroux, Catherine; Croci, Nicole; Plotkine, Michel; Scherman, Daniel; Escriou, Virginie

2008-01-01

Background Traumatic brain injury models are widely studied, especially through gene expression, either to further understand implied biological mechanisms or to assess the efficiency of potential therapies. A large number of biological pathways are affected in brain trauma models, whose elucidation might greatly benefit from transcriptomic studies. However the suitability of reference genes needed for quantitative RT-PCR experiments is missing for these models. Results We have compared five potential reference genes as well as total cDNA level monitored using Oligreen reagent in order to determine the best normalizing factors for quantitative RT-PCR expression studies in the early phase (0–48 h post-trauma (PT)) of a murine model of diffuse brain injury. The levels of 18S rRNA, and of transcripts of β-actin, glyceraldehyde-3P-dehydrogenase (GAPDH), β-microtubulin and S100β were determined in the injured brain region of traumatized mice sacrificed at 30 min, 3 h, 6 h, 12 h, 24 h and 48 h post-trauma. The stability of the reference genes candidates and of total cDNA was evaluated by three different methods, leading to the following rankings as normalization factors, from the most suitable to the less: by using geNorm VBA applet, we obtained the following sequence: cDNA(Oligreen); GAPDH > 18S rRNA > S100β > β-microtubulin > β-actin; by using NormFinder Excel Spreadsheet, we obtained the following sequence: GAPDH > cDNA(Oligreen) > S100β > 18S rRNA > β-actin > β-microtubulin; by using a Confidence-Interval calculation, we obtained the following sequence: cDNA(Oligreen) > 18S rRNA; GAPDH > S100β > β-microtubulin > β-actin. Conclusion This work suggests that Oligreen cDNA measurements, 18S rRNA and GAPDH or a combination of them may be used to efficiently normalize qRT-PCR gene expression in mouse brain trauma injury, and that β-actin and β-microtubulin should be avoided. The potential of total cDNA as measured by Oligreen as a first-intention normalizing factor with a broad field of applications is highlighted. Pros and cons of the three methods of normalization factors selection are discussed. A generic time- and cost-effective procedure for normalization factor validation is proposed. PMID:18611280

In vitro replication of poliovirus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lubinski, J.M.

1986-01-01

Poliovirus is a member of the Picornaviridae whose genome is a single stranded RNA molecule of positive polarity surrounded by a proteinaceous capsid. Replication of poliovirus occurs via negative strand intermediates in infected cells using a virally encoded RNA-dependent RNA polymerase and host cell proteins. The authors have exploited the fact that complete cDNA copies of the viral genome when transfected onto susceptible cells generate virus. Utilizing the bacteriophage SP6 DNA dependent RNA polymerase system to synthesize negative strands in vitro and using these in an in vitro reaction the authors have generated full length infectious plus strands. Mutagenesis ofmore » the 5' and 3' ends of the negative and positive strands demonstrated that replication could occur either de novo or be extensions of the templates from their 3' ends or from nicks occurring during replication. The appearance of dimeric RNA molecules generated in these reactions was not dependent upon the same protein required for de novo initiation. Full length dimeric RNA molecules using a 5' /sup 32/P end-labelled oligo uridylic acid primer and positive strand template were demonstrated in vitro containing only the 35,000 Mr host protein and the viral RNA-dependent RNA polymerase. A model for generating positive strands without protein priming by cleavage of dimeric RNA molecules was proposed.« less

Comparison of various RNA extraction methods, cDNA preparation and isolation of calmodulin gene from a highly melanized isolate of apple leaf blotch fungus Marssonina coronaria.

PubMed

Chauhan, Arjun; Sharma, J N; Modgil, Manju; Siddappa, Sundaresha

2018-05-29

Marssonina coronaria causes apple blotch disease resulting in severe premature defoliation, and is distributed in many leading apple-growing areas in the world. Effective, reliable and high-quality RNA extraction is an indispensable procedure in any molecular biology study. No method currently exists for RNA extraction from M. coronaria that produces a high quantity of melanin-free RNA. Therefore, we evaluated eight RNA extraction methods including manual and commercial kits, to yield a sufficient quantity of high-quality and melanin-free RNA. Manual methods used here resulted in low quality and black colored RNA pellets showing the presence of melanin, despite all the modifications employed to original procedures. However, these methods when coupled with clean up resulted in melanin-free RNA. On the other hand, all commercial kits used were able to yield high-quality melanin-free RNA having variable yields. TRIzol™ Reagent + RNA Clean & Concentrator™-5 and Ambion-PureLink® RNA Mini Kit were found to be the best methods as the RNA extracted with these methods from 15 day old fungal culture grown on solid medium were free of melanin with good yield. RNA extracted by this improved methodology was applied for RT-PCR, subsequent PCR amplification, and isolation of calmodulin gene sequences from M. coronaria and infected apple leaf pieces. These methods are more time effective than traditional methods and take only an hour to complete. To our knowledge, this is the first report on the method of isolation of high-quality RNA for cDNA synthesis as well as isolation of the calmodulin gene sequence from this fungus. Copyright © 2018 Elsevier B.V. All rights reserved.

Primary structure of prostaglandin G/H synthase from sheep vesicular gland determined from the complementary DNA sequence.

PubMed Central

DeWitt, D L; Smith, W L

1988-01-01

Prostaglandin G/H synthase (8,11,14-icosatrienoate, hydrogen-donor:oxygen oxidoreductase, EC 1.14.99.1) catalyzes the first step in the formation of prostaglandins and thromboxanes, the conversion of arachidonic acid to prostaglandin endoperoxides G and H. This enzyme is the site of action of nonsteroidal anti-inflammatory drugs. We have isolated a 2.7-kilobase complementary DNA (cDNA) encompassing the entire coding region of prostaglandin G/H synthase from sheep vesicular glands. This cDNA, cloned from a lambda gt 10 library prepared from poly(A)+ RNA of vesicular glands, hybridizes with a single 2.75-kilobase mRNA species. The cDNA clone was selected using oligonucleotide probes modeled from amino acid sequences of tryptic peptides prepared from the purified enzyme. The full-length cDNA encodes a protein of 600 amino acids, including a signal sequence of 24 amino acids. Identification of the cDNA as coding for prostaglandin G/H synthase is based on comparison of amino acid sequences of seven peptides comprising 103 amino acids with the amino acid sequence deduced from the nucleotide sequence of the cDNA. The molecular weight of the unglycosylated enzyme lacking the signal peptide is 65,621. The synthase is a glycoprotein, and there are three potential sites for N-glycosylation, two of them in the amino-terminal half of the molecule. The serine reported to be acetylated by aspirin is at position 530, near the carboxyl terminus. There is no significant similarity between the sequence of the synthase and that of any other protein in amino acid or nucleotide sequence libraries, and a heme binding site(s) is not apparent from the amino acid sequence. The availability of a full-length cDNA clone coding for prostaglandin G/H synthase should facilitate studies of the regulation of expression of this enzyme and the structural features important for catalysis and for interaction with anti-inflammatory drugs. Images PMID:3125548

Molecular cloning of Kazal-type proteinase inhibitor of the shrimp Fenneropenaeus chinensis.

