Sequence, molecular properties, and chromosomal mapping of mouse lumican
NASA Technical Reports Server (NTRS)
Funderburgh, J. L.; Funderburgh, M. L.; Hevelone, N. D.; Stech, M. E.; Justice, M. J.; Liu, C. Y.; Kao, W. W.; Conrad, G. W.; Spooner, B. S. (Principal Investigator)
1995-01-01
PURPOSE. Lumican is a major proteoglycan of vertebrate cornea. This study characterizes mouse lumican, its molecular form, cDNA sequence, and chromosomal localization. METHODS. Lumican sequence was determined from cDNA clones selected from a mouse corneal cDNA expression library using a bovine lumican cDNA probe. Tissue expression and size of lumican mRNA were determined using Northern hybridization. Glycosidase digestion followed by Western blot analysis provided characterization of molecular properties of purified mouse corneal lumican. Chromosomal mapping of the lumican gene (Lcn) used Southern hybridization of a panel of genomic DNAs from an interspecific murine backcross. RESULTS. Mouse lumican is a 338-amino acid protein with high-sequence identity to bovine and chicken lumican proteins. The N-terminus of the lumican protein contains consensus sequences for tyrosine sulfation. A 1.9-kb lumican mRNA is present in cornea and several other tissues. Antibody against bovine lumican reacted with recombinant mouse lumican expressed in Escherichia coli and also detected high molecular weight proteoglycans in extracts of mouse cornea. Keratanase digestion of corneal proteoglycans released lumican protein, demonstrating the presence of sulfated keratan sulfate chains on mouse corneal lumican in vivo. The lumican gene (Lcn) was mapped to the distal region of mouse chromosome 10. The Lcn map site is in the region of a previously identified developmental mutant, eye blebs, affecting corneal morphology. CONCLUSIONS. This study demonstrates sulfated keratan sulfate proteoglycan in mouse cornea and describes the tools (antibodies and cDNA) necessary to investigate the functional role of this important corneal molecule using naturally occurring and induced mutants of the murine lumican gene.
Babak, Tomas; Garrett-Engele, Philip; Armour, Christopher D; Raymond, Christopher K; Keller, Mark P; Chen, Ronghua; Rohl, Carol A; Johnson, Jason M; Attie, Alan D; Fraser, Hunter B; Schadt, Eric E
2010-08-13
Identifying associations between genotypes and gene expression levels using microarrays has enabled systematic interrogation of regulatory variation underlying complex phenotypes. This approach has vast potential for functional characterization of disease states, but its prohibitive cost, given hundreds to thousands of individual samples from populations have to be genotyped and expression profiled, has limited its widespread application. Here we demonstrate that genomic regions with allele-specific expression (ASE) detected by sequencing cDNA are highly enriched for cis-acting expression quantitative trait loci (cis-eQTL) identified by profiling of 500 animals in parallel, with up to 90% agreement on the allele that is preferentially expressed. We also observed widespread noncoding and antisense ASE and identified several allele-specific alternative splicing variants. Monitoring ASE by sequencing cDNA from as little as one sample is a practical alternative to expression genetics for mapping cis-acting variation that regulates RNA transcription and processing.
Subramaniam, R; Reinold, S; Molitor, E K; Douglas, C J
1993-01-01
A heterologous probe encoding phenylalanine ammonia-lyase (PAL) was used to identify PAL clones in cDNA libraries made with RNA from young leaf tissue of two Populus deltoides x P. trichocarpa F1 hybrid clones. Sequence analysis of a 2.4-kb cDNA confirmed its identity as a full-length PAl clone. The predicted amino acid sequence is conserved in comparison with that of PAL genes from several other plants. Southern blot analysis of popular genomic DNA from parental and hybrid individuals, restriction site polymorphism in PAL cDNA clones, and sequence heterogeneity in the 3' ends of several cDNA clones suggested that PAL is encoded by at least two genes that can be distinguished by HindIII restriction site polymorphisms. Clones containing each type of PAL gene were isolated from a poplar genomic library. Analysis of the segregation of PAL-specific HindIII restriction fragment-length polymorphisms demonstrated the existence of two independently segregating PAL loci, one of which was mapped to a linkage group of the poplar genetic map. Developmentally regulated PAL expression in poplar was analyzed using RNA blots. Highest expression was observed in young stems, apical buds, and young leaves. Expression was lower in older stems and undetectable in mature leaves. Cellular localization of PAL expression by in situ hybridization showed very high levels of expression in subepidermal cells of leaves early during leaf development. In stems and petioles, expression was associated with subepidermal cells and vascular tissues. PMID:8108506
Cloning, sequencing, and expression of cDNA for human. beta. -glucuronidase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Oshima, A.; Kyle, J.W.; Miller, R.D.
1987-02-01
The authors report here the cDNA sequence for human placental ..beta..-glucuronidase (..beta..-D-glucuronoside glucuronosohydrolase, EC 3.2.1.31) and demonstrate expression of the human enzyme in transfected COS cells. They also sequenced a partial cDNA clone from human fibroblasts that contained a 153-base-pair deletion within the coding sequence and found a second type of cDNA clone from placenta that contained the same deletion. Nuclease S1 mapping studies demonstrated two types of mRNAs in human placenta that corresponded to the two types of cDNA clones isolated. The NH/sub 2/-terminal amino acid sequence determined for human spleen ..beta..-glucuronidase agreed with that inferred from the DNAmore » sequence of the two placental clones, beginning at amino acid 23, suggesting a cleaved signal sequence of 22 amino acids. When transfected into COS cells, plasmids containing either placental clone expressed an immunoprecipitable protein that contained N-linked oligosaccharides as evidenced by sensitivity to endoglycosidase F. However, only transfection with the clone containing the 153-base-pair segment led to expression of human ..beta..-glucuronidase activity. These studies provide the sequence for the full-length cDNA for human ..beta..-glucuronidase, demonstrate the existence of two populations of mRNA for ..beta..-glucuronidase in human placenta, only one of which specifies a catalytically active enzyme, and illustrate the importance of expression studies in verifying that a cDNA is functionally full-length.« less
2010-01-01
Background Identifying associations between genotypes and gene expression levels using microarrays has enabled systematic interrogation of regulatory variation underlying complex phenotypes. This approach has vast potential for functional characterization of disease states, but its prohibitive cost, given hundreds to thousands of individual samples from populations have to be genotyped and expression profiled, has limited its widespread application. Results Here we demonstrate that genomic regions with allele-specific expression (ASE) detected by sequencing cDNA are highly enriched for cis-acting expression quantitative trait loci (cis-eQTL) identified by profiling of 500 animals in parallel, with up to 90% agreement on the allele that is preferentially expressed. We also observed widespread noncoding and antisense ASE and identified several allele-specific alternative splicing variants. Conclusion Monitoring ASE by sequencing cDNA from as little as one sample is a practical alternative to expression genetics for mapping cis-acting variation that regulates RNA transcription and processing. PMID:20707912
Lu, L; Komada, M; Kitamura, N
1998-06-15
Hrs is a 115kDa zinc finger protein which is rapidly tyrosine phosphorylated in cells stimulated with various growth factors. We previously purified the protein from a mouse cell line and cloned its cDNA. In the present study, we cloned a human Hrs cDNA from a human placenta cDNA library by cross-hybridization, using the mouse cDNA as a probe, and determined its nucleotide sequence. The human Hrs cDNA encoded a 777-amino-acid protein whose sequence was 93% identical to that of mouse Hrs. Northern blot analysis showed that the Hrs mRNA was about 3.0kb long and was expressed in all the human adult and fetal tissues tested. In addition, we showed by genomic Southern blot analysis that the human Hrs gene was a single-copy gene with a size of about 20kb. Furthermore, the human Hrs gene was mapped to chromosome 17 by Southern blotting of genomic DNAs from human/rodent somatic cell hybrids. Copyright 1998 Elsevier Science B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Kikuchi, Shoshi
2009-02-01
Completion of the high-precision genome sequence analysis of rice led to the collection of about 35,000 full-length cDNA clones and the determination of their complete sequences. Mapping of these full-length cDNA sequences has given us information on (1) the number of genes expressed in the rice genome; (2) the start and end positions and exon-intron structures of rice genes; (3) alternative transcripts; (4) possible encoded proteins; (5) non-protein-coding (np) RNAs; (6) the density of gene localization on the chromosome; (7) setting the parameters of gene prediction programs; and (8) the construction of a microarray system that monitors global gene expression. Manual curation for rice gene annotation by using mapping information on full-length cDNA and EST assemblies has revealed about 32,000 expressed genes in the rice genome. Analysis of major gene families, such as those encoding membrane transport proteins (pumps, ion channels, and secondary transporters), along with the evolution from bacteria to higher animals and plants, reveals how gene numbers have increased through adaptation to circumstances. Family-based gene annotation also gives us a new way of comparing organisms. Massive amounts of data on gene expression under many kinds of physiological conditions are being accumulated in rice oligoarrays (22K and 44K) based on full-length cDNA sequences. Cluster analyses of genes that have the same promoter cis-elements, that have similar expression profiles, or that encode enzymes in the same metabolic pathways or signal transduction cascades give us clues to understanding the networks of gene expression in rice. As a tool for that purpose, we recently developed "RiCES", a tool for searching for cis-elements in the promoter regions of clustered genes.
Phaneuf, D; Labelle, Y; Bérubé, D; Arden, K; Cavenee, W; Gagné, R; Tanguay, R M
1991-01-01
Type 1 hereditary tyrosinemia (HT) is an autosomal recessive disease characterized by a deficiency of the enzyme fumarylacetoacetate hydrolase (FAH; E.C.3.7.1.2). We have isolated human FAH cDNA clones by screening a liver cDNA expression library using specific antibodies and plaque hybridization with a rat FAH cDNA probe. A 1,477-bp cDNA was sequenced and shown to code for FAH by an in vitro transcription-translation assay and sequence homology with tryptic fragments of purified FAH. Transient expression of this FAH cDNA in transfected CV-1 mammalian cells resulted in the synthesis of an immunoreactive protein comigrating with purified human liver FAH on SDS-PAGE and having enzymatic activity as shown by the hydrolysis of the natural substrate fumarylacetoacetate. This indicates that the single polypeptide chain encoded by the FAH gene contains all the genetic information required for functional activity, suggesting that the dimer found in vivo is a homodimer. The human FAH cDNA was used as a probe to determine the gene's chromosomal localization using somatic cell hybrids and in situ hybridization. The human FAH gene maps to the long arm of chromosome 15 in the region q23-q25. Images Figure 1 Figure 3 Figure 4 Figure 6 Figure 8 PMID:1998338
Human retina-specific amine oxidase (RAO): cDNA cloning, tissue expression, and chromosomal mapping
DOE Office of Scientific and Technical Information (OSTI.GOV)
Imamura, Yutaka; Kubota, Ryo; Wang, Yimin
In search of candidate genes for hereditary retinal disease, we have employed a subtractive and differential cDNA cloning strategy and isolated a novel retina-specific cDNA. Nucleotide sequence analysis revealed an open reading frame of 2187 bp, which encodes a 729-amino-acid protein with a calculated molecular mass of 80,644 Da. The putative protein contained a conserved domain of copper amine oxidase, which is found in various species from bacteria to mammals. It showed the highest homology to bovine serum amine oxidase, which is believed to control the level of serum biogenic amines. Northern blot analysis of human adult and fetal tissuesmore » revealed that the protein is expressed abundantly and specifically in retina as a 2.7-kb transcript. Thus, we considered this protein a human retina-specific amine oxidase (RAO). The RAO gene (AOC2) was mapped by fluorescence in situ hybridization to human chromosome 17q21. We propose that AOC2 may be a candidate gene for hereditary ocular diseases. 38 refs., 4 figs.« less
Pu, L; Zhang, L C; Zhang, J S; Song, X; Wang, L G; Liang, J; Zhang, Y B; Liu, X; Yan, H; Zhang, T; Yue, J W; Li, N; Wu, Q Q; Wang, L X
2016-08-12
Mitogen-activated protein kinase kinase kinase 5 (MAP3K5) is essential for apoptosis, proliferation, differentiation, and immune responses, and is a candidate marker for residual feed intake (RFI) in pig. We cloned the full-length cDNA sequence of porcine MAP3K5 by rapid-amplification of cDNA ends. The 5451-bp gene contains a 5'-untranslated region (UTR) (718 bp), a coding region (3738 bp), and a 3'-UTR (995 bp), and encodes a peptide of 1245 amino acids, which shares 97, 99, 97, 93, 91, and 84% sequence identity with cattle, sheep, human, mouse, chicken, and zebrafish MAP3K5, respectively. The deduced MAP3K5 protein sequence contains two conserved domains: a DUF4071 domain and a protein kinase domain. Phylogenetic analysis showed that porcine MAP3K5 forms a separate branch to vicugna and camel MAP3K5. Tissue expression analysis using real-time quantitative polymerase chain reaction (qRT-PCR) revealed that MAP3K5 was expressed in the heart, liver, spleen, lung, kidney, muscle, fat, pancrea, ileum, and stomach tissues. Copy number variation was detected for porcine MAP3K5 and validated by qRT-PCR. Furthermore, a significant increase in average copy number was detected in the low RFI group when compared to the high RFI group in a Duroc pig population. These results provide useful information regarding the influence of MAP3K5 on RFI in pigs.
A novel gene, RSD-3/HSD-3.1, encodes a meiotic-related protein expressed in rat and human testis.
Zhang, Xiaodong; Liu, Huixian; Zhang, Yan; Qiao, Yuan; Miao, Shiying; Wang, Linfang; Zhang, Jianchao; Zong, Shudong; Koide, S S
2003-06-01
The expression of stage-specific genes during spermatogenesis was determined by isolating two segments of rat seminiferous tubule at different stages of the germinal epithelium cycle delineated by transillumination-delineated microdissection, combined with differential display polymerase chain reaction to identify the differential transcripts formed. A total of 22 cDNAs were identified and accepted by GenBank as new expressed sequence tags. One of the expressed sequence tags was radiolabeled and used as a probe to screen a rat testis cDNA library. A novel full-length cDNA composed of 2228 bp, designated as RSD-3 (rat sperm DNA no.3, GenBank accession no. AF094609) was isolated and characterized. The reading frame encodes a polypeptide consisting of 526 amino acid residues, containing a number of DNA binding motifs and phosphorylation sites for PKC, CK-II, and p34cdc2. Northern blot of mRNA prepared from various tissues of adult rats showed that RSD-3 is expressed only in the testis. The initial expression of the RSD-3 gene was detected in the testis on the 30th postnatal day and attained adult level on the 60th postnatal day. Immunolocalization of RSD-3 in germ cells of rat testis showed that its expression is restricted to primary spermatocytes, undergoing meiosis division I. A human testis homologue of RSD-3 cDNA, designated as HSD-3.1 (GenBank accession no. AF144487) was isolated by screening the Human Testis Rapid-Screen arrayed cDNA library panels by RT-PCR. The exon-intron boundaries of HSD-3.1 gene were determined by aligning the cDNA sequence with the corresponding genome sequence. The cDNA consisted of 12 exons that span approximately 52.8 kb of the genome sequence and was mapped to chromosome 14q31.3.
[Cloning of human CD45 gene and its expression in Hela cells].
Li, Jie; Xu, Tianyu; Wu, Lulin; Zhang, Liyun; Lu, Xiao; Zuo, Daming; Chen, Zhengliang
2015-11-01
To clone human CD45 gene PTPRC and establish Hela cells overexpressing recombinant human CD45 protein. The intact cDNA encoding human CD45 amplified using RT-PCR from the total RNA extracted from peripheral blood mononuclear cells (PBMCs) of a healthy donor was cloned into pMD-18T vector. The CD45 cDNA fragment amplified from the pMD-18T-CD45 by PCR was inserted to the coding region of the PcDNA3.1-3xflag vector, and the resultant recombinant expression vector PcDNA3.1-3xflag-CD45 was transfected into Hela cells. The expression of CD45 in Hela cells was detected by flow cytometry and Western blotting, and the phosphastase activity of CD45 was quantified using an alkaline phosphatase assay kit. The cDNA fragment of about 3 900 bp was amplified from human PBMCs and cloned into pMD-18T vector. The recombinant expression vector PcDNA3.1-3xflag-CD45 was constructed, whose restriction maps and sequence were consistent with those expected. The expression of CD45 in transfected Hela cells was detected by flow cytometry and Western blotting, and the expressed recombinant CD45 protein in Hela cells showed a phosphastase activity. The cDNA of human CD45 was successfully cloned and effectively expressed in Hela cells, which provides a basis for further exploration of the functions of CD45.
USDA-ARS?s Scientific Manuscript database
Genomic and cDNA sequences corresponding to a ferredoxin-sulfite reductase (SiR) have been cloned from bulb onion (Allium cepa L.) and the expression of the gene and activity of the enzyme characterised with respect to sulfur (S) supply. Cloning, mapping and expression studies revealed that onion ha...
Isolation and expression of homeobox genes from the embryonic chicken eye.
Dhawan, R R; Schoen, T J; Beebe, D C
1997-06-11
To identify homeobox-containing genes that may play a role in the differentiation of ocular tissues. Total RNA was isolated from microdissected chicken embryo eye tissues at 3.5 days of development (embryonic day 3.5; E3.5). An "anchor-oligo-dT primer" was used for the synthesis of cDNA. Degenerate oligonucleotides designed from highly-conserved sequences in the third helix of the homeobox and the "anchor-primer" were used to amplify cDNAs by polymerase chain reaction (PCR). PCR products were cloned and sequenced. The spatial and temporal expression of selected transcripts was mapped by whole-mount in situ hybridization and northern blot analysis. After sequencing eighteen clones we identified a member of the distal-less family (dlx-3) in cDNA from presumptive neural retina and three chicken homologs of the Xenopus "anterior neural fold" (Xanf-1) in cDNA from anterior eye tissue. Dlx transcripts were mapped by in situ hybridization. Expression began at Hamburger and Hamilton stage 14 (E2.5) and was widely distributed in embryonic mesenchyme on E3 and E4. Expression increased in the retina during early development and persisted until after hatching. The one anf clone selected for further study was not detected by in situ or northern blot analysis. It is feasible to isolate homeobox cDNAs directly from microdissected embryonic tissues. Chicken dlx-3 mRNA has a wider distribution in the embryo than expected, based on the expression of the mouse homolog. Dlx-3 may play a role in establishing or maintaining the differentiation of the retina.
Candidate gene database and transcript map for peach, a model species for fruit trees.
Horn, Renate; Lecouls, Anne-Claire; Callahan, Ann; Dandekar, Abhaya; Garay, Lilibeth; McCord, Per; Howad, Werner; Chan, Helen; Verde, Ignazio; Main, Doreen; Jung, Sook; Georgi, Laura; Forrest, Sam; Mook, Jennifer; Zhebentyayeva, Tatyana; Yu, Yeisoo; Kim, Hye Ran; Jesudurai, Christopher; Sosinski, Bryon; Arús, Pere; Baird, Vance; Parfitt, Dan; Reighard, Gregory; Scorza, Ralph; Tomkins, Jeffrey; Wing, Rod; Abbott, Albert Glenn
2005-05-01
Peach (Prunus persica) is a model species for the Rosaceae, which includes a number of economically important fruit tree species. To develop an extensive Prunus expressed sequence tag (EST) database for identifying and cloning the genes important to fruit and tree development, we generated 9,984 high-quality ESTs from a peach cDNA library of developing fruit mesocarp. After assembly and annotation, a putative peach unigene set consisting of 3,842 ESTs was defined. Gene ontology (GO) classification was assigned based on the annotation of the single "best hit" match against the Swiss-Prot database. No significant homology could be found in the GenBank nr databases for 24.3% of the sequences. Using core markers from the general Prunus genetic map, we anchored bacterial artificial chromosome (BAC) clones on the genetic map, thereby providing a framework for the construction of a physical and transcript map. A transcript map was developed by hybridizing 1,236 ESTs from the putative peach unigene set and an additional 68 peach cDNA clones against the peach BAC library. Hybridizing ESTs to genetically anchored BACs immediately localized 11.2% of the ESTs on the genetic map. ESTs showed a clustering of expressed genes in defined regions of the linkage groups. [The data were built into a regularly updated Genome Database for Rosaceae (GDR), available at (http://www.genome.clemson.edu/gdr/).].
Primary structure, expression and chromosomal locus of a human homolog of rat ERK3.
Meloche, S; Beatty, B G; Pellerin, J
1996-10-03
We report the cloning and characterization of a human cDNA encoding a novel homolog of rat extracellular signal-regulated kinase 3 (ERK3). The cDNA encodes a predicted protein of 721 amino acids which shares 92% amino acid identity with rat ERK3 over their shared length. Interestingly, the human protein contains a unique extension of 178 amino acids at its carboxy terminal extremity. The human ERK3 protein also displays various degrees of homology to other members of the MAP kinases family, but does not contain the typical TXY regulatory motif between subdomains VII and VIII. Northern blot analysis revealed that ERK3 mRNA is widely distributed in human tissues, with the highest expression detected in skeletal muscle. The human ERK3 gene was mapped by fluorescence in situ hybridization to chromosome 15q21, a region associated with chromosomal abnormalities in acute nonlymphoblastic leukemias. This information should prove valuable in designing studies to define the cellular function of the ERK3 protein kinase.
Simonin, F; Gavériaux-Ruff, C; Befort, K; Matthes, H; Lannes, B; Micheletti, G; Mattéi, M G; Charron, G; Bloch, B; Kieffer, B
1995-01-01
Using the mouse delta-opioid receptor cDNA as a probe, we have isolated genomic clones encoding the human mu- and kappa-opioid receptor genes. Their organization appears similar to that of the human delta receptor gene, with exon-intron boundaries located after putative transmembrane domains 1 and 4. The kappa gene was mapped at position q11-12 in human chromosome 8. A full-length cDNA encoding the human kappa-opioid receptor has been isolated. The cloned receptor expressed in COS cells presents a typical kappa 1 pharmacological profile and is negatively coupled to adenylate cyclase. The expression of kappa-opioid receptor mRNA in human brain, as estimated by reverse transcription-polymerase chain reaction, is consistent with the involvement of kappa-opioid receptors in pain perception, neuroendocrine physiology, affective behavior, and cognition. In situ hybridization studies performed on human fetal spinal cord demonstrate the presence of the transcript specifically in lamina II of the dorsal horn. Some divergences in structural, pharmacological, and anatomical properties are noted between the cloned human and rodent receptors. Images Fig. 3 Fig. 4 PMID:7624359
Towards a transcription map spanning a 250 kb area within the DiGeorge syndrome chromosome region
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wong, W.; Emanuel, B.S.; Siegert, J.
1994-09-01
DiGeorge syndrome (DGS) and velocardiofacial syndrome (VCFS) are congenital anomalies affecting predominantly the thymus, parathyroid glands, heart and craniofacial development. Detection of 22q11.2 deletions in the majority of DGS and VCFS patients implicate 22q11 haploinsufficiency in the etiology of these disorders. The VCFS/DGS critical region lies within the proximal portion of a commonly deleted 1.2 Mb region in 22q11. A 250 kb cosmid contig covering this critical region and containing D22S74 (N25) has been established. From this contig, eleven cosmids with minimal overlap were biotinylated by nick translation, and hybridized to PCR-amplified cDNAs prepared from different tissues. The use ofmore » cDNAs from a variety of tissues increases the likelihood of identifying low abundance transcripts and tissue-specific expressed sequences. A DGCR-specific cDNA sublibrary consisting of 670 cDNA clones has been constructed. To date, 49 cDNA clones from this sub-library have been identified with single copy probes and cosmids containing putative CpG islands. Based on sequence analysis, 25 of the clones contain regions of homology to several cDNAs which map within the proximal contig. LAN is a novel partial cDNA isolated from a fetal brain library probed with one of the cosmids in the proximal contig. Using LAN as a probe, we have found 19 positive clones in the DGCR-specific cDNA sub-library (4 clones from fetal brain, 14 from adult skeletal muscle and one from fetal liver). Some of the LAN-positive clones extend the partial cDNA in the 5{prime} direction and will be useful in assembling a full length transcript. This resource will be used to develop a complete transcriptional map of the critical region in order to identify candidate gene(s) involved in the etiology of DGS/VCFS and to determine the relationship between the transcriptional and physical maps of 22q11.« less
Singh, Raksha; Lee, Jae-Eun; Dangol, Sarmina; Choi, Jihyun; Yoo, Ran Hee; Moon, Jae Sun; Shim, Jae-Kyung; Rakwal, Randeep; Agrawal, Ganesh Kumar; Jwa, Nam-Soo
2014-01-01
The mitogen-activated protein kinase (MAPK) cascade is composed at least of MAP3K (for MAPK kinase kinase), MAP2K, and MAPK family modules. These components together play a central role in mediating extracellular signals to the cell and vice versa by interacting with their partner proteins. However, the MAP3K-interacting proteins remain poorly investigated in plants. Here, we utilized a yeast two-hybrid system and bimolecular fluorescence complementation in the model crop rice (Oryza sativa) to map MAP3K-interacting proteins. We identified 12 novel nonredundant interacting protein pairs (IPPs) representing 11 nonredundant interactors using 12 rice MAP3Ks (available as full-length cDNA in the rice KOME (http://cdna01.dna.affrc.go.jp/cDNA/) at the time of experimental design and execution) as bait and a rice seedling cDNA library as prey. Of the 12 MAP3Ks, only six had interacting protein partners. The established MAP3K interactome consisted of two kinases, three proteases, two forkhead-associated domain-containing proteins, two expressed proteins, one E3 ligase, one regulatory protein, and one retrotransposon protein. Notably, no MAP3K showed physical interaction with either MAP2K or MAPK. Seven IPPs (58.3%) were confirmed in vivo by bimolecular fluorescence complementation. Subcellular localization of 14 interactors, together involved in nine IPPs (75%) further provide prerequisite for biological significance of the IPPs. Furthermore, GO of identified interactors predicted their involvement in diverse physiological responses, which were supported by a literature survey. These findings increase our knowledge of the MAP3K-interacting proteins, help in proposing a model of MAPK modules, provide a valuable resource for developing a complete map of the rice MAPK interactome, and allow discussion for translating the interactome knowledge to rice crop improvement against environmental factors. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Westhoff, Connie M.; Uy, Jon Michael; Aguad, Maria; Smeland‐Wagman, Robin; Kaufman, Richard M.; Rehm, Heidi L.; Green, Robert C.; Silberstein, Leslie E.
2015-01-01
BACKGROUND There are 346 serologically defined red blood cell (RBC) antigens and 33 serologically defined platelet (PLT) antigens, most of which have known genetic changes in 45 RBC or six PLT genes that correlate with antigen expression. Polymorphic sites associated with antigen expression in the primary literature and reference databases are annotated according to nucleotide positions in cDNA. This makes antigen prediction from next‐generation sequencing data challenging, since it uses genomic coordinates. STUDY DESIGN AND METHODS The conventional cDNA reference sequences for all known RBC and PLT genes that correlate with antigen expression were aligned to the human reference genome. The alignments allowed conversion of conventional cDNA nucleotide positions to the corresponding genomic coordinates. RBC and PLT antigen prediction was then performed using the human reference genome and whole genome sequencing (WGS) data with serologic confirmation. RESULTS Some major differences and alignment issues were found when attempting to convert the conventional cDNA to human reference genome sequences for the following genes: ABO, A4GALT, RHD, RHCE, FUT3, ACKR1 (previously DARC), ACHE, FUT2, CR1, GCNT2, and RHAG. However, it was possible to create usable alignments, which facilitated the prediction of all RBC and PLT antigens with a known molecular basis from WGS data. Traditional serologic typing for 18 RBC antigens were in agreement with the WGS‐based antigen predictions, providing proof of principle for this approach. CONCLUSION Detailed mapping of conventional cDNA annotated RBC and PLT alleles can enable accurate prediction of RBC and PLT antigens from whole genomic sequencing data. PMID:26634332
Pua, Eng-Chong; Lee, Yi-Chuan
2003-02-13
As part of a study to understand the molecular basis of fruit ripening, this study reports the isolation and characterization of a banana cytochrome P450 (P450) cDNA, designated as MAP450-1, which was associated with fruit ripening of banana. MAP450-1 encoded a single polypeptide of 507 amino acid residues that shared an overall identity of 27-45% with that of several plant P450s, among which MAP450-1 was most related phylogenetically to the avocado P450 CYP71A1. The polypeptide that possessed residue domains conserved in all P450s was classified as CYP71N1. Expression of CYP71N1 varied greatly between banana organs. Transcripts were detected only in peel and pulp of the ripening fruit and not in unripe fruit tissues at all developmental stages or other organs (root, leaf, ovary and flower). During ripening, transcripts were barely detectable in pre-climacteric and climacteric fruits but, as ripening progressed, they began to accumulate and reached a maximum in post-climacteric fruits. CYP71N1 expression in pre-climacteric fruit could be upregulated by exogenous application of ethylene (1-5 ppm) and treatment of overripe fruit with exogenous sucrose (50-300 mM) but not glucose downregulated the expression. These results indicate that P450s may not play a role in fruit development and its expression is associated with ripening, which may be regulated, in part, by ethylene and/or sucrose, at the transcript level.
Analysis of large-scale gene expression data.
Sherlock, G
2000-04-01
The advent of cDNA and oligonucleotide microarray technologies has led to a paradigm shift in biological investigation, such that the bottleneck in research is shifting from data generation to data analysis. Hierarchical clustering, divisive clustering, self-organizing maps and k-means clustering have all been recently used to make sense of this mass of data.
Shakhov, A N; Rubtsov, A V; Lyakhov, I G; Tumanov, A V; Nedospasov, S A
2000-02-01
Lymphotoxin (LT) deficient mice have profound defects in the splenic microarchitecture associated with defective expression on certain gene products, including chemokines. By using subtraction cloning of splenic cDNA from wild-type and LT alpha or TNF/LT alpha double deficient mice we isolated a novel murine gene encoding a secretory type phospholipase A2, called SPLASH. The two major alternative transcripts of SPLASH gene are predominantly expressed in lymphoid tissues, such as spleen and lymph nodes. SPLASH maps to the distal part of chromosome 4, to which several cancer-related loci have been also mapped.
Cloning of cDNA of major antigen of foot and mouth disease virus and expression in E. coli
NASA Astrophysics Data System (ADS)
Küpper, Hans; Keller, Walter; Kurz, Christina; Forss, Sonja; Schaller, Heinz
1981-02-01
Double-stranded DNA copies of the single-stranded genomic RNA of foot and mouth disease virus have been cloned into the Escherichia coli plasmid pBR322. A restriction map of the viral genome was established and aligned with the biochemical map of foot and mouth disease virus. The coding sequence for structural protein VP1, the major antigen of the virus, was identified and inserted into a plasmid vector where the expression of this sequence is under control of the phage λ PL promoter. In an appropriate host the synthesis of antigenic polypeptide can be demonstrated by radioimmunoassay.
NASA Astrophysics Data System (ADS)
Bushel, Pierre R.; Bennett, Lee; Hamadeh, Hisham; Green, James; Ableson, Alan; Misener, Steve; Paules, Richard; Afshari, Cynthia
2002-06-01
We present an analysis of pattern recognition procedures used to predict the classes of samples exposed to pharmacologic agents by comparing gene expression patterns from samples treated with two classes of compounds. Rat liver mRNA samples following exposure for 24 hours with phenobarbital or peroxisome proliferators were analyzed using a 1700 rat cDNA microarray platform. Sets of genes that were consistently differentially expressed in the rat liver samples following treatment were stored in the MicroArray Project System (MAPS) database. MAPS identified 238 genes in common that possessed a low probability (P < 0.01) of being randomly detected as differentially expressed at the 95% confidence level. Hierarchical cluster analysis on the 238 genes clustered specific gene expression profiles that separated samples based on exposure to a particular class of compound.
Turgeon, B; Saba-El-Leil, M K; Meloche, S
2000-02-15
MAP (mitogen-activated protein) kinases are a family of serine/threonine kinases that have a pivotal role in signal transduction. Here we report the cloning and characterization of a mouse homologue of extracellular-signal-regulated protein kinase (ERK)3. The mouse Erk3 cDNA encodes a predicted protein of 720 residues, which displays 94% identity with human ERK3. Transcription and translation of this cDNA in vitro generates a 100 kDa protein similar to the human gene product ERK3. Immunoblot analysis with an antibody raised against a unique sequence of ERK3 also recognizes a 100 kDa protein in mouse tissues. A single transcript of Erk3 was detected in every adult mouse tissue examined, with the highest expression being found in the brain. Interestingly, expression of Erk3 mRNA is acutely regulated during mouse development, with a peak of expression observed at embryonic day 11. The mouse Erk3 gene was mapped to a single locus on central mouse chromosome 9, adjacent to the dilute mutation locus and in a region syntenic to human chromosome 15q21. Finally, we provide several lines of evidence to support the existence of a unique Erk3 gene product of 100 kDa in mammalian cells.
Chromosomal mapping of the human M6 genes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Olinsky, S.; Loop, B.T.; DeKosky, A.
1996-05-01
M6 is a neuronal membrane glycoprotein that may have an important role in neural development. This molecule was initially defined by a monoclonal antibody that affected the survival of cultured cerebellar neurons and the outgrowth of neurites. The nature of the antigen was discovered by expression cDNA cloning using this monoclonal antibody. Two distinct murine M6 cDNAs (designated M6a and M6b) whose deduced amino acid sequences were remarkably similar to that of the myelin proteolipid protein human cDNA and genomic clones encoding M6a and M6b and have characterized them by restriction mapping, Southern hybridization with cDNA probes, and sequence analysis.more » We have localized these genes within the human genome by FISH (fluorescence in situ hybridization). The human M6a gene is located at 4q34, and the M6b gene is located at Xp22.2 A number of human neurological disorders have been mapped to the Xp22 region, including Aicardi syndrome (MIM 304050), Rett syndrome (MIM 312750), X-linked Charcot-Marie-Tooth neuropathy (MIM 302801), and X-linked mental retardation syndromes (MRX1, MIM 309530). This raises the possibility that a defect in the M6b gene is responsible for one of these neurological disorders. 8 refs., 3 figs.« less
Bioinformatics and expressional analysis of cDNA clones from floral buds
NASA Astrophysics Data System (ADS)
Pawełkowicz, Magdalena Ewa; Skarzyńska, Agnieszka; Cebula, Justyna; Hincha, Dirck; ZiÄ bska, Karolina; PlÄ der, Wojciech; Przybecki, Zbigniew
2017-08-01
The application of genomic approaches may serve as an initial step in understanding the complexity of biochemical network and cellular processes responsible for regulation and execution of many developmental tasks. The molecular mechanism of sex expression in cucumber is still not elucidated. A study of differential expression was conducted to identify genes involved in sex determination and floral organ morphogenesis. Herein, we present generation of expression sequence tags (EST) obtained by differential hybridization (DH) and subtraction technique (cDNA-DSC) and their characteristic features such as molecular function, involvement in biology processes, expression and mapping position on the genome.
Isolation and characterization of a cDNA clone specific for avian vitellogenin II.
Protter, A A; Wang, S Y; Shelness, G S; Ostapchuk, P; Williams, D L
1982-01-01
A clone for vitellogenin, a major avian, estrogen responsive egg yolk protein, was isolated from the cDNA library of estrogen-induced rooster liver. Two forms of plasma vitellogenin, vitellogenin I (VTG I) and vitellogenin II (VTG II), distinguishable on the basis of their unique partial proteolysis maps, have been characterized and their corresponding hepatic precursor forms identified. We have used this criterion to specifically characterize which vitellogenin protein had been cloned. Partial proteolysis maps of BTG I and VTG II standards, synthesized in vivo, were compared to maps of protein synthesized in vitro using RNA hybrid-selected by the vitellogenin plasmid. Eight major digest fragments were found common to the in vitro synthesized vitellogenin and the VTG II standard while no fragments were observed to correspond to the VTG I map. A restriction map of the VTG II cDNA clone permits comparison to previously described cDNA and genomic vitellogenin clones. Images PMID:6182527
USDA-ARS?s Scientific Manuscript database
The objectives of this study were (1) to evaluate differential gene expression levels for resistance to A. flavus kernel infection in susceptible (Va35) and resistant (Mp313E) maize lines using Oligonucleotide and cDNA microarray analysis, (2) to evaluate differences in A. flavus accumulation betwee...
[Multiplexing mapping of human cDNAs]. Final report, September 1, 1991--February 28, 1994
DOE Office of Scientific and Technical Information (OSTI.GOV)
Not Available
Using PCR with automated product analysis, 329 human brain cDNA sequences have been assigned to individual human chromosomes. Primers were designed from single-pass cDNA sequences expressed sequence tags (ESTs). Primers were used in PCR reactions with DNA from somatic cell hybrid mapping panels as templates, often with multiplexing. Many ESTs mapped match sequence database records. To evaluate of these matches, the position of the primers relative to the matching region (In), the BLAST scores and the Poisson probability values of the EST/sequence record match were determined. In cases where the gene product was stringently identified by the sequence match hadmore » already been mapped, the gene locus determined by EST was consistent with the previous position which strongly supports the validity of assigning unknown genes to human chromosomes based on the EST sequence matches. In the present cases mapping the ESTs to a chromosome can also be considered to have mapped the known gene product: rolipram-sensitive cAMP phosphodiesterase, chromosome 1; protein phosphatase 2A{beta}, chromosome 4; alpha-catenin, chromosome 5; the ELE1 oncogene, chromosome 10q11.2 or q2.1-q23; MXII protein, chromosome l0q24-qter; ribosomal protein L18a homologue, chromosome 14; ribosomal protein L3, chromosome 17; and moesin, Xp11-cen. There were also ESTs mapped that were closely related to non-human sequence records. These matches therefore can be considered to identify human counterparts of known gene products, or members of known gene families. Examples of these include membrane proteins, translation-associated proteins, structural proteins, and enzymes. These data then demonstrate that single pass sequence information is sufficient to design PCR primers useful for assigning cDNA sequences to human chromosomes. When the EST sequence matches previous sequence database records, the chromosome assignments of the EST can be used to make preliminary assignments of the human gene to a chromosome.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sharma, V.; Bonnycastle, L.; Poorkai, P.
1994-09-01
We have constructed a yeast artificial chromosome (YAC) contig of chromosome 14q24.3 which encompasses the chromosome 14 Alzheimer`s disease locus (AD3). Determined by linkage analysis of early-onset Alzheimer`s disease kindreds, this interval is bounded by the genetic markers D14S61-D14S63 and spans approximately 15 centimorgans. The contig consists of 29 markers and 74 YACs of which 57 are defined by one or more sequence tagged sites (STSs). The STS markers comprise 5 genes, 16 short tandem repeat polymorphisms and 8 cDNA clones. An additional number of genes, expressed sequence tags and cDNA fragments have been identified and localized to the contigmore » by hybridization and sequence analysis of anonymous clones isolated by cDNA direct selection techniques. A minimal contig of about 15 YACs averaging 0.5-1.5 megabase in length will span this interval and is, at first approximation, in rough agreement with the genetic map. For two regions of the contig, our coverage has relied on L1/THE fingerprint and Alu-PCR hybridization data of YACs provided by CEPH/Genethon. We are currently developing sequence tagged sites from these to confirm the overlaps revealed by the fingerprint data. Among the genes which map to the contig are transforming growth factor beta 3, c-fos, and heat shock protein 2A (HSPA2). C-fos is not a candidate gene for AD3 based on the sequence analysis of affected and unaffected individuals. HSPA2 maps to the proximal edge of the contig and Calmodulin 1, a candidate gene from 4q24.3, maps outside of the region. The YAC contig is a framework physical map from which cosmid or P1 clone contigs can be constructed. As more genes and cDNAs are mapped, a highly resolved transcription map will emerge, a necessary step towards positionally cloning the AD3 gene.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ishida, Yoshikazu; Hadano, Shinji; Nagayama, Tomiko
1994-07-15
The authors have established an approach to the isolation of expressed DNA sequences from a defined region of the human chromosome. The method relies on the direct screening of cDNA libraries using pooled single-copy microclones generated by a laser chromosome microdissection in conjunction with a single unique primer polymerase chain reaction (SUP-PCR) procedure. They applied this method to the distal region of human chromosome 4p (4p15-4pter), which contains the Huntington disease (HD) and the Wolf-Hirschhorn syndrome (WHS) loci. Twenty-one nonoverlapping and region-specific cDNA clones encoding novel genes were isolated in this manner. Ten of 21 clones were subregionally assigned tomore » 4p16.1-4pter, and the remainder mapped to the region proximal to 4p16.1. Northern blot and reverse transcription followed by the PCR (RT-PCR) analysis revealed that 16 of these 21 clones detected transcripts in total RNA from human tissues. The method is applicable to other chromosomal regions and is a powerful approach to the isolation of region-specific cDNA clones. 44 refs., 3 figs., 3 tabs.« less
Wistow, Graeme; Bernstein, Steven L; Wyatt, M Keith; Fariss, Robert N; Behal, Amita; Touchman, Jeffrey W; Bouffard, Gerald; Smith, Don; Peterson, Katherine
2002-06-15
The retinal pigment epithelium (RPE) and choroid comprise a functional unit of the eye that is essential to normal retinal health and function. Here we describe expressed sequence tag (EST) analysis of human RPE/choroid as part of a project for ocular bioinformatics. A cDNA library (cs) was made from human RPE/choroid and sequenced. Data were analyzed and assembled using the program GRIST (GRouping and Identification of Sequence Tags). Complete sequencing, Northern and Western blots, RH mapping, peptide antibody synthesis and immunofluorescence (IF) have been used to examine expression patterns and genome location for selected transcripts and proteins. Ten thousand individual sequence reads yield over 6300 unique gene clusters of which almost half have no matches with named genes. One of the most abundant transcripts is from a gene (named "alpha") that maps to the BBS1 region of chromosome 11. A number of tissue preferred transcripts are common to both RPE/choroid and iris. These include oculoglycan/opticin, for which an alternative splice form is detected in RPE/choroid, and "oculospanin" (Ocsp), a novel tetraspanin that maps to chromosome 17q. Antiserum to Ocsp detects expression in RPE, iris, ciliary body, and retinal ganglion cells by IF. A newly identified gene for a zinc-finger protein (TIRC) maps to 19q13.4. Variant transcripts of several genes were also detected. Most notably, the predominant form of Bestrophin represented in cs contains a longer open reading frame as a result of splice junction skipping. The unamplified cs library gives a view of the transcriptional repertoire of the adult RPE/choroid. A large number of potentially novel genes and splice forms and candidates for genetic diseases are revealed. Clones from this collection are being included in a large, nonredundant set for cDNA microarray construction.
Wang, H; Miao, S; Chen, D; Wang, L; Koide, S S
1999-10-06
The gene (HSD-1) coding a human sperm membrane protein (hSMP-1) was isolated from a human testis cDNA expression library using antibodies found in the serum of an infertile woman. HSD-1 was localized to a single locus on chromosome 9 and assigned to band 9p12-p13 by fluorescent in situ hybridization (FISH) mapping and DAPI (4,6-diamidino-2-phenylindole) banding, using rat/human somatic cell hybrids and metaphase chromosomes of human lymphocytes. In rescreening a testis lambdagt10 cDNA expression library, the full-length cDNA (HSD-1) and several truncated cDNAs with heterologous regions were isolated from positive clones. The heterology consisted of deletion, insertion and alteration of the 5'-end. These heterologous truncated fragments may be produced by alternative splicing of mRNAs. Two recombinant prokaryotic expression vectors were constructed with one of the heterologous fragment (clone #26) with and without the alternative 5'-end. Escherichia coli transfected with the construct containing the alternative 5'-end failed to produce the recombinant product, whereas those transfected with the vector lacking the 5'-end produced hSMP-1. DNASIS analysis of the structure of #26 mRNA suggests that the 5'-end has a stable secondary configuration that may maintain the mRNA in an inactivated state, whereby hindering its translation and preventing the expression of the gene.
Sequencing of cDNA Clones from the Genetic Map of Tomato (Lycopersicon esculentum)
Ganal, Martin W.; Czihal, Rosemarie; Hannappel, Ulrich; Kloos, Dorothee-U.; Polley, Andreas; Ling, Hong-Qing
1998-01-01
The dense RFLP linkage map of tomato (Lycopersicon esculentum) contains >300 anonymous cDNA clones. Of those clones, 272 were partially or completely sequenced. The sequences were compared at the DNA and protein level to known genes in databases. For 57% of the clones, a significant match to previously described genes was found. The information will permit the conversion of those markers to STS markers and allow their use in PCR-based mapping experiments. Furthermore, it will facilitate the comparative mapping of genes across distantly related plant species by direct comparison of DNA sequences and map positions. [cDNA sequence data reported in this paper have been submitted to the EMBL database under accession nos. AA824695–AA825005 and the dbEST_Id database under accession nos. 1546519–1546862.] PMID:9724330
Identification and characterization of a novel serine-threonine kinase gene from the Xp22 region.
Montini, E; Andolfi, G; Caruso, A; Buchner, G; Walpole, S M; Mariani, M; Consalez, G; Trump, D; Ballabio, A; Franco, B
1998-08-01
Eukaryotic protein kinases are part of a large and expanding family of proteins. Through our transcriptional mapping effort in the Xp22 region, we have isolated and sequenced the full-length transcript of STK9, a novel cDNA highly homologous to serine-threonine kinases. A number of human genetic disorders have been mapped to the region where STK9 has been localized including Nance-Horan (NH) syndrome, oral-facial-digital syndrome type 1 (OFD1), and a novel locus for nonsyndromic sensorineural deafness (DFN6). To evaluate the possible involvement of STK9 in any of the above-mentioned disorders, a 2416-bp full-length cDNA was assembled. The entire genomic structure of the gene, which is composed of 20 coding exons, was determined. Northern analysis revealed a transcript larger than 9.5 kb in several tissues including brain, lung, and kidney. The mouse homologue (Stk9) was identified and mapped in the mouse in the region syntenic to human Xp. This location is compatible with the location of the Xcat mutant, which shows congenital cataracts very similar to those observed in NH patients. Sequence homologies, expression pattern, and mapping information in both human and mouse make STK9 a candidate gene for the above-mentioned disorders. Copyright 1998 Academic Press.
Screening and analyzing genes associated with Amur tiger placental development.
Li, Q; Lu, T F; Liu, D; Hu, P F; Sun, B; Ma, J Z; Wang, W J; Wang, K F; Zhang, W X; Chen, J; Guan, W J; Ma, Y H; Zhang, M H
2014-09-26
The Amur tiger is a unique endangered species in the world, and thus, protection of its genetic resources is extremely important. In this study, an Amur tiger placenta cDNA library was constructed using the SMART cDNA Library Construction kit. A total of 508 colonies were sequenced, in which 205 (76%) genes were annotated and mapped to 74 KEGG pathways, including 29 metabolism, 29 genetic information processing, 4 environmental information processing, 7 cell motility, and 5 organismal system pathways. Additionally, PLAC8, PEG10 and IGF-II were identified after screening genes from the expressed sequence tags, and they were associated with placental development. These findings could lay the foundation for future functional genomic studies of the Amur tiger.
Anti-liver-kidney microsome antibody type 1 recognizes human cytochrome P450 db1.
Gueguen, M; Yamamoto, A M; Bernard, O; Alvarez, F
1989-03-15
Anti-liver-kidney microsome antibody type 1 (LKM1), present in the sera of a group of children with autoimmune hepatitis, was recently shown to recognize a 50 kDa protein identified as rat liver cytochromes P450 db1 and db2. High homology between these two members of the rat P450 IID subfamily and human P450 db1 suggested that anti-LKM1 antibody is directed against this human protein. To test this hypothesis, a human liver cDNA expression library in phage lambda GT-11 was screened using rat P450 db1 cDNA as a probe. Two human cDNA clones were found to be identical to human P450 db1 by restriction mapping. Immunoblot analysis using as antigen, the purified fusion protein from one of the human cDNA clones showed that only anti-LKM1 with anti-50 kDa reactivity recognized the fusion protein. This fusion protein was further used to develop an ELISA test that was shown to be specific for sera of children with this disease. These results: 1) identify the human liver antigen recognized by anti-LKM1 auto-antibodies as cytochrome P450 db1, 2) allow to speculate that mutation on the human P450 db1 gene could alter its expression in the hepatocyte and make it auto-antigenic, 3) provide a simple and specific diagnostic test for this disease.
Yamaguchi, Shinji; Fujii-Taira, Ikuko; Murakami, Akio; Hirose, Naoki; Aoki, Naoya; Izawa, Ei-Ichi; Fujimoto, Yasuyuki; Takano, Tatsuya; Matsushima, Toshiya; Homma, Koichi J
2008-06-15
Using cDNA microarrays, we have identified elsewhere the genes of microtubule-associated proteins as a group up-regulated in newly hatched chick brains after filial imprinting training. Here we show by in situ hybridization that the mRNA for the microtubule-associated protein 2 (MAP2) gene was enriched in the mesopallium and the hippocampus in the trained chick brain. The regionally specific enrichments of MAP2 mRNA were not observed in the brain of dark-reared or light-exposed chick as controls, implying an association between the degree of expression and the strength of the learned preference. In agreement with the gene expression, MAP2 protein was accumulated in the mesopallium of the trained chick brain, but not in the brains of the controls. The accumulation of MAP2 was found in the cytosol of neurons and co-localized with beta-tubulin, suggesting a change in microtubule assembly. Our results suggest a postnatal reorganization of cytoskeleton following filial imprinting.
Bushakra, Jill M; Lewers, Kim S; Staton, Margaret E; Zhebentyayeva, Tetyana; Saski, Christopher A
2015-10-26
Due to a relatively high level of codominant inheritance and transferability within and among taxonomic groups, simple sequence repeat (SSR) markers are important elements in comparative mapping and delineation of genomic regions associated with traits of economic importance. Expressed sequence tags (ESTs) are a source of SSRs that can be used to develop markers to facilitate plant breeding and for more basic research across genera and higher plant orders. Leaf and meristem tissue from 'Heritage' red raspberry (Rubus idaeus) and 'Bristol' black raspberry (R. occidentalis) were utilized for RNA extraction. After conversion to cDNA and library construction, ESTs were sequenced, quality verified, assembled and scanned for SSRs. Primers flanking the SSRs were designed and a subset tested for amplification, polymorphism and transferability across species. ESTs containing SSRs were functionally annotated using the GenBank non-redundant (nr) database and further classified using the gene ontology database. To accelerate development of EST-SSRs in the genus Rubus (Rosaceae), 1149 and 2358 cDNA sequences were generated from red raspberry and black raspberry, respectively. The cDNA sequences were screened using rigorous filtering criteria which resulted in the identification of 121 and 257 SSR loci for red and black raspberry, respectively. Primers were designed from the surrounding sequences resulting in 131 and 288 primer pairs, respectively, as some sequences contained more than one SSR locus. Sequence analysis revealed that the SSR-containing genes span a diversity of functions and share more sequence identity with strawberry genes than with other Rosaceous species. This resource of Rubus-specific, gene-derived markers will facilitate the construction of linkage maps composed of transferable markers for studying and manipulating important traits in this economically important genus.
Fan, Qing-Jie; Yan, Feng-Xia; Qiao, Guang; Zhang, Bing-Xue; Wen, Xiao-Peng
2014-01-01
Drought is one of the most severe threats to the growth, development and yield of plant. In order to unravel the molecular basis underlying the high tolerance of pitaya (Hylocereus undatus) to drought stress, suppression subtractive hybridization (SSH) and cDNA microarray approaches were firstly combined to identify the potential important or novel genes involved in the plant responses to drought stress. The forward (drought over drought-free) and reverse (drought-free over drought) suppression subtractive cDNA libraries were constructed using in vitro shoots of cultivar 'Zihonglong' exposed to drought stress and drought-free (control). A total of 2112 clones, among which half were from either forward or reverse SSH library, were randomly picked up to construct a pitaya cDNA microarray. Microarray analysis was carried out to verify the expression fluctuations of this set of clones upon drought treatment compared with the controls. A total of 309 expressed sequence tags (ESTs), 153 from forward library and 156 from reverse library, were obtained, and 138 unique ESTs were identified after sequencing by clustering and blast analyses, which included genes that had been previously reported as responsive to water stress as well as some functionally unknown genes. Thirty six genes were mapped to 47 KEGG pathways, including carbohydrate metabolism, lipid metabolism, energy metabolism, nucleotide metabolism, and amino acid metabolism of pitaya. Expression analysis of the selected ESTs by reverse transcriptase polymerase chain reaction (RT-PCR) corroborated the results of differential screening. Moreover, time-course expression patterns of these selected ESTs further confirmed that they were closely responsive to drought treatment. Among the differentially expressed genes (DEGs), many are related to stress tolerances including drought tolerance. Thereby, the mechanism of drought tolerance of this pitaya genotype is a very complex physiological and biochemical process, in which multiple metabolism pathways and many genes were implicated. The data gained herein provide an insight into the mechanism underlying the drought stress tolerance of pitaya, as well as may facilitate the screening of candidate genes for drought tolerance. © 2013 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Haiming Chen; Lalioti, M.D.; Perrin, G.
1996-07-01
In an effort to contribute to the transcript map of human chromosome 21 and the understanding of the pathophysiology of trisomy 21, we have used exon trapping to identify fragments of chromosome 21 genes. Two trapped exons, from pools of chromosome 21-specific cosmids, showed homology to the Drosophila white (w) gene. We subsequently cloned the corresponding cDNA for a human homologue of the Drosophila w gene (hW) from human retina and fetal brain cDNA libraries. The gene belongs to the ATP-binding cassette transporter gene family and is homologous to Drosophila w (and to 2 genes from other species) and tomore » a lesser extent to Drosophila brown (bw) and scarlet (st) genes that are all involved in the transport of eye pigment precursor molecules. A DNA polymorphism with 62% heterozygosity due to variation of a poly (T) region in the 3{prime} UTR of the hW has been identified and used for the incorporation of this gene to the genetic map of chromosome 21. The hW is located at 21q22.3 between DNA markers D21S212 and D21S49 in a P1 clone that also contains marker BCEI. The gene is expressed at various levels in many human tissues. The contributions of this gene to the Down syndrome phenotypes, to human eye color, and to the resulting phenotypes of null or missense mutations are presently unknown. 56 refs., 8 figs., 1 tab.« less
NASA Technical Reports Server (NTRS)
Reddy, A. S.; Reddy, V. S.; Golovkin, M.
2000-01-01
Calmodulin (CaM), a key calcium sensor in all eukaryotes, regulates diverse cellular processes by interacting with other proteins. To isolate CaM binding proteins involved in ethylene signal transduction, we screened an expression library prepared from ethylene-treated Arabidopsis seedlings with 35S-labeled CaM. A cDNA clone, EICBP (Ethylene-Induced CaM Binding Protein), encoding a protein that interacts with activated CaM was isolated in this screening. The CaM binding domain in EICBP was mapped to the C-terminus of the protein. These results indicate that calcium, through CaM, could regulate the activity of EICBP. The EICBP is expressed in different tissues and its expression in seedlings is induced by ethylene. The EICBP contains, in addition to a CaM binding domain, several features that are typical of transcription factors. These include a DNA-binding domain at the N terminus, an acidic region at the C terminus, and nuclear localization signals. In database searches a partial cDNA (CG-1) encoding a DNA-binding motif from parsley and an ethylene up-regulated partial cDNA from tomato (ER66) showed significant similarity to EICBP. In addition, five hypothetical proteins in the Arabidopsis genome also showed a very high sequence similarity with EICBP, indicating that there are several EICBP-related proteins in Arabidopsis. The structural features of EICBP are conserved in all EICBP-related proteins in Arabidopsis, suggesting that they may constitute a new family of DNA binding proteins and are likely to be involved in modulating gene expression in the presence of ethylene.
Yao, Q; Fischer, K P; Tyrrell, D L; Gutfreund, K S
2015-04-01
Programmed death ligand-1 (PD-L1) plays an important role in the attenuation of adaptive immune responses in higher vertebrates. Here, we describe the identification of the Pekin duck PD-L1 orthologue (duPD-L1) and its gene structure. The duPD-L1 cDNA encodes a 311-amino acid protein that has an amino acid identity of 78% and 42% with chicken and human PD-L1, respectively. Mapping of the duPD-L1 cDNA with duck genomic sequences revealed an exonic structure of its coding sequence similar to those of other vertebrates but lacked a noncoding exon 1. Homology modelling of the duPD-L1 extracellular domain was compatible with the tandem IgV-like and IgC-like IgSF domain structure of human PD-L1 (PDB ID: 3BIS). Residues known to be important for receptor binding of human PD-L1 were mostly conserved in duPD-L1 within the N-terminus and the G sheet, and partially conserved within the F sheet but not within sheets C and C'. DuPD-L1 mRNA was constitutively expressed in all tissues examined with highest expression levels in lung and spleen and very low levels of expression in muscle, kidney and brain. Mitogen stimulation of duck peripheral blood mononuclear cells transiently increased duPD-L1 mRNA expression. Our observations demonstrate evolutionary conservation of the exonic structure of its coding sequence, the extracellular domain structure and residues implicated in receptor binding, but the role of the longer cytoplasmic tail in avian PD-L1 proteins remains to be determined. © 2014 John Wiley & Sons Ltd.
Characterization of embryo-specific genes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Not Available
1989-01-01
The objective of the proposed research is to characterize the structure and function of a set of genes whose expression is regulated in embryo development, and that is not expressed in mature tissues -- the embryonic genes. In the last two years, using cDNA clones, we have isolated 22 cDNA clones, and characterized the expression pattern of their corresponding RNA. At least 4 cDNA clones detect RNAs of embryonic genes. These cDNA clones detect RNAs expressed in somatic as well as zygotic embryos of carrot. Using the cDNA clones, we screened the genomic library of carrot embryo DNA, and isolatedmore » genomic clones for three genes. The structure and function of two genes DC 8 and DC 59 have been characterized and are reported in this paper.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hadano, S.; Ishida, Y.; Tomiyasu, H.
1994-09-01
To complete a transcription map of the 1 Mb region in human chromosome 4p16.3 containing the Huntington disease (HD) gene, the isolation of cDNA clones are being performed throughout. Our method relies on a direct screening of the cDNA libraries probed with single copy microclones from 3 YAC clones spanning 1 Mbp of the HD gene region. AC-DNAs were isolated by a preparative pulsed-field gel electrophoresis, amplified by both a single unique primer (SUP)-PCR and a linker ligation PCR, and 6 microclone-DNA libraries were generated. Then, 8,640 microclones from these libraries were independently amplified by PCR, and arrayed onto themore » membranes. 800-900 microclones that were not cross-hybridized with total human and yeast genomic DNA, TAC vector DNA, and ribosomal cDNA on a dot hybridization (putatively carrying single copy sequences) were pooled to make 9 probe pools. A total of {approximately}1.8x10{sup 7} plaques from the human brain cDNA libraries was screened with 9 pool-probes, and then 672 positive cDNA clones were obtained. So far, 597 cDNA clones were defined and arrayed onto a map of the 1 Mbp of the HD gene region by hybridization with HD region-specific cosmid contigs and YAC clones. Further characterization including a DNA sequencing and Northern blot analysis is currently underway.« less
Characterization and mapping of cDNA encoding aspartate aminotransferase in rice, Oryza sativa L.
Song, J; Yamamoto, K; Shomura, A; Yano, M; Minobe, Y; Sasaki, T
1996-10-31
Fifteen cDNA clones, putatively identified as encoding aspartate aminotransferase (AST, EC 2.6.1.1.), were isolated and partially sequenced. Together with six previously isolated clones putatively identified to encode ASTs (Sasaki, et al. 1994, Plant Journal 6, 615-624), their sequences were characterized and classified into 4 cDNA species. Two of the isolated clones, C60213 and C2079, were full-length cDNAs, and their complete nucleotide sequences were determined. C60213 was 1612 bp long and its deduced amino acid sequence showed 88% homology with that of Panicum miliaceum L. mitochondrial AST. The C60213-encoded protein had an N-terminal amino acid sequence that was characteristic of a mitochondrial transit peptide. On the other hand, C2079 was 1546 bp long and had 91% amino acid sequence homology with P. miliaceum L. cytosolic AST but lacked in the transit peptide sequence. The homologies of nucleotide sequences and deduced amino acid sequences of C2079 and C60213 were 54% and 52%, respectively. C2079 and C60213 were mapped on chromosomes 1 and 6, respectively, by restriction fragment length polymorphism linkage analysis. Northern blot analysis using C2079 as a probe revealed much higher transcript levels in callus and root than in green and etiolated shoots, suggesting tissue-specific variations of AST gene expression.
A Linkage Map of the Asian Tiger Mosquito (Aedes albopictus) Based on cDNA Markers
Sutherland, Ian W.; Mori, Akio; Montgomery, John; Fleming, Karen L.; Anderson, Jennifer M.; Valenzuela, Jesus G.; Severson, David W.
2011-01-01
The Asian tiger mosquito, Aedes (Stegomyia) albopictus (Skuse), is an important vector of a number of arboviruses, and populations exhibit extreme variation in adaptive traits such as egg diapause, cold hardiness, and autogeny (ability to mature a batch of eggs without blood feeding). The genetic basis of some of these traits has been established, but lack of a high-resolution linkage map has prevented in-depth genetic analyses of the genes underlying these complex traits. We report here on the breeding of 4 F1 intercross mapping families and the use of these to locate 35 cDNA markers to the A. albopictus linkage map. The present study increases the number of markers on the A. albopictus cDNA linkage map from 38 to 73 and the density of markers from 1 marker/5.7 cM to 1 marker/2.9 cM and adds 9, 16, and 10 markers to the 3 linkage groups, respectively. The overall lengths of the 3 linkage groups are 64.5, 76.5, and 71.6 cM, respectively, for a combined length of 212.6 cM. Despite conservation in the order of most genes among the 4 families and a previous mapping family, we found substantial heterogeneity in the amount of recombination among markers. This was most marked in linkage group I, which varied between 16.7 and 69.3 cM. A map integrating the results from these 4 families with an earlier cDNA linkage map is presented. PMID:21148282
van Zyl, Leonel; von Arnold, Sara; Bozhkov, Peter; Chen, Yongzhong; Egertsdotter, Ulrika; MacKay, John; Sederoff, Ronald R.; Shen, Jing; Zelena, Lyubov
2002-01-01
Hybridization of labelled cDNA from various cell types with high-density arrays of expressed sequence tags is a powerful technique for investigating gene expression. Few conifer cDNA libraries have been sequenced. Because of the high level of sequence conservation between Pinus and Picea we have investigated the use of arrays from one genus for studies of gene expression in the other. The partial cDNAs from 384 identifiable genes expressed in differentiating xylem of Pinus taeda were printed on nylon membranes in randomized replicates. These were hybridized with labelled cDNA from needles or embryogenic cultures of Pinus taeda, P. sylvestris and Picea abies, and with labelled cDNA from leaves of Nicotiana tabacum. The Spearman correlation of gene expression for pairs of conifer species was high for needles (r2 = 0.78 − 0.86), and somewhat lower for embryogenic cultures (r2 = 0.68 − 0.83). The correlation of gene expression for tobacco leaves and needles of each of the three conifer species was lower but sufficiently high (r2 = 0.52 − 0.63) to suggest that many partial gene sequences are conserved in angiosperms and gymnosperms. Heterologous probing was further used to identify tissue-specific gene expression over species boundaries. To evaluate the significance of differences in gene expression, conventional parametric tests were compared with permutation tests after four methods of normalization. Permutation tests after Z-normalization provide the highest degree of discrimination but may enhance the probability of type I errors. It is concluded that arrays of cDNA from loblolly pine are useful for studies of gene expression in other pines or spruces. PMID:18629264
Huebner, K; Druck, T; Croce, C M; Thiesen, H J
1991-01-01
cDNA clones encoding zinc finger structures were isolated by screening Molt4 and Jurkat cDNA libraries with zinc finger consensus sequences. Candidate clones were partially sequenced to verify the presence of zinc finger-encoding regions; nonoverlapping cDNA clones were chosen on the basis of sequences and genomic hybridization pattern. Zinc finger structure-encoding clones, which were designated by the term "Kox" and a number from 1 to 32 and which were apparently unique (i.e., distinct from each other and distinct from those isolated by other laboratories), were chosen for mapping in the human genome. DNAs from rodent-human somatic cell hybrids retaining defined complements of human chromosomes were analyzed for the presence of each of the Kox genes. Correlation between the presence of specific human chromosome regions and specific Kox genes established the chromosomal locations. Multiple Kox loci were mapped to 7q (Kox 18 and 25 and a locus detected by both Kox 8 cDNA and Kox 27 cDNA), 8q24 5' to the myc locus (Kox 9 and 32), 10cen----q24 (Kox 2, 15, 19, 21, 30, and 31), 12q13-qter (Kox 1 and 20), 17p13 (Kox 11 and 26), and 19q (Kox 5, 6, 10, 22, 24, and 28). Single Kox loci were mapped to 7p22 (Kox 3), 18q12 (Kox 17), 19p (Kox 13), 22q11 between IG lambda and BCR-1 (locus detected by both Kox 8 cDNA and Kox 27 cDNA), and Xp (Kox 14). Several of the Kox loci map to regions in which other zinc finger structure-encoding loci have already been localized, indicating possible zinc finger gene clusters. In addition, Kox genes at 8q24, 17p13, and 22q11--and perhaps other Kox genes--are located near recurrent chromosomal translocation breakpoints. Others, such as those on 7p and 7q, may be near regions specifically active in T cells. Images Figure 4 Figure 5 Figure 2 Figure 3 PMID:2014798
Rustenholz, Camille; Choulet, Frédéric; Laugier, Christel; Safár, Jan; Simková, Hana; Dolezel, Jaroslav; Magni, Federica; Scalabrin, Simone; Cattonaro, Federica; Vautrin, Sonia; Bellec, Arnaud; Bergès, Hélène; Feuillet, Catherine; Paux, Etienne
2011-12-01
To improve our understanding of the organization and regulation of the wheat (Triticum aestivum) gene space, we established a transcription map of a wheat chromosome (3B) by hybridizing a newly developed wheat expression microarray with bacterial artificial chromosome pools from a new version of the 3B physical map as well as with cDNA probes derived from 15 RNA samples. Mapping data for almost 3,000 genes showed that the gene space spans the whole chromosome 3B with a 2-fold increase of gene density toward the telomeres due to an increase in the number of genes in islands. Comparative analyses with rice (Oryza sativa) and Brachypodium distachyon revealed that these gene islands are composed mainly of genes likely originating from interchromosomal gene duplications. Gene Ontology and expression profile analyses for the 3,000 genes located along the chromosome revealed that the gene islands are enriched significantly in genes sharing the same function or expression profile, thereby suggesting that genes in islands acquired shared regulation during evolution. Only a small fraction of these clusters of cofunctional and coexpressed genes was conserved with rice and B. distachyon, indicating a recent origin. Finally, genes with the same expression profiles in remote islands (coregulation islands) were identified suggesting long-distance regulation of gene expression along the chromosomes in wheat.
Xu, Y L; Li, L; Wu, K; Peeters, A J; Gage, D A; Zeevaart, J A
1995-07-03
The biosynthesis of gibberellins (GAs) after GA12-aldehyde involves a series of oxidative steps that lead to the formation of bioactive GAs. Previously, a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing), EC 1.14.11.-] was isolated by immunoscreening a cDNA library from liquid endosperm of pumpkin (Cucurbita maxima L.) with antibodies against partially purified GA 20-oxidase. Here, we report isolation of a genomic clone for GA 20-oxidase from a genomic library of the long-day species Arabidopsis thaliana Heynh., strain Columbia, by using the pumpkin cDNA clone as a heterologous probe. This genomic clone contains a GA 20-oxidase gene that consists of three exons and two introns. The three exons are 1131-bp long and encode 377 amino acid residues. A cDNA clone corresponding to the putative GA 20-oxidase genomic sequence was constructed with the reverse transcription-PCR method, and the identity of the cDNA clone was confirmed by analyzing the capability of the fusion protein expressed in Escherichia coli to convert GA53 to GA44 and GA19 to GA20. The Arabidopsis GA 20-oxidase shares 55% identity and > 80% similarity with the pumpkin GA 20-oxidase at the derived amino acid level. Both GA 20-oxidases share high homology with other 2-oxoglutarate-dependent dioxygenases (2-ODDs), but the highest homology was found between the two GA 20-oxidases. Mapping results indicated tight linkage between the cloned GA 20-oxidase and the GA5 locus of Arabidopsis. The ga5 semidwarf mutant contains a G-->A point mutation that inserts a translational stop codon in the protein-coding sequence, thus confirming that the GA5 locus encodes GA 20-oxidase. Expression of the GA5 gene in Ara-bidopsis leaves was enhanced after plants were transferred from short to long days; it was reduced by GA4 treatment, suggesting end-product repression in the GA biosynthetic pathway.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xu, Yun-Ling; Li, Li; Wu, Keqiang
1995-07-03
The biosynthesis of gibberellins (GAs) after GA{sub 12}-aldehyde involves a series of oxidative steps that lead to the formation of bioactive GAs. Previously, a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing), EC 1.14.11-] was isolated by immunoscreening a cDNA library from liquid endosperm of pumpkin (Cucurbita maxima L.) with antibodies against partially purified GA 20-oxidase. Here, we report isolation of a genomic clone for GA 20-oxidase from a genomic library of the long-day species Arabidopsis thaliana Heynh., strain Columbia, by using the pumpkin cDNA clone as a heterologous probe. This genomic clone contains a GA 20-oxidasemore » gene that consists of three exons and two introns. The three exons are 1131-bp long and encode 377 amino acid residues. A cDNA clone corresponding to the putative GA 20-oxidase genomic sequence was constructed with the reverse transcription-PCR method, and the identity of the cDNA clone was confirmed by analyzing the capability of the fusion protein expressed in Escherichia coli to convert GA{sub 53} to GA{sub 44} and GA{sub 19} to GA{sub 20}. The Arabidopsis GA 20-oxidase shares 55% identity and >80% similarity with the pumpkin GA 20-oxidase at the derived amino acid level. Both GA 20-oxidases share high homology with other 2-oxoglutarate-dependent dioxygenases (2-ODDs), but the highest homology was found between the two GA 20-oxidases. Mapping results indicated tight linkage between the cloned GA 20-oxidase and the GA locus of Arabidopsis. The ga5 semidwarf mutant contains a G {yields} A point mutation that inserts a translational stop codon in the protein-coding sequence, thus confirming that the GA5 locus encodes GA 20-oxidase. Expression of the GA5 gene in Arabidopsis leaves was enhanced after plants were transferred from short to long days; it was reduced by GA{sub 4} treatment, suggesting end-product repression in the GA biosynthetic pathway. 28 refs., 6 figs.« less
Characterization and chromosomal mapping of the human TFG gene involved in thyroid carcinoma
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mencinger, M.; Panagopoulos, I.; Andreasson, P.
1997-05-01
Homology searches in the Expressed Sequence Tag Database were performed using SPYGQ-rich regions as query sequences to find genes encoding protein regions similar to the N-terminal parts of the sarcoma-associated EWS and FUS proteins. Clone 22911 (T74973), encoding a SPYGQ-rich region in its 5{prime} end, and several other clones that overlapped 22911 were selected. The combined data made it possible to assemble a full-length cDNA sequence. This cDNA sequence is 1677 bp, containing an initiation codon ATG, an open reading frame of 400 amino acids, a poly(A) signal, and a poly(A) tail. We found 100% identity between the 5{prime} partmore » of the consensus sequence and the 598-bp-long sequence named TFG. The TFG sequence is fused to the 3{prime} end of NTRK1, generating the TRK-T3 fusion transcript found in papillary thyroid carcinoma. The cDNA therefore represents the full-length transcript of the TFG gene. TFG was localized to 3q11-q12 by fluorescence in situ hybridization. The 3{prime} and the 5{prime} ends of the TFG cDNA probe hybridized to a 2.2-kb band on Northern blot filters in all tissues examined. 28 refs., 5 figs., 1 tab.« less
Chung, F Z; Lentes, K U; Gocayne, J; Fitzgerald, M; Robinson, D; Kerlavage, A R; Fraser, C M; Venter, J C
1987-01-26
Two cDNA clones, lambda-CLFV-108 and lambda-CLFV-119, encoding for the beta-adrenergic receptor, have been isolated from a human brain stem cDNA library. One human genomic clone, LCV-517 (20 kb), was characterized by restriction mapping and partial sequencing. The human brain beta-receptor consists of 413 amino acids with a calculated Mr of 46480. The gene contains three potential glucocorticoid receptor-binding sites. The beta-receptor expressed in human brain was homology with rodent (88%) and avian (52%) beta-receptors and with porcine muscarinic cholinergic receptors (31%), supporting our proposal [(1984) Proc. Natl. Acad. Sci. USA 81, 272 276] that adrenergic and muscarinic cholinergic receptors are structurally related. This represents the first cloning of a neurotransmitter receptor gene from human brain.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Claffey, K.P.; Herrera, V.L.; Brecher, P.
1987-12-01
A fatty acid binding protein (FABP) as been identified and characterized in rat heart, but the function and regulation of this protein are unclear. In this study the cDNA for rat heart FABP was cloned from a lambda gt11 library. Sequencing of the cDNA showed an open reading frame coding for a protein with 133 amino acids and a calculated size of 14,776 daltons. Several differences were found between the sequence determined from the cDNA and that reported previously by protein sequencing techniques. Northern blot analysis using rat heart FABP cDNA as a probe established the presence of an abundantmore » mRNA in rat heart about 0.85 kilobases in length. This mRNA was detected, but was not abundant, in fetal heart tissue. Tissue distribution studies showed a similar mRNA species in red, but not white, skeletal muscle. In general, the mRNA tissue distribution was similar to that of the protein detected by Western immunoblot analysis, suggesting that heart FABP expression may be regulated at the transcriptional level. S1 nuclease mapping studies confirmed that the mRNA hybridized to rat heart FABP cDNA was identical in heart and red skeletal muscle throughout the entire open reading frame. The structural differences between heart FABP and other members of this multigene family may be related to the functional requirements of oxidative muscle for fatty acids as a fuel source.« less
Burgess, D; Penton, A; Dunsmuir, P; Dooner, H
1997-02-01
Three ADP-glucose pyrophosphorylase (ADPG-PPase) cDNA clones have been isolated and characterized from a pea cotyledon cDNA library. Two of these clones (Psagps1 and Psagps2) encode the small subunit of ADPG-PPase. The deduced amino acid sequences for these two clones are 95% identical. Expression of these two genes differs in that the Psagps2 gene shows comparatively higher expression in seeds relative to its expression in other tissues. Psagps2 expression also peaks midway through seed development at a time in which Psagps1 transcripts are still accumulating. The third cDNA isolated (Psagp11) encodes the large subunit of ADPG-PPase. It shows greater selectivity in expression than either of the small subunit clones. It is highly expressed in sink organs (seed, pod, and seed coat) and undetectable in leaves.
Trujillo-Esquivel, Elías; Franco, Bernardo; Flores-Martínez, Alberto; Ponce-Noyola, Patricia; Mora-Montes, Héctor M
2016-08-02
Analysis of gene expression is a common research tool to study networks controlling gene expression, the role of genes with unknown function, and environmentally induced responses of organisms. Most of the analytical tools used to analyze gene expression rely on accurate cDNA synthesis and quantification to obtain reproducible and quantifiable results. Thus far, most commercial kits for isolation and purification of cDNA target double-stranded molecules, which do not accurately represent the abundance of transcripts. In the present report, we provide a simple and fast method to purify single-stranded cDNA, exhibiting high purity and yield. This method is based on the treatment with RNase H and RNase A after cDNA synthesis, followed by separation in silica spin-columns and ethanol precipitation. In addition, our method avoids the use of DNase I to eliminate genomic DNA from RNA preparations, which improves cDNA yield. As a case report, our method proved to be useful in the purification of single-stranded cDNA from the pathogenic fungus Sporothrix schenckii.
Alkio, Merianne; Jonas, Uwe; Declercq, Myriam; Van Nocker, Steven; Knoche, Moritz
2014-01-01
The exocarp, or skin, of fleshy fruit is a specialized tissue that protects the fruit, attracts seed dispersing fruit eaters, and has large economical relevance for fruit quality. Development of the exocarp involves regulated activities of many genes. This research analyzed global gene expression in the exocarp of developing sweet cherry (Prunus avium L., ‘Regina’), a fruit crop species with little public genomic resources. A catalog of transcript models (contigs) representing expressed genes was constructed from de novo assembled short complementary DNA (cDNA) sequences generated from developing fruit between flowering and maturity at 14 time points. Expression levels in each sample were estimated for 34 695 contigs from numbers of reads mapping to each contig. Contigs were annotated functionally based on BLAST, gene ontology and InterProScan analyses. Coregulated genes were detected using partitional clustering of expression patterns. The results are discussed with emphasis on genes putatively involved in cuticle deposition, cell wall metabolism and sugar transport. The high temporal resolution of the expression patterns presented here reveals finely tuned developmental specialization of individual members of gene families. Moreover, the de novo assembled sweet cherry fruit transcriptome with 7760 full-length protein coding sequences and over 20 000 other, annotated cDNA sequences together with their developmental expression patterns is expected to accelerate molecular research on this important tree fruit crop. PMID:26504533
Xu, Y; Ehringer, M; Yang, F; Sikela, J M
2001-06-01
Inbred long-sleep (ILS) and short-sleep (ISS) mice show significant central nervous system-mediated differences in sleep time for sedative dose of ethanol and are frequently used as a rodent model for ethanol sensitivity. In this study, we have used complementary DNA (cDNA) array hybridization methodology to identify genes that are differentially expressed between the brains of ILS and ISS mice. To carry out this analysis, we used both the gene discovery array (GDA) and the Mouse GEM 1 Microarray. GDA consists of 18,378 nonredundant mouse cDNA clones on a single nylon filter. Complex probes were prepared from total brain mRNA of ILS or ISS mice by using reverse transcription and 33P labeling. The labeled probes were hybridized in parallel to the gene array filters. Data from GDA experiments were analyzed with SQL-Plus and Oracle 8. The GEM microarray includes 8,730 sequence-verified clones on a glass chip. Two fluorescently labeled probes were used to hybridize a microarray simultaneously. Data from GEM experiments were analyzed by using the GEMTools software package (Incyte). Differentially expressed genes identified from each method were confirmed by relative quantitative reverse transcription-polymerase chain reaction (RT-PCR). A total of 41 genes or expressed sequence tags (ESTs) display significant expression level differences between brains of ILS and ISS mice after GDA, GEM1 hybridization, and quantitative RT-PCR confirmation. Among them, 18 clones were expressed higher in ILS mice, and 23 clones were expressed higher in ISS mice. The individual gene or EST's function and mapping information have been analyzed. This study identified 41 genes that are differentially expressed between brains of ILS and ISS mice. Some of them may have biological relevance in mediation of phenotypic variation between ILS and ISS mice for ethanol sensitivity. This study also demonstrates that parallel gene expression comparison with high-density cDNA arrays is a rapid and efficient way to discover potential genes and pathways involved in alcoholism and alcohol-related physiologic processes.
Chin, H; Krall, M; Kim, H L; Kozak, C A; Mock, B
1992-12-01
Cchl1a3 encodes the dihydropyridine-sensitive calcium channel alpha 1 subunit isoform predominantly expressed in skeletal muscle. mdg (muscular dysgenesis) has previously been implicated as a mutant allele of this gene. Hybridization of a rat brain cDNA probe for Cchl1a3 to Southern blots of DNAs from a panel of Chinese hamster x mouse somatic cell hybrids suggested that this gene maps to mouse Chromosome 1. Analysis of the progeny of an inbred strain cross-positioned Cchl1a3 1.3 cM proximal to the Pep-3 locus on Chr 1.
Wang, Xiaohong; Zheng, Zhi-Ming
2016-01-01
Papillomaviruses are a family of small, non-enveloped DNA tumor viruses. Knowing a complete transcription map from each papillomavirus genome can provide guidance for various papillomavirus studies. This unit provides detailed protocols to construct a transcription map of human papillomavirus type 18. The same approach can be easily adapted to other transcription map studies of any other papillomavirus genotype due to the high degree of conservation in the genome structure, organization and gene expression among papillomaviruses. The focused methods are 5’- and 3’- rapid amplification of cDNA ends (RACE), which are the techniques commonly used in molecular biology to obtain the full length RNA transcript or to map a transcription start site (TSS) or an RNA polyadenylation (pA) cleavage site. Primer walking RT-PCR is a method for studying splicing junction of RACE products. In addition, RNase protection assay and primer extension are also introduced as alternative methods in the mapping analysis. PMID:26855281
Characterization of PsMPK2, the first C1 subgroup MAP kinase from pea (Pisum sativum L.).
Ortiz-Masia, Dolores; Perez-Amador, Miguel A; Carbonell, Pablo; Aniento, Fernando; Carbonell, Juan; Marcote, Maria J
2008-05-01
Mitogen-activated protein kinase (MAPK) cascades play a key role in plant growth and development as well as in biotic and abiotic stress responses. They are classified according to their sequence homology into four major groups (A-D). A large amount of information about MAPKs in groups A and B is available but few data of the C group have been reported. In this study, a C1 subgroup MAP kinase cDNA, PsMPK2, was isolated from Pisum sativum. PsMPK2 is expressed in vegetative (root and leaf) and reproductive (stamen, pistil and fruit) organs. Expression of PsMPK2 in Arabidopsis thaliana shows that mechanical injury and other stress signals as abscisic acid, jasmonic acid and hydrogen peroxide increase its kinase activity, extending previous results indicating that C1 subgroup MAPKs may be involved in the response to stress.