PubMed

Kong, Hee Jeong; Cho, Hyun Kook; Park, Eun-Mi; Hong, Gyeong-Eun; Kim, Young-Ok; Nam, Bo-Hye; Kim, Woo-Jin; Lee, Sang-Jun; Han, Hyon Sob; Jang, In-Kwon; Lee, Chang Hoon; Cheong, Jaehun; Choi, Tae-Jin

2009-01-01

Proteinase inhibitors play important roles in host defence systems involving blood coagulation and pathogen digestion. We isolated and characterized a cDNA clone for a Kazal-type proteinase inhibitor (KPI) from a hemocyte cDNA library of the oriental white shrimp Fenneropenaeus chinensis. The KPI gene consists of three exons and two introns. KPI cDNA contains an open reading frame of 396 bp, a polyadenylation signal sequence AATAAA, and a poly (A) tail. KPI cDNA encodes a polypeptide of 131 amino acids with a putative signal peptide of 21 amino acids. The deduced amino acid sequence of KPI contains two homologous Kazal domains, each with six conserved cysteine residues. The mRNA of KPI is expressed in the hemocytes of healthy shrimp, and the higher expression of KPI transcript is observed in shrimp infected with the white spot syndrome virus (WSSV), suggesting a potential role for KPI in host defence mechanisms.

Construction of a cDNA microarray derived from the ascidian Ciona intestinalis.

PubMed

Azumi, Kaoru; Takahashi, Hiroki; Miki, Yasufumi; Fujie, Manabu; Usami, Takeshi; Ishikawa, Hisayoshi; Kitayama, Atsusi; Satou, Yutaka; Ueno, Naoto; Satoh, Nori

2003-10-01

A cDNA microarray was constructed from a basal chordate, the ascidian Ciona intestinalis. The draft genome of Ciona has been read and inferred to contain approximately 16,000 protein-coding genes, and cDNAs for transcripts of 13,464 genes have been characterized and compiled as the "Ciona intestinalis Gene Collection Release I". In the present study, we constructed a cDNA microarray of these 13,464 Ciona genes. A preliminary experiment with Cy3- and Cy5-labeled probes showed extensive differential gene expression between fertilized eggs and larvae. In addition, there was a good correlation between results obtained by the present microarray analysis and those from previous EST analyses. This first microarray of a large collection of Ciona intestinalis cDNA clones should facilitate the analysis of global gene expression and gene networks during the embryogenesis of basal chordates.

Cloning and expression of cDNA coding for bouganin.

PubMed

den Hartog, Marcel T; Lubelli, Chiara; Boon, Louis; Heerkens, Sijmie; Ortiz Buijsse, Antonio P; de Boer, Mark; Stirpe, Fiorenzo

2002-03-01

Bouganin is a ribosome-inactivating protein that recently was isolated from Bougainvillea spectabilis Willd. In this work, the cloning and expression of the cDNA encoding for bouganin is described. From the cDNA, the amino-acid sequence was deduced, which correlated with the primary sequence data obtained by amino-acid sequencing on the native protein. Bouganin is synthesized as a pro-peptide consisting of 305 amino acids, the first 26 of which act as a leader signal while the 29 C-terminal amino acids are cleaved during processing of the molecule. The mature protein consists of 250 amino acids. Using the cDNA sequence encoding the mature protein of 250 amino acids, a recombinant protein was expressed, purified and characterized. The recombinant molecule had similar activity in a cell-free protein synthesis assay and had comparable toxicity on living cells as compared to the isolated native bouganin.

Detection of Helicobacter Pylori Genome with an Optical Biosensor Based on Hybridization of Urease Gene with a Gold Nanoparticles-Labeled Probe

NASA Astrophysics Data System (ADS)

Shahrashoob, M.; Mohsenifar, A.; Tabatabaei, M.; Rahmani-Cherati, T.; Mobaraki, M.; Mota, A.; Shojaei, T. R.

2016-05-01

A novel optics-based nanobiosensor for sensitive determination of the Helicobacter pylori genome using a gold nanoparticles (AuNPs)-labeled probe is reported. Two specific thiol-modified capture and signal probes were designed based on a single-stranded complementary DNA (cDNA) region of the urease gene. The capture probe was immobilized on AuNPs, which were previously immobilized on an APTES-activated glass, and the signal probe was conjugated to different AuNPs as well. The presence of the cDNA in the reaction mixture led to the hybridization of the AuNPs-labeled capture probe and the signal probe with the cDNA, and consequently the optical density of the reaction mixture (AuNPs) was reduced proportionally to the cDNA concentration. The limit of detection was measured at 0.5 nM.

cDNA Microarray Screening in Food Safety

PubMed Central

ROY, SASHWATI; SEN, CHANDAN K

2009-01-01

The cDNA microarray technology and related bioinformatics tools presents a wide range of novel application opportunities. The technology may be productively applied to address food safety. In this mini-review article, we present an update highlighting the late breaking discoveries that demonstrate the vitality of cDNA microarray technology as a tool to analyze food safety with reference to microbial pathogens and genetically modified foods. In order to bring the microarray technology to mainstream food safety, it is important to develop robust user-friendly tools that may be applied in a field setting. In addition, there needs to be a standardized process for regulatory agencies to interpret and act upon microarray-based data. The cDNA microarray approach is an emergent technology in diagnostics. Its values lie in being able to provide complimentary molecular insight when employed in addition to traditional tests for food safety, as part of a more comprehensive battery of tests. PMID:16466843

Identification of Delta5-fatty acid desaturase from the cellular slime mold dictyostelium discoideum.

PubMed

Saito, T; Ochiai, H

1999-10-01

cDNA fragments putatively encoding amino acid sequences characteristic of the fatty acid desaturase were obtained using expressed sequence tag (EST) information of the Dictyostelium cDNA project. Using this sequence, we have determined the cDNA sequence and genomic sequence of a desaturase. The cloned cDNA is 1489 nucleotides long and the deduced amino acid sequence comprised 464 amino acid residues containing an N-terminal cytochrome b5 domain. The whole sequence was 38.6% identical to the initially identified Delta5-desaturase of Mortierella alpina. We have confirmed its function as Delta5-desaturase by over expression mutation in D. discoideum and also the gain of function mutation in the yeast Saccharomyces cerevisiae. Analysis of the lipids from transformed D. discoideum and yeast demonstrated the accumulation of Delta5-desaturated products. This is the first report concering fatty acid desaturase in cellular slime molds.

Molecular cloning and characterization of ADP-glucose pyrophosphorylase cDNA clones isolated from pea cotyledons.

PubMed

Burgess, D; Penton, A; Dunsmuir, P; Dooner, H

1997-02-01

Three ADP-glucose pyrophosphorylase (ADPG-PPase) cDNA clones have been isolated and characterized from a pea cotyledon cDNA library. Two of these clones (Psagps1 and Psagps2) encode the small subunit of ADPG-PPase. The deduced amino acid sequences for these two clones are 95% identical. Expression of these two genes differs in that the Psagps2 gene shows comparatively higher expression in seeds relative to its expression in other tissues. Psagps2 expression also peaks midway through seed development at a time in which Psagps1 transcripts are still accumulating. The third cDNA isolated (Psagp11) encodes the large subunit of ADPG-PPase. It shows greater selectivity in expression than either of the small subunit clones. It is highly expressed in sink organs (seed, pod, and seed coat) and undetectable in leaves.

Expression profiling suggests a regulatory role of gallbladder in lipid homeostasis

PubMed Central

Yuan, Zuo-Biao; Han, Tian-Quan; Jiang, Zhao-Yan; Fei, Jian; Zhang, Yi; Qin, Jian; Tian, Zhi-Jie; Shang, Jun; Jiang, Zhi-Hong; Cai, Xing-Xing; Jiang, Yu; Zhang, Sheng-Dao; Jin, Gang

2005-01-01

AIM: To examine expression profile of gallbladder using microarray and to investigate the role of gallbladder in lipid homeostasis. METHODS: 33P-labelled cDNA derived from total RNA of gallbladder tissue was hybridized to a cDNA array representing 17000 cDNA clusters. Genes with intensities ≥2 and variation <0.33 between two samples were considered as positive signals with subtraction of background chosen from an area where no cDNA was spotted. The average gray level of two gallbladders was adopted to analyze its bioinformatics. Identified target genes were confirmed by touch-down polymerase chain reaction and sequencing. RESULTS: A total of 11 047 genes expressed in normal gallbladder, which was more than that predicted by another author, and the first 10 genes highly expressed (high gray level in hybridization image), e.g., ARPC5 (2225.88±90.46), LOC55972 (2220.32±446.51) and SLC20A2 (1865.21±98.02), were related to the function of smooth muscle contraction and material transport. Meanwhile, 149 lipid-related genes were expressed in the gallbladder, 89 of which were first identified (with gray level in hybridization image), e.g., FASN (11.42±2.62), APOD (92.61±8.90) and CYP21A2 (246.11±42.36), and they were involved in each step of lipid metabolism pathway. In addition, 19 of those 149 genes were gallstone candidate susceptibility genes (with gray level in hybridization image), e.g., HMGCR (10.98±0.31), NPC1 (34.88±12.12) and NR1H4 (16.8±0.65), which were previously thought to be expressed in the liver and/or intestine tissue only. CONCLUSION: Gallbladder expresses 11 047 genes and takes part in lipid homeostasis. PMID:15810076

Structure, organization and expression of common carp (Cyprinus carpio L.) SLP-76 gene.

PubMed

Huang, Rong; Sun, Xiao-Feng; Hu, Wei; Wang, Ya-Ping; Guo, Qiong-Lin

2008-05-01

SLP-76 is an important member of the SLP-76 family of adapters, and it plays a key role in TCR signaling and T cell function. Partial cDNA sequence of SLP-76 of common carp (Cyprinus carpio L.) was isolated from thymus cDNA library by the method of suppression subtractive hybridization (SSH). Subsequently, the full length cDNA of carp SLP-76 was obtained by means of 3' RACE and 5' RACE, respectively. The full length cDNA of carp SLP-76 was 2007 bp, consisting of a 5'-terminal untranslated region (UTR) of 285 bp, a 3'-terminal UTR of 240 bp, and an open reading frame of 1482 bp. Sequence comparison showed that the deduced amino acid sequence of carp SLP-76 had an overall similarity of 34-73% to that of other species homologues, and it was composed of an NH2-terminal domain, a central proline-rich domain, and a C-terminal SH2 domain. Amino acid sequence analysis indicated the existence of a Gads binding site R-X-X-K, a 10-aa-long sequence which binds to the SH3 domain of LCK in vitro, and three conserved tyrosine-containing sequence in the NH2-terminal domain. Then we used PCR to obtain a genomic DNA which covers the entire coding region of carp SLP-76. In the 9.2k-long genomic sequence, twenty one exons and twenty introns were identified. RT-PCR results showed that carp SLP-76 was expressed predominantly in hematopoietic tissues, and was upregulated in thymus tissue of four-month carp compared to one-year old carp. RT-PCR and virtual northern hybridization results showed that carp SLP-76 was also upregulated in thymus tissue of GH transgenic carp at the age of four-months. These results suggest that the expression level of SLP-76 gene may be related to thymocyte development in teleosts.

Effectiveness of Liquid Soap and Hand Sanitizer against Norwalk Virus on Contaminated Hands▿

PubMed Central

Liu, Pengbo; Yuen, Yvonne; Hsiao, Hui-Mien; Jaykus, Lee-Ann; Moe, Christine

2010-01-01

Disinfection is an essential measure for interrupting human norovirus (HuNoV) transmission, but it is difficult to evaluate the efficacy of disinfectants due to the absence of a practicable cell culture system for these viruses. The purpose of this study was to screen sodium hypochlorite and ethanol for efficacy against Norwalk virus (NV) and expand the studies to evaluate the efficacy of antibacterial liquid soap and alcohol-based hand sanitizer for the inactivation of NV on human finger pads. Samples were tested by real-time reverse transcription-quantitative PCR (RT-qPCR) both with and without a prior RNase treatment. In suspension assay, sodium hypochlorite concentrations of ≥160 ppm effectively eliminated RT-qPCR detection signal, while ethanol, regardless of concentration, was relatively ineffective, giving at most a 0.5 log10 reduction in genomic copies of NV cDNA. Using the American Society for Testing and Materials (ASTM) standard finger pad method and a modification thereof (with rubbing), we observed the greatest reduction in genomic copies of NV cDNA with the antibacterial liquid soap treatment (0.67 to 1.20 log10 reduction) and water rinse only (0.58 to 1.58 log10 reduction). The alcohol-based hand sanitizer was relatively ineffective, reducing the genomic copies of NV cDNA by only 0.14 to 0.34 log10 compared to baseline. Although the concentrations of genomic copies of NV cDNA were consistently lower on finger pad eluates pretreated with RNase compared to those without prior RNase treatment, these differences were not statistically significant. Despite the promise of alcohol-based sanitizers for the control of pathogen transmission, they may be relatively ineffective against the HuNoV, reinforcing the need to develop and evaluate new products against this important group of viruses. PMID:19933337

Proteome-wide Identification of Novel Ceramide-binding Proteins by Yeast Surface cDNA Display and Deep Sequencing.

PubMed

Bidlingmaier, Scott; Ha, Kevin; Lee, Nam-Kyung; Su, Yang; Liu, Bin

2016-04-01

Although the bioactive sphingolipid ceramide is an important cell signaling molecule, relatively few direct ceramide-interacting proteins are known. We used an approach combining yeast surface cDNA display and deep sequencing technology to identify novel proteins binding directly to ceramide. We identified 234 candidate ceramide-binding protein fragments and validated binding for 20. Most (17) bound selectively to ceramide, although a few (3) bound to other lipids as well. Several novel ceramide-binding domains were discovered, including the EF-hand calcium-binding motif, the heat shock chaperonin-binding motif STI1, the SCP2 sterol-binding domain, and the tetratricopeptide repeat region motif. Interestingly, four of the verified ceramide-binding proteins (HPCA, HPCAL1, NCS1, and VSNL1) and an additional three candidate ceramide-binding proteins (NCALD, HPCAL4, and KCNIP3) belong to the neuronal calcium sensor family of EF hand-containing proteins. We used mutagenesis to map the ceramide-binding site in HPCA and to create a mutant HPCA that does not bind to ceramide. We demonstrated selective binding to ceramide by mammalian cell-produced wild type but not mutant HPCA. Intriguingly, we also identified a fragment from prostaglandin D2synthase that binds preferentially to ceramide 1-phosphate. The wide variety of proteins and domains capable of binding to ceramide suggests that many of the signaling functions of ceramide may be regulated by direct binding to these proteins. Based on the deep sequencing data, we estimate that our yeast surface cDNA display library covers ∼60% of the human proteome and our selection/deep sequencing protocol can identify target-interacting protein fragments that are present at extremely low frequency in the starting library. Thus, the yeast surface cDNA display/deep sequencing approach is a rapid, comprehensive, and flexible method for the analysis of protein-ligand interactions, particularly for the study of non-protein ligands. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

[Cloning of Chinese Banna minipig inbred-line alpha1,3-galactosyltransferase gene and construction of its recombinant eukaryotic expression vector].