Kato, Tatsushi; Satoh, Seiji; Okabe, Hiroshi; Kitahara, Osamu; Ono, Kenji; Kihara, Chikashi; Tanaka, Toshihiro; Tsunoda, Tatsuhiko; Yamaoka, Yoshio; Nakamura, Yusuke; Furukawa, Yoichi
2001-01-01
Abstract Activation of the Wnt-signaling pathway is known to play a crucial role in carcinogenesis of various human organs including the colon, liver, prostate, and endometrium. To investigate the mechanisms underlying hepatocellular carcinogenesis, we attempted to identify genes regulated by β-catenin/Tcf complex in a human hepatoma cell line, HepG2, in which an activated form of β-catenin is expressed. By means of cDNA microarray, we isolated a novel human gene, termed MARKL1 (MAP/microtubule affinity-regulating kinase-like 1), whose expression was downregulated in response to decreased Tcf/LEF1 activity. The transcript expressed in liver consisted of 3529 nucleotides that contained an open reading frame of 2256 nucleotides, encoding 752 amino acids homologous to human MARK3 (MAP/microtubule affinity-regulating kinase 3). Expression levels of MARKL1 were markedly elevated in eight of nine HCCs in which nuclear accumulation of β-catenin was observed, which may suggest that MARKL1 plays some role in hepatocellular carcinogenesis. PMID:11326310
Multiplex cDNA quantification method that facilitates the standardization of gene expression data
Gotoh, Osamu; Murakami, Yasufumi; Suyama, Akira
2011-01-01
Microarray-based gene expression measurement is one of the major methods for transcriptome analysis. However, current microarray data are substantially affected by microarray platforms and RNA references because of the microarray method can provide merely the relative amounts of gene expression levels. Therefore, valid comparisons of the microarray data require standardized platforms, internal and/or external controls and complicated normalizations. These requirements impose limitations on the extensive comparison of gene expression data. Here, we report an effective approach to removing the unfavorable limitations by measuring the absolute amounts of gene expression levels on common DNA microarrays. We have developed a multiplex cDNA quantification method called GEP-DEAN (Gene expression profiling by DCN-encoding-based analysis). The method was validated by using chemically synthesized DNA strands of known quantities and cDNA samples prepared from mouse liver, demonstrating that the absolute amounts of cDNA strands were successfully measured with a sensitivity of 18 zmol in a highly multiplexed manner in 7 h. PMID:21415008
Peng, Jinbiao; Han, Hongxiao; Hong, Yang; Wang, Yan; Guo, Fanji; Shi, Yaojun; Fu, Zhiqiang; Liu, Jinming; Cheng, Guofeng; Lin, Jiaojiao
2010-03-01
The present study was intend to clone and express the cDNA encoding Cyclophilin B (CyPB) of Schistosoma japonicum, its preliminary biological function and further immunoprotective effect against schistosome infection in mice. RT-PCR technique was applied to amplify a full-length cDNA encoding protein Cyclophilin B (Sj CyPB) from schistosomula cDNA. The expression profiles of Sj CyPB were determined by Real-time PCR using the template cDNAs isolated from 7, 13, 18, 23, 32 and 42 days parasites. The cDNA containing the Open Reading Frame of CyPB was then subcloned into a pGEX-6P-1 vector and transformed into competent Escherichia coli BL21 for expressing. The recombinant protein was renaturated, purified and its antigenicity were detected by Western blotting, and the immunoprotective effect induced by recombinant Sj CyPB was evaluated in Balb/C mice. The cDNA containing the ORF of Sj CyPB was cloned with the length of 672 base pairs, encoding 223 amino acids. Real-time PCR analysis revealed that the gene had the highest expression in 18-day schistosomula, suggesting that Sj CyPB was schistosomula differentially expressed gene. The recombinant protein showed a good antigenicity detected by Western blotting. Animal experiment indicated that the vaccination of recombinant CyPB protein in mice led to 31.5% worm and 41.01% liver egg burden reduction, respectively, compared with those of the control. A full-length cDNA differentially expressed in schistosomula was obtained. The recombinant Sj CyPB protein could induce partial protection against schistosome infection.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Clines, G.; Lovett, M.
1994-09-01
Diastrophic dysplasia (DTD) is an autosomal recessive disorder of unknown pathogenesis that is characterized by abnormal skeletal and cartilage growth. Phenotypic characteristics of the disorder include short stature, scoliosis, and deformation of the first metacarpal. The diastrophic dysplasia gene has been localized to chromosome 5q31-33, within {approximately}60 kb of the colony stimulating factor 1 receptor gene (CSF1R). We have used direct cDNA selection to build a transcription map across {approximately}250 kb surrounding and including the CSF1R locus. cDNA pools from human placenta, activated T cells, cerebellum, Hela cells, fetal brain, chondrocytes, chondrosarcomas and osteosarcomas were multiplexed in these selections. Aftermore » two rounds of selection, an analysis revealed that {approximately}70% of the selected cDNAs were contained within the contig. DNA sequencing and cosmid mapping data from a collection of 310 clones revealed the presence of three new genes in this region that show no appreciable homologies on sequence database searches, as well as cDNA clones from the CSF1R and the PDGFRB loci (another of the known genes in the region). An additional cDNA was found with 100% homology to the gene encoding human ribosomal protein L7 (RPL7). This cDNA comprised {approximately}25% of all selected clones. However, further analysis of the genomic contig revealed the presence of an RPL7 processed pseudogene in very close proximity to the CSF1R and PDGFRB genes. The selection of processed pseudogenes is one previously anticipated artifact of selection metholodolgies, but has not been previously observed. Mutational analysis of the three new genes is underway in diastrophic dysplasia families, as is derivation of full length cDNA clones and the expansion of this detailed transcription map into a larger genomic contig.« less
STUDIES OF NORMAL GENE EXPRESSION IN THE RAT NASAL EPITHELIUM USNG CDNA ARRAY TECHNOLOGY
Studies of Normal Gene Expression in the Rat Nasal Epithelium Using cDNA Array
The nasal epithelium is an important target site for chemically-induced toxicity and carcinogenicity .Gene expression data are being used increasingly for studies of such conditions. In or...
Functional characterization of two flap endonuclease-1 homologues in rice.
Kimura, Seisuke; Furukawa, Tomoyuki; Kasai, Nobuyuki; Mori, Yoko; Kitamoto, Hiroko K; Sugawara, Fumio; Hashimoto, Junji; Sakaguchi, Kengo
2003-09-18
Flap endonuclease-1 (FEN-1) is an important enzyme involved in DNA replication and repair. Previously, we isolated and characterized a complementary DNA (cDNA) from rice (Oryza sativa) encoding a protein which shows homology with the eukaryotic flap endonuclease-1 (FEN-1). In this report, we found that rice (O. sativa L. cv. Nipponbare) possessed two FEN-1 homologues designated as OsFEN-1a and OsFEN-1b. The OsFEN-1a and OsFEN-1b genes were mapped to chromosome 5 and 3, respectively. Both genes contained 17 exons and 16 introns. Alignment of OsFEN-1a protein with OsFEN-1b protein showed a high degree of sequence similarity, particularly around the N and I domains. Northern hybridization and in situ hybridization analysis demonstrated preferential expression of OsFEN-1a and OsFEN-1b in proliferating tissues such as the shoot apical meristem or young leaves. The levels of OsFEN-1a and OsFEN-1b expression were significantly reduced when cell proliferation was temporarily halted by the removal of sucrose from the growth medium. When the growth-halted cells began to regrow following the addition of sucrose to the medium, both OsFEN-1a and OsFEN-1b were again expressed at high level. These results suggested that OsFEN-1a and OsFEN-1b are required for cell proliferation. Functional complementation assay suggested that OsFEN-1a cDNA had the ability to complement Saccharomyces cerevisiae rad27 null mutant. On the other hand, OsFEN-1b cDNA could not complement the rad27 mutant. The roles of OsFEN-1a and OsFEN-1b in plant DNA replication and repair are discussed.
[Cloning and characterization of a novel rat gene RSD-7 differentially expressed in testis].
Zhang, Xiao-dong; Gou, Da-wei; Miao, Shi-ying; Zhang, Jian-chao; Zong, Shu-dong; Wang, Lin-fang
2003-06-01
To isolate and identify the differentially expressed genes in spermatogenesis for the understanding molecular mechanism of spermatogenesis. Screening of the cDNA library, Northern blot, expression and purification in E. coli with GST expression system, immunocytochemical staining of testis sections were used. (1) A cDNA fragment designated as RSD-7 was isolated from rat testis cDNA library. It was 1,238 bp in length, coding a protein of 232 amino acids with the GenBank accession number AF315467. The encoding protein of RSD-7 cDNA had a Ubiquitin-like domain. (2) Northern blot indicated that RSD-7 was uniquely expressed in rat testis, and in the testis RSD-7 emerged on the 30th postnatal day and expressed until 120th postnatal day. (3) Expression and purification of RSD-7 protein in E. coli with GST expression system and were used to obtain anti-RSD-7 antibody. (4) Immunolocalization of RSD-7 in rat testis revealed that it is expressed only in Sertoli cells. Transcription pattern of RSD-7 and localization of RSD-7 protein in testis have been made, which established the base for the functional study of RSD-7.
Analysis of expressed sequence tags generated from full-length enriched cDNA libraries of melon
2011-01-01
Background Melon (Cucumis melo), an economically important vegetable crop, belongs to the Cucurbitaceae family which includes several other important crops such as watermelon, cucumber, and pumpkin. It has served as a model system for sex determination and vascular biology studies. However, genomic resources currently available for melon are limited. Result We constructed eleven full-length enriched and four standard cDNA libraries from fruits, flowers, leaves, roots, cotyledons, and calluses of four different melon genotypes, and generated 71,577 and 22,179 ESTs from full-length enriched and standard cDNA libraries, respectively. These ESTs, together with ~35,000 ESTs available in public domains, were assembled into 24,444 unigenes, which were extensively annotated by comparing their sequences to different protein and functional domain databases, assigning them Gene Ontology (GO) terms, and mapping them onto metabolic pathways. Comparative analysis of melon unigenes and other plant genomes revealed that 75% to 85% of melon unigenes had homologs in other dicot plants, while approximately 70% had homologs in monocot plants. The analysis also identified 6,972 gene families that were conserved across dicot and monocot plants, and 181, 1,192, and 220 gene families specific to fleshy fruit-bearing plants, the Cucurbitaceae family, and melon, respectively. Digital expression analysis identified a total of 175 tissue-specific genes, which provides a valuable gene sequence resource for future genomics and functional studies. Furthermore, we identified 4,068 simple sequence repeats (SSRs) and 3,073 single nucleotide polymorphisms (SNPs) in the melon EST collection. Finally, we obtained a total of 1,382 melon full-length transcripts through the analysis of full-length enriched cDNA clones that were sequenced from both ends. Analysis of these full-length transcripts indicated that sizes of melon 5' and 3' UTRs were similar to those of tomato, but longer than many other dicot plants. Codon usages of melon full-length transcripts were largely similar to those of Arabidopsis coding sequences. Conclusion The collection of melon ESTs generated from full-length enriched and standard cDNA libraries is expected to play significant roles in annotating the melon genome. The ESTs and associated analysis results will be useful resources for gene discovery, functional analysis, marker-assisted breeding of melon and closely related species, comparative genomic studies and for gaining insights into gene expression patterns. PMID:21599934
Assaf, S; Hazard, D; Pitel, F; Morisson, M; Alizadeh, M; Gondret, F; Diot, C; Vignal, A; Douaire, M; Lagarrigue, S
2003-01-01
Sterol regulatory element binding protein-1 and -2 (SREBP-1 and -2) are key transcription factors involved in the biosynthesis of cholesterol and fatty adds. The SREBP have mainly been studied in rodents in which lipogenesis is regulated in both liver and adipose tissue. There is, however, a paucity of information on birds, in which lipogenesis occurs essentially in the liver as in humans. As a prelude to the investigation of the role of SREBP in lipid metabolism regulation in chicken, we sequenced the cDNA, encoding the mature nuclear form of chicken SREBP-2 protein, mapped SREBP-1 and -2 genes and studied their tissue expressions. The predicted chicken SREBP-2 amino acid sequence shows a 77 to 79% identity with human, mouse, and hamster homologues, with a nearly perfect conservation in all the important functional motifs, basic, helix-loop-helix, and leucine zipper (bHLH-Zip) region as well as cleavage sites. As in the human genome, SREBP-1 and SREBP-2 chicken genes are located on two separate chromosomes, respectively microchromosome 14 and macrochromosome 1. Tissue expression data show that SREBP-1 and SREBP-2 are expressed in a wide variety of tissues in chicken. However, unlike SREBP-2, SREBP-1 is expressed preferentially in the liver and uropygial gland, suggesting an important role of SREBP-1 in the regulation of lipogenesis in avian species.
Huang, Shengbing; Song, Wei; Lin, Qishui
2005-08-01
A membrane-bound protein was purified from rat liver mitochondria. After being digested with V8 protease, two peptides containing identical 14 amino acid residue sequences were obtained. Using the 14 amino acid peptide derived DNA sequence as gene specific primer, the cDNA of correspondent gene 5'-terminal and 3'-terminal were obtained by RACE technique. The full-length cDNA that encoded a protein of 616 amino acids was thus cloned, which included the above mentioned peptide sequence. The full length cDNA was highly homologous to that of human ETF-QO, indicating that it may be the cDNA of rat ETF-QO. ETF-QO is an iron sulfur protein located in mitochondria inner membrane containing two kinds of redox center: FAD and [4Fe-4S] center. After comparing the sequence from the cDNA of the 616 amino acids protein with that of the mature protein of rat liver mitochondria, it was found that the N terminal 32 amino acid residues did not exist in the mature protein, indicating that the cDNA was that of ETF-QOp. When the cDNA was expressed in Saccharomyces cerevisiae with inducible vectors, the protein product was enriched in mitochondrial fraction and exhibited electron transfer activity (NBT reductase activity) of ETF-QO. Results demonstrated that the 32 amino acid peptide was a mitochondrial targeting peptide, and both FAD and iron-sulfur cluster were inserted properly into the expressed ETF-QO. ETF-QO had a high level expression in rat heart, liver and kidney. The fusion protein of GFP-ETF-QO co-localized with mitochondria in COS-7 cells.
Panagopoulos, Ioannis; Gorunova, Ludmila; Bjerkehagen, Bodil; Heim, Sverre
2014-01-01
Whole transcriptome sequencing was used to study a small round cell tumor in which a t(4;19)(q35;q13) was part of the complex karyotype but where the initial reverse transcriptase PCR (RT-PCR) examination did not detect a CIC-DUX4 fusion transcript previously described as the crucial gene-level outcome of this specific translocation. The RNA sequencing data were analysed using the FusionMap, FusionFinder, and ChimeraScan programs which are specifically designed to identify fusion genes. FusionMap, FusionFinder, and ChimeraScan identified 1017, 102, and 101 fusion transcripts, respectively, but CIC-DUX4 was not among them. Since the RNA sequencing data are in the fastq text-based format, we searched the files using the "grep" command-line utility. The "grep" command searches the text for specific expressions and displays, by default, the lines where matches occur. The "specific expression" was a sequence of 20 nucleotides from the coding part of the last exon 20 of CIC (Reference Sequence: NM_015125.3) chosen since all the so far reported CIC breakpoints have occurred here. Fifteen chimeric CIC-DUX4 cDNA sequences were captured and the fusion between the CIC and DUX4 genes was mapped precisely. New primer combinations were constructed based on these findings and were used together with a polymerase suitable for amplification of GC-rich DNA templates to amplify CIC-DUX4 cDNA fragments which had the same fusion point found with "grep". In conclusion, FusionMap, FusionFinder, and ChimeraScan generated a plethora of fusion transcripts but did not detect the biologically important CIC-DUX4 chimeric transcript; they are generally useful but evidently suffer from imperfect both sensitivity and specificity. The "grep" command is an excellent tool to capture chimeric transcripts from RNA sequencing data when the pathological and/or cytogenetic information strongly indicates the presence of a specific fusion gene.
Lee, Ra Mi; Ryu, Rae Hyung; Jeong, Seong Won; Oh, Soo Jin; Huang, Hue; Han, Jin Soo; Lee, Chi Ho; Lee, C. Justin; Jan, Lily Yeh
2011-01-01
To clone the first anion channel from Xenopus laevis (X. laevis), we isolated a calcium-activated chloride channel (CLCA)-like membrane protein 6 gene (CMP6) in X. laevis. As a first step in gene isolation, an expressed sequence tags database was screened to find the partial cDNA fragment. A putative partial cDNA sequence was obtained by comparison with rat CLCAs identified in our laboratory. First stranded cDNA was synthesized by reverse transcription polymerase-chain reaction (RT-PCR) using a specific primer designed for the target cDNA. Repeating the 5' and 3' rapid amplification of cDNA ends, full-length cDNA was constructed from the cDNA pool. The full-length CMP6 cDNA completed via 5'- and 3'-RACE was 2,940 bp long and had an open reading frame (ORF) of 940 amino acids. The predicted 940 polypeptides have four major transmembrane domains and showed about 50% identity with that of rat brain CLCAs in our previously published data. Semi-quantification analysis revealed that CMP6 was most abundantly expressed in small intestine, colon and liver. However, all tissues except small intestine, colon and liver had undetectable levels. This result became more credible after we did real-time PCR quantification for the target gene. In view of all CLCA studies focused on human or murine channels, this finding suggests a hypothetical protein as an ion channel, an X. laevis CLCA. PMID:21826170
Cryptic splice site in the complementary DNA of glucocerebrosidase causes inefficient expression.
Bukovac, Scott W; Bagshaw, Richard D; Rigat, Brigitte A; Callahan, John W; Clarke, Joe T R; Mahuran, Don J
2008-10-15
The low levels of human lysosomal glucocerebrosidase activity expressed in transiently transfected Chinese hamster ovary (CHO) cells were investigated. Reverse transcription PCR (RT-PCR) demonstrated that a significant portion of the transcribed RNA was misspliced owing to the presence of a cryptic splice site in the complementary DNA (cDNA). Missplicing results in the deletion of 179 bp of coding sequence and a premature stop codon. A repaired cDNA was constructed abolishing the splice site without changing the amino acid sequence. The level of glucocerebrosidase expression was increased sixfold. These data demonstrate that for maximum expression of any cDNA construct, the transcription products should be examined.
Cheng, Xiao-Rui; Zhou, Wen-Xia; Zhang, Yong-Xiang
2006-05-01
Alzheimer' s disease (AD) is the most common form of dementia in the elderly. AD is an invariably fatal neurodegenerative disorder with no effective treatment. Senescence-accelerated mouse prone 8 (SAMP8) is a model for studying age-related cognitive impairments and also is a good model to study brain aging and one of mouse model of AD. The technique of cDNA microarray can monitor the expression levels of thousands of genes simultaneously and can be used to study AD with the character of multi-mechanism, multi-targets and multi-pathway. In order to disclose the mechanism of AD and find the drug targets of AD, cDNA microarray containing 3136 cDNAs amplified from the suppression subtracted cDNA library of hippocampus of SAMP8 and SAMR1 was prepared with 16 blocks and 14 x 14 pins, the housekeeping gene beta-actin and G3PDH as inner conference. The background of this microarray was low and unanimous, and dots divided evenly. The conditions of hybridization and washing were optimized during the hybridization of probe and target molecule. After the data of hybridization analysis, the differential expressed cDNAs were sequenced and analyzed by the bioinformatics, and some of genes were quantified by the real time RT-PCR and the reliability of this cDNA microarray were validated. This cDNA microarray may be the good means to select the differential expressed genes and disclose the molecular mechanism of SAMP8's brain aging and AD.
2011-01-01
Background Abiotic stresses, such as water deficit and soil salinity, result in changes in physiology, nutrient use, and vegetative growth in vines, and ultimately, yield and flavor in berries of wine grape, Vitis vinifera L. Large-scale expressed sequence tags (ESTs) were generated, curated, and analyzed to identify major genetic determinants responsible for stress-adaptive responses. Although roots serve as the first site of perception and/or injury for many types of abiotic stress, EST sequencing in root tissues of wine grape exposed to abiotic stresses has been extremely limited to date. To overcome this limitation, large-scale EST sequencing was conducted from root tissues exposed to multiple abiotic stresses. Results A total of 62,236 expressed sequence tags (ESTs) were generated from leaf, berry, and root tissues from vines subjected to abiotic stresses and compared with 32,286 ESTs sequenced from 20 public cDNA libraries. Curation to correct annotation errors, clustering and assembly of the berry and leaf ESTs with currently available V. vinifera full-length transcripts and ESTs yielded a total of 13,278 unique sequences, with 2302 singletons and 10,976 mapped to V. vinifera gene models. Of these, 739 transcripts were found to have significant differential expression in stressed leaves and berries including 250 genes not described previously as being abiotic stress responsive. In a second analysis of 16,452 ESTs from a normalized root cDNA library derived from roots exposed to multiple, short-term, abiotic stresses, 135 genes with root-enriched expression patterns were identified on the basis of their relative EST abundance in roots relative to other tissues. Conclusions The large-scale analysis of relative EST frequency counts among a diverse collection of 23 different cDNA libraries from leaf, berry, and root tissues of wine grape exposed to a variety of abiotic stress conditions revealed distinct, tissue-specific expression patterns, previously unrecognized stress-induced genes, and many novel genes with root-enriched mRNA expression for improving our understanding of root biology and manipulation of rootstock traits in wine grape. mRNA abundance estimates based on EST library-enriched expression patterns showed only modest correlations between microarray and quantitative, real-time reverse transcription-polymerase chain reaction (qRT-PCR) methods highlighting the need for deep-sequencing expression profiling methods. PMID:21592389
Physical and genetic mapping of the dipeptidase gene DPEP1 to 16q24. 3
DOE Office of Scientific and Technical Information (OSTI.GOV)
Austruy, E.; Jeanpierre, C.; Junien, C.
1993-03-01
The authors report the subregional physical and genetic mapping on chromosome 16q of a cDNA clone selected as a potential tumor/growth suppressor sequence. By DNA sequencing and RNA expression pattern, this clone was identified as part of the renal dipeptidase gene (DPEP1). Using somatic cell hybrids carrying either different human chromosomes or chromosome 16 segments, they confirm and refine the physical mapping of DPEP1 to the chromosome 16 subregion q24.3. Two RFLPs, a biallelic polymorphism detected by TaqI and a VNTR detected by BamHI, EcoRI, and BglII, are described. Using the VNTR polymorphism, DPEP1 was shown to be linked tomore » D16S7 with a maximum lod score of 5.8 at a recombination fraction of 0.03. 14 refs., 2 figs., 2 tabs.« less
Rapid and efficient cDNA library screening by self-ligation of inverse PCR products (SLIP).
Hoskins, Roger A; Stapleton, Mark; George, Reed A; Yu, Charles; Wan, Kenneth H; Carlson, Joseph W; Celniker, Susan E
2005-12-02
cDNA cloning is a central technology in molecular biology. cDNA sequences are used to determine mRNA transcript structures, including splice junctions, open reading frames (ORFs) and 5'- and 3'-untranslated regions (UTRs). cDNA clones are valuable reagents for functional studies of genes and proteins. Expressed Sequence Tag (EST) sequencing is the method of choice for recovering cDNAs representing many of the transcripts encoded in a eukaryotic genome. However, EST sequencing samples a cDNA library at random, and it recovers transcripts with low expression levels inefficiently. We describe a PCR-based method for directed screening of plasmid cDNA libraries. We demonstrate its utility in a screen of libraries used in our Drosophila EST projects for 153 transcription factor genes that were not represented by full-length cDNA clones in our Drosophila Gene Collection. We recovered high-quality, full-length cDNAs for 72 genes and variously compromised clones for an additional 32 genes. The method can be used at any scale, from the isolation of cDNA clones for a particular gene of interest, to the improvement of large gene collections in model organisms and the human. Finally, we discuss the relative merits of directed cDNA library screening and RT-PCR approaches.
Strand-specific transcriptome profiling with directly labeled RNA on genomic tiling microarrays
2011-01-01
Background With lower manufacturing cost, high spot density, and flexible probe design, genomic tiling microarrays are ideal for comprehensive transcriptome studies. Typically, transcriptome profiling using microarrays involves reverse transcription, which converts RNA to cDNA. The cDNA is then labeled and hybridized to the probes on the arrays, thus the RNA signals are detected indirectly. Reverse transcription is known to generate artifactual cDNA, in particular the synthesis of second-strand cDNA, leading to false discovery of antisense RNA. To address this issue, we have developed an effective method using RNA that is directly labeled, thus by-passing the cDNA generation. This paper describes this method and its application to the mapping of transcriptome profiles. Results RNA extracted from laboratory cultures of Porphyromonas gingivalis was fluorescently labeled with an alkylation reagent and hybridized directly to probes on genomic tiling microarrays specifically designed for this periodontal pathogen. The generated transcriptome profile was strand-specific and produced signals close to background level in most antisense regions of the genome. In contrast, high levels of signal were detected in the antisense regions when the hybridization was done with cDNA. Five antisense areas were tested with independent strand-specific RT-PCR and none to negligible amplification was detected, indicating that the strong antisense cDNA signals were experimental artifacts. Conclusions An efficient method was developed for mapping transcriptome profiles specific to both coding strands of a bacterial genome. This method chemically labels and uses extracted RNA directly in microarray hybridization. The generated transcriptome profile was free of cDNA artifactual signals. In addition, this method requires fewer processing steps and is potentially more sensitive in detecting small amount of RNA compared to conventional end-labeling methods due to the incorporation of more fluorescent molecules per RNA fragment. PMID:21235785
Wu, Zhencai; Burns, Jacqueline K
2003-04-01
The genetics and expression of a lipid transfer protein (LTP) gene was examined during abscission of mature fruit of 'Valencia' orange. A cDNA encoding an LTP, CsLTP, was isolated from a cDNA subtraction library constructed from mature fruit abscission zones 48 h after application of a mature fruit-specific abscission agent, 5-chloro-3-methyl-4-nitro-pyrazole (CMN-pyrazole). A full-length cDNA clone of 652 nucleotides was isolated using 5' and 3' RACE followed by cDNA library screening and PCR amplification. The cDNA clone encoded a protein of 155 amino acid residues with a molecular mass and isoelectric point of 9.18 kDa and 9.12, respectively. A partial genomic clone of 505 nucleotides containing one intron of 101 base pairs was amplified from leaf genomic DNA. Southern blot hybridization demonstrated that at least two closely related CsLTP genes are present in 'Valencia' orange. Temporal expression patterns in mature fruit abscission zones were examined by northern hybridization. Increased expression of CsLTP mRNA was detected in RNA of mature fruit abscission zones 6, 24, 48, and 72 h after application of a non-specific abscission agent, ethephon. Low expression of CsLTP transcripts was observed after treatment of CMN-pyrazole until 24 h after application. After this time, expression markedly increased. The results suggest that CsLTP has a role in the abscission process, possibly by assisting transport of cutin monomers to the fracture plane of the abscission zone or through its anti-microbial activity by reducing the potential of microbial attack.
Non-biased and efficient global amplification of a single-cell cDNA library
Huang, Huan; Goto, Mari; Tsunoda, Hiroyuki; Sun, Lizhou; Taniguchi, Kiyomi; Matsunaga, Hiroko; Kambara, Hideki
2014-01-01
Analysis of single-cell gene expression promises a more precise understanding of molecular mechanisms of a living system. Most techniques only allow studies of the expressions for limited numbers of gene species. When amplification of cDNA was carried out for analysing more genes, amplification biases were frequently reported. A non-biased and efficient global-amplification method, which uses a single-cell cDNA library immobilized on beads, was developed for analysing entire gene expressions for single cells. Every step in this analysis from reverse transcription to cDNA amplification was optimized. By removing degrading excess primers, the bias due to the digestion of cDNA was prevented. Since the residual reagents, which affect the efficiency of each subsequent reaction, could be removed by washing beads, the conditions for uniform and maximized amplification of cDNAs were achieved. The differences in the amplification rates for randomly selected eight genes were within 1.5-folds, which could be negligible for most of the applications of single-cell analysis. The global amplification gives a large amount of amplified cDNA (>100 μg) from a single cell (2-pg mRNA), and that amount is enough for downstream analysis. The proposed global-amplification method was used to analyse transcript ratios of multiple cDNA targets (from several copies to several thousand copies) quantitatively. PMID:24141095
Travis, G H; Sutcliffe, J G
1988-01-01
To isolate cDNA clones of low-abundance mRNAs expressed in monkey cerebral cortex but absent from cerebellum, we developed an improved subtractive cDNA cloning procedure that requires only modest quantities of mRNA. Plasmid DNA from a monkey cerebellum cDNA library was hybridized in large excess to radiolabeled monkey cortex cDNA in a phenol emulsion-enhanced reaction. The unhybridized cortex cDNA was isolated by chromatography on hydroxyapatite and used to probe colonies from a monkey cortex cDNA library. Of 60,000 colonies screened, 163 clones were isolated and confirmed by colony hybridization or RNA blotting to represent mRNAs, ranging from 0.001% to 0.1% abundance, specific to or highly enriched in cerebral cortex relative to cerebellum. Clones of one medium-abundance mRNA were recovered almost quantitatively. Two of the lower-abundance mRNAs were expressed at levels reduced by a factor of 10 in Alzheimer disease relative to normal human cortex. One of these was identified as the monkey preprosomatostatin I mRNA. Images PMID:2894033
NORMAL NASAL GENE EXPRESSION LEVELS USING CDNA ARRAY TECHNOLOGY
Normal Nasal Gene Expression Levels Using cDNA Array Technology.
The nasal epithelium is a target site for chemically-induced toxicity and carcinogenicity. To detect and analyze genetic events which contribute to nasal tumor development, we first defined the gene expressi...
Tissue Gene Expression Analysis Using Arrayed Normalized cDNA Libraries
Eickhoff, Holger; Schuchhardt, Johannes; Ivanov, Igor; Meier-Ewert, Sebastian; O'Brien, John; Malik, Arif; Tandon, Neeraj; Wolski, Eryk-Witold; Rohlfs, Elke; Nyarsik, Lajos; Reinhardt, Richard; Nietfeld, Wilfried; Lehrach, Hans
2000-01-01
We have used oligonucleotide-fingerprinting data on 60,000 cDNA clones from two different mouse embryonic stages to establish a normalized cDNA clone set. The normalized set of 5,376 clones represents different clusters and therefore, in almost all cases, different genes. The inserts of the cDNA clones were amplified by PCR and spotted on glass slides. The resulting arrays were hybridized with mRNA probes prepared from six different adult mouse tissues. Expression profiles were analyzed by hierarchical clustering techniques. We have chosen radioactive detection because it combines robustness with sensitivity and allows the comparison of multiple normalized experiments. Sensitive detection combined with highly effective clustering algorithms allowed the identification of tissue-specific expression profiles and the detection of genes specifically expressed in the tissues investigated. The obtained results are publicly available (http://www.rzpd.de) and can be used by other researchers as a digital expression reference. [The sequence data described in this paper have been submitted to the EMBL data library under accession nos. AL360374–AL36537.] PMID:10958641
Poly A- transcripts expressed in HeLa cells.
Wu, Qingfa; Kim, Yeong C; Lu, Jian; Xuan, Zhenyu; Chen, Jun; Zheng, Yonglan; Zhou, Tom; Zhang, Michael Q; Wu, Chung-I; Wang, San Ming
2008-07-30
Transcripts expressed in eukaryotes are classified as poly A+ transcripts or poly A- transcripts based on the presence or absence of the 3' poly A tail. Most transcripts identified so far are poly A+ transcripts, whereas the poly A- transcripts remain largely unknown. We developed the TRD (Total RNA Detection) system for transcript identification. The system detects the transcripts through the following steps: 1) depleting the abundant ribosomal and small-size transcripts; 2) synthesizing cDNA without regard to the status of the 3' poly A tail; 3) applying the 454 sequencing technology for massive 3' EST collection from the cDNA; and 4) determining the genome origins of the detected transcripts by mapping the sequences to the human genome reference sequences. Using this system, we characterized the cytoplasmic transcripts from HeLa cells. Of the 13,467 distinct 3' ESTs analyzed, 24% are poly A-, 36% are poly A+, and 40% are bimorphic with poly A+ features but without the 3' poly A tail. Most of the poly A- 3' ESTs do not match known transcript sequences; they have a similar distribution pattern in the genome as the poly A+ and bimorphic 3' ESTs, and their mapped intergenic regions are evolutionarily conserved. Experiments confirmed the authenticity of the detected poly A- transcripts. Our study provides the first large-scale sequence evidence for the presence of poly A- transcripts in eukaryotes. The abundance of the poly A- transcripts highlights the need for comprehensive identification of these transcripts for decoding the transcriptome, annotating the genome and studying biological relevance of the poly A- transcripts.
Chromosome-specific physical localisation of expressed sequence tag loci in Corchorus olitorius L.
Joshi, A; Das, S K; Samanta, P; Paria, P; Sen, S K; Basu, A
2014-11-01
Jute (Corchorus spp.), as a natural fibre-producing species, ranks next only to cotton. Inadequate understanding of its genetic architecture is a major lacuna for genetic improvement of this crop in terms of yield and quality. Establishment of a physical map provides a genomic tool that helps in positional cloning of valuable genes. In this report, an attempt was initiated to study association and localisation of single copy expressed sequence tag (EST) loci in the genome of Corchorus olitorius. The chromosome-specific association of EST was determined based on the appearance of an extra signal for a single copy cDNA probe in mitotic interphase nuclei of specific trisomic(s) for fluorescence in situ hybridisation, and validated using a cDNA fragment of the 26S rRNA gene (600 bp) as molecular probe. The probe exhibited three signals in meiotic interphase nuclei of trisomic 5, instead of two as observed in diploids and other trisomics, indicating its association with chromosome 5. Subsequent hybridisation of the same probe on the pachytene chromosomes of diploids confirmed that 26S rRNA occupies the terminal end of the short arm of chromosome 5 in C. olitorius. Subsequently, chromosome-specific association of 63 single copy EST and their physical localisation were determined on chromosomes 2, 4, 5 and 7. The study describes chromosome-specific physical localisation of genes in jute. The approach used here could be a step towards construction of genome-wide physical maps for any recalcitrant plant species like jute. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.
The isolation of cDNAs from OATL1 at Xp11.2 using a 480-kb YAC
DOE Office of Scientific and Technical Information (OSTI.GOV)
Geraghty, M.T.; Brody, L.C.; Martin, L.S.
1993-05-01
Using an ornithine-{delta}-aminotransferase (OAT) cDNA, the authors identified five YACs that cover two nonadjacent OAT-related loci in Xp11.2-p11.3, designated OATL1 (distal) and OATL2 (proximal). Because several retinal degenerative disorders map to this region, they used YAC2 (480 kb), which covers the most distal part of OATL1, as a probe to screen a retinal cDNA library. From 8 {times} 10{sup 4} plaques screened, they isolated 13 clones. Two were OAT cDNAs. The remaining 11 were divided into eight groups by cross-hybridization. Groups 1-4 contain cDNAs that originate from single-copy X-linked genes in YAC2. Each has an open reading frame of >500more » bp and detects one or more transcripts on a Northern blot. The gene for each was sublocalized and ordered in YAC2. The cDNAs in groups 5-8 contained two or more Alu sequences, had no open reading frames, and did not detect transcripts. The cDNAs from groups 1-4 provide expressed sequence tags and identify candidate genes for the genetic disorders that map to this region. 28 refs., 5 figs., 1 tab.« less
A neurotransmitter transporter encoded by the Drosophila inebriated gene
Soehnge, Holly; Huang, Xi; Becker, Marie; Whitley, Penn; Conover, Diana; Stern, Michael
1996-01-01
Behavioral and electrophysiological studies on mutants defective in the Drosophila inebriated (ine) gene demonstrated increased excitability of the motor neuron. In this paper, we describe the cloning and sequence analysis of ine. Mutations in ine were localized on cloned DNA by restriction mapping and restriction fragment length polymorphism (RFLP) mapping of ine mutants. DNA from the ine region was then used to isolate an ine cDNA. In situ hybridization of ine transcripts to developing embryos revealed expression of this gene in several cell types, including the posterior hindgut, Malpighian tubules, anal plate, garland cells, and a subset of cells in the central nervous system. The ine cDNA contains an open reading frame of 658 amino acids with a high degree of sequence similarity to members of the Na+/Cl−-dependent neurotransmitter transporter family. Members of this family catalyze the rapid reuptake of neurotransmitters released into the synapse and thereby play key roles in controlling neuronal function. We conclude that ine mutations cause increased excitability of the Drosophila motor neuron by causing the defective reuptake of the substrate neurotransmitter of the ine transporter and thus overstimulation of the motor neuron by this neurotransmitter. From this observation comes a unique opportunity to perform a genetic dissection of the regulation of excitability of the Drosophila motor neuron. PMID:8917579
Overexpression of peptide deformylase in breast, colon, and lung cancers.
Randhawa, Harsharan; Chikara, Shireen; Gehring, Drew; Yildirim, Tuba; Menon, Jyotsana; Reindl, Katie M
2013-07-01
Human mitochondrial peptide deformylase (PDF) has been proposed as a novel cancer therapeutic target. However, very little is known about its expression and regulation in human tissues. The purpose of this study was to characterize the expression pattern of PDF in cancerous tissues and to identify mechanisms that regulate its expression. The mRNA expression levels of PDF and methionine aminopeptidase 1D (MAP1D), an enzyme involved in a related pathway with PDF, were determined using tissue panels containing cDNA from patients with various types of cancer (breast, colon, kidney, liver, lung, ovarian, prostate, or thyroid) and human cell lines. Protein levels of PDF were also determined in 2 colon cancer patients via western blotting. Colon cancer cells were treated with inhibitors of ERK, Akt, and mTOR signaling pathways and the resulting effects on PDF and MAP1D mRNA levels were determined by qPCR for colon and lung cancer cell lines. Finally, the effects of a PDF inhibitor, actinonin, on the proliferation of breast, colon, and prostate cell lines were determined using the CyQUANT assay. PDF and MAP1D mRNA levels were elevated in cancer cell lines compared to non-cancer lines. PDF mRNA levels were significantly increased in breast, colon, and lung cancer samples while MAP1D mRNA levels were increased in just colon cancers. The expression of PDF and MAP1D varied with stage in these cancers. Further, PDF protein expression was elevated in colon cancer tissue samples. Inhibition of the MEK/ERK, but not PI3K or mTOR, pathway reduced the expression of PDF and MAP1D in both colon and lung cancer cell lines. Further, inhibition of PDF with actinonin resulted in greater reduction of breast, colon, and prostate cancer cell proliferation than non-cancer cell lines. This is the first report showing that PDF is over-expressed in breast, colon, and lung cancers, and the first evidence that the MEK/ERK pathway plays a role in regulating the expression of PDF and MAP1D. The over-expression of PDF in several cancers and the inhibition of cancer cell growth by a PDF inhibitor suggest this enzyme may act as an oncogene to promote cancer cell proliferation.
Overexpression of peptide deformylase in breast, colon, and lung cancers
2013-01-01
Background Human mitochondrial peptide deformylase (PDF) has been proposed as a novel cancer therapeutic target. However, very little is known about its expression and regulation in human tissues. The purpose of this study was to characterize the expression pattern of PDF in cancerous tissues and to identify mechanisms that regulate its expression. Methods The mRNA expression levels of PDF and methionine aminopeptidase 1D (MAP1D), an enzyme involved in a related pathway with PDF, were determined using tissue panels containing cDNA from patients with various types of cancer (breast, colon, kidney, liver, lung, ovarian, prostate, or thyroid) and human cell lines. Protein levels of PDF were also determined in 2 colon cancer patients via western blotting. Colon cancer cells were treated with inhibitors of ERK, Akt, and mTOR signaling pathways and the resulting effects on PDF and MAP1D mRNA levels were determined by qPCR for colon and lung cancer cell lines. Finally, the effects of a PDF inhibitor, actinonin, on the proliferation of breast, colon, and prostate cell lines were determined using the CyQUANT assay. Results PDF and MAP1D mRNA levels were elevated in cancer cell lines compared to non-cancer lines. PDF mRNA levels were significantly increased in breast, colon, and lung cancer samples while MAP1D mRNA levels were increased in just colon cancers. The expression of PDF and MAP1D varied with stage in these cancers. Further, PDF protein expression was elevated in colon cancer tissue samples. Inhibition of the MEK/ERK, but not PI3K or mTOR, pathway reduced the expression of PDF and MAP1D in both colon and lung cancer cell lines. Further, inhibition of PDF with actinonin resulted in greater reduction of breast, colon, and prostate cancer cell proliferation than non-cancer cell lines. Conclusions This is the first report showing that PDF is over-expressed in breast, colon, and lung cancers, and the first evidence that the MEK/ERK pathway plays a role in regulating the expression of PDF and MAP1D. The over-expression of PDF in several cancers and the inhibition of cancer cell growth by a PDF inhibitor suggest this enzyme may act as an oncogene to promote cancer cell proliferation. PMID:23815882
Sachdev, S W; Dietz, U H; Oshima, Y; Lang, M R; Knapik, E W; Hiraki, Y; Shukunami, C
2001-07-01
Chondromodulin-I (ChM-I) is suggested in higher vertebrate systems to function as a key regulatory protein for cartilage development. To further understand the process of chondrogenesis and the function of ChM-I, we have cloned the zebrafish cDNA for chondromodulin-1 (chm1) and have mapped the chm1 gene locus. The expression profile of chm1 was determined during zebrafish embryonic development and compared to that of type II collagen (col2a1). Maternal chm1 transcripts were detected before midblastula transition and zygotic expression of chm1 was first observed in the notochord at the 10-somite stage. At later developmental stages, chm1 expression was detected in areas surrounding the otic vesicles, in the developing craniofacial cartilage elements, and in the chondrogenic region of the pectoral fins.
Li, XiaoChing; Wang, Xiu-Jie; Tannenhauser, Jonathan; Podell, Sheila; Mukherjee, Piali; Hertel, Moritz; Biane, Jeremy; Masuda, Shoko; Nottebohm, Fernando; Gaasterland, Terry
2007-01-01
Vocal learning and neuronal replacement have been studied extensively in songbirds, but until recently, few molecular and genomic tools for songbird research existed. Here we describe new molecular/genomic resources developed in our laboratory. We made cDNA libraries from zebra finch (Taeniopygia guttata) brains at different developmental stages. A total of 11,000 cDNA clones from these libraries, representing 5,866 unique gene transcripts, were randomly picked and sequenced from the 3′ ends. A web-based database was established for clone tracking, sequence analysis, and functional annotations. Our cDNA libraries were not normalized. Sequencing ESTs without normalization produced many developmental stage-specific sequences, yielding insights into patterns of gene expression at different stages of brain development. In particular, the cDNA library made from brains at posthatching day 30–50, corresponding to the period of rapid song system development and song learning, has the most diverse and richest set of genes expressed. We also identified five microRNAs whose sequences are highly conserved between zebra finch and other species. We printed cDNA microarrays and profiled gene expression in the high vocal center of both adult male zebra finches and canaries (Serinus canaria). Genes differentially expressed in the high vocal center were identified from the microarray hybridization results. Selected genes were validated by in situ hybridization. Networks among the regulated genes were also identified. These resources provide songbird biologists with tools for genome annotation, comparative genomics, and microarray gene expression analysis. PMID:17426146
Hitzler, J K; Witte, D P; Jenkins, N A; Copeland, N G; Gilbert, D J; Naeve, C W; Look, A T; Morris, S W
1999-07-01
The NPM-MLF1 fusion protein is expressed in blasts from patients with myelodysplasia/acute myeloid leukemia (MDS/AML) containing the t(3;5) chromosomal rearrangement. Nucleophosmin (NPM), a previously characterized nucleolar phosphoprotein, contributes to two other fusion proteins found in lympho-hematopoietic malignancies, anaplastic large cell lymphoma (NPM-ALK) and acute promyelocytic leukemia (NPM-RARalpha). By contrast, the function of the carboxy-terminal fusion partner, myelodysplasia/myeloid leukemia factor 1 (MLF1), is unknown. To aid in understanding normal MLF1 function, we isolated the murine cDNA, determined the chromosomal localization of Mlf1, and defined its tissue expression by in situ hybridization. Mlf1 was highly similar to its human homologue (86% and 84% identical nucleotide and amino acid sequence, respectively) and mapped to the central region of chromosome 3, within a segment lacking known mouse mutations. Mlf1 tissue distribution was restricted during both development and postnatal life, with high levels present only in skeletal, cardiac, and selected smooth muscle, gonadal tissues, and rare epithelial tissues including the nasal mucosa and the ependyma/choroid plexus in the brain. Mlf1 transcripts were undetectable in the lympho-hematopoietic organs of both the embryonic and adult mouse, suggesting that NPM-MLF1 contributes to the genesis of MDS/AML in part by enforcing the ectopic overexpression of MLF1 within hematopoietic tissues.
Chen, Jin-Zhong; Wang, Shu; Tang, Rong; Yang, Quan-Sheng; Zhao, Enpeng; Chao, Yaoqiong; Ying, Kang; Xie, Yi; Mao, Yu-Min
2002-09-01
A cDNA was isolated from the fetal brain cDNA library by high throughput cDNA sequencing. The 2390 bp cDNA with an open reading fragment (ORF) of 816 bp encodes a 272 amino acids putative protein with a thrombospondin type I repeat (TSR) domain and a cysteine-rich region at the N-terminus, so it is named hPWTSR. We used Northern blot detected two bands with length of about 3 kb and 4 kb respectively, which expressed in human adult tissues with different intensities. The expression pattern was verified by RT-PCR, revealing that the transcripts were expressed ubiquitously in fetal tissues and human tumor tissues too. However, the transcript was detected neither in ovarian carcinoma GI-102 nor in lung carcinoma LX-1. Blast analysis against NCBI database revealed that the new gene contained at least 5 exons and located in human chromosome 6q22.33. Our results demonstrate that the gene is a novel member of TSR supergene family.
Characterization of embryo-specific genes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sung, Z.R.
1988-01-01
The objective of the proposed research is to characterize the structure and function of a set of genes whose expression is regulated in embryo development, and that are not expressed in mature tissues -- the embryogenic genes. In order to isolate these genes, we immunized a rabbit with total extracts of somatic embryos of carrot, and enriched the anti-embryo antiserum for antibodies reacting with extracts of carrot somatic embryos. Using this enriched antiserum, we screened a lambda gt11 cDNA library constructed from embryo poly A{sup +} RNA, and isolated 10 cDNA clones that detect embryogenic mRNAs. Monospecific antibodies have beenmore » purified for proteins corresponding to each cDNA sequence. Four cDNA clones were further characterized in terms of the expression of their corresponding mRNA and protein in somatic embryos of carrot. In some cases, comparable gene sequences or products have been detected in somatic and zygotic embryos of other plant species. The characteristics of these 4 cDNA clones -- clone Nos. 8, 59, and 66 -- are described in this report. 3 figs.« less
Characterization and phylogenetic epitope mapping of CD38 ADPR cyclase in the cynomolgus macaque
Ferrero, Enza; Orciani, Monia; Vacca, Paola; Ortolan, Erika; Crovella, Sergio; Titti, Fausto; Saccucci, Franca; Malavasi, Fabio
2004-01-01
Background The CD38 transmembrane glycoprotein is an ADP-ribosyl cyclase that moonlights as a receptor in cells of the immune system. Both functions are independently implicated in numerous areas related to human health. This study originated from an inherent interest in studying CD38 in the cynomolgus monkey (Macaca fascicularis), a species closely related to humans that also represents a cogent animal model for the biomedical analysis of CD38. Results A cDNA was isolated from cynomolgus macaque peripheral blood leukocytes and is predicted to encode a type II membrane protein of 301 amino acids with 92% identity to human CD38. Both RT-PCR-mediated cDNA cloning and genomic DNA PCR surveying were possible with heterologous human CD38 primers, demonstrating the striking conservation of CD38 in these primates. Transfection of the cDNA coincided with: (i) surface expression of cynomolgus macaque CD38 by immunofluorescence; (ii) detection of ~42 and 84 kDa proteins by Western blot and (iii) the appearance of ecto-enzymatic activity. Monoclonal antibodies were raised against the cynomolgus CD38 ectodomain and were either species-specific or cross-reactive with human CD38, in which case they were directed against a common disulfide-requiring conformational epitope that was mapped to the C-terminal disulfide loop. Conclusion This multi-faceted characterization of CD38 from cynomolgus macaque demonstrates its high genetic and biochemical similarities with human CD38 while the immunological comparison adds new insights into the dominant epitopes of the primate CD38 ectodomain. These results open new prospects for the biomedical and pharmacological investigations of this receptor-enzyme. PMID:15383153
Koloušková, Pavla; Stone, James D.
2017-01-01
Accurate gene expression measurements are essential in studies of both crop and wild plants. Reverse transcription quantitative real-time PCR (RT-qPCR) has become a preferred tool for gene expression estimation. A selection of suitable reference genes for the normalization of transcript levels is an essential prerequisite of accurate RT-qPCR results. We evaluated the expression stability of eight candidate reference genes across roots, leaves, flower buds and pollen of Silene vulgaris (bladder campion), a model plant for the study of gynodioecy. As random priming of cDNA is recommended for the study of organellar transcripts and poly(A) selection is indicated for nuclear transcripts, we estimated gene expression with both random-primed and oligo(dT)-primed cDNA. Accordingly, we determined reference genes that perform well with oligo(dT)- and random-primed cDNA, making it possible to estimate levels of nucleus-derived transcripts in the same cDNA samples as used for organellar transcripts, a key benefit in studies of cyto-nuclear interactions. Gene expression variance was estimated by RefFinder, which integrates four different analytical tools. The SvACT and SvGAPDH genes were the most stable candidates across various organs of S. vulgaris, regardless of whether pollen was included or not. PMID:28817728
Cloning and expression of cDNA coding for bouganin.
den Hartog, Marcel T; Lubelli, Chiara; Boon, Louis; Heerkens, Sijmie; Ortiz Buijsse, Antonio P; de Boer, Mark; Stirpe, Fiorenzo
2002-03-01
Bouganin is a ribosome-inactivating protein that recently was isolated from Bougainvillea spectabilis Willd. In this work, the cloning and expression of the cDNA encoding for bouganin is described. From the cDNA, the amino-acid sequence was deduced, which correlated with the primary sequence data obtained by amino-acid sequencing on the native protein. Bouganin is synthesized as a pro-peptide consisting of 305 amino acids, the first 26 of which act as a leader signal while the 29 C-terminal amino acids are cleaved during processing of the molecule. The mature protein consists of 250 amino acids. Using the cDNA sequence encoding the mature protein of 250 amino acids, a recombinant protein was expressed, purified and characterized. The recombinant molecule had similar activity in a cell-free protein synthesis assay and had comparable toxicity on living cells as compared to the isolated native bouganin.
Dhakate, Priyanka; Tyagi, Shikha; Singh, Anupama; Singh, Anandita
2017-05-01
LEAFY plays a central role in regulation of flowering time and floral meristem identity in plants. Unfortunately, LFY function remains uncharacterized in agronomicaly important Brassicas. Herein, we illustrate fine-mapping of expression domains of LFY in 15 cultivars of 6 Brassica species and describe gain-of-function phenotypes in Arabidopsis and Brassica. We depict early flowering and altered fatty-acid composition in transgenic seed. The cDNA encoding BjuLFY (417aa) shared only 85% identity with reported homolog of B.juncea implying distinctness. Quantitative RT-PCR based coarse expression mapping of BjuLFY in tissue samples representing 3 time points at specific days after sowing (DAS), pre-flowering (30 DAS), flowering (75 DAS) and post-flowering (110 DAS), depicted an intense pulse of BjuLFY expression restricted to primary floral buds (75 DAS) which subsided in secondary floral buds (110 DAS); expression in root samples was also recorded implying neo-functionalization. Fine-mapping of expression during flowering confirmed tightly regulated LFY expression during early stages of bud development in 15 cultivars of 6 Brassica species implying functional conservation. Ectopic expression of BjuLFY in A. thaliana and B. juncea caused floral meristem defects and precocious flowering. B. juncea transgenics (T 1 ) over-expressing BjuLFY flowered 20days earlier produced normal flowers. GC-MS analysis of mature seed from Brassica transgenics showed an altered fatty-acid profile suggestive of seed maturation occurring at lower temperatures vis-à-vis control. Our findings implicate BjuLFY as a regulator of flowering in B. juncea and suggest its application in developing climate resilient crops. Copyright © 2017 Elsevier B.V. All rights reserved.
Colby, Sheila M.; Crock, John; Dowdle-Rizzo, Barbara; Lemaux, Peggy G.; Croteau, Rodney
1998-01-01
Germacrene C was found by GC-MS and NMR analysis to be the most abundant sesquiterpene in the leaf oil of Lycopersicon esculentum cv. VFNT Cherry, with lesser amounts of germacrene A, guaia-6,9-diene, germacrene B, β-caryophyllene, α-humulene, and germacrene D. Soluble enzyme preparations from leaves catalyzed the divalent metal ion-dependent cyclization of [1-3H]farnesyl diphosphate to these same sesquiterpene olefins, as determined by radio-GC. To obtain a germacrene synthase cDNA, a set of degenerate primers was constructed based on conserved amino acid sequences of related terpenoid cyclases. With cDNA prepared from leaf epidermis-enriched mRNA, these primers amplified a 767-bp fragment that was used as a hybridization probe to screen the cDNA library. Thirty-one clones were evaluated for functional expression of terpenoid cyclase activity in Escherichia coli by using labeled geranyl, farnesyl, and geranylgeranyl diphosphates as substrates. Nine cDNA isolates expressed sesquiterpene synthase activity, and GC-MS analysis of the products identified germacrene C with smaller amounts of germacrene A, B, and D. None of the expressed proteins was active with geranylgeranyl diphosphate; however, one truncated protein converted geranyl diphosphate to the monoterpene limonene. The cDNA inserts specify a deduced polypeptide of 548 amino acids (Mr = 64,114), and sequence comparison with other plant sesquiterpene cyclases indicates that germacrene C synthase most closely resembles cotton δ-cadinene synthase (50% identity). PMID:9482865
Display of a maize cDNA library on baculovirus infected insect cells.
Meller Harel, Helene Y; Fontaine, Veronique; Chen, Hongying; Jones, Ian M; Millner, Paul A
2008-08-12
Maize is a good model system for cereal crop genetics and development because of its rich genetic heritage and well-characterized morphology. The sequencing of its genome is well advanced, and new technologies for efficient proteomic analysis are needed. Baculovirus expression systems have been used for the last twenty years to express in insect cells a wide variety of eukaryotic proteins that require complex folding or extensive posttranslational modification. More recently, baculovirus display technologies based on the expression of foreign sequences on the surface of Autographa californica (AcMNPV) have been developed. We investigated the potential of a display methodology for a cDNA library of maize young seedlings. We constructed a full-length cDNA library of young maize etiolated seedlings in the transfer vector pAcTMVSVG. The library contained a total of 2.5 x 10(5) independent clones. Expression of two known maize proteins, calreticulin and auxin binding protein (ABP1), was shown by western blot analysis of protein extracts from insect cells infected with the cDNA library. Display of the two proteins in infected insect cells was shown by selective biopanning using magnetic cell sorting and demonstrated proof of concept that the baculovirus maize cDNA display library could be used to identify and isolate proteins. The maize cDNA library constructed in this study relies on the novel technology of baculovirus display and is unique in currently published cDNA libraries. Produced to demonstrate proof of principle, it opens the way for the development of a eukaryotic in vivo display tool which would be ideally suited for rapid screening of the maize proteome for binding partners, such as proteins involved in hormone regulation or defence.
Transcriptome analysis of zebrafish embryos exposed to deltamethrin.
Chueh, Tsung-Cheng; Hsu, Li-Sung; Kao, Chin-Ming; Hsu, Tung-Wei; Liao, Hung-Yu; Wang, Kuan-Yi; Chen, Ssu Ching
2017-05-01
Deltamethrin (DTM), a type II pyrethroid, is one of the most commonly used insecticides. The increased use of pyrethroid leads to potential adverse effects, particularly in sensitive populations such as children and pregnant women. None of the related studies was focused on the transcriptome responses in zebrafish embryos after treatment with DTM; therefore, RNA-seq, a high-throughput method, was performed to analyze the global expression of differential expressed genes (DEGs) in zebrafish embryos treated with DTM (40 and 80 μg/L) from fertilization to 48 h postfertilization (hpf) as compared with that in the control group (without DTM treatment). Two cDNA libraries were generated from treated embryos and one cDNA library from nontreated embryos, respectively. Over 92% of reads mapped to the reference in these three libraries. It was observed that many differential genes were expressed in comparison with embryos before and after DTM. The 20 most differentially expressed upregulated or downregulated genes were majorly involved in the signaling transduction. Validation of selected nine genes expression using qRT-PCR confirmed RNA-seq results. The transcriptome sequences were further subjected to gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis, showing G-protein-coupled receptor signaling pathway and neuroactive ligand-receptor interaction, respectively, were most enriched. The data from this study contributed to a better understanding of the potential consequences of fish exposed to DTM, to an evaluation of the potential threat of DTM to fish populations in aquatic environments. © 2016 Wiley Periodicals, Inc. Environ Toxicol 32: 1548-1557, 2017. © 2016 Wiley Periodicals, Inc.
Den Dunnen, J T; Grootscholten, P M; Bakker, E; Blonden, L A; Ginjaar, H B; Wapenaar, M C; van Paassen, H M; van Broeckhoven, C; Pearson, P L; van Ommen, G J
1989-01-01
We have studied 34 Becker and 160 Duchenne muscular dystrophy (DMD) patients with the dystrophin cDNA, using conventional blots and FIGE analysis. One hundred twenty-eight mutations (65%) were found, 115 deletions and 13 duplications, of which 106 deletions and 11 duplications could be precisely mapped in relation to both the mRNA and the major and minor mutation hot spots. Junction fragments, ideal markers for carrier detection, were found in 23 (17%) of the 128 cases. We identified eight new cDNA RFLPs within the DMD gene. With the use of cDNA probes we have completed the long-range map of the DMD gene, by the identification of a 680-kb SfiI fragment containing the gene's 3' end. The size of the DMD gene is now determined to be about 2.3 million basepairs. The combination of cDNA hybridizations with long-range analysis of deletion and duplication patients yields a global picture of the exon spacing within the dystrophin gene. The gene shows a large variability of intron size, ranging from only a few kilobases to 160-180 kb for the P20 intron. Images Figure 1 Figure 4 PMID:2573997
EXPRESSION PROFILING OF ESTROGENIC COMPOUNDS USING A SHEEPSHEAD MINNOW CDNA MACROARRAY
Larkin, Patrick, Leroy C. Folmar, Michael J. Hemmer, Arianna J. Poston and Nancy D. Denslow. 2003. Expression Profiling of Estrogenic Compounds Using a Sheepshead Minnow cDNA Macroarray. Environ. Health Perspect. 111(6):839-846. (ERL,GB 1171).
A variety of anthropogenic c...
The spermatogenic cell-specific variant of glyceraldehyde 3-phosphate dehydrogenase (GAPDS) has been cloned from a rat testis cDNA library and its pattern of expression determined. A 1417 nucleotide cDNA has been found to encode an enzyme with substantial homology to mouse GAPDS...
Problem-Solving Test: Expression Cloning of the Erythropoietin Receptor
ERIC Educational Resources Information Center
Szeberenyi, Jozsef
2008-01-01
Terms to be familiar with before you start to solve the test: cytokines, cytokine receptors, cDNA library, cDNA synthesis, poly(A)[superscript +] RNA, primer, template, reverse transcriptase, restriction endonucleases, cohesive ends, expression vector, promoter, Shine-Dalgarno sequence, poly(A) signal, DNA helicase, DNA ligase, topoisomerases,…
Shafaghat, Farzaneh; Abbasi-Kenarsari, Hajar; Majidi, Jafar; Movassaghpour, Ali Akbar; Shanehbandi, Dariush; Kazemi, Tohid
2015-01-01
Purpose: Transmembrane CD34 glycoprotein is the most important marker for identification, isolation and enumeration of hematopoietic stem cells (HSCs). We aimed in this study to clone the cDNA coding for human CD34 from KG1a cell line and stably express in mouse fibroblast cell line NIH-3T3. Such artificial cell line could be useful as proper immunogen for production of mouse monoclonal antibodies. Methods: CD34 cDNA was cloned from KG1a cell line after total RNA extraction and cDNA synthesis. Pfu DNA polymerase-amplified specific band was ligated to pGEMT-easy TA-cloning vector and sub-cloned in pCMV6-Neo expression vector. After transfection of NIH-3T3 cells using 3 μg of recombinant construct and 6 μl of JetPEI transfection reagent, stable expression was obtained by selection of cells by G418 antibiotic and confirmed by surface flow cytometry. Results: 1158 bp specific band was aligned completely to reference sequence in NCBI database corresponding to long isoform of human CD34. Transient and stable expression of human CD34 on transfected NIH-3T3 mouse fibroblast cells was achieved (25% and 95%, respectively) as shown by flow cytometry. Conclusion: Cloning and stable expression of human CD34 cDNA was successfully performed and validated by standard flow cytometric analysis. Due to murine origin of NIH-3T3 cell line, CD34-expressing NIH-3T3 cells could be useful as immunogen in production of diagnostic monoclonal antibodies against human CD34. This approach could bypass the need for purification of recombinant proteins produced in eukaryotic expression systems. PMID:25789221
Haas, Christian S; Creighton, Chad J; Pi, Xiujun; Maine, Ira; Koch, Alisa E; Haines, G Kenneth; Ling, Song; Chinnaiyan, Arul M; Holoshitz, Joseph
2006-07-01
To identify disease-specific gene expression profiles in patients with rheumatoid arthritis (RA), using complementary DNA (cDNA) microarray analyses on lymphoblastoid B cell lines (LCLs) derived from RA-discordant monozygotic (MZ) twins. The cDNA was prepared from LCLs derived from the peripheral blood of 11 pairs of RA-discordant MZ twins. The RA twin cDNA was labeled with cy5 fluorescent dye, and the cDNA of the healthy co-twin was labeled with cy3. To determine relative expression profiles, cDNA from each twin pair was combined and hybridized on 20,000-element microarray chips. Immunohistochemistry and real-time polymerase chain reaction were used to detect the expression of selected gene products in synovial tissue from patients with RA compared with patients with osteoarthritis and normal healthy controls. In RA twin LCLs compared with healthy co-twin LCLs, 1,163 transcripts were significantly differentially expressed. Of these, 747 were overexpressed and 416 were underexpressed. Gene ontology analysis revealed many genes known to play a role in apoptosis, angiogenesis, proteolysis, and signaling. The 3 most significantly overexpressed genes were laeverin (a novel enzyme with sequence homology to CD13), 11beta-hydroxysteroid dehydrogenase type 2 (a steroid pathway enzyme), and cysteine-rich, angiogenic inducer 61 (a known angiogenic factor). The products of these genes, heretofore uncharacterized in RA, were all abundantly expressed in RA synovial tissues. Microarray cDNA analysis of peripheral blood-derived LCLs from well-controlled patient populations is a useful tool to detect RA-relevant genes and could help in identifying novel therapeutic targets.
Cloning and Expression of cDNA for Rat Heme Oxygenase
NASA Astrophysics Data System (ADS)
Shibahara, Shigeki; Muller, Rita; Taguchi, Hayao; Yoshida, Tadashi
1985-12-01
Two cDNA clones for rat heme oxygenase have been isolated from a rat spleen cDNA library in λ gt11 by immunological screening using a specific polyclonal antibody. One of these clones has an insert of 1530 nucleotides that contains the entire protein-coding region. To confirm that the isolated cDNA encodes heme oxygenase, we transfected monkey kidney cells (COS-7) with the cDNA carried in a simian virus 40 vector. The heme oxygenase was highly expressed in endoplasmic reticulum of transfected cells. The nucleotide sequence of the cloned cDNA was determined and the primary structure of heme oxygenase was deduced. Heme oxygenase is composed of 289 amino acids and has one hydrophobic segment at its carboxyl terminus, which is probably important for the insertion of heme oxygenase into endoplasmic reticulum. The cloned cDNA was used to analyze the induction of heme oxygenase in rat liver by treatment with CoCl2 or with hemin. RNA blot analysis showed that both CoCl2 and hemin increased the amount of hybridizable mRNA, suggesting that these substances may act at the transcriptional level to increase the amount of heme oxygenase.
Cloning and expression of a cDNA coding for catalase from zebrafish (Danio rerio).
Ken, C F; Lin, C T; Wu, J L; Shaw, J F
2000-06-01
A full-length complementary DNA (cDNA) clone encoding a catalase was amplified by the rapid amplication of cDNA ends-polymerase chain reaction (RACE-PCR) technique from zebrafish (Danio rerio) mRNA. Nucleotide sequence analysis of this cDNA clone revealed that it comprised a complete open reading frame coding for 526 amino acid residues and that it had a molecular mass of 59 654 Da. The deduced amino acid sequence showed high similarity with the sequences of catalase from swine (86.9%), mouse (85.8%), rat (85%), human (83.7%), fruit fly (75.6%), nematode (71.1%), and yeast (58.6%). The amino acid residues for secondary structures are apparently conserved as they are present in other mammal species. Furthermore, the coding region of zebrafish catalase was introduced into an expression vector, pET-20b(+), and transformed into Escherichia coli expression host BL21(DE3)pLysS. A 60-kDa active catalase protein was expressed and detected by Coomassie blue staining as well as activity staining on polyacrylamide gel followed electrophoresis.
ALP gene expression in cDNA samples from bone tissue engineering using a HA/TCP/Chitosan scaffold
NASA Astrophysics Data System (ADS)
Stephanie, N.; Katarina, H.; Amir, L. R.; Gunawan, H. A.
2017-08-01
This study examined the potential use of hydroxyapatite (HA)/tricalcium phosphate (TCP)/Chitosan as a bone tissue engineering scaffold. The potential for using HA/TCP/chitosan as a scaffold was analyzed by measuring expression of the ALP osteogenic gene in cDNA from bone biopsies from four Macaque nemestrina. Experimental conditions included control (untreated), treatment with HA/TCP 70:30, HA/TCP 50:50, and HA/TCP/chitosan. cDNA samples were measured quantitively with Real-Time PCR (qPCR) and semi-quantitively by gel electrophoresis. There were no significant differences in ALP gene expression between treatment subjects after two weeks, but the HA/TCP/chitosan treatment gave the highest level of expression after four weeks. The scaffold using the HA/TCP/chitosan combination induced a higher level of expression of the osteogenic gene ALP than did scaffold without chitosan.
Casein expression in cytotoxic T lymphocytes.
Grusby, M J; Mitchell, S C; Nabavi, N; Glimcher, L H
1990-01-01
A cDNA that expresses a mRNA restricted to cytotoxic T lymphocytes (CTL) and mammary tissue has been isolated and characterized. The deduced amino acid sequence from this cDNA shows extensive homology with the previously reported amino acid sequence for rat alpha-casein. Indeed, the presence of a six-residue-repeated motif that is specific for rodent alpha-caseins strongly supports the identification of this cDNA as mouse alpha-casein. Northern (RNA) blot analysis of many hematopoietic cell types revealed that this gene is restricted to CTL, being expressed in four of six CTL lines examined. Furthermore, CTL that express this gene were also found to express other members of the casein gene family, such as beta- and kappa-casein. These results suggest that caseins may be important in CTL function, and their potential role in CTL-mediated lysis is discussed. Images PMID:2395885
Shiraishi, H; Ishikura, S; Matsuura, K; Deyashiki, Y; Ninomiya, M; Sakai, S; Hara, A
1998-01-01
Human liver contains three isoforms (DD1, DD2 and DD4) of dihydrodiol dehydrogenase with 20alpha- or 3alpha-hydroxysteroid dehydrogenase activity; the dehydrogenases belong to the aldo-oxo reductase (AKR) superfamily. cDNA species encoding DD1 and DD4 have been identified. However, four cDNA species with more than 99% sequence identity have been cloned and are compatible with a partial amino acid sequence of DD2. In this study we have isolated a cDNA clone encoding DD2, which was confirmed by comparison of the properties of the recombinant and hepatic enzymes. This cDNA showed differences of one, two, four and five nucleotides from the previously reported four cDNA species for a dehydrogenase of human colon carcinoma HT29 cells, human prostatic 3alpha-hydroxysteroid dehydrogenase, a human liver 3alpha-hydroxysteroid dehydrogenase-like protein and chlordecone reductase-like protein respectively. Expression of mRNA species for the five similar cDNA species in 20 liver samples and 10 other different tissue samples was examined by reverse transcriptase-mediated PCR with specific primers followed by diagnostic restriction with endonucleases. All the tissues expressed only one mRNA species corresponding to the newly identified cDNA for DD2: mRNA transcripts corresponding to the other cDNA species were not detected. We suggest that the new cDNA is derived from the principal gene for DD2, which has been named AKR1C2 by a new nomenclature for the AKR superfamily. It is possible that some of the other cDNA species previously reported are rare allelic variants of this gene. PMID:9716498
Ben, Jin; Jabs, Ethylin Wang; Chong, Samuel S
2005-06-01
Van der Woude syndrome (VWS) and popliteal pterygium syndrome (PPS) are autosomal dominant clefting disorders recently discovered to be caused by mutations in the IRF6 (Interferon Regulatory Factor 6) gene. The IRF gene family consists of nine members encoding transcription factors that share a highly conserved helix-turn-helix DNA-binding domain and a less conserved protein-binding domain. Most IRFs regulate the expression of interferon-alpha and -beta after viral infection, but the function of IRF6 remains unknown. We have isolated a full-length zebrafish irf6 cDNA, which encodes a 492 amino acid protein that contains a Smad-IRF interaction motif and a DNA-binding domain. The zebrafish irf6 gene consists of eight exons and maps to linkage group 22 closest to marker unp1375. By in situ hybridization analysis of embryo whole-mounts and cryosections, we demonstrate that irf6 is first expressed as a maternal transcript. During gastrulation, irf6 expression was concentrated in the forerunner cells. From the bud stage to the 3-somite stage, irf6 expression was observed in the Kupffer's vesicle. No expression could be detected at the 6-somite and 10-somite stages. At the 14-somite stage, expression was detected in the otic placode. At the 17-somite stage, strong expression was also observed in the cloaca. During the pharyngula, hatch and larva periods up to 5 days post-fertilization, irf6 was expressed in the pharyngeal arches, olfactory and otic placodes, and in the epithelial cells of endoderm derived tissues. The latter tissues include the mouth, pharynx, esophagus, endodermal lining of swim bladder, liver, exocrine pancreas, and associated ducts. Overall, the zebrafish expression data are consistent with the observations of lip pits in VWS patients, as well as more recent reports of alae nasi, otitis media and sensorineural hearing loss documented in some patients.
PanGEA: identification of allele specific gene expression using the 454 technology.
Kofler, Robert; Teixeira Torres, Tatiana; Lelley, Tamas; Schlötterer, Christian
2009-05-14
Next generation sequencing technologies hold great potential for many biological questions. While mainly used for genomic sequencing, they are also very promising for gene expression profiling. Sequencing of cDNA does not only provide an estimate of the absolute expression level, it can also be used for the identification of allele specific gene expression. We developed PanGEA, a tool which enables a fast and user-friendly analysis of allele specific gene expression using the 454 technology. PanGEA allows mapping of 454-ESTs to genes or whole genomes, displaying gene expression profiles, identification of SNPs and the quantification of allele specific gene expression. The intuitive GUI of PanGEA facilitates a flexible and interactive analysis of the data. PanGEA additionally implements a modification of the Smith-Waterman algorithm which deals with incorrect estimates of homopolymer length as occuring in the 454 technology To our knowledge, PanGEA is the first tool which facilitates the identification of allele specific gene expression. PanGEA is distributed under the Mozilla Public License and available at: http://www.kofler.or.at/bioinformatics/PanGEA
PanGEA: Identification of allele specific gene expression using the 454 technology
Kofler, Robert; Teixeira Torres, Tatiana; Lelley, Tamas; Schlötterer, Christian
2009-01-01
Background Next generation sequencing technologies hold great potential for many biological questions. While mainly used for genomic sequencing, they are also very promising for gene expression profiling. Sequencing of cDNA does not only provide an estimate of the absolute expression level, it can also be used for the identification of allele specific gene expression. Results We developed PanGEA, a tool which enables a fast and user-friendly analysis of allele specific gene expression using the 454 technology. PanGEA allows mapping of 454-ESTs to genes or whole genomes, displaying gene expression profiles, identification of SNPs and the quantification of allele specific gene expression. The intuitive GUI of PanGEA facilitates a flexible and interactive analysis of the data. PanGEA additionally implements a modification of the Smith-Waterman algorithm which deals with incorrect estimates of homopolymer length as occuring in the 454 technology Conclusion To our knowledge, PanGEA is the first tool which facilitates the identification of allele specific gene expression. PanGEA is distributed under the Mozilla Public License and available at: PMID:19442283
Wang, Li Ke; Niu, Xiao Wei; Lv, Yan Hui; Zhang, Tian Zhen; Guo, Wang Zhen
2010-10-01
Annexins constitute a family of multifunction and structurally related proteins. These proteins are ubiquitous in the plant kingdom, and are important calcium-dependent membrane-binding proteins that participate in the polar development of different plant regions such as rhizoids, root caps, and pollen tube tips. In this study, a novel cotton annexin gene (designated as GhFAnnx) was isolated from a fiber cDNA library of cotton (Gossypium hirsutum). The full-length cDNA of GhFAnnx comprises an open reading frame of 945 bp that encodes a 314-amino acid protein with a calculated molecular mass of 35.7 kDa and an isoelectric point of 6.49. Genomic GhFAnnx sequences from different cotton species, TM-1, Hai7124 and two diploid progenitor cottons, G. herbaceum (A-genome) and G. raimondii (D-genome) showed that at least two copies of the GhFAnnx gene, each with six exons and five introns in the coding region, were identified in the allotetraploid cotton genome. The GhFAnnx gene cloned from the cDNA library in this study was mapped to the chromosome 10 of the A-subgenome of the tetraploid cotton. Sequence alignment revealed that GhFAnnx contained four repeats of 70 amino acids. Semi-quantitative reverse transcriptase-polymerase chain reaction revealed that GhFAnnx is preferentially expressed in different developmental fibers but its expression is low in roots, stems, and leaves. Subcellular localization of GhFAnnx in onion epidermal cells and cotton fibers suggests that this protein is ubiquitous in the epidermal cells of onion, but assembles at the edge and the inner side of the apex of the cotton fiber tips with brilliant spots. In summary, GhFAnnx influences fiber development and is associated with the polar expansion of the cotton fiber during elongation stages.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bozza, M.; Gerard, C.; Kolakowski, L.F. Jr.
1995-06-10
Macrophage migration inhibitory factor, MIF, is a cytokine released by T-lymphocytes, macrophages, and the pituitary gland that serves to integrate peripheral and central inflammatory responses. Ubiquitous expression and developmental regulation suggest that MIF may have additional roles outside of the immune system. Here we report the structure and chromosomal location of the mouse Mif gene and the partial characterization of five Mif pseudogenes. The mouse Mif gene spans less than 0.7 kb of chromosomal DNA and is composed of three exons. A comparison between the mouse and the human genes shows a similar gene structure and common regulatory elements inmore » both promoter regions. The mouse Mif gene maps to the middle region of chromosome 10, between Bcr and S100b, which have been mapped to human chromosomes 22q11 and 21q22.3, respectively. The entire sequence of two pseudogenes demonstrates the absence of introns, the presence of the 5{prime} untranslated region of the cDNA, a 3{prime} poly(A) tail, and the lack of sequence similarity with untranscribed regions of the gene. The five pseudogenes are highly homologous to the cDNA, but contain a variable number of mutations that would produce mutated or truncated MIF-like proteins. Phylogenetic analyses of MIF genes and pseudogenes indicate several independent genetic events that can account for multiple genomic integrations. Three of the Mif pseudogenes were also mapped by interspecific backcross to chromosomes 1, 9, and 17. These results suggest that Mif pseudogenes originated by retrotransposition. 46 refs., 5 figs., 1 tab.« less
Lin, Zeng-Mao; Zhao, Jian-Xin; Duan, Xue-Ning; Zhang, Lan-Bo; Ye, Jing-Ming; Xu, Ling; Liu, Yin-Hua
2014-01-01
This study aimed to explore the expression of tissue factor (TF), protease activated receptor-2 (PAR-2), and matrix metalloproteinase-9 (MMP-9) in the MCF-7 breast cancer cell line and influence on invasiveness. Stable MCF-7 cells transfected with TF cDNA and with TF ShRNA were established. TF, PAR-2, and MMP-9 protein expression was analyzed using indirect immunofluorescence and invasiveness was evaluated using a cell invasion test. Effects of an exogenous PAR-2 agonist were also examined. TF protein expression significantly differed between the TF cDNA and TF ShRNA groups. MMP-9 protein expression was significantly correlated with TF protein expression, but PAR-2 protein expression was unaffected. The PAR- 2 agonist significantly enhanced MMP-9 expression and slightly increased TF and PAR-2 expression in the TF ShRNA group, but did not significantly affect protein expression in MCF-7 cells transfected with TF cDNA. TF and MMP-9 expression was positively correlated with the invasiveness of tumor cells. TF, PAR-2, and MMP-9 affect invasiveness of MCF-7 cells. TF may increase MMP-9 expression by activating PAR-2.
[Construction of fetal mesenchymal stem cell cDNA subtractive library].
Yang, Li; Wang, Dong-Mei; Li, Liang; Bai, Ci-Xian; Cao, Hua; Li, Ting-Yu; Pei, Xue-Tao
2002-04-01
To identify differentially expressed genes between fetal mesenchymal stem cell (MSC) and adult MSC, especially specified genes expressed in fetal MSC, a cDNA subtractive library of fetal MSC was constructed using suppression subtractive hybridization (SSH) technique. At first, total RNA was isolated from fetal and adult MSC. Using SMART PCR synthesis method, single-strand and double-strand cDNAs were synthesized. After Rsa I digestion, fetal MSC cDNAs were divided into two groups and ligated to adaptor 1 and adaptor 2 respectively. Results showed that the amplified library contains 890 clones. Analysis of 890 clones with PCR demonstrated that 768 clones were positive. The positive rate is 86.3%. The size of inserted fragments in these positive clones was between 0.2 - 1 kb, with an average of 400 - 600 bp. SSH is a convenient and effective method for screening differentially expressed genes. The constructed cDNA subtractive library of fetal MSC cDNA lays solid foundation for screening and cloning new and specific function related genes of fetal MSC.
Cloning and High-Level Expression of α-Galactosidase cDNA from Penicillium purpurogenum
Shibuya, Hajime; Nagasaki, Hiroaki; Kaneko, Satoshi; Yoshida, Shigeki; Park, Gwi Gun; Kusakabe, Isao; Kobayashi, Hideyuki
1998-01-01
The cDNA coding for Penicillium purpurogenum α-galactosidase (αGal) was cloned and sequenced. The deduced amino acid sequence of the α-Gal cDNA showed that the mature enzyme consisted of 419 amino acid residues with a molecular mass of 46,334 Da. The derived amino acid sequence of the enzyme showed similarity to eukaryotic αGals from plants, animals, yeasts, and filamentous fungi. The highest similarity observed (57% identity) was to Trichoderma reesei AGLI. The cDNA was expressed in Saccharomyces cerevisiae under the control of the yeast GAL10 promoter. Almost all of the enzyme produced was secreted into the culture medium, and the expression level reached was approximately 0.2 g/liter. The recombinant enzyme purified to homogeneity was highly glycosylated, showed slightly higher specific activity, and exhibited properties almost identical to those of the native enzyme from P. purpurogenum in terms of the N-terminal amino acid sequence, thermoactivity, pH profile, and mode of action on galacto-oligosaccharides. PMID:9797312
Poly A- Transcripts Expressed in HeLa Cells
Lu, Jian; Xuan, Zhenyu; Chen, Jun; Zheng, Yonglan; Zhou, Tom; Zhang, Michael Q.; Wu, Chung-I; Wang, San Ming
2008-01-01
Background Transcripts expressed in eukaryotes are classified as poly A+ transcripts or poly A- transcripts based on the presence or absence of the 3′ poly A tail. Most transcripts identified so far are poly A+ transcripts, whereas the poly A- transcripts remain largely unknown. Methodology/Principal Findings We developed the TRD (Total RNA Detection) system for transcript identification. The system detects the transcripts through the following steps: 1) depleting the abundant ribosomal and small-size transcripts; 2) synthesizing cDNA without regard to the status of the 3′ poly A tail; 3) applying the 454 sequencing technology for massive 3′ EST collection from the cDNA; and 4) determining the genome origins of the detected transcripts by mapping the sequences to the human genome reference sequences. Using this system, we characterized the cytoplasmic transcripts from HeLa cells. Of the 13,467 distinct 3′ ESTs analyzed, 24% are poly A-, 36% are poly A+, and 40% are bimorphic with poly A+ features but without the 3′ poly A tail. Most of the poly A- 3′ ESTs do not match known transcript sequences; they have a similar distribution pattern in the genome as the poly A+ and bimorphic 3′ ESTs, and their mapped intergenic regions are evolutionarily conserved. Experiments confirmed the authenticity of the detected poly A- transcripts. Conclusion/Significance Our study provides the first large-scale sequence evidence for the presence of poly A- transcripts in eukaryotes. The abundance of the poly A- transcripts highlights the need for comprehensive identification of these transcripts for decoding the transcriptome, annotating the genome and studying biological relevance of the poly A- transcripts. PMID:18665230
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, C.H.; Wei, Li-Na; Copeland, N.G.