PubMed

Zhu, Shengming; Wang, Yanping; Zheng, Hong; Cheng, Jingqiu; Lu, Yanrong; Zeng, Yangzhi; Wang, Yu; Wang, Zhu

2009-04-01

This study sought to clone Chinese Banna minipig inbred-line (BMI) alpha1,3-galactosyltransferase (alpha1,3-GT) gene and construct its recombinant eukaryotic expression vector. Total RNA was isolated from BMI liver. Full length cDNA of alpha1,3-GT gene was amplified by RT-PCR and cloned into pMD18-T vector to sequence. Subsequently, alpha1,3-GT gene was inserted into pEGFP-N1 to construct eukaryotic expression vector pEGFP-N1-GT. Then the reconstructed plasmid pEGFP-N1-GT was transiently transfected into human lung cancer cell line A549. The expression of alpha1,3-GT mRNA in transfected cells was detected by RT-PCR. FITC-BS-IB4 lectin was used in the direct immunofluorescence method, which was performed to observe the alpha-Gal synthesis function of BMI alpha1,3-GT in transfected cells. The results showed that full length of BMI alpha1,3-GT cDNA was 1116 bp. BMI alpha1,3-GT cDNA sequence was highly homogenous with those of mouse and bovine, and was exactly the same as the complete sequence of those of swine, pEGFP-N1-GT was confirmed by enzyme digestion and PCR. The expression of alpha1,3-GT mRNA was detected in A549 cells transfected by pEGFP-N1-GT. The expression of alpha-Gal was observed on the membrane of A549 cells transfected by pEGFP-N1-GT. Successful cloning of BMI alpha1,3-GT cDNA and construction of its eukaryotic expression vector have established a foundation for further research and application of BMI alpha1,3-GT in the fields of xenotransplantation and immunological therapy of cancer.

Analysis of gene expression profile induced by EMP-1 in esophageal cancer cells using cDNA Microarray

PubMed Central

Wang, Hai-Tao; Kong, Jian-Ping; Ding, Fang; Wang, Xiu-Qin; Wang, Ming-Rong; Liu, Lian-Xin; Wu, Min; Liu, Zhi-Hua

2003-01-01

AIM: To obtain human esophageal cancer cell EC9706 stably expressed epithelial membrane protein-1 (EMP-1) with integrated eukaryotic plasmid harboring the open reading frame (ORF) of human EMP-1, and then to study the mechanism by which EMP-1 exerts its diverse cellular action on cell proliferation and altered gene profile by exploring the effect of EMP-1. METHODS: The authors first constructed pcDNA3.1/myc-his expression vector harboring the ORF of EMP-1 and then transfected it into human esophageal carcinoma cell line EC9706. The positive clones were analyzed by Western blot and RT-PCR. Moreover, the cell growth curve was observed and the cell cycle was checked by FACS technique. Using cDNA microarray technology, the authors compared the gene expression pattern in positive clones with control. To confirm the gene expression profile, semi-quantitative RT-PCR was carried out for 4 of the randomly picked differentially expressed genes. For those differentially expressed genes, classification was performed according to their function and cellular component. RESULTS: Human EMP-1 gene can be stably expressed in EC9706 cell line transfected with human EMP-1. The authors found the cell growth decreased, among which S phase was arrested and G1 phase was prolonged in the transfected positive clones. By cDNA microarray analysis, 35 genes showed an over 2.0 fold change in expression level after transfection, with 28 genes being consistently up-regulated and 7 genes being down-regulated. Among the classified genes, almost half of the induced genes (13 out of 28 genes) were related to cell signaling, cell communication and particularly to adhesion. CONCLUSION: Overexpression of human EMP-1 gene can inhibit the proliferation of EC9706 cell with S phase arrested and G1 phase prolonged. The cDNA microarray analysis suggested that EMP-1 may be one of regulators involved in cell signaling, cell communication and adhesion regulators. PMID:12632483

Molecular characterization and phylogenetic analysis of a yak (Bos grunniens) κ-casein cDNA from lactating mammary gland.

PubMed

Bai, W L; Yin, R H; Dou, Q L; Jiang, W Q; Zhao, S J; Ma, Z J; Luo, G B; Zhao, Z H

2011-04-01

κ-Casein is one of the major proteins in the milk of mammals. It plays an important role in determining the size and specific function of milk micelles. We have previously identified and characterized a genetic variant of yak κ-casein by evaluating genomic DNA. Here, we isolate and characterize a yak κ-casein cDNA harboring the full-length open reading frame (ORF) from lactating mammary gland. Total RNA was extracted from mammary tissue of lactating female yak, and the κ-casein cDNA were synthesized by RT-PCR technique, then cloned and sequenced. The obtained cDNA of 660-bp contained an ORF sufficient to encode the entire amino acid sequence of κ-casein precursor protein consisting of 190 amino acids with a signal peptide of 21 amino acids. Yak κ-casein has a predicted molecular mass of 19,006.588 Da with a calculated isoelectric point of 7.245. Compared with the corresponding sequences in GenBank of cattle, buffalo, sheep, goat, Arabian camel, horse, and rabbit, yak κ-casein sequence had identity of 64.76-98.78% in cDNA, and identity of 44.79-98.42% and similarity of 53.65-98.42% in deduced amino acids, revealing a high homology with the other livestock species. Based on κ-casein cDNA sequences, the phylogenetic analysis indicated that yak κ-casein had a close relationship with that of cattle. This work might be useful in the genetic engineering researches for yak κ-casein.

[Cloning and expressing of cyclophilin B gene from Schistosoma japonnicum and the analysis of immunoprotective effect].

PubMed

Peng, Jinbiao; Han, Hongxiao; Hong, Yang; Wang, Yan; Guo, Fanji; Shi, Yaojun; Fu, Zhiqiang; Liu, Jinming; Cheng, Guofeng; Lin, Jiaojiao

2010-03-01

The present study was intend to clone and express the cDNA encoding Cyclophilin B (CyPB) of Schistosoma japonicum, its preliminary biological function and further immunoprotective effect against schistosome infection in mice. RT-PCR technique was applied to amplify a full-length cDNA encoding protein Cyclophilin B (Sj CyPB) from schistosomula cDNA. The expression profiles of Sj CyPB were determined by Real-time PCR using the template cDNAs isolated from 7, 13, 18, 23, 32 and 42 days parasites. The cDNA containing the Open Reading Frame of CyPB was then subcloned into a pGEX-6P-1 vector and transformed into competent Escherichia coli BL21 for expressing. The recombinant protein was renaturated, purified and its antigenicity were detected by Western blotting, and the immunoprotective effect induced by recombinant Sj CyPB was evaluated in Balb/C mice. The cDNA containing the ORF of Sj CyPB was cloned with the length of 672 base pairs, encoding 223 amino acids. Real-time PCR analysis revealed that the gene had the highest expression in 18-day schistosomula, suggesting that Sj CyPB was schistosomula differentially expressed gene. The recombinant protein showed a good antigenicity detected by Western blotting. Animal experiment indicated that the vaccination of recombinant CyPB protein in mice led to 31.5% worm and 41.01% liver egg burden reduction, respectively, compared with those of the control. A full-length cDNA differentially expressed in schistosomula was obtained. The recombinant Sj CyPB protein could induce partial protection against schistosome infection.

Molecular cloning and characterization of a new basic peroxidase cDNA from soybean hypocotyls infected with Phytophthora sojae f.sp. glycines.

PubMed

Yi, S Y; Hwang, B K

1998-10-31

Differential display techniques were used to isolate cDNA clones corresponding to genes which were expressed in soybean hypocotyls by Phytophthora sojae f.sp. glycines infection. With a partial cDNA clone C20CI4 from the differential display PCR as a probe, a new basic peroxidase cDNA clone, designated GMIPER1, was isolated from a cDNA library of soybean hypocotyls infected with P. sojae f.sp. glycines. Sequence analysis revealed that the peroxidase clone encodes a mature protein of 35,813 Da with a putative signal peptide of 27 amino acids in its N-terminus. The amino acid sequence of the soybean peroxidase GMIPER1 is between 54-75% identical to other plant peroxidases including a soybean seed coat peroxidase. Southern blot analysis indicated that multiple copies of sequences related to GMIPER1 exist in the soybean genome. The mRNAs corresponding to the GMIPER1 cDNA accumulated predominantly in the soybean hypocotyls infected with the incompatible race of P. sojae f.sp. glycines, but were expressed at low levels in the compatible interaction. Soybean GMIPER1 mRNAs were not expressed in hypocotyls, leaves, stems, and roots of soybean seedlings. However, treatments with ethephon, salicylic acid or methyl jasmonate induced the accumulation of the GMIPER1 mRNAs in the different organs of soybean. These results suggest that the GMIPER1 gene encoding a putative pathogen-induced peroxidase may play an important role in induced resistance of soybean to P. sojae f.sp. glycines and in response to various external stresses.

Cloning of a cDNA encoding bovine mitochondrial NADP(+)-specific isocitrate dehydrogenase and structural comparison with its isoenzymes from different species.

PubMed Central

Huh, T L; Ryu, J H; Huh, J W; Sung, H C; Oh, I U; Song, B J; Veech, R L

1993-01-01

Mitochondrial NADP(+)-specific isocitrate dehydrogenase (IDP) was co-purified with the pyruvate dehydrogenase complex from bovine kidney mitochondria. The determination of its N-terminal 16-amino-acid sequence revealed that it is highly similar to the IDP from yeast. A cDNA clone (1.8 kb long) encoding this protein was isolated from a bovine kidney lambda gt11 cDNA library using a synthetic oligodeoxynucleotide. The deduced protein sequence of this cDNA clone rendered a precursor protein of 452 amino-acid residues (50,830 Da) and a mature protein of 413 amino-acid residues (46,519 Da). It is 100% identical to the internal tryptic peptide sequences of the autologous form from pig heart and 62% similar to that from yeast. However, it shares little similarity with the mitochondrial NAD(+)-specific isoenzyme from yeast. Structural analyses of the deduced proteins of IDP isoenzymes from different species indicated that similarity exists in certain regions, which may represent the common domains for the active sites or coenzyme-binding sites. In Northern-blot analysis, one species of mRNA (about 2.2 kb for both bovine and human) was hybridized with a 32P-labelled cDNA probe. Southern-blot analysis of genomic DNAs verified simple patterns of hybridization with this cDNA. These results strongly indicate that the mitochondrial IDP may be derived from a single gene family which does not appear to be closely related to that of the NAD(+)-specific isoenzyme. Images Figure 1 Figure 3 Figure 4 Figure 5 PMID:8318002

Cloning and molecular characterization of scorpion Buthus martensi venom hyaluronidases: a novel full-length and diversiform noncoding isoforms.

PubMed

Xia, Xichao; Liu, Rongzhi; Li, Yi; Xue, Shipeng; Liu, Qingchun; Jiang, Xiao; Zhang, Wenjuan; Ding, Ke

2014-09-01

Hyaluronidase is a common component of scorpion venom and has been considered as "spreading factor" that promotes a fast penetration of the venom in the anaphylactic reaction. In the current study, a novel full-length of hyaluronidase BmHYI and three noncoding isoforms of BmHYII, BmHYIII and BmHYIV were cloned by using a combined strategy based on peptide sequencing and Rapid Amplification of cDNA Ends (RACE). BmHYI has 410 amino acid residues containing the catalytic, positional and five potential N-glycosylation sites. The deduced protein sequence of BmHYI shares significant identity with venom hyaluronidases from bees and snakes. The phylogenetic analysis showed early divergence and independent evolution of BmHYI from other hyaluronidases. An extraordinarily high level of sequence similarity was detected among four sequences. But, BmHYII, BmHYIII and BmHYIV were short of stop-codon in the open reading frame and poly(A) signal in the 3' end. Copyright © 2014 Elsevier B.V. All rights reserved.

d-Ala-d-Ser VanN-Type Transferable Vancomycin Resistance in Enterococcus faecium▿

PubMed Central

Lebreton, François; Depardieu, Florence; Bourdon, Nancy; Fines-Guyon, Marguerite; Berger, Pierre; Camiade, Sabine; Leclercq, Roland; Courvalin, Patrice; Cattoir, Vincent

2011-01-01

Enterococcus faecium UCN71, isolated from a blood culture, was resistant to low levels of vancomycin (MIC, 16 μg/ml) but susceptible to teicoplanin (MIC, 0.5 μg/ml). No amplification was observed with primers specific for the previously described glycopeptide resistance ligase genes, but a PCR product corresponding to a gene called vanN was obtained using degenerate primers and was sequenced. The deduced VanN protein was related (65% identity) to the d-alanine:d-serine VanL ligase. The organization of the vanN gene cluster, determined using degenerate primers and by thermal asymmetric interlaced (TAIL)-PCR, was similar to that of the vanC operons. A single promoter upstream from the resistance operon was identified by rapid amplification of cDNA ends (RACE)-PCR. The presence of peptidoglycan precursors ending in d-serine and d,d-peptidase activities in the absence of vancomycin indicated constitutive expression of the resistance operon. VanN-type resistance was transferable by conjugation to E. faecium. This is the first report of transferable d-Ala-d-Ser-type resistance in E. faecium. PMID:21807981

DNA Book

PubMed Central

Kawai, Jun; Hayashizaki, Yoshihide

2003-01-01

We propose herein a new method of DNA distribution, whereby DNA clones or PCR products are printed directly onto the pages of books and delivered to users along with relevant scientific information. DNA sheets, comprising water-soluble paper onto which DNA is spotted, can be bound into books. Readers can easily extract the DNA fragments from DNA sheets and amplify them using PCR. We show that DNA sheets can withstand various conditions that may be experienced during bookbinding and delivery, such as high temperatures and humidity. Almost all genes (95%–100% of randomly selected RIKEN mouse cDNA clones) were recovered successfully by use of PCR. Readers can start their experiments after a 2-h PCR amplification without waiting for the delivery of DNA clones. The DNA Book thus provides a novel method for delivering DNA in a timely and cost-effective manner. A sample DNA sheet (carrying RIKEN mouse cDNA clones encoding genes of enzymes for the TCA cycle) is included in this issue for field-testing. We would greatly appreciate it if readers could attempt to extract DNA and report the results and whether the DNA sheet was shipped to readers in good condition. PMID:12819147

A low-density cDNA microarray with a unique reference RNA: pattern recognition analysis for IFN efficacy prediction to HCV as a model.

PubMed

Daiba, Akito; Inaba, Niro; Ando, Satoshi; Kajiyama, Naoki; Yatsuhashi, Hiroshi; Terasaki, Hiroshi; Ito, Atsushi; Ogasawara, Masanori; Abe, Aki; Yoshioka, Junichi; Hayashida, Kazuhiro; Kaneko, Shuichi; Kohara, Michinori; Ito, Satoru

2004-03-19

We have designed and established a low-density (295 genes) cDNA microarray for the prediction of IFN efficacy in hepatitis C patients. To obtain a precise and consistent microarray data, we collected a data set from three spots for each gene (mRNA) and using three different scanning conditions. We also established an artificial reference RNA representing pseudo-inflammatory conditions from established hepatocyte cell lines supplemented with synthetic RNAs to 48 inflammatory genes. We also developed a novel algorithm that replaces the standard hierarchical-clustering method and allows handling of the large data set with ease. This algorithm utilizes a standard space database (SSDB) as a key scale to calculate the Mahalanobis distance (MD) from the center of gravity in the SSDB. We further utilized sMD (divided by parameter k: MD/k) to reduce MD number as a predictive value. The efficacy prediction of conventional IFN mono-therapy was 100% for non-responder (NR) vs. transient responder (TR)/sustained responder (SR) (P < 0.0005). Finally, we show that this method is acceptable for clinical application.