We have isolated and characterized overlapping genomic clones containing the complete transcribed region of a newly isolated mouse cDNA encoding an orphan receptor expressed specifically in midgestation embryos and adult testis. This gene spans a distance of more than 50 kb and is organized into 13 exons. The transcription initiation site is located at the 158th nucleotide upstream from the translation initiation codon. All the exon/intron junction sequences follow the GT/AG rule. Based upon Northern blot analysis and the size of the transcribed region of the gene, its transcript was determined to be approximately 2.5 kb. Within approximately 500 hpmore » upstream from the transcription initiation site, several immune response regulatory elements were identified but no TATA box was located. This gene was mapped to the distal region of mouse chromosome 10 and its locus has been designated Tr2-11. Immunohistochemical studies show that the Tr2-11 protein is present mainly in advanced germ cell populations of mature testes and that Tr2-11 gene expression is dramatically decreased in vitamin A-depleted animals. 23 refs., 7 figs.« less
Smith, C D; Baglia, L A; Curristin, S M; Ruddell, A
1994-10-01
Two long terminal repeat (LTR) enhancer-binding proteins which may regulate high rates of avian leukosis virus (ALV) LTR-enhanced c-myc transcription during bursal lymphomagenesis have been identified (A. Ruddell, M. Linial, and M. Groudine, Mol. Cell. Biol. 9:5660-5668, 1989). The genes encoding the a1/EBP and a3/EBP binding factors were cloned by expression screening of a lambda gt11 cDNA library from chicken bursal lymphoma cells. The a1/EBP cDNA encodes a novel leucine zipper transcription factor (W. Bowers and A. Ruddell, J. Virol. 66:6578-6586, 1992). The partial a3/EBP cDNA clone encodes amino acids 84 to 313 of vitellogenin gene-binding protein (VBP), a leucine zipper factor that binds the avian vitellogenin II gene promoter (S. Iyer, D. Davis, and J. Burch, Mol. Cell. Biol. 11:4863-4875, 1991). Multiple VBP mRNAs are expressed in B cells in a pattern identical to that previously observed for VBP in other cell types. The LTR-binding activities of VBP, a1/EBP, and B-cell nuclear extract protein were compared and mapped by gel shift, DNase I footprinting, and methylation interference assays. The purified VBP and a1/EBP bacterial fusion proteins bind overlapping but distinct subsets of CCAAT/enhancer elements in the closely related ALV and Rous sarcoma virus (RSV) LTR enhancers. Protein binding to these CCAAT/enhancer elements accounts for most of the labile LTR enhancer-binding activity observed in B-cell nuclear extracts. VBP and a1/EBP could mediate the high rates of ALV and RSV LTR-enhanced transcription in bursal lymphoma cells and many other cell types.
Munday, J; Kerr, S; Ni, J; Cornish, A L; Zhang, J Q; Nicoll, G; Floyd, H; Mattei, M G; Moore, P; Liu, D; Crocker, P R
2001-01-01
Here we characterize Siglec-10 as a new member of the Siglec family of sialic acid-binding Ig-like lectins. A full-length cDNA was isolated from a human spleen library and the corresponding gene identified. Siglec-10 is predicted to contain five extracellular Ig-like domains and a cytoplasmic tail containing three putative tyrosine-based signalling motifs. Siglec-10 exhibited a high degree of sequence similarity to CD33-related Siglecs and mapped to the same region, on chromosome 19q13.3. The expressed protein was able to mediate sialic acid-dependent binding to human erythrocytes and soluble sialoglycoconjugates. Using specific antibodies, Siglec-10 was detected on subsets of human leucocytes including eosinophils, monocytes and a minor population of natural killer-like cells. The molecular properties and expression pattern suggest that Siglec-10 may function as an inhibitory receptor within the innate immune system. PMID:11284738
Wang, Hong; Bi, Yongyi; Tao, Ning; Wang, Chunhong
2005-08-01
To detect the differential expression of cell signal transduction genes associated with benzene poisoning, and to explore the pathogenic mechanisms of blood system damage induced by benzene. Peripheral white blood cell gene expression profile of 7 benzene poisoning patients, including one aplastic anemia, was determined by cDNA microarray. Seven chips from normal workers were served as controls. Cluster analysis of gene expression profile was performed. Among the 4265 target genes, 176 genes associated with cell signal transduction were differentially expressed. 35 up-regulated genes including PTPRC, STAT4, IFITM1 etc were found in at least 6 pieces of microarray; 45 down-regulated genes including ARHB, PPP3CB, CDC37 etc were found in at least 5 pieces of microarray. cDNA microarray technology is an effective technique for screening the differentially expressed genes of cell signal transduction. Disorder in cell signal transduction may play certain role in the pathogenic mechanism of benzene poisoning.
Cloning, sequencing and expression in MEL cells of a cDNA encoding the mouse ribosomal protein S5.
Vanegas, N; Castañeda, V; Santamaría, D; Hernández, P; Schvartzman, J B; Krimer, D B
1997-06-05
We describe the isolation and characterization of a cDNA encoding the mouse S5 ribosomal protein. It was isolated from a MEL (murine erythroleukemia) cell cDNA library by differential hybridization as a down regulated sequence during HMBA-induced differentiation. Northern series analysis showed that S5 mRNA expression is reduced 5-fold throughout the differentiation process. The mouse S5 mRNA is 760 bp long and encodes for a 204 amino acid protein with 94% homology with the human and rat S5.
Dunham, S P; Onions, D E
2001-06-21
A cDNA encoding feline granulocyte colony stimulating factor (fG-CSF) was cloned from alveolar macrophages using the reverse transcriptase-polymerase chain reaction. The cDNA is 949 bp in length and encodes a predicted mature protein of 174 amino acids. Recombinant fG-CSF was expressed as a glutathione S-transferase fusion and purified by affinity chromatography. Biological activity of the recombinant protein was demonstrated using the murine myeloblastic cell line GNFS-60, which showed an ED50 for fG-CSF of approximately 2 ng/ml. Copyright 2001 Academic Press.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Feyereisen-Koener, J.M.
Double-stranded cDNA was prepared from infectious hematopoietic necrosis virus mRNA and cloned into the plasmid vector pUC8. A coprotein (G-protein) of infectious hematopoietic necrosis virus was selected by hybridization to a /sup 32/P-labeled probe. The restriction map and nucleotide sequence of the mRNA encoding the glycoprotein of infectious hematopoietic necrosis virus was determined using this full-length cDNA clone.
Takakura, Y; Ito, T; Saito, H; Inoue, T; Komari, T; Kuwata, S
2000-04-01
A flower-predominant cDNA for a gene, termed OsChia 1;175, was isolated from a cDNA library of rice pistils. Northern blot and RT-PCR analyses revealed that the OsChia 1;175 gene is highly expressed in floral organs (pistils, stamens and lodicules at the heading stage) but not or at an extremely low level in vegetative organs. OsChia 1;175 encodes a protein that consists of 340 amino acid residues, and the putative mature protein shows 52% to 63% amino acid identity to class I chitinases of rice or other plants. The phylogenetic tree shows that the OsChia 1;175 protein is a new type of plant class I chitinase in rice. The expression of OsChia 1;175 in vegetative organs is not induced by several chemicals, UV, and wounding. The soluble putative mature OsChia 1;175 protein expressed in Escherichia coli exhibited chitinase activity in the assay with colloidal chitin as a substrate. Genomic Southern analysis revealed that the OsChia 1;175 gene was organized as a low-copy gene family. The rice genomic library was screened and a genome clone corresponding to OsChia 1;175 was isolated. The transcription start sites of the OsChia 1;175 gene were mapped by primer extension analysis. The 1.2 kb putative promoter region of the OsChia 1;175 gene was fused to the GUS (beta-glucuronidase) gene, and this chimeric gene was introduced to rice by Agrobacterium-mediated transformation. The flower-predominant gene expression was identified also in the transgenic rice plants. The high promoter activity was detected in the stigmas, styles, stamens and lodicules in transgenic plants. The possible functions of OsChia 1;175 are discussed.
Hitzler, Johann K.; Witte, David P.; Jenkins, Nancy A.; Copeland, Neal G.; Gilbert, Debra J.; Naeve, Clayton W.; Look, A. Thomas; Morris, Stephan W.
1999-01-01
The NPM-MLF1 fusion protein is expressed in blasts from patients with myelodysplasia/acute myeloid leukemia (MDS/AML) containing the t(3;5) chromosomal rearrangement. Nucleophosmin (NPM), a previously characterized nucleolar phosphoprotein, contributes to two other fusion proteins found in lympho-hematopoietic malignancies, anaplastic large cell lymphoma (NPM-ALK) and acute promyelocytic leukemia (NPM-RARα). By contrast, the function of the carboxy-terminal fusion partner, myelodysplasia/myeloid leukemia factor 1 (MLF1), is unknown. To aid in understanding normal MLF1 function, we isolated the murine cDNA, determined the chromosomal localization of Mlf1, and defined its tissue expression by in situ hybridization. Mlf1 was highly similar to its human homologue (86% and 84% identical nucleotide and amino acid sequence, respectively) and mapped to the central region of chromosome 3, within a segment lacking known mouse mutations. Mlf1 tissue distribution was restricted during both development and postnatal life, with high levels present only in skeletal, cardiac, and selected smooth muscle, gonadal tissues, and rare epithelial tissues including the nasal mucosa and the ependyma/choroid plexus in the brain. Mlf1 transcripts were undetectable in the lympho-hematopoietic organs of both the embryonic and adult mouse, suggesting that NPM-MLF1 contributes to the genesis of MDS/AML in part by enforcing the ectopic overexpression of MLF1 within hematopoietic tissues. PMID:10393836
Unprecedented multiplicity of Ig transmembrane and secretory mRNA forms in the cartilaginous fish.
Rumfelt, Lynn L; Diaz, Marilyn; Lohr, Rebecca L; Mochon, Evonne; Flajnik, Martin F
2004-07-15
In most jawed vertebrates including cartilaginous fish, membrane-bound IgM is expressed as a five Ig superfamily (Igsf)-domain H chain attached to a transmembrane (Tm) region. Heretofore, bony fish IgM was the one exception with IgM mRNA spliced to produce a four-domain Tm H chain. We now demonstrate that the Tm and secretory (Sec) mRNAs of the novel cartilaginous fish Ig isotypes, IgW and IgNAR, are present in multiple forms, most likely generated by alternative splicing. In the nurse shark, Ginglymostoma cirratum, and horn shark, Heterodontus francisci, alternative splicing of Tm exons to the second or the fourth constant (C(H)) exons produces two distinct IgW Tm cDNAs. Although the seven-domain IgW Sec cDNA form contains a canonical secretory tail shared with IgM, IgNAR, and IgA, we report a three-domain cDNA form of shark IgW (IgW(short)) having an unusual Sec tail, which is orthologous to skate IgX(short) cDNA. The IgW and IgW(short) Sec transcripts are restricted in their tissue distribution and expression levels vary among individual sharks, with all forms expressed early in ontogeny. IgNAR mRNA is alternatively spliced to produce a truncated four-domain Tm cDNA and a second Tm cDNA is expressed identical in Igsf domains as the Sec form. PBL is enriched in the Tm cDNA of these Igs. These molecular data suggest that cartilaginous fish have augmented their humoral immune repertoire by diversifying the sizes of their Ig isotypes. Furthermore, these Tm cDNAs are prototypical and the truncated variants may translate as more stable protein at the cell surface.
Isolation and expression of three gibberellin 20-oxidase cDNA clones from Arabidopsis.
Phillips, A L; Ward, D A; Uknes, S; Appleford, N E; Lange, T; Huttly, A K; Gaskin, P; Graebe, J E; Hedden, P
1995-07-01
Using degenerate oligonucleotide primers based on a pumpkin (Cucurbita maxima) gibberellin (GA) 20-oxidase sequence, six different fragments of dioxygenase genes were amplified by polymerase chain reaction from arabidopsis thaliana genomic DNA. One of these was used to isolate two different full-length cDNA clones, At2301 and At2353, from shoots of the GA-deficient Arabidopsis mutant ga1-2. A third, related clone, YAP169, was identified in the Database of Expressed Sequence Tags. The cDNA clones were expressed in Escherichia coli as fusion proteins, each of which oxidized GA12 at C-20 to GA15, GA24, and the C19 compound GA9, a precursor of bioactive GAs; the C20 tricarboxylic acid compound GA25 was formed as a minor product. The expression products also oxidized the 13-hydroxylated substrate GA53, but less effectively than GA12. The three cDNAs hybridized to mRNA species with tissue-specific patterns of accumulation, with At2301 being expressed in stems and inflorescences, At2353 in inflorescences and developing siliques, and YAP169 in siliques only. In the floral shoots of the ga1-2 mutant, transcript levels corresponding to each cDNA decreased dramatically after GA3 application, suggesting that GA biosynthesis may be controlled, at least in part, through down-regulation of the expression of the 20-oxidase genes.
Yang, J; Yamamoto, M; Ishibashi, J; Taniai, K; Yamakawa, M
1998-08-01
An antibacterial protein, designated rhinocerosin, was purified to homogeneity from larvae of the coconut rhinoceros beetle, Oryctes rhinoceros immunized with Escherichia coli. Based on the amino acid sequence of the N-terminal region, a degenerate primer was synthesized and reverse-transcriptase PCR was performed to clone rhinocerosin cDNA. As a result, a 279-bp fragment was obtained. The complete nucleotide sequence was determined by sequencing the extended rhinocerosin cDNA clone by 5' rapid amplification of cDNA ends. The deduced amino acid sequence of the mature portion of rhinocerosin was composed of 72 amino acids without cystein residues and was shown to be rich in glycine (11.1%) and proline (11.1%) residues. Comparison of the deduced amino acid sequence of rhinocerosin with those of other antibacterial proteins indicated that it has 77.8% and 44.6% identity with holotricin 2 and coleoptrecin, respectively. Rhinocerosin had strong antibacterial activity against E. coli, Streptococcus pyogenes, Staphylococcus aureus but not against Pseudomonas aeruginosa. Results of reverse-transcriptase PCR analysis of gene expression in different tissues indicated that the rhinocerosin gene is strongly expressed in the fat body and the Malpighian tubule, and weakly expressed in hemocytes and midgut. In addition, gene expression was inducible by bacteria in the fat body, the Malpighian tubule and hemocyte but constitutive expression was observed in the midgut.
Reddy, M K; Nair, S; Tewari, K K; Mudgil, Y; Yadav, B S; Sopory, S K
1999-09-01
We have isolated and sequenced four overlapping cDNA clones to identify the full-length cDNA for topoisomerase II (PsTopII) from pea. Using degenerate primers, based on the conserved amino acid sequences of other eukaryotic type II topoisomerases, a 680 bp fragment was PCR-amplified with pea cDNA as template. This fragment was used as a probe to screen an oligo-dT-primed pea cDNA library. A partial cDNA clone was isolated that was truncated at the 3' end. RACE-PCR was employed to isolate the remaining portion of the gene. The total size of PsTopII is 4639 bp with an open reading frame of 4392 bp. The deduced amino acid sequence shows a strong homology to other eukaryotic topoisomerase II (topo II) at the N-terminus end. The topo II transcript was abundant in proliferative tissues. We also show that the level of topo II transcripts could be stimulated by exogenous application of growth factors that induced proliferation in vitro cultures. Light irradiation to etiolated tissue strongly stimulated the expression of topo II. These results suggest that topo II gene expression is up-regulated in response to light and hormones and correlates with cell proliferation. Besides, we have also isolated and analysed the 5'-flanking region of the pea TopII gene. This is first report on the isolation of a putative promoter for topoisomerase II from plants.
Paznekas, W A; Zhang, N; Gridley, T; Jabs, E W
1997-09-08
Mutations in the human TCOF1 gene have been identified in patients with Treacher Collins Syndrome (Mandibulofacial Dysostosis), an autosomal dominant condition affecting the craniofacial region. We report the isolation of the entire mouse Tcof1 coding sequence (3960 bp) by performing a computer-based search for mouse cDNA clones homologous to TCOF1 and generating overlapping RT-PCR products from mouse RNA. Tcof1 is a 1320 amino acid protein of 135 kd with 61.4% identity to TCOF1 and displays repeating motifs enriched for serine- and acidic amino acid-rich regions with potential phosphorylation sites and putative nuclear localization signals. Tcof1 maps to the mouse chromosome 18 region syntenic with human chromosome 5q32-->q33 which contains the TCOF1 locus. Northern blot hybridization indicates Tcof1 expression is ubiquitous in adult tissues and in the embryonic stage, is elevated at 11 dpc when the branchial arches and facial swellings are present in mouse. Our results are consistent with TCOF1 mutations leading to the Treacher Collins syndrome phenotype.
Metz, James G.; Pollard, Michael R.; Anderson, Lana; Hayes, Thomas R.; Lassner, Michael W.
2000-01-01
The jojoba (Simmondsia chinensis) plant produces esters of long-chain alcohols and fatty acids (waxes) as a seed lipid energy reserve. This is in contrast to the triglycerides found in seeds of other plants. We purified an alcohol-forming fatty acyl-coenzyme A reductase (FAR) from developing embryos and cloned the cDNA encoding the enzyme. Expression of a cDNA in Escherichia coli confers FAR activity upon those cells and results in the accumulation of fatty alcohols. The FAR sequence shows significant homology to an Arabidopsis protein of unknown function that is essential for pollen development. When the jojoba FAR cDNA is expressed in embryos of Brassica napus, long-chain alcohols can be detected in transmethylated seed oils. Resynthesis of the gene to reduce its A plus T content resulted in increased levels of alcohol production. In addition to free alcohols, novel wax esters were detected in the transgenic seed oils. In vitro assays revealed that B. napus embryos have an endogenous fatty acyl-coenzyme A: fatty alcohol acyl-transferase activity that could account for this wax synthesis. Thus, introduction of a single cDNA into B. napus results in a redirection of a portion of seed oil synthesis from triglycerides to waxes. PMID:10712526
Metz, J G; Pollard, M R; Anderson, L; Hayes, T R; Lassner, M W
2000-03-01
The jojoba (Simmondsia chinensis) plant produces esters of long-chain alcohols and fatty acids (waxes) as a seed lipid energy reserve. This is in contrast to the triglycerides found in seeds of other plants. We purified an alcohol-forming fatty acyl-coenzyme A reductase (FAR) from developing embryos and cloned the cDNA encoding the enzyme. Expression of a cDNA in Escherichia coli confers FAR activity upon those cells and results in the accumulation of fatty alcohols. The FAR sequence shows significant homology to an Arabidopsis protein of unknown function that is essential for pollen development. When the jojoba FAR cDNA is expressed in embryos of Brassica napus, long-chain alcohols can be detected in transmethylated seed oils. Resynthesis of the gene to reduce its A plus T content resulted in increased levels of alcohol production. In addition to free alcohols, novel wax esters were detected in the transgenic seed oils. In vitro assays revealed that B. napus embryos have an endogenous fatty acyl-coenzyme A: fatty alcohol acyl-transferase activity that could account for this wax synthesis. Thus, introduction of a single cDNA into B. napus results in a redirection of a portion of seed oil synthesis from triglycerides to waxes.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Srivastava, A.K.; Schlessinger, D.; Kere, J.
1994-09-01
The gene for the X chromosomal developmental disorder anhidrotic ectodermal dysplasia (EDA) has been mapped to Xq12-q13 by linkage analysis and is expressed in a few females with chromosomal translocations involving band Xq12-q13. A yeast artificial chromosome (YAC) contig (2.0 Mb) spanning two translocation breakpoints has been assembled by sequence-tagged site (STS)-based chromosomal walking. The two translocation breakpoints (X:autosome translocations from the affected female patients) have been mapped less than 60 kb apart within a YAC contig. Unique probes and intragenic STSs (mapped between the two translocations) have been developed and a somatic cell hybrid carrying the translocated X chromosomemore » from the AK patient has been analyzed by isolating unique probes that span the breakpoint. Several STSs made from intragenic sequences have been found to be conserved in mouse, hamster and monkey, but we have detected no mRNAs in a number of tissues tested. However, a probe and STS developed from the DNA spanning the AK breakpoint is conserved in mouse, hamster and monkey, and we have detected expressed sequences in skin cells and cDNA libraries. In addition, unique sequences have been obtained from two CpG islands in the region that maps proximal to the breakpoints. cDNAs containing these sequences are being studied as candidates for the gene affected in the etiology of EDA.« less
Mizrahi-Aviv, Ela; Mills, David; Benzioni, Aliza; Bar-Zvi, Dudy
2002-10-01
Salt stress results in a massive change in gene expression. An 837 bp cDNA designated ScRab was cloned from shoot cultures of the salt tolerant jojoba (Simmondsia chinesis). The cloned cDNA encodes a full length 200 amino acid long polypeptide that bears high homology to the Rab subfamily of small GTP binding proteins, particularly, the Rab5 subfamily. ScRab expression is reduced in shoots grown in the presence of salt compared to shoots from non-stressed cultures. His6-tagged ScRAB protein was expressed in E. coli, and purified to homogeneity. The purified protein bound radiolabelled GTP. The unlabelled guanine nucleotides GTP, GTP gamma S and GDP but not ATP, CTP or UTP competed with GTP binding.
Oishi, M; Gohma, H; Lejukole, H Y; Taniguchi, Y; Yamada, T; Suzuki, K; Shinkai, H; Uenishi, H; Yasue, H; Sasaki, Y
2004-05-01
Expressed sequence tags (ESTs) generated based on characterization of clones isolated randomly from cDNA libraries are used to study gene expression profiles in specific tissues and to provide useful information for characterizing tissue physiology. In this study, two directionally cloned cDNA libraries were constructed from 60 day-old bovine whole fetus and fetal placenta. We have characterized 5357 and 1126 clones, and then identified 3464 and 795 unique sequences for the fetus and placenta cDNA libraries: 1851 and 504 showed homology to already identified genes, and 1613 and 291 showed no significant matches to any of the sequences in DNA databases, respectively. Further, we found 94 unique sequences overlapping in both the fetus and the placenta, leading to a catalog of 4165 genes expressed in 60 day-old fetus and placenta. The catalog is used to examine expression profile of genes in 60 day-old bovine fetus and placenta.
Metatranscriptomics of Soil Eukaryotic Communities.
Yadav, Rajiv K; Bragalini, Claudia; Fraissinet-Tachet, Laurence; Marmeisse, Roland; Luis, Patricia
2016-01-01
Functions expressed by eukaryotic organisms in soil can be specifically studied by analyzing the pool of eukaryotic-specific polyadenylated mRNA directly extracted from environmental samples. In this chapter, we describe two alternative protocols for the extraction of high-quality RNA from soil samples. Total soil RNA or mRNA can be converted to cDNA for direct high-throughput sequencing. Polyadenylated mRNA-derived full-length cDNAs can also be cloned in expression plasmid vectors to constitute soil cDNA libraries, which can be subsequently screened for functional gene categories. Alternatively, the diversity of specific gene families can also be explored following cDNA sequence capture using exploratory oligonucleotide probes.
Toll like receptors gene expression of human keratinocytes cultured of severe burn injury.
Cornick, Sarita Mac; Noronha, Silvana Aparecida Alves Corrêa de; Noronha, Samuel Marcos Ribeiro de; Cezillo, Marcus V B; Ferreira, Lydia Masako; Gragnani, Alfredo
2014-01-01
To evaluate the expression profile of genes related to Toll Like Receptors (TLR) pathways of human Primary Epidermal keratinocytes of patients with severe burns. After obtaining viable fragments of skin with and without burning, culture hKEP was initiated by the enzymatic method using Dispase (Sigma-Aldrich). These cells were treated with Trizol(r) (Life Technologies) for extraction of total RNA. This was quantified and analyzed for purity for obtaining cDNA for the analysis of gene expression using specific TLR pathways PCR Arrays plates (SA Biosciences). After the analysis of gene expression we found that 21% of these genes were differentially expressed, of which 100% were repressed or hyporegulated. Among these, the following genes (fold decrease): HSPA1A (-58), HRAS (-36), MAP2K3 (-23), TOLLIP (-23), RELA (-18), FOS (-16), and TLR1 (-6.0). This study contributes to the understanding of the molecular mechanisms related to TLR pathways and underlying wound infection caused by the burn. Furthermore, it may provide new strategies to restore normal expression of these genes and thereby change the healing process and improve clinical outcome.
A fine structure genomic map of the region of 12q13 containing SAS and CDK4
DOE Office of Scientific and Technical Information (OSTI.GOV)
Linder, C.Y.; Elkahloun, A.G.; Su, Y.A.
1994-09-01
We have recently adapted a method, originally described by Rackwitz, to the rapid restriction mapping of multiple cosmid DNA samples. Linearization of the cosmids at the lambda cohesive site using lambda terminase is followed by partial digestion with selected restriction enzymes and hybridization to oligonucleotides specific for the right or left hand termini. Partial digestions are performed in a microtiter plate thus allowing up to 12 cosmid clones to be digested with one restriction enzyme. We have applied this rapid restriction mapping method to cosmids derived from a region of chromosome 12q13 that has recently been shown to be amplifiedmore » in a variety of cancers including malignant fibrous histiocytoma, fibrosarcoma, liposarcoma, osteosarcoma and brain tumors. A small segment of this amplification unit containing three genes, SAS (a membrane protein), CDK4 (a cyclin dependent kinase) and OS-9 (a recently described cDNA) has been analyzed with the system described above. This fine structure genomic map will be useful for completing the expression map of this region as well as characterizing its pattern of amplification in tumor specimens.« less
Fibrinolysis in Tumor Associated Angiogenesis
2005-07-01
tPA expression in mammary vessel assays and in animals with use of retroviral vectors to deliver antisense RNA . We still intend to use that strategy...pads of nude mice. RNA obtained from tumor- and mam- mary fat pad-associated endothelial cells was used to synthesize cDNA and cDNA libraries, which... RNA (mRNA) for tPA and MT1-MMP, with some upregulation of uPA expression. BODY 1. Confirm differential expression of tPA and MT1-MIP with GAPDH control
Informatic selection of a neural crest-melanocyte cDNA set for microarray analysis
Loftus, S. K.; Chen, Y.; Gooden, G.; Ryan, J. F.; Birznieks, G.; Hilliard, M.; Baxevanis, A. D.; Bittner, M.; Meltzer, P.; Trent, J.; Pavan, W.
1999-01-01
With cDNA microarrays, it is now possible to compare the expression of many genes simultaneously. To maximize the likelihood of finding genes whose expression is altered under the experimental conditions, it would be advantageous to be able to select clones for tissue-appropriate cDNA sets. We have taken advantage of the extensive sequence information in the dbEST expressed sequence tag (EST) database to identify a neural crest-derived melanocyte cDNA set for microarray analysis. Analysis of characterized genes with dbEST identified one library that contained ESTs representing 21 neural crest-expressed genes (library 198). The distribution of the ESTs corresponding to these genes was biased toward being derived from library 198. This is in contrast to the EST distribution profile for a set of control genes, characterized to be more ubiquitously expressed in multiple tissues (P < 1 × 10−9). From library 198, a subset of 852 clustered ESTs were selected that have a library distribution profile similar to that of the 21 neural crest-expressed genes. Microarray analysis demonstrated the majority of the neural crest-selected 852 ESTs (Mel1 array) were differentially expressed in melanoma cell lines compared with a non-neural crest kidney epithelial cell line (P < 1 × 10−8). This was not observed with an array of 1,238 ESTs that was selected without library origin bias (P = 0.204). This study presents an approach for selecting tissue-appropriate cDNAs that can be used to examine the expression profiles of developmental processes and diseases. PMID:10430933
GENE EXPRESSION IN THE TESTES OF NORMOSPERMIC VERSUS TERATOSPERMIC DOMESTIC CATS USING HUMAN cDNA MICROARRAY ANALYSES
B.S. Pukazhenthi1, J. C. Rockett2, M. Ouyang3, D.J. Dix2, J.G. Howard1, P. Georgopoulos4, W.J. J. Welsh3 and D. E. Wildt1
1Department of Reproductiv...
Luis F. Larrondo; Marcela Avila; Loreto Salas; Dan Cullen; Rafael Vicuna
2003-01-01
Analysis of genomic clones encoding a putative laccase in homokaryon strains of Ceriporiopsis subvermispora led to the identification of an allelic variant of the previously described lcs-1 gene. A cDNA clone corresponding to this gene was expressed in Aspergillus nidulans and in Aspergillus niger. Enzyme assays and Western blots showed that both hosts secreted active...
Guo, Mei; Lu, Fuping; Pu, Jun; Bai, Dongqing; Du, Lianxiang
2005-11-01
A cDNA encoding for laccase was isolated from the ligninolytic fungus Trametes versicolor by RNA-PCR. The cDNA corresponds to the gene Lcc1, which encodes a laccase isoenzyme of 498 amino acid residues preceded by a 22-residue signal peptide. The Lcc1 cDNA was cloned into the vectors pMETA and pMETalphaA and expressed in Pichia methanolica. The laccase activity obtained with the Saccharomyces cerevisiae alpha-factor signal peptide was found to be twofold higher than that obtained with the native secretion signal peptide. The extracellular laccase activity in recombinants with the alpha-factor signal peptide was 9.79 U ml(-1). The presence of 0.2 mM copper was necessary for optimal activity of laccase. The expression level was favoured by lower cultivation temperature. The identity of the recombinant protein was further confirmed by immunodetection using Western blot analysis. As expected, the molecular mass of the mature laccase was 64.0 kDa, similar to that of the native form.
Molecular and characterization of NnPPO cDNA from lotus (Nelumbo nucifera) in rhizome browning.
Dong, C; Yu, A Q; Yang, M G; Zhou, M Q; Hu, Z L
2016-04-30
The complete cDNA (NnPPO) of polyphenol oxidase in Nelumbo nucifera was successfully isolated, using Rapid amplification cDNA end (RACE) assays. The full-length cDNA of NnPPO was 2069 bp in size, containing a 1791 bp open reading frame coding 597 amino acids. The putative NnPPO possessed the conserved active sites and domains for PPO function. Phylogenetic analysis revealed that NnPPO shared high homology with PPO of high plants, and the homology modeling proved that NnPPO had the typical structure of PPO family. In order to characterize the role of NnPPO, Real-time PCR assay demonstrated that NnPPO mRNA was expressed in different tissues of N. nucifera including young leave, rhizome, flower, root and leafstalk, with the highest expression in rhizome. Patterns of NnPPO expression in rhizome illustrated its mRNA level was significantly elevated, which was consistent with the change of NnPPO activity during rhizome browning. Therefore, transcriptional activation of NnPPO was probably the main reason causing rhizome browning.
Goldman, D; Sapru, M K; Stewart, S; Plotkin, J; Libermann, T A; Wasylyk, B; Guan, K
1998-10-15
An Ets transcription factor family member, GETS-1, was cloned from a goldfish retina cDNA library. GETS-1 contains a conserved Ets DNA-binding domain at its N-terminus and is most similar to ternary complex factor (TCF) serum-response-factor protein-1a (SAP-1a). GETS-1 is expressed in many tissues, but is enriched in retina and brain. As with the TCFs SAP-1a and ets-related protein (ERP), overexpression of the GETS-1 promoter suppresses nicotinic acetylcholine receptor epsilon-subunit gene expression in cultured muscle cells. A consensus Ets binding site sequence in the promoter of the epsilon-subunit gene is required for GETS-1-mediated repression. GETS-1 repressor activity is abrogated by overexpression of an activated Ras/mitogen-activated protein kinase (MAP kinase) or by mutation of Ser-405, a MAP kinase phosphorylation site in GETS-1. Fusion proteins created between GETS-1 and the Gal4 DNA-binding domain show that, like other TCFs, GETS-1 contains a C-terminal activation domain that is activated by a Ras/MAP kinase signalling cascade. Interestingly, mutation of Ser-405 located within this activation domain abrogated transcriptional activation of the fusion protein.
Meesapyodsuk, Dauenpen; Balsevich, John; Reed, Darwin W.; Covello, Patrick S.
2007-01-01
Saponaria vaccaria (Caryophyllaceae), a soapwort, known in western Canada as cowcockle, contains bioactive oleanane-type saponins similar to those found in soapbark tree (Quillaja saponaria; Rosaceae). To improve our understanding of the biosynthesis of these saponins, a combined polymerase chain reaction and expressed sequence tag approach was taken to identify the genes involved. A cDNA encoding a β-amyrin synthase (SvBS) was isolated by reverse transcription-polymerase chain reaction and characterized by expression in yeast (Saccharomyces cerevisiae). The SvBS gene is predominantly expressed in leaves. A S. vaccaria developing seed expressed sequence tag collection was developed and used for the isolation of a full-length cDNA bearing sequence similarity to ester-forming glycosyltransferases. The gene product of the cDNA, classified as UGT74M1, was expressed in Escherichia coli, purified, and identified as a triterpene carboxylic acid glucosyltransferase. UGT74M1 is expressed in roots and leaves and appears to be involved in monodesmoside biosynthesis in S. vaccaria. PMID:17172290
Characterization of transformation related genes in oral cancer cells.
Chang, D D; Park, N H; Denny, C T; Nelson, S F; Pe, M
1998-04-16
A cDNA representational difference analysis (cDNA-RDA) and an arrayed filter technique were used to characterize transformation-related genes in oral cancer. From an initial comparison of normal oral epithelial cells and a human papilloma virus (HPV)-immortalized oral epithelial cell line, we obtained 384 differentially expressed gene fragments and arrayed them on a filter. Two hundred and twelve redundant clones were identified by three rounds of back hybridization. Sequence analysis of the remaining clones revealed 99 unique clones corresponding to 69 genes. The expression of these transformation related gene fragments in three nontumorigenic HPV-immortalized oral epithelial cell lines and three oral cancer cell lines were simultaneously monitored using a cDNA array hybridization. Although there was a considerable cell line-to-cell line variability in the expression of these clones, a reliable prediction of their expression could be made from the cDNA array hybridization. Our study demonstrates the utility of combining cDNA-RDA and arrayed filters in high-throughput gene expression difference analysis. The differentially expressed genes identified in this study should be informative in studying oral epithelial cell carcinogenesis.
Molecular cloning of Kazal-type proteinase inhibitor of the shrimp Fenneropenaeus chinensis.
Kong, Hee Jeong; Cho, Hyun Kook; Park, Eun-Mi; Hong, Gyeong-Eun; Kim, Young-Ok; Nam, Bo-Hye; Kim, Woo-Jin; Lee, Sang-Jun; Han, Hyon Sob; Jang, In-Kwon; Lee, Chang Hoon; Cheong, Jaehun; Choi, Tae-Jin
2009-01-01
Proteinase inhibitors play important roles in host defence systems involving blood coagulation and pathogen digestion. We isolated and characterized a cDNA clone for a Kazal-type proteinase inhibitor (KPI) from a hemocyte cDNA library of the oriental white shrimp Fenneropenaeus chinensis. The KPI gene consists of three exons and two introns. KPI cDNA contains an open reading frame of 396 bp, a polyadenylation signal sequence AATAAA, and a poly (A) tail. KPI cDNA encodes a polypeptide of 131 amino acids with a putative signal peptide of 21 amino acids. The deduced amino acid sequence of KPI contains two homologous Kazal domains, each with six conserved cysteine residues. The mRNA of KPI is expressed in the hemocytes of healthy shrimp, and the higher expression of KPI transcript is observed in shrimp infected with the white spot syndrome virus (WSSV), suggesting a potential role for KPI in host defence mechanisms.
Construction of a cDNA microarray derived from the ascidian Ciona intestinalis.
Azumi, Kaoru; Takahashi, Hiroki; Miki, Yasufumi; Fujie, Manabu; Usami, Takeshi; Ishikawa, Hisayoshi; Kitayama, Atsusi; Satou, Yutaka; Ueno, Naoto; Satoh, Nori
2003-10-01
A cDNA microarray was constructed from a basal chordate, the ascidian Ciona intestinalis. The draft genome of Ciona has been read and inferred to contain approximately 16,000 protein-coding genes, and cDNAs for transcripts of 13,464 genes have been characterized and compiled as the "Ciona intestinalis Gene Collection Release I". In the present study, we constructed a cDNA microarray of these 13,464 Ciona genes. A preliminary experiment with Cy3- and Cy5-labeled probes showed extensive differential gene expression between fertilized eggs and larvae. In addition, there was a good correlation between results obtained by the present microarray analysis and those from previous EST analyses. This first microarray of a large collection of Ciona intestinalis cDNA clones should facilitate the analysis of global gene expression and gene networks during the embryogenesis of basal chordates.
Saito, T; Ochiai, H
1999-10-01
cDNA fragments putatively encoding amino acid sequences characteristic of the fatty acid desaturase were obtained using expressed sequence tag (EST) information of the Dictyostelium cDNA project. Using this sequence, we have determined the cDNA sequence and genomic sequence of a desaturase. The cloned cDNA is 1489 nucleotides long and the deduced amino acid sequence comprised 464 amino acid residues containing an N-terminal cytochrome b5 domain. The whole sequence was 38.6% identical to the initially identified Delta5-desaturase of Mortierella alpina. We have confirmed its function as Delta5-desaturase by over expression mutation in D. discoideum and also the gain of function mutation in the yeast Saccharomyces cerevisiae. Analysis of the lipids from transformed D. discoideum and yeast demonstrated the accumulation of Delta5-desaturated products. This is the first report concering fatty acid desaturase in cellular slime molds.
Cadet, Patrick; Mantione, Kirk J; Stefano, George B
2003-05-15
Studies from our laboratory have revealed a novel mu opiate receptor, mu 3, which is expressed in both vascular tissues and leukocytes. The mu 3 receptor is selective for opiate alkaloids and is insensitive to opioid peptides. We now identify the mu 3 receptor at the molecular level using a 441-bp conserved region of the mu 1 receptor. Sequence analysis of the isolated cDNA suggests that it is a novel, alternatively spliced variant of the mu opiate receptor gene. To determine whether protein expressed from this cDNA exhibits the biochemical characteristics expected of the mu 3 receptor, the cDNA clone was expressed in a heterologous system. At the functional level, COS-1 cells transfected with the mu 3 receptor cDNA exhibited dose-dependent release of NO following treatment with morphine, but not opioid peptides (i.e., Met-enkephalin). Naloxone was able to block the effect of morphine on COS-1 transfected cells. Nontransfected COS-1 cells did not produce NO in the presence of morphine or the opioid peptides at similar concentrations. Receptor binding analysis with [(3)H]dihydromorphine further supports the opiate alkaloid selectivity and opioid peptide insensitivity of this receptor. These data suggest that this new mu opiate receptor cDNA encodes the mu 3 opiate receptor, since it exhibits biochemical characteristics known to be unique to this receptor (opiate alkaloid selective and opioid peptide insensitive). Furthermore, using Northern blot, RT-PCR, and sequence analysis, we have demonstrated the expression of this new mu variant in human vascular tissue, mononuclear cells, polymorphonuclear cells, and human neuroblastoma cells.
Zhao, Hongjuan; Hastie, Trevor; Whitfield, Michael L; Børresen-Dale, Anne-Lise; Jeffrey, Stefanie S
2002-01-01
Background T7 based linear amplification of RNA is used to obtain sufficient antisense RNA for microarray expression profiling. We optimized and systematically evaluated the fidelity and reproducibility of different amplification protocols using total RNA obtained from primary human breast carcinomas and high-density cDNA microarrays. Results Using an optimized protocol, the average correlation coefficient of gene expression of 11,123 cDNA clones between amplified and unamplified samples is 0.82 (0.85 when a virtual array was created using repeatedly amplified samples to minimize experimental variation). Less than 4% of genes show changes in expression level by 2-fold or greater after amplification compared to unamplified samples. Most changes due to amplification are not systematic both within one tumor sample and between different tumors. Amplification appears to dampen the variation of gene expression for some genes when compared to unamplified poly(A)+ RNA. The reproducibility between repeatedly amplified samples is 0.97 when performed on the same day, but drops to 0.90 when performed weeks apart. The fidelity and reproducibility of amplification is not affected by decreasing the amount of input total RNA in the 0.3–3 micrograms range. Adding template-switching primer, DNA ligase, or column purification of double-stranded cDNA does not improve the fidelity of amplification. The correlation coefficient between amplified and unamplified samples is higher when total RNA is used as template for both experimental and reference RNA amplification. Conclusion T7 based linear amplification reproducibly generates amplified RNA that closely approximates original sample for gene expression profiling using cDNA microarrays. PMID:12445333
An annotated genetic map of loblolly pine based on microsatellite and cDNA markers
USDA-ARS?s Scientific Manuscript database
Previous loblolly pine (Pinus taeda L.) genetic linkage maps have been based on a variety of DNA polymorphisms, such as AFLPs, RAPDs, RFLPs, and ESTPs, but only a few SSRs (simple sequence repeats), also known as simple tandem repeats or microsatellites, have been mapped in P. taeda. The objective o...
Yu, Shunwu; Luo, Lijun
2008-12-01
Pyridoxal kinase is key enzyme for the biosynthesis of pyridoxal 5'-phosphate, the biologically active form of vitamin B6, in the salvage pathway. A pyridoxal kinase gene, BnPKL (GenBank accession No. DQ463962), was isolated from oilseed rape (Brassica napus L.) following water stress through rapid amplification of complementary DNA (cDNA) ends. The results showed that the gene had two splice variants: PKL and PKL2. PKL, the long cDNA, encodes a 334 amino acid protein with a complete ATP-binding site, pyridoxal kinase-binding site and dimer interface site of a pyridoxal kinase, while PKL2, the short cDNA, lacked a partial domain. Southern blot showed that there were two copies in Brassica napus. The expression of BnPKL cDNA could rescue the mutant phenotype of Escherichia coli defective in pyridoxal kinase. Real-time reverse transcription-polymerase chain reaction revealed that the relative abundance of two transcripts are modulated by development and environmental stresses. Abscisic acid and NaCl were inclined to decrease PKL expression, but H2O2 and cold temperatures induced the PKL expression. In addition, the PKL expression could be transiently induced by jasmonate acid at an early stage, abscisic acid, salicylic acid and jasmonate acid enhanced the PKL expression in roots. Our results demonstrated that BnPKL was a pyridoxal kinase involved in responses to biotic and abiotic stresses.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hamann, J.; Hamann, D.; Lier, R.A.W.
1995-08-15
CD97 is a monomeric glycoprotein of 75 to 85 kDa that is induced rapidly on the surface of most leukocytes upon activation. We herein report the isolation of a cDNA encoding human CD97 by expression cloning in COS cells. The 3-kb cDNA clone encodes a mature polypeptide chain of 722 amino acids with a predicted molecular mass of 79 kDa. Within the C-terminal part of the protein, a region with seven hydrophobic segments was identified, suggesting that CD97 is a seven-span transmembrane molecule. Sequence comparison indicates that CD97 is the first leukocyte Ag in a recently described superfamily that includesmore » the receptors for secretin, calcitonin, and other mammalian and insect peptide hormones. Different from these receptors, CD97 has an extended extracellular region of 433 amino acids that possesses three N-terminal epidermal growth factor-like domains, two of them with a calcium-binding site, and single Arg-Gly-Asp (RGD) motif. The existence of structural elements characteristic for extracellular matrix proteins in a seven-span transmembrane molecule makes CD97 a receptor potentially involved in both adhesion and signaling processes early after leukocyte activation. The gene encoding CD97 is localized on chromosome 19 (19p13.12-13.2).« less
Yi, S Y; Hwang, B K
1998-10-31
Differential display techniques were used to isolate cDNA clones corresponding to genes which were expressed in soybean hypocotyls by Phytophthora sojae f.sp. glycines infection. With a partial cDNA clone C20CI4 from the differential display PCR as a probe, a new basic peroxidase cDNA clone, designated GMIPER1, was isolated from a cDNA library of soybean hypocotyls infected with P. sojae f.sp. glycines. Sequence analysis revealed that the peroxidase clone encodes a mature protein of 35,813 Da with a putative signal peptide of 27 amino acids in its N-terminus. The amino acid sequence of the soybean peroxidase GMIPER1 is between 54-75% identical to other plant peroxidases including a soybean seed coat peroxidase. Southern blot analysis indicated that multiple copies of sequences related to GMIPER1 exist in the soybean genome. The mRNAs corresponding to the GMIPER1 cDNA accumulated predominantly in the soybean hypocotyls infected with the incompatible race of P. sojae f.sp. glycines, but were expressed at low levels in the compatible interaction. Soybean GMIPER1 mRNAs were not expressed in hypocotyls, leaves, stems, and roots of soybean seedlings. However, treatments with ethephon, salicylic acid or methyl jasmonate induced the accumulation of the GMIPER1 mRNAs in the different organs of soybean. These results suggest that the GMIPER1 gene encoding a putative pathogen-induced peroxidase may play an important role in induced resistance of soybean to P. sojae f.sp. glycines and in response to various external stresses.
Large-scale analysis of gene expression using cDNA microarrays promises the
rapid detection of the mode of toxicity for drugs and other chemicals. cDNA
microarrays were used to examine chemically-induced alterations of gene
expression in HepG2 cells exposed to oxidative ...
NASA Astrophysics Data System (ADS)
Woon, J. S. K.; Murad, A. M. A.; Abu Bakar, F. D.
2015-09-01
A cellobiohydrolase B (CbhB) from Aspergillus niger ATCC 10574 was cloned and expressed in E. coli. CbhB has an open reading frame of 1611 bp encoding a putative polypeptide of 536 amino acids. Analysis of the encoded polypeptide predicted a molecular mass of 56.2 kDa, a cellulose binding module (CBM) and a catalytic module. In order to obtain the mRNA of cbhB, total RNA was extracted from A. niger cells induced by 1% Avicel. First strand cDNA was synthesized from total RNA via reverse transcription. The full length cDNA of cbhB was amplified by PCR and cloned into the cloning vector, pGEM-T Easy. A comparison between genomic DNA and cDNA sequences of cbhB revealed that the gene is intronless. Upon the removal of the signal peptide, the cDNA of cbhB was cloned into the expression vector pET-32b. However, the recombinant CbhB was expressed in Escherichia coli Origami DE3 as an insoluble protein. A homology model of CbhB predicted the presence of nine disulfide bonds in the protein structure which may have contributed to the improper folding of the protein and thus, resulting in inclusion bodies in E. coli.
A Potato cDNA Encoding a Homologue of Mammalian Multidrug Resistant P-Glycoprotein
NASA Technical Reports Server (NTRS)
Wang, W.; Takezawa, D.; Poovaiah, B. W.
1996-01-01
A homologue of the multidrug resistance (MDR) gene was obtained while screening a potato stolon tip cDNA expression library with S-15-labeled calmodulin. The mammalian MDR gene codes for a membrane-bound P-glycoprotein (170-180 kDa) which imparts multidrug resistance to cancerous cells. The potato cDNA (PMDR1) codes for a polypeptide of 1313 amino acid residues (ca. 144 kDa) and its structural features are very similar to the MDR P-glycoprotein. The N-terminal half of the PMDR1-encoded protein shares striking homology with its C-terminal half, and each half contains a conserved ATP-binding site and six putative transmembrane domains. Southern blot analysis indicated that potato has one or two MDR-like genes. PMDR1 mRNA is constitutively expressed in all organs studied with higher expression in the stem and stolon tip. The PMDR1 expression was highest during tuber initiation and decreased during tuber development.
Rim, Kyung Taek; Park, Kun Koo; Sung, Jae Hyuck; Chung, Yong Hyun; Han, Jeong Hee; Cho, Key Seung; Kim, Kwang Jong; Yu, Il Je
2004-06-01
Welders with radiographic pneumoconiosis abnormalities have shown a gradual clearing of the X-ray identified effects following removal from exposure. In some cases, the pulmonary fibrosis associated with welding fumes appears in a more severe form in welders. Accordingly, for the early detection of welding-fume-exposure-induced pulmonary fibrosis, the gene expression profiles of peripheral mononuclear cells from rats exposed to welding fumes were studied using suppression-subtractive hybridization (SSH) and a cDNA microarray. As such, Sprague-Dawley rats were exposed to a stainless steel arc welding fume for 2 h/day in an inhalation chamber with a 1107.5 +/- 2.6 mg/m3 concentration of total suspended particulate (TSP) for 30 days. Thereafter, the total RNA was extracted from the peripheral blood mononuclear cells, the cDNA synthesized from the total RNA using the SMART PCR cDNA method, and SSH performed to select the welding-fume-exposure-regulated genes. The cDNAs identified by the SSH were then cloned into a plasmid miniprep, sequenced and the sequences analysed using the NCBI BLAST programme. In the SSH cloned cDNA microarray analysis, five genes were found to increase their expression by 1.9-fold or more, including Rgs 14, which plays an important function in cellular signal transduction pathways; meanwhile 36 genes remained the same and 30 genes decreased their expression by more than 59%, including genes associated with the immune response, transcription factors and tyrosine kinases. Among the 5200 genes analysed, 256 genes (5.1%) were found to increase their gene expression, while 742 genes (15%) decreased their gene expression in response to the welding-fume exposure when tested using a commercial 5.0k DNA microarray. Therefore, unlike exposure to other toxic substances, prolonged welding-fume exposure was found to substantially downregulate many genes.
Feeding-Related Traits Are Affected by Dosage of the foraging Gene in Drosophila melanogaster
Allen, Aaron M.; Anreiter, Ina; Neville, Megan C.; Sokolowski, Marla B.
2017-01-01
Nutrient acquisition and energy storage are critical parts of achieving metabolic homeostasis. The foraging gene in Drosophila melanogaster has previously been implicated in multiple feeding-related and metabolic traits. Before foraging’s functions can be further dissected, we need a precise genetic null mutant to definitively map its amorphic phenotypes. We used homologous recombination to precisely delete foraging, generating the for0 null allele, and used recombineering to reintegrate a full copy of the gene, generating the {forBAC} rescue allele. We show that a total loss of foraging expression in larvae results in reduced larval path length and food intake behavior, while conversely showing an increase in triglyceride levels. Furthermore, varying foraging gene dosage demonstrates a linear dose-response on these phenotypes in relation to foraging gene expression levels. These experiments have unequivocally proven a causal, dose-dependent relationship between the foraging gene and its pleiotropic influence on these feeding-related traits. Our analysis of foraging’s transcription start sites, termination sites, and splicing patterns using rapid amplification of cDNA ends (RACE) and full-length cDNA sequencing, revealed four independent promoters, pr1–4, that produce 21 transcripts with nine distinct open reading frames (ORFs). The use of alternative promoters and alternative splicing at the foraging locus creates diversity and flexibility in the regulation of gene expression, and ultimately function. Future studies will exploit these genetic tools to precisely dissect the isoform- and tissue-specific requirements of foraging’s functions and shed light on the genetic control of feeding-related traits involved in energy homeostasis. PMID:28007892
Huether, Alexander; Höpfner, Michael; Sutter, Andreas P; Baradari, Viola; Schuppan, Detlef; Scherübl, Hans
2006-01-01
AIM: To examine the underlying mechanisms of erlotinib-induced growth inhibition in hepatocellular carcinoma (HCC). METHODS: Erlotinib-induced alterations in gene expression were evaluated using cDNA array technology; changes in protein expression and/or protein activation due to erlotinib treatment as well as IGF-1-induced EGFR transactivation were investigated using Western blotting. RESULTS: Erlotinib treatment inhibited the mitogen activated protein (MAP)-kinase pathway and signal transducer of activation and transcription (STAT)-mediated signaling which led to an altered expression of apoptosis and cell cycle regulating genes as demonstrated by cDNA array technology. Overexpression of proapoptotic factors like caspases and gadds associated with a down-regulation of antiapoptotic factors like Bcl-2, Bcl-XL or jun D accounted for erlotinib's potency to induce apoptosis. Downregulation of cell cycle regulators promoting the G1/S-transition and overexpression of cyclin-dependent kinase inhibitors and gadds contributed to the induction of a G1/G0-arrest in response to erlotinib. Furthermore, we displayed the transactivation of EGFR-mediated signaling by the IGF-1-receptor and showed erlotinib’s inhibitory effects on the receptor-receptor cross talk. CONCLUSION: Our study sheds light on the under-standing of the mechanisms of action of EGFR-TK-inhibition in HCC-cells and thus might facilitate the design of combination therapies that act additively or synergistically. Moreover, our data on the pathways responding to erlotinib treatment could be helpful in predicting the responsiveness of tumors to EGFR-TKIs in the future. PMID:16937526
Identification and genetic mapping of a homeobox gene to the 4p16. 1 region of human chromosome 4
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stadler, H.S.; Padanilam, B.J.; Solursh, M.
1992-12-01
A human craniofacial cDNA library was screened with a degenerate oligonucleotide probe based on the conserved third helix of homeobox genes. From this screening, we identified a homeobox gene, H6, which shared only 57-65% amino acid identity to previously reported homeodomains. H6 was physically mapped to the 4P16.1 region by using somatic cell hybrids containing specific deletions of human chromosome 4. Linkage data from a single-stranded conformational polymorphism derived from the 3[prime] untranslated region of the H6 cDNA placed this homeobox gene more than 20 centimorgans proximal of the previously mapped HOX7 gene on chromosome 4. Identity comparisons of themore » H6 Homeodomain with previously reported homeodomains reveal the highest identities to be with the Nk class of homeobox genes in Drosophila melanogaster. 53 refs., 5 figs., 2 tabs.« less
2013-01-01
identity to acetylcholinesterase mRNA sequences of Culex tritaeniorhynchus and Lutzomyia longipalpis, respectively. The P. papatasi cDNA ORF encoded a...tritaeniorhynchus and Lutzomyia longipalpis, respectively. The P. papatasi cDNA ORF encoded a 710-amino acid protein [GenBank: AFP20868] exhibiting 85...improve effectiveness of pesticide application for control of the new world sand fly Lutzomyia longipalpis in chicken sheds [13]. Attempts to control
cDNA sequence and expression of a cold-responsive gene in Citrus unshiu.
Hara, M; Wakasugi, Y; Ikoma, Y; Yano, M; Ogawa, K; Kuboi, T
1999-02-01
A cDNA clone encoding a protein (CuCOR19), the sequence of which is similar to Poncirus COR19, of the dehydrin family was isolated from the epicarp of Citrus unshiu. The molecular mass of the predicted protein was 18,980 daltons. CuCOR19 was highly hydrophilic and contained three repeating elements including Lys-rich motifs. The gene expression in leaves increased by cold stress.
Cystic Fibrosis Gene Encodes a cAMP-Dependent Chloride Channel in Heart
NASA Astrophysics Data System (ADS)
Hart, Padraig; Warth, John D.; Levesque, Paul C.; Collier, Mei Lin; Geary, Yvonne; Horowitz, Burton; Hume, Joseph R.
1996-06-01
cAMP-dependent chloride channels in heart contribute to autonomic regulation of action potential duration and membrane potential and have been inferred to be due to cardiac expression of the epithelial cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel. In this report, a cDNA from rabbit ventricle was isolated and sequenced, which encodes an exon 5 splice variant (exon 5-) of CFTR, with >90% identity to human CFTR cDNA present in epithelial cells. Expression of this cDNA in Xenopus oocytes gave rise to robust cAMP-activated chloride currents that were absent in control water-injected oocytes. Antisense oligodeoxynucleotides directed against CFTR significnatly reduced the density of cAMP-dependent chloride currents in acutely cultured myocytes, thereby establishing a direct functional link between cardiac expression of CFTR protein and an endogenous chloride channel in native cardiac myocytes.
Cloning of rat MLH1 and expression analysis of MSH2, MSH3, MSH6, and MLH1 during spermatogenesis.
Geeta Vani, R; Varghese, C M; Rao, M R
1999-12-15
The mismatch repair system has been highly conserved in various species. In eukaryotic cells, the Mut S and Mut L homologues play crucial roles in both DNA mismatch repair and meiotic recombination. A full-length rat cDNA clone for rat MLH1 has been constructed using the RT-PCR method. The cDNA has an open reading frame of 2274 nucleotides for a protein of 757 amino acids. We have also obtained partial cDNA clones for MSH3 and MSH6. Northern blot analysis of rat MLH1, MSH2, MSH3, and MSH6 in the testes of rats of different ages showed differential expression of these genes as a function of developmental maturation of the testes. The expression analysis suggests that MSH3 may have a more predominant role in the meiotic recombination process. Copyright 1999 Academic Press.
JPRS Report, Science and Technology USSR: Life Sciences.
1990-07-16
4 1 VETERINARY MEDICINE Primary Structure of RNA Polymerase Gene of Foot-and-Mouth Disease Virus ( FMDV ...neering were used to obtain cDNA corresponding to the Primary Structure of RNA Polymerase Gene of RNA polymerase gene to FMDV A 2 2 , with a map of the...Foot-and-Mouth Disease Virus ( FMDV ) A22 primary nucleotide sequence of the cDNA provided. 18400538F Moscow BIOORGANICHESKA YA Analysis of the data
Yan, P; Gao, X Z; Shen, W T; Zhou, P
2011-02-01
The fruit flesh color of papaya is an important nutritional quality trait and is due to the accumulation of carotenoid. To elucidate the carotenoid biosynthesis pathway in Carica papaya, the phytoene desaturase (PDS) and the ζ-carotene desaturase (ZDS) genes were isolated from papaya (named CpPDS and CpZDS) using the rapid amplification of cDNA ends (RACE) approach, and their expression levels were investigated in red- and yellow-fleshed papaya varieties. CpPDS contains a 1749 bp open reading frame coding for 583 amino acids, while CpZDS contains a 1716 bp open reading frame coding for 572 amino acids. The deduced CpPDS and CpZDS proteins contain a conserved dinucleotide-binding site at the N-terminus and a carotenoid-binding domain at the C-terminus. Papaya genome sequence analysis revealed that CpPDS and CpZDS are single copy; the CpPDS was mapped to papaya chromosome LG6, and the CpZDS was mapped to chromosome LG3. Quantitative PCR showed that both CpPDS and CpZDS were expressed in all tissues examined with the highest expression in maturing fruits, and that the expression of CpPDS and CpZDS were higher in red-fleshed fruits than in yellow-fleshed fruits. These results indicated that the differential accumulation of carotenoids in red- and yellow-fleshed papaya varieties might be partly explained by the transcriptional level of CpPDS and CpZDS.
Fiermonte, G; Runswick, M J; Walker, J E; Palmieri, F
1992-01-01
A human cDNA has been isolated previously from a thyroid library with the aid of serum from a patient with Grave's disease. It encodes a protein belonging to the mitochondrial metabolite carrier family, referred to as the Grave's disease carrier protein (GDC). Using primers based on this sequence, overlapping cDNAs encoding the bovine homologue of the GDC have been isolated from total bovine heart poly(A)+ cDNA. The bovine protein is 18 amino acids shorter than the published human sequence, but if a frame shift requiring the removal of one nucleotide is introduced into the human cDNA sequence, the human and bovine proteins become identical in their C-terminal regions, and 308 out of 330 amino acids are conserved over their entire sequences. The bovine cDNA has been used to investigate the expression of the GDC in various bovine tissues. In the tissues that were examined, the GDC is most strongly expressed in the thyroid, but substantial amounts of its mRNA were also detected in liver, lung and kidney, and lesser amounts in heart and skeletal muscle.
Yi, S Y; Yu, S H; Choi, D
1999-06-30
Recent reports revealed that catalase has a role in the plant defense mechanism against a broad range of pathogens through being inhibited by salicylic acid (SA). During an effort to clone disease resistance-responsive genes, a cDNA encoding catalase (Ngcat1; Nicotiana glutinosa cat1) was isolated from a tobacco cDNA library. In N. glutinosa, catalase is encoded by a small gene family. The deduced amino acid sequence of the Ngcat1 cDNA has 98% homology with the cat1 gene of N. plumbaginifolia. The Ngcat1 expression is controlled by the circadian clock, and its mRNA level is the most abundant in leaves. Both the expression of Ngcat1 mRNA and its enzyme activity in the tobacco plant undergoing a hypersensitive response (HR) to TMV infection were repressed. The repression of the mRNA level was also observed following treatment with SA. These results imply that SA may act as an inhibitor of catalase transcription during the HR of tobacco. Cloning and expression of the Ngcat1 in tobacco following pathogen infection and SA treatment are presented.
Wang, Tao; Yuan, Dengyue; Zhou, Chaowei; Lin, Fangjun; Wei, Rongbin; Chen, Hu; Wu, Hongwei; Xin, Zhiming; Liu, Ju; Gao, Yundi; Chen, Defang; Yang, Shiyong; Wang, Yan; Pu, Yundan; Li, Zhiqiong
2016-06-01
Melanin-concentrating hormone (MCH) is a crucial neuropeptide involved in various biological functions in both mammals and fish. In this study, the full-length MCH cDNA was obtained from Schizothorax prenanti by rapid amplification of cDNA ends polymerase chain reaction. The full-length MCH cDNA contained 589 nucleotides including an open reading frame of 375 nucleotides encoding 256 amino acids. MCH mRNA was highly expressed in the brain by real-time quantitative PCR analysis. Within the brain, expression of MCH mRNA was preponderantly detected in the hypothalamus. In addition, the MCH mRNA expression in the S. prenanti hypothalamus of fed group was significantly decreased compared with the fasted group at 1 and 3 h post-feeding, respectively. Furthermore, the MCH gene expression presented significant increase in the hypothalamus of fasted group compared with the fed group during long-term fasting. After re-feeding, there was a dramatic decrease in MCH mRNA expression in the hypothalamus of S. prenanti. The results indicate that the expression of MCH is affected by feeding status. Taken together, our results suggest that MCH may be involved in food intake regulation in S. prenanti.
Abolhassani, Mohsen; Roux, Kenneth H
2009-06-01
Tree nuts, including almond (prunus dulcis) are a source of food allergens often associated with life-threatening allergic reactions in susceptible individuals. Although the proteins in almonds have been biochemically characterized, relatively little has been reported regarding the identity of the allergens involved in almond sensitivity. The present study was undertaken to identify the allergens of the almond by cDNA library approach. cDNA library of almond seeds was constructed in Uni-Zap XR lamda vector and expressed in E. coli XL-1 blue. Plaques were immunoscreened with pooled sera of allergic patients. The cDNA clone reacting significantly with specific IgE antibodies was selected and subcloned and subsequently expressed in E. coli. The amino acids deducted from PCR product of clone showed homology to 60s acidic ribosomal protein of almond. The expressed protein was 11,450 Dalton without leader sequence. Immunoreactivity of the recombinant 60s ribosomal protein (r60sRP) was evaluated with dot blot analysis using pooled and individual sera of allergic patients. The data showed that r60sRP and almond extract (as positive control) possess the ability to bind the IgE antibodies. The results showed that expressed protein is an almond allergen.Whether this r60sRP represents a major allergen of almond needs to be further studied which requires a large number of sera from the almond atopic patients and also need to determine the IgE-reactive frequencies of each individual allergen.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Du, L.; Desbarats, M.; Viel, J.
1996-08-15
The recently identified human PEX g ene apparently encodes for a neutral endopeptidase that is mutated in patients with X-linked hypophosphatemia. The 3{prime} and 5{prime} ends of the coding region of PEX have not been cloned, nor has the tissue expression of the gene been identified. Here we report the isolation and characterization of the complete open reading frame of the mouse Pex gene and the demonstration of its expression in bone. Mouse Pex cDNA is predicted to encode a protein of 749 amino acids with 95% identity to the available human PEX sequence and significant homology to members ofmore » the membrane-bound metalloendopeptidase family. Northern blot analysis revealed a 6.6-kb transcript in bone and in cultured osteoblasts from normal mice that was not detectable in samples from the Hyp mouse, the murine homolog of human X-linked hypophosphatemia. Pex transcripts were, however, detectable in Hyp bone by RT-PCR amplification. Of particular interest, a cDNA clone from rat incisor shows 93% sequence identity to the 5{prime} end of Pex cDNA, suggesting that Pex may be expressed in another calcified tissue, the tooth. The association of impaired mineralization of bone and teeth and disturbed renal phosphate reabsorption with altered expression of Pex suggests that the Pex gene product may play a critical role in these processes. 47 refs., 2 figs., 1 tab.« less
Treves, S; Feriotto, G; Moccagatta, L; Gambari, R; Zorzato, F
2000-12-15
Screening a cDNA library from human skeletal muscle and cardiac muscle with a cDNA probe derived from junctin led to the isolation of two groups of cDNA clones. The first group displayed a deduced amino acid sequence that is 84% identical to that of dog heart junctin, whereas the second group had a single open reading frame that encoded a polypeptide with a predicted mass of 33 kDa, whose first 78 NH(2)-terminal residues are identical to junctin whereas its COOH terminus domain is identical to aspartyl beta-hydroxylase, a member of the alpha-ketoglutarate-dependent dioxygenase family. We named the latter amino acid sequence junctate. Northern blot analysis indicates that junctate is expressed in a variety of human tissues including heart, pancreas, brain, lung, liver, kidney, and skeletal muscle. Fluorescence in situ hybridization analysis revealed that the genetic loci of junctin and junctate map to the same cytogenetic band on human chromosome 8. Analysis of intron/exon boundaries of the genomic BAC clones demonstrate that junctin, junctate, and aspartyl beta-hydroxylase result from alternative splicing of the same gene. The predicted lumenal portion of junctate is enriched in negatively charged residues and is able to bind calcium. Scatchard analysis of equilibrium (45)Ca(2+) binding in the presence of a physiological concentration of KCl demonstrate that junctate binds 21.0 mol of Ca(2+)/mol protein with a k(D) of 217 +/- 20 microm (n = 5). Tagging recombinant junctate with green fluorescent protein and expressing the chimeric polypeptide in COS-7-transfected cells indicates that junctate is located in endoplasmic reticulum membranes and that its presence increases the peak amplitude and transient calcium released by activation of surface membrane receptors coupled to InsP(3) receptor activation. Our study shows that alternative splicing of the same gene generates the following functionally distinct proteins: an enzyme (aspartyl beta-hydroxylase), a structural protein of SR (junctin), and a membrane-bound calcium binding protein (junctate).
Réfega, Susana; Girard-Misguich, Fabienne; Bourdieu, Christiane; Péry, Pierre; Labbé, Marie
2003-04-02
Specific antibodies were produced ex vivo from intestinal culture of Eimeria tenella infected chickens. The specificity of these intestinal antibodies was tested against different parasite stages. These antibodies were used to immunoscreen first generation schizont and sporozoite cDNA libraries permitting the identification of new E. tenella antigens. We obtained a total of 119 cDNA clones which were subjected to sequence analysis. The sequences coding for the proteins inducing local immune responses were compared with nucleotide or protein databases and with expressed sequence tags (ESTs) databases. We identified new Eimeria genes coding for heat shock proteins, a ribosomal protein, a pyruvate kinase and a pyridoxine kinase. Specific features of other sequences are discussed.
Single molecule fluorescence microscopy for ultra-sensitive RNA expression profiling
NASA Astrophysics Data System (ADS)
Hesse, Jan; Jacak, Jaroslaw; Regl, Gerhard; Eichberger, Thomas; Aberger, Fritz; Schlapak, Robert; Howorka, Stefan; Muresan, Leila; Frischauf, Anna-Maria; Schütz, Gerhard J.
2007-02-01
We developed a microarray analysis platform for ultra-sensitive RNA expression profiling of minute samples. It utilizes a novel scanning system for single molecule fluorescence detection on cm2 size samples in combination with specialized biochips, optimized for low autofluorescence and weak unspecific adsorption. 20 μg total RNA was extracted from 10 6 cells of a human keratinocyte cell line (HaCaT) and reversely transcribed in the presence of Alexa647-aha-dUTP. 1% of the resulting labeled cDNA was used for complex hybridization to a custom-made oligonucleotide microarray representing a set of 125 different genes. For low abundant genes, individual cDNA molecules hybridized to the microarray spots could be resolved. Single cDNA molecules hybridized to the chip surface appeared as diffraction limited features in the fluorescence images. The à trous wavelet method was utilized for localization and counting of the separated cDNA signals. Subsequently, the degree of labeling of the localized cDNA molecules was determined by brightness analysis for the different genes. Variations by factors up to 6 were found, which in conventional microarray analysis would result in a misrepresentation of the relative abundance of mRNAs.
Hirotani, M; Kuroda, R; Suzuki, H; Yoshikawa, T
2000-05-01
A cDNA encoding UDP-glucose: baicalein 7-O-glucosyltransferase (UBGT) was isolated from a cDNA library from hairy root cultures of Scutellaria baicalensis Georgi probed with a partial-length cDNA clone of a UDP-glucose: flavonoid 3-O-glucosyltransferase (UFGT) from grape (Vitis vinifera L.). The heterologous probe contained a glucosyltransferase consensus amino acid sequence which was also present in the Scutellaria cDNA clones. The complete nucleotide sequence of the 1688-bp cDNA insert was determined and the deduced amino acid sequences are presented. The nucleotide sequence analysis of UBGT revealed an open reading frame encoding a polypeptide of 476 amino acids with a calculated molecular mass of 53,094 Da. The reaction product for baicalein and UDP-glucose catalyzed by recombinant UBGT in Escherichia coli was identified as authentic baicalein 7-O-glucoside using high-performance liquid chromatography and proton nuclear magnetic resonance spectroscopy. The enzyme activities of recombinant UBGT expressed in E. coli were also detected towards flavonoids such as baicalein, wogonin, apigenin, scutellarein, 7,4'-dihydroxyflavone and kaempferol, and phenolic compounds. The accumulation of UBGT mRNA in hairy roots was in response to wounding or salicylic acid treatments.
Structure and chromosomal localization of the human PD-1 gene (PDCD1)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shinohara, T.; Ishida, Y.; Kawaichi, M.
1994-10-01
A cDNA encoding mouse PD-1, a member of the immunoglobulin superfamily, was previously isolated from apoptosis-induced cells by subtractive hybridization. To determine the structure and chromosomal location of the human PD-1 gene, we screened a human T cell cDNA library by mouse PD-1 probe and isolated a cDNA coding for the human PD-1 protein. The deduced amino acid sequence of human PD-1 was 60% identical to the mouse counterpart, and a putative tyrosine kinase-association motif was well conserved. The human PD-1 gene was mapped to 2q37.3 by chromosomal in situ hybridization. 7 refs., 3 figs.
Dreyer, Christine; Hoffmann, Margarete; Lanz, Christa; Willing, Eva-Maria; Riester, Markus; Warthmann, Norman; Sprecher, Andrea; Tripathi, Namita; Henz, Stefan R; Weigel, Detlef
2007-01-01
Background The guppy, Poecilia reticulata, is a well-known model organism for studying inheritance and variation of male ornamental traits as well as adaptation to different river habitats. However, genomic resources for studying this important model were not previously widely available. Results With the aim of generating molecular markers for genetic mapping of the guppy, cDNA libraries were constructed from embryos and different adult organs to generate expressed sequence tags (ESTs). About 18,000 ESTs were annotated according to BLASTN and BLASTX results and the sequence information from the 3' UTRs was exploited to generate PCR primers for re-sequencing of genomic DNA from different wild type strains. By comparison of EST-linked genomic sequences from at least four different ecotypes, about 1,700 polymorphisms were identified, representing about 400 distinct genes. Two interconnected MySQL databases were built to organize the ESTs and markers, respectively. A robust phylogeny of the guppy was reconstructed, based on 10 different nuclear genes. Conclusion Our EST and marker databases provide useful tools for genetic mapping and phylogenetic studies of the guppy. PMID:17686157
Assignment of xeroderma pigmentosum group C(XPC) gene to chromosome 3p25
DOE Office of Scientific and Technical Information (OSTI.GOV)
Legerski, R.J.; Liu, P.; Li, L.
1994-05-01
The human gene XPC (formerly designated XPCC), which corrects the repair deficiency of xeroderma pigmentosum (XP) group C cells, was mapped to 3p25. A cDNA probe for Southern blot hybridization and diagnostic PCR analyses of hybrid clone panels informative for human chromosomes in general and portions of chromosome 3 in particular produced the initial results. Fluorescence in situ hybridization utilizing both a yeast artificial chromosome DNA containing the gene and XPC cDNA as probes provided verification and specific regional assignment. A conflicting assignment of XPC to chromosome 5 is discussed in light of inadequacies in the exclusive use of microcell-mediatedmore » chromosome transfer for gene mapping. 12 refs., 3 figs.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Laig-Webster, M.; Lim, M.E.; Chehab, F.F.
1994-09-01
The molecular defect underlying an autosomal recessive form of genetic obesity in a classical mouse model C57 BL/6J-ob/ob has not yet been elucidated. Whereas metabolic and physiological disturbances such as diabetes and hypertension are associated with obesity, the site of expression and the nature of the primary lesion responsible for this cascade of events remains elusive. Our efforts aimed at the positional cloning of the ob gene by YAC contig mapping and gene identification have resulted in the cloning of a brain-specific gene cluster from the ob critical region. The expression of this gene cluster is remarkably complex owing tomore » the multitude of brain-specific mRNA transcripts detected on Northern blots. cDNA cloning of these transcripts suggests that they are expressed from different genes as well as by alternate splicing mechanisms. Furthermore, the genomic organization of the cluster appears to consist of at least two identical promoters displaying CpG islands characteristic of housekeeping genes, yet clearly involving tissue-specific expression. Sense and anti-sense synthetic RNA probes were derived from a common DNA sequence on 3 cDNA clones and hybridized to 8-16 days mouse embryonic stages and mouse adult brain sections. Expression in development was noticeable as of the 11th day of gestation and confined to the central nervous system mainly in the telencephalon and spinal cord. Coronal and sagittal sections of the adult mouse brain showed expression only in 3 different regions of the brain stem. In situ hybridization to mouse hypothalamus sections revealed the presence of a localized and specialized group of cells expressing high levels of mRNA, suggesting that this gene cluster may also be involved in the regulation of hypothalamic activities. The hypothalamus has long been hypothesized as a primary candidate tissue for the expression of the obesity gene mainly because of its well-established role in the regulation of energy metabolism and food intake.« less
MOLECULAR CHARACTERIZATION OF ENDOCRINE DISRUPTION IN FISH USING CDNA ARRAYS.
We are developing cDNA macroarrays to measure the induction of gene expression in sheepshead minnows and largemouth bass exposed to anthropogenic chemicals that can mimic the action of endogenous hormones. For sheepshead minnows exposed in aqua, we observed similar genetic profil...
NASA Astrophysics Data System (ADS)
Gray, Patrick W.; Barrett, Kathy; Chantry, David; Turner, Martin; Feldmann, Marc
1990-10-01
The cDNA for one of the receptors for human tumor necrosis factor (TNF) has been isolated. This cDNA encodes a protein of 455 amino acids that is divided into an extracellular domain of 171 residues and a cytoplasmic domain of 221 residues. The extracellular domain has been engineered for expression in mammalian cells, and this recombinant derivative binds TNFα with high affinity and inhibits its cytotoxic activity in vitro. The TNF receptor exhibits similarity with a family of cell surface proteins that includes the nerve growth factor receptor, the human B-cell surface antigen CD40, and the rat T-cell surface antigen OX40. The TNF receptor contains four cysteine-rich subdomains in the extra-cellular portion. Mammalian cells transfected with the entire TNF receptor cDNA bind radiolabeled TNFα with an affinity of 2.5 x 10-9 M. This binding can be competitively inhibited with unlabeled TNFα or lymphotoxin (TNFβ).
Construction and application of EST library from Setaria italica in response to dehydration stress.
Zhang, Jinpeng; Liu, Tingsong; Fu, Junjie; Zhu, Yun; Jia, Jinping; Zheng, Jun; Zhao, Yinhe; Zhang, Ying; Wang, Guoying
2007-07-01
Foxtail millet is a gramineous crop with low water requirement. Despite its high water use efficiency, less attention has been paid to the molecular genetics of foxtail millet. This article reports the construction of subtracted cDNA libraries from foxtail millet seedlings under dehydration stress and the expression profile analysis of 1947 UniESTs from the subtracted cDNA libraries by a cDNA microarray. The results showed that 95 and 57 ESTs were upregulated by dehydration stress, respectively, in roots and shoots of seedlings and that 10 and 27 ESTs were downregulated, respectively, in roots and shoots. The expression profile analysis showed that genes induced in foxtail millet roots were different from those in shoots during dehydration stress and that the early response to dehydration stress in foxtail millet roots was the activation of the glycolysis metabolism. Moreover, protein degradation pathway may also play a pivotal role in drought-tolerant responses of foxtail millet. Finally, Northern blot analysis validated well the cDNA microarray data.
Eberwine, James; Bartfai, Tamas
2011-01-01
We report on an ‘unbiased’ molecular characterization of individual, adult neurons, active in a central, anterior hypothalamic neuronal circuit, by establishing cDNA libraries from each individual, electrophysiologically identified warm sensitive neuron (WSN). The cDNA libraries were analyzed by Affymetrix microarray. The presence and frequency of cDNAs was confirmed and enhanced with Illumina sequencing of each single cell cDNA library. cDNAs encoding the GABA biosynthetic enzyme. GAD1 and of adrenomedullin, galanin, prodynorphin, somatostatin, and tachykinin were found in the WSNs. The functional cellular and in vivo studies on dozens of the more than 500 neurotransmitter -, hormone- receptors and ion channels, whose cDNA was identified and sequence confirmed, suggest little or no discrepancy between the transcriptional and functional data in WSNs; whenever agonists were available for a receptor whose cDNA was identified, a functional response was found.. Sequencing single neuron libraries permitted identification of rarely expressed receptors like the insulin receptor, adiponectin receptor2 and of receptor heterodimers; information that is lost when pooling cells leads to dilution of signals and mixing signals. Despite the common electrophysiological phenotype and uniform GAD1 expression, WSN- transcriptomes show heterogenity, suggesting strong epigenetic influence on the transcriptome. Our study suggests that it is well-worth interrogating the cDNA libraries of single neurons by sequencing and chipping. PMID:20970451
Multidisciplinary Biomarkers of Early Mammary Carcinogenesis
2011-04-01
cDNA prepared. Quantitative real-time PCR (qRT-PCR) was then performed on the cDNA. All qRT-PCR reactions were performed in triplicate. ESR1 ...in Figure 4, all ER(+) cells express ESR1 at high levels (at least 4 fold higher than ER(-) cell lines). A Pearson correlation coefficient was...calculated to determine the linear relationship between the optical redox ratio and ESR1 expression levels and found to be significant (p = 0.0024, r
DOE Office of Scientific and Technical Information (OSTI.GOV)
Woon, J. S. K., E-mail: jameswoon@siswa.ukm.edu.my; Murad, A. M. A., E-mail: munir@ukm.edu.my; Abu Bakar, F. D., E-mail: fabyff@ukm.edu.my
A cellobiohydrolase B (CbhB) from Aspergillus niger ATCC 10574 was cloned and expressed in E. coli. CbhB has an open reading frame of 1611 bp encoding a putative polypeptide of 536 amino acids. Analysis of the encoded polypeptide predicted a molecular mass of 56.2 kDa, a cellulose binding module (CBM) and a catalytic module. In order to obtain the mRNA of cbhB, total RNA was extracted from A. niger cells induced by 1% Avicel. First strand cDNA was synthesized from total RNA via reverse transcription. The full length cDNA of cbhB was amplified by PCR and cloned into the cloning vector, pGEM-Tmore » Easy. A comparison between genomic DNA and cDNA sequences of cbhB revealed that the gene is intronless. Upon the removal of the signal peptide, the cDNA of cbhB was cloned into the expression vector pET-32b. However, the recombinant CbhB was expressed in Escherichia coli Origami DE3 as an insoluble protein. A homology model of CbhB predicted the presence of nine disulfide bonds in the protein structure which may have contributed to the improper folding of the protein and thus, resulting in inclusion bodies in E. coli.« less
Paramyosin from the parasitic mite Sarcoptes scabiei: cDNA cloning and heterologous expression.
Mattsson, J G; Ljunggren, E L; Bergström, K
2001-05-01
The burrowing mite Sarcoptes scabiei is the causative agent of the highly contagious disease sarcoptic mange or scabies. So far, there is no in vitro propagation system for S. scabiei available, and mites used for various purposes must be isolated from infected hosts. Lack of parasite-derived material has limited the possibilities to study several aspects of scabies, including pathogenesis and immunity. It has also hampered the development of high performance serological assays. We have now constructed an S. scabiei cDNA expression library with mRNA purified from mites isolated from red foxes. Immunoscreening of the library enabled us to clone a full-length cDNA coding for a 102.5 kDa protein. Sequence similarity searches identified the protein as a paramyosin. Recombinant S. scabiei paramyosin expressed in Escherichia coli was recognized by sera from dogs and swine infected with S. scabiei. We also designed a small paramyosin construct of about 17 kDa that included the N-terminal part, an evolutionary variable part of the helical core, and the C-terminal part of the molecule. The miniaturized protein was efficiently expressed in E. coli and was recognized by sera from immunized rabbits. These data demonstrate that the cDNA library can assist in the isolation of important S. scabiei antigens and that recombinant proteins can be useful for the study of scabies.