Deletion detection for diagnosis of Duchenne muscular dystrophy in the Japanese population--comparison between the polymerase chain reaction and the Southern blot analysis.

PubMed

Katayama, S; Takeshita, N; Yano, T; Ubagai, T; Qiu, X J; Katagiri, Y; Kubo, H; Hirakawa, S

1993-06-01

We compared the efficacy of the multiplex PCR with that of the cDNA analysis for detection of deletions of the DMD gene in the Japanese patients. Thirty males with DMD from 27 Japanese families were studied by the multiplex PCR, and 24 of them were also investigated by Southern blot analysis. We used five dystrophin cDNA probes for deletion analysis. A total of 19 regions were amplified by the PCR to detect deletions, 9 regions by the method of Chamberlain et al. and another 10 regions by the method of Beggs et al. Deletions were detected in 14 (52%) out of 27 DMD families by the PCR. Southern blot analysis detected deletions in 14 (64%) out of 22 families. Thirteen (93%) of the 14 DMD families with deletions detected by Southern blotting were also confirmed by the multiplex PCR. Provided care is taken in cases where the deletion is limited to a single exon, the multiplex PCR appears to be an efficient and useful alternative to conventional Southern blot analysis for detecting deletions during the prenatal and postnatal diagnosis of DMD.

An integrated PCR colony hybridization approach to screen cDNA libraries for full-length coding sequences.

PubMed

Pollier, Jacob; González-Guzmán, Miguel; Ardiles-Diaz, Wilson; Geelen, Danny; Goossens, Alain

2011-01-01

cDNA-Amplified Fragment Length Polymorphism (cDNA-AFLP) is a commonly used technique for genome-wide expression analysis that does not require prior sequence knowledge. Typically, quantitative expression data and sequence information are obtained for a large number of differentially expressed gene tags. However, most of the gene tags do not correspond to full-length (FL) coding sequences, which is a prerequisite for subsequent functional analysis. A medium-throughput screening strategy, based on integration of polymerase chain reaction (PCR) and colony hybridization, was developed that allows in parallel screening of a cDNA library for FL clones corresponding to incomplete cDNAs. The method was applied to screen for the FL open reading frames of a selection of 163 cDNA-AFLP tags from three different medicinal plants, leading to the identification of 109 (67%) FL clones. Furthermore, the protocol allows for the use of multiple probes in a single hybridization event, thus significantly increasing the throughput when screening for rare transcripts. The presented strategy offers an efficient method for the conversion of incomplete expressed sequence tags (ESTs), such as cDNA-AFLP tags, to FL-coding sequences.

Rapid screening for nuclear genes mutations in isolated respiratory chain complex I defects.

PubMed

Pagniez-Mammeri, Hélène; Lombes, Anne; Brivet, Michèle; Ogier-de Baulny, Hélène; Landrieu, Pierre; Legrand, Alain; Slama, Abdelhamid

2009-04-01

Complex I or reduced nicotinamide adenine dinucleotide (NADH): ubiquinone oxydoreductase deficiency is the most common cause of respiratory chain defects. Molecular bases of complex I deficiencies are rarely identified because of the dual genetic origin of this multi-enzymatic complex (nuclear DNA and mitochondrial DNA) and the lack of phenotype-genotype correlation. We used a rapid method to screen patients with isolated complex I deficiencies for nuclear genes mutations by Surveyor nuclease digestion of cDNAs. Eight complex I nuclear genes, among the most frequently mutated (NDUFS1, NDUFS2, NDUFS3, NDUFS4, NDUFS7, NDUFS8, NDUFV1 and NDUFV2), were studied in 22 cDNA fragments spanning their coding sequences in 8 patients with a biochemically proved complex I deficiency. Single nucleotide polymorphisms and missense mutations were detected in 18.7% of the cDNA fragments by Surveyor nuclease treatment. Molecular defects were detected in 3 patients. Surveyor nuclease screening is a reliable method for genotyping nuclear complex I deficiencies, easy to interpret, and limits the number of sequence reactions. Its use will enhance the possibility of prenatal diagnosis and help us for a better understanding of complex I molecular defects.

Cloning, sequencing and expression in MEL cells of a cDNA encoding the mouse ribosomal protein S5.

PubMed

Vanegas, N; Castañeda, V; Santamaría, D; Hernández, P; Schvartzman, J B; Krimer, D B

1997-06-05

We describe the isolation and characterization of a cDNA encoding the mouse S5 ribosomal protein. It was isolated from a MEL (murine erythroleukemia) cell cDNA library by differential hybridization as a down regulated sequence during HMBA-induced differentiation. Northern series analysis showed that S5 mRNA expression is reduced 5-fold throughout the differentiation process. The mouse S5 mRNA is 760 bp long and encodes for a 204 amino acid protein with 94% homology with the human and rat S5.

Characterization of ROS1 cDNA from a human glioblastoma cell line

DOE Office of Scientific and Technical Information (OSTI.GOV)

Birchmeier, C.; O'Neill, K.; Riggs, M.

1990-06-01

The authors have isolated and characterized a human ROS1 cDNA from the glioblastoma cell line SW-1088. The cDNA, 8.3 kilobases long, has the potential to encode a transmembrane tyrosine-specific protein kinase with a predicted molecular mass of 259 kDa. The putative extracellular domain of ROS1 is homologous to the extracellular domain of the sevenless gene product from Drosophila. No comparable similarities in the extracellular domains were found between ROS1 and other receptor-type tyrosine kinases. Together, ROS1 and sevenless gene products define a distinct subclass of transmember tyrosine kinases.

Isolation, nucleotide sequence and expression of a cDNA encoding feline granulocyte colony-stimulating factor.

PubMed

Dunham, S P; Onions, D E

2001-06-21

A cDNA encoding feline granulocyte colony stimulating factor (fG-CSF) was cloned from alveolar macrophages using the reverse transcriptase-polymerase chain reaction. The cDNA is 949 bp in length and encodes a predicted mature protein of 174 amino acids. Recombinant fG-CSF was expressed as a glutathione S-transferase fusion and purified by affinity chromatography. Biological activity of the recombinant protein was demonstrated using the murine myeloblastic cell line GNFS-60, which showed an ED50 for fG-CSF of approximately 2 ng/ml. Copyright 2001 Academic Press.

Purification of a Jojoba Embryo Fatty Acyl-Coenzyme A Reductase and Expression of Its cDNA in High Erucic Acid Rapeseed

PubMed Central

Metz, James G.; Pollard, Michael R.; Anderson, Lana; Hayes, Thomas R.; Lassner, Michael W.