Hamatani, Kiyohiro; Eguchi, Hidetaka; Koyama, Kazuaki; Mukai, Mayumi; Nakachi, Kei; Kusunoki, Yoichiro
2014-11-01
During analysis of RET/PTC rearrangements in papillary thyroid cancer (PTC) among atomic bomb survivors, a cDNA fragment of a novel type of RET rearrangement was identified in a PTC patient exposed to a high radiation dose using the improved 5' RACE method. This gene resulted from the fusion of the 3' portion of RET containing tyrosine kinase domain to the 5' portion of the acyl-coenzyme A binding domain containing 5 (ACBD5) gene, by pericentric inversion inv(10)(p12.1;q11.2); expression of the fusion gene was confirmed by RT-PCR. ACBD5 gene is ubiquitously expressed in various human normal tissues including thyroid. Full-length cDNA of the ACBD5-RET gene was constructed and then examined for tumorigenicity. Enhanced phosphorylation of ERK proteins in the MAPK pathway was observed in NIH3T3 cells transfected with expression vector encoding the full-length ACBD5/RET cDNA, while this was not observed in the cells transfected with empty expression vector. Stable NIH3T3 transfectants with ACBD5-RET cDNA induced tumor formation after their injection into nude mice. These findings suggest that the ACBD5-RET rearrangement is causatively involved in the development of PTC.
Molecular cloning and expression of rat liver bile acid CoA ligase.
Falany, Charles N; Xie, Xiaowei; Wheeler, James B; Wang, Jin; Smith, Michelle; He, Dongning; Barnes, Stephen
2002-12-01
Bile acid CoA ligase (BAL) is responsible for catalyzing the first step in the conjugation of bile acids with amino acids. Sequencing of putative rat liver BAL cDNAs identified a cDNA (rBAL-1) possessing a 51 nucleotide 5'-untranslated region, an open reading frame of 2,070 bases encoding a 690 aa protein with a molecular mass of 75,960 Da, and a 138 nucleotide 3'-nontranslated region followed by a poly(A) tail. Identity of the cDNA was established by: 1) the rBAL-1 open reading frame encoded peptides obtained by chemical sequencing of the purified rBAL protein; 2) expressed rBAL-1 protein comigrated with purified rBAL during SDS-polyacrylamide gel electrophoresis; and 3) rBAL-1 expressed in insect Sf9 cells had enzymatic properties that were comparable to the enzyme isolated from rat liver. Evidence for a relationship between fatty acid and bile acid metabolism is suggested by specific inhibition of rBAL-1 by cis-unsaturated fatty acids and its high homology to a human very long chain fatty acid CoA ligase. In summary, these results indicate that the cDNA for rat liver BAL has been isolated and expression of the rBAL cDNA in insect Sf9 cells results in a catalytically active enzyme capable of utilizing several different bile acids as substrates.
Kuefer, M U; Look, A T; Williams, D C; Valentine, V; Naeve, C W; Behm, F G; Mullersman, J E; Yoneda-Kato, N; Montgomery, K; Kucherlapati, R; Morris, S W
1996-07-15
A fusion gene between nucleophosmin (NPM) and myelodysplasia/myeloid leukemia factor 1 (MLF1) is formed by a recurrent t(3;5)(q25.1;q34) in myelodysplastic syndrome and acute myeloid leukemia. Here we report the identification of a novel gene, MLF2, which contains an open reading frame of 744 bp encoding a 248-amino-acid protein highly related to the previously identified MLF1 protein (63% similarity, 40% identity). In contrast to the tissue-restricted expression pattern of MLF1, the MLF2 messenger RNA is expressed ubiquitously. The MLF2 gene locus was mapped by fluorescence in situ hybridization to human chromosome 12p13, a chromosomal region frequently involved in translocations and deletions in acute leukemias of lymphoid or myeloid lineage. In a physical map of chromosome 12, MLF2 was found to reside on the yeast artificial chromosome clone 765b9. Southern blotting analysis of malignant cell DNAs prepared from a series of acute lymphoblastic leukemia cases with translocations involving chromosome arm 12p, as well as a group of acute myeloid leukemias with various cytogenetic abnormalities, failed to reveal MLF2 gene rearrangements.
Li, Lishu; Ikezono, Tetsuo; Sekine, Kuwon; Shindo, Susumu; Matsumura, Tomohiro; Pawankar, Ruby; Ichimiya, Issei; Yagi, Toshiaki
2010-08-01
We have cloned guinea pig Coch cDNA and the sequence information will be useful for future molecular study combined with physiological experiments. Proper Coch gene expression appears to be dependent on the unique extracellular micro-environment of the inner ear in vivo. These results provide insight into the Coch gene expression and its regulation. To characterize the guinea pig Coch gene, we performed molecular cloning and expression analysis in the inner ear and cultured fibrocytes of the spiral ligament. The Coch cDNA was isolated using RACE. Cochlin isofoms were studied by Western blot using three different types of mammalian inner ear. The cochlear fibrocytes were cultured and characterized by immunostaining. Coch gene expression in the fibrocytes was investigated and the influence of cytokine stimulation was evaluated. The full-length 1991 bp Coch cDNA that encodes a 553 amino acid protein was isolated. The sequence had significant homology with other mammals, and the sizes of the Cochlin isoforms were identical. In the cultured fibrocytes, Coch mRNA was expressed in a very small amount and the isoform production was different, compared with the results in vivo. Cytokine stimulation did not alter the level of mRNA expression or isoform formation.
Aramrak, Attawan; Kidwell, Kimberlee K; Steber, Camille M; Burke, Ian C
2015-10-23
5-Enolpyruvylshikimate-3-phosphate synthase (EPSPS) is the sixth and penultimate enzyme in the shikimate biosynthesis pathway, and is the target of the herbicide glyphosate. The EPSPS genes of allohexaploid wheat (Triticum aestivum, AABBDD) have not been well characterized. Herein, the three homoeologous copies of the allohexaploid wheat EPSPS gene were cloned and characterized. Genomic and coding DNA sequences of EPSPS from the three related genomes of allohexaploid wheat were isolated using PCR and inverse PCR approaches from soft white spring "Louise'. Development of genome-specific primers allowed the mapping and expression analysis of TaEPSPS-7A1, TaEPSPS-7D1, and TaEPSPS-4A1 on chromosomes 7A, 7D, and 4A, respectively. Sequence alignments of cDNA sequences from wheat and wheat relatives served as a basis for phylogenetic analysis. The three genomic copies of wheat EPSPS differed by insertion/deletion and single nucleotide polymorphisms (SNPs), largely in intron sequences. RT-PCR analysis and cDNA cloning revealed that EPSPS is expressed from all three genomic copies. However, TaEPSPS-4A1 is expressed at much lower levels than TaEPSPS-7A1 and TaEPSPS-7D1 in wheat seedlings. Phylogenetic analysis of 1190-bp cDNA clones from wheat and wheat relatives revealed that: 1) TaEPSPS-7A1 is most similar to EPSPS from the tetraploid AB genome donor, T. turgidum (99.7 % identity); 2) TaEPSPS-7D1 most resembles EPSPS from the diploid D genome donor, Aegilops tauschii (100 % identity); and 3) TaEPSPS-4A1 resembles EPSPS from the diploid B genome relative, Ae. speltoides (97.7 % identity). Thus, EPSPS sequences in allohexaploid wheat are preserved from the most two recent ancestors. The wheat EPSPS genes are more closely related to Lolium multiflorum and Brachypodium distachyon than to Oryza sativa (rice). The three related EPSPS homoeologues of wheat exhibited conservation of the exon/intron structure and of coding region sequence, but contained significant sequence variation within intron regions. The genome-specific primers developed will enable future characterization of natural and induced variation in EPSPS sequence and expression. This can be useful in investigating new causes of glyphosate herbicide resistance.
Comparison of next generation sequencing technologies for transcriptome characterization
2009-01-01
Background We have developed a simulation approach to help determine the optimal mixture of sequencing methods for most complete and cost effective transcriptome sequencing. We compared simulation results for traditional capillary sequencing with "Next Generation" (NG) ultra high-throughput technologies. The simulation model was parameterized using mappings of 130,000 cDNA sequence reads to the Arabidopsis genome (NCBI Accession SRA008180.19). We also generated 454-GS20 sequences and de novo assemblies for the basal eudicot California poppy (Eschscholzia californica) and the magnoliid avocado (Persea americana) using a variety of methods for cDNA synthesis. Results The Arabidopsis reads tagged more than 15,000 genes, including new splice variants and extended UTR regions. Of the total 134,791 reads (13.8 MB), 119,518 (88.7%) mapped exactly to known exons, while 1,117 (0.8%) mapped to introns, 11,524 (8.6%) spanned annotated intron/exon boundaries, and 3,066 (2.3%) extended beyond the end of annotated UTRs. Sequence-based inference of relative gene expression levels correlated significantly with microarray data. As expected, NG sequencing of normalized libraries tagged more genes than non-normalized libraries, although non-normalized libraries yielded more full-length cDNA sequences. The Arabidopsis data were used to simulate additional rounds of NG and traditional EST sequencing, and various combinations of each. Our simulations suggest a combination of FLX and Solexa sequencing for optimal transcriptome coverage at modest cost. We have also developed ESTcalc http://fgp.huck.psu.edu/NG_Sims/ngsim.pl, an online webtool, which allows users to explore the results of this study by specifying individualized costs and sequencing characteristics. Conclusion NG sequencing technologies are a highly flexible set of platforms that can be scaled to suit different project goals. In terms of sequence coverage alone, the NG sequencing is a dramatic advance over capillary-based sequencing, but NG sequencing also presents significant challenges in assembly and sequence accuracy due to short read lengths, method-specific sequencing errors, and the absence of physical clones. These problems may be overcome by hybrid sequencing strategies using a mixture of sequencing methodologies, by new assemblers, and by sequencing more deeply. Sequencing and microarray outcomes from multiple experiments suggest that our simulator will be useful for guiding NG transcriptome sequencing projects in a wide range of organisms. PMID:19646272
Lockyer, Anne E; Spinks, Jenny; Kane, Richard A; Hoffmann, Karl F; Fitzpatrick, Jennifer M; Rollinson, David; Noble, Leslie R; Jones, Catherine S
2008-01-01
Background Biomphalaria glabrata is an intermediate snail host for Schistosoma mansoni, one of the important schistosomes infecting man. B. glabrata/S. mansoni provides a useful model system for investigating the intimate interactions between host and parasite. Examining differential gene expression between S. mansoni-exposed schistosome-resistant and susceptible snail lines will identify genes and pathways that may be involved in snail defences. Results We have developed a 2053 element cDNA microarray for B. glabrata containing clones from ORESTES (Open Reading frame ESTs) libraries, suppression subtractive hybridization (SSH) libraries and clones identified in previous expression studies. Snail haemocyte RNA, extracted from parasite-challenged resistant and susceptible snails, 2 to 24 h post-exposure to S. mansoni, was hybridized to the custom made cDNA microarray and 98 differentially expressed genes or gene clusters were identified, 94 resistant-associated and 4 susceptible-associated. Quantitative PCR analysis verified the cDNA microarray results for representative transcripts. Differentially expressed genes were annotated and clustered using gene ontology (GO) terminology and Kyoto Encyclopaedia of Genes and Genomes (KEGG) pathway analysis. 61% of the identified differentially expressed genes have no known function including the 4 susceptible strain-specific transcripts. Resistant strain-specific expression of genes implicated in innate immunity of invertebrates was identified, including hydrolytic enzymes such as cathepsin L, a cysteine proteinase involved in lysis of phagocytosed particles; metabolic enzymes such as ornithine decarboxylase, the rate-limiting enzyme in the production of polyamines, important in inflammation and infection processes, as well as scavenging damaging free radicals produced during production of reactive oxygen species; stress response genes such as HSP70; proteins involved in signalling, such as importin 7 and copine 1, cytoplasmic intermediate filament (IF) protein and transcription enzymes such as elongation factor 1α and EF-2. Conclusion Production of the first cDNA microarray for profiling gene expression in B. glabrata provides a foundation for expanding our understanding of pathways and genes involved in the snail internal defence system (IDS). We demonstrate resistant strain-specific expression of genes potentially associated with the snail IDS, ranging from signalling and inflammation responses through to lysis of proteinacous products (encapsulated sporocysts or phagocytosed parasite components) and processing/degradation of these targeted products by ubiquitination. PMID:19114004
Lockyer, Anne E; Spinks, Jenny; Kane, Richard A; Hoffmann, Karl F; Fitzpatrick, Jennifer M; Rollinson, David; Noble, Leslie R; Jones, Catherine S
2008-12-29
Biomphalaria glabrata is an intermediate snail host for Schistosoma mansoni, one of the important schistosomes infecting man. B. glabrata/S. mansoni provides a useful model system for investigating the intimate interactions between host and parasite. Examining differential gene expression between S. mansoni-exposed schistosome-resistant and susceptible snail lines will identify genes and pathways that may be involved in snail defences. We have developed a 2053 element cDNA microarray for B. glabrata containing clones from ORESTES (Open Reading frame ESTs) libraries, suppression subtractive hybridization (SSH) libraries and clones identified in previous expression studies. Snail haemocyte RNA, extracted from parasite-challenged resistant and susceptible snails, 2 to 24 h post-exposure to S. mansoni, was hybridized to the custom made cDNA microarray and 98 differentially expressed genes or gene clusters were identified, 94 resistant-associated and 4 susceptible-associated. Quantitative PCR analysis verified the cDNA microarray results for representative transcripts. Differentially expressed genes were annotated and clustered using gene ontology (GO) terminology and Kyoto Encyclopaedia of Genes and Genomes (KEGG) pathway analysis. 61% of the identified differentially expressed genes have no known function including the 4 susceptible strain-specific transcripts. Resistant strain-specific expression of genes implicated in innate immunity of invertebrates was identified, including hydrolytic enzymes such as cathepsin L, a cysteine proteinase involved in lysis of phagocytosed particles; metabolic enzymes such as ornithine decarboxylase, the rate-limiting enzyme in the production of polyamines, important in inflammation and infection processes, as well as scavenging damaging free radicals produced during production of reactive oxygen species; stress response genes such as HSP70; proteins involved in signalling, such as importin 7 and copine 1, cytoplasmic intermediate filament (IF) protein and transcription enzymes such as elongation factor 1alpha and EF-2. Production of the first cDNA microarray for profiling gene expression in B. glabrata provides a foundation for expanding our understanding of pathways and genes involved in the snail internal defence system (IDS). We demonstrate resistant strain-specific expression of genes potentially associated with the snail IDS, ranging from signalling and inflammation responses through to lysis of proteinacous products (encapsulated sporocysts or phagocytosed parasite components) and processing/degradation of these targeted products by ubiquitination.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mathew, S.; Murty, V.V.V.S.; Chaganti, R.S.K.
The human fibroblast activation protein {alpha} (FAP{alpha}) is an inducible cell surface glycoprotein of M{sub r} 95,000 recognized by a number of monoclonal antibodies (mAbs), including the prototype mAb F19. Immunohistochemical studies have shown that FAP{alpha} expression in vivo is tightly regulated, with transient expression in some fetal mesenchymal tissues but absence of expression in most normal adult tissues. Reexpression of FAP{alpha} is observed in the reactive stromal fibroblasts of several common types of epithelial cancers, including >90% of breast, colorectal, and lung carcinomas and healing wounds. Cloning and sequence analysis of an FAP{alpha}-specific cDNA has revealed that the moleculemore » is encoded by a novel gene, FAP, which shows sequence similarity to members of the serine protease family of integral membrane proteins, namely dipeptidyl peptidase IV (DPPIV, also known as lymphocyte activation antigen, CD26, or adenosine dearoinase binding protein) and DPPX, a DPPIV-related molecule of unknown function. 15 refs., 1 fig.« less
Schwartz, R S; Rybicki, A C; Nagel, R L
1997-10-15
We report the cloning and sequencing from human reticulocytes of cDNA coding for the Cl- channel-associated protein, pICln. Human reticulocyte pICln (HRpICln) cDNA encodes a protein (predicted molecular mass 26293Da) identical with human non-pigmented ciliary epithelial cell pICln. By using full-length HRpICln cDNA (approx. 1.2 kb) to probe human lymphocyte metaphase-chromosome spreads, the location of the human ICln gene was mapped to 11q13 by fluorescence in situ hybridization analysis. Polyclonal antibodies to recombinant HRpICln detected bands at approx. 43 kDa and approx. 37 kDa in both normal (AA) and sickle (SS) red blood cell (RBC) ghost membranes. In SS ghosts, and in ghosts from a patient with autoimmune haemolytic anaemia with 9.8% reticulocytes, the amount of HRpICln was increased compared with AA ghosts, suggesting that the expression or membrane assembly of HRpICln is cell age-dependent. Laser scanning confocal fluorescent microscopy immunolocalized HRpICln largely to the RBC membrane. The increased staining intensity of HRpICln in a reticulocyte-enriched AA RBC density-separated fraction is consistent with a dependence of HRpICln membrane content on cell age. HRpICln and beta-actin form stable complexes in vivo, demonstrated with the yeast two-hybrid system. Low-ionic-strength extraction of ghost membranes, which results in the extraction of the spectrin-actin cytoskeleton, also results in the extraction of HRpICln, consistent with the possibility for the association of these proteins in RBCs in vivo. The results presented here establish the presence of the Cl- channel-associated protein, pICln, in human RBCs, and raises the possibility that this protein has a role in RBC Cl- transport and volume regulation in young RBCs. Moreover the association of RBC pICln with actin offers a model in which to test interactions between RBC ion channels and the cytoskeleton.
Goetz, Frederick W; Norberg, Birgitta; McCauley, Linda A R; Iliev, Dimitar B
2004-03-01
The full-length cDNA for the cod (Gadus morhua) StAR was cloned by RT-PCR and library screening using ovarian RNA. From the library screening, 2 size classes of cDNA were obtained; a 1577 bp cDNA (cStAR1) and a 2851 bp cDNA (cStAR2). The cStAR1 cDNA presumably encodes a protein of 286 amino acids. The cStAR2 cDNA was composed of 6 separated sequences that contained all of the coding regions of cStAR1 when added together, but also contained 5 noncoding regions not observed in cStAR1. Polymerase chain reactions of cod genomic DNA produced products slightly larger than cStAR2. The sequence of these products were the same as cStAR2 but revealed one additional noncoding region (intron). Thus, the fish StAR gene contains the same number of exons (7) and introns (6) as observed in mammals, but is approximately half the size of the mammalian gene. Using Northern analysis and RT-PCR, cStAR1 expression was observed only in testes, ovaries and head kidneys. Polymerase chain reaction products were also observed using cDNA from steroidogenic tissues and primers designed to regions specific for cStAR2, indicating that cStAR2 is expressed in tissues and may account for the presence of larger transcripts observed on Northern blots.
Genetic Regulation in the Aiptasia pallida Symbiosis - Performance Report, Year 1.
1997-02-01
and symbiotic zooxanthellae is one developed for serial analysis of gene expression (SAGE). We initially tested the SAGE protocol with cDNA generated...technically difficult. We are now focusing on constructing representative cDNA libraries from cultured and symbiotic zooxanthellae and will sequence
Roux, Michelle M.; Pain, Arnab; Klimpel, Kurt R.; Dhar, Arun K.
2002-01-01
Pattern recognition proteins such as lipopolysaccharide and β-1,3-glucan binding protein (LGBP) play an important role in the innate immune response of crustaceans and insects. Random sequencing of cDNA clones from a hepatopancreas cDNA library of white spot virus (WSV)-infected shrimp provided a partial cDNA (PsEST-289) that showed similarity to the LGBP gene of crayfish and insects. Subsequently full-length cDNA was cloned by the 5′-RACE (rapid amplification of cDNA ends) technique and sequenced. The shrimp LGBP gene is 1,352 bases in length and is capable of encoding a polypeptide of 376 amino acids that showed significant similarity to homologous genes from crayfish, insects, earthworms, and sea urchins. Analysis of the shrimp LGBP deduced amino acid sequence identified conserved features of this gene family including a potential recognition motif for β-(1→3) linkage of polysaccharides and putative RGD cell adhesion sites. It is known that LGBP gene expression is upregulated in bacterial and fungal infection and that the binding of lipopolysaccharide and β-1,3-glucan to LGBP activates the prophenoloxidase (proPO) cascade. The temporal expression of LGBP and proPO genes in healthy and WSV-challenged Penaeus stylirostris shrimp was measured by real-time quantitative reverse transcription-PCR, and we showed that LGBP gene expression in shrimp was upregulated as the WSV infection progressed. Interestingly, the proPO expression was upregulated initially after infection followed by a downregulation as the viral infection progressed. The downward trend in the expression of proPO coincided with the detection of WSV in the infected shrimp. Our data suggest that shrimp LGBP is an inducible acute-phase protein that may play a critical role in shrimp-WSV interaction and that the WSV infection regulates the activation and/or activity of the proPO cascade in a novel way. PMID:12072514
Wang, Hai-Tao; Kong, Jian-Ping; Ding, Fang; Wang, Xiu-Qin; Wang, Ming-Rong; Liu, Lian-Xin; Wu, Min; Liu, Zhi-Hua
2003-01-01
AIM: To obtain human esophageal cancer cell EC9706 stably expressed epithelial membrane protein-1 (EMP-1) with integrated eukaryotic plasmid harboring the open reading frame (ORF) of human EMP-1, and then to study the mechanism by which EMP-1 exerts its diverse cellular action on cell proliferation and altered gene profile by exploring the effect of EMP-1. METHODS: The authors first constructed pcDNA3.1/myc-his expression vector harboring the ORF of EMP-1 and then transfected it into human esophageal carcinoma cell line EC9706. The positive clones were analyzed by Western blot and RT-PCR. Moreover, the cell growth curve was observed and the cell cycle was checked by FACS technique. Using cDNA microarray technology, the authors compared the gene expression pattern in positive clones with control. To confirm the gene expression profile, semi-quantitative RT-PCR was carried out for 4 of the randomly picked differentially expressed genes. For those differentially expressed genes, classification was performed according to their function and cellular component. RESULTS: Human EMP-1 gene can be stably expressed in EC9706 cell line transfected with human EMP-1. The authors found the cell growth decreased, among which S phase was arrested and G1 phase was prolonged in the transfected positive clones. By cDNA microarray analysis, 35 genes showed an over 2.0 fold change in expression level after transfection, with 28 genes being consistently up-regulated and 7 genes being down-regulated. Among the classified genes, almost half of the induced genes (13 out of 28 genes) were related to cell signaling, cell communication and particularly to adhesion. CONCLUSION: Overexpression of human EMP-1 gene can inhibit the proliferation of EC9706 cell with S phase arrested and G1 phase prolonged. The cDNA microarray analysis suggested that EMP-1 may be one of regulators involved in cell signaling, cell communication and adhesion regulators. PMID:12632483
Wang, Hai-Tao; Kong, Jian-Ping; Ding, Fang; Wang, Xiu-Qin; Wang, Ming-Rong; Liu, Lian-Xin; Wu, Min; Liu, Zhi-Hua
2003-03-01
To obtain human esophageal cancer cell EC9706 stably expressed epithelial membrane protein-1 (EMP-1) with integrated eukaryotic plasmid harboring the open reading frame (ORF) of human EMP-1, and then to study the mechanism by which EMP-1 exerts its diverse cellular action on cell proliferation and altered gene profile by exploring the effect of EMP-1. The authors first constructed pcDNA3.1/myc-his expression vector harboring the ORF of EMP-1 and then transfected it into human esophageal carcinoma cell line EC9706. The positive clones were analyzed by Western blot and RT-PCR. Moreover, the cell growth curve was observed and the cell cycle was checked by FACS technique. Using cDNA microarray technology, the authors compared the gene expression pattern in positive clones with control. To confirm the gene expression profile, semi-quantitative RT-PCR was carried out for 4 of the randomly picked differentially expressed genes. For those differentially expressed genes, classification was performed according to their function and cellular component. Human EMP-1 gene can be stably expressed in EC9706 cell line transfected with human EMP-1. The authors found the cell growth decreased, among which S phase was arrested and G1 phase was prolonged in the transfected positive clones. By cDNA microarray analysis, 35 genes showed an over 2.0 fold change in expression level after transfection, with 28 genes being consistently up-regulated and 7 genes being down-regulated. Among the classified genes, almost half of the induced genes (13 out of 28 genes) were related to cell signaling, cell communication and particularly to adhesion. Overexpression of human EMP-1 gene can inhibit the proliferation of EC9706 cell with S phase arrested and G1 phase prolonged. The cDNA microarray analysis suggested that EMP-1 may be one of regulators involved in cell signaling, cell communication and adhesion regulators.
Yamamura, Yoshimi; Sahin, F Pinar; Nagatsu, Akito; Mizukami, Hajime
2003-04-01
A cDNA (LEPS-2) encoding a novel cell wall protein was cloned from shikonin-producing callus tissues of Lithospermum erythrorhizon by differential display between a shikonin-producing culture strain and a non-producing strain. The LEPS-2 cDNA encoded a polypeptide of 184 amino acids. The deduced amino acid sequence exhibited no significant homology with known proteins. Expression of LEPS-2 gene as well as accumulation of LEPS-2 protein was highly correlated with shikonin production in L. erythrorhizon cells in culture. In the intact plant, expression of LEPS-2 was detected only in the roots where shikonin pigments accumulated. Cell fractionation experiments and immunocytochemical analysis showed that the protein was localized in the apoplast fraction of the cell walls. The shikonin pigments were also stored on the cell walls as oil droplets. These results indicate that expression of the LEPS-2 is closely linked with shikonin biosynthesis and the LEPS-2 protein may be involved in the intra-cell wall trapping of shikonin pigments.
NASA Astrophysics Data System (ADS)
Liu, Jiao; Li, Xianchao; Tang, Xuexi; Zhou, Bin
2016-03-01
Members of the DnaJ family are proteins that play a pivotal role in various cellular processes, such as protein folding, protein transport and cellular responses to stress. In the present study, we identified and characterized the full-length DnaJ cDNA sequence from expressed sequence tags of Pyropia yezoensis ( PyDnaJ) via rapid identification of cDNA ends. This cDNA encoded a protein of 429 amino acids, which shared high sequence similarity with other identified DnaJ proteins, such as a heat shock protein 40/DnaJ from Pyropia haitanensis. The relative mRNA expression level of PyDnaJ was investigated using real-time PCR to determine its specific expression during the algal life cycle and during desiccation. The relative mRNA expression level in sporophytes was higher than that in gametophytes and significantly increased during the whole desiccation process. These results indicate that PyDnaJ is an authentic member of the DnaJ family in plants and red algae and might play a pivotal role in mitigating damage to P. yezoensis during desiccation.
Characterization and expression of the calpastatin gene in Cyprinus carpio.
Chen, W X; Ma, Y
2015-07-03
Calpastatin, an important protein used to regulate meat quality traits in animals, is encoded by the CAST gene. The aim of the present study was to clone the cDNA sequence of the CAST gene and detect the expression of CAST in the tissues of Cyprinus carpio. The cDNA of the C. carpio CAST gene, amplified using rapid amplification of cDNA ends PCR, is 2834 bp in length (accession No. JX275386), contains a 2634-bp open reading frame, and encodes a protein with 877 amino acid residues. The amino acid sequence of the C. carpio CAST gene was 88, 80, and 59% identical to the sequences observed in grass carp, zebrafish, and other fish, respectively. The C. carpio CAST was observed to contain four conserved domains with 54 serine phosphorylation loci, 28 threonine phosphorylation loci, 1 tyrosine phosphorylation loci, and 6 specific protein kinase C phosphorylation loci. The CAST gene showed widespread expression in different tissues of C. carpio. Surprisingly, the relative expression of the CAST transcript in the muscle and heart tissues of C. carpio was significantly higher than in other tissues (P < 0.01).
Cross-referencing yeast genetics and mammalian genomes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hieter, P.; Basset, D.; Boguski, M.
1994-09-01
We have initiated a project that will systematically transfer information about yeast genes onto the genetic maps of mice and human beings. Rapidly expanding human EST data will serve as a source of candidate human homologs that will be repeatedly searched using yeast protein sequence queries. Search results will be automatically reported to participating labs. Human cDNA sequences from which the ESTs are derived will be mapped at high resolution in the human and mouse genomes. The comparative mapping information cross-references the genomic position of novel human cDNAs with functional information known about the cognate yeast genes. This should facilitatemore » the initial identification of genes responsible for mammalian mutant phenotypes, including human disease. In addition, the identification of mammalian homologs of yeast genes provides reagents for determining evolutionary conservation and for performing direct experiments in multicellular eukaryotes to enhance study of the yeast protein`s function. For example, ESTs homologous to CDC27 and CDC16 were identified, and the corresponding cDNA clones were obtained from ATTC, completely sequenced, and mapped on human and mouse chromosomes. In addition, the CDC17hs cDNA has been used to raise antisera to the CDC27Hs protein and used in subcellular localization experiments and junctional studies in mammalian cells. We have received funding from the National Center for Human Genome Research to provide a community resource which will establish comprehensive cross-referencing among yeast, human, and mouse loci. The project is set up as a service and information on how to communicate with this effort will be provided.« less
BIGEL analysis of gene expression in HL60 cells exposed to X rays or 60 Hz magnetic fields
NASA Technical Reports Server (NTRS)
Balcer-Kubiczek, E. K.; Zhang, X. F.; Han, L. H.; Harrison, G. H.; Davis, C. C.; Zhou, X. J.; Ioffe, V.; McCready, W. A.; Abraham, J. M.; Meltzer, S. J.
1998-01-01
We screened a panel of 1,920 randomly selected cDNAs to discover genes that are differentially expressed in HL60 cells exposed to 60 Hz magnetic fields (2 mT) or X rays (5 Gy) compared to unexposed cells. Identification of these clones was accomplished using our two-gel cDNA library screening method (BIGEL). Eighteen cDNAs differentially expressed in X-irradiated compared to control HL60 cells were recovered from a panel of 1,920 clones. Differential expression in experimental compared to control cells was confirmed independently by Northern blotting of paired total RNA samples hybridized to each of the 18 clone-specific cDNA probes. DNA sequencing revealed that 15 of the 18 cDNA clones produced matches with the database for genes related to cell growth, protein synthesis, energy metabolism, oxidative stress or apoptosis (including MYC, neuroleukin, copper zinc-dependent superoxide dismutase, TC4 RAS-like protein, peptide elongation factor 1alpha, BNIP3, GATA3, NF45, cytochrome c oxidase II and triosephosphate isomerase mRNAs). In contrast, BIGEL analysis of the same 1,920 cDNAs revealed no differences greater than 1.5-fold in expression levels in magnetic-field compared to sham-exposed cells. Magnetic-field-exposed and control samples were analyzed further for the presence of mRNA encoding X-ray-responsive genes by hybridization of the 18 specific cDNA probes to RNA from exposed and control HL60 cells. Our results suggest that differential gene expression is induced in approximately 1% of a random pool of cDNAs by ionizing radiation but not by 60 Hz magnetic fields under the present experimental conditions.
An annotated genetic map of loblolly pine based on microsatellite and cDNA markers
Craig S. Echt; Surya Saha; Konstantin V. Krutovsky; Kokulapalan Wimalanathan; John E. Erpelding; Chun Liang; C Dana Nelson
2011-01-01
Previous loblolly pine (Pinus taeda L.) genetic linkage maps have been based on a variety of DNA polymorphisms, such as AFLPs, RAPDs, RFLPs, and ESTPs, but only a few SSRs (simple sequence repeats), also known as simple tandem repeats or microsatellites, have been mapped in P. taeda. The objective of this study was to integrate a large set of SSR markers from a variety...
Wang, Jian-Hua; Chen, Shi-Shu
2002-07-01
To clone gastric adenocarcinoma metastasis related genes, RF-1 cell line (primary tumor of a gastric adenocarcinoma patient ) and RF-48 cell line (its metastatic counterpart) were used as a model for studying the molecular mechanism of tumor metastasis. Two fluorescent cDNA probes, labeled with Cy3 and Cy5 dyes, were prepared from RF-1 and RF-48 mRNA samples by reverse transcription method. The two color probes were then mixed and hybridized to the cDNA chip constructed by double-dots of 4 096 human genes, and scanned at two wavelengths. The experiment was repeated for 2 times. Differential expression genes from the above two cells were analyzed using the computer. 138 in all genes (3.4%) revealed differential expression in RF-48 cells compared with RF-1 cells: 81(2.1%) genes revealed apparent up-regulation, and 56(1.3%) genes revealed down-regulation. 45 genes involved in gastric adenocarcinoma metastasis were cloned using fluorescent differential display-PCR (FDD-PCR), including 3 novel genes. There were 7 differential expression genes that agreed with each other in two detection methods. The possible roles of some differential expressed genes, which maybe involved in the mechanism of tumor metastasis, were discussed. cDNA chip was used to analyze gene expression in a high-throughput and large scale manner, in combination with FDD-PCR for cloning unknown novel genes. In conclusion, some genes related to metastasis were preliminarily scanned, which would contribute to disclose the molecular mechanism of gastric adenocarcinoma metastasis.
Simon, J W; Slabas, A R
1998-09-18
The GenBank database was searched using the E. coli malonyl CoA:ACP transacylase (MCAT) sequence, for plant protein/cDNA sequences corresponding to MCAT, a component of plant fatty acid synthetase (FAS), for which the plant cDNA has not been isolated. A 272-bp Zea mays EST sequence (GenBank accession number: AA030706) was identified which has strong homology to the E. coli MCAT. A PCR derived cDNA probe from Zea mays was used to screen a Brassica napus (rape) cDNA library. This resulted in the isolation of a 1200-bp cDNA clone which encodes an open reading frame corresponding to a protein of 351 amino acids. The protein shows 47% homology to the E. coli MCAT amino acid sequence in the coding region for the mature protein. Expression of a plasmid (pMCATrap2) containing the plant cDNA sequence in Fab D89, an E. coli mutant, in MCAT activity restores growth demonstrating functional complementation and direct function of the cloned cDNA. This is the first functional evidence supporting the identification of a plant cDNA for MCAT.
Liu, G; Gelboin, H V; Myers, M J
1991-02-01
The role of P450 IA2 in the hydroxylation of acetanilide was examined using an inhibitory monoclonal antibody (MAb) 1-7-1 and vaccinia cDNA expression producing murine P450 IA1 (mIA1), murine P450 IA2 (mIA2), or human P450 IA2 (hIA2). Acetanilide hydroxylase (AcOH) activity was measured using an HPLC method with more than 500-fold greater sensitivity than previously described procedures. This method, which does not require the use of radioactive acetanilide, was achieved by optimizing both the gradient system and the amount of enzyme needed to achieve detection by uv light. MAb 1-7-1 inhibits up to 80% of the AcOH activity in both rat liver microsomes and cDNA expressed mouse and human P450 IA2. MAb 1-7-1, which recognizes both P450 IA1 and P450 IA2, completely inhibits the aryl hydrocarbon hydroxylase (AHH) activity of cDNA expressed in IA1. The inhibition of only 80% of the AHH activity present in MC liver microsomes by MAb 1-7-1 suggests that additional P450 forms are contributing to the overall AHH activity present in methylcholanthrene (MC)-liver microsomes as MAb 1-7-1 almost completely inhibits the AHH activity of expressed mIA1. Maximal inhibition of IA2 by 1-7-1 results in an 80% decrease in acetanilide hydroxylase activity in both liver microsomes and expressed mouse and human IA2. The capacity of MAb 1-7-1 to produce identical levels of inhibition of acetanilide hydroxylase activity in rat MC microsomes (80%) and in expressed mouse (81%) and human P450 IA2 (80%) strongly suggests that P450 IA2 is the major and perhaps the only enzyme responsible for the metabolism of acetanilide. These results demonstrate the complementary utility of monoclonal antibodies and cDNA expression for defining the contribution of specific P450 enzymes to the metabolism of a given substrate. This complementary approach allows for a more precise determination of the inhibitory capacity of MAb with respect to the metabolic capacity of the target P450.
A pilot study of gene expression analysis in workers with hand-arm vibration syndrome.
Maeda, Setsuo; Yu, Xiaozhong; Wang, Rui-Sheng; Sakakibara, Hisataka
2008-04-01
The purpose of this pilot study was to examine differences in gene expressions by cDNA microarray analysis of hand-arm vibration syndrome (HAVS) patients. Vein blood samples were collected and total RNA was extracted. All blood samples were obtained in the morning in one visit after a standard light breakfast. We performed microarray analysis with the labeled cDNA prepared by reverse transcription from RNA samples, using the Human CHIP version 1 (DNA Chip Research Inc, Yokohama, Japan). There are 2,976 genes on the chip, and these genes were selected from a cDNA library prepared with human peripheral white blood cells (WBC). Different gene levels between the HAVS patients and controls, and between groups of HAVS with different levels of symptoms, were indicated by the randomized variance model. The most up-regulated genes were analyzed for their possible functions and association with the occurrence of HAVS. From the results of this pilot study, although the results were obtained a limited number of subjects, it would appear that cDNA microarray analysis of HAVS patients has potential as a new objective method of HAVS diagnosis. Further research is needed to examine the gene expression with increased numbers of patients at different stages of HAVS.
Peterbauer, T; Mucha, J; Mayer, U; Popp, M; Glössl, J; Richter, A
1999-12-01
Stachyose is the major soluble carbohydrate in seeds of a number of important crop species. It is synthesized from raffinose and galactinol by the action of stachyose synthase (EC 2.4.1.67). We report here on the identification of a cDNA encoding stachyose synthase from seeds of adzuki bean (Vigna angularis Ohwi et Ohashi). Based on internal amino acid sequences of the enzyme purified from adzuki bean, oligonucleotides were designed and used to amplify corresponding sequences from adzuki bean cDNA by RT-PCR, followed by rapid amplification of cDNA ends (RACE-PCR). The complete cDNA sequence comprised 3046 nucleotides and included an open reading frame which encoded a polypeptide of 857 amino acid residues. The entire coding region was amplified by PCR, engineered into the baculovirus expression vector pVL1393 and introduced into Spodoptera frugiperda (Sf21) insect cells for heterologous expression. The recombinant protein was immunologically reactive with polyclonal antibodies raised against stachyose synthase purified from adzuki bean and was shown to be a functional stachyose synthase with the same catalytic properties as its native counterpart. High levels of stachyose synthase mRNA were transiently accumulated midway through seed development, and the enzyme was also present in mature seeds and during germination.
Wang, Ning; Kinoshita, Shigeharu; Nomura, Naoko; Riho, Chihiro; Maeyama, Kaoru; Nagai, Kiyohito; Watabe, Shugo
2012-04-01
Recent researches revealed the regional preference of biomineralization gene transcription in the pearl oyster Pinctada fucata: it transcribed mainly the genes responsible for nacre secretion in mantle pallial, whereas the ones regulating calcite shells expressed in mantle edge. This study took use of this character and constructed the forward and reverse suppression subtractive hybridization (SSH) cDNA libraries. A total of 669 cDNA clones were sequenced and 360 expressed sequence tags (ESTs) greater than 100 bp were generated. Functional annotation associated 95 ESTs with specific functions, and 79 among them were identified from P. fucata at the first time. In the forward SSH cDNA library, it recognized mass amount of nacre protein genes, biomineralization genes dominantly expressed in the mantle pallial, calcium-ion-binding genes, and other biomineralization-related genes important for pearl formation. Real-time PCR showed that all the examined genes were distributed in oyster mantle tissues with a consistence to the SSH design. The detection of their RNA transcripts in pearl sac confirmed that the identified genes were certainly involved in pearl formation. Therefore, the data from this work will initiate a new round of pearl formation gene study and shed new insights into molluscan biomineralization.
Xu, De-Quan; Zhang, Yi-Bing; Xiong, Yuan-Zhu; Gui, Jian-Fang; Jiang, Si-Wen; Su, Yu-Hong
2003-07-01
Using suppression subtractive hybridization (SSH) technique, forward and reverse subtracted cDNA libraries were constructed between Longissimus muscles from Meishan and Landrace pigs. A housekeeping gene, G3PDH, was used to estimate the efficiency of subtractive cDNA. In two cDNA libraries, G3PDH was subtracted very efficiently at appropriate 2(10) and 2(5) folds, respectively, indicating that some differentially expressed genes were also enriched at the same folds and the two subtractive cDNA libraries were very successful. A total of 709 and 673 positive clones were isolated from forward and reverse subtracted cDNA libraries, respectively. Analysis of PCR showed that most of all plasmids in the clones contained 150-750 bp inserts. The construction of subtractive cDNA libraries between muscle tissue from different pig breeds laid solid foundations for isolating and identifying the genes determining muscle growth and meat quality, which will be important to understand the mechanism of muscle growth, determination of meat quality and practice of molecular breeding.
Hu, Lin-Yong; Cui, Chen-Chen; Song, Yu-Jie; Wang, Xiang-Guo; Jin, Ya-Ping; Wang, Ai-Hua; Zhang, Yong
2012-07-01
cDNA is widely used in gene function elucidation and/or transgenics research but often suitable tissues or cells from which to isolate mRNA for reverse transcription are unavailable. Here, an alternative method for cDNA cloning is described and tested by cloning the cDNA of human LALBA (human alpha-lactalbumin) from genomic DNA. First, genomic DNA containing all of the coding exons was cloned from human peripheral blood and inserted into a eukaryotic expression vector. Next, by delivering the plasmids into either 293T or fibroblast cells, surrogate cells were constructed. Finally, the total RNA was extracted from the surrogate cells and cDNA was obtained by RT-PCR. The human LALBA cDNA that was obtained was compared with the corresponding mRNA published in GenBank. The comparison showed that the two sequences were identical. The novel method for cDNA cloning from surrogate eukaryotic cells described here uses well-established techniques that are feasible and simple to use. We anticipate that this alternative method will have widespread applications.
Wu, Fang; Yan, Ming; Li, Yikun; Chang, Shaojie; Song, Xiaomin; Zhou, Zhaocai; Gong, Weimin
2003-12-19
SPE-16 is a new 16kDa protein that has been purified from the seeds of Pachyrrhizus erosus. It's N-terminal amino acid sequence shows significant sequence homology to pathogenesis-related class 10 proteins. cDNA encoding 150 amino acids was cloned by RT-PCR and the gene sequence proved SPE-16 to be a new member of PR-10 family. The cDNA was cloned into pET15b plasmid and expressed in Escherichia coli. The bacterially expressed SPE-16 also demonstrated ribonuclease-like activity in vitro. Site-directed mutation of three conserved amino acids E95A, E147A, Y150A, and a P-loop truncated form were constructed and their different effects on ribonuclease activities were observed. SPE-16 is also able to bind the fluorescent probe 8-anilino-1-naphthalenesulfonate (ANS) in the native state. The ANS anion is a much-utilized "hydrophobic probe" for proteins. This binding activity indicated another biological function of SPE-16.
Subtraction of cap-trapped full-length cDNA libraries to select rare transcripts.
Hirozane-Kishikawa, Tomoko; Shiraki, Toshiyuki; Waki, Kazunori; Nakamura, Mari; Arakawa, Takahiro; Kawai, Jun; Fagiolini, Michela; Hensch, Takao K; Hayashizaki, Yoshihide; Carninci, Piero
2003-09-01
The normalization and subtraction of highly expressed cDNAs from relatively large tissues before cloning dramatically enhanced the gene discovery by sequencing for the mouse full-length cDNA encyclopedia, but these methods have not been suitable for limited RNA materials. To normalize and subtract full-length cDNA libraries derived from limited quantities of total RNA, here we report a method to subtract plasmid libraries excised from size-unbiased amplified lambda phage cDNA libraries that avoids heavily biasing steps such as PCR and plasmid library amplification. The proportion of full-length cDNAs and the gene discovery rate are high, and library diversity can be validated by in silico randomization.
Eberwine, James; Bartfai, Tamas
2011-03-01
We report on an 'unbiased' molecular characterization of individual, adult neurons, active in a central, anterior hypothalamic neuronal circuit, by establishing cDNA libraries from each individual, electrophysiologically identified warm sensitive neuron (WSN). The cDNA libraries were analyzed by Affymetrix microarray. The presence and frequency of cDNAs were confirmed and enhanced with Illumina sequencing of each single cell cDNA library. cDNAs encoding the GABA biosynthetic enzyme Gad1 and of adrenomedullin, galanin, prodynorphin, somatostatin, and tachykinin were found in the WSNs. The functional cellular and in vivo studies on dozens of the more than 500 neurotransmitters, hormone receptors and ion channels, whose cDNA was identified and sequence confirmed, suggest little or no discrepancy between the transcriptional and functional data in WSNs; whenever agonists were available for a receptor whose cDNA was identified, a functional response was found. Sequencing single neuron libraries permitted identification of rarely expressed receptors like the insulin receptor, adiponectin receptor 2 and of receptor heterodimers; information that is lost when pooling cells leads to dilution of signals and mixing signals. Despite the common electrophysiological phenotype and uniform Gad1 expression, WSN transcriptomes show heterogeneity, suggesting strong epigenetic influence on the transcriptome. Our study suggests that it is well-worth interrogating the cDNA libraries of single neurons by sequencing and chipping. Copyright © 2010 Elsevier Inc. All rights reserved.
Pereira, Clifford T; Herndon, David N; Rocker, Roland; Jeschke, Marc G
2007-05-15
Growth factors affect the complex cascade of wound healing; however, interaction between different growth factors during dermal and epidermal regeneration are still not entirely defined. In the present study, we thought to determine the interaction between keratinocyte growth factor (KGF) administered as liposomal cDNA with other dermal and epidermal growth factors and collagen synthesis in an acute wound. Rats received an acute wound and were divided into two groups to receive weekly subcutaneous injections of liposomes plus the Lac-Z gene (0.22 microg, vehicle), or liposomes plus the KGF cDNA (2.2 microg) and Lac-Z gene (0.22 microg). Histological and immunohistochemical techniques were used to determine growth factor, collagen expression, and dermal and epidermal structure. KGF cDNA increased insulin-like growth factor-I (IGF-I), insulin-like growth factor binding protein-3 (IGFBP-3), and fibroblast growth factor (FGF), decreased transforming growth factor-beta (TGF-beta), while it had no effect on platelet-derived growth factor (PDGF) levels in the wound. KGF cDNA significantly increased collagen Type IV at both the wound edge as well as the wound bed, while it had no effect on collagen Type I and III. KGF cDNA increased re-epithelialization, improved dermal regeneration, and increased neovascularization. Exogenous administered KGF cDNA causes increases in IGF-I, IGF-BP3, FGF, and collagen IV and decreases TGF-beta concentration. KGF gene transfer accelerates wound healing without causing an increase in collagen I or III.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zelinka, L.; McCann, S.; Budde, J.
2011-08-05
Highlights: {yields} Affinity purification of the autoimmune rippling muscle disease immunogenic domain of titin. {yields} Partial sequence analysis confirms that the peptides is in the I band region of titin. {yields} This region of the human titin shows high degree of homology to mouse titin N2-A. -- Abstract: Autoimmune rippling muscle disease (ARMD) is an autoimmune neuromuscular disease associated with myasthenia gravis (MG). Past studies in our laboratory recognized a very high molecular weight skeletal muscle protein antigen identified by ARMD patient antisera as the titin isoform. These past studies used antisera from ARMD and MG patients as probes tomore » screen a human skeletal muscle cDNA library and several pBluescript clones revealed supporting expression of immunoreactive peptides. This study characterizes the products of subcloning the titin immunoreactive domain into pGEX-3X and the subsequent fusion protein. Sequence analysis of the fusion gene indicates the cloned titin domain (GenBank ID: (EU428784)) is in frame and is derived from a sequence of N2-A spanning the exons 248-250 an area that encodes the fibronectin III domain. PCR and EcoR1 restriction mapping studies have demonstrated that the inserted cDNA is of a size that is predicted by bioinformatics analysis of the subclone. Expression of the fusion protein result in the isolation of a polypeptide of 52 kDa consistent with the predicted inferred amino acid sequence. Immunoblot experiments of the fusion protein, using rippling muscle/myasthenia gravis antisera, demonstrate that only the titin domain is immunoreactive.« less
Chinnakkannu, Panneerselvam; Samanna, Venkatesababa; Cheng, Guangmao; Ablonczy, Zsolt; Baicu, Catalin F; Bethard, Jennifer R; Menick, Donald R; Kuppuswamy, Dhandapani; Cooper, George
2010-07-09
In severe pressure overload-induced cardiac hypertrophy, a dense, stabilized microtubule network forms that interferes with cardiocyte contraction and microtubule-based transport. This is associated with persistent transcriptional up-regulation of cardiac alpha- and beta-tubulin and microtubule-stabilizing microtubule-associated protein 4 (MAP4). There is also extensive microtubule decoration by MAP4, suggesting greater MAP4 affinity for microtubules. Because the major determinant of this affinity is site-specific MAP4 dephosphorylation, we characterized this in hypertrophied myocardium and then assessed the functional significance of each dephosphorylation site found by mimicking it in normal cardiocytes. We first isolated MAP4 from normal and pressure overload-hypertrophied feline myocardium; volume-overloaded myocardium, which has an equal degree and duration of hypertrophy but normal functional and cytoskeletal properties, served as a control for any nonspecific growth-related effects. After cloning cDNA-encoding feline MAP4 and obtaining its deduced amino acid sequence, we characterized by mass spectrometry any site-specific MAP4 dephosphorylation. Solely in pressure overload-hypertrophied myocardium, we identified striking MAP4 dephosphorylation at Ser-472 in the MAP4 N-terminal projection domain and at Ser-924 and Ser-1056 in the assembly-promoting region of the C-terminal microtubule-binding domain. Site-directed mutagenesis of MAP4 cDNA was then used to switch each serine to non-phosphorylatable alanine. Wild-type and mutated cDNAs were used to construct adenoviruses; microtubule network density, stability, and MAP4 decoration were assessed in normal cardiocytes following an equivalent level of MAP4 expression. The Ser-924 --> Ala MAP4 mutant produced a microtubule phenotype indistinguishable from that seen in pressure overload hypertrophy, such that Ser-924 MAP4 dephosphorylation during pressure overload hypertrophy may be central to this cytoskeletal abnormality.
Molecular cloning of cDNAs for the nerve-cell specific phosphoprotein, synapsin I.
Kilimann, M W; DeGennaro, L J
1985-01-01
To provide access to synapsin I-specific DNA sequences, we have constructed cDNA clones complementary to synapsin I mRNA isolated from rat brain. Synapsin I mRNA was specifically enriched by immunoadsorption of polysomes prepared from the brains of 10-14 day old rats. Employing this enriched mRNA, a cDNA library was constructed in pBR322 and screened by differential colony hybridization with single-stranded cDNA probes made from synapsin I mRNA and total polysomal poly(A)+ RNA. This screening procedure proved to be highly selective. Five independent recombinant plasmids which exhibited distinctly stronger hybridization with the synapsin I probe were characterized further by restriction mapping. All of the cDNA inserts gave restriction enzyme digestion patterns which could be aligned. In addition, some of the cDNA inserts were shown to contain poly(dA) sequences. Final identification of synapsin I cDNA clones relied on the ability of the cDNA inserts to hybridize specifically to synapsin I mRNA. Several plasmids were tested by positive hybridization selection. They specifically selected synapsin I mRNA which was identified by in vitro translation and immunoprecipitation of the translation products. The established cDNA clones were used for a blot-hybridization analysis of synapsin I mRNA. A fragment (1600 bases) from the longest cDNA clone hybridized with two discrete RNA species 5800 and 4500 bases long, in polyadenylated RNA from rat brain and PC12 cells. No hybridization was detected to RNA from rat liver, skeletal muscle or cardiac muscle. Images Fig. 1. Fig. 2. Fig. 4. Fig. 5. PMID:3933975
Nicosia, Aldo; Maggio, Teresa; Mazzola, Salvatore; Cuttitta, Angela
2013-10-30
Anemonia viridis is a widespread and extensively studied Mediterranean species of sea anemone from which a large number of polypeptide toxins, such as blood depressing substances (BDS) peptides, have been isolated. The first members of this class, BDS-1 and BDS-2, are polypeptides belonging to the β-defensin fold family and were initially described for their antihypertensive and antiviral activities. BDS-1 and BDS-2 are 43 amino acid peptides characterised by three disulfide bonds that act as neurotoxins affecting Kv3.1, Kv3.2 and Kv3.4 channel gating kinetics. In addition, BDS-1 inactivates the Nav1.7 and Nav1.3 channels. The development of a large dataset of A. viridis expressed sequence tags (ESTs) and the identification of 13 putative BDS-like cDNA sequences has attracted interest, especially as scientific and diagnostic tools. A comparison of BDS cDNA sequences showed that the untranslated regions are more conserved than the protein-coding regions. Moreover, the KA/KS ratios calculated for all pairwise comparisons showed values greater than 1, suggesting mechanisms of accelerated evolution. The structures of the BDS homologs were predicted by molecular modelling. All toxins possess similar 3D structures that consist of a triple-stranded antiparallel β-sheet and an additional small antiparallel β-sheet located downstream of the cleavage/maturation site; however, the orientation of the triple-stranded β-sheet appears to differ among the toxins. To characterise the spatial expression profile of the putative BDS cDNA sequences, tissue-specific cDNA libraries, enriched for BDS transcripts, were constructed. In addition, the proper amplification of ectodermal or endodermal markers ensured the tissue specificity of each library. Sequencing randomly selected clones from each library revealed ectodermal-specific expression of ten BDS transcripts, while transcripts of BDS-8, BDS-13, BDS-14 and BDS-15 failed to be retrieved, likely due to under-representation in our cDNA libraries. The calculation of the relative abundance of BDS transcripts in the cDNA libraries revealed that BDS-1, BDS-3, BDS-4, BDS-5 and BDS-6 are the most represented transcripts.
Takahashi, C; Akiyama, N; Matsuzaki, T; Takai, S; Kitayama, H; Noda, M
1996-05-16
A cDNA (termed CT124) encoding a carboxyl-terminal fragment of the human homeobox protein MSX-2 was found to induce flat reversion when expressed in v-Ki-ras-transformed NIH3T3 cells. Although the expression of endogenous MSX-2 gene is low in most of the normal adult tissues examined, it is frequently activated in carcinoma-derived cell lines. Likewise, the gene is inactive in NIH3T3 cells but is transcriptionally activated after transformation by v-Ki-ras oncogene, suggesting that the intact MSX-2 may play a positive, rather than suppressive, role in cell transformation. To test this possibility, we isolated a near full-length human MSX-2 cDNA and tested its activities in two cell systems, i.e. fibroblast and myoblast. In NIH3T3 fibroblasts, although the gene by itself failed to confer a transformed phenotype, antisense MSX-2 cDNA as well as truncated CT124 cDNA interfered with the transforming activities of v-Ki-ras oncogene. In C2C12 myoblasts, MSX-2 was found to suppress MyoD gene expression, as do activated ras oncogenes, under certain culture conditions, and CT124 was found to inhibit the activities of both MSX-2 and ras in this system as well. Our findings not only suggest that CT124 may act as a dominant suppressor of MSX-2 but also raise the possibility that MSX-2 gene may be an important downstream target for the Ras signaling pathways.
Identification of drought-responsive genes in roots of upland rice (Oryza sativa L)
Rabello, Aline R; Guimarães, Cléber M; Rangel, Paulo HN; da Silva, Felipe R; Seixas, Daniela; de Souza, Emanuel; Brasileiro, Ana CM; Spehar, Carlos R; Ferreira, Márcio E; Mehta, Ângela
2008-01-01
Background Rice (Oryza sativa L.) germplasm represents an extraordinary source of genes that control traits of agronomic importance such as drought tolerance. This diversity is the basis for the development of new cultivars better adapted to water restriction conditions, in particular for upland rice, which is grown under rainfall. The analyses of subtractive cDNA libraries and differential protein expression of drought tolerant and susceptible genotypes can contribute to the understanding of the genetic control of water use efficiency in rice. Results Two subtractive libraries were constructed using cDNA of drought susceptible and tolerant genotypes submitted to stress against cDNA of well-watered plants. In silico analysis revealed 463 reads, which were grouped into 282 clusters. Several genes expressed exclusively in the tolerant or susceptible genotypes were identified. Additionally, proteome analysis of roots from stressed plants was performed and 22 proteins putatively associated to drought tolerance were identified by mass spectrometry. Conclusion Several genes and proteins involved in drought-response, as well as genes with no described homologs were identified. Genes exclusively expressed in the tolerant genotype were, in general, related to maintenance of turgor and cell integrity. In contrast, in the susceptible genotype, expression of genes involved in protection against cell damage was not detected. Several protein families identified in the proteomic analysis were not detected in the cDNA analysis. There is an indication that the mechanisms of susceptibility to drought in upland rice are similar to those of lowland varieties. PMID:18922162
NASA Technical Reports Server (NTRS)
Balcer-Kubiczek, E. K.; Meltzer, S. J.; Han, L. H.; Zhang, X. F.; Shi, Z. M.; Harrison, G. H.; Abraham, J. M.
1997-01-01
A novel polymerase chain reaction (PCR)-based method was used to identify candidate genes whose expression is altered in cancer cells by ionizing radiation. Transcriptional induction of randomly selected genes in control versus irradiated human HL60 cells was compared. Among several complementary DNA (cDNA) clones recovered by this approach, one cDNA clone (CL68-5) was downregulated in X-irradiated HL60 cells but unaffected by 12-O-tetradecanoyl phorbol-13-acetate, forskolin, or cyclosporin-A. DNA sequencing of the CL68-5 cDNA revealed 100% nucleotide sequence homology to the reported human Csa-19 gene. Northern blot analysis of RNA from control and irradiated cells revealed the expression of a single 0.7-kilobase (kb) messenger RNA (mRNA) transcript. This 0.7-kb Csa-19 mRNA transcript was also expressed in a variety of human adult and corresponding fetal normal tissues. Moreover, when the effect of X- or fission neutron-irradiation on Csa-19 mRNA was compared in cultured human cells differing in p53 gene status (p53-/- versus p53+/+), downregulation of Csa-19 by X-rays or fission neutrons was similar in p53-wild type and p53-null cell lines. Our results provide the first known example of a radiation-responsive gene in human cancer cells whose expression is not associated with p53, adenylate cyclase or protein kinase C.
Bhattachary, R; Bukkapatnam, R; Prawoko, I; Soto, J; Morgan, M; Salup, R R
2002-05-01
Despite early diagnosis and improved therapy, 31,500 men will die from prostate cancer (PC) this year. The HER2/neu oncoprotein is an important effector of cell growth found in the majority of high-grade prostatic tumors and is capable of rendering immunogenicity. The antigenicity of this oncoprotein might prove useful in the development of PC vaccines. Our goal is to prove the principle that a single DNA vaccine can provide reliable immunity against PC in the MatLyLu (MLL) translational tumor model. The parental rat MatLyLu PC cell line expresses low to moderate levels of the rat neu protein. To simulate in vivo human PC, MatLyLu cells were transfected with a truncated sequence of human HER2/neu cDNA cloned into the pCI-neo vector. This HER2/neu cDNA sequence encodes the first 433 amino acids of the extracellular domain (ECD). MatLyLu cells were also transfected with the same HER2/neu cDNA sequence cloned into the N1-terminal sequence of EGFP reporter gene to produce a fusion protein. The partial ECD sequence of HER2/neu includes five rat major histocompatibility (MHC)-II-restricted peptides with complete human-to-rat cross-species homology. The HER2/neu protein overexpression was documented by Western Blot analysis, and the expression of fusion protein was monitored by confocal microscopy and fluorimetry. Vaccination with a single injection of HER2/neu cDNA protected 50% of animals against HER2/neu-MatLyLu tumors (P < 0.01). When the tumor cells were engineered to express HER2/neu-EGFP fusion protein, the antitumor immunity was enhanced, as following vaccination with HER2/neu-EGFP cDNA, 80% of these rats rejected HER2/neu-EGFP-MatLyLu (P<0.001). Both vaccines induced HER2/neu-specific antibody titers. Rats vaccinated with EGFP-cDNA rejected 80% of EGFP-MatLyLu tumors and, interestingly, 40% of HER2/neu-MatLyLu tumors. None of the cDNA vaccines induced immunity against parental MatLyLu cells. Our data clearly demonstrate that a single injection of HER2/neu-EGFP cDNA is a very effective vaccine against PC tumors expressing the cognate tumor-associated antigen (TA). The antitumor immunity is significantly more pronounced if the tumors express xenogeneic HER2/neu-EGFP fusion protein as opposed to only the syngeneic HER2/neu oncoprotein. Our data suggests that the HER2/neu-EGFP-MatLyLu tumor is a potential animal tumor model for investigating therapeutic vaccine strategies against PC in vivo and demonstrates the limitations of a cDNA vaccine only encoding for MHC-II-restricted HER2/neu-ECD sequence peptides.
Cirelli, C; Tononi, G
1999-06-01
The consequences of sleep and sleep deprivation at the molecular level are largely unexplored. Knowledge of such molecular events is essential to understand the restorative processes occurring during sleep as well as the cellular mechanisms of sleep regulation. Here we review the available data about changes in neural gene expression across different behavioural states using candidate gene approaches such as in situ hybridization and immunocytochemistry. We then describe new techniques for systematic screening of gene expression in the brain, such as subtractive hybridization, mRNA differential display, and cDNA microarray technology, outlining advantages and disadvantages of these methods. Finally, we summarize our initial results of a systematic screening of gene expression in the rat brain across behavioural states using mRNA differential display and cDNA microarray technology. The expression pattern of approximately 7000 genes was analysed in the cerebral cortex of rats after 3 h of spontaneous sleep, 3 h of spontaneous waking, or 3 h of sleep deprivation. While the majority of transcripts were expressed at the same level among these three conditions, 14 mRNAs were modulated by sleep and waking. Six transcripts, four more expressed in waking and two more expressed in sleep, corresponded to novel genes. The eight known transcripts were all expressed at higher levels in waking than in sleep and included transcription factors and mitochondrial genes. A possible role for these known transcripts in mediating neural plasticity during waking is discussed.
Azumi, Kaoru; Usami, Takeshi; Kamimura, Akiko; Sabau, Sorin V; Miki, Yasufumi; Fujie, Manabu; Jung, Sung-Ju; Kitamura, Shin-Ichi; Suzuki, Satoru; Yokosawa, Hideyoshi
2007-12-01
A serious disease of the ascidian Halocynthia roretzi has been spread extensively among Korean aquaculture sites. To reveal the cause of the disease and establish a monitoring system for it, we constructed a cDNA microarray spotted with 2,688 cDNAs derived from H. roretzi hemocyte cDNA libraries to detect genes differentially expressed in hemocytes between diseased and non-diseased ascidians. We detected 21 genes showing increased expression and 16 genes showing decreased expression in hemocytes from diseased ascidians compared with those from non-diseased ascidians. RT-PCR analyses confirmed that the expression levels of genes encoding astacin, lysozyme, ribosomal protein PO, and ubiquitin-ribosomal protein L40e fusion protein were increased in hemocytes from diseased ascidians, while those of genes encoding HSP40, HSP70, fibronectin, carboxypeptidase and lactate dehydrogenase were decreased. These genes were expressed not only in hemocytes but also in various other tissues in ascidians. Furthermore, the expression of glutathione-S transferase omega, which is known to be up-regulated in H. roretzi hemocytes during inflammatory responses, was strongly increased in hemocytes from diseased ascidians. These gene expression profiles suggest that immune and inflammatory reactions occur in the hemocytes of diseased ascidians. These genes will be good markers for detecting and monitoring this disease of ascidians in Korean aquaculture sites.
Sakai, Shinya; Mantani, Naoki; Kogure, Toshiaki; Ochiai, Hiroshi; Shimada, Yutaka; Terasawa, Katsutoshi
2002-12-01
Influenza virus is a worldwide health problem with significant economic consequences. To study the gene expression pattern induced by influenza virus infection, it is useful to reveal the pathogenesis of influenza virus infection; but this has not been well examined, especially in vivo study. To assess the influence of influenza virus infection on gene expression in mice, mRNA levels in the lung and tracheal tissue 48 h after infection were investigated by cDNA array analysis. Four-week-old outbred, specific pathogen free strain, ICR female mice were infected by intra-nasal inoculation of a virus solution under ether anesthesia. The mice were sacrificed 48 h after infection and the tracheas and lungs were removed. To determine gene expression, the membrane-based microtechnique with an Atlas cDNA expression array (mouse 1.2 array II) was performed in accordance with the manual provided. We focused on the expression of 46 mRNAs for cell surface antigens. Of these 46 mRNAs that we examined, four (CD1d2 antigen, CD39 antigen-like 1, CD39 antigen-like 3, CD68 antigen) were up-regulated and one (CD36 antigen) was down-regulated. Although further studies are required, these data suggest that these molecules play an important role in influenza virus infection, especially the phase before specific immunity.
Ning, ZhongHua; Hincke, Maxwell T.; Yang, Ning; Hou, ZhuoCheng
2014-01-01
Efficiently obtaining full-length cDNA for a target gene is the key step for functional studies and probing genetic variations. However, almost all sequenced domestic animal genomes are not ‘finished’. Many functionally important genes are located in these gapped regions. It can be difficult to obtain full-length cDNA for which only partial amino acid/EST sequences exist. In this study we report a general pipeline to obtain full-length cDNA, and illustrate this approach for one important gene (Ovocleidin-17, OC-17) that is associated with chicken eggshell biomineralization. Chicken OC-17 is one of the best candidates to control and regulate the deposition of calcium carbonate in the calcified eggshell layer. OC-17 protein has been purified, sequenced, and has had its three-dimensional structure solved. However, researchers still cannot conduct OC-17 mRNA related studies because the mRNA sequence is unknown and the gene is absent from the current chicken genome. We used RNA-Seq to obtain the entire transcriptome of the adult hen uterus, and then conducted de novo transcriptome assembling with bioinformatics analysis to obtain candidate OC-17 transcripts. Based on this sequence, we used RACE and PCR cloning methods to successfully obtain the full-length OC-17 cDNA. Temporal and spatial OC-17 mRNA expression analyses were also performed to demonstrate that OC-17 is predominantly expressed in the adult hen uterus during the laying cycle and barely at immature developmental stages. Differential uterine expression of OC-17 was observed in hens laying eggs with weak versus strong eggshell, confirming its important role in the regulation of eggshell mineralization and providing a new tool for genetic selection for eggshell quality parameters. This study is the first one to report the full-length OC-17 cDNA sequence, and builds a foundation for OC-17 mRNA related studies. We provide a general method for biologists experiencing difficulty in obtaining candidate gene full-length cDNA sequences. PMID:24676480
Zhang, Quan; Liu, Long; Zhu, Feng; Ning, ZhongHua; Hincke, Maxwell T; Yang, Ning; Hou, ZhuoCheng
2014-01-01
Efficiently obtaining full-length cDNA for a target gene is the key step for functional studies and probing genetic variations. However, almost all sequenced domestic animal genomes are not 'finished'. Many functionally important genes are located in these gapped regions. It can be difficult to obtain full-length cDNA for which only partial amino acid/EST sequences exist. In this study we report a general pipeline to obtain full-length cDNA, and illustrate this approach for one important gene (Ovocleidin-17, OC-17) that is associated with chicken eggshell biomineralization. Chicken OC-17 is one of the best candidates to control and regulate the deposition of calcium carbonate in the calcified eggshell layer. OC-17 protein has been purified, sequenced, and has had its three-dimensional structure solved. However, researchers still cannot conduct OC-17 mRNA related studies because the mRNA sequence is unknown and the gene is absent from the current chicken genome. We used RNA-Seq to obtain the entire transcriptome of the adult hen uterus, and then conducted de novo transcriptome assembling with bioinformatics analysis to obtain candidate OC-17 transcripts. Based on this sequence, we used RACE and PCR cloning methods to successfully obtain the full-length OC-17 cDNA. Temporal and spatial OC-17 mRNA expression analyses were also performed to demonstrate that OC-17 is predominantly expressed in the adult hen uterus during the laying cycle and barely at immature developmental stages. Differential uterine expression of OC-17 was observed in hens laying eggs with weak versus strong eggshell, confirming its important role in the regulation of eggshell mineralization and providing a new tool for genetic selection for eggshell quality parameters. This study is the first one to report the full-length OC-17 cDNA sequence, and builds a foundation for OC-17 mRNA related studies. We provide a general method for biologists experiencing difficulty in obtaining candidate gene full-length cDNA sequences.
Molecular Cloning and Sequencing of Channel Catfish, Ictalurus punctatus, Cathepsin H and L cDNA
USDA-ARS?s Scientific Manuscript database
Cathepsin H and L, a lysosomal cysteine endopeptidase of the papain family, are ubiquitously expressed and involve in antigen processing. In this communication, the channel catfish cathepsin H and L transcripts were sequenced and analyzed. Total RNA from tissues was extracted and cDNA libraries we...
Promoter-Based Theranostics for Prostate Cancer
2016-06-01
diagnosis vector consists of the tumor-specific PEG-promoter (PEG-Prom) and cDNA of human chorionic gonadotropin β chain (βhCG) as a reporter. We...transfection efficiency. We also used CpG-free cDNA of Figure 5. pCpGfree-PEGwt-HSV1-tk-neo vector expressed functional thymidine kinase in human
A cDNA clone highly expressed in ripe banana fruit shows homology to pectate lyases.
Dominguez-Puigjaner, E; LLop, I; Vendrell, M; Prat, S
1997-07-01
A cDNA clone (Ban17), encoding a protein homologous to pectate lyase, has been isolated from a cDNA library from climacteric banana fruit by means of differential screening. Northern analysis showed that Ban17 mRNA is first detected in early climacteric fruit, reaches a steady-state maximum at the climacteric peak, and declines thereafter in overripe fruit. Accumulation of the Ban17 transcript can be induced in green banana fruit by exogenous application of ethylene. The demonstrates that expression of this gene is under hormonal control, its induction being regulated by the rapid increase in ethylene production at the onset of ripening. The deduced amino acid sequence derived from the Ban17 cDNA shares significant identity with pectate lyases from pollen and plant pathogenic bacteria of the genus Erwinia. Similarity to bacterial pectate lyases that were proven to break down the pectic substances of the plant cell wall suggest that Ban17 might play a role in the loss of mesocarp firmness during fruit ripening.
Salinas, Alejandro; Vega, Marcela; Lienqueo, María Elena; Garcia, Alejandro; Carmona, Rene; Salazar, Oriana
2011-12-10
Total cDNA isolated from cellulolytic fungi cultured in cellulose was examined for the presence of sequences encoding for endoglucanases. Novel sequences encoding for glycoside hydrolases (GHs) were identified in Fusarium oxysporum, Ganoderma applanatum and Trametes versicolor. The cDNA encoding for partial sequences of GH family 61 cellulases from F. oxysporum and G. applanatum shares 58 and 68% identity with endoglucanases from Glomerella graminicola and Laccaria bicolor, respectively. A new GH family 5 endoglucanase from T. versicolor was also identified. The cDNA encoding for the mature protein was completely sequenced. This enzyme shares 96% identity with Trametes hirsuta endoglucanase and 22% with Trichoderma reesei endoglucanase II (EGII). The enzyme, named TvEG, has N-terminal family 1 carbohydrate binding module (CBM1). The full length cDNA was cloned into the pPICZαB vector and expressed as an active, extracellular enzyme in the methylotrophic yeast Pichia pastoris. Preliminary studies suggest that T. versicolor could be useful for lignocellulose degradation. Copyright © 2011 Elsevier Inc. All rights reserved.
Taft, A S; Vermeire, J J; Bernier, J; Birkeland, S R; Cipriano, M J; Papa, A R; McArthur, A G; Yoshino, T P
2009-04-01
Infection of the snail, Biomphalaria glabrata, by the free-swimming miracidial stage of the human blood fluke, Schistosoma mansoni, and its subsequent development to the parasitic sporocyst stage is critical to establishment of viable infections and continued human transmission. We performed a genome-wide expression analysis of the S. mansoni miracidia and developing sporocyst using Long Serial Analysis of Gene Expression (LongSAGE). Five cDNA libraries were constructed from miracidia and in vitro cultured 6- and 20-day-old sporocysts maintained in sporocyst medium (SM) or in SM conditioned by previous cultivation with cells of the B. glabrata embryonic (Bge) cell line. We generated 21 440 SAGE tags and mapped 13 381 to the S. mansoni gene predictions (v4.0e) either by estimating theoretical 3' UTR lengths or using existing 3' EST sequence data. Overall, 432 transcripts were found to be differentially expressed amongst all 5 libraries. In total, 172 tags were differentially expressed between miracidia and 6-day conditioned sporocysts and 152 were differentially expressed between miracidia and 6-day unconditioned sporocysts. In addition, 53 and 45 tags, respectively, were differentially expressed in 6-day and 20-day cultured sporocysts, due to the effects of exposure to Bge cell-conditioned medium.
Construction of a cDNA library for miniature pig mandibular deciduous molars
2014-01-01
Background The miniature pig provides an excellent experimental model for tooth morphogenesis because its diphyodont and heterodont dentition resembles that of humans. However, little information is available on the process of tooth development or the exact molecular mechanisms controlling tooth development in miniature pigs or humans. Thus, the analysis of gene expression related to each stage of tooth development is very important. Results In our study, after serial sections were made, the development of the crown of the miniature pigs’ mandibular deciduous molar could be divided into five main phases: dental lamina stage (E33-E35), bud stage (E35-E40), cap stage (E40-E50), early bell stage (E50-E60), and late bell stage (E60-E65). Total RNA was isolated from the tooth germ of miniature pig embryos at E35, E45, E50, and E60, and a cDNA library was constructed. Then, we identified cDNA sequences on a large scale screen for cDNA profiles in the developing mandibular deciduous molars (E35, E45, E50, and E60) of miniature pigs using Illumina Solexa deep sequencing. Microarray assay was used to detect the expression of genes. Lastly, through Unigene sequence analysis and cDNA expression pattern analysis at E45 and E60, we found that 12 up-regulated and 15 down-regulated genes during the four periods are highly conserved genes homologous with known Homo sapiens genes. Furthermore, there were 6 down-regulated and 2 up-regulated genes in the miniature pig that were highly homologous to Homo sapiens genes compared with those in the mouse. Conclusion Our results not only identify the specific transcriptome and cDNA profile in developing mandibular deciduous molars of the miniature pig, but also provide useful information for investigating the molecular mechanism of tooth development in the miniature pig. PMID:24750690
Yang, XinChao; Li, MengHui; Liu, JianHua; Ji, YiHong; Li, XiangRui; Xu, LiXin; Yan, RuoFeng; Song, XiaoKai
2017-02-16
Eimeria maxima is one of the most prevalent Eimeria species causing avian coccidiosis, and results in huge economic loss to the global poultry industry. Current control strategies, such as anti-coccidial medication and live vaccines have been limited because of their drawbacks. The third generation anticoccidial vaccines including the recombinant vaccines as well as DNA vaccines have been suggested as a promising alternative strategy. To date, only a few protective antigens of E. maxima have been reported. Hence, there is an urgent need to identify novel protective antigens of E. maxima for the development of neotype anticoccidial vaccines. With the aim of identifying novel protective genes of E. maxima, a cDNA expression library of E. maxima sporozoites was constructed using Gateway technology. Subsequently, the cDNA expression library was divided into 15 sub-libraries for cDNA expression library immunization (cDELI) using parasite challenged model in chickens. Protective sub-libraries were selected for the next round of screening until individual protective clones were obtained, which were further sequenced and analyzed. Adopting the Gateway technology, a high-quality entry library was constructed, containing 9.2 × 10 6 clones with an average inserted fragments length of 1.63 kb. The expression library capacity was 2.32 × 10 7 colony-forming units (cfu) with an average inserted fragments length of 1.64 Kb. The expression library was screened using parasite challenged model in chickens. The screening yielded 6 immune protective genes including four novel protective genes of EmJS-1, EmRP, EmHP-1 and EmHP-2, and two known protective genes of EmSAG and EmCKRS. EmJS-1 is the selR domain-containing protein of E. maxima whose function is unknown. EmHP-1 and EmHP-2 are the hypothetical proteins of E. maxima. EmRP and EmSAG are rhomboid-like protein and surface antigen glycoproteins of E. maxima respectively, and involved in invasion of the parasite. Our results provide a cDNA expression library for further screening of T cell stimulating or inhibiting antigens of E. maxima. Moreover, our results provide six candidate protective antigens for developing new vaccines against E. maxima.
Human mRNA polyadenylate binding protein: evolutionary conservation of a nucleic acid binding motif.
Grange, T; de Sa, C M; Oddos, J; Pictet, R
1987-01-01
We have isolated a full length cDNA (cDNA) coding for the human poly(A) binding protein. The cDNA derived 73 kd basic translation product has the same Mr, isoelectric point and peptidic map as the poly(A) binding protein. DNA sequence analysis reveals a 70,244 dalton protein. The N terminal part, highly homologous to the yeast poly(A) binding protein, is sufficient for poly(A) binding activity. This domain consists of a four-fold repeated unit of approximately 80 amino acids present in other nucleic acid binding proteins. In the C terminal part there is, as in the yeast protein, a sequence of approximately 150 amino acids, rich in proline, alanine and glutamine which together account for 48% of the residues. A 2,9 kb mRNA corresponding to this cDNA has been detected in several vertebrate cell types and in Drosophila melanogaster at every developmental stage including oogenesis. Images PMID:2885805
Expression profiling suggests a regulatory role of gallbladder in lipid homeostasis
Yuan, Zuo-Biao; Han, Tian-Quan; Jiang, Zhao-Yan; Fei, Jian; Zhang, Yi; Qin, Jian; Tian, Zhi-Jie; Shang, Jun; Jiang, Zhi-Hong; Cai, Xing-Xing; Jiang, Yu; Zhang, Sheng-Dao; Jin, Gang
2005-01-01
AIM: To examine expression profile of gallbladder using microarray and to investigate the role of gallbladder in lipid homeostasis. METHODS: 33P-labelled cDNA derived from total RNA of gallbladder tissue was hybridized to a cDNA array representing 17000 cDNA clusters. Genes with intensities ≥2 and variation <0.33 between two samples were considered as positive signals with subtraction of background chosen from an area where no cDNA was spotted. The average gray level of two gallbladders was adopted to analyze its bioinformatics. Identified target genes were confirmed by touch-down polymerase chain reaction and sequencing. RESULTS: A total of 11 047 genes expressed in normal gallbladder, which was more than that predicted by another author, and the first 10 genes highly expressed (high gray level in hybridization image), e.g., ARPC5 (2225.88±90.46), LOC55972 (2220.32±446.51) and SLC20A2 (1865.21±98.02), were related to the function of smooth muscle contraction and material transport. Meanwhile, 149 lipid-related genes were expressed in the gallbladder, 89 of which were first identified (with gray level in hybridization image), e.g., FASN (11.42±2.62), APOD (92.61±8.90) and CYP21A2 (246.11±42.36), and they were involved in each step of lipid metabolism pathway. In addition, 19 of those 149 genes were gallstone candidate susceptibility genes (with gray level in hybridization image), e.g., HMGCR (10.98±0.31), NPC1 (34.88±12.12) and NR1H4 (16.8±0.65), which were previously thought to be expressed in the liver and/or intestine tissue only. CONCLUSION: Gallbladder expresses 11 047 genes and takes part in lipid homeostasis. PMID:15810076
Zhu, Shengming; Wang, Yanping; Zheng, Hong; Cheng, Jingqiu; Lu, Yanrong; Zeng, Yangzhi; Wang, Yu; Wang, Zhu
2009-04-01
This study sought to clone Chinese Banna minipig inbred-line (BMI) alpha1,3-galactosyltransferase (alpha1,3-GT) gene and construct its recombinant eukaryotic expression vector. Total RNA was isolated from BMI liver. Full length cDNA of alpha1,3-GT gene was amplified by RT-PCR and cloned into pMD18-T vector to sequence. Subsequently, alpha1,3-GT gene was inserted into pEGFP-N1 to construct eukaryotic expression vector pEGFP-N1-GT. Then the reconstructed plasmid pEGFP-N1-GT was transiently transfected into human lung cancer cell line A549. The expression of alpha1,3-GT mRNA in transfected cells was detected by RT-PCR. FITC-BS-IB4 lectin was used in the direct immunofluorescence method, which was performed to observe the alpha-Gal synthesis function of BMI alpha1,3-GT in transfected cells. The results showed that full length of BMI alpha1,3-GT cDNA was 1116 bp. BMI alpha1,3-GT cDNA sequence was highly homogenous with those of mouse and bovine, and was exactly the same as the complete sequence of those of swine, pEGFP-N1-GT was confirmed by enzyme digestion and PCR. The expression of alpha1,3-GT mRNA was detected in A549 cells transfected by pEGFP-N1-GT. The expression of alpha-Gal was observed on the membrane of A549 cells transfected by pEGFP-N1-GT. Successful cloning of BMI alpha1,3-GT cDNA and construction of its eukaryotic expression vector have established a foundation for further research and application of BMI alpha1,3-GT in the fields of xenotransplantation and immunological therapy of cancer.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Potier, M.C.; Dutriaux, A.; Lambolez, B.
1993-03-01
Ionotropic L-glutamate receptors form transmembrane channels permeant to cations which are involved in synaptic transmission. Nine different subunits coding for non-NMDA (N-methyl-D-aspartate) receptors have been cloned and sequenced in rat. One of them, the GluR5 subunit, has a high affinity binding site for kainate and is expressed in neurons of the developing and adult nervous system. The permeability of the GluR5 receptor channel is modulated by edition of the transcripts. In human, GluR1 and GluR2 cDNAs have been sequenced and mapped to chromosomes 5 and 4, respectively. Also, GluR3 and GluR4 genes have been mapped to chromosome X and 11,more » respectively. Screening of the YAC chromosome 21 library was performed by colony hybridization on nylon Hybond-N filters at high stringency, as previously described, with the pore located in the center of the rat cDNA. Two positive colonies were obtained and analyzed for their YAC content by PFGE and Southern blotting. Only one (HY128) contained a 450-kb YAC hybridizing to the central rat cDNA probe as well as to the 5[prime] and 3[prime] end probes. Since GluR5 and GluR6 are highly homologous in rat, a probe in the 3[prime] untranslated region of GluR6, showing low homology to GluR5, was synthetized by PCR. Sequences and positions of the PCR primers on the rat sequence (9) are from 5[prime] to 3[prime]: CGACAGAAGGTTGCCAGGT (sense, position 2690-2708)/GATGTTCTGCCTTCAGTTCCAC (antisense, 3314-3335). HY128 YAC did not hybridize to the GluR6 probe (data not shown). Southern blot of human genomic DNA and yeast DNA from HY128 clone cut with EcoRI and HindIII showed the same bands of more than 10 and 6.6 kb, respectively, when hybridized to the 3[prime] end rat cDNA probe (data not shown). This last result confirms the presence of human GluR5 gene in HY128.« less
Wu, Zhencai; Burns, Jacqueline K
2004-07-01
beta-galactosidases have been detected in a wide range of plants and are characterized by their ability to hydrolyse terminal non-reducing beta-D-galactosyl residues from beta-D-galactosides. These enzymes have been detected in a wide range of plant organs and tissues. In a search for differentially expressed genes during the abscission process in citrus, sequences encoding beta-galactosidase were identified. Three cDNA fragments of a beta-galactosidase gene were isolated from a cDNA subtraction library constructed from mature fruit abscission zones 48 h after the application of a mature fruit-specific abscission agent, 5-chloro-3-methyl-4-nitro-1H-pyrazole (CMN-pyrazole). Based on sequence information derived from these fragments, a full-length cDNA of 2847 nucleotides (GenBank accession number AY029198) encoding beta-galactosidase was isolated from mature fruit abscission zones by 5'- and 3'-RACE approaches. The beta-galactosidase cDNA encoded a protein of 737 amino acid residues with a calculated molecular weight of 82 kDa. The deduced protein was highly homologous to plant beta-galactosidases expressed in fruit ripening. Southern blot analysis demonstrated that at least two closely related beta-galactosidase genes were present in 'Valencia' orange. Temporal expression patterns in mature fruit abscission zones indicated beta-galactosidase mRNA was detected 48 h after treatment of CMN-pyrazole and ethephon in mature fruit abscission zones. beta-galactosidase transcripts were detected in leaf abscission zones only after ethephon application. The citrus beta-galactosidase was expressed in stamens and petals of fully opened flowers and young fruitlets. The results suggest that this beta-galactosidase may play a role during abscission as well as early growth and development processes in flowers and fruitlets.
Zhou, Rongqiong; Xia, Qingyou; Huang, Hancheng; Lai, Min; Wang, Zhenxin
2011-10-01
Toxocara canis is a widespread intestinal nematode parasite of dogs, which can also cause disease in humans. We employed an expressed sequence tag (EST) strategy in order to study gene-expression including development, digestion and reproduction of T. canis. ESTs provided a rapid way to identify genes, particularly in organisms for which we have very little molecular information. In this study, a cDNA library was constructed from a female adult of T. canis and 215 high-quality ESTs from 5'-ends of the cDNA clones representing 79 unigenes were obtained. The titer of the primary cDNA library was 1.83×10(6)pfu/mL with a recombination rate of 99.33%. Most of the sequences ranged from 300 to 900bp with an average length of 656bp. Cluster analysis of these ESTs allowed identification of 79 unique sequences containing 28 contigs and 51 singletons. BLASTX searches revealed that 18 unigenes (22.78% of the total) or 70 ESTs (32.56% of the total) were novel genes that had no significant matches to any protein sequences in the public databases. The rest of the 61 unigenes (77.22% of the total) or 145 ESTs (67.44% of the total) were closely matched to the known genes or sequences deposited in the public databases. These genes were classified into seven groups based on their known or putative biological functions. We also confirmed the gene expression patterns of several immune-related genes using RT-PCR examination. This work will provide a valuable resource for the further investigations in the stage-, sex- and tissue-specific gene transcription or expression. Copyright © 2011. Published by Elsevier Inc.
Molecular cloning and characterization of SoxB2 gene from Zhikong scallop Chlamys farreri
NASA Astrophysics Data System (ADS)
He, Yan; Bao, Zhenmin; Guo, Huihui; Zhang, Yueyue; Zhang, Lingling; Wang, Shi; Hu, Jingjie; Hu, Xiaoli
2013-11-01
The Sox proteins play critical roles during the development of animals, including sex determination and central nervous system development. In this study, the SoxB2 gene was cloned from a mollusk, the Zhikong scallop ( Chlamys farreri), and characterized with respect to phylogeny and tissue distribution. The full-length cDNA and genomic DNA sequences of C. farreri SoxB2 ( Cf SoxB2) were obtained by rapid amplification of cDNA ends and genome walking, respectively, using a partial cDNA fragment from the highly conserved DNA-binding domain, i.e., the High Mobility Group (HMG) box. The full-length cDNA sequence of Cf SoxB2 was 2 048 bp and encoded 268 amino acids protein. The genomic sequence was 5 551 bp in length with only one exon. Several conserved elements, such as the TATA-box, GC-box, CAAT-box, GATA-box, and Sox/sry-sex/testis-determining and related HMG box factors, were found in the promoter region. Furthermore, real-time quantitative reverse transcription PCR assays were carried out to assess the mRNA expression of Cf SoxB 2 in different tissues. SoxB2 was highly expressed in the mantle, moderately in the digestive gland and gill, and weakly expressed in the gonad, kidney and adductor muscle. In male and female gonads at different developmental stages of reproduction, the expression levels of Cf SoxB2 were similar. Considering the specific expression and roles of SoxB 2 in other animals, in particular vertebrates, and the fact that there are many pallial nerves in the mantle, cerebral ganglia in the digestive gland and gill nerves in gill, we propose a possible essential role in nervous tissue function for Sox B 2 in C. farreri.
Cloning and expression analysis of a HSP70 gene from Pacific abalone (Haliotis discus hannai).
Cheng, Peizhou; Liu, Xiao; Zhang, Guofan; He, Jianguo
2007-01-01
Heat shock protein 70 (HSP70), the primary member of HSPs that are responsive of thermal stress, is found in all multicellular organisms and functions mostly as molecular chaperon. The inducible HSP70 cDNA cloned from Pacific abalone (Haliotis discus hannai) using rapid amplification of cDNA ends (RACE), was highly homologous to other HSP70 genes. The full-length cDNA of the Pacific abalone HSP70 was 2631bp, consisting of a 5'-terminal untranslated region (UTR) of 90bp, a 3'-terminal UTR of 573bp with a canonical polyadenylation signal sequence AATAAA and a poly (A) tail, and an open reading frame of 1968bp. The HSP70 cDNA encoded a polypeptide of 655 amino acids with an ATPase domain of 382 amino acids, the substrate peptide binding domain of 161 amino acids and a C-terminus domain of 112 amino acids. The temporal expression of HSP70 was measured by semi-quantitative RT-PCR after heat shock and bacterial challenge. Challenge of Pacific abalone with heat shock or the pathogenic bacteria Vibrio anguillarum resulted in a dramatic increase in the expression of HSP70 mRNA level in muscle, followed by a recovery to normal level after 96h. Unlike the muscle, the levels of HSP70 expression in gills reached the top at 12h and maintained a relatively high level compared with the control after thermal and bacterial challenge. The upregulated mRNA expression of HSP70 in the abalone following heat shock and infection response indicates that the HSP70 gene is inducible and involved in immune response.
RICD: a rice indica cDNA database resource for rice functional genomics.
Lu, Tingting; Huang, Xuehui; Zhu, Chuanrang; Huang, Tao; Zhao, Qiang; Xie, Kabing; Xiong, Lizhong; Zhang, Qifa; Han, Bin
2008-11-26
The Oryza sativa L. indica subspecies is the most widely cultivated rice. During the last few years, we have collected over 20,000 putative full-length cDNAs and over 40,000 ESTs isolated from various cDNA libraries of two indica varieties Guangluai 4 and Minghui 63. A database of the rice indica cDNAs was therefore built to provide a comprehensive web data source for searching and retrieving the indica cDNA clones. Rice Indica cDNA Database (RICD) is an online MySQL-PHP driven database with a user-friendly web interface. It allows investigators to query the cDNA clones by keyword, genome position, nucleotide or protein sequence, and putative function. It also provides a series of information, including sequences, protein domain annotations, similarity search results, SNPs and InDels information, and hyperlinks to gene annotation in both The Rice Annotation Project Database (RAP-DB) and The TIGR Rice Genome Annotation Resource, expression atlas in RiceGE and variation report in Gramene of each cDNA. The online rice indica cDNA database provides cDNA resource with comprehensive information to researchers for functional analysis of indica subspecies and for comparative genomics. The RICD database is available through our website http://www.ncgr.ac.cn/ricd.
Identification of genes differentially expressed in association with acquired cisplatin resistance
Johnsson, A; Zeelenberg, I; Min, Y; Hilinski, J; Berry, C; Howell, S B; Los, G
2000-01-01
The goal of this study was to identify genes whose mRNA levels are differentially expressed in human cells with acquired cisplatin (cDDP) resistance. Using the parental UMSCC10b head and neck carcinoma cell line and the 5.9-fold cDDP-resistant subline, UMSCC10b/Pt-S15, two suppressive subtraction hybridization (SSH) cDNA libraries were prepared. One library represented mRNAs whose levels were increased in the cDDP resistant variant (the UP library), the other one represented mRNAs whose levels were decreased in the resistant cells (the DOWN library). Arrays constructed with inserts recovered from these libraries were hybridized with SSH products to identify truly differentially expressed elements. A total of 51 cDNA fragments present in the UP library and 16 in the DOWN library met the criteria established for differential expression. The sequences of 87% of these cDNA fragments were identified in Genbank. Among the mRNAs in the UP library that were frequently isolated and that showed high levels of differential expression were cytochrome oxidase I, ribosomal protein 28S, elongation factor 1α, α-enolase, stathmin, and HSP70. The approach taken in this study permitted identification of many genes never before linked to the cDDP-resistant phenotype. © 2000 Cancer Research Campaign PMID:10993653
Dobmeyer, J M; Rexin, M; Dobmeyer, T S; Klein, S A; Rossol, R; Feussner, G
1998-06-22
A simple method of obtaining semiquantitative and reliable data on apolipoprotein (apo) sigma gene expression is described. We detected apo sigma specific sequences by reverse transcription (rT)-PCR. For quantitative measurement, an apo sigma DNA standard was produced allowing the development of a competitive PCR-method. The efficiency of RNA extraction and cDNA synthesis was controlled by quantitation of a housekeeping gene (glyceraldehyde-3-phosphatedehydrogenase, G3PDH) in separate reactions. To imitate a defined induction of apo sigma gene expression, serial twofold dilutions of total RNA were reversely transcribed and the respective cDNAs used to perform a competitive apo sigma and G3PDH PCR. The change in apo sigma cDNA and G3PDH cDNA was 1.7-2.3-fold with an expected value of 2.0-fold. Standard deviations in three independently performed experiments were within a range of < 15% of the mean, indicating low intra-assay variation and high reproducibility. To illustrate this method, apo sigma gene expression was measured in a patient with complete lack of functional active apo E in comparison to healthy controls. The method presented here might be valuable in assessment of apo sigma gene expression in human disease.
Freije, J M; Díez-Itza, I; Balbín, M; Sánchez, L M; Blasco, R; Tolivia, J; López-Otín, C
1994-06-17
A cDNA coding for a new human matrix metalloproteinase (MMP) has been cloned from a cDNA library derived from a breast tumor. The isolated cDNA contains an open reading frame coding for a polypeptide of 471 amino acids. The predicted protein sequence displays extensive similarity to the previously known MMPs and presents all the structural features characteristic of the members of this protein family, including the well conserved PRCGXPD motif, involved in the latency of the enzyme and the zinc-binding domain (HEXGHXXXXXHS). In addition, this novel human MMP contains in its amino acid sequence several residues specific to the collagenase subfamily (Tyr-214, Asp-235, and Gly-237) and lacks the 9-residue insertion present in the stromelysins. According to these structural characteristics, the MMP described herein has been tentatively called collagenase-3, since it represents the third member of this subfamily, composed at present of fibroblast and neutrophil collagenases. The collagenase-3 cDNA was expressed in a vaccinia virus system, and the recombinant protein was able to degrade fibrillar collagens, providing support to the hypothesis that the isolated cDNA codes for an authentic collagenase. Northern blot analysis of RNA from normal and pathological tissues demonstrated the existence in breast tumors of three different mRNA species, which seem to be the result of the utilization of different polyadenylation sites present in the 3'-noncoding region of the gene. By contrast, no collagenase-3 mRNA was detected either by Northern blot or RNA polymerase chain reaction analysis with RNA from other human tissues, including normal breast, mammary fibroadenomas, liver, placenta, ovary, uterus, prostate, and parotid gland. On the basis of the increased expression of collagenase-3 in breast carcinomas and the absence of detectable expression in normal tissues, a possible role for this metalloproteinase in the tumoral process is proposed.
Zhang, Chun-Rong; Yang, Quan; Chen, Hu-Biao; Pang, Yu-Xin; Tang, Xiao-Min; Cheng, Xuan-Xuan; Wu, Wen-Ya; Chen, Shi-Min
2012-11-01
The rhizome of Alpinia officinarum is a widely used Chinese herbal medicine. The essential oil in A. officinarum rhizome is mainly composed of 1, 8-cineole and other monoterpenes, as the major bioactive ingredients. In plants, monoterpenes are synthesized through the methylerythritol phosphate (MEP) pathway in the plastids, and 1-deoxy-D-xylulose 5-phosphate reductoisomerase (DXR) is an enzyme catalyzing a committed step of the MEP pathway. In the present study, the full-length cDNA encoding DXR was cloned from the rhizome of A. officinarum, using homology-based RT-PCR and rapid amplification of cDNA ends (RACE) techniques. The new cDNA was designated as AoDXR and submitted to GenBank to be assigned with an accession number HQ874658. The full-length cDNA of AoDXR was 1 670 bp containing a 1 419 bp open reading frame encoding a polypeptide of 472 amino acids with a calculated molecular mass of 51.48 kDa and an isoelectric point of 6.15. Bioinformatic analyses revealed that AoDXR showed extensive homology with DXRs from other plant species and contained a conserved plastids transit peptide, a Pro-rich region and two highly conserved NADPH-binding motifs in its N-terminal region characterized by all plant DXRs. The phylogenetic analysis revealed that AoDXR belonged to angiosperm DXRs. The structural modeling of AoDXR showed that AoDXR had the typical V-shaped structure of DXR proteins. The tissue expression pattern analysis indicated that AoDXR expressed strongly in leaves, weak in rhizomes of A. officinarum. Exogenous methyl jasmonate (MeJA) could enhance the expression of AoDXR and the production of 1, 8-cineole in A. officinarum rhizomes. The cloning and characterization of AoDXR will be helpful to reveal the molecular regulation mechanism of monoterpene biosynthesis in A. officinarum and provides a candidate gene for metabolic engineering in improving the medicinal quality of A. officinarum rhizome.
Blair, Matthew W; Hurtado, Natalia; Chavarro, Carolina M; Muñoz-Torres, Monica C; Giraldo, Martha C; Pedraza, Fabio; Tomkins, Jeff; Wing, Rod
2011-03-22
Sequencing of cDNA libraries for the development of expressed sequence tags (ESTs) as well as for the discovery of simple sequence repeats (SSRs) has been a common method of developing microsatellites or SSR-based markers. In this research, our objective was to further sequence and develop common bean microsatellites from leaf and root cDNA libraries derived from the Andean gene pool accession G19833 and the Mesoamerican gene pool accession DOR364, mapping parents of a commonly used reference map. The root libraries were made from high and low phosphorus treated plants. A total of 3,123 EST sequences from leaf and root cDNA libraries were screened and used for direct simple sequence repeat discovery. From these EST sequences we found 184 microsatellites; the majority containing tri-nucleotide motifs, many of which were GC rich (ACC, AGC and AGG in particular). Di-nucleotide motif microsatellites were about half as common as the tri-nucleotide motif microsatellites but most of these were AGn microsatellites with a moderate number of ATn microsatellites in root ESTs followed by few ACn and no GCn microsatellites. Out of the 184 new SSR loci, 120 new microsatellite markers were developed in the BMc (Bean Microsatellites from cDNAs) series and these were evaluated for their capacity to distinguish bean diversity in a germplasm panel of 18 genotypes. We developed a database with images of the microsatellites and their polymorphism information content (PIC), which averaged 0.310 for polymorphic markers. The present study produced information about microsatellite frequency in root and leaf tissues of two important genotypes for common bean genomics: namely G19833, the Andean genotype selected for whole genome shotgun sequencing from race Peru, and DOR364 a race Mesoamerica subgroup 2 genotype that is a small-red seeded, released variety in Central America. Both race Peru and Mesoamerica subgroup 2 (small red beans) have been understudied in comparison to race Nueva Granada and Mesoamerica subgroup 1 (black beans) both with regards to gene expression and as sources of markers. However, we found few differences between SSR type and frequency between the G19833 leaf and DOR364 root tissue-derived ESTs. Overall, our work adds to the analysis of microsatellite frequency evaluation for common bean and provides a new set of 120 BMc markers which combined with the 248 previously developed BMc markers brings the total in this series to 368 markers. Once we include BMd markers, which are derived from GenBank sequences, the current total of gene-based markers from our laboratory surpasses 500 markers. These markers are basic for studies of the transcriptome of common bean and can form anchor points for genetic mapping studies in the future.
Reddy, B A; Kloc, M; Etkin, L D
1992-12-01
We have cloned a cDNA (xlan4) from a Xenopus laevis oocyte cDNA library whose cognate mRNA is localized in the animal pole region of full grown oocytes. The cDNA can be translated in vitro to produce a predicted size protein of 35 kDa and, is also expressed in E. coli as a fusion protein. The conceptual protein encoded by the xlan4 cDNA is 17.5% proline rich and possesses several PEST sequences found in proteins with short half-lives. The xlan4 mRNA is 2.6 kb and during early development its titer decreases until the neurula stage after which it begins to reaccumulate. Northern blots on dissected embryos and in situ hybridization revealed that the zygotic expression is limited to the dorsal axial structures consisting primarily of the CNS. UV irradiation of the vegetal pole region immediately following fertilization that produces ventralized embryos results in a loss of zygotic xlan4 expression. In the adult, xlan4 mRNA is limited primarily to the brain. The presence of this mRNA in animal pole region which contributes to the future neural cell lineages suggests that this gene product may function either in the specification of neural cell types or in a neural specific function.
Walker, M D; Park, C W; Rosen, A; Aronheim, A
1990-01-01
Cell specific expression of the insulin gene is achieved through transcriptional mechanisms operating on multiple DNA sequence elements located in the 5' flanking region of the gene. Of particular importance in the rat insulin I gene are two closely similar 9 bp sequences (IEB1 and IEB2): mutation of either of these leads to 5-10 fold reduction in transcriptional activity. We have screened an expression cDNA library derived from mouse pancreatic endocrine beta cells with a radioactive DNA probe containing multiple copies of the IEB1 sequence. A cDNA clone (A1) isolated by this procedure encodes a protein which shows efficient binding to the IEB1 probe, but much weaker binding to either an unrelated DNA probe or to a probe bearing a single base pair insertion within the recognition sequence. DNA sequence analysis indicates a protein belonging to the helix-loop-helix family of DNA-binding proteins. The ability of the protein encoded by clone A1 to recognize a number of wild type and mutant DNA sequences correlates closely with the ability of each sequence element to support transcription in vivo in the context of the insulin 5' flanking DNA. We conclude that the isolated cDNA may encode a transcription factor that participates in control of insulin gene expression. Images PMID:2181401
Fabrication of high quality cDNA microarray using a small amount of cDNA.
Park, Chan Hee; Jeong, Ha Jin; Jung, Jae Jun; Lee, Gui Yeon; Kim, Sang-Chul; Kim, Tae Soo; Yang, Sang Hwa; Chung, Hyun Cheol; Rha, Sun Young
2004-05-01
DNA microarray technology has become an essential part of biological research. It enables the genome-scale analysis of gene expression in various types of model systems. Manufacturing high quality cDNA microarrays of microdeposition type depends on some key factors including a printing device, spotting pins, glass slides, spotting solution, and humidity during spotting. UsingEthe Microgrid II TAS model printing device, this study defined the optimal conditions for producing high density, high quality cDNA microarrays with the least amount of cDNA product. It was observed that aminosilane-modified slides were superior to other types of surface modified-slides. A humidity of 30+/-3% in a closed environment and the overnight drying of the spotted slides gave the best conditions for arraying. In addition, the cDNA dissolved in 30% DMSO gave the optimal conditions for spotting compared to the 1X ArrayIt, 3X SSC and 50% DMSO. Lastly, cDNA in the concentration range of 100-300 ng/ micro l was determined to be best for arraying and post-processing. Currently, the printing system in this study yields reproducible 9000 spots with a spot size 150 mm diameter, and a 200 nm spot spacing.
Diurnal oscillation of SBE expression in sorghum endosperm
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sun, Chuanxin; Mutisya, J.; Rosenquist, S.
2009-01-15
Spatial and temporal expression patterns of the sorghum SBEI, SBEIIA and SBEIIB genes, encoding, respectively, starch branching enzyme (SBE) I, IIA and IIB, in the developing endosperm of sorghum (Sorghum bicolor) were studied. Full-length genomic and cDNA clones for sorghum was cloned and the SBEIIA cDNA was used together with gene-specific probes for sorghum SBEIIB and SBEI. In contrast to sorghum SBEIIB, which was expressed primarily in endosperm and embryo, SBEIIA was expressed also in vegetative tissues. All three genes shared a similar temporal expression profile during endosperm development, with a maximum activity at 15-24 days after pollination. This ismore » different from barley and maize where SBEI gene activity showed a significantly later onset compared to that of SBEIIA and SBEIIB. Expression of the three SBE genes in the sorghum endosperm exhibited a diurnal rhythm during a 24-h cycle.« less
The road ahead: working towards effective clinical translation of myocardial gene therapies
Katz, Michael G; Fargnoli, Anthony S; Williams, Richard D; Bridges, Charles R
2014-01-01
During the last two decades the fields of molecular and cellular cardiology, and more recently molecular cardiac surgery, have developed rapidly. The concept of delivering cDNA encoding a therapeutic gene to cardiomyocytes using a vector system with substantial cardiac tropism, allowing for long-term expression of a therapeutic protein, has moved from hypothesis to bench to clinical application. However, the clinical results to date are still disappointing. The ideal gene transfer method should be explored in clinically relevant animal models of heart disease to evaluate the relative roles of specific molecular pathways in disease pathogenesis, helping to validate the potential targets for therapeutic intervention. Successful clinical cardiovascular gene therapy also requires the use of nonimmunogenic cardiotropic vectors capable of expressing the requisite amount of therapeutic protein in vivo and in situ. Depending on the desired application either regional or global myocardial gene delivery is required. Cardiac-specific delivery techniques incorporating mapping technologies for regional delivery and highly efficient methodologies for global delivery should improve the precision and specificity of gene transfer to the areas of interest and minimize collateral organ gene expression. PMID:24341816
Isolation and characterization of a novel calmodulin-binding protein from potato
NASA Technical Reports Server (NTRS)
Reddy, Anireddy S N.; Day, Irene S.; Narasimhulu, S. B.; Safadi, Farida; Reddy, Vaka S.; Golovkin, Maxim; Harnly, Melissa J.
2002-01-01
Tuberization in potato is controlled by hormonal and environmental signals. Ca(2+), an important intracellular messenger, and calmodulin (CaM), one of the primary Ca(2+) sensors, have been implicated in controlling diverse cellular processes in plants including tuberization. The regulation of cellular processes by CaM involves its interaction with other proteins. To understand the role of Ca(2+)/CaM in tuberization, we have screened an expression library prepared from developing tubers with biotinylated CaM. This screening resulted in isolation of a cDNA encoding a novel CaM-binding protein (potato calmodulin-binding protein (PCBP)). Ca(2+)-dependent binding of the cDNA-encoded protein to CaM is confirmed by (35)S-labeled CaM. The full-length cDNA is 5 kb long and encodes a protein of 1309 amino acids. The deduced amino acid sequence showed significant similarity with a hypothetical protein from another plant, Arabidopsis. However, no homologs of PCBP are found in nonplant systems, suggesting that it is likely to be specific to plants. Using truncated versions of the protein and a synthetic peptide in CaM binding assays we mapped the CaM-binding region to a 20-amino acid stretch (residues 1216-1237). The bacterially expressed protein containing the CaM-binding domain interacted with three CaM isoforms (CaM2, CaM4, and CaM6). PCBP is encoded by a single gene and is expressed differentially in the tissues tested. The expression of CaM, PCBP, and another CaM-binding protein is similar in different tissues and organs. The predicted protein contained seven putative nuclear localization signals and several strong PEST motifs. Fusion of the N-terminal region of the protein containing six of the seven nuclear localization signals to the reporter gene beta-glucuronidase targeted the reporter gene to the nucleus, suggesting a nuclear role for PCBP.
2000-04-01
Genes, LOH Mapping, Chromosome 17, Physical Mapping, Genetic Mapping, CDNA Screening, Humans, Anatomical 81 Samples, Mutation Detection, Breast Cancer...According to the established model for LOH involving tumor suppressor genes, the allele remaining in the tumor sample would harbor the deleterious mutation ...sequencing on an AB1373A sequencer (Applied Biosystems, Foster City, CA). As none of the samples we have sequenced have revealed any mutations , we have
Assignment of Alzheimer's presenilin-2 (PS-2) gene to 1q42.1 by fluorescence in situ hybridization.
Takano, T; Sahara, N; Yamanouchi, Y; Mori, H
1997-01-17
Presenilin-2 (PS-2) was suggested to be localized on 1q31-42 based on linkage analysis and cDNA cloning. The final identification of PS-2 as the causal gene for early-onset familial Alzheimer's disease in Voga-German pedigrees was concluded based on the point mutation found in the candidate cDNA isolated from this familial AD. We present evidence of its physical genome mapping of PS-2 on chromosome 1q42.1 by fluorescence in situ hybridization method.
Chu, Bing; Yao, Feng; Cheng, Cheng; Wu, Yang; Mei, Yanli; Li, Xuejie; Liu, Yan; Wang, Peisheng; Hou, Lin; Zou, Xiangyang
2014-01-01
During embryonic development of Artemia sinica, environmental stresses induce the embryo diapause phenomenon, required to resist apoptosis and regulate cell cycle activity. The small ubiquitin-related modifier-1 (SUMO), a reversible post-translational protein modifier, plays an important role in embryo development. SUMO regulates multiple cellular processes, including development and other biological processes. The molecular mechanism of diapause, diapause termination and the role of As-sumo-1 in this processes and in early embryo development of Artemia sinica still remains unknown. In this study, the complete cDNA sequences of the sumo-1 homolog, sumo ligase homolog, caspase-1 homolog and cyclin B homolog from Artemia sinica were cloned. The mRNA expression patterns of As-sumo-1, sumo ligase, caspase-1, cyclin B and the location of As-sumo-1 were investigated. SUMO-1, p53, Mdm2, Caspase-1, Cyclin B and Cyclin E proteins were analyzed during different developmental stages of the embryo of A. sinica. Small interfering RNA (siRNA) was used to verify the function of sumo-1 in A. sinica. The full-length cDNA of As-sumo-1 was 476 bp, encoding a 92 amino acid protein. The As-caspases-1 cDNA was 966 bp, encoding a 245 amino-acid protein. The As-sumo ligase cDNA was 1556 bp encoding, a 343 amino acid protein, and the cyclin B cDNA was 739 bp, encoding a 133 amino acid protein. The expressions of As-sumo-1, As-caspase-1 and As-cyclin B were highest at the 10 h stage of embryonic development, and As-sumo ligase showed its highest expression at 0 h. The expression of As-SUMO-1 showed no tissue or organ specificity. Western blotting showed high expression of As-SUMO-1, p53, Mdm2, Caspase-1, Cyclin B and Cyclin E at the 10 h stage. The siRNA caused abnormal development of the embryo, with increased malformation and mortality. As-SUMO-1 is a crucial regulation and modification protein resumption of embryonic diapause and early embryo development of A. sinica. PMID:24404204
Pusterla, N; Wilson, W D; Conrad, P A; Barr, B C; Ferraro, G L; Daft, B M; Leutenegger, C M
2006-09-09
This study was designed to determine the relative levels of gene transcription of selected pathogens and cytokines in the brain and spinal cord of 12 horses with equine protozoal myeloencephalitis (EPM), 11 with equine herpesvirus type 1 (EHV-1) myeloencephalopathy, and 12 healthy control horses by applying a real time pcr to the formalin-fixed and paraffin-embedded tissues. Total rna was extracted from each tissue, transcribed to complementary dna (cDNA) and assayed for Sarcocystis neurona, Neospora hughesi, EHV-1, equine GAPDH (housekeeping gene), tumour necrosis factor (TNF)-alpha, interferon (IFN)-gamma, interleukin (IL)-1beta, IL-2, IL-4, IL-6, IL-8, IL-10 AND IL-12 p40. S neurona cdna was detected in the neural tissue from all 12 horses with EPM, and two of them also had amplifiable cDNA of N hughesi. The relative levels of transcription of protozoal cdna ranged from 1 to 461 times baseline (mean 123). All the horses with ehv-1 myeloencephalopathy had positive viral signals by PCR with relative levels of transcription ranging from 1 to 1618 times baseline (mean 275). All the control horses tested negative for S neurona, N hughesi and EHV-1 cdna. The cytokine profiles of each disease indicated a balance between pro- and anti-inflammatory markers. In the horses with epm the pro-inflammatory Th1 cytokines (IL-8, TNF-alpha and IFN-gamma) were commonly expressed but the anti-inflammatory Th2 cytokines (IL-4, IL-6 AND IL-10) were absent or rare. In the horses with ehv-1 the proinflammatory cytokine IL-8 was commonly expressed, but IL-10 and IFN-gamma were not, and TNF-alpha was rare. Tissue from the control horses expressed only the gene GAPDH.
Zhang, Mingming; Pan, Xietian; Zou, Qian; Xia, Yuesheng; Chen, Jiangwei; Hao, Qimeng; Wang, Haichang; Sun, Dongdong
2016-10-01
Notch3 and TGF-β1 signaling play a key role in the pathogenesis and progression of chronic cardiovascular disease. However, whether Notch3 protects against myocardial infarction (MI) and the underlying mechanisms remains unknown. C57BL/6 mice were randomized to be treated with Notch3 siRNA (siNotch3) or lentivirus carrying Notch3 cDNA (Notch3) before coronary artery ligation. Four weeks after constructing MI model, cardiac function and fibrosis were compared between groups. The cardiac fibroblast cells (CFs) were isolated from newborn C57BL/6 mice (1-3 days old) and transfected with lentivirus carrying Notch3 cDNA. TGF-β1 (5 ng/ml), a well-known pro-fibrotic factor, was administered 72 h after Notch3 cDNA administration in CFs. The related proteins of fibrosis such as a-smooth muscle actin (a-SMA), Type I collagen, metalloprotease (MMP)-9 and the tissue inhibitor of metalloproteinases (TIMP)-2 were examined by western blot analysis. Notch3 cDNA treatment attenuated cardiac damage and inhibited fibrosis in mice with MI. Meanwhile, Notch3 siRNA administration aggravated cardiac function damage and markedly enhanced cardiac fibrosis in mice with MI. Overexpression of Notch3 inhibited TGF-β1-induced fibroblast-myofibroblast transition of mouse cardiac fibroblast cells, as evidenced by down-regulating a-SMA and Type I collagen expression. Notch3 cDNA treatment also increased MMP-9 expression and decreased TIMP-2 expression in the TGF-β1-stimulated cells. This study indicates that Notch3 is an important protective factor for cardiac fibrosis in a MI model, and the protective effect of Notch3 is attributable to its action on TGF-β1/Smad3 signaling.
Sirakova, T D; Markaryan, A; Kolattukudy, P E
1994-01-01
An extracellular elastinolytic metalloproteinase, purified from Aspergillus fumigatus isolated from an aspergillosis and patient/and an internal peptide derived from it were subjected to N-terminal sequencing. Oligonucleotide primers based on these sequences were used to PCR amplify a segment of the metalloproteinase cDNA, which was used as a probe to isolate the cDNA and gene for this enzyme. The gene sequence matched exactly with the cDNA sequence except for the four introns that interrupted the open reading frame. According to the deduced amino acid sequence, the metalloproteinase has a signal sequence and 227 additional amino acids preceding the sequence for the mature protein of 389 amino acids with a calculated molecular mass of 42 kDa, which is close to the size of the purified mature fungal proteinase. This sequence contains segments that matched both the N terminus of the mature protein and the internal peptide. A. fumigatus metalloproteinase contains some of the conserved zinc-binding and active-site motifs characteristic of metalloproteinases but shows no overall homology with known metalloproteinases. The cDNA of the mature protein when introduced into Escherichia coli directed the expression of a protein with a size, N-terminal sequence, and immunological cross-reactivity identical to those of the native fungal enzyme. Although the enzyme in the inclusion bodies could not be renatured, expression at 30 degrees C yielded soluble enzyme that showed chromatographic behavior identical to that of the native fungal enzyme and catalyzed hydrolysis of elastin. The metalloproteinase gene described here was not found in Aspergillus flavus. Images PMID:7927676
Isolation of human hexosaminidase. cap alpha. cDNA and expression of. cap alpha. chains in E. coli
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wiktorowicz, J.E.; Whitman, J.M.
1986-05-01
Pooled antisera against homogeneous, glutaraldehyde cross-linked hexosaminidase (hex) A was adsorbed with E. coli lysate insolubilized on Sepharose 4B. Aliquots of a human liver lambdagtll cDNA library (50,000-100,000 pfu) were plated on E. coli Y1090. Expression of cloned cDNA, after sufficient plaque growth at 42/sup 0/, was accomplished by induction with isopropylthiogalactoside soaked nitrocellulose filters. Identification of hex cDNA clones was performed by incubation of the filters with purified antisera. Protein A labelled with I-125 was used to develop the reactive plaques. Positive plaques, identified by autoradiography, were picked, replated at a lower density, and rescreened. This was repeated severalmore » more times until all plaques yielded positive signals. Identification of the clones as containing ..cap alpha.. or ..beta.. cDNA was accomplished by replating the purified phage and rescreening the plaques with anti-hex B antiserum preadsorbed with E. coli lysate. According to this protocol several hex ..cap alpha.. clones have been identified. While these clones generate ..beta..-galactosidase: hex ..cap alpha.. fusion proteins, these findings suggest that in the future it may be possible to obtain large quantities of unmodified hex ..cap alpha.. and ..beta.. polypeptides from E. coli for the study of the structural and enzymatic properties of these polypeptides and for diagnostic purposes in the GM2 gangliosidoses.« less
Zheng, Min; Mitra, Rajendra N; Filonov, Nazar A; Han, Zongchao
2016-03-01
Previously, we compared the efficacy of nanoparticle (NP)-mediated intron-containing rhodopsin (sgRho) vs. intronless cDNA in ameliorating retinal disease phenotypes in a rhodopsin knockout (RKO) mouse model of retinitis pigmentosa. We showed that NP-mediated sgRho delivery achieved long-term expression and phenotypic improvement in RKO mice, but not NP housing cDNA. However, the protein level of the NP-sgRho construct was only 5-10% of wild-type at 8 mo postinjection. To have a better understanding of the reduced levels of long-term expression of the vectors, in the present study, we evaluated the epigenetic changes of subretinal delivering NP-cDNA vs. NP-sgRho in the RKO mouse eyes. Following the administration, DNA methylation and histone status of specific regions (bacteria plasmid backbone, promoter, rhodopsin gene, and scaffold/matrix attachment region) of the vectors were evaluated at various time points. We documented that epigenetic transgene silencing occurred in vector-mediated gene transfer, which were caused by the plasmid backbone and the cDNA of the transgene, but not the intron-containing transgene. No toxicity or inflammation was found in the treated eyes. Our results suggest that cDNA of the rhodopsin transgene and bacteria backbone interfered with the host defense mechanism of DNA methylation-mediated transgene silencing through heterochromatin-associated modifications. © FASEB.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pham-Dinh, D.; Dautigny, A.; Mattei, M.G.
1993-09-01
Myelin/oligodendrocyte glycoprotein (MOG) is found on the surface of myelinating oligodendrocytes and external lamellae of myelin sheaths in the central nervous system, and it is target antigen in experimental autoimmune encephalomyelitis and multiple sclerosis. The authors have isolated bovine, mouse, and rat MOG cDNA clones and shown that the developmental pattern of MOG expression in the rat central nervous system coincides with the late stages of myelination. The amino-terminal, extracellular domain of MOG has characteristics of an immunoglobulin variable domain and is 46% and 41% identical with the amino terminus of bovine butyrophilin (expressed in the lactating mammary gland) andmore » B-G antigens of the chicken major histocompatibility complex (MHC), respectively; these proteins thus form a subset of the immunoglobulin superfamily. The homology between MOG and B-G extends beyond their structure and genetic mapping to their ability to induce strong antibody responses and has implications for the role of MOG in pathological, autoimmune conditions. The authors colocalized the MOG and BT genes to the human MHC on chromosome 6p21.3-p22. The mouse MOG gene was mapped to the homologous band C of chromosome 17, within the M region of the mouse MHC. 38 refs., 6 figs.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kuefer, M.U.; Valentine, V.; Behm, F.G.
A fusion gene between nucleophosmin (NPM) and myelodysplasia/myeloid leukemia factor 1 (MLF1) and myelodysplasia/myeloid leukemia factor 1 (MLF1) is formed by a recurrent t(3;5)(q25.1;q34) in myelodysplastic syndrome and acute myeloid leukemia. Here we report the identification of a novel gene, MLF2, which contains an open reading frame of 744 bp encoding a 248-amino-acid protein highly related to the previously identified MLF1 protein (63% similarity, 40% identity). In contrast to the tissue-restricted expression pattern of MLF1, and MLF2 messenger RNA is expressed ubiquitously. The MLF2 gene locus was mapped by fluorescence in situ hybridization to human chromosome 12p13, a chromosomal regionmore » frequently involved in translocations and deletions in acute leukemias of lymphoid or myeloid lineage. In a physical map of chromosome 12, MLF2 was found to reside on the yeast artificial chromosome clone 765b9. Southern blotting analysis of malignant cell DNAs prepared from a series of acute lymphoblastic leukemia cases with translocations involving chromosome arm 12p, as well as a group of acute myeloid leukemias with various cytogenetic abnormalities, failed to reveal MLF2 gene rearrangements. 19 refs., 2 figs.« less
Song, Xiaomin; Wang, Jing; Wu, Fang; Li, Xu; Teng, Maikun; Gong, Weimin
2005-01-01
SPE10 is an antifungal protein isolated from the seeds of Pachyrrhizus erosus. cDNA encoding a 47 amino acid peptide was cloned by RT-PCR and the gene sequence proved SPE10 to be a new member of plant defensin family. The synthetic cDNA with codons preferred in yeast was cloned into the pPIC9 plasmid directly in-frame with the secretion signal alpha-mating factor, and highly expressed in methylotrophic Pichia pastoris. Activity assays showed the recombinant SPE10 inhibited specifically the growth of several pathogenic fungi as native SPE10. Circular dichroism and fluorescence spectroscopy analysis indicated that the native and recombinant protein should have same folding, though there are eight cystein residues in the sequence. Several evidence suggested SPE10 should be the first dimeric plant defensin reported so far.
Capsicum annuum dehydrin, an osmotic-stress gene in hot pepper plants.
Chung, Eunsook; Kim, Soo-Yong; Yi, So Young; Choi, Doil
2003-06-30
Osmotic stress-related genes were selected from an EST database constructed from 7 cDNA libraries from different tissues of the hot pepper. A full-length cDNA of Capsicum annuum dehydrin (Cadhn), a late embryogenesis abundant (lea) gene, was selected from the 5' single pass sequenced cDNA clones and sequenced. The deduced polypeptide has 87% identity with potato dehydrin C17, but very little identity with the dehydrin genes of other organisms. It contains a serine-tract (S-segment) and 3 conserved lysine-rich domains (K-segments). Southern blot analysis showed that 2 copies are present in the hot pepper genome. Cadhn was induced by osmotic stress in leaf tissues as well as by the application of abscisic acid. The RNA was most abundant in green fruit. The expression of several osmotic stress-related genes was examined and Cadhn proved to be the most abundantly expressed of these in response to osmotic stress.
Gorodkin, Jan; Cirera, Susanna; Hedegaard, Jakob; Gilchrist, Michael J; Panitz, Frank; Jørgensen, Claus; Scheibye-Knudsen, Karsten; Arvin, Troels; Lumholdt, Steen; Sawera, Milena; Green, Trine; Nielsen, Bente J; Havgaard, Jakob H; Rosenkilde, Carina; Wang, Jun; Li, Heng; Li, Ruiqiang; Liu, Bin; Hu, Songnian; Dong, Wei; Li, Wei; Yu, Jun; Wang, Jian; Stærfeldt, Hans-Henrik; Wernersson, Rasmus; Madsen, Lone B; Thomsen, Bo; Hornshøj, Henrik; Bujie, Zhan; Wang, Xuegang; Wang, Xuefei; Bolund, Lars; Brunak, Søren; Yang, Huanming; Bendixen, Christian; Fredholm, Merete
2007-01-01
Background Knowledge of the structure of gene expression is essential for mammalian transcriptomics research. We analyzed a collection of more than one million porcine expressed sequence tags (ESTs), of which two-thirds were generated in the Sino-Danish Pig Genome Project and one-third are from public databases. The Sino-Danish ESTs were generated from one normalized and 97 non-normalized cDNA libraries representing 35 different tissues and three developmental stages. Results Using the Distiller package, the ESTs were assembled to roughly 48,000 contigs and 73,000 singletons, of which approximately 25% have a high confidence match to UniProt. Approximately 6,000 new porcine gene clusters were identified. Expression analysis based on the non-normalized libraries resulted in the following findings. The distribution of cluster sizes is scaling invariant. Brain and testes are among the tissues with the greatest number of different expressed genes, whereas tissues with more specialized function, such as developing liver, have fewer expressed genes. There are at least 65 high confidence housekeeping gene candidates and 876 cDNA library-specific gene candidates. We identified differential expression of genes between different tissues, in particular brain/spinal cord, and found patterns of correlation between genes that share expression in pairs of libraries. Finally, there was remarkable agreement in expression between specialized tissues according to Gene Ontology categories. Conclusion This EST collection, the largest to date in pig, represents an essential resource for annotation, comparative genomics, assembly of the pig genome sequence, and further porcine transcription studies. PMID:17407547
The ATRX cDNA is prone to bacterial IS10 element insertions that alter its structure.
Valle-García, David; Griffiths, Lyra M; Dyer, Michael A; Bernstein, Emily; Recillas-Targa, Félix
2014-01-01
The SWI/SNF-like chromatin-remodeling protein ATRX has emerged as a key factor in the regulation of α-globin gene expression, incorporation of histone variants into the chromatin template and, more recently, as a frequently mutated gene across a wide spectrum of cancers. Therefore, the availability of a functional ATRX cDNA for expression studies is a valuable tool for the scientific community. We have identified two independent transposon insertions of a bacterial IS10 element into exon 8 of ATRX isoform 2 coding sequence in two different plasmids derived from a single source. We demonstrate that these insertion events are common and there is an insertion hotspot within the ATRX cDNA. Such IS10 insertions produce a truncated form of ATRX, which significantly compromises its nuclear localization. In turn, we describe ways to prevent IS10 insertion during propagation and cloning of ATRX-containing vectors, including optimal growth conditions, bacterial strains, and suggested sequencing strategies. Finally, we have generated an insertion-free plasmid that is available to the community for expression studies of ATRX.
Akao, Takeshi; Gomi, Katsuya; Goto, Kuniyasu; Okazaki, Naoto; Akita, Osamu
2002-07-01
In solid-state cultures (SC), Aspergillus oryzae shows characteristics such as high-level production and secretion of enzymes and hyphal differentiation with asexual development which are absent in liquid (submerged) culture (LC). It was predicted that many of the genes involved in the characteristics of A. oryzae in SC are differentially expressed between SC and LC. We generated two subtracted cDNA libraries with bi-directional cDNA subtractive hybridizations to isolate and identify such genes. Among them, we identified genes upregulated in or specific to SC, such as the AOS ( A. oryzae SC-specific gene) series, and those downregulated or not expressed in SC, such as the AOL ( A. oryzae LC-specific) series. Sequencing analyses revealed that the AOS series and the AOL series contain genes encoding extra- and intracellular enzymes and transport proteins. However, half were functionally unclassified by nucleotide sequences. Also, by expression profile, the AOS series comprised two groups. These gene products' molecular functions and physiological roles in SC await further investigation.
Haskill, S; Martin, G; Van Le, L; Morris, J; Peace, A; Bigler, C F; Jaffe, G J; Hammerberg, C; Sporn, S A; Fong, S
1991-01-01
A cDNA encoding a receptor antagonist of interleukin 1 (IL-1ra), secreted from human monocytes, has recently been isolated and sequenced [Eisenberg, S. P., Evans, R. J., Arend, W. P., Verderber, E., Brewer, M. T., Hannum, C. H. & Thompson, R. C. (1990) Nature (London) 343, 341-346]. We have identified another version of this IL-1ra, which is predominantly expressed in epithelial cells. This IL-1ra lacks a leader sequence and, thus, is probably intracellular. Both proteins are derived from the same gene through use of an alternative transcriptional start site and internal splice-acceptor site. Expression of intracellular IL-1ra cDNA in COS cells demonstrated that the intracellular product specifically inhibited exogenous interleukin 1-dependent responses. Keratinocytes were shown to contain significant amounts of nonsecreted IL-1ra protein. Constitutive expression of the intracellular IL-1ra may be an intracellular defensive mechanism in exposed epithelial cells and/or may serve to regulate autocrine interleukin 1-mediated pathways of differentiation. Images PMID:1827201
Cioffi, Anna Valentina; Ferrara, Diana; Cubellis, Maria Vittoria; Aniello, Francesco; Corrado, Marcella; Liguori, Francesca; Amoroso, Alessandro; Fucci, Laura; Branno, Margherita
2002-08-01
Analysis of the genome structure of the Paracentrotus lividus (sea urchin) DNA methyltransferase (DNA MTase) gene showed the presence of an open reading frame, named METEX, in intron 7 of the gene. METEX expression is developmentally regulated, showing no correlation with DNA MTase expression. In fact, DNA MTase transcripts are present at high concentrations in the early developmental stages, while METEX is expressed at late stages of development. Two METEX cDNA clones (Met1 and Met2) that are different in the 3' end have been isolated in a cDNA library screening. The putative translated protein from Met2 cDNA clone showed similarity with Escherichia coli endonuclease III on the basis of sequence and predictive three-dimensional structure. The protein, overexpressed in E. coli and purified, had functional properties similar to the endonuclease specific for apurinic/apyrimidinic (AP) sites on the basis of the lyase activity. Therefore the open reading frame, present in intron 7 of the P. lividus DNA MTase gene, codes for a functional AP endonuclease designated SuAP1.
Owman, C; Blay, P; Nilsson, C; Lolait, S J
1996-11-12
Using PCR with degenerate primers and screening of a human B-cell lymphoblast cDNA library, a full-length cDNA encoding a 375-amino-acid protein was isolated. It contains seven regions of hydrophobic amino acids probably representing membrane-spanning domains of a novel heptahelix receptor, tentatively named CMKRL2. It shows nearly 30% overall identity with the high-affinity IL8 receptor and similar degree of homology with other chemoattractant receptors, including the "fusin" coreceptors for HIV1. Measurements of various transduction pathways following application of a panel of chemokines to transfected cells failed to evoke any reproducible response. Although the natural ligand for CMKRL2 could, thus, not be identified, receptor expression in spleen and lymph nodes as well as in Burkitt's lymphoma (irrespective of EBV status) supports a functional role in activated B-cells. Receptor message was ubiquitously distributed in normal peripheral tissues and CNS, suggesting that CMKRL2 is expressed in widespread cell populations, such as macrophages and neuroglia.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Schlagnhaufer, C.D.; Arteca, R.N.; Pell, E.J.
When potato plants (Solanum tuberosum L. cv Norland) are subjected to oxone stress ethylene is emitted. Increases in ethylene production are often the result of increased expression of the enzyme ACC synthase. We used the polymerase chain reaction (PCR) to clone a cDNA encoding an ozone-induced ACC synthase. After treating potato plants with 300 ppb ozone for 4 h, RNA was extracted using a guanidinium isothiocyanate method. Using degenerate oligonucleotides corresponding to several conserved regions of ACC synthase sequences reported from different plant tissues as primers, we were able to reverse transcribe the RNA and amplify a cDNA for ACCmore » synthase. The clone is 1098 bp in length encoding for 386 amino acids comprising [approximately]80% of the protein. Computer analysis of the deduced amino acid sequence showed that our clone is 50-70% homologous with ACC synthase genes cloned from other plant tissues. Using the cDNA as a probe in northern analysis we found that there is little or no expression in control tissue: however there is a large increase in the expression of the ACC synthase message in response to ozone treatment.« less
Wei, Chunhua; Chen, Xiner; Wang, Zhongyuan; Liu, Qiyan; Li, Hao; Zhang, Yong; Ma, Jianxiang; Yang, Jianqiang
2017-01-01
The lobed leaf character is a unique morphologic trait in crops, featuring many potential advantages for agricultural productivity. Although the majority of watermelon varieties feature lobed leaves, the genetic factors responsible for lobed leaf formation remain elusive. The F2:3 leaf shape segregating population offers the opportunity to study the underlying mechanism of lobed leaf formation in watermelon. Genetic analysis revealed that a single dominant allele (designated ClLL1) controlled the lobed leaf trait. A large-sized F3:4 population derived from F2:3 individuals was used to map ClLL1. A total of 5,966 reliable SNPs and indels were identified genome-wide via a combination of BSA and RNA-seq. Using the validated SNP and indel markers, the location of ClLL1 was narrowed down to a 127.6-kb region between markers W08314 and W07061, containing 23 putative ORFs. Expression analysis via qRT-PCR revealed differential expression patterns (fold-changes above 2-fold or below 0.5-fold) of three ORFs (ORF3, ORF11, and ORF18) between lobed and non-lobed leaf plants. Based on gene annotation and expression analysis, ORF18 (encoding an uncharacterized protein) and ORF22 (encoding a homeobox-leucine zipper-like protein) were considered as most likely candidate genes. Furthermore, sequence analysis revealed no polymorphisms in cDNA sequences of ORF18; however, two notable deletions were identified in ORF22. This study is the first report to map a leaf shape gene in watermelon and will facilitate cloning and functional characterization of ClLL1 in future studies. PMID:28704497
Wei, Chunhua; Chen, Xiner; Wang, Zhongyuan; Liu, Qiyan; Li, Hao; Zhang, Yong; Ma, Jianxiang; Yang, Jianqiang; Zhang, Xian
2017-01-01
The lobed leaf character is a unique morphologic trait in crops, featuring many potential advantages for agricultural productivity. Although the majority of watermelon varieties feature lobed leaves, the genetic factors responsible for lobed leaf formation remain elusive. The F2:3 leaf shape segregating population offers the opportunity to study the underlying mechanism of lobed leaf formation in watermelon. Genetic analysis revealed that a single dominant allele (designated ClLL1) controlled the lobed leaf trait. A large-sized F3:4 population derived from F2:3 individuals was used to map ClLL1. A total of 5,966 reliable SNPs and indels were identified genome-wide via a combination of BSA and RNA-seq. Using the validated SNP and indel markers, the location of ClLL1 was narrowed down to a 127.6-kb region between markers W08314 and W07061, containing 23 putative ORFs. Expression analysis via qRT-PCR revealed differential expression patterns (fold-changes above 2-fold or below 0.5-fold) of three ORFs (ORF3, ORF11, and ORF18) between lobed and non-lobed leaf plants. Based on gene annotation and expression analysis, ORF18 (encoding an uncharacterized protein) and ORF22 (encoding a homeobox-leucine zipper-like protein) were considered as most likely candidate genes. Furthermore, sequence analysis revealed no polymorphisms in cDNA sequences of ORF18; however, two notable deletions were identified in ORF22. This study is the first report to map a leaf shape gene in watermelon and will facilitate cloning and functional characterization of ClLL1 in future studies.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ishikawa, Jun; Kaisho, Tsuneyasu; Tomizawa, Hitoshi
1995-04-10
Bone marrow stromal cells regulate B-cell growth and development through their surface molecules and cytokines. In this study, we generated a mAb, RS38, that recognized a novel human membrane protein, BST-2, expressed on bone marrow stromal cell lines and synovial cell lines. We cloned a cDNA encoding BST-2 from a rheumatoid arthritis-derived synovial cell line. BST-2 is a 30- to 36-kDa type II transmembrane protein, consisting of 180 amino acids. The BST-2 gene (HGMW-approved symbol BST2) is located on chromosome 19p13.2. BST-2 is expressed not only on certain bone marrow stromal cell lines but also on various normal tissues, althoughmore » its expression pattern is different from that of another bone marrow stromal cell surface molecule, BST-1. BST-2 surface expression on fibroblast cell lines facilitated the stromal cell-dependent growth of a murine bone marrow-derived pre-B-cell line, DW34. The results suggest that BST-2 may be involved in pre-B-cell growth. 45 refs., 7 figs., 2 tabs.« less
Han, Benfeng; Zhang, Shen; Zeng, Fanrong; Mao, Jianjun
2017-01-01
Background The green lacewing, Chrysopa pallens Rambur, is one of the most important natural predators because of its extensive spectrum of prey and wide distribution. However, what we know about the nutritional and reproductive physiology of this species is very scarce. Results By cDNA amplification and Illumina short-read sequencing, we analyzed transcriptomes of C. pallens female adult under starved and fed conditions. In total, 71236 unigenes were obtained with an average length of 833 bp. Four vitellogenins, three insulin-like peptides and two insulin receptors were annotated. Comparison of gene expression profiles suggested that totally 1501 genes were differentially expressed between the two nutritional statuses. KEGG orthology classification showed that these differentially expression genes (DEGs) were mapped to 241 pathways. In turn, the top 4 are ribosome, protein processing in endoplasmic reticulum, biosynthesis of amino acids and carbon metabolism, indicating a distinct difference in nutritional and reproductive signaling between the two feeding conditions. Conclusions Our study yielded large-scale molecular information relevant to C. pallens nutritional and reproductive signaling, which will contribute to mass rearing and commercial use of this predaceous insect species. PMID:28683101
Han, Benfeng; Zhang, Shen; Zeng, Fanrong; Mao, Jianjun
2017-01-01
The green lacewing, Chrysopa pallens Rambur, is one of the most important natural predators because of its extensive spectrum of prey and wide distribution. However, what we know about the nutritional and reproductive physiology of this species is very scarce. By cDNA amplification and Illumina short-read sequencing, we analyzed transcriptomes of C. pallens female adult under starved and fed conditions. In total, 71236 unigenes were obtained with an average length of 833 bp. Four vitellogenins, three insulin-like peptides and two insulin receptors were annotated. Comparison of gene expression profiles suggested that totally 1501 genes were differentially expressed between the two nutritional statuses. KEGG orthology classification showed that these differentially expression genes (DEGs) were mapped to 241 pathways. In turn, the top 4 are ribosome, protein processing in endoplasmic reticulum, biosynthesis of amino acids and carbon metabolism, indicating a distinct difference in nutritional and reproductive signaling between the two feeding conditions. Our study yielded large-scale molecular information relevant to C. pallens nutritional and reproductive signaling, which will contribute to mass rearing and commercial use of this predaceous insect species.
Differential cDNA cloning by enzymatic degrading subtraction (EDS).
Zeng, J; Gorski, R A; Hamer, D
1994-01-01
We describe a new method, called enzymatic degrading subtraction (EDS), for the construction of subtractive libraries from PCR amplified cDNA. The novel features of this method are that i) the tester DNA is blocked by thionucleotide incorporation; ii) the rate of hybridization is accelerated by phenol-emulsion reassociation; and iii) the driver cDNA and hybrid molecules are enzymatically removed by digestion with exonucleases III and VII rather than by physical partitioning. We demonstrate the utility of EDS by constructing a subtractive library enriched for cDNAs expressed in adult but not in embryonic rat brains. Images PMID:7971268
Bellantuono, I; Lashford, L S; Rafferty, J A; Fairbairn, L J
2000-05-01
As a single gene defect in mature bone marrow cells, chronic granulomatous disease (X-CGD) represents a disorder which may be amenable to gene therapy by the transfer of the missing subunit into hemopoietic stem cells. In the majority of cases lack of Gp91-phox causes the disease. So far, studies involving transfer of Gp91-phox cDNA, including a phase I clinical trial, have yielded disappointing results. Most often, low titers of virus have been reported. In the present study we investigated the possible reasons for low titer amphotropic viral production. To investigate the effect of Gp91 cDNA on the efficiency of retroviral production from the packaging cell line, GP+envAm12, we constructed vectors containing either the native cDNA, truncated versions of the cDNA or a mutated form (LATG) in which the natural translational start codon was changed to a stop codon. Following derivation of clonal packaging cell lines, these were assessed for viral titer by RNA slot blot and analyzed by non-parametrical statistical analysis (Whitney-Mann U-test). An improvement in viral titer of just over two-fold was found in packaging cells containing the start-codon mutant of Gp91 and no evidence of truncated viral RNA was seen in these cells. Further analysis revealed the presence of rearranged forms of the provirus in Gp91-expressing cells, and the production of truncated, unpackaged viral RNA. Protein analysis revealed that LATG-transduced cells did not express full-length Gp91-phox, whereas those containing the wild-type cDNA did. However, a truncated protein was seen in ATG-transduced cells which was also present in wild type cells. No evidence for the presence of a negative transcriptional regulatory element was found from studies with the deletion mutants. A statistically significant effect of protein production on the production of virus from Gp91-expressing cells was found. Our data point to a need to restrict expression of the Gp91-phox protein and its derivatives in order to enhance retroviral production and suggest that improvements in current vectors for CGD gene therapy may need to include controlled, directed expression only in mature neutrophils.
Mutations Affecting Expression of the rosy Locus in Drosophila melanogaster
Lee, Chong Sung; Curtis, Daniel; McCarron, Margaret; Love, Carol; Gray, Mark; Bender, Welcome; Chovnick, Arthur
1987-01-01
The rosy locus in Drosophila melanogaster codes for the enzyme xanthine dehydrogenase (XDH). Previous studies defined a "control element" near the 5' end of the gene, where variant sites affected the amount of rosy mRNA and protein produced. We have determined the DNA sequence of this region from both genomic and cDNA clones, and from the ry+10 underproducer strain. This variant strain had many sequence differences, so that the site of the regulatory change could not be fixed. A mutagenesis was also undertaken to isolate new regulatory mutations. We induced 376 new mutations with 1-ethyl-1-nitrosourea (ENU) and screened them to isolate those that reduced the amount of XDH protein produced, but did not change the properties of the enzyme. Genetic mapping was used to find mutations located near the 5' end of the gene. DNA from each of seven mutants was cloned and sequenced through the 5' region. Mutant base changes were identified in all seven; they appear to affect splicing and translation of the rosy mRNA. In a related study (T. P. Keith et al. 1987), the genomic and cDNA sequences are extended through the 3' end of the gene; the combined sequences define the processing pattern of the rosy transcript and predict the amino acid sequence of XDH. PMID:3036645
DOE Office of Scientific and Technical Information (OSTI.GOV)
Szoets, H.; Reithmueller, G.; Weiss, E.
1986-03-01
Antigen HLA-B27 is a high-risk genetic factor with respect to a group of rheumatoid disorders, especially ankylosing spondylitis. A cDNA library was constructed from an autozygous B-cell line expressing HLA-B27, HLA-Cw1, and the previously cloned HLA-A2 antigen. Clones detected with an HLA probe were isolated and sorted into homology groups by differential hybridization and restriction maps. Nucleotide sequencing allowed the unambiguous assignment of cDNAs to HLA-A, -B, and -C loci. The HLA-B27 mRNA has the structure features and the codon variability typical of an HLA class I transcript but it specifies two uncommon amino acid replacements: a cysteine in positionmore » 67 and a serine in position 131. The latter substitution may have functional consequences, because it occurs in a conserved region and at a position invariably occupied by a species-specific arginine in humans and lysine in mice. The availability of the complete sequence of HLA-B27 and of the partial sequence of HLA-Cw1 allows the recognition of locus-specific sequence markers, particularly, but not exclusively, in the transmembrane and cytoplasmic domains.« less
Genomic resources for Myzus persicae: EST sequencing, SNP identification, and microarray design
Ramsey, John S; Wilson, Alex CC; de Vos, Martin; Sun, Qi; Tamborindeguy, Cecilia; Winfield, Agnese; Malloch, Gaynor; Smith, Dawn M; Fenton, Brian; Gray, Stewart M; Jander, Georg
2007-01-01
Background The green peach aphid, Myzus persicae (Sulzer), is a world-wide insect pest capable of infesting more than 40 plant families, including many crop species. However, despite the significant damage inflicted by M. persicae in agricultural systems through direct feeding damage and by its ability to transmit plant viruses, limited genomic information is available for this species. Results Sequencing of 16 M. persicae cDNA libraries generated 26,669 expressed sequence tags (ESTs). Aphids for library construction were raised on Arabidopsis thaliana, Nicotiana benthamiana, Brassica oleracea, B. napus, and Physalis floridana (with and without Potato leafroll virus infection). The M. persicae cDNA libraries include ones made from sexual and asexual whole aphids, guts, heads, and salivary glands. In silico comparison of cDNA libraries identified aphid genes with tissue-specific expression patterns, and gene expression that is induced by feeding on Nicotiana benthamiana. Furthermore, 2423 genes that are novel to science and potentially aphid-specific were identified. Comparison of cDNA data from three aphid lineages identified single nucleotide polymorphisms that can be used as genetic markers and, in some cases, may represent functional differences in the protein products. In particular, non-conservative amino acid substitutions in a highly expressed gut protease may be of adaptive significance for M. persicae feeding on different host plants. The Agilent eArray platform was used to design an M. persicae oligonucleotide microarray representing over 10,000 unique genes. Conclusion New genomic resources have been developed for M. persicae, an agriculturally important insect pest. These include previously unknown sequence data, a collection of expressed genes, molecular markers, and a DNA microarray that can be used to study aphid gene expression. These resources will help elucidate the adaptations that allow M. persicae to develop compatible interactions with its host plants, complementing ongoing work illuminating plant molecular responses to phloem-feeding insects. PMID:18021414
Design and screening of M13 phage display cDNA libraries.
Georgieva, Yuliya; Konthur, Zoltán
2011-02-17
The last decade has seen a steady increase in screening of cDNA expression product libraries displayed on the surface of filamentous bacteriophage. At the same time, the range of applications extended from the identification of novel allergens over disease markers to protein-protein interaction studies. However, the generation and selection of cDNA phage display libraries is subjected to intrinsic biological limitations due to their complex nature and heterogeneity, as well as technical difficulties regarding protein presentation on the phage surface. Here, we review the latest developments in this field, discuss a number of strategies and improvements anticipated to overcome these challenges making cDNA and open reading frame (ORF) libraries more readily accessible for phage display. Furthermore, future trends combining phage display with next generation sequencing (NGS) will be presented.
USDA-ARS?s Scientific Manuscript database
Like IGF-I, progranulin (pgrn) is a growth factor involved in tumorigenesis and wound healing. We report here the identification and characterization of pgrn cDNA in tilapia and the regulation of its expression by growth hormone(GH). The tilapia pgrn cDNA was cloned by RT-PCR ampliWcation, using g...
Lu, W; Wainwright, G; Olohan, L A; Webster, S G; Rees, H H; Turner, P C
2001-10-31
Synthesis of ecdysteroids (molting hormones) by crustacean Y-organs is regulated by a neuropeptide, molt-inhibiting hormone (MIH), produced in eyestalk neural ganglia. We report here the molecular cloning of a cDNA encoding MIH of the edible crab, Cancer pagurus. Full-length MIH cDNA was obtained by using reverse transcription-polymerase chain reaction (RT-PCR) with degenerate oligonucleotides based upon the amino acid sequence of MIH, in conjunction with 5'- and 3'-RACE. Full-length clones of MIH cDNA were obtained that encoded a 35 amino acid putative signal peptide and the mature 78 amino acid peptide. Of various tissues examined by Northern blot analysis, the X-organ was the sole major site of expression of the MIH gene. However, a nested-PCR approach using non-degenerate MIH-specific primers indicated the presence of MIH transcripts in other tissues. Southern blot analysis indicated a simple gene arrangement with at least two copies of the MIH gene in the genome of C. pagurus. Additional Southern blotting experiments detected MIH-hybridizing bands in another Cancer species, Cancer antennarius and another crab species, Carcinus maenas.
Sangesland, Maya; Atwood-Moore, Angela; Rai, Sudhir K; Levin, Henry L
2016-01-01
Transposition and homologous recombination assays are valuable genetic tools to measure the production and integration of cDNA from the long terminal repeat (LTR) retrotransposon Tf1 in the fission yeast (Schizosaccharomyces pombe). Here we describe two genetic assays, one that measures the transposition activity of Tf1 by monitoring the mobility of a drug resistance marked Tf1 element expressed from a multi-copy plasmid and another assay that measures homologous recombination between Tf1 cDNA and the expression plasmid. While the transposition assay measures insertion of full-length Tf1 cDNA mediated by the transposon integrase, the homologous recombination assay measures levels of cDNA present in the nucleus and is independent of integrase activity. Combined, these assays can be used to systematically screen large collections of strains to identify mutations that specifically inhibit the integration step in the retroelement life cycle. Such mutations can be identified because they reduce transposition activity but nevertheless have wild-type frequencies of homologous recombination. Qualitative assays of yeast patches on agar plates detect large defects in integration and recombination, while the quantitative approach provides a precise method of determining integration and recombination frequencies.
Automated multiplex genome-scale engineering in yeast
Si, Tong; Chao, Ran; Min, Yuhao; Wu, Yuying; Ren, Wen; Zhao, Huimin
2017-01-01
Genome-scale engineering is indispensable in understanding and engineering microorganisms, but the current tools are mainly limited to bacterial systems. Here we report an automated platform for multiplex genome-scale engineering in Saccharomyces cerevisiae, an important eukaryotic model and widely used microbial cell factory. Standardized genetic parts encoding overexpression and knockdown mutations of >90% yeast genes are created in a single step from a full-length cDNA library. With the aid of CRISPR-Cas, these genetic parts are iteratively integrated into the repetitive genomic sequences in a modular manner using robotic automation. This system allows functional mapping and multiplex optimization on a genome scale for diverse phenotypes including cellulase expression, isobutanol production, glycerol utilization and acetic acid tolerance, and may greatly accelerate future genome-scale engineering endeavours in yeast. PMID:28469255
Luzio, J P; Brake, B; Banting, G; Howell, K E; Braghetta, P; Stanley, K K
1990-01-01
Organelle-specific integral membrane proteins were identified by a novel strategy which gives rise to monospecific antibodies to these proteins as well as to the cDNA clones encoding them. A cDNA expression library was screened with a polyclonal antiserum raised against Triton X-114-extracted organelle proteins and clones were then grouped using antibodies affinity-purified on individual fusion proteins. The identification, molecular cloning and sequencing are described of a type 1 membrane protein (TGN38) which is located specifically in the trans-Golgi network. Images Fig. 1. Fig. 3. PMID:2204342
Mapping Flagellar Genes in Chlamydomonas Using Restriction Fragment Length Polymorphisms
Ranum, LPW.; Thompson, M. D.; Schloss, J. A.; Lefebvre, P. A.; Silflow, C. D.
1988-01-01
To correlate cloned nuclear DNA sequences with previously characterized mutations in Chlamydomonas and, to gain insight into the organization of its nuclear genome, we have begun to map molecular markers using restriction fragment length polymorphisms (RFLPs). A Chlamydomonas reinhardtii strain (CC-29) containing phenotypic markers on nine of the 19 linkage groups was crossed to the interfertile species Chlamydomonas smithii. DNA from each member of 22 randomly selected tetrads was analyzed for the segregation of RFLPs associated with cloned genes detected by hybridization with radioactive DNA probes. The current set of markers allows the detection of linkage to new molecular markers over approximately 54% of the existing genetic map. This study focused on mapping cloned flagellar genes and genes whose transcripts accumulate after deflagellation. Twelve different molecular clones have been assigned to seven linkage groups. The α-1 tubulin gene maps to linkage group III and is linked to the genomic sequence homologous to pcf6-100, a cDNA clone whose corresponding transcript accumulates after deflagellation. The α-2 tubulin gene maps to linkage group IV. The two β-tubulin genes are linked, with the β-1 gene being approximately 12 cM more distal from the centromere than the β-2 gene. A clone corresponding to a 73-kD dynein protein maps to the opposite arm of the same linkage group. The gene corresponding to the cDNA clone pcf6-187, whose mRNA accumulates after deflagellation, maps very close to the tightly linked pf-26 and pf-1 mutations on linkage group V. PMID:2906025
Remapping of the stripe rust resistance gene Yr10 in common wheat.
Yuan, Cuiling; Wu, Jingzheng; Yan, Baiqiang; Hao, Qunqun; Zhang, Chaozhong; Lyu, Bo; Ni, Fei; Caplan, Allan; Wu, Jiajie; Fu, Daolin
2018-06-01
Yr10 is an important gene to control wheat stripe rust, and the search for Yr10 needs to be continued. Wheat stripe rust or yellow rust is a devastating fungal disease caused by Puccinia striiformis f. sp. tritici (Pst). Host disease resistance offers a primary source for controlling wheat stripe rust. The stripe rust resistance gene Yr10 confers the race-specific resistance to most tested Pst races in China including CYR29. Early studies proposed that Yr10 was a nucleotide-binding site, leucine-rich repeat gene archived as GenBank accession AF149112 (hereafter designated the Yr10 candidate gene or Yr10 CG ). In this study, we revealed that 15 Chinese wheat cultivars positive for Yr10 CG are susceptible to CYR29. We then expressed the Yr10 CG cDNA in the common wheat 'Bobwhite'. The Yr10 CG -cDNA positive transgenic plants were also susceptible to CYR29. Thus, it is highly unlikely that Yr10 CG corresponds to the Yr10 resistance gene. Using the Yr10 donor 'Moro' and the Pst-susceptible wheat 'Huixianhong', we generated two F 3 populations that displayed a single Mendelian segregation on the Yr10 gene, and used them to remap the Yr10 gene. Six markers were placed in the Yr10 region, with the Yr10 CG gene now mapping about 1.2-cM proximal to the Yr10 locus and the Xsdauw79 marker is completely linked to the Yr10 locus. Apparently, the Yr10 gene has not yet been identified. Fine mapping and positional cloning of Yr10 is important for gene pyramiding for stripe rust resistance in wheat.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Geraghty, M.T.; Stetten, G.; Kearns, W.
1994-09-01
X-linked adrenoleukodystrophy (ALD) is a disorder of peroxisomal {beta}-oxidation of very long chain fatty acids. It presents either as progressive dementia in childhood or as progressive paraparesis in later years. Adrenal insufficiency occurs in both phenotypes. The gene of the ALD protein has been mapped to Xq28 and has recently been cloned and characterized. The ALD protein has significant homology to the peroxisomal membrane protein, PMP70 and belongs to the ATP binding cassette superfamily of transporters. We screened a human genomic library with an ALDP cDNA and isolated 5 different but highly similar clones containing sequences corresponding to the 3{prime}more » end of the ALDP gene. Comparison of the sequences over the region corresponding to exon 9 through the 3{prime} end of the ALDP gene reveals {approximately}96% nucleotide identity in both exonic and intronic regions. Splice sites and open reading frames are maintained. Using both FISH and human-rodent DNA mapping panels, we positively assign these ALDP-related sequences to chromosomes 2, 16 and 22, and provisionally to 1 and 20. Southern blot of primate DNA probed with a partial ALDP cDNA (exon 2-10) shows that expansion of ALDP-related sequences occurred in higher primates (chimp, gorilla and human). Although Northern blots show multiple ALDP-hybridizing transcripts in certain tissues, we have no evidence to date for expression of these ALDP-related sequences. In conclusion, our data show there has been an unusual and recent dispersal to multiple chromosomes of structural gene sequences related to the ALDP gene. The functional significance of these sequences remains to be determined but their existence complicates PCR and mutation analysis of the ALDP gene.« less
Characterization of human septic sera induced gene expression modulation in human myocytes
Hussein, Shaimaa; Michael, Paul; Brabant, Danielle; Omri, Abdelwahab; Narain, Ravin; Passi, Kalpdrum; Ramana, Chilakamarti V.; Parrillo, Joseph E.; Kumar, Anand; Parissenti, Amadeo; Kumar, Aseem
2009-01-01
To gain a better understanding of the gene expression changes that occurs during sepsis, we have performed a cDNA microarray study utilizing a tissue culture model that mimics human sepsis. This study utilized an in vitro model of cultured human fetal cardiac myocytes treated with 10% sera from septic patients or 10% sera from healthy volunteers. A 1700 cDNA expression microarray was used to compare the transcription profile from human cardiac myocytes treated with septic sera vs normal sera. Septic sera treatment of myocytes resulted in the down-regulation of 178 genes and the up-regulation of 4 genes. Our data indicate that septic sera induced cell cycle, metabolic, transcription factor and apoptotic gene expression changes in human myocytes. Identification and characterization of gene expression changes that occur during sepsis may lead to the development of novel therapeutics and diagnostics. PMID:19684886
Ibrahim, Ahmed Ragaa Nour; Kawamoto, Seiji; Aki, Tsunehiro; Shimada, Yayoi; Rikimaru, Satoshi; Onishi, Nobukazu; Babiker, Elfadil Elfadl; Oiso, Isao; Hashimoto, Kunihiko; Hayashi, Takaharu; Ono, Kazuhisa
2010-01-01
Japanese cedar (Cryptomeria japonica) pollen is a major cause of seasonal pollinosis in Japan. Protease activity in the pollen grains may trigger pro-allergic responses but no such proteases have yet been identified as pollen allergens. We report the molecular cloning and immunochemical characterization of a novel C. japonica pollen allergen belonging to the aspartic protease family. We focused on the C. japonica pollen allergen spot No. 63 (CPA63, 47.5% IgE binding frequency) on our 2-dimensional IgE immunoblot map. The internal amino acid sequences were determined using time-of-flight mass spectrometry. Full-length cpa63 cDNA was cloned by rapid amplification of cDNA ends (RACE)-PCR. Recombinant CPA63 (r-CPA63) was expressed using the baculovirus-insect cell culture system and its IgE binding capacity was analyzed by enzyme-linked immunosorbent assay (ELISA). The proteolytic activity of r-CPA63 was also assessed using a putative mature enzyme produced upon autolysis. cpa63 cDNA encoded a 472 amino acid polypeptide showing about 40% sequence identity to members of the plant atypical aspartic protease family. ELISA showed that r-CPA63 was recognized by IgE antibodies in the serum of 58% (18/31) of Japanese cedar pollinosis patients. We also demonstrated an aspartic protease-like enzyme activity of the putative mature r-CPA63. We have identified the first plant aspartic protease allergen from Japanese cedar pollen. The availability of the CPA63 sequence and its recombinant allergen production system are useful not only for pharmaceutical applications but also for further examination of the role of protease activity in the pathogenesis of cedar pollinosis. 2010 S. Karger AG, Basel.
Mohr, Sabine; Ghanem, Eman; Smith, Whitney; Sheeter, Dennis; Qin, Yidan; King, Olga; Polioudakis, Damon; Iyer, Vishwanath R; Hunicke-Smith, Scott; Swamy, Sajani; Kuersten, Scott; Lambowitz, Alan M
2013-07-01
Mobile group II introns encode reverse transcriptases (RTs) that function in intron mobility ("retrohoming") by a process that requires reverse transcription of a highly structured, 2-2.5-kb intron RNA with high processivity and fidelity. Although the latter properties are potentially useful for applications in cDNA synthesis and next-generation RNA sequencing (RNA-seq), group II intron RTs have been difficult to purify free of the intron RNA, and their utility as research tools has not been investigated systematically. Here, we developed general methods for the high-level expression and purification of group II intron-encoded RTs as fusion proteins with a rigidly linked, noncleavable solubility tag, and we applied them to group II intron RTs from bacterial thermophiles. We thus obtained thermostable group II intron RT fusion proteins that have higher processivity, fidelity, and thermostability than retroviral RTs, synthesize cDNAs at temperatures up to 81°C, and have significant advantages for qRT-PCR, capillary electrophoresis for RNA-structure mapping, and next-generation RNA sequencing. Further, we find that group II intron RTs differ from the retroviral enzymes in template switching with minimal base-pairing to the 3' ends of new RNA templates, making it possible to efficiently and seamlessly link adaptors containing PCR-primer binding sites to cDNA ends without an RNA ligase step. This novel template-switching activity enables facile and less biased cloning of nonpolyadenylated RNAs, such as miRNAs or protein-bound RNA fragments. Our findings demonstrate novel biochemical activities and inherent advantages of group II intron RTs for research, biotechnological, and diagnostic methods, with potentially wide applications.
Gillick, Kieran; Pollpeter, Darja; Phalora, Prabhjeet; Kim, Eun-Young; Wolinsky, Steven M.
2013-01-01
The Vif protein of human immunodeficiency virus type 1 (HIV-1) promotes viral replication by downregulation of the cell-encoded, antiviral APOBEC3 proteins. These proteins exert their suppressive effects through the inhibition of viral reverse transcription as well as the induction of cytidine deamination within nascent viral cDNA. Importantly, these two effects have not been characterized in detail in human CD4+ T cells, leading to controversies over their possible contributions to viral inhibition in the natural cell targets of HIV-1 replication. Here we use wild-type and Vif-deficient viruses derived from the CD4+ T cells of multiple donors to examine the consequences of APOBEC3 protein function at natural levels of expression. We demonstrate that APOBEC3 proteins impart a profound deficiency to reverse transcription from the initial stages of cDNA synthesis, as well as excessive cytidine deamination (hypermutation) of the DNAs that are synthesized. Experiments using viruses from transfected cells and a novel method for mapping the 3′ termini of cDNAs indicate that the inhibition of reverse transcription is not limited to a few specific sites, arguing that APOBEC3 proteins impede enzymatic processivity. Detailed analyses of mutation spectra in viral cDNA strongly imply that one particular APOBEC3 protein, APOBEC3G, provides the bulk of the antiviral phenotype in CD4+ T cells, with the effects of APOBEC3F and APOBEC3D being less significant. Taken together, we conclude that the dual mechanisms of action of APOBEC3 proteins combine to deliver more effective restriction of HIV-1 than either function would by itself. PMID:23152537
Cloning, structure, and chromosome localization of the mouse glutaryl-CoA dehydrogenase gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Koeller, D.M.; DiGiulio, A.; Frerman, F.E.
Glutaryl-CoA dehydrogenase (GCDH) is a nuclear-encoded, mitochondrial matrix enzyme. In humans, deficiency of GCDH leads to glutaric acidemia type I, and inherited disorder of amino acid metabolism characterized by a progressive neurodegenerative disease. In this report we describe the cloning and structure of the mouse GCDH (Gcdh) gene and cDNA and its chromosomal localization. The mouse Gcdh cDNA is 1.75 kb long and contains and open reading frame of 438 amino acids. The amino acid sequences of mouse, human, and pig GCDH are highly conserved. The mouse Gcdh gene contains 11 exons and spans 7 kb of genomic DNA. Gcdhmore » was mapped by backcross analysis to mouse chromosome 8 within a region that is homologous to a region of human chromosome 19, where the human gene was previously mapped. 14 refs., 3 figs.« less
Kerschner, Joseph E; Erdos, Geza; Hu, Fen Ze; Burrows, Amy; Cioffi, Joseph; Khampang, Pawjai; Dahlgren, Margaret; Hayes, Jay; Keefe, Randy; Janto, Benjamin; Post, J Christopher; Ehrlich, Garth D
2010-04-01
We sought to construct and partially characterize complementary DNA (cDNA) libraries prepared from the middle ear mucosa (MEM) of chinchillas to better understand pathogenic aspects of infection and inflammation, particularly with respect to leukotriene biogenesis and response. Chinchilla MEM was harvested from controls and after middle ear inoculation with nontypeable Haemophilus influenzae. RNA was extracted to generate cDNA libraries. Randomly selected clones were subjected to sequence analysis to characterize the libraries and to provide DNA sequence for phylogenetic analyses. Reverse transcription-polymerase chain reaction of the RNA pools was used to generate cDNA sequences corresponding to genes associated with leukotriene biosynthesis and metabolism. Sequence analysis of 921 randomly selected clones from the uninfected MEM cDNA library produced approximately 250,000 nucleotides of almost entirely novel sequence data. Searches of the GenBank database with the Basic Local Alignment Search Tool provided for identification of 515 unique genes expressed in the MEM and not previously described in chinchillas. In almost all cases, the chinchilla cDNA sequences displayed much greater homology to human or other primate genes than with rodent species. Genes associated with leukotriene metabolism were present in both normal and infected MEM. Based on both phylogenetic comparisons and gene expression similarities with humans, chinchilla MEM appears to be an excellent model for the study of middle ear inflammation and infection. The higher degree of sequence similarity between chinchillas and humans compared to chinchillas and rodents was unexpected. The cDNA libraries from normal and infected chinchilla MEM will serve as useful molecular tools in the study of otitis media and should yield important information with respect to middle ear pathogenesis.