2000-01-01

The jojoba (Simmondsia chinensis) plant produces esters of long-chain alcohols and fatty acids (waxes) as a seed lipid energy reserve. This is in contrast to the triglycerides found in seeds of other plants. We purified an alcohol-forming fatty acyl-coenzyme A reductase (FAR) from developing embryos and cloned the cDNA encoding the enzyme. Expression of a cDNA in Escherichia coli confers FAR activity upon those cells and results in the accumulation of fatty alcohols. The FAR sequence shows significant homology to an Arabidopsis protein of unknown function that is essential for pollen development. When the jojoba FAR cDNA is expressed in embryos of Brassica napus, long-chain alcohols can be detected in transmethylated seed oils. Resynthesis of the gene to reduce its A plus T content resulted in increased levels of alcohol production. In addition to free alcohols, novel wax esters were detected in the transgenic seed oils. In vitro assays revealed that B. napus embryos have an endogenous fatty acyl-coenzyme A: fatty alcohol acyl-transferase activity that could account for this wax synthesis. Thus, introduction of a single cDNA into B. napus results in a redirection of a portion of seed oil synthesis from triglycerides to waxes. PMID:10712526

Purification of a jojoba embryo fatty acyl-coenzyme A reductase and expression of its cDNA in high erucic acid rapeseed.

PubMed

Metz, J G; Pollard, M R; Anderson, L; Hayes, T R; Lassner, M W

2000-03-01

The jojoba (Simmondsia chinensis) plant produces esters of long-chain alcohols and fatty acids (waxes) as a seed lipid energy reserve. This is in contrast to the triglycerides found in seeds of other plants. We purified an alcohol-forming fatty acyl-coenzyme A reductase (FAR) from developing embryos and cloned the cDNA encoding the enzyme. Expression of a cDNA in Escherichia coli confers FAR activity upon those cells and results in the accumulation of fatty alcohols. The FAR sequence shows significant homology to an Arabidopsis protein of unknown function that is essential for pollen development. When the jojoba FAR cDNA is expressed in embryos of Brassica napus, long-chain alcohols can be detected in transmethylated seed oils. Resynthesis of the gene to reduce its A plus T content resulted in increased levels of alcohol production. In addition to free alcohols, novel wax esters were detected in the transgenic seed oils. In vitro assays revealed that B. napus embryos have an endogenous fatty acyl-coenzyme A: fatty alcohol acyl-transferase activity that could account for this wax synthesis. Thus, introduction of a single cDNA into B. napus results in a redirection of a portion of seed oil synthesis from triglycerides to waxes.

Deletions of fetal and adult muscle cDNA in Duchenne and Becker muscular dystrophy patients.

PubMed Central

Cross, G S; Speer, A; Rosenthal, A; Forrest, S M; Smith, T J; Edwards, Y; Flint, T; Hill, D; Davies, K E

1987-01-01

We have isolated a cDNA molecule from a human adult muscle cDNA library which is deleted in several Duchenne muscular dystrophy patients. Patient deletions have been used to map the exons across the Xp21 region of the short arm of the X chromosome. We demonstrate that a very mildly affected 61 year old patient is deleted for at least nine exons of the adult cDNA. We find no evidence for differential exon usage between adult and fetal muscle in this region of the gene. There must therefore be less essential domains of the protein structure which can be removed without complete loss of function. The sequence of 2.0 kb of the adult cDNA shows no homology to any previously described protein listed in the data banks although sequence comparison at the amino acid level suggests that the protein has a structure not dissimilar to rod structures of cytoskeletal proteins such as lamin and myosin. There are single nucleotide differences in the DNA sequence between the adult and fetal cDNAs which result in amino acid changes but none that would be predicted to change the structure of the protein dramatically. Images Fig. 1. Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 7. PMID:3428261

[Effects of adenoviral vector containing human angiotensin II type 1 receptor antisense cDNA on biological action of human pulmonary artery smooth muscle cells].

PubMed

Tu, Ming-li; Wang, Han-qin; Lei, Huai-ding; Luo, Guo-shi; Liu, Xian-jun; Liu, Wei-shun; Xiong, Chang; Liu, Yu-quan; Ren, Si-qun

2005-04-01

To investigate the effect of human angiotensin II (AngII) type 1 receptor (AT(1)R) antisense cDNA (ahAT(1)) on migration, proliferation, and apoptosis of cultured human pulmonary artery smooth muscle cells (PASMC). Two recombinant adenoviral vectors, AdCMVahAT(1) containing full length antisense cDNA targeting to human AT(1)R mRNA, and AdCMVLacZ containing LacZ, were constructed by orientation clone technology and homologous recombination. The PASMC was divided into 3 groups (DMEM, AdCMVLacZ, AdCMVahAT(1)) and different interventions were given to different groups. AT(1)R expression was detected by RT-PCR and immunohistochemistry method; migration of PASMC was measured by Boyden's Chamer method. Other PASMC was divided into 4 groups (DMEM, AngII, AdCMVLacZ + AngII and AdCMVahAT(1) + AngII), and only the last 2 groups were respectively transfected with AdCMVLacZ and AdCMVahAT(1) before administration of AngII. From 6 h to 96 h after stimulation by AngII (10(-7) mol/L), proliferation index (PI) and apoptosis of PASMC were determined by flow cytometry. At the 48 h the level of AT(1)R mRNA was significantly less in PASMC transfected AdCMVahAT(1) than that in group DMEM and in group AdCMVLacZ. The protein level showed a same difference (P < 0.01). At 24 h the migration distance of PASMC also was significantly less in group AdCMVahAT(1) than that in group DMEM and Group AdCMVLacZ (P < 0.01). Stimulated by AngII for 48 h, in group AngII the PI of PASMC markedly increased (P < 0.01 vs group DMEM). But in Group AdCMVahAT(1) + AngII PI of PASMC clearly decreased (P < 0.01 vs group AngII and group DMEM respectively). There was no statistic difference of PI between group AdCMVLacZ + AngII and group AngII. Moreover, apoptosis peak emerged only in group AdCMVahAT(1) + AngII. The rate of apoptosis in those PASMC used AdCMVahAT(1) and AngII was 24.70 +/- 4.04 (P < 0.01 vs the other 3 groups respectively). These results indicate that AngII stimulates proliferation via AT(1) receptors in human PASMC, and antisense cDNA targeting to human AT(1)R transfection mediated by adenoviral vector has powerful inhibitory effects on AngII-induced migration and proliferation of human PASMC by attenuating AT(1)R mRNA and protein expression. Also, it can promote apoptosis of human PASMC. That demonstrate that AT(1)R antisense cDNA is a potent inhibitors of the actions of AngII on PASMC. Antisense inhibition targeting to AT(1)R has therapeutic potential for the treatment of pulmonary vascular diseases.

Dye bias correction in dual-labeled cDNA microarray gene expression measurements.

PubMed Central

Rosenzweig, Barry A; Pine, P Scott; Domon, Olen E; Morris, Suzanne M; Chen, James J; Sistare, Frank D

2004-01-01

A significant limitation to the analytical accuracy and precision of dual-labeled spotted cDNA microarrays is the signal error due to dye bias. Transcript-dependent dye bias may be due to gene-specific differences of incorporation of two distinctly different chemical dyes and the resultant differential hybridization efficiencies of these two chemically different targets for the same probe. Several approaches were used to assess and minimize the effects of dye bias on fluorescent hybridization signals and maximize the experimental design efficiency of a cell culture experiment. Dye bias was measured at the individual transcript level within each batch of simultaneously processed arrays by replicate dual-labeled split-control sample hybridizations and accounted for a significant component of fluorescent signal differences. This transcript-dependent dye bias alone could introduce unacceptably high numbers of both false-positive and false-negative signals. We found that within a given set of concurrently processed hybridizations, the bias is remarkably consistent and therefore measurable and correctable. The additional microarrays and reagents required for paired technical replicate dye-swap corrections commonly performed to control for dye bias could be costly to end users. Incorporating split-control microarrays within a set of concurrently processed hybridizations to specifically measure dye bias can eliminate the need for technical dye swap replicates and reduce microarray and reagent costs while maintaining experimental accuracy and technical precision. These data support a practical and more efficient experimental design to measure and mathematically correct for dye bias. PMID:15033598

Characterization of xanthine dehydrogenase and aldehyde oxidase of Marsupenaeus japonicus and their response to microbial pathogen.