Kerschner, Joseph E.; Erdos, Geza; Hu, Fen Ze; Burrows, Amy; Cioffi, Joseph; Khampang, Pawjai; Dahlgren, Margaret; Hayes, Jay; Keefe, Randy; Janto, Benjamin; Post, J. Christopher; Ehrlich, Garth D.
2010-01-01
Objectives We sought to construct and partially characterize complementary DNA (cDNA) libraries prepared from the middle ear mucosa (MEM) of chinchillas to better understand pathogenic aspects of infection and inflammation, particularly with respect to leukotriene biogenesis and response. Methods Chinchilla MEM was harvested from controls and after middle ear inoculation with nontypeable Haemophilus influenzae. RNA was extracted to generate cDNA libraries. Randomly selected clones were subjected to sequence analysis to characterize the libraries and to provide DNA sequence for phylogenetic analyses. Reverse transcription–polymerase chain reaction of the RNA pools was used to generate cDNA sequences corresponding to genes associated with leukotriene biosynthesis and metabolism. Results Sequence analysis of 921 randomly selected clones from the uninfected MEM cDNA library produced approximately 250,000 nucleotides of almost entirely novel sequence data. Searches of the GenBank database with the Basic Local Alignment Search Tool provided for identification of 515 unique genes expressed in the MEM and not previously described in chinchillas. In almost all cases, the chinchilla cDNA sequences displayed much greater homology to human or other primate genes than with rodent species. Genes associated with leukotriene metabolism were present in both normal and infected MEM. Conclusions Based on both phylogenetic comparisons and gene expression similarities with humans, chinchilla MEM appears to be an excellent model for the study of middle ear inflammation and infection. The higher degree of sequence similarity between chinchillas and humans compared to chinchillas and rodents was unexpected. The cDNA libraries from normal and infected chinchilla MEM will serve as useful molecular tools in the study of otitis media and should yield important information with respect to middle ear pathogenesis. PMID:20433028
Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P
1988-02-01
Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators.
Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P
1988-01-01
Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators. Images PMID:3257578
Tong, C G; Reichler, S; Blumenthal, S; Balk, J; Hsieh, H L; Roux, S J
1997-01-01
A cDNA encoding a nucleolar protein was selected from a pea (Pisum sativum) plumule library, cloned, and sequenced. The translated sequence of the cDNA has significant percent identity to Xenopus laevis nucleolin (31%), the alfalfa (Medicago sativa) nucleolin homolog (66%), and the yeast (Saccharomyces cerevisiae) nucleolin homolog (NSR1) (28%). It also has sequence patterns in its primary structure that are characteristic of all nucleolins, including an N-terminal acidic motif, RNA recognition motifs, and a C-terminal Gly- and Arg-rich domain. By immunoblot analysis, the polyclonal antibodies used to select the cDNA bind selectively to a 90-kD protein in purified pea nuclei and nucleoli and to an 88-kD protein in extracts of Escherichia coli expressing the cDNA. In immunolocalization assays of pea plumule cells, the antibodies stained primarily a region surrounding the fibrillar center of nucleoli, where animal nucleolins are typically found. Southern analysis indicated that the pea nucleolin-like protein is encoded by a single gene, and northern analysis showed that the labeled cDNA binds to a single band of RNA, approximately the same size and the cDNA. After irradiation of etiolated pea seedlings by red light, the mRNA level in plumules decreased during the 1st hour and then increased to a peak of six times the 0-h level at 12 h. Far-red light reversed this effect of red light, and the mRNA accumulation from red/far-red light irradiation was equal to that found in the dark control. This indicates that phytochrome may regulate the expression of this gene. PMID:9193096
Cheng, Benson Yee Hin; Zhi, Jizu; Santana, Alexis; Khan, Sohail; Salinas, Eduardo; Forrest, J. Craig; Zheng, Yueting; Jaggi, Shirin; Leatherwood, Janet
2012-01-01
We applied a custom tiled microarray to examine murine gammaherpesvirus 68 (MHV68) polyadenylated transcript expression in a time course of de novo infection of fibroblast cells and following phorbol ester-mediated reactivation from a latently infected B cell line. During de novo infection, all open reading frames (ORFs) were transcribed and clustered into four major temporal groups that were overlapping yet distinct from clusters based on the phorbol ester-stimulated B cell reactivation time course. High-density transcript analysis at 2-h intervals during de novo infection mapped gene boundaries with a 20-nucleotide resolution, including a previously undefined ORF73 transcript and the MHV68 ORF63 homolog of Kaposi's sarcoma-associated herpesvirus vNLRP1. ORF6 transcript initiation was mapped by tiled array and confirmed by 5′ rapid amplification of cDNA ends. The ∼1.3-kb region upstream of ORF6 was responsive to lytic infection and MHV68 RTA, identifying a novel RTA-responsive promoter. Transcription in intergenic regions consistent with the previously defined expressed genomic regions was detected during both types of productive infection. We conclude that the MHV68 transcriptome is dynamic and distinct during de novo fibroblast infection and upon phorbol ester-stimulated B cell reactivation, highlighting the need to evaluate further transcript structure and the context-dependent molecular events that govern viral gene expression during chronic infection. PMID:22318145
Lewers, Kim S; Saski, Chris A; Cuthbertson, Brandon J; Henry, David C; Staton, Meg E; Main, Dorrie S; Dhanaraj, Anik L; Rowland, Lisa J; Tomkins, Jeff P
2008-01-01
Background The recent development of novel repeat-fruiting types of blackberry (Rubus L.) cultivars, combined with a long history of morphological marker-assisted selection for thornlessness by blackberry breeders, has given rise to increased interest in using molecular markers to facilitate blackberry breeding. Yet no genetic maps, molecular markers, or even sequences exist specifically for cultivated blackberry. The purpose of this study is to begin development of these tools by generating and annotating the first blackberry expressed sequence tag (EST) library, designing primers from the ESTs to amplify regions containing simple sequence repeats (SSR), and testing the usefulness of a subset of the EST-SSRs with two blackberry cultivars. Results A cDNA library of 18,432 clones was generated from expanding leaf tissue of the cultivar Merton Thornless, a progenitor of many thornless commercial cultivars. Among the most abundantly expressed of the 3,000 genes annotated were those involved with energy, cell structure, and defense. From individual sequences containing SSRs, 673 primer pairs were designed. Of a randomly chosen set of 33 primer pairs tested with two blackberry cultivars, 10 detected an average of 1.9 polymorphic PCR products. Conclusion This rate predicts that this library may yield as many as 940 SSR primer pairs detecting 1,786 polymorphisms. This may be sufficient to generate a genetic map that can be used to associate molecular markers with phenotypic traits, making possible molecular marker-assisted breeding to compliment existing morphological marker-assisted breeding in blackberry. PMID:18570660
Guan, Hongyu; Zhao, Yujun; Su, Ping; Tong, Yuru; Liu, Yujia; Hu, Tianyuan; Zhang, Yifeng; Zhang, Xianan; Li, Jia; Wu, Xiaoyi; Huang, Luqi; Gao, Wei
2017-09-01
Sterol C24-methyltransferase (SMT) plays multiple important roles in plant growth and development. SMT1, which belongs to the family of transferases and transforms cycloartenol into 24-methylene cycloartenol, is involved in the biosynthesis of 24-methyl sterols. Here, we report the cloning and characterization of a cDNA encoding a sterol C24-methyltransferase from Tripterygium wilfordii ( TwSMT1 ). TwSMT1 (GenBank access number KU885950) is a 1530 bp cDNA with a 1041 bp open reading frame predicted to encode a 346-amino acid, 38.62 kDa protein. The polypeptide encoded by the SMT1 cDNA was expressed and purified as a recombinant protein from Escherichia coli ( E. coli ) and showed SMT activity. The expression of TwSMT1 was highly up-regulated in T. wilfordii cell suspension cultures treated with methyl jasmonate (MeJA). Tissue expression pattern analysis showed higher expression in the phellem layer compared to the other four organs (leaf, stem, xylem and phloem), which is about ten times that of the lowest expression in leaf. The results are meaningful for the study of sterol biosynthesis of T. wilfordii and will further lay the foundations for the research in regulating both the content of other main compounds and growth and development of T. wilfordii.
Effects of Nickel Treatment on H3K4 Trimethylation and Gene Expression
Tchou-Wong, Kam-Meng; Kluz, Thomas; Arita, Adriana; Smith, Phillip R.; Brown, Stuart; Costa, Max
2011-01-01
Occupational exposure to nickel compounds has been associated with lung and nasal cancers. We have previously shown that exposure of the human lung adenocarcinoma A549 cells to NiCl2 for 24 hr significantly increased global levels of trimethylated H3K4 (H3K4me3), a transcriptional activating mark that maps to the promoters of transcribed genes. To further understand the potential epigenetic mechanism(s) underlying nickel carcinogenesis, we performed genome-wide mapping of H3K4me3 by chromatin immunoprecipitation and direct genome sequencing (ChIP-seq) and correlated with transcriptome genome-wide mapping of RNA transcripts by massive parallel sequencing of cDNA (RNA-seq). The effect of NiCl2 treatment on H3K4me3 peaks within 5,000 bp of transcription start sites (TSSs) on a set of genes highly induced by nickel in both A549 cells and human peripheral blood mononuclear cells were analyzed. Nickel exposure increased the level of H3K4 trimethylation in both the promoters and coding regions of several genes including CA9 and NDRG1 that were increased in expression in A549 cells. We have also compared the extent of the H3K4 trimethylation in the absence and presence of formaldehyde crosslinking and observed that crosslinking of chromatin was required to observe H3K4 trimethylation in the coding regions immediately downstream of TSSs of some nickel-induced genes including ADM and IGFBP3. This is the first genome-wide mapping of trimethylated H3K4 in the promoter and coding regions of genes induced after exposure to NiCl2. This study may provide insights into the epigenetic mechanism(s) underlying the carcinogenicity of nickel compounds. PMID:21455298
Morgan, Michael B; Edge, Sara E; Snell, Terry W
2005-01-01
A coral cDNA array containing 32 genes was used to examine the gene expression profiles of coral populations located at four sites that varied with distance from a semi-submerged municipal dump in Castle Harbour, Bermuda (previously identified as a point source of anthropogenic stressors). Genes on the array represent transcripts induced under controlled laboratory conditions to a variety of stressors both natural (temperature, sediment, salinity, darkness) and xenobiotic (heavy metals, pesticides, PAH) in origin. The gene expression profiles produced revealed information about the types of stressors. Consistent with other studies undertaken in Castle Harbour, the coral cDNA array detected responses to heavy metals, sedimentation, as well as oxidative stress.
Deletions of fetal and adult muscle cDNA in Duchenne and Becker muscular dystrophy patients.
Cross, G S; Speer, A; Rosenthal, A; Forrest, S M; Smith, T J; Edwards, Y; Flint, T; Hill, D; Davies, K E
1987-01-01
We have isolated a cDNA molecule from a human adult muscle cDNA library which is deleted in several Duchenne muscular dystrophy patients. Patient deletions have been used to map the exons across the Xp21 region of the short arm of the X chromosome. We demonstrate that a very mildly affected 61 year old patient is deleted for at least nine exons of the adult cDNA. We find no evidence for differential exon usage between adult and fetal muscle in this region of the gene. There must therefore be less essential domains of the protein structure which can be removed without complete loss of function. The sequence of 2.0 kb of the adult cDNA shows no homology to any previously described protein listed in the data banks although sequence comparison at the amino acid level suggests that the protein has a structure not dissimilar to rod structures of cytoskeletal proteins such as lamin and myosin. There are single nucleotide differences in the DNA sequence between the adult and fetal cDNAs which result in amino acid changes but none that would be predicted to change the structure of the protein dramatically. Images Fig. 1. Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 7. PMID:3428261
EST Express: PHP/MySQL based automated annotation of ESTs from expression libraries
Smith, Robin P; Buchser, William J; Lemmon, Marcus B; Pardinas, Jose R; Bixby, John L; Lemmon, Vance P
2008-01-01
Background Several biological techniques result in the acquisition of functional sets of cDNAs that must be sequenced and analyzed. The emergence of redundant databases such as UniGene and centralized annotation engines such as Entrez Gene has allowed the development of software that can analyze a great number of sequences in a matter of seconds. Results We have developed "EST Express", a suite of analytical tools that identify and annotate ESTs originating from specific mRNA populations. The software consists of a user-friendly GUI powered by PHP and MySQL that allows for online collaboration between researchers and continuity with UniGene, Entrez Gene and RefSeq. Two key features of the software include a novel, simplified Entrez Gene parser and tools to manage cDNA library sequencing projects. We have tested the software on a large data set (2,016 samples) produced by subtractive hybridization. Conclusion EST Express is an open-source, cross-platform web server application that imports sequences from cDNA libraries, such as those generated through subtractive hybridization or yeast two-hybrid screens. It then provides several layers of annotation based on Entrez Gene and RefSeq to allow the user to highlight useful genes and manage cDNA library projects. PMID:18402700
EST Express: PHP/MySQL based automated annotation of ESTs from expression libraries.
Smith, Robin P; Buchser, William J; Lemmon, Marcus B; Pardinas, Jose R; Bixby, John L; Lemmon, Vance P
2008-04-10
Several biological techniques result in the acquisition of functional sets of cDNAs that must be sequenced and analyzed. The emergence of redundant databases such as UniGene and centralized annotation engines such as Entrez Gene has allowed the development of software that can analyze a great number of sequences in a matter of seconds. We have developed "EST Express", a suite of analytical tools that identify and annotate ESTs originating from specific mRNA populations. The software consists of a user-friendly GUI powered by PHP and MySQL that allows for online collaboration between researchers and continuity with UniGene, Entrez Gene and RefSeq. Two key features of the software include a novel, simplified Entrez Gene parser and tools to manage cDNA library sequencing projects. We have tested the software on a large data set (2,016 samples) produced by subtractive hybridization. EST Express is an open-source, cross-platform web server application that imports sequences from cDNA libraries, such as those generated through subtractive hybridization or yeast two-hybrid screens. It then provides several layers of annotation based on Entrez Gene and RefSeq to allow the user to highlight useful genes and manage cDNA library projects.
Laoong-u-thai, Yanisa; Zhao, Baoping; Phongdara, Amornrat; Ako, Harry; Yang, Jinzeng
2009-01-01
Small ubiquitin-like modifiers (SUMO) work in a similar way as ubiquitin to alter the biological properties of a target protein by conjugation. A shrimp SUMO cDNA named LvSUMO-1 was identified in Litopenaeus vannamei. LvSUMO-1 cDNA contains a coding sequence of 282 nucleotides with untranslated regions of 37 bp at 5'-end and 347 bp at 3'-end, respectively. The deduced 93 amino acids exhibit 83% identity with the Western Honeybee SUMO-1, and more than 65% homologies with human and mouse SUMO-1. LvSUMO-1 mRNA is expressed in most L. vannamei tissues with the highest level in hepatopancrease. The mRNA expression of LvSUMO-1 over development stages in L. Vammamei is distinguished by a low level in nauplius stage and relatively high level in postlarva stage with continuous expression until juvenile stage. The LvSUMO-1 protein and its conjugated proteins are detected in both cytoplasm and nucleus in several tissues. Interestingly, LvSUMO-1 mRNA levels are high in abdominal muscle during the premolt stage, wherein it has significant activities of protein degradation, suggesting its possible role in the regulation of shrimp muscle protein degradation. PMID:19240809
Thu-Hang, Pham; Bassie, Ludovic; Safwat, Gehan; Trung-Nghia, Pham; Christou, Paul; Capell, Teresa
2002-01-01
We posed the question of whether steady-state levels of the higher polyamines spermidine and spermine in plants can be influenced by overexpression of a heterologous cDNA involved in the later steps of the pathway, in the absence of any further manipulation of the two synthases that are also involved in their biosynthesis. Transgenic rice (Oryza sativa) plants engineered with the heterologous Datura stramonium S-adenosylmethionine decarboxylase (samdc) cDNA exhibited accumulation of the transgene steady-state mRNA. Transgene expression did not affect expression of the orthologous samdc gene. Significant increases in SAMDC activity translated to a direct increase in the level of spermidine, but not spermine, in leaves. Seeds recovered from a number of plants exhibited significant increases in spermidine and spermine levels. We demonstrate that overexpression of the D. stramonium samdc cDNA in transgenic rice is sufficient for accumulation of spermidine in leaves and spermidine and spermine in seeds. These findings suggest that increases in enzyme activity in one of the two components of the later parts of the pathway leading to the higher polyamines is sufficient to alter their levels mostly in seeds and, to some extent, in vegetative tissue such as leaves. Implications of our results on the design of rational approaches for the modulation of the polyamine pathway in plants are discussed in the general framework of metabolic pathway engineering. PMID:12177487
Possible involvement of MSX-2 homeoprotein in v-ras-induced transformation.
Takahashi, C; Akiyama, N; Kitayama, H; Takai, S; Noda, M
1997-04-01
A truncated MSX-2 homeoprotein was found to induce flat reversion when expressed in v-Ki-ras-transformed NIH3T3 cells. Although the expression of endogenous MSX-2 gene is low in most of the normal adult tissues examined, it is frequently activated in carcinoma-derived cell lines. Likewise, the gene is inactive in untransformed cells but is transcriptionally activated after transformation by v-Ki-ras oncogene, suggesting that the intact MSX-2 may play a positive, rather than suppressive, role in cell transformation. To test this possibility, we isolated a full-length human MSX-2 cDNA and tested its activities in two cell systems: fibroblast and myoblast. In NIH3T3 fibroblasts, although the gene by itself failed to confer a transformed phenotype, antisense MSX-2 cDNA as well as truncated MSX-2 cDNA interfered with the transforming activities of both v-Ki-ras and v-raf oncogene. In C2C12 myoblasts, MSX-2 was found to suppress MyoD gene expression, as do activated ras oncogenes, under certain culture conditions, and truncated MSX-2 cDNA was found to inhibit the activities of both MSX-2 and ras in this system as well. Our findings not only suggest that the truncated version MSX-2 may act as a dominant suppressor of intact MSX-2 but also raise the possibility that MSX-2 gene may be an important downstream target for the Ras signaling pathways.
[Expression of cell adhesion molecules in acute leukemia cell].
Ju, Xiaoping; Peng, Min; Xu, Xiaoping; Lu, Shuqing; Li, Yao; Ying, Kang; Xie, Yi; Mao, Yumin; Xia, Fang
2002-11-01
To investigate the role of cell adhesion molecule in the development and extramedullary infiltration (EI) of acute leukemia. The expressions of neural cell adhesion molecule (NCAM) gene, intercellular adhesion molecule-1 (ICAM-1) and vascular cell adhesion molecule (VCAM-1) genes in 25 acute leukemia patients bone marrow cells were detected by microarray and reverse transcriptase-polymerase chain reaction (RT-PCR). The expressions of NCAM, ICAM-1 and VCAM-1 gene were significantly higher in acute leukemia cells and leukemia cells with EI than in normal tissues and leukemia cells without EI, respectively, both by cDNA microarray and by RT-PCR. The cDNA microarray is a powerful technique in analysis of acute leukemia cells associated genes. High expressions of cell adhesion molecule genes might be correlated with leukemia pathogenesis and infiltration of acute leukemia cell.
Lu, M; Wang, L F; Du, X H; Yu, Y K; Pan, J B; Nan, Z J; Han, J; Wang, W X; Zhang, Q Z; Sun, Q P
2015-11-30
Various plant genes can be activated or inhibited by phytohormones under conditions of biotic and abiotic stress, especially in response to jasmonic acid (JA) and salicylic acid (SA). Interactions between JA and SA may be synergistic or antagonistic, depending on the stress condition. In this study, we cloned a full-length cDNA (LeWRKY1, GenBank accession No. FJ654265) from Lycopersicon esculentum by rapid amplification of cDNA ends. Sequence analysis showed that this gene is a group II WRKY transcription factor. Analysis of LeWRKY1 mRNA expression in various tissues by qRT-PCR showed that the highest and lowest expression occurred in the leaves and stems, respectively. In addition, LeWRKY1 expression was induced by JA and Botrytis cinerea Pers., but not by SA.
Cloning and baculovirus expression of a desiccation stress gene from the beetle, Tenebrio molitor.
Graham, L A; Bendena, W G; Walker, V K
1996-02-01
The cDNA sequence encoding a novel desiccation stress protein (dsp28) found in the hemolymph of the common yellow mealworm beetle, Tenebrio molitor, has been determined. The sequence encodes a 225 amino acid protein containing a 20 amino acid signal peptide. Dsp28 shows no significant similarity to any known nucleic acid or protein sequence. Levels of dsp28 mRNA were found to increase approx 5-fold following desiccation. Dsp28 cDNA has been cloned into a baculovirus expression vector and the expressed protein was compared to native dsp28. Both dsp28 expressed by recombinant baculovirus and native dsp28 are glycosylated and N-terminally processed. Although dsp28 is induced by cold in addition to desiccation stress, it does not contribute to the freezing point depression (thermal hysteresis) observed in Tenebrio hemolymph.
Qu, Chun-Pu; Xu, Zhi-Ru; Liu, Guan-Jun; Liu, Chun; Li, Yang; Wei, Zhi-Gang; Liu, Gui-Feng
2010-01-01
In aerobic organisms, protection against oxidative damage involves the combined action of highly specialized antioxidant enzymes, such as copper-zinc superoxide dismutase. In this work, a cDNA clone which encodes a copper-zinc superoxide dismutase gene, named PS-CuZnSOD, has been identified from P. sibiricum Laxm. by the rapid amplification of cDNA ends method (RACE). Analysis of the nucleotide sequence reveals that the PS-CuZnSOD gene cDNA clone consists of 669 bp, containing 87 bp in the 5' untranslated region; 459 bp in the open reading frame (ORF) encoding 152 amino acids; and 123 bp in 3' untranslated region. The gene accession nucleotide sequence number in GenBank is GQ472846. Sequence analysis indicates that the protein, like most plant superoxide dismutases (SOD), includes two conserved ecCuZnSOD signatures that are from the amino acids 43 to 51, and from the amino acids 137 to 148, and it has a signal peptide extension in the front of the N-terminus (1-16 aa). Expression analysis by real-time quantitative PCR reveals that the PS-CuZnSOD gene is expressed in leaves, stems and underground stems. PS-CuZnSOD gene expression can be induced by 3% NaHCO(3). The different mRNA levels' expression of PS-CuZnSOD show the gene's different expression modes in leaves, stems and underground stems under the salinity-alkalinity stress.
Shiue, Yow-Ling; Chen, Lih-Ren; Chen, Chih-Feng; Chen, Yi-Ling; Ju, Jhy-Phen; Chao, Ching-Hsien; Lin, Yuan-Ping; Kuo, Yu-Ming; Tang, Pin-Chi; Lee, Yen-Pai
2006-09-15
To identify transcripts related to high egg production expressed specifically in the hypothalamus and pituitary gland of the chicken, two subtracted cDNA libraries were constructed. Two divergently selected strains of Taiwan Country Chickens (TCCs), B (sire line) and L2 (dam line) were used; they had originated from a single population and were further subjected (since 1982) to selection for egg production to 40 wk of age and body weight/comb size, respectively. A total of 324 and 370 clones were identified from the L2-B (L2-subtract-B) and the B-L2 subtracted cDNA libraries, respectively. After sequencing and annotation, 175 and 136 transcripts that represented 53 known and 65 unknown non-redundant sequences were characterized in the L2-B subtracted cDNA library. Quantitative reverse-transcription (RT)-PCR was used to screen the mRNA expression levels of 32 randomly selected transcripts in another 78 laying hens from five different strains. These strains included the two original strains (B and L2) used to construct the subtracted cDNA libraries and an additional three commercial strains, i.e., Black- and Red-feather TCCs and Single-Comb White Leghorn (WL) layer. The mRNA expression levels of 16 transcripts were significantly higher in the L2 than in the B strain, whereas the mRNA expression levels of nine transcripts, BDH, NCAM1, PCDHA@, PGDS, PLAG1, PRL, SAR1A, SCG2 and STMN2, were significantly higher in two high egg production strains, L2 and Single-Comb WL; this indicated their usefulness as molecular markers of high egg production.
Thormar, Hans G; Gudmundsson, Bjarki; Eiriksdottir, Freyja; Kil, Siyoen; Gunnarsson, Gudmundur H; Magnusson, Magnus Karl; Hsu, Jason C; Jonsson, Jon J
2013-04-01
The causes of imprecision in microarray expression analysis are poorly understood, limiting the use of this technology in molecular diagnostics. Two-dimensional strandness-dependent electrophoresis (2D-SDE) separates nucleic acid molecules on the basis of length and strandness, i.e., double-stranded DNA (dsDNA), single-stranded DNA (ssDNA), and RNA·DNA hybrids. We used 2D-SDE to measure the efficiency of cDNA synthesis and its importance for the imprecision of an in vitro transcription-based microarray expression analysis. The relative amount of double-stranded cDNA formed in replicate experiments that used the same RNA sample template was highly variable, ranging between 0% and 72% of the total DNA. Microarray experiments showed an inverse relationship between the difference between sample pairs in probe variance and the relative amount of dsDNA. Approximately 15% of probes showed between-sample variation (P < 0.05) when the dsDNA percentage was between 12% and 35%. In contrast, only 3% of probes showed between-sample variation when the dsDNA percentage was 69% and 72%. Replication experiments of the 35% dsDNA and 72% dsDNA samples were used to separate sample variation from probe replication variation. The estimated SD of the sample-to-sample variation and of the probe replicates was lower in 72% dsDNA samples than in 35% dsDNA samples. Variation in the relative amount of double-stranded cDNA synthesized can be an important component of the imprecision in T7 RNA polymerase-based microarray expression analysis. © 2013 American Association for Clinical Chemistry
Shin, Seung-Yong; Lee, Haeng-Soon; Kwon, Suk-Yoon; Kwon, Soon-Tae; Kwak, Sang-Soo
2005-01-01
Superoxide dismutase (SOD) cDNA, mSOD2, encoding cytosolic copper/zinc SOD (CuZnSOD) cDNA was isolated from suspension-cultured cells of cassava (Manihot esculenta Crantz) by cDNA library screening, and its expression was investigated in relation to environmental stress. mSOD2 is 774 bp in length with an open reading frame (ORF) of 152 amino acids, corresponding to a protein of predicted molecular mass 15 kDa and a pI of 5.22. One copy of the mSOD2 gene was found to be present in the cassava genome by Southern analysis using an mSOD2 cDNA-specific probe. Reverse transcriptase-polymerase chain reaction (RT-PCR) analysis revealed diverse expression patterns for the mSOD2 gene in various tissues of intact cassava plants, at various stages of the growth in suspension cultures, and in the leaf tissues exposed to different stresses. The mSOD2 gene was highly expressed in suspension-cultured cells and in the stems of intact plants. However, it was expressed at low levels in leaves and roots. During suspension cell growth, the mSOD2 transcript progressively increased during culture. Moreover, the mSOD2 gene in excised cassava leaves responded to various stresses in different ways. In particular, it was highly induced in leaf tissue by several abiotic stresses, including high temperature (37 degrees C), chilling (4 degrees C), methyl viologen (MV) exposure, and wounding treatment. These results indicate that the mSOD2 gene is involved in the antioxidative process triggered by oxidative stress induced by environmental change.
Wang, Jianhua; Chen, Shishu
2002-10-01
To identify certain gastric adenocarcinoma metastasis-related genes, an RF-1 cell line (primary tumor from a gastric adenocarcinoma patient) and an RF-48 cell line (its metastatic counterpart) were used as a model for studying the molecular mechanism of tumor metastasis. Two fluorescent cDNA probes, labeled with Cy3 and Cy5 dyes, were prepared from RF-1 and RF-48 mRNA samples by the reverse transcription method. The two color probes were then mixed and hybridized to a cDNA chip constructed with double-dots from 4,096 human genes, and scanned at two wavelengths. The experiment was repeated twice. Differentially expressedn genes from the above two cells were analyzed by use of computer. Of the total genes, 138 (3.4%) revealed differential expression in RF-48 cells compared with RF-1 cells: 81 (2.1%) genes revealed apparent up-regulation, and 56 (1.3%) genes revealed down-regulation. Forty-five genes involved in gastric adenocarcinoma metastasis were cloned using fluorescent differential display-PCR (FDD-PCR), including three novel genes. There were seven differentially expressed genes that presented the same behaviour under both detection methods. The possible roles of some differentially expressed genes, which may be involved in the mechanism of tumor metastasis, were discussed. cDNA chip was used to analyze gene expression in a high-throughput and large-scale manner in combination with FDD-PCR for cloning unknown novel genes. Some genes related to metastasis were preliminarily scanned, which would contribute to disclose the molecular mechanism of gastric adenocarcinoma metastasis and provide new targets for therapeutic intervention.
Characterization and simulation of cDNA microarray spots using a novel mathematical model
Kim, Hye Young; Lee, Seo Eun; Kim, Min Jung; Han, Jin Il; Kim, Bo Kyung; Lee, Yong Sung; Lee, Young Seek; Kim, Jin Hyuk
2007-01-01
Background The quality of cDNA microarray data is crucial for expanding its application to other research areas, such as the study of gene regulatory networks. Despite the fact that a number of algorithms have been suggested to increase the accuracy of microarray gene expression data, it is necessary to obtain reliable microarray images by improving wet-lab experiments. As the first step of a cDNA microarray experiment, spotting cDNA probes is critical to determining the quality of spot images. Results We developed a governing equation of cDNA deposition during evaporation of a drop in the microarray spotting process. The governing equation included four parameters: the surface site density on the support, the extrapolated equilibrium constant for the binding of cDNA molecules with surface sites on glass slides, the macromolecular interaction factor, and the volume constant of a drop of cDNA solution. We simulated cDNA deposition from the single model equation by varying the value of the parameters. The morphology of the resulting cDNA deposit can be classified into three types: a doughnut shape, a peak shape, and a volcano shape. The spot morphology can be changed into a flat shape by varying the experimental conditions while considering the parameters of the governing equation of cDNA deposition. The four parameters were estimated by fitting the governing equation to the real microarray images. With the results of the simulation and the parameter estimation, the phenomenon of the formation of cDNA deposits in each type was investigated. Conclusion This study explains how various spot shapes can exist and suggests which parameters are to be adjusted for obtaining a good spot. This system is able to explore the cDNA microarray spotting process in a predictable, manageable and descriptive manner. We hope it can provide a way to predict the incidents that can occur during a real cDNA microarray experiment, and produce useful data for several research applications involving cDNA microarrays. PMID:18096047
Rojas-Cartagena, Carmencita; Ortíz-Pineda, Pablo; Ramírez-Gómez, Francisco; Suárez-Castillo, Edna C.; Matos-Cruz, Vanessa; Rodríguez, Carlos; Ortíz-Zuazaga, Humberto; García-Arrarás, José E.
2010-01-01
Repair and regeneration are key processes for tissue maintenance, and their disruption may lead to disease states. Little is known about the molecular mechanisms that underline the repair and regeneration of the digestive tract. The sea cucumber Holothuria glaberrima represents an excellent model to dissect and characterize the molecular events during intestinal regeneration. To study the gene expression profile, cDNA libraries were constructed from normal, 3-day, and 7-day regenerating intestines of H. glaberrima. Clones were randomly sequenced and queried against the nonredundant protein database at the National Center for Biotechnology Information. RT-PCR analyses were made of several genes to determine their expression profile during intestinal regeneration. A total of 5,173 sequences from three cDNA libraries were obtained. About 46.2, 35.6, and 26.2% of the sequences for the normal, 3-days, and 7-days cDNA libraries, respectively, shared significant similarity with known sequences in the protein database of GenBank but only present 10% of similarity among them. Analysis of the libraries in terms of functional processes, protein domains, and most common sequences suggests that a differential expression profile is taking place during the regeneration process. Further examination of the expressed sequence tag dataset revealed that 12 putative genes are differentially expressed at significant level (R > 6). Experimental validation by RT-PCR analysis reveals that at least three genes (unknown C-4677-1, melanotransferrin, and centaurin) present a differential expression during regeneration. These findings strongly suggest that the gene expression profile varies among regeneration stages and provide evidence for the existence of differential gene expression. PMID:17579180
Uchida, Katsuhisa; Moriyama, Shunsuke; Breves, Jason P; Fox, Bradley K; Pierce, Andrew L; Borski, Russell J; Hirano, Tetsuya; Grau, E Gordon
2009-04-01
Somatolactin (SL) is a member of the growth hormone (GH)/prolactin (PRL) family of pituitary hormones, and is found in a variety of teleost species. Somatolactin is thought to be involved in a wide range of physiological actions, including reproduction, stress response, the regulation of Ca(2+) and acid-base balance, growth, metabolism, and immune response. We report here on the cDNA structure of SL from the pituitary of Mozambique tilapia, Oreochromis mossambicus, and its gene expression in response to seawater acclimation, stress, and fasting. Tilapia SL cDNA (1573bp long) encoded a prehormone of 230 amino acids. Sequence analysis of purified SL revealed that the prehormone is composed of a signal peptide of 23 amino acids and a mature protein of 207 amino acids, which has a possible N-glycosylation site at position 121 and seven Cys residues. Tilapia SL shows over 80% amino acid identity with SLalpha of advanced teleosts such as medaka and flounder, and around 50% identity with SLbeta of carp and goldfish. Acclimation to seawater had no effect on pituitary expression of SL or on hepatic expression of the putative tilapia SL receptor (GHR1). By contrast, seawater acclimation resulted in significant increases in pituitary GH expression and in hepatic expression of tilapia GH receptor (GHR2). Confinement stress had no effect on pituitary expression of either SL or GH, or on hepatic expression of GHR1, whereas a significant increase was seen in GHR2 expression in the liver. Fasting for 4 weeks resulted in significant reductions in SL transcripts both in fresh water and seawater. It is highly likely that SL is involved in metabolic processes in tilapia along with the GH/IGF-I axis.
A new approach for cloning hLIF cDNA from genomic DNA isolated from the oral mucous membrane.
Cui, Y H; Zhu, G Q; Chen, Q J; Wang, Y F; Yang, M M; Song, Y X; Wang, J G; Cao, B Y
2011-11-25
Complementary DNA (cDNA) is valuable for investigating protein structure and function in the study of life science, but it is difficult to obtain by traditional reverse transcription. We employed a novel strategy to clone human leukemia inhibitory factor (hLIF) gene cDNA from genomic DNA, which was directly isolated from the mucous membrane of mouth. The hLIF sequence, which is 609 bp long and is composed of three exons, can be acquired within a few hours by amplifying each exon and splicing all of them using overlap-PCR. This new approach developed is simple, time- and cost-effective, without RNA preparation or cDNA synthesis, and is not limited to the specific tissues for a particular gene and the expression level of the gene.
Differences in expression of retinal pigment epithelium mRNA between normal canines
2004-01-01
Abstract A reference database of differences in mRNA expression in normal healthy canine retinal pigment epithelium (RPE) has been established. This database identifies non-informative differences in mRNA expression that can be used in screening canine RPE for mutations associated with clinical effects on vision. Complementary DNA (cDNA) pools were prepared from mRNA harvested from RPE, amplified by PCR, and used in a subtractive hybridization protocol (representational differential analysis) to identify differences in RPE mRNA expression between canines. The effect of relatedness of the test canines on the frequency of occurrence of differences was evaluated by using 2 unrelated canines for comparison with 2 female sibling canines of blue heeler/bull terrier lineage. Differentially expressed cDNA species were cloned, sequenced, and identified by comparison to public database entries. The most frequently observed differentially expressed sequence from the unrelated canine comparison was cDNA with 21 base pairs (bp) identical to the human epithelial membrane protein 1 gene (present in 8 of 20 clones). Different clones from the same-sex sibling RPE contained repetitions of several short sequence motifs including the human epithelial membrane protein 1 (4 of 25 clones). Other prevalent differences between sibling RPE included sequences similar to a chicken genetic marker sequence motif (5 of 25), and 6 clones with homology to porcine major histocompatibility loci. In addition to identifying several repetitively occurring, noninformative, differentially expressed RPE mRNA species, the findings confirm that fewer differences occurred between siblings, highlighting the importance of using closely related subjects in representational difference analysis studies. PMID:15352545
Bernstein, Steven L; Guo, Yan; Peterson, Katherine; Wistow, Graeme
2009-01-01
Background The optic nerve is a pure white matter central nervous system (CNS) tract with an isolated blood supply, and is widely used in physiological studies of white matter response to various insults. We examined the gene expression profile of human optic nerve (ON) and, through the NEIBANK online resource, to provide a resource of sequenced verified cDNA clones. An un-normalized cDNA library was constructed from pooled human ON tissues and was used in expressed sequence tag (EST) analysis. Location of an abundant oligodendrocyte marker was examined by immunofluorescence. Quantitative real time polymerase chain reaction (qRT-PCR) and Western analysis were used to compare levels of expression for key calcium channel protein genes and protein product in primate and rodent ON. Results Our analyses revealed a profile similar in many respects to other white matter related tissues, but significantly different from previously available ON cDNA libraries. The previous libraries were found to include specific markers for other eye tissues, suggesting contamination. Immune/inflammatory markers were abundant in the new ON library. The oligodendrocyte marker QKI was abundant at the EST level. Immunofluorescence revealed that this protein is a useful oligodendrocyte cell-type marker in rodent and primate ONs. L-type calcium channel EST abundance was found to be particularly low. A qRT-PCR-based comparative mammalian species analysis reveals that L-type calcium channel expression levels are significantly lower in primate than in rodent ON, which may help account for the class-specific difference in responsiveness to calcium channel blocking agents. Several known eye disease genes are abundantly expressed in ON. Many genes associated with normal axonal function, mRNAs associated with axonal transport, inflammation and neuroprotection are observed. Conclusion We conclude that the new cDNA library is a faithful representation of human ON and EST data provide an initial overview of gene expression patterns in this tissue. The data provide clues for tissue-specific and species-specific properties of human ON that will help in design of therapeutic models. PMID:19778450
Chinnakkannu, Panneerselvam; Samanna, Venkatesababa; Cheng, Guangmao; Ablonczy, Zsolt; Baicu, Catalin F.; Bethard, Jennifer R.; Menick, Donald R.; Kuppuswamy, Dhandapani; Cooper, George
2010-01-01
In severe pressure overload-induced cardiac hypertrophy, a dense, stabilized microtubule network forms that interferes with cardiocyte contraction and microtubule-based transport. This is associated with persistent transcriptional up-regulation of cardiac α- and β-tubulin and microtubule-stabilizing microtubule-associated protein 4 (MAP4). There is also extensive microtubule decoration by MAP4, suggesting greater MAP4 affinity for microtubules. Because the major determinant of this affinity is site-specific MAP4 dephosphorylation, we characterized this in hypertrophied myocardium and then assessed the functional significance of each dephosphorylation site found by mimicking it in normal cardiocytes. We first isolated MAP4 from normal and pressure overload-hypertrophied feline myocardium; volume-overloaded myocardium, which has an equal degree and duration of hypertrophy but normal functional and cytoskeletal properties, served as a control for any nonspecific growth-related effects. After cloning cDNA-encoding feline MAP4 and obtaining its deduced amino acid sequence, we characterized by mass spectrometry any site-specific MAP4 dephosphorylation. Solely in pressure overload-hypertrophied myocardium, we identified striking MAP4 dephosphorylation at Ser-472 in the MAP4 N-terminal projection domain and at Ser-924 and Ser-1056 in the assembly-promoting region of the C-terminal microtubule-binding domain. Site-directed mutagenesis of MAP4 cDNA was then used to switch each serine to non-phosphorylatable alanine. Wild-type and mutated cDNAs were used to construct adenoviruses; microtubule network density, stability, and MAP4 decoration were assessed in normal cardiocytes following an equivalent level of MAP4 expression. The Ser-924 → Ala MAP4 mutant produced a microtubule phenotype indistinguishable from that seen in pressure overload hypertrophy, such that Ser-924 MAP4 dephosphorylation during pressure overload hypertrophy may be central to this cytoskeletal abnormality. PMID:20436166
Genomic clones for human cholinesterase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kott, M.; Venta, P.J.; Larsen, J.
1987-05-01
A human genomic library was prepared from peripheral white blood cells from a single donor by inserting an MboI partial digest into BamHI poly-linker sites of EMBL3. This library was screened using an oligolabeled human cholinesterase cDNA probe over 700 bp long. The latter probe was obtained from a human basal ganglia cDNA library. Of approximately 2 million clones screened with high stringency conditions several positive clones were identified; two have been plaque purified. One of these clones has been partially mapped using restriction enzymes known to cut within the coded region of the cDNA for human serum cholinesterase. Hybridizationmore » of the fragments and their sizes are as expected if the genomic clone is cholinesterase. Sequencing of the DNA fragments in M13 is in progress to verify the identify of the clone and the location of introns.« less
Bai, W L; Yang, R J; Yin, R H; Jiang, W Q; Luo, G B; Yin, R L; Zhao, S J; Li, C; Zhao, Z H
2012-04-01
Osteopontin (OPN) is a secreted phosphorylated glycoprotein. It has an important role in mammary gland development and lactation, as well as, is thought to be a potential candidate gene for lactation traits. In the present work, we isolated and characterized a full-length open reading frame (ORF) of yak OPN cDNA from lactating mammary tissue, and examined its expression pattern in mammary gland during different stages of lactation, as well as, the recombinant OPN protein of yak was expressed successfully in E. coli. The sequencing results indicated that the isolated cDNA was 1132-bp in length containing a complete ORF of 837-bp. It encoded a precursor protein of yak OPN consisting of 278 amino acid with a signal peptide of 16 amino acids. Yak OPN has a predicted molecular mass of 29285.975 Da and an isoelectric point of 4.245. It had an identity of 65.50-99.16% in cDNA, identity of 52.06-98.56% and similarity of 65.40-98.56% in deduced amino acids with the corresponding sequences of cattle, buffalo, sheep, goat, pig, human, and rabbit. The phylogenetic analysis indicated that yak OPN had the closest evolutionary relationship with that of cattle, and next buffalo. In mammary gland, yak OPN was generally transcribed in a declining pattern from colostrum period to dry period with an apparent increase of OPN expression being present in the late period of lactation compared with peak period of lactation. Western blot analysis indicated that His-tagged yak OPN protein expressed in E. coli could be recognized not only by an anti-His-tag antibody but also by an anti-human OPN antibody. These results from the present work provided a foundation for further insight into the role of OPN gene in yak lactation.
Construction and application of a bovine immune-endocrine cDNA microarray.
Tao, Wenjing; Mallard, Bonnie; Karrow, Niel; Bridle, Byram
2004-09-01
A variety of commercial DNA arrays specific for humans and rodents are widely available; however, microarrays containing well-characterized genes to study pathway-specific gene expression are not as accessible for domestic animals, such as cattle, sheep and pigs. Therefore, a small-scale application-targeted bovine immune-endocrine cDNA array was developed to evaluate genetic pathways involved in the immune-endocrine axis of cattle during periods of altered homeostasis provoked by physiological or environmental stressors, such as infection, vaccination or disease. For this purpose, 167 cDNA sequences corresponding to immune, endocrine and inflammatory response genes were collected and categorized. Positive controls included 5 housekeeping genes (glyceraldehydes-3-phosphate dehydrogenase, hypoxanthine phosphoribosyltransferase, ribosomal protein L19, beta-actin, beta2-microglobulin) and bovine genomic DNA. Negative controls were a bacterial gene (Rhodococcus equi 17-kDa virulence-associated protein) and a partial sequence of the plasmid pACYC177. In addition, RNA extracted from un-stimulated, as well as superantigen (Staphylococcus aureus enterotoxin-A, S. aureus Cowan Pansorbin Cells) and mitogen-stimulated (LPS, ConA) bovine blood leukocytes was mixed, reverse transcribed and PCR amplified using gene-specific primers. The endocrine-associated genes were amplified from cDNA derived from un-stimulated bovine hypothalamus, pituitary, adrenal and thyroid gland tissues. The array was constructed in 4 repeating grids of 180 duplicated spots by coupling the PCR amplified 213-630 bp gene fragments onto poly-l-lysine coated glass slides. The bovine immune-endocrine arrays were standardized and preliminary gene expression profiles generated using Cy3 and Cy5 labelled cDNA from un-stimulated and ConA (5 microg/ml) stimulated PBMC of 4 healthy Holstein cows (2-4 replicate arrays/cow) in a time course study. Mononuclear cell-derived cytokine and chemokine (IL-2, IL-1alpha, TNFalpha, IFN-gamma, TGFbeta-1, MCP-1, MCP-2 and MIP-3alpha) mRNA exhibited a repeatable and consistently low expression in un-stimulated cells and at least a two-fold increased expression following 6 and 24 h ConA stimulation as compared to 0 h un-stimulated controls. In contrast, expression of antigen presenting molecules, MHC-DR, MHC-DQ and MHC-DY, were consistently at least two-fold lower following 6 and 24 h ConA stimulation. The only endocrine gene with differential expression following ConA stimulation was prolactin. Additionally, due to the high level of genetic homology between ovine, swine and bovine genes, RNA similarly acquired from sheep and pigs was evaluated and similar gene expression patterns were noted. These data demonstrate that this application-targeted array containing a set of well characterized genes can be used to determine the relative gene expression corresponding to immune-endocrine responses of cattle and related species, sheep and pigs.
Comparative gene expression in sexual and apomictic ovaries of Pennisetum ciliare (L.) Link.
Vielle-Calzada, J P; Nuccio, M L; Budiman, M A; Thomas, T L; Burson, B L; Hussey, M A; Wing, R A
1996-12-01
Limited emphasis has been given to the molecular study of apomixis, an asexual method of reproduction where seeds are produced without fertilization. Most buffelgrass (Pennisetum ciliare (L.) Link syn = Cenchrus ciliaris L.) genotypes reproduce by obligate apomixis (apospory); however, rare sexual plants have been recovered. A modified differential display procedure was used to compare gene expression in unpollinated ovaries containing ovules with either sexual or apomictic female gametophytes. The modification incorporated end-labeled poly(A)+ anchored primers as the only isotopic source, and was a reliable and consistent approach for detecting differentially displayed transcripts. Using 20 different decamers and two anchor primers, 2268 cDNA fragments between 200 and 600 bp were displayed. From these, eight reproducible differentially displayed cDNAs were identified and cloned. Based on northern analysis, one cDNA was detected in only the sexual ovaries, two cDNAs in only apomictic ovaries and one cDNA was present in both types of ovaries. Three fragments could not be detected and one fragment was detected in ovaries, stems, and leaves. Comparison of gene expression during sexual and apomictic development in buffelgrass represents a new model system and a strategy for investigating female reproductive development in the angiosperms.
Fu, L; Hou, Y L; Ding, X; Du, Y J; Zhu, H Q; Zhang, N; Hou, W R
2016-08-30
The complementary DNA (cDNA) of the giant panda (Ailuropoda melanoleuca) ferritin light polypeptide (FTL) gene was successfully cloned using reverse transcription-polymerase chain reaction technology. We constructed a recombinant expression vector containing FTL cDNA and overexpressed it in Escherichia coli using pET28a plasmids. The expressed protein was then purified by nickel chelate affinity chromatography. The cloned cDNA fragment was 580 bp long and contained an open reading frame of 525 bp. The deduced protein sequence was composed of 175 amino acids and had an estimated molecular weight of 19.90 kDa, with an isoelectric point of 5.53. Topology prediction revealed one N-glycosylation site, two casein kinase II phosphorylation sites, one N-myristoylation site, two protein kinase C phosphorylation sites, and one cell attachment sequence. Alignment indicated that the nucleotide and deduced amino acid sequences are highly conserved across several mammals, including Homo sapiens, Cavia porcellus, Equus caballus, and Felis catus, among others. The FTL gene was readily expressed in E. coli, which gave rise to the accumulation of a polypeptide of the expected size (25.50 kDa, including an N-terminal polyhistidine tag).
Vettore, André L.; da Silva, Felipe R.; Kemper, Edson L.; Souza, Glaucia M.; da Silva, Aline M.; Ferro, Maria Inês T.; Henrique-Silva, Flavio; Giglioti, Éder A.; Lemos, Manoel V.F.; Coutinho, Luiz L.; Nobrega, Marina P.; Carrer, Helaine; França, Suzelei C.; Bacci, Maurício; Goldman, Maria Helena S.; Gomes, Suely L.; Nunes, Luiz R.; Camargo, Luis E.A.; Siqueira, Walter J.; Van Sluys, Marie-Anne; Thiemann, Otavio H.; Kuramae, Eiko E.; Santelli, Roberto V.; Marino, Celso L.; Targon, Maria L.P.N.; Ferro, Jesus A.; Silveira, Henrique C.S.; Marini, Danyelle C.; Lemos, Eliana G.M.; Monteiro-Vitorello, Claudia B.; Tambor, José H.M.; Carraro, Dirce M.; Roberto, Patrícia G.; Martins, Vanderlei G.; Goldman, Gustavo H.; de Oliveira, Regina C.; Truffi, Daniela; Colombo, Carlos A.; Rossi, Magdalena; de Araujo, Paula G.; Sculaccio, Susana A.; Angella, Aline; Lima, Marleide M.A.; de Rosa, Vicente E.; Siviero, Fábio; Coscrato, Virginia E.; Machado, Marcos A.; Grivet, Laurent; Di Mauro, Sonia M.Z.; Nobrega, Francisco G.; Menck, Carlos F.M.; Braga, Marilia D.V.; Telles, Guilherme P.; Cara, Frank A.A.; Pedrosa, Guilherme; Meidanis, João; Arruda, Paulo
2003-01-01
To contribute to our understanding of the genome complexity of sugarcane, we undertook a large-scale expressed sequence tag (EST) program. More than 260,000 cDNA clones were partially sequenced from 26 standard cDNA libraries generated from different sugarcane tissues. After the processing of the sequences, 237,954 high-quality ESTs were identified. These ESTs were assembled into 43,141 putative transcripts. Of the assembled sequences, 35.6% presented no matches with existing sequences in public databases. A global analysis of the whole SUCEST data set indicated that 14,409 assembled sequences (33% of the total) contained at least one cDNA clone with a full-length insert. Annotation of the 43,141 assembled sequences associated almost 50% of the putative identified sugarcane genes with protein metabolism, cellular communication/signal transduction, bioenergetics, and stress responses. Inspection of the translated assembled sequences for conserved protein domains revealed 40,821 amino acid sequences with 1415 Pfam domains. Reassembling the consensus sequences of the 43,141 transcripts revealed a 22% redundancy in the first assembling. This indicated that possibly 33,620 unique genes had been identified and indicated that >90% of the sugarcane expressed genes were tagged. PMID:14613979
Trejo, Sebastián A; López, Laura M I; Caffini, Néstor O; Natalucci, Claudia L; Canals, Francesc; Avilés, Francesc X
2009-07-01
Asclepain f is a papain-like protease previously isolated and characterized from latex of Asclepias fruticosa. This enzyme is a member of the C1 family of cysteine proteases that are synthesized as preproenzymes. The enzyme belongs to the alpha + beta class of proteins, with two disulfide bridges (Cys22-Cys63 and Cys56-Cys95) in the alpha domain, and another one (Cys150-Cys201) in the beta domain, as was determined by molecular modeling. A full-length 1,152 bp cDNA was cloned by RT-RACE-PCR from latex mRNA. The sequence was predicted as an open reading frame of 340 amino acid residues, of which 16 residues belong to the signal peptide, 113 to the propeptide and 211 to the mature enzyme. The full-length cDNA was ligated to pPICZalpha vector and expressed in Pichia pastoris. Recombinant asclepain f showed endopeptidase activity on pGlu-Phe-Leu-p-nitroanilide and was identified by PMF-MALDI-TOF MS. Asclepain f is the first peptidase cloned and expressed from mRNA isolated from plant latex, confirming the presence of the preprocysteine peptidase in the latex.
Asamizu, E; Nakamura, Y; Sato, S; Tabata, S
2000-06-30
For comprehensive analysis of genes expressed in the model dicotyledonous plant, Arabidopsis thaliana, expressed sequence tags (ESTs) were accumulated. Normalized and size-selected cDNA libraries were constructed from aboveground organs, flower buds, roots, green siliques and liquid-cultured seedlings, respectively, and a total of 14,026 5'-end ESTs and 39,207 3'-end ESTs were obtained. The 3'-end ESTs could be clustered into 12,028 non-redundant groups. Similarity search of the non-redundant ESTs against the public non-redundant protein database indicated that 4816 groups show similarity to genes of known function, 1864 to hypothetical genes, and the remaining 5348 are novel sequences. Gene coverage by the non-redundant ESTs was analyzed using the annotated genomic sequences of approximately 10 Mb on chromosomes 3 and 5. A total of 923 regions were hit by at least one EST, among which only 499 regions were hit by the ESTs deposited in the public database. The result indicates that the EST source generated in this project complements the EST data in the public database and facilitates new gene discovery.
Sipka, Sándor; Zilahi, Erika; Papp, Gábor; Chen, Ji-Qing; Nagy, Andrea; Hegyi, Katalin; Kónya, József; Zeher, Margit
2017-05-01
We described earlier a simultaneously increased that the increased expression of miRNA-146a/b was accompanied by an increase in the expression of and TRAF6 and a decrease in the expression of IRAK1 genes in the peripheral mononuclear cells (PBMCs) of patients with primary Sjogren's syndrome (pSS) patients. Recently, the expression of EBV encoded. RNA (EBER) was published in the B cells of salivary glands of in pSS. In the present study, we applied an EBV-EBER1 specific synthetic single stranded complementary DNA molecule (EBV-EBER1-cDNA) to test whether any EBER1 related effect exists also in PBMCs of pSS patients. In the PBMCs of pSS patients and healthy controls, we investigated in vitro the effects of a synthetic single stranded EBV-EBER1-cDNA molecule, synthetic double-stranded (ds)RNA polyinosinic-polycytidylic acid [poly (I:C)] and polyadenylic acid potassium salt poly-adenylic acid [poly-(A)] on the expression of TRAF6 gene tested by qRTPCR. The release of interferon -α was detected by ELISA. EBV-EBER1-cDNA resulted in a significant reduction in the expression of TRAF6 in the cells of patients, but in the healthy controls not, whereas the treatments with poly (I:C) and poly-(A) could not reduce the TRAF6 over-expression. No release of EBER1 could be observed in the culture supernatants of patients with pSS. Only the treatment with poly (I:C) resulted in a significant increase of interferon -α release, and only in the heathy controls. No release of EBER1 molecules took place during the culturing of cells. EBV-EBER- cDNA acted functionally on the cells of patients only. These findings give a further evidence of the linkage between EBV and pSS, furthermore, they show the possible role of EBV-EBER1 in the induction of increased TRAF6 expression in the peripheral B cells of Sjögren's patients. © 2017 Asia Pacific League of Associations for Rheumatology and John Wiley & Sons Australia, Ltd.
Frame-Insensitive Expression Cloning of Fluorescent Protein from Scolionema suvaense.
Horiuchi, Yuki; Laskaratou, Danai; Sliwa, Michel; Ruckebusch, Cyril; Hatori, Kuniyuki; Mizuno, Hideaki; Hotta, Jun-Ichi
2018-01-26
Expression cloning from cDNA is an important technique for acquiring genes encoding novel fluorescent proteins. However, the probability of in-frame cDNA insertion following the first start codon of the vector is normally only 1/3, which is a cause of low cloning efficiency. To overcome this issue, we developed a new expression plasmid vector, pRSET-TriEX, in which transcriptional slippage was induced by introducing a DNA sequence of (dT) 14 next to the first start codon of pRSET. The effectiveness of frame-insensitive cloning was validated by inserting the gene encoding eGFP with all three possible frames to the vector. After transformation with one of these plasmids, E. coli cells expressed eGFP with no significant difference in the expression level. The pRSET-TriEX vector was then used for expression cloning of a novel fluorescent protein from Scolionema suvaense . We screened 3658 E. coli colonies transformed with pRSET-TriEX containing Scolionema suvaense cDNA, and found one colony expressing a novel green fluorescent protein, ScSuFP. The highest score in protein sequence similarity was 42% with the chain c of multi-domain green fluorescent protein like protein "ember" from Anthoathecata sp. Variations in the N- and/or C-terminal sequence of ScSuFP compared to other fluorescent proteins indicate that the expression cloning, rather than the sequence similarity-based methods, was crucial for acquiring the gene encoding ScSuFP. The absorption maximum was at 498 nm, with an extinction efficiency of 1.17 × 10⁵ M -1 ·cm -1 . The emission maximum was at 511 nm and the fluorescence quantum yield was determined to be 0.6. Pseudo-native gel electrophoresis showed that the protein forms obligatory homodimers.
Bovine mammary gene expression profiling during the onset of lactation.
Gao, Yuanyuan; Lin, Xueyan; Shi, Kerong; Yan, Zhengui; Wang, Zhonghua
2013-01-01
Lactogenesis includes two stages. Stage I begins a few weeks before parturition. Stage II is initiated around the time of parturition and extends for several days afterwards. To better understand the molecular events underlying these changes, genome-wide gene expression profiling was conducted using digital gene expression (DGE) on bovine mammary tissue at three time points (on approximately day 35 before parturition (-35 d), day 7 before parturition (-7 d) and day 3 after parturition (+3 d)). Approximately 6.2 million (M), 5.8 million (M) and 6.1 million (M) 21-nt cDNA tags were sequenced in the three cDNA libraries (-35 d, -7 d and +3 d), respectively. After aligning to the reference sequences, the three cDNA libraries included 8,662, 8,363 and 8,359 genes, respectively. With a fold change cutoff criteria of ≥ 2 or ≤-2 and a false discovery rate (FDR) of ≤ 0.001, a total of 812 genes were significantly differentially expressed at -7 d compared with -35 d (stage I). Gene ontology analysis showed that those significantly differentially expressed genes were mainly associated with cell cycle, lipid metabolism, immune response and biological adhesion. A total of 1,189 genes were significantly differentially expressed at +3 d compared with -7 d (stage II), and these genes were mainly associated with the immune response and cell cycle. Moreover, there were 1,672 genes significantly differentially expressed at +3 d compared with -35 d. Gene ontology analysis showed that the main differentially expressed genes were those associated with metabolic processes. The results suggest that the mammary gland begins to lactate not only by a gain of function but also by a broad suppression of function to effectively push most of the cell's resources towards lactation.
Di Gennaro, Simone; Ficca, Anna G; Panichi, Daniela; Poerio, Elia
2005-04-01
A cDNA encoding the proteinase inhibitor WSCI (wheat subtilisin/chymotrypsin inhibitor) was isolated by RT-PCR. Degenerate oligonucleotide primers were designed based on the amino acid sequence of WSCI and on the nucleotide sequence of the two homologous inhibitors (CI-2A and CI-2B) isolated from barley. For large-scale production, wsci cDNA was cloned into the E. coli vector pGEX-2T. The fusion protein GST-WSCI was efficiently produced in the bacterial expression system and, as the native inhibitor, was capable of inhibiting bacterial subtilisin, mammalian chymotrypsins and chymotrypsin-like activities present in crude extracts of a number of insect larvae ( Helicoverpa armigera , Plodia interpunctella and Tenebrio molitor ). The recombinant protein produced was also able to interfere with chymotrypsin-like activity isolated from immature wheat caryopses. These findings support a physiological role for this inhibitor during grain maturation.
Cloning and expression studies of the Dunaliella salina UDP-glucose dehydrogenase cDNA.
Qinghua, He; Dairong, Qiao; Qinglian, Zhang; Shunji, He; Yin, Li; Linhan, Bai; Zhirong, Yang; Yi, Cao
2005-06-01
The enzyme UDP-glucose dehydrogenase (EC 1.1.1.22) converts UDP-glucose to UDP-glucuronate. Plant UDP-glucose dehydrogenase (UGDH) is an important enzyme in the formation of hemicellulose and pectin, the components of primary cell walls. A cDNA, named DsUGDH, (GeneBank accession number: AY795899) corresponding to UGDH was cloned by RT-PCR approach from Dunaliella salina. The cDNA is 1941-bp long and has an open reading frame encoded a protein of 483 amino acids with a calculated molecular weight of 53 kDa. The derived amino acids sequence shows high homology with reported plants UGDHs, and has highly conserved amino acids motifs believed to be NAD binding site and catalytic site. Although UDP-glucose dehydrogenase is a comparatively well characterized enzyme, the cloning and characterization of the green alga Dunaliella salina UDP-glucose dehydrogenase gene is very important to understand the salt tolerance mechanism of Dunaliella salina. Northern analyses indicate that NaCl can induce the expression the DsUGDH.
Qin, Xiaobo; Lin, Fanrong; Lii, Yifan; Gou, Chunbao; Chen, Fang
2011-03-01
A cDNA clone designated arf1 was isolated from a physic nut (Jatropha curcas L.) endosperm cDNA library which encodes a small GTP-binding protein and has significant homology to ADP-ribosylation factors (ARF) in plants, animals and microbes. The cDNA contains an open reading frame that encodes a polypeptide of 181 amino acids with a calculated molecular mass of 20.7 kDa. The deduced amino acid sequence showed high homology to known ARFs from other organisms. The products of the arf1 obtained by overexpression in E. coli revealed the specific binding activity toward GTP. The expression of arf1 was observed in flowers, roots, stems and leaves as analyzed by RT-PCR, and its transcriptional level was highest in flowers. In particular, the accumulation of arf1 transcripts was different under various environmental stresses in seedlings. The results suggest that arf1 plays distinct physiological roles in Jatropha curcas cells.
Ichinose, H; Wariishi, H; Tanaka, H
2002-09-01
A cDNA encoding cytochrome P450 oxidoreductase (CPR) from the lignin-degrading basidiomycete Coriolus versicolor was identified using RT-PCR. The full-length cDNA consisted of 2,484 nucleotides with a poly(A) tail, and contained an open reading frame. The G+C content of the cDNA isolated was 60%. A deduced protein contained 730 amino acid residues with a calculated molecular weight of 80.7 kDa. The conserved amino acid residues involved in functional domains such as FAD-, FMN-, and NADPH-binding domains, were all found in the deduced protein. A phylogenetic analysis demonstrated that C. versicolor CPR is significantly similar to CPR of the basidiomycete Phanerochaete chrysosporium and that they share the same major branch in the fungal cluster. A recombinant CPR protein was expressed using a pET/ Escherichia coli system. The recombinant CPR protein migrated at 81 kDa on SDS polyacrylamide gel electrophoresis. It exhibited an NADPH-dependent cytochrome c reducing activity.
Alabadí, David; Carbonell, Juan
1998-01-01
A cDNA encoding for a functional ornithine decarboxylase has been isolated from a cDNA library of carpels of tomato (Lycopersicon esculentum Mill.). Ornithine decarboxylase in tomato is represented by a single-copy gene that we show to be up-regulated during early fruit growth induced by 2,4-dichlorophenoxyacetic acid and gibberellic acid. PMID:9733552
Ahmad, Muhammad Khairi; Tabana, Yasser M; Ahmed, Mowaffaq Adam; Sandai, Doblin Anak; Mohamed, Rafeezul; Ismail, Ida Shazrina; Zulkiflie, Nurulisa; Yunus, Muhammad Amir
2017-12-01
A norovirus maintains its viability, infectivity and virulence by its ability to replicate. However, the biological mechanisms of the process remain to be explored. In this work, the NanoLuc™ Luciferase gene was used to develop a reporter-tagged replicon system to study norovirus replication. The NanoLuc™ Luciferase reporter protein was engineered to be expressed as a fusion protein for MNV-1 minor capsid protein, VP2. The foot-and-mouth disease virus 2A (FMDV2A) sequence was inserted between the 3'end of the reporter gene and the VP2 start sequence to allow co-translational 'cleavage' of fusion proteins during intracellular transcript expression. Amplification of the fusion gene was performed using a series of standard and overlapping polymerase chain reactions. The resulting amplicon was then cloned into three readily available backbones of MNV-1 cDNA clones. Restriction enzyme analysis indicated that the NanoLucTM Luciferase gene was successfully inserted into the parental MNV-1 cDNA clone. The insertion was further confirmed by using DNA sequencing. NanoLuc™ Luciferase-tagged MNV-1 cDNA clones were successfully engineered. Such clones can be exploited to develop robust experimental assays for in vitro assessments of viral RNA replication.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Livi, G.P.; McHale, M.J.; Sathe, G.M.
1990-06-01
The authors have isolated cDNA clones representing cyclic AMP (cAMP)-specific phosphodiesterases (PDEases) from a human monocyte cDNA library. One cDNA clone (hPDE-1) defines a large open reading frame of ca. 2.1 kilobases, predicting a 686-amino-acid, ca. 77-kilodalton protein which contains significant homology to both rat brain and {ital Drosophila} cAMP PDEases, especially within an internal conserved domain of ca. 270 residues. Amino acid sequence divergence exists at the NH{sub 2} terminus and also within a 40- to 100-residue domain near the COOH-terminal end. hPDE-1 hybridizes to a major 4.8-kilobase mRNA transcript from both human monocytes and placenta. The coding regionmore » of hPDE-1 was engineered for expression in COS-1 cells, resulting in the overproduction of cAMP PDEase activity. The hPDE-1 recombinant gene product was identified as a low-{ital K{sub m}} cAMP phosphodiesterase on the basis of several biochemical properties including selective inhibition by the antidepressant drug rolipram. Known inhibitors of other PDEases (cGMP-specific PDEase, cGMP-inhibited PDEase) had little or no effect on the hPDE-1 recombinant gene product.« less
Dai, W; Pan, H; Hassanain, H; Gupta, S L; Murphy, M J
1994-03-01
Using a combination of polymerase chain reaction and conventional cDNA library screening approaches, we have cloned and characterized a putative receptor tyrosine kinase termed tif. The extracellular domain of tif has an immunoglobulin-like loop and a fibronectin type III structure. The intracellular domain contains a tyrosine kinase domain. Compared with ryk, a ubiquitously expressed receptor tyrosine kinase, tif expression is tissue-specific with human ovary and testis containing the highest amount of tif mRNA. Many other tested human tissues such as heart, liver, pancreas and thymus do not contain detectable levels of tif mRNA. The molecular cloning and characterization of tif cDNA will facilitate the identification of a potential ligand(s) for the putative receptor and the study of its biological role.
Rapid in silico cloning of genes using expressed sequence tags (ESTs).
Gill, R W; Sanseau, P
2000-01-01
Expressed sequence tags (ESTs) are short single-pass DNA sequences obtained from either end of cDNA clones. These ESTs are derived from a vast number of cDNA libraries obtained from different species. Human ESTs are the bulk of the data and have been widely used to identify new members of gene families, as markers on the human chromosomes, to discover polymorphism sites and to compare expression patterns in different tissues or pathologies states. Information strategies have been devised to query EST databases. Since most of the analysis is performed with a computer, the term "in silico" strategy has been coined. In this chapter we will review the current status of EST databases, the pros and cons of EST-type data and describe possible strategies to retrieve meaningful information.
McPhaul, M; Berg, P
1986-01-01
The rat asialoglycoprotein receptor (ASGP-R) has been expressed in cultured rat hepatoma cells (HTC cells) after transfection with cloned cDNAs. Fluorescence-activated cell sorting of transfected cells was used to identify the functional cDNA clones and to isolate cells expressing the ASGP-R. Simultaneous or sequential transfections with two cloned cDNAs that encode related but distinctive polypeptide chains were needed to obtain ASGP-R activity; transfection with either cDNA alone failed to produce detectable ASGP-R. The affinity of transduced ASGP-R for asialo orosomucoid is less than that of the native rat ASGP-R, and the number of surface receptors in clones expressing ASGP-R is about one-fifth that found on rat hepatocytes. Images PMID:3466162
Triazophos up-regulated gene expression in the female brown planthopper, Nilaparvata lugens.
Bao, Yan-Yuan; Li, Bao-Ling; Liu, Zhao-Bu; Xue, Jian; Zhu, Zeng-Rong; Cheng, Jia-An; Zhang, Chuan-Xi
2010-09-01
The widespread use of insecticides has caused the resurgence of the brown planthopper, Nilaparvata lugens, in Asia. In this study, we investigated an organo-phosphorous insecticide, triazophos, and its ability to induce gene expression variation in female N. lugens nymphs just before emergence. By using the suppression subtractive hybridization method, a triazophos-induced cDNA library was constructed. In total, 402 differentially expressed cDNA clones were obtained. Real-time qPCR analysis confirmed that triazophos up-regulated the expression of six candidate genes at the transcript level in nymphs on day 3 of the 5th instar. These genes encode N. lugens vitellogenin, bystin, multidrug resistance protein (MRP), purine nucleoside phosphorylase (PNP), pyrroline-5-carboxylate reductase (P5CR) and carboxylesterase. Our results imply that the up-regulation of these genes may be involved in the induction of N. lugens female reproduction or resistance to insecticides.
Laursen, J R; di Liu, H; Wu, X J; Yoshino, T P
1997-11-01
Sublethal heat-shock of cells of the Bge (Biomphalaria glabrata embryonic) snail cell line resulted in increased or new expression of metabolically labeled polypeptides of approximately 21.5, 41, 70, and 74 kDa molecular mass. Regulation of this response appeared to be at the transcriptional level since a similar protein banding pattern was seen upon SDS-PAGE/fluorographic analysis of polypeptides produced by in vitro translation of total RNA from cells subjected to heat shock. Using a yeast (Saccharomyces cerevisiae) 70-kDa heat-shock protein (HSP70) probe to screen a cDNA library from heat-treated Bge cells, we isolated a full-length cDNA clone encoding a putative Bge HSP70. The cDNA was 2453 bp in length and contained an open reading frame of 1908 bp encoding a 636-amino-acid polypeptide with calculated molecular mass of 70,740 Da. Comparison of a conserved region of 209 amino acid residues revealed > 80% identity between the deduced amino acid sequence of Bge HSP70 and that of yeast (81%), the human blood fluke Schistosoma mansoni (for which B. glabrata serves as intermediate host) (81%), Drosophila (81%), human (84%), and the marine gastropod Aplysia californica (88%, 90%). In addition to the extensive sharing of sequence homology, the identification of several eukaryotic HSP70 signature sequences and an N-linked glycosylation site characteristic of cytoplasmic HSPs strongly support the identity of the Bge cDNA as encoding an authentic HSP70. Results of a Northern blot analysis, using Bge HSP70 clone-specific probes, indicated that gene expression was heat inducible and not constitutively expressed. This is the first reported sequence of an inducible HSP70 from cells originating from a freshwater gastropod and provides a first step in the development of a genetic transformation system for molluscs of medical importance.
Friis, Thor Einar; Stephenson, Sally; Xiao, Yin; Whitehead, Jon
2014-01-01
The sheep (Ovis aries) is favored by many musculoskeletal tissue engineering groups as a large animal model because of its docile temperament and ease of husbandry. The size and weight of sheep are comparable to humans, which allows for the use of implants and fixation devices used in human clinical practice. The construction of a complimentary DNA (cDNA) library can capture the expression of genes in both a tissue- and time-specific manner. cDNA libraries have been a consistent source of gene discovery ever since the technology became commonplace more than three decades ago. Here, we describe the construction of a cDNA library using cells derived from sheep bones based on the pBluescript cDNA kit. Thirty clones were picked at random and sequenced. This led to the identification of a novel gene, C12orf29, which our initial experiments indicate is involved in skeletal biology. We also describe a polymerase chain reaction-based cDNA clone isolation method that allows the isolation of genes of interest from a cDNA library pool. The techniques outlined here can be applied in-house by smaller tissue engineering groups to generate tools for biomolecular research for large preclinical animal studies and highlights the power of standard cDNA library protocols to uncover novel genes. PMID:24447069
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wagner, B.J.; Long, L.; Pettenati, M.J.
Messenger RNAs encoding many oncoproteins and cytokines are relatively unstable. Their instability, which ensures appropriate levels and timing of expression, is controlled in part by proteins that bind to A + U-rich instability elements (AREs) present in the 3{prime}-untranslated regions of the mRNAs. cDNAs encoding the AUF1 family of ARE-binding proteins were cloned from human and murine cDNA libraries. In the present study monochromosomal somatic cell hybrids were used to localize two AUF1 loci to human chromosomes 4 and X. In situ hybridization analyses using P1 clones as probes identified the 4q21.1-q21.2 and Xq12 regions as the locations of themore » AUF1 genes. 10 refs., 2 figs.« less
Miao, Hong-Xia; Qin, Yong-Hua; Ye, Zi-Xing; Hu, Gui-Bing
2013-01-25
Ubiquitin-activating enzyme E1 (UBE1) catalyzes the first step in the ubiquitination reaction, which targets a protein for degradation via a proteasome pathway. UBE1 plays an important role in metabolic processes. In this study, full-length cDNA and DNA sequences of UBE1 gene, designated CrUBE1, were obtained from 'Wuzishatangju' (self-incompatible, SI) and 'Shatangju' (self-compatible, SC) mandarins. 5 amino acids and 8 bases were different in cDNA and DNA sequences of CrUBE1 between 'Wuzishatangju' and 'Shatangju', respectively. Southern blot analysis showed that there existed only one copy of the CrUBE1 gene in genome of 'Wuzishatangju' and 'Shatangju'. The temporal and spatial expression characteristics of the CrUBE1 gene were investigated using semi-quantitative RT-PCR (SqPCR) and quantitative real-time PCR (qPCR). The expression level of the CrUBE1 gene in anthers of 'Shatangju' was approximately 10-fold higher than in anthers of 'Wuzishatangju'. The highest expression level of CrUBE1 was detected in pistils at 7days after self-pollination of 'Wuzishatangju', which was approximately 5-fold higher than at 0 h. To obtain CrUBE1 protein, the full-length cDNA of CrUBE1 genes from 'Wuzishatangju' and 'Shatangju' were successfully expressed in Pichia pastoris. Pollen germination frequency of 'Wuzishatangju' was significantly inhibited with increasing of CrUBE1 protein concentrations from 'Wuzishatangju'. Copyright © 2012 Elsevier B.V. All rights reserved.
Su, Y; Feng, J; Sun, X; Guo, Z; Xu, L; Jiang, J
2013-01-01
Chemokines are small, secreted cytokine peptides, known principally for their ability to induce migration and activation of leukocyte populations under both pathological and physiological conditions. On the basis of previously constructed express sequence tags (ESTs) of the head kidney and spleen cDNA library of the perciform marine fish Rachycentron canadum (common name cobia). We used bi-directional rapid amplification of cDNA ends (RACE) and obtained a full-length cDNA of a new CC chemokine gene (designated RcCC3). The RcCC3 putative peptide exhibits sequence similarity to the group of CCL19/21/25 CC chemokines. The reverse transcription quantitative polymerase chain reaction (RT-qPCR) was used in transcript expression studies of RcCC3. We examined the constitutive expression of the transcripts in 12 tissues of non-stressed cobia; RcCC3 transcripts were detected in all tissues examined, with the highest expression in gill and liver, following by head kidney, kidney, spleen, skin, intestine, muscle, stomach, heart, blood and brain. Transcript expression of RcCC3 was examined in immune-related organs, including head kidney, spleen and liver, following intraperitoneal injection of phosphate-buffered saline control, polyriboinosinic polyribocytidylic acid (poly(I:C)) and formalin-killed Vibrio carchariae (bacterial vaccine). The transcripts in these tissues were quickly up-regulated by the injection of poly(I:C) and bacterial vaccine at early time points, although with different expression profiles. These results indicate RcCC3 represents an important component of innate immunity in cobia.
MORPHOLOGIC ANALYSIS CORRELATES WITH GENE EXPRESSION CHANGES IN CULTURED F344 RAT MESOTHELIAL CELLS
The gene expression pattern of mesothelial cells in vitro was determined after 4 or 12 h exposure to the rat mesothelial, kidney and thyroid carcinogen, and oxidative stressor potassium bromate (KBr03). Gene expression changes observed using cDNA arrays indicated oxidative stres...
Characterizing the stress/defense transcriptome of Arabidopsis
Mahalingam, Ramamurthy; Gomez-Buitrago, AnaMaria; Eckardt, Nancy; Shah, Nigam; Guevara-Garcia, Angel; Day, Philip; Raina, Ramesh; Fedoroff, Nina V
2003-01-01
Background To understand the gene networks that underlie plant stress and defense responses, it is necessary to identify and characterize the genes that respond both initially and as the physiological response to the stress or pathogen develops. We used PCR-based suppression subtractive hybridization to identify Arabidopsis genes that are differentially expressed in response to ozone, bacterial and oomycete pathogens and the signaling molecules salicylic acid (SA) and jasmonic acid. Results We identified a total of 1,058 differentially expressed genes from eight stress cDNA libraries. Digital northern analysis revealed that 55% of the stress-inducible genes are rarely transcribed in unstressed plants and 17% of them were not previously represented in Arabidopsis expressed sequence tag databases. More than two-thirds of the genes in the stress cDNA collection have not been identified in previous studies as stress/defense response genes. Several stress-responsive cis-elements showed a statistically significant over-representation in the promoters of the genes in the stress cDNA collection. These include W- and G-boxes, the SA-inducible element, the abscisic acid response element and the TGA motif. Conclusions The stress cDNA collection comprises a broad repertoire of stress-responsive genes encoding proteins that are involved in both the initial and subsequent stages of the physiological response to abiotic stress and pathogens. This set of stress-, pathogen- and hormone-modulated genes is an important resource for understanding the genetic interactions underlying stress signaling and responses and may contribute to the characterization of the stress transcriptome through the construction of standardized specialized arrays. PMID:12620105
Cloning and expression of a Ca(2+)-inhibitable adenylyl cyclase from NCB-20 cells.
Yoshimura, M; Cooper, D M
1992-01-01
A cDNA that encodes an adenylyl cyclase [ATP pyrophosphate-lyase (cyclizing), EC 4.6.1.1] has been cloned from NCB-20 cells, in which adenylyl cyclase activity is inhibited by Ca2+ at physiological concentrations. The cDNA clone (5.8 kilobases) was isolated by polymerase chain reaction (PCR) using degenerate primers designed by comparison of three adenylyl cyclase sequences (types I, II, and III) and subsequent library screening. Northern analysis revealed expression of mRNA (6.1 kilobases) corresponding to this cDNA in cardiac tissue, which is a prominent source of Ca(2+)-inhibitable adenylyl cyclase. The clone encodes a protein of 1165 amino acids, whose hydrophilicity profile was very similar to those of other mammalian adenylyl cyclases that have recently been cloned. A noticeable difference between this protein and other adenylyl cyclases was a lengthy aminoterminal region before the first transmembrane span. Transient expression of this cDNA in the human embryonic kidney cell line 293 revealed a 3-fold increase in cAMP production in response to forskolin compared with control transfected cells. In purified plasma membranes from transfected cells, increased adenylyl cyclase activity was also detected, which was susceptible to inhibition by submicromolar Ca2+. Thus, this adenylyl cyclase seems to represent the Ca(2+)-inhibitable form that is encountered in NCB-20 cells, cardiac tissue, and elsewhere. Its identification should permit a determination of the structural features that determine the mode of regulation of adenylyl cyclase by Ca2+. Images PMID:1379717
NASA Technical Reports Server (NTRS)
Wu, L. L.; Mitchell, J. P.; Cohn, N. S.; Kaufman, P. B.
1993-01-01
The invertase (EC 3.2.1.26) purified from cell walls of dwarf pea stems to homogeneity has a molecular mass of 64 kilodaltons (kD). Poly(A)+RNA was isolated from shoots of dwarf pea plants, and a cDNA library was constructed using lambda gt11 as an expression vector. The expression cDNA library was screened with polyclonal antibodies against pea cell wall invertase. One invertase cDNA clone was characterized as a full-length cDNA with 1,863 base pairs. Compared with other known invertases, one homologous region in the amino acid sequence was found. The conserved motif, Asn-Asp-Pro-Asn-Gly, is located near the N-terminal end of invertase. Northern blot analysis showed that the amount of invertase mRNA (1.86 kb) was rapidly induced to a maximal level 4 h after GA3 treatment, then gradually decreased to the control level. The mRNA level at 4 h in GA3-treated peas was fivefold higher than that of the control group. The maximal increase in activity of pea cell wall invertase elicited by GA3 occcured at 8 h after GA3 treatment. This invertase isoform was shown immunocytochemically to be localized in the cell walls, where a 10-fold higher accumulation occurred in GA3-treated tissue compared with control tissue. This study indicates that the expression of the pea shoot cell-wall invertase gene could be regulated by GA3 at transcriptional and/or translational levels.
Li, Juan; Zhou, Jiao; Sun, Rongbo; Zhang, Haolin; Zong, Shixiang; Luo, Youqing; Sheng, Xia; Weng, Qiang
2013-04-01
The PBAN (pheromone biosynthesis activating neuropeptide)/pyrokinin peptides comprise a major neuropeptide family characterized by a common FXPRL amide at the C-terminus. These peptides are actively involved in many essential endocrine functions. For the first time, we reported the cDNA cloning and sequence determination of the PBAN from the seabuckthorn carpenterworm, Holcocerus hippophaecolus, by using rapid amplification of cDNA ends. The full-length cDNA of Hh-DH-PBAN contained five peptides: diapause hormone (DH) homolog, α-neuropeptide (NP), β-NP, PBAN, and γ-NP. All of the peptides were amidated at their C-terminus and shared a conserved motif, FXPR (or K) L. Moreover, Hh-DH-PBAN had high homology to the other members of the PBAN peptide family: 56% with Manduca sexta, 66% with Bombyx mori, 77% with Helicoverpa zea, and 47% with Plutella xylostella. Phylogenetic analysis revealed that Hh-DH-PBAN was closely related to PBANs from Noctuidae, demonstrated by the relatively higher similarity compared with H. zea. In addition, real-time quantitative PCR (qRT-PCR) analysis showed that Hh-DH-PBAN mRNA expression peaked in the brain-subesophageal ganglion (Br-SOG) complex, and was also detected at high levels during larval and adult stages. The expression decreased significantly after pupation. These results provided information concerning molecular structure characteristics of Hh-DH-PBAN, whose expression profile suggested that the Hh-DH-PBAN gene might be correlated with larval development and sex pheromone biosynthesis in females of the H. hippophaecolus. 2013 Wiley Periodicals, Inc
Production of biologically active recombinant human factor H in Physcomitrella.
Büttner-Mainik, Annette; Parsons, Juliana; Jérôme, Hanna; Hartmann, Andrea; Lamer, Stephanie; Schaaf, Andreas; Schlosser, Andreas; Zipfel, Peter F; Reski, Ralf; Decker, Eva L
2011-04-01
The human complement regulatory serum protein factor H (FH) is a promising future biopharmaceutical. Defects in the gene encoding FH are associated with human diseases like severe kidney and retinal disorders in the form of atypical haemolytic uremic syndrome (aHUS), membranoproliferative glomerulonephritis II (MPGN II) or age-related macular degeneration (AMD). There is a current need to apply intact full-length FH for the therapy of patients with congenital or acquired defects of this protein. Application of purified or recombinant FH (rFH) to these patients is an important and promising approach for the treatment of these diseases. However, neither protein purified from plasma of healthy individuals nor recombinant protein is currently available on the market. Here, we report the first stable expression of the full-length human FH cDNA and the subsequent production of this glycoprotein in a plant system. The moss Physcomitrella patens perfectly suits the requirements for the production of complex biopharmaceuticals as this eukaryotic system not only offers an outstanding genetical accessibility, but moreover, proteins can be produced safely in scalable photobioreactors without the need for animal-derived medium compounds. Transgenic moss lines were created, which express the human FH cDNA and target the recombinant protein to the culture supernatant via a moss-derived secretion signal. Correct processing of the signal peptide and integrity of the moss-produced rFH were verified via peptide mapping by mass spectrometry. Ultimately, we show that the rFH displays complement regulatory activity comparable to FH purified from plasma. © 2010 The Authors. Plant Biotechnology Journal © 2010 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.
Schulmeister, Ulrike; Hochwallner, Heidrun; Swoboda, Ines; Focke-Tejkl, Margarete; Geller, Beate; Nystrand, Mats; Härlin, Annika; Thalhamer, Josef; Scheiblhofer, Sandra; Keller, Walter; Niggemann, Bodo; Quirce, Santiago; Ebner, Christoph; Mari, Adriano; Pauli, Gabrielle; Herz, Udo; Valenta, Rudolf; Spitzauer, Susanne
2009-06-01
Milk is one of the first components introduced into human diet. It also represents one of the first allergen sources, which induces IgE-mediated allergies in childhood ranging from gastrointestinal, skin, and respiratory manifestations to severe life-threatening manifestations, such as anaphylaxis. Here we isolated a cDNA coding for a major cow's milk allergen, alphaS1-casein, from a bovine mammary gland cDNA library with allergic patients' IgE Abs. Recombinant alphaS1-casein was expressed in Escherichia coli, purified, and characterized by circular dichroism as a folded protein. IgE epitopes of alphaS1-casein were determined with recombinant fragments and synthetic peptides spanning the alphaS1-casein sequence using microarrayed components and sera from 66 cow's milk-sensitized patients. The allergenic activity of ralphaS1-casein and the alphaS1-casein-derived peptides was determined using rat basophil leukemia cells transfected with human FcepsilonRI, which had been loaded with the patients' serum IgE. Our results demonstrate that ralphaS1-casein as well as alphaS1-casein-derived peptides exhibit IgE reactivity, but mainly the intact ralphaS1-casein induced strong basophil degranulation. These results suggest that primarily intact alphaS1-casein or larger IgE-reactive portions thereof are responsible for IgE-mediated symptoms of food allergy. Recombinant alphaS1-casein as well as alphaS1-casein-derived peptides may be used in clinical studies to further explore pathomechanisms of food allergy as well as for the development of new diagnostic and therapeutic strategies for milk allergy.
Skogsberg, J; Kannisto, K; Roshani, L; Gagne, E; Hamsten, A; Larsson, C; Ehrenborg, E
2000-07-01
Peroxisome proliferator activated receptors (PPARs) are nuclear receptors regulating the expression of genes involved in lipid and glucose metabolism. Three different PPARs; alpha (PPARA), gamma (PPARG) and delta (PPARD) have been characterized and they are distinguished from each other by tissue distribution and cell activation. In this study, the structure and detailed chromosomal localization of the human PPARD gene was determined. Three genomic clones containing the PPARD gene was isolated from a human P1 library. The gene spans approximately 85 kb of DNA and consists of 9 exons and 8 introns with exons ranging in size from 84 bp to 2.3 kb and introns ranging from 180 bp to 50 kb. All splice acceptor and donor sites conform to the consensus sequences including the AG-GT motif. Although PPARD lacks a TATA box, the gene is transcribed from a unique start site located 380 bp upstream of the ATG initiation codon. The 5' and 3' ends were mapped by rapid amplification of cDNA ends and the mRNA size of PPARD based upon the structure of the gene is 3803 bp. In addition, the chromosomal sublocalization of PPARD was determined by radiation hybrid mapping. The PPARD gene is located at 14 cR from the colipase gene and 15 cR from the serine kinase gene at chromosomal region 6p21.2.
Ma, Keyi; Liao, Minghui; Liu, Feng; Ye, Baoqing; Sun, Fei; Yue, Gen Hua
2016-01-01
Zinc finger AN1-type domain 3 (ZFAND3) is essential for spermatogenesis in mice. However, its function in teleosts remains unclear. In this study, we characterized the ZFAND3 gene (termed as OsZFAND3) in an important food fish, tilapia. The OsZFAND3 cDNA sequence is 1,050 bp in length, containing an ORF of 615 bp, which encodes a putative peptide of 204 amino acid residues. Quantitative real-time PCR revealed that the OsZFAND3 transcripts were exclusively expressed in the testis and ovary. In situ hybridization showed that the high expression of OsZFAND3 transcripts was predominantly localized in the spermatocyte and spermatid. These results suggest that OsZFAND3 is involved in male germ cell maturation. Three single nucleotide polymorphisms (SNPs) were detected in the introns of OsZFAND3. The OsZFAND3 gene was mapped in the sex-determining locus on linkage group 1 (LG1). The three SNPs in the OsZFAND3 gene were strictly associated with sex phenotype, suggesting that the OsZFAND3 gene is tightly linked to the sex-determining locus. Our study provides new insights into the functions of the OsZFAND3 gene in tilapia and a foundation for further detailed analysis of the OsZFAND3 gene in sex determination and differentiation. PMID:27137111
Thomason, Maureen K.; Bischler, Thorsten; Eisenbart, Sara K.; Förstner, Konrad U.; Zhang, Aixia; Herbig, Alexander; Nieselt, Kay
2014-01-01
While the model organism Escherichia coli has been the subject of intense study for decades, the full complement of its RNAs is only now being examined. Here we describe a survey of the E. coli transcriptome carried out using a differential RNA sequencing (dRNA-seq) approach, which can distinguish between primary and processed transcripts, and an automated prediction algorithm for transcriptional start sites (TSS). With the criterion of expression under at least one of three growth conditions examined, we predicted 14,868 TSS candidates, including 5,574 internal to annotated genes (iTSS) and 5,495 TSS corresponding to potential antisense RNAs (asRNAs). We examined expression of 14 candidate asRNAs by Northern analysis using RNA from wild-type E. coli and from strains defective for RNases III and E, two RNases reported to be involved in asRNA processing. Interestingly, nine asRNAs detected as distinct bands by Northern analysis were differentially affected by the rnc and rne mutations. We also compared our asRNA candidates with previously published asRNA annotations from RNA-seq data and discuss the challenges associated with these cross-comparisons. Our global transcriptional start site map represents a valuable resource for identification of transcription start sites, promoters, and novel transcripts in E. coli and is easily accessible, together with the cDNA coverage plots, in an online genome browser. PMID:25266388
Myozenin: An α-actinin- and γ-filamin-binding protein of skeletal muscle Z lines
Takada, Fumio; Woude, Douglas L. Vander; Tong, Hui-Qi; Thompson, Terri G.; Watkins, Simon C.; Kunkel, Louis M.; Beggs, Alan H.
2001-01-01
To better understand the structure and function of Z lines, we used sarcomeric isoforms of α-actinin and γ-filamin to screen a human skeletal muscle cDNA library for interacting proteins by using the yeast two-hybrid system. Here we describe myozenin (MYOZ), an α-actinin- and γ-filamin-binding Z line protein expressed predominantly in skeletal muscle. Myozenin is predicted to be a 32-kDa, globular protein with a central glycine-rich domain flanked by α-helical regions with no strong homologies to any known genes. The MYOZ gene has six exons and maps to human chromosome 10q22.1-q22.2. Northern blot analysis demonstrated that this transcript is expressed primarily in skeletal muscle with significantly lower levels of expression in several other tissues. Antimyozenin antisera stain skeletal muscle in a sarcomeric pattern indistinguishable from that seen by using antibodies for α-actinin, and immunogold electron microscopy confirms localization specifically to Z lines. Thus, myozenin is a skeletal muscle Z line protein that may be a good candidate gene for limb-girdle muscular dystrophy or other neuromuscular disorders. PMID:11171996
Characterization of gonadal transcriptomes from the turbot (Scophthalmus maximus).
Hu, Yulong; Huang, Meng; Wang, Weiji; Guan, Jiantao; Kong, Jie
2016-01-01
The mechanisms underlying sexual reproduction and sex ratio determination remains unclear in turbot, a flatfish of great commercial value. And there is limited information in the turbot database regarding genes related to the reproductive system. Here, we conducted high-throughput transcriptome profiling of turbot gonad tissues to better understand their reproductive functions and to supply essential gene sequence information for marker-assisted selection programs in the turbot industry. In this study, two gonad libraries representing sex differences in Scophthalmus maximus yielded 453 818 high-quality reads that were assembled into 24 611 contigs and 33 713 singletons by using 454 pyrosequencing, 13 936 contigs and singletons (CS) of which were annotated using BLASTx. GO (Gene Ontology) and KEGG (Kyoto Encyclopedia of Genes and Genomes) pathway analyses revealed that various biological functions and processes were associated with many of the annotated CS. Expression analyses showed that 510 genes were differentially expressed in males versus females; 80% of these genes were annotated. In addition, 6484 and 6036 single nucleotide polymorphisms (SNPs) were identified in male and female libraries, respectively. This transcriptome resource will serve as the foundation for cDNA or SNP microarray construction, gene expression characterization, and sex-specific linkage mapping in turbot.
Gene expression profiles in liver of mouse after chronic exposure to drinking water.
Wu, Bing; Zhang, Yan; Zhao, Dayong; Zhang, Xuxiang; Kong, Zhiming; Cheng, Shupei
2009-10-01
cDNA micorarray approach was applied to hepatic transcriptional profile analysis in male mouse (Mus musculus, ICR) to assess the potential health effects of drinking water in Nanjing, China. Mice were treated with continuous exposure to drinking water for 90 days. Hepatic gene expression was analyzed with Affymetrix Mouse Genome 430A 2.0 arrays, and pathway analysis was carried out by Molecule Annotation System 2.0 and KEGG pathway database. A total of 836 genes were found to be significantly altered (1.5-fold, P < or = 0.05), including 294 up-regulated genes and 542 down-regulated genes. According to biological pathway analysis, drinking water exposure resulted in aberration of gene expression and biological pathways linked to xenobiotic metabolism, signal transduction, cell cycle and oxidative stress response. Further, deregulation of several genes associated with carcinogenesis or tumor progression including Ccnd1, Egfr, Map2k3, Mcm2, Orc2l and Smad2 was observed. Although transcription changes in identified genes are unlikely to be used as a sole indicator of adverse health effects, the results of this study could enhance our understanding of early toxic effects of drinking water exposure and support future studies on drinking water safety.
Constructing and detecting a cDNA library for mites.
Hu, Li; Zhao, YaE; Cheng, Juan; Yang, YuanJun; Li, Chen; Lu, ZhaoHui
2015-10-01
RNA extraction and construction of complementary DNA (cDNA) library for mites have been quite challenging due to difficulties in acquiring tiny living mites and breaking their hard chitin. The present study is to explore a better method to construct cDNA library for mites that will lay the foundation on transcriptome and molecular pathogenesis research. We selected Psoroptes cuniculi as an experimental subject and took the following steps to construct and verify cDNA library. First, we combined liquid nitrogen grinding with TRIzol for total RNA extraction. Then, switching mechanism at 5' end of the RNA transcript (SMART) technique was used to construct full-length cDNA library. To evaluate the quality of cDNA library, the library titer and recombination rate were calculated. The reliability of cDNA library was detected by sequencing and analyzing positive clones and genes amplified by specific primers. The results showed that the RNA concentration was 836 ng/μl and the absorbance ratio at 260/280 nm was 1.82. The library titer was 5.31 × 10(5) plaque-forming unit (PFU)/ml and the recombination rate was 98.21%, indicating that the library was of good quality. In the 33 expressed sequence tags (ESTs) of P. cuniculi, two clones of 1656 and 1658 bp were almost identical with only three variable sites detected, which had an identity of 99.63% with that of Psoroptes ovis, indicating that the cDNA library was reliable. Further detection by specific primers demonstrated that the 553-bp Pso c II gene sequences of P. cuniculi had an identity of 98.56% with those of P. ovis, confirming that the cDNA library was not only reliable but also feasible.
Quantification of differential gene expression by multiplexed targeted resequencing of cDNA
Arts, Peer; van der Raadt, Jori; van Gestel, Sebastianus H.C.; Steehouwer, Marloes; Shendure, Jay; Hoischen, Alexander; Albers, Cornelis A.
2017-01-01
Whole-transcriptome or RNA sequencing (RNA-Seq) is a powerful and versatile tool for functional analysis of different types of RNA molecules, but sample reagent and sequencing cost can be prohibitive for hypothesis-driven studies where the aim is to quantify differential expression of a limited number of genes. Here we present an approach for quantification of differential mRNA expression by targeted resequencing of complementary DNA using single-molecule molecular inversion probes (cDNA-smMIPs) that enable highly multiplexed resequencing of cDNA target regions of ∼100 nucleotides and counting of individual molecules. We show that accurate estimates of differential expression can be obtained from molecule counts for hundreds of smMIPs per reaction and that smMIPs are also suitable for quantification of relative gene expression and allele-specific expression. Compared with low-coverage RNA-Seq and a hybridization-based targeted RNA-Seq method, cDNA-smMIPs are a cost-effective high-throughput tool for hypothesis-driven expression analysis in large numbers of genes (10 to 500) and samples (hundreds to thousands). PMID:28474677
Bhore, Subhash J; Kassim, Amelia; Loh, Chye Ying; Shah, Farida H
2010-01-01
It is well known that the nutritional quality of the American oil-palm (Elaeis oleifera) mesocarp oil is superior to that of African oil-palm (Elaeis guineensis Jacq. Tenera) mesocarp oil. Therefore, it is of important to identify the genetic features for its superior value. This could be achieved through the genome sequencing of the oil-palm. However, the genome sequence is not available in the public domain due to commercial secrecy. Hence, we constructed a cDNA library and generated expressed sequence tags (3,205) from the mesocarp tissue of the American oil-palm. We continued to annotate each of these cDNAs after submitting to GenBank/DDBJ/EMBL. A rough analysis turned our attention to the beta-carotene hydroxylase (Chyb) enzyme encoding cDNA. Then, we completed the full sequencing of cDNA clone for its both strands using M13 forward and reverse primers. The full nucleotide and protein sequence was further analyzed and annotated using various Bioinformatics tools. The analysis results showed the presence of fatty acid hydroxylase superfamily domain in the protein sequence. The multiple sequence alignment of selected Chyb amino acid sequences from other plant species and algal members with E. oleifera Chyb using ClustalW and its phylogenetic analysis suggest that Chyb from monocotyledonous plant species, Lilium hubrid, Crocus sativus and Zea mays are the most evolutionary related with E. oleifera Chyb. This study reports the annotation of E. oleifera Chyb. Abbreviations ESTs - expressed sequence tags, EoChyb - Elaeis oleifera beta-carotene hydroxylase, MC - main cluster PMID:21364789
Stec, James; Wang, Jing; Coombes, Kevin; Ayers, Mark; Hoersch, Sebastian; Gold, David L.; Ross, Jeffrey S; Hess, Kenneth R.; Tirrell, Stephen; Linette, Gerald; Hortobagyi, Gabriel N.; Symmans, W. Fraser; Pusztai, Lajos
2005-01-01
We examined how well differentially expressed genes and multigene outcome classifiers retain their class-discriminating values when tested on data generated by different transcriptional profiling platforms. RNA from 33 stage I-III breast cancers was hybridized to both Affymetrix GeneChip and Millennium Pharmaceuticals cDNA arrays. Only 30% of all corresponding gene expression measurements on the two platforms had Pearson correlation coefficient r ≥ 0.7 when UniGene was used to match probes. There was substantial variation in correlation between different Affymetrix probe sets matched to the same cDNA probe. When cDNA and Affymetrix probes were matched by basic local alignment tool (BLAST) sequence identity, the correlation increased substantially. We identified 182 genes in the Affymetrix and 45 in the cDNA data (including 17 common genes) that accurately separated 91% of cases in supervised hierarchical clustering in each data set. Cross-platform testing of these informative genes resulted in lower clustering accuracy of 45 and 79%, respectively. Several sets of accurate five-gene classifiers were developed on each platform using linear discriminant analysis. The best 100 classifiers showed average misclassification error rate of 2% on the original data that rose to 19.5% when tested on data from the other platform. Random five-gene classifiers showed misclassification error rate of 33%. We conclude that multigene predictors optimized for one platform lose accuracy when applied to data from another platform due to missing genes and sequence differences in probes that result in differing measurements for the same gene. PMID:16049308
Edvardsen, Rolf B; Malde, Ketil; Mittelholzer, Christian; Taranger, Geir Lasse; Nilsen, Frank
2011-03-01
The Atlantic cod, Gadus morhua, is an important species both for traditional fishery and increasingly also in fish farming. The Atlantic cod is also under potential threat from various environmental changes such as pollution and climate change, but the biological impact of such changes are not well known, in particular when it comes to sublethal effects that can be difficult to assert. Modern molecular and genomic approaches have revolutionized biological research during the last decade, and offer new avenues to study biological functions and e.g. the impact of anthropogenic activities at different life-stages for a given organism. In order to develop genomic data and genomic tools for Atlantic cod we conducted a program were we constructed 20 cDNA libraries, and produced and analyzed 44006 expressed sequence tags (ESTs) from these. Several tissues are represented in the multiple cDNA libraries, that differ in either sexual maturation or immulogical stimulation. This approach allowed us to identify genes that are expressed in particular tissues, life-stages or in response to specific stimuli, and also gives us information about potential functions of the transcripts. The ESTs were used to construct a 16k cDNA microarray to further investigate the cod transcriptome. Microarray analyses were preformed on pylorus, pituitary gland, spleen and testis of sexually maturing male cod. The four different tissues displayed tissue specific transcriptomes demonstrating that the cDNA array is working as expected and will prove to be a powerful tool in further experiments. Copyright © 2010 Elsevier Inc. All rights reserved.
Xu, Li; Ding, Zhi-Shan; Zhou, Yun-Kai; Tao, Xue-Fen
2009-06-01
To obtain the full-length cDNA sequence of Secoisolariciresinol Dehydrogenase gene from Dysosma versipellis by RACE PCR,then investigate the character of Secoisolariciresinol Dehydrogenase gene. The full-length cDNA sequence of Secoisolariciresinol Dehydrogenase gene was obtained by 3'-RACE and 5'-RACE from Dysosma versipellis. We first reported the full cDNA sequences of Secoisolariciresinol Dehydrogenase in Dysosma versipellis. The acquired gene was 991bp in full length, including 5' untranslated region of 42bp, 3' untranslated region of 112bp with Poly (A). The open reading frame (ORF) encoding 278 amino acid with molecular weight 29253.3 Daltons and isolectric point 6.328. The gene accession nucleotide sequence number in GeneBank was EU573789. Semi-quantitative RT-PCR analysis revealed that the Secoisolariciresinol Dehydrogenase gene was highly expressed in stem. Alignment of the amino acid sequence of Secoisolariciresinol Dehydrogenase indicated there may be some significant amino acid sequence difference among different species. Obtain the full-length cDNA sequence of Secoisolariciresinol Dehydrogenase gene from Dysosma versipellis.
Monoterpene engineering in a woody plant Eucalyptus camaldulensis using a limonene synthase cDNA.
Ohara, Kazuaki; Matsunaga, Etsuko; Nanto, Kazuya; Yamamoto, Kyoko; Sasaki, Kanako; Ebinuma, Hiroyasu; Yazaki, Kazufumi
2010-01-01
Metabolic engineering aimed at monoterpene production has become an intensive research topic in recent years, although most studies have been limited to herbal plants including model plants such as Arabidopsis. The genus Eucalyptus includes commercially important woody plants in terms of essential oil production and the pulp industry. This study attempted to modify the production of monoterpenes, which are major components of Eucalyptus essential oil, by introducing two expression constructs containing Perilla frutescens limonene synthase (PFLS) cDNA, whose gene products were designed to be localized in either the plastid or cytosol, into Eucalyptus camaldulensis. The expression of the plastid-type and cytosol-type PFLS cDNA in transgenic E. camaldulensis was confirmed by real-time polymerase chain reaction (PCR). Gas chromatography with a flame ionization detector analyses of leaf extracts revealed that the plastidic and cytosolic expression of PFLS yielded 2.6- and 4.5-times more limonene than that accumulated in wild-type E. camaldulensis, respectively, while the ectopic expression of PFLS had only a small effect on the emission of limonene from the leaves of E. camaldulensis. Surprisingly, the high level of PFLS in Eucalyptus was accompanied by a synergistic increase in the production of 1,8-cineole and alpha-pinene, two major components of Eucalyptus monoterpenes. This genetic engineering of monoterpenes demonstrated a new potential for molecular breeding in woody plants.
Gong, Ya-Nan; Li, Wei-Wei; Sun, Jiang-Ling; Ren, Fei; He, Lin; Jiang, Hui; Wang, Qun
2010-09-16
Fatty acid-binding proteins (FABPs), small cytosolic proteins that function in the uptake and utilization of fatty acids, have been extensively studied in higher vertebrates while invertebrates have received little attention despite similar nutritional requirements during periods of reproductive activity. Therefore, a cDNA encoding Eriocheir sinensis FABP (Es-FABP) was cloned based upon EST analysis of a hepatopancreas cDNA library. The full length cDNA was 750 bp and encoded a 131 aa polypeptide that was highly homologous to related genes reported in shrimp. The 9108 bp Es-FABP gene contained four exons that were interrupted by three introns, a genomic organization common among FABP multigene family members in vertebrates. Gene expression analysis, as determined by RT-PCR, revealed the presence of Es-FABP transcripts in hepatopancreas, hemocytes, ovary, gills, muscle, thoracic ganglia, heart, and intestine, but not stomach or eyestalk. Real-time quantitative RT-PCR analysis revealed that Es-FABP expression in ovary, hemocytes, and hepatopancreas was dependent on the status of ovarian development, with peak expression observed in January. Evidence provided in the present report supports a role of Es-FABP in lipid transport during the period of rapid ovarian growth in E. sinensis, and indirectly confirms the participation of the hepatopancreas, ovary, and hemocytes in lipid nutrient absorption and utilization processes.
Hussey, Richard S; Huang, Guozhong; Allen, Rex
2011-01-01
Identifying parasitism genes encoding proteins secreted from a plant-parasitic nematode's esophageal gland cells and injected through its stylet into plant tissue is the key to understanding the molecular basis of nematode parasitism of plants. Parasitism genes have been cloned by directly microaspirating the cytoplasm from the esophageal gland cells of different parasitic stages of cyst or root-knot nematodes to provide mRNA to create a gland cell-specific cDNA library by long-distance reverse-transcriptase polymerase chain reaction. cDNA clones are sequenced and deduced protein sequences with a signal peptide for secretion are identified for high-throughput in situ hybridization to confirm gland-specific expression.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yoshida, Michihiro C.; Wada, Makio; Satoh, Hitoshi
1988-07-01
The human HST1 gene, previously designated the hst gene, and now assigned the name HSTF1 for heparin-binding secretory transforming factor in human gene nomenclature, was originally identified as a transforming gene in DNAs from human stomach cancers by transfection assay with mouse NIH 3T3 cells. The amino acid sequence of the product deduced from DNA sequences of the HST1 cDNA and genomic clones had approximately 40% homology to human basic and acidic fibroblast growth factors and mouse Int-2-encoded protein. The authors have mapped the human HST1 gene to chromosome 11 at band q13.3 by Southern blot hybridization analysis of amore » panel of human and mouse somatic cell hybrids and in situ hybridization with an HST1 cDNA probe. The HST1 gene was found to be amplified in DNAs obtained from a stomach cancer and a vulvar carcinoma cell line, A431. In all of these samples of DNA, the INT2 gene, previously mapped to human chromosome 11q13, was also amplified to the same degree as the HST1 gene.« less
Hill, M. Garry; Wurms, Kirstin V.; Davy, Marcus W.; Gould, Elaine; Allan, Andrew; Mauchline, Nicola A.; Luo, Zhiwei; Ah Chee, Annette; Stannard, Kate; Storey, Roy D.; Rikkerink, Erik H.
2015-01-01
The kiwifruit cultivar Actinidia chinensis ‘Hort16A’ is resistant to the polyphagous armoured scale insect pest Hemiberlesia lataniae (Hemiptera: Diaspididae). A cDNA microarray consisting of 17,512 unigenes selected from over 132,000 expressed sequence tags (ESTs) was used to measure the transcriptomic profile of the A. chinensis ‘Hort16A’ canes in response to a controlled infestation of H. lataniae. After 2 days, 272 transcripts were differentially expressed. After 7 days, 5,284 (30%) transcripts were differentially expressed. The transcripts were grouped into 22 major functional categories using MapMan software. After 7 days, transcripts associated with photosynthesis (photosystem II) were significantly down-regulated, while those associated with secondary metabolism were significantly up-regulated. A total of 643 transcripts associated with response to stress were differentially expressed. This included biotic stress-related transcripts orthologous with pathogenesis related proteins, the phenylpropanoid pathway, NBS-LRR (R) genes, and receptor-like kinase–leucine rich repeat signalling proteins. While transcriptional studies are not conclusive in their own right, results were suggestive of a defence response involving both ETI and PTI, with predominance of the SA signalling pathway. Exogenous application of an SA-mimic decreased H. lataniae growth on A. chinensis ‘Hort16A’ plants in two laboratory experiments. PMID:26571404
Yoshida, S; Arakawa, F; Higuchi, F; Ishibashi, Y; Goto, M; Sugita, Y; Nomura, Y; Niino, D; Shimizu, K; Aoki, R; Hashikawa, K; Kimura, Y; Yasuda, K; Tashiro, K; Kuhara, S; Nagata, K; Ohshima, K
2012-01-01
Objectives The main histological change in rheumatoid arthritis (RA) is the villous proliferation of synovial lining cells, an important source of cytokines and chemokines, which are associated with inflammation. The aim of this study was to evaluate gene expression in the microdissected synovial lining cells of RA patients, using those of osteoarthritis (OA) patients as the control. Methods Samples were obtained during total joint replacement from 11 RA and five OA patients. Total RNA from the synovial lining cells was derived from selected specimens by laser microdissection (LMD) for subsequent cDNA microarray analysis. In addition, the expression of significant genes was confirmed immunohistochemically. Results The 14 519 genes detected by cDNA microarray were used to compare gene expression levels in synovial lining cells from RA with those from OA patients. Cluster analysis indicated that RA cells, including low- and high-expression subgroups, and OA cells were stored in two main clusters. The molecular activity of RA was statistically consistent with its clinical and histological activity. Expression levels of signal transducer and activator of transcription 1 (STAT1), interferon regulatory factor 1 (IRF1), and the chemokines CXCL9, CXCL10, and CCL5 were statistically significantly higher in the synovium of RA than in that of OA. Immunohistochemically, the lining synovium of RA, but not that of OA, clearly expressed STAT1, IRF1, and chemokines, as was seen in microarray analysis combined with LMD. Conclusions Our findings indicate an important role for lining synovial cells in the inflammatory and proliferative processes of RA. Further understanding of the local signalling in structural components is important in rheumatology. PMID:22401175
Blanchard, Raymond K.; Moore, J. Bernadette; Green, Calvert L.; Cousins, Robert J.
2001-01-01
Mammalian nutritional status affects the homeostatic balance of multiple physiological processes and their associated gene expression. Although DNA array analysis can monitor large numbers of genes, there are no reports of expression profiling of a micronutrient deficiency in an intact animal system. In this report, we have tested the feasibility of using cDNA arrays to compare the global changes in expression of genes of known function that occur in the early stages of rodent zinc deficiency. The gene-modulating effects of this deficiency were demonstrated by real-time quantitative PCR measurements of altered mRNA levels for metallothionein 1, zinc transporter 2, and uroguanylin, all of which have been previously documented as zinc-regulated genes. As a result of the low level of inherent noise within this model system and application of a recently reported statistical tool for statistical analysis of microarrays [Tusher, V.G., Tibshirani, R. & Chu, G. (2001) Proc. Natl. Acad. Sci. USA 98, 5116–5121], we demonstrate the ability to reproducibly identify the modest changes in mRNA abundance produced by this single micronutrient deficiency. Among the genes identified by this array profile are intestinal genes that influence signaling pathways, growth, transcription, redox, and energy utilization. Additionally, the influence of dietary zinc supply on the expression of some of these genes was confirmed by real-time quantitative PCR. Overall, these data support the effectiveness of cDNA array expression profiling to investigate the pleiotropic effects of specific nutrients and may provide an approach to establishing markers for assessment of nutritional status. PMID:11717422
Rampuria, Sakshi; Joshi, Uma; Palit, Paramita; Deokar, Amit A; Meghwal, Raju R; Mohapatra, T; Srinivasan, R; Bhatt, K V; Sharma, Ramavtar
2012-11-01
Moth bean ( Vigna aconitifolia (Jacq.) Marechal) is an important grain legume crop grown in rain fed areas of hot desert regions of Thar, India, under scorching sun rays with very little supplementation of water. An SSH cDNA library was generated from leaf tissues of V. aconitifolia var. RMO-40 exposed to an elevated temperature of 42 °C for 5 min to identify early-induced genes. A total of 488 unigenes (114 contigs and 374 singletons) were derived by cluster assembly and sequence alignment of 738 ESTs; out of 206 ESTs (28%) of unknown proteins, 160 ESTs (14%) were found to be novel to moth bean. Only 578 ESTs (78%) showed significant BLASTX similarity (<1 × 10(-6)) in the NCBI non-redundant database. Gene ontology functional classification terms were retrieved for 479 (65%) sequences, and 339 sequences were annotated with 165 EC codes and mapped to 68 different KEGG pathways. Four hundred and fifty-two ESTs were further annotated with InterProScan (IPS), and no IPS was assigned to 153 ESTs. In addition, the expression level of 27 ESTs in response to heat stress was evaluated through semiquantitative RT-PCR assay. Approximately 20 different signaling genes and 16 different transcription factors have been shown to be associated with heat stress in moth bean for the first time.
Curbo, Sophie; Lagier-Tourenne, Clotilde; Carrozzo, Rosalba; Palenzuela, Lluis; Lucioli, Simona; Hirano, Michio; Santorelli, Filippo; Arenas, Joaquin; Karlsson, Anna; Johansson, Magnus
2006-03-01
Pyrophosphatases (PPases) catalyze the hydrolysis of inorganic pyrophosphate generated in several cellular enzymatic reactions. A novel human pyrophosphatase cDNA encoding a 334-amino-acid protein approximately 60% identical to the previously identified human cytosolic PPase was cloned and characterized. The novel enzyme, named PPase-2, was enzymatically active and catalyzed hydrolysis of pyrophosphate at a rate similar to that of the previously identified PPase-1. A functional mitochondrial import signal sequence was identified in the N-terminus of PPase-2, which targeted the enzyme to the mitochondrial matrix. The human pyrophosphatase 2 gene (PPase-2) was mapped to chromosome 4q25 and the 1.4-kb mRNA was ubiquitously expressed in human tissues, with highest levels in muscle, liver, and kidney. The yeast homologue of the mitochondrial PPase-2 is required for mitochondrial DNA maintenance and yeast cells lacking the enzyme exhibit mitochondrial DNA depletion. We sequenced the PPA2 gene in 13 patients with mitochondrial DNA depletion syndromes (MDS) of unknown cause to determine if mutations in the PPA2 gene of these patients were associated with this disease. No pathogenic mutations were identified in the PPA2 gene of these patients and we found no evidence that PPA2 gene mutations are a common cause of MDS in humans.
Chernicky, C L; Tan, H; Burfeind, P; Ilan, J; Ilan, J
1996-02-01
There are several cell types within the placenta that produce cytokines which can contribute to the regulatory mechanisms that ensure normal pregnancy. The immunological milieu at the maternofetal interface is considered to be crucial for survival of the fetus. Interleukin-2 (IL-2) is expressed by the syncytiotrophoblast, the cell layer between the mother and the fetus. IL-2 appears to be a key factor in maintenance of pregnancy. Therefore, it was important to determine the sequence of human placental interleukin-2. Direct sequencing of human placental IL-2 cDNA was determined for the coding region. Subclone sequencing was carried out for the 5'- and 3'-untranslated regions (5'-UTR and 3'-UTR). The 5'-UTR for human placental IL-2 cDNA is 294 bp, which is 247 nucleotides longer than that reported for cDNA IL-2 derived from T cells. The sequence of the coding region is identical to that reported for T cell IL-2, while sequence analysis of the polymerase chain reaction (PCR) product showed that the cDNA from the 3' end was the same as that reported for cDNA from T cells. Human placental IL-2 cDNA is 1,028 base pairs (excluding the poly A tail), which is 247 bp longer at the 5' end than that reported for IL-2 T cell cDNA. Therefore, the extended 5'-UTR of the placental IL-2 cDNA may be a consequence of alternative promoter utilization in the placenta.
Isolation of a cDNA Encoding a Granule-Bound 152-Kilodalton Starch-Branching Enzyme in Wheat1
Båga, Monica; Nair, Ramesh B.; Repellin, Anne; Scoles, Graham J.; Chibbar, Ravindra N.
2000-01-01
Screening of a wheat (Triticum aestivum) cDNA library for starch-branching enzyme I (SBEI) genes combined with 5′-rapid amplification of cDNA ends resulted in isolation of a 4,563-bp composite cDNA, Sbe1c. Based on sequence alignment to characterized SBEI cDNA clones isolated from plants, the SBEIc predicted from the cDNA sequence was produced with a transit peptide directing the polypeptide into plastids. Furthermore, the predicted mature form of SBEIc was much larger (152 kD) than previously characterized plant SBEI (80–100 kD) and contained a partial duplication of SBEI sequences. The first SBEI domain showed high amino acid similarity to a 74-kD wheat SBEI-like protein that is inactive as a branching enzyme when expressed in Escherichia coli. The second SBEI domain on SBEIc was identical in sequence to a functional 87-kD SBEI produced in the wheat endosperm. Immunoblot analysis of proteins produced in developing wheat kernels demonstrated that the 152-kD SBEIc was, in contrast to the 87- to 88-kD SBEI, preferentially associated with the starch granules. Proteins similar in size and recognized by wheat SBEI antibodies were also present in Triticum monococcum, Triticum tauschii, and Triticum turgidum subsp. durum. PMID:10982440
Chen, Ding-Ping; Tseng, Ching-Ping; Lin, Chi-Jui; Wang, Wei-Ting; Sun, Chien-Feng
2015-01-01
In the case of blood type B3 with typical mixed-field agglutination of RBCs in the presence of anti-B or anti-AB antibody, a number of genetic alternations have been reported. It is well known that the IVS3+5G→A mutation in the B gene destroys the consensus of the splice donor site leading to exon 3 skipping during mRNA splicing. The lack of exon 3 likely causes a short stem region, producing an unstable B3 protein, and is concomitant with a decrease in B3 protein expression. Whether the phenomenon also appears in the type A blood group is of question. In this study, we evaluate whether exon 3 deletion in the blood type A gene also results in mixed-field phenotype. Site-directed mutagenesis was used to generate cDNA encoding A1 gene with exon 3 deletion. The cDNA was stably expressed in K562 cells. The expression of A antigen was compared with expression in parental K562 cells that did not express A antigen and in the stable K562 cell line expressing A(1) cDNA by flow cytometry analyses. The expression of A antigen in A1 stable cells and parental K562 cells was set as 100% and 0%, respectively. The mean relative percentage of A antigen expression for the cells of A1 with exon 3 deletion was 59.9% of A1 stable cells. Consistent with the observations of B3, which is B gene with exon 3 deletion, mixed field agglutination was observed for the cells expressing A1 with exon 3 deletion. Exon 3 deletion results in mixed field phenotype in both type A and B RBCs. However, the degree of antigen expression change for exon 3 deletion in A gene was less severe when compared with the deletion occurred in B gene. © 2015 by the Association of Clinical Scientists, Inc.
Xu, Yipeng; Zheng, Guowan; Dong, Shengzhang; Liu, Guangfu; Yu, Xiaoping
2014-12-01
The golden apple snail, Pomacea canaliculata, has strong tolerance to high temperature, facilitating its invasion in East and Southeast Asia. In the present study, three cDNAs encoding heat shock proteins (PocaHSP60, PocaHSP70, PocaHSP90) in P. canaliculata were cloned and characterized. The PocaHSP60 cDNA was 2447 bp, containing an ORF encoding a polypeptide of 574 amino acids. The PocaHSP70 cDNA was 2644 bp, containing an ORF encoding a polypeptide of 643 amino acids. The PocaHSP90 cDNA was 2546 bp, containing an ORF encoding a polypeptide of 726 amino acids. Genomic DNA analysis showed that PocaHSP60 had 11 introns in the coding region and PocaHSP90 had 7 introns but PocaHSP70 had no one. The expression changes of these three PocaHSPs in the gill, digestive gland, kidney and foot muscle of P. canaliculata exposed to high and low temperature were investigated. The results of quantitative PCR and western blotting showed that the expression level of PocaHSP90 was much higher than PocaHSP60 and PocaHSP70 at room temperature, and PocaHSP70 expression level was the lowest among them. Afterheat shock, PocaHSP70 expression increased rapidly, much more significantly than PocaHSP90 expression, and the effect of heat shock on the expression of PocaHSP70 and PocaHSP90 in the different tissues of P. canaliculata was not the same. Unlike PocaHSP70 and PocaHSP90, PocaHSP60 expression seemed not to be affected by heat shock, because its expression was moderately induced only in the foot muscle. However, cool shock had little effect on the expression change of above three PocaHSPs. These results indicated that HSPs might be related to the thermal resistance of P. canaliculata.
Planarian homolog of puromycin-sensitive aminopeptidase DjPsa is required for brain regeneration.
Wu, Suge; Liu, Bin; Yuan, Zuoqing; Zhang, Xiufang; Liu, Hong; Pang, Qiuxiang; Zhao, Bosheng
2017-06-01
Puromycin-sensitive aminopeptidase (PSA) belongs to the M1 zinc metallopeptidase family. PSA is the most abundant aminopeptidase in the brain and plays a role in the metabolism of neuropeptides including those involved in neurodegeneration. A cDNA DjPsa was identified from the planarian Dugesia japonica cDNA library. It contains a 639-bp open reading frame corresponding to a deduced protein of 212 amino acids. Whole mount in situ hybridization revealed that DjPsa is expressed in the brain and ventral nerve cords of intact and regenerating animals and demonstrates a tissue and stage-specific expression pattern of DjPsa in developing embryos and larvae. Knocking down DjPsa gene expression with RNA interference during planarian regeneration inhibits the brain reformation completely. The results suggest that DjPsa is required for planarian brain regeneration.
Lin, Hui-Jun; Viswanath, Kotapati Kasi; Lin, Chih-Peng; Chang, Bill Chia-Han; Chiu, Pei-Hsun; Chiu, Chan-Tai; Wang, Ren-Huang; Chin, Shih-Wen; Chen, Fure-Chyi
2018-01-01
Carica papaya L. is an important economic crop worldwide and is used as a model plant for sex-determination research. To study the different flower sex types, we screened sex-related genes using alternative splicing sequences (AS-seqs) from a transcriptome database of the three flower sex types, i.e., males, females, and hermaphrodites, established at 28 days before flowering using 15 bacterial artificial chromosomes (BACs) of C. papaya L. After screening, the cDNA regions of the three sex-related loci, including short vegetative phase-like (CpSVPL), the chromatin assembly factor 1 subunit A-like (CpCAF1AL), and the somatic embryogenesis receptor kinase (CpSERK), which contained eight sex-related single-nucleotide polymorphisms (SNPs) from the different sex types of C. papaya L., were genotyped using high-resolution melting (HRM). The three loci were examined regarding the profiles of the third whorl, as described below. CpSVPL, which had one SNP associated with the three sex genotypes, was highly expressed in the male and female sterile flowers (abnormal hermaphrodite flowers) that lacked the fourth whorl structure. CpCAF1AL, which had three SNPs associated with the male genotype, was highly expressed in male and normal hermaphrodite flowers, and had no AS-seqs, whereas it exhibited low expression and an AS-seqs in intron 11 in abnormal hermaphrodite flowers. Conversely, carpellate flowers (abnormal hermaphrodite flowers) showed low expression of CpSVPL and AS-seqs in introns 5, 6, and 7 of CpSERK, which contained four SNPs associated with the female genotype. Specifically, the CpSERK and CpCAF1AL loci exhibited no AS-seq expression in the third whorl of the male and normal hermaphrodite flowers, respectively, and variance in the AS-seq expression of all other types of flowers. Functional mapping of the third whorl of normal hermaphrodites indicated no AS-seq expression in CpSERK, low CpSVPL expression, and, for CpCAF1AL, high expression and no AS-seq expression on XYh-type chromosomes. PMID:29566053
Bae, S; Seong, J; Paik, Y
2001-01-01
Sterol Delta(8)-isomerase (SI) (EC 5.3.3.5), also known as emopamil binding protein or sigma receptor, catalyses the conversion of the 8-ene isomer into the 7-ene isomer in the cholesterol biosynthetic pathway in mammals. Recently, mutations of SI have been found to be associated with Conradi-Hünermann syndrome in humans. To investigate the in vitro and in vivo modes of molecular regulation of SI and its role in cholesterol biosynthesis in mammals, we isolated a full-length cDNA encoding rat SI. The deduced amino-acid sequence of rat SI predicts a 230-residue protein (26737 Da) with 87% and 80% amino-acid identity to mouse and human counterparts. The rat SI gene was mapped to chromosome 12q1.2 using fluorescence in situ hybridization (FISH). The biological function of the cloned rat SI cDNA was verified by overexpressing recombinant Myc-SI in Saccharomyces cerevisiae. It showed a characteristic pattern of inhibition on exposure to trans-2-[4-(1,2-diphenylbuten-1-yl)phenoxy]-N,N-dimethylethylamine (tamoxifen; IC(50)=11.2 microM) and 3beta-[2-(diethylamino)ethoxy]androst-5-en-17-one (U18666A; IC(50)=4.2 microM), two well known potent inhibitors of SI. Northern-blot analysis of 3-week-old rats compared with 2-year-old rats showed that SI mRNA expression in both age groups was restricted to liver, where a 70% reduction in mRNA levels was observed in 2-year-old rats. The FISH studies revealed ubiquitous expression of SI mRNA in rat hepatocytes. The in vitro studies showed that the SI mRNA was highly suppressed by 25-hydroxycholesterol in H4IIE cells. Treatment of H4IIE cells grown in medium supplemented with fetal bovine serum with tamoxifen for 24 h resulted in a dose-dependent induction of SI mRNA, with a concomitant suppression of sterol regulatory element binding protein-1 mRNA. Interestingly, this effect was not seen in emopamil-treated cells. The in vivo experiments also indicate that both mRNA expression and enzymic activity of SI in liver were induced approx. 3-fold in rats fed 5% (w/w) cholestyramine plus 0.1% (w/w) lovastatin in normal chow for 2 weeks. With this newly cloned rat SI cDNA, it becomes possible to gain molecular understanding of previously unknown and tamoxifen-mediated gene regulation of SI that is involved in cholesterol metabolism, ischaemia and genetic diseases. PMID:11171067
Hook, Sharon E; Skillman, Ann D; Small, Jack A; Schultz, Irvin R
2006-07-01
Determining how gene expression profiles change with toxicant dose will improve the utility of arrays in identifying biomarkers and modes of toxic action. Isogenic rainbow trout, Oncorhyncus mykiss,were exposed to 10, 50 or 100 ng/L ethynylestradiol (a xeno-estrogen) for 7 days. Following exposure hepatic RNA was extracted. Fluorescently labeled cDNA were generated and hybridized against a commercially available Atlantic Salmon/Trout array (GRASP project, University of Victoria) spotted with 16,000 cDNAs. Transcript expression in treated vs control fish was analyzed via Genespring (Silicon Genetics) to identify genes with altered expression, as well as to determine gene clustering patterns that can be used as "expression signatures". Array results were confirmed via qRT PCR. Our analysis indicates that gene expression profiles varied somewhat with dose. Established biomarkers of exposure to estrogenic chemicals, such as vitellogenin, vitelline envelope proteins, and the estrogen receptor alpha, were induced at every dose. Other genes were dose specific, suggesting that different doses induce distinct physiological responses. These findings demonstrate that cDNA microarrays could be used to identify both toxicant class and relative dose.
Culture Conditions Affect Expression of DUX4 in FSHD Myoblasts.
Pandey, Sachchida Nand; Khawaja, Hunain; Chen, Yi-Wen
2015-05-08
Facioscapulohumeral muscular dystrophy (FSHD) is believed to be caused by aberrant expression of double homeobox 4 (DUX4) due to epigenetic changes of the D4Z4 region at chromosome 4q35. Detecting DUX4 is challenging due to its stochastic expression pattern and low transcription level. In this study, we examined different cDNA synthesis strategies and the sensitivity for DUX4 detection. In addition, we investigated the effects of dexamethasone and knockout serum replacement (KOSR) on DUX4 expression in culture. Our data showed that DUX4 was consistently detected in cDNA samples synthesized using Superscript III. The sensitivity of DUX4 detection was higher in the samples synthesized using oligo(dT) primers compared to random hexamers. Adding dexamethasone to the culture media significantly suppressed DUX4 expression in immortalized (1.3 fold, p < 0.01) and primary (4.7 fold, p < 0.01) FSHD myoblasts, respectively. Culture medium with KOSR increased DUX4 expression and the response is concentration dependent. The findings suggest that detection strategies and culture conditions should be carefully considered when studying DUX4 in cultured cells.
Activation-induced proteolysis of cytoplasmic domain of zeta in T cell receptors and Fc receptors.
Taupin, J L; Anderson, P
1994-12-01
The CD3-T cell receptor (TCR) complex on T cells and the Fc gamma receptor type III (Fc gamma RIII)-zeta-gamma complex on natural killer cells are functionally analogous activation receptors that associate with a family of disulfide-linked dimers composed of the related subunits zeta and gamma. Immunochemical analysis of receptor complexes separated on two-dimensional diagonal gels allowed the identification of a previously uncharacterized zeta-p14 heterodimer. zeta-p14 is a component of both CD3-TCR and Fc gamma RIII-zeta-gamma. Peptide mapping analysis shows that p14 is structurally related to zeta, suggesting that it is either: (i) derived from zeta proteolytically or (ii) the product of an alternatively spliced mRNA. The observation that COS cells transformed with a cDNA encoding zeta express zeta-p14 supports the former possibility. The expression of CD3-TCR complexes including zeta-p14 increases following activation with phorbol 12-myristate 13-acetate or concanavalin A, suggesting that proteolysis of zeta may contribute to receptor modulation or desensitization.
Jin, Hyun Mi; Jeong, Hye Im; Kim, Kyung Hyun; Hahn, Yoonsoo; Madsen, Eugene L; Jeon, Che Ok
2016-02-18
A genome-wide transcriptional analysis of Alteromonas naphthalenivorans SN2 was performed to investigate its ecophysiological behavior in contaminated tidal flats and seawater. The experimental design mimicked these habitats that either added naphthalene or pyruvate; tidal flat-naphthalene (TF-N), tidal flat-pyruvate (TF-P), seawater-naphthalene (SW-N), and seawater-pyruvate (SW-P). The transcriptional profiles clustered by habitat (TF-N/TF-P and SW-N/SW-P), rather than carbon source, suggesting that the former may exert a greater influence on genome-wide expression in strain SN2 than the latter. Metabolic mapping of cDNA reads from strain SN2 based on KEGG pathway showed that metabolic and regulatory genes associated with energy metabolism, translation, and cell motility were highly expressed in all four test conditions, probably highlighting the copiotrophic properties of strain SN2 as an opportunistic marine r-strategist. Differential gene expression analysis revealed that strain SN2 displayed specific cellular responses to environmental variables (tidal flat, seawater, naphthalene, and pyruvate) and exhibited certain ecological fitness traits -- its notable PAH degradation capability in seasonally cold tidal flat might be reflected in elevated expression of stress response and chaperone proteins, while fast growth in nitrogen-deficient and aerobic seawater probably correlated with high expression of glutamine synthetase, enzymes utilizing nitrite/nitrate, and those involved in the removal of reactive oxygen species.
Jin, Hyun Mi; Jeong, Hye Im; Kim, Kyung Hyun; Hahn, Yoonsoo; Madsen, Eugene L.; Jeon, Che Ok
2016-01-01
A genome-wide transcriptional analysis of Alteromonas naphthalenivorans SN2 was performed to investigate its ecophysiological behavior in contaminated tidal flats and seawater. The experimental design mimicked these habitats that either added naphthalene or pyruvate; tidal flat-naphthalene (TF-N), tidal flat-pyruvate (TF-P), seawater-naphthalene (SW-N), and seawater-pyruvate (SW-P). The transcriptional profiles clustered by habitat (TF-N/TF-P and SW-N/SW-P), rather than carbon source, suggesting that the former may exert a greater influence on genome-wide expression in strain SN2 than the latter. Metabolic mapping of cDNA reads from strain SN2 based on KEGG pathway showed that metabolic and regulatory genes associated with energy metabolism, translation, and cell motility were highly expressed in all four test conditions, probably highlighting the copiotrophic properties of strain SN2 as an opportunistic marine r-strategist. Differential gene expression analysis revealed that strain SN2 displayed specific cellular responses to environmental variables (tidal flat, seawater, naphthalene, and pyruvate) and exhibited certain ecological fitness traits –– its notable PAH degradation capability in seasonally cold tidal flat might be reflected in elevated expression of stress response and chaperone proteins, while fast growth in nitrogen-deficient and aerobic seawater probably correlated with high expression of glutamine synthetase, enzymes utilizing nitrite/nitrate, and those involved in the removal of reactive oxygen species. PMID:26887987
van de Vrugt, H J; Cheng, N C; de Vries, Y; Rooimans, M A; de Groot, J; Scheper, R J; Zhi, Y; Hoatlin, M E; Joenje, H; Arwert, F
2000-04-01
Fanconi anemia (FA) is an autosomal recessive disorder in humans characterized by bone marrow failure, cancer predisposition, and cellular hypersensitivity to cross-linking agents such as mitomycin C and diepoxybutane. FA genes display a caretaker function essential for maintenance of genomic integrity. We have cloned the murine homolog of FANCA, the gene mutated in the major FA complementation group (FA-A). The full-length mouse Fanca cDNA consists of 4503 bp and encodes a protein with a predicted molecular weight of 161 kDa. The deduced Fanca mouse protein shares 81% amino acid sequence similarity and 66% identity with the human protein. The nuclear localization signal and partial leucine zipper consensus motifs found in the human FANCA protein were also present in the murine homolog. In spite of the species difference, the murine Fanca cDNA was capable of correcting the cross-linker sensitive phenotype of human FA-A cells, suggesting functional conservation. Based on Northern as well as Western blots, Fanca was mainly expressed in lymphoid tissues, testis, and ovary. This expression pattern correlates with some of the clinical symptoms observed in FA patients. The availability of the murine Fanca cDNA now allows the gene to be studied in experimental mouse models.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, Seoung Hoon; Kim, Taesoo; Park, Eui-Soon
2008-05-02
Bone homeostasis is tightly regulated by the balanced actions of osteoblasts (OBs) and osteoclasts (OCs). We previously analyzed the gene expression profile of OC differentiation using a cDNA microarray, and identified a novel osteoclastogenic gene candidate, clone OCL-1-E7 [J. Rho, C.R. Altmann, N.D. Socci, L. Merkov, N. Kim, H. So, O. Lee, M. Takami, A.H. Brivanlou, Y. Choi, Gene expression profiling of osteoclast differentiation by combined suppression subtractive hybridization (SSH) and cDNA microarray analysis, DNA Cell Biol. 21 (2002) 541-549]. In this study, we have isolated full-length cDNAs corresponding to this clone from mice and humans to determine the functionalmore » roles of this gene in osteoclastogenesis. The full-length cDNA of OCL-1-E7 encodes 12 membrane-spanning domains that are typical of isoforms of the Na{sup +}/H{sup +} exchangers (NHEs), indicating that this clone is a novel member of the NHE family (hereafter referred to as NHE10). Here, we show that NHE10 is highly expressed in OCs in response to receptor activator of nuclear factor-{kappa}B ligand signaling and is required for OC differentiation and survival.« less
Hsieh, S L; Liu, R W; Wu, C H; Cheng, W T; Kuo, Ching-Ming
2003-12-01
A cDNA sequence of stearoyl-CoA desaturase (SCD) was determined from zebrafish (Danio rerio) and compared to the corresponding genes in several teleosts. Zebrafish SCD cDNA has a size of 1,061 bp, encodes a polypeptide of 325 amino acids, and shares 88, 85, 84, and 83% similarities with tilapia (Oreochromis mossambicus), grass carp (Ctenopharyngodon idella), common carp (Cyprinus carpio), and milkfish (Chanos chanos), respectively. This 1,061 bp sequence specifies a protein that, in common with other fatty acid desaturases, contains three histidine boxes, believed to be involved in catalysis. These observations suggested that SCD genes are highly conserved. In addition, an oligonucleotide probe complementary to zebrafish SCD mRNA was hybridized to mRNA of approximately 396 bases with Northern blot analysis. The Northern blot and RT-PCR analyses showed that the SCD mRNA was expressed predominantly in the liver, intestine, gill, and muscle, while a lower level was found in the brain. Furthermore, we utilized whole-mount in situ hybridization and real-time quantitative RT-PCR to identify expression of the zebrafish SCD gene at five different stages of development. This revealed that very high levels of transcripts were found in zebrafish at all stages during embryogenesis and early development. Copyright 2003 Wiley-Liss, Inc.
Karsten, Stanislav L.; Van Deerlin, Vivianna M. D.; Sabatti, Chiara; Gill, Lisa H.; Geschwind, Daniel H.
2002-01-01
Archival formalin-fixed, paraffin-embedded and ethanol-fixed tissues represent a potentially invaluable resource for gene expression analysis, as they are the most widely available material for studies of human disease. Little data are available evaluating whether RNA obtained from fixed (archival) tissues could produce reliable and reproducible microarray expression data. Here we compare the use of RNA isolated from human archival tissues fixed in ethanol and formalin to frozen tissue in cDNA microarray experiments. Since an additional factor that can limit the utility of archival tissue is the often small quantities available, we also evaluate the use of the tyramide signal amplification method (TSA), which allows the use of small amounts of RNA. Detailed analysis indicates that TSA provides a consistent and reproducible signal amplification method for cDNA microarray analysis, across both arrays and the genes tested. Analysis of this method also highlights the importance of performing non-linear channel normalization and dye switching. Furthermore, archived, fixed specimens can perform well, but not surprisingly, produce more variable results than frozen tissues. Consistent results are more easily obtainable using ethanol-fixed tissues, whereas formalin-fixed tissue does not typically provide a useful substrate for cDNA synthesis and labeling. PMID:11788730
Sanz, M J; Loarce, Y; Fominaya, A; Vossen, J H; Ferrer, E
2013-01-01
Two of the domains most widely shared among R genes are the nucleotide binding site (NBS) and protein kinase (PK) domains. The present study describes and maps a number of new oat resistance gene analogues (RGAs) with two purposes in mind: (1) to identify genetic regions that contain R genes and (2) to determine whether RGAs can be used as molecular markers for qualitative loci and for QTLs affording resistance to Puccinia coronata. Such genes have been mapped in the diploid A. strigosa × A. wiestii (Asw map) and the hexaploid MN841801-1 × Noble-2 (MN map). Genomic and cDNA NBS-RGA probes from oat, barley and wheat were used to produce RFLPs and to obtain markers by motif-directed profiling based on the NBS (NBS profiling) and PK (PK profiling) domains. The efficiency of primers used in NBS/PK profiling to amplify RGA fragments was assessed by sequencing individual marker bands derived from genomic and cDNA fragments. The positions of 184 markers were identified in the Asw map, while those for 99 were identified in the MN map. Large numbers of NBS and PK profiling markers were found in clusters across different linkage groups, with the PK profiling markers more evenly distributed. The location of markers throughout the genetic maps and the composition of marker clusters indicate that NBS- and PK-based markers cover partly complementary regions of oat genomes. Markers of the different classes obtained were found associated with the two resistance loci, PcA and R-284B-2, mapped on Asw, and with five out of eight QTLs for partial resistance in the MN map. 53 RGA-RFLPs and 187 NBS/PK profiling markers were also mapped on the hexaploid map A. byzantina cv. Kanota × A. sativa cv. Ogle. Significant co-localization was seen between the RGA markers in the KO map and other markers closely linked to resistance loci, such as those for P. coronata and barley yellow dwarf virus (Bydv) that were previously mapped in other segregating populations.
Clark, D P; Durell, S; Maloy, W L; Zasloff, M
1994-04-08
Antimicrobial peptides comprise a diverse class of molecules used in host defense by plants, insects, and animals. In this study we have isolated a novel antimicrobial peptide from the skin of the bullfrog, Rana catesbeiana. This 20 amino acid peptide, which we have termed Ranalexin, has the amino acid sequence: NH2-Phe-Leu-Gly-Gly-Leu-Ile-Lys-Ile-Val-Pro-Ala-Met-Ile-Cys-Ala-Val-Thr- Lys-Lys - Cys-COOH, and it contains a single intramolecular disulfide bond which forms a heptapeptide ring within the molecule. Structurally, Ranalexin resembles the bacterial antibiotic, polymyxin, which contains a similar heptapeptide ring. We have also cloned the cDNA for Ranalexin from a metamorphic R. catesbeiana tadpole cDNA library. Based on the cDNA sequence, it appears that Ranalexin is initially synthesized as a propeptide with a putative signal sequence and an acidic amino acid-rich region at its amino-terminal end. Interestingly, the putative signal sequence of the Ranalexin cDNA is strikingly similar to the signal sequence of opioid peptide precursors isolated from the skin of the South American frogs Phyllomedusa sauvagei and Phyllomedusa bicolor. Northern blot analysis and in situ hybridization experiments demonstrated that Ranalexin mRNA is first expressed in R. catesbeiana skin at metamorphosis and continues to be expressed into adulthood.
Yang, Bing-Yan; Huo, Xiu-Ai; Li, Peng-Fei; Wang, Cui-Xia; Duan, Hui-Jun
2014-08-01
Full-length cDNAs are very important for genome annotation and functional analysis of genes. The number of full-length cDNAs from watermelon remains limited. Here we report first the construction of a full-length enriched cDNA library from Fusarium wilt stressed watermelon (Citrullus lanatus Thunb.) cultivar PI296341 root tissues using the SMART method. The titer of primary cDNA library and amplified library was 2.21 x 10(6) and 2.0 x 10(10) pfu/ml, respectively and the rate of recombinant was above 85%. The size of insert fragment ranged from 0.3 to 2.0 kb. In this study, we first cloned a gene named ClWRKY1, which was 1981 bp long and encoded a protein consisting of 394 amino acids. It contained two characteristic WRKY domains and two zinc finger motifs. Quantitative real-time PCR showed that ClWRKY1 expression levels reached maximum level at 12 h after inoculation with Fusarium oxysporum f. sp. niveum. The full-length cDNA library of watermelon root tissues is not only essential for the cloning of genes which are known, but also an initial key for the screening and cloning of new genes that might be involved in resistance to Fusarium wilt.
Lardizabal, K D; Metz, J G; Sakamoto, T; Hutton, W C; Pollard, M R; Lassner, M W
2000-03-01
Wax synthase (WS, fatty acyl-coenzyme A [coA]: fatty alcohol acyltransferase) catalyzes the final step in the synthesis of linear esters (waxes) that accumulate in seeds of jojoba (Simmondsia chinensis). We have characterized and partially purified this enzyme from developing jojoba embryos. A protein whose presence correlated with WS activity during chromatographic fractionation was identified and a cDNA encoding that protein was cloned. Seed-specific expression of the cDNA in transgenic Arabidopsis conferred high levels of WS activity on developing embryos from those plants. The WS sequence has significant homology with several Arabidopsis open reading frames of unknown function. Wax production in jojoba requires, in addition to WS, a fatty acyl-CoA reductase (FAR) and an efficient fatty acid elongase system that forms the substrates preferred by the FAR. We have expressed the jojoba WS cDNA in Arabidopsis in combination with cDNAs encoding the jojoba FAR and a beta-ketoacyl-CoA synthase (a component of fatty acid elongase) from Lunaria annua. (13)C-Nuclear magnetic resonance analysis of pooled whole seeds from transgenic plants indicated that as many as 49% of the oil molecules in the seeds were waxes. Gas chromatography analysis of transmethylated oil from individual seeds suggested that wax levels may represent up to 70% (by weight) of the oil present in those seeds.
Ahmad, Muhammad Khairi; Tabana, Yasser M; Ahmed, Mowaffaq Adam; Sandai, Doblin Anak; Mohamed, Rafeezul; Ismail, Ida Shazrina; Zulkiflie, Nurulisa; Yunus, Muhammad Amir
2017-01-01
Background A norovirus maintains its viability, infectivity and virulence by its ability to replicate. However, the biological mechanisms of the process remain to be explored. In this work, the NanoLuc™ Luciferase gene was used to develop a reporter-tagged replicon system to study norovirus replication. Methods The NanoLuc™ Luciferase reporter protein was engineered to be expressed as a fusion protein for MNV-1 minor capsid protein, VP2. The foot-and-mouth disease virus 2A (FMDV2A) sequence was inserted between the 3′end of the reporter gene and the VP2 start sequence to allow co-translational ‘cleavage’ of fusion proteins during intracellular transcript expression. Amplification of the fusion gene was performed using a series of standard and overlapping polymerase chain reactions. The resulting amplicon was then cloned into three readily available backbones of MNV-1 cDNA clones. Results Restriction enzyme analysis indicated that the NanoLucTM Luciferase gene was successfully inserted into the parental MNV-1 cDNA clone. The insertion was further confirmed by using DNA sequencing. Conclusion NanoLuc™ Luciferase-tagged MNV-1 cDNA clones were successfully engineered. Such clones can be exploited to develop robust experimental assays for in vitro assessments of viral RNA replication. PMID:29379384
van Gennip, H G; van Rijn, P A; Widjojoatmodjo, M N; Moormann, R J
1999-03-01
A new method for the recovery of infectious classical swine fever virus (CSFV) from full-length genomic cDNA clones of the C-strain was developed. Classical reverse genetics is based on transfection of in vitro transcribed RNA to target cells to recover RNA viruses. However, the specific infectivity of such in vitro transcribed RNA in swine kidney cells is usually low. To improve reverse genetics for CSFV, a stable swine kidney cell line was established that expresses cytoplasmic bacteriophage T7 RNA polymerase (SK6.T7). A 200-fold increased virus titre was obtained from SK6.T7 cells transfected with linearized full-length cDNA compared to in vitro transcribed RNA, whereas transfection of circular full-length cDNA resulted in 20-fold increased virus titres. Viruses generated on the SK6.T7 cells are indistinguishable from the viruses generated by the classical reverse genetic procedures. These results show the improved recovery of infectious CSFV directly from full-length cDNAs. Furthermore, the reverse genetic procedures are simplified to a faster, one step protocol. We conclude that the SK6.T7 cell line will be a valuable tool for recovering mutant CSFV and will contribute to future pestivirus research.
Guanine nucleotide-binding regulatory proteins in retinal pigment epithelial cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jiang, Meisheng; Tran, V.T.; Fong, H.K.W.
1991-05-01
The expression of GTP-binding regulatory proteins (G proteins) in retinal pigment epithelial (RPE) cells was analyzed by RNA blot hybridization and cDNA amplification. Both adult and fetal human RPE cells contain mRNA for multiple G protein {alpha} subunits (G{alpha}) including G{sub s}{alpha}, G{sub i-1}{alpha}, G{sub i-2}{alpha}, G{sub i-3}{alpha}, and G{sub z}{alpha} (or G{sub x}{alpha}), where G{sub s} and G{sub i} are proteins that stimulate or inhibit adenylyl cyclase, respectively, and G{sub z} is a protein that may mediate pertussis toxin-insensitive events. Other G{alpha}-related mRNA transcripts were detected in fetal RPE cells by low-stringency hybridization to G{sub i-2}{alpha} and G{sub s}{alpha}more » protein-coding cDNA probes. The diversity of G proteins in RPE cells was further studied by cDNA amplification with reverse transcriptase and the polymerase chain reaction. This approach revealed that, besides the above mentioned members of the G{alpha} gene family, at least two other G{alpha} subunits are expressed in RPE cells. Human retinal cDNA clones that encode one of the additional G{alpha} subunits were isolated and characterized. The results indicate that this G{alpha} subunit belongs to a separate subfamily of G proteins that may be insensitive to inhibition by pertussis toxin.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jin Qingwen; Agrawal, Lokesh; Walther Cancer Institute, Indianapolis, IN 46208
2006-09-15
The human glucose transporter protein 1 (GLUT-1) functions as a receptor for human T cell leukemia virus (HTLV). GLUT-1 is a twelve-transmembrane cell surface receptor with six extracellular (ECL) and seven intracellular domains. To analyze HTLV-1 cytotropism, we utilized polyclonal antibodies to a synthetic peptide corresponding to the large extracellular domain of GLUT-1. The antibodies caused significant blocking of envelope (Env)-mediated fusion and pseudotyped virus infection of HeLa cells but had no significant effect on infection of U87 cells. This differential effect correlated with the detection of high-level surface expression of GLUT-1 on HeLa cells and very weak staining ofmore » U87 cells. To investigate this in terms of viral cytotropism, we cloned GLUT-1 cDNA from U87 cells and isolated two different versions of cDNA clones: the wild-type sequence (encoding 492 residues) and a mutant cDNA with a 5-base pair deletion (GLUT-1{delta}5) between nucleotides 1329 and 1333. The deletion, also detected in genomic DNA, resulted in a frame-shift and premature termination producing a truncated protein of 463 residues. Transfection of the wild-type GLUT-1 but not GLUT-1{delta}5 cDNA into CHO cells resulted in efficient surface expression of the human GLUT-1. Co-expression of GLUT-1 with GLUT-1{delta}5 produces a trans-inhibition by GLUT-1{delta}5 of GLUT-1-mediated HTLV-1 envelope (Env)-mediated fusion. Co-immunoprecipitation experiments demonstrated physical interaction of the wild-type and mutant proteins. Northern blot and RT-PCR analyses demonstrated lower GLUT-1 RNA expression in U87 cells. We propose two mechanisms to account for the impaired cell surface expression of GLUT-1 on U87 cells: low GLUT-1 RNA expression and the formation of GLUT-1/GLUT-1{delta}5 heterodimers that are retained intracellularly. Significant RNAi-mediated reduction of endogenous GLUT-1 expression impaired HTLV-1 Env-mediated fusion with HeLa cells but not with U87 cells. We propose a GLUT-1-independent mechanism of HTLV-1 infection of U87 cells. The results may have important implications for HTLV-1 neurotropism and pathogenesis.« less
Wistow, Graeme; Bernstein, Steven L; Wyatt, M Keith; Behal, Amita; Touchman, Jeffrey W; Bouffard, Gerald; Smith, Don; Peterson, Katherine
2002-06-15
To explore the expression profile of the human lens and to provide a resource for microarray studies, expressed sequence tag (EST) analysis has been performed on cDNA libraries from adult lenses. A cDNA library was constructed from two adult (40 year old) human lenses. Over two thousand clones were sequenced from the unamplified, un-normalized library. The library was then normalized and a further 2200 sequences were obtained. All the data were analyzed using GRIST (GRouping and Identification of Sequence Tags), a procedure for gene identification and clustering. The lens library (by) contains a low percentage of non-mRNA contaminants and a high fraction (over 75%) of apparently full length cDNA clones. Approximately 2000 reads from the unamplified library yields 810 clusters, potentially representing individual genes expressed in the lens. After normalization, the content of crystallins and other abundant cDNAs is markedly reduced and a similar number of reads from this library (fs) yields 1455 unique groups of which only two thirds correspond to named genes in GenBank. Among the most abundant cDNAs is one for a novel gene related to glutamine synthetase, which was designated "lengsin" (LGS). Analyses of ESTs also reveal examples of alternative transcripts, including a major alternative splice form for the lens specific membrane protein MP19. Variant forms for other transcripts, including those encoding the apoptosis inhibitor Livin and the armadillo repeat protein ARVCF, are also described. The lens cDNA libraries are a resource for gene discovery, full length cDNAs for functional studies and microarrays. The discovery of an abundant, novel transcript, lengsin, and a major novel splice form of MP19 reflect the utility of unamplified libraries constructed from dissected tissue. Many novel transcripts and splice forms are represented, some of which may be candidates for genetic diseases.
Lake, Jennifer; Gravel, Catherine; Koko, Gabriel Koffi D; Robert, Claude; Vandenberg, Grant W
2010-03-01
Phosphorus (P)-responsive genes and how they regulate renal adaptation to phosphorous-deficient diets in animals, including fish, are not well understood. RNA abundance profiling using cDNA microarrays is an efficient approach to study nutrient-gene interactions and identify these dietary P-responsive genes. To test the hypothesis that dietary P-responsive genes are differentially expressed in fish fed varying P levels, rainbow trout were fed a practical high-P diet (R20: 0.96% P) or a low-P diet (R0: 0.38% P) for 7 weeks. The differentially-expressed genes between dietary groups were identified and compared from the kidney by combining suppressive subtractive hybridization (SSH) with cDNA microarray analysis. A number of genes were confirmed by real-time PCR, and correlated with plasma and bone P concentrations. Approximately 54 genes were identified as potential dietary P-responsive after 7 weeks on a diet deficient in P according to cDNA microarray analysis. Of 18 selected genes, 13 genes were confirmed to be P-responsive at 7 weeks by real-time PCR analysis, including: iNOS, cytochrome b, cytochrome c oxidase subunit II , alpha-globin I, beta-globin, ATP synthase, hyperosmotic protein 21, COL1A3, Nkef, NDPK, glucose phosphate isomerase 1, Na+/H+ exchange protein and GDP dissociation inhibitor 2. Many of these dietary P-responsive genes responded in a moderate way (R0/R20 ratio: <2-3 or >0.5) and in a transient manner to dietary P limitation. In summary, renal adaptation to dietary P deficiency in trout involves changes in the expression of several genes, suggesting a profile of metabolic stress, since many of these differentially-expressed candidates are associated with the cellular adaptative responses. Crown Copyright 2009. Published by Elsevier Inc. All rights reserved.
Isolation of stress responsive Psb A gene from rice (Oryza sativa l.) using differential display.
Tyagi, Aruna; Chandra, Arti
2006-08-01
Differential display (DD) experiments were performed on drought-tolerant rice (Oryza sativa L.) genotype N22 to identify both upregulated and downregulated partial cDNAs with respect to moisture stress. DNA polymorphism was detected between drought-stressed and control leaf tissues on the DD gels. A partial cDNA showing differential expression, with respect to moisture stress was isolated from the gel. Northern blotting analysis was performed using this cDNA as a probe and it was observed that mRNA corresponding to this transcript was accumulated to high level in rice leaves under water deficit stress. At the DNA sequence level, the partial cDNA showed homology with psb A gene encoding for Dl protein.
Guerrero, Consuelo; Martín-Rufián, M; Reina, José J; Heredia, Antonio
2006-01-01
A cDNA encoding an acyl-CoA binding protein (ACBP) homologue has been cloned from a cDNA library made from mRNA isolated from epidermis of young leaves of Agave americana L. The derived amino acid sequence reveals a protein corresponding to the membrane-associated form of ACBPs only previously described in Arabidopsis and rice. Northern blot analysis showed that the A. americana ACBP gene is mainly expressed in the epidermis of mature zone of the leaves. The epidermis of A. americana leaves have a well developed cuticle with the highest amounts of the cuticular components waxes, cutin and cutan suggesting a potential role of the protein in cuticle formation.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Goodyer, P.R.; Torban, E.; Dehbi, M.
1994-09-01
The Wilms` tumor gene encodes a 47-49 kDa transcription factor expressed in kidney, gonads and mesothelium during embryogenesis. Inherited mutations of WT1 lead to aberrant urogenital development and Wilms` tumor, but the role of WT1 in development is not fully understood. Since the human RAR-{alpha} gene contains a potential WT1 binding site at its 5{prime} end, we studied the effect of WT1 co-transfection on expression of an RAR-{alpha} promoter/CAT reporter construct in COS cells. COS cells were plated at 5X10{sup 5} cells/dish in DMEM with 10% FBS and transfected by the Ca/PO4 method with an expression plasmid containing the full-lengthmore » WT1 (-/-) cDNA under the control of the CMV promoter, plasmid containing the RAR-{alpha} promoter (-519 to +36)/CAT reporter and TK/growth hormone plasmid to control for efficiency of transfection. CAT/GH activity at 48 hours was inhibited by co-transfection with increasing amounts of WT1 (-/-); maximum inhibition = 5% of control. WT1 co-transfection did not affect expression of TKGH, nor of a CMV-CAT vector. Expression of WT1 protein in tranfected COS cells was demonstrated by Western blotting. Minimal inhibiton of RAR-{alpha}/CAT activity was seen when cells were co-transfected with vectors containing WT1 deletion mutants, alternate WT1 splicing variants, or WT1 (-/-) cDNA bearing a mutation identified in a patient with Drash syndrome. Gel shift assays indicated binding of WT1 to RAR-{alpha} cDNA but not to an RAR-{alpha} deletion mutant lacking the GCGGGGGGCG site. These observations suggest that WT1 may function to regulate RAR-{alpha} expression during normal development.« less
Expression analysis of HSP70 in the testis of Octopus tankahkeei under thermal stress.
Long, Ling-Li; Han, Ying-Li; Sheng, Zhang; Du, Chen; Wang, You-Fa; Zhu, Jun-Quan
2015-09-01
The gene encoding heat shock protein 70 (HSP70) was identified in Octopus tankahkeei by homologous cloning and rapid amplification of cDNA ends (RACE). The full-length cDNA (2471 bp) consists of a 5'-untranslated region (UTR) (89 bp), a 3'-UTR (426 bp), and an open reading frame (1956 bp) that encodes 651 amino acid residues with a predicted molecular mass of 71.8 kDa and an isoelectric point of 5.34. Based on the amino acid sequence analysis and multiple sequence alignment, this cDNA is a member of cytoplasmic hsp70 subfamily of the hsp70 family and was designated as ot-hsp70. Tissue expression analysis showed that HSP70 expression is highest in the testes when all examined organs were compared. Immunohistochemistry analysis, together with hematoxylin-eosin staining, revealed that the HSP70 protein was expressed in all spermatogenic cells, but not in fibroblasts. In addition, O. tankahkeei were heat challenged by exposure to 32 °C seawater for 2 h, then returned to 13 °C for various recovery time (0-24 h). Relative expression of ot-hsp70 mRNA in the testes was measured at different time points post-challenge by quantitative real-time PCR. A clear time-dependent mRNA expression of ot-hsp70 after thermal stress indicates that the HSP70 gene is inducible. Ultrastructural changes of the heat-stressed testis were observed by transmission electron microscopy. We suggest that HSP70 plays an important role in spermatogenesis and testis protection against thermal stress in O. tankahkeei. Copyright © 2015 Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Reilly, D.S.; Nussbaum, R.L.
1994-09-01
The Lowe oculocerebrorenal syndrome (OCRL) is an X-linked disease characterized by congenital cataract, mental retardation, and renal tubular dysfunction. A candidate cDNA, OCRL-1, was identified by positional cloning and mutations in OCRL-1 have been detected in patients with Lowe syndrome. The OCRL-1 nucleotide sequence encodes a predicted protein of 968 amino acids and shares 51% amino acid identity with a human inositol polyphosphate-5-phosphatase. This suggests that the underlying defect in OCRL may be due to a defect in inositol phosphate metabolism. The isolation of OCRL-1 provides the opportunity to investigate its function through the use of animal model systems. Wemore » have isolated a partial cDNA clone encoding an OCRL-1 homologue, X-OCRL, from the South African clawed frog, Xenopus laevis. We used a portion of the human cDNA to screen a Xenopus laevis embryo cDNA library and isolated four positive clones. One clone, 42-5A, is a 650 bp insert with over 75% amino acid identity to the corresponding region of the human OCRL-1 sequence. 42-5A detects messenger RNA in adult Xenopus brain, stomach, small intestine, skin, muscle, lung, blood, and oviduct. X-OCRL messenger RNA is first detected during late gastrula and continues to be expressed throughout Xenopus development. In situ hybridization studies are underway to identify the cellular localization of X-OCRL expression in Xenopus embryos and adult tissues. We are especially interested in characterizing X-OCRL expression during formation of the amphibian lens since congenital cataracts are a constant feature of the human disease.« less
Yang, H; Egan, J M; Rodgers, B D; Bernier, M; Montrose-Rafizadeh, C
1999-06-01
To identify novel seven transmembrane domain proteins from 3T3-L1 adipocytes, we used PCR to amplify 3T3-L1 adipocyte complementary DNA (cDNA) with primers homologous to the N- and C-termini of pancreatic glucagon-like peptide-1 (GLP-1) receptor. We screened a cDNA library prepared from fully differentiated 3T3-L1 adipocytes using a 500-bp cDNA PCR product probe. Herein describes the isolation and characterization of a 1.6-kb cDNA clone that encodes a novel 298-amino acid protein that we termed TPRA40 (transmembrane domain protein of 40 kDa regulated in adipocytes). TPRA40 has seven putative transmembrane domains and shows little homology with the known GLP-1 receptor or with other G protein-coupled receptors. The levels of TPRA40 mRNA and protein were higher in 3T3-L1 adipocytes than in 3T3-L1 fibroblasts. TPRA40 is present in a number of mouse and human tissues. Interestingly, TPRA40 mRNA levels were significantly increased by 2- to 3-fold in epididymal fat of 24-month-old mice vs. young controls as well as in db/db and ob/ob mice vs. nondiabetic control littermates. No difference in TPRA40 mRNA levels was observed in brain, heart, skeletal muscle, liver, or kidney. Furthermore, no difference in TPRA40 expression was detected in brown fat of ob/ob mice when compared with age-matched controls. Taken together, these data suggest that TPRA40 represents a novel membrane-associated protein whose expression in white adipose tissue is altered with aging and type 2 diabetes.
Berg, Thomas; Hopwood, John J
2002-03-16
alpha-Mannosidosis is a lysosomal storage disorder caused by deficient activity of the lysosomal alpha-mannosidase. We report here the sequencing and expression of the lysosomal alpha-mannosidase cDNA from normal and alpha-mannosidosis guinea pigs. The amino acid sequence of the guinea pig enzyme displayed 82-85% identity to the lysosomal alpha-mannosidase in other mammals. The cDNA of the alpha-mannosidosis guinea pig contained a missense mutation, 679C>T, leading to substitution of arginine by tryptophan at amino acid position 227 (R227W). The R227W allele segregated with the alpha-mannosidosis genotype in the guinea pig colony and introduction of R227W into the wild-type sequence eliminated the production of recombinant alpha-mannosidase activity in heterologous expression studies. Furthermore, the guinea pig mutation has been found in human patients. Our results strongly indicate that the 679C>T mutation causes alpha-mannosidosis and suggest that the guinea pig will be an excellent model for investigation of pathogenesis and evaluation of therapeutic strategies for human alpha-mannosidosis.
Baxter, Laura L; Hsu, Benjamin J; Umayam, Lowell; Wolfsberg, Tyra G; Larson, Denise M; Frith, Martin C; Kawai, Jun; Hayashizaki, Yoshihide; Carninci, Piero; Pavan, William J
2007-06-01
As part of the RIKEN mouse encyclopedia project, two cDNA libraries were prepared from melanocyte-derived cell lines, using techniques of full-length clone selection and subtraction/normalization to enrich for rare transcripts. End sequencing showed that these libraries display over 83% complete coding sequence at the 5' end and 96-97% complete coding sequence at the 3' end. Evaluation of the libraries, derived from B16F10Y tumor cells and melan-c cells, revealed that they contain clones for a majority of the genes previously demonstrated to function in melanocyte biology. Analysis of genomic locations for transcripts revealed that the distribution of melanocyte genes is non-random throughout the genome. Three genomic regions identified that showed significant clustering of melanocyte-expressed genes contain one or more genes previously shown to regulate melanocyte development or function. A catalog of genes expressed in these libraries is presented, providing a valuable resource of cDNA clones and sequence information that can be used for identification of new genes important for melanocyte development, function, and disease.