PubMed

Okamura, Yo; Inada, Mari; Elshopakey, Gehad Elsaid; Itami, Toshiaki

2018-05-16

Reactive oxygen species (ROS) play key roles in many physiological processes. In particular, the sterilization mechanism of bacteria using ROS in macrophages is a very important function for biological defense. Xanthine dehydrogenase (XDH) and aldehyde oxidase (AOX), members of the molybdo-flavoenzyme subfamily, are known to generate ROS. Although these enzymes occur in many vertebrates, some insects, and plants, little research has been conducted on XDHs and AOXs in crustaceans. Here, we cloned the entire cDNA sequences of XDH (MjXDH: 4328 bp) and AOX (MjAOX: 4425 bp) from Marsupenaeus japonicus (kuruma shrimp) using reverse transcriptase-polymerase chain reaction (RT-PCR) and random amplification of cDNA ends (RACE). Quantitative real-time RT-PCR transcriptional analysis revealed that MjXDH mRNA is highly expressed in heart and stomach tissues, whereas MjAOX mRNA is highly expressed in the lymphoid organ and intestinal tissues. Furthermore, expression of MjAOX was determined to be up-regulated in the lymphoid organ in response to Vibrio penaeicida at 48 and 72 h after injection; in contrast, hydrogen peroxide (H 2 O 2 ) concentrations increased significantly at 6, 12, 48, and 72 h after injection with white spot syndrome virus (WSSV) and at 72 h after injection with V. penaeicida. To the best of our knowledge, this study is the first to have identified and cloned XDH and AOX from a crustacean species.

Frameshifting in the p6 cDNA phage display system.

PubMed

Govarts, Cindy; Somers, Klaartje; Stinissen, Piet; Somers, Veerle

2010-12-20

Phage display is a powerful technique that enables easy identification of targets for any type of ligand. Targets are displayed at the phage surface as a fusion protein to one of the phage coat proteins. By means of a repeated process of affinity selection on a ligand, specific enrichment of displayed targets will occur. In our studies using C-terminal display of cDNA fragments to phage coat protein p6, we noticed the occasional enrichment of targets that do not contain an open reading frame. This event has previously been described in other phage display studies using N-terminal display of targets to phage coat proteins and was due to uncommon translational events like frameshifting. The aim of this study was to examine if C-terminal display of targets to p6 is also subjected to frameshifting. To this end, an enriched target not containing an open reading frame was selected and an E-tag was coupled at the C-terminus in order to measure target display at the surface of the phage. The tagged construct was subsequently expressed in 3 different reading frames and display of both target and E-tag measured to detect the occurrence of frameshifting. As a result, we were able to demonstrate display of the target both in the 0 and in the +1 reading frame indicating that frameshifting can also take place when C-terminal fusion to minor coat protein p6 is applied.

Characterization and expression analysis of a complement component gene in sea cucumber ( Apostichopus japonicus)

NASA Astrophysics Data System (ADS)

Chen, Zhong; Zhou, Zunchun; Yang, Aifu; Dong, Ying; Guan, Xiaoyan; Jiang, Bei; Wang, Bai

2015-12-01

The complement system plays a crucial role in the innate immune system of animals. It can be activated by distinct yet overlapping classical, alternative and lectin pathways. In the alternative pathway, complement factor B (Bf) serves as the catalytic subunit of complement component 3 (C3) convertase, which plays the central role among three activation pathways. In this study, the Bf gene in sea cucumber ( Apostichopus japonicus), termed AjBf, was obtained by rapid amplification of cDNA ends (RACE). The full-length cDNA of AjBf was 3231 bp in length barring the poly (A) tail. It contained an open reading frame (ORF) of 2742 bp encoding 913 amino acids, a 105 bp 5'-UTR (5'-terminal untranslated region) and a 384 bp 3'-UTR. AjBf was a mosaic protein with six CCP (complement control protein) domains, a VWA (von Willebrand factor A) domain, and a serine protease domain. The deduced molecular weight of AjBf protein was 101 kDa. Quantitative real time PCR (qRT-PCR) analysis indicated that the expression level of AjBf in A. japonicus was obviously higher at larval stage than that at embryonic stage. Expression detection in different tissues showed that AjBf expressed higher in coelomocytes than in other four tissues. In addation, AjBf expression in different tissues was induced significantly after LPS or PolyI:C challenge. These results indicated that AjBf plays an important role in immune responses to pathogen infection.

Expression and Enzyme Activity of Catalase in Chilo suppressalis (Lepidoptera: Crambidae) Is Responsive to Environmental Stresses.

PubMed

Lu, Yanhui; Bai, Qi; Zheng, Xusong; Lu, Zhongxian

2017-08-01

Catalase (CAT) is an important antioxidant enzyme that protects organisms against oxidative stresses by eliminating hydrogen peroxide. In this study, we cloned and characterized a full-length cDNA of CAT from Chilo suppressalis (CsCAT) and examined the influence of environmental stresses on CsCAT expression and enzyme activity. The cDNA contains a 1659-bp open reading frame encoding a polypeptide of 553 amino acids most closely related (90.14%) to Papilio polytes catalases. The CsCAT was expressed in all developmental stages with the highest expression in the fat body, and the CsCAT enzyme activity closely mirrored its observed mRNA expression patterns. The CsCAT mRNA was up-regulated when the larvae were exposed to high temperature (≥30 °C), insecticides (abamectin and chlorantraniliprole), chemicals (H2O2, CHP, CdCl2, and CuSO4), and a dead-end trap plant (vetiver grass), and the CsCAT enzyme activity again mirrored the observed CsCAT expression patterns. These results suggest that up-regulation of CsCAT may enhance the defense response of C. suppressalis by weakening the effects of environmental stresses, and provide insight into the role of CsCAT during development of C. suppressalis. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Expression profiles of three types of GnRH during sex-change in the protandrous cinnamon clownfish, Amphiprion melanopus: Effects of exogenous GnRHs.

PubMed

Kim, Na Na; Shin, Hyun Suk; Habibi, Hamid R; Lee, Jehee; Choi, Cheol Young

2012-02-01

Gonadotropin-releasing hormones (GnRHs) play pivotal roles in the control of reproduction and gonadal maturation in teleost fish. Fish have multiple GnRH genes that encode structurally distinct peptides. We identified salmon GnRH (sGnRH), seabream GnRH (sbGnRH), and chicken GnRH-II (cGnRH-II) by cDNA cloning in cinnamon clownfish (Amphiprion melanopus) using reverse transcription-PCR (RT-PCR) and rapid amplification of cDNA ends-PCR (RACE-PCR). Gene identity was confirmed by sequence alignment and subsequent phylogenetic analyses. We also investigated GnRH mRNA expression in the gonads by quantitative real time-PCR (Q-PCR), and measured plasma estradiol-17β (E(2)) levels in immature fish following treatment with the three molecular forms of GnRHs. The expression levels of sGnRH, sbGnRH, and cGnRH-II mRNA were higher in mature testes and ovaries, as compared to the levels in gonads at earlier stages of maturity. The levels of the three prepro-GnRH mRNA species and the plasma E(2) levels increased after injection of the three GnRH variants. These findings support the hypothesis that GnRH peptides play important roles in the regulation of the hypothalamic-pituitary-gonadal axis and are probably involved in paracrine control of gonadal development and sex change in cinnamon clownfish. Copyright © 2011 Elsevier Inc. All rights reserved.