Huang, P L; Do, Y Y; Huang, F C; Thay, T S; Chang, T W
1997-04-01
A cDNA encoding the banana 1-aminocyclopropane-1-carboxylate (ACC) oxidase has previously been isolated from a cDNA library that was constructed by extracting poly(A)+ RNA from peels of ripening banana. This cDNA, designated as pMAO2, has 1,199 bp and contains an open reading frame of 318 amino acids. In order to identify ripening-related promoters of the banana ACC oxidase gene, pMAO2 was used as a probe to screen a banana genomic library constructed in the lambda EMBL3 vector. The banana ACC oxidase MAO2 gene has four exons and three introns, with all of the boundaries between these introns and exons sharing a consensus dinucleotide sequence of GT-AG. The expression of MAO2 gene in banana begins after the onset of ripening (stage 2) and continuous into later stages of the ripening process. The accumulation of MAO2 mRNA can be induced by 1 microliter/l exogenous ethylene, and it reached steady state level when 100 microliters/l exogenous ethylene was present.
de Oliveira, Ursula Castro; Assui, Alessandra; da Silva, Alvaro Rossan de Brandão Prieto; de Oliveira, Jane Silveira; Ho, Paulo Lee
2003-09-01
During the cloning of abundant cDNAs expressed in the Micrurus corallinus coral snake venom gland, several putative toxins, including a phospholipase A2 homologue cDNA (clone V2), were identified. The V2 cDNA clone codes for a potential coral snake toxin with a signal peptide of 27 amino acid residues plus a predicted mature protein with 119 amino acid residues. The deduced protein is highly similar to known phospholipases A2, with seven deduced S-S bridges at the same conserved positions. This protein was expressed in Escherichia coli as a His-tagged protein that allowed the rapid purification of the recombinant protein. This protein was used to generate antibodies, which recognized the recombinant protein in Western blot. This antiserum was used to screen a large number of venoms, showing a ubiquitous distribution of immunorelated proteins in all elapidic venoms but not in the viperidic Bothrops jararaca venom. This is the first description of a complete primary structure of a phospholipase A2 homologue deduced by cDNA cloning from a coral snake.
Zhao, Wei; Li, Xin; Liu, Wen-Hui; Zhao, Jian; Jin, Yi-Ming; Sui, Ting-Ting
2014-09-01
Human epithelial colorectal adenocarcinoma (Caco-2) cells are widely used as an in vitro model of the human small intestinal mucosa. Caco-2 cells are host cells of the human astrovirus (HAstV) and other enteroviruses. High quality cDNA libraries are pertinent resources and critical tools for protein-protein interaction research, but are currently unavailable for Caco-2 cells. To construct a three-open reading frame, full length-expression cDNA library from the Caco-2 cell line for application to HAstV protein-protein interaction screening, total RNA was extracted from Caco-2 cells. The switching mechanism at the 5' end of the RNA transcript technique was used for cDNA synthesis. Double-stranded cDNA was digested by Sfi I and ligated to reconstruct a pGADT7-Sfi I three-frame vector. The ligation mixture was transformed into Escherichia coli HST08 premium electro cells by electroporation to construct the primary cDNA library. The library capacity was 1.0×10(6)clones. Gel electrophoresis results indicated that the fragments ranged from 0.5kb to 4.2kb. Randomly picked clones show that the recombination rate was 100%. The three-frame primary cDNA library plasmid mixture (5×10(5)cfu) was also transformed into E. coli HST08 premium electro cells, and all clones were harvested to amplify the cDNA library. To detect the sufficiency of the cDNA library, HAstV capsid protein as bait was screened and tested against the Caco-2 cDNA library by a yeast two-hybrid (Y2H) system. A total of 20 proteins were found to interact with the capsid protein. These results showed that a high-quality three-frame cDNA library from Caco-2 cells was successfully constructed. This library was efficient for the application to the Y2H system, and could be used for future research. Copyright © 2014 Elsevier B.V. All rights reserved.
Poirier, John T; Reddy, P Seshidhar; Idamakanti, Neeraja; Li, Shawn S; Stump, Kristine L; Burroughs, Kevin D; Hallenbeck, Paul L; Rudin, Charles M
2012-12-01
Seneca Valley virus (SVV-001) is an oncolytic picornavirus with selective tropism for a subset of human cancers with neuroendocrine differentiation. To characterize further the specificity of SVV-001 and its patterns and kinetics of intratumoral spread, bacterial plasmids encoding a cDNA clone of the full-length wild-type virus and a derivative virus expressing GFP were generated. The full-length cDNA of the SVV-001 RNA genome was cloned into a bacterial plasmid under the control of the T7 core promoter sequence to create an infectious cDNA clone, pNTX-09. A GFP reporter virus cDNA clone, pNTX-11, was then generated by cloning a fusion protein of GFP and the 2A protein from foot-and-mouth disease virus immediately following the native SVV-001 2A sequence. Recombinant GFP-expressing reporter virus, SVV-GFP, was rescued from cells transfected with in vitro RNA transcripts from pNTX-11 and propagated in cell culture. The proliferation kinetics of SVV-001 and SVV-GFP were indistinguishable. The SVV-GFP reporter virus was used to determine that a subpopulation of permissive cells is present in small-cell lung cancer cell lines previously thought to lack permissivity to SVV-001. Finally, it was shown that SVV-GFP administered to tumour-bearing animals homes in to and infects tumours whilst having no detectable tropism for normal mouse tissues at 1×10(11) viral particles kg(-1), a dose equivalent to that administered in ongoing clinical trials. These infectious clones will be of substantial value in further characterizing the biology of this virus and as a backbone for the generation of additional oncolytic derivatives.
The effect of column purification on cDNA indirect labelling for microarrays
Molas, M Lia; Kiss, John Z
2007-01-01
Background The success of the microarray reproducibility is dependent upon the performance of standardized procedures. Since the introduction of microarray technology for the analysis of global gene expression, reproducibility of results among different laboratories has been a major problem. Two of the main contributors to this variability are the use of different microarray platforms and different laboratory practices. In this paper, we address the latter question in terms of how variation in one of the steps of a labelling procedure affects the cDNA product prior to microarray hybridization. Results We used a standard procedure to label cDNA for microarray hybridization and employed different types of column chromatography for cDNA purification. After purifying labelled cDNA, we used the Agilent 2100 Bioanalyzer and agarose gel electrophoresis to assess the quality of the labelled cDNA before its hybridization onto a microarray platform. There were major differences in the cDNA profile (i.e. cDNA fragment lengths and abundance) as a result of using four different columns for purification. In addition, different columns have different efficiencies to remove rRNA contamination. This study indicates that the appropriate column to use in this type of protocol has to be experimentally determined. Finally, we present new evidence establishing the importance of testing the method of purification used during an indirect labelling procedure. Our results confirm the importance of assessing the quality of the sample in the labelling procedure prior to hybridization onto a microarray platform. Conclusion Standardization of column purification systems to be used in labelling procedures will improve the reproducibility of microarray results among different laboratories. In addition, implementation of a quality control check point of the labelled samples prior to microarray hybridization will prevent hybridizing a poor quality sample to expensive micorarrays. PMID:17597522
The effect of column purification on cDNA indirect labelling for microarrays.
Molas, M Lia; Kiss, John Z
2007-06-27
The success of the microarray reproducibility is dependent upon the performance of standardized procedures. Since the introduction of microarray technology for the analysis of global gene expression, reproducibility of results among different laboratories has been a major problem. Two of the main contributors to this variability are the use of different microarray platforms and different laboratory practices. In this paper, we address the latter question in terms of how variation in one of the steps of a labelling procedure affects the cDNA product prior to microarray hybridization. We used a standard procedure to label cDNA for microarray hybridization and employed different types of column chromatography for cDNA purification. After purifying labelled cDNA, we used the Agilent 2100 Bioanalyzer and agarose gel electrophoresis to assess the quality of the labelled cDNA before its hybridization onto a microarray platform. There were major differences in the cDNA profile (i.e. cDNA fragment lengths and abundance) as a result of using four different columns for purification. In addition, different columns have different efficiencies to remove rRNA contamination. This study indicates that the appropriate column to use in this type of protocol has to be experimentally determined. Finally, we present new evidence establishing the importance of testing the method of purification used during an indirect labelling procedure. Our results confirm the importance of assessing the quality of the sample in the labelling procedure prior to hybridization onto a microarray platform. Standardization of column purification systems to be used in labelling procedures will improve the reproducibility of microarray results among different laboratories. In addition, implementation of a quality control check point of the labelled samples prior to microarray hybridization will prevent hybridizing a poor quality sample to expensive micorarrays.
Yang, Ping; Tanaka, Hiromasa; Kuwano, Eiichi; Suzuki, Koichi
2008-03-01
A new cytochrome P450 gene, CYP4G25, was identified as a differentially expressed gene between the diapausing and post-diapausing pharate first instar larvae of the wild silkmoth Antheraea yamamai, using subtractive cDNA hybridization. The cDNA sequence of CYP4G25 has an open reading frame of 1674 nucleotides encoding 557 amino acid residues. Sequence analysis of the putative CYP4G25 protein disclosed the motif FXXGXRXCXG that is essential for heme binding in P450 cytochromes. Hybridization in situ demonstrated predominant expression of CYP4G25 in the integument of pharate first instar larvae. Northern blotting analysis showed an intensive signal after the initiation of diapause and no or weak expression throughout the periods of pre-diapause and post-diapause, including larval development. These results indicate that CYP4G25 is strongly associated with diapause in pharate first instar larvae.
Jackson, S; Gascón, J; Carrera, E; Monte, E; Prat, S
1997-01-01
Differential screening of a potato leaf cDNA library with cDNA probes made from tuberizing and non-tuberizing Solanum demissum plants led to the identification of a clone that is upregulated in leaves and other tissues upon tuberization. This clone was also shown to have a high level of expression in green tomato fruit, its expression falling off as the fruit turns red. No sucrose or hormonal regulation of the expression of this clone was observed and it did not respond to wounding or heat stress. Clone 32B is 532 bp long and contains an open reading frame encoding a small protein of 98 amino acids. The deduced protein sequence has a putative signal peptide for ER transport and a 10 amino acid domain in the C-terminal region of the protein, both of which are also found in the cotton LEA5, Arabidopsis Di21 and the mungbean Arg2 proteins.
Human Neoplasms Elicit Multiple Specific Immune Responses in the Autologous Host
NASA Astrophysics Data System (ADS)
Sahin, Ugur; Tureci, Ozlem; Schmitt, Holger; Cochlovius, Bjorn; Johannes, Thomas; Schmits, Rudolf; Stenner, Frank; Luo, Guorong; Schobert, Ingrid; Pfreundschuh, Michael
1995-12-01
Expression of cDNA libraries from human melanoma, renal cancer, astrocytoma, and Hodgkin disease in Escherichia coli and screening for clones reactive with high-titer IgG antibodies in autologous patient serum lead to the discovery of at least four antigens with a restricted expression pattern in each tumor. Besides antigens known to elicit T-cell responses, such as MAGE-1 and tyrosinase, numerous additional antigens that were overexpressed or specifically expressed in tumors of the same type were identified. Sequence analyses suggest that many of these molecules, besides being the target of a specific immune response, might be of relevance for tumor growth. Antibodies to a given antigen were usually confined to patients with the same tumor type. The unexpected frequency of human tumor antigens, which can be readily defined at the molecular level by the serological analysis of autologous tumor cDNA expression cloning, indicates that human neoplasms elicit multiple specific immune responses in the autologous host and provides diagnostic and therapeutic approaches to human cancer.
Construction, database integration, and application of an Oenothera EST library.
Mrácek, Jaroslav; Greiner, Stephan; Cho, Won Kyong; Rauwolf, Uwe; Braun, Martha; Umate, Pavan; Altstätter, Johannes; Stoppel, Rhea; Mlcochová, Lada; Silber, Martina V; Volz, Stefanie M; White, Sarah; Selmeier, Renate; Rudd, Stephen; Herrmann, Reinhold G; Meurer, Jörg
2006-09-01
Coevolution of cellular genetic compartments is a fundamental aspect in eukaryotic genome evolution that becomes apparent in serious developmental disturbances after interspecific organelle exchanges. The genus Oenothera represents a unique, at present the only available, resource to study the role of the compartmentalized plant genome in diversification of populations and speciation processes. An integrated approach involving cDNA cloning, EST sequencing, and bioinformatic data mining was chosen using Oenothera elata with the genetic constitution nuclear genome AA with plastome type I. The Gene Ontology system grouped 1621 unique gene products into 17 different functional categories. Application of arrays generated from a selected fraction of ESTs revealed significantly differing expression profiles among closely related Oenothera species possessing the potential to generate fertile and incompatible plastid/nuclear hybrids (hybrid bleaching). Furthermore, the EST library provides a valuable source of PCR-based polymorphic molecular markers that are instrumental for genotyping and molecular mapping approaches.
Sullivan, William J; Monroy, M Alexandra; Bohne, Wolfgang; Nallani, Karuna C; Chrivia, John; Yaciuk, Peter; Smith, Charles K; Queener, Sherry F
2003-05-01
We have identified and mapped a gene in Toxoplasma gondii that encodes a homologue of SRCAP (Snf2-related CBP activator protein), a member of the SNF/SWI family of chromatin remodeling factors. The genomic locus (TgSRCAP) is present as a single copy and contains 16 introns. The predicted cDNA contains an open reading frame of 8,775 bp and encodes a protein of 2,924 amino acids. We have identified additional SRCAP-like sequences in Apicomplexa for comparison by screening genomic databases. An analysis of SRCAP homologues between species reveals signature features that may be indicative of SRCAP members. Expression of mRNA encoding TgSRCAP is upregulated when tachyzoite (invasive form) parasites are induced to differentiate into bradyzoites (encysted form) in vitro. Recombinant TgSRCAP protein is functionally equivalent to the human homologue, being capable of increasing transcription mediated by CREB.
Technique for quantitative RT-PCR analysis directly from single muscle fibers.
Wacker, Michael J; Tehel, Michelle M; Gallagher, Philip M
2008-07-01
The use of single-cell quantitative RT-PCR has greatly aided the study of gene expression in fields such as muscle physiology. For this study, we hypothesized that single muscle fibers from a biopsy can be placed directly into the reverse transcription buffer and that gene expression data can be obtained without having to first extract the RNA. To test this hypothesis, biopsies were taken from the vastus lateralis of five male subjects. Single muscle fibers were isolated and underwent RNA isolation (technique 1) or placed directly into reverse transcription buffer (technique 2). After cDNA conversion, individual fiber cDNA was pooled and quantitative PCR was performed using primer-probes for beta(2)-microglobulin, glyceraldehyde-3-phosphate dehydrogenase, insulin-like growth factor I receptor, and glucose transporter subtype 4. The no RNA extraction method provided similar quantitative PCR data as that of the RNA extraction method. A third technique was also tested in which we used one-quarter of an individual fiber's cDNA for PCR (not pooled) and the average coefficient of variation between fibers was <8% (cycle threshold value) for all genes studied. The no RNA extraction technique was tested on isolated muscle fibers using a gene known to increase after exercise (pyruvate dehydrogenase kinase 4). We observed a 13.9-fold change in expression after resistance exercise, which is consistent with what has been previously observed. These results demonstrate a successful method for gene expression analysis directly from single muscle fibers.
Kurtz, Brian M.; Singletary, Lauren B.; Kelly, Sean D.; Frampton, Arthur R.
2010-01-01
In this study, Equus caballus major histocompatibility complex class I (MHC-I) was identified as a cellular entry receptor for the alphaherpesvirus equine herpesvirus type 1 (EHV-1). This novel EHV-1 receptor was discovered using a cDNA library from equine macrophages. cDNAs from this EHV-1-susceptible cell type were inserted into EHV-1-resistant B78H1 murine melanoma cells, these cells were infected with an EHV-1 lacZ reporter virus, and cells that supported virus infection were identified by X-Gal (5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside) staining. Positive cells were subjected to several rounds of purification to obtain homogeneous cell populations that were shown to be uniformly infected with EHV-1. cDNAs from these cell populations were amplified by PCR and then sequenced. The sequence data revealed that the EHV-1-susceptible cells had acquired an E. caballus MHC-I cDNA. Cell surface expression of this receptor was verified by confocal immunofluorescence microscopy. The MHC-I cDNA was cloned into a mammalian expression vector, and stable B78H1 cell lines were generated that express this receptor. These cell lines were susceptible to EHV-1 infection while the parental B78H1 cells remained resistant to infection. In addition, EHV-1 infection of the B78H1 MHC-I-expressing cell lines was inhibited in a dose-dependent manner by an anti-MHC-I antibody. PMID:20610718
Yasuno, Rie; Wada, Hajime
1998-01-01
Lipoic acid is a coenzyme that is essential for the activity of enzyme complexes such as those of pyruvate dehydrogenase and glycine decarboxylase. We report here the isolation and characterization of LIP1 cDNA for lipoic acid synthase of Arabidopsis. The Arabidopsis LIP1 cDNA was isolated using an expressed sequence tag homologous to the lipoic acid synthase of Escherichia coli. This cDNA was shown to code for Arabidopsis lipoic acid synthase by its ability to complement a lipA mutant of E. coli defective in lipoic acid synthase. DNA-sequence analysis of the LIP1 cDNA revealed an open reading frame predicting a protein of 374 amino acids. Comparisons of the deduced amino acid sequence with those of E. coli and yeast lipoic acid synthase homologs showed a high degree of sequence similarity and the presence of a leader sequence presumably required for import into the mitochondria. Southern-hybridization analysis suggested that LIP1 is a single-copy gene in Arabidopsis. Western analysis with an antibody against lipoic acid synthase demonstrated that this enzyme is located in the mitochondrial compartment in Arabidopsis cells as a 43-kD polypeptide. PMID:9808738
Shpakovskiĭ, G V; Lebedenko, E N; Thuriaux, P
1997-02-01
The rpb10 cDNA of the fission yeast Schizosaccharomyces pombe, encoding one of the five small subunits common to all three nuclear DNA-dependent RNA polymerases, was isolated from an expression cDNA library by two independent approaches: PCR-based screening and direct suppression by means of heterospecific complementation of a temperature-sensitive mutant defective in the corresponding gene of Saccharomyces cerevisiae. The cloned Sz. pombe cDNA encodes a protein Rpb10 of 71 amino acids with an M of 8,275 Da, sharing 51 amino acids (71% identity) with the subunit ABC10 beta of RNA polymerases I-III from S. cerevisiae. All eukaryotic members of this protein family have the same general organization featuring two highly conserved motifs (RCFT/SCGK and RYCCRRM) around an atypical zinc finger and an additional invariant HVDLIEK motif toward the C-terminal end. The last motif is only characteristics for homologs from eukaryotes. In keeping with this remarkable structural conservation, the Sz. pombe cDNA also fully complemented a S. cerevisiae deletion mutant lacking subunit ABC10 beta (null allele rpb10-delta 1::HIS3).
Hagiwara, Koichi; Kobayashi, Tatsuo; Tobita, Masato; Kikyo, Nobuaki; Yazaki, Yoshio
1995-01-01
We have found growth‐promoting activity for vascular endothelial cells in the conditioned medium of a human lung cancer cell line, T3M‐11. Purification and characterization of the growth‐promoting activity have been carried out using ammonium sulfate precipitation and gel‐exclusion chromatography. The activity migrated as a single peak just after ribonuclease. It did not bind to a heparin affinity column. These results suggest that the activity is not a heparin‐binding growth factor (including fibroblast growth factors) or a vascular endothelial growth factor. To identify the molecule exhibiting the growth‐promoting activity, a cDNA encoding the growth factor was isolated through functional expression cloning in COS‐1 cells from a cDNA library prepared from T3M‐11 cells. The nucleotide sequence encoded by the cDNA proved to be identical with that of insulin‐like growth factor II. PMID:7730145
Yanagawa, Rempei; Furukawa, Yoichi; Tsunoda, Tatsuhiko; Kitahara, Osamu; Kameyama, Masao; Murata, Kohei; Ishikawa, Osamu; Nakamura, Yusuke
2001-01-01
Abstract In spite of intensive and increasingly successful attempts to determine the multiple steps involved in colorectal carcinogenesis, the mechanisms responsible for metastasis of colorectal tumors to the liver remain to be clarified. To identify genes that are candidates for involvement in the metastatic process, we analyzed genome-wide expression profiles of 10 primary colorectal cancers and their corresponding metastatic lesions by means of a cDNA microarray consisting of 9121 human genes. This analysis identified 40 genes whose expression was commonly upregulated in metastatic lesions, and 7 that were commonly downregulated. The upregulated genes encoded proteins involved in cell adhesion, or remodeling of the actin cytoskeleton. Investigation of the functions of more of the altered genes should improve our understanding of metastasis and may identify diagnostic markers and/or novel molecular targets for prevention or therapy of metastatic lesions. PMID:11687950
Yao, Lin; Yang, Qian; Song, Jinzhu; Tan, Chong; Guo, Changhong; Wang, Li; Qu, Lianhai; Wang, Yun
2013-04-01
Trichoderma harzianum 88, a filamentous soil fungus, is an effective biocontrol agent against several plant pathogens. High-throughput sequencing was used here to study the mycoparasitism mechanisms of T. harzianum 88. Plate confrontation tests of T. harzianum 88 against plant pathogens were conducted, and a cDNA library was constructed from T. harzianum 88 mycelia in the presence of plant pathogen cell walls. Randomly selected transcripts from the cDNA library were compared with eukaryotic plant and fungal genomes. Of the 1,386 transcripts sequenced, the most abundant Gene Ontology (GO) classification group was "physiological process". Differential expression of 19 genes was confirmed by real-time RT-PCR at different mycoparasitism stages against plant pathogens. Gene expression analysis revealed the transcription of various genes involved in mycoparasitism of T. harzianum 88. Our study provides helpful insights into the mechanisms of T. harzianum 88-plant pathogen interactions.
Sun, Jie; Li, Yuan-Li; Wang, Ruo-Hai; Xia, Gui-Xian
2004-01-01
Fluorescence differential display (FDD) technique was used to identify genes that are specifically or preferentially expressed in different developmental stages of cotton fiber cells. One hundred and nine differentially displayed cDNA fragments were isolated using 9, 21 and 27 DPA (days postanthesis) fibers as experimental materials. By a combination of two rounds of reverse Northern hybridization and Northern blot analyses, a number of such cDNA fragments were proved to represent fiber-specific/preferential genes. Sequencing determination and database searching indicated that most of these genes are novel. This work is an important step towards cloning the full-length cDNAs and characterizing the cellular functions of aforementioned genes in fiber development.
Gene for ataxia-telangiectasia complementation group D (ATDC)
Murnane, John P.; Painter, Robert B.; Kapp, Leon N.; Yu, Loh-Chung
1995-03-07
Disclosed herein is a new gene, an AT gene for complementation group D, the ATDC gene and fragments thereof. Nucleic acid probes for said gene are provided as well as proteins encoded by said gene, cDNA therefrom, preferably a 3 kilobase (kb) cDNA, and recombinant nucleic acid molecules for expression of said proteins. Further disclosed are methods to detect mutations in said gene, preferably methods employing the polymerase chain reaction (PCR). Also disclosed are methods to detect AT genes from other AT complementation groups.
Selective Chemosensitization of Rb Mutant Cells
2001-07-01
MA). pLPC-12S coexpresses an E1A 12S cDNA with puromycin phosphotransferase (puro) and pWZL-12S coexpresses E1A with hygromycin phospho...expressing puromycin phosphotransferase (puro); LPC-12S, a 12S El A cDNA in LPC (McCurrach et al. 1997); LPC-12S.AN and LPC-12S.ACR2, El A mutants that...2, -3, conserved regions 1, 2, and 3; MEF, mouse embryonic fibroblast; puro, puromycin; hygro, hygromycin . To whom reprint requests should be
Ines Pisanelli; Magdalena Kujawa; Oliver Spadiut; Roman Kittl; Petr Halada; Jindrich Volc; Michael D. Mozuch; Philip Kersten; Dietmar Haltrich; Clemens Peterbauer
2009-01-01
The presented work reports the isolation and heterologous expression of the p2ox gene encoding the flavoprotein pyranose 2-oxidase (P2Ox) from the basidiomycete Phanerochaete chrysosporium. The p2ox cDNA was inserted into the bacterial expression vector pET21a(+) and successfully expressed in Escherichia coli. We obtained active, fully flavinylated recombinant P2Ox in...
Zandawala, Meet; Haddad, Amir S; Hamoudi, Zina; Orchard, Ian
2015-09-01
The mammalian gonadotropin-releasing hormone is evolutionarily related to the arthropod adipokinetic hormone and the recently discovered adipokinetic hormone/corazonin-related peptide (ACP). The function of the ACP signaling system in arthropods is currently unknown. In the present study, we identify and characterize the ACP signaling system in the kissing bug Rhodnius prolixus. We isolated the complete cDNA sequence encoding R. prolixus ACP (Rhopr-ACP) and examined its expression pattern. Rhopr-ACP is predominantly expressed in the central nervous system. In particular, it is found in both the brain and corpus cardiacum (CC)/corpora allata (CA) complex. To gain an insight into its role in R. prolixus, we also isolated and functionally characterized cDNA sequences of three splice variants (Rhopr-ACPR-A, B and C) encoding R. prolixus ACP G protein-coupled receptor (Rhopr-ACPR). Rhopr-ACPR-A has only five transmembrane domains, whereas Rhopr-ACPR-B and C have all seven domains. Interestingly, Rhopr-ACPR-A, B and C were all activated by Rhopr-ACP, albeit at different sensitivities, when expressed in Chinese hamster ovary cells stably expressing the human G-protein G16 (CHO/G16). To our knowledge, this is the first study to isolate a truncated receptor cDNA in invertebrates that is functional in a heterologous expression system. Moreover, Rhopr-ACPR-B and C but not Rhopr-ACPR-A can be coupled with Gq α subunits. Expression profiling indicates that Rhopr-ACPR is highly expressed in the central nervous system, as well as the CC/CA complex, suggesting that it may control the release of other hormones found in the CC in a manner analogous to gonadotropin-releasing hormone. Temporal expression profiling shows that both Rhopr-ACP and Rhopr-ACPR are upregulated after ecdysis, suggesting that this neuropeptide may be involved in processes associated with post-ecdysis. © 2015 FEBS.
Analysis of the antibody repertoire of lymphoma patients.
Huang, Shaoming; Preuss, Klaus-Dieter; Xie, Xiaoxun; Regitz, Evi; Pfreundschuh, Michael
2002-12-01
Cancer testis or cancer germline antigens (CGA) are promising vaccine candidates because they are expressed only in malignant but not in normal tissues, except for germ cells in the testis. Since non-Hodgkin's lymphomas (NHL) express the known CGA at low frequencies, we aimed at increasing the number of CGA with frequent expression in NHL by screening a cDNA expression library derived from normal testis for reactivity with high-titered IgG antibodies in the sera of lymphoma patients using SEREX, the serological identification of antigens by recombinant cDNA expression cloning. The analysis of 1.6x10(6) clones with the sera of 25 lymphoma patients revealed 42 clones which coded for 23 antigens, 12 of which had already been included in the SEREX databank. Four cDNA clones coded for unknown and 19 for known genes. Three antigens reacted only with the serum by which they had been detected, 9 antigens reacted with the sera of several NHL patients, but not with that of healthy controls, and 11 antigens reacted with both normal and NHL sera. Most of the antigens were ubiquitously expressed. Only HOM-NHL-6, HOM-NHL-8, HOM-NHL-21 and HOM-NHL-23 showed a restricted expression pattern. HOM-NHL-6 and HOM-NHL-8 were homologous to the previously described CGA NY-ESO-1 and HOM-TES-14/SCP-1, respectively. HOM-NHL-21 was expressed in rare cases of lymphomas, but not in normal tissues except for testis and brain, while HOM-NHL-23 appeared to be a testis-specific antigen. In summary, using the antibody repertoire of these 25 NHL patients, no new CGA were detected. The number of CGA detectable by the classical SEREX approach appears to be limited, and novel strategies are necessary to identify antigens that can serve as a vaccine target in a broad spectrum of NHL patients.
Gottschalk, Laura B.; Vecchio-Pagan, Briana; Sharma, Neeraj; Han, Sangwoo T.; Franca, Arianna; Wohler, Elizabeth S.; Batista, Denise A.S.; Goff, Loyal A.; Cutting, Garry R.
2016-01-01
Background Analysis of the functional consequences and treatment response of rare CFTR variants is challenging due to the limited availability of primary airways cells. Methods A Flp recombination target (FRT) site for stable expression of CFTR was incorporated into an immortalized CF bronchial epithelial cell line (CFBE41o−). CFTR cDNA was integrated into the FRT site. Expression was evaluated by western blotting and confocal microscopy and function measured by short circuit current. RNA sequencing was used to compare the transcriptional profile of the resulting CF8Flp cell line to primary cells and tissues. Results Functional CFTR was expressed from integrated cDNA at the FRT site of the CF8Flp cell line at levels comparable to that seen in native airway cells. CF8Flp cells expressing WT-CFTR have a stable transcriptome comparable to that of primary cultured airway epithelial cells, including genes that play key roles in CFTR pathways. Conclusion CF8Flp cells provide a viable substitute for primary CF airway cells for the analysis of CFTR variants in a native context. PMID:26694805
Katano, Yuta; Li, Tongyang; Baba, Misato; Nakamura, Miyo; Ito, Masaaki; Kojima, Kenji; Takita, Teisuke; Yasukawa, Kiyoshi
2017-12-01
We attempted to increase the thermostability of Moloney murine leukemia virus (MMLV) reverse transcriptase (RT). The eight-site saturation mutagenesis libraries corresponding to Ala70-Arg469 in the whole MMLV RT (Thr24-Leu671), in each of which 1 out of 50 amino acid residues was replaced with other amino acid residue, were constructed. Seven-hundred and sixty eight MMLV RT clones were expressed using a cell-free protein expression system, and their thermostabilities were assessed by the temperature of thermal treatment at which they retained cDNA synthesis activity. One clone D200C was selected as the most thermostable variant. The highest temperature of thermal treatment at which D200C exhibited cDNA synthesis activity was 57ºC, which was higher than for WT (53ºC). Our results suggest that a combination of site saturation mutagenesis library and cell-free protein expression system might be useful for generation of thermostable MMLV RT in a short period of time for expression and selection.
Beldade, P; McMillan, W O; Papanicolaou, A
2008-02-01
Technological and conceptual advances of the last decade have led to an explosion of genomic data and the emergence of new research avenues. Evolutionary and ecological functional genomics, with its focus on the genes that affect ecological success and adaptation in natural populations, benefits immensely from a phylogenetically widespread sampling of biological patterns and processes. Among those organisms outside established model systems, butterflies offer exceptional opportunities for multidisciplinary research on the processes generating and maintaining variation in ecologically relevant traits. Here we highlight research on wing color pattern variation in two groups of Nymphalid butterflies, the African species Bicyclus anynana (subfamily Satyrinae) and species of the South American genus Heliconius (subfamily Heliconiinae), which are emerging as important systems for studying the nature and origins of functional diversity. Growing genomic resources including genomic and cDNA libraries, dense genetic maps, high-density gene arrays, and genetic transformation techniques are extending current gene mapping and expression profiling analysis and enabling the next generation of research questions linking genes, development, form, and fitness. Efforts to develop such resources in Bicyclus and Heliconius underscore the general challenges facing the larger research community and highlight the need for a community-wide effort to extend ongoing functional genomic research on butterflies.
Conditional poliovirus mutants made by random deletion mutagenesis of infectious cDNA.
Kirkegaard, K; Nelsen, B
1990-01-01
Small deletions were introduced into DNA plasmids bearing cDNA copies of Mahoney type 1 poliovirus RNA. The procedure used was similar to that of P. Hearing and T. Shenk (J. Mol. Biol. 167:809-822, 1983), with modifications designed to introduce only one lesion randomly into each DNA molecule. Methods to map small deletions in either large DNA or RNA molecules were employed. Two poliovirus mutants, VP1-101 and VP1-102, were selected from mutagenized populations on the basis of their host range phenotype, showing a large reduction in the relative numbers of plaques on CV1 and HeLa cells compared with wild-type virus. The deletions borne by the mutant genomes were mapped to the region encoding the amino terminus of VP1. That these lesions were responsible for the mutant phenotypes was substantiated by reintroduction of the sequenced lesions into a wild-type poliovirus cDNA by deoxyoligonucleotide-directed mutagenesis. The deletion of nucleotides encoding amino acids 8 and 9 of VP1 was responsible for the VP1-101 phenotype; the VP1-102 defect was caused by the deletion of the sequences encoding the first four amino acids of VP1. The peptide sequence at the VP1-VP3 proteolytic cleavage site was altered from glutamine-glycine to glutamine-methionine in VP1-102; this apparently did not alter the proteolytic cleavage pattern. The biochemical defects resulting from these mutations are discussed in the accompanying report. Images PMID:2152811
Characterization of Light and Nitrogen Regulated Gene Expression Pathways in Marine Diatoms
1992-12-31
DNA and cDNA from the seagrass Zostera marina and marine unicellular chlorophyte Dunaliella tertiolecta, using oligonucleotide primers based on...availability of carbon skeletons from photosynthesis may also function in the modulation of gene expression in diatoms. FCP abundance did not exhibit any
Jouffe, Vincent; Rowe, Suzanne; Liaubet, Laurence; Buitenhuis, Bart; Hornshøj, Henrik; SanCristobal, Magali; Mormède, Pierre; de Koning, D J
2009-07-16
Microarray studies can supplement QTL studies by suggesting potential candidate genes in the QTL regions, which by themselves are too large to provide a limited selection of candidate genes. Here we provide a case study where we explore ways to integrate QTL data and microarray data for the pig, which has only a partial genome sequence. We outline various procedures to localize differentially expressed genes on the pig genome and link this with information on published QTL. The starting point is a set of 237 differentially expressed cDNA clones in adrenal tissue from two pig breeds, before and after treatment with adrenocorticotropic hormone (ACTH). Different approaches to localize the differentially expressed (DE) genes to the pig genome showed different levels of success and a clear lack of concordance for some genes between the various approaches. For a focused analysis on 12 genes, overlapping QTL from the public domain were presented. Also, differentially expressed genes underlying QTL for ACTH response were described. Using the latest version of the draft sequence, the differentially expressed genes were mapped to the pig genome. This enabled co-location of DE genes and previously studied QTL regions, but the draft genome sequence is still incomplete and will contain many errors. A further step to explore links between DE genes and QTL at the pathway level was largely unsuccessful due to the lack of annotation of the pig genome. This could be improved by further comparative mapping analyses but this would be time consuming. This paper provides a case study for the integration of QTL data and microarray data for a species with limited genome sequence information and annotation. The results illustrate the challenges that must be addressed but also provide a roadmap for future work that is applicable to other non-model species.
Rathinasabapathi, Bala; Wu, Shan; Sundaram, Sabarinath; Rivoal, Jean; Srivastava, Mrittunjai; Ma, Lena Q
2006-12-01
Arsenic hyperaccumulator Pteris vittata L. (Chinese brake fern) grows well in arsenic-contaminated media, with an extraordinary ability to tolerate high levels of arsenic. An expression cloning strategy was employed to identify cDNAs for the genes involved in arsenic resistance in P. vittata. Excised plasmids from the cDNA library of P. vittata fronds were introduced into Escherichia coli XL-1 Blue and plated on medium containing 4 mM of arsenate, a common form of arsenic in the environment. The deduced amino acid sequence of an arsenate-resistant clone, PV4-8, had cDNA highly homologous to plant cytosolic triosephosphate isomerases (cTPI). Cell-free extracts of PV4-8 had 3-fold higher level of triosephosphate isomerase (TPI) specific activities than that found in E. coli XL-1 Blue and had a 42 kD fusion protein immunoreactive to polyclonal antibodies raised against recombinant Solanum chacoense cTPI. The PV4-8 cDNA complemented a TPI-deficient E. coli mutant. PV4-8 expression improved arsenate resistance in E. coli WC3110, a strain deficient in arsenate reductase but not in AW3110 deficient for the whole ars operon. This is consistent with the hypothesis that PV4-8 TPI increased arsenate resistance in E. coli by directly or indirectly functioning as an arsenate reductase. When E. coli tpi gene was expressed in the same vector, bacterial arsenate resistance was not altered, indicating that arsenate tolerance was specific to P. vittata TPI. Paradoxically, P. vittata TPI activity was not more resistant to inhibition by arsenate in vitro than its bacterial counterpart suggesting that arsenate resistance of conventional TPI reaction was not the basis for the cellular arsenate resistance. P. vittata TPI activity was inhibited by incubation with reduced glutathione while bacterial TPI was unaffected. Consistent with cTPI's role in arsenate reduction, bacterial cells expressing fern TPI had significantly greater per cent of cellular arsenic as arsenite compared to cells expressing E. coli TPI. Excised frond tissue infiltrated with arsenate reduced arsenate significantly more under light than dark. This research highlights a novel role for P. vittata cTPI in arsenate reduction.
Barbosa, Eder Alves; Iembo, Tatiane; Martins, Graciella Ribeiro; Silva, Luciano Paulino; Prates, Maura Vianna; Andrade, Alan Carvalho; Bloch, Carlos
2015-11-15
Amphibians can produce a large amount of bioactive peptides over the skin. In order to map the precise tissue localization of these compounds and evaluate their functions, mass spectrometry imaging (MSI) and gene expression studies were used to investigate a possible correlation between molecules involved in the antimicrobial defense mechanisms and anti-predatory behavior by Physalaemus nattereri. Total skin secretion of P. nattereri was analyzed by classical Protein Chemistry and proteomic techniques. Intact inguinal macroglands were dissected from the rest of the skin and both tissues were analyzed by MSI and real-time polymerase chain reaction (RT-PCR) experiments. Peptides were primarily identified by de novo sequencing, automatic Edman degradation and cDNA data. Fifteen bradykinin (BK)-related peptides and two antimicrobial peptides were sequenced and mapped by MSI on the inguinal macrogland and the rest of P. nattereri skin. RT-PCR results revealed that BK-related peptide levels of expression were about 30,000 times higher on the inguinal macroglands than on the any other region of the skin, whilst antimicrobial peptide ions appear to be evenly distributed in both investigated regions. The presence of antimicrobial peptides in all investigated tissue regions is in accordance with the defensive role against microorganisms thoroughly demonstrated in the literature, whereas BK-related molecules are largely found on the inguinal macroglands suggesting an intriguing link between their noxious activities against potential predators of P. nattereri and the frog's deimatic behavior. Copyright © 2015 John Wiley & Sons, Ltd.
Thomason, Maureen K; Bischler, Thorsten; Eisenbart, Sara K; Förstner, Konrad U; Zhang, Aixia; Herbig, Alexander; Nieselt, Kay; Sharma, Cynthia M; Storz, Gisela
2015-01-01
While the model organism Escherichia coli has been the subject of intense study for decades, the full complement of its RNAs is only now being examined. Here we describe a survey of the E. coli transcriptome carried out using a differential RNA sequencing (dRNA-seq) approach, which can distinguish between primary and processed transcripts, and an automated prediction algorithm for transcriptional start sites (TSS). With the criterion of expression under at least one of three growth conditions examined, we predicted 14,868 TSS candidates, including 5,574 internal to annotated genes (iTSS) and 5,495 TSS corresponding to potential antisense RNAs (asRNAs). We examined expression of 14 candidate asRNAs by Northern analysis using RNA from wild-type E. coli and from strains defective for RNases III and E, two RNases reported to be involved in asRNA processing. Interestingly, nine asRNAs detected as distinct bands by Northern analysis were differentially affected by the rnc and rne mutations. We also compared our asRNA candidates with previously published asRNA annotations from RNA-seq data and discuss the challenges associated with these cross-comparisons. Our global transcriptional start site map represents a valuable resource for identification of transcription start sites, promoters, and novel transcripts in E. coli and is easily accessible, together with the cDNA coverage plots, in an online genome browser. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Mo, Delin; Zhu, Zhengmao; te Pas, Marinus F W; Li, Xinyun; Yang, Shulin; Wang, Heng; Wang, Huanling; Li, Kui
2008-06-30
In a previous screen to identify differentially expressed genes associated with embryonic development, the porcine PNAS-4 gene had been found. Considering differentially expressed genes in early stages of muscle development are potential candidate genes to improve meat quality and production efficiency, we determined how porcine PNAS-4 gene regulates meat production. Therefore, this gene has been sequenced, expression analyzed and associated with meat production traits. We cloned the full-length cDNA of porcine PNAS-4 gene encoding a protein of 194 amino acids which was expressed in the Golgi complex. This gene was mapped to chromosome 10, q11-16, in a region of conserved synteny with human chromosome 1 where the human homologous gene was localized. Real-time PCR revealed that PNAS-4 mRNA was widely expressed with highest expression levels in skeletal muscle followed by lymph, liver and other tissues, and showed a down-regulated expression pattern during prenatal development while a up-regulated expression pattern after weaning. Association analysis revealed that allele C of SNP A1813C was prevalent in Chinese indigenous breeds whereas A was dominant allele in Landrace and Large White, and the pigs with homozygous CC had a higher fat content than those of the pigs with other genotypes (P < 0.05). Porcine PNAS-4 protein tagged with green fluorescent protein accumulated in the Golgi complex, and its mRNA showed a widespread expression across many tissues and organs in pigs. It may be an important factor affecting the meat production efficiency, because its down-regulated expression pattern during early embryogenesis suggests involvement in increase of muscle fiber number. In addition, the SNP A1813C associated with fat traits might be a genetic marker for molecular-assisted selection in animal breeding.
The Role of ABC Proteins in Drug-Resistant Breast Cancer Cells
2007-04-01
and a biotin acceptor domain) under control of the alcohol oxidase promoter (Figure 2). Upon methanol induction, the yeast expressed high levels of...as native cDNA. Therefore, we backtranslated the protein into a nucleotide sequence codon-optimized for expression in Pichia pastoris yeast. Yeast
APPLICATION OF DNA MICROARRAYS TO REPRODUCTIVE TOXICOLOGY AND THE DEVELOPMENT OF A TESTIS ARRAY
With the advent of sequence information for entire mammalian genomes, it is now possible to analyze gene expression and gene polymorphisms on a genomic scale. The primary tool for analysis of gene expression is the DNA microarray. We have used commercially available cDNA micro...
With the advent of sequence information for entire eukaryotic genomes, it is now possible to analyze gene expression on a genomic scale. The primary tool for genomic analysis of gene expression is the gene microarray. We have used commercially available and custom cDNA microarray...
Lardizabal, Kathryn D.; Metz, James G.; Sakamoto, Tetsuo; Hutton, William C.; Pollard, Michael R.; Lassner, Michael W.
2000-01-01
Wax synthase (WS, fatty acyl-coenzyme A [coA]: fatty alcohol acyltransferase) catalyzes the final step in the synthesis of linear esters (waxes) that accumulate in seeds of jojoba (Simmondsia chinensis). We have characterized and partially purified this enzyme from developing jojoba embryos. A protein whose presence correlated with WS activity during chromatographic fractionation was identified and a cDNA encoding that protein was cloned. Seed-specific expression of the cDNA in transgenic Arabidopsis conferred high levels of WS activity on developing embryos from those plants. The WS sequence has significant homology with several Arabidopsis open reading frames of unknown function. Wax production in jojoba requires, in addition to WS, a fatty acyl-CoA reductase (FAR) and an efficient fatty acid elongase system that forms the substrates preferred by the FAR. We have expressed the jojoba WS cDNA in Arabidopsis in combination with cDNAs encoding the jojoba FAR and a β-ketoacyl-CoA synthase (a component of fatty acid elongase) from Lunaria annua. 13C-Nuclear magnetic resonance analysis of pooled whole seeds from transgenic plants indicated that as many as 49% of the oil molecules in the seeds were waxes. Gas chromatography analysis of transmethylated oil from individual seeds suggested that wax levels may represent up to 70% (by weight) of the oil present in those seeds. PMID:10712527
Heterogeneous RNA-binding protein M4 is a receptor for carcinoembryonic antigen in Kupffer cells.
Bajenova, O V; Zimmer, R; Stolper, E; Salisbury-Rowswell, J; Nanji, A; Thomas, P
2001-08-17
Here we report the isolation of the recombinant cDNA clone from rat macrophages, Kupffer cells (KC) that encodes a protein interacting with carcinoembryonic antigen (CEA). To isolate and identify the CEA receptor gene we used two approaches: screening of a KC cDNA library with a specific antibody and the yeast two-hybrid system for protein interaction using as a bait the N-terminal part of the CEA encoding the binding site. Both techniques resulted in the identification of the rat heterogeneous RNA-binding protein (hnRNP) M4 gene. The rat ortholog cDNA sequence has not been previously described. The open reading frame for this gene contains a 2351-base pair sequence with the polyadenylation signal AATAAA and a termination poly(A) tail. The mRNA shows ubiquitous tissue expression as a 2.4-kilobase transcript. The deduced amino acid sequence comprised a 78-kDa membrane protein with 3 putative RNA-binding domains, arginine/methionine/glutamine-rich C terminus and 3 potential membrane spanning regions. When hnRNP M4 protein is expressed in pGEX4T-3 vector system in Escherichia coli it binds (125)I-labeled CEA in a Ca(2+)-dependent fashion. Transfection of rat hnRNP M4 cDNA into a non-CEA binding mouse macrophage cell line p388D1 resulted in CEA binding. These data provide evidence for a new function of hnRNP M4 protein as a CEA-binding protein in Kupffer cells.
Loudig, Olivier; Wang, Tao; Ye, Kenny; Lin, Juan; Wang, Yihong; Ramnauth, Andrew; Liu, Christina; Stark, Azadeh; Chitale, Dhananjay; Greenlee, Robert; Multerer, Deborah; Honda, Stacey; Daida, Yihe; Spencer Feigelson, Heather; Glass, Andrew; Couch, Fergus J.; Rohan, Thomas; Ben-Dov, Iddo Z.
2017-01-01
Formalin-fixed paraffin-embedded (FFPE) specimens, when used in conjunction with patient clinical data history, represent an invaluable resource for molecular studies of cancer. Even though nucleic acids extracted from archived FFPE tissues are degraded, their molecular analysis has become possible. In this study, we optimized a laboratory-based next-generation sequencing barcoded cDNA library preparation protocol for analysis of small RNAs recovered from archived FFPE tissues. Using matched fresh and FFPE specimens, we evaluated the robustness and reproducibility of our optimized approach, as well as its applicability to archived clinical specimens stored for up to 35 years. We then evaluated this cDNA library preparation protocol by performing a miRNA expression analysis of archived breast ductal carcinoma in situ (DCIS) specimens, selected for their relation to the risk of subsequent breast cancer development and obtained from six different institutions. Our analyses identified six miRNAs (miR-29a, miR-221, miR-375, miR-184, miR-363, miR-455-5p) differentially expressed between DCIS lesions from women who subsequently developed an invasive breast cancer (cases) and women who did not develop invasive breast cancer within the same time interval (control). Our thorough evaluation and application of this laboratory-based miRNA sequencing analysis indicates that the preparation of small RNA cDNA libraries can reliably be performed on older, archived, clinically-classified specimens. PMID:28335433
The Regulation of Gene Expression in Cnidarian-Algal Associations.
1998-07-13
symbiotic cnidarians , Aiptasia pallida, Anthopleura eligantissima, synbiosis-specific proteins, cDNA libraries, O. SECURITY CLASSIFICATION OP REPORT...gene expression in cnidarian -algal associations Award Period: 1 July 1995-30 June 1998 Objectives: A. To identify and characterize heat shock...Exploring Symbiosis-Specific Gene Expression in Cnidarian /Algal Associations. In: Molecular Approaches to the Study of the Ocean.. Ed. K. Cooksey, Chapman
STEAP: A prostate-specific cell-surface antigen highly expressed in human prostate tumors
Hubert, Rene S.; Vivanco, Igor; Chen, Emily; Rastegar, Shiva; Leong, Kahan; Mitchell, Steve C.; Madraswala, Rashida; Zhou, Yanhong; Kuo, James; Raitano, Arthur B.; Jakobovits, Aya; Saffran, Douglas C.; Afar, Daniel E. H.
1999-01-01
In search of novel genes expressed in metastatic prostate cancer, we subtracted cDNA isolated from benign prostatic hypertrophic tissue from cDNA isolated from a prostate cancer xenograft model that mimics advanced disease. One novel gene that is highly expressed in advanced prostate cancer encodes a 339-amino acid protein with six potential membrane-spanning regions flanked by hydrophilic amino- and carboxyl-terminal domains. This structure suggests a potential function as a channel or transporter protein. This gene, named STEAP for six-transmembrane epithelial antigen of the prostate, is expressed predominantly in human prostate tissue and is up-regulated in multiple cancer cell lines, including prostate, bladder, colon, ovarian, and Ewing sarcoma. Immunohistochemical analysis of clinical specimens demonstrates significant STEAP expression at the cell–cell junctions of the secretory epithelium of prostate and prostate cancer cells. Little to no staining was detected at the plasma membranes of normal, nonprostate human tissues, except for bladder tissue, which expressed low levels of STEAP at the cell membrane. Protein analysis located STEAP at the cell surface of prostate-cancer cell lines. Our results support STEAP as a cell-surface tumor-antigen target for prostate cancer therapy and diagnostic imaging. PMID:10588738
Sarker, Lukman S; Galata, Mariana; Demissie, Zerihun A; Mahmoud, Soheil S
2012-12-15
Several varieties of Lavandula x intermedia (lavandins) are cultivated for their essential oils (EOs) for use in cosmetic, hygiene and personal care products. These EOs are mainly constituted of monoterpenes including camphor, which contributes an off odor reducing the olfactory appeal of the oil. We have recently constructed a cDNA library from the glandular trichomes (the sites of EO synthesis) of L. x intermedia plants. Here, we describe the cloning of a borneol dehydrogenase cDNA (LiBDH) from this library. The 780 bp open reading frame of the cDNA encoded a 259 amino acid short chain alcohol dehydrogenase with a predicted molecular mass of ca. 27.5 kDa. The recombinant LiBDH was expressed in Escherichia coli, purified by Ni-NTA agarose affinity chromatography, and functionally characterized in vitro. The bacterially produced enzyme specifically converted borneol to camphor as the only product with K(m) and k(cat) values of 53 μM and 4.0 × 10(-4) s(-1), respectively. The LiBDH transcripts were specifically expressed in glandular trichomes of mature flowers indicating that like other Lavandula monoterpene synthases the expression of this gene is regulated in a tissue-specific manner. The cloning of LiBDH has far reaching implications in improving the quality of Lavandula EOs through metabolic engineering. Copyright © 2012 Elsevier Inc. All rights reserved.
Kalapothakis, Evanguedes; Araujo, Simone Costa; de Castro, Cibele Soares; Mendes, Thais Melo; Gomez, Marcus Vinícius; Mangili, Oldemir C; Gubert, Ida C; Chávez-Olórtegui, Carlos
2002-12-01
The present report describes the identification and molecular characterization of LiD1, a protein expressed in the venom gland of the brown spider Loxosceles intermedia. LiD1 belongs to a family of proteins with dermonecrotic activity and members of this family have been found in spiders from the genus Loxosceles. The necrotic lesions caused by this group of proteins may lead to serious socio-economic problems such as surgical tissue reconstitution and even patient death. LiD1 was cloned using a cDNA library constructed from the venom gland of L. intermedia and antibodies against proteins with dermonecrotic activity isolated from the crude venom of this spider. The amino acid sequence deduced from the cDNA revealed a mature protein of approximately 31 kDa, with a pI of 7.37. The cDNA also revealed the existence of a signal peptide, a propeptide and also an untranslated 3' region with 218 nucleotides. LiD1 was expressed as a protein fused with beta-galactoside protein using the vector pBK-CMV, resulting in the recombinant protein recLiD1 with important immunological properties. recLiD1 was strongly recognised by anti-dermonecrotic antibodies and was also able to generate reactive antibodies against native dermonecrotic proteins isolated from the venom of L. intermedia.
Expression of a coriander desaturase results in petroselinic acid production in transgenic tobacco
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cahoon, E.B.; Shanklin, J.; Ohlrogge, J.B.
1992-12-01
Little is known about the metabolic origin of petroselinic acid (18:1[Delta][sup 6cis]), the principal fatty acid of the seed oil of most Umbelliferae, Araliaceae, and Garryaceae species. To examine the possibility that petroselinic acid is the product of an acyl-acyl carrier protein (ACP) desaturase, Western blots of coriander and other Umbelliferae seed extracts were probed with antibodies against the [Delta][sup 9]-stearoyl-ACP desaturase of avocado. In these extracts, proteins of 39 and 36 kDa were detected. Of these, only the 36-kDa peptide was specific to tissues which synthesize petroselinic acid. A cDNA encoding the 36-kDa peptide was isolated from a coriandermore » endosperm cDNA library, placed under control of the cauliflower mosaic virus 35S promoter, and introduced into tobacco by Agrobacterium tumefaciens-mediated transformation. Expression of this cDNA in transgenic tobacco callus was accompanied by the accumulation of petroselinic acid and [Delta][sup 4]-hexadecenoic acid, both of which were absent from control callus. These results demonstrate the involvement of a 36-kDa putative acyl-ACP desaturase in the biosynthetic pathway of petroselinic acid and the ability to produce fatty acids of unusual structure in transgenic plants by the expression of the gene for this desaturase. 27 refs., 5 figs.« less
Hong, Y K; Kim, D H; Beletskii, A; Lee, C; Memili, E; Strauss, W M
2001-04-01
Most conditional expression vectors designed for mammalian cells have been valuable systems for studying genes of interest by regulating their expressions. The available vectors, however, are reliable for the short-length cDNA clones and not optimal for relatively long fragments of genomic DNA or long cDNAs. Here, we report the construction of two bacterial artificial chromosome (BAC) vectors, capable of harboring large inserts and shuttling among Escherichia coli, yeast, and mammalian cells. These two vectors, pEYMT and pEYMI, contain conditional expression systems which are designed to be regulated by tetracycline and mouse interferons, respectively. To test the properties of the vectors, we cloned in both vectors the green fluorescence protein (GFP) through an in vitro ligation reaction and the 17.8-kb-long X-inactive-specific transcript (Xist) cDNA through homologous recombination in yeast. Subsequently, we characterized their regulated expression properties using real-time quantitative RT-PCR (TaqMan) and RNA-fluorescent in situ hybridization (FISH). We demonstrate that these two BAC vectors are good systems for recombination-based cloning and regulated expression of large genes in mammalian cells. Copyright 2001 Academic Press.
Qi, Jing; Dong, Zhen; Zhang, Yu-Xing
2015-12-01
The aim of the present study was to genetically modify plantlets of the Chinese yali pear to reduce their expression of ripening-associated 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) and therefore increase the shelf-life of the fruit. Primers were designed with selectivity for the conserved regions of published ACO gene sequences, and yali complementary DNA (cDNA) cloning was performed by reverse transcription quantitative polymerase chain reaction (PCR). The obtained cDNA fragment contained 831 base pairs, encoding 276 amino acid residues, and shared no less than 94% nucleotide sequence identity with other published ACO genes. The cDNA fragment was inversely inserted into a pBI121 expression vector, between the cauliflower mosaic virus 35S promoter and the nopaline synthase terminator, in order to construct the anti‑sense expression vector of the ACO gene; it was transfected into cultured yali plants using Agrobacterium LBA4404. Four independent transgenic lines of pear plantlets were obtained and validated by PCR analysis. A Southern blot assay revealed that there were three transgenic lines containing a single copy of exogenous gene and one line with double copies. The present study provided germplasm resources for the cultivation of novel storage varieties of pears, therefore providing a reference for further applications of anti‑sense RNA technology in the genetic improvement of pears and other fruit.
Hook, Sharon E.; Skillman, Ann D.; Small, Jack A.; Schultz, Irvin R.
2008-01-01
Determining how gene expression profiles change with toxicant dose will improve the utility of arrays in identifying biomarkers and modes of toxic action. Isogenic rainbow trout, Oncorhyncus mykiss, were exposed to 10, 50 or 100 ng/L ethynylestradiol (a xeno-estrogen) for 7 days. Following exposure hepatic RNA was extracted. Fluorescently labeled cDNA were generated and hybridized against a commercially available Atlantic Salmon/Trout array (GRASP project, University of Victoria) spotted with 16,000 cDNAs. Transcript expression in treated vs control fish was analyzed via Genespring (Silicon Genetics) to identify genes with altered expression, as well as to determine gene clustering patterns that can be used as “expression signatures”. Array results were confirmed via qRT PCR. Our analysis indicates that gene expression profiles varied somewhat with dose. Established biomarkers of exposure to estrogenic chemicals, such as vitellogenin, vitelline envelope proteins, and the estrogen receptor alpha, were induced at every dose. Other genes were dose specific, suggesting that diffierent doses induce distinct physiological responses. These findings demonstrate that cDNA microarrays could be used to identify both toxicant class and relative dose. PMID:16725192
Highly abundant and stage-specific mRNAs in the obligate pathogen Bremia lactucae.
Judelson, H S; Michelmore, R W
1990-01-01
Germinating spores of the obligate pathogen Bremia lactucae (lettuce downy mildew) contain several unusually abundant species of mRNA. Thirty-nine cDNA clones corresponding to prevalent transcripts were isolated from a library synthesized using poly(A)+ RNA from germinating spores; these clones represented only five distinct classes. Each corresponding mRNA accounted for from 0.4 to 9 percent by mass of poly(A)+ RNA from germinating spores and together represented greater than 20 percent of the mRNA. The expression of the corresponding genes, and a gene encoding Hsp70, was analyzed in spores during germination and during growth in planta. The Hsp70 mRNA and mRNA from one abundant cDNA clone (ham34) were expressed constitutively. Two clones (ham9 and ham12) hybridized only to mRNA from spores and germinating spores. Two clones (ham37 and ham27) showed hybridization specific to germinating spores. Quantification of the number of genes homologous to each cDNA clone indicated that four clones corresponded to one or two copies per haploid genome, and one hybridized to an approximately 11-member family of genes. A sequence of the gene corresponding to ham34 was obtained to investigate its function and to identify sequences conferring high levels of gene expression for use in constructing vectors for the transformation of B. lactucae.
Zhou, Man; Mi, Hai-Feng; Liu, Wen-Bin; Wu, Ye-Yang; Wang, Kai-Zhou; Jiang, Guang-Zhen
2017-08-01
Tumour necrosis factor alpha (TNF-α) is one kind of cytokines which is related to inflammation and lipid metabolism. TNF-α cDNA was cloned from the liver of blunt snout bream (Megalobrama amblycephala) through real-time polymerase chain reaction (PCR) and rapid amplification of cDNA ends (RACE) methods. The full-length cDNA of TNF-α covered 1467 bp, with an open reading frame (ORF) of 723 bp, which encodes 240 amino acids. It possessed the TNF family signature IIIPDDGIYFVYSQ. After the lipopolysaccharide (LPS) challenge test, a graded tissue-specific expression pattern of TNF-α was observed and there was high expression abundance in the kidney, brain and liver. After 8 weeks feeding trial, liver samples, two groups fed with 6% and 11% lipid levels, were collected. The results showed that, for fish fed with high-fat diet, the triglyceride of serum and lipid content of liver were elevated. Furthermore, TNF-α and peroxisome proliferator-activated receptors (PPARα, β) mRNA expression of fish fed 11% lipid diet were significantly up-regulated (p < 0.05). Lipoprotein lipase (LPL) and PPARγ mRNA expression of fish fed 11% lipid lever diet were significantly decreased compared to those of fish fed 6% (p < 0.05). The differences between the various expression of related genes in the high and low fat groups demonstrated that TNF-α played a key role in lipid metabolism, which may have an influence on fat metabolism through reducing fat synthesis and strengthening the β-oxidation of fatty acid. These discrepancies warrant further research.
Zhang, Li-Feng; Li, Wan-Feng; Han, Su-Ying; Yang, Wen-Hua; Qi, Li-Wang
2013-10-15
A full-length cDNA and genomic sequences of a translationally controlled tumor protein (TCTP) gene were isolated from Japanese larch (Larix leptolepis) and designated LaTCTP. The length of the cDNA was 1, 043 bp and contained a 504 bp open reading frame that encodes a predicted protein of 167 amino acids, characterized by two signature sequences of the TCTP protein family. Analysis of the LaTCTP gene structure indicated four introns and five exons, and it is the largest of all currently known TCTP genes in plants. The 5'-flanking promoter region of LaTCTP was cloned using an improved TAIL-PCR technique. In this region we identified many important potential cis-acting elements, such as a Box-W1 (fungal elicitor responsive element), a CAT-box (cis-acting regulatory element related to meristem expression), a CGTCA-motif (cis-acting regulatory element involved in MeJA-responsiveness), a GT1-motif (light responsive element), a Skn-1-motif (cis-acting regulatory element required for endosperm expression) and a TGA-element (auxin-responsive element), suggesting that expression of LaTCTP is highly regulated. Expression analysis demonstrated ubiquitous localization of LaTCTP mRNA in the roots, stems and needles, high mRNA levels in the embryonal-suspensor mass (ESM), browning embryogenic cultures and mature somatic embryos, and low levels of mRNA at day five during somatic embryogenesis. We suggest that LaTCTP might participate in the regulation of somatic embryo development. These results provide a theoretical basis for understanding the molecular regulatory mechanism of LaTCTP and lay the foundation for artificial regulation of somatic embryogenesis. © 2013.
Characterization and mapping of the mouse NDP (Norrie disease) locus (Ndp).
Battinelli, E M; Boyd, Y; Craig, I W; Breakefield, X O; Chen, Z Y
1996-02-01
Norrie disease is a severe X-linked recessive neurological disorder characterized by congenital blindness with progressive loss of hearing. Over half of Norrie patients also manifest different degrees of mental retardation. The gene for Norrie disease (NDP) has recently been cloned and characterized. With the human NDP cDNA, mouse genomic phage libraries were screened for the homolog of the gene. Comparison between mouse and human genomic DNA blots hybridized with the NDP cDNA, as well as analysis of phage clones, shows that the mouse NDP gene is 29 kb in size (28 kb for the human gene). The organization in the two species is very similar. Both have three exons with similar-sized introns and identical exon-intron boundaries between exon 2 and 3. The mouse open reading frame is 393 bp and, like the human coding sequence, is encoded in exons 2 and 3. The absence of six nucleotides in the second mouse exon results in the encoded protein being two amino acids smaller than its human counterpart. The overall homology between the human and mouse NDP protein is 95% and is particularly high (99%) in exon 3, consistent with the apparent functional importance of this region. Analysis of transcription initiation sites suggests the presence of multiple start sites associated with expression of the mouse NDP gene. Pedigree analysis of an interspecific mouse backcross localizes the mouse NDP gene close to Maoa in the conserved segment, which runs from CYBB to PFC in both human and mouse.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Prody, C.A.; Dreyfus, P.; Soreq, H.
1989-01-01
A 100-fold DNA amplification in the CHE gene, coding for serum butyrylcholinesterase (BtChoEase), was found in a farmer expressing silent CHE phenotype. Individuals homozygous for this gene display a defective serum BtChoEase and are particularly vulnerable to poisoning by agricultural organophosphorus insecticides, to which all members of this family had long been exposed. DNA blot hybridization with regional BtChoEase cDNA probes suggested that the amplification was most intense in regions encoding central sequences within BtChoEase cDNA, whereas distal sequences were amplified to a much lower extent. This is in agreement with the onion skin model, based on amplification of genesmore » in cultured cells and primary tumors. The amplification was absent in the grandparents but present at the same extent in one of their sons and in a grandson, with similar DNA blot hybridization patterns. In situ hybridization experiments localized the amplified sequences to the long arm of chromosome 3, close to the site where the authors previously mapped the CHE gene. Altogether, these observations suggest that the initial amplification event occurred early in embryogenesis, spermatogenesis, or oogenesis, where the CHE gene is intensely active and where cholinergic functioning was indicated to be physiologically necessary. These findings demonstrate a de novo amplification in apparently healthy individuals within an autosomal gene producing a target protein to an inhibitor.« less
Inheritance of RFLP loci in a loblolly pine three-generation pedigree
M.D. Devey; K.D. Jermstad; C.G. Tauer; D.B. Neale
1991-01-01
A high-density restriction fragment length polymorphism (RFLP) linkage map is being constructed for loblolly pine (Pinus taeda L.). Loblolly pine cDNA and genomic DNA clones were used as probes in hybridizations to genomic DNAs prepared from grandparents, parents, and progeny of a three-generation outbred pedigree. Approximately 200 probes were...
Marques, M Carmen; Alonso-Cantabrana, Hugo; Forment, Javier; Arribas, Raquel; Alamar, Santiago; Conejero, Vicente; Perez-Amador, Miguel A
2009-01-01
Background Interpretation of ever-increasing raw sequence information generated by modern genome sequencing technologies faces multiple challenges, such as gene function analysis and genome annotation. Indeed, nearly 40% of genes in plants encode proteins of unknown function. Functional characterization of these genes is one of the main challenges in modern biology. In this regard, the availability of full-length cDNA clones may fill in the gap created between sequence information and biological knowledge. Full-length cDNA clones facilitate functional analysis of the corresponding genes enabling manipulation of their expression in heterologous systems and the generation of a variety of tagged versions of the native protein. In addition, the development of full-length cDNA sequences has the power to improve the quality of genome annotation. Results We developed an integrated method to generate a new normalized EST collection enriched in full-length and rare transcripts of different citrus species from multiple tissues and developmental stages. We constructed a total of 15 cDNA libraries, from which we isolated 10,898 high-quality ESTs representing 6142 different genes. Percentages of redundancy and proportion of full-length clones range from 8 to 33, and 67 to 85, respectively, indicating good efficiency of the approach employed. The new EST collection adds 2113 new citrus ESTs, representing 1831 unigenes, to the collection of citrus genes available in the public databases. To facilitate functional analysis, cDNAs were introduced in a Gateway-based cloning vector for high-throughput functional analysis of genes in planta. Herein, we describe the technical methods used in the library construction, sequence analysis of clones and the overexpression of CitrSEP, a citrus homolog to the Arabidopsis SEP3 gene, in Arabidopsis as an example of a practical application of the engineered Gateway vector for functional analysis. Conclusion The new EST collection denotes an important step towards the identification of all genes in the citrus genome. Furthermore, public availability of the cDNA clones generated in this study, and not only their sequence, enables testing of the biological function of the genes represented in the collection. Expression of the citrus SEP3 homologue, CitrSEP, in Arabidopsis results in early flowering, along with other phenotypes resembling the over-expression of the Arabidopsis SEPALLATA genes. Our findings suggest that the members of the SEP gene family play similar roles in these quite distant plant species. PMID:19747386
Mahesh, Venkataramaiah; Rakotomalala, Jean Jacques; Le Gal, Lénaïg; Vigne, Hélène; de Kochko, Alexandre; Hamon, Serge; Noirot, Michel; Campa, Claudine
2006-09-01
Biosynthesis of caffeoylquinic acids occurs via the phenylpropanoid pathway in which the phenylalanine ammonia-lyase (PAL) acts as a key-control enzyme. A full-length cDNA (pF6), corresponding to a PAL gene (CcPAL1), was isolated by screening a Coffea canephora fruit cDNA library and its corresponding genomic sequence was characterized. Amplification of total DNA from seven Coffea species revealed differences in intronic length. This interspecific polymorphism was used to locate the gene on a genetic map established for a backcross progeny between Coffea pseudozanguebariae and C. dewevrei. The CcPAL1 gene was found on the same linkage group, but genetically independent, as a caffeoyl-coenzyme A-O-methyltransferase gene, another gene intervening in the phenylpropanoid pathway. In the same backcross, a lower caffeoylquinic acid content was observed in seeds harvested from plants harbouring the C. pseudozanguebariae CcPAL1 allele. Involvement of the CcPAL1 allelic form in the differential accumulation of caffeoylquinic acids in coffee green beans is then discussed.
Yan, Y L; Jowett, T; Postlethwait, J H
1998-12-01
To investigate pattern formation in the vertebrate hindbrain, we isolated a full length hoxb2 cDNA clone from zebrafish. In a gene phylogeny, zebrafish hoxb2 clusters with human HOXB2, and it maps on linkage group 3 along with several other loci whose orthologues are syntenic with human HOXB2. In the hindbrain, hoxb2 is expressed at high levels in rhombomere 3 (r3), lower levels in r4, still lower in r5, and at undetectable levels in r6. In r7, r8, and the rostral spinal cord, hoxb2 is expressed at a lower level than in r5. Lateral cells appearing to emanate from r4 express both hoxb2 and dlx2, suggesting that they are neural crest. Overexpression of hoxb2 by mRNA injections into early cleavage stage embryos resulted in abnormal morphogenesis of the midbrain and rostral hindbrain, abnormal patterning in r4, fusion of cartilage elements arising from pharyngeal arches 1 and 2, and ectopic expression of krx20 and valentino (but not pax2, rtk1, or hoxb1) in the rostral hindbrain, midbrain, and, surprisingly, the eye. Treatments with retinoic acid produced a phenotype similar to that of ectopic hoxb2 expression, including ectopic krx20 (but not valentino) expression in the eye, and fusion of cartilages from pharyngeal arches 1 and 2. The results suggest that hoxb2 plays an important role in the patterning of hindbrain and pharyngeal arches in the zebrafish.
Cloning and expression of trehalose-6-phosphate synthase 1 from Rhizopus oryzae.
Ozer Uyar, Ebru; Yücel, Meral; Hamamcı, Haluk
2016-05-01
Trehalose is a reducing disaccharide acting as a protectant against environmental stresses in many organisms. In fungi, Trehalose-6-phosphate synthase 1 (TPS1) plays a key role in the biosynthesis of trehalose. In this study, a full-length cDNA from Rhizopus oryzae encoding TPS1 (designated as RoTPS1) was isolated. The RoTPS1 cDNA is composed of 2505 nucleotides and encodes a protein of 834 amino acids with a molecular mass of 97.8 kDa. The amino acid sequence of RoTPS1 has a relatively high homology with the TPS1s in several other filamentous fungi. RoTPS1 was cloned into Saccharomyces cerevisiae and secretively expressed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Molecular cloning of chitinase 33 (chit33) gene from Trichoderma atroviride
Matroudi, S.; Zamani, M.R.; Motallebi, M.
2008-01-01
In this study Trichoderma atroviride was selected as over producer of chitinase enzyme among 30 different isolates of Trichoderma sp. on the basis of chitinase specific activity. From this isolate the genomic and cDNA clones encoding chit33 have been isolated and sequenced. Comparison of genomic and cDNA sequences for defining gene structure indicates that this gene contains three short introns and also an open reading frame coding for a protein of 321 amino acids. The deduced amino acid sequence includes a 19 aa putative signal peptide. Homology between this sequence and other reported Trichoderma Chit33 proteins are discussed. The coding sequence of chit33 gene was cloned in pEt26b(+) expression vector and expressed in E. coli. PMID:24031242
Zhu, Ling; Song, Linsheng; Zhang, Huan; Zhao, Jianmin; Li, Chenghua; Xu, Wei
2008-06-01
Apoptosis is an active process of cell death, which is an integral part of growth and development in multicellular organisms. The defender against cell death 1 (DAD1), the regulatory protein to inhibit the apoptosis process, was first cloned from the bay scallop Argopecten irradians by randomly sequencing a whole tissue cDNA library and rapid amplification of cDNA end (RACE). The full-length cDNA of the A. irradians DAD1 was 607 bp, consist of a 5'-terminal untranslated region (UTR) of 63 bp, a 3'-terminal UTR of 205 bp with a canonical polyadenylation signal sequence AATAAA and a poly (A) tail, and an open reading frame of 339 bp. The deduced amino acid sequence of the A. irradians DAD1 showed 75.5% identity to Araneus ventricosus, 74.5% to Drosophila melanogaster, and 73.6% to Homo sapiens, Sus scrofa, Mesocricetus auratus, Rattus norvegicus and Mus musculus. Excluding the Saccharomyces cerevisiae DAD1 homologue, all animal DAD1 including A. irradians DAD1 homologue formed a subgroup and all plant DAD1 proteins formed another subgroup in the phylogenetic analysis. The A. irradians DAD1 was expressed in all examined tissues including adductor muscle, mantle, gills, digestive gland, gonad and hemolymph, suggesting that A. irradians DAD1 is expressed in most body tissues. Furthermore, the mRNA expression levels of A. irradians DAD1 gene of hemolymph were particularly high after injury, suggesting that the gene is responsive to injury stimuli.
Varasteh, Abdol-Reza; Sankian, Mojtaba; Midoro-Horiuti, Terumi; Moghadam, Malihe; Shakeri, Mohamad Taghi; Brooks, Edward G.; Goldblum, Randall M.; Chapman, Martin D.; Pomés, Anna
2012-01-01
Background: The cultivation of saffron is expanding through the southeast of Iran, and allergy to saffron pollen occurs in workers involved in processing this plant. We aimed to clone, sequence and express a major allergen involved in saffron pollen allergy, and to compare the recombinant with the natural allergen. Methods: The N-terminal amino acid sequence of Cro s 1, an allergen from saffron pollen, was determined after immunoblotting. The cDNA encoding for this allergen was cloned by PCR utilizing a primer based on the N-terminal amino acid sequence. Recombinant Cro s 1 (rCro s 1) was expressed as a soluble protein in Pichia pastoris and purified to homogeneity by gel filtration. Inhibition of IgE binding to rCro s 1 by pollen extract was analyzed by ELISA. Section Title The allergen Cro s 1 was identified from saffron pollen extracts and cloned by PCR. Cro s 1 cDNA defined an acidic polypeptide with homology to pollen proteins from Chenopodium album and Ligastrum vulgaris. The rCro s 1 was expressed in P. pastoris at 28 mg/l. Saffron pollen extract inhibited the binding of patient serum IgE to rCro s 1. Conclusion: We identified and cloned the first Crocus sativus pollen allergen. rCro s 1 cDNA shows a very high homology with Che a 1, the major allergen of lamb's-quarter, Chenopodium album, Caryophyllales, pollen (97%). Cro s 1 is a useful tool for specific diagnosis and structural studies of occupational allergy to saffron. PMID:26989701
Upregulated Genes In Sporadic, Idiopathic Pulmonary Arterial Hypertension
Edgar, Alasdair J; Chacón, Matilde R; Bishop, Anne E; Yacoub, Magdi H; Polak, Julia M
2006-01-01
Background To elucidate further the pathogenesis of sporadic, idiopathic pulmonary arterial hypertension (IPAH) and identify potential therapeutic avenues, differential gene expression in IPAH was examined by suppression subtractive hybridisation (SSH). Methods Peripheral lung samples were obtained immediately after removal from patients undergoing lung transplant for IPAH without familial disease, and control tissues consisted of similarly sampled pieces of donor lungs not utilised during transplantation. Pools of lung mRNA from IPAH cases containing plexiform lesions and normal donor lungs were used to generate the tester and driver cDNA libraries, respectively. A subtracted IPAH cDNA library was made by SSH. Clones isolated from this subtracted library were examined for up regulated expression in IPAH using dot blot arrays of positive colony PCR products using both pooled cDNA libraries as probes. Clones verified as being upregulated were sequenced. For two genes the increase in expression was verified by northern blotting and data analysed using Student's unpaired two-tailed t-test. Results We present preliminary findings concerning candidate genes upregulated in IPAH. Twenty-seven upregulated genes were identified out of 192 clones examined. Upregulation in individual cases of IPAH was shown by northern blot for tissue inhibitor of metalloproteinase-3 and decorin (P < 0.01) compared with the housekeeping gene glyceraldehydes-3-phosphate dehydrogenase. Conclusion Four of the up regulated genes, magic roundabout, hevin, thrombomodulin and sucrose non-fermenting protein-related kinase-1 are expressed specifically by endothelial cells and one, muscleblind-1, by muscle cells, suggesting that they may be associated with plexiform lesions and hypertrophic arterial wall remodelling, respectively. PMID:16390543
Liu, Su; Liang, Qing-Mei; Huang, Yuan-Jie; Yuan, Xin; Zhou, Wen-Wu; Qiao, Fei; Cheng, Jiaan; Gurr, Geoff M; Zhu, Zeng-Rong
2013-01-01
NADPH-cytochrome P450 reductase (CPR) is one of the most important components of the cytochrome P450 enzyme system. It catalyzes electron transfer from NADPH to all known P450s, thus plays central roles not only in the metabolism of exogenous xenobiotics but also in the regulation of endogenous hormones in insects. In this study, a full-length cDNA encoding of a CPR (named CsCPR) was isolated from the Asiatic rice striped stem borer, Chilo suppressalis, by using reverse transcription-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE) methods. The cDNA contains a 2061 bp open reading frame, which encodes an enzyme of 686 amino acid residues, with a calculated molecular mass of 77.6 kDa. The deduced peptide has hallmarks of typical CPR, including an N-terminal membrane anchor and the FMN, FAD and NADPH binding domains. The N-terminal-truncated protein fused with a 6 × His·tag was heterologously expressed in Escherichia coli Rosetta (DE3) cells and purified, specific activity and the Km values of the recombinant enzyme were determined. Tissue- and developmental stage-dependent expression of CsCPR mRNA was investigated by real-time quantitative PCR. The CsCPR mRNA was noticeably expressed in the digestive, metabolic, and olfactory organs of the larvae and adults of C. suppressalis. Our initial results would provide valuable information for further study on the interactions between CPR and cytochrome P450 enzyme systems. © 2013.
González-Carranza, Zinnia Haydé; Whitelaw, Catherine Ann; Swarup, Ranjan; Roberts, Jeremy Alan
2002-01-01
During leaf abscission in oilseed rape (Brassica napus), cell wall degradation is brought about by the action of several hydrolytic enzymes. One of these is thought to be polygalacturonase (PG). Degenerate primers were used to isolate a PG cDNA fragment by reverse transcriptase-polymerase chain reaction from RNA extracted from ethylene-promoted leaf abscission zones (AZs), and in turn a full-length clone (CAW471) from an oilseed rape AZ cDNA library. The highest homology of this cDNA (82%) was to an Arabidopsis sequence that was predicted to encode a PG protein. Analysis of expression revealed that CAW471 mRNA accumulated in the AZ of leaves and reached a peak 24 h after ethylene treatment. Ethylene-promoted leaf abscission in oilseed rape was not apparent until 42 h after exposure to the gas, reaching 50% at 48 h and 100% by 56 h. In floral organ abscission, expression of CAW471 correlated with cell separation. Genomic libraries from oilseed rape and Arabidopsis were screened with CAW471 and the respective genomic clones PGAZBRAN and PGAZAT isolated. Characterization of these PG genes revealed that they had substantial homology within both the coding regions and in the 5′-upstream sequences. Fusion of a 1,476-bp 5′-upstream sequence of PGAZAT to β-glucuronidase or green fluorescent protein and transformation of Arabidopsis revealed that this fragment was sufficient to drive expression of these reporter genes in the AZs at the base of the anther filaments, petals, and sepals. PMID:11842157
Varasteh, Abdol-Reza; Sankian, Mojtaba; Midoro-Horiuti, Terumi; Moghadam, Malihe; Shakeri, Mohamad Taghi; Brooks, Edward G; Goldblum, Randall M; Chapman, Martin D; Pomés, Anna
2012-10-01
The cultivation of saffron is expanding through the southeast of Iran, and allergy to saffron pollen occurs in workers involved in processing this plant. We aimed to clone, sequence and express a major allergen involved in saffron pollen allergy, and to compare the recombinant with the natural allergen. The N-terminal amino acid sequence of Cro s 1, an allergen from saffron pollen, was determined after immunoblotting. The cDNA encoding for this allergen was cloned by PCR utilizing a primer based on the N-terminal amino acid sequence. Recombinant Cro s 1 (rCro s 1) was expressed as a soluble protein in Pichia pastoris and purified to homogeneity by gel filtration. Inhibition of IgE binding to rCro s 1 by pollen extract was analyzed by ELISA. The allergen Cro s 1 was identified from saffron pollen extracts and cloned by PCR. Cro s 1 cDNA defined an acidic polypeptide with homology to pollen proteins from Chenopodium album and Ligastrum vulgaris. The rCro s 1 was expressed in P. pastoris at 28 mg/l. Saffron pollen extract inhibited the binding of patient serum IgE to rCro s 1. We identified and cloned the first Crocus sativus pollen allergen. rCro s 1 cDNA shows a very high homology with Che a 1, the major allergen of lamb's-quarter, Chenopodium album, Caryophyllales, pollen (97%). Cro s 1 is a useful tool for specific diagnosis and structural studies of occupational allergy to saffron.
Yan, Xu; Bishop, David J.
2018-01-01
Gene expression analysis by quantitative PCR in skeletal muscle is routine in exercise studies. The reproducibility and reliability of the data fundamentally depend on how the experiments are performed and interpreted. Despite the popularity of the assay, there is a considerable variation in experimental protocols and data analyses from different laboratories, and there is a lack of consistency of proper quality control steps throughout the assay. In this study, we present a number of experiments on various steps of quantitative PCR workflow, and demonstrate how to perform a quantitative PCR experiment with human skeletal muscle samples in an exercise study. We also tested some common mistakes in performing qPCR. Interestingly, we found that mishandling of muscle for a short time span (10 mins) before RNA extraction did not affect RNA quality, and isolated total RNA was preserved for up to one week at room temperature. Demonstrated by our data, use of unstable reference genes lead to substantial differences in the final results. Alternatively, cDNA content can be used for data normalisation; however, complete removal of RNA from cDNA samples is essential for obtaining accurate cDNA content. PMID:29746477